Science.gov

Sample records for anthracis dihydrofolate reductase

  1. Synthetic and Crystallographic Studies of a New Inhibitor Series Targeting Bacillus anthracis Dihydrofolate Reductase

    PubMed Central

    Beierlein, Jennifer M.; Frey, Kathleen M.; Bolstad, David B.; Pelphrey, Phillip M.; Joska, Tammy M.; Smith, Adrienne E.; Priestley, Nigel D.; Wright, Dennis L.; Anderson, Amy C.

    2008-01-01

    Bacillus anthracis, the causative agent of anthrax, poses a significant biodefense danger. Serious limitations in approved therapeutics and the generation of resistance have produced a compelling need for new therapeutic agents against this organism. Bacillus anthracis is known to be insensitive to the clinically used antifolate, trimethoprim, because of a lack of potency against the dihydrofolate reductase enzyme. Herein, we describe a novel lead series of B. anthracis dihydrofolate reductase inhibitors characterized by an extended trimethoprim-like scaffold. The best lead compound adds only 22 Da to the molecular weight and is 82-fold more potent than trimethoprim. An X-ray crystal structure of this lead compound bound to B. anthracis dihydrofolate reductase in the presence of NADPH was determined to 2.25 Å resolution. The structure reveals several features that can be exploited for further development of this lead series. PMID:19007108

  2. Synthetic and Crystallographic Studies of a New Inhibitor Series Targeting Bacillus anthracis Dihydrofolate Reductase

    SciTech Connect

    Beierlein, J.; Frey, K; Bolstad, D; Pelphrey, P; Joska, T; Smith, A; Priestley, N; Wright, D; Anderson, A

    2008-01-01

    Bacillus anthracis, the causative agent of anthrax, poses a significant biodefense danger. Serious limitations in approved therapeutics and the generation of resistance have produced a compelling need for new therapeutic agents against this organism. Bacillus anthracis is known to be insensitive to the clinically used antifolate, trimethoprim, because of a lack of potency against the dihydrofolate reductase enzyme. Herein, we describe a novel lead series of B. anthracis dihydrofolate reductase inhibitors characterized by an extended trimethoprim-like scaffold. The best lead compound adds only 22 Da to the molecular weight and is 82-fold more potent than trimethoprim. An X-ray crystal structure of this lead compound bound to B. anthracis dihydrofolate reductase in the presence of NADPH was determined to 2.25 A resolution. The structure reveals several features that can be exploited for further development of this lead series.

  3. Molecular modeling toward selective inhibitors of dihydrofolate reductase from the biological warfare agent Bacillus anthracis.

    PubMed

    Giacoppo, Juliana O S; Mancini, Daiana T; Guimarães, Ana P; Gonçalves, Arlan S; da Cunha, Elaine F F; França, Tanos C C; Ramalho, Teodorico C

    2015-02-16

    In the present work, we applied docking and molecular dynamics techniques to study 11 compounds inside the enzymes dihydrofolate reductase (DHFR) from the biological warfare agent Bacillus anthracis (BaDHFR) and Homo sapiens sapiens (HssDHFR). Six of these compounds were selected for a study with the mutant BaF96IDHFR. Our results corroborated with experimental data and allowed the proposition of a new molecule with potential activity and better selectivity for BaDHFR.

  4. Structure-activity relationship for enantiomers of potent inhibitors of B. anthracis dihydrofolate reductase

    PubMed Central

    Bourne, Christina R.; Wakeham, Nancy; Nammalwar, Baskar; Tseitin, Vladimir; Bourne, Philip C.; Barrow, Esther W.; Mylvaganam, Shankari; Ramnarayan, Kal; Bunce, Richard A.; Berlin, K. Darrell; Barrow, William W.

    2012-01-01

    Background Bacterial resistance to antibiotic therapies is increasing and new treatment options are badly needed. There is an overlap between these resistant bacteria and organisms classified as likely bioterror weapons. For example, Bacillus anthracis is innately resistant to the anti-folate trimethoprim due to sequence changes found in the dihydrofolate reductase enzyme. Development of new inhibitors provides an opportunity to enhance the current arsenal of anti-folate antibiotics while also expanding the coverage of the anti-folate class. Methods We have characterized inhibitors of Bacillus anthracis dihydrofolate reductase by measuring the Ki and MIC values and calculating the energetics of binding. This series contains a core diaminopyrimidine ring, a central dimethoxybenzyl ring, and a dihydrophthalazine moiety. We have altered the chemical groups extended from a chiral center on the dihydropyridazine ring of the phthalazine moiety. The interactions for the most potent compounds were visualized by X-ray structure determination. Results We find that the potency of individual enantiomers is divergent with clear preference for the S-enantiomer, while maintaining a high conservation of contacts within the binding site. The preference for enantiomers seems to be predicated largely by differential interactions with protein residues Leu29, Gln30 and Arg53. Conclusions These studies have clarified the activity of modifications and of individual enantiomers, and highlighted the role of the less-active R-enantiomer in effectively diluting the more active S-enantiomer in racemic solutions. This directly contributes to the development of new antimicrobials, combating trimethoprim resistance, and treatment options for potential bioterrorism agents. PMID:22999981

  5. Targeted Mutations of Bacillus anthracis Dihydrofolate Reductase Condense Complex Structure-Activity Relationships

    SciTech Connect

    J Beierlein; N Karri; A Anderson

    2011-12-31

    Several antifolates, including trimethoprim (TMP) and a series of propargyl-linked analogues, bind dihydrofolate reductase from Bacillus anthracis (BaDHFR) with lower affinity than is typical in other bacterial species. To guide lead optimization for BaDHFR, we explored a new approach to determine structure-activity relationships whereby the enzyme is altered and the analogues remain constant, essentially reversing the standard experimental design. Active site mutants of the enzyme, Ba(F96I)DHFR and Ba(Y102F)DHFR, were created and evaluated with enzyme inhibition assays and crystal structures. The affinities of the antifolates increase up to 60-fold with the Y102F mutant, suggesting that interactions with Tyr 102 are critical for affinity. Crystal structures of the enzymes bound to TMP and propargyl-linked inhibitors reveal the basis of TMP resistance and illuminate the influence of Tyr 102 on the lipophilic linker between the pyrimidine and aryl rings. Two new inhibitors test and validate these conclusions and show the value of the technique for providing new directions during lead optimization.

  6. Modified 2,4-diaminopyrimidine-based dihydrofolate reductase inhibitors as potential drug scaffolds against Bacillus anthracis

    PubMed Central

    Nammalwar, Baskar; Bourne, Christina R.; Wakeham, Nancy; Bourne, Philip C.; Barrow, Esther W.; Muddala, N. Prasad; Bunce, Richard A.; Berlin, K. Darrell; Barrow, William W.

    2014-01-01

    The current paper describes the synthesis and biological evaluation of dihydrophthalazine-appended 2,4-diaminopyrimidine (DAP) inhibitors (1) oxidized at the methylene bridge linking the DAP ring to the central aromatic ring and (2) modified at the central ring ether groups. Structures 4a-b incorporating an oxidized methylene bridge showed a decrease in activity, while slightly larger alkyl groups (CH2CH3 versus CH3) on the central ring oxygen atoms (R2 and R3) had a minimal impact on the inhibition. Comparison of the potency data for previously reported RAB1 and BN-53 with the most potent of the new derivatives (19b and 20a-b) showed similar values for inhibition of cellular growth and direct enzymatic inhibition (MICs 0.5-2 μg/mL). Compounds 29-34 with larger ester and ether groups containing substituted aromatic rings at R3 exhibited slightly reduced activity (MICs 2-16 μg/mL). One explanation for this attenuated activity could be encroachment of the extended R3 into the neighboring NADPH co-factor. These results indicate that modest additions to the central ring oxygen atoms are well tolerated, while larger modifications have the potential to act as dual-site inhibitors of dihydrofolate reductase (DHFR). PMID:25435253

  7. Control of dihydrofolate reductase messenger ribonucleic acid production

    SciTech Connect

    Leys, E.J.; Kellems, R.E.

    1981-11-01

    The authors used methotrexate-resistant mouse cells in which dihydrofolate reductase levels are approximately 500 times normal to study the effect of growth stimulation on dihydrofolate reductase gene expression. As a result of growth stimulation, the relative rate of dihydrofolate reductase protein synthesis increased threefold, reaching a maximum between 25 and 30 h after stimulation. The relative rate of dihydrofolate reductase messenger ribonucleic acid production (i.e., the appearance of dihydrofolate reductase messenger ribonucleic acid in the cytoplasm) increased threefold after growth stimulation and was accompanied by a corresponding increase in the relative steady-state level of dihydrofolate reductase ribonucleic acid in the nucleus. However, the increase in the nuclear level of dihydrofolate reductase ribonucleic acid was not accompanied by a significant increase in the relative rate of transcription of the dihydrofolate reductase genes. These data indicated that the relative rate of appearance of dihydrofolate reductase messenger ribonucleic acid in the cytoplasm depends on the relative stability of the dihydrofolate reductase ribonucleic acid sequences in the nucleus and is not dependent on the relative rate of transcription of the dihydrofolate reductase genes.

