Layered Structure and Swelling Behavior of a Multiple Hydrate-Forming Pharmaceutical Compound

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kiang, Y.; Xu, W; Stephens, P

2009-01-01

Investigation of one anhydrous and four hydrated forms of a pharmaceutical compound (1) using both single-crystal and high-resolution powder X-ray diffraction methods revealed a two-dimensional framework which, upon exposure to moisture, absorbed water between the layers, causing the lattice to expand by as much as 20% of the axial length along a. The single-crystal structure was solved and refined for the pentahydrate form in space group C2 with unit cell parameters a = 36.961(5) Angstroms, b = 7.458(2) Angstroms, c = 20.691(4) Angstroms, e = 99.461(1), and V = 5626(4) Angstroms3. In the single-crystal structure the water layers were parallelmore » to the bc plane and sandwiched by the crystalline compound 1 framework. Upon a change of relative humidity, water goes in and out of the interlayer space with the retention of the layer structure of the development compound. Starting from the anhydrous form, each additional water of hydration increased the interlayer spacing of the pharmaceutical solid by 1.3 Angstroms, half the size of a water molecule. In an exploratory formulation, this expansion of interlayer spacing caused tablets to crack upon storage at high relative humidity.« less

Crystal Structure of Human Liver [delta][superscript 4]-3-Ketosteroid 5[beta]-Reductase (AKR1D1) and Implications for Substrate Binding and Catalysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Di Costanzo, Luigi; Drury, Jason E.; Penning, Trevor M.

2008-07-15

AKR1D1 (steroid 5{beta}-reductase) reduces all {Delta}{sup 4}-3-ketosteroids to form 5{beta}-dihydrosteroids, a first step in the clearance of steroid hormones and an essential step in the synthesis of all bile acids. The reduction of the carbon-carbon double bond in an {alpha}{beta}-unsaturated ketone by 5{beta}-reductase is a unique reaction in steroid enzymology because hydride transfer from NADPH to the {beta}-face of a {Delta}{sup 4}-3-ketosteroid yields a cis-A/B-ring configuration with an {approx}90{sup o} bend in steroid structure. Here, we report the first x-ray crystal structure of a mammalian steroid hormone carbon-carbon double bond reductase, human {Delta}{sup 4}-3-ketosteroid 5{beta}-reductase (AKR1D1), and its complexes withmore » intact substrates. We have determined the structures of AKR1D1 complexes with NADP{sup +} at 1.79- and 1.35-{angstrom} resolution (HEPES bound in the active site), NADP{sup +} and cortisone at 1.90-{angstrom} resolution, NADP{sup +} and progesterone at 2.03-{angstrom} resolution, and NADP{sup +} and testosterone at 1.62-{angstrom} resolution. Complexes with cortisone and progesterone reveal productive substrate binding orientations based on the proximity of each steroid carbon-carbon double bond to the re-face of the nicotinamide ring of NADP{sup +}. This orientation would permit 4-pro-(R)-hydride transfer from NADPH. Each steroid carbonyl accepts hydrogen bonds from catalytic residues Tyr{sup 58} and Glu{sup 120}. The Y58F and E120A mutants are devoid of activity, supporting a role for this dyad in the catalytic mechanism. Intriguingly, testosterone binds nonproductively, thereby rationalizing the substrate inhibition observed with this particular steroid. The locations of disease-linked mutations thought to be responsible for bile acid deficiency are also revealed.« less

Crystal Structure of Human Liver delta {4}-3-Ketosteroid 5 beta-Reductase (AKR1D1) and Implications for Substrate Binding and Catalysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Di Costanzo,L.; Drury, J.; Penning, T.

2008-01-01

AKR1D1 (steroid 5{beta}-reductase) reduces all 4-3-ketosteroids to form 5{beta}-dihydrosteroids, a first step in the clearance of steroid hormones and an essential step in the synthesis of all bile acids. The reduction of the carbon-carbon double bond in an a,{beta}-unsaturated ketone by 5{beta}-reductase is a unique reaction in steroid enzymology because hydride transfer from NADPH to the {beta}-face of a 4-3-ketosteroid yields a cis-A/B-ring configuration with an {approx}90 bend in steroid structure. Here, we report the first x-ray crystal structure of a mammalian steroid hormone carbon-carbon double bond reductase, human 4-3-ketosteroid 5{beta}-reductase (AKR1D1), and its complexes with intact substrates. We havemore » determined the structures of AKR1D1 complexes with NADP+ at 1.79- and 1.35- Angstroms resolution (HEPES bound in the active site), NADP+ and cortisone at 1.90- Angstroms resolution, NADP+ and progesterone at 2.03- Angstroms resolution, and NADP+ and testosterone at 1.62- Angstroms resolution. Complexes with cortisone and progesterone reveal productive substrate binding orientations based on the proximity of each steroid carbon-carbon double bond to the re-face of the nicotinamide ring of NADP+. This orientation would permit 4-pro-(R)-hydride transfer from NADPH. Each steroid carbonyl accepts hydrogen bonds from catalytic residues Tyr58 and Glu120. The Y58F and E120A mutants are devoid of activity, supporting a role for this dyad in the catalytic mechanism. Intriguingly, testosterone binds nonproductively, thereby rationalizing the substrate inhibition observed with this particular steroid. The locations of disease-linked mutations thought to be responsible for bile acid deficiency are also revealed.« less

Structural trends for celestite (SrSO[subscript 4]), anglesite (PbSO[subscript 4]), and barite (BaSO[subscript 4]): Confirmation of expected variations within the SO[subscript 4] groups

DOE Office of Scientific and Technical Information (OSTI.GOV)

Antao, Sytle M.

2012-05-10

The crystal structures of the isostructural orthorhombic sulfates celestite (SrSO{sub 4}), anglesite (PbSO{sub 4}), and barite (BaSO{sub 4}) were refined by Rietveld methods using synchrotron high-resolution powder X-ray diffraction (HRPXRD) data. Their structural model was refined in space group Pbnm. The unit-cell parameters are a = 6.87032(3), b = 8.36030(5), c = 5.34732(1) {angstrom}, and V = 307.139(3) {angstrom}{sup 3} for SrSO{sub 4}; a = 6.95802(1), b = 8.48024(3), c = 5.39754(1) {angstrom}, and V = 318.486(1) {angstrom}{sup 3} for PbSO{sub 4}; and a = 7.15505(1), b = 8.88101(3), c = 5.45447(1) {angstrom}, and V = 346.599(1) {angstrom}{sup 3} formore » BaSO{sub 4}. The average [12] distances are 2.827(1), 2.865(1), and 2.953(1) {angstrom} for SrSO{sub 4}, PbSO{sub 4}, and BaSO{sub 4}, respectively, and their corresponding average [4] distances are 1.480(1), 1.477(3), and 1.471(1) {angstrom}. The geometrical features of the SO{sub 4} and MO{sub 12} polyhedra become more symmetrical from SrSO{sub 4} to BaSO{sub 4}. Across the series, the a, b, and c parameters vary non-linearly with increasing V. The radii of the M{sup 2+} cations, rM, [12], and [4] distances vary linearly with V. These structural trends arise from the effective size of the M{sup 2+} cation (rM: Sr < Pb < Ba) that is coordinated to 12 O atoms.« less

Crystal Structures of Apo and Metal-Bound Forms of the UreE Protein from Helicobacter pylori: Role of Multiple Metal Binding Sites

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shi, Rong; Munger, Christine; Asinas, Abdalin

2010-10-22

The crystal structure of the urease maturation protein UreE from Helicobacter pylori has been determined in its apo form at 2.1 {angstrom} resolution, bound to Cu{sup 2+} at 2.7 {angstrom} resolution, and bound to Ni{sup 2+} at 3.1 {angstrom} resolution. Apo UreE forms dimers, while the metal-bound enzymes are arranged as tetramers that consist of a dimer of dimers associated around the metal ion through coordination by His102 residues from each subunit of the tetramer. Comparison of independent subunits from different crystal forms indicates changes in the relative arrangement of the N- and C-terminal domains in response to metal binding.more » The improved ability of engineered versions of UreE containing hexahistidine sequences at either the N-terminal or C-terminal end to provide Ni{sup 2+} for the final metal sink (urease) is eliminated in the H102A version. Therefore, the ability of the improved Ni{sup 2+}-binding versions to deliver more nickel is likely an effect of an increased local concentration of metal ions that can rapidly replenish transferred ions bound to His102.« less

Crystal Structures of Phosphite Dehydrogenase Provide Insights into Nicotinamide Cofactor Regeneration

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zou, Yaozhong; Zhang, Houjin; Brunzelle, Joseph S.

The enzyme phosphite dehydrogenase (PTDH) catalyzes the NAD{sup +}-dependent conversion of phosphite to phosphate and represents the first biological catalyst that has been shown to conduct the enzymatic oxidation of phosphorus. Despite investigation for more than a decade into both the mechanism of its unusual reaction and its utility in cofactor regeneration, there has been a lack of any structural data for PTDH. Here we present the cocrystal structure of an engineered thermostable variant of PTDH bound to NAD{sup +} (1.7 {angstrom} resolution), as well as four other cocrystal structures of thermostable PTDH and its variants with different ligands (allmore » between 1.85 and 2.3 {angstrom} resolution). These structures provide a molecular framework for understanding prior mutational analysis and point to additional residues, located in the active site, that may contribute to the enzymatic activity of this highly unusual catalyst.« less

Crystal structures of the psychrophilic alpha-amylase from Alteromonas haloplanctis in its native form and complexed with an inhibitor.

PubMed Central

Aghajari, N.; Feller, G.; Gerday, C.; Haser, R.

1998-01-01

Alteromonas haloplanctis is a bacterium that flourishes in Antarctic sea-water and it is considered as an extreme psychrophile. We have determined the crystal structures of the alpha-amylase (AHA) secreted by this bacterium, in its native state to 2.0 angstroms resolution as well as in complex with Tris to 1.85 angstroms resolution. The structure of AHA, which is the first experimentally determined three-dimensional structure of a psychrophilic enzyme, resembles those of other known alpha-amylases of various origins with a surprisingly greatest similarity to mammalian alpha-amylases. AHA contains a chloride ion which activates the hydrolytic cleavage of substrate alpha-1,4-glycosidic bonds. The chloride binding site is situated approximately 5 angstroms from the active site which is characterized by a triad of acid residues (Asp 174, Glu 200, Asp 264). These are all involved in firm binding of the Tris moiety. A reaction mechanism for substrate hydrolysis is proposed on the basis of the Tris inhibitor binding and the chloride activation. A trio of residues (Ser 303, His 337, Glu 19) having a striking spatial resemblance with serine-protease like catalytic triads was found approximately 22 angstroms from the active site. We found that this triad is equally present in other chloride dependent alpha-amylases, and suggest that it could be responsible for autoproteolytic events observed in solution for this cold adapted alpha-amylase. PMID:9541387

Mechanisms of proton relay and product release by Class A β-lactamase at ultrahigh resolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lewandowski, Eric M.; Lethbridge, Kathryn G.; Sanishvili, Ruslan

The beta-lactam antibiotics inhibit penicillin-binding proteins (PBPs) by forming a stable, covalent, acyl-enzyme complex. During the evolution from PBPs to Class A beta-lactamases, the beta-lactamases acquired Glu166 to activate a catalytic water and cleave the acyl-enzyme bond. Here we present three product complex crystal structures of CTX-M-14 Class A beta-lactamase with a ruthenocene-conjugated penicillin-a 0.85 angstrom resolution structure of E166A mutant complexed with the penilloate product, a 1.30 angstrom resolution complex structure of the same mutant with the penicilloate product, and a 1.18 angstrom resolution complex structure of S70G mutant with a penicilloate product epimer-shedding light on the catalytic mechanismsmore » and product inhibition of PBPs and Class A beta-lactamases. The E166A-penilloate complex captured the hydrogen bonding network following the protonation of the leaving group and, for the first time, unambiguously show that the ring nitrogen donates a proton to Ser130, which in turn donates a proton to Lys73. These observations indicate that in the absence of Glu166, the equivalent lysine would be neutral in PBPs and therefore capable of serving as the general base to activate the catalytic serine. Together with previous results, this structure suggests a common proton relay network shared by Class A beta-lactamases and PBPs, from the catalytic serine to the lysine, and ultimately to the ring nitrogen. Additionally, the E166A-penicilloate complex reveals previously unseen conformational changes of key catalytic residues during the release of the product, and is the first structure to capture the hydrolyzed product in the presence of an unmutated catalytic serine.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Los Alamos National Laboratory, Mailstop M888, Los Alamos, NM 87545, USA; Lawrence Berkeley National Laboratory, One Cyclotron Road, Building 64R0121, Berkeley, CA 94720, USA; Department of Haematology, University of Cambridge, Cambridge CB2 0XY, England

The PHENIX AutoBuild Wizard is a highly automated tool for iterative model-building, structure refinement and density modification using RESOLVE or TEXTAL model-building, RESOLVE statistical density modification, and phenix.refine structure refinement. Recent advances in the AutoBuild Wizard and phenix.refine include automated detection and application of NCS from models as they are built, extensive model completion algorithms, and automated solvent molecule picking. Model completion algorithms in the AutoBuild Wizard include loop-building, crossovers between chains in different models of a structure, and side-chain optimization. The AutoBuild Wizard has been applied to a set of 48 structures at resolutions ranging from 1.1 {angstrom} tomore » 3.2 {angstrom}, resulting in a mean R-factor of 0.24 and a mean free R factor of 0.29. The R-factor of the final model is dependent on the quality of the starting electron density, and relatively independent of resolution.« less

Structures of human Bruton's tyrosine kinase in active and inactive conformations suggest a mechanism of activation for TEC family kinases

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marcotte, Douglas J.; Liu, Yu-Ting; Arduini, Robert M.

Bruton's tyrosine kinase (BTK), a member of the TEC family of kinases, plays a crucial role in B-cell maturation and mast cell activation. Although the structures of the unphosphorylated mouse BTK kinase domain and the unphosphorylated and phosphorylated kinase domains of human ITK are known, understanding the kinase selectivity profiles of BTK inhibitors has been hampered by the lack of availability of a high resolution, ligand-bound BTK structure. Here, we report the crystal structures of the human BTK kinase domain bound to either Dasatinib (BMS-354825) at 1.9 {angstrom} resolution or to 4-amino-5-(4-phenoxyphenyl)-7H-pyrrolospyrimidin- 7-yl-cyclopentane at 1.6 {angstrom} resolution. This data providesmore » information relevant to the development of small molecule inhibitors targeting BTK and the TEC family of nonreceptor tyrosine kinases. Analysis of the structural differences between the TEC and Src families of kinases near the Trp-Glu-Ile motif in the N-terminal region of the kinase domain suggests a mechanism of regulation of the TEC family members.« less

Atomic-Resolution Structures of Horse Liver Alcohol Dehydrogenase with NAD[superscript +] and Fluoroalcohols Define Strained Michaelis Complexes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Plapp, Bryce V.; Ramaswamy, S.; Iowa)

2013-01-16

Structures of horse liver alcohol dehydrogenase complexed with NAD{sup +} and unreactive substrate analogues, 2,2,2-trifluoroethanol or 2,3,4,5,6-pentafluorobenzyl alcohol, were determined at 100 K at 1.12 or 1.14 {angstrom} resolution, providing estimates of atomic positions with overall errors of 0.02 {angstrom}, the geometry of ligand binding, descriptions of alternative conformations of amino acid residues and waters, and evidence of a strained nicotinamide ring. The four independent subunits from the two homodimeric structures differ only slightly in the peptide backbone conformation. Alternative conformations for amino acid side chains were identified for 50 of the 748 residues in each complex, and Leu-57 andmore » Leu-116 adopt different conformations to accommodate the different alcohols at the active site. Each fluoroalcohol occupies one position, and the fluorines of the alcohols are well-resolved. These structures closely resemble the expected Michaelis complexes with the pro-R hydrogens of the methylene carbons of the alcohols directed toward the re face of C4N of the nicotinamide rings with a C-C distance of 3.40 {angstrom}. The oxygens of the alcohols are ligated to the catalytic zinc at a distance expected for a zinc alkoxide (1.96 {angstrom}) and participate in a low-barrier hydrogen bond (2.52 {angstrom}) with the hydroxyl group of Ser-48 in a proton relay system. As determined by X-ray refinement with no restraints on bond distances and planarity, the nicotinamide rings in the two complexes are slightly puckered (quasi-boat conformation, with torsion angles of 5.9{sup o} for C4N and 4.8{sup o} for N1N relative to the plane of the other atoms) and have bond distances that are somewhat different compared to those found for NAD(P){sup +}. It appears that the nicotinamide ring is strained toward the transition state on the path to alcohol oxidation.« less

The Crystal Structure of Coxsackievirus A21 and Its Interaction with ICAM-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiao, Chuan; Bator-Kelly, Carol M.; Rieder, Elizabeth

2010-11-30

CVA21 and polioviruses both belong to the Enterovirus genus in the family of Picornaviridae, whereas rhinoviruses form a distinct picornavirus genus. Nevertheless, CVA21 and the major group of human rhinoviruses recognize intercellular adhesion molecule-1 (ICAM-1) as their cellular receptor, whereas polioviruses use poliovirus receptor. The crystal structure of CVA21 has been determined to 3.2 {angstrom} resolution. Its structure has greater similarity to poliovirus structures than to other known picornavirus structures. Cryo-electron microscopy (cryo-EM) was used to determine an 8.0 {angstrom} resolution structure of CVA21 complexed with an ICAM-1 variant, ICAM-1{sup Kilifi}. The cryo-EM map was fitted with the crystal structuresmore » of ICAM-1 and CVA21. Significant differences in the structure of CVA21 with respect to the poliovirus structures account for the inability of ICAM-1 to bind polioviruses. The interface between CVA21 and ICAM-1 has shape and electrostatic complementarity with many residues being conserved among those CVAs that bind ICAM-1.« less

Crystallization of the Nonameric Small Terminase Subunit of Bacteriophage P22

DOE Office of Scientific and Technical Information (OSTI.GOV)

A Roy; A Bhardwaj; G Cingolani

2011-12-31

The packaging of viral genomes into preformed empty procapsids is powered by an ATP-dependent genome-translocating motor. This molecular machine is formed by a heterodimer consisting of large terminase (L-terminase) and small terminase (S-terminase) subunits, which is assembled into a complex of unknown stoichiometry, and a dodecameric portal protein. There is considerable confusion in the literature regarding the biologically relevant oligomeric state of terminases, which, like portal proteins, form ring-like structures. The number of subunits in a hollow oligomeric protein defines the internal diameter of the central channel and the ability to fit DNA inside. Thus, knowledge of the exact stoichiometrymore » of terminases is critical to decipher the mechanisms of terminase-dependent DNA translocation. Here, the gene encoding bacteriophage P22 S-terminase in Escherichia coli has been overexpressed and the protein purified under native conditions. In the absence of detergents and/or denaturants that may cause disassembly of the native oligomer and formation of aberrant rings, it was found that P22 S-terminase assembles into a concentration-independent nonamer of {approx}168 kDa. Nonameric S-terminase was crystallized in two different crystal forms at neutral pH. Crystal form I belonged to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 144.2, b = 144.2, c = 145.3 {angstrom}, and diffracted to 3.0 {angstrom} resolution. Crystal form II belonged to space group P2{sub 1}, with unit-cell parameters a = 76.48, b = 100.9, c = 89.95 {angstrom}, {beta} = 93.73{sup o}, and diffracted to 1.75 {angstrom} resolution. Preliminary crystallographic analysis of crystal form II confirms that the S-terminase crystals contain a nonamer in the asymmetric unit and are suitable for high-resolution structure determination.« less

Crystallization of the Nonameric Small Terminase Subunit of bacteriophage P22

DOE Office of Scientific and Technical Information (OSTI.GOV)

A Roy; A Bhardwaj; G Cingoloni

2011-12-31

The packaging of viral genomes into preformed empty procapsids is powered by an ATP-dependent genome-translocating motor. This molecular machine is formed by a heterodimer consisting of large terminase (L-terminase) and small terminase (S-terminase) subunits, which is assembled into a complex of unknown stoichiometry, and a dodecameric portal protein. There is considerable confusion in the literature regarding the biologically relevant oligomeric state of terminases, which, like portal proteins, form ring-like structures. The number of subunits in a hollow oligomeric protein defines the internal diameter of the central channel and the ability to fit DNA inside. Thus, knowledge of the exact stoichiometrymore » of terminases is critical to decipher the mechanisms of terminase-dependent DNA translocation. Here, the gene encoding bacteriophage P22 S-terminase in Escherichia coli has been overexpressed and the protein purified under native conditions. In the absence of detergents and/or denaturants that may cause disassembly of the native oligomer and formation of aberrant rings, it was found that P22 S-terminase assembles into a concentration-independent nonamer of {approx}168 kDa. Nonameric S-terminase was crystallized in two different crystal forms at neutral pH. Crystal form I belonged to space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 144.2, b = 144.2, c = 145.3 {angstrom}, and diffracted to 3.0 {angstrom} resolution. Crystal form II belonged to space group P2{sub 1}, with unit-cell parameters a = 76.48, b = 100.9, c = 89.95 {angstrom}, {beta} = 93.73{sup o}, and diffracted to 1.75 {angstrom} resolution. Preliminary crystallographic analysis of crystal form II confirms that the S-terminase crystals contain a nonamer in the asymmetric unit and are suitable for high-resolution structure determination.« less

High Resolution Crystal Structure of the Catalytic Domain of ADAMTS-5 (Aggrecanase-2)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shieh, Huey-Sheng; Mathis, Karl J.; Williams, Jennifer M.

Aggrecanase-2 (a disintegrin and metalloproteinase with thrombospondin motifs-5 (ADAMTS-5)), a member of the ADAMTS protein family, is critically involved in arthritic diseases because of its direct role in cleaving the cartilage component aggrecan. The catalytic domain of aggrecanase-2 has been refolded, purified, and crystallized, and its three-dimensional structure determined to 1.4{angstrom} resolution in the presence of an inhibitor. A high resolution structure of an ADAMTS/aggrecanase protein provides an opportunity for the development of therapeutics to treat osteoarthritis.

Design considerations for ultra-precision magnetic bearing supported slides

NASA Technical Reports Server (NTRS)

Slocum, Alexander H.; Eisenhaure, David B.

1993-01-01

Development plans for a prototype servocontrolled machine with 1 angstrom resolution of linear motion and 50 mm range of travel are described. Two such devices could then be combined to produce a two dimensional machine for probing large planar objects with atomic resolution, the Angstrom Resolution Measuring Machine (ARMM).

DOE Office of Scientific and Technical Information (OSTI.GOV)

Antao, S.M.

The crystal structure of a biogenic aragonite from the nacre of an ammonite shell was obtained using synchrotron high-resolution powder X-ray diffraction (HRPXRD) data and Rietveld structure refinement. The well-preserved ammonite sample is from Alberta, Canada, and is from the Cretaceous period. The aragonite structure was refined in space group Pmcn, Z = 4, and the cell parameters obtained are a = 4.96265(2), b = 7.97016(4), c = 5.74474(3) {angstrom}, and V = 227.222(2) {angstrom}{sup 3}. The chemical analyses indicate a formula of [Ca{sub 0.995}Sr{sub 0.004}Ba{sub 0.001}]{Sigma} = 1.0(CO{sub 3}). The average and distances are 2.5281(3) and 1.2871(6)more » {angstrom}, respectively, and the average angle is 119.94(8){sup o}. The CO{sub 3} groups are non-planar. Based on crystal-structure data for biogenic and non-biogenic aragonite samples, aragonite from ammonite nacre has minimal structural distortions and is very similar to non-biogenic aragonite, in particular, a sample from Spain.« less

Structure of a designed, right-handed coiled-coil tetramer containing all biological amino acids.

PubMed

Sales, Mark; Plecs, Joseph J; Holton, James M; Alber, Tom

2007-10-01

The previous design of an unprecedented family of two-, three-, and four-helical, right-handed coiled coils utilized nonbiological amino acids to efficiently pack spaces in the oligomer cores. Here we show that a stable, right-handed parallel tetrameric coiled coil, called RH4B, can be designed entirely using biological amino acids. The X-ray crystal structure of RH4B was determined to 1.1 Angstrom resolution using a designed metal binding site to coordinate a single Yb(2+) ion per 33-amino acid polypeptide chain. The resulting experimental phases were particularly accurate, and the experimental electron density map provided an especially clear, unbiased view of the molecule. The RH4B structure closely matched the design, with equivalent core rotamers and an overall root-mean-square deviation for the N-terminal repeat of the tetramer of 0.24 Angstrom. The clarity and resolution of the electron density map, however, revealed alternate rotamers and structural differences between the three sequence repeats in the molecule. These results suggest that the RH4B structure populates an unanticipated variety of structures.

Structure of the catalytic domain of glucuronoyl esterase Cip2 from Hypocrea jecorina

USDA-ARS?s Scientific Manuscript database

The structure of the catalytic domain of glucuronoyl esterase Cip2 from the fungus Hypocrea jecorina was determined at a resolution of 1.9 Angstroms. This is the first structure of the newly established carbohydrate esterase family 15. The structure has revealed the residues Ser278–His411–Glu301 pre...

Structure of bacteriophage [phi]29 head fibers has a supercoiled triple repeating helix-turn-helix motif

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiang, Ye; Rossmann, Michael G.

2011-12-22

The tailed bacteriophage {phi}29 capsid is decorated with 55 fibers attached to quasi-3-fold symmetry positions. Each fiber is a homotrimer of gene product 8.5 (gp8.5) and consists of two major structural parts, a pseudohexagonal base and a protruding fibrous portion that is about 110 {angstrom} in length. The crystal structure of the C-terminal fibrous portion (residues 112-280) has been determined to a resolution of 1.6 {angstrom}. The structure is about 150 {angstrom} long and shows three distinct structural domains designated as head, neck, and stem. The stem region is a unique three-stranded helix-turn-helix supercoil that has not previously been described.more » When fitted into a cryoelectron microscope reconstruction of the virus, the head structure corresponded to a disconnected density at the distal end of the fiber and the neck structure was located in weak density connecting it to the fiber. Thin section studies of Bacillus subtilis cells infected with fibered or fiberless {phi}29 suggest that the fibers might enhance the attachment of the virions onto the host cell wall.« less

Crystal Structure of Human Nicotinamide Riboside Kinase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Khan,J.; Xiang, S.; Tong, L.

2007-01-01

Nicotinamide riboside kinase (NRK) has an important role in the biosynthesis of NAD{sup +} as well as the activation of tiazofurin and other NR analogs for anticancer therapy. NRK belongs to the deoxynucleoside kinase and nucleoside monophosphate (NMP) kinase superfamily, although the degree of sequence conservation is very low. We report here the crystal structures of human NRK1 in a binary complex with the reaction product nicotinamide mononucleotide (NMN) at 1.5 {angstrom} resolution and in a ternary complex with ADP and tiazofurin at 2.7 {angstrom} resolution. The active site is located in a groove between the central parallel {beta} sheetmore » core and the LID and NMP-binding domains. The hydroxyl groups on the ribose of NR are recognized by Asp56 and Arg129, and Asp36 is the general base of the enzyme. Mutation of residues in the active site can abolish the catalytic activity of the enzyme, confirming the structural observations.« less

Angstrom-Resolution Magnetic Resonance Imaging of Single Molecules via Wave-Function Fingerprints of Nuclear Spins

NASA Astrophysics Data System (ADS)

Ma, Wen-Long; Liu, Ren-Bao

2016-08-01

Single-molecule sensitivity of nuclear magnetic resonance (NMR) and angstrom resolution of magnetic resonance imaging (MRI) are the highest challenges in magnetic microscopy. Recent development in dynamical-decoupling- (DD) enhanced diamond quantum sensing has enabled single-nucleus NMR and nanoscale NMR. Similar to conventional NMR and MRI, current DD-based quantum sensing utilizes the "frequency fingerprints" of target nuclear spins. The frequency fingerprints by their nature cannot resolve different nuclear spins that have the same noise frequency or differentiate different types of correlations in nuclear-spin clusters, which limit the resolution of single-molecule MRI. Here we show that this limitation can be overcome by using "wave-function fingerprints" of target nuclear spins, which is much more sensitive than the frequency fingerprints to the weak hyperfine interaction between the targets and a sensor under resonant DD control. We demonstrate a scheme of angstrom-resolution MRI that is capable of counting and individually localizing single nuclear spins of the same frequency and characterizing the correlations in nuclear-spin clusters. A nitrogen-vacancy-center spin sensor near a diamond surface, provided that the coherence time is improved by surface engineering in the near future, may be employed to determine with angstrom resolution the positions and conformation of single molecules that are isotope labeled. The scheme in this work offers an approach to breaking the resolution limit set by the "frequency gradients" in conventional MRI and to reaching the angstrom-scale resolution.

Three-dimensional structure of homodimeric cholesterol esterase-ligand complex at 1.4 Å resolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pletnev, V.; Addlagatta, A.; Wawrzak, Z.

2010-03-08

The three-dimensional structure of a Candida cylindracea cholesterol esterase (ChE) homodimer (534 x 2 amino acids) in complex with a ligand of proposed formula C{sub 23}H{sub 48}O{sub 2} has been determined at 1.4 {angstrom} resolution in space group P1 using synchrotron low-temperature data. The structure refined to R = 0.136 and R{sub free} = 0.169 and has revealed new stereochemical details in addition to those detected for the apo- and holo-forms at 1.9 and 2.0 {angstrom} resolution, respectively [Ghosh et al. (1995), Structure, 3, 279-288]. The cholesterol esterase structure is a dimer with four spatially separated interfacial contact areas andmore » two symmetry-related pairs of openings to an internal intradimer cavity. Hydrophobic active-site gorges in each subunit face each other across a central interfacial cavity. The ChE subunits have carbohydrate chains attached to their Asn314 and Asn351 residues, with two ordered N-acetyl-D-glucosoamine moieties visible at each site. The side chains of 14 residues have two alternative conformations with occupancy values of 0.5 {+-} 0.2. For each subunit the electron density in the enzyme active-site gorge is well modeled by a C{sub 23}-chain fatty acid.« less

2.0 Angstrom Structure of Prostaglandin H2 Synthase-1 Reconstituted with a Manganese Porphyrin Cofactor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gupta,K.; Selinsky, B.; Loll, P.

2006-01-01

Prostaglandin H{sub 2} synthase (EC 1.14.99.1) is a clinically important drug target that catalyzes two key steps in the biosynthesis of the eicosanoid hormones. The enzyme contains spatially distinct cyclooxygenase and peroxidase active sites, both of which require a heme cofactor. Substitution of ferric heme by Mn{sup III} protoporphyrin IX greatly diminishes the peroxidase activity, but has little effect on the cyclooxygenase activity. Here, the 2.0 Angstrom resolution crystal structure of the Mn{sup III} form of ovine prostaglandin H{sub 2} synthase-1 is described (R = 21.8%, R{sub free} = 23.7%). Substitution of Mn{sup III} for Fe{sup III} causes no structuralmore » perturbations in the protein. However, the out-of-plane displacement of the manganese ion with respect to the porphyrin is greater than that of the iron by approximately 0.2 Angstroms. This perturbation may help to explain the altered catalytic properties of the manganese enzyme.« less

The Influence of Surface Morphology and Diffraction Resolution of Canavalin Crystals

NASA Technical Reports Server (NTRS)

Plomp, M.; Thomas, B. R.; Day, J. S.; McPherson, A.; Chernov, A. A.; Malkin, A.

2003-01-01

Canavalin crystals grown from material purified and not purified by High Performance Liquid Chromatography were studied by atomic force microscopy and x-ray diffraction. After purification, resolution was improved from 2.55Angstroms to 2.22Angstroms and jagged isotropic spiral steps transformed into regular, well polygonized steps.

Three-dimensional structure of photosystem II from Thermosynechococcus elongates in complex with terbutryn

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gabdulkhakov, A. G., E-mail: azat@vega.protes.ru; Dontsova, M. V.; Saenger, W.

Photosystem II is a key component of the photosynthetic pathway producing oxygen at the thylakoid membrane of cyanobacteria, green algae, and plants. The three-dimensional structure of photosystem II from the cyanobacterium Thermosynechococcus elongates in a complex with herbicide terbutryn (a photosynthesis inhibitor) was determined for the first time by X-ray diffraction and refined at 3.2 Angstrom-Sign resolution (R{sub factor} = 26.9%, R{sub free} = 29.9%, rmsd for bond lengths is 0.013 Angstrom-Sign , and rmsd for bond angles is 2.2 Degree-Sign ). The terbutryn molecule was located in the binding pocket of the mobile plastoquinone. The atomic coordinates of themore » refined structure of photosystem II in a complex with terbutryn were deposited in the Protein Data Bank.« less

The crystal structure of tin sulphate, SnSO[subscript 4], and comparison with isostructural SrSO[subscript 4], PbSO[subscript 4], and BaSO[subscript 4

DOE Office of Scientific and Technical Information (OSTI.GOV)

Antao, Sytle M.

2012-10-23

The crystal structure of tin (II) sulphate, SnSO{sub 4}, was obtained by Rietveld refinement using synchrotron high-resolution powder X-ray diffraction (HRPXRD) data. The structure was refined in space group Pbnm. The unit-cell parameters for SnSO{sub 4} are a = 7.12322(1), b = 8.81041(1), c = 5.32809(1) {angstrom}, and V = 334.383(1) {angstrom}{sup 3}. The average [12] distance is 2.9391(4) {angstrom}. However, the Sn{sup 2+} cation has a pyramidal [3]-coordination to O atoms and the average [3] = 2.271(1) {angstrom}. If Sn is considered as [12]-coordinated, SnSO{sub 4} has a structure similar to barite, BaSO{sub 4}, and its structuralmore » parameters are intermediate between those of BaSO{sub 4} and PbSO{sub 4}. The tetrahedral SO{sub 4} group has an average [4] = 1.472(1) {angstrom} in SnSO{sub 4}. Comparing SnSO{sub 4} with the isostructural SrSO{sub 4}, PbSO{sub 4}, and BaSO{sub 4}, several well-defined trends are observed. The radii, rM, of the M{sup 2+}(=Sr, Pb, Sn, and Ba) cations and average distances vary linearly with V because of the effective size of the M{sup 2+} cation. Based on the trend for the isostructural sulphates, the average [12] distance is slightly longer than expected because of the lone pair of electrons on the Sn{sup 2+} cation.« less

The structures of marialite (Me[subscript 6]) and meionite (Me[subscript 93]) in space groups P4[subscript 2]/n and I4/m, and the absence of phase transitions in the scapolite series

DOE Office of Scientific and Technical Information (OSTI.GOV)

Antao, Sytle M.; Hassan, Ishmael; Calgary)

2014-05-28

The crystal structures of marialite (Me{sub 6}) from Badakhshan, Afghanistan and meionite (Me{sub 93}) from Mt. Vesuvius, Italy were obtained using synchrotron high-resolution powder X-ray diffraction (HRPXRD) data and Rietveld structure refinements. Their structures were refined in space groups I4/m and P42/n, and similar results were obtained. The Me{sub 6} sample has a formula Ca{sub 0.24}Na{sub 3.37}K{sub 0.24}[Al{sub 3.16}Si{sub 8.84}O{sub 24}]Cl{sub 0.84}(CO{sub 3}){sub 0.15}, and its unit-cell parameters are a = 12.047555(7), c = 7.563210(6) {angstrom}, and V = 1097.751(1) {angstrom}{sup 3}. The average (T1-O) distances are 1.599(1) {angstrom} in I4/m and 1.600(2) {angstrom} in P4{sub 2}/n, indicating that themore » T1 site contains only Si atoms. In P4{sub 2}/n, the average distances of (T2-O) = 1.655(2) and (T3-O) = 1.664(2) {angstrom} are distinct and are not equal to each other. However, the mean (T2,3-O) = 1.659(2) {angstrom} in P4{sub 2}/n and is identical to the (T2-O) = 1.659(1) {angstrom} in I4/m. The (M-O) [7] = 2.754(1) {angstrom} (M site is coordinated to seven framework O atoms) and M-A = 2.914(1) {angstrom}; these distances are identical in both space groups. The Me{sub 93} sample has a formula of Na{sub 0.29}Ca{sub 3.76}[Al{sub 5.54}Si{sub 6.46}O{sub 24}]Cl{sub 0.05}(SO{sub 4}){sub 0.02}(CO{sub 3}){sub 0.93}, and its unit-cell parameters are a = 12.19882(1), c = 7.576954(8) {angstrom}, and V = 1127.535(2) {angstrom}{sup 3}. A similar examination of the Me{sub 93} sample also shows that both space groups give similar results; however, the C-O distance is more reasonable in P4{sub 2}/n than in I4/m. Refining the scapolite structure near Me{sub 0} or Me{sub 100} in I4/m forces the T2 and T3 sites (both with multiplicity 8 in P4{sub 2}/n) to be equivalent and form the T2' site (with multiplicity 16 in I4/m), but (T2-O) is not equal to (T3-O) in P4{sub 2}/n. Using different space groups for different regions across the series implies phase transitions, which do not occur in the scapolite series.« less

Ultra-high-resolution X-ray structure of proteins.

PubMed

Lecomte, C; Guillot, B; Muzet, N; Pichon-Pesme, V; Jelsch, C

2004-04-01

The constant advances in synchrotron radiation sources and crystallogenesis methods and the impulse of structural genomics projects have brought biocrystallography to a context favorable to subatomic resolution protein and nucleic acid structures. Thus, as soon as such precision can be frequently obtained, the amount of information available in the precise electron density should also be easily and naturally exploited, similarly to the field of small molecule charge density studies. Indeed, the use of a nonspherical model for the atomic electron density in the refinement of subatomic resolution protein structures allows the experimental description of their electrostatic properties. Some methods we have developed and implemented in our multipolar refinement program MoPro for this purpose are presented. Examples of successful applications to several subatomic resolution protein structures, including the 0.66 angstrom resolution human aldose reductase, are described.

Crystal and cryoEM structural studies of a cell wall degrading enzyme in the bacteriophage [psi]29 tail

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiang, Ye; Morais, Marc C.; Cohen, Daniel N.

2009-08-28

The small bacteriophage {phi}29 must penetrate the {approx}250-{angstrom} thick external peptidoglycan cell wall and cell membrane of the Gram-positive Bacillus subtilis, before ejecting its dsDNA genome through its tail into the bacterial cytoplasm. The tail of bacteriophage {phi}29 is noncontractile and {approx}380 {angstrom} long. A 1.8-{angstrom} resolution crystal structure of gene product 13 (gp13) shows that this tail protein has spatially well separated N- and C-terminal domains, whose structures resemble lysozyme-like enzymes and metallo-endopeptidases, respectively. CryoEM reconstructions of the WT bacteriophage and mutant bacteriophages missing some or most of gp13 shows that this enzyme is located at the distal endmore » of the {phi}29 tail knob. This finding suggests that gp13 functions as a tail-associated, peptidoglycan-degrading enzyme able to cleave both the polysaccharide backbone and peptide cross-links of the peptidoglycan cell wall. Comparisons of the gp13{sup -} mutants with the {phi}29 mature and emptied phage structures suggest the sequence of events that occur during the penetration of the tail through the peptidoglycan layer.« less

Structural redesign of lipase B from Candida antarctica by circular permutation and incremental truncation.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qian, Zhen; Horton, John R.; Cheng, Xiadong

2009-11-02

Circular permutation of Candida antarctica lipase B yields several enzyme variants with substantially increased catalytic activity. To better understand the structural and functional consequences of protein termini reorganization, we have applied protein engineering and x-ray crystallography to cp283, one of the most active hydrolase variants. Our initial investigation has focused on the role of an extended surface loop, created by linking the native N- and C-termini, on protein integrity. Incremental truncation of the loop partially compensates for observed losses in secondary structure and the permutants temperature of unfolding. Unexpectedly, the improvements are accompanied by quaternary-structure changes from monomer to dimer.more » The crystal structures of one truncated variant (cp283{Delta}7) in the apo-form determined at 1.49 {angstrom} resolution and with a bound phosphonate inhibitor at 1.69 {angstrom} resolution confirmed the formation of a homodimer by swapping of the enzyme's 35-residue N-terminal region. Separately, the new protein termini at amino acid positions 282/283 convert the narrow access tunnel to the catalytic triad into a broad crevice for accelerated substrate entry and product exit while preserving the native active-site topology for optimal catalytic turnover.« less

Structure of Plasmodium falciparum ADP-ribosylation factor 1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cook, William J.; Smith, Craig D.; Senkovich, Olga

Vesicular trafficking may play a crucial role in the pathogenesis and survival of the malaria parasite. ADP-ribosylation factors (ARFs) are among the major components of vesicular trafficking pathways in eukaryotes. The crystal structure of ARF1 GTPase from Plasmodium falciparum has been determined in the GDP-bound conformation at 2.5 {angstrom} resolution and is compared with the structures of mammalian ARF1s.

A Quasi-Laue Neutron Crystallographic Study of D-Xylose Isomerase

NASA Technical Reports Server (NTRS)

Meilleur, Flora; Snell, Edward H.; vanderWoerd, Mark; Judge, Russell A.; Myles, Dean A. A.

2006-01-01

Hydrogen atom location and hydrogen bonding interaction determination are often critical to explain enzymatic mechanism. Whilst it is difficult to determine the position of hydrogen atoms using X-ray crystallography even with subatomic (less than 1.0 Angstrom) resolution data available, neutron crystallography provides an experimental tool to directly localise hydrogeddeuteriwn atoms in biological macromolecules at resolution of 1.5-2.0 Angstroms. Linearisation and isomerisation of xylose at the active site of D-xylose isomerase rely upon a complex hydrogen transfer. Neutron quasi-Laue data were collected on Streptomyces rubiginosus D-xylose isomerase crystal using the LADI instrument at ILL with the objective to provide insight into the enzymatic mechanism (Myles et al. 1998). The neutron structure unambiguously reveals the protonation state of His 53 in the active site, identifying the model for the enzymatic pathway.

X-ray Structure of Imidazolonepropionase from Agrobacterium tumefaciens at 1.87 angstrom Resolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tyagi,R.; Kumaran, D.; Burley, S.

2007-01-01

Histidine degradation in agrobacterium tumefaciens involves four enzymes, including histidase, urocanase, imidazolonepropionase, and N-formylglutamate amido hydrolase. The third enzyme of the pathway, imidazolone-propionase, a 45.6 kDa protein, catalyzes conversion of imidazolone-5-propanoate to N-forminio-t-glutamate.

Concept Study Report: Extreme-Ultraviolet Imaging Spectrometer Solar-B

NASA Technical Reports Server (NTRS)

Doschek, George, A.; Brown, Charles M.; Davila, Joseph M.; Dere, Kenneth P.; Korendyke, Clarence M.; Mariska, John T.; Seely, John F.

1999-01-01

We propose a next generation Extreme-ultraviolet Imaging Spectrometer (EIS) that for the first time combines high spectral, spatial, and temporal resolution in a single solar spectroscopic instrument. The instrument consists of a multilayer-coated off-axis telescope mirror and a multilayer-coated grating spectrometer. The telescope mirror forms solar images on the spectrometer entrance slit assembly. The spectrometer forms stigmatic spectra of the solar region located at the slit. This region is selected by the articulated telescope mirror. Monochromatic images are obtained either by rastering the solar region across a narrow entrance slit, or by using a very wide slit (called a slot) in place of the slit. Monochromatic images of the region centered on the slot are obtained in a single exposure. Half of each optic is coated to maximize reflectance at 195 Angstroms; the other half to maximize reflectance at 270 Angstroms. The two Extreme Ultraviolet (EUV) wavelength bands have been selected to maximize spectral and dynamical and plasma diagnostic capabilities. Spectral lines are observed that are formed over a temperature range from about 0.1 MK to about 20 MK. The main EIS instrument characteristics are: wavelength bands - 180 to 204 Angstroms; 250 to 290 Angstroms; spectral resolution - 0.0223 Angstroms/pixel (34.3km/s at 195 Angstroms and 23.6 km/s at 284 Angstroms); slit dimensions - 4 slits, two currently specified dimensions are 1" x 1024" and 50" x 1024" (the slot); largest spatial field of view in a single exposure - 50" x 1024"; highest time resolution for active region velocity studies - 4.4 s.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Heaslet, H.; Rosenfeld, R.; Giffin, M.

The crystal structures of wild-type HIV protease (HIV PR) in the absence of substrate or inhibitor in two related crystal forms at 1.4 and 2.15 {angstrom} resolution are reported. In one crystal form HIV PR adopts an 'open' conformation with a 7.7 {angstrom} separation between the tips of the flaps in the homodimer. In the other crystal form the tips of the flaps are 'curled' towards the 80s loop, forming contacts across the local twofold axis. The 2.3 {angstrom} resolution crystal structure of a sixfold mutant of HIV PR in the absence of substrate or inhibitor is also reported. Themore » mutant HIV PR, which evolved in response to treatment with the potent inhibitor TL-3, contains six point mutations relative to the wild-type enzyme (L24I, M46I, F53L, L63P, V77I, V82A). In this structure the flaps also adopt a 'curled' conformation, but are separated and not in contact. Comparison of the apo structures to those with TL-3 bound demonstrates the extent of conformational change induced by inhibitor binding, which includes reorganization of the packing between twofold-related flaps. Further comparison with six other apo HIV PR structures reveals that the 'open' and 'curled' conformations define two distinct families in HIV PR. These conformational states include hinge motion of residues at either end of the flaps, opening and closing the entire {beta}-loop, and translational motion of the flap normal to the dimer twofold axis and relative to the 80s loop. The alternate conformations also entail changes in the {beta}-turn at the tip of the flap. These observations provide insight into the plasticity of the flap domains, the nature of their motions and their critical role in binding substrates and inhibitors.« less

Photoelectron diffraction and holography: Some new directions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fadley, C.S.

1993-08-01

Photoelectron diffraction has by now become a versatile and powerful technique for studying surface structures, with special capabilities for resolving chemical and magnetic states of atoms and deriving direct structural information from both forward scattering along bond directions and back-scattering path length differences. Further fitting experiment to theory can lead to structural accuracies in the {plus_minus}0.03 ){Angstrom} range. Holographic inversions of such diffraction data also show considerable promise for deriving local three-dimensional structures around a given emitter with accuracies of {plus_minus}0.2--0.3 {Angstrom}. Resolving the photoelectron spin in some way and using circularly polarized radiation for excitation provide added dimensions formore » the study of magnetic systems and chiral experimental geometries. Synchrotron radiation with the highest brightness and energy resolution, as well as variable polarization, is crucial to the full exploitation of these techniques.« less

X-Ray Crystal Structure of Bone Marrow Kinase in the X Chromosome: A Tec Family Kinase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Muckelbauer, Jodi; Sack, John S.; Ahmed, Nazia

Bone marrow kinase in the X chromosome, a member of the Tec family of tyrosine kinases, plays a role in both monocyte/macrophage trafficking as well as cytokine secretion. Although the structures of Tec family kinases Bruton's tyrosine kinase and IL-2-inducible T-cell kinase are known, the crystal structures of other Tec family kinases have remained elusive. We report the X-ray crystal structures of bone marrow kinase in the X chromosome in complex with dasatinib at 2.4 {angstrom} resolution and PP2 at 1.9 {angstrom} resolution. The bone marrow kinase in the X chromosome structures reveal a typical kinase protein fold; with well-orderedmore » protein conformation that includes an open/extended activation loop and a stabilized DFG-motif rendering the kinase in an inactive conformation. Dasatinib and PP2 bind to bone marrow kinase in the X chromosome in the ATP binding pocket and display similar binding modes to that observed in other Tec and Src protein kinases. The bone marrow kinase in the X chromosome structures identify conformational elements of the DFG-motif that could potentially be utilized to design potent and/or selective bone marrow kinase in the X chromosome inhibitors.« less

The Fundamental Structure of Coronal Loops

NASA Technical Reports Server (NTRS)

Winebarger, Amy; Warren, Harry; Cirtain, Jonathan; Kobayashi, Ken; Korreck, Kelly; Golub, Leon; Kuzin, Sergey; Walsh, Robert; DePontieu, Bart; Title, Alan;

The Structures of Coiled-Coil Domains from Type III Secretion System Translocators Reveal Homology to Pore-Forming Toxins

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barta, Michael L.; Dickenson, Nicholas E.; Patil, Mrinalini

2012-03-26

Many pathogenic Gram-negative bacteria utilize type III secretion systems (T3SSs) to alter the normal functions of target cells. Shigella flexneri uses its T3SS to invade human intestinal cells to cause bacillary dysentery (shigellosis) that is responsible for over one million deaths per year. The Shigella type III secretion apparatus is composed of a basal body spanning both bacterial membranes and an exposed oligomeric needle. Host altering effectors are secreted through this energized unidirectional conduit to promote bacterial invasion. The active needle tip complex of S. flexneri is composed of a tip protein, IpaD, and two pore-forming translocators, IpaB and IpaC.more » While the atomic structure of IpaD has been elucidated and studied, structural data on the hydrophobic translocators from the T3SS family remain elusive. We present here the crystal structures of a protease-stable fragment identified within the N-terminal regions of IpaB from S. flexneri and SipB from Salmonella enterica serovar Typhimurium determined at 2.1 {angstrom} and 2.8 {angstrom} limiting resolution, respectively. These newly identified domains are composed of extended-length (114 {angstrom} in IpaB and 71 {angstrom} in SipB) coiled-coil motifs that display a high degree of structural homology to one another despite the fact that they share only 21% sequence identity. Further structural comparisons also reveal substantial similarity to the coiled-coil regions of pore-forming proteins from other Gram-negative pathogens, notably, colicin Ia. This suggests that these mechanistically separate and functionally distinct membrane-targeting proteins may have diverged from a common ancestor during the course of pathogen-specific evolutionary events.« less

Crystal structure of prethrombin-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen, Zhiwei; Pelc, Leslie A.; Di Cera, Enrico

2010-11-15

Prothrombin is the zymogen precursor of the clotting enzyme thrombin, which is generated by two sequential cleavages at R271 and R320 by the prothrombinase complex. The structure of prothrombin is currently unknown. Prethrombin-1 differs from prothrombin for the absence of 155 residues in the N-terminal domain and is composed of a single polypeptide chain containing fragment 2 (residues 156-271), A chain (residues 272-320), and B chain (residues 321-579). The X-ray crystal structure of prethrombin-1 solved at 2.2-{angstrom} resolution shows an overall conformation significantly different (rmsd = 3.6 {angstrom}) from that of its active form meizothrombin desF1 carrying a cleavage atmore » R320. Fragment 2 is rotated around the y axis by 29{sup o} and makes only few contacts with the B chain. In the B chain, the oxyanion hole is disrupted due to absence of the I16-D194 ion pair and the Na{sup +} binding site and adjacent primary specificity pocket are highly perturbed. A remarkable feature of the structure is that the autolysis loop assumes a helical conformation enabling W148 and W215, located 17 {angstrom} apart in meizothrombin desF1, to come within 3.3 {angstrom} of each other and completely occlude access to the active site. These findings suggest that the zymogen form of thrombin possesses conformational plasticity comparable to that of the mature enzyme and have significant implications for the mechanism of prothrombin activation and the zymogen {yields} protease conversion in trypsin-like proteases.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Soares, Alexei S.; Engel, Matthew A.; Stearns, Richard

We demonstrate a general strategy for determining structures from showers of microcrystals. It uses acoustic droplet ejection to transfer 2.5 nL droplets from the surface of microcrystal slurries, through the air, onto mounting micromesh pins. Individual microcrystals are located by raster-scanning a several-micrometer X-ray beam across the cryocooled micromeshes. X-ray diffraction data sets merged from several micrometer-sized crystals are used to determine 1.8 {angstrom} resolution crystal structures.

Conformational flexibility in recombinant measles virus nucleocapsids visualised by cryo-negative stain electron microscopy and real-space helical reconstruction.

PubMed

Bhella, David; Ralph, Adam; Yeo, Robert Paul

2004-07-02

Measles virus is a highly contagious virus that, despite the existence of an effective vaccine, is a major cause of illness and mortality worldwide. The virus has a negative-sense, single-stranded RNA genome that is encapsidated by the nucleocapsid protein (N) to form a helical ribonucleoprotein complex known as the nucleocapsid. This structure serves as the template for both transcription and replication. Paramyxovirus nucleocapsids are flexible structures, a trait that has hitherto hampered structural analysis even at low resolution. We have investigated the extent of this structural plasticity, using real-space methods to calculate three-dimensional reconstructions of recombinant nucleocapsids from cryo-negative stain transmission electron micrographs. Images of short sections of helix were sorted according to both pitch (the axial rise per turn) and twist (the number of subunits per turn). Our analysis indicates that there is extensive conformational flexibility within these structures, ranging in pitch from 50 Angstrom to 66 Angstrom, while twist varies from at least 13.04 to 13.44 with a greater number of helices comprising around 13.1 subunits per turn. We have also investigated the influence of the C terminus of N on helix conformation, analysing nucleocapsids after having removed this domain by trypsin digestion. We have found that this causes a marked change in both pitch and twist, such that the pitch becomes shorter, ranging from 46 Angstrom to 52 Angstrom, while more helices have a twist of approximately 13.3 subunits per turn. Our findings lead us to propose a mechanism whereby changes in conformation, influenced by interactions between viral or host proteins and the C terminus of N, might have a role in regulating the balance of transcription and replication during virus infection.

Structural Characterization of the 1918 Influenza H1N1 Neuraminidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, X.; Zhu, X.; Dwek, R.A.

2009-05-28

Influenza virus neuraminidase (NA) plays a crucial role in facilitating the spread of newly synthesized virus in the host and is an important target for controlling disease progression. The NA crystal structure from the 1918 'Spanish flu' (A/Brevig Mission/1/18 H1N1) and that of its complex with zanamivir (Relenza) at 1.65-{angstrom} and 1.45-{angstrom} resolutions, respectively, corroborated the successful expression of correctly folded NA tetramers in a baculovirus expression system. An additional cavity adjacent to the substrate-binding site is observed in N1, compared to N2 and N9 NAs, including H5N1. This cavity arises from an open conformation of the 150 loop (Gly147more » to Asp151) and appears to be conserved among group 1 NAs (N1, N4, N5, and N8). It closes upon zanamivir binding. Three calcium sites were identified, including a novel site that may be conserved in N1 and N4. Thus, these high-resolution structures, combined with our recombinant expression system, provide new opportunities to augment the limited arsenal of therapeutics against influenza.« less

The 830--1120 A Spectrum of a Bright Comet: First Results on Hale-Bopp

NASA Astrophysics Data System (ADS)

Stern, S. Alan; Festou, Michel C.; Slater, David C.; Parker, Joel Wm.; A'Hearn, Michael F.

1998-09-01

The EUVS planetary sounding rocket spectrograph was flown on 29 March 1997 from White Sands, New Mexico to observe comet Hale-Bopp in the bandpass from 830--1120 Angstroms. At the time of launch the comet was near perihelion, 0.92 AU from the Sun, 1.34 AU from Earth, and traveling at a heliocentric radial velocity of +0.70 km/s. EUVS obtained its primary spectra of the comet at resolution near 3 Angstroms, collecting 9340 counts over approximately 330 seconds of integration time. To our knowledge, the resulting dataset is both the most sensitive and the highest spectral resolution probe of a comet in the UV below 1200 Angstroms yet achieved. The spectrum includes significant detections which we tentatively attribute to due to 834 Angstroms 0 II, the 1026 Angstroms H I Lyman beta /O I blend, and 989 Angstroms O I; we will also discuss evidence for Argon signatures, as well as two additional, yet to be identified features. We will describe the EUVS Hale-Bopp experiment and its results, including feature brightnesses, corresponding columns, and species abundance ratios in the inner coma. In addition to its value for providing insight into comets in general, and Hale-Bopp in particular, this spectrum is serving as an excellent input for New Millennium Deep Space 1/MICAS and Rosetta/ALICE UV observation planning below 1200 Angstroms.

Structural characterization of Burkholderia pseudomallei adenylate kinase (Adk): Profound asymmetry in the crystal structure of the 'open' state

DOE Office of Scientific and Technical Information (OSTI.GOV)

Buchko, G.W.; Robinson, H.; Abendroth, J.

2010-04-16

In all organisms adenylate kinases (Adks) play a vital role in cellular energy metabolism and nucleic acid synthesis. Due to differences in catalytic properties between the Adks found in prokaryotes and in the cytoplasm of eukaryotes, there is interest in targeting this enzyme for new drug therapies against infectious bacterial agents. Here we report the 2.1 {angstrom} resolution crystal structure for the 220-residue Adk from Burkholderia pseudomallei (BpAdk), the etiological agent responsible for the infectious disease melioidosis. The general structure of apo BpAdk is similar to other Adk structures, composed of a CORE subdomain with peripheral ATP-binding (ATP{sub bd}) andmore » LID subdomains. The two molecules in the asymmetric unit have significantly different conformations, with a backbone RMSD of 1.46 {angstrom}. These two BpAdk conformations may represent 'open' Adk sub-states along the preferential pathway to the 'closed' substrate-bound state.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Walden, William E.; Selezneva, Anna I.; Dupuy, Jérôme

Iron regulatory protein 1 (IRP1) binds iron-responsive elements (IREs) in messenger RNAs (mRNAs), to repress translation or degradation, or binds an iron-sulfur cluster, to become a cytosolic aconitase enzyme. The 2.8 angstrom resolution crystal structure of the IRP1:ferritin H IRE complex shows an open protein conformation compared with that of cytosolic aconitase. The extended, L-shaped IRP1 molecule embraces the IRE stem-loop through interactions at two sites separated by {approx}30 angstroms, each involving about a dozen protein:RNA bonds. Extensive conformational changes related to binding the IRE or an iron-sulfur cluster explain the alternate functions of IRP1 as an mRNA regulator ormore » enzyme.« less

Structures of Bacterial Biosynthetic Arginine Decarboxylases

DOE Office of Scientific and Technical Information (OSTI.GOV)

F Forouhar; S Lew; J Seetharaman

2011-12-31

Biosynthetic arginine decarboxylase (ADC; also known as SpeA) plays an important role in the biosynthesis of polyamines from arginine in bacteria and plants. SpeA is a pyridoxal-5'-phosphate (PLP)-dependent enzyme and shares weak sequence homology with several other PLP-dependent decarboxylases. Here, the crystal structure of PLP-bound SpeA from Campylobacter jejuni is reported at 3.0 {angstrom} resolution and that of Escherichia coli SpeA in complex with a sulfate ion is reported at 3.1 {angstrom} resolution. The structure of the SpeA monomer contains two large domains, an N-terminal TIM-barrel domain followed by a {beta}-sandwich domain, as well as two smaller helical domains. Themore » TIM-barrel and {beta}-sandwich domains share structural homology with several other PLP-dependent decarboxylases, even though the sequence conservation among these enzymes is less than 25%. A similar tetramer is observed for both C. jejuni and E. coli SpeA, composed of two dimers of tightly associated monomers. The active site of SpeA is located at the interface of this dimer and is formed by residues from the TIM-barrel domain of one monomer and a highly conserved loop in the {beta}-sandwich domain of the other monomer. The PLP cofactor is recognized by hydrogen-bonding, {pi}-stacking and van der Waals interactions.« less

Crystal structure of CD155 and electron microscopic studies of its complexes with polioviruses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Ping; Mueller, Steffen; Morais, Marc C.

2010-11-02

When poliovirus (PV) recognizes its receptor, CD155, the virus changes from a 160S to a 135S particle before releasing its genome into the cytoplasm. CD155 is a transmembrane protein with 3 Ig-like extracellular domains, D1-D3, where D1 is recognized by the virus. The crystal structure of D1D2 has been determined to 3.5-{angstrom} resolution and fitted into {approx}8.5-{angstrom} resolution cryoelectron microscopy reconstructions of the virus-receptor complexes for the 3 PV serotypes. These structures show that, compared with human rhinoviruses, the virus-receptor interactions for PVs have a greater dependence on hydrophobic interactions, as might be required for a virus that can inhabitmore » environments of different pH. The pocket factor was shown to remain in the virus during the first recognition stage. The present structures, when combined with earlier mutational investigations, show that in the subsequent entry stage the receptor moves further into the canyon when at a physiological temperature, thereby expelling the pocket factor and separating the viral subunits to form 135S particles. These results provide a detailed analysis of how a nonenveloped virus can enter its host cell.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hwang,W.; Lin, Y.; Santelli, E.

Severe acute respiratory syndrome (SARS) is a newly emerged infectious disease that caused pandemic spread in 2003. The etiological agent of SARS is a novel coronavirus (SARS-CoV). The coronaviral surface spike protein S is a type I transmembrane glycoprotein that mediates initial host binding via the cell surface receptor angiotensin-converting enzyme 2 (ACE2), as well as the subsequent membrane fusion events required for cell entry. Here we report the crystal structure of the S1 receptor binding domain (RBD) in complex with a neutralizing antibody, 80R, at 2.3 {angstrom} resolution, as well as the structure of the uncomplexed S1 RBD atmore » 2.2 {angstrom} resolution. We show that the 80R-binding epitope on the S1 RBD overlaps very closely with the ACE2-binding site, providing a rationale for the strong binding and broad neutralizing ability of the antibody. We provide a structural basis for the differential effects of certain mutations in the spike protein on 80R versus ACE2 binding, including escape mutants, which should facilitate the design of immunotherapeutics to treat a future SARS outbreak. We further show that the RBD of S1 forms dimers via an extensive interface that is disrupted in receptor- and antibody-bound crystal structures, and we propose a role for the dimer in virus stability and infectivity.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

J Bachega; l Bleicher; E Horjales

Glossoscolex paulistus is a free-living earthworm encountered in south-east Brazil. Its oxygen transport requirements are undertaken by a giant extracellular haemoglobin, or erythrocruorin (HbGp), which has an approximate molecular mass of 3.6 MDa and, by analogy with its homologue from Lumbricus terrestris (HbLt), is believed to be composed of a total of 180 polypeptide chains. In the present work the full 3.6 MDa particle in its cyanomet state was purified and crystallized using sodium citrate or PEG8000 as precipitant. The crystals contain one-quarter of the full particle in the asymmetric unit of the I222 cell and have parameters of amore » = 270.8 {angstrom}, b = 320.3 {angstrom} and c = 332.4 {angstrom}. Diffraction data were collected to 3.15 {angstrom} using synchrotron radiation on beamline X29A at the Brookhaven National Laboratory and represent the highest resolution data described to date for similar erythrocruorins. The structure was solved by molecular replacement using a search model corresponding to one-twelfth of its homologue from HbLt. This revealed that HbGp belongs to the type I class of erythrocruorins and provided an interpretable initial electron density map in which many features including the haem groups and disulfide bonds could be identified.« less

A Comparison of Cocrystal Structure Solutions from Powder and Single Crystal Techniques

DOE Office of Scientific and Technical Information (OSTI.GOV)

S Lapidus; P Stephens; K Arora

We demonstrate the effectiveness and accuracy of high resolution powder diffraction for determination of cocrystal structures through a double-blind study. Structures of 10 cocrystals of varying complexity were determined independently using single crystal and powder techniques. The two methodologies give identical molecular packing and hydrogen bond topology, and an rms difference in covalent bond lengths of 0.035 {angstrom}. Powder techniques are clearly sufficient to establish a complete characterization of cocrystal geometry.

Energy flux and characteristic energy of an elemental auroral structure

NASA Technical Reports Server (NTRS)

Lanchester, B. S.; Palmer, J. R.; Rees, M. H.; Lummerzheim, D.; Kaila, K.; Turunen, T.

1994-01-01

Electron density profiles acquired with the EISCAT radar at 0.2 s time resolution, together with TV images and photometric intensities, were used to study the characteristics of thin (less than 1 km) auroral arc structures that drifted through the field of view of the instruments. It is demonstrated that both high time and space resolution are essential for deriving the input parameters of the electron flux responsible for the elemental auroral structures. One such structure required a 400 mW/sq m (erg/sq cm s) downward energy flux carried by an 8 keV monochromatic electron flux equivalent to a current density of 50 micro Angstrom/sq m.

2.2 Å resolution cryo-EM structure of β-galactosidase in complex with a cell-permeant inhibitor.

PubMed

Bartesaghi, Alberto; Merk, Alan; Banerjee, Soojay; Matthies, Doreen; Wu, Xiongwu; Milne, Jacqueline L S; Subramaniam, Sriram

2015-06-05

Cryo-electron microscopy (cryo-EM) is rapidly emerging as a powerful tool for protein structure determination at high resolution. Here we report the structure of a complex between Escherichia coli β-galactosidase and the cell-permeant inhibitor phenylethyl β-D-thiogalactopyranoside (PETG), determined by cryo-EM at an average resolution of ~2.2 angstroms (Å). Besides the PETG ligand, we identified densities in the map for ~800 water molecules and for magnesium and sodium ions. Although it is likely that continued advances in detector technology may further enhance resolution, our findings demonstrate that preparation of specimens of adequate quality and intrinsic protein flexibility, rather than imaging or image-processing technologies, now represent the major bottlenecks to routinely achieving resolutions close to 2 Å using single-particle cryo-EM. Copyright © 2015, American Association for the Advancement of Science.

Neutral Atomic Emissions from Comet Hale-Bopp

NASA Astrophysics Data System (ADS)

Oliversen, R. J.; Scherb, F.; Roesler, F. L.; Mierkiewicz, E. J.; Woodward, R. C.; Hilton, G. M.; Doane, N. E.

1997-07-01

High resolution (R=100,000) spectra of atomic oxygen, hydrogen, and carbon from Comet Hale-Bopp were obtained at the NSO McMath-Pierce main telescope from February 8 to April 19, 1997, using a 50 mm dual-etalon Fabry-Perot/CCD spectrometer. The field of view was 6 arcmin. Spectra with good signal-to-noise were obtained for the emission lines [O I] 6300 Angstroms, Hα (6563 Angstroms), and [C I] 9850 Angstroms. On several of these nights, complementary [O I] 6300 Angstroms observations were simultaneously obtained with the Wisconsin Hα Mapper (WHα M) at Kitt Peak. Additional [O I] 6300 Angstroms observations were also obtained in September 1996. These [C I] 9850 Angstroms observations are the first extensive data set of this cometary line. We will present an overview of our observations and preliminary results.

Stabilization of the E* Form Turns Thrombin into an Anticoagulant

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bah, Alaji; Carrell, Christopher J.; Chen, Zhiwei

2009-07-31

Previous studies have shown that deletion of nine residues in the autolysis loop of thrombin produces a mutant with an anticoagulant propensity of potential clinical relevance, but the molecular origin of the effect has remained unresolved. The x-ray crystal structure of this mutant solved in the free form at 1.55 {angstrom} resolution reveals an inactive conformation that is practically identical (root mean square deviation of 0.154 {angstrom}) to the recently identified E* form. The side chain of Trp215 collapses into the active site by shifting >10 {angstrom} from its position in the active E form, and the oxyanion hole ismore » disrupted by a flip of the Glu192-Gly193 peptide bond. This finding confirms the existence of the inactive form E* in essentially the same incarnation as first identified in the structure of the thrombin mutant D102N. In addition, it demonstrates that the anticoagulant profile often caused by a mutation of the thrombin scaffold finds its likely molecular origin in the stabilization of the inactive E* form that is selectively shifted to the active E form upon thrombomodulin and protein C binding.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sippel, K.; Boehlein, S; Sakai, Y

Mycoplasma genitalium is a human pathogen that is associated with nongonococcal urethritis in men and cervicitis in women. The cloning, expression, purification and crystallization of the protein MG289 from M. genitalium strain G37 are reported here. Crystals of MG289 diffracted X-rays to 2.8 {angstrom} resolution. The crystals belonged to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.7, b = 90.9, c = 176.1 {angstrom}. The diffraction data after processing had an overall R{sub merge} of 8.7%. The crystal structure of Cypl, the ortholog of MG289 from M. hyorhinis, has recently been determined, providing amore » reasonable phasing model; molecular replacement is currently under way.« less

Purification, Crystallization, and Preliminary Crystallographic Analysis of Deoxyuridine Triphosphate Nucleotidohydrolase from Arabidopsis Thaliana

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bajaj,M.; Moriyama, H.

2007-01-01

The deoxyuridine triphosphate nucleotidohydrolase gene from Arabidopsis thaliana was expressed and the gene product was purified. Crystallization was performed by the hanging-drop vapour-diffusion method at 298 K using 2 M ammonium sulfate as the precipitant. X-ray diffraction data were collected to 2.2 Angstroms resolution using Cu K{alpha} radiation. The crystal belongs to the orthorhombic space group P212121, with unit-cell parameters a = 69.90, b = 70.86 Angstroms, c = 75.55 Angstroms . Assuming the presence of a trimer in the asymmetric unit, the solvent content was 30%, with a VM of 1.8 Angstroms 3 Da-1.

Discrimination between Closely Related Cellular Metabolites by the SAM-I Riboswitch

DOE Office of Scientific and Technical Information (OSTI.GOV)

Montange, R.; Mondragon, E; van Tyne, D

2010-01-01

The SAM-I riboswitch is a cis-acting element of genetic control found in bacterial mRNAs that specifically binds S-adenosylmethionine (SAM). We previously determined the 2.9-{angstrom} X-ray crystal structure of the effector-binding domain of this RNA element, revealing details of RNA-ligand recognition. To improve this structure, variations were made to the RNA sequence to alter lattice contacts, resulting in a 0.5-{angstrom} improvement in crystallographic resolution and allowing for a more accurate refinement of the crystallographic model. The basis for SAM specificity was addressed by a structural analysis of the RNA complexed to S-adenosylhomocysteine (SAH) and sinefungin and by measuring the affinity ofmore » SAM and SAH for a series of mutants using isothermal titration calorimetry. These data illustrate the importance of two universally conserved base pairs in the RNA that form electrostatic interactions with the positively charged sulfonium group of SAM, thereby providing a basis for discrimination between SAM and SAH.« less

Production, Purification, Crystallization and Preliminary X-ray Structural Studies of Adeno-Associated Virus Serotype 5

DOE Office of Scientific and Technical Information (OSTI.GOV)

DiMattia,M.; Govindasamy, L.; Levy, H.

2005-01-01

Adeno-associated virus serotype 5 (AAV5) is under development for gene-therapy applications for the treatment of cystic fibrosis. To elucidate the structural features of AAV5 that control its enhanced transduction of the apical surface of airway epithelia compared with other AAV serotypes, X-ray crystallographic studies of the viral capsid have been initiated. The production, purification, crystallization and preliminary crystallographic analysis of empty AAV5 viral capsids are reported. The crystals diffract X-rays to beyond 3.2 Angstroms resolution using synchrotron radiation and belong to the orthorhombic space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 264.7, b = 447.9, c =more » 629.7 Angstroms. There is one complete T = 1 viral capsid per asymmetric unit. The orientation and position of the viral capsid in the asymmetric unit have been determined by rotation and translation functions, respectively, and the AAV5 structure determination is in progress.« less

The 2.3 {angstrom} crystal structure of cholera toxin B subunit pentamer: Choleragenoid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Rong-Guang; Westbrook, M.L.; Maulik, P.R.

1996-02-01

Cholera toxin, a heterohexameric AB{sub 5} enterotoxin released by Vibrio cholera, induces a profuse secretory diarrhea in susceptible hosts. Choleragenoid, the B subunit pentamer of cholera toxin, directs the enzymatic A subunit to its target by binding to GM{sub 1} gangliosides exposed on the luminal surface of intestinal epithelial cells. We have solved the crystal structure of choleragenoid at 2.3 {Angstrom} resolution by combining single isomorphous replacement with non-crystallographic symmetry averaging. The structure of the B subunits, and their pentameric arrangement, closely resembles that reported for the intact holotoxin (choleragen), the heat-labile enterotoxin from E. coli, and for a choleragenoid-GM{submore » 1} pentasaccharide complex. In the absence of the A subunit the central cavity of the B pentamer is a highly solvated channel. The binding of the A subunit or the receptor pentasaccharide to choleragenoid has only a modest effect on the local stereochemistry and does not perceptibly alter the subunit interface.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Balakrishna, A.M.; Saxena, A.; Mok, H. Y.-K.

The type IVb pilus of the enteropathogenic bacteria Salmonella typhi is a major adhesion factor during the entry of this pathogen into gastrointestinal epithelial cells. Its target of adhesion is a stretch of 10 residues from the first extracellular domain of cystic fibrosis transmembrane conductance regulator (CFTR). The crystal structure of the N-terminal 25 amino acid deleted S. typhi native PilS protein ({Delta}PilS), which makes the pilus, was determined at 1.9 {angstrom} resolution by the multiwavelength anomalous dispersion method. Also, the structure of the complex of {Delta}PilS and a target CFTR peptide, determined at 1.8 {angstrom}, confirms that residues 113-117more » (NKEER) of CFTR are involved in binding with the pilin protein and gives us insight on the amino acids that are essential for binding. Furthermore, we have also explored the role of a conserved disulfide bridge in pilus formation. The subunit structure and assembly architecture are crucial for understanding pilus functions and designing suitable therapeutics against typhoid.« less

Structural Basis for Inhibition of Mammalian Adenylyl Cyclase by Calcium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mou, Tung-Chung; Masada, Nanako; Cooper, Dermot M.F.

2009-09-11

Type V and VI mammalian adenylyl cyclases (AC5, AC6) are inhibited by Ca{sup 2+} at both sub- and supramicromolar concentration. This inhibition may provide feedback in situations where cAMP promotes opening of Ca{sup 2+} channels, allowing fine control of cardiac contraction and rhythmicity in cardiac tissue where AC5 and AC6 predominate. Ca{sup 2+} inhibits the soluble AC core composed of the C1 domain of AC5 (VC1) and the C2 domain of AC2 (IIC2). As observed for holo-AC5, inhibition is biphasic, showing 'high-affinity' (K{sub i} = {approx}0.4 {mu}M) and 'low-affinity' (K{sub i} = {approx}100 {mu}M) modes of inhibition. At micromolar concentration,more » Ca{sup 2+} inhibition is nonexclusive with respect to pyrophosphate (PP{sub i}), a noncompetitive inhibitor with respect to ATP, but at >100 {mu}M Ca{sup 2+}, inhibition appears to be exclusive with respect to PP{sub i}. The 3.0 {angstrom} resolution structure of G{alpha}s{center_dot}GTP{gamma}S/forskolin-activated VC1:IIC2 crystals soaked in the presence of ATP{alpha}S and 8 {mu}M free Ca{sup 2+} contains a single, loosely coordinated metal ion. ATP soaked into VC1:IIC2 crystals in the presence of 1.5 mM Ca{sup 2+} is not cyclized, and two calcium ions are observed in the 2.9 {angstrom} resolution structure of the complex. In both of the latter complexes VC1:IIC2 adopts the 'open', catalytically inactive conformation characteristic of the apoenzyme, in contrast to the 'closed', active conformation seen in the presence of ATP analogues and Mg{sup 2+} or Mn{sup 2+}. Structures of the pyrophosphate (PP{sub i}) complex with 10 mM Mg{sup 2+} (2.8 {angstrom}) or 2 mM Ca{sup 2+} (2.7 {angstrom}) also adopt the open conformation, indicating that the closed to open transition occurs after cAMP release. In the latter complexes, Ca{sup 2+} and Mg{sup 2+} bind only to the high-affinity 'B' metal site associated with substrate/product stabilization. Ca{sup 2+} thus stabilizes the inactive conformation in both ATP- and PP{sub i}-bound states.« less

Crystal Structure of the Arginine Repressor Protein in Complex With the DNA Operator From Mycobacterium Tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cherney, L.T.; Cherney, M.M.; Garen, C.R.

2009-05-12

The Mycobacterium tuberculosis (Mtb) gene product encoded by open reading frame Rv1657 is an arginine repressor (ArgR). All genes involved in the L-arginine (hereafter arginine) biosynthetic pathway are essential for optimal growth of the Mtb pathogen, thus making MtbArgR a potential target for drug design. The C-terminal domains of arginine repressors (CArgR) participate in oligomerization and arginine binding. Several crystal forms of CArgR from Mtb (MtbCArgR) have been obtained. The X-ray crystal structures of MtbCArgR were determined at 1.85 {angstrom} resolution with bound arginine and at 2.15 {angstrom} resolution in the unliganded form. These structures show that six molecules ofmore » MtbCArgR are arranged into a hexamer having approximate 32 point symmetry that is formed from two trimers. The trimers rotate relative to each other by about 11{sup o} upon binding arginine. All residues in MtbCArgR deemed to be important for hexamer formation and for arginine binding have been identified from the experimentally determined structures presented. The hexamer contains six regular sites in which the arginine molecules have one common binding mode and three sites in which the arginine molecules have two overlapping binding modes. The latter sites only bind the ligand at high (200 mM) arginine concentrations.« less

Structural reorganization of the interleukin-7 signaling complex

DOE Office of Scientific and Technical Information (OSTI.GOV)

McElroy, Craig A.; Holland, Paul J.; Zhao, Peng

2012-06-29

We report here an unliganded receptor structure in the common gamma-chain ({gamma}{sub c}) family of receptors and cytokines. The crystal structure of the unliganded form of the interleukin-7 alpha receptor (IL-7R{alpha}) extracellular domain (ECD) at 2.15 {angstrom} resolution reveals a homodimer forming an 'X' geometry looking down onto the cell surface with the C termini of the two chains separated by 110 {angstrom} and the dimer interface comprising residues critical for IL-7 binding. Further biophysical studies indicate a weak association of the IL-7R{alpha} ECDs but a stronger association between the {gamma}{sub c}/IL-7R{alpha} ECDs, similar to previous studies of the full-lengthmore » receptors on CD4{sup +} T cells. Based on these and previous results, we propose a molecular mechanism detailing the progression from the inactive IL-7R{alpha} homodimer and IL-7R{alpha}-{gamma}{sub c} heterodimer to the active IL-7-IL-7R{alpha}-{gamma}{sub c} ternary complex whereby the two receptors undergo at least a 90{sup o} rotation away from the cell surface, moving the C termini of IL-7R{alpha} and {gamma}{sub c} from a distance of 110 {angstrom} to less than 30 {angstrom} at the cell surface. This molecular mechanism can be used to explain recently discovered IL-7- and {gamma}{sub c}-independent gain-of-function mutations in IL-7R{alpha} from B- and T-cell acute lymphoblastic leukemia patients. The mechanism may also be applicable to other {gamma}{sub c} receptors that form inactive homodimers and heterodimers independent of their cytokines.« less

Biochemical and Structural Characterization of Lysophosphatidic Acid Binding by a Humanized Monoclonal Antibody

DOE Office of Scientific and Technical Information (OSTI.GOV)

J Fleming; J Wojciak; M Campbell

Lysophosphatidic acid (LPA) is a common product of glycerophospholipid metabolism and an important mediator of signal transduction. Aberrantly high LPA concentrations accompany multiple disease states. One potential approach for treatment of these diseases, therefore, is the therapeutic application of antibodies that recognize and bind LPA as their antigen. We have determined the X-ray crystal structure of an anti-LPA antibody (LT3015) Fab fragment in its antigen-free form to 2.15 {angstrom} resolution and in complex with two LPA isotypes (14:0 and 18:2) to resolutions of 1.98 and 2.51 {angstrom}, respectively. The variable CDR (complementarity-determining region) loops at the antigen binding site adoptmore » nearly identical conformations in the free and antigen-bound crystal structures. The crystallographic models reveal that the LT3015 antibody employs both heavy- and light-chain CDR loops to create a network of eight hydrogen bonds with the glycerophosphate head group of its LPA antigen. The head group is almost completely excluded from contact with solvent, while the hydrocarbon tail is partially solvent-exposed. In general, mutation of amino acid residues at the antigen binding site disrupts LPA binding. However, the introduction of particular mutations chosen strategically on the basis of the structures can positively influence LPA binding affinity. Finally, these structures elucidate the exquisite specificity demonstrated by an anti-lipid antibody for binding a structurally simple and seemingly unconstrained target molecule.« less

Purification, crystallization and preliminary X-ray diffraction analysis of the carbohydrate-binding region of the Streptococcus gordonii adhesin GspB

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pyburn, Tasia M.; Yankovskaya, Victoria; Bensing, Barbara A.

2012-07-11

The carbohydrate-binding region of the bacterial adhesin GspB from Streptococcus gordonii strain M99 (GspB{sub BR}) was expressed in Escherichia coli and purified using affinity and size-exclusion chromatography. Separate sparse-matrix screening of GspB{sub BR} buffered in either 20 mM Tris pH 7.4 or 20 mM HEPES pH 7.5 resulted in different crystallographic behavior such that different precipitants, salts and additives supported crystallization of GspB{sub BR} in each buffer. While both sets of conditions supported crystal growth in space group P2{sub 1}2{sub 1}2{sub 1}, the crystals had distinct unit-cell parameters of a = 33.3, b = 86.7, c = 117.9 {angstrom} formore » crystal form 1 and a = 34.6, b = 98.3, c = 99.0 {angstrom} for crystal form 2. Additive screening improved the crystals grown in both conditions such that diffraction extended to beyond 2 {angstrom} resolution. A complete data set has been collected to 1.3 {angstrom} resolution with an overall R{sub merge} value of 0.04 and an R{sub merge} value of 0.33 in the highest resolution shell.« less

Structural Basis for the Catalytic Activity of Human SER/THR Protein Phosphatase-5

NASA Technical Reports Server (NTRS)

Swingle, M. R.; Honkanen, R.; Ciszak, E.

2004-01-01

Serinekhreonine protein phosphatase-5 (PP5) affects many signaling networks that regulate cell growth. Here we report the 1.6 Angstrom resolution crystal structure of PP5 catalytic domain with metal and phosphate ions in the active site. The structure reveals a mechanism for PPS-mediated catalysis that requires the precise positioning of two metal ions within a conserved Asp(sup 271)-M(sub 1),-M(sub 2)-His(sup 427)-W(sup 2)-His(sup 304)-Asp(sup 274) catalytic motif, and provides a structural basis for the exceptional catalytic proficiency of protein phosphatases placing them among the most powerful catalysts. Resolution of the entire C-terminus revealed a novel subdomain, and the structure of PP5 should aid development of specific inhibitors.

Design of structurally distinct proteins using strategies inspired by evolution

DOE PAGES

Jacobs, T. M.; Williams, B.; Williams, T.; ...

2016-05-06

Natural recombination combines pieces of preexisting proteins to create new tertiary structures and functions. In this paper, we describe a computational protocol, called SEWING, which is inspired by this process and builds new proteins from connected or disconnected pieces of existing structures. Helical proteins designed with SEWING contain structural features absent from other de novo designed proteins and, in some cases, remain folded at more than 100°C. High-resolution structures of the designed proteins CA01 and DA05R1 were solved by x-ray crystallography (2.2 angstrom resolution) and nuclear magnetic resonance, respectively, and there was excellent agreement with the design models. Finally, thismore » method provides a new strategy to rapidly create large numbers of diverse and designable protein scaffolds.« less

Expression, purification, crystallization and preliminary X-ray crystallographic analysis of L-lactate dehydrogenase and its H171C mutant from Bacillus subtilis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Yanfeng; Gao, Xiaoli

2012-08-31

L-Lactate dehydrogenase (LDH) is an important enzyme involved in the last step of glycolysis that catalyzes the reversible conversion of pyruvate to L-lactate with the simultaneous oxidation of NADH to NAD{sup +}. In this study, wild-type LDH from Bacillus subtilis (BsLDH-WT) and the H171C mutant (BsLDH-H171C) were expressed in Escherichia coli and purified to near-homogeneity. BsLDH-WT was crystallized in the presence of fructose 1,6-bisphosphate (FBP) and NAD{sup +} and the crystal diffracted to 2.38 {angstrom} resolution. The crystal belonged to space group P3, with unit-cell parameters a = b = 171.04, c = 96.27 {angstrom}. BsLDH-H171C was also crystallized asmore » the apoenzyme and in complex with NAD{sup +}, and data sets were collected to 2.20 and 2.49 {angstrom} resolution, respectively. Both BsLDH-H171C crystals belonged to space group P3, with unit-cell parameters a = b = 133.41, c = 99.34 {angstrom} and a = b = 133.43, c = 99.09 {angstrom}, respectively. Tetramers were observed in the asymmetric units of all three crystals.« less

The 2.6 Angstrom Crystal Structure of a Human A[subscript 2A] Adenosine Receptor Bound to an Antagonist

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jaakola, Veli-Pekka; Griffith, Mark T.; Hanson, Michael A.

2009-01-15

The adenosine class of heterotrimeric guanine nucleotide-binding protein (G protein)-coupled receptors (GPCRs) mediates the important role of extracellular adenosine in many physiological processes and is antagonized by caffeine. We have determined the crystal structure of the human A{sub 2A} adenosine receptor, in complex with a high-affinity subtype-selective antagonist, ZM241385, to 2.6 angstrom resolution. Four disulfide bridges in the extracellular domain, combined with a subtle repacking of the transmembrane helices relative to the adrenergic and rhodopsin receptor structures, define a pocket distinct from that of other structurally determined GPCRs. The arrangement allows for the binding of the antagonist in an extendedmore » conformation, perpendicular to the membrane plane. The binding site highlights an integral role for the extracellular loops, together with the helical core, in ligand recognition by this class of GPCRs and suggests a role for ZM241385 in restricting the movement of a tryptophan residue important in the activation mechanism of the class A receptors.« less

Allosteric Inhibition via R-state Destabilization in ATP Sulfurylase from Penicillium chrysogenum

DOE Office of Scientific and Technical Information (OSTI.GOV)

MacRae, I. J.

2002-01-01

The structure of the cooperative hexameric enzyme ATP sulfurylase from Penicillium chrysogenum bound to its allosteric inhibitor, 3'-phosphoadenosine-5'-phosphosulfate (PAPS), was determined to 2.6 {angstrom} resolution. This structure represents the low substrate-affinity T-state conformation of the enzyme. Comparison with the high substrate-affinity R-state structure reveals that a large rotational rearrangement of domains occurs as a result of the R-to-T transition. The rearrangement is accompanied by the 17 {angstrom} movement of a 10-residue loop out of the active site region, resulting in an open, product release-like structure of the catalytic domain. Binding of PAPS is proposed to induce the allosteric transition bymore » destabilizing an R-state-specific salt linkage between Asp 111 in an N-terminal domain of one subunit and Arg 515 in the allosteric domain of a trans-triad subunit. Disrupting this salt linkage by site-directed mutagenesis induces cooperative inhibition behavior in the absence of an allosteric effector, confirming the role of these two residues.« less

Expression, purification, crystallization and preliminary X-ray studies of Lactobacillus jensenii enolase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harris, Paul T.; Raghunathan, Kannan; Spurbeck, Rachel R.

2010-09-02

Recombinant Lactobacillus jensenii enolase fused to a C-terminal noncleavable His tag was expressed in Escherichia coli, purified and crystallized by sitting-drop vapor diffusion. A complete data set was collected to 3.25 {angstrom} resolution. The crystals belonged to space group I4, with unit-cell parameters a = b = 145.31, c = 99.79 {angstrom}. There were two protein subunits in the asymmetric unit, which gave a Matthews coefficient V{sub M} of 2.8 {angstrom}{sup 3} Da{sup -1}, corresponding to 55.2% solvent content.

Resolution Quality and Atom Positions in Sub-?ngstr?m Electron Microscopy

DOE Office of Scientific and Technical Information (OSTI.GOV)

O'Keefe, Michael A.; Allard Jr, Lawrence Frederick; Blom, Douglas Allen

2005-01-01

John Cowley pioneered use of transmission electron microscopy (TEM) for high-resolution imaging and helped spur improvements in resolution that enabled researchers to pinpoint the positions of all but the lightest atoms within a crystal structure. Sub-{angstrom} capabilities allow imaging of even the lightest atoms. Initially achieved with software aberration correction (focal-series reconstruction of the specimen exit-surface wave), sub-{angstrom} imaging will become commonplace for next-generation electron microscopes with hardware-corrected lenses and monochromated electron beams. Currently, advanced HR-TEMs can image columns of light atoms (carbon, oxygen, nitrogen) in complex structures, including the lithium atoms present in battery materials. The ability to determinemore » whether an image peak represents one single atom (or atom column) instead of several depends on the resolution of the HR-(S)TEM. Rayleigh's resolution criterion, an accepted standard in optics, was derived as a means for judging when two image intensity peaks from two sources of light (stars) are distinguishable from a single source. Atom spacings closer than the Rayleigh limit have been resolved in HR-TEM, suggesting that it may be useful to consider other limits, such as the Sparrow resolution criterion. From the viewpoint of the materials scientist, it is important to be able to use the image to determine whether an image feature represents one or more atoms (resolution), and where the atoms (or atom columns) are positioned relative to one another (resolution quality). When atoms and the corresponding image peaks are separated by more than the Rayleigh limit of the HR-(S)TEM, it is possible to adjust imaging parameters so that relative peak positions in the image correspond to relative atom positions in the specimen. When atoms are closer than the Rayleigh limit, we must find the relationship of the peak position to the atom position by peak fitting or, if we have a suitable model, by image simulation.« less

Synthesis and Structural Characterization of Magnesium Based Coordination Networks in Different Solvents

DOE Office of Scientific and Technical Information (OSTI.GOV)

D Banerjee; J Finkelstein; A Smirnov

2011-12-31

Three magnesium based metal-organic frameworks, Mg{sub 3}(3,5-PDC){sub 3}(DMF){sub 3} {center_dot} DMF [1], Mg(3,5-PDC)(H{sub 2}O) {center_dot} (H{sub 2}O) [3], and Mg{sub 4}(3,5-PDC){sub 4}(DMF){sub 2}(H{sub 2}O){sub 2} {center_dot} 2DMF {center_dot} 4.5H{sub 2}O [4], and a 2-D coordination polymer, [Mg(3,5-PDC)(H{sub 2}O){sub 2}] [2] [PDC = pyridinedicarboxylate], were synthesized using a combination of DMF, methanol, ethanol, and water. Compound 1 [space group P2{sub 1}/n, a = 12.3475(5) {angstrom}, b = 11.1929(5) {angstrom}, c = 28.6734(12) {angstrom}, {beta} = 98.8160(10){sup o}, V = 3916.0(3) {angstrom}{sup 3}] consists of a combination of isolated and corner-sharing magnesium octahedra connected by the organic linkers to form a 3-Dmore » network with a 12.2 {angstrom} x 4.6 {angstrom} 1-D channel. The channel contains coordinated and free DMF molecules. In compound 2 [space group C2/c, a = 9.964(5) {angstrom}, b = 12.0694(6) {angstrom}, c = 7.2763(4) {angstrom}, {beta} = 106.4970(6){sup o}, V = 836.70(6) {angstrom}{sup 3}], PDC connects isolated seven coordinated magnesium polyhedra into a layered structure. Compound 3 [space group P6{sub 1}22, a = 11.479(1) {angstrom}, c = 14.735(3) {angstrom}, V = 1681.7(4) {angstrom}{sup 3}] (previously reported) contains isolated magnesium octahedra connected by the organic linker with each other forming a 3D network. Compound 4 [space group P2{sub 1}/c, a = 13.7442(14) {angstrom}, b = 14.2887(15) {angstrom}, c = 14.1178(14) {angstrom}, {beta} = 104.912(2){sup o}, V = 2679.2(5) {angstrom}{sup 3}] also exhibits a 3D network based on isolated magnesium octahedra with square cavities containing both disordered DMF and water molecules. The structural topologies originate due to the variable coordination ability of solvent molecules with the metal center. Water molecules coordinate with the magnesium metal centers preferably over other polar solvents (DMF, methanol, ethanol) used to synthesize the coordination networks. Despite testing multiple desolvation routes, we were unable to measure BET surface areas greater than 51.9 m{sup 2}/g for compound 1.« less

Synthesis and Structural Characterization of Magnesium Based Coordination Networks in Different Solvents

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, Debasis; Finkelstein, Jeffrey; Smirnov, A.

2015-10-15

Three magnesium based metal-organic frameworks, Mg{sub 3}(3,5-PDC){sub 3}(DMF){sub 3} {center_dot} DMF [1], Mg(3,5-PDC)(H{sub 2}O) {center_dot} (H{sub 2}O) [3], and Mg4(3,5-PDC)4(DMF){sub 2}(H{sub 2}O){sub 2} {center_dot} 2DMF {center_dot} 4.5H{sub 2}O [4], and a 2-D coordination polymer, [Mg(3,5-PDC)(H{sub 2}O){sub 2}] [2] [PDC = pyridinedicarboxylate], were synthesized using a combination of DMF, methanol, ethanol, and water. Compound 1 [space group P2{sub 1}/n, a = 12.3475(5) {angstrom}, b = 11.1929(5) {angstrom}, c = 28.6734(12) {angstrom}, {beta} = 98.8160(10){sup o}, V = 3916.0(3) {angstrom}{sup 3}] consists of a combination of isolated and corner-sharing magnesium octahedra connected by the organic linkers to form a 3-D network withmore » a 12.2 {angstrom} x 4.6 {angstrom} 1-D channel. The channel contains coordinated and free DMF molecules. In compound 2 [space group C2/c, a = 9.964(5) {angstrom}, b = 12.0694(6) {angstrom}, c = 7.2763(4) {angstrom}, {beta} = 106.4970(6){sup o}, V = 836.70(6) {angstrom}{sup 3}], PDC connects isolated seven coordinated magnesium polyhedra into a layered structure. Compound 3 [space group P6{sub 1}22, a = 11.479(1) {angstrom}, c = 14.735(3) {angstrom}, V = 1681.7(4) {angstrom}{sup 3}] (previously reported) contains isolated magnesium octahedra connected by the organic linker with each other forming a 3D network. Compound 4 [space group P2{sub 1}/c, a = 13.7442(14) {angstrom}, b = 14.2887(15) {angstrom}, c = 14.1178(14) {angstrom}, {beta} = 104.912(2){sup o}, V = 2679.2(5) {angstrom}{sup 3}] also exhibits a 3D network based on isolated magnesium octahedra with square cavities containing both disordered DMF and water molecules. The structural topologies originate due to the variable coordination ability of solvent molecules with the metal center. Water molecules coordinate with the magnesium metal centers preferably over other polar solvents (DMF, methanol, ethanol) used to synthesize the coordination networks. Despite testing multiple desolvation routes, we were unable to measure BET surface areas greater than 51.9 m{sup 2}/g for compound 1.« less

Atomic-Resolution Structure of an N(5) Flavin Adduct in D-Arginine Dehydrogenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fu, Guoxing; Yuan, Hongling; Wang, Siming

2011-09-06

D-Arginine dehydrogenase (DADH) catalyzes the flavin-dependent oxidative deamination of D-arginine and other D-amino acids to the corresponding imino acids. The 1.07 {angstrom} atomic-resolution structure of DADH crystallized with D-leucine unexpectedly revealed a covalent N(5) flavin adduct, instead of the expected iminoleucine product in the active site. This acyl adduct has been successfully reproduced by photoreduction of DADH in the presence of 4-methyl-2-oxopentanoic acid (ketoleucine). The iminoleucine may be released readily because of weak interactions in the binding site, in contrast to iminoarginine, converted to ketoleucine, which reacts with activated FAD to form the covalently linked acyl adduct.

Complete Al-SI Order in Scapolite Me[subscript 37.5], Ideally Ca[subscript 3]Na[subscript 5][Al[subscript 8]Si[subscript 16]O[subscript 48

DOE Office of Scientific and Technical Information (OSTI.GOV)

Antao, Sytle M.; Hassan, Ishmael; West Indies)

2011-09-06

The structure of an intermediate scapolite (Me{sub 36.6}) from Lake Clear, Ontario, was obtained using synchrotron high-resolution powder X-ray diffraction (HRPXRD) data and Rietveld structure refinement in space group P4{sub 2}/n. The chemical formula obtained by electron microprobe is Na{sub 2.19}Ca{sub 1.35}K{sub 0.16}[Al{sub 3.95}Si{sub 8.05}O{sub 24}]Cl{sub 0.55}(CO{sub 3}){sub 0.41}(SO{sub 4}){sub 0.04}, equivalent to Me{sub 36.6}. The unit-cell parameters are a 12.07899(1), c 7.583467(9) {angstrom}, and V 1106.443(2) {angstrom}{sup 3}. The average distances are = 1.617(1) {angstrom}, = 1.744(1) {angstrom}, and = 1.601(1) {angstrom}. Therefore, the T1 and T3 sites contain only Si atoms, and the T2 sitemore » contains only Al atoms, so the Al and Si atoms are completely ordered. Complete Al-Si order was predicted for Me{sub 37.5}, ideally Ca{sub 3}Na{sub 5}[Al{sub 8}Si{sub 16}O{sub 48}]Cl(CO{sub 3}), and is confirmed in this study. Antiphase domain boundaries (APBs) in scapolite cannot arise from Al-Si order because the average distances indicate complete Al-Si order in Me{sub 36.6}. If APBs were to arise from Al-Si order, switching of the T sites across the APBs will occur, and complete Al-Si order cannot be observed. Therefore, Al-Si order, which is present to various extents across the scapolite series, can be ruled out as the cause for the APBs. Order involving Cl and CO{sub 3} is the cause for the APBs in scapolite.« less

Structure of the Apo Form of Bacillus stearothermophilus Phosphofructokinase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mosser, Rockann; Reddy, Manchi C.M.; Bruning, John B.

2012-02-08

The crystal structure of the unliganded form of Bacillus stearothermophilus phosphofructokinase (BsPFK) was determined using molecular replacement to 2.8 {angstrom} resolution (Protein Data Bank entry 3U39). The apo BsPFK structure serves as the basis for the interpretation of any structural changes seen in the binary or ternary complexes. When the apo BsPFK structure is compared with the previously published liganded structures of BsPFK, the structural impact that the binding of the ligands produces is revealed. This comparison shows that the apo form of BsPFK resembles the substrate-bound form of BsPFK, a finding that differs from previous predictions.

A Spectral Comparison of the M Asteroid 75 Eurydike and S Asteroid 27 Euterpe

NASA Astrophysics Data System (ADS)

Busarev, V. V.

1996-09-01

75 Euridyke and 27 Euterpe were observed under small phase angles and air mass differences with the same reference star of solar type (HD11170) in the course of a night. A scanning spectrophotometer operating in the mode of photon counting in the {3380--7617 Angstroms} range with a resolution of {48 Angstroms} mounted on the 1.25-m telescope in Crimea was used. The obtained reflectance spectra are similar in general shapes to those of other asteroids of corresponding classes [1]. So the bodies may have ordinary contents. On the spectra there are the following absorption features exeeded the error limits (RMSD). For 75 Eurydike these are at {5100 Angstroms} ( ~ 10% with a width of ~ {200 Angstroms}) and {6300 Angstroms} ( ~ 8% with a width of ~ {300 Angstroms}). For 27 Euterpe there are {5100 Angstroms} and {5650 Angstroms} (3--4% with widths of {200 Angstroms}), {6000 Angstroms} and {6550 Angstroms} (2--3% with widths of {400--500 Angstroms}) weak absorption bands. The common spectral features on the bodies at {5100 Angstroms} and {5650 Angstroms} may be a result of crystal-field transitions of Fe(2+) in pyroxenes as in lunar those [2]. The specific absorption band for 75 Eurydike at {6300 Angstroms} may be caused by charge transfer transitions Fe(2+) -Fe(3+) in oxidized pyroxenes as on Earth [4]. The features on the 27 Euterpe's spectra at {6000 Angstroms} and {6550 Angstroms} may arise in oxidized Fe-Ni metal and spinel-group minerals as on other S asteroids [3]. The results show that regolithes of both M and S asteroids may contain pyroxenes and Fe-Ni metal including their oxidized states as common factors influencing optical properties of the bodies. REFERENCES: 1. Chapman C. R. and M. J. Gaffey 1979. In: "Asteroids"(T. Gehrels, Ed.), p. 655--687. Univ. of Arizona Press, Tucson. 2. Hazen R. M. et al. 1978. In: "Proc. LPSC 9th", p. 2919--2934. 3. Hiroi T. and F. Vilas 1996. "Icarus", V.119, p. 202--208. 4. Wagner J. K. et al. 1987. "Icarus", V.69, p. 14--28.

Structural Basis for Flip-Flop Action of Thiamin Pyrophosphate-dependent Enzymes Revealed by Human Pyruvate Dehydrogenase

NASA Technical Reports Server (NTRS)

Ciszak, Ewa M.; Korotchkina, Lioubov G.; Dominiak, Paulina M.; Sidhu, Sukdeep; Patel, Mulchand S.

2003-01-01

The derivative of vitamin B1, thiamin pyrophosphate, is a cofactor of enzymes performing catalysis in pathways of energy production. In alpha (sub 2) beta (sub 2)-heterotetrameric human pyruvate dehydrogenase, this cofactor is used to cleave the C(sup alpha) -C(=O) bond of pyruvate followed by reductive acetyl transfer to lipoyl-dihydrolipoamide acetyltransferase. The dynamic nonequivalence of two, otherwise chemically equivalent, catalytic sites has not yet been understood. To understand the mechanism of action of this enzyme, we determined the crystal structure of the holo-form of human pyruvate dehydrogenase at 1.95-Angstrom resolution. We propose a model for the flip-flop action of this enzyme through a concerted approximately 2-Angstrom shuttle-like motion of its heterodimers. Similarity of thiamin pyrophosphate binding in human pyruvate dehydrogenase with functionally related enzymes suggests that this newly defined shuttle-like motion of domains is common to the family of thiamin pyrophosphate-dependent enzymes.

Anomalous expansion of the copper-apical-oxygen distance in superconducting cuprate bilayers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Hua; Yacoby, Yizhak; Butko, Vladimir Y.

2010-08-27

We have introduced an improved x-ray phase-retrieval method with unprecedented speed of convergence and precision, and used it to determine with sub-Angstrom resolution the complete atomic structure of epitaxial La{sub 2-x}Sr{sub x}CuO{sub 4} ultrathin films. We focus on superconducting heterostructures built from constituent materials that are not superconducting in bulk samples. Single-phase metallic or superconducting films are also studied for comparison. The results show that this phase-retrieval diffraction method enables accurate measurement of structural modifications in near-surface layers, which may be critically important for elucidation of surface-sensitive experiments. Specifically we find that, while the copper-apical-oxygen distance remains approximately constant inmore » single-phase films, it shows a dramatic increase from the metallic-insulating interface of the bilayer towards the surface by as much as 0.45 {angstrom}. The apical-oxygen displacement is known to have a profound effect on the superconducting transition temperature.« less

Notch-Jagged complex structure implicates a catch bond in tuning ligand sensitivity

DOE PAGES

Luca, Vincent C.; Kim, Byoung Choul; Ge, Chenghao; ...

2017-03-02

Notch receptor activation initiates cell fate decisions and is distinctive in its reliance on mechanical force and protein glycosylation. The 2.5-angstrom-resolution crystal structure of the extracellular interacting region of Notch1 complexed with an engineered, high-affinity variant of Jagged1 (Jag1) reveals a binding interface that extends ~120 angstroms along five consecutive domains of each protein. O-Linked fucose modifications on Notch1 epidermal growth factor–like (EGF) domains 8 and 12 engage the EGF3 and C2 domains of Jag1, respectively, and different Notch1 domains are favored in binding to Jag1 than those that bind to the Delta-like 4 ligand. Jag1 undergoes conformational changes uponmore » Notch binding, exhibiting catch bond behavior that prolongs interactions in the range of forces required for Notch activation. In conclusion, this mechanism enables cellular forces to regulate binding, discriminate among Notch ligands, and potentiate Notch signaling.« less

Notch-Jagged complex structure implicates a catch bond in tuning ligand sensitivity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luca, Vincent C.; Kim, Byoung Choul; Ge, Chenghao

Notch receptor activation initiates cell fate decisions and is distinctive in its reliance on mechanical force and protein glycosylation. The 2.5-angstrom-resolution crystal structure of the extracellular interacting region of Notch1 complexed with an engineered, high-affinity variant of Jagged1 (Jag1) reveals a binding interface that extends ~120 angstroms along five consecutive domains of each protein. O-Linked fucose modifications on Notch1 epidermal growth factor–like (EGF) domains 8 and 12 engage the EGF3 and C2 domains of Jag1, respectively, and different Notch1 domains are favored in binding to Jag1 than those that bind to the Delta-like 4 ligand. Jag1 undergoes conformational changes uponmore » Notch binding, exhibiting catch bond behavior that prolongs interactions in the range of forces required for Notch activation. In conclusion, this mechanism enables cellular forces to regulate binding, discriminate among Notch ligands, and potentiate Notch signaling.« less

Crystal Structure of Poliovirus 3CD Protein: Virally Encoded Protease and Precursor to the RNA-Dependent RNA Polymerase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Marcotte,L.; Wass, A.; Gohara, D.

2007-01-01

Poliovirus 3CD is a multifunctional protein that serves as a precursor to the protease 3Cpro and the viral polymerase 3Dpol and also plays a role in the control of viral replication. Although 3CD is a fully functional protease, it lacks polymerase activity. We have solved the crystal structures of 3CD at a 3.4- Angstroms resolution and the G64S fidelity mutant of 3Dpol at a 3.0- Angstroms resolution. In the 3CD structure, the 3C and 3D domains are joined by a poorly ordered polypeptide linker, possibly to facilitate its cleavage, in an arrangement that precludes intramolecular proteolysis. The polymerase active sitemore » is intact in both the 3CD and the 3Dpol G64S structures, despite the disruption of a network proposed to position key residues in the active site. Therefore, changes in molecular flexibility may be responsible for the differences in fidelity and polymerase activities. Extensive packing contacts between symmetry-related 3CD molecules and the approach of the 3C domain's N terminus to the VPg binding site suggest how 3Dpol makes biologically relevant interactions with the 3C, 3CD, and 3BCD proteins that control the uridylylation of VPg during the initiation of viral replication. Indeed, mutations designed to disrupt these interfaces have pronounced effects on the uridylylation reaction in vitro.« less

Myotonic Dystrophy Type 1 RNA Crystal Structures Reveal Heterogeneous 1 × 1 Nucleotide UU Internal Loop Conformations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumar, Amit; Park, HaJeung; Fang, Pengfei

2012-03-27

RNA internal loops often display a variety of conformations in solution. Herein, we visualize conformational heterogeneity in the context of the 5'CUG/3'GUC repeat motif present in the RNA that causes myotonic dystrophy type 1 (DM1). Specifically, two crystal structures of a model DM1 triplet repeating construct, 5'r[{und UU}GGGC(C{und U}G){sub 3}GUCC]{sub 2}, refined to 2.20 and 1.52 {angstrom} resolution are disclosed. Here, differences in the orientation of the 5' dangling UU end between the two structures induce changes in the backbone groove width, which reveals that noncanonical 1 x 1 nucleotide UU internal loops can display an ensemble of pairing conformations.more » In the 2.20 {angstrom} structure, CUGa, the 5' UU forms a one hydrogen-bonded pair with a 5' UU of a neighboring helix in the unit cell to form a pseudoinfinite helix. The central 1 x 1 nucleotide UU internal loop has no hydrogen bonds, while the terminal 1 x 1 nucleotide UU internal loops each form a one-hydrogen bond pair. In the 1.52 {angstrom} structure, CUGb, the 5' UU dangling end is tucked into the major groove of the duplex. While the canonically paired bases show no change in base pairing, in CUGb the terminal 1 x 1 nucleotide UU internal loops now form two hydrogen-bonded pairs. Thus, the shift in the major groove induced by the 5' UU dangling end alters noncanonical base patterns. Collectively, these structures indicate that 1 x 1 nucleotide UU internal loops in DM1 may sample multiple conformations in vivo. This observation has implications for the recognition of this RNA, and other repeating transcripts, by protein and small molecule ligands.« less

Structural basis of the inhibition of class C acid phosphatases by adenosine 5;#8242;-phosphorothioate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Harkewal; Reilly, Thomas J.; Tanner, John J.

2012-01-20

The inhibition of phosphatases by adenosine 5'-phosphorothioate (AMPS) was first reported in the late 1960s; however, the structural basis for the inhibition has remained unknown. Here, it is shown that AMPS is a submicromolar inhibitor of class C acid phosphatases, a group of bacterial outer membrane enzymes belonging to the haloacid dehalogenase structural superfamily. Furthermore, the 1.35-{angstrom} resolution crystal structure of the inhibited recombinant Haemophilus influenzae class C acid phosphatase was determined; this is the first structure of a phosphatase complexed with AMPS. The conformation of AMPS is identical to that of the substrate 5'-AMP, except that steric factors forcemore » a rotation of the thiophosphoryl out of the normal phosphoryl-binding pocket. This conformation is catalytically nonproductive, because the P atom is not positioned optimally for nucleophilic attack by Asp64, and the O atom of the scissile O-P bond is too far from the Asp (Asp66) that protonates the leaving group. The structure of 5'-AMP complexed with the Asp64 {yields} Asn mutant enzyme was also determined at 1.35-{angstrom} resolution. This mutation induces the substrate to adopt the same nonproductive binding mode that is observed in the AMPS complex. In this case, electrostatic considerations, rather than steric factors, underlie the movement of the phosphoryl. The structures not only provide an explanation for the inhibition by AMPS, but also highlight the precise steric and electrostatic requirements of phosphoryl recognition by class C acid phosphatases. Moreover, the structure of the Asp64 {yields} Asn mutant illustrates how a seemingly innocuous mutation can cause an unexpected structural change.« less

Design, Fabrication and Testing of Multilayer Coated X-Ray Optics for the Water Window Imaging X-Ray Microscope

NASA Technical Reports Server (NTRS)

Spencer, Dwight C.

1996-01-01

Hoover et. al. built and tested two imaging Schwarzschild multilayer microscopes. These instruments were constructed as prototypes for the "Water Window Imaging X-Ray Microscope," which is a doubly reflecting, multilayer x-ray microscope configured to operate within the "water window." The "water window" is the narrow region of the x-ray spectrum between the K absorption edges of oxygen (lamda = 23.3 Angstroms) and of carbon (lamda = 43.62 Angstroms), where water is relatively highly transmissive and carbon is highly absorptive. This property of these materials, thus permits the use of high resolution multilayer x-ray microscopes for producing high contrast images of carbon-based structures within the aqueous physiological environments of living cells. We report the design, fabrication and testing of multilayer optics that operate in this regime.

Crystal Structures of Aedes Aegypt Alanine Glyoxylate Aminotransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Han,Q.; Robinson, H.; Gao, Y.

Mosquitoes are unique in having evolved two alanine glyoxylate aminotransferases (AGTs). One is 3-hydroxykynurenine transaminase (HKT), which is primarily responsible for catalyzing the transamination of 3-hydroxykynurenine (3-HK) to xanthurenic acid (XA). Interestingly, XA is used by malaria parasites as a chemical trigger for their development within the mosquito. This 3-HK to XA conversion is considered the major mechanism mosquitoes use to detoxify the chemically reactive and potentially toxic 3-HK. The other AGT is a typical dipteran insect AGT and is specific for converting glyoxylic acid to glycine. Here we report the 1.75{angstrom} high-resolution three-dimensional crystal structure of AGT from themore » mosquito Aedes aegypti (AeAGT) and structures of its complexes with reactants glyoxylic acid and alanine at 1.75 and 2.1{angstrom} resolution, respectively. This is the first time that the three-dimensional crystal structures of an AGT with its amino acceptor, glyoxylic acid, and amino donor, alanine, have been determined. The protein is dimeric and adopts the type I-fold of pyridoxal 5-phosphate (PLP)-dependent aminotransferases. The PLP co-factor is covalently bound to the active site in the crystal structure, and its binding site is similar to those of other AGTs. The comparison of the AeAGT-glyoxylic acid structure with other AGT structures revealed that these glyoxylic acid binding residues are conserved in most AGTs. Comparison of the AeAGT-alanine structure with that of the Anopheles HKT-inhibitor complex suggests that a Ser-Asn-Phe motif in the latter may be responsible for the substrate specificity of HKT enzymes for 3-HK.« less

Crystallization and preliminary X-ray diffraction analysis of red clover necrotic mosaic virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Martin, Stanton L.; Guenther, Richard H.; Sit, Tim L.

2010-11-12

Red clover necrotic mosaic virus (RCNMV) is a species that belongs to the Tombusviridae family of plant viruses with a T = 3 icosahedral capsid. RCNMV virions were purified and were crystallized for X-ray analysis using the hanging-drop vapor-diffusion method. Self-rotation functions and systematic absences identified the space group as I23, with two virions in the unit cell. The crystals diffracted to better than 4 {angstrom} resolution but were very radiation-sensitive, causing rapid decay of the high-resolution reflections. The data were processed to 6 {angstrom} in the analysis presented here.

Structures of the Kplus and NH4 Forms of Linde J

DOE Office of Scientific and Technical Information (OSTI.GOV)

R Broach; R Kirchner

2011-12-31

The aluminosilicate zeolite Linde J has a unique topology. The structures of the K{sup +} and NH{sub 4}{sup +} forms of Linde J ([X{sub 2}(H{sub 2}O)][Si{sub 2}Al{sub 2}O{sub 8}] where X = K or NH{sub 4}) are identical except for slight cell size and positional differences due to NH{sub 4}{sup +} being larger than K{sup +} cations. The space group is P2{sub 1}2{sub 1}2{sub 1}. Cell dimensions are: K{sup +} Linde J, a = 9.4577(2) {angstrom}, b = 9.5573(2) {angstrom}, c = 9.9429(2) {angstrom}; NH{sub 4}{sup +} Linde J, a = 9.6324(4) {angstrom}, b = 9.6423(3) {angstrom}, c = 10.0230(3)more » {angstrom}. Zigzag 8-ring channels intersect giving a 2-D pore system.« less

Crystal structure of phosphoethanolamine methyltransferase from Plasmodium falciparum in complex with amodiaquine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Soon Goo; Alpert, Tara D.; Jez, Joseph M.

2012-07-17

Phosphoethanolamine N-methyltransferase (PMT) is essential for phospholipid biogenesis in the malarial parasite Plasmodium falciparum. PfPMT catalyzes the triple methylation of phosphoethanolamine to produce phosphocholine, which is then used for phosphatidylcholine synthesis. Here we describe the 2.0 {angstrom} resolution X-ray crystal structure of PfPMT in complex with amodiaquine. To better characterize inhibition of PfPMT by amodiaquine, we determined the IC{sub 50} values of a series of aminoquinolines using a direct radiochemical assay. Both structural and functional analyses provide a possible approach for the development of new small molecule inhibitors of PfPMT.

Crystal Structures of Lys-63-linked tri- and di-ubiquitin Reveal a Highly Extended Chain Architecture

DOE Office of Scientific and Technical Information (OSTI.GOV)

Weeks, S.; Grasty, K; Hernandez-Cuebas, L

2009-01-01

The covalent attachment of different types of poly-ubiquitin chains signal different outcomes for the proteins so targeted. For example, a protein modified with Lys-48-linked poly-ubiquitin chains is targeted for proteasomal degradation, whereas Lys-63-linked chains encode nondegradative signals. The structural features that enable these different types of chains to encode different signals have not yet been fully elucidated. We report here the X-ray crystal structures of Lys-63-linked tri- and di-ubiquitin at resolutions of 2.3 and 1.9 {angstrom}, respectively. The tri- and di-ubiquitin species adopt essentially identical structures. In both instances, the ubiquitin chain assumes a highly extended conformation with a left-handedmore » helical twist; the helical chain contains four ubiquitin monomers per turn and has a repeat length of {approx}110 {angstrom}. Interestingly, Lys-48 ubiquitin chains also adopt a left-handed helical structure with a similar repeat length. However, the Lys-63 architecture is much more open than that of Lys-48 chains and exposes much more of the ubiquitin surface for potential recognition events. These new crystal structures are consistent with the results of solution studies of Lys-63 chain conformation, and reveal the structural basis for differential recognition of Lys-63 versus Lys-48 chains.« less

Amateur Spectroscopy: What is Achievable from the Backyard?

NASA Astrophysics Data System (ADS)

Mais, D. E.; Stencel, R. E.

2004-05-01

Recent advances in technology have opened the doors for amateurs to potentially contribute in the area of spectroscopy. This is due to both a shift in the use of more sensitive CCD detectors and the recent availability of powerful and versatile spectrometers aimed at the amateur community. We will focus on the instrument produced by Santa Barbara Instrument Group (SBIG), the Self-Guided Spectrometer (SGS). This instrument appeared on the market about four years ago aimed at a sub group of amateurs. In conjunction with SBIG CCD cameras, the SGS is self-guiding in that it keeps the image of an object locked onto the entrance slit, which allows for long exposures to be taken. The SGS allows spectra to be obtained with only modest aperture instruments of stars down to 10-12 magnitude. In addition, the SGS features a dual grating carousal which, with the flip of a lever, allows you to obtain dispersions in the low-resolution mode ( 4 Angstroms/pixel) or higher resolution mode ( 1 Angstrom/pixel). In the low-resolution mode, about 3000 Angstrom coverage is obtained whereas in the high-resolution mode, about 750 Angstroms. The area of the visible and near infrared part of the spectrum you decide to obtain a spectrum is dialed in by the user. More recently, swappable grating carousals have allowed for gratings with even higher dispersions (0.5 -0.3 Angstroms/pixel). The lower resolution mode is useful for stellar classification and obtaining spectra of planetary nebula. In the high-resolution modes, many absorption lines are visible of atoms, ions and simple molecules. In addition, one can measure the Doppler shift of absorption and emission lines to determine velocities of approach or recession of objects along with rotation velocities of stars and planets. Our particular interests have focused on identifying chemical elements/ions and compounds in the atmospheres of stars and nebulae. The resolution and sensitivity of the instrument is such that we have been able to identify the unstable element technetium in certain S and C type stars along with anomalous 12C/13C ratios as measured by absorption bands of diatomic carbon (C2). Measurements of certain line intensity ratios in planetary nebula allows for the calculation of both the nebula temperature and electron density. Our presentation will go into detail on the use of the SGS, its calibration and some of the kinds of measurements that can be made with an amateur sized telescope equipped with such "off the shelf" instrument.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee, Debasis; Borkowski, Lauren A.; Kim, Sun Jin

Two lithium-based metal-organic frameworks, Li{sub 2}(C{sub 14}H{sub 8}O{sub 4}) [Li{sub 2}(4,4'-BPDC) [1]; ULMOF-2, UL = ultralight; BPDC = biphenyldicarboxylate]; space group P2{sub 1}/c, a = 12.758(2) {angstrom}, b = 5.142(4) {angstrom}, c = 8.00(2) {angstrom}, {beta} = 97.23{sup o}, V = 520.6(14) {angstrom}{sup 3} and Li{sub 2}(C{sub 14}H{sub 8}O{sub 6}S) [Li{sub 2}(4,4'-SDB) [2]; ULMOF-3, UL = ultralight; SDB = sulfonyldibenzoate], space group P2{sub 1}/n, a = 5.5480(11) {angstrom}, b = 23.450(5) {angstrom}, c = 10.320(2) {angstrom}, {beta} = 96.47(3){sup o}, V = 1334.1(5) {angstrom}3, were synthesized. Compounds 1 and 2 were synthesized by solvothermal methods and were characterized using singlemore » crystal X-ray diffraction. Structure 1 consists of layers of two-dimensional antifluorite related LiO motif connected by BPDC linkers, whereas structure 2 is constructed by a combination of tetrameric lithium polyhedral clusters connected by the sulfonyldibenzoate linker. The frameworks are stable up to 575 and 500 C, respectively, under N{sub 2} atmosphere.« less

Structural Basis for Reversible and Irreversible Inhibition of Human Cathepsin L by their Respective dipeptidyl glyoxal and diazomethylketone Inhibitors

DOE Office of Scientific and Technical Information (OSTI.GOV)

R Shenoy; J Sivaraman

Cathepsin L plays a key role in many pathophysiological conditions including rheumatoid arthritis, tumor invasion and metastasis, bone resorption and remodeling. Here we report the crystal structures of two analogous dipeptidyl inhibitor complexes which inhibit human cathepsin L in reversible and irreversible modes, respectively. To-date, there are no crystal structure reports of complexes of proteases with their glyoxal inhibitors or complexes of cathepsin L and their diazomethylketone inhibitors. These two inhibitors - inhibitor 1, an {alpha}-keto-{beta}-aldehyde and inhibitor 2, a diazomethylketone, have different groups in the S1 subsite. Inhibitor 1 [Z-Phe-Tyr (OBut)-COCHO], with a Ki of 0.6 nM, is themore » most potent, reversible, synthetic peptidyl inhibitor of cathepsin L reported to-date. The structure of the inhibitor 1 complex was refined up to 2.2 {angstrom} resolution. The structure of the complex of the inhibitor 2 [Z-Phe-Tyr (t-Bu)-diazomethylketone], an irreversible inhibitor that can inactivate cathepsin L at {micro}M concentrations, was refined up to 1.76 {angstrom} resolution. These two inhibitors have substrate-like interactions with the active site cysteine (Cys25). Inhibitor 1 forms a tetrahedral hemithioacetal adduct, whereas the inhibitor 2 forms a thioester with Cys25. The inhibitor 1 {beta}-aldehyde group is shown to make a hydrogen bond with catalytic His163, whereas the ketone carbonyl oxygen of the inhibitor 2 interacts with the oxyanion hole. tert-Butyl groups of both inhibitors are found to make several non-polar contacts with S' subsite residues of cathepsin L. These studies, combined with other complex structures of cathepsin L, reveal the structural basis for their potency and selectivity.« less

Unusual Water-mediated Antigenic Recognition of the Proinflammatory Cytokine Interleukin-18

DOE Office of Scientific and Technical Information (OSTI.GOV)

Argiriadi, Maria A.; Xiang, Tao; Wu, Chengbin

2009-10-21

The unique cytokine interleukin-18 (IL-18) acts synergistically with IL-12 to regulate T-helper 1 and 2 lymphocytes and, as such, seems to underlie the pathogenesis of various autoimmune and allergic diseases. Several anti-IL-18 agents are in clinical development, including the recombinant human antibody ABT-325, which is entering trials for autoimmune diseases. Given competing cytokine/receptor and cytokine/receptor decoy interactions, understanding the structural basis for recognition is critical for effective development of anti-cytokine therapies. Here we report three crystal structures: the murine antibody 125-2H Fab fragment bound to human IL-18, at 1.5 {angstrom} resolution; the 125-2H Fab (2.3 {angstrom}); and the ABT-325 Fabmore » (1.5 {angstrom}). These structures, along with human/mouse IL-18 chimera binding data, allow us to make three key observations relevant to the biology and antigenic recognition of IL-18 and related cytokines. First, several IL-18 residues shift dramatically (>10 {angstrom}) upon binding 125-2H, compared with unbound IL-18 (Kato, Z., Jee, J., Shikano, H., Mishima, M., Ohki, I., Ohnishi, H., Li, A., Hashimoto, K., Matsukuma, E., Omoya, K., Yamamoto, Y., Yoneda, T., Hara, T., Kondo, N., and Shirakawa, M. (2003) Nat. Struct. Biol. 10, 966-971). IL-18 thus exhibits plasticity that may be common to its interactions with other receptors. Related cytokines may exhibit similar plasticity. Second, ABT-325 and 125-2H differ significantly in combining site character and architecture, thus explaining their ability to bind IL-18 simultaneously at distinct epitopes. These data allow us to define the likely ABT-325 epitope and thereby explain the distinct neutralizing mechanisms of both antibodies. Third, given the high 125-2H potency, 10 well ordered water molecules are trapped upon complex formation in a cavity between two IL-18 loops and all six 125-2H complementarity-determining regions. Thus, counterintuitively, tight and specific antibody binding may in some cases be water-mediated.« less

Crystal structures reveal an induced-fit binding of a substrate-like Aza-peptide epoxide to SARS coronavirus main peptidase.

PubMed

Lee, Ting-Wai; Cherney, Maia M; Liu, Jie; James, Karen Ellis; Powers, James C; Eltis, Lindsay D; James, Michael N G

2007-02-23

The SARS coronavirus main peptidase (SARS-CoV M(pro)) plays an essential role in the life-cycle of the virus and is a primary target for the development of anti-SARS agents. Here, we report the crystal structure of M(pro) at a resolution of 1.82 Angstroms, in space group P2(1) at pH 6.0. In contrast to the previously reported structure of M(pro) in the same space group at the same pH, the active sites and the S1 specificity pockets of both protomers in the structure of M(pro) reported here are in the catalytically competent conformation, suggesting their conformational flexibility. We report two crystal structures of M(pro) having an additional Ala at the N terminus of each protomer (M(+A(-1))(pro)), both at a resolution of 2.00 Angstroms, in space group P4(3)2(1)2: one unbound and one bound by a substrate-like aza-peptide epoxide (APE). In the unbound form, the active sites and the S1 specificity pockets of both protomers of M(+A(-1))(pro) are observed in a collapsed (catalytically incompetent) conformation; whereas they are in an open (catalytically competent) conformation in the APE-bound form. The observed conformational flexibility of the active sites and the S1 specificity pockets suggests that these parts of M(pro) exist in dynamic equilibrium. The structural data further suggest that the binding of APE to M(pro) follows an induced-fit model. The substrate likely also binds in an induced-fit manner in a process that may help drive the catalytic cycle.

Preliminary neutron diffraction studies of Escherichia coli dihydrofolate reductase bound to the anticancer drug methotrexate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bennett, Brad C.; Meilleur, Flora; Myles, Dean A A

2005-01-01

The contribution of H atoms in noncovalent interactions and enzymatic reactions underlies virtually all aspects of biology at the molecular level, yet their 'visualization' is quite difficult. To better understand the catalytic mechanism of Escherichia coli dihydrofolate reductase (ecDHFR), a neutron diffraction study is under way to directly determine the accurate positions of H atoms within its active site. Despite exhaustive investigation of the catalytic mechanism of DHFR, controversy persists over the exact pathway associated with proton donation in reduction of the substrate, dihydrofolate. As the initial step in a proof-of-principle experiment which will identify ligand and residue protonation statesmore » as well as precise solvent structures, a neutron diffraction data set has been collected on a 0.3 mm{sup 3} D{sub 2}O-soaked crystal of ecDHFR bound to the anticancer drug methotrexate (MTX) using the LADI instrument at ILL. The completeness in individual resolution shells dropped to below 50% between 3.11 and 3.48 {angstrom} and the I/{sigma}(I) in individual shells dropped to below 2 at around 2.46 {angstrom}. However, reflections with I/{sigma}(I) greater than 2 were observed beyond these limits (as far out as 2.2 {angstrom}). To our knowledge, these crystals possess one of the largest primitive unit cells (P6{sub 1}, a = b = 92, c = 73 {angstrom}) and one of the smallest crystal volumes so far tested successfully with neutrons.« less

Crystallization and preliminary X-ray analysis of the stress-response PPM phosphatase RsbX from Bacillus subtilis.

PubMed

Suganuma, Masatoshi; Teh, Aik Hong; Makino, Masatomo; Shimizu, Nobutaka; Kaneko, Tomonori; Hirata, Kunio; Yamamoto, Masaki; Kumasaka, Takashi

2009-11-01

RsbX from Bacillus subtilis is a manganese-dependent PPM phosphatase and negatively regulates the signal transduction of the general stress response by the dephosphorylation of RsbS and RsbR, which are activators of the alternative RNA polymerase sigma factor SigB. In order to elucidate the structural-functional relationship of its Ser/Thr protein-phosphorylation mechanism, an X-ray crystallographic diffraction study of RsbX was performed. Recombinant RsbX was expressed in Escherichia coli, purified and crystallized. Crystals were obtained using the sitting-drop vapour-diffusion method and X-ray diffraction data were collected to 1.06 angstrom resolution with an R(merge) of 8.1%. The crystals belonged to the triclinic space group P1, with unit-cell parameters a = 33.3, b = 41.7, c = 68.6 angstrom , alpha = 98.8, beta = 90.0, gamma = 108.4 degrees.

Rhenium(V)-oxo complexes of neutral and monoanionic tetraazamacrocycles. X-ray structures of trans-oxohydroxo(1,4,8,11-tetraazacyclotetradecane)rhenium(V) bis(perchlorate)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsang, B.W.; Reibenspies, J.; Martell, A.E.

1993-03-17

The complexes of ReO[sub 2][sup +] and ReO(OH)[sup 2+] with 1,4,8,11-tetraazacyclotetradecane (cyclam) and 1,4,8,11-tetraazacyclotetradecan-2-one (O[sub 1]cyclam) have been synthesized and characterized. The complexes were prepared by ligand exchange reactions of the macrocycles with a variety of starting compounds including ReOCl[sub 3](PPh[sub 3])[sub 2] and ReO[sub 2](en)[sub 2]Cl. The ReO(OH)[sup 2+] complexes have been structurally characterized. ReO(OH)(H[sub [minus]1]O[sub 1]cyclam)ReO[sub 4] crystallizes in the monoclinic P2[sub 1]/n space group with a = 10.308(3) [Angstrom], b = 9.527(2) [Angstrom], c = 17.808(3) [Angstrom], and [beta] = 106.57(2)[degrees]. ReO(OH)(cyclam)(ClO[sub 4])[sub 2] crystallizes in the monoclinic C2/c space group with a = 9.734(4) [Angstrom], bmore » = 16.999(5) [Angstrom], c = 12.187(5) [Angstrom], and [beta] = 106.36[degrees]. The complex ReO(OH)(H[sub [minus]1]O[sub 1]cyclam)ReO[sub 4] has a distorted octahedral structure with one short ReO(oxo) bond and one long ReO(hydroxo) bond (1.685(8) vs 1.970(8) [Angstrom]). The deprotonated amide ReN(sp[sup 2]) bond is shorter than the other three ReN(sp[sup 3]) bond lengths (1.98(1) vs 2.13(3) [Angstrom] (average)). The structure of the ReO(OH)(cyclam)(ClO[sub 4])[sub 2] complex shows no distinction between the lengths of the two ReO(oxo and hydroxo) bonds (1.766(5) [Angstrom]) due to disorder of the oxo and hydroxo groups. Spectroscopic evidence is reported to confirm the presence of both oxo and hydroxo groups coordinated to rhenium. 38 refs., 7 figs., 6 tabs.« less

Structure of the Bacteriophage [phi]KZ Lytic Transglycosylase gp144

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fokine, Andrei; Miroshnikov, Konstantin A.; Shneider, Mikhail M.

2008-04-02

Lytic transglycosylases are enzymes that act on the peptidoglycan of bacterial cell walls. They cleave the glycosidic linkage between N-acetylmuramoyl and N-acetylglucosaminyl residues with the concomitant formation of a 1,6-anhydromuramoyl product. The x-ray structure of the lytic transglycosylase gp144 from the Pseudomonas bacteriophage {phi}KZ has been determined to 2.5-{angstrom} resolution. This protein is probably employed by the bacteriophage in the late stage of the virus reproduction cycle to destroy the bacterial cell wall to release the phage progeny. {phi}KZ gp144 is a 260-residue {alpha}-helical protein composed of a 70-residue N-terminal cell wall-binding domain and a C-terminal catalytic domain. The foldmore » of the N-terminal domain is similar to the peptidoglycan-binding domain from Streptomyces albus G d-Ala-d-Ala carboxypeptidase and to the N-terminal prodomain of human metalloproteinases that act on extracellular matrices. The C-terminal catalytic domain of gp144 has a structural similarity to the catalytic domain of the transglycosylase Slt70 from Escherichia coli and to lysozymes. The gp144 catalytic domain has an elongated groove that can bind at least five sugar residues at sites A-E. As in other lysozymes, the peptidoglycan cleavage (catalyzed by Glu{sup 115} in gp144) occurs between sugar-binding subsites D and E. The x-ray structure of the {phi}KZ transglycosylase complexed with the chitotetraose (N-acetylglucosamine){sub 4} has been determined to 2.6-{angstrom} resolution. The N-acetylglucosamine residues of the chitotetraose bind in sites A-D.« less

Crystal Structures of MEK1 Binary and Ternary Complexes with Nucleotides and Inhibitors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fischmann, Thierry O.; Smith, Catherine K.; Mayhood, Todd W.

MEK1 is a member of the MAPK signal transduction pathway that responds to growth factors and cytokines. We have determined that the kinase domain spans residues 35-382 by proteolytic cleavage. The complete kinase domain has been crystallized and its X-ray crystal structure as a complex with magnesium and ATP-{gamma}S determined at 2.1 {angstrom}. Unlike crystals of a truncated kinase domain previously published, the crystals of the intact domain can be grown either as a binary complex with a nucleotide or as a ternary complex with a nucleotide and one of a multitude of allosteric inhibitors. Further, the crystals allow formore » the determination of costructures with ATP competitive inhibitors. We describe the structures of nonphosphorylated MEK1 (npMEK1) binary complexes with ADP and K252a, an ATP-competitive inhibitor (see Table 1), at 1.9 and 2.7 {angstrom} resolution, respectively. Ternary complexes have also been solved between npMEK1, a nucleotide, and an allosteric non-ATP competitive inhibitor: ATP-{gamma}S with compound 1 and ADP with either U0126 or the MEK1 clinical candidate PD325089 at 1.8, 2.0, and 2.5 {angstrom}, respectively. Compound 1 is structurally similar to PD325901. These structures illustrate fundamental differences among various mechanisms of inhibition at the molecular level. Residues 44-51 have previously been shown to play a negative regulatory role in MEK1 activity. The crystal structure of the integral kinase domain provides a structural rationale for the role of these residues. They form helix A and repress enzymatic activity by stabilizing an inactive conformation in which helix C is displaced from its active state position. Finally, the structure provides for the first time a molecular rationale that explains how mutations in MEK may lead to the cardio-facio-cutaneous syndrome.« less

Crystal structures and transition mechanism of VO{sub 2}(A)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oka, Yoshio; Yao, Takeshi; Yamamoto, Naoichi

1998-12-01

Structures of VO{sub 2}(A) have been redetermined by single-crystal diffractometry for low- (LTP) and high-temperature (HTP) phases at 298 and 473 K, respectively. The LTP adopts the tetragonal system P4/ncc with a = 8.4403(9) {angstrom}, c = 7.666(1) {angstrom}, and Z = 16, whereas the HTP adopts the body-centered tetragonal system I4/m with a = 8.476(2) {angstrom}, c = 3.824(2) {angstrom}, and Z = 8. The refinements led to R/R{sub w} = 0.031/0.032 for LTP and 0.012/0.033 for HTP. The structures of both phases consist of edge-sharing VO{sub 6} octahedra and exhibit quite similar oxygen frameworks. Through the transition themore » V{sup 4+}-V{sup 4+} bonding in LTP with a distance of 2.7695(8) {angstrom} is dissociated in HTP to a distance of 3.0794(3) {angstrom}. The transition occurs with cooperative movements of the V atoms, namely, a rotation around the c axis and a shift along the c axis. Strangely, twinning is induced on the LTP to HTP transition but disappears on the reverse transition.« less

Optical Interferometric Micrometrology

NASA Technical Reports Server (NTRS)

Abel, Phillip B.; Lauer, James R.

1989-01-01

Resolutions in angstrom and subangstrom range sought for atomic-scale surface probes. Experimental optical micrometrological system built to demonstrate calibration of piezoelectric transducer to displacement sensitivity of few angstroms. Objective to develop relatively simple system producing and measuring translation, across surface of specimen, of stylus in atomic-force or scanning tunneling microscope. Laser interferometer used to calibrate piezoelectric transducer used in atomic-force microscope. Electronic portion of calibration system made of commercially available components.

Structure of the catalytic domain of Plasmodium falciparum ARF GTPase-activating protein (ARFGAP)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cook, William J.; Senkovich, Olga; Chattopadhyay, Debasish

2012-03-26

The crystal structure of the catalytic domain of the ADP ribosylation factor GTPase-activating protein (ARFGAP) from Plasmodium falciparum has been determined and refined to 2.4 {angstrom} resolution. Multiwavelength anomalous diffraction (MAD) data were collected utilizing the Zn{sup 2+} ion bound at the zinc-finger domain and were used to solve the structure. The overall structure of the domain is similar to those of mammalian ARFGAPs. However, several amino-acid residues in the area where GAP interacts with ARF1 differ in P. falciparum ARFGAP. Moreover, a number of residues that form the dimer interface in the crystal structure are unique in P. falciparummore » ARFGAP.« less

Column ratio mapping: a processing technique for atomic resolution high-angle annular dark-field (HAADF) images.

PubMed

Robb, Paul D; Craven, Alan J

2008-12-01

An image processing technique is presented for atomic resolution high-angle annular dark-field (HAADF) images that have been acquired using scanning transmission electron microscopy (STEM). This technique is termed column ratio mapping and involves the automated process of measuring atomic column intensity ratios in high-resolution HAADF images. This technique was developed to provide a fuller analysis of HAADF images than the usual method of drawing single intensity line profiles across a few areas of interest. For instance, column ratio mapping reveals the compositional distribution across the whole HAADF image and allows a statistical analysis and an estimation of errors. This has proven to be a very valuable technique as it can provide a more detailed assessment of the sharpness of interfacial structures from HAADF images. The technique of column ratio mapping is described in terms of a [110]-oriented zinc-blende structured AlAs/GaAs superlattice using the 1 angstroms-scale resolution capability of the aberration-corrected SuperSTEM 1 instrument.

Cloning, overexpression, purification and preliminary crystallographic studies of a mitochondrial type II peroxiredoxin from Pisum sativum.

PubMed

Barranco-Medina, Sergio; López-Jaramillo, Francisco Javier; Bernier-Villamor, Laura; Sevilla, Francisca; Lázaro, Juan José

2006-07-01

A cDNA encoding an open reading frame of 199 amino acids corresponding to a type II peroxiredoxin from Pisum sativum with its transit peptide was isolated by RT-PCR. The 171-amino-acid mature protein (estimated molecular weight 18.6 kDa) was cloned into the pET3d vector and overexpressed in Escherichia coli. The recombinant protein was purified and crystallized by the hanging-drop vapour-diffusion technique. A full data set (98.2% completeness) was collected using a rotating-anode generator to a resolution of 2.8 angstroms from a single crystal flash-cooled at 100 K. X-ray data revealed that the protein crystallizes in space group P1, with unit-cell parameters a = 61.88, b = 66.40, c = 77.23 angstroms, alpha = 102.90, beta = 104.40, gamma = 99.07 degrees, and molecular replacement using a theoretical model predicted from the primary structure as a search model confirmed the presence of six molecules in the unit cell as expected from the Matthews coefficient. Refinement of the structure is in progress.

X-ray Crystal Structure of Aristolochene Synthase from Aspergillus terreus and Evolution of Templates for the Cyclization of Farnesyl Diphosphate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shishova,E.; Di Costanzo, L.; Cane, D.

2007-01-01

Aristolochene synthase from Aspergillus terreus catalyzes the cyclization of the universal sesquiterpene precursor, farnesyl diphosphate, to form the bicyclic hydrocarbon aristolochene. The 2.2 {angstrom} resolution X-ray crystal structure of aristolochene synthase reveals a tetrameric quaternary structure in which each subunit adopts the {alpha}-helical class I terpene synthase fold with the active site in the 'open', solvent-exposed conformation. Intriguingly, the 2.15 {angstrom} resolution crystal structure of the complex with Mg{sup 2+}{sub 3}-pyrophosphate reveals ligand binding only to tetramer subunit D, which is stabilized in the 'closed' conformation required for catalysis. Tetramer assembly may hinder conformational changes required for the transition frommore » the inactive open conformation to the active closed conformation, thereby accounting for the attenuation of catalytic activity with an increase in enzyme concentration. In both conformations, but especially in the closed conformation, the active site contour is highly complementary in shape to that of aristolochene, and a catalytic function is proposed for the pyrophosphate anion based on its orientation with regard to the presumed binding mode of aristolochene. A similar active site contour is conserved in aristolochene synthase from Penicillium roqueforti despite the substantial divergent evolution of these two enzymes, while strikingly different active site contours are found in the sesquiterpene cyclases 5-epi-aristolochene synthase and trichodiene synthase. Thus, the terpenoid cyclase active site plays a critical role as a template in binding the flexible polyisoprenoid substrate in the proper conformation for catalysis. Across the greater family of terpenoid cyclases, this template is highly evolvable within a conserved {alpha}-helical fold for the synthesis of terpene natural products of diverse structure and stereochemistry.« less

Conformational Changes and Substrate Recognition in Pseudomonas aeruginosa d-Arginine Dehydrogenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fu, Guoxing; Yuan, Hongling; Li, Congran

2010-11-15

DADH catalyzes the flavin-dependent oxidative deamination of D-amino acids to the corresponding {alpha}-keto acids and ammonia. Here we report the first X-ray crystal structures of DADH at 1.06 {angstrom} resolution and its complexes with iminoarginine (DADH{sub red}/iminoarginine) and iminohistidine (DADH{sub red}/iminohistidine) at 1.30 {angstrom} resolution. The DADH crystal structure comprises an unliganded conformation and a product-bound conformation, which is almost identical to the DADH{sub red}/iminoarginine crystal structure. The active site of DADH was partially occupied with iminoarginine product (30% occupancy) that interacts with Tyr53 in the minor conformation of a surface loop. This flexible loop forms an 'active site lid',more » similar to those seen in other enzymes, and may play an essential role in substrate recognition. The guanidinium side chain of iminoarginine forms a hydrogen bond interaction with the hydroxyl of Thr50 and an ionic interaction with Glu87. In the structure of DADH in complex with iminohistidine, two alternate conformations were observed for iminohistidine where the imidazole groups formed hydrogen bond interactions with the side chains of His48 and Thr50 and either Glu87 or Gln336. The different interactions and very distinct binding modes observed for iminoarginine and iminohistidine are consistent with the 1000-fold difference in k{sub cat}/K{sub m} values for D-arginine and D-histidine. Comparison of the kinetic data for the activity of DADH on different D-amino acids and the crystal structures in complex with iminoarginine and iminohistidine establishes that this enzyme is characterized by relatively broad substrate specificity, being able to oxidize positively charged and large hydrophobic D-amino acids bound within a flask-like cavity.« less

Subangstrom resolution X-ray structure details aquaporin-water interactions.

PubMed

Eriksson, Urszula Kosinska; Fischer, Gerhard; Friemann, Rosmarie; Enkavi, Giray; Tajkhorshid, Emad; Neutze, Richard

2013-06-14

Aquaporins are membrane channels that facilitate the flow of water across biological membranes. Two conserved regions are central for selective function: the dual asparagine-proline-alanine (NPA) aquaporin signature motif and the aromatic and arginine selectivity filter (SF). Here, we present the crystal structure of a yeast aquaporin at 0.88 angstrom resolution. We visualize the H-bond donor interactions of the NPA motif's asparagine residues to passing water molecules; observe a polarized water-water H-bond configuration within the channel; assign the tautomeric states of the SF histidine and arginine residues; and observe four SF water positions too closely spaced to be simultaneously occupied. Strongly correlated movements break the connectivity of SF waters to other water molecules within the channel and prevent proton transport via a Grotthuss mechanism.

High-resolution electron microscope

NASA Technical Reports Server (NTRS)

Nathan, R.

1977-01-01

Employing scanning transmission electron microscope as interferometer, relative phases of diffraction maximums can be determined by analysis of dark field images. Synthetic aperture technique and Fourier-transform computer processing of amplitude and phase information provide high resolution images at approximately one angstrom.

The three-dimensional crystal structure of cholera toxin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Rong-Guang; Westbrook, M.L.; Nance, S.

1996-02-01

The clinical manifestations of cholera are largely attributable to the actions of a secreted hexameric AB{sub 5} enterotoxin (choleragen). We have solved the three-dimensional structure of choleragen at 2.5 {Angstrom} resolution and compared the refined coordinates with those of choleragenoid (isolated B pentamer) and the heat-labile enterotoxin from Escherichia coli (LT). The crystalline coordinates provide a detailed view of the stereochemistry implicated in binding to GM1 gangliosides and in carrying out ADP-ribosylation. The A2 chain of choleragen, in contrast to that of LT, is a nearly continuous {alpha}-helix with an interpretable carboxyl tail.

Cyclopentadienylniobium and -molybdenum phosphorodithioate complexes. X-ray crystal structures of CpNbCl sub 3 (S sub 2 P(OPr sup i ) sub 2 ), CpNbCl(. mu. -Cl) sub 2 Nb(S sub 2 P(OPr sup i ) sub 2 )Cp, and cis-Cp prime Mo(CO) sub 2 (S sub 2 P(OPr sup i ) sub 2 )

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woodward, S.; Riaz, U.; Curtis, M.D.

1990-10-01

Reaction of CpNbCl{sub 4} (Cp = {eta}-C{sub 5}H{sub 5}) with (Pr{sup i}O){sub 2}P(S)(SH) in the presence of NEt{sub 3} yields CpNbCl{sub 3}(S{sub 2}P(S{sub 2}Pr{sup i}){sub 2}) (1). Reduction of 1 with Na/Hg affords the Nb-Nb-bonded complex CpNbCl({mu}-Cl){sub 2}Nb(S{sub 2}P(OR){sub 2})Cp (2). In refluxing toluene, (Pr{sup i}O){sub 2}P(S)(SH) with (Cp{prime}Mo(CO){sub 3}){sub 2} (Cp{prime} = {eta}-C{sub 5}H{sub 4}Me) gives cis-Cp{prime}Mo(CO){sub 2}(S{sub 2}P(OPr{sup i}){sub 2}) (3). Oxidation of 3 with I{sub 2} affords Cp{prime}MoI{sub 2}(CO)(S{sub 2}P(OPr{sup i}){sub 2}) (4). The crystal structures of 1-3 are compared. For 1, triclinic, P{bar 1}, a = 7.122 (3) {angstrom}, b = 11.365 (4) {angstrom}, c =more » 12.532 (4) {angstrom}, {alpha} = 77.38 (3){degree}, {beta} = 89.08 (3){degree}, {gamma} = 72.87 (3){degree}, V = 944.5 (8) {angstrom}{sup 3}. For 2, triclinic, P{bar 1}, a = 7.251 (3) {angstrom}, b = 12.386 (5) {angstrom}, c = 13.988 (5) {angstrom}, {alpha} = 102.66 (3){degree}, {beta} = 103.56 (3){degree}, {gamma} = 94.66 (3){degree}, V = 1180.0 (8) {angstrom}{sup 3}, Z = 2. For 3, orthorhombic, Pbca, a = 12.703 (3) {angstrom}, b = 16.707 (4) {angstrom}, c = 18.398 (4) {angstrom}, V = 3904.4 (17) {angstrom}{sup 3}, Z = 8.« less

Crystallisation and preliminary X-ray diffraction analysis of the protease from Southampton norovirus complexed with a Michael-acceptor inhibitor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Coates, Leighton; Cooper, Jon; Hussey, Robert

2008-01-01

Noroviruses are the predominant cause of human epidemic nonbacterial gastroenteritis. Viral replication requires a cysteine protease that cleaves a 200 kDa viral polyprotein into its constituent functional parts. Here, the crystallization of the recombinant protease from the Southampton norovirus is described. While the native crystals were found to diffract only to medium resolution (2.9 {angstrom}), cocrystals of an inhibitor complex diffracted X-rays to 1.7 {angstrom} resolution. The polypeptide inhibitor (Ac-EFQLQ-propenyl ethyl ester) possesses an amino-acid sequence designed to match the substrate specificity of the enzyme, but was synthesized with a reactive Michael acceptor group at the C-terminal end.

X-ray crystallographic analysis of adipocyte fatty acid binding protein (aP2) modified with 4-hydroxy-2-nonenal

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hellberg, Kristina; Grimsrud, Paul A.; Kruse, Andrew C.

2012-07-11

Fatty acid binding proteins (FABP) have been characterized as facilitating the intracellular solubilization and transport of long-chain fatty acyl carboxylates via noncovalent interactions. More recent work has shown that the adipocyte FABP is also covalently modified in vivo on Cys117 with 4-hydroxy-2-nonenal (4-HNE), a bioactive aldehyde linked to oxidative stress and inflammation. To evaluate 4-HNE binding and modification, the crystal structures of adipocyte FABP covalently and noncovalently bound to 4-HNE have been solved to 1.9 {angstrom} and 2.3 {angstrom} resolution, respectively. While the 4-HNE in the noncovalently modified protein is coordinated similarly to a carboxylate of a fatty acid, themore » covalent form show a novel coordination through a water molecule at the polar end of the lipid. Other defining features between the two structures with 4-HNE and previously solved structures of the protein include a peptide flip between residues Ala36 and Lys37 and the rotation of the side chain of Phe57 into its closed conformation. Representing the first structure of an endogenous target protein covalently modified by 4-HNE, these results define a new class of in vivo ligands for FABPs and extend their physiological substrates to include bioactive aldehydes.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

G Deb; K Boeshanes; W Idler

Lipoxygenases are a family of nonheme iron-containing dioxygenases. An Escherichia coli expression system producing the bacterial chaperones GroES and GroEL was engineered and successfully used to produce large quantities of recombinant human 12R-LOX (LOXR; MW 80.34 kDa; 701 amino-acid residues). The co-overproduction of the two chaperones with 12R-LOX resulted in increased solubility of 12R-LOX and allowed the purification of milligram amounts of active enzyme for structural studies by X-ray diffraction. The lipoxygenase protein was purified on an affinity column and a gel-filtration column with chaperone protein (MW 57.16 kDa). The LOXR-chaperone complex was crystallized with ligand by the hanging-drop vapor-diffusionmore » method using 1.5 M ammonium hydrogen phosphate as precipitant. The crystals belonged to the monoclinic system, space group P2{sub 1}, with unit-cell parameters a = 138.97, b = 266.11, c = 152.26 {angstrom}, {beta} = 101.07{sup o}. Based on the calculated Matthews coefficient (3.1 {angstrom}3 Da{sup -1}), it is estimated that one molecule of LOXR complexed with two molecules of chaperone is present in the asymmetric unit of the crystal lattice. X-ray diffraction data were collected to 4 {angstrom} resolution using synchrotron radiation.« less

Structure of a eukaryotic voltage-gated sodium channel at near-atomic resolution.

PubMed

Shen, Huaizong; Zhou, Qiang; Pan, Xiaojing; Li, Zhangqiang; Wu, Jianping; Yan, Nieng

2017-03-03

Voltage-gated sodium (Na v ) channels are responsible for the initiation and propagation of action potentials. They are associated with a variety of channelopathies and are targeted by multiple pharmaceutical drugs and natural toxins. Here, we report the cryogenic electron microscopy structure of a putative Na v channel from American cockroach (designated Na v PaS) at 3.8 angstrom resolution. The voltage-sensing domains (VSDs) of the four repeats exhibit distinct conformations. The entrance to the asymmetric selectivity filter vestibule is guarded by heavily glycosylated and disulfide bond-stabilized extracellular loops. On the cytoplasmic side, a conserved amino-terminal domain is placed below VSD I , and a carboxy-terminal domain binds to the III-IV linker. The structure of Na v PaS establishes an important foundation for understanding function and disease mechanism of Na v and related voltage-gated calcium channels. Copyright © 2017, American Association for the Advancement of Science.

High-resolution Bent-crystal Spectrometer for the Ultra-soft X-ray Region

DOE R&D Accomplishments Database

Beiersdorfer, P.; von Goeler, S.; Bitter, M.; Hill, K. W.; Hulse, R. A.; Walling, R. S.

1988-10-01

A multichannel vacuum Brag-crystal spectrometer has been developed for high-resolution measurements of the line emission from tokamak plasmas in the wavelength region between 4 and 25 angstrom. The spectrometer employs a bent crystal in Johann geometry and a microchannel-plate intensified photodiode array. The instrument is capable of measuring high-resolution spectra (lambda/..delta..lambda approx. 3000) with fast time resolution (4 msec per spectrum) and good spatial resolution (3 cm). The spectral bandwidth is ..delta..lambda/lambda{sub 0} = 8 angstrom. A simple tilt mechanism allows access to different wavelength intervals. In order to illustrate the utility of the new spectrometer, time- and space-resolved measurements of the n = 3 to n = 2 spectrum of selenium from the Princeton Large Torus tokamak plasmas are presented. The data are used to determine the plasma transport parameters and to infer the radial distribution of fluorinelike, neonlike, and sodiumlike ions of selenium in the plasma. The new ultra-soft x-ray spectrometer has thus enabled us to demonstrate the utility of high-resolution L-shell spectroscopy of neonlike ions as a fusion diagnostic.

On the Relation Between Facular Bright Points and the Magnetic Field

NASA Astrophysics Data System (ADS)

Berger, Thomas; Shine, Richard; Tarbell, Theodore; Title, Alan; Scharmer, Goran

1994-12-01

Multi-spectral images of magnetic structures in the solar photosphere are presented. The images were obtained in the summers of 1993 and 1994 at the Swedish Solar Telescope on La Palma using the tunable birefringent Solar Optical Universal Polarimeter (SOUP filter), a 10 Angstroms wide interference filter tuned to 4304 Angstroms in the band head of the CH radical (the Fraunhofer G-band), and a 3 Angstroms wide interference filter centered on the Ca II--K absorption line. Three large format CCD cameras with shuttered exposures on the order of 10 msec and frame rates of up to 7 frames per second were used to create time series of both quiet and active region evolution. The full field--of--view is 60times 80 arcseconds (44times 58 Mm). With the best seeing, structures as small as 0.22 arcseconds (160 km) in diameter are clearly resolved. Post--processing of the images results in rigid coalignment of the image sets to an accuracy comparable to the spatial resolution. Facular bright points with mean diameters of 0.35 arcseconds (250 km) and elongated filaments with lengths on the order of arcseconds (10(3) km) are imaged with contrast values of up to 60 % by the G--band filter. Overlay of these images on contemporal Fe I 6302 Angstroms magnetograms and Ca II K images reveals that the bright points occur, without exception, on sites of magnetic flux through the photosphere. However, instances of concentrated and diffuse magnetic flux and Ca II K emission without associated bright points are common, leading to the conclusion that the presence of magnetic flux is a necessary but not sufficient condition for the occurence of resolvable facular bright points. Comparison of the G--band and continuum images shows a complex relation between structures in the two bandwidths: bright points exceeding 350 km in extent correspond to distinct bright structures in the continuum; smaller bright points show no clear relation to continuum structures. Size and contrast statistical cross--comparisons compiled from measurements of over two-thousand bright point structures are presented. Preliminary analysis of the time evolution of bright points in the G--band reveals that the dominant mode of bright point evolution is fission of larger structures into smaller ones and fusion of small structures into conglomerate structures. The characteristic time scale for the fission/fusion process is on the order of minutes.

Atomistic three-dimensional coherent x-ray imaging of nonbiological systems

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ho, Phay J.; Knight, Chris; Tegze, Miklos

We computationally study the resolution limits for three-dimensional coherent x-ray diffractive imaging of heavy, nonbiological systems using Ar clusters as a prototype. We treat electronic and nuclear dynamics on an equal footing and remove the frozen-lattice approximation often used in electronic damage studies. We explore the achievable resolution as a function of pulse parameters (fluence level, pulse duration, and photon energy) and particle size. The contribution of combined lattice and electron dynamics is not negligible even for 2 fs pulses, and the Compton scattering is less deleterious than in biological systems for atomic-scale imaging. Although free-electron scattering represents a significantmore » background, we find that recovery of the original structure is in principle possible with 3 angstrom resolution for particles of 11 nm diameter.« less

Atomistic three-dimensional coherent x-ray imaging of nonbiological systems

DOE PAGES

Ho, Phay J.; Knight, Chris; Tegze, Miklos; ...

2016-12-12

We computationally study the resolution limits for three-dimensional coherent x-ray diffractive imaging of heavy, nonbiological systems using Ar clusters as a prototype. We treat electronic and nuclear dynamics on an equal footing and remove the frozen-lattice approximation often used in electronic damage studies. We explore the achievable resolution as a function of pulse parameters (fluence level, pulse duration, and photon energy) and particle size. The contribution of combined lattice and electron dynamics is not negligible even for 2 fs pulses, and the Compton scattering is less deleterious than in biological systems for atomic-scale imaging. Although free-electron scattering represents a significantmore » background, we find that recovery of the original structure is in principle possible with 3 angstrom resolution for particles of 11 nm diameter.« less

Ultraviolet Changes of the Central Source and the Very Nearby Ejecta

NASA Technical Reports Server (NTRS)

Gull, Theodore R.; Nielsen, Krister; Vierira, Gladys; Hillier, John; Walborn, Nolan; Davidson, Kris

2004-01-01

We utilized the high spatial and high spectral resolution of the HST/STIS MAMA echelle modes in the ultraviolet (0.025 inch spatial resolution and 30,000 to 120,000 spectral resolving power) to view changes in and around Eta Carinae before and after the X-Ray drop which occurred on June 29, 2003 (M. Corcoran, IAUC 8160). Major changes in the spectra of the Central Source and nearby nebulosities occurred between June 22 and July 5. Visibility of the Central Source dropped, especially between 1175 and 1350 Angstroms, but not uniformly throughout the ultraviolet. This fading is likely due to multiple line absorptions both in the source and in the intervening ejecta. Nebular emission of Si III] and Fe III, located 0.09 sec. to the west, disappeared. By July 29, a bright feature extending up to 0.071 sec. east of the Central Source became prominent in broad emission lines near 2500 Angstroms, but was not noticeable longward of 2900 Angstroms. ACS/HRC imagery and STIS CCD spectra taken concurrently are being examined for larger scale changes. Numerous narrow velocity components between -146 and -585 kilometers per second were identified in spectra before the minimum. New components appeared primarily in Fe II absorption lines with velocities between -170 and -380 kilometers per second. While the lines of the -513 kilometers per second component did not change, most lines of the -146 kilometers per second component changed considerably. Lines originating from high energy levels diminished or disappeared, while lines originating from lower energy levels strengthened. Strong absorption lines of Ti II, not present before the X-Ray drop, appeared within seven days, but disappeared by July 29. Further analysis of these unprecedented data will provide significant new information about the structure of Eta Carinae and its periodic variations.

Pyridine Nucleotide Complexes with Bacillus anthracis Coenzyme A-Disulfide Reductase: A Structural Analysis of Dual NAD(P)H Specificity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wallen,J.; Paige, C.; Mallett, T.

2008-01-01

We have recently reported that CoASH is the major low-molecular weight thiol in Bacillus anthracis, and we have now characterized the kinetic and redox properties of the B. anthracis coenzyme A-disulfide reductase (CoADR, BACoADR) and determined the crystal structure at 2.30 Angstroms resolution. While the Staphylococcus aureus and Borrelia burgdorferi CoADRs exhibit strong preferences for NADPH and NADH, respectively, B. anthracis CoADR can use either pyridine nucleotide equally well. Sequence elements within the respective NAD(P)H-binding motifs correctly reflect the preferences for S. aureus and Bo. burgdorferi CoADRs, but leave questions as to how BACoADR can interact with both pyridine nucleotides.more » The structures of the NADH and NADPH complexes at ca. 2.3 Angstroms resolution reveal that a loop consisting of residues Glu180-Thr187 becomes ordered and changes conformation on NAD(P)H binding. NADH and NADPH interact with nearly identical conformations of this loop; the latter interaction, however, involves a novel binding mode in which the 2'-phosphate of NADPH points out toward solvent. In addition, the NAD(P)H-reduced BACoADR structures provide the first view of the reduced form (Cys42-SH/CoASH) of the Cys42-SSCoA redox center. The Cys42-SH side chain adopts a new conformation in which the conserved Tyr367'-OH and Tyr425'-OH interact with the nascent thiol(ate) on the flavin si-face. Kinetic data with Y367F, Y425F, and Y367, 425F BACoADR mutants indicate that Tyr425' is the primary proton donor in catalysis, with Tyr367' functioning as a cryptic alternate donor in the absence of Tyr425'.« less

Structure-Function, Stability, and Chemical Modification of the Cyanobacterial Cytochrome b[subscript 6]f Complex from Nostoc sp. PCC 7120

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baniulis, Danas; Yamashita, Eiki; Whitelegge, Julian P.