  8. Tales of Dihydrofolate Binding to R67 Dihydrofolate Reductase

    PubMed Central

    2015-01-01

    Homotetrameric R67 dihydrofolate reductase possesses 222 symmetry and a single active site pore. This situation results in a promiscuous binding site that accommodates either the substrate, dihydrofolate (DHF), or the cofactor, NADPH. NADPH interacts more directly with the protein as it is larger than the substrate. In contrast, the p-aminobenzoyl-glutamate tail of DHF, as monitored by nuclear magnetic resonance and crystallography, is disordered when bound. To explore whether smaller active site volumes (which should decrease the level of tail disorder by confinement effects) alter steady state rates, asymmetric mutations that decreased the half-pore volume by ∼35% were constructed. Only minor effects on kcat were observed. To continue exploring the role of tail disorder in catalysis, 1-ethyl-3-[3-(dimethylamino)propyl]carbodiimide-mediated cross-linking between R67 DHFR and folate was performed. A two-folate, one-tetramer complex results in the loss of enzyme activity where two symmetry-related K32 residues in the protein are cross-linked to the carboxylates of two bound folates. The tethered folate could be reduced, although with a ≤30-fold decreased rate, suggesting decreased dynamics and/or suboptimal positioning of the cross-linked folate for catalysis. Computer simulations that restrain the dihydrofolate tail near K32 indicate that cross-linking still allows movement of the p-aminobenzoyl ring, which allows the reaction to occur. Finally, a bis-ethylene-diamine-α,γ-amide folate adduct was synthesized; both negatively charged carboxylates in the glutamate tail were replaced with positively charged amines. The Ki for this adduct was ∼9-fold higher than for folate. These various results indicate a balance between folate tail disorder, which helps the enzyme bind substrate while dynamics facilitates catalysis. PMID:26637016

  9. Microsecond subdomain folding in dihydrofolate reductase.

    PubMed

    Arai, Munehito; Iwakura, Masahiro; Matthews, C Robert; Bilsel, Osman

    2011-07-08

    The characterization of microsecond dynamics in the folding of multisubdomain proteins has been a major challenge in understanding their often complex folding mechanisms. Using a continuous-flow mixing device coupled with fluorescence lifetime detection, we report the microsecond folding dynamics of dihydrofolate reductase (DHFR), a two-subdomain α/β/α sandwich protein known to begin folding in this time range. The global dimensions of early intermediates were monitored by Förster resonance energy transfer, and the dynamic properties of the local Trp environments were monitored by fluorescence lifetime detection. We found that substantial collapse occurs in both the locally connected adenosine binding subdomain and the discontinuous loop subdomain within 35 μs of initiation of folding from the urea unfolded state. During the fastest observable ∼550 μs phase, the discontinuous loop subdomain further contracts, concomitant with the burial of Trp residue(s), as both subdomains achieve a similar degree of compactness. Taken together with previous studies in the millisecond time range, a hierarchical assembly of DHFR--in which each subdomain independently folds, subsequently docks, and then anneals into the native conformation after an initial heterogeneous global collapse--emerges. The progressive acquisition of structure, beginning with a continuously connected subdomain and spreading to distal regions, shows that chain entropy is a significant organizing principle in the folding of multisubdomain proteins and single-domain proteins. Subdomain folding also provides a rationale for the complex kinetics often observed.

  10. Dihydrofolate reductase: A potential drug target in trypanosomes and leishmania

    NASA Astrophysics Data System (ADS)

    Zuccotto, Fabio; Martin, Andrew C. R.; Laskowski, Roman A.; Thornton, Janet M.; Gilbert, Ian H.

    1998-05-01

    Dihydrofolate reductase has successfully been used as a drug target in the area of anti-cancer, anti-bacterial and anti-malarial chemotherapy. Little has been done to evaluate it as a drug target for treatment of the trypanosomiases and leishmaniasis. A crystal structure of Leishmania major dihydrofolate reductase has been published. In this paper, we describe the modelling of Trypanosoma cruzi and Trypanosoma brucei dihydrofolate reductases based on this crystal structure. These structures and models have been used in the comparison of protozoan, bacterial and human enzymes in order to highlight the different features that can be used in the design of selective anti-protozoan agents. Comparison has been made between residues present in the active site, the accessibility of these residues, charge distribution in the active site, and the shape and size of the active sites. Whilst there is a high degree of similarity between protozoan, human and bacterial dihydrofolate reductase active sites, there are differences that provide potential for selective drug design. In particular, we have identified a set of residues which may be important for selective drug design and identified a larger binding pocket in the protozoan than the human and bacterial enzymes.

  11. Fluorescent analogues of methotrexate: characterization and interaction with dihydrofolate reductase.

    PubMed

    Kumar, A A; Kempton, R J; Anstead, G M; Freisheim, J H

    1983-01-18

    The dansylated derivatives of lysine and ornithine analogues of methotrexate exhibit fluorescence properties characteristic of the dansyl moiety with an excitation at 328 nm and an emission maximum at 580 nm in aqueous media. As in the case of dansyl amino acids, the fluorescence emission is dependent upon the polarity of the medium. In solvents of low dielectric constant there is an enhancement of the dansyl fluorescence intensity as well as a shift to shorter wavelengths. The dansylated analogues show a reduction in the quantum yields as compared to N epsilon-dansyl-L-lysine and 5-(N,N-dimethylamino)-1-naphthalenesulfonic acid. The absorption spectra of the two dansyl analogues are similar to the spectra of the parent basic amino acid precursors but with reduced molar extinction values. The two fluorescent analogues of methotrexate were found to be potent inhibitors of purified dihydrofolate reductases from Lactobacillus casei and from chicken liver. The binding of these fluorescent analogues to either dihydrofolate reductase resulted in 10-15-nm blue shift of the ligand emission maxima and a 2-5-fold enhancement of the emission. These fluorescent properties of the bound ligands indicate a possible interaction of the dansyl moiety with a region on the enzyme molecule which is more hydrophobic relative to the surrounding solvent.

  12. Correlated Protein Motion Measurements of Dihydrofolate Reductase Crystals

    NASA Astrophysics Data System (ADS)

    Xu, Mengyang; Niessen, Katherine; Pace, James; Cody, Vivian; Markelz, Andrea

    2014-03-01

    We report the first direct measurements of the long range structural vibrational modes in dihydrofolate reductase (DHFR). DHFR is a universal housekeeping enzyme that catalyzes the reduction of 7,8-dihydrofolate to 5,6,7,8-tetra-hydrofolate, with the aid of coenzyme nicotinamide adenine dinucleotide phosphate (NADPH). This crucial enzymatic role as the target for anti-cancer [methotrexate (MTX)], and other clinically useful drugs, has made DHFR a long-standing target of enzymological studies. The terahertz (THz) frequency range (5-100 cm-1), corresponds to global correlated protein motions. In our lab we have developed Crystal Anisotropy Terahertz Microscopy (CATM), which directly measures these large scale intra-molecular protein vibrations, by removing the relaxational background of the solvent and residue side chain librational motions. We demonstrate narrowband features in the anisotropic absorbance for mouse DHFR with the ligand binding of NADPH and MTX single crystals as well as Escherichia coli DHFR with the ligand binding of NADPH and MTX single crystals. This work is supported by NSF grant MRI2 grant DBI2959989.

  13. Structure and kinetics assays of recombinant Schistosoma mansoni dihydrofolate reductase.

    PubMed

    Serrão, Vitor Hugo Balasco; Romanello, Larissa; Cassago, Alexandre; de Souza, Juliana Roberta Torini; Cheleski, Juliana; DeMarco, Ricardo; Brandão-Neto, José; Pereira, Humberto D'Muniz

    2017-03-11

    The parasite Schistosoma mansoni possesses all pathways for pyrimidine biosynthesis, in which dihydrofolate reductase (DHFR), thymidylate cycle participants, is essential for nucleotide metabolism to obtain energy and structural nucleic acids. Thus, DHFRs have been widely suggested as therapeutic targets for the treatment of infectious diseases. In this study, we expressed recombinant SmDHFR in a heterologous manner to obtain structural, biochemical and kinetic information. X-ray diffraction of recombinant SmDHFR at 1.95Å resolution showed that the structure exhibited the canonical DHFR fold. Isothermal titration calorimetry was used to determine the kinetic constants for NADP(+) and dihydrofolate. Moreover, inhibition assays were performed using the commercial folate analogs methotrexate and aminopterin; these analogs are recognized as folate competitors and are used as chemotherapeutic agents in cancer and autoimmune diseases. This study provides information that may prove useful for the future discovery of novel drugs and for understanding these metabolic steps from this pathway of S. mansoni, thus aiding in our understanding of the function of these essential pathways for parasite metabolism.