2009-06-08

The crystal structure of the cyanobacterial cytochrome b{sub 6}f complex has previously been solved to 3.0-{angstrom} resolution using the thermophilic Mastigocladus laminosus whose genome has not been sequenced. Several unicellular cyanobacteria, whose genomes have been sequenced and are tractable for mutagenesis, do not yield b{sub 6}f complex in an intact dimeric state with significant electron transport activity. The genome of Nostoc sp. PCC 7120 has been sequenced and is closer phylogenetically to M. laminosus than are unicellular cyanobacteria. The amino acid sequences of the large core subunits and four small peripheral subunits of Nostoc are 88 and 80% identical tomore » those in the M. laminosus b{sub 6}f complex. Purified b{sub 6}f complex from Nostoc has a stable dimeric structure, eight subunits with masses similar to those of M. laminosus, and comparable electron transport activity. The crystal structure of the native b{sub 6}f complex, determined to a resolution of 3.0{angstrom} (PDB id: 2ZT9), is almost identical to that of M. laminosus. Two unique aspects of the Nostoc complex are: (i) a dominant conformation of heme b{sub p} that is rotated 180 deg. about the {alpha}- and {gamma}-meso carbon axis relative to the orientation in the M. laminosus complex and (ii) acetylation of the Rieske iron-sulfur protein (PetC) at the N terminus, a post-translational modification unprecedented in cyanobacterial membrane and electron transport proteins, and in polypeptides of cytochrome bc complexes from any source. The high spin electronic character of the unique heme cn is similar to that previously found in the b{sub 6}f complex from other sources.« less

Expression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae pseudopilin EpsH

DOE Office of Scientific and Technical Information (OSTI.GOV)

Raghunathan, Kannan; Vago, Frank S.; Ball, Terry

2010-01-12

EpsH is a minor pseudopilin protein of the Vibrio cholerae type II secretion system. A truncated form of EpsH with a C-terminal noncleavable His tag was constructed and expressed in Escherichia coli, purified and crystallized by sitting-drop vapor diffusion. A complete data set was collected to 1.71 {angstrom} resolution. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 53.39, b = 71.11, c = 84.64 {angstrom}. There were two protein molecules in the asymmetric unit, which gave a Matthews coefficient V{sub M} of 2.1 {angstrom}{sup 3} Da{sup -1}, corresponding to 41.5% solvent content.

Coronal Fine Structure in Dynamic Events Observed by Hi-C

NASA Technical Reports Server (NTRS)

Winebarger, Amy; Schuler, Timothy

2013-01-01

The High-Resolution Coronal Imager (Hi-C) flew aboard a NASA sounding rocket on 2012 July 11 and captured roughly 345 s of high spatial and temporal resolution images of the solar corona in a narrowband 193 Angstrom channel. We have analyzed the fluctuations in intensity of Active Region 11520. We selected events based on a lifetime greater than 11 s (two Hi-C frames) and intensities greater than a threshold determined from the photon and readout noise. We compare the Hi-C events with those determined from AIA. We find that HI-C detects shorter and smaller events than AIA. We also find that the intensity increase in the Hi-C events is approx. 3 times greater than the intensity increase in the AIA events we conclude the events are related to linear sub-structure that is unresolved by AIA

Structure of a group A streptococcal phage-encoded virulence factor reveals a catalytically active triple-stranded beta-helix.

PubMed

Smith, Nicola L; Taylor, Edward J; Lindsay, Anna-Marie; Charnock, Simon J; Turkenburg, Johan P; Dodson, Eleanor J; Davies, Gideon J; Black, Gary W

2005-12-06

Streptococcus pyogenes (group A Streptococcus) causes severe invasive infections including scarlet fever, pharyngitis (streptococcal sore throat), skin infections, necrotizing fasciitis (flesh-eating disease), septicemia, erysipelas, cellulitis, acute rheumatic fever, and toxic shock. The conversion from nonpathogenic to toxigenic strains of S. pyogenes is frequently mediated by bacteriophage infection. One of the key bacteriophage-encoded virulence factors is a putative "hyaluronidase," HylP1, a phage tail-fiber protein responsible for the digestion of the S. pyogenes hyaluronan capsule during phage infection. Here we demonstrate that HylP1 is a hyaluronate lyase. The 3D structure, at 1.8-angstroms resolution, reveals an unusual triple-stranded beta-helical structure and provides insight into the structural basis for phage tail assembly and the role of phage tail proteins in virulence. Unlike the triple-stranded beta-helix assemblies of the bacteriophage T4 injection machinery and the tailspike endosialidase of the Escherichia coli K1 bacteriophage K1F, HylP1 possesses three copies of the active center on the triple-helical fiber itself without the need for an accessory catalytic domain. The triple-stranded beta-helix is not simply a structural scaffold, as previously envisaged; it is harnessed to provide a 200-angstroms-long substrate-binding groove for the optimal reduction in hyaluronan viscosity to aid phage penetration of the capsule.

On macromolecular refinement at subatomic resolution withinteratomic scatterers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Afonine, Pavel V.; Grosse-Kunstleve, Ralf W.; Adams, Paul D.

2007-11-09

A study of the accurate electron density distribution in molecular crystals at subatomic resolution, better than {approx} 1.0 {angstrom}, requires more detailed models than those based on independent spherical atoms. A tool conventionally used in small-molecule crystallography is the multipolar model. Even at upper resolution limits of 0.8-1.0 {angstrom}, the number of experimental data is insufficient for the full multipolar model refinement. As an alternative, a simpler model composed of conventional independent spherical atoms augmented by additional scatterers to model bonding effects has been proposed. Refinement of these mixed models for several benchmark datasets gave results comparable in quality withmore » results of multipolar refinement and superior of those for conventional models. Applications to several datasets of both small- and macro-molecules are shown. These refinements were performed using the general-purpose macromolecular refinement module phenix.refine of the PHENIX package.« less

Characterizing the True Background Corona with SDO/AIA

NASA Technical Reports Server (NTRS)

Napier, Kate; Winebarger, Amy; Alexander, Caroline

2014-01-01

Characterizing the nature of the solar coronal background would enable scientists to more accurately determine plasma parameters, and may lead to a better understanding of the coronal heating problem. Because scientists study the 3D structure of the Sun in 2D, any line of sight includes both foreground and background material, and thus, the issue of background subtraction arises. By investigating the intensity values in and around an active region, using multiple wavelengths collected from the Atmospheric Imaging Assembly (AIA) on the Solar Dynamics Observatory (SDO) over an eight-hour period, this project aims to characterize the background as smooth or structured. Different methods were employed to measure the true coronal background and create minimum intensity images. These were then investigated for the presence of structure. The background images created were found to contain long-lived structures, including coronal loops, that were still present in all of the wavelengths, 193 Angstroms,171 Angstroms,131 Angstroms, and 211 Angstroms. The intensity profiles across the active region indicate that the background is much more structured than previously thought.

“Ultra-high resolution optical trap with single fluorophore sensitivity”

PubMed Central

Comstock, Matthew J; Ha, Taekjip; Chemla, Yann R

2013-01-01

We present a single-molecule instrument that combines a timeshared ultra-high resolution dual optical trap interlaced with a confocal fluorescence microscope. In a demonstration experiment, individual single-fluorophore labeled DNA oligonucleotides were observed to bind and unbind to complementary DNA suspended between two trapped beads. Simultaneous with the single-fluorophore detection, coincident angstrom-scale changes in tether extension could be clearly observed. Fluorescence readout allowed us to determine the duplex melting rate as a function of force. The new instrument will enable the simultaneous measurement of angstrom-scale mechanical motion of individual DNA-binding proteins (e.g., single base pair stepping of DNA translocases) along with the detection of fluorescently labeled protein properties (e.g., internal configuration). PMID:21336286

The Structures of the C185S and C185A Mutants of Sulfite Oxidase Reveal Rearrangement of the Active Site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qiu, James A.; Wilson, Heather L.; Pushie, M. Jake

Sulfite oxidase (SO) catalyzes the physiologically critical conversion of sulfite to sulfate. Enzymatic activity is dependent on the presence of the metal molybdenum complexed with a pyranopterin-dithiolene cofactor termed molybdopterin. Comparison of the amino acid sequences of SOs from a variety of sources has identified a single conserved Cys residue essential for catalytic activity. The crystal structure of chicken liver sulfite oxidase indicated that this residue, Cys185 in chicken SO, coordinates the Mo atom in the active site. To improve our understanding of the role of this residue in the catalytic mechanism of sulfite oxidase, serine and alanine variants atmore » position 185 of recombinant chicken SO were generated. Spectroscopic and kinetic studies indicate that neither variant is capable of sulfite oxidation. The crystal structure of the C185S variant was determined to 1.9 {angstrom} resolution and to 2.4 {angstrom} resolution in the presence of sulfite, and the C185A variant to 2.8 {angstrom} resolution. The structures of the C185S and C185A variants revealed that neither the Ser or Ala side chains appeared to closely interact with the Mo atom and that a third oxo group replaced the usual cysteine sulfur ligand at the Mo center, confirming earlier extended X-ray absorption fine structure spectroscopy (EXAFS) work on the human C207S mutant. An unexpected result was that in the C185S variant, in the absence of sulfite, the active site residue Tyr322 became disordered as did the loop region flanking it. In the C185S variant crystallized in the presence of sulfite, the Tyr322 residue relocalized to the active site. The C185A variant structure also indicated the presence of a third oxygen ligand; however, Tyr322 remained in the active site. EXAFS studies of the Mo coordination environment indicate the Mo atom is in the oxidized Mo{sup VI} state in both the C185S and C185A variants of chicken SO and show the expected trioxodithiolene active site. Density functional theory calculations of the trioxo form of the cofactor reasonably reproducd the Mo=O distances of the complex; however, the calculated Mo-S distances were slightly longer than either crystallographic or EXAFS measurements. Taken together, these results indicate that the active sites of the C185S and C185A variants are essentially catalytically inactive, the crystal structures of C185S and C185A variants contain a fully oxidized, trioxo form of the cofactor, and Tyr322 can undergo a conformational change that is relevant to the reaction mechanism. Additional DFT calculations demonstrated that such methods can reasonably reproduce the geometry and bond lengths of the active site.« less

Branching Ratios for The Radiometric Calibration of EUNIS-2012

NASA Technical Reports Server (NTRS)

Daw, Adrian N.; Bhatia, A. K.; Rabin, Douglas M.

2012-01-01

The Extreme Ultraviolet Normal Incidence Spectrograph (EUNIS) sounding rocket instrument is a two-channel imaging spectrograph that observes the solar corona and transition region with high spectral resolution and a rapid cadence made possible by unprecedented sensitivity. The upcoming flight will incorporate a new wavelength channel covering the range 524-630 Angstroms, the previously-flown 300-370 Angstroms channel, and the first flight demonstration of cooled active pixel sensor (APS) arrays. The new 524-630 Angstrom channel incorporates a Toroidal Varied Line Space (TVLS) grating coated with B4C/Ir, providing broad spectral coverage and a wide temperature range of 0.025 to 10 MK. Absolute radiometric calibration of the two channels is being performed using a hollow cathode discharge lamp and NIST-calibrated AXUV-100G photodiode. Laboratory observations of He I 584 Angstroms and He II 304 Angstroms provide absolute radiometric calibrations of the two channels at those two respective wavelengths by using the AXUV photodiode as a transfer standard. The spectral responsivity is being determined by observing line pairs with a common upper state in the spectra of Ne I-III and Ar II-III. Calculations of A-values for the observed branching ratios are in progress.

A Potent and Broad Neutralizing Antibody Recognizes and Penetrates the HIV Glycan Shield

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pejchal, Robert; Doores, Katie J.; Walker, Laura M.

The HIV envelope (Env) protein gp120 is protected from antibody recognition by a dense glycan shield. However, several of the recently identified PGT broadly neutralizing antibodies appear to interact directly with the HIV glycan coat. Crystal structures of antigen-binding fragments (Fabs) PGT 127 and 128 with Man{sub 9} at 1.65 and 1.29 angstrom resolution, respectively, and glycan binding data delineate a specific high mannose-binding site. Fab PGT 128 complexed with a fully glycosylated gp120 outer domain at 3.25 angstroms reveals that the antibody penetrates the glycan shield and recognizes two conserved glycans as well as a short {beta}-strand segment ofmore » the gp120 V3 loop, accounting for its high binding affinity and broad specificify. Furthermore, our data suggest that the high neutralization potency of PGT 127 and 128 immunoglobulin Gs may be mediated by cross-linking Env trimers on the viral surface.« less

LIFTING THE VEIL OF DUST TO REVEAL THE SECRETS OF SPIRAL GALAXIES

NASA Technical Reports Server (NTRS)

2002-01-01

Astronomers have combined information from the NASA Hubble Space Telescope's visible- and infrared-light cameras to show the hearts of four spiral galaxies peppered with ancient populations of stars. The top row of pictures, taken by a ground-based telescope, represents complete views of each galaxy. The blue boxes outline the regions observed by the Hubble telescope. The bottom row represents composite pictures from Hubble's visible- and infrared-light cameras, the Wide Field and Planetary Camera 2 (WFPC2) and the Near Infrared Camera and Multi-Object Spectrometer (NICMOS). Astronomers combined views from both cameras to obtain the true ages of the stars surrounding each galaxy's bulge. The Hubble telescope's sharper resolution allows astronomers to study the intricate structure of a galaxy's core. The galaxies are ordered by the size of their bulges. NGC 5838, an 'S0' galaxy, is dominated by a large bulge and has no visible spiral arms; NGC 7537, an 'Sbc' galaxy, has a small bulge and loosely wound spiral arms. Astronomers think that the structure of NGC 7537 is very similar to our Milky Way. The galaxy images are composites made from WFPC2 images taken with blue (4445 Angstroms) and red (8269 Angstroms) filters, and NICMOS images taken in the infrared (16,000 Angstroms). They were taken in June, July, and August of 1997. Credits for the ground-based images: Allan Sandage (The Observatories of the Carnegie Institution of Washington) and John Bedke (Computer Sciences Corporation and the Space Telescope Science Institute) Credits for WFPC2 and NICMOS composites: NASA, ESA, and Reynier Peletier (University of Nottingham, United Kingdom)

Low resolution structures of cold, warm, and chemically denatured cytochrome-c via SAXS

NASA Astrophysics Data System (ADS)

Asta, Christopher; Banks, Anthony; Elmer, Margaret; Grandpre, Trevor; Landahl, Eric

2013-03-01

The results of a small-angle x-ray scattering (SAXS) study of equine cytochrome-c protein under different unfolding conditions are discussed. Although the measured radius of gyration of this protein over a wide range of temperatures and GuHCl concentrations conform to a two-state model, we find different levels of residual structure present depending on whether the protein is cold- or warm- denatured. We present DAMMIF reconstructions of these different unfolded states using 1532 dummy atoms with a 1.5 Angstrom radius, and suggest ways that these different states may be described by the same folding free energy. To whom correspondence should be addressed.

P. aeruginosa PilT Structures with and without Nucleotide Reveal a Dynamic Type IV Pilus Retraction Motor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Misic, Ana M.; Satyshur, Kenneth A.; Forest, Katrina T.

Type IV pili are bacterial extracellular filaments that can be retracted to create force and motility. Retraction is accomplished by the motor protein PilT. Crystal structures of Pseudomonas aeruginosa PilT with and without bound {beta},{gamma}-methyleneadenosine-5{prime}-triphosphate have been solved at 2.6 {angstrom} and 3.1 {angstrom} resolution, respectively, revealing an interlocking hexamer formed by the action of a crystallographic 2-fold symmetry operator on three subunits in the asymmetric unit and held together by extensive ionic interactions. The roles of two invariant carboxylates, Asp Box motif Glu163 and Walker B motif Glu204, have been assigned to Mg{sup 2+} binding and catalysis, respectively. Themore » nucleotide ligands in each of the subunits in the asymmetric unit of the {beta},{gamma}-methyleneadenosine-5{prime}-triphosphate-bound PilT are not equally well ordered. Similarly, the three subunits in the asymmetric unit of both structures exhibit differing relative conformations of the two domains. The 12{sup o} and 20{sup o} domain rotations indicate motions that occur during the ATP-coupled mechanism of the disassembly of pili into membrane-localized pilin monomers. Integrating these observations, we propose a three-state 'Ready, Active, Release' model for the action of PilT.« less

Direct Visualization of Local Electromagnetic Field Structures by Scanning Transmission Electron Microscopy.

PubMed

Shibata, Naoya; Findlay, Scott D; Matsumoto, Takao; Kohno, Yuji; Seki, Takehito; Sánchez-Santolino, Gabriel; Ikuhara, Yuichi

2017-07-18

The functional properties of materials and devices are critically determined by the electromagnetic field structures formed inside them, especially at nanointerface and surface regions, because such structures are strongly associated with the dynamics of electrons, holes and ions. To understand the fundamental origin of many exotic properties in modern materials and devices, it is essential to directly characterize local electromagnetic field structures at such defect regions, even down to atomic dimensions. In recent years, rapid progress in the development of high-speed area detectors for aberration-corrected scanning transmission electron microscopy (STEM) with sub-angstrom spatial resolution has opened new possibilities to directly image such electromagnetic field structures at very high-resolution. In this Account, we give an overview of our recent development of differential phase contrast (DPC) microscopy for aberration-corrected STEM and its application to many materials problems. In recent years, we have developed segmented-type STEM detectors which divide the detector plane into 16 segments and enable simultaneous imaging of 16 STEM images which are sensitive to the positions and angles of transmitted/scattered electrons on the detector plane. These detectors also have atomic-resolution imaging capability. Using these segmented-type STEM detectors, we show DPC STEM imaging to be a very powerful tool for directly imaging local electromagnetic field structures in materials and devices in real space. For example, DPC STEM can clearly visualize the local electric field variation due to the abrupt potential change across a p-n junction in a GaAs semiconductor, which cannot be observed by normal in-focus bright-field or annular type dark-field STEM imaging modes. DPC STEM is also very effective for imaging magnetic field structures in magnetic materials, such as magnetic domains and skyrmions. Moreover, real-time imaging of electromagnetic field structures can now be realized through very fast data acquisition, processing, and reconstruction algorithms. If we use DPC STEM for atomic-resolution imaging using a sub-angstrom size electron probe, it has been shown that we can directly observe the atomic electric field inside atoms within crystals and even inside single atoms, the field between the atomic nucleus and the surrounding electron cloud, which possesses information about the atomic species, local chemical bonding and charge redistribution between bonded atoms. This possibility may open an alternative way for directly visualizing atoms and nanostructures, that is, seeing atoms as an entity of electromagnetic fields that reflect the intra- and interatomic electronic structures. In this Account, the current status of aberration-corrected DPC STEM is highlighted, along with some applications in real material and device studies.

Elongated fibrillar structure of a streptococcal adhesin assembled by the high-affinity association of [alpha]- and PPII-helices

DOE Office of Scientific and Technical Information (OSTI.GOV)

Larson, Matthew R.; Rajashankar, Kanagalaghatta R.; Patel, Manisha H.

2010-08-18

Streptococcus mutans antigen I/II (AgI/II) is a cell surface-localized protein adhesin that interacts with salivary components within the salivary pellicle. AgI/II contributes to virulence and has been studied as an immunological and structural target, but a fundamental understanding of its underlying architecture has been lacking. Here we report a high-resolution (1.8 {angstrom}) crystal structure of the A{sub 3}VP{sub 1} fragment of S. mutans AgI/II that demonstrates a unique fibrillar form (155 {angstrom}) through the interaction of two noncontiguous regions in the primary sequence. The A{sub 3} repeat of the alanine-rich domain adopts an extended {alpha}-helix that intertwines with the P{submore » 1} repeat polyproline type II (PPII) helix to form a highly extended stalk-like structure heretofore unseen in prokaryotic or eukaryotic protein structures. Velocity sedimentation studies indicate that full-length AgI/II that contains three A/P repeats extends over 50 nanometers in length. Isothermal titration calorimetry revealed that the high-affinity association between the A{sub 3} and P{sub 1} helices is enthalpically driven. Two distinct binding sites on AgI/II to the host receptor salivary agglutinin (SAG) were identified by surface plasmon resonance (SPR). The current crystal structure reveals that AgI/II family proteins are extended fibrillar structures with the number of alanine- and proline-rich repeats determining their length.« less

The D/H Ratio in Interstellar Gas towards G191-B2B from STIS Echelle Observations

NASA Astrophysics Data System (ADS)

Sahu, M. S.; Landsman, W. B.; Bruhweiler, F. C.; Gull, T. R.; Bowers, C. A.; Lindler, D.; Feggans, K.; Barstow, M. A.; Hubeny, I.; Holberg, J. B.

1999-05-01

We present STIS echelle observations of interstellar D i and H i Lyα and N i (1199.5, 1200.2 and 1200.7 Angstroms), C ii 1334.5 Angstroms, C(*) ii 1335.7 Angstroms, O i 1302 Angstroms, Si ii (1190, 1193, 1260, 1304 and 1526 Angstroms), Si iii 1206.5 Angstroms, Al ii 1670.8 Angstroms, S ii 1259.5 Angstroms and Fe ii 1608.5 Angstroms in the line of sight to the nearby (69 pc) hot, white dwarf (WD) G191-B2B. Compared to the GHRS study of G191-B2B by Vidal-Madjar et al. 1998 (VM98), the STIS E140H spectra have a higher velocity resolution (3 km s(-1) ), better S/N (between 20 to 50) and broader wavelength coverage (1150 to 1700 Angstroms). We use the Barstow & Hubeny stratified non-LTE model atmosphere calculations which include the effects of line-blanketing from more than 9x10(6) atomic transitions (mainly Ni and Fe), both to determine the NLTE shape of the stellar Lyalpha profile and to estimate the contamination of the interstellar lines by WD photospheric lines. The interstellar N i 1200.7 Angstroms, Si ii 1193 & 1304 Angstroms and Fe ii lines show no contamination by WD photospheric lines and are given more weight in our analysis. VM98 reported three components while we detect only two velocity components in all the interstellar species observed: one at ~ 8.5 km s(-1) and one at ~ 19.3 km s(-1) which we identify as the LIC component. Using the NLTE stellar Lyα profile and a total column density of N(H i) ~ 2 x 10(18) cm(-2) for both components (consistent with EUVE observations), we derive confidence contours. We find the D/H ratio with 2sigma confidence limits to lie within 1.77+/-0.2x10(-5) . This value is consistent with the value of (D/H)LIC = 1.6+/-0.1x10(-5) determined towards Capella (Linsky et al. 1995). The STIS data provide no evidence for local or cloud-to-cloud variation in the D/H ratio as suggested by VM98. Re-analysis of the GHRS data and comparison to the STIS data is in progress.

Low-energy electron holographic imaging of individual tobacco mosaic virions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Longchamp, Jean-Nicolas, E-mail: longchamp@physik.uzh.ch; Latychevskaia, Tatiana; Escher, Conrad

2015-09-28

Modern structural biology relies on Nuclear Magnetic Resonance (NMR), X-ray crystallography, and cryo-electron microscopy for gaining information on biomolecules at nanometer, sub-nanometer, or atomic resolution. All these methods, however, require averaging over a vast ensemble of entities, and hence knowledge on the conformational landscape of an individual particle is lost. Unfortunately, there are now strong indications that even X-ray free electron lasers will not be able to image individual molecules but will require nanocrystal samples. Here, we show that non-destructive structural biology of single particles has now become possible by means of low-energy electron holography. As an example, individual tobaccomore » mosaic virions deposited on ultraclean freestanding graphene are imaged at 1 nm resolution revealing structural details arising from the helical arrangement of the outer protein shell of the virus. Since low-energy electron holography is a lens-less technique and since electrons with a deBroglie wavelength of approximately 1 Å do not impose radiation damage to biomolecules, the method has the potential for Angstrom resolution imaging of single biomolecules.« less

Novel alkaline earth copper germanates with ferro and antiferromagnetic S=1/2 chains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brandao, Paula; Reis, Mario S; Gai, Zheng

Two new alkaline earth copper(II) germanates were hydrothermally synthesized: CaCuGeO4 center dot H2O (1) and BaCu2Ge3O9 center dot H2O (2), and their structures determined by single crystal X-ray diffraction. Compound (1) crystallizes in space group P2(1)/c with a=5.1320(2) angstrom, b=16.1637(5) angstrom, c=5.4818(2) angstrom, beta=102.609(2)degrees, V=443.76(3) angstrom(3) and Z=4. This copper germanate contains layers of composition [CuGeO4](infinity)(2-) comprising CuO4 square planes and GeO4 tetrahedra with calcium and water molecules in the inter-layer space. Compound (2) crystallizes in the Cmcm space group with a=5.5593(3) angstrom, b=10.8606(9) angstrom, c=13.5409(8) angstrom, V=817.56(9) angstrom(3) and Z=4. This structure contains GeO6 and CuO6 octahedra as wellmore » as GeO4 tetrahedra, forming a three-dimensional network of interconnecting six-membered ring channels. The magnetic susceptibility for both samples can be interpreted as S=1/2 chains, in agreement with the copper topology observed in the crystal structure. The susceptibility of (1) exhibits a Bonner-Fisher type behavior, resulting from antiferromagnetic intra-chain interactions without three-dimensional ordering down to 5 K-the lowest measured temperature. This observation, together with the absence of super-exchange paths between the copper chains, make this system particularly promising for the study of low dimensional magnetism. The magnetic properties of (2) show a very weak ferromagnetic near-neighbor interaction along the chain. In this compound a peak the chi T plot seems to indicate the onset of interchain antiferromagentic correlations. However, no ordering temperature is detected in the susceptibility data.« less

An unexpected twist in viral capsid maturation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gertsman, Ilya; Gan, Lu; Guttman, Miklos

2009-04-14

Lambda-like double-stranded (ds) DNA bacteriophage undergo massive conformational changes in their capsid shell during the packaging of their viral genomes. Capsid shells are complex organizations of hundreds of protein subunits that assemble into intricate quaternary complexes that ultimately are able to withstand over 50 atm of pressure during genome packaging. The extensive integration between subunits in capsids requires the formation of an intermediate complex, termed a procapsid, from which individual subunits can undergo the necessary refolding and structural rearrangements needed to transition to the more stable capsid. Although various mature capsids have been characterized at atomic resolution, no such procapsidmore » structure is available for a dsDNA virus or bacteriophage. Here we present a procapsid X-ray structure at 3.65 {angstrom} resolution, termed prohead II, of the lambda-like bacteriophage HK97, the mature capsid structure of which was previously solved to 3.44 {angstrom}. A comparison of the two largely different capsid forms has unveiled an unprecedented expansion mechanism that describes the transition. Crystallographic and hydrogen/deuterium exchange data presented here demonstrate that the subunit tertiary structures are significantly different between the two states, with twisting and bending motions occurring in both helical and -sheet regions. We also identified subunit interactions at each three-fold axis of the capsid that are maintained throughout maturation. The interactions sustain capsid integrity during subunit refolding and provide a fixed hinge from which subunits undergo rotational and translational motions during maturation. Previously published calorimetric data of a closely related bacteriophage, P22, showed that capsid maturation was an exothermic process that resulted in a release of 90 kJ mol{sup -1} of energy. We propose that the major tertiary changes presented in this study reveal a structural basis for an exothermic maturation process probably present in many dsDNA bacteriophage and possibly viruses such as herpesvirus, which share the HK97 subunit fold.« less

Crystal Structure of TDP-Fucosamine Acetyl Transferase (WECD) from Escherichia Coli, an Enzyme Required for Enterobacterial Common Antigen Synthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hung,M.; Rangarajan, E.; Munger, C.

2006-01-01

Enterobacterial common antigen (ECA) is a polysaccharide found on the outer membrane of virtually all gram-negative enteric bacteria and consists of three sugars, N-acetyl-D-glucosamine, N-acetyl-D-mannosaminuronic acid, and 4-acetamido-4,6-dideoxy-D-galactose, organized into trisaccharide repeating units having the sequence {yields}(3)-{alpha}-D-Fuc4NAc-(1{yields}4)-{beta}-D-ManNAcA-(1{yields}4)-{alpha}-D-GlcNAc-(1{yields}). While the precise function of ECA is unknown, it has been linked to the resistance of Shiga-toxin-producing Escherichia coli (STEC) O157:H7 to organic acids and the resistance of Salmonella enterica to bile salts. The final step in the synthesis of 4-acetamido-4,6-dideoxy-D-galactose, the acetyl-coenzyme A (CoA)-dependent acetylation of the 4-amino group, is carried out by TDP-fucosamine acetyltransferase (WecD). We have determined the crystal structuremore » of WecD in apo form at a 1.95-Angstroms resolution and bound to acetyl-CoA at a 1.66-Angstroms resolution. WecD is a dimeric enzyme, with each monomer adopting the GNAT N-acetyltransferase fold, common to a number of enzymes involved in acetylation of histones, aminoglycoside antibiotics, serotonin, and sugars. The crystal structure of WecD, however, represents the first structure of a GNAT family member that acts on nucleotide sugars. Based on this cocrystal structure, we have used flexible docking to generate a WecD-bound model of the acetyl-CoA-TDP-fucosamine tetrahedral intermediate, representing the structure during acetyl transfer. Our structural data show that WecD does not possess a residue that directly functions as a catalytic base, although Tyr208 is well positioned to function as a general acid by protonating the thiolate anion of coenzyme A.« less

Polymeric networks of copper(II) phenylmalonate with heteroaromatic n-donor ligands: synthesis, crystal structure, and magnetic properties.

PubMed

Pasán, Jorge; Sanchiz, Joaquín; Ruiz-Pérez, Catalina; Lloret, Francesc; Julve, Miguel

2005-10-31

Two new phenylmalonate-bridged copper(II) complexes with the formulas [Cu(4,4'-bpy)(Phmal)](n).2nH(2)O (1) and [Cu(2,4'-bpy)(Phmal)(H(2)O)](n)() (2) (Phmal = phenylmalonate dianion, 4,4'-bpy = 4,4'-bipyridine, 2,4'-bpy = 2,4'-bipyridine) have been synthesized and characterized by X-ray diffraction. Complex 1 crystallizes in monoclinic space group P2(1), Z = 4, with unit cell parameters of a = 9.0837(6) Angstroms, b = 9.3514(4) Angstroms, c = 11.0831(8) Angstroms, and beta = 107.807(6) degrees , whereas complex 2 crystallizes in orthorhombic space group C2cb, Z = 8, with unit cell parameters of a = 10.1579(7) Angstroms, b = 10.3640(8) Angstroms, and c = 33.313(4) Angstroms. The structures of 1 and 2 consist of layers of copper(II) ions with bridging bis-monodentate phenylmalonate (1 and 2) and 4,4'-bpy (1) ligands and terminal monodentate 2,4'-bpy (2) groups. Each layer in 1 contains rectangles with dimensions of 11.08 x 4.99 Angstroms(2), the edges being defined by the Phmal and 4,4'-bpy ligands. The intralayer copper-copper separations in 1 through the anti-syn equatorial-apical carboxylate-bridge and the 4,4'-bpy molecule are 4.9922(4) and 11.083(1) Angstroms, respectively. The anti-syn equatorial-equatorial carboxylate bridge links the copper(II) atoms in complex 2 within each layer with a mean copper-copper separation of 5.3709(8) Angstroms. The presence of 2,4'-bpy as a terminal ligand accounts for the large interlayer separation of 15.22 Angstroms. The copper(II) environment presents a static pseudo-Jahn-Teller disorder which has been studied by EPR and low-temperature X-ray diffraction. Magnetic susceptibility measurements of both compounds in the temperature range 2-290 K show the occurrence of weak antiferromagnetic [J = -0.59(1) cm(-1) (1)] and ferromagnetic [J = +0.77(1) cm(-1) (2)] interactions between the copper(II) ions. The conformation of the phenylmalonate-carboxylate bridge and other structural factors, such as the planarity of the exchange pathway in 1, account for the different nature of the magnetic interaction.

Expression, Purification, Crystallization of Two Major Envelope Proteins from White Spot Syndrome Virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tang,X.; Hew, C.

2007-01-01

White spot syndrome virus (WSSV) is a major virulent pathogen known to infect penaeid shrimp and other crustaceans. VP26 and VP28, two major envelope proteins from WSSV, have been identified and overexpressed in Escherichia coli. In order to facilitate purification and crystallization, predicted N-terminal transmembrane regions of approximately 35 amino acids have been truncated from both VP26 and VP28. Truncated VP26 and VP28 and their corresponding SeMet-labelled proteins were purified and the SeMet proteins were crystallized by the hanging-drop vapor-diffusion method. Crystals of SeMet-labelled VP26 were obtained using a reservoir consisting of 0.1 M citric acid pH 3.5, 3.0 Mmore » sodium chloride and 1%(w/v) polyethylene glycol 3350, whereas SeMet VP28 was crystallized using a reservoir solution consisting of 25% polyethylene glycol 8000, 0.2 M calcium acetate, 0.1 M Na HEPES pH 7.5 and 1.5%(w/v) 1,2,3-heptanetriol. Crystals of SeMet-labelled VP26 diffract to 2.2 {angstrom} resolution and belong to space group R32, with unit-cell parameters a = b = 73.92, c = 199.31 {angstrom}. SeMet-labelled VP28 crystallizes in space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 105.33, b = 106.71, c = 200.37 {angstrom}, and diffracts to 2.0 {angstrom} resolution.« less

The Fe{sup 2+}/Fe{sup 3+} ratio in natural and heat-treated iron-rich eudialytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rastsvetaeva, R. K., E-mail: rast@ns.crys.ras.ru; Aksenov, S. M.; Rozenberg, K. A.

2011-03-15

The structures of natural iron-rich eudialyte (specimen 3458 from the Khibiny massif, the Kola Peninsula) and two heat-treated samples of this mineral calcined at 700 and 800 Degree-Sign C were determined by X-ray diffraction. The trigonal unit-cell parameters (sp. gr. R3m) are as follows: a = 14.2645(1) Angstrom-Sign , c = 29.9635(5) Angstrom-Sign ; a = 14.1307(1) Angstrom-Sign , c = 30.1229(3) Angstrom-Sign ; a = 14.1921(2) Angstrom-Sign , c = 30.2417(5) Angstrom-Sign , respectively. It was found that Fe{sup 3+} ions in the calcined eudialytes, as well as impurities in the starting specimen, occupy the square-pyramidal Fe{sup 3+}(V) sites,more » whereas Fe{sup 2+} ions are in the planar-tetragonal Fe{sup 2+}(IV) sites.« less

(Ag{sub 2}TeS{sub 3}){sub 2} {small_bullet} A{sub 2}S{sub 6} (A = Rb, Cs) : layers of silver thiotellurite intergrown with alkali-metal polysulfides.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nguyen, S. L.; Jang, J. I.; Ketterson, J. B.

2010-09-22

The layered compounds RbAg{sub 2}TeS{sub 6} and CsAg{sub 2}TeS{sub 6} crystallize in the noncentrosymmetric space group P6{sub 3}cm, with a = 19.15 {angstrom}, c = 14.64 {angstrom}, and V = 4648 {angstrom}{sup 3} and a = 19.41 {angstrom}, c = 14.84 {angstrom}, and V = 4839 {angstrom}{sup 3}, respectively. The structures are composed of neutral [Ag{sub 2}TeS{sub 3}] layers alternating with charge-balanced salt layers containing polysulfide chains of [S{sub 6}]{sup 2-} and alkali-metal ions. RbAg{sub 2}TeS{sub 6} and CsAg{sub 2}TeS{sub 6} are air- and water-stable, wide-band-gap semiconductors (E{sub g} {approx} 2.0 eV) exhibiting nonlinear-optical second-harmonic generation.

Antiprismatic Coordination about Xenon: The Structure of Nitrosonium Octafluoroxenate(VI).

PubMed

Peterson, S W; Holloway, J H; Coyle, B A; Williams, J M

1971-09-24

The structure of nitrosonium octafluoroxenate(VI), 2NOF . XeF(6), has been determined by means of single-crystal x-ray counter methods (R-index = 0.046, weighted R-index = 0.042). The space group is Pnma, with a = 8.914(10) angstroms, b = 5.945(10) angstroms, and c = 12.83(2) angstroms (the numbers in parentheses are the standard deviations to the least significant digit or digits); the calculated density (rho) is 3.354 grams per cubic centimeter, and there are four formula units per unit cell. The material consists of well-separated NO(+) and (XeF(8))(2-) ions; the structural formula is thus (NO)(2) (XeF(8)). The anion configuration is that of a slightly distorted Archimedean antiprism. The observed distortion appears incompatible with a lone-pair repulsion model. Xenon-fluorine bond lengths of 1.971(7), 1.946(5), 1.958(7), 2.052(5), and 2.099(5) angstroms were found.

Synthesis and structure determination of Sm{sub 3}NbSe{sub 3}O{sub 4}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Meerschaut, A.; Boyer, C.; Lafond, A.

1998-04-01

Sm{sub 3}NbSe{sub 3}O{sub 4} has been synthesized and its structure determined. The following crystal data were obtained: M{sub r} = 844.84 g{center_dot}mol{sup {minus}1}, orthorhombic, Pnma, a = 6.8943(4) {angstrom}, b = 7.7529(7) {angstrom}, c = 14.7644(12) {angstrom}, V = 789.2(1) {angstrom}{sup 3}, Z = 4, D{sub x} = 7.111 g{center_dot}cm{sup {minus}3}, MoK{alpha}, {lambda} = 0.71073 {angstrom}, {mu} = 372 cm{sup {minus}1}, F(000) = 1444, T = 295 K, R = 0.035 for 1466 unique reflections with F{sub o} > 4{sigma}(F{sub o}), 62 variables, GoF = 0.818. The structure of Sm{sub 3}NbSe{sub 3}O{sub 4} was determined by single-crystal X-ray diffraction. Twomore » distinct types of polyhedra can be distinguished: a very distorted one with eight surrounding atoms (four O and four Se atoms) around Sm1 and Nb, and a bicapped trigonal prismatic one around Sm2. The crystal structure of this new compound can be described on the basis of corrugated planes perpendicular to the c axis. These planes are built up from edge-sharing trigonal prismatic polyhedra (Sm2); connection between successive planes is achieved through the distorted polyhedra which surround atoms Sm1 and Nb.« less

Atomic resolution structure of cucurmosin, a novel type 1 ribosome-inactivating protein from the sarcocarp of Cucurbita moschata

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hou, Xiaomin; Meehan, Edward J.; Xie, Jieming

2008-10-27

A novel type 1 ribosome-inactivating protein (RIP) designated cucurmosin was isolated from the sarcocarp of Cucurbita moschata (pumpkin). Besides rRNA N-glycosidase activity, cucurmosin exhibits strong cytotoxicities to three cancer cell lines of both human and murine origins, but low toxicity to normal cells. Plant genomic DNA extracted from the tender leaves was amplified by PCR between primers based on the N-terminal sequence and X-ray sequence of the C-terminal. The complete mature protein sequence was obtained from N-terminal protein sequencing and partial DNA sequencing, confirmed by high resolution crystal structure analysis. The crystal structure of cucurmosin has been determined at 1.04more » {angstrom}, a resolution that has never been achieved before for any RIP. The structure contains two domains: a large N-terminal domain composed of seven {alpha}-helices and eight {beta}-strands, and a smaller C-terminal domain consisting of three {alpha}-helices and two {beta}-strands. The high resolution structure established a glycosylation pattern of GlcNAc{sub 2}Man3Xyl. Asn225 was identified as a glycosylation site. Residues Tyr70, Tyr109, Glu158 and Arg161 define the active site of cucurmosin as an RNA N-glycosidase. The structural basis of cytotoxicity difference between cucurmosin and trichosanthin is discussed.« less

Engineering Protein Allostery: 1.05 Å Resolution Structure and Enzymatic Properties of a Na[superscript +]-activated Trypsin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Page, Michael J.; Carrell, Christopher J.; Di Cera, Enrico

2008-05-28

Some trypsin-like proteases are endowed with Na{sup +}-dependent allosteric enhancement of catalytic activity, but this important mechanism has been difficult to engineer in other members of the family. Replacement of 19 amino acids in Streptomyces griseus trypsin targeting the active site and the Na{sup +}-binding site were found necessary to generate efficient Na{sup +} activation. Remarkably, this property was linked to the acquisition of a new substrate selectivity profile similar to that of factor Xa, a Na{sup -} activated protease involved in blood coagulation. The X-ray crystal structure of the mutant trypsin solved to 1.05 {angstrom} resolution defines the engineeredmore » Na{sup +} site and active site loops in unprecedented detail. The results demonstrate that trypsin can be engineered into an efficient allosteric protease, and that Na+ activation is interwoven with substrate selectivity in the trypsin scaffold.« less

The high pressure crystal structures of tin sulphate: a case study for maximal information recovery from 2D powder diffraction data

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hinrichsen, Bernd; Dinnebier, Robert E.; Liu, Haozhe

2008-12-09

Our recently proposed method for automatic detection, calibration and evaluation of Debye-Scherrer ellipses using pattern recognition techniques and advanced signal filtering was applied to 2D powder diffraction data of tin sulphate in dependence on pressure. Three phase transitions towards higher pressure could be identified, and their respective crystal structures have been determined. The high pressure behaviour of the stereoactive lone pair of Sn{sup 2+} was investigated. At ambient conditions, SnSO{sub 4} crystallizes in a strongly distorted Barite structure type in space group Pnma (phase I). In the pressure range between P = 0.15 and P = 0.2 GPa, it exhibitsmore » a displacive second order phase transition into a structure with space group P112{sub 1}/a (phase II at P = 0.2 GPa: a = 8.7022(9) {angstrom}, b = 5.3393(5) {angstrom}, c = 7.0511(6) A, y = 89.90(1){sup o}). A second displacive phase transition occurs between P = 4.40 and P = 5.07 GPa into another structure with space group PI (phase III at P = 13.5 GPa: a = 8.067(3) {angstrom}, b = 5.141(2) {angstrom}, c = 6.609(2) {angstrom}, a = 90.56(3){sup o}, {beta} = 90.65(2){sup o}, y = 89.46(2){sup o}). A third displacive phase transition towards another crystal structure in space group P1 occurs between P = 13.6 and P = 15.3 GPa (phase IV at P = 20.5 GPa: a = 7.889(5) {angstrom}, b = 5.028(3) {angstrom}, c = 6.462(3) {angstrom}, a = 90.99(3){sup o}, {beta}=91.01(3){sup o}, y = 89.89(4){sup o}). A non-linear compression behaviour over the entire pressure range is observed, which can be described by three Vinet relations in the ranges from P = 0.21 to 4.4 GPa, from P = 5.07 to 13.55 GPa and from P = 15.26 to 20.5 GPa. The extrapolated bulk moduli of the high-pressure phases were determined to K{sub 0} = 48(1) GPa for phase II, K{sub 0} = 56(2) GPa for phase III, and K{sub 0} = 51(13) GPa for phase IV. The crystal structures of all phases are refined against X-ray powder diffraction data measured at several pressures between 0.15 and 20.5 GPa. The structural phase transitions of SnSO{sub 4} are mainly characterized by a reorientation of the SO{sub 4} tetrahedra, in order to optimize crystal packing. With increasing pressure, the lone pair which is localized at Sn{sup 2+} increasingly adopts pure s-character.« less

Magnetochemistry of the tetrahaloferrate (III) ions. 7. Crystal structure and magnetic ordering in (pyridinium){sub 3}Fe{sub 2}Br{sub 9}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lowe, C.B.; Shaviv, R.; Carlin, R.L.

1994-07-06

A monoclinic crystal structure was found by X-ray diffraction for bis [pyridinium tetrabromferrate(III)]-pyridinium bromide. The double salt contains two slightly distorted [FeBr{sub 4}]{sup -} tetrahedra, three pyridinium rings, and an uncoordinated halide in each asymmetric unit, as is characteristic of the A{sub 3}Fe{sub 2}X{sub 9} series of compounds. Unit cell parameters, monoclinic space group P2{sub 1}, are a = 7.656(3) {angstrom}, b = 14.237(5) {angstrom}, c = 13.725(5) {angstrom}, {beta} = 93.42(3){degrees}, and V = 1493(1) {angstrom}{sup 3}, using Mo K{alpha} radiation {lambda} = 0.710 69 {angstrom}, {rho}{sub calc} = 2.38 g cm{sup -3}, and Z = 2. The tetrahedramore » are aligned with their 3-fold axes parallel to the crystallographic c axis. Bond lengths (Fe-Br) range from 2.271(9) {angstrom} to 2.379(9) {angstrom} for the two different slightly distorted tetrahedral units. Magnetic susceptibility studies show that the material orders three-dimensionally at 7.4 {+-} 0.2 K. The data are compared to a HTS expansion of 1/{sub {chi}} for the S = 5/2 three-dimensional Heisenberg model antiferromagnet for a sc lattice with g = 1.98 and J/k{sub B} = -0.43 K. The specific heat measurements indicate two odd-shaped {lambda} features, at 7.3 and 8 K.« less

STEREO's Extreme UltraViolet Imager (EUVI)

NASA Technical Reports Server (NTRS)

2007-01-01

At a pixel resolution of 2048x2048, the STEREO EUVI instrument provides views of the Sun in ultraviolet light that rivals the full-disk views of SOHO/EIT. This image is through the 171 Angstrom (ultraviolet) filter which is characteristic of iron ions (missing eight and nine electrons) at 1 million degrees. There is a short data gap in the latter half of the movie that creates a freeze and then jump in the data view. This is a movie of the Sun in 171 Angstrom ultraviolet light. The time frame is late January, 2007

Mechanism of N[superscript 10]-formyltetrahydrofolate synthetase derived from complexes with intermediates and inhibitors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Celeste, Lesa R.; Chai, Geqing; Bielak, Magdalena

N{sup 10}-formyltetrahydrofolate synthetase (FTHFS) is a folate enzyme that catalyzes the formylation of tetrahydrofolate (THF) in an ATP dependent manner. Structures of FTHFS from the thermophilic homoacetogen, Moorella thermoacetica, complexed with (1) a catalytic intermediate-formylphosphate (XPO) and product-ADP; (2) with an inhibitory substrate analog-folate; (3) with XPO and an inhibitory THF analog, ZD9331, were used to analyze the enzyme mechanism. Nucleophilic attack of the formate ion on the gamma phosphate of ATP leads to the formation of XPO and the first product ADP. A channel that leads to the putative formate binding pocket allows for the binding of ATP andmore » formate in random order. Formate binding is due to interactions with the gamma-phosphate moiety of ATP and additionally to two hydrogen bonds from the backbone nitrogen of Ala276 and the side chain of Arg97. Upon ADP dissociation, XPO reorients and moves to the position previously occupied by the beta-phosphate of ATP. Conformational changes that occur due to the XPO presence apparently allow for the recruitment of the third substrate, THF, with its pterin moiety positioned between Phe384 and Trp412. This position overlaps with that of the bound nucleoside, which is consistent with a catalytic mechanism hypothesis that FTHFS works via a sequential ping-pong mechanism. More specifically, a random bi uni uni bi ping-pong ter ter mechanism is proposed. Additionally, the native structure originally reported at a 2.5 {angstrom} resolution was redetermined at a 2.2 {angstrom} resolution.« less

Synthesis and Structural Characterization of a Novel Indium Mercapto Derivative [clln(sch2(co)o)2]2-[(4-mepyh)2]2+

NASA Technical Reports Server (NTRS)

Banger, Kulbinder K.; Duraj, Stan A.; Fanwick, Philip E.; Hepp, Aloysius F.; Martock, Robert A.

2004-01-01

The synthesis and structural characterization of a novel In(III) complex is described. The reaction between InCl3 with sodium mercapto-acetic acid, (NaSCH2(CO)OH) in 4-methylpyridine, (CH3(C5H5N), (4-Mepy)) at 25 C affords [ClIn(SCH2(CO)O)2]2- [(4-MepyH)2]2+. X-ray diffraction studies show it to have a distorted square pyramidal geometry, with the [(-SCH2(CO)CO-)] ligands in a trans conformation. The compound crystallizes in the P(raised dash) 1 (No. 2) space group with a = 7.8624 Angstrom, b = 9.950 Angstrom, c = 13.793 Angstrom, alpha = 107.60 degrees, beta= 90.336 degrees, gamma = 98.983 degrees, V = 1014.3 Angstroms (sup 3), R(F(raised circle)) = 0.037, and R(sub w) = 0.048.

Structure of Penaeus stylirostris Densovirus, a Shrimp Pathogen

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaufmann, Bärbel; Bowman, Valorie D.; Li, Yi

Penaeus stylirostris densovirus (PstDNV), a pathogen of penaeid shrimp, causes significant damage to farmed and wild shrimp populations. In contrast to other parvoviruses, PstDNV probably has only one type of capsid protein that lacks the phospholipase A2 activity that has been implicated as a requirement during parvoviral host cell infection. The structure of recombinant virus-like particles, composed of 60 copies of the 37.5-kDa coat protein, the smallest parvoviral capsid protein reported thus far, was determined to 2.5-{angstrom} resolution by X-ray crystallography. The structure represents the first near-atomic resolution structure within the genus Brevidensovirus. The capsid protein has a {beta}-barrel 'jellymore » roll' motif similar to that found in many icosahedral viruses, including other parvoviruses. The N-terminal portion of the PstDNV coat protein adopts a 'domain-swapped' conformation relative to its twofold-related neighbor similar to the insect parvovirus Galleria mellonella densovirus (GmDNV) but in stark contrast to vertebrate parvoviruses. However, most of the surface loops have little structural resemblance to any of the known parvoviral capsid proteins.« less

Transmission electron microscopy characterization of a large-pore titanium silicate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bozhilov, K.N.; Valtchev, V.P.

1993-11-01

The large-pore titanium silicate ETS-10, synthesized with tetramethylammonium, was characterized by means of TEM. The parameters of an orthorhombic unit cell, a = 14.79 [angstrom], b = 14.5 [angstrom], c = 13.06 [angstrom], were determined based on both electron and x-ray diffraction data. A one-dimensional channel structure is proposed, with channels running parallel to [001]. The cations and molecules occupying channel positions display significant positional disorder.

Structural Characterization of Aluminum (Oxy)hydroxide Films at the Muscovite (001)–Water Interface

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Sang Soo; Schmidt, Moritz; Fister, Timothy T.

2016-01-19

The formation of Al (oxy)hydroxide on the basal surface of muscovite mica was investigated to understand how the structure of the substrate controls the nucleation and growth of secondary phases. Atomic force microscopy images showed that solid phases nucleated on the surface initially as two-dimensional islands that were <= 10 angstrom in height and <= 200 angstrom in diameter after 16-50 h of reaction in a 100 mu M AlCl3 solution at pH 4.2 at room temperature. High-resolution X-ray reflectivity data indicated that these islands were gibbsite layers whose basic unit is composed of a plane of Al ions octahedrallymore » coordinated to oxygen or hydroxyl groups. The formation of gibbsite layers is likely favored because of the structural similarity between its basal plane and the underlying mica surface. After 700-2000 h of reaction, a thicker and continuous film had formed on top of the initial gibbsite layers. X-ray diffraction data showed that this film was composed of diaspore that grew predominantly with its [040] and [140] crystallographic directions oriented along the muscovite [001] direction. These results show the structural characteristics of the muscovite (001) and Al (oxy)hydroxide film interface where presumed epitaxy had facilitated nucleation of metastable gibbsite layers which acted as a structural anchor for the subsequent growth of thermodynamically stable diaspore grown from a mildly acidic and Al-rich solution.« less

Snapshots of the maltose transporter during ATP hydrolysis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Oldham, Michael L.; Chen, Jue

2011-12-05

ATP-binding cassette transporters are powered by ATP, but the mechanism by which these transporters hydrolyze ATP is unclear. In this study, four crystal structures of the full-length wild-type maltose transporter, stabilized by adenosine 5{prime}-({beta},{gamma}-imido)triphosphate or ADP in conjunction with phosphate analogs BeF{sub 3}{sup -}, VO{sub 4}{sup 3-}, or AlF{sub 4}{sup -}, were determined to 2.2- to 2.4-{angstrom} resolution. These structures led to the assignment of two enzymatic states during ATP hydrolysis and demonstrate specific functional roles of highly conserved residues in the nucleotide-binding domain, suggesting that ATP-binding cassette transporters catalyze ATP hydrolysis via a general base mechanism.

Structure of the Protease Domain of Memapsin 2 (β-Secretase) Complexed with Inhibitor

NASA Astrophysics Data System (ADS)

Hong, Lin; Koelsch, Gerald; Lin, Xinli; Wu, Shili; Terzyan, Simon; Ghosh, Arun K.; Zhang, Xuenjun C.; Tang, Jordan

2000-10-01

Memapsin 2 (β-secretase) is a membrane-associated aspartic protease involved in the production of β-amyloid peptide in Alzheimer's disease and is a major target for drug design. We determined the crystal structure of the protease domain of human memapsin 2 complexed to an eight-residue inhibitor at 1.9 angstrom resolution. The active site of memapsin 2 is more open and less hydrophobic than that of other human aspartic proteases. The subsite locations from S4 to S2' are well defined. A kink of the inhibitor chain at P2' and the change of chain direction of P3' and P4' may be mimicked to provide inhibitor selectivity.

Femtosecond movies of water near interfaces at sub-Angstrom resolution

NASA Astrophysics Data System (ADS)

Coridan, Robert; Hwee Lai, Ghee; Schmidt, Nathan; Abbamonte, Peter; Wong, Gerard C. L.

2010-03-01

The behavior of liquid water near interfaces with nanoscopic variations in chemistry influences a broad range of phenomena in biology. Using inelastic x-ray scattering (IXS) data from 3rd-generation synchrotron x-ray sources, we reconstruct the Greens function of liquid water, which describes the å-scale spatial and femtosecond-scale temporal evolution of density fluctuations. We extend this response function formalism to reconstruct the evolution of hydration structures near dynamic surfaces with different charge distributions, in order to define more precisely the molecular signature of hydrophilicity and hydrophobicity. Moreover, we investigate modifications to surface hydration structures and dynamics as the size of hydrophilic and hydrophobic patches are varied.

Ab initio structural modeling of and experimental validation for Chlamydia trachomatis protein CT296 reveal structural similarity to Fe(II) 2-oxoglutarate-dependent enzymes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kemege, Kyle E.; Hickey, John M.; Lovell, Scott

2012-02-13

Chlamydia trachomatis is a medically important pathogen that encodes a relatively high percentage of proteins with unknown function. The three-dimensional structure of a protein can be very informative regarding the protein's functional characteristics; however, determining protein structures experimentally can be very challenging. Computational methods that model protein structures with sufficient accuracy to facilitate functional studies have had notable successes. To evaluate the accuracy and potential impact of computational protein structure modeling of hypothetical proteins encoded by Chlamydia, a successful computational method termed I-TASSER was utilized to model the three-dimensional structure of a hypothetical protein encoded by open reading frame (ORF)more » CT296. CT296 has been reported to exhibit functional properties of a divalent cation transcription repressor (DcrA), with similarity to the Escherichia coli iron-responsive transcriptional repressor, Fur. Unexpectedly, the I-TASSER model of CT296 exhibited no structural similarity to any DNA-interacting proteins or motifs. To validate the I-TASSER-generated model, the structure of CT296 was solved experimentally using X-ray crystallography. Impressively, the ab initio I-TASSER-generated model closely matched (2.72-{angstrom} C{alpha} root mean square deviation [RMSD]) the high-resolution (1.8-{angstrom}) crystal structure of CT296. Modeled and experimentally determined structures of CT296 share structural characteristics of non-heme Fe(II) 2-oxoglutarate-dependent enzymes, although key enzymatic residues are not conserved, suggesting a unique biochemical process is likely associated with CT296 function. Additionally, functional analyses did not support prior reports that CT296 has properties shared with divalent cation repressors such as Fur.« less

Ultrafast and low barrier motions in the photoreactions of the green fluorescent protein.

PubMed

van Thor, Jasper J; Georgiev, Georgi Y; Towrie, Michael; Sage, J Timothy

2005-09-30

Green fluorescent protein (GFP) fluoresces efficiently under blue excitation despite major electrostatic rearrangements resulting from photoionization of the chromophore and neutralization of Glu-222. A competing phototransformation process, which ionizes the chromophore and decarboxylates Glu-222, mimics the electrostatic and structural changes in the fluorescence photocycle. Structural and spectroscopic analysis of the cryogenically stabilized photoproduct at 100 K and a structurally annealed intermediate of the phototransformed protein at 170 K reveals distinct structural relaxations involving protein, chromophore, solvent, and photogenerated CO2. Strong structural changes of the 100 K photoproduct after decarboxylation appear exclusively within 15 angstroms of the chromophore and include the electrostatically driven perturbations of Gln-69, Cys-70, and water molecules in an H-bonding network connecting the chromophore. X-ray crystallography to 1.85 angstroms resolution and static and picosecond time-resolved IR spectroscopy identify structural mechanisms common to phototransformation and to the fluorescence photocycle. In particular, the appearance of a 1697 cm(-1) (+) difference band in both photocycle and phototransformation intermediates is a spectroscopic signature for the structural perturbation of Gln-69. This is taken as evidence for an electrostatically driven dynamic response that is common to both photoreaction pathways. The interactions between the chromophore and the perturbed residues and solvent are decreased or removed in the T203H single and T203H/Q69L double mutants, resulting in a strong reduction of the fluorescence quantum yield. This suggests that the electrostatic response to the transient formation of a buried charge in the wild type is important for the bright fluorescence.

Sixty years from discovery to solution: crystal structure of bovine liver catalase form III

DOE Office of Scientific and Technical Information (OSTI.GOV)

Foroughi, Leila M.; Kang, You-Na; Matzger, Adam J.

2012-03-27

The crystallization and structural characterization of bovine liver catalase (BLC) has been intensively studied for decades. Forms I and II of BLC have previously been fully characterized using single-crystal X-ray diffraction. Form III has previously been analyzed by electron microscopy, but owing to the thinness of this crystal form an X-ray crystal structure had not been determined. Here, the crystal structure of form III of BLC is presented in space group P212121, with unit-cell parameters a = 68.7, b = 173.7, c = 186.3 {angstrom}. The asymmetric unit is composed of the biological tetramer, which is packed in a tetrahedronmore » motif with three other BLC tetramers. This higher resolution structure has allowed an assessment of the previously published electron-microscopy studies.« less

Crystal Structure of a CRISPR RNA-guided Surveillance Complex Bound to a ssDNA Target

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mulepati, Sabin; Heroux, Annie; Bailey, Scott

In prokaryotes, RNA derived from type I and type III CRISPR loci direct large ribonucleoprotein complexes to destroy invading bacteriophage and plasmids. In Escherichia coli, this 405-kilodalton complex is called Cascade. We report the crystal structure of Cascade bound to a single-stranded DNA (ssDNA) target at a resolution of 3.03 angstroms. The structure reveals that the CRISPR RNA and target strands do not form a double helix but instead adopt an underwound ribbon-like structure. This noncanonical structure is facilitated by rotation of every sixth nucleotide out of the RNA-DNA hybrid and is stabilized by the highly interlocked organization of proteinmore » subunits. These studies provide insight into both the assembly and the activity of this complex and suggest a mechanism to enforce fidelity of target binding.« less

A new structure related to the layered cuprates: The {open_quotes}1201{angstrom} shear-like phase Tl{sub 5}Ba{sub 3}Sr{sub 5}Cu{sub 3}O{sub 19}, third member of the series (TlA{sub 2}CuO{sub 5}){sub m}{center_dot}Tl{sub 2}A{sub 2}O{sub 4}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Letouze, F.; Martin, C.; Hervieu, M.

1997-01-01

A thallium cuprate, Tl{sub 5}Ba{sub 3}Sr{sub 5}Cu{sub 3}O{sub 19}, whose structure can be derived by systematically shearing the {open_quotes}1201{close_quotes} structure has been synthesized for the first time. It crystallizes in an orthorhombic cell with a=3.7536(2) {angstrom}, b=30.631(2) {angstrom}, c=9.219(1) {angstrom}, and A-type symmetry. This new structure consists of {open_quotes}1201{close_quotes} ribbons parallel to (010) which are three CuO{sub 6} octahedra wide and are interconnected through {open_quotes}Tl{sub 2}A{sub 2}O{sub 4}{close_quotes} ribbons whose cationic configuration is that of the rock salt structure. This phase can be considered to be the m = 3 member of a new series with the generic formulation (TlA{submore » 2}CuO{sub 5}){sub m} {center_dot} Tl{sub 2}A{sub 2}O{sub 4} with A = Ba, Sr.« less

Structural analysis of the Sil1-Bip complex reveals the mechanism for Sil1 to function as a nucleotide-exchange factor

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yan, Ming; Li, Jingzhi; Sha, Bingdong

2013-01-16

Sil1 functions as a NEF (nucleotide-exchange factor) for the ER (endoplasmic reticulum) Hsp70 (heat-shock protein of 70 kDa) Bip in eukaryotic cells. Sil1 may catalyse the ADP release from Bip by interacting directly with the ATPase domain of Bip. In the present study we show the complex crystal structure of the yeast Bip and the NEF Sil1 at the resolution of 2.3 {angstrom} (1 {angstrom} = 0.1 nm). In the Sil1-Bip complex structure, the Sil1 molecule acts as a 'clamp' which binds lobe IIb of the Bip ATPase domain. The binding of Sil1 causes the rotation of lobe IIb {approx}more » 13.5{sup o} away from the ADP-binding pocket. The complex formation also induces lobe Ib to swing in the opposite direction by {approx} 3.7{sup o}. These conformational changes open up the nucleotide-binding pocket in the Bip ATPase domain and disrupt the hydrogen bonds between Bip and bound ADP, which may catalyse ADP release. Mutation of the Sil1 residues involved in binding the Bip ATPase domain compromise the binding affinity of Sil1 to Bip, and these Sil1 mutants also abolish the ability to stimulate the ATPase activity of Bip.« less

Structures of NodZ [alpha]1,6-fucosyltransferase in complex with GDP and GDP-fucose

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brzezinski, Krzysztof; Dauter, Zbigniew; Jaskolski, Mariusz

Rhizobial NodZ {alpha}1,6-fucosyltransferase ({alpha}1,6-FucT) catalyzes the transfer of the fucose (Fuc) moiety from guanosine 5'-diphosphate-{beta}-L-fucose to the reducing end of the chitin oligosaccharide core during Nod-factor (NF) biosynthesis. NF is a key signaling molecule required for successful symbiosis with a legume host for atmospheric nitrogen fixation. To date, only two {alpha}1,6-FucT structures have been determined, both without any donor or acceptor molecule that could highlight the structural background of the catalytic mechanism. Here, the first crystal structures of {alpha}1,6-FucT in complex with its substrate GDP-Fuc and with GDP, which is a byproduct of the enzymatic reaction, are presented. The crystalmore » of the complex with GDP-Fuc was obtained through soaking of native NodZ crystals with the ligand and its structure has been determined at 2.35 {angstrom} resolution. The fucose residue is exposed to solvent and is disordered. The enzyme-product complex crystal was obtained by cocrystallization with GDP and an acceptor molecule, penta-N-acetyl-L-glucosamine (penta-NAG). The structure has been determined at 1.98 {angstrom} resolution, showing that only the GDP molecule is present in the complex. In both structures the ligands are located in a cleft formed between the two domains of NodZ and extend towards the C-terminal domain, but their conformations differ significantly. The structures revealed that residues in three regions of the C-terminal domain, which are conserved among {alpha}1,2-, {alpha}1,6- and protein O-fucosyltransferases, are involved in interactions with the sugar-donor molecule. There is also an interaction with the side chain of Tyr45 in the N-terminal domain, which is very unusual for a GT-B-type glycosyltransferase. Only minor conformational changes of the protein backbone are observed upon ligand binding. The only exception is a movement of the loop located between strand {beta}C2 and helix {alpha}C3. In addition, there is a shift of the {alpha}C3 helix itself upon GDP-Fuc binding.« less

Superconducting structure with layers of niobium nitride and aluminum nitride

DOEpatents

Murduck, James M.; Lepetre, Yves J.; Schuller, Ivan K.; Ketterson, John B.

1989-01-01

A superconducting structure is formed by depositing alternate layers of aluminum nitride and niobium nitride on a substrate. Deposition methods include dc magnetron reactive sputtering, rf magnetron reactive sputtering, thin-film diffusion, chemical vapor deposition, and ion-beam deposition. Structures have been built with layers of niobium nitride and aluminum nitride having thicknesses in a range of 20 to 350 Angstroms. Best results have been achieved with films of niobium nitride deposited to a thickness of approximately 70 Angstroms and aluminum nitride deposited to a thickness of approximately 20 Angstroms. Such films of niobium nitride separated by a single layer of aluminum nitride are useful in forming Josephson junctions. Structures of 30 or more alternating layers of niobium nitride and aluminum nitride are useful when deposited on fixed substrates or flexible strips to form bulk superconductors for carrying electric current. They are also adaptable as voltage-controlled microwave energy sources.

Superconducting structure with layers of niobium nitride and aluminum nitride

DOEpatents

Murduck, J.M.; Lepetre, Y.J.; Schuller, I.K.; Ketterson, J.B.

1989-07-04

A superconducting structure is formed by depositing alternate layers of aluminum nitride and niobium nitride on a substrate. Deposition methods include dc magnetron reactive sputtering, rf magnetron reactive sputtering, thin-film diffusion, chemical vapor deposition, and ion-beam deposition. Structures have been built with layers of niobium nitride and aluminum nitride having thicknesses in a range of 20 to 350 Angstroms. Best results have been achieved with films of niobium nitride deposited to a thickness of approximately 70 Angstroms and aluminum nitride deposited to a thickness of approximately 20 Angstroms. Such films of niobium nitride separated by a single layer of aluminum nitride are useful in forming Josephson junctions. Structures of 30 or more alternating layers of niobium nitride and aluminum nitride are useful when deposited on fixed substrates or flexible strips to form bulk superconductors for carrying electric current. They are also adaptable as voltage-controlled microwave energy sources. 8 figs.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Selezneva, Anna I.; Cavigiolio, Giorgio; Theil, Elizabeth C.

Iron regulatory protein 1 (IRP1) is a bifunctional protein with activity as an RNA-binding protein or as a cytoplasmic aconitase. Interconversion of IRP1 between these mutually exclusive states is central to cellular iron regulation and is accomplished through iron-responsive assembly and disassembly of a [4Fe-4S] cluster. When in its apo form, IRP1 binds to iron responsive elements (IREs) found in mRNAs encoding proteins of iron storage and transport and either prevents translation or degradation of the bound mRNA. Excess cellular iron stimulates the assembly of a [4Fe-4S] cluster in IRP1, inhibiting its IRE-binding ability and converting it to an aconitase.more » The three-dimensional structure of IRP1 in its different active forms will provide details of the interconversion process and clarify the selective recognition of mRNA, Fe-S sites and catalytic activity. To this end, the apo form of IRP1 bound to a ferritin IRE was crystallized. Crystals belong to the monoclinic space group P21, with unit-cell parameters a = 109.6, b = 80.9, c = 142.9 {angstrom}, = 92.0{sup o}. Native data sets have been collected from several crystals with resolution extending to 2.8 {angstrom} and the structure has been solved by molecular replacement.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hamiaux, C.; Stanley, D.; Greenwood, D.R.

Takeout (To) proteins are found exclusively in insects and have been proposed to have important roles in various aspects of their physiology and behavior. Limited sequence similarity with juvenile hormone-binding proteins (JHBPs), which specifically bind and transport juvenile hormones in Lepidoptera, suggested a role for To proteins in binding hydrophobic ligands. We present the first crystal structure of a To protein, EpTo1 from the light brown apple moth Epiphyas postvittana, solved in-house by the single-wavelength anomalous diffraction technique using sulfur anomalous dispersion, and refined to 1.3 {angstrom} resolution. EpTo1 adopts the unusual {alpha}/{beta}-wrap fold, seen only for JHBP and severalmore » mammalian lipid carrier proteins, a scaffold tailored for the binding and/or transport of hydrophobic ligands. EpTo1 has a 45 {angstrom} long, purely hydrophobic, internal tunnel that extends for the full length of the protein and accommodates a bound ligand. The latter was shown by mass spectrometry to be ubiquinone-8 and is probably derived from Escherichia coli. The structure provides the first direct experimental evidence that To proteins are ligand carriers; gives insights into the nature of endogenous ligand(s) of EpTo1; shows, by comparison with JHBP, a basis for different ligand specificities; and suggests a mechanism for the binding/release of ligands.« less

Crystallization of the receptor-binding domain of parathyroid hormone-related protein in complex with a neutralizing monoclonal antibody Fab fragment

DOE Office of Scientific and Technical Information (OSTI.GOV)

McKinstry, William J.; Polekhina, Galina; Diefenbach-Jagger, Hannelore

Parathyroid hormone-related protein (PTHrP) plays an important role in regulating embryonic skeletal development and is abnormally regulated in the pathogenesis of skeletal complications observed with many cancers and osteoporosis. It exerts its action through binding to a G-protein-coupled seven-transmembrane cell-surface receptor (GPCR). Structurally, GPCRs are very difficult to study by X-ray crystallography. In this study, a monoclonal antibody Fab fragment which recognizes the same region of PTHrP as its receptor, PTH1R, was used to aid in the crystallization of PTHrP. The resultant protein complex was crystallized using the hanging-drop vapour-diffusion method with polyethylene glycol as a precipitant. The crystals belongedmore » to the orthorhombic space group P2{sub 1}2{sub 1}2, with unit-cell parameters a = 72.6, b = 96.3, c = 88.5 {angstrom}, and diffracted to 2.0 {angstrom} resolution using synchrotron radiation. The crystal structure will shed light on the nature of the key residues of PTHrP that interact with the antibody and will provide insights into how the antibody is able to discriminate between PTHrP and the related molecule parathyroid homone.« less

Visualizing Key Hinges and a Potential Major Source of Compliance in the Lever Arm of Myosin

DOE Office of Scientific and Technical Information (OSTI.GOV)

J Brown; V Senthil Kumar; E ONeall-Hennessey

2011-12-31

We have determined the 2.3-{angstrom}-resolution crystal structure of a myosin light chain domain, corresponding to one type found in sea scallop catch ('smooth') muscle. This structure reveals hinges that may function in the 'on' and 'off' states of myosin. The molecule adopts two different conformations about the heavy chain 'hook' and regulatory light chain (RLC) helix D. This conformational change results in extended and compressed forms of the lever arm whose lengths differ by 10 {angstrom}. The heavy chain hook and RLC helix D hinges could thus serve as a potential major and localized source of cross-bridge compliance during themore » contractile cycle. In addition, in one of the molecules of the crystal, part of the RLC N-terminal extension is seen in atomic detail and forms a one-turn alpha-helix that interacts with RLC helix D. This extension, whose sequence is highly variable in different myosins, may thus modulate the flexibility of the lever arm. Moreover, the relative proximity of the phosphorylation site to the helix D hinge suggests a potential role for conformational changes about this hinge in the transition between the on and off states of regulated myosins.« less

Visualizing key hinges and a potential major source of compliance in the lever arm of myosin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brown, J.H.; Robinson, H.; Senthil Kumar, V. S.

2011-01-04

We have determined the 2.3-{angstrom}-resolution crystal structure of a myosin light chain domain, corresponding to one type found in sea scallop catch ('smooth') muscle. This structure reveals hinges that may function in the 'on' and 'off' states of myosin. The molecule adopts two different conformations about the heavy chain 'hook' and regulatory light chain (RLC) helix D. This conformational change results in extended and compressed forms of the lever arm whose lengths differ by 10 {angstrom}. The heavy chain hook and RLC helix D hinges could thus serve as a potential major and localized source of cross-bridge compliance during themore » contractile cycle. In addition, in one of the molecules of the crystal, part of the RLC N-terminal extension is seen in atomic detail and forms a one-turn alpha-helix that interacts with RLC helix D. This extension, whose sequence is highly variable in different myosins, may thus modulate the flexibility of the lever arm. Moreover, the relative proximity of the phosphorylation site to the helix D hinge suggests a potential role for conformational changes about this hinge in the transition between the on and off states of regulated myosins.« less

Crystal Structure of Biotin Carboxylase in Complex with Substrates and Implications for Its Catalytic Mechanism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chou, C.; Yu, L; Tong, L

2009-01-01

Biotin-dependent carboxylases are widely distributed in nature and have important functions in many cellular processes. These enzymes share a conserved biotin carboxylase (BC) component, which catalyzes the ATP-dependent carboxylation of biotin using bicarbonate as the donor. Despite the availability of a large amount of biochemical and structural information on BC, the molecular basis for its catalysis is currently still poorly understood. We report here the crystal structure at 2.0 {angstrom} resolution of wild-type Escherichia coli BC in complex with its substrates biotin, bicarbonate, and Mg-ADP. The structure suggests that Glu{sup 296} is the general base that extracts the proton frommore » bicarbonate, and Arg{sup 338} is the residue that stabilizes the enolate biotin intermediate in the carboxylation reaction. The B domain of BC is positioned closer to the active site, leading to a 2-{angstrom} shift in the bound position of the adenine nucleotide and bringing it near the bicarbonate for catalysis. One of the oxygen atoms of bicarbonate is located in the correct position to initiate the nucleophilic attack on ATP to form the carboxyphosphate intermediate. This oxygen is also located close to the N1' atom of biotin, providing strong evidence that the phosphate group, derived from decomposition of carboxyphosphate, is the general base that extracts the proton on this N1' atom. The structural observations are supported by mutagenesis and kinetic studies. Overall, this first structure of BC in complex with substrates offers unprecedented insights into the molecular mechanism for the catalysis by this family of enzymes.« less

Expression, purification, crystallization and preliminary X-ray analysis of conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708.

PubMed

Yamamura, Akihiro; Maruoka, Shintaro; Ohtsuka, Jun; Miyakawa, Takuya; Nagata, Koji; Kataoka, Michihiko; Kitamura, Nahoko; Shimizu, Sakayu; Tanokura, Masaru

2009-11-01

Conjugated polyketone reductase C2 (CPR-C2) from Candida parapsilosis IFO 0708 is a member of the NADPH-dependent aldo-keto reductase (AKR) superfamily and catalyzes the stereospecific reduction of ketopantoyl lactone to d-pantoyl lactone. A diffraction-quality crystal of recombinant CPR-C2 was obtained by the sitting-drop vapour-diffusion method using PEG 3350 as the precipitant. The crystal diffracted X-rays to 1.7 angstrom resolution on beamline NW12A of the Photon Factory-Advanced Ring (Tsukuba, Japan). The crystal belonged to space group P2(1)2(1)2(1), with unit-cell parameters a = 55.02, b = 68.30, c = 68.93 angstrom. The Matthews coefficient (V(M) = 1.76 angstrom(3) Da(-1)) indicated that the crystal contained one CPR-C2 molecule per asymmetric unit.

Electron fractography used to examine nickel-base alloys

NASA Technical Reports Server (NTRS)

Jewett, R. P.

1970-01-01

Electron fractography establishes causes of metal fatigue and stress failures. Technique produces surface features at magnification as high as 9000X with excellent resolution. Method permits observation of features with dimensions of only 50 angstroms.

VizieR Online Data Catalog: Copernicus 0.2-A Resolution Far-UV Stellar Spectra (Snow+ 1977)

NASA Astrophysics Data System (ADS)

Snow, T. P., Jr.; Jenkins, E. B.

1997-08-01

The catalog is a subset comprising data for 60 O- and B-type stars observed by the Copernicus satellite. For each star a FITS file was created of the observed spectrum. Each spectrum has 2250 photometric data points. The wavelength range is from 1000 to 1450 Angstroems in 0.2-Angstrom steps. The data were acquired with photomultiplier U2, which had a nominal bandpass of 0.2 Angstrom (A) and scanned the spectrum with a 0.2 A step length, integrating for 13.6 sec at each wavelength position. (61 data files).

Structure of the SH3 Domain of Rat Endophilin A2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Loll,P.; Swain, E.; Chen, Y.

2008-01-01

The crystal structure of the SH3 domain of rat endophilin A2 has been determined by the multiwavelength anomalous dispersion method and refined at a resolution of 1.70 Angstroms to R and Rfree values of 0.196 and 0.217, respectively. The structure adheres to the canonical SH3-domain fold and is highly similar to those of the corresponding domains of endophilins A1 and A3. An intermolecular packing interaction between two molecules in the lattice exploits features that are commonly observed in SH3-domain ligand recognition, including the insertion of a proline side chain into the ligand-binding groove of the protein and the recognition ofmore » a basic residue by a cluster of acidic side chains on the RT loop.« less

Structure of alpha-glycerophosphate Oxidase from Streptococcus sp.: a Template for the Mitochondrial alpha-glycerophosphate Dehydrogenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

T Colussi; D Parsonage; W Boles

The FAD-dependent {alpha}-glycerophosphate oxidase (GlpO) from Enterococcus casseliflavus and Streptococcus sp. was originally studied as a soluble flavoprotein oxidase; surprisingly, the GlpO sequence is 30-43% identical to those of the {alpha}-glycerophosphate dehydrogenases (GlpDs) from mitochondrial and bacterial sources. The structure of a deletion mutant of Streptococcus sp. GlpO (GlpO{Delta}, lacking a 50-residue insert that includes a flexible surface region) has been determined using multiwavelength anomalous dispersion data and refined at 2.3 {angstrom} resolution. Using the GlpO{Delta} structure as a search model, we have also determined the intact GlpO structure, as refined at 2.4 {angstrom} resolution. The first two domains ofmore » the GlpO fold are most closely related to those of the flavoprotein glycine oxidase, where they function in FAD binding and substrate binding, respectively; the GlpO C-terminal domain consists of two helix bundles and is not closely related to any known structure. The flexible surface region in intact GlpO corresponds to a segment of missing electron density that links the substrate-binding domain to a {beta}{beta}{alpha} element of the FAD-binding domain. In accordance with earlier biochemical studies (stabilizations of the covalent FAD-N5-sulfite adduct and p-quinonoid form of 8-mercapto-FAD), Ile430-N, Thr431-N, and Thr431-OG are hydrogen bonded to FAD-O2{alpha} in GlpO{Delta}, stabilizing the negative charge in these two modified flavins and facilitating transfer of a hydride to FAD-N5 (from Glp) as well. Active-site overlays with the glycine oxidase-N-acetylglycine and d-amino acid oxidase-d-alanine complexes demonstrate that Arg346 of GlpO{Delta} is structurally equivalent to Arg302 and Arg285, respectively; in both cases, these residues interact directly with the amino acid substrate or inhibitor carboxylate. The structural and functional divergence between GlpO and the bacterial and mitochondrial GlpDs is also discussed.« less

Structure of {alpha}-Glycerophosphate Oxidase from Streptococcus sp.: A Template for the Mitochondrial {alpha}-Glycerophosphate Dehydrogenase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Colussi,T.; Parsonage, D.; Boles, W.