  14. Optical observation of correlated motions in dihydrofolate reductase

    NASA Astrophysics Data System (ADS)

    Xu, Mengyang; Niessen, Katherine; Pace, James; Cody, Vivian; Markelz, Andrea

    2015-03-01

    Enzyme function relies on its structural flexibility to make conformational changes for substrate binding and product release. An example of a metabolic enzyme where such structural changes are vital is dihydrofolate reductase (DHFR). DHFR is essential in both prokaryotes and eukaryotes for the nucleotide biosynthesis by catalyzing the reduction of dihydrofolate to tetrahydrofolate. NMR dynamical measurements found large amplitude fast dynamics that could indicate rigid-body, twisting-hinge motion for ecDHFR that may mediate flux. The role of such long-range correlated motions in function was suggested by the observed sharp decrease in enzyme activity for the single point mutation G121V, which is remote from active sites. This decrease in activity may be caused by the mutation interfering with the long-range intramolecular vibrations necessary for rapid access to functional configurations. We use our new technique of crystal anisotropy terahertz microscopy (CATM), to observe correlated motions in ecDHFR crystals with the bonding of NADPH and methotrexate. We compare the measured intramolecular vibrational spectrum with calculations using normal mode analysis.

  15. Amplification and loss of dihydrofolate reductase genes in a Chinese hamster ovary cell line

    SciTech Connect

    Kaufman, R.J.; Schimke, R.T.

    1981-12-01

    During stepwise increases in the methotrexate concentration in culture medium, the authors selected Chinese hamster ovary cells that contained elevated dihydrofolate reductase levels which were proportional to the number of dihydrofolate reductase gene copies (i.e., gene amplification). The authors studied the dihydrofolate reductase levels in individual cells that underwent the initial steps of methotrexate resistance by using the fluorescence-activated cell sorter technique. Such cells constituted a heterogeneous population with differing dihydrofolate reductase levels, and they characteristically lost the elevated enzyme levels when they were grown in the absence of methotrexate. The progeny of individual cells with high enzyme levels behaved differently and could lose all or variable numbers of the amplified genes.

  16. Hydride transfer during catalysis by dihydrofolate reductase from Thermotoga maritima.

    PubMed Central

    Maglia, Giovanni; Javed, Masood H; Allemann, Rudolf K

    2003-01-01

    DHFR (dihydrofolate reductase) catalyses the metabolically important reduction of 7,8-dihydrofolate by NADPH. DHFR from the hyperthermophilic bacterium Thermotoga maritima (TmDHFR), which shares similarity with DHFR from Escherichia coli, has previously been characterized structurally. Its tertiary structure is similar to that of DHFR from E. coli but it is the only DHFR characterized so far that relies on dimerization for stability. The midpoint of the thermal unfolding of TmDHFR was at approx. 83 degrees C, which was 30 degrees C higher than the melting temperature of DHFR from E. coli. The turnover and the hydride-transfer rates in the kinetic scheme of TmDHFR were derived from measurements of the steady-state and pre-steady-state kinetics using absorbance and stopped-flow fluorescence spectroscopy. The rate constant for hydride transfer was found to depend strongly on the temperature and the pH of the solution. Hydride transfer was slow (0.14 s(-1) at 25 degrees C) and at least partially rate limiting at low temperatures but increased dramatically with temperature. At 80 degrees C the hydride-transfer rate of TmDHFR was 20 times lower than that observed for the E. coli enzyme at its physiological temperature. Hydride transfer depended on ionization of a single group in the active site with a p K(a) of 6.0. While at 30 degrees C, turnover of substrate by TmDHFR was almost two orders of magnitude slower than by DHFR from E. coli; the steady-state rates of the two enzymes differed only 8-fold at their respective working temperatures. PMID:12765545

  17. Inhibition of Bacterial Dihydrofolate Reductase by 6-Alkyl-2,4-diaminopyrimidines

    PubMed Central

    Nammalwar, Baskar; Bourne, Christina R.; Bunce, Richard A.; Wakeham, Nancy; Bourne, Philip C.; Ramnarayan, Kal; Mylvaganam, Shankari; Berlin, K. Darrell; Barrow, Esther W.; Barrow, William W.

    2012-01-01

    A series of (±)-6-alkyl-2,4-diaminopyrimidine-based inhibitors of bacterial dihydrofolate reductase (DHFR) have been prepared and evaluated for biological potency against Bacillus anthracis and Staphylococcus aureus. Biological studies reveal attenuated activity relative to earlier structures lacking substitution at C6 of the diaminopyrimidine moiety, though minimum inhibitory concentration (MIC) values are in the 0.125–8 μg/mL range for both organisms. This effect was rationalized from previous three-dimensional X-ray structure studies that indicate the presence of a side pocket containing two water molecules adjacent to the main binding pocket. Because of the hydrophobic nature of the substitutions at C6 the main interactions are with protein residues Leu20 and Leu28. These interactions lead to a minor conformational change in the protein, which opens the pocket containing these waters such that it is continuous with the main binding pocket. These water molecules are reported to play a critical role in the catalytic reaction. This highlights a new area for inhibitor expansion within the limited architectural variation at the catalytic site of bacterial DHFR. PMID:22930550

  18. A second target of benzamide riboside: dihydrofolate reductase.

    PubMed

    Roussel, Breton; Johnson-Farley, Nadine; Kerrigan, John E; Scotto, Kathleen W; Banerjee, Debabrata; Felczak, Krzysztof; Pankiewicz, Krzysztof W; Gounder, Murugesan; Lin, HongXia; Abali, Emine Ercikan; Bertino, Joseph R

    2012-11-01

    Dihydrofolate reductase (DHFR) is an essential enzyme involved in de novo purine and thymidine biosynthesis. For several decades, selective inhibition of DHFR has proven to be a potent therapeutic approach in the treatment of various cancers including acute lymphoblastic leukemia, non-Hodgkin's lymphoma, osteogenic sarcoma, carcinoma of the breast, and head and neck cancer. Therapeutic success with DHFR inhibitor methotrexate (MTX) has been compromised in the clinic, which limits the success of MTX treatment by both acquired and intrinsic resistance mechanisms. We report that benzamide riboside (BR), via anabolism to benzamide adenine dinucleotide (BAD) known to potently inhibit inosine monophosphate dehydrogenase (IMPDH), also inhibits cell growth through a mechanism involving downregulation of DHFR protein. Evidence to support this second site of action of BR includes the finding that CCRF-CEM/R human T-cell lymphoblasic leukemia cells, resistant to MTX as a consequence of gene amplification and overexpression of DHFR, are more resistant to BR than are parental cells. Studies of the mechanism by which BR lowers DHFR showed that BR, through its metabolite BAD, reduced NADP and NADPH cellular levels by inhibiting nicotinamide adenine dinucleotide kinase (NADK). As consequence of the lack of NADPH, DHFR was shown to be destabilized. We suggest that, inhibition of NADK is a new approach to downregulate DHFR and to inhibit cell growth.

  19. Lausannevirus Encodes a Functional Dihydrofolate Reductase Susceptible to Proguanil

    PubMed Central

    Mueller, L.; Hauser, P. M.; Gauye, F.

    2017-01-01

    ABSTRACT Lausannevirus belongs to the family Marseilleviridae within the group of nucleocytoplasmic large DNA viruses (NCLDVs). These giant viruses exhibit unique features, including a large genome, ranging from 100 kb to 2.5 Mb and including from 150 to more than 2,500 genes, as well as the presence of genes coding for proteins involved in transcription and translation. The large majority of Lausannevirus open reading frames have unknown functions. Interestingly, a bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) is encoded in the Lausannevirus genome. The enzyme plays central roles in DNA precursor biosynthesis. DHFR is the pharmacological target of antifolates, such as trimethoprim, pyrimethamine, and proguanil. First, the functionality of Lausannevirus DHFR-TS was demonstrated by the successful complementation of a DHFR-deficient Saccharomyces cerevisiae strain with a plasmid expressing the heterologous gene. Additionally, using this heterologous expression system, we demonstrated the in vitro susceptibility of Lausannevirus DHFR-TS to proguanil and its resistance to pyrimethamine and trimethoprim. Proguanil may provide a unique and useful treatment if Lausannevirus proves to be a human pathogen. To our knowledge, this is the first time that a DHFR-TS has been described and characterized in an NCLDV. PMID:28137801

  20. Solvent effects on catalysis by Escherichia coli dihydrofolate reductase.

    PubMed

    Loveridge, E Joel; Tey, Lai-Hock; Allemann, Rudolf K

    2010-01-27

    Hydride transfer catalyzed by dihydrofolate reductase (DHFR) has been described previously within an environmentally coupled model of hydrogen tunneling, where protein motions control binding of substrate and cofactor to generate a tunneling ready conformation and modulate the width of the activation barrier and hence the reaction rate. Changes to the composition of the reaction medium are known to perturb protein motions. We have measured kinetic parameters of the reaction catalyzed by DHFR from Escherichia coli in the presence of various cosolvents and cosolutes and show that the dielectric constant, but not the viscosity, of the reaction medium affects the rate of reaction. Neither the primary kinetic isotope effect on the reaction nor its temperature dependence were affected by changes to the bulk solvent properties. These results are in agreement with our previous report on the effect of solvent composition on catalysis by DHFR from the hyperthermophile Thermotoga maritima. However, the effect of solvent on the temperature dependence of the kinetic isotope effect on hydride transfer catalyzed by E. coli DHFR is difficult to explain within a model, in which long-range motions couple to the chemical step of the reaction, but may indicate the existence of a short-range promoting vibration or the presence of multiple nearly isoenergetic conformational substates of enzymes with similar but distinct catalytic properties.

  1. Recombinant bovine dihydrofolate reductase produced by mutagenesis and nested PCR of murine dihydrofolate reductase cDNA.

    PubMed

    Cody, Vivian; Mao, Qilong; Queener, Sherry F

    2008-11-01

    Recent reports of the slow-tight binding inhibition of bovine liver dihydrofolate reductase (bDHFR) in the presence of polyphenols isolated from green tea leaves has spurred renewed interest in the biochemical properties of bDHFR. Earlier studies were done with native bDHFR but in order to validate models of polyphenol binding to bDHFR, larger quantities of bDHFR are necessary to support structural studies. Bovine DHFR differs from its closest sequence homologue, murine DHFR, by 19 amino acids. To obtain the bDHFR cDNA, murineDHFR cDNA was transformed by a series of nested PCRs to reproduce the amino acid coding sequence for bovine DHFR. The bovine liver DHFR cDNA has an open reading frame of 561 base pairs encoding a protein of 187 amino acids that has a high level of conservation at the primary sequence level with other DHFR enzymes, and more so for the amino acid residues in the active site of the mammalian DHFR enzymes. Expression of the bovine DHFR cDNA in bacterial cells produced a stable recombinant protein with high enzymatic activity and kinetic properties similar to those previously reported for the native protein.

  2. A DFT-based QSAR study on inhibition of human dihydrofolate reductase.

    PubMed

    Karabulut, Sedat; Sizochenko, Natalia; Orhan, Adnan; Leszczynski, Jerzy

    2016-11-01

    Diaminopyrimidine derivatives are frequently used as inhibitors of human dihydrofolate reductase, for example in treatment of patients whose immune system are affected by human immunodeficiency virus. Forty-seven dicyclic and tricyclic potential inhibitors of human dihydrofolate reductase were analyzed using the quantitative structure-activity analysis supported by DFT-based and DRAGON-based descriptors. The developed model yielded an RMSE deviation of 1.1 a correlation coefficient of 0.81. The prediction set was characterized by R(2)=0.60 and RMSE=3.59. Factors responsible for inhibition process were identified and discussed. The resulting model was validated via cross validation and Y-scrambling procedure. From the best model, we found several mass-related descriptors and Sanderson electronegativity-related descriptors that have the best correlations with the investigated inhibitory concentration. These descriptors reflect results from QSAR studies based on characteristics of human dihydrofolate reductase inhibitors.

  3. Human endothelial dihydrofolate reductase low activity limits vascular tetrahydrobiopterin recycling.

    PubMed

    Whitsett, Jennifer; Rangel Filho, Artur; Sethumadhavan, Savitha; Celinska, Joanna; Widlansky, Michael; Vasquez-Vivar, Jeannette

    2013-10-01

    Tetrahydrobiopterin (BH₄) is required for NO synthesis and inhibition of superoxide release from endothelial NO synthase. Clinical trials using BH₄ to treat endothelial dysfunction have produced mixed results. Poor outcomes may be explained by the rapid systemic and cellular oxidation of BH₄. One of the oxidation products of BH₄, 7,8-dihydrobiopterin (7,8-BH₂), is recycled back to BH₄ by dihydrofolate reductase (DHFR). This enzyme is ubiquitously distributed and shows a wide range of activity depending on species-specific factors and cell type. Information about the kinetics and efficiency of BH4 recycling in human endothelial cells receiving BH₄ treatment is lacking. To characterize this reaction, we applied a novel multielectrode coulometric HPLC method that enabled the direct quantification of 7,8-BH₂ and BH₄, which is not possible with fluorescence-based methodologies. We found that basal untreated BH₄ and 7,8-BH₂ concentrations in human endothelial cells (ECs) are lower than in bovine and murine endothelioma cells. Treatment of human ECs with BH₄ transiently increased intracellular BH₄ while accumulating the more stable 7,8-BH₂. This was different from bovine or murine ECs, which resulted in preferential BH₄ increase. Using BH₄ diastereomers, 6S-BH₄ and 6R-BH₄, the narrow contribution of enzymatic DHFR recycling to total intracellular BH₄ was demonstrated. Reduction of 7,8-BH₂ to BH₄ occurs at very slow rates in cells and needs supraphysiological levels of 7,8-BH₂, indicating this reaction is kinetically limited. Activity assays verified that human DHFR has very low affinity for 7,8-BH₂ (DHF7,8-BH₂) and folic acid inhibits 7,8-BH₂ recycling. We conclude that low activity of endothelial DHFR is an important factor limiting the benefits of BH4 therapies, which may be further aggravated by folate supplements.

  4. The Effect of Protein Mass Modulation on Human Dihydrofolate Reductase

    PubMed Central

    Francis, Kevin; Sapienza, Paul J.; Lee, Andrew L.; Kohen, Amnon

    2016-01-01

    Dihydrofolate reductase (DHFR) from Escherichia coli has long served as a model enzyme with which to elucidate possible links between protein dynamics and the catalyzed reaction. Such physical properties of its human counterpart have not been rigorously studied so far, but recent computer-based simulations suggest that these two DHFRs differ significantly in how closely coupled the protein dynamics and the catalyzed C-H→C hydride transfer step are. To test this prediction, two contemporary probes for studying the effect of protein dynamics on catalysis were combined here: temperature dependence of intrinsic kinetic isotope effects (KIEs) that are sensitive to the physical nature of the chemical step, and protein mass-modulation that slows down fast dynamics (femto- to picosecond timescale) throughout the protein. The intrinsic H/T KIEs of human DHFR, like those of E. coli DHFR, are shown to be temperature-independent in the range from 5–45 °C, indicating fast sampling of donor and acceptor distances (DADs) at the reaction’s transition state (or tunneling ready state – TRS). Mass modulation of these enzymes through isotopic labeling with 13C, 15N, and 2H at nonexchangeable hydrogens yield an 11% heavier enzyme. The additional mass has no effect on the intrinsic KIEs of the human enzyme. This finding indicates that the mass-modulation of the human DHFR affects neither DAD distribution nor the DAD’s conformational sampling dynamics. Furthermore, reduction in the enzymatic turnover number and the dissociation rate constant for the product indicate that the isotopic substitution affects kinetic steps that are not the catalyzed C-H→C hydride transfer. The findings are discussed in terms of fast dynamics and their role in catalysis, the comparison of calculations and experiments, and the interpretation of isotopically-modulated heavy enzymes in general. PMID:26813442

  5. Environmental Adaptation of Dihydrofolate Reductase from Deep-Sea Bacteria.

    PubMed

    Ohmae, Eiji; Gekko, Kunihiko; Kato, Chiaki

    2015-01-01

    In order to elucidate the molecular adaptation mechanisms of enzymes to the high hydrostatic pressure of the deep sea, we cloned, purified, and characterized more than ten dihydrofolate reductases (DHFRs) from bacteria living in deep-sea and ambient atmospheric pressure environments. The nucleotide and amino acid sequences of these DHFRs indicate the deep-sea bacteria are adapted to their environments after the differentiation of their genus from ancestors inhabiting atmospheric pressure environments. In particular, the backbone structure of the deep-sea DHFR from Moritella profunda (mpDHFR) almost overlapped with the normal homolog from Escherichia coli (ecDHFR). Thus, those of other DHFRs would also overlap on the basis of their sequence similarities. However, the structural stability of both DHFRs was quite different: compared to ecDHFR, mpDHFR was more thermally stable but less stable against urea and pressure unfolding. The smaller volume changes due to unfolding suggest that the native structure of mpDHFR has a smaller cavity and/or enhanced hydration compared to ecDHFR. High hydrostatic pressure reduced the enzymatic activity of many DHFRs, but three deep-sea DHFRs and the D27E mutant of ecDHFR exhibited pressure-dependent activation. The inverted activation volumes from positive to negative values indicate the modification of their structural dynamics, conversion of the rate-determining step of the enzymatic reaction, and different contributions of the cavity and hydration to the transition-state structure. Since the cavity and hydration depend on amino acid side chains, DHFRs would adapt to the deep-sea environment by regulating the cavity and hydration by substituting their amino acid side chains without altering their backbone structure. The results of this study clearly indicate that the cavity and hydration play important roles in the adaptation of enzymes to the deep-sea environment.