The FAD-dependent a-glycerophosphate oxidase (GlpO) from Enterococcus casseliflavus and Streptococcus sp. was originally studied as a soluble flavoprotein oxidase; surprisingly, the GlpO sequence is 30-43% identical to those of the a-glycerophosphate dehydrogenases (GlpDs) from mitochondrial and bacterial sources. The structure of a deletion mutant of Streptococcus sp. GlpO (GlpO?, lacking a 50-residue insert that includes a flexible surface region) has been determined using multiwavelength anomalous dispersion data and refined at 2.3 Angstroms resolution. Using the GlpO? structure as a search model, we have also determined the intact GlpO structure, as refined at 2.4 Angstroms resolution. The first two domains ofmore » the GlpO fold are most closely related to those of the flavoprotein glycine oxidase, where they function in FAD binding and substrate binding, respectively; the GlpO C-terminal domain consists of two helix bundles and is not closely related to any known structure. The flexible surface region in intact GlpO corresponds to a segment of missing electron density that links the substrate-binding domain to a {beta}a element of the FAD-binding domain. In accordance with earlier biochemical studies (stabilizations of the covalent FAD-N5-sulfite adduct and p-quinonoid form of 8-mercapto-FAD), Ile430-N, Thr431-N, and Thr431-OG are hydrogen bonded to FAD-O2a in GlpO?, stabilizing the negative charge in these two modified flavins and facilitating transfer of a hydride to FAD-N5 (from Glp) as well. Active-site overlays with the glycine oxidase-N-acetylglycine and d-amino acid oxidase-d-alanine complexes demonstrate that Arg346 of GlpO? is structurally equivalent to Arg302 and Arg285, respectively; in both cases, these residues interact directly with the amino acid substrate or inhibitor carboxylate. The structural and functional divergence between GlpO and the bacterial and mitochondrial GlpDs is also discussed.« less

Synthesis and Structural Characterization of the Aluminosilicate LZ-135, a Zeolite Related to ZSM-10

DOE Office of Scientific and Technical Information (OSTI.GOV)

McCusker, Lynne B.; Baerlocher, Christian; Wilson, Stephen T.

2009-09-02

The aluminosilicate LZ-135 was one of the first zeolites to be prepared in the presence of two or more organic structure-directing agents (in this case, Me{sub 4}N{sup +} (TMA) and Et{sub 4}N{sup +} (TEA)) and was patented 20 years ago. However, the material was polycrystalline, and at the time, its aluminosilicate framework structure could not be determined. In view of the fact that methods of structure determination from powder diffraction data have developed considerably in the meantime, a fresh analysis of the problem was undertaken. High-resolution synchrotron powder diffraction data were collected on a calcined sample of LZ-135 (as synthesizedmore » composition ca. |Na{sub 26}TMA{sub 6}|[Si{sub 76}Al{sub 32}O{sub 216}]), and the new powder charge-flipping structure-solution algorithm was applied. The framework structure (P6{sub 3}/mmc; a = 31.3830(2) {angstrom}, c = 7.6513(1) {angstrom}) was revealed immediately, and then the positions of the Na{sup +} ions and a few water molecules were located in a series of difference electron density maps. The [001] projection of the framework structure is identical to that of ZSM-10 (P6{sub 3}/mmm), but the (up-down) orientations of the (Si,Al) tetrahedra, and therefore their connectivities, are different, and this leads to a distinctly different topology with two 1-dimensional, 12-ring channel systems with effective pore widths of 7.2 and 6.5 {angstrom}. The new framework has been assigned the framework type code LTF by the International Zeolite Association. The framework structures of LZ-135 and ZSM-10 are related to one another in the same way as are those of mazzite and zeolite L. Approximately 27.5 Na{sup +} ions were located in six different sites, and all are coordinated to oxygen atoms of the framework. Twelve H{sub 2}O molecules per unit cell are associated with one of the Na{sup +} ion positions, where they serve to complete an octahedral coordination geometry around the ion, and 5.2 are located in the larger of the two 12-ring channels, where they make hydrogen-bonding contacts to framework oxygen atoms and are probably associated with protons.« less

Structure of Glycerol Dehydratase Reactivase: A New Type of Molecular Chaperone

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liao, Der-Ing; Reiss, Lisa; Turner, Jr., Ivan

2010-03-08

The function of glycerol dehydratase (GDH) reactivase is to remove damaged coenzyme B{sub 12} from GDH that has suffered mechanism-based inactivation. The structure of GDH reactivase from Klebsiella pneumoniae was determined at 2.4 {angstrom} resolution by the single isomorphous replacement with anomalous signal (SIR/AS) method. Each tetramer contains two elongated 63 kDa {alpha} subunits and two globular 14 kDa {beta} subunits. The {alpha} subunit contains structural features resembling both GroEL and Hsp70 groups of chaperones, and it appears chaperone like in its interactions with ATP. The fold of the {beta} subunit resembles that of the {beta} subunit of glycerol dehydratase,more » except that it lacks some coenzyme B12 binding elements. A hypothesis for the reactivation mechanism of reactivase is proposed based on these structural features.« less

Structure of Mycobacterium tuberculosis phosphopantetheine adenylyltransferase in complex with the feedback inhibitor CoA reveals only one active-site conformation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wubben, T.; Mesecar, A.D.; UIC)

Phosphopantetheine adenylyltransferase (PPAT) catalyzes the penultimate step in the coenzyme A (CoA) biosynthetic pathway, reversibly transferring an adenylyl group from ATP to 4'-phosphopantetheine to form dephosphocoenzyme A (dPCoA). To complement recent biochemical and structural studies on Mycobacterium tuberculosis PPAT (MtPPAT) and to provide further insight into the feedback regulation of MtPPAT by CoA, the X-ray crystal structure of the MtPPAT enzyme in complex with CoA was determined to 2.11 {angstrom} resolution. Unlike previous X-ray crystal structures of PPAT-CoA complexes from other bacteria, which showed two distinct CoA conformations bound to the active site, only one conformation of CoA is observedmore » in the MtPPAT-CoA complex.« less

Synthesis and Crystal Structure of 2’-Se-modified guanosine Containing DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Salon, J.; Sheng, J; Gan, J

Selenium modification of nucleic acids is of great importance in X-ray crystal structure determination and functional study of nucleic acids. Herein, we describe a convenient synthesis of a new building block, the 2{prime}-SeMe-modified guanosine (G{sub Se}) phosphoramidite, and report the first incorporation of the 2{prime}-Se-G moiety into DNA. The X-ray crystal structure of the 2{prime}-Se-modified octamer DNA (5{prime}-GTG{sub Se}TACAC-3{prime}) was determined at a resolution of 1.20 {angstrom}. We also found that the 2{prime}-Se modification points to the minor groove and that the modified and native structures are virtually identical. Furthermore, we observed that the 2{prime}-Se-G modification can significantly facilitate themore » crystal growth with respect to the corresponding native DNA.« less

Crystal structure of a shark single-domain antibody V region in complex with lysozyme.

PubMed

Stanfield, Robyn L; Dooley, Helen; Flajnik, Martin F; Wilson, Ian A

2004-09-17

Cartilaginous fish are the phylogenetically oldest living organisms known to possess components of the vertebrate adaptive immune system. Key to their immune response are heavy-chain, homodimeric immunoglobulins called new antigen receptors (IgNARs), in which the variable (V) domains recognize antigens with only a single immunoglobulin domain, akin to camelid heavy-chain V domains. The 1.45 angstrom resolution crystal structure of the type I IgNAR V domain in complex with hen egg-white lysozyme (HEL) reveals a minimal antigen-binding domain that contains only two of the three conventional complementarity-determining regions but still binds HEL with nanomolar affinity by means of a binding interface comparable in size to conventional antibodies.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Modolo, Luzia V.; Li, Lenong; Pan, Haiyun

The glycosyltransferase UGT78G1 from Medicago truncatula catalyzes the glycosylation of various (iso)flavonoids such as the flavonols kaempferol and myricetin, the isoflavone formononetin, and the anthocyanidins pelargonidin and cyanidin. It also catalyzes a reverse reaction to remove the sugar moiety from glycosides. The structures of UGT78G1 bound with uridine diphosphate or with both uridine diphosphate and myricetin were determined at 2.1 {angstrom} resolution, revealing detailed interactions between the enzyme and substrates/products and suggesting a distinct binding mode for the acceptor/product. Comparative structural analysis and mutagenesis identify glutamate 192 as a key amino acid for the reverse reaction. This information provides amore » basis for enzyme engineering to manipulate substrate specificity and to design effective biocatalysts with glycosylation and/or deglycosylation activity.« less

Conformational flexibility in the catalytic triad revealed by the high-resolution crystal structure of Streptomyces erythraeus trypsin in an unliganded state

PubMed Central

Blankenship, Elise; Vukoti, Krishna; Miyagi, Masaru; Lodowski, David T.

2014-01-01

With more than 500 crystal structures determined, serine proteases make up greater than one-third of all proteases structurally examined to date, making them among the best biochemically and structurally characterized enzymes. Despite the numerous crystallographic and biochemical studies of trypsin and related serine proteases, there are still considerable shortcomings in the understanding of their catalytic mechanism. Streptomyces erythraeus trypsin (SET) does not exhibit autolysis and crystallizes readily at physiological pH; hence, it is well suited for structural studies aimed at extending the understanding of the catalytic mechanism of serine proteases. While X-ray crystallographic structures of this enzyme have been reported, no coordinates have ever been made available in the Protein Data Bank. Based on this, and observations on the extreme stability and unique properties of this particular trypsin, it was decided to crystallize it and determine its structure. Here, the first sub-angstrom resolution structure of an unmodified, unliganded trypsin crystallized at physiological pH is reported. Detailed structural analysis reveals the geometry and structural rigidity of the catalytic triad in the unoccupied active site and comparison to related serine proteases provides a context for interpretation of biochemical studies of catalytic mechanism and activity. PMID:24598752

Conformational flexibility in the catalytic triad revealed by the high-resolution crystal structure of Streptomyces erythraeus trypsin in an unliganded state.

PubMed

Blankenship, Elise; Vukoti, Krishna; Miyagi, Masaru; Lodowski, David T

2014-03-01

With more than 500 crystal structures determined, serine proteases make up greater than one-third of all proteases structurally examined to date, making them among the best biochemically and structurally characterized enzymes. Despite the numerous crystallographic and biochemical studies of trypsin and related serine proteases, there are still considerable shortcomings in the understanding of their catalytic mechanism. Streptomyces erythraeus trypsin (SET) does not exhibit autolysis and crystallizes readily at physiological pH; hence, it is well suited for structural studies aimed at extending the understanding of the catalytic mechanism of serine proteases. While X-ray crystallographic structures of this enzyme have been reported, no coordinates have ever been made available in the Protein Data Bank. Based on this, and observations on the extreme stability and unique properties of this particular trypsin, it was decided to crystallize it and determine its structure. Here, the first sub-angstrom resolution structure of an unmodified, unliganded trypsin crystallized at physiological pH is reported. Detailed structural analysis reveals the geometry and structural rigidity of the catalytic triad in the unoccupied active site and comparison to related serine proteases provides a context for interpretation of biochemical studies of catalytic mechanism and activity.

The Flavivirus Precursor Membrane-Envelope Protein Complex: Structure and Maturation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Long; Lok, Shee-Mei; Yu, I-Mei

2008-09-17

Many viruses go through a maturation step in the final stages of assembly before being transmitted to another host. The maturation process of flaviviruses is directed by the proteolytic cleavage of the precursor membrane protein (prM), turning inert virus into infectious particles. We have determined the 2.2 angstrom resolution crystal structure of a recombinant protein in which the dengue virus prM is linked to the envelope glycoprotein E. The structure represents the prM-E heterodimer and fits well into the cryo-electron microscopy density of immature virus at neutral pH. The pr peptide {beta}-barrel structure covers the fusion loop in E, preventingmore » fusion with host cell membranes. The structure provides a basis for identifying the stages of its pH-directed conformational metamorphosis during maturation, ending with release of pr when budding from the host.« less

Structural and Mechanistic Insights into C-P Bond Hydrolysis by Phosphonoacetate Hydrolase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Agarwal, Vinayak; Borisova, Svetlana A.; Metcalf, William W.

2011-12-22

Bacteria have evolved pathways to metabolize phosphonates as a nutrient source for phosphorus. In Sinorhizobium meliloti 1021, 2-aminoethylphosphonate is catabolized to phosphonoacetate, which is converted to acetate and inorganic phosphate by phosphonoacetate hydrolase (PhnA). Here we present detailed biochemical and structural characterization of PhnA that provides insights into the mechanism of C-P bond cleavage. The 1.35 {angstrom} resolution crystal structure reveals a catalytic core similar to those of alkaline phosphatases and nucleotide pyrophosphatases but with notable differences, such as a longer metal-metal distance. Detailed structure-guided analysis of active site residues and four additional cocrystal structures with phosphonoacetate substrate, acetate, phosphonoformatemore » inhibitor, and a covalently bound transition state mimic provide insight into active site features that may facilitate cleavage of the C-P bond. These studies expand upon the array of reactions that can be catalyzed by enzymes of the alkaline phosphatase superfamily.« less

Spectral observations of the extreme ultraviolet background.

PubMed

Labov, S E; Bowyer, S

1991-04-20

A grazing incidence spectrometer was designed to measure the diffuse extreme ultraviolet background. It was flown on a sounding rocket, and data were obtained on the diffuse background between 80 and 650 angstroms. These are the first spectral measurements of this background below 520 angstroms. Several emission features were detected, including interplanetary He I 584 angstroms emission and geocoronal He II 304 angstroms emission. Other features observed may originate in a hot ionized interstellar gas, but if this interpretation is correct, gas at several different temperatures is present. The strongest of these features is consistent with O V emission at 630 angstroms. This emission, when combined with upper limits for other lines, restricts the temperature of this component to 5.5 < log T < 5.7, in agreement with temperatures derived from O VI absorption studies. A power-law distribution of temperatures is consistent with this feature only if the power-law coefficient is negative, as is predicted for saturated evaporation of clouds in a hot medium. In this case, the O VI absorption data confine the filling factor of the emission of f < or = 4% and the pressure to more than 3.7 x 10(4) cm-3 K, substantially above ambient interstellar pressure. Such a pressure enhancement has been predicted for clouds undergoing saturated evaporation. Alternatively, if the O V emission covers a considerable fraction of the sky, it would be a major source of ionization. A feature centered at about 99 angstroms is well fitted by a cluster of Fe XVIII and Fe XIX lines from gas at log T = 6.6-6.8. These results are consistent with previous soft X-ray observations with low-resolution detectors. A feature found near 178 angstroms is consistent with Fe X and Fe XI emission from gas at log T = 6; this result is consistent with results from experiments employing broad-band soft X-ray detectors.

The Solar Chromosphere/Corona Interface. I; FUV-EUV Observations and Modeling of Unresolved Coronal Funnels

NASA Technical Reports Server (NTRS)

Martinez-Galarce, D. S.; Walker, A. B. C.; Barbee, T. W., II; Hoover, R. B.

2003-01-01

A coronal funnel model, developed by Rabin (199l), was tested against a calibrated spectroheliogram recorded in 171 - 175 Angstrom bandpass. This image was recorded on board a sounding rocket experiment flown on 1994 November 3, called the Multi-Spectral Solar Telescope Array, II (MSSTA II), MSSTA, a joint project of Stanford University, the NASA Marshall Space Flight Center and the Lawrence Livermore National Laboratory, is an observing platform composed of a set of normal-incidence, multilayer-coated optics designed to obtain narrow bandpass, high resolution images (1 - 3 arc sec) at selected FUV, EUV and soft X-ray wavelengths (44 Angstroms - 1550 Angstroms). Using full-disk images centered at 1550 Angstroms (C IV) and 173 Angstroms (FE IX/X), the funnel model, which is based on coronal back-heating, was tested against the data incorporating observed constraints on global coverage and measured flux. Found, was a class of funnel models that could account for the quiescent, globally diffuse and unresolved emission seen in the 171 - 175 Angstrom bandpass, where the funnels are assumed to be rooted in the C IV supergranular network. These models, when incorporated with the Chianti spectral code, suggest that this emission is mostly of upper transition region origin and primarily composed of FE IX plasma. The funnels are found to have constrictions, Gamma approx. 6 - 20, which is in good agreement with the observations. Further, the fitted models simultaneously satisfy global areal constraints seen in both images; namely, that a global network of funnels must cover approx. 70 - 95 % of the total solar surface area seen in the 171 - 175 Angstrom image, and = 45 % of the disk area seen in the 1550 Angstrom bandpass. These findings support the configuration of the EUV magnetic network as suggested by Reeves et af. (1974) and put forth in more detail by Gabriel (1976). Furthermore, the models are in good agreement with differential emission measure estimates made of the transition region by Raymond & Doyle (1981) for temperatures, 250,000 K = T = 650,000 K, based on full-disk observations made on board by SkyLab.

Structural Analysis of the Receptor Binding Domain of Botulinum Neurotoxin Serotype D

DOE Office of Scientific and Technical Information (OSTI.GOV)

Y Zhang; G Buchko; L Qin

2011-12-31

Botulinum neurotoxins (BoNTs) are the most toxic proteins known. The mechanism for entry into neuronal cells for serotypes A, B, E, F, and G involves a well understood dual receptor (protein and ganglioside) process, however, the mechanism of entry for serotypes C and D remains unclear. To provide structural insights into how BoNT/D enters neuronal cells, the crystal structure of the receptor binding domain (S863-E1276) for this serotype (BoNT/D-HCR) was determined at 1.65{angstrom} resolution. While BoNT/D-HCR adopts an overall fold similar to that observed in other known BoNT HCRs, several major structural differences are present. These structural differences are locatedmore » at, or near, putative receptor binding sites and may be responsible for BoNT/D host preferences. Two loops, S1195-I1204 and K1236-N1244, located on both sides of the putative protein receptor binding pocket, are displaced >10{angstrom} relative to the corresponding residues in the crystal structures of BoNT/B and G. Obvious clashes were observed in the putative protein receptor binding site when the BoNT/B protein receptor synaptotagmin II was modeled into the BoNT/D-HCR structure. Although a ganglioside binding site has never been unambiguously identified in BoNT/D-HCR, a shallow cavity in an analogous location to the other BoNT serotypes HCR domains is observed in BoNT/D-HCR that has features compatible with membrane binding. A portion of a loop near the putative receptor binding site, K1236-N1244, is hydrophobic and solvent-exposed and may directly bind membrane lipids. Liposome-binding experiments with BoNT/D-HCR demonstrate that this membrane lipid may be phosphatidylethanolamine.« less

SUMER: Solar Ultraviolet Measurements of Emitted Radiation

NASA Technical Reports Server (NTRS)

Wilhelm, K.; Axford, W. I.; Curdt, W.; Gabriel, A. H.; Grewing, M.; Huber, M. C. E.; Jordan, M. C. E.; Lemaire, P.; Marsch, E.; Poland, A. I.

1988-01-01

The SUMER (solar ultraviolet measurements of emitted radiation) experiment is described. It will study flows, turbulent motions, waves, temperatures and densities of the plasma in the upper atmosphere of the Sun. Structures and events associated with solar magnetic activity will be observed on various spatial and temporal scales. This will contribute to the understanding of coronal heating processes and the solar wind expansion. The instrument will take images of the Sun in EUV (extreme ultra violet) light with high resolution in space, wavelength and time. The spatial resolution and spectral resolving power of the instrument are described. Spectral shifts can be determined with subpixel accuracy. The wavelength range extends from 500 to 1600 angstroms. The integration time can be as short as one second. Line profiles, shifts and broadenings are studied. Ratios of temperature and density sensitive EUV emission lines are established.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cao, Hongnan; Pauff, James M.; Hille, Russ

Xanthine oxidase is a molybdenum-containing enzyme catalyzing the hydroxylation of a sp{sup 2}-hybridized carbon in a broad range of aromatic heterocycles and aldehydes. Crystal structures of the bovine enzyme in complex with the physiological substrate hypoxanthine at 1.8 {angstrom} resolution and the chemotherapeutic agent 6-mercaptopurine at 2.6 {angstrom} resolution have been determined, showing in each case two alternate orientations of substrate in the two active sites of the crystallographic asymmetric unit. One orientation is such that it is expected to yield hydroxylation at C-2 of substrate, yielding xanthine. The other suggests hydroxylation at C-8 to give 6,8-dihydroxypurine, a putative productmore » not previously thought to be generated by the enzyme. Kinetic experiments demonstrate that >98% of hypoxanthine is hydroxylated at C-2 rather than C-8, indicating that the second crystallographically observed orientation is significantly less catalytically effective than the former. Theoretical calculations suggest that enzyme selectivity for the C-2 over C-8 of hypoxanthine is largely due to differences in the intrinsic reactivity of the two sites. For the orientation of hypoxanthine with C-2 proximal to the molybdenum center, the disposition of substrate in the active site is such that Arg880 and Glu802, previous shown to be catalytically important for the conversion of xanthine to uric acid, play similar roles in hydroxylation at C-2 as at C-8. Contrary to the literature, we find that 6,8-dihydroxypurine is effectively converted to uric acid by xanthine oxidase.« less

High-resolution crystal spectrometer for the 10-60 (angstrom) EUV region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beiersdorfer, P; Brown, G V; Goddard, R

2004-02-20

A vacuum crystal spectrometer with nominal resolving power approaching 1000 is described for measuring emission lines with wavelength in the extreme ultraviolet region up to 60 Angstroms. The instrument utilizes a flat octadecyl hydrogen maleate (OHM) crystal and a thin-window 1-D position-sensitive gas proportional detector. This detector employs a 1 {micro}m-thick 100 x8 mm{sup 2} aluminized polyimide window and operates at one atmosphere pressure. The spectrometer has been implemented on the Livermore electron beam ion traps. The performance of the instrument is illustrated in measurements of the newly discovered magnetic field-sensitive line in Ar{sup 8+}.

Atomic Structure of a Cesium Aluminosilicate Geopolymer: A Pair Distribution Function Study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bell, J.; Sarin, P; Provis, J

2008-01-01

The atomic pair distribution function (PDF) method was used to study the structure of cesium aluminosilicate geopolymer. The geopolymer was prepared by reacting metakaolin with cesium silicate solution followed by curing at 50C for 24 h in a sealed container. Heating of Cs-geopolymer above 1000C resulted in formation of crystalline pollucite (CsAlSi{sub 2}O{sub 6}). PDF refinement of the pollucite phase formed displayed an excellent fit over the 10-30 {angstrom} range when compared with a cubic pollucite model. A poorer fit was attained from 1-10 {angstrom} due to an additional amorphous phase present in the heated geopolymer. On the basis ofmore » PDF analysis, unheated Cs-geopolymer displayed structural ordering similar to pollucite up to a length scale of 9 {angstrom}, despite some differences. Our results suggest that hydrated Cs{sup +} ions were an integral part of the Cs-geopolymer structure and that most of the water present was not associated with Al-OH or Si-OH bonds.« less

Structural basis of IFNα receptor recognition by TYK2

PubMed Central

Wallweber, Heidi J.A.; Tam, Christine; Franke, Yvonne; Starovasnik, Melissa A.; Lupardus, Patrick J.

2014-01-01

Tyrosine kinase 2 (TYK2) is a member of the Janus kinase (JAK) family of non-receptor tyrosine kinases, which are essential for proper signaling in immune responses and development. Here we present a 2.0 angstrom resolution crystal structure of a receptor-binding fragment of human TYK2 encompassing the FERM and SH2 domains in complex with a so-called “box2” containing intracellular peptide motif from the IFNα receptor (IFNAR1). The TYK2–IFNAR1 interface reveals an unexpected receptor-binding mode that mimics a SH2 domain–phosphopeptide interaction, with a glutamate replacing the canonical phosphotyrosine residue. This structure provides the first view to our knowledge of a JAK in complex with its cognate receptor and defines the molecular logic through which JAKs evolved to interact with divergent receptor sequences. PMID:24704786

Coiled-Coil Irregularities and Instabilities in Group A Streptococcus M1 Are Required for Virulence

DOE Office of Scientific and Technical Information (OSTI.GOV)

McNamara, Case; Zinkernagel, Annelies S.; Macheboeuf, Pauline

2008-07-21

Antigenically variable M proteins are major virulence factors and immunogens of the human pathogen group A Streptococcus (GAS). Here, we report the -3 angstrom resolution structure of a GAS M1 fragment containing the regions responsible for eliciting type-specific, protective immunity and for binding fibrinogen, which promotes M1 proinflammatory and antiphagocytic functions. The structure revealed substantial irregularities and instabilities throughout the coiled coil of the M1 fragment. Similar structural irregularities occur in myosin and tropomyosin, explaining the patterns of cross-reactivity seen in autoimmune sequelae of GAS infection. Sequence idealization of a large segment of the M1 coiled coil enhanced stability butmore » diminished fibrinogen binding, proinflammatory effects, and antibody cross-reactivity, whereas it left protective immunogenicity undiminished. Idealized M proteins appear to have promise as vaccine immunogens.« less

Insights into Strand Exchange in BTB Domain Dimers from the Crystal Structures of FAZF and Miz1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stogios, Peter J.; Cuesta-Seijo, Jose Antonio; Chen, Lu

2010-09-22

The BTB domain is a widely distributed protein-protein interaction motif that is often found at the N-terminus of zinc finger transcription factors. Previous crystal structures of BTB domains have revealed tightly interwound homodimers, with the N-terminus from one chain forming a two-stranded anti-parallel {beta}-sheet with a strand from the other chain. We have solved the crystal structures of the BTB domains from Fanconi anemia zinc finger (FAZF) and Miz1 (Myc-interacting zinc finger 1) to resolutions of 2.0 {angstrom} and 2.6 {angstrom}, respectively. Unlike previous examples of BTB domain structures, the FAZF BTB domain is a nonswapped dimer, with each N-terminalmore » {beta}-strand associated with its own chain. As a result, the dimerization interface in the FAZF BTB domain is about half as large as in the domain-swapped dimers. The Miz1 BTB domain resembles a typical swapped BTB dimer, although it has a shorter N-terminus that is not able to form the interchain sheet. Using cysteine cross-linking, we confirmed that the promyelocytic leukemia zinc finger (PLZF) BTB dimer is strand exchanged in solution, while the FAZF BTB dimer is not. A phylogenic tree of the BTB fold based on both sequence and structural features shows that the common ancestor of the BTB domain in BTB-ZF (bric a brac, tramtrack, broad-complex zinc finger) proteins was a domain-swapped dimer. The differences in the N-termini seen in the FAZF and Miz1 BTB domains appear to be more recent developments in the structural evolution of the domain.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brautigam, Chad A.; Chuang, Jacinta L.; Tomchick, Diana R.

Human dihydrolipoamide dehydrogenase (hE3) is an enzymatic component common to the mitochondrial {alpha}-ketoacid dehydrogenase and glycine decarboxylase complexes. Mutations to this homodimeric flavoprotein cause the often-fatal human disease known as E3 deficiency. To catalyze the oxidation of dihydrolipoamide, hE3 uses two molecules: noncovalently bound FAD and a transiently bound substrate, NAD{sup +}. To address the catalytic mechanism of hE3 and the structural basis for E3 deficiency, the crystal structures of hE3 in the presence of NAD{sup +} or NADH have been determined at resolutions of 2.5 {angstrom} and 2.1 {angstrom}, respectively. Although the overall fold of the enzyme is similarmore » to that of yeast E3, these two structures differ at two loops that protrude from the proteins and at their FAD-binding sites. The structure of oxidized hE3 with NAD{sup +} bound demonstrates that the nicotinamide moiety is not proximal to the FAD. When NADH is present, however, the nicotinamide base stacks directly on the isoalloxazine ring system of the FAD. This is the first time that this mechanistically requisite conformation of NAD{sup +} or NADH has been observed in E3 from any species. Because E3 structures were previously available only from unicellular organisms, speculations regarding the molecular mechanisms of E3 deficiency were based on homology models. The current hE3 structures show directly that the disease-causing mutations occur at three locations in the human enzyme: the dimer interface, the active site, and the FAD and NAD{sup +}-binding sites. The mechanisms by which these mutations impede the function of hE3 are discussed.« less

The Crystal Structure of the Ivy delta4-16:0-ACP Desaturase Reveals Structural Details of the Oxidized Active Site and Potential Determinants of Regioselectivity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guy,J.; Whittle, E.; Kumaran, D.

2007-01-01

The multifunctional acyl-acyl carrier protein (ACP) desaturase from Hedera helix (English ivy) catalyzes the {Delta}{sup 4} desaturation of 16:0-ACP and the{Delta}{sup 9} desaturation of 18:0-ACP and further desaturates{Delta}{sup 9}-16:1 or {Delta}{sup 9}-18:1 to the corresponding {Delta}{sup 4,9} dienes. The crystal structure of the enzyme has been solved to 1.95{angstrom} resolution, and both the iron-iron distance of 3.2{angstrom} and the presence of a {mu}-oxo bridge reveal this to be the only reported structure of a desaturase in the oxidized FeIII-FeIII form. Significant differences are seen between the oxidized active site and the reduced active site of the Ricinus communis (castor) desaturase;more » His{sup 227} coordination to Fe2 is lost, and the side chain of Glu{sup 224}, which bridges the two iron ions in the reduced structure, does not interact with either iron. Although carboxylate shifts have been observed on oxidation of other diiron proteins, this is the first example of the residue moving beyond the coordination range of both iron ions. Comparison of the ivy and castor structures reveal surface amino acids close to the annulus of the substrate-binding cavity and others lining the lower portion of the cavity that are potential determinants of their distinct substrate specificities. We propose a hypothesis that differences in side chain packing explains the apparent paradox that several residues lining the lower portion of the cavity in the ivy desaturase are bulkier than their equivalents in the castor enzyme despite the necessity for the ivy enzyme to accommodate three more carbons beyond the diiron site.« less

Crystal structure of homoisocitrate dehydrogenase from Schizosaccharomyces pombe

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bulfer, Stacie L.; Hendershot, Jenna M.; Trievel, Raymond C.

Lysine biosynthesis in fungi, euglena, and certain archaebacteria occurs through the {alpha}-aminoadipate pathway. Enzymes in the first steps of this pathway have been proposed as potential targets for the development of antifungal therapies, as they are absent in animals but are conserved in several pathogenic fungi species, including Candida, Cryptococcus, and Aspergillus. One potential antifungal target in the {alpha}-aminoadipate pathway is the third enzyme in the pathway, homoisocitrate dehydrogenase (HICDH), which catalyzes the divalent metal-dependent conversion of homoisocitrate to 2-oxoadipate (2-OA) using nicotinamide adenine dinucleotide (NAD{sup +}) as a cofactor. HICDH belogns to a family of {beta}-hydroxyacid oxidative decarboxylases thatmore » includes malate dehydrogenase, tartrate dehydrogenase, 6-phosphogluconate dehydrogenase, isocitrate dehydrogenase (ICDH), and 3-isopropylmalte dehydrogenase (IPMDH). ICDH and IPMDH are well-characterized enzymes that catalyze the decarboxylation of isocitrate to yield 2-oxoglutarate (2-OG) in the citric acid cycle and the conversion of 3-isopropylmalate to 2-oxoisovalerate in the leucine biosynthetic pathway, respectively. Recent structural and biochemical studies of HICDH reveal that this enzyme shares sequence, structural, and mechanistic homology with ICDH and IPMDH. To date, the only published structures of HICDH are from the archaebacteria Thermus thermophilus (TtHICDH). Fungal HICDHs diverge from TtHICDH in several aspects, including their thermal stability, oligomerization state, and substrate specificity, thus warranting further characterization. To gain insights into these differences, they determined crystal structures of a fungal Schizosaccharomyces pombe HICDH (SpHICDH) as an apoenzyme and as a binary complex with additive tripeptide glycyl-glycyl-glycine (GGG) to 1.55 {angstrom} and 1.85 {angstrom} resolution, respectively. Finally, a comparison of the SpHICDH and TtHICDH structures reveal differences in their active sites that help explain the variations in their respective substrate specificities.« less

Crystal structure of triaquamaleatostrontium(II) monohydrate, [Sr(C{sub 4}H{sub 2}O{sub 4})(OH{sub 2}{sub 3}) {center_dot}] H{sub 2}O

DOE Office of Scientific and Technical Information (OSTI.GOV)

Diaz de Delgado, G.; Parra, P.P.; Briceno, A.

1995-05-01

(Sr(C{sub 4}H{sub 2}O{sub 4})(OH{sub 2}{sub 3}) {center_dot} H{sub 2}O is monoclinic, P2{sub 1}/n, with a = 11.476(2), b = 7.027(1), c = 12.344(2) {angstrom}, {beta} = 115.74(3){degrees}, V= 896.67 {angstrom}{sup 3}, Z = 4. The Sr atom is surrounded by nine oxygen atoms which come from four different maleate anions and three water molecules. The Sr-O distances range from 2.546(2) to 2.808(2) {angstrom}. The C-O distances are equal within the standard deviation 1.263(3) to 1.258(3) {angstrom}). In the maleate anion, the planes that contain the carboxylate groups form an angle of 74.44(9){degrees}. Both carboxylate groups deviate significantly from planarity. Themore » different coordination modes of the carboxylate group and the extensive hydrogen bonding present are responsible for the polymeric nature of the structure.« less

Structure and molecular mechanism of a nucleobase-cation-symport-1 family transporter.

PubMed

Weyand, Simone; Shimamura, Tatsuro; Yajima, Shunsuke; Suzuki, Shun'ichi; Mirza, Osman; Krusong, Kuakarun; Carpenter, Elisabeth P; Rutherford, Nicholas G; Hadden, Jonathan M; O'Reilly, John; Ma, Pikyee; Saidijam, Massoud; Patching, Simon G; Hope, Ryan J; Norbertczak, Halina T; Roach, Peter C J; Iwata, So; Henderson, Peter J F; Cameron, Alexander D

2008-10-31

The nucleobase-cation-symport-1 (NCS1) transporters are essential components of salvage pathways for nucleobases and related metabolites. Here, we report the 2.85-angstrom resolution structure of the NCS1 benzyl-hydantoin transporter, Mhp1, from Microbacterium liquefaciens. Mhp1 contains 12 transmembrane helices, 10 of which are arranged in two inverted repeats of five helices. The structures of the outward-facing open and substrate-bound occluded conformations were solved, showing how the outward-facing cavity closes upon binding of substrate. Comparisons with the leucine transporter LeuT(Aa) and the galactose transporter vSGLT reveal that the outward- and inward-facing cavities are symmetrically arranged on opposite sides of the membrane. The reciprocal opening and closing of these cavities is synchronized by the inverted repeat helices 3 and 8, providing the structural basis of the alternating access model for membrane transport.

Natively Inhibited Trypanosoma brucei Cathepsin B Structure Determined by Using an X-ray Laser

PubMed Central

DePonte, Daniel P.; White, Thomas A.; Rehders, Dirk; Barty, Anton; Stellato, Francesco; Liang, Mengning; Barends, Thomas R.M.; Boutet, Sébastien; Williams, Garth J.; Messerschmidt, Marc; Seibert, M. Marvin; Aquila, Andrew; Arnlund, David; Bajt, Sasa; Barth, Torsten; Bogan, Michael J.; Caleman, Carl; Chao, Tzu-Chiao; Doak, R. Bruce; Fleckenstein, Holger; Frank, Matthias; Fromme, Raimund; Galli, Lorenzo; Grotjohann, Ingo; Hunter, Mark S.; Johansson, Linda C.; Kassemeyer, Stephan; Katona, Gergely; Kirian, Richard A.; Koopmann, Rudolf; Kupitz, Chris; Lomb, Lukas; Martin, Andrew V.; Mogk, Stefan; Neutze, Richard; Shoeman, Robert L.; Steinbrener, Jan; Timneanu, Nicusor; Wang, Dingjie; Weierstall, Uwe; Zatsepin, Nadia A.; Spence, John C. H.; Fromme, Petra; Schlichting, Ilme; Duszenko, Michael; Betzel, Christian; Chapman, Henry N.

2013-01-01

The Trypanosoma brucei cysteine protease cathepsin B (TbCatB), which is involved in host protein degradation, is a promising target to develop new treatments against sleeping sickness, a fatal disease caused by this protozoan parasite. The structure of the mature, active form of TbCatB has so far not provided sufficient information for the design of a safe and specific drug against T. brucei. By combining two recent innovations, in vivo crystallization and serial femtosecond crystallography, we obtained the room-temperature 2.1 angstrom resolution structure of the fully glycosylated precursor complex of TbCatB. The structure reveals the mechanism of native TbCatB inhibition and demonstrates that new biomolecular information can be obtained by the “diffraction-before-destruction” approach of x-ray free-electron lasers from hundreds of thousands of individual microcrystals. PMID:23196907

An atomic model of HIV-1 capsid-SP1 reveals structures regulating assembly and maturation.

PubMed

Schur, Florian K M; Obr, Martin; Hagen, Wim J H; Wan, William; Jakobi, Arjen J; Kirkpatrick, Joanna M; Sachse, Carsten; Kräusslich, Hans-Georg; Briggs, John A G

2016-07-29

Immature HIV-1 assembles at and buds from the plasma membrane before proteolytic cleavage of the viral Gag polyprotein induces structural maturation. Maturation can be blocked by maturation inhibitors (MIs), thereby abolishing infectivity. The CA (capsid) and SP1 (spacer peptide 1) region of Gag is the key regulator of assembly and maturation and is the target of MIs. We applied optimized cryo-electron tomography and subtomogram averaging to resolve this region within assembled immature HIV-1 particles at 3.9 angstrom resolution and built an atomic model. The structure reveals a network of intra- and intermolecular interactions mediating immature HIV-1 assembly. The proteolytic cleavage site between CA and SP1 is inaccessible to protease. We suggest that MIs prevent CA-SP1 cleavage by stabilizing the structure, and MI resistance develops by destabilizing CA-SP1. Copyright © 2016, American Association for the Advancement of Science.

Crystal Structure of AGR_C_4470p from Agrobacterium tumefaciens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vorobiev,S.; Neely, H.; Seetharaman, J.

2007-01-01

We report here the crystal structure at 2.0 {angstrom} resolution of the AGR{_}C{_}4470p protein from the Gram-negative bacterium Agrobacterium tumefaciens. The protein is a tightly associated dimer, each subunit of which bears strong structural homology with the two domains of the heme utilization protein ChuS from Escherichia coli and HemS from Yersinia enterocolitica. Remarkably, the organization of the AGR{_}C{_}4470p dimer is the same as that of the two domains in ChuS and HemS, providing structural evidence that these two proteins evolved by gene duplication. However, the binding site for heme, while conserved in HemS and ChuS, is not conserved inmore » AGR{_}C{_}4470p, suggesting that it probably has a different function. This is supported by the presence of two homologs of AGR{_}C{_}4470p in E. coli, in addition to the ChuS protein.« less

PHOTOSYNTHESIS. A 12 Å carotenoid translocation in a photoswitch associated with cyanobacterial photoprotection.

PubMed

Leverenz, Ryan L; Sutter, Markus; Wilson, Adjélé; Gupta, Sayan; Thurotte, Adrien; Bourcier de Carbon, Céline; Petzold, Christopher J; Ralston, Corie; Perreau, François; Kirilovsky, Diana; Kerfeld, Cheryl A

2015-06-26

Pigment-protein and pigment-pigment interactions are of fundamental importance to the light-harvesting and photoprotective functions essential to oxygenic photosynthesis. The orange carotenoid protein (OCP) functions as both a sensor of light and effector of photoprotective energy dissipation in cyanobacteria. We report the atomic-resolution structure of an active form of the OCP consisting of the N-terminal domain and a single noncovalently bound carotenoid pigment. The crystal structure, combined with additional solution-state structural data, reveals that OCP photoactivation is accompanied by a 12 angstrom translocation of the pigment within the protein and a reconfiguration of carotenoid-protein interactions. Our results identify the origin of the photochromic changes in the OCP triggered by light and reveal the structural determinants required for interaction with the light-harvesting antenna during photoprotection. Copyright © 2015, American Association for the Advancement of Science.

Structural virology. Near-atomic cryo-EM structure of the helical measles virus nucleocapsid.

PubMed

Gutsche, Irina; Desfosses, Ambroise; Effantin, Grégory; Ling, Wai Li; Haupt, Melina; Ruigrok, Rob W H; Sachse, Carsten; Schoehn, Guy

2015-05-08

Measles is a highly contagious human disease. We used cryo-electron microscopy and single particle-based helical image analysis to determine the structure of the helical nucleocapsid formed by the folded domain of the measles virus nucleoprotein encapsidating an RNA at a resolution of 4.3 angstroms. The resulting pseudoatomic model of the measles virus nucleocapsid offers important insights into the mechanism of the helical polymerization of nucleocapsids of negative-strand RNA viruses, in particular via the exchange subdomains of the nucleoprotein. The structure reveals the mode of the nucleoprotein-RNA interaction and explains why each nucleoprotein of measles virus binds six nucleotides, whereas the respiratory syncytial virus nucleoprotein binds seven. It provides a rational basis for further analysis of measles virus replication and transcription, and reveals potential targets for drug design. Copyright © 2015, American Association for the Advancement of Science.

The Interface Region Imaging Spectrograph (IRIS) Small Explorer

NASA Astrophysics Data System (ADS)

de Pontieu, B.; Title, A. M.; Schryver, C. J.; Lemen, J. R.; Golub, L.; Kankelborg, C. C.; Carlsson, M.

2009-12-01

The Interface Region Imaging Spectrograph (IRIS) was recently selected as a small explorer mission by NASA. The primary goal of IRIS is to understand how the solar atmosphere is energized. The IRIS investigation combines advanced numerical modeling with a high resolution 20 cm UV imaging spectrograph that will obtain spectra covering temperatures from 4,500 to 10 MK in three wavelength ranges (1332-1358 Angstrom, 1390-1406 Angstrom and 2785-2835 Angstrom) and simultaneous images covering temperatures from 4,500 K to 65,000 K. IRIS will obtain UV spectra and images with high resolution in space (1/3 arcsec) and time (1s) focused on the chromosphere and transition region of the Sun, a complex dynamic interface region between the photosphere and corona. In this region, all but a few percent of the non-radiative energy leaving the Sun is converted into heat and radiation. IRIS fills a crucial gap in our ability to advance Sun-Earth connection studies by tracing the flow of energy and plasma through this foundation of the corona and heliosphere. The IRIS investigation is led by PI Alan Title (LMSAL) with major participation by the Harvard Smithsonian Astrophysical Observatory, Montana State University, NASA Ames Research Center, Stanford University and the University of Oslo (Norway). IRIS is scheduled for launch in late 2012, and will have a nominal two year mission lifetime.

Patchy intergalactic He II absorption in HE 2347-4342. II. The possible discovery of the epoch of He-reionization

NASA Astrophysics Data System (ADS)

Reimers, D.; Kohler, S.; Wisotzki, L.; Groote, D.; Rodriguez-Pascual, P.; Wamsteker, W.

1997-11-01

We report on observations of redshifted Heii303.8 Angstroms absorption in the high-redshift QSO HE2347-4342 (z=2.885, V=16.1) with the Goddard High Resolution Spectrograph on board HST in its low resolution mode (bigtriangleup lambda = 0.7 Angstroms). With f_λ=3.6\\ 10(-15) ergcm(-2) s(-1) Angstroms(-1) at the expected position of Heii304 Angstroms absorption it is the most UV-bright high redshift QSO discovered so far. We show that the Heii opacity as a function of redshift is patchy showing spectral regions with low Heii opacity (``voids'') and regions with high Heii opacity (blacked-out ``troughs'') and no detectable flux. Combination with high-resolution optical spectra of the Lyalpha forest using CASPEC at the 3.6m telescope shows that the voids can be explained either exclusively by Lyalpha forest cloud absorption with a moderate N_{subs {He{sc ii}}}/N_{subs {H{sc i}}} ratio eta <=100 and turbulent line broadening or by a combination of Lyalpha forest with eta = 45 and thermal broadening plus a diffuse medium with tau_ {subs {GP}}({subs {He{sc ) ii}}} ~ 0.3. Since the latter is a minimum assumption for the Lyalpha forest, a strict upper limit to a diffuse medium is Omega_ {subs {diff}}<0.02 h50(-1.5) at z=2.8. In the troughs in addition to the Lyalpha forest opacity a continuous Heii 304 Angstroms opacity tau = 4.8(+infty }_{-2) is required. In case of photoionization, the troughs would require a diffuse component with a density close to Omega =~ 0.077(eta /45)(-0.5) h50(-1.5) , i.e. all baryons in the universe, which is inconsistent, however, with the observed absence of such a component in the voids. A tentative interpretation is that we observe the epoch of partial Heii reionization of the universe with patches not yet reionized. In that case a diffuse component with Omega_ {subs {diff}}>= 1.3\\ 10(-4) h(-1}_{50) would be sufficient to explain the ``trough'' opacity. The size of the 1163--1172 Angstroms trough is ~ 6 h50(-1) Mpc or ~ 2300 kms(-1) , respectively. We also discuss partially resolved Heii absorption of a high-ionization associated absorption system. Despite its high luminosity HE2347-4342 does not show a Heii proximity effect. A possible reason is that the strong associated system shields the Heii ionizing continuum. Based on observations collected at the European Southern Observatory, La Silla, Chile (ESO No.\\ 58.B--0116). Based on IUE observations collected at the ESA VILSPA ground station near Madrid, Spain. Based on observations with the NASA/ESA Hubble Space Telescope, obtained at the Space Telescope Science Institute, which is operated by Aura, Inc., under NASA contract NAS 5--26\\,555.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barrila, J.; Gabelli, S; Bacha, U

Coronaviruses are responsible for a significant proportion of annual respiratory and enteric infections in humans and other mammals. The most prominent of these viruses is the severe acute respiratory syndrome coronavirus (SARS-CoV) which causes acute respiratory and gastrointestinal infection in humans. The coronavirus main protease, 3CL{sup pro}, is a key target for broad-spectrum antiviral development because of its critical role in viral maturation and high degree of structural conservation among coronaviruses. Dimerization is an indispensable requirement for the function of SARS 3CL{sup pro} and is regulated through mechanisms involving both direct and long-range interactions in the enzyme. While many ofmore » the binding interactions at the dimerization interface have been extensively studied, those that are important for long-range control are not well-understood. Characterization of these dimerization mechanisms is important for the structure-based design of new treatments targeting coronavirus-based infections. Here we report that Asn28, a residue 11 {angstrom} from the closest residue in the opposing monomer, is essential for the enzymatic activity and dimerization of SARS 3CLpro. Mutation of this residue to alanine almost completely inactivates the enzyme and results in a 19.2-fold decrease in the dimerization K{sub d}. The crystallographic structure of the N28A mutant determined at 2.35 {angstrom} resolution reveals the critical role of Asn28 in maintaining the structural integrity of the active site and in orienting key residues involved in binding at the dimer interface and substrate catalysis. These findings provide deeper insight into complex mechanisms regulating the activity and dimerization of SARS 3CL{sup pro}.« less

New Antimony Lanthanide Disulfide Dibromides LnSbS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gout, D.; Jobic, S.; Evain, M.

2001-05-01

CeSbS{sub 2}Br{sub 2} (I), Ce{sub 1/2}La{sub 1/2}SbS{sub 2}Br{sub 2} (II), and LaSbS{sub 2}Br{sub 2} (III) have been synthesized at 700 C from a mixture of LnBr{sub 3}, Ln{sub 2}S{sub 3}, Sb, and S and characterized by single-crystal X-ray diffraction. The three phases are isostructural (space group P2{sub 1}/c, Z=4) and crystallize in a novel, dense, bidimensional structure with cell parameters a=8.709(3) {angstrom}, b=9.187(2) {angstrom}, c=17.397(5) {angstrom} {beta}=104.26(3) for I, a=8.739(7) {angstrom}, b=9.219(7) {angstrom}, c=17.41(2) {angstrom}, =104.3(1) for II, and a=8.785(1) {angstrom}, b=9.236(2) {angstrom}, c=17.372(3) {angstrom}, {beta}=104.09(2) for III. In these compounds, [Ln S{sub 5}Br{sub 4}] and [Ln S{sub 3}Br{sub 6}]more » (Ln=Ce, La) distorted tricapped trigonal prisms define infinite {sub {infinity}}{sup 2}[LnS{sub 2}Br{sub 2}] layers counterbalanced and capped by antimony cations. In good accordance with the structural features, the charge balance in these materials is to be written Ln{sup III}Sb{sup III}S{sup -II}{sub 2}Br{sup -I}{sub 2}. These compounds exhibit a yellow hue with a measured absorption threshold of 2.42(1), 2.55(1), and 2.72(1) eV for I, II, and III, respectively. In the two cerium containing bromothioantimonates I and II, the origin of the color is assigned to a Ce-4f{yields}Ce-5d electronic transition, which shifts to higher energy from I to II due either to a matrix effect (increase of the mean Ln-S distances under the substitution of Ce for La) or to an atomic ordering between Ce and La cations on the Ln(1) and Ln(2) crystallographic sites. In contrast, the electronic transition at play in III involves a charge transfer from the bromine and sulfur ions to the antimony ions, the latter contributing substantially to the lowermost levels of the conduction band.« less

Synthesis and X-ray crystal structures of (Mo(CO)(Et{sub 2}PC{sub 2}H{sub 4}PEt{sub 2}){sub 2}){sub 2}({mu}-N{sub 2}) with an end-on bridging dinitrogen ligand and Mo(CO)(Bu{sup i}{sub 2}PC{sub 2}H{sub 4}PBu{sup i}{sub 2}){sub 2} containing an agostic Mo...H-C interaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luo, X.L.; Kubas, G.J.; Burns, C.J.

1995-12-20

The compound formed by the reaction of trans-Mo(N{sub 2})(Et{sub 2}PC{sub 2}H{sub 4}PEt{sub 2}){sub 2} with ethyl acetate in refluxing toluene under argon has been formulated as the bridging dinitrogen complex (Mo(CO)(Et{sub 2}PC{sub 2}H{sub 4}PEt{sub 2}){sub 2}){sub 2}({mu}-N{sub 2}) (1), in contrast with the previously proposed formulation of Mo(CO)(Et{sub 2}PC{sub 2}H{sub 4}PEt{sub 2}){sub 2} (2). In refluxing p-xylene and under argon, compound 1 eliminates the bridging dinitrogen ligand to form the nitrogen-free compound 2. The reaction of trans-Mo(N{sub 2})(Bu{sup i}{sub 2}PC{sub 2}H{sub 4}PBu{sup i}{sub 2}){sub 2} (3). The molecular structures of compounds 1 and 3 have been determined by single-crystal X-raymore » diffraction studies. Compound 1 contains an end-on bridging dinitrogen ligand. Compound 3 attains a formal 18-electron configuration by virtue of an agostic Mo...H-C interaction between the molybdenum atom and an alphiatic {gamma}-C-H bond of the alkyldiphosphine ligand. On the basis of the agostic Mo...C and Mo...H distances, the agostic interaction in 3 appears to be stronger than that in the related compound Mo(CO)(Ph{sub 2}PC{sub 2}H{sub 4}PPh{sub 2}){sub 2} which involves an ortho aromatic C-H bond of the diphosphine ligand. Crystallographic data for 1: monoclinic, space group C2/c, a=24.270(2){angstrom}, b=44.233(4){angstrom}, c=20.378(2){angstrom}, {beta}=90.725(9){angstrom}, V=21875(3){angstrom}{sup 3}, Z=16, and R=0.048. Crystallographic data for 3: orthorhombic, space group Pna2{sub 1}, a=18.332(4){angstrom}, b=22.0664(4){angstrom}, c=10.589(2){angstrom}, V=4283(2){angstrom}{sup 3}, Z=4, and R=0.034.« less

Incommensurate structure of a lillianite-type samarium chromium sulfide Sm{sub 2/3}Cr{sub 2}S{sub 4}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lafond, A.; Cario, L.; Meerschaut, A.

1996-12-01

The structure of Sm{sub 2/3}Cr{sub 2}S{sub 4} has been solved from single-crystal X-ray diffraction data. This compound presents a 3 X a superstructure along a and an incommensurate superstructure along b close to 3 x b. The basic structure is described in the space group Pmnb with a = 3.5030(3) {Angstrom}, b = 10.9199(8) {Angstrom}, c = 12.7987(8) {Angstrom}, Z = 4, R = 0.046 for 916 observed reflections. The modulated structure refinement, taking into account the two superstructures, was carried out in a (3 + 2)D superspace group and leads to R = 0.063 for 1706 reflections. This structuremore » consists of staggered double columns of [CrS{sub 6}] octahedra connected by samarium atoms in a trigonal prismatic bicapped environment. This structure is reminiscent of that found in the lillianite mineral family. The statistical occupancy of samarium atoms (1/3), in agreement with the charge equilibrium (Sm{sup 3+}, Cr{sup 3+}, S{sup 2-}), is related to the superstructure.« less

Scanning transmission electron microscopy and its application to the study of nanoparticles and nanoparticle systems.

PubMed

Liu, Jingyue

2005-06-01

Scanning transmission electron microscopy (STEM) techniques can provide imaging, diffraction and spectroscopic information, either simultaneously or in a serial manner, of the specimen with an atomic or a sub-nanometer spatial resolution. High-resolution STEM imaging, when combined with nanodiffraction, atomic resolution electron energy-loss spectroscopy and nanometer resolution X-ray energy dispersive spectroscopy techniques, is critical to the fundamental studies of importance to nanoscience and nanotechnology. The availability of sub-nanometer or sub-angstrom electron probes in a STEM instrument, due to the use of a field emission gun and aberration correctors, ensures the greatest capabilities for studies of sizes, shapes, defects, crystal and surface structures, and compositions and electronic states of nanometer-size regions of thin films, nanoparticles and nanoparticle systems. The various imaging, diffraction and spectroscopy modes available in a dedicated STEM or a field emission TEM/STEM instrument are reviewed and the application of these techniques to the study of nanoparticles and nanostructured catalysts is used as an example to illustrate the critical role of the various STEM techniques in nanotechnology and nanoscience research.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Hao; Malliakas, Christos D.; Han, Fei

The quaternary compound TlHgInS3 crystallizes in a new structure type of space group, C2/c, with cell parameters a = 13.916(3) angstrom, b = 3.9132(8) angstrom, c = 21.403(4) angstrom, beta = 104.16(3)degrees, V = 1130.1(8) angstrom(3), and rho = 7.241 g/cm(3). The structure is a unique three-dimensional framework with parallel tunnels, which is formed by (1)(infinity)[InS33-] infinite chains bridged by linearly coordinated Hg2+ ions. TlHgInS3 is a semiconductor with a band gap of 1.74 eV and a resistivity of similar to 4.32 G Omega cm. TlHgInS3 single crystals exhibit photocurrent response when exposed to Ag X-rays. The mobility-lifetime product (mumore » tau) of the electrons and holes estimated from the photocurrent measurements are (mu tau)(e) approximate to 3.6 x 10(-4) cm(2)/V and (mu tau)(h) approximate to 2.0 x 10(-4) cm(2)/V. Electronic structure calculations at the density functional theory level indicate an indirect band gap and a relatively small effective mass for both electrons and holes. Based on the photoconductivity data, TlHgInS3 is a potential material for radiation detection applications.« less

Structural Analysis of MoS2 and other 2D layered materials using LEEM/LEED-I(V) and STM

NASA Astrophysics Data System (ADS)

Grady, Maxwell; Dai, Zhongwei; Jin, Wencan; Dadap, Jerry; Osgood, Richard; Sadowski, Jerzy; Pohl, Karsten

Layered two-dimensional materials, such as molybdenum disulfide, MoS2, are of interest for the development of many types of novel electronic devices. To fully understand the interfaces between these new materials, the atomic reconstructions at their surfaces must be understood. Low Energy Electron Microscopy and Diffraction, LEEM/ μLEED, present a unique method for rapid material characterization in real space and reciprocal space with high resolution. Here we present a study of the surface structure of 2H-MoS2 using μLEED intensity-voltage analysis. To aid this analysis, software is under development to automate the procedure of extracting I(V) curves from LEEM and LEED data. When matched with computational modeling, this data provides information with angstrom level resolution concerning the three dimensional atomic positions. We demonstrate that the surface structure of bulk MoS2 is distinct from the bulk crystal structure and exhibits a smaller surface relaxation at 320K compared to previous results at 95K. Furthermore, suspended monolayer samples exhibit large interlayer relaxations compared to the bulk surface termination. Further techniques for refining layer thickness determination are under development.

Ultrahigh and High Resolution Structures and Mutational Analysis of Monomeric Streptococcus pyogenes SpeB Reveal a Functional Role for the Glycine-rich C-terminal Loop

DOE Office of Scientific and Technical Information (OSTI.GOV)

González-Páez, Gonzalo E.; Wolan, Dennis W.

2012-09-05

Cysteine protease SpeB is secreted from Streptococcus pyogenes and has been studied as a potential virulence factor since its identification almost 70 years ago. Here, we report the crystal structures of apo mature SpeB to 1.06 {angstrom} resolution as well as complexes with the general cysteine protease inhibitor trans-epoxysuccinyl-L-leucylamido(4-guanidino)butane and a novel substrate mimetic peptide inhibitor. These structures uncover conformational changes associated with maturation of SpeB from the inactive zymogen to its active form and identify the residues required for substrate binding. With the use of a newly developed fluorogenic tripeptide substrate to measure SpeB activity, we determined IC{sub 50}more » values for trans-epoxysuccinyl-L-leucylamido(4-guanidino)butane and our new peptide inhibitor and the effects of mutations within the C-terminal active site loop. The structures and mutational analysis suggest that the conformational movements of the glycine-rich C-terminal loop are important for the recognition and recruitment of biological substrates and release of hydrolyzed products.« less

Ion beam sputter deposited zinc telluride films

NASA Technical Reports Server (NTRS)

Gulino, D. A.

1986-01-01

Zinc telluride is of interest as a potential electronic device material, particularly as one component in an amorphous superlattice, which is a new class of interesting and potentially useful materials. Some structural and electronic properties of ZnTe films deposited by argon ion beam sputter deposition are described. Films (up to 3000 angstroms thick) were deposited from a ZnTe target. A beam energy of 1000 eV and a current density of 4 mA/sq cm resulted in deposition rates of approximately 70 angstroms/min. The optical band gap was found to be approximately 1.1 eV, indicating an amorphous structure, as compared to a literature value of 2.26 eV for crystalline material. Intrinsic stress measurements showed a thickness dependence, varying from tensile for thicknesses below 850 angstroms to compressive for larger thicknesses. Room temperature conductivity measurement also showed a thickness dependence, with values ranging from 1.86 x 10 to the -6th/ohm cm for 300 angstrom film to 2.56 x 10 to the -1/ohm cm for a 2600 angstrom film. Measurement of the temperature dependence of the conductivity for these films showed complicated behavior which was thickness dependent. Thinner films showed at least two distinct temperature dependent conductivity mechanisms, as described by a Mott-type model. Thicker films showed only one principal conductivity mechanism, similar to what might be expected for a material with more crystalline character.

Ion beam sputter deposited zinc telluride films

NASA Technical Reports Server (NTRS)

Gulino, D. A.

1985-01-01

Zinc telluride is of interest as a potential electronic device material, particularly as one component in an amorphous superlattice, which is a new class of interesting and potentially useful materials. Some structural and electronic properties of ZnTe films deposited by argon ion beam sputter depoairion are described. Films (up to 3000 angstroms thick) were deposited from a ZnTe target. A beam energy of 1000 eV and a current density of 4 mA/sq. cm. resulted in deposition rates of approximately 70 angstroms/min. The optical band gap was found to be approximately 1.1 eV, indicating an amorphous structure, as compared to a literature value of 2.26 eV for crystalline material. Intrinsic stress measurements showed a thickness dependence, varying from tensile for thicknesses below 850 angstroms to compressive for larger thicknesses. Room temperature conductivity measurement also showed a thickness dependence, with values ranging from 1.86 x to to the -6/ohm. cm. for 300 angstrom film to 2.56 x 10 to the -1/ohm. cm. for a 2600 angstrom film. Measurement of the temperature dependence of the conductivity for these films showed complicated behavior which was thickness dependent. Thinner films showed at least two distinct temperature dependent conductivity mechanisms, as described by a Mott-type model. Thicker films showed only one principal conductivity mechanism, similar to what might be expected for a material with more crystalline character.

Nonequilibrium phase transitions in cuprates observed by ultrafast electron crystallography.

PubMed

Gedik, Nuh; Yang, Ding-Shyue; Logvenov, Gennady; Bozovic, Ivan; Zewail, Ahmed H

2007-04-20

Nonequilibrium phase transitions, which are defined by the formation of macroscopic transient domains, are optically dark and cannot be observed through conventional temperature- or pressure-change studies. We have directly determined the structural dynamics of such a nonequilibrium phase transition in a cuprate superconductor. Ultrafast electron crystallography with the use of a tilted optical geometry technique afforded the necessary atomic-scale spatial and temporal resolutions. The observed transient behavior displays a notable "structural isosbestic" point and a threshold effect for the dependence of c-axis expansion (Deltac) on fluence (F), with Deltac/F = 0.02 angstrom/(millijoule per square centimeter). This threshold for photon doping occurs at approximately 0.12 photons per copper site, which is unexpectedly close to the density (per site) of chemically doped carriers needed to induce superconductivity.

Covalent Incorporation of Selenium into Oligonucleotides for X-ray Crystal Structure Determination via MAD: Proof of Principle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Teplova, M.; Wilds, C.J.; Wawrzak, Z.

2010-03-08

Selenium was incorporated into an oligodeoxynucleotide in the form of 2'-methylseleno-uridine (U{sub Se}). The X-ray crystal structure of the duplex d(GCGTA)U{sub Se}d(ACGC){sub 2} was determined by the multiwavelength anomalous dispersion (MAD) technique and refined to a resolution of 1.3 {angstrom}, demonstrating that selenium can selectively substitute oxygen in DNA and that the resulting compounds are chemically stable. Since derivatization at the 2'-{alpha}-position with selenium does not affect the preference of the sugar for the C3'-endo conformation, this strategy is suitable for incorporating selenium into RNA. The availability of selenium-containing nucleic acids for crystallographic phasing offers an attractive alternative to themore » commonly used halogenated pyrimidines.« less

Cutting Edge: Molecular Structure of the IL-1R-Associated Kinase-4 Death Domain and Its Implications for TLR Signaling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lasker, Michael V.; Gajjar, Mark M.; Nair, Satish K.

2010-07-19

IL-1R-associated kinase (IRAK) 4 is an essential component of innate immunity. IRAK-4 deficiency in mice and humans results in severe impairment of IL-1 and TLR signaling. We have solved the crystal structure for the death domain of Mus musculus IRAK-4 to 1.7 {angstrom} resolution. This is the first glimpse of the structural details of a mammalian IRAK family member. The crystal structure reveals a six-helical bundle with a prominent loop, which among IRAKs and Pelle, a Drosophila homologue, is unique to IRAK-4. This highly structured loop contained between helices two and three, comprises an 11-aa stretch. Although innate immune domainmore » recognition is thought to be very similar between Drosophila and mammals, this structural component points to a drastic difference. This structure can be used as a framework for future mutation and deletion studies and potential drug design.« less

Binding of ReO[subscript 4];#8722; with an engineered MoO[subscript 4 superscript 2];#8722;-binding protein: towards a new approach in radiopharmaceutical applications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aryal, Baikuntha P.; Brugarolas, Pedro; He, Chuan

2012-05-25

Radiolabeled biomolecules are routinely used for clinical diagnostics. {sup 99m}Tc is the most commonly used radioactive tracer in radiopharmaceuticals. {sup 188}Re and {sup 186}Re are also commonly used as radioactive tracers in medicine. However, currently available methods for radiolabeling are lengthy and involve several steps in bioconjugation processes. In this work we present a strategy to engineer proteins that may selectively recognize the perrhenate (ReO{sub 4}{sup -}) ion as a new way to label proteins. We found that a molybdate (MoO{sub 4}{sup 2-})-binding protein (ModA) from Escherichia coli can bind perrhenate with high affinity. Using fluorescence and isothermal titration calorimetrymore » measurements, we determined the dissociation constant of ModA for ReO{sub 4}{sup -} to be 541 nM and we solved a crystal structure of ModA with a bound ReO{sub 4}{sup -}. On the basis of the structure we created a mutant protein containing a disulfide linkage, which exhibited increased affinity for perrhenate (K{sub d} = 104 nM). High-resolution crystal structures of ModA (1.7 {angstrom}) and A11C/R153C mutant (2.0 {angstrom}) were solved with bound perrhenate. Both structures show that a perrhenate ion occupies the molybdate binding site using the same amino acid residues that are involved in molybdate binding. The overall structure of the perrhenate-bound ModA is unchanged compared with that of the molybdate-bound form. In the mutant protein, the bound perrhenate is further stabilized by the engineered disulfide bond.« less

Structure of dehaloperoxidase B at 1.58 Å resolution and structural characterization of the AB dimer from Amphitrite ornata

DOE Office of Scientific and Technical Information (OSTI.GOV)

de Serrano, Vesna; D; Antonio, Jennifer

2012-04-18

As members of the globin superfamily, dehaloperoxidase (DHP) isoenzymes A and B from the marine annelid Amphitrite ornata possess hemoglobin function, but they also exhibit a biologically relevant peroxidase activity that is capable of converting 2,4,6-trihalophenols to the corresponding 2,6-dihaloquinones in the presence of hydrogen peroxide. Here, a comprehensive structural study of recombinant DHP B, both by itself and cocrystallized with isoenzyme A, using X-ray diffraction is presented. The structure of DHP B refined to 1.58 {angstrom} resolution exhibits the same distal histidine (His55) conformational flexibility as that observed in isoenzyme A, as well as additional changes to the distalmore » and proximal hydrogen-bonding networks. Furthermore, preliminary characterization of the DHP AB heterodimer is presented, which exhibits differences in the AB interface that are not observed in the A-only or B-only homodimers. These structural investigations of DHP B provide insights that may relate to the mechanistic details of the H{sub 2}O{sub 2}-dependent oxidative dehalogenation reaction catalyzed by dehaloperoxidase, present a clearer description of the function of specific residues in DHP at the molecular level and lead to a better understanding of the paradigms of globin structure-function relationships.« less

Fine-Scale Fluctuations in the Corona Observed with Hi-C

NASA Technical Reports Server (NTRS)

Winebarger, Amy; Schuler, Timothy

2013-01-01

The High Resolution Coronal Imager(HiC) flew aboard a NASA sounding rocket on 2012 July11 and captured roughly 345 s of high spatial and temporal resolution images of the solar corona in a narrowband 193 Angstrom channel. We have analyzed the fluctuations in intensity of Active Region11520.We selected events based on a lifetime greater than 11s (twoHiC frames)and intensities greater than a threshold determined from the average background intensity in a pixel and the photon and electronic noise. We find fluctuations occurring down to the smallest timescale(11s).Typical intensity fluctuations are 20% background intensity, while some events peaka t100%the background intensity.Generally the fluctuations are clustered in solar structures, particularly the moss.We interpret the fluctuations in the moss as indicative of heating events. We use the observed events to model the active region core.

Crystallization and preliminary X-ray analysis of the inducible lysine decarboxylase from Escherichia coli

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alexopoulos, E.; Kanjee, U.; Snider, J.

2010-02-11

The decameric inducible lysine decarboxylase (LdcI) from Escherichia coli has been crystallized in space groups C2 and C222{sub 1}; the Ta{sub 6}Br{sub 12}{sup 2+} cluster was used to derivatize the C2 crystals. The method of single isomorphous replacement with anomalous scattering (SIRAS) as implemented in SHELXD was used to solve the Ta{sub 6}Br{sub 12}{sup 2+}-derivatized structure to 5 {angstrom} resolution. Many of the Ta{sub 6}Br{sub 12}{sup 2+}-binding sites had twofold and fivefold noncrystallographic symmetry. Taking advantage of this feature, phase modification was performed in DM. The electron-density map of LdcI displays many features in agreement with the low-resolution negative-stain electron-densitymore » map [Snider et al. (2006), J. Biol. Chem. 281, 1532-1546].« less

Optical and Infrared Spectral Features of Nova Canis Majoris 2018

NASA Astrophysics Data System (ADS)

Rudy, Richard; Mauerhan, Jon; Crawford, Kirk; Russell, Ray; Wiktorowicz, Sloane

2018-04-01

Optical and IR spectra from 0.47-2.5 microns (resolution: 5-30 angstroms) of Nova Canis Majoris (CBET 4499), were obtained 2018 April 21.14 (UT) with the Aerospace Corporation's 1.0 m telescope using its Visible and Infrared Imaging Spectrograph (VNIRIS).

Determining the material type of man-made orbiting objects using low-resolution reflectance spectroscopy

NASA Astrophysics Data System (ADS)

Jorgensen, Kira; Africano, John L.; Stansbery, Eugene G.; Kervin, Paul W.; Hamada, Kris M.; Sydney, Paul F.

2001-12-01

The purpose of this research is to improve the knowledge of the physical properties of orbital debris, specifically the material type. Combining the use of the fast-tracking United States Air Force Research Laboratory (AFRL) telescopes with a common astronomical technique, spectroscopy, and NASA resources was a natural step toward determining the material type of orbiting objects remotely. Currently operating at the AFRL Maui Optical Site (AMOS) is a 1.6-meter telescope designed to track fast moving objects like those found in lower Earth orbit (LEO). Using the spectral range of 0.4 - 0.9 microns (4000 - 9000 angstroms), researchers can separate materials into classification ranges. Within the above range, aluminum, paints, plastics, and other metals have different absorption features as well as slopes in their respective spectra. The spectrograph used on this telescope yields a three-angstrom resolution; large enough to see smaller features mentioned and thus determine the material type of the object. The results of the NASA AMOS Spectral Study (NASS) are presented herein.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Overexpression, purification, crystallization and preliminary X-ray studies of Vibrio cholerae EpsG

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jens, Jason; Raghunathan, Kannan; Vago, Frank

2010-01-12

EpsG is the major pseudopilin protein of the Vibrio cholerae type II secretion system. An expression plasmid that encodes an N-terminally truncated form of EpsG with a C-terminal noncleavable His tag was constructed. Recombinant EpsG was expressed in Escherichia coli; the truncated protein was purified and crystallized by hanging-drop vapor diffusion against a reservoir containing 6 mM zinc sulfate, 60 mM MES pH 6.5, 15% PEG MME 550. The crystals diffracted X-rays to a resolution of 2.26 {angstrom} and belonged to space group P2{sub 1}, with unit-cell parameters a = 88.61, b = 70.02, c = 131.54 {angstrom}.

Cloning, expression, purification, crystallization and preliminary X-ray diffraction analysis of macrophage growth locus A (MglA) protein from Francisella tularensis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Subburaman, P.; Austin, B.P.; Shaw, G.X.

2010-11-03

Francisella tularensis, a potential bioweapon, causes a rare infectious disease called tularemia in humans and animals. The macrophage growth locus A (MglA) protein from F. tularensis associates with RNA polymerase to positively regulate the expression of multiple virulence factors that are required for its survival and replication within macrophages. The MglA protein was overproduced in Escherichia coli, purified and crystallized. The crystals diffracted to 7.5 {angstrom} resolution at the Advanced Photon Source, Argonne National Laboratory and belonged to the hexagonal space group P6{sub 1} or P6{sub 5}, with unit-cell parameters a = b = 125, c = 54 {angstrom}.

Crystallization and preliminary X-ray diffraction analysis of West Nile virus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kaufmann, Barbel; Plevka, Pavel; Kuhn, Richard J.

2010-05-25

West Nile virus, a human pathogen, is closely related to other medically important flaviviruses of global impact such as dengue virus. The infectious virus was purified from cell culture using polyethylene glycol (PEG) precipitation and density-gradient centrifugation. Thin amorphously shaped crystals of the lipid-enveloped virus were grown in quartz capillaries equilibrated by vapor diffusion. Crystal diffraction extended at best to a resolution of about 25 {angstrom} using synchrotron radiation. A preliminary analysis of the diffraction images indicated that the crystals had unit-cell parameters a {approx_equal} b {approx_equal} 480 {angstrom}, {gamma} = 120{sup o}, suggesting a tight hexagonal packing of onemore » virus particle per unit cell.« less

Polymorphic one-dimensional (N2H4)2ZnTe: soluble precursors for the formation of hexagonal or cubic zinc telluride.

PubMed

Mitzi, David B

2005-10-03

Two hydrazine zinc(II) telluride polymorphs, (N2H4)2ZnTe, have been isolated, using ambient-temperature solution-based techniques, and the crystal structures determined: alpha-(N2H4)2ZnTe (1) [P21, a = 7.2157(4) Angstroms, b = 11.5439(6) Angstroms, c = 7.3909(4) Angstroms, beta = 101.296(1) degrees, Z = 4] and beta-(N2H4)2ZnTe (2) [Pn, a = 8.1301(5) Angstroms, b = 6.9580(5) Angstroms, c = 10.7380(7) Angstroms, beta = 91.703(1) degrees, Z = 4]. The zinc atoms in 1 and 2 are tetrahedrally bonded to two terminal hydrazine molecules and two bridging tellurium atoms, leading to the formation of extended one-dimensional (1-D) zinc telluride chains, with different chain conformations and packings distinguishing the two polymorphs. Thermal decomposition of (N2H4)2ZnTe first yields crystalline wurtzite (hexagonal) ZnTe at temperatures as low as 200 degrees C, followed by the more stable zinc blende (cubic) form at temperatures above 350 degrees C. The 1-D polymorphs are soluble in hydrazine and can be used as convenient precursors for the low-temperature solution processing of p-type ZnTe semiconducting films.

Structure of a Trypanosoma Brucei Alpha/Beta--Hydrolase Fold Protein With Unknown Function

DOE Office of Scientific and Technical Information (OSTI.GOV)

Merritt, E.A.; Holmes, M.; Buckner, F.S.

2009-05-26

The structure of a structural genomics target protein, Tbru020260AAA from Trypanosoma brucei, has been determined to a resolution of 2.2 {angstrom} using multiple-wavelength anomalous diffraction at the Se K edge. This protein belongs to Pfam sequence family PF08538 and is only distantly related to previously studied members of the {alpha}/{beta}-hydrolase fold family. Structural superposition onto representative {alpha}/{beta}-hydrolase fold proteins of known function indicates that a possible catalytic nucleophile, Ser116 in the T. brucei protein, lies at the expected location. However, the present structure and by extension the other trypanosomatid members of this sequence family have neither sequence nor structural similaritymore » at the location of other active-site residues typical for proteins with this fold. Together with the presence of an additional domain between strands {beta}6 and {beta}7 that is conserved in trypanosomatid genomes, this suggests that the function of these homologs has diverged from other members of the fold family.« less

GHRS Spectra of the Very Low Mass Star VB 10 (M8 Ve)

NASA Astrophysics Data System (ADS)

Linsky, J. L.; Wood, B.; Brown, A.

1994-12-01

We report on ultraviolet spectra of the M8 Ve star VB10 = Gl 752B, probably the coolest and lowest mass star observed so far in the ultraviolet. This star is of great interest because it lies almost at the end of the main sequence where stars are thought to be fully convective and solar-type dynamo processes should not be present. On 1994 October 12 we observed the brighter companion Gl 752A (M3 Ve) and then offset to VB10. Both stars were observed with the G140L grating on the HST Goddard High Resolution Spectrograph. The spectrum of Gl 752A shows the expected transition region lines of solar-type stars consisting of C III 1175 Angstroms, H I Lyman-alpha , N V 1240 Angstroms, O I 1304 Angstroms, C II 1335 Angstroms, Si IV 1400 Angstroms, C IV 1550 Angstroms, He II 1640 Angstroms, and others. The spectrum of VB10, on the other hand, provided a surprise. Our spectra of this star consists of 11 integrations, each of about 5 minutes duration. The first 10 integrations show no emission features with very small upper limits to the surface fluxes in the transition region lines. The last integration, however, shows strong emission in the C II, Si IV, and C IV lines, which we interpret as a flare. The VB10 spectra imply that there is little if any continuous heating of the transition regions of the very coolest M dwarf stars. Instead, there is only transient emission during major realignments of the magnetic field. By contrast, hotter stars show continuous emission in the transition region lines, indicating a continuous heating process or a large number of small flares (microflaring). This change in behavior may be due to the absence of radiative cores in the coolest M dwarfs and the inability of the solar-type alpha -omega dynamo to operate in stars without an interface between a radiative core and a convective envelope. Our data indicate that the coolest M dwarfs nevertheless do have magnetic fields. This work is supported by NASA Interagency Transfer S-56460-D to the National Institute of Standards and Technology.

Structural comparison of cytochromes P450 2A6, 2A13, and 2E1 with pilocarpine

DOE Office of Scientific and Technical Information (OSTI.GOV)

DeVore, Natasha M.; Meneely, Kathleen M.; Bart, Aaron G.

2013-11-20

Human xenobiotic-metabolizing cytochrome P450 (CYP) enzymes can each bind and monooxygenate a diverse set of substrates, including drugs, often producing a variety of metabolites. Additionally, a single ligand can interact with multiple CYP enzymes, but often the protein structural similarities and differences that mediate such overlapping selectivity are not well understood. Even though the CYP superfamily has a highly canonical global protein fold, there are large variations in the active site size, topology, and conformational flexibility. We have determined how a related set of three human CYP enzymes bind and interact with a common inhibitor, the muscarinic receptor agonist drugmore » pilocarpine. Pilocarpine binds and inhibits the hepatic CYP2A6 and respiratory CYP2A13 enzymes much more efficiently than the hepatic CYP2E1 enzyme. To elucidate key residues involved in pilocarpine binding, crystal structures of CYP2A6 (2.4 {angstrom}), CYP2A13 (3.0 {angstrom}), CYP2E1 (2.35 {angstrom}), and the CYP2A6 mutant enzyme, CYP2A6 I208S/I300F/G301A/S369G (2.1 {angstrom}) have been determined with pilocarpine in the active site. In all four structures, pilocarpine coordinates to the heme iron, but comparisons reveal how individual residues lining the active sites of these three distinct human enzymes interact differently with the inhibitor pilocarpine.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xia, Shuangluo; Konigsberg, William H.; Wang, Jimin

Results obtained using 2,4-difluorotoluene nucleobase (dF) as a nonpolar thymine isostere by Kool and colleagues challenged the Watson-Crick dogma that hydrogen bonds between complementary bases are an absolute requirement for accurate DNA replication. Here, we report crystal structure of an RB69 DNA polymerase L561A/S565G/Y567A triple mutant ternary complex with a templating dF opposite dTTP at 1.8 {angstrom}-resolution. In this structure, direct hydrogen bonds were observed between: (i) dF and the incoming dTTP, (ii) dF and residue G568 of the polymerase, and (iii) dF and ordered water molecules surrounding the nascent base pair. Therefore, this structure provides evidence that a templatingmore » dF can form novel hydrogen bonds with the incoming dTTP and with the enzyme that differ from those formed with a templating dT.« less

U2504 Determines the Species Specificity of the A-site Cleft Antibiotics: The sStructures of Tiamulin, Homoharringtonine and Bruceantin Bound to the Ribosome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gurel, G.; Blaha, G; Moore, P

2009-01-01

Structures have been obtained for the complexes that tiamulin, homoharringtonine, and bruceantin form with the large ribosomal subunit of Haloarcula marismortui at resolutions ranging from 2.65 to 3.2 {angstrom}. They show that all these inhibitors block protein synthesis by competing with the amino acid side chains of incoming aminoacyl-tRNAs for binding in the A-site cleft in the peptidyl-transferase center, which is universally conserved. In addition, these structures support the hypothesis that the species specificity exhibited by the A-site cleft inhibitors is determined by the interactions they make, or fail to make, with a single nucleotide, U2504 (Escherichia coli). In themore » ribosome, the position of U2504 is controlled by its interactions with neighboring nucleotides, whose identities vary among kingdoms.« less

U2504 Determines the Species Specificity of the A-Site Cleft Antibiotics: The Structures of Tiamulin, Homoharringtonine, and Bruceantin Bound to the Ribosome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gürel, Güliz; Blaha, Gregor; Moore, Peter B.