  6. Endothelial human dihydrofolate reductase low activity limits vascular tetrahydrobiopterin recycling

    PubMed Central

    Whitsett, Jennifer; Filho, Artur Rangel; Sethumadhavan, Savitha; Celinska, Joanna; Widlansky, Michael; Vásquez-Vivar, Jeannette

    2013-01-01

    Tetrahydrobiopterin (BH4) is required for NO synthesis and inhibition of superoxide release from eNOS. Clinical trials using BH4 to treat endothelial dysfunction have produced mixed results. Poor outcomes may be explained by the rapid systemic and cellular oxidation of BH4. One of the oxidation products of BH4, 7,8-dihydrobiopterin (7,8-BH2), is recycled back to BH4 by dihydrofolate reductase (DHFR). This enzyme is ubiquitously distributed and shows a wide range of activity depending on species-specific factors and cell type. Information about the kinetics and efficiency of BH4 recycling in human endothelial cells receiving BH4 treatment is lacking. To characterize this reaction, we applied a novel multi-electrode coulometric HPLC method that enabled the direct quantification of 7,8-BH2 and BH4 which is not possible with fluorescent-based methodologies. We found that basal untreated BH4 and 7,8-BH2 concentrations in human ECs is lower than bovine and murine endothelioma cells. Treatment of human ECs with BH4 transiently increased intracellular BH4 while accumulating the more stable 7,8-BH2. This was different from bovine or murine ECs that resulted in preferential BH4 increase. Using BH4 diastereomers, 6S-BH4 and 6R-BH4, the narrow contribution of enzymatic DHFR recycling to total intracellular BH4 was demonstrated. Reduction of 7,8-BH2 to BH4 occurs at very slow rates in cells and needs supra-physiological levels of 7,8-BH2, indicating this reaction is kinetically limited. Activity assays verified that hDHFR has very low affinity for 7,8-BH2 (DHF7,8-BH2) and folic acid inhibits 7,8-BH2 recycling. We conclude that low activity of endothelial DHFR is an important factor limiting the benefits of BH4 therapies which may be further aggravated by folate supplements. PMID:23707606

  7. The crystal structure of dihydrofolate reductase from Thermotoga maritima: molecular features of thermostability.

    PubMed

    Dams, T; Auerbach, G; Bader, G; Jacob, U; Ploom, T; Huber, R; Jaenicke, R

    2000-03-31

    Two high-resolution structures have been obtained for dihydrofolate reductase from the hyperthermophilic bacterium Thermotoga maritima in its unliganded state, and in its ternary complex with the cofactor NADPH and the inhibitor, methotrexate. While the overall fold of the hyperthermophilic enzyme is closely similar to monomeric mesophilic dihydrofolate reductase molecules, its quaternary structure is exceptional, in that T. maritima dihydrofolate reductase forms a highly stable homodimer. Here, the molecular reasons for the high intrinsic stability of the enzyme are elaborated and put in context with the available data on the physical parameters governing the folding reaction. The molecule is extremely rigid, even with respect to structural changes during substrate binding and turnover. Subunit cooperativity can be excluded from structural and biochemical data. Major contributions to the high intrinsic stability of the enzyme result from the formation of the dimer. Within the monomer, only subtle stabilizing interactions are detectable, without clear evidence for any of the typical increments of thermal stabilization commonly reported for hyperthermophilic proteins. The docking of the subunits is optimized with respect to high packing density in the dimer interface, additional salt-bridges and beta-sheets. The enzyme does not show significant structural changes upon binding its coenzyme, NADPH, and the inhibitor, methotrexate. The active-site loop, which is known to play an important role in catalysis in mesophilic dihydrofolate reductase molecules, is rearranged, participating in the association of the subunits; it no longer participates in catalysis.

  8. Loss and stabilization of amplified dihydrofolate reductase genes in mouse sarcoma S-180 cell lines

    SciTech Connect

    Kaufman, R.J.; Brown, P.C.; Schimke, R.T.

    1981-12-01

    The authors studied the loss and stabilization of dihydrofolate reductase genes in clones of a methotrexate-resistant murine S-180 cell line. These cells contained multiple copies of the dihydrofolate reductase gene which were associated with double minute chromosomes. The growth rate of these cells in the absence of methotrexate was inversely related to the degree of gene amplification (number of double minute chromosomes). Cells could both gain and lose genes as a result of an unequal distribution of double minute chromosomes into daughter cells at mitosis. The loss of amplified dihydrofolate reductase genes during growth in the absence of methotrexate resulted from the continual generation of cells containing lower numbers of double minute chromosomes. Because of the growth advantage of these cells, they became dominant in the population. They also studied an unstably resistant S-180 cell line (clone) that, after 3 years of continuous growth in methotrexate, generated cells containing stably amplified dihydrofolate reductase genes. These genes were present on one or more chromosomes, and they were retained in a stable state.

  9. Assignment of the human dihydrofolate reductase gene to the q11. -->. q22 region of chromosome 5

    SciTech Connect

    Funanage, V.L.; Myoda, T.T.; Moses, P.A.; Cowell, H.R.

    1984-10-01

    Cells from a dihydrofolate reductase-deficit Chinese hamster ovary cell line were hybridized to human fetal skin fibroblast cells. Nineteen dihydrofolate reductase-positive hybrid clones were isolated and characterized. Cytogenetic and biochemical analyses of these clones have shown that the human dihydrofolate reductase (DHFR) gene is located on chromosome 5. Three of these hybrid cell lines contained different terminal deletions of chromosome 5. An analysis of the breakpoints of these deletions has demonstrated that the DHFR gene resides in the q11..-->..q22 region.

  10. A qualitative and quantitative cytochemical assay of dihydrofolate reductase in erythroid cells.

    PubMed

    Nano, R; Gerzeli, G; Invernizzi, R; Supino, R

    1989-01-01

    The distribution and intensity of dihydrofolate reductase (DHFR) cytochemically demonstrable was studied in erythroid cells. Cells of normal human bone marrow, of human erythroleukaemia (M6), and cells of the Friend (MEL) clone 745A murine erythroleukaemia (also after differentiation with dimethylsulphoxide, DMSO) were stained according to Gerzeli and de Piceis Polver (1969) technique; quantification of the reaction product was made using a Vickers M86 microdensitometer. The enzyme activity progressively decreased during the normal differentiation of the erythropoietic series while persisted at high levels in erythroleukaemia cells. It can be suggested that in the 1st case, the cytochemical pattern of dihydrofolate reductase may be a useful added tool for studying the erythroid differentiation. In the 2nd case, the increased level of this enzyme may be related to an amplification of the gene of DHFR in the malignant transformation.

  11. Dihydrofolate reductase as a model for studies of enzyme dynamics and catalysis

    PubMed Central

    Kohen, Amnon

    2015-01-01

    Dihydrofolate reductase from Escherichia coli (ecDHFR) serves as a model system for investigating the role of protein dynamics in enzyme catalysis. We discuss calculations predicting a network of dynamic motions that is coupled to the chemical step catalyzed by this enzyme. Kinetic studies testing these predictions are presented, and their potential use in better understanding the role of these dynamics in enzyme catalysis is considered. The cumulative results implicate motions across the entire protein in catalysis. PMID:26918149

  12. Functional significance of evolving protein sequence in dihydrofolate reductase from bacteria to humans.

    PubMed

    Liu, C Tony; Hanoian, Philip; French, Jarrod B; Pringle, Thomas H; Hammes-Schiffer, Sharon; Benkovic, Stephen J

    2013-06-18

    With the rapidly growing wealth of genomic data, experimental inquiries on the functional significance of important divergence sites in protein evolution are becoming more accessible. Here we trace the evolution of dihydrofolate reductase (DHFR) and identify multiple key divergence sites among 233 species between humans and bacteria. We connect these sites, experimentally and computationally, to changes in the enzyme's binding properties and catalytic efficiency. One of the identified evolutionarily important sites is the N23PP modification (∼mid-Devonian, 415-385 Mya), which alters the conformational states of the active site loop in Escherichia coli dihydrofolate reductase and negatively impacts catalysis. This enzyme activity was restored with the inclusion of an evolutionarily significant lid domain (G51PEKN in E. coli enzyme; ∼2.4 Gya). Guided by this evolutionary genomic analysis, we generated a human-like E. coli dihydrofolate reductase variant through three simple mutations despite only 26% sequence identity between native human and E. coli DHFRs. Molecular dynamics simulations indicate that the overall conformational motions of the protein within a common scaffold are retained throughout evolution, although subtle changes to the equilibrium conformational sampling altered the free energy barrier of the enzymatic reaction in some cases. The data presented here provide a glimpse into the evolutionary trajectory of functional DHFR through its protein sequence space that lead to the diverged binding and catalytic properties of the E. coli and human enzymes.

  13. Over-production of dihydrofolate reductase leads to sulfa-dihydropteroate resistance in yeast.

    PubMed

    Patel, Onisha; Karnik, Kuldeep; Macreadie, Ian G

    2004-07-15

    Dihydropteroate synthase (DHPS) can metabolise sulfa drugs into sulfa-dihydropteroate (sulfa-DHP), which inhibits cell growth through competition with dihydrofolate (DHF), possibly indicating dihydrofolate reductase (DHFR) as the target of sulfa-DHP. The effect of over-production of DHFR on sulfa-DHP resistance was examined in Saccharomyces cerevisiae using a strain that requires DHF for growth. This strain was transformed with a plasmid which encodes over-production of DHFR in the presence of CuSO4. Over-production led to resistance to sulfa-DHP suggesting that sulfa-DHP targets DHFR. Spontaneous mutants hyper-resistant to sulfa-DHP did not show any changes within DHFR.

  14. Relationship of amplified dihydrofolate reductase genes to double minute chromosomes in unstably resistant mouse fibroblast cell lines.

    PubMed Central

    Brown, P C; Beverley, S M; Schimke, R T

    1981-01-01

    Murine 3T6 selected in increasing concentrations of methotrexate were unstable with respect to dihydrofolate reductase overproduction and methotrexate resistance when they are cultured in the absence of methotrexate. An analysis of the karyotypes of these resistant cells revealed the presence of numerous double minute chromosomes. We observed essentially identical kinetics of loss of dihydrofolate reductase gene sequences in total deoxyribonucleic acid and in deoxyribonucleic acid from fractions enriched in double minute chromosomes and in the numbers of double minute chromosomes per cell during reversion to methotrexate sensitivity, and this suggested that unstably amplified gene sequences were localized on double minute chromosomes. This conclusion ws also supported by an analysis of cell populations sorted according to dihydrofolate reductase enzyme contents, in which relative gene amplification and double minute chromosome content were related proportionally. Images PMID:6287217

  15. Enhancement of methotrexate resistance and dihydrofolate reductase gene amplification by treatment of mouse 3T6 cells with hydroxyurea.

    PubMed Central

    Brown, P C; Tlsty, T D; Schimke, R T

    1983-01-01

    We investigated various parameters associated with the initial selection of mouse 3T6 cells for resistance to single concentrations of methotrexate and characterized resistant colonies for the presence of additional (amplified) copies of the dihydrofolate reductase gene. Our results indicate that the frequency of occurrence of dihydrofolate reductase gene amplification varies with the selecting concentration of methotrexate and is highly variable between clonally derived sublines of mouse 3T6 cells. Second, we increased the frequency of occurrence of cells with amplified dihydrofolate reductase genes by transiently inhibiting DNA synthesis with hydroxyurea before the selection of cells in single concentrations of methotrexate. This effect was dependent on the concentration of hydroxyurea, the time of exposure to the drug, and the time interval between the removal of hydroxyurea and the selection of cells in methotrexate. Images PMID:6877240

  16. [Comparison of Physico-chemical Aspects between E. coli and Human Dihydrofolate Reductase: an Equilibrium Unfolding Study].

    PubMed

    Thapliyal, Charu; Jain, Neha; Chaudhuri, Pratima

    2015-01-01

    A protein, differing in origin, may exhibit variable physicochemical behaviour, difference in sequence homology, fold and function. Thus studying structure-function relationship of proteins from altered sources is meaningful in the sense that it may give rise to comparative aspects of their sequence-structure-function relationship. Dihydrofolate reductase is an enzyme involved in cell cycle regulation. It is a significant enzyme as.a target for developing anticancer drugs. Hence, detailed understanding of structure-function relationships of wide variants of the enzyme dihydrofolate reductase would be important for developing an inhibitor or an antagonist against the enzyme involved in the cellular developmental processes. In this communication, we have reported the comparative structure-function relationship between E. coli and human dihydrofolate reductase. The differences in the unfolding behaviour of these two proteins have been investigated to understand various properties of these two proteins like relative' stability differences and variation in conformational changes under identical denaturing conditions. The equilibrium unfolding mechanism of dihydrofolate reductase proteins using guanidine hydrochloride as a denaturant in the presence of various types of osmolytes has been monitored using loss in enzymatic activity, intrinsic tryptophan fluorescence and an extrinsic fluorophore 8-anilino-1-naphthalene-sulfonic acid as probes. It has been observed that osmolytes, such as 1M sucrose, and 30% glycerol, provided enhanced stability to both variants of dihydrofolate reductase. Their level of stabilisation has been observed to be dependent on intrinsic protein stability. It was observed that 100 mM proline does not show any 'significant stabilisation to either of dihydrofolate reductases. In the present study, it has been observed that the human protein is relatively less stable than the E.coli counterpart.

  17. Inhibitor-bound complexes of dihydrofolate reductase-thymidylate synthase from Babesia bovis

    PubMed Central

    Begley, Darren W.; Edwards, Thomas E.; Raymond, Amy C.; Smith, Eric R.; Hartley, Robert C.; Abendroth, Jan; Sankaran, Banumathi; Lorimer, Donald D.; Myler, Peter J.; Staker, Bart L.; Stewart, Lance J.

    2011-01-01

    Babesiosis is a tick-borne disease caused by eukaryotic Babesia parasites which are morphologically similar to Plasmodium falciparum, the causative agent of malaria in humans. Like Plasmodium, different species of Babesia are tuned to infect different mammalian hosts, including rats, dogs, horses and cattle. Most species of Plasmodium and Babesia possess an essential bifunctional enzyme for nucleotide synthesis and folate metabolism: dihydrofolate reductase-thymidylate synthase. Although thymidylate synthase is highly conserved across organisms, the bifunctional form of this enzyme is relatively uncommon in nature. The structural characterization of dihydrofolate reductase-thymidylate synthase in Babesia bovis, the causative agent of babesiosis in livestock cattle, is reported here. The apo state is compared with structures that contain dUMP, NADP and two different antifolate inhibitors: pemetrexed and raltitrexed. The complexes reveal modes of binding similar to that seen in drug-resistant malaria strains and point to the utility of applying structural studies with proven cancer chemotherapies towards infectious disease research. PMID:21904052

  18. Synthesis and characterization of potent inhibitors of Trypanosoma cruzi dihydrofolate reductase

    SciTech Connect

    Schormann, Norbert; Velu, Sadanandan E.; Murugesan, Srinivasan; Senkovich, Olga; Walker, Kiera; Chenna, Bala C.; Shinkre, Bidhan; Desai, Amar; Chattopadhyay, Debasish

    2010-09-17

    Dihydrofolate reductase (DHFR) of the parasite Trypanosoma cruzi (T. cruzi) is a potential target for developing drugs to treat Chagas disease. We have undertaken a detailed structure-activity study of this enzyme. We report here synthesis and characterization of six potent inhibitors of the parasitic enzyme. Inhibitory activity of each compound was determined against T. cruzi and human DHFR. One of these compounds, ethyl 4-(5-[(2,4-diamino-6-quinazolinyl)methyl]amino-2-methoxyphenoxy)butanoate (6b) was co-crystallized with the bifunctional dihydrofolate reductase-thymidylate synthase enzyme of T. cruzi and the crystal structure of the ternary enzyme:cofactor:inhibitor complex was determined. Molecular docking was used to analyze the potential interactions of all inhibitors with T. cruzi DHFR and human DHFR. Inhibitory activities of these compounds are discussed in the light of enzyme-ligand interactions. Binding affinities of each inhibitor for the respective enzymes were calculated based on the experimental or docked binding mode. An estimated 60-70% of the total binding energy is contributed by the 2,4-diaminoquinazoline scaffold.

  19. A study of chromosomal changes associated with amplified dihydrofolate reductase genes in rat hepatoma cells and their dedifferentiated variants

    PubMed Central

    1984-01-01

    We have examined the karyological consequences of dihydrofolate reductase gene amplification in a series of six rat hepatoma cell lines, all derived from the same clone. Cells of three of these lines express a series of liver-specific functions whereas those of three others fail to express these functions. Cells of each line have been subjected to stepwise selection for methotrexate resistance and, in most cases, resistance is associated with a 40-50-fold amplification of sequences hybridizing to a dihydrofolate reductase cDNA probe. In one line no modified chromosome is observed, whereas in two others the amplified genes are associated with an expanded chromosomal region. R- banding analysis of these karyotypes showed that few changes have occurred. These observations apply to two of the well-differentiated lines, and to a variant able to revert to the differentiated state. In contrast, in the two stably dedifferentiated hepatoma cell lines, amplified dihydrofolate reductase genes are found on large chromosomes of variable size, on ring chromosomes, and on chromosomes containing terminal, median, or multiple centromeres. We conclude that the nature of the chromosomal changes associated with dihydrofolate reductase gene amplification are the result of differences in cell lines rather than in the protocols employed for selection. PMID:6746737

  20. Dihydrofolate reductase: low-resolution mass-spectrometric analysis of an elastase digest as a sequencing tool (Short Communication)

    PubMed Central

    Morris, Howard R.; Batley, Karen E.; Harding, Nigel G. L.; Bjur, Richard A.; Dann, John G.; King, Rodney W.