2009-06-30

Structures have been obtained for the complexes that tiamulin, homoharringtonine, and bruceantin form with the large ribosomal subunit of Haloarcula marismortui at resolutions ranging from 2.65 to 3.2 {angstrom}. They show that all these inhibitors block protein synthesis by competing with the amino acid side chains of incoming aminoacyl-tRNAs for binding in the Asite cleft in the peptidyl-transferase center, which is universally conserved. In addition, these structures support the hypothesis that the species specificity exhibited by the A-site cleft inhibitors is determined by the interactions they make, or fail to make, with a single nucleotide, U2504 (Escherichia coli). In themore » ribosome, the position of U2504 is controlled by its interactions with neighboring nucleotides, whose identities vary among kingdoms.« less

Structural characterization of the mitomycin 7-O-methyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Shanteri; Chang, Aram; Goff, Randal D.

2014-10-02

Mitomycins are quinone-containing antibiotics, widely used as antitumor drugs in chemotherapy. Mitomycin-7-O-methyltransferase (MmcR), a key tailoring enzyme involved in the biosynthesis of mitomycin in Streptomyces lavendulae, catalyzes the 7-O-methylation of both C9{beta}- and C9{alpha}-configured 7-hydroxymitomycins. We have determined the crystal structures of the MmcR-S-adenosylhomocysteine (SAH) binary complex and MmcR-SAH-mitomycin A (MMA) ternary complex at resolutions of 1.9 and 2.3 {angstrom}, respectively. The study revealed MmcR to adopt a common S-adenosyl-L-methionine-dependent O-methyltransferase fold and the presence of a structurally conserved active site general acid-base pair is consistent with a proton-assisted methyltransfer common to most methyltransferases. Given the importance of C7 alkylationmore » to modulate mitomycin redox potential, this study may also present a template toward the future engineering of catalysts to generate uniquely bioactive mitomycins.« less

Atomic model for the dimeric FO region of mitochondrial ATP synthase.

PubMed

Guo, Hui; Bueler, Stephanie A; Rubinstein, John L

2017-11-17

Mitochondrial adenosine triphosphate (ATP) synthase produces the majority of ATP in eukaryotic cells, and its dimerization is necessary to create the inner membrane folds, or cristae, characteristic of mitochondria. Proton translocation through the membrane-embedded F O region turns the rotor that drives ATP synthesis in the soluble F 1 region. Although crystal structures of the F 1 region have illustrated how this rotation leads to ATP synthesis, understanding how proton translocation produces the rotation has been impeded by the lack of an experimental atomic model for the F O region. Using cryo-electron microscopy, we determined the structure of the dimeric F O complex from Saccharomyces cerevisiae at a resolution of 3.6 angstroms. The structure clarifies how the protons travel through the complex, how the complex dimerizes, and how the dimers bend the membrane to produce cristae. Copyright © 2017, American Association for the Advancement of Science.

Structure and permeation mechanism of a mammalian urea transporter

DOE Office of Scientific and Technical Information (OSTI.GOV)

Levin, Elena J.; Cao, Yu; Enkavi, Giray

2012-09-17

As an adaptation to infrequent access to water, terrestrial mammals produce urine that is hyperosmotic to plasma. To prevent osmotic diuresis by the large quantity of urea generated by protein catabolism, the kidney epithelia contain facilitative urea transporters (UTs) that allow rapid equilibration between the urinary space and the hyperosmotic interstitium. Here we report the first X-ray crystal structure of a mammalian UT, UT-B, at a resolution of 2.36 {angstrom}. UT-B is a homotrimer and each protomer contains a urea conduction pore with a narrow selectivity filter. Structural analyses and molecular dynamics simulations showed that the selectivity filter has twomore » urea binding sites separated by an approximately 5.0 kcal/mol energy barrier. Functional studies showed that the rate of urea conduction in UT-B is increased by hypoosmotic stress, and that the site of osmoregulation coincides with the location of the energy barrier.« less

Crystal Structure of a Mammalian Voltage-Dependent Shaker Family K+ Channel

NASA Astrophysics Data System (ADS)

Long, Stephen B.; Campbell, Ernest B.; MacKinnon, Roderick

2005-08-01

Voltage-dependent potassium ion (K+) channels (Kv channels) conduct K+ ions across the cell membrane in response to changes in the membrane voltage, thereby regulating neuronal excitability by modulating the shape and frequency of action potentials. Here we report the crystal structure, at a resolution of 2.9 angstroms, of a mammalian Kv channel, Kv1.2, which is a member of the Shaker K+ channel family. This structure is in complex with an oxido-reductase β subunit of the kind that can regulate mammalian Kv channels in their native cell environment. The activation gate of the pore is open. Large side portals communicate between the pore and the cytoplasm. Electrostatic properties of the side portals and positions of the T1 domain and β subunit are consistent with electrophysiological studies of inactivation gating and with the possibility of K+ channel regulation by the β subunit.

Structure of the mouse galectin-4 N-terminal carbohydrate-recognition domain reveals the mechanism of oligosaccharide recognition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krejciríková, Veronika; Pachl, Petr; Fábry, Milan

2011-11-18

Galectin-4, a member of the tandem-repeat subfamily of galectins, participates in cell-membrane interactions and plays an important role in cell adhesion and modulation of immunity and malignity. The oligosaccharide specificity of the mouse galectin-4 carbohydrate-recognition domains (CRDs) has been reported previously. In this work, the structure and binding properties of the N-terminal domain CRD1 were further investigated and the crystal structure of CRD1 in complex with lactose was determined at 2.1 {angstrom} resolution. The lactose-binding affinity was characterized by fluorescence measurements and two lactose-binding sites were identified: a high-affinity site with a K{sub d} value in the micromolar range (K{submore » d1} = 600 {+-} 70 {mu}M) and a low-affinity site with K{sub d2} = 28 {+-} 10 mM.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Manglik, Aashish; Kruse, Andrew C.; Kobilka, Tong Sun

Opium is one of the world's oldest drugs, and its derivatives morphine and codeine are among the most used clinical drugs to relieve severe pain. These prototypical opioids produce analgesia as well as many undesirable side effects (sedation, apnoea and dependence) by binding to and activating the G-protein-coupled {mu}-opioid receptor ({mu}-OR) in the central nervous system. Here we describe the 2.8 {angstrom} crystal structure of the mouse {mu}-OR in complex with an irreversible morphinan antagonist. Compared to the buried binding pocket observed in most G-protein-coupled receptors published so far, the morphinan ligand binds deeply within a large solvent-exposed pocket. Ofmore » particular interest, the {mu}-OR crystallizes as a two-fold symmetrical dimer through a four-helix bundle motif formed by transmembrane segments 5 and 6. These high-resolution insights into opioid receptor structure will enable the application of structure-based approaches to develop better drugs for the management of pain and addiction.« less

Crystal structure of hydrogen-bearing vuonnemite from the Lovozero alkaline massif

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rastsvetaeva, R. K., E-mail: rast@ns.crys.ras.ru; Aksenov, S. M.; Verin, I. A.

2011-05-15

Hydrogen-bearing vuonnemite from the Shkatulka hyperagpaitic pegmatite (the Lovozero alkaline massif, Kola Peninsula) was studied by single-crystal X-ray diffraction. The triclinic unit-cell parameters are as follows: a = 5.4712(1) Angstrom-Sign , b = 7.1626(1) Angstrom-Sign , c = 14.3702(3) Angstrom-Sign , {alpha} = 92.623(2) Degree-Sign , {beta} = 95.135(1) Degree-Sign , {gamma} = 90.440(1) Degree-Sign , sp. gr. P1, R = 3.4%. The Na{sup +} cations and H{sub 2}O molecules are ordered in sites between the packets. The water molecules are hydrogen bonded to the PO{sub 4} tetrahedra.

Computation of Bragg Reflection for Layered Microstructures

NASA Technical Reports Server (NTRS)

Underwood, J. W.; Barbee, T. W.

1984-01-01

Bragg diffractors analyzed for use in X-ray mirrors and other applications. SLM tailored to specific applications by varying layer thicknesses and number of layers to control reflectivity diffraction width, and wavelength resolution. Applications as glancing incidence mirrors or filters for wavelengths of few to few hundred angstroms.

Structure, Receptor Binding, and Antigenicity of Influenza Virus Hemagglutinins from the 1957 H2N2 Pandemic

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xu, Rui; McBride, Ryan; Paulson, James C.

2010-03-04

The hemagglutinin (HA) envelope protein of influenza viruses mediates essential viral functions, including receptor binding and membrane fusion, and is the major viral antigen for antibody neutralization. The 1957 H2N2 subtype (Asian flu) was one of the three great influenza pandemics of the last century and caused 1 million deaths globally from 1957 to 1968. Three crystal structures of 1957 H2 HAs have been determined at 1.60 to 1.75 {angstrom} resolutions to investigate the structural basis for their antigenicity and evolution from avian to human binding specificity that contributed to its introduction into the human population. These structures, which representmore » the highest resolutions yet recorded for a complete ectodomain of a glycosylated viral surface antigen, along with the results of glycan microarray binding analysis, suggest that a hydrophobicity switch at residue 226 and elongation of receptor-binding sites were both critical for avian H2 HA to acquire human receptor specificity. H2 influenza viruses continue to circulate in birds and pigs and, therefore, remain a substantial threat for transmission to humans. The H2 HA structure also reveals a highly conserved epitope that could be harnessed in the design of a broader and more universal influenza A virus vaccine.« less

Fine structural features of nanoscale zero-valent iron characterized by spherical aberration corrected scanning transmission electron microscopy (Cs-STEM).

PubMed

Liu, Airong; Zhang, Wei-xian

2014-09-21

An angstrom-resolution physical model of nanoscale zero-valent iron (nZVI) is generated with a combination of spherical aberration corrected scanning transmission electron microscopy (Cs-STEM), selected area electron diffraction (SAED), energy-dispersive X-ray spectroscopy (EDS) and electron energy-loss spectroscopy (EELS) on the Fe L-edge. Bright-field (BF), high-angle annular dark-field (HAADF) and secondary electron (SE) imaging of nZVI acquired by a Hitachi HD-2700 STEM show near atomic resolution images and detailed morphological and structural information of nZVI. The STEM-EDS technique confirms that the fresh nZVI comprises of a metallic iron core encapsulated with a thin layer of iron oxides or oxyhydroxides. SAED patterns of the Fe core suggest the polycrystalline structure in the metallic core and amorphous nature of the oxide layer. Furthermore, Fe L-edge of EELS shows varied structural features from the innermost Fe core to the outer oxide shell. A qualitative analysis of the Fe L(2,3) edge fine structures reveals that the shell of nZVI consists of a mixed Fe(II)/Fe(III) phase close to the Fe (0) interface and a predominantly Fe(III) at the outer surface of nZVI.

Synthesis, structure, and thermal properties of soluble hydrazinium germanium(IV) and tin(IV) selenide salts.

PubMed

Mitzi, David B

2005-05-16

The crystal structures of two hydrazinium-based germanium(IV) and tin(IV) selenide salts are determined. (N(2)H(5))(4)Ge(2)Se(6) (1) [I4(1)cd, a = 12.708(1) Angstroms, c = 21.955(2) Angstroms, Z = 8] and (N(2)H(4))(3)(N(2)H(5))(4)Sn(2)Se(6) (2) [P, a = 6.6475(6) Angstroms, b = 9.5474(9) Angstroms, c = 9.8830(10) Angstroms, alpha = 94.110(2) degrees, beta = 99.429(2) degrees, gamma = 104.141(2) degrees, Z = 1] each consist of anionic dimers of edge-sharing metal selenide tetrahedra, M(2)Se(6)(4-) (M = Ge or Sn), separated by hydrazinium cations and, for 2, additional neutral hydrazine molecules. Substantial hydrogen bonding exists among the hydrazine/hydrazinium molecules as well as between the hydrazinium cations and the selenide anions. Whereas the previously reported tin(IV) sulfide system, (N(2)H(5))(4)Sn(2)S(6), decomposes cleanly to microcrystalline SnS(2) when heated to 200 degrees C in an inert atmosphere, higher temperatures (>300 degrees C) are required to dissociate selenium from 1 and 2 for the analogous preparations of single-phase metal selenides. The metal chalcogenide salts are highly soluble in hydrazine, as well as in a variety of amines and DMSO, highlighting the potential usefulness of these compounds as precursors for the solution deposition of the corresponding metal chalcogenide films.

Crystal Structure of the Catalytic Domain of a Serine Threonine Protein Phosphatase

NASA Technical Reports Server (NTRS)

Swinglel, Mark; Honkanel, Richard; Ciszak, Ewa

2003-01-01

Reversible phosphorylation of serine and threonine residues is a well-recognized mechanism in eukaryotic cells for the regulation of cell-cycle progression, cell growth and metabolism. Human serine/threonine phosphatases can be placed into two major families, PPP and PPM. To date the structure on one PPP family member (PPl) has been determined. Here we present the structure of a 323-residue catalytic domain of a second phosphatase belonging to the PPP family of enzyme. catalytic domain of the enzyme has been determined to 1.60Angstrom resolution and refined to R=17.5 and Rfree = 20.8%. The catalytic domain possesses a unique fold consisting of a largely monolithic structure, divisible into closely-associated helical and sheet regions. The catalytic site contains two manganese ions that are involved in substrate binding and catalysis. The enzyme crystallizes as a dimer that completely buries catalytic surfaces of both monomers, Also, the structure shows evidence of some flexibility around the active site cleft that may be related to substrate specificity of this enzyme.

Crystal structure and substrate specificity of the [beta]-ketoacyl-acyl carrier protein synthase III (FabH) from Staphylococcus aureus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qiu, Xiayang; Choudhry, Anthony E.; Janson, Cheryl A.

{beta}-Ketoacyl-ACP synthase III (FabH), an essential enzyme for bacterial viability, catalyzes the initiation of fatty acid elongation by condensing malonyl-ACP with acetyl-CoA. We have determined the crystal structure of FabH from Staphylococcus aureus, a Gram-positive human pathogen, to 2 {angstrom} resolution. Although the overall structure of S. aureus FabH is similar to that of Escherichia coli FabH, the primer binding pocket in S. aureus FabH is significantly larger than that present in E. coli FabH. The structural differences, which agree with kinetic parameters, provide explanation for the observed varying substrate specificity for E. coli and S. aureus FabH. The rankmore » order of activity of S. aureus FabH with various acyl-CoA primers was as follows: isobutyryl- > hexanoyl- > butyryl- > isovaleryl- >> acetyl-CoA. The availability of crystal structure may aid in designing potent, selective inhibitors of S. aureus FabH.« less

Structure of the voltage-gated K⁺ channel Eag1 reveals an alternative voltage sensing mechanism.

PubMed

Whicher, Jonathan R; MacKinnon, Roderick

2016-08-12

Voltage-gated potassium (K(v)) channels are gated by the movement of the transmembrane voltage sensor, which is coupled, through the helical S4-S5 linker, to the potassium pore. We determined the single-particle cryo-electron microscopy structure of mammalian K(v)10.1, or Eag1, bound to the channel inhibitor calmodulin, at 3.78 angstrom resolution. Unlike previous K(v) structures, the S4-S5 linker of Eag1 is a five-residue loop and the transmembrane segments are not domain swapped, which suggest an alternative mechanism of voltage-dependent gating. Additionally, the structure and position of the S4-S5 linker allow calmodulin to bind to the intracellular domains and to close the potassium pore, independent of voltage-sensor position. The structure reveals an alternative gating mechanism for K(v) channels and provides a template to further understand the gating properties of Eag1 and related channels. Copyright © 2016, American Association for the Advancement of Science.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aich, Sanjukta; Prasad, Lata; Delbaere, Louis T.J.

GTP-dependent phosphoenolpyruvate carboxykinase (PCK) is the key enzyme that controls the blood glucose level during fasting in higher animals. Here we report the first substrate-free structure of a GTP-dependent phosphoenolpyruvate (PEP) carboxykinase from a bacterium, Corynebacterium glutamicum (CgPCK). The protein crystallizes in space group P2{sub 1} with four molecules per asymmetric unit. The 2.3 {angstrom} resolution structure was solved by molecular replacement using the human cytosolic PCK (hcPCK) structure (PDB ID: 1KHF) as the starting model. The four molecules in the asymmetric unit pack as two dimers, and is an artifact of crystal packing. However, the P-loop and the guaninemore » binding loop of the substrate-free CgPCK structure have different conformations from the other published GTP-specific PCK structures, which all have bound substrates and/or metal ions. It appears that a change in the P-loop and guanine binding loop conformation is necessary for substrate binding in GTP-specific PCKs, as opposed to overall domain movement in ATP-specific PCKs.« less

Structure of MyTH4-FERM domains in myosin VIIa tail bound to cargo.

PubMed

Wu, Lin; Pan, Lifeng; Wei, Zhiyi; Zhang, Mingjie

2011-02-11

The unconventional myosin VIIa (MYO7A) is one of the five proteins that form a network of complexes involved in formation of stereocilia. Defects in these proteins cause syndromic deaf-blindness in humans [Usher syndrome I (USH1)]. Many disease-causing mutations occur in myosin tail homology 4-protein 4.1, ezrin, radixin, moesin (MyTH4-FERM) domains in the myosin tail that binds to another USH1 protein, Sans. We report the crystal structure of MYO7A MyTH4-FERM domains in complex with the central domain (CEN) of Sans at 2.8 angstrom resolution. The MyTH4 and FERM domains form an integral structural and functional supramodule binding to two highly conserved segments (CEN1 and 2) of Sans. The MyTH4-FERM/CEN complex structure provides mechanistic explanations for known deafness-causing mutations in MYO7A MyTH4-FERM. The structure will also facilitate mechanistic and functional studies of MyTH4-FERM domains in other myosins.

Structure of Tetrahymena telomerase reveals previously unknown subunits, functions, and interactions

DOE PAGES

Jiang, Jiansen; Chan, Henry; Cash, Darian D.; ...

2015-10-15

Telomerase helps maintain telomeres by processive synthesis of telomere repeat DNA at their 3'-ends, using an integral telomerase RNA (TER) and telomerase reverse transcriptase (TERT). In this paper, we report the cryo–electron microscopy structure of Tetrahymena telomerase at ~9 angstrom resolution. In addition to seven known holoenzyme proteins, we identify two additional proteins that form a complex (TEB) with single-stranded telomere DNA-binding protein Teb1, paralogous to heterotrimeric replication protein A (RPA). The p75-p45-p19 subcomplex is identified as another RPA-related complex, CST (CTC1-STN1-TEN1). This study reveals the paths of TER in the TERT-TER-p65 catalytic core and single-stranded DNA exit; extensive subunitmore » interactions of the TERT essential N-terminal domain, p50, and TEB; and other subunit identities and structures, including p19 and p45C crystal structures. Finally, our findings provide structural and mechanistic insights into telomerase holoenzyme function.« less

Structure of Tetrahymena telomerase reveals previously unknown subunits, functions, and interactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jiang, Jiansen; Chan, Henry; Cash, Darian D.

Telomerase helps maintain telomeres by processive synthesis of telomere repeat DNA at their 3'-ends, using an integral telomerase RNA (TER) and telomerase reverse transcriptase (TERT). In this paper, we report the cryo–electron microscopy structure of Tetrahymena telomerase at ~9 angstrom resolution. In addition to seven known holoenzyme proteins, we identify two additional proteins that form a complex (TEB) with single-stranded telomere DNA-binding protein Teb1, paralogous to heterotrimeric replication protein A (RPA). The p75-p45-p19 subcomplex is identified as another RPA-related complex, CST (CTC1-STN1-TEN1). This study reveals the paths of TER in the TERT-TER-p65 catalytic core and single-stranded DNA exit; extensive subunitmore » interactions of the TERT essential N-terminal domain, p50, and TEB; and other subunit identities and structures, including p19 and p45C crystal structures. Finally, our findings provide structural and mechanistic insights into telomerase holoenzyme function.« less

Structural Basis for Catalytic Activation of a Serine Recombinase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Keenholtz, Ross A.; Rowland, Sally-J.; Boocock, Martin R.

2014-10-02

Sin resolvase is a site-specific serine recombinase that is normally controlled by a complex regulatory mechanism. A single mutation, Q115R, allows the enzyme to bypass the entire regulatory apparatus, such that no accessory proteins or DNA sites are required. Here, we present a 1.86 {angstrom} crystal structure of the Sin Q115R catalytic domain, in a tetrameric arrangement stabilized by an interaction between Arg115 residues on neighboring subunits. The subunits have undergone significant conformational changes from the inactive dimeric state previously reported. The structure provides a new high-resolution view of a serine recombinase active site that is apparently fully assembled, suggestingmore » roles for the conserved active site residues. The structure also suggests how the dimer-tetramer transition is coupled to assembly of the active site. The tetramer is captured in a different rotational substate than that seen in previous hyperactive serine recombinase structures, and unbroken crossover site DNA can be readily modeled into its active sites.« less

Far Ultraviolet Astronomy

NASA Technical Reports Server (NTRS)

Sonneborn, George; Rabin, Douglas M. (Technical Monitor)

2002-01-01

The Far Ultraviolet Spectroscopic Explorer (FUSE) is studying a wide range of astronomical problems in the 905-1187 Angstrom wavelength region through the use of high resolution spectroscopy. The FUSE bandpass forms a nearly optimal complement to the spectral coverage provided by the Hubble Space Telescope (HST), which extends down to approximately 1170 Angstroms. The photoionization threshold of atomic hydrogen (911 Angstroms) sets a natural short-wavelength limit for the FUV. FUSE was launched in June 1999 from Cape Canaveral, Florida, on a Delta II rocket into a 768 km circular orbit. Scientific observations started later that year. This spectral region is extremely rich in spectral diagnostics of astrophysical gases over a wide range of temperatures (100 K to over 10 million K). Important strong spectral lines in this wavelength range include those of neutral hydrogen, deuterium, nitrogen, oxygen, and argon (H I, D I, N I, O I, and Ar I), molecular hydrogen (H2), five-times ionized oxygen (O VI), and several ionization states of sulfur (S III - S VI). These elements are essential for understanding the origin and evolution of the chemical elements, the formation of stars and our Solar System, and the structure of galaxies, including our Milky Way. FUSE is one of NASA's Explorer missions and a cooperative project of NASA and the space agencies of Canada and France. These missions are smaller, more scientifically focused missions than the larger observatories, like Hubble and Chandra. FUSE was designed, built and operated for NASA by the Department of Physics and Astronomy at Johns Hopkins University. Hundreds of astronomers world-wide are using FUSE for a wide range of scientific research. Some of the important scientific discoveries from the first two years of the mission are described.

UNC-45/CRO1/She4p (UCS) Protein Forms Elongated Dimer and Joins Two Myosin Heads Near Their Actin Binding Region

DOE Office of Scientific and Technical Information (OSTI.GOV)

H Shi; G Blobel

2011-12-31

UNC-45/CRO1/She4p (UCS) proteins have variously been proposed to affect the folding, stability, and ATPase activity of myosins. They are the only proteins known to interact directly with the motor domain. To gain more insight into UCS function, we determined the atomic structure of the yeast UCS protein, She4p, at 2.9 {angstrom} resolution. We found that 16 helical repeats are organized into an L-shaped superhelix with an amphipathic N-terminal helix dangling off the short arm of the L-shaped molecule. In the crystal, She4p forms a 193-{angstrom}-long, zigzag-shaped dimer through three distinct and evolutionary conserved interfaces. We have identified She4p's C-terminal regionmore » as a ligand for a 27-residue-long epitope on the myosin motor domain. Remarkably, this region consists of two adjacent, but distinct, binding epitopes localized at the nucleotide-responsive cleft between the nucleotide- and actin-filament-binding sites. One epitope is situated inside the cleft, the other outside the cleft. After ATP hydrolysis and Pi ejection, the cleft narrows at its base from 20 to 12 {angstrom} thereby occluding the inside the cleft epitope, while leaving the adjacent, outside the cleft binding epitope accessible to UCS binding. Hence, one cycle of higher and lower binding affinity would accompany one ATP hydrolysis cycle and a single step in the walk on an actin filament rope. We propose that a UCS dimer links two myosins at their motor domains and thereby functions as one of the determinants for step size of myosin on actin filaments.« less

The Structure of Barmah Forest Virus as Revealed by Cryo-Electron Microscopy at a 6-Angstrom Resolution Has Detailed Transmembrane Protein Architecture and Interactions ▿ †

PubMed Central

Kostyuchenko, Victor A.; Jakana, Joanita; Liu, Xiangan; Haddow, Andrew D.; Aung, Myint; Weaver, Scott C.; Chiu, Wah; Lok, Shee-Mei

2011-01-01

Barmah Forest virus (BFV) is a mosquito-borne alphavirus that infects humans. A 6-Å-resolution cryo-electron microscopy three-dimensional structure of BFV exhibits a typical alphavirus organization, with RNA-containing nucleocapsid surrounded by a bilipid membrane anchored with the surface proteins E1 and E2. The map allows details of the transmembrane regions of E1 and E2 to be seen. The C-terminal end of the E2 transmembrane helix binds to the capsid protein. Following the E2 transmembrane helix, a short α-helical endodomain lies on the inner surface of the lipid envelope. The E2 endodomain interacts with E1 transmembrane helix from a neighboring E1-E2 trimeric spike, thereby acting as a spacer and a linker between spikes. In agreement with previous mutagenesis studies, the endodomain plays an important role in recruiting other E1-E2 spikes to the budding site during virus assembly. The E2 endodomain may thus serve as a target for antiviral drug design. PMID:21752915

The Effects of Stoichiometry on the Mechanical Properties of Icosahedral Boron Carbide Under Loading

DTIC Science & Technology

2012-11-19

ranging from 10% to 20% C using glancing incidence x - ray diffraction and similar experimental studies of structure as a function of stoichiometry were...blue) positions. it has been suggested that x - ray diffraction analysis of a series of boron-rich materials indicates a distinct change in the c lattice...Angstroms, angles in degrees, volume in cubic Angstroms). Structure Formula % C a b c α β γ Volume Experiment37 B5.6C 15.2 5.19 5.19 5.19 65.18 65.18

Diphosphine- and CO-Induced Fragmentation of Chloride-bridged Dinuclear Complex and Cp*Ir(mu-Cl)(3)Re(CO)(3) and Attempted Synthesis of Cp*Ir(mu-Cl)(3)Mn(CO)(3): Spectroscopic Data and X-ray Diffraction Structures of the Pentamethylcyclopentadienyl Compounds [Cp*IrCl{(Z)-Ph2PCH = CHPPh2}][Cl]center dot 2CHCl(3) and Cp*Ir(CO)Cl-2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hammons, Casey; Wang, Xiaoping; Nesterov, Vladimir

2010-01-01

The confacial bioctahedral compound Cp*Ir(mu-Cl)(3)Re(CO)(3) (1) undergoes rapid fragmentation in the presence of the unsaturated diphosphine ligand (Z)-Ph2PCH = CHPPh2 to give the mononuclear compounds [Cp*IrCl {(Z)-Ph2PCH = CHPPh2}][Cl] (2) and fac-ClRe(CO)(3)[(Z)-Ph2PCH = CHPPh2] (3). 2 has been characterized by H-1 and P-31 NMR spectroscopy and X-ray diffraction analysis. 2 center dot 2CHCl(3) crystallizes in the monoclinic space group C2/c, a = 35.023 (8) angstrom, b = 10.189 (2) angstrom, c = 24.003 (6) angstrom, b = 103.340 (3), V = 8,335 (3) angstrom 3, Z = 8, and d(calc) = 1.647 Mg/m(3); R = 0.0383, R-w = 0.1135 formore » 8,178 reflections with I> 2 sigma(I). The Ir(III) center in 2 exhibits a six-coordinate geometry and displays a chelating diphosphine group. Compound 1 reacts with added CO with fragmentation to yield the known compounds Cp*Ir(CO)Cl-2 (4) and ClRe(CO)(5) (5) in near quantitative yield by IR spectroscopy. Using the protocol established by our groups for the synthesis of 1, we have explored the reaction of [Cp*IrCl2](2) with ClMn(CO)(5) as a potential route to Cp*Ir(mu-Cl)(3)Mn(CO)(3); unfortunately, 4 was the only product isolated from this reaction. The solid-state structure of 4 was determined by X-ray diffraction analysis. 4 crystallizes in the triclinic space group P-1, a = 7.4059 (4) angstrom, b = 7.8940 (4) angstrom, c = 11.8488 (7) angstrom, alpha = 80.020 (1), beta = 79.758 (1), gamma = 68.631 (1), V = 630.34 (6) angstrom(3), Z = 2, and d(calc) = 2.246 Mg/m(3); R = 0.0126, R-w = 0.0329 for 2,754 reflections with I> 2 sigma(I). The expected three-legged piano-stool geometry in 4 has been crystallographically confirmed.« less

The 3.2 Angstrom Resolution Structure of the Polymorphic Cowpea Chlorotic Mottle Virus Ribonucleoprotein Particle

NASA Astrophysics Data System (ADS)

Speir, Jeffrey Alan

Structural studies of the polymorphic cowpea chlorotic mottle virus have resulted in high resolution structures for two distinct icosahedral ribonucleoprotein particle conformations dependent upon whether acidic or basic pH conditions prevail. CCMV is stable below pH 6.5, however metal-free particles maintain a 10% increase in hydrodynamic volume at pH >=q 7.5. Identification of this swollen' form of CCMV, which can easily be disrupted with 1M NaCl, led to the first reassembly of an icosahedral virus in vitro from purified viral protein and RNA to form infectious particles, and its assembly has been the subject of biochemical and biophysical investigations for over twenty-five years. Under well defined conditions of pH, ionic strength and divalent metal ion concentration, CCMV capsid protein or capsid protein and RNA will reassemble to form icosahedral particles of various sizes, sheets, tubes, rosettes, and a variety of laminar structures which resemble virion structures from non-related virus families. Analysis of native particles at 3.2A resolution and swollen particles at 28A resolution has suggested that the chemical basis for the formation of polymorphic icosahedral and anisometric structures is: (i) hexamers formed of beta-barrel subunits stabilized by an unusual hexameric parallel beta structure made up of their N-termini, (ii) the location of protein-RNA interactions, (iii) divalent metal cation binding sites that regulate quasi-symmetrical subunit associations, (iv) charge repulsion across the same interfaces when lacking divalent metal ions at basic pH, which induces the formation of sixty 20A diameter portals for RNA release, and (v) a novel, C-terminal-based, subunit dimer assembly unit. The use of C- and N-terminal arms in CCMV has not been observed in other icosahedral RNA virus structures determined at near atomic resolution, however, their detailed interactions and roles in stabilizing the quaternary organization of CCMV are related to that found in the atomic structures of the DNA tumor papovaviruses (SV40 and polyoma). The swollen structure is closely similar to the expanded form of tomato bushy stunt virus (TBSV) previously determined at 8A resolution by X-ray crystallography.

A Common Fold Mediates Vertebrate Defense and Bacterial Attack

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rosado, Carlos J.; Buckle, Ashley M.; Law, Ruby H.P.

2008-10-02

Proteins containing membrane attack complex/perforin (MACPF) domains play important roles in vertebrate immunity, embryonic development, and neural-cell migration. In vertebrates, the ninth component of complement and perforin form oligomeric pores that lyse bacteria and kill virus-infected cells, respectively. However, the mechanism of MACPF function is unknown. We determined the crystal structure of a bacterial MACPF protein, Plu-MACPF from Photorhabdus luminescens, to 2.0 angstrom resolution. The MACPF domain reveals structural similarity with poreforming cholesterol-dependent cytolysins (CDCs) from Gram-positive bacteria. This suggests that lytic MACPF proteins may use a CDC-like mechanism to form pores and disrupt cell membranes. Sequence similarity between bacterialmore » and vertebrate MACPF domains suggests that the fold of the CDCs, a family of proteins important for bacterial pathogenesis, is probably used by vertebrates for defense against infection.« less

Crystal structure of tabtoxin resistance protein complexed with acetyl coenzyme A reveals the mechanism for {beta}-lactam acetylation.

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, H.; Ding, Y.; Bartlam, M.

2003-01-31

Tabtoxin resistance protein (TTR) is an enzyme that renders tabtoxin-producing pathogens, such as Pseudomonas syringae, tolerant to their own phytotoxins. Here, we report the crystal structure of TTR complexed with its natural cofactor, acetyl coenzyme A (AcCoA), to 1.55 {angstrom} resolution. The binary complex forms a characteristic 'V' shape for substrate binding and contains the four motifs conserved in the GCN5-related N-acetyltransferase (GNAT) superfamily, which also includes the histone acetyltransferases (HATs). A single-step mechanism is proposed to explain the function of three conserved residues, Glu92, Asp130 and Tyr141, in catalyzing the acetyl group transfer to its substrate. We also reportmore » that TTR possesses HAT activity and suggest an evolutionary relationship between TTR and other GNAT members.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ogle, James M.; Brodersen, Ditlev E.; Clemons, William M.

Crystal structures of the 30S ribosomal subunit in complex with messenger RNA and cognate transfer RNA in the A site, both in the presence and absence of the antibiotic paromomycin, have been solved at between 3.1 and 3.3 angstroms resolution. Cognate transfer RNA (tRNA) binding induces global domain movements of the 30S subunit and changes in the conformation of the universally conserved and essential bases A1492, A1493, and G530 of 16S RNA. These bases interact intimately with the minor groove of the first two base pairs between the codon and anticodon, thus sensing Watson-Crick base-pairing geometry and discriminating against near-cognatemore » tRNA. The third, or 'wobble,' position of the codon is free to accommodate certain noncanonical base pairs. By partially inducing these structural changes, paromomycin facilitates binding of near-cognate tRNAs.« less

Cocrystallization studies of full-length recombinant butyrylcholinesterase (BChE) with cocaine

DOE Office of Scientific and Technical Information (OSTI.GOV)

Asojo, Oluwatoyin Ajibola; Asojo, Oluyomi Adebola; Ngamelue, Michelle N.

Human butyrylcholinesterase (BChE; EC 3.1.1.8) is a 340 kDa tetrameric glycoprotein that is present in human serum at about 5 mg l{sup -1} and has well documented therapeutic effects on cocaine toxicity. BChE holds promise as a therapeutic that reduces and finally eliminates the rewarding effects of cocaine, thus weaning an addict from the drug. There have been extensive computational studies of cocaine hydrolysis by BChE. Since there are no reported structures of BChE with cocaine or any of the hydrolysis products, full-length monomeric recombinant wild-type BChE was cocrystallized with cocaine. The refined 3 {angstrom} resolution structure appears to retainmore » the hydrolysis product benzoic acid in sufficient proximity to form a hydrogen bond to the active-site Ser198.« less

Molecular basis for insulin fibril assembly

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ivanova, Magdalena I.; Sievers, Stuart A.; Sawaya, Michael R.

2009-12-01

In the rare medical condition termed injection amyloidosis, extracellular fibrils of insulin are observed. We found that the segment of the insulin B-chain with sequence LVEALYL is the smallest segment that both nucleates and inhibits the fibrillation of full-length insulin in a molar ratio-dependent manner, suggesting that this segment is central to the cross-{beta} spine of the insulin fibril. In isolation from the rest of the protein, LVEALYL forms microcrystalline aggregates with fibrillar morphology, the structure of which we determined to 1 {angstrom} resolution. The LVEALYL segments are stacked into pairs of tightly interdigitated {beta}-sheets, each pair displaying the drymore » steric zipper interface typical of amyloid-like fibrils. This structure leads to a model for fibrils of human insulin consistent with electron microscopic, x-ray fiber diffraction, and biochemical studies.« less

New Atomic Data for Doubly Ionized Iron Group Atoms by High Resolution UV Fourier Transform Spectroscopy

NASA Technical Reports Server (NTRS)

Smith, Peter L.; Pickering, Juliet C.; Thorne, A. P.

2002-01-01

Currently available laboratory spectroscopic data of doubly ionized iron-group element were obtained about 50 years ago using spectrographs of modest dispersion, photographic plates, and eye estimates of intensities. The accuracy of the older wavelength data is about 10 mAngstroms at best, whereas wavelengths are now needed to an accuracy of 1 part in 10(exp 6) to 10(exp 7) (0.2 to 2 mAngstroms at 2000 Angstroms). The Fourier transform (FT) spectroscopy group at Imperial College, London, and collaborators at the Harvard College Observatory have used a unique VUV FT spectrometer in a program focussed on improving knowledge of spectra of many neutral and singly and doubly ionized, astrophysically important, iron group elements. Spectra of Fe II and Fe III have been recorded at UV and VUV wavelengths with signal-to-noise ratios of several hundred for the stronger lines. Wavelengths and energy levels for Fe III are an order of magnitude more accurate than previous work; analysis is close to completion. f-values for Fe II have been published.

Probing the Martian atmosphere in the ultraviolet

NASA Technical Reports Server (NTRS)

Lindner, Bernhard Lee

1994-01-01

Ozone is a key to understanding atmospheric chemistry on Mars. The O3 abundance has been inferred from UV spectra by several spacecraft, with the most complete coverage provided by Mariner 9. The Mariner 9 UV spectrometer scanned from 2100 to 3500 Angstroms in one of its two spectral channels every 3 seconds with a spectral resolution of 15 Angstroms and an effective field-of-view of approximately 300 sq km. The only atmospheric absorption in the 2000 to 3000 Angstrom region was assumed to come from the Hardey band system of ozone, which has an opacity of order unity. Therefore, the amount of ozone was inferred by fitting this absorption feature with laboratory data of ozone absorption, as shown in Fig 1. Mars O3 shows strong seasonal and latitudinal variation, with column abundances ranging from 0.2 micron-atm at equatorial latitudes to 60 micron-atm over the northern winter polar latitudes (1 micron-atm is a column abundance of 2.689 x 10(exp 15) molecules cm(exp -2). However, the O3 abundance is never great enough to significantly affect atmospheric temperatures or surface temperatures and frost budgets.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Asthalter,T.; Sergueev, I.; Van Burck, U.

The low- and high-temperature phases of octamethyl ferrocene were studied in detail, using high-resolution X-ray powder diffraction, differential scanning calorimetry and nuclear resonant scattering, in particular the novel technique of synchrotron radiation perturbed angular correlations (SRPAC). Much as in the case of an analogous but more unsymmetrical molecule, octamethyl ethinyl ferrocene, the high-temperature phase possesses the space group R{bar 3}m source with lattice parameters a = b = 12.5568(1) Angstroms, c = 9.6045(1) Angstroms, which in the rhombohedral setting correspond to a = 7.9251(1) Angstroms, {alpha}=104.79 degrees. An increase of the volume per formula unit of about 12% across themore » phase transition is observed. The rotation of the electric field gradient, which can be identified with the rotation of the entire molecule within the lattice, follows Arrhenius behavior with a high activation energy of (40.3 {+-} 3.3)kJ mol{sup -1}. Whereas precursor effects and a change in activation energy were observed for octamethyl ethinyl ferrocene, no such effects are observed for octamethyl ferrocene. We relate this difference to the absence of the ethinyl substituent in octamethyl ferrocene.« less

CURRENT RESEARCH TOWARDS IMAGING BIOLOGICAL MOLECULES USING FIELD DESORPTION MICROSCOPY AND FIELD ION MICROSCOPY OF DIAMOND

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hirsch, G.; Washburn, J.

1977-11-01

Work is currently in progress investigating the possibility of imaging large organic and biological molecules in a modification of field desorption microscopy (FDM). A field ion microscope (FIM) is being converted to an FDM by installation of a chevron channel tron electron multiplier array (CEMA), commonly called a chevron channel plate. The chevron CEMA has a gain of over 10{sup 7} and can thus produce enough light from single field desorbed ions to be readily photographed. In field desorption microscopy, a fine metal tip is subjected to positive electric fields high enough to field evaporate the metal as positive ions.more » These ions follow the field lines radially away from the tip and strike the CEMA. One therefore gets a greatly magnified image of the tip by field evaporated ions. The magnification, M equals R/{beta}r where R is the tip to screen distance, typically 5-10 cm, r is the tip radius, typically 100-1000 {angstrom} and {beta} is an electrostatic compression factor due to the field lines being Slightly compressed at the tip. Magnifications of over 10{sup 6} are easily obtained and at low temperatures, metal atoms field evaporating from adjacent lattice positions on the tip will strike the CEMA within separate areas. Therefore the resolution is less than 3 {angstrom}. A large amount of work has been done attempting to image molecules on tips by FIM and field emission microscopy (FEM). In FEM, the resolution is normally limited to about 25{angstrom} due to the large transverse momentum of the emitted electrons. The images of molecules obtained have therefore been of low resolution and hard to interpret due to effects which are still controversial in interpretation. By reversing the field and adding an imaging gas one would hope to be able to get high resolution FIM images of adsorbed molecules. It turns out however that the molecules are pulled off the tips in fields of approximately +100 to +200 MV/cm. In FEM which uses fields of -30 to -50 MV/cm this is managable. In FIM, the best resolution is obtained using helium imaging gas which has a best imaging field ({approx}440 MV/cm) well above the desorption field of the molecules. By substituting lower ionization potential imaging gases, the field can be lowered. Thus FIM images of molecules have been obtained with H{sub 2} and Hg which require fields of {approx} 200 MV/cm and 80 MV/cm respectfully. The resolution is not very good however; one only sees diffuse patches of light with no structure. Even if one gets some direct image of a molecule via FIM, the fields are so high that the molecule will be severely distorted and possibly dissociated. The imaging gases which field ionize at low fields all produce low resolution FIM images. In addition, these gases are usually highly chemically reactive at the imaging field. Other attempts have been made to shadow molecules on a tip with vapor deposited metal atoms or encasing molecules in an electroplated deposit on a tip. By field evaporating the deposit until a cavity with an enclosed molecule is uncovered, one might hope to see an outline of the molecule by imaging of the surrounding matrix atoms. Again however, the resolution is not very good because of the uncertainty of the metal atoms to reliably encase the molecule.« less

The Crystal Structure of GXGD Membrane Protease FlaK

DOE Office of Scientific and Technical Information (OSTI.GOV)

J Hu; Y Xue; S Lee

2011-12-31

The GXGD proteases are polytopic membrane proteins with catalytic activities against membrane-spanning substrates that require a pair of aspartyl residues. Representative members of the family include preflagellin peptidase, type 4 prepilin peptidase, presenilin and signal peptide peptidase. Many GXGD proteases are important in medicine. For example, type 4 prepilin peptidase may contribute to bacterial pathogenesis, and mutations in presenilin are associated with Alzheimer's disease. As yet, there is no atomic-resolution structure in this protease family. Here we report the crystal structure of FlaK, a preflagellin peptidase from Methanococcus maripaludis, solved at 3.6 {angstrom} resolution. The structure contains six transmembrane helices.more » The GXGD motif and a short transmembrane helix, helix 4, are positioned at the centre, surrounded by other transmembrane helices. The crystal structure indicates that the protease must undergo conformational changes to bring the GXGD motif and a second essential aspartyl residue from transmembrane helix 1 into close proximity for catalysis. A comparison of the crystal structure with models of presenilin derived from biochemical analysis reveals three common transmembrane segments that are similarly arranged around the active site. This observation reinforces the idea that the prokaryotic and human proteases are evolutionarily related. The crystal structure presented here provides a framework for understanding the mechanism of the GXGD proteases, and may facilitate the rational design of inhibitors that target specific members of the family.« less

The crystal structure of GXGD membrane protease FlaK

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hu, Jian; Xue, Yi; Lee, Sangwon

2011-09-20

The GXGD proteases are polytopic membrane proteins with catalytic activities against membrane-spanning substrates that require a pair of aspartyl residues. Representative members of the family include preflagellin peptidase, type 4 prepilin peptidase, presenilin and signal peptide peptidase. Many GXGD proteases are important in medicine. For example, type 4 prepilin peptidase may contribute to bacterial pathogenesis, and mutations in presenilin are associated with Alzheimer's disease. As yet, there is no atomic-resolution structure in this protease family. Here we report the crystal structure of FlaK, a preflagellin peptidase from Methanococcus maripaludis, solved at 3.6 {angstrom} resolution. The structure contains six transmembrane helices.more » The GXGD motif and a short transmembrane helix, helix 4, are positioned at the centre, surrounded by other transmembrane helices. The crystal structure indicates that the protease must undergo conformational changes to bring the GXGD motif and a second essential aspartyl residue from transmembrane helix 1 into close proximity for catalysis. A comparison of the crystal structure with models of presenilin derived from biochemical analysis reveals three common transmembrane segments that are similarly arranged around the active site. This observation reinforces the idea that the prokaryotic and human proteases are evolutionarily related. The crystal structure presented here provides a framework for understanding the mechanism of the GXGD proteases, and may facilitate the rational design of inhibitors that target specific members of the family.« less

X-ray structure of imidazolonepropionase from Agrobacterium tumefaciens at 1.87 Å resolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tyagi, Rajiv; Kumaran, Desigan; Burley, Stephen K.

2010-01-12

Histidine degradation in Agrobacterium tumefaciens involves four enzymes, including histidase (EC 4.3.1.3), urocanase (EC 4.2.1.49), imidazolonepropionase (EC 3.5.2.7), and N-formylglutamate amidohydrolase (EC 3.5.3.8). The third enzyme of the pathway, imidazolone-propionase, a 45.6 kDa protein, catalyzes conversion of imidazolone-5-propanoate to N-forminio-L-glutamate. Initial studies of the role of imidazolonepropionase in histidine degradation were published in 1953. Subsequent publications have been limited to enzyme kinetics, crystallization, and a recently reported structure determination. The imidazolonepropionases are members of metallodepenent-hydrolases (or amidohydroase) superfamily, which includs ureases, adenosine deaminases, phosphotriesterases, dihydroorotases, allantoinases, hydantoinases, adenine and cytosine deaminases, imidazolonepropionases, aryldial-kylphosphatases, chlorohydrolases, and formylmethanofuran dehydroases. Proteins belonging tomore » this large group share a common three-dimensional structural motif (an eightfold {alpha}/{beta} or TIM barrel) with similar active sites. Most superfamily members also share a conserved metal binding site, involving four histidine residues and one aspartic acid. Imidazolonepropionase is one of the targets selected for X-ray crystallpgrahpic structure determination by the New York Structural GenomiX Research Consortium (NYSGXRC) Target ID: 9252b to correlate the structure function relationship of poorly studied by important enzyme. Here they report the crystal structure of imidazolonepropionase from Agrobacterium tumefaciens determined at 1.87 {angstrom} resolution.« less

Structure of a prokaryotic virtual proton pump at 3.2 Å resolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fang, Yiling; Jayaram, Hariharan; Shane, Tania

2009-09-15

To reach the mammalian gut, enteric bacteria must pass through the stomach. Many such organisms survive exposure to the harsh gastric environment (pH 1.5-4) by mounting extreme acid-resistance responses, one of which, the arginine-dependent system of Escherichia coli, has been studied at levels of cellular physiology, molecular genetics and protein biochemistry. This multiprotein system keeps the cytoplasm above pH 5 during acid challenge by continually pumping protons out of the cell using the free energy of arginine decarboxylation. At the heart of the process is a 'virtual proton pump' in the inner membrane, called AdiC, that imports L-arginine from themore » gastric juice and exports its decarboxylation product agmatine. AdiC belongs to the APC superfamily of membrane proteins, which transports amino acids, polyamines and organic cations in a multitude of biological roles, including delivery of arginine for nitric oxide synthesis, facilitation of insulin release from pancreatic {beta}-cells, and, when inappropriately overexpressed, provisioning of certain fast-growing neoplastic cells with amino acids. High-resolution structures and detailed transport mechanisms of APC transporters are currently unknown. Here we describe a crystal structure of AdiC at 3.2 {angstrom} resolution. The protein is captured in an outward-open, substrate-free conformation with transmembrane architecture remarkably similar to that seen in four other families of apparently unrelated transport proteins.« less

A Two-Phase Intergrowth in Genthelvite from Mont Saint-Hilaire, Quebec

DOE Office of Scientific and Technical Information (OSTI.GOV)

Antao, Sytle M.; Hassan, Ishmael; West Indies)

Synchrotron high-resolution powder X-ray-diffraction (HRPXRD) data and Rietveld structure refinement were used to examine a two-phase intergrowth of genthelvite, ideally Zn{sub 8}[Be{sub 6}Si{sub 6}O{sub 24}]S{sub 2}, from the alkaline intrusive complex at Mont Saint-Hilaire, Quebec, where genthelvite occurs in nepheline syenite pegmatites. The structural parameters obtained for the two phases are slightly different from each other. The unit-cell parameters are 8.119190(7) {angstrom} (51% phase 1) and 8.128914(9) {angstrom} (49% phase 2). The refinement gives the chemical formulae and interstitial M cation in terms of Zn and Mn (the Fe content is practically zero) for the Mn-poor genthelvite phase 1 asmore » (Zn{sub 7.8}Mn{sub 0.2}){Sigma}{sub 8}[Be{sub 6}Si{sub 6}O{sub 24}]S{sub 2}, and the Mn-rich genthelvite phase 2 as (Zn{sub 7.0}Mn{sub 1.0}){Sigma}{sub 8}[Be{sub 6}Si{sub 6}O{sub 24}]S{sub 2}. These formulae are comparable to the Mn-poor and Mn-rich phases obtained by electron-microprobe analysis. The intergrowth indicates that diffusion is absent among the interstitial M cations of similar size (Zn{sup 2+}, Fe{sup 2+} and Mn{sup 2+}). Such intergrowths may form under distinct f(O{sub 2}) conditions and probably low temperature of crystallization that inhibits diffusion of M cations.« less

Structural and Functional Analysis of the Interaction Between the Nucleoporin Nup98 and the mRNA Export Facto Rae1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Y Ren; H Seo; G Blobel

The export of mRNAs is a multistep process, involving the packaging of mRNAs into messenger ribonucleoprotein particles (mRNPs), their transport through nuclear pore complexes, and mRNP remodeling events prior to translation. Ribonucleic acid export 1 (Rae1) and Nup98 are evolutionarily conserved mRNA export factors that are targeted by the vesicular stomatitis virus matrix protein to inhibit host cell nuclear export. Here, we present the crystal structure of human Rae1 in complex with the Gle2-binding sequence (GLEBS) of Nup98 at 1.65 {angstrom} resolution. Rae1 forms a seven-bladed {beta}-propeller with several extensive surface loops. The Nup98 GLEBS motif forms an {approx}50-{angstrom}-long hairpinmore » that binds with its C-terminal arm to an essentially invariant hydrophobic surface that extends over the entire top face of the Rae1 {beta}-propeller. The C-terminal arm of the GLEBS hairpin is necessary and sufficient for Rae1 binding, and we identify a tandem glutamate element in this arm as critical for complex formation. The Rae1 {center_dot} Nup98{sup GLEBS} surface features an additional conserved patch with a positive electrostatic potential, and we demonstrate that the complex possesses single-stranded RNA-binding capability. Together, these data suggest that the Rae1 {center_dot} Nup98 complex directly binds to the mRNP at several stages of the mRNA export pathway.« less

Formation of ferric oxides from aqueous solutions: A polyhedral approach by X-ray absorption spectroscopy. I. Hydrolysis and formation of ferric gels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Combes, J.M.; Manceau, A.; Calas, G.

1989-03-01

X-ray absorption spectroscopy (XAS) was used to follow the evolution of local structural environments around ferric ions during the formation of ferric hydrous oxide gels from 1 M chloride and 0.1 M nitrate solutions. Fe K-XANES and EXAFS confirm that ferric ions remain 6-fold coordinated during this evolution. With increasing OH availability in the solution, Cl{sup {minus}} anions tend gradually to be exchanged for (O, OH, OH{sub 2}) ligands. Below OH/Fe = 1, no structural order is detected beyond the first coordination sphere. Above this ratio, two Fe-Fe distances at 3.05 {angstrom} and 3.44 {angstrom} are observed and correspond tomore » the presence of edge- and vertex-sharing Fe-octahedra. XAS results show that ferric gels and highly polymerized aqueous species are short-range ordered. The main contribution to disorder in the gels arises from the small size of coherently scattering domains also responsible for their X-ray amorphous character. From the initial to the final stage of hydrolysis, particles possess a nearly spherical shape with a minimum average diameter ranging from 10-30 {angstrom} for polymers formed from chloride and nitrate solutions. As polymerization proceeds, the local order extends to several tens of angstroms and the particle structures becomes progressively closer to that of akaganeite ({beta}-FeOOH) or goethite ({alpha}-FeOOH). This local structure is distinct from that of the lepidocrocite ({gamma}-FeOOH)-like structure of ferric gels precipitated after oxidation of divalent Fe solutions. The growth of the crystalline Fe-oxyhydroxides from gels takes place by the progressive long-range ordering in the ferric polymers without modifying the short-range order around Fe.« less

Atomic-Resolution Spectrum Imaging of Semiconductor Nanowires.

PubMed

Zamani, Reza R; Hage, Fredrik S; Lehmann, Sebastian; Ramasse, Quentin M; Dick, Kimberly A

2018-03-14

Over the past decade, III-V heterostructure nanowires have attracted a surge of attention for their application in novel semiconductor devices such as tunneling field-effect transistors (TFETs). The functionality of such devices critically depends on the specific atomic arrangement at the semiconductor heterointerfaces. However, most of the currently available characterization techniques lack sufficient spatial resolution to provide local information on the atomic structure and composition of these interfaces. Atomic-resolution spectrum imaging by means of electron energy-loss spectroscopy (EELS) in the scanning transmission electron microscope (STEM) is a powerful technique with the potential to resolve structure and chemical composition with sub-angstrom spatial resolution and to provide localized information about the physical properties of the material at the atomic scale. Here, we demonstrate the use of atomic-resolution EELS to understand the interface atomic arrangement in three-dimensional heterostructures in semiconductor nanowires. We observed that the radial interfaces of GaSb-InAs heterostructure nanowires are atomically abrupt, while the axial interface in contrast consists of an interfacial region where intermixing of the two compounds occurs over an extended spatial region. The local atomic configuration affects the band alignment at the interface and, hence, the charge transport properties of devices such as GaSb-InAs nanowire TFETs. STEM-EELS thus represents a very promising technique for understanding nanowire physical properties, such as differing electrical behavior across the radial and axial heterointerfaces of GaSb-InAs nanowires for TFET applications.

DOE Office of Scientific and Technical Information (OSTI.GOV)

DuBois, Rebecca M.; Zaraket, Hassan; Reddivari, Muralidhar

Highly pathogenic avian influenza viruses of the H5N1 subtype continue to threaten agriculture and human health. Here, we use biochemistry and x-ray crystallography to reveal how amino-acid variations in the hemagglutinin (HA) protein contribute to the pathogenicity of H5N1 influenza virus in chickens. HA proteins from highly pathogenic (HP) A/chicken/Hong Kong/YU562/2001 and moderately pathogenic (MP) A/goose/Hong Kong/437-10/1999 isolates of H5N1 were found to be expressed and cleaved in similar amounts, and both proteins had similar receptor-binding properties. However, amino-acid variations at positions 104 and 115 in the vestigial esterase sub-domain of the HA1 receptor-binding domain (RBD) were found to modulatemore » the pH of HA activation such that the HP and MP HA proteins are activated for membrane fusion at pH 5.7 and 5.3, respectively. In general, an increase in H5N1 pathogenicity in chickens was found to correlate with an increase in the pH of HA activation for mutant and chimeric HA proteins in the observed range of pH 5.2 to 6.0. We determined a crystal structure of the MP HA protein at 2.50 {angstrom} resolution and two structures of HP HA at 2.95 and 3.10 {angstrom} resolution. Residues 104 and 115 that modulate the acid stability of the HA protein are situated at the N- and C-termini of the 110-helix in the vestigial esterase sub-domain, which interacts with the B loop of the HA2 stalk domain. Interactions between the 110-helix and the stalk domain appear to be important in regulating HA protein acid stability, which in turn modulates influenza virus replication and pathogenesis. Overall, an optimal activation pH of the HA protein is found to be necessary for high pathogenicity by H5N1 influenza virus in avian species.« less

Charge-density analysis of a protein structure at subatomic resolution: the human aldose reductase case.

PubMed

Guillot, Benoît; Jelsch, Christian; Podjarny, Alberto; Lecomte, Claude

2008-05-01

The valence electron density of the protein human aldose reductase was analyzed at 0.66 angstroms resolution. The methodological developments in the software MoPro to adapt standard charge-density techniques from small molecules to macromolecular structures are described. The deformation electron density visible in initial residual Fourier difference maps was significantly enhanced after high-order refinement. The protein structure was refined after transfer of the experimental library multipolar atom model (ELMAM). The effects on the crystallographic statistics, on the atomic thermal displacement parameters and on the structure stereochemistry are analyzed. Constrained refinements of the transferred valence populations Pval and multipoles Plm were performed against the X-ray diffraction data on a selected substructure of the protein with low thermal motion. The resulting charge densities are of good quality, especially for chemical groups with many copies present in the polypeptide chain. To check the effect of the starting point on the result of the constrained multipolar refinement, the same charge-density refinement strategy was applied but using an initial neutral spherical atom model, i.e. without transfer from the ELMAM library. The best starting point for a protein multipolar refinement is the structure with the electron density transferred from the database. This can be assessed by the crystallographic statistical indices, including Rfree, and the quality of the static deformation electron-density maps, notably on the oxygen electron lone pairs. The analysis of the main-chain bond lengths suggests that stereochemical dictionaries would benefit from a revision based on recently determined unrestrained atomic resolution protein structures.

Crystal structure of the mineral (Na,Ca,K){sub 2}(Ca,Na){sub 4}(Mg,Fe){sub 5}(Mg,Fe,Ti){sub 5}[Si{sub 12}Al{sub 4}O{sub 44}](F,O){sub 4}: a triclinic representative of the amphibole family

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rastsvetaeva, R. K., E-mail: rast@ns.crys.ras.ru; Aksenov, S. M.

2012-05-15

A mineral belonging to the amphibole family found at the Rothenberg paleovolcano (Eifel, Germany) was studied by single-crystal X-ray diffraction. The triclinic pseudomonoclinic unit-cell parameters are a = 5.3113(1) Angstrom-Sign , b = 18.0457(3) Angstrom-Sign ; c = 9.8684(2) Angstrom-Sign , {alpha} = 90.016(2) Degree-Sign , {beta} = 105.543(4) Degree-Sign , {gamma} = 89.985(2) Degree-Sign . The structure was solved by direct methods in sp. gr. P1 and refined to the R factor of 2.7% based on 6432 reflections with |F| > 3{sigma}(F) taking into account twinning. The mineral with the idealized formula (Na,Ca,K){sub 2}(Ca,Na){sub 4}(Mg,Fe){sub 5}(Mg,Fe,Ti){sub 5}[Si{sub 12}Al{sub 4}O{submore » 44}](F,O){sub 4} has some symmetry and structural features that distinguish it from other minerals of this family.« less

Oxidative addition of allylic halides to ruthenium(II) compounds. Preparation, reactions, and X-ray crystallographic structure of ruthenium(IV)-allyl complexes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nagashima, Hideo; Mukai, Katsunori; Shiota, Yusuke

1990-03-01

The oxidative addition of allylic halides to (C{sub 5}R{sub 5})RuL{sub 2}X (R = H, Me; L = CO, PPh{sub 3}) gave new Ru(IV)-{eta}{sup 3}-allyl complexes, (C{sub 5}R{sub 5})RuX{sub 2}({eta}{sup 3}-allyl). An X-ray structure determination was carried out on (C{sub 5}Me{sub 5})RuBr{sub 2}({eta}{sup 3}-C{sub 3}H{sub 5}), indicating a pseudo-piano-stool structure having two Br atoms and two terminal carbons of the endo-{eta}{sup 3}-allyl ligand located at the basal positions. There is a crystal mirror plane bisecting the pentamethylcyclopentadienyl and the {pi}-allyl ligands. Crystal data: orthorhombic, space group P2{sub 1}2{sub 1}2{sub 1}, a = 22.738 (1) {angstrom}, b = 13.367 (7) {angstrom}, cmore » = 9.383 (1) {angstrom}, Z = 4., data refined to R = 0.0695. Its {sup 1}H and {sup 13}C NMR spectra showed symmetric allyl signals, supporting that the above-described piano-stool structure is maintained even in solution.« less

Analysis of shipboard aerosol optical thickness measurements from multiple sunphotometers aboard the R/V Ronald H. Brown during the Aerosol Characterization Experiment - Asia

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, Mark A.; Knobelspiesse, Kirk; Frouin, Robert

2005-06-20

Marine sunphotometer measurements collected aboard the R/V Ronald H. Brown during the Aerosol Characterization Experiment - Asia (ACE-Asia) are used to evaluate the ability of complementary instrumentation to obtain the best possible estimates of aerosol optical thickness and Angstrom exponent from ships at sea. A wide range of aerosol conditions, including clean maritime conditions and highly polluted coastal environments, were encountered during the ACE-Asia cruise. The results of this study suggest that shipboard hand-held sunphotometers and fast-rotating shadow-band radiometers (FRSRs) yield similar measurements and uncertainties if proper measurement protocols are used and if the instruments are properly calibrated. The automatedmore » FRSR has significantly better temporal resolution (2 min) than the hand-held sunphotometers when standard measurement protocols are used, so it more faithfully represents the variability of the local aerosol structure in polluted regions. Conversely, results suggest that the hand-held sunphotometers may perform better in clean, maritime air masses for unknown reasons. Results also show that the statistical distribution of the Angstrom exponent measurements is different when the distributions from hand-held sunphotometers are compared with those from the FRSR and that the differences may arise from a combination of factors.« less

Structural Basis of TLR5-Flagellin Recognition and Signaling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoon, Sung-il; Kurnasov, Oleg; Natarajan, Venkatesh

2012-03-01

Toll-like receptor 5 (TLR5) binding to bacterial flagellin activates signaling through the transcription factor NF-{kappa}B and triggers an innate immune response to the invading pathogen. To elucidate the structural basis and mechanistic implications of TLR5-flagellin recognition, we determined the crystal structure of zebrafish TLR5 (as a variable lymphocyte receptor hybrid protein) in complex with the D1/D2/D3 fragment of Salmonella flagellin, FliC, at 2.47 angstrom resolution. TLR5 interacts primarily with the three helices of the FliC D1 domain using its lateral side. Two TLR5-FliC 1:1 heterodimers assemble into a 2:2 tail-to-tail signaling complex that is stabilized by quaternary contacts of themore » FliC D1 domain with the convex surface of the opposing TLR5. The proposed signaling mechanism is supported by structure-guided mutagenesis and deletion analyses on CBLB502, a therapeutic protein derived from FliC.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bae, Brian; Cobb, Ryan E.; DeSieno, Matthew A.

The enzyme FrbF from Streptomyces rubellomurinus has attracted significant attention due to its role in the biosynthesis of the antimalarial phosphonate FR-900098. The enzyme catalyzes acetyl transfer onto the hydroxamate of the FR-900098 precursors cytidine 5'-monophosphate-3-aminopropylphosphonate and cytidine 5'-monophosphate-N-hydroxy-3-aminopropylphosphonate. Despite the established function as a bona fide N-acetyltransferase, FrbF shows no sequence similarity to any member of the GCN5-like N-acetyltransferase (GNAT) superfamily. Here, we present the 2.0 {angstrom} resolution crystal structure of FrbF in complex with acetyl-CoA, which demonstrates a unique architecture that is distinct from those of canonical GNAT-like acetyltransferases. We also utilized the co-crystal structure to guide structure-functionmore » studies that identified the roles of putative active site residues in the acetyltransferase mechanism. The combined biochemical and structural analyses of FrbF provide insights into this previously uncharacterized family of N-acetyltransferases and also provide a molecular framework toward the production of novel N-acyl derivatives of FR-900098.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, Huixian; Wacker, Daniel; Mileni, Mauro

Opioid receptors mediate the actions of endogenous and exogenous opioids on many physiological processes, including the regulation of pain, respiratory drive, mood, and - in the case of {kappa}-opioid receptor ({kappa}-OR) - dysphoria and psychotomimesis. Here we report the crystal structure of the human {kappa}-OR in complex with the selective antagonist JDTic, arranged in parallel dimers, at 2.9 {angstrom} resolution. The structure reveals important features of the ligand-binding pocket that contribute to the high affinity and subtype selectivity of JDTic for the human {kappa}-OR. Modelling of other important {kappa}-OR-selective ligands, including the morphinan-derived antagonists norbinaltorphimine and 5'-guanidinonaltrindole, and the diterpenemore » agonist salvinorin A analogue RB-64, reveals both common and distinct features for binding these diverse chemotypes. Analysis of site-directed mutagenesis and ligand structure-activity relationships confirms the interactions observed in the crystal structure, thereby providing a molecular explanation for {kappa}-OR subtype selectivity, and essential insights for the design of compounds with new pharmacological properties targeting the human {kappa}-OR.« less

Crystal structure of (Mo,W){sub 9}O{sub 25}, homologue of the Mo{sub 4}O{sub 11} (Orthorhombic)-type structure

DOE Office of Scientific and Technical Information (OSTI.GOV)

D`Yachenko, O.G.; Tabachenko, V.V.; Sundberg, M.

The structure of Mo{sub 7.6}W{sub 1.4}O{sup 25} has been determined from single crystal X-ray data. The symmetry is monoclinic with lattice parameters a = 5.448(1), b = 27.639(8), c = 6.739 (1) {angstrom}, {beta} = 90.180(9){degrees}, and space group P2{sub 1}/n. The refinement led to R = 0.046 for 2060 observed unique reflections. The Mo:W ratio was confirmed by microanalysis. The (Mo, W){sub 9}O{sub 25} structure is built up of cornersharing distorted MO{sub 6} octahedra in slabs of ReO{sub 3}-type, cut parallel to (211) and seven octahedra wide along two subcell axes. The slabs appear alternatively in mirrored orientations. Themore » slabs are mutually linked by corner sharing of fairly regular MoO{sub 4} tetrahedra so that five-sided tunnels are formed. High-resolution electron microscopy images showed well-ordered crystal fragments.« less

The Structure of the Anti-tuberculosis Antibiotics Viomycin and Capreomycin Bound to the 70S Ribosome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stanley, R.; Blaha, G; Grodzicki, R

2010-01-01

Viomycin and capreomycin belong to the tuberactinomycin family of antibiotics, which are among the most effective antibiotics against multidrug-resistant tuberculosis. Here we present two crystal structures of the 70S ribosome in complex with three tRNAs and bound to either viomycin or capreomycin at 3.3- and 3.5-{angstrom} resolution, respectively. Both antibiotics bind to the same site on the ribosome, which lies at the interface between helix 44 of the small ribosomal subunit and helix 69 of the large ribosomal subunit. The structures of these complexes suggest that the tuberactinomycins inhibit translocation by stabilizing the tRNA in the A site in themore » pretranslocation state. In addition, these structures show that the tuberactinomycins bind adjacent to the binding sites for the paromomycin and hygromycin B antibiotics, which may enable the development of new derivatives of tuberactinomycins that are effective against drug-resistant strains.« less

The structures of the anti-tuberculosis antibiotics viomycin and capreomycin bound to the 70S ribosome

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stanley, Robin E.; Blaha, Gregor; Grodzicki, Robert L.

2010-05-03

Viomycin and capreomycin belong to the tuberactinomycin family of antibiotics, which are among the most effective antibiotics against multidrug-resistant tuberculosis. Here we present two crystal structures of the 70S ribosome in complex with three tRNAs and bound to either viomycin or capreomycin at 3.3- and 3.5-{angstrom} resolution, respectively. Both antibiotics bind to the same site on the ribosome, which lies at the interface between helix 44 of the small ribosomal subunit and helix 69 of the large ribosomal subunit. The structures of these complexes suggest that the tuberactinomycins inhibit translocation by stabilizing the tRNA in the A site in themore » pretranslocation state. In addition, these structures show that the tuberactinomycins bind adjacent to the binding sites for the paromomycin and hygromycin B antibiotics, which may enable the development of new derivatives of tuberactinomycins that are effective against drug-resistant strains.« less

Crystal Structure of the Frizzled-Like Cysteine-Rich Domain of the Receptor Tyrosine Kinase MuSK

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stiegler, A.; Burden, S; Hubbard, S

Muscle-specific kinase (MuSK) is an essential receptor tyrosine kinase for the establishment and maintenance of the neuromuscular junction (NMJ). Activation of MuSK by agrin, a neuronally derived heparan-sulfate proteoglycan, and LRP4 (low-density lipoprotein receptor-related protein-4), the agrin receptor, leads to clustering of acetylcholine receptors on the postsynaptic side of the NMJ. The ectodomain of MuSK comprises three immunoglobulin-like domains and a cysteine-rich domain (Fz-CRD) related to those in Frizzled proteins, the receptors for Wnts. Here, we report the crystal structure of the MuSK Fz-CRD at 2.1 {angstrom} resolution. The structure reveals a five-disulfide-bridged domain similar to CRDs of Frizzled proteinsmore » but with a divergent C-terminal region. An asymmetric dimer present in the crystal structure implicates surface hydrophobic residues that may function in homotypic or heterotypic interactions to mediate co-clustering of MuSK, rapsyn, and acetylcholine receptors at the NMJ.« less

Structural and Functional Analyses of a Glycoside Hydrolase Family 5 Enzyme with an Unexpected [beta]-Fucosidase Activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yoshida, Shosuke; Park, David S.; Bae, Brian

2012-02-15

We present characterization of PbFucA, a family 5 glycoside hydrolase (GH5) from Prevotella bryantii B{sub 1}4. While GH5 members typically are xylanases, PbFucA shows no activity toward xylan polysaccharides. A screen against a panel of p-nitrophenol coupled sugars identifies PbFucA as a {beta}-D-fucosidase. We also present the 2.2 {angstrom} resolution structure of PbFucA and use structure-based mutational analysis to confirm the role of catalytically essential residues. A comparison of the active sites of PbFucA with those of family 5 and 51 glycosidases reveals that while the essential catalytic framework is identical between these enzymes, the steric contours of the respectivemore » active site clefts are distinct and likely account for substrate discrimination. Our results show that members of this cluster of orthologous group (COG) 5520 have {beta}-D-fucosidase activities, despite showing an overall sequence and structural similarity to GH-5 xylanases.« less

Temperature, density and magnetic field structure of the corona during the total eclipse of 1999 August 11

NASA Astrophysics Data System (ADS)

Habbal, S. R.; Johnson, J.; Nisenson, P.; Woo, R.; Fineschi, S.; Esser, R.; Wood, C. H.; Hale, J.; Forman, M. A.; Johnson, J. A.; Jabbour, J.

2000-05-01

The goal of the eclipse expedition of the Harvard-Smithsonian Center for Astrophysics on 1999 August 11 to Ayn Diwar in Syria was to explore the temperature, density and magnetic structure of the corona through simultaneous imaging in the Fe X 6374, XIV 5303 and XI 7892 Angstroms lines, the Hα 6563 Angstroms line, and the polarized brightness or white light. Polarization measurements were made in the Fe XIV 5303 Angstroms and Hα 6563 Angstroms lines to yield the direction of the coronal magnetic field. Inferences of the temperature distribution were made from the three iron lines, while density profiles were derived from the polarized brightness measurements. Supporting space based observations were acquired with LASCO and UVCS on SOHO. The comprehensive diagnostic resulting from the analysis of the observations of the close-to-spherically symmetric corona of 1999 August 11 approaching solar maximum will be presented. Funding for this research was provided by NSF grant ATM 9521733 to the Smithsonian Astrophysical Observatory. We acknowledge the generous hospitality and support bestowed upon the team by the Syrian Ministry of Higher Education to conduct the experiment in Syria. The digitization of the photographic film was made with the help of Dr. J. Thornton and S. Sarafian from the Image Science Laboratory at Polaroid Corporation.

Colossal terahertz nonlinearity of tunneling van der Waals gap (Conference Presentation)

NASA Astrophysics Data System (ADS)

Bahk, Young-Mi; Kang, Bong Joo; Kim, Yong Seung; Kim, Joon-Yeon; Kim, Won Tae; Kim, Tae Yun; Kang, Taehee; Rhie, Ji Yeah; Han, Sanghoon; Park, Cheol-Hwan; Rotermund, Fabian; Kim, Dai-Sik

2016-09-01

We manufactured an array of three angstrom-wide, five millimeter-long van der Waals gaps of copper-graphene-copper composite, in which unprecedented nonlinearity was observed. To probe and manipulate van der Waals gaps with long wavelength electromagnetic waves such as terahertz waves, one is required to fabricate vertically oriented van der Waals gaps sandwiched between two metal planes with an infinite length in the sense of being much larger than any of the wavelengths used. By comparison with the simple vertical stacking of metal-graphene-metal structure, in our structure, background signals are completely blocked enabling all the light to squeeze through the gap without any strays. When the angstrom-sized van der Waals gaps are irradiated with intense terahertz pulses, the transient voltage across the gap reaches up to 5 V with saturation, sufficiently strong to deform the quantum barrier of angstrom gaps. The large transient potential difference across the gap facilitates electron tunneling through the quantum barrier, blocking terahertz waves completely. This negative feedback of electron tunneling leads to colossal nonlinear optical response, a 97% decrease in the normalized transmittance. Our technology for infinitely long van der Waals gaps can be utilized for other atomically thin materials than single layer graphene, enabling linear and nonlinear angstrom optics in a broad spectral range.

Synthesis and structural characterization of (C sub 5 Me sub 5 )Zr(R) sub 2 (L) sub n sup + complexes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Crowther, D.J.; Jordan, R.F.; Baenziger, N.C.

1990-09-01

The reaction of (C{sub 5}Me{sub 5})Zr(CH{sub 3}){sub 3} with ((C{sub 5}H{sub 4}Me){sub 2}Fe)(BPh{sub 4}) in THF yields ((C{sub 5}Me{sub 5})Zr(CH{sub 3}){sub 2}(THF){sub 2})(BPh{sub 4}) (1) via oxidative cleavage of a Zr-CH{sub 3} bond. X-ray diffraction reveals that the cation of 1 adopts a square-pyramidal/four-legged piano-stool structure with cis CH{sub 3} groups. The orientations of the THF ligands and the Zr-O bond distances suggest that Zr-O {pi}-bonding is important for at least one of the THF ligands. Data for 1: a = 14.551 (2) {angstrom}, b = 15.191 (4) {angstrom}, c = 17.852 (19) {angstrom}, {beta} = 92.26 (3){degree}, V =more » 3,943 (6) {angstrom}{sup 3}, Z = 4 in space group P2{sub 1}/c. Reaction of 1 with excess dmpe in THF solution yields ((C{sub 5}Me{sub 5})Zr(CH{sub 3}){sub 2}(dmpe)(THF))(BPh{sub 4}) (2), which also has been characterized by X-ray diffraction.« less

Synthesis, Structures, and Vibrational Spectroscopy of the Two-Dimensional Iodates Ln(IO) 3 and Ln(IO 3) 3(H 2O) ( Ln-Yb,Lu)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Assefa, Zerihun; Ling, Jie; Haire, Richard

2006-01-01

The reaction of Lu3+ or Yb3+ and H5IO6 in aqueous media at 180 C leads to the formation of Yb(IO3)3(H2O) or Lu(IO3)3(H2O), respectively, while the reaction of Yb metal with H5IO6 under similar reaction conditions gives rise to the anhydrous iodate, Yb(IO3)3. Under supercritical conditions Lu3+ reacts with HIO3 and KIO4 to yield the isostructural Lu(IO3)3. The structures have been determined by single-crystal X-ray diffraction. Crystallographic data are (MoKa, {lambda}=0.71073 {angstrom}): Yb(IO3)3, monoclinic, space group P21/n, a=8.6664(9) {angstrom}, b=5.9904(6) {angstrom}, c=14.8826(15) {angstrom}, {beta}=96.931(2){sup o}, V=766.99(13), Z=4, R(F)=4.23% for 114 parameters with 1880 reflections with I>2s(I); Lu(IO3)3, monoclinic, space group P21/n,more » a=8.6410(9), b=5.9961(6), c=14.8782(16) {angstrom}, {beta}=97.028(2){sup o}, V=765.08(14), Z=4, R(F)=2.65% for 119 parameters with 1756 reflections with I>2s(I); Yb(IO3)3(H2O), monoclinic, space group C2/c, a=27.2476(15), b=5.6296(3), c=12.0157(7) {angstrom}, {beta}=98.636(1){sup o}, V=1822.2(2), Z=8, R(F)=1.51% for 128 parameters with 2250 reflections with I>2s(I); Lu(IO3)3(H2O), monoclinic, space group C2/c, a=27.258(4), b=5.6251(7), c=12.0006(16) {angstrom}, {beta}=98.704(2){sup o}, V=1818.8(4), Z=8, R(F)=1.98% for 128 parameters with 2242 reflections with I>2s(I). The f elements in all of the compounds are found in seven-coordinate environments and bridged with monodentate, bidentate, or tridentate iodate anions. Both Lu(IO3)3(H2O) and Yb(IO3)3(H2O) display distinctively different vibrational profiles from their respective anhydrous analogs. Hence, the Raman profile can be used as a complementary diagnostic tool to discern the different structural motifs of the compounds.« less

Spectroscopic Classification of PSN J11492548-0507138 as a Type Ia Supernova

NASA Astrophysics Data System (ADS)

Rudy, R. J.; Ardila, D. R.; Crawford, K. B.; Moody, M. S. L.; Safrit, T. K.; Puetter, R. C.

2015-07-01

Optical and IR spectra from 0.47-2.5 microns (resolution: 5-30 angstroms) of PSN J11492548-0507138 (ATEL #7732) were obtained on 2015 July 12.15 with the Shane 3.0 m Telescope of Lick Observatory using the Aerospace Corporation's Visible and Infrared Imaging Spectrograph (VNIRIS).

Development and applications of optical interferometric micrometrology in the Angstrom and subangstrom range

NASA Technical Reports Server (NTRS)

Lauer, James L.; Abel, Phillip B.

1988-01-01

The characteristics of the scanning tunneling microscope and atomic force microscope (AFM) are briefly reviewed, and optical methods, mainly interferometry, of sufficient resolution to measure AFM deflections are discussed. The methods include optical resonators, laser interferometry, multiple-beam interferometry, and evanescent wave detection. Experimental results using AFM are reviewed.

Analysis of achievable disturbance attenuation in a precision magnetically-suspended motion control system

NASA Technical Reports Server (NTRS)

Kuzin, Alexander V.; Holmes, Michael L.; Behrouzjou, Roxana; Trumper, David L.

1994-01-01

The results of the analysis of the achievable disturbance attenuation to get an Angstrom motion control resolution and macroscopic travel in a precision magnetically-suspended motion control system are presented in this paper. Noise sources in the transducers, electronics, and mechanical vibrations are used to develop the control design.

Crystal structures of dioxonium hexafluorotantalate and dioxonium hexafluoroniobate complexes with tetrabenzo-30-crown-10

DOE Office of Scientific and Technical Information (OSTI.GOV)

Furmanova, N. G., E-mail: furm@ns.crys.ras.ru; Rabadanov, M. Kh.; Chernaya, T. S.

2008-03-15

Two isostructural complexes of dioxonium [H{sub 5}O{sub 2}]{sup +} with tetrabenzo-30-crown-10 of the compositions [(tetrabenzo-30-crown-10 {center_dot} H{sub 5}O{sub 2})][TaF{sub 6}] (I) and [(tetrabenzo-30-crown-10 {center_dot} H{sub 5}O{sub 2})][NbF{sub 6}] (II) are studied using X-ray diffraction. The complexes crystallize in the monoclinic crystal system (space group C2/c, Z = 4). The unit cell parameters of these compounds are as follows: a = 15.6583(12) Angstrom-Sign , b = 15.2259(13) Angstrom-Sign , c = 16.4473(13) Angstrom-Sign , and {beta} = 99.398(6) Degree-Sign for complex I and a = 15.7117(12) Angstrom-Sign , b = 15.2785(15) Angstrom-Sign , c = 16.5247(15) Angstrom-Sign , and {beta} =more » 99.398(7) Degree-Sign for complex II. These complexes belong to the ionic type. The dioxonium cation [H{sub 5}O{sub 2}]{sup +} in the form of the two-unit cluster [H{sub 3}O {center_dot} H{sub 2}O]{sup +} is stabilized by the strong hydrogen bond OH Midline-Horizontal-Ellipsis O [O Midline-Horizontal-Ellipsis O, 2.353(4) Angstrom-Sign ] and encapsulated by the crown ether. Each oxygen atom of the dioxonium cation also forms two oxygen bonds O Midline-Horizontal-Ellipsis O(crown). The crown ether adopts an unusual two-level (pocket-like) conformation, which provides a complete encapsulation of the oxonium associate. The interaction of the cationic complex with the anion in the crystal occurs through contacts of the C-H Midline-Horizontal-Ellipsis F type.« less

Daughter Species Abundances in Comet C/2014 Q2 (Lovejoy)

NASA Astrophysics Data System (ADS)

McKay, Adam; Cochran, Anita; Dello Russo, Neil; Kelley, Michael

2015-11-01

We present analysis of high spectral resolution optical spectra of C/2014 Q2 (Lovejoy) acquired with the Tull Coude spectrometer on the 2.7-meter Harlan J. Smith Telescope at McDonald Observatory and the ARCES spectrometer mounted on the 3.5-meter Astrophysical Research Consortium Telescope at Apache Point Observatory. Both Tull Coude and ARCES provide high spectral resolution (R=30,000-60,000) and a large spectral range of approximately 3500-10000 Angstroms. We obtained two observation epochs, one in February 2015 at a heliocentric distance of 1.3 AU, and another in May 2015 at a heliocentric distance of 1.9 AU. Another epoch in late August 2015 at a heliocentric distance of 3.0 AU is scheduled. We will present production rates of the daughter species CN, C3, CH, C2, and NH2. We will also present H2O production rates derived from the [OI]6300 emission, as well as measurements of the flux ratio of the [OI]5577 Angstrom line to the sum of the [OI]6300 and [OI]6364 Angstrom lines (sometimes referred to as the oxygen line ratio). This ratio is indicative of the CO2 abundance of the comet. As we have observations at several heliocentric distances, we will examine how production rates and mixing ratios of the various species change with heliocentric distance. We will compare our oxygen line measurements to observations of CO2 made with Spitzer, as well as our other daughter species observations to those of candidate parent molecules made at IR wavelengths.

Structural Mechanisms of Inactivation in Scabies Mite Serine Protease Paralogues

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fischer, Katja; Langendorf, Christopher G.; Irving, James A.

2009-08-07

The scabies mite (Sarcoptes scabiei) is a parasite responsible for major morbidity in disadvantaged communities and immuno-compromised patients worldwide. In addition to the physical discomfort caused by the disease, scabies infestations facilitate infection by Streptococcal species via skin lesions, resulting in a high prevalence of rheumatic fever/heart disease in affected communities. The scabies mite produces 33 proteins that are closely related to those in the dust mite group 3 allergen and belong to the S1-like protease family (chymotrypsin-like). However, all but one of these molecules contain mutations in the conserved active-site catalytic triad that are predicted to render them catalyticallymore » inactive. These molecules are thus termed scabies mite inactivated protease paralogues (SMIPPs). The precise function of SMIPPs is unclear; however, it has been suggested that these proteins might function by binding and protecting target substrates from cleavage by host immune proteases, thus preventing the host from mounting an effective immune challenge. In order to begin to understand the structural basis for SMIPP function, we solved the crystal structures of SMIPP-S-I1 and SMIPP-S-D1 at 1.85 {angstrom} and 2.0 {angstrom} resolution, respectively. Both structures adopt the characteristic serine protease fold, albeit with large structural variations over much of the molecule. In both structures, mutations in the catalytic triad together with occlusion of the S1 subsite by a conserved Tyr200 residue is predicted to block substrate ingress. Accordingly, we show that both proteases lack catalytic function. Attempts to restore function (via site-directed mutagenesis of catalytic residues as well as Tyr200) were unsuccessful. Taken together, these data suggest that SMIPPs have lost the ability to bind substrates in a classical 'canonical' fashion, and instead have evolved alternative functions in the lifecycle of the scabies mite.« less

Expression, Purification, Crystallization And Preliminary X-Ray Studies of a Prolyl-4-Hydroxylase Protein From Bacillus Anthracis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, M.A.; Scott, E.E.; Limburg, J.

2009-05-26

Collagen prolyl-4-hydroxylase (C-P4H) catalyzes the hydroxylation of specific proline residues in procollagen, which is an essential step in collagen biosynthesis. A new form of P4H from Bacillus anthracis (anthrax-P4H) that shares many characteristics with the type I C-P4H from human has recently been characterized. The structure of anthrax-P4H could provide important insight into the chemistry of C-P4Hs and into the function of this unique homodimeric P4H. X-ray diffraction data of selenomethionine-labeled anthrax-P4H recombinantly expressed in Escherichia coli have been collected to 1.4 {angstrom} resolution.

Aerosol and Cloud Interaction Observed From High Spectral Resolution Lidar Data

NASA Technical Reports Server (NTRS)

Su, Wenying; Schuster, Gregory L.; Loeb, Norman G.; Rogers, Raymond R.; Ferrare, Richard A.; Hostetler, Chris A.; Hair, Johnathan W.; Obland, Michael D.

2008-01-01

Recent studies utilizing satellite retrievals have shown a strong correlation between aerosol optical depth (AOD) and cloud cover. However, these retrievals from passive sensors are subject to many limitations, including cloud adjacency (or 3D) effects, possible cloud contamination, uncertainty in the AOD retrieval. Some of these limitations do not exist in High Spectral Resolution Lidar (HSRL) observations; for instance, HSRL observations are not a ected by cloud adjacency effects, are less prone to cloud contamination, and offer accurate aerosol property measurements (backscatter coefficient, extinction coefficient, lidar ratio, backscatter Angstrom exponent,and aerosol optical depth) at a neospatial resolution (less than 100 m) in the vicinity of clouds. Hence, the HSRL provides an important dataset for studying aerosol and cloud interaction. In this study, we statistically analyze aircraft-based HSRL profiles according to their distance from the nearest cloud, assuring that all profile comparisons are subject to the same large-scale meteorological conditions. Our results indicate that AODs from HSRL are about 17% higher in the proximity of clouds (approximately 100 m) than far away from clouds (4.5 km), which is much smaller than the reported cloud 3D effect on AOD retrievals. The backscatter and extinction coefficients also systematically increase in the vicinity of clouds, which can be explained by aerosol swelling in the high relative humidity (RH) environment and/or aerosol growth through in cloud processing (albeit not conclusively). On the other hand, we do not observe a systematic trend in lidar ratio; we hypothesize that this is caused by the opposite effects of aerosol swelling and aerosol in-cloud processing on the lidar ratio. Finally, the observed backscatter Angstrom exponent (BAE) does not show a consistent trend because of the complicated relationship between BAE and RH. We demonstrate that BAE should not be used as a surrogate for Angstrom exponent, especially at high RH.

A Study Of The Kinematics Of Stellar Sub-populations In M31's Disk And Spheroid Using PHAT And SPLASH Data

NASA Astrophysics Data System (ADS)

Guhathakurta, Puragra; Dorman, C.; Seth, A.; Dalcanton, J.; Gilbert, K.; Howley, K.; Johnson, L. C.; Kalirai, J.; Krause, T.; Lang, D.; Williams, B.; PHAT Team; SPLASH Collaboration

2012-01-01

We present a comparative study of the kinematics of different types of stars in the Andromeda galaxy (M31). Our fields of study span a range of projected radii from 2 to 15 kpc in the NE and SE quadrants of M31's disk and spheroid. The kinematical part of this study is based on radial velocity measurements of a few thousand stars obtained using the Keck II telescope and DEIMOS spectrograph as part of the SPLASH survey. The DEIMOS spectra have a spectral resolution of about 1.5 Angstrom (FWHM) and cover the wavelength range 6500-9000 Angstrom. The stellar populations part of this study - specifically, the division of stars into sub-populations - is based on high spatial resolution Hubble Space Telescope (HST) Advanced Camera for Surveys (ACS) and Wide-Field Camera 3 (WFC3) images and photometry in six filters: two ultraviolet bands (F275W and F336W), two optical bands (F475W and F814W), and two near-infrared bands (F110W and F160W). The stellar sub-populations we study include metal-rich, metal-intermediate, and metal-poor red giants, asymptotic giant branch stars, He-burning blue loop stars, massive main sequence stars, planetary nebulae, and X-ray binaries. Kinematical information allows us to measure the fraction of each sub-population that is associated with M31's disk versus its spheroid. The excellent synergy between HST and Keck provides insight into the relationship between the dynamical, star formation, and chemical enrichment histories of the structural sub-components of M31 and, by association, other large spiral galaxies. This research was supported by the National Science Foundation, NASA, and the Science Internship Program (SIP) at UCSC.

Preliminary crystallographic analysis of mouse Elf3 C-terminal DNA-binding domain in complex with type II TGF-[beta] receptor promoter DNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Agarkar, Vinod B.; Babayeva, Nigar D.; Rizzino, Angie

2010-10-08

Ets proteins are transcription factors that activate or repress the expression of genes that are involved in various biological processes, including cellular proliferation, differentiation, development, transformation and apoptosis. Like other Ets-family members, Elf3 functions as a sequence-specific DNA-binding transcriptional factor. A mouse Elf3 C-terminal fragment (amino-acid residues 269-371) containing the DNA-binding domain has been crystallized in complex with mouse type II TGF-{beta} receptor promoter (TR-II) DNA. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 42.66, b = 52, c = 99.78 {angstrom}, and diffracted to a resolution of 2.2 {angstrom}.

Growth Defects in Biomacromolecular Crystals

NASA Technical Reports Server (NTRS)

2003-01-01

NASA's ground based program confirmed close similarity between protein and small molecules crystal growth, but also revealed essential differences. No understanding exists as to why and when crystals grown in space are, in approx. 20 percent of cases, of higher quality. More rationale is needed in flight experiments. Ferritin crystals grown in space are 2.5 times cleaner than their terrestrial counterparts. This may occur because of the existence of a zone depleted with respect to impurities around a crystal growing in stagnant solution. This zone should appear since the distribution coefficient for homologous impurities exceeds unity. This impurity depletion zone hypothesis requires verification and development. Thorough purification from homologous impurities brought about resolution improvement from 2.6 to 1.8 angstroms for ferritin and from 2.6 to 2.0 angstroms for canavalin.

Structural and Functional Analyses of a Conserved Hydrophobic Pocket of Flavivirus Methyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

H Dong; L Liu; G Zou

2011-12-31

The flavivirus methyltransferase (MTase) sequentially methylates the N7 and 2'-O positions of the viral RNA cap (GpppA-RNA {yields} m(7)GpppA-RNA {yields} m(7)GpppAm-RNA), using S-adenosyl-l-methionine (AdoMet) as a methyl donor. We report here that sinefungin (SIN), an AdoMet analog, inhibits several flaviviruses through suppression of viral MTase. The crystal structure of West Nile virus MTase in complex with SIN inhibitor at 2.0-{angstrom} resolution revealed a flavivirus-conserved hydrophobic pocket located next to the AdoMet-binding site. The pocket is functionally critical in the viral replication and cap methylations. In addition, the N7 methylation efficiency was found to correlate with the viral replication ability. Thus,more » SIN analogs with modifications that interact with the hydrophobic pocket are potential specific inhibitors of flavivirus MTase.« less

Structural basis for antibody-mediated neutralization of Lassa virus.

PubMed

Hastie, Kathryn M; Zandonatti, Michelle A; Kleinfelter, Lara M; Heinrich, Megan L; Rowland, Megan M; Chandran, Kartik; Branco, Luis M; Robinson, James E; Garry, Robert F; Saphire, Erica Ollmann

2017-06-02

The arenavirus Lassa causes severe hemorrhagic fever and a significant disease burden in West Africa every year. The glycoprotein, GPC, is the sole antigen expressed on the viral surface and the critical target for antibody-mediated neutralization. Here we present the crystal structure of the trimeric, prefusion ectodomain of Lassa GP bound to a neutralizing antibody from a human survivor at 3.2-angstrom resolution. The antibody extensively anchors two monomers together at the base of the trimer, and biochemical analysis suggests that it neutralizes by inhibiting conformational changes required for entry. This work illuminates pH-driven conformational changes in both receptor-binding and fusion subunits of Lassa virus, illustrates the unique assembly of the arenavirus glycoprotein spike, and provides a much-needed template for vaccine design against these threats to global health. Copyright © 2017, American Association for the Advancement of Science.

Monomer/Dimer Transition of the Caspase-Recruitment Domain of Human Nod1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Srimathi,T.; Robbins, S.; Dubas, R.

2008-01-01

Nod1 is an essential cytoplasmic sensor for bacterial peptidoglycans in the innate immune system. The caspase-recruitment domain of Nod1 (Nod1{_}CARD) is indispensable for recruiting a downstream kinase, receptor-interacting protein 2 (RIP2), that activates nuclear factor-?B (NF-?B). The crystal structure of human Nod1{_}CARD at 1.9 Angstroms resolution reveals a novel homodimeric conformation. Our structural and biochemical analysis shows that the homodimerization of Nod1{_}CARD is achieved by swapping the H6 helices at the carboxy termini and stabilized by forming an interchain disulfide bond between the Cys39 residues of the two monomers in solution and in the crystal. In addition, we present experimentalmore » evidence for a pH-sensitive conformational change of Nod1{_}CARD. Our results suggest that the pH-sensitive monomer/dimer transition is a unique molecular property of Nod1{_}CARD.« less

Structure of Rotavirus Outer-Layer Protein VP7 Bound with a Neutralizing Fab

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aoki, Scott T.; Settembre, Ethan C.; Trask, Shane D.

2009-06-17

Rotavirus outer-layer protein VP7 is a principal target of protective antibodies. Removal of free calcium ions (Ca{sup 2+}) dissociates VP7 trimers into monomers, releasing VP7 from the virion, and initiates penetration-inducing conformational changes in the other outer-layer protein, VP4. We report the crystal structure at 3.4 angstrom resolution of VP7 bound with the Fab fragment of a neutralizing monoclonal antibody. The Fab binds across the outer surface of the intersubunit contact, which contains two Ca{sup 2+} sites. Mutations that escape neutralization by other antibodies suggest that the same region bears the epitopes of most neutralizing antibodies. The monovalent Fab ismore » sufficient to neutralize infectivity. We propose that neutralizing antibodies against VP7 act by stabilizing the trimer, thereby inhibiting the uncoating trigger for VP4 rearrangement. A disulfide-linked trimer is a potential subunit immunogen.« less

Na[superscript +] binding to meizothrombin desF1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Papaconstantinou, M.E.; Gandhi, P.S.; Chen, Z.

2009-06-10

Meizothrombin is the physiologically active intermediate generated by a single cleavage of prothrombin at R320 to separate the A and B chains. Recent evidence has suggested that meizothrombin, like thrombin, is a Na{sup +}-activated enzyme. In this study we present the first X-ray crystal structure of human meizothrombin desF1 solved in the presence of the active site inhibitor PPACK at 2.1 {angstrom} resolution. The structure reveals a Na{sup +} binding site whose architecture is practically identical to that of human thrombin. Stopped-flow measurements of Na{sup +} binding to meizothrombin desF1 document a slow phase of fluorescence change with a kmore » obs decreasing hyperbolically with increasing [Na{sup +}], consistent with the existence of three conformations in equilibrium, E*, E and E:Na{sup +}, as for human thrombin. Evidence that meizothrombin exists in multiple conformations provides valuable new information for studies of the mechanism of prothrombin activation.« less

Serial femtosecond crystallography at the SACLA: breakthrough to dynamic structural biology.

PubMed

Mizohata, Eiichi; Nakane, Takanori; Fukuda, Yohta; Nango, Eriko; Iwata, So

2018-04-01

X-ray crystallography visualizes the world at the atomic level. It has been used as the most powerful technique for observing the three-dimensional structures of biological macromolecules and has pioneered structural biology. To determine a crystal structure with high resolution, it was traditionally required to prepare large crystals (> 200 μm). Later, synchrotron radiation facilities, such as SPring-8, that produce powerful X-rays were built. They enabled users to obtain good quality X-ray diffraction images even with smaller crystals (ca. 200-50 μm). In recent years, one of the most important technological innovations in structural biology has been the development of X-ray free electron lasers (XFELs). The SPring-8 Angstrom Compact free electron LAser (SACLA) in Japan generates the XFEL beam by accelerating electrons to relativistic speeds and directing them through in-vacuum, short-period undulators. Since user operation started in 2012, we have been involved in the development of serial femtosecond crystallography (SFX) measurement systems using XFEL at the SACLA. The SACLA generates X-rays a billion times brighter than SPring-8. The extremely bright XFEL pulses enable data collection with microcrystals (ca. 50-1 μm). Although many molecular analysis techniques exist, SFX is the only technique that can visualize radiation-damage-free structures of biological macromolecules at room temperature in atomic resolution and fast time resolution. Here, we review the achievements of the SACLA-SFX Project in the past 5 years. In particular, we focus on: (1) the measurement system for SFX; (2) experimental phasing by SFX; (3) enzyme chemistry based on damage-free room-temperature structures; and (4) molecular movie taken by time-resolved SFX.

A Dream of a Mission: Stellar Imager and Seismic Probe

NASA Technical Reports Server (NTRS)

Carpenter, Kenneth G.; Schrijver, Carolus J.; Fisher, Richard R. (Technical Monitor)

2000-01-01

The Stellar Imager and Seismic Probe (SISP) is a mission to understand the various effects of magnetic fields of stars, the dynamos that generate them, and the internal structure and dynamics of the stars in which they exist. The ultimate goal is to achieve the best-possible forecasting of solar activity on times scales ranging up to decades, and an understanding of the impact of stellar magnetic activity on astrobiology and life in the Universe. The road to that goal will revolutionize our understanding of stars and stellar systems, the building blocks of the Universe. SISP will zoom in on what today - with few exceptions - we only know as point sources, revealing processes never before seen, thus providing a tool to astrophysics as fundamental as the microscope is to the study of life on Earth. SISP is an ultraviolet aperture-synthesis imager with 8-10 telescopes with meter-class apertures, and a central hub with focal-plane instrumentation that allows spectrophotometry in passbands as narrow as a few Angstroms up to hundreds of Angstroms. SISP will image stars and binaries with one hundred to one thousand resolution elements on their surface, and sound their interiors through asteroseismology to image internal structure, differential rotation, and large-scale circulations; this will provide accurate knowledge of stellar structure and evolution and complex transport processes, and will impact numerous branches of (astro)physics ranging from the Big Bang to the future of the Universe. Fitting naturally within the NASA long-term time line, SISP complements defined missions, and with them will show us entire other solar systems, from the central star to their orbiting planets.

Thioredoxin Reductase From Thermoplasma Acidophilum: a New Twist on Redox Regulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hernandez, H.H.; Jaquez, O.A.; Hamill, M.J.

2009-05-18

Thioredoxin reductases (TrxRs) regulate the intracellular redox environment by using NADPH to provide reducing equivalents for thioredoxins (Trxs). Here we present the cloning and biochemical characterization of a putative TrxR (Ta0984) and a putative Trx (Ta0866) from Thermoplasma acidophilum. Our data identify Ta0866 as a Trx through its capacity to reduce insulin and be reduced by Escherichia coli TrxR in a NADPH-dependent manner. Our data also establish Ta0984 as a TrxR due to its ability to reduce T. acidophilum Trx (taTrx), although not in a NADPH- or NADH-dependent manner. To explore the apparent inability of taTrxR to use NADPH ormore » NADH as a reductant, we carried out a complete electrochemical characterization, which suggests that redox potential is not the source of this nonreactivity [Hamill et al. (2008) Biochemistry 47, 9738-9746]. Turning to crystallographic analysis, a 2.35 {angstrom} resolution structure of taTrxR, also presented here, shows that despite the overall structural similarity to the well-characterized TrxR from E. coli (RMSD 1.30 {angstrom}{sup 2} for chain A), the 'NADPH binding pocket' is not conserved. E. coli TrxR residues implicated in NADPH binding, H175, R176, R177, and R181, have been substituted with E185, Y186, M187, and M191 in the ta protein. Thus, we have identified a Trx and TrxR protein system from T. acidophilum for which the TrxR shares overall structural and redox properties with other TrxRs but lacks the appropriate binding motif to use the standard NADPH reductant. Our discovery of a TrxR that does not use NADPH provides a new twist in redox regulation.« less

Structural and Thermodynamic Signatures of DNA Recognition by Mycobacterium tuberculosis DnaA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsodikov, Oleg V.; Biswas, Tapan

An essential protein, DnaA, binds to 9-bp DNA sites within the origin of replication oriC. These binding events are prerequisite to forming an enigmatic nucleoprotein scaffold that initiates replication. The number, sequences, positions, and orientations of these short DNA sites, or DnaA boxes, within the oriCs of different bacteria vary considerably. To investigate features of DnaA boxes that are important for binding Mycobacterium tuberculosis DnaA (MtDnaA), we have determined the crystal structures of the DNA binding domain (DBD) of MtDnaA bound to a cognate MtDnaA-box (at 2.0 {angstrom} resolution) and to a consensus Escherichia coli DnaA-box (at 2.3 {angstrom}). Thesemore » structures, complemented by calorimetric equilibrium binding studies of MtDnaA DBD in a series of DnaA-box variants, reveal the main determinants of DNA recognition and establish the [T/C][T/A][G/A]TCCACA sequence as a high-affinity MtDnaA-box. Bioinformatic and calorimetric analyses indicate that DnaA-box sequences in mycobacterial oriCs generally differ from the optimal binding sequence. This sequence variation occurs commonly at the first 2 bp, making an in vivo mycobacterial DnaA-box effectively a 7-mer and not a 9-mer. We demonstrate that the decrease in the affinity of these MtDnaA-box variants for MtDnaA DBD relative to that of the highest-affinity box TTGTCCACA is less than 10-fold. The understanding of DnaA-box recognition by MtDnaA and E. coli DnaA enables one to map DnaA-box sequences in the genomes of M. tuberculosis and other eubacteria.« less

Crystal structure of delta9 stearoyl-acyl carrier protein desaturase from castor seed and its relationship to other di-iron proteins.

PubMed Central

Lindqvist, Y; Huang, W; Schneider, G; Shanklin, J

1996-01-01

The three-dimensional structure of recombinant homodimeric delta9 stearoyl-acyl carrier protein desaturase, the archetype of the soluble plant fatty acid desaturases that convert saturated to unsaturated fatty acids, has been determined by protein crystallographic methods to a resolution of 2.4 angstroms. The structure was solved by a combination of single isomorphous replacement, anomalous contribution from the iron atoms to the native diffraction data and 6-fold non-crystallographic symmetry averaging. The 363 amino acid monomer consists of a single domain of 11 alpha-helices. Nine of these form an antiparallel helix bundle. The enzyme subunit contains a di-iron centre, with ligands from four of the alpha-helices in the helix bundle. The iron ions are bound in a highly symmetric environment, with one of the irons forming interactions with the side chains of E196 and H232 and the second iron with the side chains of E105 and H146. Two additional glutamic acid side chains, from E143 and E229, are within coordination distance to both iron ions. A water molecule is found within the second coordination sphere from the iron atoms. The lack of electron density corresponding to a mu-oxo bridge, and the long (4.2 angstroms) distance between the iron ions suggests that this probably represents the diferrous form of the enzyme. A deep channel which probably binds the fatty acid extends from the surface into the interior of the enzyme. Modelling of the substrate, stearic acid, into this channel places the delta9 carbon atom in the vicinity of one of the iron ions. Images PMID:8861937

Crystal structure of delta9 stearoyl-acyl carrier protein desaturase from castor seed and its relationship to other di-iron proteins.

PubMed

Lindqvist, Y; Huang, W; Schneider, G; Shanklin, J

1996-08-15

The three-dimensional structure of recombinant homodimeric delta9 stearoyl-acyl carrier protein desaturase, the archetype of the soluble plant fatty acid desaturases that convert saturated to unsaturated fatty acids, has been determined by protein crystallographic methods to a resolution of 2.4 angstroms. The structure was solved by a combination of single isomorphous replacement, anomalous contribution from the iron atoms to the native diffraction data and 6-fold non-crystallographic symmetry averaging. The 363 amino acid monomer consists of a single domain of 11 alpha-helices. Nine of these form an antiparallel helix bundle. The enzyme subunit contains a di-iron centre, with ligands from four of the alpha-helices in the helix bundle. The iron ions are bound in a highly symmetric environment, with one of the irons forming interactions with the side chains of E196 and H232 and the second iron with the side chains of E105 and H146. Two additional glutamic acid side chains, from E143 and E229, are within coordination distance to both iron ions. A water molecule is found within the second coordination sphere from the iron atoms. The lack of electron density corresponding to a mu-oxo bridge, and the long (4.2 angstroms) distance between the iron ions suggests that this probably represents the diferrous form of the enzyme. A deep channel which probably binds the fatty acid extends from the surface into the interior of the enzyme. Modelling of the substrate, stearic acid, into this channel places the delta9 carbon atom in the vicinity of one of the iron ions.

New Images of the Solar Corona

NASA Astrophysics Data System (ADS)

Gurman, Joseph B.; Thompson, Barbara J.; Newmark, Jeffrey A.; Deforest, Craig E.

In 1.5 years of operation, The Extreme Ultraviolet Imaging Telescope (EIT) on SOHO has obtained over 40,000 images of the Sun in four wavebands between 171 Angstroms and 304 Angstroms, with spatial resolution limited only by the pixel scale of 2.59 arcsec. These images, and in particular compilations of time series of images into digital movies, have changed several of our ideas about the corona at temperatures of 0.9 - 2.5 MK. For the first time, we are able to see outflow in polar plumes and microjets inputting momentum into the high-speed, polar wind flow. For the first time, in conjunction with the LASCO coronagraphs and ground-based He I imagers, we have been able to see all the structures involved in coronal mass ejections (CMEs), from the surface of the Sun to 30 solar radii above it. In several cases, we have been able to observe directly the dramatic Moreton waves emanating from the active region where the CMEs originate, and radiating across virtually the entire visible hemisphere of the Sun. We interpret these large-scale coronal disturbances as fast-mode waves. Such events appear in the SOHO-LASCO coronagraphs as earthward-directed, and several have been detected by solar wind monitoring experiments on SOHO and other spacecraft. We have been able to view a variety of small-scale phenomena as well, including motions in prominences and filaments, macrospicular and polar microjet eruptions, and fine structures in the polar crown filament belt. The multi-wavelength capability of EIT makes it possible to determine the temperature of the coronal plasma and, here, too, we have been afforded a novel view: the heating in coronal active regions occurs over a considerably larger area than the high-density loops structures alone (i.e., bright features) would indicate.

Structural and Biophysical Analysis of BST-2/Tetherin Ectodomains Reveals an Evolutionary Conserved Design to Inhibit Virus Release

DOE Office of Scientific and Technical Information (OSTI.GOV)

Swiecki, M.; Allaire, M.; Scheaffer, S.

2011-01-28

BST-2/tetherin is a host antiviral molecule that functions to potently inhibit the release of enveloped viruses from infected cells. In return, viruses have evolved antagonists to this activity. BST-2 traps budding virions by using two separate membrane-anchoring regions that simultaneously incorporate into the host and viral membranes. Here, we detailed the structural and biophysical properties of the full-length BST-2 ectodomain, which spans the two membrane anchors. The 1.6-{angstrom} crystal structure of the complete mouse BST-2 ectodomain reveals an {approx}145-{angstrom} parallel dimer in an extended {alpha}-helix conformation that predominantly forms a coiled coil bridged by three intermolecular disulfides that are requiredmore » for stability. Sequence analysis in the context of the structure revealed an evolutionarily conserved design that destabilizes the coiled coil, resulting in a labile superstructure, as evidenced by solution x-ray scattering displaying bent conformations spanning 150 and 180 {angstrom} for the mouse and human BST-2 ectodomains, respectively. Additionally, crystal packing analysis revealed possible curvature-sensing tetrameric structures that may aid in proper placement of BST-2 during the genesis of viral progeny. Overall, this extended coiled-coil structure with inherent plasticity is undoubtedly necessary to accommodate the dynamics of viral budding while ensuring separation of the anchors.« less

A Crystal Structure of a Dimer of the Antibiotic Ramoplanin Illustrates Membrane Positioning and a Potential Lipid II Docking Interface

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hamburger, J.; Hoertz, A; Lee, A

2009-01-01

The glycodepsipeptide antibiotic ramoplanin A2 is in late stage clinical development for the treatment of infections from Gram-positive pathogens, especially those that are resistant to first line antibiotics such as vancomycin. Ramoplanin A2 achieves its antibacterial effects by interfering with production of the bacterial cell wall; it indirectly inhibits the transglycosylases responsible for peptidoglycan biosynthesis by sequestering their Lipid II substrate. Lipid II recognition and sequestration occur at the interface between the extracellular environment and the bacterial membrane. Therefore, we determined the structure of ramoplanin A2 in an amphipathic environment, using detergents as membrane mimetics, to provide the most physiologicallymore » relevant structural context for mechanistic and pharmacological studies. We report here the X-ray crystal structure of ramoplanin A2 at a resolution of 1.4 {angstrom}. This structure reveals that ramoplanin A2 forms an intimate and highly amphipathic dimer and illustrates the potential means by which it interacts with bacterial target membranes. The structure also suggests a mechanism by which ramoplanin A2 recognizes its Lipid II ligand.« less

Crystal and Molecular Structure of a Collagen-Like Peptide at 1.9 overset{circ}{A} Resolution

NASA Astrophysics Data System (ADS)

Bella, Jordi; Eaton, Mark; Brodsky, Barbara; Berman, Helen M.

1994-10-01

The structure of a protein triple helix has been determined at 1.9 angstrom resolution by x-ray crystallographic studies of a collagen-like peptide containing a single substitution of the consensus sequence. This peptide adopts a triple-helical structure that confirms the basic features determined from fiber diffraction studies on collagen: supercoiling of polyproline II helices and interchain hydrogen bonding that follows the model II of Rich and Crick. In addition, the structure provides new information concerning the nature of this protein fold. Each triple helix is surrounded by a cylinder of hydration, with an extensive hydrogen bonding network between water molecules and peptide acceptor groups. Hydroxyproline residues have a critical role in this water network. The interaxial spacing of triple helices in the crystal is similar to that in collagen fibrils, and the water networks linking adjacent triple helices in the crystal structure are likely to be present in connective tissues. The breaking of the repeating (X-Y-Gly)_n pattern by a Gly-->Ala substitution results in a subtle alteration of the conformation, with a local untwisting of the triple helix. At the substitution site, direct interchain hydrogen bonds are replaced with interstitial water bridges between the peptide groups. Similar conformational changes may occur in Gly-->X mutated collagens responsible for the diseases osteogenesis imperfecta, chondrodysplasias, and Ehlers-Danlos syndrome IV.

Atomic resolution of Lithium Ions in LiCoO

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shao-Horn, Yang; Croguennec, Laurence; Delmas, Claude

2003-03-18

LiCoO2 is the most common lithium storage material for lithium rechargeable batteries, used widely to power portable electronic devices such as laptop computers. Lithium arrangements in the CoO2 framework have a profound effect on the structural stability and electrochemical properties of LixCoO2 (0 < x < 1), however, probing lithium ions has been difficult using traditional X-ray and neutron diffraction techniques. Here we have succeeded in simultaneously resolving columns of cobalt, oxygen, and lithium atoms in layered LiCoO2 battery material using experimental focal series of LiCoO2 images obtained at sub-Angstrom resolution in a mid-voltage transmission electron microscope. Lithium atoms aremore » the smallest and lightest metal atoms, and scatter electrons only very weakly. We believe our observations of lithium to be the first by electron microscopy, and that they show promise to direct visualization of the ordering of lithium and vacancy in LixCoO2.« less

Apo And Calcium-Bound Crystal Structures of Alpha-11 Giardin, An Unusual Annexin From 'Giardia Lamblia'

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pathuri, P.; Nguyen, E.T.; Svard, S.G.

2007-07-12

Alpha-11 giardin is a member of the multi-gene alpha-giardin family in the intestinal protozoan, Giardia lamblia. This gene family shares an ancestry with the annexin super family, whose common characteristic is calcium-dependent binding to membranes that contain acidic phospholipids. Several alpha giardins are highly expressed during parasite-induced diarrhea in humans. Despite being a member of a large family of proteins, little is known about the function and cellular localization of alpha-11 giardin, although giardins are often associated with the cytoskeleton. It has been shown that Giardia exhibits high levels of alpha-11 giardin mRNA transcript throughout its life cycle; however, constitutivemore » over-expression of this protein is lethal to the parasite. Determining the three-dimensional structure of an alpha-giardin is essential to identifying functional domains shared in the alpha-giardin family. Here we report the crystal structures of the apo and Ca{sup 2+}-bound forms of alpha-11 giardin, the first alpha giardin to be characterized structurally. Crystals of apo and Ca{sup 2+}-bound alpha-11 giardin diffracted to 1.1 angstroms and 2.93 angstroms, respectively. The crystal structure of selenium-substituted apo alpha-11 giardin reveals a planar array of four tandem repeats of predominantly {alpha}-helical domains, reminiscent of previously determined annexin structures, making this the highest-resolution structure of an annexin to date. The apo alpha-11 giardin structure also reveals a hydrophobic core formed between repeats I/IV and II/III, a region typically hydrophilic in other annexins. Surprisingly, the Ca{sup 2+}-bound structure contains only a single calcium ion, located in the DE loop of repeat I and coordinated differently from the two types of calcium sites observed in previous annexin structures. The apo and Ca{sup 2+}-bound alpha-11 giardin structures assume overall similar conformations; however, Ca2+-bound alpha-11 giardin crystallized in a lower-symmetry space group with four molecules in the asymmetric unit. Vesicle-binding studies suggest that alpha-11 giardin, unlike most other annexins, does not bind to vesicles composed of acidic phospholipids in a calcium-dependent manner.« less

(Pentamethylcyclopentadienyl)molybdenum(IV) chloride. Synthesis, structure, and properties

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abugideiri, F.; Desai, J.U.; Gordon, J.C.

1994-08-17

Three different syntheses of trichloro(pentamethylcyclopentadienyl)molybdenum(IV) are described, I.E. (1) thermal decarbonylation of Cp{sup *}MoCl{sub 3}(CO){sub 2}, (2) reduction of Cp{sup *}MoCl{sub 4}, and (3) chlorination of [Cp{sup *}MoCl{sub 2}]{sub 2}. A fourth route (conproportionation of [Cp{sup *}MoCl{sub 2}]{sub 2} and Cp{sup *}MoCl{sub 4}) has been investigated by {sup 1}H-NMR. The product has a dinuclear, dichloro-bridged structure with a four-legged piano stool geometry around each metal atom; the two piano stools have a mutual anti arrangement and the two metals are 3.888(1) {Angstrom} from each other, indicating the absence of a direct metal-metal bonding interaction. Crystal data: monoclinic, space group P2{submore » 1}/n, a = 8.424(1) {Angstrom}, b = 13.323(4) {Angstrom}, c = 11.266(2) {Angstrom}, {beta} = 93.87(1){degrees}, V = 1261.6(8) {Angstrom}{sup 3}, Z = 2, R = 0.038, R{sub w} = 0.057 for 127 parameters and 1350 observed reflections with F{sub o}{sup 2} > 3{sigma}(F{sub o}{sup 2}). The temperature dependent magnetic moment of the material could be fit to the sum of two Bleany-Bowers equations. [Cp{sup *}MoCl{sub 3}]{sub 2} reacts readily with CO, Cl{sup {minus}}, and PMe{sub 3} to afford Cp{sup *}MoCl{sub 3}(CO){sub 2}, [Cp{sup *}MoCl{sub 4}]{sup {minus}}, and Cp{sup *}MoCl{sub 3}(PMe{sub 3}), respectively, while the reaction with 1,2-bis(diphenylphosphino)ethane (dppe) affords the reduction product Cp{sup *}MoCl{sub 2}(dppe).« less

QSO Lyalpha Absorption Lines in Galaxy Superclusters and Voids

NASA Astrophysics Data System (ADS)

Stocke, J. T.; Shull, J. M.; Penton, S.; Burks, G.; Donahue, M.

1993-12-01

We have used the Hubble Space Telescope (HST) Goddard High Resolution Spectrograph (GHRS) to search for Lyalpha absorption clouds in nearby galaxy voids (cz <= 10,000 km s(-1) ). Thus far, we have obtained GHRS spectra (G160M, 1225 -- 1255 Angstroms, 0.25 Angstroms resolution) of three very bright Active Galactic Nuclei, Mrk 501, I Zw I, and Mrk 335, at V <= 14.5. We find 4 probable (4.0 sigma - 4.5 sigma ) and 4 definite (5 sigma - 16 sigma ) Lyalpha absorption lines, with equivalent widths W_λ = 50 - 200 m Angstroms, corresponding to column densities N(H I) = 10(13) -- 10(14) cm(-2) , assuming a typical Doppler parameter of b = 25 km s(-1) . Based on an updated version of the CfA redshift survey (Huchra and Clemens, private communication), most of these Lyalpha systems appear to be associated with supercluster - sized ``strings'' of galaxies similar to the ``Great Wall''. Toward Mrk 501, the nearest bright galaxy at the redshift of the strongest (200 m Angstroms) Lyalpha cloud lies 500 h75(-1) kpc off the line of sight. Models of H I disks exposed to the intergalactic ionizing radiation field (Dove & Shull 1994, ApJ, 423, in press) show that the N(H I) = 10(13) cm(-2) contour in a typical spiral galaxy is reached at 100 kpc radial extent. Thus, the Lyalpha absorbers associated with galaxy-string systems may be the result of H I in an extended halo, in dwarf satellite galaxies (M_B > -15), or in tidally-stripped gas. Most importantly for cosmological origins of baryons, one (4.3 sigma ) Lyalpha absorption line in the spectrum of Mrk 501 lies within the galaxy void in the foreground of the ``Great Wall''. The nearest bright galaxy, to a level M_B <= -18.5 for H_0 = 75 km s(-1) Mpc(-1) , is more than 5 Mpc away. A pencil-beam survey of faint galaxies to M_B = -16.0 finds no galaxy within 100 h75(-1) kpc of the line of sight, at or near the absorber redshift.

Structural biology. Structural basis for chemokine recognition and activation of a viral G protein-coupled receptor.

PubMed

Burg, John S; Ingram, Jessica R; Venkatakrishnan, A J; Jude, Kevin M; Dukkipati, Abhiram; Feinberg, Evan N; Angelini, Alessandro; Waghray, Deepa; Dror, Ron O; Ploegh, Hidde L; Garcia, K Christopher

2015-03-06

Chemokines are small proteins that function as immune modulators through activation of chemokine G protein-coupled receptors (GPCRs). Several viruses also encode chemokines and chemokine receptors to subvert the host immune response. How protein ligands activate GPCRs remains unknown. We report the crystal structure at 2.9 angstrom resolution of the human cytomegalovirus GPCR US28 in complex with the chemokine domain of human CX3CL1 (fractalkine). The globular body of CX3CL1 is perched on top of the US28 extracellular vestibule, whereas its amino terminus projects into the central core of US28. The transmembrane helices of US28 adopt an active-state-like conformation. Atomic-level simulations suggest that the agonist-independent activity of US28 may be due to an amino acid network evolved in the viral GPCR to destabilize the receptor's inactive state. Copyright © 2015, American Association for the Advancement of Science.

Structure of a C-terminal fragment of its Vps53 subunit suggests similarity of Golgi-associated retrograde protein (GARP) complex to a family of tethering complexes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vasan, Neil; Hutagalung, Alex; Novick, Peter

2010-08-13

The Golgi-associated retrograde protein (GARP) complex is a membrane-tethering complex that functions in traffic from endosomes to the trans-Golgi network. Here we present the structure of a C-terminal fragment of the Vps53 subunit, important for binding endosome-derived vesicles, at a resolution of 2.9 {angstrom}. We show that the C terminus consists of two {alpha}-helical bundles arranged in tandem, and we identify a highly conserved surface patch, which may play a role in vesicle recognition. Mutations of the surface result in defects in membrane traffic. The fold of the Vps53 C terminus is strongly reminiscent of proteins that belong to threemore » other tethering complexes - Dsl1, conserved oligomeric Golgi, and the exocyst - thought to share a common evolutionary origin. Thus, the structure of the Vps53 C terminus suggests that GARP belongs to this family of complexes.« less

How to Switch Off a Histidine Kinase: Crystal Structure of Geobacillus Stearothermophilus KinB with the Inhibitor Sda

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bick, M.; Lamour, V; Rajashankar, K

2009-01-01

Entry to sporulation in bacilli is governed by a histidine kinase phosphorelay, a variation of the predominant signal transduction mechanism in prokaryotes. Sda directly inhibits sporulation histidine kinases in response to DNA damage and replication defects. We determined a 2.0-Angstroms-resolution X-ray crystal structure of the intact cytoplasmic catalytic core [comprising the dimerization and histidine phosphotransfer domain (DHp domain), connected to the ATP binding catalytic domain] of the Geobacillus stearothermophilus sporulation kinase KinB complexed with Sda. Structural and biochemical analyses reveal that Sda binds to the base of the DHp domain and prevents molecular transactions with the DHp domain to whichmore » it is bound by acting as a simple molecular barricade. Sda acts to sterically block communication between the catalytic domain and the DHp domain, which is required for autophosphorylation, as well as to sterically block communication between the response regulator Spo0F and the DHp domain, which is required for phosphotransfer and phosphatase activities.« less

Homologue Structure of the SLAC1 Anion Channel for Closing Stomata in Leaves

DOE Office of Scientific and Technical Information (OSTI.GOV)

Y Chen; L Hu; M Punta

2011-12-31

The plant SLAC1 anion channel controls turgor pressure in the aperture-defining guard cells of plant stomata, thereby regulating the exchange of water vapour and photosynthetic gases in response to environmental signals such as drought or high levels of carbon dioxide. Here we determine the crystal structure of a bacterial homologue (Haemophilus influenzae) of SLAC1 at 1.20 {angstrom} resolution, and use structure-inspired mutagenesis to analyse the conductance properties of SLAC1 channels. SLAC1 is a symmetrical trimer composed from quasi-symmetrical subunits, each having ten transmembrane helices arranged from helical hairpin pairs to form a central five-helix transmembrane pore that is gated bymore » an extremely conserved phenylalanine residue. Conformational features indicate a mechanism for control of gating by kinase activation, and electrostatic features of the pore coupled with electrophysiological characteristics indicate that selectivity among different anions is largely a function of the energetic cost of ion dehydration.« less

Structure-Based Design of Potent Bcl-2/Bcl-xL Inhibitors with Strong in Vivo Antitumor Activity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhou, Haibin; Aguilar, Angelo; Chen, Jianfang

Bcl-2 and Bcl-xL are key apoptosis regulators and attractive cancer therapeutic targets. We have designed and optimized a class of small-molecule inhibitors of Bcl-2 and Bcl-xL containing a 4,5-diphenyl-1H-pyrrole-3-carboxylic acid core structure. A 1.4 {angstrom} resolution crystal structure of a lead compound, 12, complexed with Bcl-xL has provided a basis for our optimization. The most potent compounds, 14 and 15, bind to Bcl-2 and Bcl-xL with subnanomolar K{sub i} values and are potent antagonists of Bcl-2 and Bcl-xL in functional assays. Compounds 14 and 15 inhibit cell growth with low nanomolar IC{sub 50} values in multiple small-cell lung cancer cellmore » lines and induce robust apoptosis in cancer cells at concentrations as low as 10 nM. Compound 14 also achieves strong antitumor activity in an animal model of human cancer.« less

The Structure of Sucrose Synthase-1 from Arabidopsis thaliana and Its Functional Implications

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zheng, Yi; Anderson, Spencer; Zhang, Yanfeng

2014-10-02

Sucrose transport is the central system for the allocation of carbon resources in vascular plants. During growth and development, plants control carbon distribution by coordinating sites of sucrose synthesis and cleavage in different plant organs and different cellular locations. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, provides a direct and reversible means to regulate sucrose flux. Depending on the metabolic environment, sucrose synthase alters its cellular location to participate in cellulose, callose, and starch biosynthesis through its interactions with membranes, organelles, and cytoskeletal actin. The x-ray crystal structure of sucrose synthase isoform 1 from Arabidopsis thaliana (AtSus1) hasmore » been determined as a complex with UDP-glucose and as a complex with UDP and fructose, at 2.8- and 2.85-{angstrom} resolutions, respectively. The AtSus1 structure provides insights into sucrose catalysis and cleavage, as well as the regulation of sucrose synthase and its interactions with cellular targets.« less

Crystal Structures of Human and Staphylococcus aureus Pyruvate Carboxylase and Molecular Insights into the Carboxyltransfer Reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Xiang,S.; Tong, L.

2008-01-01

Pyruvate carboxylase (PC) catalyzes the biotin-dependent production of oxaloacetate and has important roles in gluconeogenesis, lipogenesis, insulin secretion and other cellular processes. PC contains the biotin carboxylase (BC), carboxyltransferase (CT) and biotin-carboxyl carrier protein (BCCP) domains. We report here the crystal structures at 2.8-Angstroms resolution of full-length PC from Staphylococcus aureus and the C-terminal region (missing only the BC domain) of human PC. A conserved tetrameric association is observed for both enzymes, and our structural and mutagenesis studies reveal a previously uncharacterized domain, the PC tetramerization (PT) domain, which is important for oligomerization. A BCCP domain is located in themore » active site of the CT domain, providing the first molecular insights into how biotin participates in the carboxyltransfer reaction. There are dramatic differences in domain positions in the monomer and the organization of the tetramer between these enzymes and the PC from Rhizobium etli.« less

An Active Site Water Network in the Plasminogen Activator Pla from Yersinia pestis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Eren, Elif; Murphy, Megan; Goguen, Jon

2010-08-13

The plasminogen activator Pla from Yersinia pestis is an outer membrane protease (omptin) that is important for the virulence of plague. Here, we present the high-resolution crystal structure of wild-type, enzymatically active Pla at 1.9 {angstrom}. The structure shows a water molecule located between active site residues D84 and H208, which likely corresponds to the nucleophilic water. A number of other water molecules are present in the active site, linking residues important for enzymatic activity. The R211 sidechain in loop L4 is close to the nucleophilic water and possibly involved in the stabilization of the oxyanion intermediate. Subtle conformational changesmore » of H208 result from the binding of lipopolysaccharide to the outside of the barrel, explaining the unusual dependence of omptins on lipopolysaccharide for activity. The Pla structure suggests a model for the interaction with plasminogen substrate and provides a more detailed understanding of the catalytic mechanism of omptin proteases.« less

Structural Characterization and Reversal of the Natural Organophosphate Resistance of a D-Type Esterase, Saccharomyces cerevisiae S-Formylglutathione Hydrolase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Legler,P.; Kumaran, D.; Swaminathan, S.

2008-01-01

Saccharomyces cerevisiae expresses a 67.8 kDa homodimeric serine thioesterase, S-formylglutathione hydrolase (SFGH), that is 39.9% identical with human esterase D. Both enzymes possess significant carboxylesterase and S-formylglutathione thioesterase activity but are unusually resistant to organophosphate (OP) inhibitors. We determined the X-ray crystal structure of yeast (y) SFGH to 2.3 Angstroms resolution by multiwavelength anomalous dispersion and used the structure to guide site-specific mutagenesis experiments addressing substrate and inhibitor reactivity. Our results demonstrate a steric mechanism of OP resistance mediated by a single indole ring (W197) located in an enzyme 'acyl pocket'. The W197I substitution enhances ySFGH reactivity with paraoxon bymore » >1000-fold (kiW197I = 16 {+-} 2 mM-1 h-1), thereby overcoming natural OP resistance. W197I increases the rate of OP inhibition under pseudo-first-order conditions but does not accelerate OP hydrolysis. The structure of the paraoxon-inhibited W197I variant was determined by molecular replacement (2.2 Angstroms); it revealed a stabilized sulfenic acid at Cys60. Wild-type (WT) ySFGH is inhibited by thiol reactive compounds and is sensitive to oxidation; thus, the cysteine sulfenic acid may play a role in the regulation of a 'D-type' esterase. The structure of the W197I variant is the first reported cysteine sulfenic acid in a serine esterase. We constructed five Cys60/W197I variants and show that introducing a positive charge near the oxyanion hole, W197I/C60R or W197I/C60K, results in a further enhancement of the rates of phosphorylation with paraoxon (ki = 42 or 80 mM-1 h-1, respectively) but does not affect the dephosphorylation of the enzyme. We also characterized three histidine substitutions near the oxyanion hole, G57H, L58H, and M162H, which significantly decrease esterase activity.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Caspi, S.; Schlueter, R.; Tatchyn, R.

Linac-driven X-Ray Free Electron Lasers (e.g., Linac Coherent Light Sources (LCLSs)), operating on the principle of single-pass saturation in the Self-Amplified Spontaneous Emission (SASE) regime typically require multi-GeV beam energies and undulator lengths in excess of tens of meters to attain sufficient gain in the 1{angstrom}--0.1{angstrom} range. In this parameter regime, the undulator structure must provide: (1) field amplitudes B{sub 0} in excess of 1T within periods of 4cm or less, (2) peak on-axis focusing gradients on the order of 30T/m, and (3) field quality in the 0.1%--0.3% range. In this paper the authors report on designs under consideration formore » a 4.5--1.5 {angstrom} LCLS based on superconducting (SC), hybrid/PM, and pulsed-Cu technologies.« less

Crystal structure of enterococcus faecalis sly A-like transcriptional factor.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu, R.; Zhang, R.; Zagnitko, O.

2003-05-30

The crystal structure of a SlyA transcriptional regulator at 1.6 {angstrom} resolution is presented, and structural relationships between members of the MarR/SlyA family are discussed. The SlyA family, which includes SlyA, Rap, Hor, and RovA proteins, is widely distributed in bacterial and archaeal genomes. Current evidence suggests that SlyA-like factors act as repressors, activators, and modulators of gene transcription. These proteins have been shown to up-regulate the expression of molecular chaperones, acid-resistance proteins, and cytolysin, and down-regulate several biosynthetic enzymes. The structure of SlyA from Enterococcus faecalis, determined as a part of an ongoing structural genomics initiative (www.mcsg.anl.gov), revealed themore » same winged helix DNA-binding motif that was recently found in the MarR repressor from Escherichia coli and the MexR repressor from Pseudomonas aeruginosa, a sequence homologue of MarR. Phylogenetic analysis of the MarR/SlyA family suggests that Sly is placed between the SlyA and MarR subfamilies and shows significant sequence similarity to members of both subfamilies.« less

Crystal structure of MboIIA methyltransferase.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Osipiuk, J.; Walsh, M. A.; Joachimiak, A.

2003-09-15

DNA methyltransferases (MTases) are sequence-specific enzymes which transfer a methyl group from S-adenosyl-L-methionine (AdoMet) to the amino group of either cytosine or adenine within a recognized DNA sequence. Methylation of a base in a specific DNA sequence protects DNA from nucleolytic cleavage by restriction enzymes recognizing the same DNA sequence. We have determined at 1.74 {angstrom} resolution the crystal structure of a {beta}-class DNA MTase MboIIA (M {center_dot} MboIIA) from the bacterium Moraxella bovis, the smallest DNA MTase determined to date. M {center_dot} MboIIA methylates the 3' adenine of the pentanucleotide sequence 5'-GAAGA-3'. The protein crystallizes with two molecules inmore » the asymmetric unit which we propose to resemble the dimer when M {center_dot} MboIIA is not bound to DNA. The overall structure of the enzyme closely resembles that of M {center_dot} RsrI. However, the cofactor-binding pocket in M {center_dot} MboIIA forms a closed structure which is in contrast to the open-form structures of other known MTases.« less

Role of interface layers on Tunneling Magnetoresistance

NASA Astrophysics Data System (ADS)

Yang, See-Hun; Samant, Mahesh; Parkin, Stuart S. P.

2002-03-01

Thin non-magnetic metallic layers inserted at the interface between tunneling barriers and the ferromagnetic electrodes in magnetic tunnel junctions quenches the magnetoresistance (TMR) exhibited by some structures[1]. Studies have been carried out on exchange biased magnetic tunnel junction structures in which one of the ferromagnetic electrodes is pinned by coupling to IrMn or PtMn antiferromagnetic layers. For metallic aluminum interface layers thicknesses of just a few angstrom completely suppress the TMR although this characteristic thickness depends on the roughness of the tunneling barrier. A variety of structures will be discussed in which a number of interface layers have been introduced. In particular results for insertion of Cu, Ru and Cr layers on either side of the tunnel barrier will be presented. A number of techniques including XANES, XMCD and high resolution cross-section transmission electron microscopy have been used to study the structure and morphology of the interface layers and to correlate the structure of these layers with the magneto-transport properties of the tunneling junctions. [1] S.S.P. Parkin, US patent 5,764,567 issued by the United States Patent and Trademark Office, June 9, 1998.

Crystal structure of P58(IPK) TPR fragment reveals the mechanism for its molecular chaperone activity in UPR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tao, Jiahui; Petrova, Kseniya; Ron, David

2010-05-25

P58(IPK) might function as an endoplasmic reticulum molecular chaperone to maintain protein folding homeostasis during unfolded protein responses. P58(IPK) contains nine tetratricopeptide repeat (TPR) motifs and a C-terminal J-domain within its primary sequence. To investigate the mechanism by which P58(IPK) functions to promote protein folding within the endoplasmic reticulum, we have determined the crystal structure of P58(IPK) TPR fragment to 2.5 {angstrom} resolution by the SAD method. The crystal structure of P58(IPK) revealed three domains (I-III) with similar folds and each domain contains three TPR motifs. An ELISA assay indicated that P58(IPK) acts as a molecular chaperone by interacting withmore » misfolded proteins such as luciferase and rhodanese. The P58(IPK) structure reveals a conserved hydrophobic patch located in domain I that might be involved in binding the misfolded polypeptides. Structure-based mutagenesis for the conserved hydrophobic residues located in domain I significantly reduced the molecular chaperone activity of P58(IPK).« less

Crystal structure of substrate free form of glycerol dehydratase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liao, Der-Ing; Dotson, Garry; Turner, Jr., Ivan

2010-03-08

Glycerol dehydratase (GDH) and diol dehydratase (DDH) are highly homologous isofunctional enzymes that catalyze the elimination of water from glycerol and 1,2-propanediol (1,2-PD) to the corresponding aldehyde via a coenzyme B{sub 12}-dependent radical mechanism. The crystal structure of substrate free form of GDH in complex with cobalamin and K{sup +} has been determined at 2.5 {angstrom} resolution. Its overall fold and the subunit assembly closely resemble those of DDH. Comparison of this structure and the DDH structure, available only in substrate bound form, shows the expected change of the coordination of the essential K{sup +} from hexacoordinate to heptacoordinate withmore » the displacement of a single coordinated water by the substrate diol. In addition, there appears to be an increase in the rigidity of the K{sup +} coordination (as measured by lower B values) upon the binding of the substrate. Structural analysis of the locations of conserved residues among various GDH and DDH sequences has aided in identification of residues potentially important for substrate preference or specificity of protein-protein interactions.« less

Structure-Based Annotation of a Novel Sugar Isomerase from the Pathogenic E. coli O157:H7

DOE Office of Scientific and Technical Information (OSTI.GOV)

van Staalduinen, L.; Park, C; Yeom, S

2010-01-01

Prokaryotes can use a variety of sugars as carbon sources in order to provide a selective survival advantage. The gene z5688 found in the pathogenic Escherichia coli O157:H7 encodes a 'hypothetical' protein of unknown function. Sequence analysis identified the gene product as a putative member of the cupin superfamily of proteins, but no other functional information was known. We have determined the crystal structure of the Z5688 protein at 1.6 {angstrom} resolution and identified the protein as a novel E. coli sugar isomerase (EcSI) through overall fold analysis and secondary-structure matching. Extensive substrate screening revealed that EcSI is capable ofmore » acting on D-lyxose and D-mannose. The complex structure of EcSI with fructose allowed the identification of key active-site residues, and mutagenesis confirmed their importance. The structure of EcSI also suggested a novel mechanism for substrate binding and product release in a cupin sugar isomerase. Supplementation of a nonpathogenic E. coli strain with EcSI enabled cell growth on the rare pentose d-lyxose.« less

Imaging secondary structure of individual amyloid fibrils of a β2-microglobulin fragment using near-field infrared spectroscopy.

PubMed

Paulite, Melissa; Fakhraai, Zahra; Li, Isaac T S; Gunari, Nikhil; Tanur, Adrienne E; Walker, Gilbert C

2011-05-18

Amyloid fibril diseases are characterized by the abnormal production of aggregated proteins and are associated with many types of neuro- and physically degenerative diseases. X-ray diffraction techniques, solid-state magic-angle spinning NMR spectroscopy, circular dichroism (CD) spectroscopy, and transmission electron microscopy studies have been utilized to detect and examine the chemical, electronic, material, and structural properties of amyloid fibrils at up to angstrom spatial resolution. However, X-ray diffraction studies require crystals of the fibril to be analyzed, while other techniques can only probe the bulk solution or solid samples. In the work reported here, apertureless near-field scanning infrared microscopy (ANSIM) was used to probe the secondary structure of individual amyloid fibrils made from an in vitro solution. Simultaneous topographic and infrared images of individual amyloid fibrils synthesized from the #21-31 peptide fragment of β(2)-microglobulin were acquired. Using this technique, IR spectra of the amyloid fibrils were obtained with a spatial resolution of less than 30 nm. It is observed that the experimental scattered field spectrum correlates strongly with that calculated using the far-field absorption spectrum. The near-field images of the amyloid fibrils exhibit much lower scattering of the IR radiation at approximately 1630 cm(-1). In addition, the near-field images also indicate that composition and/or structural variations among individual amyloid fibrils were present. © 2011 American Chemical Society

Cholix Toxin, a Novel ADP-ribosylating Factor from Vibrio cholerae

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jorgensen, Rene; Purdy, Alexandra E.; Fieldhouse, Robert J.

2008-07-15

The ADP-ribosyltransferases are a class of enzymes that display activity in a variety of bacterial pathogens responsible for causing diseases in plants and animals, including those affecting mankind, such as diphtheria, cholera, and whooping cough. We report the characterization of a novel toxin from Vibrio cholerae, which we call cholix toxin. The toxin is active against mammalian cells (IC50 = 4.6 {+-} 0.4 ng/ml) and crustaceans (Artemia nauplii LD50 = 10 {+-} 2 {mu}g/ml). Here we show that this toxin is the third member of the diphthamide-specific class of ADP-ribose transferases and that it possesses specific ADP-ribose transferase activity againstmore » ribosomal eukaryotic elongation factor 2. We also describe the high resolution crystal structures of the multidomain toxin and its catalytic domain at 2.1- and 1.25-{angstrom} resolution, respectively. The new structural data show that cholix toxin possesses the necessary molecular features required for infection of eukaryotes by receptor-mediated endocytosis, translocation to the host cytoplasm, and inhibition of protein synthesis by specific modification of elongation factor 2. The crystal structures also provide important insight into the structural basis for activation of toxin ADP-ribosyltransferase activity. These results indicate that cholix toxin may be an important virulence factor of Vibrio cholerae that likely plays a significant role in the survival of the organism in an aquatic environment.« less

Crystallization and Preliminary X-ray Diffraction Analysis of Hemextin A: A Unique Anticoagulant Protein from Hemachatus haemachatus Venom

DOE Office of Scientific and Technical Information (OSTI.GOV)

Banerjee,Y.; Kumar, S.; Jobichen, C.

2007-01-01

Hemextin A was isolated and purified from African Ringhals cobra (Hemachatus haemachatus). It is a three-finger toxin that specifically inhibits blood coagulation factor VIIa and clot formation and that also interacts with hemextin B to form a unique anticoagulant complex. Hemextin A was crystallized by the hanging-drop vapor-diffusion method by equilibration against 0.2 M ammonium acetate, 0.1 M sodium acetate trihydrate pH 4.6 and 30% PEG 4000 as the precipitating agent. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 49.27, b = 49.51, c = 57.87 {angstrom} and two molecules in the asymmetricmore » unit. They diffracted to 1.5 {angstrom} resolution at beamline X25 at BNL.« less

Novel changes in discoidal high density lipoprotein morphology: a molecular dynamics study.

PubMed

Catte, Andrea; Patterson, James C; Jones, Martin K; Jerome, W Gray; Bashtovyy, Denys; Su, Zhengchang; Gu, Feifei; Chen, Jianguo; Aliste, Marcela P; Harvey, Stephen C; Li, Ling; Weinstein, Gilbert; Segrest, Jere P

2006-06-15

ApoA-I is a uniquely flexible lipid-scavenging protein capable of incorporating phospholipids into stable particles. Here we report molecular dynamics simulations on a series of progressively smaller discoidal high density lipoprotein particles produced by incremental removal of palmitoyloleoylphosphatidylcholine via four different pathways. The starting model contained 160 palmitoyloleoylphosphatidylcholines and a belt of two antiparallel amphipathic helical lipid-associating domains of apolipoprotein (apo) A-I. The results are particularly compelling. After a few nanoseconds of molecular dynamics simulation, independent of the starting particle and method of size reduction, all simulated double belts of the four lipidated apoA-I particles have helical domains that impressively approximate the x-ray crystal structure of lipid-free apoA-I, particularly between residues 88 and 186. These results provide atomic resolution models for two of the particles produced by in vitro reconstitution of nascent high density lipoprotein particles. These particles, measuring 95 angstroms and 78 angstroms by nondenaturing gradient gel electrophoresis, correspond in composition and in size/shape (by negative stain electron microscopy) to the simulated particles with molar ratios of 100:2 and 50:2, respectively. The lipids of the 100:2 particle family form minimal surfaces at their monolayer-monolayer interface, whereas the 50:2 particle family displays a lipid pocket capable of binding a dynamic range of phospholipid molecules.

Expression, Purification And Preliminary X-Ray Analysis of the C-Terminal Domain of An Arginine Repressor Protein From Mycobacterium Tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lu, G.J.; Garen, C.R.; Cherney, M.M.

2009-06-03

The gene product of an open reading frame Rv1657 from Mycobacterium tuberculosis is a putative arginine repressor protein (ArgR), a transcriptional factor that regulates the expression of arginine-biosynthetic enzymes. Rv1657 was expressed and purified and a C-terminal domain was crystallized using the hanging-drop vapour-diffusion method. Diffraction data were collected and processed to a resolution of 2.15 {angstrom}. The crystals belong to space group P1 and the Matthews coefficient suggests that the crystals contain six C-terminal domain molecules per unit cell. Previous structural and biochemical studies on the arginine repressor proteins from other organisms have likewise shown the presence of sixmore » molecules per unit cell.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pemble,C.; Johnson, L.; Kridel, S.

Human fatty acid synthase (FAS) is uniquely expressed at high levels in many tumor types. Pharmacological inhibition of FAS therefore represents an important therapeutic opportunity. The drug Orlistat, which has been approved by the US Food and Drug Administration, inhibits FAS, induces tumor cell-specific apoptosis and inhibits the growth of prostate tumor xenografts. We determined the 2.3-{angstrom}-resolution crystal structure of the thioesterase domain of FAS inhibited by Orlistat. Orlistat was captured in the active sites of two thioesterase molecules as a stable acyl-enzyme intermediate and as the hydrolyzed product. The details of these interactions reveal the molecular basis for inhibitionmore » and suggest a mechanism for acyl-chain length discrimination during the FAS catalytic cycle. Our findings provide a foundation for the development of new cancer drugs that target FAS.« less

Crystal structures of human 108V and 108M catechol O-methyltransferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rutherford, K.; Le Trong, I.; Stenkamp, R.E.

2008-08-01

Catechol O-methyltransferase (COMT) plays important roles in the metabolism of catecholamine neurotransmitters and catechol estrogens. The development of COMT inhibitors for use in the treatment of Parkinson's disease has been aided by crystallographic structures of the rat enzyme. However, the human and rat proteins have significantly different substrate specificities. Additionally, human COMT contains a common valine-methionine polymorphism at position 108. The methionine protein is less stable than the valine polymorph, resulting in decreased enzyme activity and protein levels in vivo. Here we describe the crystal structures of the 108V and 108M variants of the soluble form of human COMT boundmore » with S-adenosylmethionine (SAM) and a substrate analog, 3,5-dinitrocatechol. The polymorphic residue 108 is located in the {alpha}5-{beta}3 loop, buried in a hydrophobic pocket {approx}16 {angstrom} from the SAM-binding site. The 108V and 108M structures are very similar overall [RMSD of C{sup {alpha}} atoms between two structures (C{sup {alpha}} RMSD) = 0.2 {angstrom}], and the active-site residues are superposable, in accord with the observation that SAM stabilizes 108M COMT. However, the methionine side chain is packed more tightly within the polymorphic site and, consequently, interacts more closely with residues A22 ({alpha}2) and R78 ({alpha}4) than does valine. These interactions of the larger methionine result in a 0.7-{angstrom} displacement in the backbone structure near residue 108, which propagates along {alpha}1 and {alpha}5 toward the SAM-binding site. Although the overall secondary structures of the human and rat proteins are very similar (C{sup {alpha}} RMSD = 0.4 {angstrom}), several nonconserved residues are present in the SAM-(I89M, I91M, C95Y) and catechol- (C173V, R201M, E202K) binding sites. The human protein also contains three additional solvent-exposed cysteine residues (C95, C173, C188) that may contribute to intermolecular disulfide bond formation and protein aggregation.« less

PUMA: the first results of a nebular spectrograph for the study of the kinematics of interstellar medium

NASA Astrophysics Data System (ADS)

Langarica, Rosalia; Bernal, Abel; Rosado, Margarita; Cobos Duenas, Francisco J.; Garfias, Fernando; Gutierrez, Leonel; Le Coarer, Etienne; Tejada, Carlos; Tinoco, Silvio J.

1998-07-01

The kinematics of the interstellar medium may be studied by means of a scanning Fabry-Perot interferometer (SFPI). This allows the coverage of a wider field of view with higher spatial and spectral resolution than when a high-dispersion classical spectrograph is used. The system called PUMA consists of a focal reducer and a SFPI installed in the 2.1 m telescope of the San Pedro Martir National Astronomical Observatory (SPM), Mexico, in its f/7.5 configuration. It covers a field of view of 10 arcmin providing direct images as well as interferograms which are focused on a 1024 X 1024 Tektronix CCD, covering a wide spectral range. It is considered the integration of other optical elements for further developments. The optomechanical system and the developed software allow exact, remote positioning of all movable parts and control the FPI scanning and data acquisition. The parallelism of the interferometer plates is automatically achieved by a custom method. The PUMA provides spectral resolutions of 0.414 Angstrom and a free spectral range of 19.8 Angstrom. Results of high quality that compete with those obtained by similar systems in bigger telescopes, are presented.

Membrane protein structure determination by SAD, SIR, or SIRAS phasing in serial femtosecond crystallography using an iododetergent

PubMed Central

Nakane, Takanori; Hanashima, Shinya; Suzuki, Mamoru; Saiki, Haruka; Hayashi, Taichi; Kakinouchi, Keisuke; Sugiyama, Shigeru; Kawatake, Satoshi; Matsuoka, Shigeru; Matsumori, Nobuaki; Nango, Eriko; Kobayashi, Jun; Shimamura, Tatsuro; Kimura, Kanako; Mori, Chihiro; Kunishima, Naoki; Sugahara, Michihiro; Takakyu, Yoko; Inoue, Shigeyuki; Masuda, Tetsuya; Hosaka, Toshiaki; Tono, Kensuke; Joti, Yasumasa; Kameshima, Takashi; Hatsui, Takaki; Inoue, Tsuyoshi; Nureki, Osamu; Iwata, So; Murata, Michio; Mizohata, Eiichi

2016-01-01

The 3D structure determination of biological macromolecules by X-ray crystallography suffers from a phase problem: to perform Fourier transformation to calculate real space density maps, both intensities and phases of structure factors are necessary; however, measured diffraction patterns give only intensities. Although serial femtosecond crystallography (SFX) using X-ray free electron lasers (XFELs) has been steadily developed since 2009, experimental phasing still remains challenging. Here, using 7.0-keV (1.771 Å) X-ray pulses from the SPring-8 Angstrom Compact Free Electron Laser (SACLA), iodine single-wavelength anomalous diffraction (SAD), single isomorphous replacement (SIR), and single isomorphous replacement with anomalous scattering (SIRAS) phasing were performed in an SFX regime for a model membrane protein bacteriorhodopsin (bR). The crystals grown in bicelles were derivatized with an iodine-labeled detergent heavy-atom additive 13a (HAD13a), which contains the magic triangle, I3C head group with three iodine atoms. The alkyl tail was essential for binding of the detergent to the surface of bR. Strong anomalous and isomorphous difference signals from HAD13a enabled successful phasing using reflections up to 2.1-Å resolution from only 3,000 and 4,000 indexed images from native and derivative crystals, respectively. When more images were merged, structure solution was possible with data truncated at 3.3-Å resolution, which is the lowest resolution among the reported cases of SFX phasing. Moreover, preliminary SFX experiment showed that HAD13a successfully derivatized the G protein-coupled A2a adenosine receptor crystallized in lipidic cubic phases. These results pave the way for de novo structure determination of membrane proteins, which often diffract poorly, even with the brightest XFEL beams. PMID:27799539

Membrane protein structure determination by SAD, SIR, or SIRAS phasing in serial femtosecond crystallography using an iododetergent.

PubMed

Nakane, Takanori; Hanashima, Shinya; Suzuki, Mamoru; Saiki, Haruka; Hayashi, Taichi; Kakinouchi, Keisuke; Sugiyama, Shigeru; Kawatake, Satoshi; Matsuoka, Shigeru; Matsumori, Nobuaki; Nango, Eriko; Kobayashi, Jun; Shimamura, Tatsuro; Kimura, Kanako; Mori, Chihiro; Kunishima, Naoki; Sugahara, Michihiro; Takakyu, Yoko; Inoue, Shigeyuki; Masuda, Tetsuya; Hosaka, Toshiaki; Tono, Kensuke; Joti, Yasumasa; Kameshima, Takashi; Hatsui, Takaki; Yabashi, Makina; Inoue, Tsuyoshi; Nureki, Osamu; Iwata, So; Murata, Michio; Mizohata, Eiichi

2016-11-15

The 3D structure determination of biological macromolecules by X-ray crystallography suffers from a phase problem: to perform Fourier transformation to calculate real space density maps, both intensities and phases of structure factors are necessary; however, measured diffraction patterns give only intensities. Although serial femtosecond crystallography (SFX) using X-ray free electron lasers (XFELs) has been steadily developed since 2009, experimental phasing still remains challenging. Here, using 7.0-keV (1.771 Å) X-ray pulses from the SPring-8 Angstrom Compact Free Electron Laser (SACLA), iodine single-wavelength anomalous diffraction (SAD), single isomorphous replacement (SIR), and single isomorphous replacement with anomalous scattering (SIRAS) phasing were performed in an SFX regime for a model membrane protein bacteriorhodopsin (bR). The crystals grown in bicelles were derivatized with an iodine-labeled detergent heavy-atom additive 13a (HAD13a), which contains the magic triangle, I3C head group with three iodine atoms. The alkyl tail was essential for binding of the detergent to the surface of bR. Strong anomalous and isomorphous difference signals from HAD13a enabled successful phasing using reflections up to 2.1-Å resolution from only 3,000 and 4,000 indexed images from native and derivative crystals, respectively. When more images were merged, structure solution was possible with data truncated at 3.3-Å resolution, which is the lowest resolution among the reported cases of SFX phasing. Moreover, preliminary SFX experiment showed that HAD13a successfully derivatized the G protein-coupled A2a adenosine receptor crystallized in lipidic cubic phases. These results pave the way for de novo structure determination of membrane proteins, which often diffract poorly, even with the brightest XFEL beams.

Strontianite in coral skeletal aragonite

DOE Office of Scientific and Technical Information (OSTI.GOV)

Greegor, R.B.; Pingitore, N.E. Jr.; Lytle, F.W.

1997-03-07

An x-ray spectroscopic study of scleractinian coral skeletons indicated that, although some strontium substitutes for calcium in the aragonite structure, at concentrations of about 7500 parts per million, as much as 40 percent of the strontium resides in strontianite (SrCO{sub 3}). A doublet peak in the Fourier transform of the extended x-ray absorption fine structure of the coral correspond to six metal and 13 oxygen neighbors surrounding strontium at about 4.05 angstroms in strontium-substituted aragonite and at about 4.21 angstroms in strontianite. Thus, the mechanism of the temperature-sensitive partitioning of strontium between seawater and coral skeleton used for paleothermometry ismore » unexpectedly complex. 11 refs., 5 figs., 1 tab.« less

Crystal Structure of HIV-1 Primary Receptor CD4 i Complex with a Potent Antiviral Antibody

DOE Office of Scientific and Technical Information (OSTI.GOV)

Freeman, M.M.; Hong, X.; Seaman, M.S.

2010-06-18

Ibalizumab is a humanized, anti-CD4 monoclonal antibody. It potently blocks HIV-1 infection and targets an epitope in the second domain of CD4 without interfering with immune functions mediated by interaction of CD4 with major histocompatibility complex (MHC) class II molecules. We report here the crystal structure of ibalizumab Fab fragment in complex with the first two domains (D1-D2) of CD4 at 2.2 {angstrom} resolution. Ibalizumab grips CD4 primarily by the BC-loop (residues 121125) of D2, sitting on the opposite side of gp120 and MHC-II binding sites. No major conformational change in CD4 accompanies binding to ibalizumab. Both monovalent and bivalentmore » forms of ibalizumab effectively block viral infection, suggesting that it does not need to crosslink CD4 to exert antiviral activity. While gp120-induced structural rearrangements in CD4 are probably minimal, CD4 structural rigidity is dispensable for ibalizumab inhibition. These results could guide CD4-based immunogen design and lead to a better understanding of HIV-1 entry.« less

Intermolecular Interactions and Electrostatic Properties of the [beta]-Hydroquinone Apohost: Implications for Supramolecular Chemistry

DOE Office of Scientific and Technical Information (OSTI.GOV)

Clausen, Henrik F.; Chen, Yu-Sheng; Jayatilaka, Dylan

2012-02-07

The crystal structure of the {beta}-polymorph of hydroquinone ({beta}-HQ), the apohost of a large family of clathrates, is reported with a specific focus on intermolecular interactions and the electrostatic nature of its cavity. Hirshfeld surface analysis reveals subtle close contacts between two interconnecting HQ networks, and the local packing and related close contacts were examined by breakdown of the fingerprint plot. An experimental multipole model containing anisotropic thermal parameters for hydrogen atoms has been successfully refined against 15(2) K single microcrystal synchrotron X-ray diffraction data. The experimental electron density model has been compared with a theoretical electron density calculated withmore » the molecule embedded in its own crystal field. Hirshfeld charges, interaction energies and the electrostatic potential calculated for both models are qualitatively in good agreement, but small differences in the electrostatic potential persist due to charge transfer from all hydrogen atoms to the oxygen atoms in the theoretical model. The electrostatic potential in the center of the cavity is positive, very shallow and highly symmetric, suggesting that the inclusion of polar molecules in the void will involve a balance between opposing effects. The electric field is by symmetry zero in the center of the cavity, increasing to a value of 0.0185 e/{angstrom}{sup 2} (0.27 V/{angstrom}) 1 {angstrom} along the 3-fold axis and 0.0105 e/{angstrom}{sup 2} (0.15 V/{angstrom}) 1 {angstrom} along the perpendicular direction. While these values are substantial in a macroscopic context, they are quite small for a molecular cavity and are not expected to strongly polarize a guest molecule.« less

Conserved Binding Mode of Human [beta subscript 2] Adrenergic Receptor Inverse Agonists and Antagonist Revealed by X-ray Crystallography

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wacker, Daniel; Fenalti, Gustavo; Brown, Monica A.

2010-11-15

G protein-coupled receptors (GPCRs) represent a large fraction of current pharmaceutical targets, and of the GPCRs, the {beta}{sub 2} adrenergic receptor ({beta}{sub 2}AR) is one of the most extensively studied. Previously, the X-ray crystal structure of {beta}{sub 2}AR has been determined in complex with two partial inverse agonists, but the global impact of additional ligands on the structure or local impacts on the binding site are not well-understood. To assess the extent of such ligand-induced conformational differences, we determined the crystal structures of a previously described engineered {beta}{sub 2}AR construct in complex with two inverse agonists: ICI 118,551 (2.8 {angstrom}),more » a recently described compound (2.8 {angstrom}) (Kolb et al, 2009), and the antagonist alprenolol (3.1 {angstrom}). The structures show the same overall fold observed for the previous {beta}{sub 2}AR structures and demonstrate that the ligand binding site can accommodate compounds of different chemical and pharmacological properties with only minor local structural rearrangements. All three compounds contain a hydroxy-amine motif that establishes a conserved hydrogen bond network with the receptor and chemically diverse aromatic moieties that form distinct interactions with {beta}{sub 2}AR. Furthermore, receptor ligand cross-docking experiments revealed that a single {beta}{sub 2}AR complex can be suitable for docking of a range of antagonists and inverse agonists but also indicate that additional ligand-receptor structures may be useful to further improve performance for in-silico docking or lead-optimization in drug design.« less

Near-Field Scanning Optical Microscopy and Raman Microscopy.

NASA Astrophysics Data System (ADS)

Harootunian, Alec Tate

1987-09-01

Both a one dimensional near-field scanning optical microscope and Raman microprobe were constructed. In near -field scanning optical microscopy (NSOM) a subwavelength aperture is scanned in the near-field of the object. Radiation transmitted through the aperture is collected to form an image as the aperture scans over the object. The resolution of an NSOM system is essentially wavelength independent and is limited by the diameter of the aperture used to scan the object. NSOM was developed in an effort to provide a nondestructive in situ high spatial resolution probe while still utilizing photons at optical wavelengths. The Raman microprobe constructed provided vibrational Raman information with spatial resolution equivalent that of a conventional diffraction limited microscope. Both transmission studies and near-field diffration studies of subwavelength apertures were performed. Diffraction theories for a small aperture in an infinitely thin conducting screen, a slit in a thick conducting screen, and an aperture in a black screen were examined. All three theories indicate collimation of radiation to the size to the size of the subwavelength aperture or slit in the near-field. Theoretical calculations and experimental results indicate that light transmitted through subwavelength apertures is readily detectable. Light of wavelength 4579 (ANGSTROM) was transmitted through apertures with diameters as small as 300 (ANGSTROM). These studies indicate the feasibility of constructing an NSOM system. One dimensional transmission and fluorescence NSOM systems were constructed. Apertures in the tips of metallized glass pipettes width inner diameters of less than 1000 (ANGSTROM) were used as a light source in the NSOM system. A tunneling current was used to maintain the aperture position in the near-field. Fluorescence NSOM was demonstrated for the first time. Microspectroscopic and Raman microscopic studies of turtle cone oil droplets were performed. Both the Raman vibrational frequencies and the Raman excitation data indicate that the carotenoids are unaggregated. The carotenoid astaxanthin was identified in the orange and red droplets by Raman microscopy. Future applications for both Raman microscopy and near-field microscopy were proposed. Four methods of near-field distance regulation were also examined. Finally, theoretical exposure curves for near-field lithography were calculated. Both the near-field lithographic results and the near field diffraction studies indicate essentially wavelength independent resolution. (Abstract shortened with permission of author.).