    1974-01-01

    An elastase digest of a protein of unknown structure, dihydrofolate reductase, was studied by mass spectrometry. This soluble digest contained a large number of small peptides in different yields, within the ideal molecular-weight range (200–1200) for mixture-analysis mass spectrometry. Sequences of the major component peptides in the digest are reported. PMID:4207389

  1. Comparative stability of dihydrofolate reductase mutants in vitro and in vivo.

    PubMed

    Leontiev, V V; Uversky, V N; Gudkov, A T

    1993-01-01

    Dihydrofolate reductase mutants with amino acid replacements in the active center (Thr35-->Asp mutant, Arg57-->His mutant and the mutant with triple replacement Thr35-->Asp, Asn37-->Ser, Arg57-->His) were obtained by site-directed mutagenesis. The stabilization effect of trimethoprim and NADP.H on the protein tertiary structure in vitro has been investigated. In the case of mutants with a 'weak' tertiary structure (Thr35-->Asp35 and the triple mutant) the separate addition of ligands does not affect their stability. The simultaneous addition of these ligands to Thr35-->Asp35 and the triple mutant leads to the large increase in their stability. A distinct correlation was found between the in vitro studied stability of the mutant proteins to the urea- or heat-induced denaturation and the level of proteolytic degradation of these mutants previously observed in vivo.

  2. Triazine-benzimidazole hybrids: anticancer activity, DNA interaction and dihydrofolate reductase inhibitors.

    PubMed

    Singla, Prinka; Luxami, Vijay; Paul, Kamaldeep

    2015-04-15

    A new series of triazine-benzimidazole hybrids has been synthesized with different substitution of primary and secondary amines at one of the position of triazine in moderate to good yields. These compounds were evaluated for their inhibitory activities over 60 human tumor cell lines at one dose and five dose concentrations. Compounds 6b, 8 and 9 showed broad spectrum of antitumor activities with GI50 values of 9.79, 2.58 and 3.81μM, respectively. DNA binding studies also indicated strong interaction properties of these compounds. These synthesized compounds also showed inhibition of mammalian dihydrofolate reductase (DHFR). Compound 6b was depicted as the most active member of DHFR inhibitor with IC50 value of 1.05μM. Molecular modelling studies were used to identify the stabilized interactions of Compound 6b within the active site of enzyme for DHFR.

  3. Thermal Adaptation of Dihydrofolate Reductase from the Moderate Thermophile Geobacillus stearothermophilus

    PubMed Central

    2014-01-01

    The thermal melting temperature of dihydrofolate reductase from Geobacillus stearothermophilus (BsDHFR) is ∼30 °C higher than that of its homologue from the psychrophile Moritella profunda. Additional proline residues in the loop regions of BsDHFR have been proposed to enhance the thermostability of BsDHFR, but site-directed mutagenesis studies reveal that these proline residues contribute only minimally. Instead, the high thermal stability of BsDHFR is partly due to removal of water-accessible thermolabile residues such as glutamine and methionine, which are prone to hydrolysis or oxidation at high temperatures. The extra thermostability of BsDHFR can be obtained by ligand binding, or in the presence of salts or cosolvents such as glycerol and sucrose. The sum of all these incremental factors allows BsDHFR to function efficiently in the natural habitat of G. stearothermophilus, which is characterized by temperatures that can reach 75 °C. PMID:24730604

  4. Barrier crossing in dihydrofolate reductase does not involve a rate-promoting vibration

    NASA Astrophysics Data System (ADS)

    Dametto, Mariangela; Antoniou, Dimitri; Schwartz, Steven D.

    2012-05-01

    We have studied atomic motions during the chemical reaction catalysed by the enzyme dihydrofolate reductase of Escherichia coli (EcDHFR), an important enzyme for nucleic acid synthesis. In our earlier work on the enzymes human lactate dehydrogenase and purine nucleoside phosphorylase, we had identified fast sub-ps motions that are part of the reaction coordinate. We employed Transition Path Sampling (TPS) and our recently developed reaction coordinate identification methodology to investigate if such fast motions couple to the reaction in DHFR on the barrier-crossing timescale. While we identified some protein motions near the barrier crossing event, these motions do not constitute a compressive promoting vibration, and do not appear as a clearly identifiable protein component in reaction.

  5. Discovery of Potent and Selective Leads against Toxoplasma gondii Dihydrofolate Reductase via Structure-Based Design.

    PubMed

    Welsch, Matthew E; Zhou, Jian; Gao, Yueqiang; Yan, Yunqing; Porter, Gene; Agnihotri, Gautam; Li, Yingjie; Lu, Henry; Chen, Zhongguo; Thomas, Stephen B

    2016-12-08

    Current treatment of toxoplasmosis targets the parasite's folate metabolism through inhibition of dihydrofolate reductase (DHFR). The most widely used DHFR antagonist, pyrimethamine, was introduced over 60 years ago and is associated with toxicity that can be largely attributed to a similar affinity for parasite and human DHFR. Computational analysis of biochemical differences between Toxoplasma gondii and human DHFR enabled the design of inhibitors with both improved potency and selectivity. The approach described herein yielded TRC-19, a promising lead with an IC50 of 9 nM and 89-fold selectivity in favor of Toxoplasma gondii DHFR, as well as crystallographic data to substantiate in silico methodology. Overall, 50% of synthesized in silico designs met hit threshold criteria of IC50 < 10 μM and >2-fold selectivity favoring Toxoplasma gondii, further demonstrating the efficiency of our structure-based drug design approach.

  6. Malaria antifolate resistance with contrasting Plasmodium falciparum dihydrofolate reductase (DHFR) polymorphisms in humans and Anopheles mosquitoes

    PubMed Central

    Mharakurwa, Sungano; Kumwenda, Taida; Mkulama, Mtawa A. P.; Musapa, Mulenga; Chishimba, Sandra; Shiff, Clive J.; Sullivan, David J.; Thuma, Philip E.; Liu, Kun; Agre, Peter

    2011-01-01

    Surveillance for drug-resistant parasites in human blood is a major effort in malaria control. Here we report contrasting antifolate resistance polymorphisms in Plasmodium falciparum when parasites in human blood were compared with parasites in Anopheles vector mosquitoes from sleeping huts in rural Zambia. DNA encoding P. falciparum dihydrofolate reductase (EC 1.5.1.3) was amplified by PCR with allele-specific restriction enzyme digestions. Markedly prevalent pyrimethamine-resistant mutants were evident in human P. falciparum infections—S108N (>90%), with N51I, C59R, and 108N+51I+59R triple mutants (30–80%). This resistance level may be from selection pressure due to decades of sulfadoxine/pyrimethamine use in the region. In contrast, cycloguanil-resistant mutants were detected in very low frequency in parasites from human blood samples—S108T (13%), with A16V and 108T+16V double mutants (∼4%). Surprisingly, pyrimethamine-resistant mutants were of very low prevalence (2–12%) in the midguts of Anopheles arabiensis vector mosquitoes, but cycloguanil-resistant mutants were highly prevalent—S108T (90%), with A16V and the 108T+16V double mutant (49–57%). Structural analysis of the dihydrofolate reductase by in silico modeling revealed a key difference in the enzyme within the NADPH binding pocket, predicting the S108N enzyme to have reduced stability but the S108T enzyme to have increased stability. We conclude that P. falciparum can bear highly host-specific drug-resistant polymorphisms, most likely reflecting different selective pressures found in humans and mosquitoes. Thus, it may be useful to sample both human and mosquito vector infections to accurately ascertain the epidemiological status of drug-resistant alleles. PMID:22065788

  7. Cancer metabolism and oxidative stress: Insights into carcinogenesis and chemotherapy via the non-dihydrofolate reductase effects of methotrexate

    PubMed Central

    Hess, Joshua A.; Khasawneh, Mohamad K.