Low energy electron diffraction and low energy electron microscopy microspot I/V analysis of the (4 x 4)O structure on Ag(111): surface oxide or reconstruction?

PubMed

Reichelt, R; Günther, S; Wintterlin, J; Moritz, W; Aballe, L; Mentes, T O

2007-10-07

A low energy electron diffraction (LEED) I/V analysis was performed of the (4 x 4) oxygen structure on Ag(111). Two data sets were used, one recorded with a conventional LEED system and a second with a low energy electron microscope (LEEM). The data sets agree well with each other, demonstrating that I/V structure analyses can be performed with the same quality with LEEM as with conventional LEED. The structure obtained confirms the recently proposed model that involves a reconstruction of the Ag(111) surface. Previous models based on a thin layer of Ag(2)O that had been accepted for more than 30 years are disproved. The reconstruction model contains two units of six triangularly arranged Ag atoms and a stacking fault in one half of the unit cell. The six O atoms per unit cell occupy sites in the trenches between the Ag(6) triangles. Small lateral displacements of the Ag atoms lift the mirror symmetry of the structure, leading to two nonequivalent groups of O atoms. The atoms of both groups are located approximately 0.5 Angstrom below the top Ag layer, on fourfold positions with respect to the top layer Ag atoms. Ag-O distances between 2.05 and 2.3 Angstrom are found. The oxygen atoms exhibit large static or dynamic displacements of up to 0.3 Angstrom at 300 K.

Spectroscopic Results of Gravitational Microlenses: Are These Dark Objects or Faint Stars?

NASA Astrophysics Data System (ADS)

Joseph, C. L.; Gallagher, J.; Phillips, M.

1994-12-01

We report on the spectroscopic results obtained in October 1994 with the 4-meter telescope on Cerro Tololo Interamerican Observatory (CTIO). Spectra of 2 recent microlens candidates toward the Galactic bulge reported by the Optical Gravitational Lens Experiment (OGLE) as well as one caught in the early phases of brightening toward the LMC reported by the MAssive Compact Halo Object (MACHO) Project have been obtained. The spectral coverage is from 6500 to 9800 Angstroms at a resolution of 6 Angstroms. The long-term goal of this spectroscopic study is to obtain censored statistical evidence on the luminosity of the microlenses, constraining the nature of these lenses. Several models of composite spectra of a bulge or LMC star plus a cool lensing star of different spectral types are presented to demonstrate the ranges in the product of luminosity times distance that the faint star could be detected in a composite spectrum.

Phase relations in the system In{sub 2}O{sub 3}-TiO{sub 2}-Fe{sub 2}O{sub 3} at 1100 C in air

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brown, F.; Flores, M.J.R.; Kimizuka, N.

1999-04-01

Phase relations in the system In{sub 2}O{sub 3}-TiO{sub 2}-Fe{sub 2}O{sub 3} at 1100 C in air are determined by means of a classic quenching method. There exist In{sub 2}TiO{sub 5}, Fe{sub 2}TiO{sub 5} having a pseudo-Brookite-type phase and a new phase, In{sub 3}Ti{sub 2}FeO{sub 10} having a solid solution range from In{sub 2}O{sub 3}:TiO{sub 2}:Fe{sub 2}O{sub 3} = 4:6:1 to In{sub 2}O{sub 3}:TiO{sub 2}:Fe{sub 2}O{sub 3} = 0.384:0.464:0.152 (mole ratio) on the line InFeO{sub 3}-In{sub 2}Ti{sub 2}O{sub 7}. The crystal structures of In{sub 3}Ti{sub 2}FeO{sub 10} are pyrochlore related with a{sub m} = 5.9171 (5) {angstrom}, b{sub m} = 3.3696more » (3) {angstrom}, c{sub m} = 6.3885 (6) {angstrom}, and {beta} = 108.02 (1){degree} in a monoclinic crystal system at 1100 C, and a{sub 0} = 5.9089 (5) {angstrom}, b{sub 0} = 3.3679 (3) {angstrom}, and c{sub 0} = 12.130 (1) {angstrom} in an orthorhombic system at 1200 C. The relationship between the lattice constants of these phases and those of the cubic pyrochlore type are approximately as follows: a{sub m} = {minus}{1/4}a{sub p} + ({minus}{1/2})b{sub p} + ({minus}{1/4})c{sub p}, b{sub m} = {minus}{1/4}a{sub p} + (0)b{sub p} + ({1/4})c{sub p}, c{sub m} = {1/4}a{sub p} + ({minus}{1/2})b{sub p} + ({1/4})c{sub p} and {beta} = 109.47{degree} in the monoclinic system, and a{sub 0} = {minus}{1/4}a{sub p} + ({minus}{1/2})b{sub p} + ({minus}{1/4})c{sub p}, b{sub 0} = {minus}{1/4}a{sub p} + (0)b{sub p} + ({1/4})c{sub p}, and c{sub 0} = 2/3a{sub p} + ({minus}2/3)b{sub p} + (2/3)c{sub p} in the orthorhombic system, where a{sub p} = b{sub p} = c{sub p} = 9.90 ({angstrom}) are the lattice constants of In{sub 2}Ti{sub 2}O{sub 7} having the cubic pyrochlore type. All solid solutions of In{sub 3}Ti{sub 2}FeO{sub 10} have incommensurate structures with a periodicity of q {times} b{sup *} (q = 0.281--0.356) along the b{sup *} axis and the stoichiometric phase has q = 1/3. In FeO{sub 3} having a layered structure type is unstable between 750 and 1100 C.« less

Stereochemical and electronic control of M-SO/sub 2/ bonding geometry in d/sup 6/ molybdenum and tungsten SO/sub 2/ complexes: novel n/sup 1/reverse arrown/sup 2/ SO/sub 2/ linkage isomerization in Mo(CO)/sub 2/(PPh/sub 3/)/sub 2/(CNR)(SO/sub 2/) and structures of Mo(CO)/sub 3/(P-i-Pr/sub 3/)/sub 2/(SO/sub 2/) and (Mo(CO)/sub 2/(py)(PPh/sub 3/)(. mu. -SO/sub 2/))/sub 2/

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kubas, G.J.; Jarvinen, G.D.; Ryan, R.R.

1983-04-06

New complexes, mer,trans,M(CO)/sub 3/(PR/sub 3/)/sub 2/(SO/sub 2/) (M = Mo,W; R = Ph,Cy,i-Pr) (I), cis,trans-Mo(CO)/sub 2/-(PPh/sub 3/)/sub 2/(SO/sub 2/)(L) (L = NCMe,py,CNCy,CN-t-Bu and CN(p-tolyl))(II), and (Mo(CO)/sub 2/(py)(PPh/sub 3/)(..mu..-SO/sub 2/))/sub 2/, have been prepared and characterized by infrared spectroscopy, /sup 17/O and /sup 31/P NMR spectroscopy, and X-ray crystallography. Syntheses for fac-Mo(CO)/sub 3/(n/sup 2/-SO/sub 2/)(LL) (LL = dppe,bpy,phen,2 py) have also been developed. Depending upon L, II has been found to coordinate SO/sub 2/ either in the S-bonded (n/sup 1/ planar) or O,S-bonded (n/sup 2/) geometries. Remarkably, for L = CNCy or CN-t-Bu, II has been found to contain, in themore » solid state, an apparent equimixture of both coordination types. Isomerization of fac-M(CO)/sub 3/(dppe)(n/sup 2/-SO/sub 2/) (M=Mo,w; dppe = 1,2-bis(diphenylphosphino)ethane) to an n/sup 1/-planar SO/sub 2/ form, mer-M(CO)/sub 3/(dppe)(SO/sub 2/), has also been found to occur. Thus, control of the SO/sub 2/ coordination geometry has been achieved by varying either the electronic properties of the ancillary ligands or their disposition with respect to the SO/sub 2/. The X-ray crystal structure of mer,trans-Mo(CO)/sub 3/(P-i-Pr/sub 3/)/sub 2/(SO/sub 2/) revealed n/sup 1/-planar SO/sub 2/ binding, the first example of this geometry for group 6 metals. The M-S distance, 2.239 (3) angstrom, is the longest such distance for this geometry recorded to date. Crystal data: Pbca, Z=8, a=24.712(8) angstrom, b=16.033(6) angstrom, c=14.058(5) angstrom, R=0.079 for 2934 reflections with Igreater than or equal to2sigma(I). The structure of (Mo(CO)/sub 2/(py)(PPh/sub 3/)(..mu..-SO/sub 2/))/sub 2/ showed a novel SO/sub 2/ bridging geometry in which all three atoms of SO/sub 2/ are metal coordinated. Crystal data: P1, Z=1, a=14.883(4) angstrom, b=9.264(2) angstrom, c=10.808(2) angstrom, R=0.039 for 3282 reflections with Igreater than or equal to2sigma(I).« less

Resonance Scattering of Fe XVII X-ray and EUV Lines

NASA Technical Reports Server (NTRS)

Bhatia, A. K.; Saba, J. L. R.; Fisher, Richard R. (Technical Monitor)

2001-01-01

Over the years a number of calculations have been carried out to derive intensities of various X-ray and EUV lines in Fe XVII to compare with observed spectra. The predicted intensities have not agreed with solar observations, particularly for the line at 1.5.02 Angstroms; resonance scattering has been suggested as the source for much of the disagreement. The atomic data calculated earlier used seven configurations having n=3 orbitals and the scattering calculations were carried out only for incident energies above the threshold of the highest fine-structure level. These calculations have now been extended to thirteen configurations having n=4 orbitals and the scattering calculations are carried out below as well as above the threshold of the highest fine structure level. These improved calculations of Fe XVII change the intensity ratios compared to those obtained earlier, bringing the optically thin F(15.02)/F(16.78) ratio and several other ratios closer to the observed values. However, some disagreement with the solar observations still persists, even thought the agreement of the presently calculated optically thin F(15.02)/F(15.26) ratio with the experimental results of Brown et al. (1998) and Laming et al. (2000) has improved. Some of the remaining discrepancy is still thought to be the effect of opacity, which is consistent with expected physical conditions for solar sources. EUV intensity ratios are also calculated and compared with observations. Level populations and intensity ratios are calculated, as a function of column density of Fe XVII, in the slab and cylindrical geometries. As found previously, the predicted intensities for the resonance lines at 15.02 and 15.26 Angstroms exhibit initial increases in flux relative to the forbidden line at 17.10 Angstroms and the resonance line at 16.78 Angstroms as optical thickness increases. The same behavior is predicted for the lines at 12.262 and 12.122 Angstroms. Predicted intensities for some of the allowed EUV lines are also affected by opacity.

Crystallization and Preliminary X-ray Analysis of Der f 2, a Potent Allergen Derived from the House Dust Mite

NASA Technical Reports Server (NTRS)

Roeber, Dana; Achari, Aniruddha; Takai, Toshiro; Okumura, Yasushi; Scott, David L.; Curreri, Peter (Technical Monitor)

2002-01-01

Although a number of allergens have been identified and isolated, the underlying molecular basis for the potent immune response is poorly understood. House dust mites (Dermatophugoides sp.) are particularly ubiquitous contributors to atopy in developed countries. The rhinitis, dermatitis, and asthma associated with allergic reactions to these arthropods are often caused by relatively small (125-129 amino acids) mite proteins of unclear biological function. Der f 2, a major allergen from the mite Dermatophagoides farinae, has been recombinantly expressed and characterized. The Der f 2 protein has been crystallized in our laboratory and a native data set collected at a synchrotron source. The crystals belong to the orthorhombic space group I422 with unit cell parameters of a = 95.2 Angstroms, b = 95.2 Angstroms, and c = 103.3 Angstroms. An essentially complete (97.2%) data set has been collected to 2.4 Angstroms. Attempts to solve the crystal structure of Der f 2 by molecular replacement using the available NMR coordinates for either Der f 2 or Der p 2 (the homologous protein from D. pterovssinus) failed to reveal a creditable solution.

Mechlorethamine-based drug structures for intervention of central nervous system tumors.

PubMed

Bartzatt, Ronald

2013-06-01

Tumors of the central nervous system are the third most common type of childhood cancers. Brain tumors occur in children and adults; however pediatric patients require a different treatment process. Thirteen drugs similar to mechlorethamine are analyzed in this study. These drugs possess molecular properties enabling substantial and successful access to tumors of the central nervous system. All drugs exhibit zero violations of the Rule of 5, which indicate favorable bioavailability. Ranges in Log P, formula weight, and polar surface area for these drugs are: 1.554 to 3.52, 156.06 to 460.45, and 3.238 Angstroms(2) to 45.471 Angstroms(2), respectively. Hierarchical cluster analysis determined that agents 7 and 12 are most similar to the parent compound mechlorethamine. The mean values of Log P, formula weight, polar surface area, and molecular volume are 2.25, 268.51, 16.57 Angstroms(2), and 227.01 Angstroms(3), respectively. Principal component analysis indicates that agents 7 and 12 are most similar to mechlorethamine and multiple regression analysis of molecular properties produced a model to enable the design of similar alkylating agents. Values of Log (Cbrain/Cblood) indicate these agents will have very high permeation into the central nervous system.

Enhanced High Resolution RBS System

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pollock, Thomas J.; Hass, James A.; Klody, George M.

2011-06-01

Improvements in full spectrum resolution with the second NEC high resolution RBS system are summarized. Results for 50 A ring TiN/HfO films on Si yielding energy resolution on the order of 1 keV are also presented. Detector enhancements include improved pulse processing electronics, upgraded shielding for the MCP/RAE detector, and reduced noise generated from pumping. Energy resolution measurements on spectra front edge coupled with calculations using 0.4mStr solid angle show that beam energy spread at 400 KeV from the Pelletron registered accelerator is less than 100 eV. To improve user throughput, magnet control has been added to the automatic datamore » collection. Depth profiles derived from experimental data are discussed. For the thin films profiled, depth resolutions were on the Angstrom level with the non-linear energy/channel conversions ranging from 100 to 200 eV.« less

Heterodyne Interferometry with a Scanning Optical Microscope.

NASA Astrophysics Data System (ADS)

Hobbs, Philip Charles Danby

The design and implementation of a confocal optical microscope which functions as an electronically scanned heterodyne interferometer are described. Theoretical models based on Fourier optics for general samples and on exact series solution of the scalar Helmholtz equation for a class of trench structures are developed and compared with experimental data. Good agreement is obtained. The associated data acquisition system, also described, enables the system to measure both the amplitude (to 12 bits) and the phase (to 0.1^circ) of a returned optical beam, at a continuous rate of 30,000 points per second. The microscope system uses a wide-band tellurium dioxide acousto-optic cell for electronic scanning, frequency shifting, and beam splitting/combining. It uses a stationary reference beam on the sample for vibration cancellation, which results in a system of great vibration immunity. It can measure relief ranging from a few tenths of a micron down to a few Angstroms, and line widths down to well below 0.4 micron, using light of 0.5 micron wavelength. Angstrom resolution can be achieved in a single full-speed scan, without special vibration isolation equipment, providing that folding mirrors are avoided. A signal processing algorithm based on Fourier deconvolution is presented; it takes advantage of the extra bandwidth of a confocal system and the availability of both amplitude and phase, to improve the lateral resolution by approximately a factor of two. Experimental results are shown, which demonstrate phase edge resolution (10%-90%) of 0.45 lambda (raw data), and 0.18 lambda (after filtering), in excellent agreement with the Fourier optics prediction. The exact scalar theory calculates the response of the microscope as it scans over an infinitely long rectangular trench in a plane boundary on which Dirichlet boundary conditions apply. An expansion in cavity modes inside the trench is used to match the field and its derivatives across the mouth of the trench to get the self-consistent solution. A listing is appended of a program for an HP personal computer which performs the simulation in 1 to 5 minutes' running time for most cases. The trench theory is compared with the Fourier theory and with experimental results for actual metal trenches, with good results.

Closely Related Antibody Receptors Exploit Fundamentally Different Strategies for Steroid Recognition

DOE Office of Scientific and Technical Information (OSTI.GOV)

Verdino, P.; Aldag, C.; Hilvert, D.

2009-05-26

Molecular recognition by the adaptive immune system relies on specific high-affinity antibody receptors that are generated from a restricted set of starting sequences through homologous recombination and somatic mutation. The steroid binding antibody DB3 and the catalytic Diels-Alderase antibody 1E9 derive from the same germ line sequences but exhibit very distinct specificities and functions. However, mutation of only two of the 36 sequence differences in the variable domains, Leu{sup H47}Trp and Arg{sup H100}Trp, converts 1E9 into a high-affinity steroid receptor with a ligand recognition profile similar to DB3. To understand how these changes switch binding specificity and function, we determinedmore » the crystal structures of the 1E9 Leu{sup H47}Trp/Arg{sup H100}Trp double mutant (1E9dm) as an unliganded Fab at 2.05 {angstrom} resolution and in complex with two configurationally distinct steroids at 2.40 and 2.85 {angstrom}. Surprisingly, despite the functional mimicry of DB3, 1E9dm employs a distinct steroid binding mechanism. Extensive structural rearrangements occur in the combining site, where residue H47 acts as a specificity switch and H100 adapts to different ligands. Unlike DB3, 1E9dm does not use alternative binding pockets or different sets of hydrogen-bonding interactions to bind configurationally distinct steroids. Rather, the different steroids are inserted more deeply into the 1E9dm combining site, creating more hydrophobic contacts that energetically compensate for the lack of hydrogen bonds. These findings demonstrate how subtle mutations within an existing molecular scaffold can dramatically modulate the function of immune receptors by inducing unanticipated, but compensating, mechanisms of ligand interaction.« less

Molecular modeling of calmodulin: a comparison with crystallographic data

NASA Technical Reports Server (NTRS)

McDonald, J. J.; Rein, R.

1989-01-01

Two methods of side-chain placement on a modeled protein have been examined. Two molecular models of calmodulin were constructed that differ in the treatment of side chains prior to optimization of the molecule. A virtual bond analysis program developed by Purisima and Scheraga was used to determine the backbone conformation based on 2.2 angstroms resolution C alpha coordinates for the molecules. In the first model, side chains were initially constructed in an extended conformation. In the second model, a conformational grid search technique was employed. Calcium ions were treated explicitly during energy optimization using CHARMM. The models are compared to a recently published refined crystal structure of calmodulin. The results indicate that the initial choices for side-chains, but also significant effects on the main-chain conformation and supersecondary structure. The conformational differences are discussed. Analysis of these and other methods makes possible the formulation of a methodology for more appropriate side-chain placement in modeled proteins.

Structure and Functional Characterization of the RNA-Binding Element of the NLRX1 Innate Immune Modulator

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hong, Minsun; Yoon, Sung-il; Wilson, Ian A.

2012-06-20

Mitochondrial NLRX1 is a member of the family of nucleotide-binding domain and leucine-rich-repeat-containing proteins (NLRs) that mediate host innate immunity as intracellular surveillance sensors against common molecular patterns of invading pathogens. NLRX1 functions in antiviral immunity, but the molecular mechanism of its ligand-induced activation is largely unknown. The crystal structure of the C-terminal fragment (residues 629975) of human NLRX1 (cNLRX1) at 2.65 {angstrom} resolution reveals that cNLRX1 consists of an N-terminal helical (LRRNT) domain, central leucine-rich repeat modules (LRRM), and a C-terminal three-helix bundle (LRRCT). cNLRX1 assembles into a compact hexameric architecture that is stabilized by intersubunit and interdomain interactionsmore » of LRRNT and LRRCT in the trimer and dimer components of the hexamer, respectively. Furthermore, we find that cNLRX1 interacts directly with RNA and supports a role for NLRX1 in recognition of intracellular viral RNA in antiviral immunity.« less

Classification of a Haemophilus influenzae ABC Transporter HI1470/71 through Its Cognate Molybdate Periplasmic Binding Protein, MolA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tirado-Lee, Leidamarie; Lee, Allen; Rees, Douglas C.

2014-10-02

molA (HI1472) from H. influenzae encodes a periplasmic binding protein (PBP) that delivers substrate to the ABC transporter MolB{sub 2}C{sub 2} (formerly HI1470/71). The structures of MolA with molybdate and tungstate in the binding pocket were solved to 1.6 and 1.7 {angstrom} resolution, respectively. The MolA-binding protein binds molybdate and tungstate, but not other oxyanions such as sulfate and phosphate, making it the first class III molybdate-binding protein structurally solved. The {approx}100 {mu}M binding affinity for tungstate and molybdate is significantly lower than observed for the class II ModA molybdate-binding proteins that have nanomolar to low micromolar affinity for molybdate.more » The presence of two molybdate loci in H. influenzae suggests multiple transport systems for one substrate, with molABC constituting a low-affinity molybdate locus.« less

Structural basis for Notch1 engagement of Delta-like 4

DOE PAGES

Luca, Vincent C.; Jude, Kevin M.; Pierce, Nathan W.; ...

2015-02-20

Notch receptors guide mammalian cell fate decisions by engaging the proteins Jagged and Delta-like (DLL). The 2.3 angstrom resolution crystal structure of the interacting regions of the Notch1-DLL4 complex reveals a two-site, antiparallel binding orientation assisted by Notch1 O-linked glycosylation. Notch1 epidermal growth factor–like repeats 11 and 12 interact with the DLL4 Delta/Serrate/Lag-2 (DSL) domain and module at the N-terminus of Notch ligands (MNNL) domains, respectively. Threonine and serine residues on Notch1 are functionalized with O-fucose and O-glucose, which act as surrogate amino acids by making specific, and essential, contacts to residues on DLL4. Lastly, the elucidation of a directmore » chemical role for O-glycans in Notch1 ligand engagement demonstrates how, by relying on posttranslational modifications of their ligand binding sites, Notch proteins have linked their functional capacity to developmentally regulated biosynthetic pathways.« less

Structural Basis of Ligand Binding by a C-di-GMP Riboswitch

DOE Office of Scientific and Technical Information (OSTI.GOV)

Smith, K.; Lipchock, S; Ames, T

2009-01-01

The second messenger signaling molecule bis-(3{prime}-5{prime})-cyclic dimeric guanosine monophosphate (c-di-GMP) regulates many processes in bacteria, including motility, pathogenesis and biofilm formation. c-di-GMP-binding riboswitches are important downstream targets in this signaling pathway. Here we report the crystal structure, at 2.7 {angstrom} resolution, of a c-di-GMP riboswitch aptamer from Vibrio cholerae bound to c-di-GMP, showing that the ligand binds within a three-helix junction that involves base-pairing and extensive base-stacking. The symmetric c-di-GMP is recognized asymmetrically with respect to both the bases and the backbone. A mutant aptamer was engineered that preferentially binds the candidate signaling molecule c-di-AMP over c-di-GMP. Kinetic and structuralmore » data suggest that genetic regulation by the c-di-GMP riboswitch is kinetically controlled and that gene expression is modulated through the stabilization of a previously unidentified P1 helix, illustrating a direct mechanism for c-di-GMP signaling.« less

Structure of Vibrio cholerae ToxT reveals a mechanism for fatty acid regulation of virulence genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lowden, Michael J.; Skorupski, Karen; Pellegrini, Maria

2010-03-04

Cholera is an acute intestinal infection caused by the bacterium Vibrio cholerae. In order for V. cholerae to cause disease, it must produce two virulence factors, the toxin-coregulated pilus (TCP) and cholera toxin (CT), whose expression is controlled by a transcriptional cascade culminating with the expression of the AraC-family regulator, ToxT. We have solved the 1.9 {angstrom} resolution crystal structure of ToxT, which reveals folds in the N- and C-terminal domains that share a number of features in common with AraC, MarA, and Rob as well as the unexpected presence of a buried 16-carbon fatty acid, cis-palmitoleate. The finding thatmore » cis-palmitoleic acid reduces TCP and CT expression in V. cholerae and prevents ToxT from binding to DNA in vitro provides a direct link between the host environment of V. cholerae and regulation of virulence gene expression.« less

Crystallization of isoelectrically homogeneous cholera toxin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Spangler, B.D.; Westbrook, E.M.

1989-02-07

Past difficulty in growing good crystals of cholera toxin has prevented the study of the crystal structure of this important protein. The authors have determined that failure of cholera toxin to crystallize well has been due to its heterogeneity. They have now succeeded in overcoming the problem by isolating a single isoelectric variant of this oligomeric protein (one A subunit and five B subunits). Cholera toxin purified by their procedure readily forms large single crystals. The crystal form has been described previously. They have recorded data from native crystals of cholera toxin to 3.0-{angstrom} resolution with our electronic area detectors.more » With these data, they have found the orientation of a 5-fold symmetry axis within these crystals, perpendicular to the screw dyad of the crystal. They are now determining the crystal structure of cholera toxin by a combination of multiple heavy-atom isomorphous replacement and density modification techniques, making use of rotational 5-fold averaging of the B subunits.« less

Structural basis for Notch1 engagement of Delta-like 4

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luca, Vincent C.; Jude, Kevin M.; Pierce, Nathan W.

Notch receptors guide mammalian cell fate decisions by engaging the proteins Jagged and Delta-like (DLL). The 2.3 angstrom resolution crystal structure of the interacting regions of the Notch1-DLL4 complex reveals a two-site, antiparallel binding orientation assisted by Notch1 O-linked glycosylation. Notch1 epidermal growth factor–like repeats 11 and 12 interact with the DLL4 Delta/Serrate/Lag-2 (DSL) domain and module at the N-terminus of Notch ligands (MNNL) domains, respectively. Threonine and serine residues on Notch1 are functionalized with O-fucose and O-glucose, which act as surrogate amino acids by making specific, and essential, contacts to residues on DLL4. Lastly, the elucidation of a directmore » chemical role for O-glycans in Notch1 ligand engagement demonstrates how, by relying on posttranslational modifications of their ligand binding sites, Notch proteins have linked their functional capacity to developmentally regulated biosynthetic pathways.« less

Architecture of eukaryotic mRNA 3′-end processing machinery

PubMed Central

Hill, Chris H.; Easter, Ashley D.; Emsley, Paul; Degliesposti, Gianluca; Gordiyenko, Yuliya; Santhanam, Balaji; Wolf, Jana; Wiederhold, Katrin; Dornan, Gillian L.; Skehel, Mark; Robinson, Carol V.; Passmore, Lori A.

2018-01-01

Newly transcribed eukaryotic precursor messenger RNAs (pre-mRNAs) are processed at their 3′ ends by the ~1-megadalton multiprotein cleavage and polyadenylation factor (CPF). CPF cleaves pre-mRNAs, adds a polyadenylate tail, and triggers transcription termination, but it is unclear how its various enzymes are coordinated and assembled. Here, we show that the nuclease, polymerase, and phosphatase activities of yeast CPF are organized into three modules. Using electron cryomicroscopy, we determined a 3.5-angstrom-resolution structure of the ~200-kilodalton polymerase module. This revealed four β propellers, in an assembly markedly similar to those of other protein complexes that bind nucleic acid. Combined with in vitro reconstitution experiments, our data show that the polymerase module brings together factors required for specific and efficient polyadenylation, to help coordinate mRNA 3′-end processing. PMID:29074584

DOE Office of Scientific and Technical Information (OSTI.GOV)

T Yeh; C Lee; L Amzel

Fission yeast protein Sre1, the homolog of the mammalian sterol regulatory element-binding protein (SREBP), is a hypoxic transcription factor required for sterol homeostasis and low-oxygen growth. Nro1 regulates the stability of the N-terminal transcription factor domain of Sre1 (Sre1N) by inhibiting the action of the prolyl 4-hydroxylase-like Ofd1 in an oxygen-dependent manner. The crystal structure of Nro1 determined at 2.2 {angstrom} resolution shows an all-{alpha}-helical fold that can be divided into two domains: a small N-terminal domain, and a larger C-terminal HEAT-repeat domain. Follow-up studies showed that Nro1 defines a new class of nuclear import adaptor that functions both inmore » Ofd1 nuclear localization and in the oxygen-dependent inhibition of Ofd1 to control the hypoxic response.« less

Mutation of a Conserved Active Site Residue Converts Tyrosyl-DNA Phosphodiesterase l Into a DNA Topoisomerase l-Dependent Poison

DOE Office of Scientific and Technical Information (OSTI.GOV)

He,X.; van Waardenburg, R.; Babaoglu, K.

2007-01-01

Tyrosyl-DNA phosphodiesterase 1 (Tdp1) catalyzes the resolution of 3' and 5' phospho-DNA adducts. A defective mutant, associated with the recessive neurodegenerative disease SCAN1, accumulates Tdp1-DNA complexes in vitro. To assess the conservation of enzyme architecture, a 2.0 {angstrom} crystal structure of yeast Tdp1 was determined that is very similar to human Tdp1. Poorly conserved regions of primary structure are peripheral to an essentially identical catalytic core. Enzyme mechanism was also conserved, because the yeast SCAN1 mutant (H{sub 432}R) enhanced cell sensitivity to the DNA topoisomerase I (Top1) poison camptothecin. A more severe Top1-dependent lethality of Tdp1H{sub 432}N was drug-independent, coincidingmore » with increased covalent Top1-DNA and Tdp1-DNA complex formation in vivo. However, both H432 mutants were recessive to wild-type Tdp1. Thus, yeast H{sub 432} acts in the general acid/base catalytic mechanism of Tdp1 to resolve 3' phosphotyrosyl and 3' phosphoamide linkages. However, the distinct pattern of mutant Tdp1 activity evident in yeast cells, suggests a more severe defect in Tdp1H{sub 432}N-catalyzed resolution of 3' phospho-adducts.« less

EUV multilayer coatings for the Atmospheric Imaging Assembly instrument aboard the Solar Dynamics Observatory

DOE Office of Scientific and Technical Information (OSTI.GOV)

Soufli, R; Windt, D L; Robinson, J C

2006-02-09

Multilayer coatings for the 7 EUV channels of the AIA have been developed and completed successfully on all AIA flight mirrors. Mo/Si coatings (131, 171, 193.5, 211 {angstrom}) were deposited at Lawrence Livermore National Laboratory (LLNL). Mg/SiC (304, 335 {angstrom}) and Mo/Y (94 {angstrom}) coatings were deposited at Columbia University. EUV reflectance of the 131/335 {angstrom}, 171 {angstrom}, 193.5/211 {angstrom} primary and secondary flight mirrors and the 94/304 {angstrom} secondary flight mirror was measured at beamline 6.3.2. of the Advanced Light Source (ALS) at LBNL. EUV reflectance of the 94/304 {angstrom} primary and secondary flight mirrors was measured at beamlinemore » X24C of the National Synchrotron Light Source (NSLS) at Brookhaven National Lab. Preliminary EUV reflectance measurements of the 94, 304 and 335 {angstrom} coatings were performed with a laser plasma source reflectometer located at Columbia University. Prior to multilayer coating, Atomic Force Microscopy (AFM) characterization and cleaning of all flight substrates was performed at LLNL.« less

Crystal Structure of the Japanese Encephalitis Virus Envelope Protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Luca, Vincent C.; AbiMansour, Jad; Nelson, Christopher A.

2012-03-13

Japanese encephalitis virus (JEV) is the leading global cause of viral encephalitis. The JEV envelope protein (E) facilitates cellular attachment and membrane fusion and is the primary target of neutralizing antibodies. We have determined the 2.1-{angstrom} resolution crystal structure of the JEV E ectodomain refolded from bacterial inclusion bodies. The E protein possesses the three domains characteristic of flavivirus envelopes and epitope mapping of neutralizing antibodies onto the structure reveals determinants that correspond to the domain I lateral ridge, fusion loop, domain III lateral ridge, and domain I-II hinge. While monomeric in solution, JEV E assembles as an antiparallel dimermore » in the crystal lattice organized in a highly similar fashion as seen in cryo-electron microscopy models of mature flavivirus virions. The dimer interface, however, is remarkably small and lacks many of the domain II contacts observed in other flavivirus E homodimers. In addition, uniquely conserved histidines within the JEV serocomplex suggest that pH-mediated structural transitions may be aided by lateral interactions outside the dimer interface in the icosahedral virion. Our results suggest that variation in dimer structure and stability may significantly influence the assembly, receptor interaction, and uncoating of virions.« less

Domain organization and crystal structure of the catalytic domain of E.coli RluF, a pseudouridine synthase that acts on 23S rRNA

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sunita,S.; Zhenxing, H.; Swaathi, J.

2006-01-01

Pseudouridine synthases catalyze the isomerization of uridine to pseudouridine ({psi}) in rRNA and tRNA. The pseudouridine synthase RluF from Escherichia coli (E.C. 4.2.1.70) modifies U2604 in 23S rRNA, and belongs to a large family of pseudouridine synthases present in all kingdoms of life. Here we report the domain architecture and crystal structure of the catalytic domain of E. coli RluF at 2.6 Angstroms resolution. Limited proteolysis, mass spectrometry and N-terminal sequencing indicate that RluF has a distinct domain architecture, with the catalytic domain flanked at the N and C termini by additional domains connected to it by flexible linkers. Themore » structure of the catalytic domain of RluF is similar to those of RsuA and TruB. RluF is a member of the RsuA sequence family of {psi}-synthases, along with RluB and RluE. Structural comparison of RluF with its closest structural homologues, RsuA and TruB, suggests possible functional roles for the N-terminal and C-terminal domains of RluF.« less

Atomic structure of the nuclear pore complex targeting domain of a Nup116 homologue from the yeast, Candida glabrata

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sampathkumar, Parthasarathy; Kim, Seung Joong; Manglicmot, Danalyn

2012-10-23

The nuclear pore complex (NPC), embedded in the nuclear envelope, is a large, dynamic molecular assembly that facilitates exchange of macromolecules between the nucleus and the cytoplasm. The yeast NPC is an eightfold symmetric annular structure composed of {approx}456 polypeptide chains contributed by {approx}30 distinct proteins termed nucleoporins. Nup116, identified only in fungi, plays a central role in both protein import and mRNA export through the NPC. Nup116 is a modular protein with N-terminal 'FG' repeats containing a Gle2p-binding sequence motif and a NPC targeting domain at its C-terminus. We report the crystal structure of the NPC targeting domain ofmore » Candida glabrata Nup116, consisting of residues 882-1034 [CgNup116(882-1034)], at 1.94 {angstrom} resolution. The X-ray structure of CgNup116(882-1034) is consistent with the molecular envelope determined in solution by small-angle X-ray scattering. Structural similarities of CgNup116(882-1034) with homologous domains from Saccharomyces cerevisiae Nup116, S. cerevisiae Nup145N, and human Nup98 are discussed.« less

Structure and organization of heteromeric AMPA-type glutamate receptors.

PubMed

Herguedas, Beatriz; García-Nafría, Javier; Cais, Ondrej; Fernández-Leiro, Rafael; Krieger, James; Ho, Hinze; Greger, Ingo H

2016-04-29

AMPA-type glutamate receptors (AMPARs), which are central mediators of rapid neurotransmission and synaptic plasticity, predominantly exist as heteromers of the subunits GluA1 to GluA4. Here we report the first AMPAR heteromer structures, which deviate substantially from existing GluA2 homomer structures. Crystal structures of the GluA2/3 and GluA2/4 N-terminal domains reveal a novel compact conformation with an alternating arrangement of the four subunits around a central axis. This organization is confirmed by cysteine cross-linking in full-length receptors, and it permitted us to determine the structure of an intact GluA2/3 receptor by cryogenic electron microscopy. Two models in the ligand-free state, at resolutions of 8.25 and 10.3 angstroms, exhibit substantial vertical compression and close associations between domain layers, reminiscent of N-methyl-D-aspartate receptors. Model 1 resembles a resting state and model 2 a desensitized state, thus providing snapshots of gating transitions in the nominal absence of ligand. Our data reveal organizational features of heteromeric AMPARs and provide a framework to decipher AMPAR architecture and signaling. Copyright © 2016, American Association for the Advancement of Science.

Structure of apo-CAP reveals that large conformational changes are necessary for DNA binding

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sharma, Hitesh; Yu, Shaoning; Kong, Jilie

2009-10-21

The binding of cAMP to the Escherichia coli catabolite gene activator protein (CAP) produces a conformational change that enables it to bind specific DNA sequences and regulate transcription, which it cannot do in the absence of the nucleotide. The crystal structures of the unliganded CAP containing a D138L mutation and the unliganded WT CAP were determined at 2.3 and 3.6 {angstrom} resolution, respectively, and reveal that the two DNA binding domains have dimerized into one rigid body and their two DNA recognition helices become buried. The WT structure shows multiple orientations of this rigid body relative to the nucleotide bindingmore » domain supporting earlier biochemical data suggesting that the inactive form exists in an equilibrium among different conformations. Comparison of the structures of the liganded and unliganded CAP suggests that cAMP stabilizes the active DNA binding conformation of CAP through the interactions that the N{sup 6} of the adenosine makes with the C-helices. These interactions are associated with the reorientation and elongation of the C-helices that precludes the formation of the inactive structure.« less

The 1.25 Å resolution structure of phosphoribosyl-ATP pyrophosphohydrolase from Mycobacterium tuberculosis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Javid-Majd, Farah; Yang, Dong; Ioerger, Thomas R.

2008-06-23

Phosphoribosyl-ATP pyrophosphohydrolase is the second enzyme in the histidine-biosynthetic pathway, irreversibly hydrolyzing phosphoribosyl-ATP to phosphoribosyl-AMP and pyrophosphate. It is encoded by the hisE gene, which is present as a separate gene in many bacteria and archaea but is fused to hisI in other bacteria, fungi and plants. Because of its essentiality for growth in vitro, HisE is a potential drug target for tuberculosis. The crystal structures of two native (uncomplexed) forms of HisE from Mycobacterium tuberculosis have been determined to resolutions of 1.25 and 1.79 {angstrom}. The structure of the apoenzyme reveals that the protein is composed of five -helicesmore » with connecting loops and is a member of the {alpha}-helical nucleoside-triphosphate pyrophosphatase superfamily. The biological unit of the protein is a homodimer, with an active site on each subunit composed of residues exclusively from that subunit. A comparison with the Campylobacter jejuni dUTPase active site allowed the identification of putative metal- and substrate-binding sites in HisE, including four conserved glutamate and glutamine residues in the sequence that are consistent with a motif for pyrophosphohydrolase activity. However, significant differences between family members are observed in the loop region between {alpha}-helices H1 and H3. The crystal structure of M. tuberculosis HisE provides insights into possible mechanisms of substrate binding and the diversity of the nucleoside-triphosphate pyrophosphatase superfamily.« less

The search for the hydrophobic force law.

PubMed

Hammer, Malte U; Anderson, Travers H; Chaimovich, Aviel; Shell, M Scott; Israelachvili, Jacob

2010-01-01

After nearly 30 years of research on the hydrophobic interaction, the search for the hydrophobic force law is still continuing. Indeed, there are more questions than answers, and the experimental data are often quite different for nominally similar conditions, as well as, apparently, for nano-, micro-, and macroscopic surfaces. This has led to the conclusion that the experimentally observed force-distance relationships are either a combination of different 'fundamental' interactions, or that the hydrophobic force-law, if there is one, is complex--depending on numerous parameters. The only unexpectedly strong attractive force measured in all experiments so far has a range of D approximately 100-200 angstroms, increasing roughly exponentially down to approximately 10-20 angstroms and then more steeply down to adhesive contact at D = 0 or, for power-law potentials, effectively at D approximately 2 angstroms. The measured forces in this regime (100-200 angstroms) and especially the adhesive forces are much stronger, and have a different distance-dependence from the continuum VDW force (Lifshitz theory) for non-conducting dielectric media. We suggest a three-regime force-law for the forces observed between hydrophobic surfaces: In the first, from 100-200 angstroms to thousands of angstroms, the dominating force is created by complementary electrostatic domains or patches on the apposing surfaces and/or bridging vapour cavities; a 'pure' but still not well-understood 'long-range hydrophobic force' dominates the second regime from approximately 150 to approximately 15 angstroms, possibly due to an enhanced Hamaker constant associated with the 'proton-hopping' polarizability of water; while below approximately 10-15 anstroms to contact there is another 'pure short-range hydrophobic force' related to water structuring effects associated with surface-induced changes in the orientation and/or density of water molecules and H-bonds at the water-hydrophobic interface. We present recent SFA and other experimental results, as well as a simplified model for water based on a spherically-symmetric potential that is able to capture some basic features of hydrophobic association. Such a model may be useful for theoretical studies of the HI over the broad range of scales observed in SFA experiments.

Structure-Based Design of Novel HIV-1 Protease Inhibitors to Combat Drug Resistance

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ghosh,A.; Sridhar, P.; Leshchenko, S.

2006-01-01

Structure-based design and synthesis of novel HIV protease inhibitors are described. The inhibitors are designed specifically to interact with the backbone of HIV protease active site to combat drug resistance. Inhibitor 3 has exhibited exceedingly potent enzyme inhibitory and antiviral potency. Furthermore, this inhibitor maintains impressive potency against a wide spectrum of HIV including a variety of multi-PI-resistant clinical strains. The inhibitors incorporated a stereochemically defined 5-hexahydrocyclopenta[b]furanyl urethane as the P2-ligand into the (R)-(hydroxyethylamino)sulfonamide isostere. Optically active (3aS,5R,6aR)-5-hydroxy-hexahydrocyclopenta[b]furan was prepared by an enzymatic asymmetrization of meso-diacetate with acetyl cholinesterase, radical cyclization, and Lewis acid-catalyzed anomeric reduction as the key steps.more » A protein-ligand X-ray crystal structure of inhibitor 3-bound HIV-1 protease (1.35 Angstroms resolution) revealed extensive interactions in the HIV protease active site including strong hydrogen bonding interactions with the backbone. This design strategy may lead to novel inhibitors that can combat drug resistance.« less

Structural basis for membrane targeting by the MVB12-associated [beta]-prism domain of the human ESCRT-I MVB12 subunit

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boura, Evzen; Hurley, James H.

2012-03-15

MVB12-associated {beta}-prism (MABP) domains are predicted to occur in a diverse set of membrane-associated bacterial and eukaryotic proteins, but their existence, structure, and biochemical properties have not been characterized experimentally. Here, we find that the MABP domains of the MVB12A and B subunits of ESCRT-I are functional modules that bind in vitro to liposomes containing acidic lipids depending on negative charge density. The MABP domain is capable of autonomously localizing to subcellular puncta and to the plasma membrane. The 1.3-{angstrom} atomic resolution crystal structure of the MVB12B MABP domain reveals a {beta}-prism fold, a hydrophobic membrane-anchoring loop, and an electropositivemore » phosphoinositide-binding patch. The basic patch is open, which explains how it senses negative charge density but lacks stereoselectivity. These observations show how ESCRT-I could act as a coincidence detector for acidic phospholipids and protein ligands, enabling it to function both in protein transport at endosomes and in cytokinesis and viral budding at the plasma membrane.« less

Crystallographic, Spectroscopic, and Computational Analysis of a Flavin-C4a-Oxygen Adduct in Choline Oxidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Orville, A.M.; Lountos, G. T.; Finnegan, S.

2009-02-03

Flavin C4a-OO(H) and C4a-OH adducts are critical intermediates proposed in many flavoenzyme reaction mechanisms, but they are rarely detected even by rapid transient kinetics methods. We observe a trapped flavin C4a-OH or C4a-OO(H) adduct by single-crystal spectroscopic methods and in the 1.86 {angstrom} resolution X-ray crystal structure of choline oxidase. The microspectrophotometry results show that the adduct forms rapidly in situ at 100 K upon exposure to X-rays. Density functional theory calculations establish the electronic structures for the flavin C4a-OH and C4a-OO(H) adducts and estimate the stabilization energy of several active site hydrogen bonds deduced from the crystal structure. Wemore » propose that the enzyme-bound FAD is reduced in the X-ray beam. The aerobic crystals then form either a C4a-OH or C4a-OO(H) adduct, but an insufficient proton inventory prevents their decay at cryogenic temperatures.« less

Crystallographic, Spectroscopic, and Computational Analysis of a Flavin C4a-Oxygen Adduct in Choline Oxidase

DOE Office of Scientific and Technical Information (OSTI.GOV)

Orville, A.; Lountos, G; Finnegan, S

2009-01-01

Flavin C4a-OO(H) and C4a-OH adducts are critical intermediates proposed in many flavoenzyme reaction mechanisms, but they are rarely detected even by rapid transient kinetics methods. We observe a trapped flavin C4a-OH or C4a-OO(H) adduct by single-crystal spectroscopic methods and in the 1.86 {angstrom} resolution X-ray crystal structure of choline oxidase. The microspectrophotometry results show that the adduct forms rapidly in situ at 100 K upon exposure to X-rays. Density functional theory calculations establish the electronic structures for the flavin C4a-OH and C4a-OO(H) adducts and estimate the stabilization energy of several active site hydrogen bonds deduced from the crystal structure. Wemore » propose that the enzyme-bound FAD is reduced in the X-ray beam. The aerobic crystals then form either a C4a-OH or C4a-OO(H) adduct, but an insufficient proton inventory prevents their decay at cryogenic temperatures.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tan, K.; Sather, A.; Robertson, J. L.

ZntB is the distant homolog of CorA Mg{sup 2+} transporter within the metal ion transporter superfamily. It was early reported that the ZntB from Salmonella typhimurium facilitated efflux of Zn{sup 2+} and Cd{sup 2+}, but not Mg{sup 2+}. Here, we report the 1.90 {angstrom} crystal structure of the intracellular domain of ZntB from Vibrio parahemolyticus. The domain forms a funnel-shaped homopentamer that is similar to the full-length CorA from Thermatoga maritima, but differs from two previously reported dimeric structures of truncated CorA intracellular domains. However, no Zn{sup 2+} or Cd{sup 2+} binding sites were identified in the high-resolution structure. Instead,more » 25 well-defined Cl{sup -} ions were observed and some of these binding sites are highly conserved within the ZntB family. Continuum electrostatics calculations suggest that the central pore of the funnel is highly attractive for cations, especially divalents. The presence of the bound Cl{sup -} ions increases the stability of cations along the pore suggesting they could be important in enhancing cation transport.« less

Structure of n-alkyltrichlorosilane mono layers on Si(100)/SiO 2

DOE PAGES

H. -G. Steinruck; Ocko, B.; Will, J.; ...

2015-10-05

The structure of n-alkyltrichlorosilane self-assembled monolayers (SAMs) of alkyl chain lengths n = 12, 14, 18, and 22 formed on the amorphous native oxide of silicon (100) has been investigated via angstrom-resolution surface X-ray scattering techniques, with particular focus on the proliferation of lateral order along the molecules’ long axis. Grazing incidence diffraction shows that the monolayer is composed of hexagonally packed crystalline-like domains for n = 14, 18, and 22 with a lateral size of about 60 Å. However, Bragg rod analysis shows that ~12 of the CH 2 units are not included in the crystalline-like domains. We assignmore » this, and the limited lateral crystallites’ size, to strain induced by the size mismatch between the optimal chain–chain and headgroup–headgroup spacings. Lastly, analysis of X-ray reflectivity profiles for n = 12, 14, and 22 shows that the density profile used to successfully model n = 18 provides an excellent fit where the analysis-derived parameters provide complementary structural information to the grazing incidence results.« less

The Crystal Structure of Cobra Venom Factor, a Cofactor for C3- and C5-Convertase CVFBb

DOE Office of Scientific and Technical Information (OSTI.GOV)

Krishnan, Vengadesan; Ponnuraj, Karthe; Xu, Yuanyuan

2009-05-26

Cobra venom factor (CVF) is a functional analog of human complement component C3b, the active fragment of C3. Similar to C3b, in human and mammalian serum, CVF binds factor B, which is then cleaved by factor D, giving rise to the CVFBb complex that targets the same scissile bond in C3 as the authentic complement convertases C4bC2a and C3bBb. Unlike the latter, CVFBb is a stable complex and an efficient C5 convertase. We solved the crystal structure of CVF, isolated from Naja naja kouthia venom, at 2.6 {angstrom} resolution. The CVF crystal structure, an intermediate between C3b and C3c, lacksmore » the TED domain and has the CUB domain in an identical position to that seen in C3b. The similarly positioned CUB and slightly displaced C345c domains of CVF could play a vital role in the formation of C3 convertases by providing important primary binding sites for factor B.« less

High-resolution reversible folding of hyperstable RNA tetraloops using molecular dynamics simulations

PubMed Central

Chen, Alan A.; García, Angel E.

2013-01-01

We report the de novo folding of three hyperstable RNA tetraloops to 1–3 Å rmsd from their experimentally determined structures using molecular dynamics simulations initialized in the unfolded state. RNA tetraloops with loop sequences UUCG, GCAA, or CUUG are hyperstable because of the formation of noncanonical loop-stabilizing interactions, and they are all faithfully reproduced to angstrom-level accuracy in replica exchange molecular dynamics simulations, including explicit solvent and ion molecules. This accuracy is accomplished using unique RNA parameters, in which biases that favor rigid, highly stacked conformations are corrected to accurately capture the inherent flexibility of ssRNA loops, accurate base stacking energetics, and purine syn-anti interconversions. In a departure from traditional quantum chemistrycentric approaches to force field optimization, our parameters are calibrated directly from thermodynamic and kinetic measurements of intra- and internucleotide structural transitions. The ability to recapitulate the signature noncanonical interactions of the three most abundant hyperstable stem loop motifs represents a significant milestone to the accurate prediction of RNA tertiary structure using unbiased all-atom molecular dynamics simulations. PMID:24043821

Structure and Function of the Macrolide Biosensor Protein, MphR(A), with and without Erythromycin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zheng, Jianting; Sagar, Vatsala; Smolinsky, Adam

2009-09-02

The regulatory protein MphR(A) has recently seen extensive use in synthetic biological applications, such as metabolite sensing and exogenous control of gene expression. This protein negatively regulates the expression of a macrolide 2{prime}-phosphotransferase I resistance gene (mphA) via binding to a 35-bp DNA operator upstream of the start codon and is de-repressed by the presence of erythromycin. Here, we present the refined crystal structure of the MphR(A) protein free of erythromycin and that of the MphR(A) protein with bound erythromycin at 2.00- and 1.76-{angstrom} resolutions, respectively. We also studied the DNA binding properties of the protein and identified mutants ofmore » MphR(A) that are defective in gene repression and ligand binding in a cell-based reporter assay. The combination of these two structures illustrates the molecular basis of erythromycin-induced gene expression and provides a framework for additional applied uses of this protein in the isolation and engineered biosynthesis of polyketide natural products.« less

Luminescence and ESR studies of relationships between O(-)-centres and structural iron in natural and synthetically hydrated kaolinites

NASA Technical Reports Server (NTRS)

Coyne, L. M.; Costanzo, P. M.; Theng, B. K.

1989-01-01

Luminescence, induced by dehydration and by wetting with hydrazine and unsymmetrically substituted hydrazine, and related ESR spectra have been observed from several kaolinites, synthetically hydrated kaolinites, and metahalloysites. The amine-wetting luminescence results suggest that intercalation, not a chemiluminescence reaction, is the luminescence trigger. Correlation between hydration-induced luminescence and g = 2 ESR signals associated with O(-)-centres in several natural halloysites, and concurrent diminution of the intensity of both these signal types as a function of aging in two 8.4 angstroms synthetically hydrated, kaolinites, confirm a previously-reported relationship between the luminescence induced by dehydration and in the presence of O(-)-centres (holes, i.e., electron vacancies) in the tetrahedral sheet. Furthermore, the ESR spectra of the 8.4 angstroms hydrate showed a concurrent change in the line shape of the g = 4 signal from a shape usually associated with structural Fe in an ordered kaolinite, to a simpler one typically observed in more disordered kaolinite, halloysite, and montmorillonite. Either structural Fe centres and the O(-)-centres interact, or both are subject to factors previously associated with degree of order. The results question the long-term stability of the 8.4 angstroms hydrate, although XRD does not indicate interlayer collapse over this period. Complex inter-relationships are shown between intercalation, stored energy, structural Fe, and the degree of hydration which may be reflected in catalytic as well as spectroscopic properties of the clays.

Thaumatin Crystallization Aboard the International Space Station Using Liquid-Liquid Diffusion in the Enhanced Gaseous Nitrogen Dewar (EGN)

NASA Technical Reports Server (NTRS)

Kundrot, Craig; Barnes, Cindy L.; Snell, Edward H.; Stinson, Thomas N. (Technical Monitor)

2002-01-01

This paper reports results from the first biological crystal growth experiment on the International Space Station (ISS). Crystals of thaumatin were grown using liquid-liquid diffusion in Tygon tubing transported in the Enhanced Gaseous Nitrogen Dewar (EGN). Different Volume ratios and concentrations of protein and precipitant were used to test different adaptations of the vapor diffusion crystallization recipe to the liquid-liquid diffusion method. The EGN warmed up from -196 C to 0 C in about four days, about the same time it took to warm from 0 C to 20 C. The temperature within the EGN was 20 - 24 C for the majority of the experiment. Air gaps that blocked liquid-liquid diffusion formed in the tubes. Nonetheless, crystals were grown. Synchrotron diffraction data collected from the best space grown crystal extended to 1.28 Angstroms, comparable to previous studies of space-grown thaumatin crystals. The resolution of the best ground control crystal was only 1.47 Angstroms. It is not clear if the difference in diffraction limit is due to factors other than crystal size. Improvements in temperature control and the elimination of air gaps are needed, but the results show that EGN on the ISS can be used to produce space grown crystals that diffract to high resolution.

Imaging ultrafast dynamics of molecules with laser-induced electron diffraction.

PubMed

Lin, C D; Xu, Junliang

2012-10-14

We introduce a laser-induced electron diffraction method (LIED) for imaging ultrafast dynamics of small molecules with femtosecond mid-infrared lasers. When molecules are placed in an intense laser field, both low- and high-energy photoelectrons are generated. According to quantitative rescattering (QRS) theory, high-energy electrons are produced by a rescattering process where electrons born at the early phase of the laser pulse are driven back to rescatter with the parent ion. From the high-energy electron momentum spectra, field-free elastic electron-ion scattering differential cross sections (DCS), or diffraction images, can be extracted. With mid-infrared lasers as the driving pulses, it is further shown that the DCS can be used to extract atomic positions in a molecule with sub-angstrom spatial resolution, in close analogy to the standard electron diffraction method. Since infrared lasers with pulse duration of a few to several tens of femtoseconds are already available, LIED can be used for imaging dynamics of molecules with sub-angstrom spatial and a few-femtosecond temporal resolution. The first experiment with LIED has shown that the bond length of oxygen molecules shortens by 0.1 Å in five femtoseconds after single ionization. The principle behind LIED and its future outlook as a tool for dynamic imaging of molecules are presented.

TRACE Images of the Solar Chromosphere, Transition Region, and Low Corona at High Cadence and High Spatial Resolution

NASA Astrophysics Data System (ADS)

Tarbell, T. D.; Handy, B. N.; Judge, P. G.

1999-05-01

We present TRACE images and movies showing C IV emission (transition region at 80,000 degrees) and UV continuum (temperature minimum region) of quiet and active regions. TRACE images using the 1550, 1600, and 1700 Angstroms filters can be combined to estimate the total emission in the C IV 1548 and 1550 lines and the UV continuum. These are supplemented in different observations with MDI magnetograms, TRACE 171 Angstroms images (Fe IX/X and perhaps O VI), and SUMER spectra of chromospheric and transition region lines from SOHO JOP 72. In quiet sun, bright C IV transients are seen in the vicinity of flux emergence, flux cancellation, and less dramatic interactions of small magnetic structures. Some of these are accompanied by high-velocity explosive events seen in SUMER spectra. The C IV emission can be well-separated from the photospheric magnetic footpoints, suggesting that it takes place on current sheets higher in the atmosphere separating different flux systems. In active regions, both bright and dark fibrils or loops are seen in C IV. Many nano/micro/sub flares are seen, some but not all of which are associated with emerging flux. The C IV emission of "moss" regions, footpoints of hot coronal loops, is contrasted with that of similar plage which does not have hot loops above it. This work was supported by the NASA contracts and grants for TRACE, MDI, and SOHO.

Crystal Structure of Human [Beta]-Hexosaminidase B: Understanding the Molecular Basis of Sandhoff and Tay-Sachs Disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mark, Brian L.; Mahuran, Don J.; Cherney, Maia M.

2010-12-01

In humans, two major {beta}-hexosaminidase isoenzymes exist: Hex A and Hex B. Hex A is a heterodimer of subunits {alpha} and {beta} (60% identity), whereas Hex B is a homodimer of {beta}-subunits. Interest in human {beta}-hexosaminidase stems from its association with Tay-Sachs and Sandhoff disease; these are prototypical lysosomal storage disorders resulting from the abnormal accumulation of G{sub M2}-ganglioside (G{sub M2}). Hex A degrades G{sub M2} by removing a terminal N-acetyl-D-galactosamine ({beta}-GalNAc) residue, and this activity requires the G{sub M2}-activator, a protein which solubilizes the ganglioside for presentation to Hex A. We present here the crystal structure of human Hexmore » B, alone (2.4 {angstrom}) and in complex with the mechanistic inhibitors GalNAc-isofagomine (2.2 {angstrom}) or NAG-thiazoline (2.5 {angstrom}). From these, and the known X-ray structure of the G{sub M2}-activator, we have modeled Hex A in complex with the activator and ganglioside. Together, our crystallographic and modeling data demonstrate how {alpha} and {beta}-subunits dimerize to form either Hex A or Hex B, how these isoenzymes hydrolyze diverse substrates, and how many documented point mutations cause Sandhoff disease ({beta}-subunit mutations) and Tay-Sachs disease ({alpha}-subunit mutations).« less

Synthesis and crystal structure of LiCuFe{sub 2}(VO{sub 4}){sub 3} by Rietveld method

DOE Office of Scientific and Technical Information (OSTI.GOV)

Belik, A.A.

1999-10-01

A new triple vanadate LiCuFe{sub 2}(VO{sub 4}){sub 3} was synthesized by a solid-state method. The compound is isotypic with mineral howardevansite, NaCuFe{sub 2}(VO{sub 4}){sub 3}, and crystallizes in a triclinic system (space group P{bar 1} (No. 2); a = 8.1484(5), b = 9.8024(7), c = 6.6355(4) {angstrom}, {alpha} = 103.832(3), {beta} = 102.353(3), {gamma} = 106.975(3), V = 468.68 {angstrom}{sup 3}, Z = 2). Crystal structure of LiCuFe{sub 2}(VO{sub 4}){sub 3} was refined by Rietveld method with R{sub WP} = 2.32%, R{sub P} = 1.76%, R{sub I} = 2.82%, S = 1.55, using X-ray diffraction. The crystal structure has fivemore » independent cation sites. Lithium cations are located in the cavities M(1)O{sub 6} and M(5)O{sub 10}, which form infinite chains in the [001] direction and are linked through a common face. The lithium cation in the M(1)O{sub 6} cavity has a square planar coordination. The lithium cation in the M(5)O{sub 10} cavity is strongly displaced up to 1.2 {angstrom} from the special position (0, 0, 0.5) to a half-occupied general position (0.037, 0.087, 0.40).« less

Kinetic, thermodynamic and X-ray structural insights into the interaction of melatonin and analogues with quinone reductase 2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Calamini, Barbara; Santarsiero, Bernard D.; Boutin, Jean A.

Melatonin exerts its biological effects through at least two transmembrane G-protein-coupled receptors, MT1 and MT2, and a lower-affinity cytosolic binding site, designated MT3. MT3 has recently been identified as QR2 (quinone reductase 2) (EC 1.10.99.2) which is of significance since it links the antioxidant effects of melatonin to a mechanism of action. Initially, QR2 was believed to function analogously to QR1 in protecting cells from highly reactive quinones. However, recent studies indicate that QR2 may actually transform certain quinone substrates into more highly reactive compounds capable of causing cellular damage. Therefore it is hypothesized that inhibition of QR2 in certainmore » cases may lead to protection of cells against these highly reactive species. Since melatonin is known to inhibit QR2 activity, but its binding site and mode of inhibition are not known, we determined the mechanism of inhibition of QR2 by melatonin and a series of melatonin and 5-hydroxytryptamine (serotonin) analogues, and we determined the X-ray structures of melatonin and 2-iodomelatonin in complex with QR2 to between 1.5 and 1.8 {angstrom} (1 {angstrom} = 0.1 nm) resolution. Finally, the thermodynamic binding constants for melatonin and 2-iodomelatonin were determined by ITC (isothermal titration calorimetry). The kinetic results indicate that melatonin is a competitive inhibitor against N-methyldihydronicotinamide (K{sub i} = 7.2 {mu}M) and uncompetitive against menadione (K{sub i} = 92 {mu}M), and the X-ray structures shows that melatonin binds in multiple orientations within the active sites of the QR2 dimer as opposed to an allosteric site. These results provide new insights into the binding mechanisms of melatonin and analogues to QR2.« less

Understanding Blue-to-Red Conversion in Monomeric Fluorescent Timers and Hydrolytic Degradation of Thier Chromophores

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pletnev, Sergei; Subach, Fedor V.; Dauter, Zbigniew

2010-03-12

Fast-FT is a fluorescent timer (FT) engineered from DsRed-like fluorescent protein mCherry. Crystal structures of Fast-FT (chromophore Met66-Tyr67-Gly68) and its precursor with blocked blue-to-red conversion Blue102 (chromophore Leu66-Tyr67-Gly68) have been determined at the resolution of 1.15 {angstrom} and 1.81 {angstrom}, respectively. Structural data suggest that blue-to-red conversion, taking place in Fast-FT and in related FTs, is associated with the oxidation of C{alpha}2-C{beta}2 bond of Tyr67. Site directed mutagenesis revealed a crucial role of Arg70 and Tyr83 in the delayed oxidation of C{alpha}2-C{beta}2 bond, introducing the timing factor in maturation of the timer. Substitutions Ser217Ala and Ser217Cys in Fast-FT substantially slowmore » down formation of an intermediate blue chromophore but do not affect much blue-to-red conversion, whereas mutations Arg70Lys or Trp83Leu, having little effect on the blue chromophore formation rate, markedly accelerates formation of the red chromophore. The chromophore of FTs adopts a cis-conformation stabilized by a hydrogen bond between its phenolate oxygen and the side chain hydroxyl of Ser146. In Blue102, a bulky side chain of Ile146 precludes the chromophore from adopting a 'cis-like' conformation, blocking its blue-to-red conversion. Both Fast-FT and Blue102 structures revealed hydrolytic degradation of the chromophores. In Fast-FT, chromophore-forming Met66 residue is eliminated from the polypeptide chain, whereas Leu66 in Blue102 is cleaved out from the chromophore, decarboxylated and remains attached to the preceding Phe65. Hydrolysis of the chromophore competes with chromophore maturation and is driven by the same residues that participate in chromophore maturation.« less

The structure of Na{sub 3}SbTe{sub 3}: How ionic and covalent bonding forces work together

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin, Jianhua; Miller, G.J.

1994-12-01

The compound Na{sub 3}SbTe{sub 3} has been synthesized from the elements and characterized by single crystal X-ray diffraction. Na{sub 3}SbTe{sub 3} is cubic, crystallizing in the cP28 structure type (isomorphous with Na{sub 3}AsS{sub 3}); space group P2{sub 1}3 (No. 198); a=9.6114(9) {angstrom}; Z = 4; R1 = 0.0324; wR2 = 0.0561 (I {le} 2{sigma}(I)). The structure consists of isolated sodium cations and trigonal pyramidal [SbTe{sub 3}]{sup {minus}3} anions with a Sb-Te bond length of 2.787(1) {angstrom} and a Te-Sb-Te bond angle of 100.0(1){degrees}. The structure is related to both the Li{sub 3}Bi and K{sub 3}AsS{sub 4}-type structures. Both lattice energymore » and semiempirical electronic structure calculations are utilized to evaluate various local and long-range structural aspects of this Zintl phase.« less

Structure of the FANCI-FANCD2 Complex: Insights into the Fanconi Anemia DNA Repair Pathway

DOE Office of Scientific and Technical Information (OSTI.GOV)

Joo, Woo; Xu, Guozhou; Persky, Nicole S.

2011-08-29

Fanconi anemia is a cancer predisposition syndrome caused by defects in the repair of DNA interstrand cross-links (ICLs). Central to this pathway is the Fanconi anemia I-Fanconi anemia D2 (FANCI-FANCD2) (ID) complex, which is activated by DNA damage-induced phosphorylation and monoubiquitination. The 3.4 angstrom crystal structure of the {approx}300 kilodalton ID complex reveals that monoubiquitination and regulatory phosphorylation sites map to the I-D interface, suggesting that they occur on monomeric proteins or an opened-up complex and that they may serve to stabilize I-D heterodimerization. The 7.8 angstrom electron-density map of FANCI-DNA crystals and in vitro data show that each proteinmore » has binding sites for both single- and double-stranded DNA, suggesting that the ID complex recognizes DNA structures that result from the encounter of replication forks with an ICL.« less

Structure of the FANCI-FANCD2 Complex: Insights into the Fanconi Anemia DNA Repair Pathway

DOE Office of Scientific and Technical Information (OSTI.GOV)

W Joo; G Xu; n Persky

2011-12-31

Fanconi anemia is a cancer predisposition syndrome caused by defects in the repair of DNA interstrand cross-links (ICLs). Central to this pathway is the Fanconi anemia I-Fanconi anemia D2 (FANCI-FANCD2) (ID) complex, which is activated by DNA damage-induced phosphorylation and monoubiquitination. The 3.4 angstrom crystal structure of the {approx}300 kilodalton ID complex reveals that monoubiquitination and regulatory phosphorylation sites map to the I-D interface, suggesting that they occur on monomeric proteins or an opened-up complex and that they may serve to stabilize I-D heterodimerization. The 7.8 angstrom electron-density map of FANCI-DNA crystals and in vitro data show that each proteinmore » has binding sites for both single- and double-stranded DNA, suggesting that the ID complex recognizes DNA structures that result from the encounter of replication forks with an ICL.« less

Electromagnetic Saturation of Angstrom-Sized Quantum Barriers at Terahertz Frequencies

NASA Astrophysics Data System (ADS)

Bahk, Young-Mi; Kang, Bong Joo; Kim, Yong Seung; Kim, Joon-Yeon; Kim, Won Tae; Kim, Tae Yun; Kang, Taehee; Rhie, Jiyeah; Han, Sanghoon; Park, Cheol-Hwan; Rotermund, Fabian; Kim, Dai-Sik

2015-09-01

Metal-graphene-metal hybrid structures allow angstrom-scale van der Waals gaps, across which electron tunneling occurs. We squeeze terahertz electromagnetic waves through these λ /10 000 000 gaps, accompanied by giant field enhancements. Unprecedented transmission reduction of 97% is achieved with the transient voltage across the gap saturating at 5 V. Electron tunneling facilitated by the transient electric field strongly modifies the gap index, starting a self-limiting process related to the barrier height. Our work enables greater interplay between classical optics and quantum tunneling, and provides optical indices to the van der Waals gaps.

Electromagnetic Saturation of Angstrom-Sized Quantum Barriers at Terahertz Frequencies.

PubMed

Bahk, Young-Mi; Kang, Bong Joo; Kim, Yong Seung; Kim, Joon-Yeon; Kim, Won Tae; Kim, Tae Yun; Kang, Taehee; Rhie, Jiyeah; Han, Sanghoon; Park, Cheol-Hwan; Rotermund, Fabian; Kim, Dai-Sik

2015-09-18

Metal-graphene-metal hybrid structures allow angstrom-scale van der Waals gaps, across which electron tunneling occurs. We squeeze terahertz electromagnetic waves through these λ/10 000 000 gaps, accompanied by giant field enhancements. Unprecedented transmission reduction of 97% is achieved with the transient voltage across the gap saturating at 5 V. Electron tunneling facilitated by the transient electric field strongly modifies the gap index, starting a self-limiting process related to the barrier height. Our work enables greater interplay between classical optics and quantum tunneling, and provides optical indices to the van der Waals gaps.

Characterization of conductive nanobiomaterials derived from viral assemblies by low-voltage STEM imaging and Raman scattering

NASA Astrophysics Data System (ADS)

Plascencia-Villa, Germán; Carreño-Fuentes, Liliana; Bahena, Daniel; José-Yacamán, Miguel; Palomares, Laura A.; Ramírez, Octavio T.

2014-09-01

New technologies require the development of novel nanomaterials that need to be fully characterized to achieve their potential. High-resolution low-voltage scanning transmission electron microscopy (STEM) has proven to be a very powerful technique in nanotechnology, but its use for the characterization of nanobiomaterials has been limited. Rotavirus VP6 self-assembles into nanotubular assemblies that possess an intrinsic affinity for Au ions. This property was exploited to produce hybrid nanobiomaterials by the in situ functionalization of recombinant VP6 nanotubes with gold nanoparticles. In this work, Raman spectroscopy and advanced analytical electron microscopy imaging with spherical aberration-corrected (Cs) STEM and nanodiffraction at low-voltage doses were employed to characterize nanobiomaterials. STEM imaging revealed the precise structure and arrangement of the protein templates, as well as the nanostructure and atomic arrangement of gold nanoparticles with high spatial sub-Angstrom resolution and avoided radiation damage. The imaging was coupled with backscattered electron imaging, ultra-high resolution scanning electron microscopy and x-ray spectroscopy. The hybrid nanobiomaterials that were obtained showed unique properties as bioelectronic conductive devices and showed enhanced Raman scattering by their precise arrangement into superlattices, displaying the utility of viral assemblies as functional integrative self-assembled nanomaterials for novel applications.

Syntheses, crystal structures, and properties of new layered tungsten(VI)-containing materials based on the hexagonal-WO{sub 3} structure: M{sub 2}(WO{sub 3}){sub 3}SeO{sub 3} (M = NH{sub 4}, Rb, Cs)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harrison, W.T.A.; Dussack, L.L.; Jacobson, A.J.

The hydrothermal syntheses and crystal structures of (NH{sub 4}){sub 2}(WO{sub 3}){sub 3}SeO{sub 3} and Cs{sub 2}(WO{sub 3}){sub 3}SeO{sub 3}, two new noncentrosymmetric, layered tungsten(VI)-containing phases are reported. Infrared, Raman, and thermogravimetric data are also presented. (NH{sub 4}){sub 2}(WO{sub 3}){sub 3}SeO{sub 3} and Cs{sub 2}(WO{sub 3}){sub 3}SeO{sub 3} are isostructural phases built up from hexagonal-tungsten-oxide-like, anionic layers of vertex-sharing WO{sub 6} octahedra, capped on one side by Se atoms (as selenite groups). Interlayer NH{sub 4}{sup +} or Cs{sup +} cations provide charge balance. The full H-bonding scheme in (NH{sub 4}){sub 2}(WO{sub 3}){sub 3}SeO{sub 3} has been elucidated from Rietveld refinement againstmore » neutron powder diffraction data. The WO{sub 6} octahedra display a 3 short + 3 long W-O bond-distance distribution within the WO{sub 6} unit in both these phases. (NH{sub 4}){sub 2}(WO{sub 3}){sub 3}SeO{sub 3} and Cs{sub 2}(WO{sub 3}){sub 3}SeO{sub 3} are isostructural with their molybdenum(VI)-containing analogues (NH{sub 4}){sub 2}(MoO{sub 3}){sub 3}SeO{sub 3} and Cs{sub 2} (MoO{sub 3}){sub 3}SeO{sub 3}. Crystal data: (NH{sub 4}){sub 2}(WO{sub 3}){sub 3}SeO{sub 3}, M{sub r} = 858.58, hexagonal, space group P6{sub 3} (No. 173), a = 7.2291(2) {angstrom}, c = 12.1486(3) {angstrom}, V = 549.82(3) {angstrom}{sup 3}, Z = 2, R{sub p} = 1.81%, and R{sub wp} = 2.29% (2938 neutron powder data). Cs{sub 2}(WO{sub 3}){sub 3}SeO{sub 3}, M{sub r} = 1088.31, hexagonal, space group P6{sub 3} (no. 173), a = 7.2615(2) {angstrom}, c = 12.5426(3) {angstrom}{sup 3}, Z = 2, R{sub p} = 4.84%, and R{sub wp} = 5.98% (2588 neutron powder data).« less

A thermophilic mini-chaperonin contains a conserved polypeptide-binding surface: combined crystallographic and NMR studies of the GroEL Apical Domain with implications for substrate interactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hua, Q. X. H.; Dementieva, I. S. D.; Walsh, M. A. W.

2001-02-23

A homologue of the Escherichia coli GroEL apical domain was obtained from thermophilic eubacterium Thermus thermophilus. The domains share 70 % sequence identity (101 out of 145 residues). The thermal stability of the T. thermophilus apical domain (T{sub m}>100{sup o}C as evaluated by circular dichroism) is at least 35{sup o}C greater than that of the E. coli apical domain (T{sub m}=65{sup o}C). The crystal structure of a selenomethione-substituted apical domain from T. thermophilus was determined to a resolution of 1.78 {angstrom} using multiwavelength-anomalous-diffraction phasing. The structure is similar to that of the E. coli apical domain (root-mean-square deviation 0.45 {angstrom}more » based on main-chain atoms). The thermophilic structure contains seven additional salt bridges of which four contain charge-stabilized hydrogen bonds. Only one of the additional salt bridges would face the 'Anfinsen cage' in GroEL. High temperatures were exploited to map sites of interactions between the apical domain and molten globules. NMR footprints of apical domain-protein complexes were obtained at elevated temperature using {sup 15}N-{sup 1}H correlation spectra of {sup 15}N-labeled apical domain. Footprints employing two polypeptides unrelated in sequence or structure (an insulin monomer and the SRY high-mobility-group box, each partially unfolded at 50{sup o}C) are essentially the same and consistent with the peptide-binding surface previously defined in E. coli GroEL and its apical domain-peptide complexes. An additional part of this surface comprising a short N-terminal {alpha}-helix is observed. The extended footprint rationalizes mutagenesis studies of intact GroEL in which point mutations affecting substrate binding were found outside the 'classical' peptide-binding site. Our results demonstrate structural conservation of the apical domain among GroEL homologues and conservation of an extended non-polar surface recognizing diverse polypeptides.« less

ARPEFS as an analytic technique

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schach von Wittenau, A.E.

1991-04-01

Two modifications to the ARPEFS technique are introduced. These are studied using p(2 {times} 2)S/Cu(001) as a model system. The first modification is the obtaining of ARPEFS {chi}(k) curves at temperatures as low as our equipment will permit. While adding to the difficulty of the experiment, this modification is shown to almost double the signal-to-noise ratio of normal emission p(2 {times} 2)S/Cu(001) {chi}(k) curves. This is shown by visual comparison of the raw data and by the improved precision of the extracted structural parameters. The second change is the replacement of manual fitting of the Fourier filtered {chi}(k) curves bymore » the use of the simplex algorithm for parameter determination. Again using p(2 {times} 2)S/Cu(001) data, this is shown to result in better agreement between experimental {chi}(k) curves and curves calculated based on model structures. The improved ARPEFS is then applied to p(2 {times} 2)S/Ni(111) and ({radical}3 {times} {radical}3) R30{degree}S/Ni(111). For p(2 {times} 2)S/Cu(001) we find a S-Cu bond length of 2.26 {Angstrom}, with the S adatom 1.31 {Angstrom} above the fourfold hollow site. The second Cu layer appears to be corrugated. Analysis of the p(2 {times} 2)S/Ni(111) data indicates that the S adatom adatom adsorbs onto the FCC threefold hollow site 1.53 {Angstrom} above the Ni surface. The S-Ni bond length is determined to be 2.13 {Angstrom}, indicating an outwards shift of the first layer Ni atoms. We are unable to assign a unique structure to ({radical}3 {times} {radical}3)R30{degree}S/Ni(111). An analysis of the strengths and weaknesses of ARPEFS as an experimental and analytic technique is presented, along with a summary of problems still to be addressed.« less

Crystal structure of Pseudomonas aeruginosa bacteriophytochrome: Photoconversion and signal transduction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Xiaojing; Kuk, Jane; Moffat, Keith

2008-11-12

Phytochromes are red-light photoreceptors that regulate light responses in plants, fungi, and bacteria via reversible photoconversion between red (Pr) and far-red (Pfr) light-absorbing states. Here we report the crystal structure at 2.9 {angstrom} resolution of a bacteriophytochrome from Pseudomonas aeruginosa with an intact, fully photoactive photosensory core domain in its dark-adapted Pfr state. This structure reveals how unusual interdomain interactions, including a knot and an 'arm' structure near the chromophore site, bring together the PAS (Per-ARNT-Sim), GAF (cGMP phosphodiesterase/adenyl cyclase/FhlA), and PHY (phytochrome) domains to achieve Pr/Pfr photoconversion. The PAS, GAF, and PHY domains have topologic elements in common andmore » may have a single evolutionary origin. We identify key interactions that stabilize the chromophore in the Pfr state and provide structural and mutational evidence to support the essential role of the PHY domain in efficient Pr/Pfr photoconversion. We also identify a pair of conserved residues that may undergo concerted conformational changes during photoconversion. Modeling of the full-length bacteriophytochrome structure, including its output histidine kinase domain, suggests how local structural changes originating in the photosensory domain modulate interactions between long, cross-domain signaling helices at the dimer interface and are transmitted to the spatially distant effector domain, thereby regulating its histidine kinase activity.« less

1.8 Astroms Structure of Murine GITR Ligand Dimer Expressed in Drosophila Melanogaster S2 Cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chattopadhyay, K.; Ramagopal, U; Nathenson, S

2009-01-01

Glucocorticoid-induced TNF receptor ligand (GITRL), a prominent member of the TNF superfamily, activates its receptor on both effector and regulatory T cells to generate critical costimulatory signals that have been implicated in a wide range of T-cell immune functions. The crystal structures of murine and human orthologs of GITRL recombinantly expressed in Escherichia coli have previously been determined. In contrast to all classical TNF structures, including the human GITRL structure, murine GITRL demonstrated a unique 'strand-exchanged' dimeric organization. Such a novel assembly behavior indicated a dramatic impact on receptor activation as well as on the signaling mechanism associated with themore » murine GITRL costimulatory system. In this present work, the 1.8 {angstrom} resolution crystal structure of murine GITRL expressed in Drosophila melanogaster S2 cells is reported. The eukaryotic protein-expression system allows transport of the recombinant protein into the extracellular culture medium, thus maximizing the possibility of obtaining correctly folded material devoid of any folding/assembly artifacts that are often suspected with E. coli-expressed proteins. The S2 cell-expressed murine GITRL adopts an identical 'strand-exchanged' dimeric structure to that observed for the E. coli-expressed protein, thus conclusively demonstrating the novel quaternary structure assembly behavior of murine GITRL.« less

Present and future CCDs for UV and X-ray scientific measurements

NASA Technical Reports Server (NTRS)

Janesick, J. R.; Elliott, S. T.; Mccarthy, J. K.; Marsh, H. H.; Collins, S. A.; Blouke, M. M.

1985-01-01

Interacting quantum efficiencies in excess of 50 percent have been demonstrated with CCDs throughout the spectral range 600-9,00 A, and comparable sensitivity is expected to continue to wavelengths as short as a few Angstroms. Nondispersive X-ray spectra throughout the 250-8000 V range have been obtained with an FWHM spectral resolution of 200-250 eV. At present, however, both spectral and spatial resolution is limited at some energies by the diffusion of photogenerated charge into more than one picture element. Progress in reducing charge diffusion is reported, with particular attention given to a theoretical diffusion model and its implications for further improvement.

Synthesis, structures and properties of the new lithium cobalt(II) phosphate Li{sub 4}Co(PO{sub 4}){sub 2}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Glaum, R., E-mail: rglaum@uni-bonn.de; Gerber, K.; Schulz-Dobrick, M.

2012-04-15

{alpha}-Li{sub 4}Co(PO{sub 4}){sub 2} has been synthesized and crystallized by solid-state reactions. The new phosphate crystallizes in the monoclinic system (P2{sub 1}/a, Z=4, a=8.117(3) Angstrom-Sign , b=10.303(8) Angstrom-Sign , c=8.118(8) Angstrom-Sign , {beta}=104.36(8) Angstrom-Sign ) and is isotypic to {alpha}-Li{sub 4}Zn(PO{sub 4}){sub 2}. The structure of {alpha}-Li{sub 4}Co(PO{sub 4}){sub 2} has been determined from single-crystal X-ray diffraction data {l_brace}R{sub 1}=0.040, wR{sub 2}=0.135, 2278 unique reflections with F{sub o}>4{sigma}(F{sub o}){r_brace}. The crystal structure, which might be regarded as a superstructure of the wurtzite structure type, is build of layers of regular CoO{sub 4}, PO{sub 4} and Li1O{sub 4} tetrahedra. Lithium atomsmore » Li2, Li3 and Li4 are located between these layers. Thermal investigations by in-situ XRPD, DTA/TG and quenching experiments suggest decomposition followed by formation and phase transformation of Li{sub 4}Co(PO{sub 4}){sub 2}: {alpha}-Li{sub 4}Co(PO{sub 4}){sub 2} Long-Rightwards-Double-Arrow {sup 442 Degree-Sign C}{beta}-Li{sub 3}PO{sub 4}+LiCoPO{sub 4} Rightwards-Harpoon-Over-Leftwards-Harpoon {sup 773 Degree-Sign C}{beta}-Li{sub 4}Co(PO{sub 4}){sub 2} Long-Rightwards-Double-Arrow {sup quenchingto25 Degree-Sign C}{alpha}-Li{sub 4} Co(PO{sub 4}){sub 2} According to HT-XRPD at {theta}=850 Degree-Sign C{beta}-Li{sub 4}Co(PO{sub 4}){sub 2} (Pnma, Z=2, 10.3341(8) A, b=6.5829(5) A, c=5.0428(3) Angstrom-Sign ) is isostructural to {gamma}-Li{sub 3}PO{sub 4}. The powder reflectance spectrum of {alpha}-Li{sub 4}Co(PO{sub 4}){sub 2} shows the typical absorption bands for the tetrahedral chromophore [Co{sup II}O{sub 4}]. - Graphical abstract: The complex formation and decomposition behavior of Li{sub 4}Co(PO{sub 4}){sub 2} with temperature has been elucidated. The crystal structure of its {alpha}-phase was determined from single crystal data, HT-XRPD allowed derivation of a structure model for the {beta}-phase. Both modifications belong to the Li{sub 3}PO{sub 4} structure family. Highlights: Black-Right-Pointing-Pointer Li{sub 4}Co(PO{sub 4}){sub 2} exhibits complex thermal behavior. Black-Right-Pointing-Pointer The new phosphate belongs to the Li{sub 3}PO{sub 4} structure family. Black-Right-Pointing-Pointer A single-crystal structure analysis is provided for the metastable {alpha}-Li{sub 4}Co(PO{sub 4}){sub 2}. Black-Right-Pointing-Pointer From HT-XRPD data a cation distribution model is developed for {beta}-Li{sub 4}Co(PO{sub 4}){sub 2}. Black-Right-Pointing-Pointer No electrochemical delithiation is observed up to 5 V.« less

Increasing Sequence Diversity with Flexible Backbone Protein Design: The Complete Redesign of a Protein Hydrophobic Core

DOE Office of Scientific and Technical Information (OSTI.GOV)

Murphy, Grant S.; Mills, Jeffrey L.; Miley, Michael J.

2015-10-15

Protein design tests our understanding of protein stability and structure. Successful design methods should allow the exploration of sequence space not found in nature. However, when redesigning naturally occurring protein structures, most fixed backbone design algorithms return amino acid sequences that share strong sequence identity with wild-type sequences, especially in the protein core. This behavior places a restriction on functional space that can be explored and is not consistent with observations from nature, where sequences of low identity have similar structures. Here, we allow backbone flexibility during design to mutate every position in the core (38 residues) of a four-helixmore » bundle protein. Only small perturbations to the backbone, 12 {angstrom}, were needed to entirely mutate the core. The redesigned protein, DRNN, is exceptionally stable (melting point >140C). An NMR and X-ray crystal structure show that the side chains and backbone were accurately modeled (all-atom RMSD = 1.3 {angstrom}).« less

Structure of the Small Outer Capsid Protein, Soc: A Clamp for Stabilizing Capsids of T4-like Phages

DOE Office of Scientific and Technical Information (OSTI.GOV)

Qin, Li; Fokine, Andrei; O'Donnell, Erin

2010-07-22

Many viruses need to stabilize their capsid structure against DNA pressure and for survival in hostile environments. The 9-kDa outer capsid protein (Soc) of bacteriophage T4, which stabilizes the virus, attaches to the capsid during the final stage of maturation. There are 870 Soc molecules that act as a 'glue' between neighboring hexameric capsomers, forming a 'cage' that stabilizes the T4 capsid against extremes of pH and temperature. Here we report a 1.9 {angstrom} resolution crystal structure of Soc from the bacteriophage RB69, a close relative of T4. The RB69 crystal structure and a homology model of T4 Soc weremore » fitted into the cryoelectron microscopy reconstruction of the T4 capsid. This established the region of Soc that interacts with the major capsid protein and suggested a mechanism, verified by extensive mutational and biochemical studies, for stabilization of the capsid in which the Soc trimers act as clamps between neighboring capsomers. The results demonstrate the factors involved in stabilizing not only the capsids of T4-like bacteriophages but also many other virus capsids.« less

Crystal Structure of Phosphatidylglycerophosphatase (PGPase), a Putative Membrane-Bound Lipid Phosphatase, Reveals a Novel Binuclear Metal Binding Site and Two Proton Wires

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kumaran,D.; Bonnano, J.; Burley, S.

2006-01-01

Phosphatidylglycerophosphatase (PGPase), an enzyme involved in lipid metabolism, catalyzes formation of phosphatidylglycerol from phosphatidylglycerophosphate. Phosphatidylglycerol is a multifunctional phospholipid, found in the biological membranes of many organisms. Here, we report the crystal structure of Listeria monocytogenes PGPase at 1.8 Angstroms resolution. PGPase, an all-helical molecule, forms a homotetramer. Each protomer contains an independent active site with two metal ions, Ca{sup 2+} and Mg{sup 2+}, forming a hetero-binuclear center located in a hydrophilic cavity near the surface of the molecule. The binuclear center, conserved ligands, metal-bound water molecules, and an Asp-His dyad form the active site. The catalytic mechanism of thismore » enzyme is likely to proceed via binuclear metal activated nucleophilic water. The binuclear metal-binding active-site environment of this structure should provide insights into substrate binding and metal-dependent catalysis. A long channel with inter-linked linear water chains, termed 'proton wires', is observed at the tetramer interface. Comparison of similar water chain structures in photosynthetic reaction centers (RCs), Cytochrome f, gramicidin, and bacteriorhodopsin, suggests that PGPase may conduct protons via proton wires.« less

Structural Basis of the Antiproliferative Activity of Largazole a Depsipeptide Inhibitor of the Histone Deacetylases

DOE Office of Scientific and Technical Information (OSTI.GOV)

K Cole; D Dowling; M Boone

2011-12-31

Largazole is a macrocyclic depsipeptide originally isolated from the marine cyanobacterium Symploca sp., which is indigenous to the warm, blue-green waters of Key Largo, Florida (whence largazole derives its name). Largazole contains an unusual thiazoline-thiazole ring system that rigidifies its macrocyclic skeleton, and it also contains a lipophilic thioester side chain. Hydrolysis of the thioester in vivo yields largazole thiol, which exhibits remarkable antiproliferative effects and is believed to be the most potent inhibitor of the metal-dependent histone deacetylases (HDACs). Here, the 2.14 {angstrom}-resolution crystal structure of the HDAC8-largazole thiol complex is the first of an HDAC complexed with amore » macrocyclic inhibitor and reveals that ideal thiolate-zinc coordination geometry is the key chemical feature responsible for its exceptional affinity and biological activity. Notably, the core structure of largazole is conserved in romidepsin, a depsipeptide natural product formulated as the drug Istodax recently approved for cancer chemotherapy. Accordingly, the structure of the HDAC8-largazole thiol complex is the first to illustrate the mode of action of a new class of therapeutically important HDAC inhibitors.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Patikoglou,G.; Westblade, L.; Campbell, E.

The Escherichia coli Rsd protein binds tightly and specifically to the RNA polymerase (RNAP) {sigma}{sup 70} factor. Rsd plays a role in alternative {sigma} factor-dependent transcription by biasing the competition between {sigma}{sup 70} and alternative {sigma} factors for the available core RNAP. Here, we determined the 2.6 {angstrom}-resolution X-ray crystal structure of Rsd bound to {sigma}{sup 70} domain 4 ({sigma}{sup 70}{sub 4}), the primary determinant for Rsd binding within {sigma}{sup 70}. The structure reveals that Rsd binding interferes with the two primary functions of {sigma}{sup 70}{sub 4}, core RNAP binding and promoter -35 element binding. Interestingly, the most highly conservedmore » Rsd residues form a network of interactions through the middle of the Rsd structure that connect the {sigma}{sup 70}{sub 4}-binding surface with three cavities exposed on distant surfaces of Rsd, suggesting functional coupling between {sigma}{sup 70}{sub 4} binding and other binding surfaces of Rsd, either for other proteins or for as yet unknown small molecule effectors. These results provide a structural basis for understanding the role of Rsd, as well as its ortholog, AlgQ, a positive regulator of Pseudomonas aeruginosa virulence, in transcription regulation.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brandao, T.; Robinson, H; Johnson, S

Catalysis by the Yersinia protein-tyrosine phosphatase YopH is significantly impaired by the mutation of the conserved Trp354 residue to Phe. Though not a catalytic residue, this Trp is a hinge residue in a conserved flexible loop (the WPD-loop) that must close during catalysis. To learn why this seemingly conservative mutation reduces catalysis by 2 orders of magnitude, we have solved high-resolution crystal structures for the W354F YopH in the absence and in the presence of tungstate and vanadate. Oxyanion binding to the P-loop in W354F is analogous to that observed in the native enzyme. However, the WPD-loop in the presencemore » of oxyanions assumes a half-closed conformation, in contrast to the fully closed state observed in structures of the native enzyme. This observation provides an explanation for the impaired general acid catalysis observed in kinetic experiments with Trp mutants. A 1.4 Angstroms structure of the W354F mutant obtained in the presence of vanadate reveals an unusual divanadate species with a cyclic [VO]2 core, which has precedent in small molecules but has not been previously reported in a protein crystal structure.« less

Crystal Structure of Thrombin Bound to the Uncleaved Extracellular Fragment of PAR1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gandhi, Prafull S.; Chen, Zhiwei; Di Cera, Enrico

2010-05-11

Abundant structural information exists on how thrombin recognizes ligands at the active site or at exosites separate from the active site region, but remarkably little is known about how thrombin recognizes substrates that bridge both the active site and exosite I. The case of the protease-activated receptor PAR1 is particularly relevant in view of the plethora of biological effects associated with its activation by thrombin. Here, we present the 1.8 {angstrom} resolution structure of thrombin S195A in complex with a 30-residue long uncleaved extracellular fragment of PAR1 that documents for the first time a productive binding mode bridging the activemore » site and exosite I. The structure reveals two unexpected features of the thrombin-PAR1 interaction. The acidic P3 residue of PAR1, Asp{sup 39}, does not hinder binding to the active site and actually makes favorable interactions with Gly{sup 219} of thrombin. The tethered ligand domain shows a considerable degree of disorder even when bound to thrombin. The results fill a significant gap in our understanding of the molecular mechanisms of recognition by thrombin in ways that are relevant to other physiological substrates.« less

Biochemical and Structural Characterization of the Human TL1A Ectodomain

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhan, C.; Yan, Q; Patskovsky, Y

TNF-like 1A (TL1A) is a newly described member of the TNF superfamily that is directly implicated in the pathogenesis of autoimmune diseases, including inflammatory bowel disease, atherosclerosis, and rheumatoid arthritis. We report the crystal structure of the human TL1A extracellular domain at a resolution of 2.5 {angstrom}, which reveals a jelly-roll fold typical of the TNF superfamily. This structural information, in combination with complementary mutagenesis and biochemical characterization, provides insights into the binding interface and the specificity of the interactions between TL1A and the DcR3 and DR3 receptors. These studies suggest that the mode of interaction between TL1A and DcR3more » differs from other characterized TNF ligand/receptor complexes. In addition, we have generated functional TL1A mutants with altered disulfide bonding capability that exhibit enhanced solution properties, which will facilitate the production of materials for future cell-based and whole animal studies. In summary, these studies provide insights into the structure and function of TL1A and provide the basis for the rational manipulation of its interactions with cognate receptors.« less

Unraveling protein catalysis through neutron diffraction

NASA Astrophysics Data System (ADS)

Myles, Dean

Neutron scattering and diffraction are exquisitely sensitive to the location, concentration and dynamics of hydrogen atoms in materials and provide a powerful tool for the characterization of structure-function and interfacial relationships in biological systems. Modern neutron scattering facilities offer access to a sophisticated, non-destructive suite of instruments for biophysical characterization that provide spatial and dynamic information spanning from Angstroms to microns and from picoseconds to microseconds, respectively. Applications range from atomic-resolution analysis of individual hydrogen atoms in enzymes, through to multi-scale analysis of hierarchical structures and assemblies in biological complexes, membranes and in living cells. Here we describe how the precise location of protein and water hydrogen atoms using neutron diffraction provides a more complete description of the atomic and electronic structures of proteins, enabling key questions concerning enzyme reaction mechanisms, molecular recognition and binding and protein-water interactions to be addressed. Current work is focused on understanding how molecular structure and dynamics control function in photosynthetic, cell signaling and DNA repair proteins. We will highlight recent studies that provide detailed understanding of the physiochemical mechanisms through which proteins recognize ligands and catalyze reactions, and help to define and understand the key principles involved.

Spectroscopic classification of AT 2017cfd as a young Type Ia supernova

NASA Astrophysics Data System (ADS)

Vinko, J.; Wheeler, J. C.

2017-03-01

We report the spectroscopic observation of AT 2017cfd, a transient discovered by the Lick Observatory Supernova Search (LOSS) on 2017-03-16. A spectrum (range 3700-9300 Angstroms), taken with the new "Low Resolution Spectrograph-2" (LRS2) on the 10m Hobby-Eberly Telescope at McDonald Observatory by Steve Odewahn on 2017-03-18.16 UT, is similar to that of a Type Ia supernova before maximum light.

Probing the Complexities of Structural Changes in Layered Oxide Cathode Materials for Li-Ion Batteries during Fast Charge-Discharge Cycling and Heating.

PubMed

Hu, Enyuan; Wang, Xuelong; Yu, Xiqian; Yang, Xiao-Qing

2018-02-20

The rechargeable lithium-ion battery (LIB) is the most promising energy storage system to power electric vehicles with high energy density and long cycling life. However, in order to meet customers' demands for fast charging, the power performances of current LIBs need to be improved. From the cathode aspect, layer-structured cathode materials are widely used in today's market and will continue to play important roles in the near future. The high rate capability of layered cathode materials during charging and discharging is critical to the power performance of the whole cell and the thermal stability is closely related to the safety issues. Therefore, the in-depth understanding of structural changes of layered cathode materials during high rate charging/discharging and the thermal stability during heating are essential in developing new materials and improving current materials. Since structural changes take place from the atomic level to the whole electrode level, combination of characterization techniques covering multilength scales is quite important. In many cases, this means using comprehensive tools involving diffraction, spectroscopy, and imaging to differentiate the surface from the bulk and to obtain structural/chemical information with different levels of spatial resolution. For example, hard X-ray spectroscopy can yield the bulk information and soft X-ray spectroscopy can give the surface information; X-ray based imaging techniques can obtain spatial resolution of tens of nanometers, and electron-based microcopy can go to angstroms. In addition to challenges associated with different spatial resolution, the dynamic nature of structural changes during high rate cycling and heating requires characterization tools to have the capability of collecting high quality data in a time-resolved fashion. Thanks to the advancement in synchrotron based techniques and high-resolution electron microscopy, high temporal and spatial resolutions can now be achieved. In this Account, we focus on the recent works studying kinetic and thermal properties of layer-structured cathode materials, especially the structural changes during high rate cycling and the thermal stability during heating. Advanced characterization techniques relating to the rate capability and thermal stability will be introduced. The different structure evolution behavior of cathode materials cycled at high rate will be compared with that cycled at low rate. Different response of individual transition metals and the inhomogeneity in chemical distribution will be discussed. For the thermal stability, the relationship between structural changes and oxygen release will be emphatically pointed out. In all these studies being reviewed, advanced characterization techniques are critically applied to reveal complexities at multiscale in layer-structured cathode materials.

Structural Analysis of ADP-Glucose Pyrophosphorylase From the Bacterium Agrobacterium Tumefaciens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cupp-Vickery, J.R.; Igarashi, R.Y.; Perez, M.

2009-05-14

ADP-glucose pyrophosphorylase (ADPGlc PPase) catalyzes the conversion of glucose 1-phosphate and ATP to ADP-glucose and pyrophosphate. As a key step in glucan synthesis, the ADPGlc PPases are highly regulated by allosteric activators and inhibitors in accord with the carbon metabolism pathways of the organism. Crystals of Agrobacterium tumefaciens ADPGlc PPase were obtained using lithium sulfate as a precipitant. A complete anomalous selenomethionyl derivative X-ray diffraction data set was collected with unit cell dimensions a = 85.38 {angstrom}, b = 93.79 {angstrom}, and c = 140.29 {angstrom} ({alpha} = {beta} = {gamma} = 90{sup o}) and space group I{sub 222}. Themore » A. tumefaciens ADPGlc PPase model was refined to 2.1 {angstrom} with an R{sub factor} = 22% and R{sub free} = 26.6%. The model consists of two domains: an N-terminal {alpha}{beta}{alpha} sandwich and a C-terminal parallel {beta}-helix. ATP and glucose 1-phosphate were successfully modeled in the proposed active site, and site-directed mutagenesis of conserved glycines in this region (G20, G21, and G23) resulted in substantial loss of activity. The interface between the N- and the C-terminal domains harbors a strong sulfate-binding site, and kinetic studies revealed that sulfate is a competitive inhibitor for the allosteric activator fructose 6-phosphate. These results suggest that the interface between the N- and C-terminal domains binds the allosteric regulator, and fructose 6-phosphate was modeled into this region. The A. tumefaciens ADPGlc PPase/fructose 6-phosphate structural model along with sequence alignment analysis was used to design mutagenesis experiments to expand the activator specificity to include fructose 1,6-bisphosphate. The H379R and H379K enzymes were found to be activated by fructose 1,6-bisphosphate.« less

First-principles characterization of potassium intercalation in the hexagonal 2H-MoS2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Andersen, Amity; Kathmann, Shawn M.; Lilga, Michael A.

2012-01-12

Periodic density functional theory calculations were performed to study the structural and electronic properties of potassium intercalated into hexagonal MoS{sub 2} (2H-MoS{sub 2}). Metallic potassium (K) atoms are incrementally loaded in the hexagonal sites of the interstitial spaces between MoS2 sheets of the 2H-MoS{sub 2} bulk structure generating 2H-KxMoS2 (0.125 {<=} x {<=} 1.0) structures. To accommodate the potassium atoms, the interstitial spacing c parameter in the 2H-MoS{sub 2} bulk expands from 12.816 {angstrom} in 2H-MoS{sub 2} to 16.086 {angstrom} in 2H-K{sub 0.125}MoS{sub 2}. The second lowest potassium loading concentration (K{sub 0.25}MoS{sub 2}) results in the largest interstitial spacing expansionmore » (to c = 16.726 {angstrom}). Our calculations show that there is a small gradual contraction of the interstitial spacing as the potassium loading increases with c = 14.839 {angstrom} for KMoS{sub 2}. This interstitial contraction is correlated with an in-plane expansion of the MoS{sub 2} sheets, which is in good agreement with experimental X-ray diffraction (XRD) measurements. The electronic analysis shows that potassium readily donates its 4s electron to the conduction band of the 2H-K{sub x}MoS{sub 2}, and is largely ionic in character. As a result of the electron donation, the 2H-K{sub x}MoS{sub 2} system changes from a semiconductor to a more metallic system with increasing potassium intercalation. For loadings 0.25 {<=} x {<=} 0.625, triangular Mo-Mo-Mo moieties are prominent and tend to form rhombitrihexagonal motifs. Intercalation of H{sub 2}O molecules that solvate the K atoms is likely to occur in catalytic conditions. The inclusion of two H{sub 2}O molecules per K atom in the K{sub 0.25}MoS{sub 2} structure shows good agreement with XRD measurements.« less

Coherent diffractive imaging of solid state reactions in zinc oxide crystals

NASA Astrophysics Data System (ADS)

Leake, Steven J.; Harder, Ross; Robinson, Ian K.

2011-11-01

We investigated the doping of zinc oxide (ZnO) microcrystals with iron and nickel via in situ coherent x-ray diffractive imaging (CXDI) in vacuum. Evaporated thin metal films were deposited onto the ZnO microcrystals. A single crystal was selected and tracked through annealing cycles. A solid state reaction was observed in both iron and nickel experiments using CXDI. A combination of the shrink wrap and guided hybrid-input-output phasing methods were applied to retrieve the electron density. The resolution was 33 nm (half order) determined via the phase retrieval transfer function. The resulting images are nevertheless sensitive to sub-angstrom displacements. The exterior of the microcrystal was found to degrade dramatically. The annealing of ZnO microcrystals coated with metal thin films proved an unsuitable doping method. In addition the observed defect structure of one crystal was attributed to the presence of an array of defects and was found to change upon annealing.

Crystallization and Preliminary X-ray Analysis of the Human Long Myosin Light-Chain Kinase 1-Specific Domain IgCAM3

DOE Office of Scientific and Technical Information (OSTI.GOV)

W Vallen Graham; A Magis; K Bailey

2011-12-31

Myosin light-chain kinase-dependent tight junction regulation is a critical event in inflammatory cytokine-induced increases in epithelial paracellular permeability. MLCK is expressed in human intestinal epithelium as two isoforms, long MLCK1 and long MLCK2, and MLCK1 is specifically localized to the tight junction, where it regulates paracellular permeability. The sole difference between these long MLCK splice variants is the presence of an immunoglobulin-like cell-adhesion molecule domain, IgCAM3, in MLCK1. To gain insight into the structure of the IgCAM3 domain, the IgCAM3 domain of MLCK1 has been expressed, purified and crystallized. Preliminary X-ray diffraction data were collected to 2.0 {angstrom} resolution andmore » were consistent with the primitive trigonal space group P2{sub 1}2{sub 1}2{sub 1}.« less

Crystal Structure of Arginase from Plasmodium falciparum and Implications for l-Arginine Depletion in Malarial Infection

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dowling, Daniel P.; Ilies, Monica; Olszewski, Kellen L.

The 2.15 {angstrom} resolution crystal structure of arginase from Plasmodium falciparum, the parasite that causes cerebral malaria, is reported in complex with the boronic acid inhibitor 2(S)-amino-6-boronohexanoic acid (ABH) (K{sub d} = 11 {micro}M). This is the first crystal structure of a parasitic arginase. Various protein constructs were explored to identify an optimally active enzyme form for inhibition and structural studies and to probe the structure and function of two polypeptide insertions unique to malarial arginase: a 74-residue low-complexity region contained in loop L2 and an 11-residue segment contained in loop L8. Structural studies indicate that the low-complexity region ismore » largely disordered and is oriented away from the trimer interface; its deletion does not significantly compromise enzyme activity. The loop L8 insertion is located at the trimer interface and makes several intra- and intermolecular interactions important for enzyme function. In addition, we also demonstrate that arg- Plasmodium berghei sporozoites show significantly decreased liver infectivity in vivo. Therefore, inhibition of malarial arginase may serve as a possible candidate for antimalarial therapy against liver-stage infection, and ABH may serve as a lead for the development of inhibitors.« less

Profilometry In The Angstrom Region

NASA Astrophysics Data System (ADS)

Politch, Jacob

1989-01-01

An interferometric system, based on heterodyne principle is described and which enables profile measurements of a surface with a high accuracy. It is possible to measure height variations of 4 Angstroms with a spatial resolution of 1 micrometer. Fran the surface height measurements, there were calculated its statistical properties, such as the R of the heights, the slopes and also its spectral density. The last one identifies the spatial frequencies of the surface, caused for example by the diamond turning mad-line and also by the measuring maChine. For an electro-magnetic wave with a Gaussian profile, which is incident the surface under test, the reflected complex field amplitude (CFA) near the focal region was calculated. jibe have defined the "Macroscopic wavelength" A, which was found to be constant for variations ▵z of the focal distance from the plane under test, for variations of the bean diameter wo in the focal region, while the complex index of refraction (CIF) of the surface under test was kept constant.

DIBS independent of accretion in T Tauri stars

NASA Technical Reports Server (NTRS)

Ghandour, Louma; Jenniskens, Peter; Hartigan, P.

1994-01-01

The examination of high resolution spectra (5200 - 7000 Angstroms) of 36 T Tauri stars ranging in accretion rates was performed. Only the lambda lambda 5780, 5797, and 6613 bands were found detectable to within an equivalent width of 10 micro Angstroms. They are strongest in DG Tau, DR Tau, Dl Tau, and AS 353A. DR Tau was monitored over the course of four years; during this time, the accretion rate varied by a factor of five, but the equivalent widths of the DIB's (Diffuse Interstellar Bands) remained constant. The lack of correlation of the strength of the bands with the accretion rates implies that the bands are not directly produced by UV radiation from the accretion process. The bands have line strengths and ratios characteristic of the diffuse interstellar medium, from which we conclude that the diffuse interstellar bands seen in the spectra of T Tauri stars do not originate in the stars' immediate environment. Instead, they are part of a foreground extinction, probably due to the parent molecular cloud.

High-level Expression Purification Crystallization and Preliminary X-ray Crystallographic Studies of the Receptor Binding Domain of botulinum neurotoxin Serotype D

DOE Office of Scientific and Technical Information (OSTI.GOV)

Y Zhang; X Gao; G Buchko

2011-12-31

Botulinum neurotoxins (BoNTs) are highly toxic proteins for humans and animals that are responsible for the deadly neuroparalytic disease botulism. Here, details of the expression and purification of the receptor-binding domain (HCR) of BoNT/D in Escherichia coli are presented. Using a codon-optimized cDNA, BoNT/D{_}HCR was expressed at a high level (150-200 mg per litre of culture) in the soluble fraction. Following a three-step purification protocol, very pure (>98%) BoNT/D{_}HCR was obtained. The recombinant BoNT/D{_}HCR was crystallized and the crystals diffracted to 1.65 {angstrom} resolution. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 60.8,more » b = 89.7, c = 93.9 {angstrom}. Preliminary crystallographic data analysis revealed the presence of one molecule in the asymmetric unit.« less

High-level expression, purification, crystallization and preliminary X-ray crystallographic studies of the receptor-binding domain of botulinum neurotoxin serotype D

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhang, Y.; Robinson, H.; Gao, X.

2010-12-01

Botulinum neurotoxins (BoNTs) are highly toxic proteins for humans and animals that are responsible for the deadly neuroparalytic disease botulism. Here, details of the expression and purification of the receptor-binding domain (HCR) of BoNT/D in Escherichia coli are presented. Using a codon-optimized cDNA, BoNT/D{_}HCR was expressed at a high level (150-200 mg per litre of culture) in the soluble fraction. Following a three-step purification protocol, very pure (>98%) BoNT/D{_}HCR was obtained. The recombinant BoNT/D{_}HCR was crystallized and the crystals diffracted to 1.65 {angstrom} resolution. The crystals belonged to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 60.8,more » b = 89.7, c = 93.9 {angstrom}. Preliminary crystallographic data analysis revealed the presence of one molecule in the asymmetric unit.« less

Crystal chemistry of elpidite from Khan Bogdo (Mongolia) and its K- and Rb-exchanged forms

DOE Office of Scientific and Technical Information (OSTI.GOV)

Grigor'eva, A. A.; Zubkova, N. V., E-mail: nata_zubkova@rambler.ru; Pekov, I. V.

2011-09-15

Elpidite Na{sub 2}ZrSi{sub 6}O{sub 15} {center_dot} 3H{sub 2}O [space group Pbcm, a = 7.1312(12), b = 14.6853(12), and c = 14.6349(15) Angstrom-Sign ] from Khan Bogdo (Mongolia) and its K- and Rb-exchanged forms K{sub 1.78}Na{sub 0.16}H{sub 0.06}ZrSi{sub 6}O{sub 15} {center_dot} 0.85H{sub 2}O [Cmce, a = 14.054(3), b = 14.308(3), and c = 14.553(3) Angstrom-Sign ] and Na{sub 1.58}Rb{sub 0.2}H{sub 0.22}ZrSi{sub 6}O{sub 15} {center_dot} 2.69H{sub 2}O [Pbcm, a = 7.1280(10), b = 14.644(3), and c = 14.642(3) Angstrom-Sign ] that were obtained by cation exchange at 90 Degree-Sign C, as well as K{sub 1.84}Na{sub 0.11}H{sub 0.05}ZrSi{sub 6}O{sub 15} {center_dot} 0.91H{sub 2}Omore » [Cmce, a = 14.037(3), b = 14.226(3), and c = 14.552(3) Angstrom-Sign ] and Rb{sub 1.78}Na{sub 0.06}H{sub 0.16}ZrSi{sub 6}O{sub 15} {center_dot} 0.90H{sub 2}O [Cmce, a = 14.2999(12), b = 14.4408(15), and c = 14.7690(12) Angstrom-Sign ], obtained at 150 Degree-Sign C are studied by single-crystal X-ray diffraction and IR spectroscopy. The base of the structures is a heteropolyhedral Zr-Si-O framework whose cavities accommodate Na (K, Rb) cations and H{sub 2}O molecules.« less

Structural Basis for the Catalytic Activity of Human Serine/Threonine Protein Phosphatase type 5 (PP5)

NASA Technical Reports Server (NTRS)

Swingle, Mark R.; Ciszak, Ewa M.; Honkanen, Richard E.

2004-01-01

Serine/threonine protein phosphatase-5 (PP5) is a member of the PPP-gene family of protein phosphatases that is widely expressed in mammalian tissues and is highly conserved among eukaryotes. PP5 associates with several proteins that affect signal transduction networks, including the glucocorticoid receptor (GR)-heat shock protein-90 (Hsp90)-heterocomplex, the CDC16 and CDC27 subunits of the anaphase-promoting complex, elF2alpha kinase, the A subunit of PP2A, the G12-alpha / G13-alpha subunits of heterotrimeric G proteins and DNA-PK. The catalytic domain of PP5 (PP5c) shares 35-45% sequence identity with the catalytic domains of other PPP-phosphatases, including protein phosphatase-1 (PP1), -2A (PP2A), -2B / calcineurin (PP2B), -4 (PP4), -6 (PP6), and -7 (PP7). Like PP1, PP2A and PP4, PP5 is also sensitive to inhibition by okadaic acid, microcystin, cantharidin, tautomycin, and calyculin A. Here we report the crystal structure of the PP5 catalytic domain (PP5c) at a resolution of 1.6 angstroms. From this structure we propose a mechanism for PP5-mediated hydrolysis of phosphoprotein substrates, which requires the precise positioning of two metal ions within a conserved Asp(sup 271)-M(sub 1):M(sub 2)-W(sup 1)-His(sup 304)-Asp(sup 274) catalytic motif. The structure of PP5c provides a possible structural basis for explaining the exceptional catalytic proficiency of protein phosphatases, which are among the most powerful known catalysts. Resolution of the entire C-terminus revealed a novel subdomain, and the structure of the PP5c should also aid development of type-specific inhibitors.

Crystal Structure of the Bovine lactadherin C2 Domain, a Membrane Binding Motif, Shows Similarity to the C2 Domains of Factor V and Factor VIII

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin,L.

2007-01-01

Lactadherin, a glycoprotein secreted by a variety of cell types, contains two EGF domains and two C domains with sequence homology to the C domains of blood coagulation proteins factor V and factor VIII. Like these proteins, lactadherin binds to phosphatidylserine (PS)-containing membranes with high affinity. We determined the crystal structure of the bovine lactadherin C2 domain (residues 1 to 158) at 2.4 {angstrom}. The lactadherin C2 structure is similar to the C2 domains of factors V and VIII (rmsd of C{sub {alpha}} atoms of 0.9 {angstrom} and 1.2 {angstrom}, and sequence identities of 43% and 38%, respectively). The lactadherinmore » C2 domain has a discoidin-like fold containing two {beta}-sheets of five and three antiparallel {beta}-strands packed against one another. The N and C termini are linked by a disulfide bridge between Cys1 and Cys158. One {beta}-turn and two loops containing solvent-exposed hydrophobic residues extend from the C2 domain {beta}-sandwich core. In analogy with the C2 domains of factors V and VIII, some or all of these solvent-exposed hydrophobic residues, Trp26, Leu28, Phe31, and Phe81, likely participate in membrane binding. The C2 domain of lactadherin may serve as a marker of cell surface phosphatidylserine exposure and may have potential as a unique anti-thrombotic agent.« less

Crystal Structure of the Bovine lactadherin C2 Domain, a Membrane Binding Motif, Shows Similarity of the C2 Domains of Factor V and Factor VIII

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lin,L.; Huai, Q.; Huang, M.

2007-01-01

Lactadherin, a glycoprotein secreted by a variety of cell types, contains two EGF domains and two C domains with sequence homology to the C domains of blood coagulation proteins factor V and factor VIII. Like these proteins, lactadherin binds to phosphatidylserine (PS)-containing membranes with high affinity. We determined the crystal structure of the bovine lactadherin C2 domain (residues 1 to 158) at 2.4 Angstroms. The lactadherin C2 structure is similar to the C2 domains of factors V and VIII (rmsd of C? atoms of 0.9 Angstroms and 1.2 Angstroms, and sequence identities of 43% and 38%, respectively). The lactadherin C2more » domain has a discoidin-like fold containing two ?-sheets of five and three antiparallel ?-strands packed against one another. The N and C termini are linked by a disulfide bridge between Cys1 and Cys158. One ?-turn and two loops containing solvent-exposed hydrophobic residues extend from the C2 domain ?-sandwich core. In analogy with the C2 domains of factors V and VIII, some or all of these solvent-exposed hydrophobic residues, Trp26, Leu28, Phe31, and Phe81, likely participate in membrane binding. The C2 domain of lactadherin may serve as a marker of cell surface phosphatidylserine exposure and may have potential as a unique anti-thrombotic agent.« less

Organometallic oxides: Preparation, structure, and chemical and physical properties of paramagnetic ((. eta. -C sub 5 H sub 5 )NbCl(. mu. -A)) sup 3 (. mu. sub 3 -OH)(. mu. sub 3 -O) (A = Cl, OH) and other oxo-hydroxo clusters of niobium

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bottomley, F.; Keizer, P.N.; White, P.S.

Hydrolysis of Cp{prime}NbCl{sub 4} (Cp{prime} = {eta}{sup 5}-C{sub 5}H{sub 5} (Cp), {eta}-C{sub 5}H{sub 4}Me (Cp{sup 1})) in tetrahydrofuran (THF) gave a mixture of products of general formula (Cp{prime}NbL{sub 4}){sub 2}({mu}-O), where L{sub 4} is a combination of H{sub 2}O and terminal or bridging Cl that gives eight-coordinate, pentavalent, niobium. For Cp{prime} = Cp, a major constituent of the mixture is (CpNb(H{sub 2}O)Cl{sub 3}){sub 2}({mu}-O) {times} 2THF {times} 0.05Et{sub 2}O (1), the structure of which was determined by X-ray diffraction. Reduction of (Cp{prime}NbL{sub 4}){sub 2}({mu}-O) with aluminum powder gave the cluster (Cp{prime}NbCl({mu}-Cl)){sub 3}({mu}{sub 3}-OH)({mu}{sub 3}-O) (2). The structure of 2 (Cp{prime}more » = Cp) as the THF adduct was determined by X-ray diffraction. Crystal data: monoclinic; P2{sub 1}/c; a = 9.966 (1) {angstrom}, b = 12.471 (2) {angstrom}, c = 20.321 (2) {angstrom}, {beta} = 93.86 (1){degree}.« less

Crystallization of the Membrane-Associated Annexin B1: Roles of Additive Screen, Dynamic Light Scattering, and Bioactivity Assay

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ding, F.; Xu, Y; Azzi, A

2010-01-01

Annexin B1 (AnxB1) is a calcium-dependent phospholipid binding protein from Taenia solium cysticercus and has been reported to possess anticoagulant activity, to inhibit phospholipase A{sub 2}, and to regulate membrane transport. Native AnxB1 and its selenomethionyl derivative have been overproduced in Escherichia coli and purified. The results of dynamic light scattering analysis showed that Hepes buffer combined with low concentration salts (NaCl or CaCl{sub 2}) was beneficial for preventing aggregation and for AnxB1 stabilization in the storage. After the additive screen, crystals have been yielded in the presence of guanidine hydrochloride (Gn-HCl). We determined that a low concentration of Gn-HClmore » significantly delayed clotting time and increased anticoagulant activity. Analysis of the crystal showed that in the presence of Gn-HCl, AnxB1 crystallizes in orthorhombic space group, which is modified from the cubic space group for crystals grown in the absence of Gn-HCl. A high quality data set (at 1.9 {angstrom}) has been collected successfully for crystals of L-selenomethionine labeled protein in the presence of Gn-HCl, to solve the structure with the single anomalous dispersion method (SAD). The unit cell parameters are a = 102.35 {angstrom}, b = 103.59 {angstrom}, c = 114.60 {angstrom}, {alpha} = {beta} = {gamma} = 90.00{sup o}.« less

Structure of the N-terminal fragment of Escherichia coli Lon protease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Mi; Gustchina, Alla; Rasulova, Fatima S.

2010-10-22

The structure of a recombinant construct consisting of residues 1-245 of Escherichia coli Lon protease, the prototypical member of the A-type Lon family, is reported. This construct encompasses all or most of the N-terminal domain of the enzyme. The structure was solved by SeMet SAD to 2.6 {angstrom} resolution utilizing trigonal crystals that contained one molecule in the asymmetric unit. The molecule consists of two compact subdomains and a very long C-terminal {alpha}-helix. The structure of the first subdomain (residues 1-117), which consists mostly of {beta}-strands, is similar to that of the shorter fragment previously expressed and crystallized, whereas themore » second subdomain is almost entirely helical. The fold and spatial relationship of the two subdomains, with the exception of the C-terminal helix, closely resemble the structure of BPP1347, a 203-amino-acid protein of unknown function from Bordetella parapertussis, and more distantly several other proteins. It was not possible to refine the structure to satisfactory convergence; however, since almost all of the Se atoms could be located on the basis of their anomalous scattering the correctness of the overall structure is not in question. The structure reported here was also compared with the structures of the putative substrate-binding domains of several proteins, showing topological similarities that should help in defining the binding sites used by Lon substrates.« less

Simultaneous small- and wide-angle scattering at high X-ray energies.

PubMed

Daniels, J E; Pontoni, D; Hoo, Rui Ping; Honkimäki, V

2010-07-01

Combined small- and wide-angle X-ray scattering (SAXS/WAXS) is a powerful technique for the study of materials at length scales ranging from atomic/molecular sizes (a few angstroms) to the mesoscopic regime ( approximately 1 nm to approximately 1 microm). A set-up to apply this technique at high X-ray energies (E > 50 keV) has been developed. Hard X-rays permit the execution of at least three classes of investigations that are significantly more difficult to perform at standard X-ray energies (8-20 keV): (i) in situ strain analysis revealing anisotropic strain behaviour both at the atomic (WAXS) as well as at the mesoscopic (SAXS) length scales, (ii) acquisition of WAXS patterns to very large q (>20 A(-1)) thus allowing atomic pair distribution function analysis (SAXS/PDF) of micro- and nano-structured materials, and (iii) utilization of complex sample environments involving thick X-ray windows and/or samples that can be penetrated only by high-energy X-rays. Using the reported set-up a time resolution of approximately two seconds was demonstrated. It is planned to further improve this time resolution in the near future.

Carbon-carbon bond cleavage of 1,2-hydroxy ethers b7 vanadium(V) dipicolinate complexes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hanson, Susan K; Gordon, John C; Thorn, David L

2009-01-01

The development of alternatives to current petroleum-based fuels and chemicals is becoming increasingly important due to concerns over climate change, growing world energy demand, and energy security issues. Using non-food derived biomass to produce renewable feedstocks for chemicals and fuels is a particularly attractive possibility. However, the majority of biomass is in the form of lignocellulose, which is often not fully utilized due to difficulties associated with breaking down both lignin and cellulose. Recently, a number of methods have been reported to transform cellulose directly into more valuable materials such as glucose, sorbitol, 5-(chloromethyl)furfural, and ethylene glycol. Less progress hasmore » been made with selective transformations of lignin, which is typically treated in paper and forest industries by kraft pulping (sodium hydroxide/sodium sulfide) or incineration. Our group has begun investigating aerobic oxidative C-C bond cleavage catalyzed by dipicolinate vanadium complexes, with the idea that a selective C-C cleavage reaction of this type could be used to produce valuable chemicals or intermediates from cellulose or lignin. Lignin is a randomized polymer containing methoxylated phenoxy propanol units. A number of different linkages occur naturally; one of the most prevalent is the {beta}-O-4 linkage shown in Figure 1, containing a C-C bond with 1,2-hydroxy ether substituents. While the oxidative C-C bond cleavage of 1,2-diols has been reported for a number of metals, including vanadium, iron, manganese, ruthenium, and polyoxometalate complexes, C-C bond cleavage of 1,2-hydroxy ethers is much less common. We report herein vanadium-mediated cleavage of C-C bonds between alcohol and ether functionalities in several lignin model complexes. In order to explore the scope and potential of vanadium complexes to effect oxidative C-C bond cleavage in 1,2-hydroxy ethers, we examined the reactivity of the lignin model complexes pinacol monomethyl ether (A), 2-phenoxyethanol (B), and 1,2-diphenyl-2-methoxyethanol (C) (Figure 1). Reaction of (dipic)V{sup V}(O)O{sup i}Pr (1a) or (dipic)V{sup v}(O)OEt (lb) with A, B, or C in acetonitrile yielded new vanadium(V) complexes where the alcohol-ether ligand was bound in a chelating fashion. From the reaction of 1b with pinacol monomethyl ether (A) in acetonitrile solution, (dipic)V{sup v}(O)(pinOMe) (2) (PinOMe = 2,3-dimethyl-3-methoxy-2-butanoxide) was isolated in 61 % yield. Reaction of 1b with 2-phenoxyethanol (B) in acetonitrile gave the new complex (dipic)V{sup v}(O)(OPE) (3) (OPE = 2-phenoxyethoxide), which was isolated in 76% yield. In a similar fashion, 1a reacted with 1,2-diphenyl-2-methoxyethanol (C) to give (dipic)V(O)(DPME) (4) (DPME = 1,2-diphenyl-2-methoxyethoxide), which was isolated in 39% yield. Complexes 2, 3, and 4 were characterized by {sup 1}H NMR and IR spectroscopy, elemental analysis, and X-ray crystallography. Compared to the previously reported vanadium(V) pinacolate complex (dipic)V(O)(pinOH) the X-ray structure of complex 2 reveals a slightly shorter V = O bond, 1.573(2) {angstrom} vs 1.588(2) {angstrom} for the pinOH structure. Complexes 3 and 4 display similar vanadium oxo bond distances of 1.568(2) {angstrom} and 1.576(2) {angstrom}, respectively. All three complexes show longer bonds to the ether-oxygen trans to the oxo (2.388(2) {angstrom} for 2, 2.547(2) {angstrom} for 3, and 2.438(2) {angstrom} for 4) than to the hydroxy-oxygen in the pinOH structure (2.252(2) {angstrom}).« less

The crystal structure of Neisseria gonorrhoeae PriB reveals mechanistic differences among bacterial DNA replication restart pathways

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dong, Jinlan; George, Nicholas P.; Duckett, Katrina L.

2010-05-25

Reactivation of repaired DNA replication forks is essential for complete duplication of bacterial genomes. However, not all bacteria encode homologs of the well-studied Escherichia coli DNA replication restart primosome proteins, suggesting that there might be distinct mechanistic differences among DNA replication restart pathways in diverse bacteria. Since reactivation of repaired DNA replication forks requires coordinated DNA and protein binding by DNA replication restart primosome proteins, we determined the crystal structure of Neisseria gonorrhoeae PriB at 2.7 {angstrom} resolution and investigated its ability to physically interact with DNA and PriA helicase. Comparison of the crystal structures of PriB from N. gonorrhoeaemore » and E. coli reveals a well-conserved homodimeric structure consisting of two oligosaccharide/oligonucleotide-binding (OB) folds. In spite of their overall structural similarity, there is significant species variation in the type and distribution of surface amino acid residues. This correlates with striking differences in the affinity with which each PriB homolog binds single-stranded DNA and PriA helicase. These results provide evidence that mechanisms of DNA replication restart are not identical across diverse species and that these pathways have likely become specialized to meet the needs of individual organisms.« less

Structures of Mycobacterium Tuberculosis Folylpolyglutamate Synthase Complexed With ADP And AMPPCD

DOE Office of Scientific and Technical Information (OSTI.GOV)

Young, P.G.; Smith, C.A.; Metcalf, P.

2009-05-28

Folate derivatives are essential vitamins for cell growth and replication, primarily because of their central role in reactions of one-carbon metabolism. Folates require polyglutamation to be efficiently retained within the cell and folate-dependent enzymes have a higher affinity for the polyglutamylated forms of this cofactor. Polyglutamylation is dependent on the enzyme folylpolyglutamate synthetase (FPGS), which catalyzes the sequential addition of several glutamates to folate. FPGS is essential for the growth and survival of important bacterial species, including Mycobacterium tuberculosis, and is a potential drug target. Here, the crystal structures of M. tuberculosis FPGS in complex with ADP and AMPPCP aremore » reported at 2.0 and 2.3 angstroms resolution, respectively. The structures reveal a deeply buried nucleotide-binding site, as in the Escherichia coli and Lactobacillus casei FPGS structures, and a long extended groove for the binding of folate substrates. Differences from the E. coli and L. casei FPGS structures are seen in the binding of a key divalent cation, the carbamylation state of an essential lysine side chain and the adoption of an 'open' position by the active-site beta5-alpha6 loop. These changes point to coordinated events that are associated with dihydropteroate/folate binding and the catalysis of the new amide bond with an incoming glutamate residue.« less

Structure of a small-molecule inhibitor complexed with GlmU from Haemophilus influenzae reveals an allosteric binding site

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mochalkin, Igor; Lightle, Sandra; Narasimhan, Lakshmi

2008-04-02

N-Acetylglucosamine-1-phosphate uridyltransferase (GlmU) is an essential enzyme in aminosugars metabolism and an attractive target for antibiotic drug discovery. GlmU catalyzes the formation of uridine-diphospho-N-acetylglucosamine (UDP-GlcNAc), an important precursor in the peptidoglycan and lipopolisaccharide biosynthesis in both Gram-negative and Gram-positive bacteria. Here we disclose a 1.9 {angstrom} resolution crystal structure of a synthetic small-molecule inhibitor of GlmU from Haemophilus influenzae (hiGlmU). The compound was identified through a high-throughput screening (HTS) configured to detect inhibitors that target the uridyltransferase active site of hiGlmU. The original HTS hit exhibited a modest micromolar potency (IC{sub 50} - 18 {mu}M in a racemic mixture) againstmore » hiGlmU and no activity against Staphylococcus aureus GlmU (saGlmU). The determined crystal structure indicated that the inhibitor occupies an allosteric site adjacent to the GlcNAc-1-P substrate-binding region. Analysis of the mechanistic model of the uridyltransferase reaction suggests that the binding of this allosteric inhibitor prevents structural rearrangements that are required for the enzymatic reaction, thus providing a basis for structure-guided design of a new class of mechanism-based inhibitors of GlmU.« less

Structural Basis for High Affinity Volatile Anesthetic Binding in a Natural 4-helix Bundle Protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu,R.; Loll, P.; Eckenhoff, R.

2005-01-01

Physiologic sites for inhaled anesthetics are presumed to be cavities within transmembrane 4-{alpha}-helix bundles of neurotransmitter receptors, but confirmation of binding and structural detail of such sites remains elusive. To provide such detail, we screened soluble proteins containing this structural motif, and found only one that exhibited evidence of strong anesthetic binding. Ferritin is a 24-mer of 4-{alpha}-helix bundles; both halothane and isoflurane bind with K{sub A} values of {approx}10{sup 5} M{sup -1, } higher than any previously reported inhaled anesthetic-protein interaction. The crystal structures of the halothane/apoferritin and isoflurane/apoferritin complexes were determined at 1.75 Angstroms resolution, revealing a commonmore » anesthetic binding pocket within an interhelical dimerization interface. The high affinity is explained by several weak polar contacts and an optimal host/guest packing relationship. Neither the acidic protons nor ether oxygen of the anesthetics contribute to the binding interaction. Compared with unliganded apoferritin, the anesthetic produced no detectable alteration of structure or B factors. The remarkably high affinity of the anesthetic/apoferritin complex implies greater selectivity of protein sites than previously thought, and suggests that direct protein actions may underlie effects at lower than surgical levels of anesthetic, including loss of awareness.« less

Structural basis for the mechanism and substrate specificity of glycocyamine kinase, a phosphagen kinase family member

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lim, Kap; Pullalarevu, Sadhana; Surabian, Karen Talin

2010-03-12

Glycocyamine kinase (GK), a member of the phosphagen kinase family, catalyzes the Mg{sup 2+}-dependent reversible phosphoryl group transfer of the N-phosphoryl group of phosphoglycocyamine to ADP to yield glycocyamine and ATP. This reaction helps to maintain the energy homeostasis of the cell in some multicelullar organisms that encounter high and variable energy turnover. GK from the marine worm Namalycastis sp. is heterodimeric, with two homologous polypeptide chains, {alpha} and {beta}, derived from a common pre-mRNA by mutually exclusive N-terminal alternative exons. The N-terminal exon of GK{beta} encodes a peptide that is different in sequence and is 16 amino acids longermore » than that encoded by the N-terminal exon of GK{alpha}. The crystal structures of recombinant GK{alpha}{beta} and GK{beta}{beta} from Namalycastis sp. were determined at 2.6 and 2.4 {angstrom} resolution, respectively. In addition, the structure of the GK{beta}{beta} was determined at 2.3 {angstrom} resolution in complex with a transition state analogue, Mg{sup 2+}-ADP-NO{sub 3}{sup -}-glycocyamine. Consistent with the sequence homology, the GK subunits adopt the same overall fold as that of other phosphagen kinases of known structure (the homodimeric creatine kinase (CK) and the monomeric arginine kinase (AK)). As with CK, the GK N-termini mediate the dimer interface. In both heterodimeric and homodimeric GK forms, the conformations of the two N-termini are asymmetric, and the asymmetry is different than that reported previously for the homodimeric CKs from several organisms. The entire polypeptide chains of GK{alpha}{beta} are structurally defined, and the longer N-terminus of the {beta} subunit is anchored at the dimer interface. In GK{beta}{beta} the 24 N-terminal residues of one subunit and 11 N-terminal residues of the second subunit are disordered. This observation is consistent with a proposal that the GK{alpha}{beta} amino acids involved in the interface formation were optimized once a heterodimer emerged as the physiological form of the enzyme. As a consequence, the homodimer interface (either solely {alpha} or solely {beta} chains) has been corrupted. In the unbound state, GK exhibits an open conformation analogous to that observed with ligand-free CK or AK. Upon binding the transition state analogue, both subunits of GK undergo the same closure motion that clasps the transition state analogue, in contrast to the transition state analogue complexes of CK, where the corresponding transition state analogue occupies only one subunit, which undergoes domain closure. The active site environments of the GK, CK, and AK at the bound states reveal the structural determinants of substrate specificity. Despite the equivalent binding in both active sites of the GK dimer, the conformational asymmetry of the N-termini is retained. Thus, the coupling between the structural asymmetry and negative cooperativity previously proposed for CK is not supported in the case of GK.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sturza, Mihai; Bugaris, Daniel E.; Malliakas, Christos D.

The new ternary copper selenide NaCu 4Se 3 crystallizes in the RbCd 4As 3 structure type with the trigonal space group R3m and lattice constants a = 4.0316(4) angstrom and c = 31.438(8) angstrom. Its structure is built from two-dimensional slabs of 2 ∞ [Cu 4Se 3] separated by Na + cations. The compound is formally mixed-valent with Se 2-/Se - atoms and exhibits metallic properties. It is a hole conductor with an electrical conductivity of similar to 300 S cm -1 at room temperature and a thermopower of similar to 10 mu V K -1. Hall effect measurements indicatemore » holes as the dominant carrier with a concentration of similar to 6.12(1) X 10 21 cm -3 at 300 K. Density functional theory electronic structure calculations indicate p -type metallic behavior for the 2 ∞ [Cu 4Se 3] framework, which is in a good agreement with the experimental metallic conductivity and Pauli paramagnetism.« less

Midbody Targeting of the ESCRT Machinery by a Noncanonical Coiled Coil in CEP55

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Hyung Ho; Elia, Natalie; Ghirlando, Rodolfo

2008-11-14

The ESCRT (endosomal sorting complex required for transport) machinery is required for the scission of membrane necks in processes including the budding of HIV-1 and cytokinesis. An essential step in cytokinesis is recruitment of the ESCRT-I complex and the ESCRT-associated protein ALIX to the midbody (the structure that tethers two daughter cells) by the protein CEP55. Biochemical experiments show that peptides from ALIX and the ESCRT-I subunit TSG101 compete for binding to the ESCRT and ALIX-binding region (EABR) of CEP55. We solved the crystal structure of EABR bound to an ALIX peptide at a resolution of 2.0 angstroms. The structuremore » shows that EABR forms an aberrant dimeric parallel coiled coil. Bulky and charged residues at the interface of the two central heptad repeats create asymmetry and a single binding site for an ALIX or TSG101 peptide. Both ALIX and ESCRT-I are required for cytokinesis, which suggests that multiple CEP55 dimers are required for function.« less

Structural basis for sorting mechanism of p62 in selective autophagy.

PubMed

Ichimura, Yoshinobu; Kumanomidou, Taichi; Sou, Yu-shin; Mizushima, Tsunehiro; Ezaki, Junji; Ueno, Takashi; Kominami, Eiki; Yamane, Takashi; Tanaka, Keiji; Komatsu, Masaaki

2008-08-15

Impairment of autophagic degradation of the ubiquitin- and LC3-binding protein "p62" leads to the formation of cytoplasmic inclusion bodies. However, little is known about the sorting mechanism of p62 to autophagic degradation. Here we identified a motif of murine p62 consisting of 11 amino acids (Ser334-Ser344) containing conserved acidic and hydrophobic residues across species, as an LC3 recognition sequence (LRS). The crystal structure of the LC3-LRS complex at 1.56 angstroms resolution revealed interaction of Trp340 and Leu343 of p62 with different hydrophobic pockets on the ubiquitin fold of LC3. In vivo analyses demonstrated that p62 mutants lacking LC3 binding ability accumulated without entrapping into autophagosomes in the cytoplasm and subsequently formed ubiquitin-positive inclusion bodies as in autophagy-deficient cells. These results demonstrate that the intracellular level of p62 is tightly regulated by autophagy through the direct interaction of LC3 with p62 and reveal that selective turnover of p62 via autophagy controls inclusion body formation.

Antibody Recognition of a Highly Conserved Influenza Virus Epitope

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ekiert, Damian C.; Bhabha, Gira; Elsliger, Marc-André

2009-05-21

Influenza virus presents an important and persistent threat to public health worldwide, and current vaccines provide immunity to viral isolates similar to the vaccine strain. High-affinity antibodies against a conserved epitope could provide immunity to the diverse influenza subtypes and protection against future pandemic viruses. Cocrystal structures were determined at 2.2 and 2.7 angstrom resolutions for broadly neutralizing human antibody CR6261 Fab in complexes with the major surface antigen (hemagglutinin, HA) from viruses responsible for the 1918 H1N1 influenza pandemic and a recent lethal case of H5N1 avian influenza. In contrast to other structurally characterized influenza antibodies, CR6261 recognizes amore » highly conserved helical region in the membrane-proximal stem of HA1 and HA2. The antibody neutralizes the virus by blocking conformational rearrangements associated with membrane fusion. The CR6261 epitope identified here should accelerate the design and implementation of improved vaccines that can elicit CR6261-like antibodies, as well as antibody-based therapies for the treatment of influenza.« less

Modulation of kinase-inhibitor interactions by auxiliary protein binding: Crystallography studies on Aurora A interactions with VX-680 and with TPX2

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhao, Baoguang; Smallwood, Angela; Yang, Jingsong

2008-10-24

VX-680, also known as MK-0457, is an ATP-competitive small molecule inhibitor of the Aurora kinases that has entered phase II clinical trials for the treatment of cancer. We have solved the cocrystal structure of AurA/TPX2/VX-680 at 2.3 {angstrom} resolution. In the crystal structure, VX-680 binds to the active conformation of AurA. The glycine-rich loop in AurA adopts a unique bent conformation, forming a {pi}-{pi} interaction with the phenyl group of VX-680. In contrast, in the published AurA/VX-680 structure, VX-680 binds to AurA in the inactive conformation, interacting with a hydrophobic pocket only present in the inactive conformation. These data suggestmore » that TPX2, a protein cofactor, can alter the binding mode of VX-680 with AurA. More generally, the presence of physiologically relevant cofactor proteins can alter the kinetics, binding interactions, and inhibition of enzymes, and studies with these multiprotein complexes may be beneficial to the discovery and optimization of enzyme inhibitors as therapeutic agents.« less

Mechanism for the Inhibition of the Carboxyl-transferase

DOE Office of Scientific and Technical Information (OSTI.GOV)

L Yu; Y Kim; L Tong

Acetyl-CoA carboxylases (ACCs) are crucial metabolic enzymes and have been targeted for drug development against obesity, diabetes, and other diseases. The carboxyltransferase (CT) domain of this enzyme is the site of action for three different classes of herbicides, as represented by haloxyfop, tepraloxydim, and pinoxaden. Our earlier studies have demonstrated that haloxyfop and tepraloxydim bind in the CT active site at the interface of its dimer. However, the two compounds probe distinct regions of the dimer interface, sharing primarily only two common anchoring points of interaction with the enzyme. We report here the crystal structure of the CT domain ofmore » yeast ACC in complex with pinoxaden at 2.8-{angstrom} resolution. Despite their chemical diversity, pinoxaden has a similar binding mode as tepraloxydim and requires a small conformational change in the dimer interface for binding. Crystal structures of the CT domain in complex with all three classes of herbicides confirm the importance of the two anchoring points for herbicide binding. The structures also provide a foundation for understanding the molecular basis of the herbicide resistance mutations and cross resistance among the herbicides, as well as for the design and development of new inhibitors against plant and human ACCs.« less

Crystal Structure of the Agrin-Responsive Immunoglobulin-like Domains 1 and 2 of the Receptor Tyrosine Kinase MuSK

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stiegler,A.; Burden, S.; Hubbard, S.

Muscle-specific kinase (MuSK) is a receptor tyrosine kinase expressed exclusively in skeletal muscle, where it is required for formation of the neuromuscular junction. MuSK is activated by agrin, a neuron-derived heparan sulfate proteoglycan. Here, we report the crystal structure of the agrin-responsive first and second immunoglobulin-like domains (Ig1 and Ig2) of the MuSK ectodomain at 2.2 {angstrom} resolution. The structure reveals that MuSK Ig1 and Ig2 are Ig-like domains of the I-set subfamily, which are configured in a linear, semi-rigid arrangement. In addition to the canonical internal disulfide bridge, Ig1 contains a second, solvent-exposed disulfide bridge, which our biochemical datamore » indicate is critical for proper folding of Ig1 and processing of MuSK. Two Ig1-2 molecules form a non-crystallographic dimer that is mediated by a unique hydrophobic patch on the surface of Ig1. Biochemical analyses of MuSK mutants introduced into MuSK{sup -/-} myotubes demonstrate that residues in this hydrophobic patch are critical for agrin-induced MuSK activation.« less

Structure of the Ubiquitin Hydrolase UCH-L3 Complexed with a Suicide Substrate

DOE Office of Scientific and Technical Information (OSTI.GOV)

Misaghi, S.; Galardy, P.J.; Meester, W.J.

Ubiquitin C-terminal hydrolases (UCHs) comprise a family of small ubiquitin-specific proteases of uncertain function. Although no cellular substrates have been identified for UCHs, their highly tissue-specific expression patterns and the association of UCH-L1 mutations with human disease strongly suggest a critical role. The structure of the yeast UCH Yuh1-ubiquitin aldehyde complex identified an active site crossover loop predicted to limit the size of suitable substrates. We report the 1.45 {angstrom} resolution crystal structure of human UCH-L3 in complex with the inhibitor ubiquitin vinylmethylester, an inhibitor that forms a covalent adduct with the active site cysteine of ubiquitin-specific proteases. This structuremore » confirms the predicted mechanism of the inhibitor and allows the direct comparison of a UCH family enzyme in the free and ligand-bound state. We also show the efficient hydrolysis by human UCH-L3 of a 13-residue peptide in isopeptide linkage with ubiquitin, consistent with considerable flexibility in UCH substrate size. We propose a model for the catalytic cycle of UCH family members which accounts for the hydrolysis of larger ubiquitin conjugates.« less

Insights into Hsp70 Chaperone Activity from a Crystal Structure of the Yeast Hsp110 Sse1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu,Q.; Hendrickson, W.

2007-01-01

Classic Hsp70 chaperones assist in diverse processes of protein folding and translocation, and Hsp110s had seemed by sequence to be distant relatives within an Hsp70 superfamily. The 2.4 Angstroms resolution structure of Sse1 with ATP shows that Hsp110s are indeed Hsp70 relatives, and it provides insight into allosteric coupling between sites for ATP and polypeptide-substrate binding in Hsp70s. Subdomain structures are similar in intact Sse1(ATP) and in the separate Hsp70 domains, but conformational dispositions are radically different. Interfaces between Sse1 domains are extensive, intimate, and conservative in sequence with Hsp70s. We propose that Sse1(ATP) may be an evolutionary vestige ofmore » the Hsp70(ATP) state, and an analysis of 64 mutant variants in Sse1 and three Hsp70 homologs supports this hypothesis. An atomic-level understanding of Hsp70 communication between ATP and substrate-binding domains follows. Requirements on Sse1 for yeast viability are in keeping with the distinct function of Hsp110s as nucleotide exchange factors.« less

Tracking the ultrafast motion of a single molecule by femtosecond orbital imaging

PubMed Central

Yu, Ping; Repp, Jascha; Huber, Rupert

2017-01-01

Watching a single molecule move on its intrinsic time scale—one of the central goals of modern nanoscience—calls for measurements that combine ultrafast temporal resolution1–8 with atomic spatial resolution9–30. Steady-state experiments achieve the requisite spatial resolution, as illustrated by direct imaging of individual molecular orbitals using scanning tunnelling microscopy9–11 or the acquisition of tip-enhanced Raman and luminescence spectra with sub-molecular resolution27–29. But tracking the dynamics of a single molecule directly in the time domain faces the challenge that single-molecule excitations need to be confined to an ultrashort time window. A first step towards overcoming this challenge has combined scanning tunnelling microscopy with so-called ‘lightwave electronics”1–8, which uses the oscillating carrier wave of tailored light pulses to directly manipulate electronic motion on time scales faster even than that of a single cycle of light. Here we use such ultrafast terahertz scanning tunnelling microscopy to access a state-selective tunnelling regime, where the peak of a terahertz electric-field waveform transiently opens an otherwise forbidden tunnelling channel through a single molecular state and thereby removes a single electron from an individual pentacene molecule’s highest occupied molecular orbital within a time window shorter than one oscillation cycle of the terahertz wave. We exploit this effect to record ~100 fs snapshot images of the structure of the orbital involved, and to reveal through pump-probe measurements coherent molecular vibrations at terahertz frequencies directly in the time domain and with sub-angstrom spatial resolution. We anticipate that the combination of lightwave electronics1–8 and atomic resolution of our approach will open the door to controlling electronic motion inside individual molecules at optical clock rates. PMID:27830788

The Crystal Structure of a Binary Complex of Two Pseudopilins: EpsI And EpsJ From the Type 2 Secretion System of Vibrio Vulnificus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yanez, M.E.; Korotkov, K.V.; Abendroth, J.

2009-05-28

Type II secretion systems (T2SS) translocate virulence factors from the periplasmic space of many pathogenic bacteria into the extracellular environment. The T2SS of Vibrio cholerae and related species is called the extracellular protein secretion (Eps) system that consists of a core of multiple copies of 11 different proteins. The pseudopilins, EpsG, EpsH, EpsI, EpsJ and EpsK, are five T2SS proteins that are thought to assemble into a pseudopilus, which is assumed to interact with the outer membrane pore, and may actively participate in the export of proteins. We report here biochemical evidence that the minor pseudopilins EpsI and EpsJ frommore » Vibrio species interact directly with one another. Moreover, the 2.3 {angstrom} resolution crystal structure of a complex of EspI and EpsJ from Vibrio vulnificus represents the first atomic resolution structure of a complex of two different pseudopilin components from the T2SS. Both EpsI and EpsJ appear to be structural extremes within the family of type 4a pilin structures solved to date, with EpsI having the smallest, and EpsJ the largest, 'variable pilin segment' seen thus far. A high degree of sequence conservation in the EpsI:EpsJ interface indicates that this heterodimer occurs in the T2SS of a large number of bacteria. The arrangement of EpsI and EpsJ in the heterodimer would correspond to a right-handed helical character of proteins assembled into a pseudopilus.« less

Group-III nitride VCSEL structures grown by molecular beam epitaxy

NASA Astrophysics Data System (ADS)

Ng, HockMin; Moustakas, Theodore D.

2000-07-01

III-nitride VCSEL structures designed for electron-beam pumping have been grown by molecular beam epitaxy (MBE). The structures consist of a sapphire substrate on which an AlN/GaN distributed Bragg reflector (DBR) with peak reflectance >99% at 402 nm is deposited. The active region consists of a 2-(lambda) cavity with 25 In0.1Ga0.9N/GaN multiquantum wells (MQWs) whose emission coincides with the high reflectance region of the DBR. The thicknesses of the InGaN wells and the GaN barriers are 35 angstrom and 75 angstrom respectively. The top reflector consists of a silver metallic mirror which prevents charging effects during electron-beam pumping. The structure was pumped from the top- side with a cw electron-beam using a modified cathodoluminescence (CL) system mounted on a scanning electron microscope chamber. Light output was collected from the polished sapphire substrate side. Measurements performed at 100 K showed intense emission at 407 nm with narrowing of the linewidth with increasing beam current. A narrow emission linewidth of 0.7 nm was observed indicating the onset of stimulated emission.

The Crystal Structure of the Ring-Hydroxylating Dioxygenase from Sphingomonas CHY-1

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jakoncic,J.; Jouanneau, Y.; Meyer, C.

The ring-hydroxylating dioxygenase (RHD) from Sphingomonas CHY-1 is remarkable due to its ability to initiate the oxidation of a wide range of polycyclic aromatic hydrocarbons (PAHs), including PAHs containing four- and five-fused rings, known pollutants for their toxic nature. Although the terminal oxygenase from CHY-1 exhibits limited sequence similarity with well characterized RHDs from the naphthalene dioxygenase family, the crystal structure determined to 1.85 {angstrom} by molecular replacement revealed the enzyme to share the same global {alpha}{sub 3}{beta}{sub 3} structural pattern. The catalytic domain distinguishes itself from other bacterial non-heme Rieske iron oxygenases by a substantially larger hydrophobic substrate bindingmore » pocket, the largest ever reported for this type of enzyme. While residues in the proximal region close to the mononuclear iron atom are conserved, the central region of the catalytic pocket is shaped mainly by the side chains of three amino acids, Phe350, Phe404 and Leu356, which contribute to the rather uniform trapezoidal shape of the pocket. Two flexible loops, LI and LII, exposed to the solvent seem to control the substrate access to the catalytic pocket and control the pocket length. Compared with other naphthalene dioxygenases residues Leu223 and Leu226, on loop LI, are moved towards the solvent, thus elongating the catalytic pocket by at least 2 {angstrom}. An 11 {angstrom} long water channel extends from the interface between the {alpha} and {beta} subunits to the catalytic site. The comparison of these structures with other known oxygenases suggests that the broad substrate specificity presented by the CHY-1 oxygenase is primarily due to the large size and particular topology of its catalytic pocket and provided the basis for the study of its reaction mechanism.« less

Molecular dynamics studies of interfacial water at the alumina surface.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Argyris, Dr. Dimitrios; Ho, Thomas; Cole, David

2011-01-01

Interfacial water properties at the alumina surface were investigated via all-atom equilibrium molecular dynamics simulations at ambient temperature. Al-terminated and OH-terminated alumina surfaces were considered to assess the structural and dynamic behavior of the first few hydration layers in contact with the substrates. Density profiles suggest water layering up to {approx}10 {angstrom} from the solid substrate. Planar density distribution data indicate that water molecules in the first interfacial layer are organized in well-defined patterns dictated by the atomic terminations of the alumina surface. Interfacial water exhibits preferential orientation and delayed dynamics compared to bulk water. Water exhibits bulk-like behavior atmore » distances greater than {approx}10 {angstrom} from the substrate. The formation of an extended hydrogen bond network within the first few hydration layers illustrates the significance of water?water interactions on the structural properties at the interface.« less

DOE Office of Scientific and Technical Information (OSTI.GOV)

Li, Yong; Choi, Mihwa; Cavey, Greg

The orphan nuclear receptor steroidogenic factor 1 (SF-1) regulates the differentiation and function of endocrine glands. Although SF-1 is constitutively active in cell-based assays, it is not known whether this transcriptional activity is modulated by ligands. Here, we describe the 1.5 {angstrom} crystal structure of the SF-1 ligand binding domain in complex with an LXXLL motif from a coregulator protein. The structure reveals the presence of a phospholipid ligand in a surprisingly large pocket ({approx}1600 {angstrom}{sup 3}), with the receptor adopting the canonical active conformation. The bound phospholipid is readily exchanged and modulates SF-1 interactions with coactivators. Mutations designed tomore » reduce the size of the SF-1 pocket or to disrupt hydrogen bonds with the phospholipid abolish SF-1/coactivator interactions and significantly reduce SF-1 transcriptional activity. These findings provide evidence that SF-1 is regulated by endogenous ligands and suggest an unexpected relationship between phospholipids and endocrine development and function.« less

Purification, Crystallization and Preliminary X-ray Characterization of Prunin-1, a Major Component of the Almond (Prunus dulcis) Allergen Amandin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Albillos, Silvia M.; Jin, Tengchuan; Howard, Andrew

2008-08-04

The 11S globulins from plant seeds account for a number of major food allergens. Because of the interest in the structural basis underlying the allergenicity of food allergens, we sought to crystallize the main 11S seed storage protein from almond (Prunus dulcis). Prunin-1 (Pru1) was purified from defatted almond flour by water extraction, cryoprecipitation, followed by sequential anion exchange, hydrophobic interaction, and size exclusion chromatography. Single crystals of Pru1 were obtained in a screening with a crystal screen kit, using the hanging-drop vapor diffusion method. Diffraction quality crystals were grown after optimization. The Pru1 crystals diffracted to at least 3.0more » {angstrom} and belong to the tetragonal space group P4{sub 1}22, with unit cell parameters of a = b = 150.912 {angstrom}, c = 165.248 {angstrom}. Self-rotation functions and molecular replacement calculations showed that there are three molecules in the asymmetry unit with water content of 51.41%. The three Pru1 protomers are related by a noncrystallographic 3-fold axis and they form a doughnut-shaped trimer. Two prunin trimers form a homohexamer. Elucidation of prunin structure will allow further characterization of the allergenic features of the 11S protein allergens at the molecular level.« less

Heterometallic niobium complexes containing the {open_quotes}CpNb{close_quotes} unit. X-ray crystal structures of CpNbCl{sub 2}({mu}-SEt){sub 2}NiCp and CpNb(PhCCPh)({mu}-SPr{sup 1}){sub 2}Mo(CO){sub 4}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Woodward, S.; Curtis, M.D.; Rheingold, A.L.

1992-06-01

Cp{sub 2}Nb{sub 2}Cl{sub 2}({mu}-Cl{sub 2})(CO){sub 4} reacts with Cp{sub 2}Ni{sub 2}({mu}-SEt){sub 2} to yield paramagnetic CpNbCl{sub 2}({mu}-SEt){sub 2}NiCp: (g) = 2.004, A = 129 G; space group = P2{sub 1}/c,a = 7.466 (1) {Angstrom}, b = 28.427 (5) {Angstrom}, c = 8.620 (2) {Angstrom}, {beta} = 104.81 (1){degree}. CpNb(PhCCPh)({mu}-SPr{sup i}){sub 2}Mo(CO){sub 4} is synthesized by the addition of LiSPr{sup i} to CpNbCl{sub 2}PhCCPh resulting in formation of CpNb(SPr{sup i}){sub 2}(PhCCPh) followed by the reaction of the thiolate complex with Mo(MeCN){sub 3}(CO){sub 3} and CO (1 equiv). The crystal structure for CpNb(PhCCPh)({mu}-SPr{sup i}){sub 2}Mo(CO){sub 4} is reported and EHMO calculations ofmore » the bonding in CpNbCl{sub 2}({mu}-SEt{sub 2})NiCp were discussed. 27 refs., 5 figs., 5 tabs.« less

Achieving high permeability and enhanced selectivity for Angstrom-scale separations using artificial water channel membranes.

PubMed

Shen, Yue-Xiao; Song, Woochul C; Barden, D Ryan; Ren, Tingwei; Lang, Chao; Feroz, Hasin; Henderson, Codey B; Saboe, Patrick O; Tsai, Daniel; Yan, Hengjing; Butler, Peter J; Bazan, Guillermo C; Phillip, William A; Hickey, Robert J; Cremer, Paul S; Vashisth, Harish; Kumar, Manish

2018-06-12

Synthetic polymer membranes, critical to diverse energy-efficient separations, are subject to permeability-selectivity trade-offs that decrease their overall efficacy. These trade-offs are due to structural variations (e.g., broad pore size distributions) in both nonporous membranes used for Angstrom-scale separations and porous membranes used for nano to micron-scale separations. Biological membranes utilize well-defined Angstrom-scale pores to provide exceptional transport properties and can be used as inspiration to overcome this trade-off. Here, we present a comprehensive demonstration of such a bioinspired approach based on pillar[5]arene artificial water channels, resulting in artificial water channel-based block copolymer membranes. These membranes have a sharp selectivity profile with a molecular weight cutoff of ~ 500 Da, a size range challenging to achieve with current membranes, while achieving a large improvement in permeability (~65 L m -2  h -1  bar -1  compared with 4-7 L m -2  h -1  bar -1 ) over similarly rated commercial membranes.

Formation of Monolayer Films by the Spontaneous Assembly of Organic Thiols from Solution onto Gold

DTIC Science & Technology

1988-09-01

estimated a theoretical slope of 1.27 A per CH2 unit and an intercept of 4 A. The dashed line represents the thickness expected for a monolayer tilted 30...angstroms--well below the length scale expected theoretically to give rise to hysteresis.3 1 , 7 8 Figure 4 plots contact angles on a monolayer of...obtained from high resolution spectra and have been rounded to the nearest percent. Atomic compositions were derived from peak areas using photoionization

Structure-Specificity Relationships of an Intracellular Xylanase from Geobacillus stearothermophilus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Solomon,V.; Teplitsky, A.; Shulami, S.

2007-01-01

Geobacillus stearothermophilus T-6 is a thermophilic Gram-positive bacterium that produces two selective family 10 xylanases which both take part in the complete degradation and utilization of the xylan polymer. The two xylanases exhibit significantly different substrate specificities. While the extracellular xylanase (XT6; MW 43.8 kDa) hydrolyzes the long and branched native xylan polymer, the intracellular xylanase (IXT6; MW 38.6 kDa) preferentially hydrolyzes only short xylo-oligosaccharides. In this study, the detailed three-dimensional structure of IXT6 is reported, as determined by X-ray crystallography. It was initially solved by molecular replacement and then refined at 1.45 {angstrom} resolution to a final R factormore » of 15.0% and an R{sub free} of 19.0%. As expected, the structure forms the classical ({alpha}/{beta}){sub 8} fold, in which the two catalytic residues (Glu134 and Glu241) are located on the inner surface of the central cavity. The structure of IXT6 was compared with the highly homologous extracellular xylanase XT6, revealing a number of structural differences between the active sites of the two enzymes. In particular, structural differences derived from the unique subdomain in the carboxy-terminal region of XT6, which is completely absent in IXT6. These structural modifications may account for the significant differences in the substrate specificities of these otherwise very similar enzymes.« less

Femtosecond gas phase electron diffraction with MeV electrons.

PubMed

Yang, Jie; Guehr, Markus; Vecchione, Theodore; Robinson, Matthew S; Li, Renkai; Hartmann, Nick; Shen, Xiaozhe; Coffee, Ryan; Corbett, Jeff; Fry, Alan; Gaffney, Kelly; Gorkhover, Tais; Hast, Carsten; Jobe, Keith; Makasyuk, Igor; Reid, Alexander; Robinson, Joseph; Vetter, Sharon; Wang, Fenglin; Weathersby, Stephen; Yoneda, Charles; Wang, Xijie; Centurion, Martin

2016-12-16

We present results on ultrafast gas electron diffraction (UGED) experiments with femtosecond resolution using the MeV electron gun at SLAC National Accelerator Laboratory. UGED is a promising method to investigate molecular dynamics in the gas phase because electron pulses can probe the structure with a high spatial resolution. Until recently, however, it was not possible for UGED to reach the relevant timescale for the motion of the nuclei during a molecular reaction. Using MeV electron pulses has allowed us to overcome the main challenges in reaching femtosecond resolution, namely delivering short electron pulses on a gas target, overcoming the effect of velocity mismatch between pump laser pulses and the probe electron pulses, and maintaining a low timing jitter. At electron kinetic energies above 3 MeV, the velocity mismatch between laser and electron pulses becomes negligible. The relativistic electrons are also less susceptible to temporal broadening due to the Coulomb force. One of the challenges of diffraction with relativistic electrons is that the small de Broglie wavelength results in very small diffraction angles. In this paper we describe the new setup and its characterization, including capturing static diffraction patterns of molecules in the gas phase, finding time-zero with sub-picosecond accuracy and first time-resolved diffraction experiments. The new device can achieve a temporal resolution of 100 fs root-mean-square, and sub-angstrom spatial resolution. The collimation of the beam is sufficient to measure the diffraction pattern, and the transverse coherence is on the order of 2 nm. Currently, the temporal resolution is limited both by the pulse duration of the electron pulse on target and by the timing jitter, while the spatial resolution is limited by the average electron beam current and the signal-to-noise ratio of the detection system. We also discuss plans for improving both the temporal resolution and the spatial resolution.