    2015-01-01

    Methotrexate has been in use as an anti-cancer agent for over 60 years. Though inhibition of dihydrofolate reductase is its best known mechanisms of action, its non-dihydrofolate reductase dependent mechanisms disrupt metabolic pathways resulting in a depletion of NAD(P)H and increasing oxidative stress. These mechanisms highlight a novel dependence of cancer cells on their metabolic abnormalities to buffer oxidative stress and chemotherapeutic agents interfere with these cellular abilities. Mitochondria appear to play a significant role in maintaining cancer cell viability and alterations in metabolism seen in cancer cells aid this mitochondrial ability. Further research is needed to understand the effects of other chemotherapeutic agents on these pathways. PMID:26674389

  8. Sequence-specific sup 1 H and sup 15 N resonance assignments for human dihydrofolate reductase in solution

    SciTech Connect

    Stockman, B.J.; Nirmala, N.R.; Wagner, G. ); Delcamp, T.J.; DeYarman, M.T.; Freisheim, J.H. )

    1992-01-14

    Dihydrofolate reductase is an intracellular target enzyme for folate antagonists, including the anticancer drug methotrexate. In order to design novel drugs with altered binding properties, a detailed description of protein-drug interactions in solution is desirable to understand the specificity of drug binding. As a first step in this process, heteronuclear three-dimensional NMR spectroscopy has been used to make sequential resonance assignments for more than 90% of the residues in human dihydrofolate reductase complexed with methotrexate. Uniform enrichment of the 21.5-kDa protein with {sup 15}N was required to obtain the resonance assignments via heteronuclear 3D NMR spectroscopy since homonuclear 2D spectra did not provide sufficient {sup 1}H resonance dispersion. Medium- and long-range NOE's have been used to characterize the secondary structure of the binary ligand-enzyme complex in solution.

  9. Kinetic and Chemical Mechanism of the Dihydrofolate Reductase from Mycobacterium tuberculosis

    PubMed Central

    Czekster, Clarissa M.; Vandemeulebroucke, An; Blanchard, John S.

    2010-01-01

    Dihydrofolate reductase from Mycobacterium tuberculosis catalyzes the NAD(P)H dependent reduction of dihydrofolate, yielding NAD(P)+ and tetrahydrofolate, the primary one carbon unit carrier in biology. Tetrahydrofolate needs to be recycled so that reactions involved in dTMP synthesis and purine metabolism are maintained. In this work, we report the kinetic characterization of the MtDHFR. This enzyme has a sequential steady-state random kinetic mechanism, probably with a preferred pathway with NADPH binding first. A pKa value for an enzymic acid of approximately 7.0 was identified from the pH dependence of V, and the analysis of the primary kinetic isotope effects revealed that the hydride transfer step is at least partly rate limiting throughout the pH range analyzed. Additionally, the determination and analysis of solvent, and multiple kinetic isotope effects was conducted, and equilibrium isotope effects were measured on the equilibrium constant. D2OV and D2OV/K[4R-4-2H]-NADH were slightly inverse at pH 6.0, and inverse values for D2OV[4R-4-2H]-NADH and D2OV/K[4R-4-2H]-NADH suggested that a pre-equilibrium protonation is occurring before the hydride transfer step, indicating a stepwise mechanism for proton and hydride transfer. The same value was obtained for DkH at pH values of 5.5 and 7.5, reaffirming the rate-limiting nature of the hydride transfer step. A chemical mechanism is proposed based on the results obtained here. PMID:21138249

  10. Dihydrofolate reductase is required for the development of heart and outflow tract in zebrafish.

    PubMed

    Sun, Shuna; Gui, Yonghao; Jiang, Qiu; Song, Houyan

    2011-12-01

    Folic acid is very important for embryonic development and folic acid inhibition can cause congenital heart defects in vertebrates. Dihydrofolate reductase (DHFR) is a key enzyme in folate-mediated metabolism. The dysfunction of DHFR disrupts the key biological processes which folic acid participates in. DHFR gene is conserved during vertebrate evolution. It is important to investigate the roles of DHFR in cardiac developments. In this study, we showed that DHFR knockdown resulted in the abnormal developments of zebrafish embryos in the early stages. Obvious malformations in heart and outflow tract (OFT) were also observed in DHFR knockdown embryos. DHFR overexpression rescued the abnormal phenotypes in the DHFR knockdown group. DHFR knockdown had negative impacts on the expressions of NKX2.5 (NK2 transcription factor-related 5), MEF2C (myocyte-specific enhancer factor 2C), TBX20 (T-box 20), and TBX1 (T-box 1) which are important transcriptional factors during cardiac development process, while DHFR overexpression had positive effects. DHFR was required for Hedgehog pathway. DHFR knockdown caused reduced cell proliferation and increased apoptosis, while its overexpression promoted cell proliferation and inhibited apoptosis. Taken together, our study suggested that DHFR plays crucial roles in the development of heart and OFT in zebrafish by regulating gene transcriptions and affecting cell proliferation and apoptosis.

  11. Increased Dynamic Effects in a Catalytically Compromised Variant of Escherichia coli Dihydrofolate Reductase

    PubMed Central

    2013-01-01

    Isotopic substitution (15N, 13C, 2H) of a catalytically compromised variant of Escherichia coli dihydrofolate reductase, EcDHFR-N23PP/S148A, has been used to investigate the effect of these mutations on catalysis. The reduction of the rate constant of the chemical step in the EcDHFR-N23PP/S148A catalyzed reaction is essentially a consequence of an increase of the quasi-classical free energy barrier and to a minor extent of an increased number of recrossing trajectories on the transition state dividing surface. Since the variant enzyme is less well set up to catalyze the reaction, a higher degree of active site reorganization is needed to reach the TS. Although millisecond active site motions are lost in the variant, there is greater flexibility on the femtosecond time scale. The “dynamic knockout” EcDHFR-N23PP/S148A is therefore a “dynamic knock-in” at the level of the chemical step, and the increased dynamic coupling to the chemical coordinate is in fact detrimental to catalysis. This finding is most likely applicable not just to hydrogen transfer in EcDHFR but also to other enzymatic systems. PMID:24252106

  12. New small-molecule inhibitors of dihydrofolate reductase inhibit Streptococcus mutans.

    PubMed

    Zhang, Qiong; Nguyen, Thao; McMichael, Megan; Velu, Sadanandan E; Zou, Jing; Zhou, Xuedong; Wu, Hui

    2015-08-01

    Streptococcus mutans is a major aetiological agent of dental caries. Formation of biofilms is a key virulence factor of S. mutans. Drugs that inhibit S. mutans biofilms may have therapeutic potential. Dihydrofolate reductase (DHFR) plays a critical role in regulating the metabolism of folate. DHFR inhibitors are thus potent drugs and have been explored as anticancer and antimicrobial agents. In this study, a library of analogues based on a DHFR inhibitor, trimetrexate (TMQ), an FDA-approved drug, was screened and three new analogues that selectively inhibited S. mutans were identified. The most potent inhibitor had a 50% inhibitory concentration (IC50) of 454.0±10.2nM for the biofilm and 8.7±1.9nM for DHFR of S. mutans. In contrast, the IC50 of this compound for human DHFR was ca. 1000nM, a >100-fold decrease in its potency, demonstrating the high selectivity of the analogue. An analogue that exhibited the least potency for the S. mutans biofilm also had the lowest activity towards inhibiting S. mutans DHFR, further indicating that inhibition of biofilms is related to reduced DHFR activity. These data, along with docking of the most potent analogue to the modelled DHFR structure, suggested that the TMQ analogues indeed selectively inhibited S. mutans through targeting DHFR. These potent and selective small molecules are thus promising lead compounds to develop new effective therapeutics to prevent and treat dental caries.

  13. Reduced impact of pyrimethamine drug pressure on Plasmodium malariae dihydrofolate reductase gene.

    PubMed

    Khim, Nimol; Kim, Saorin; Bouchier, Christiane; Tichit, Magali; Ariey, Frédéric; Fandeur, Thierry; Chim, Pheaktra; Ke, Sopheakvatey; Sum, Sarorn; Man, Somnang; Ratsimbasoa, Arsène; Durand, Rémy; Ménard, Didier

    2012-02-01

    Molecular investigations performed following the emergence of sulfadoxine-pyrimethamine (SP) resistance in Plasmodium falciparum have allowed the identification of the dihydrofolate reductase (DHFR) enzyme as the target of pyrimethamine. Although clinical cases of Plasmodium malariae are not usually treated with antifolate therapy, incorrect diagnosis and the high frequency of undetected mixed infections has probably exposed non-P. falciparum parasites to antifolate therapy in many areas. In this context, we aimed to assess the worldwide genetic diversity of the P. malariae dhfr gene in 123 samples collected in Africa and Asia, areas with different histories of SP use. Among the 10 polymorphic sites found, we have observed 7 new mutations (K55E, S58R, S59A, F168S, N194S, D207G, and T221A), which led us to describe 6 new DHFR proteins. All isolates from African countries were classified as wild type, while new mutations and haplotypes were recognized as exclusive to Madagascar (except for the double mutations at nucleotides 341 and 342 [S114N] found in one Cambodian isolate). Among these nonsynonymous mutations, two were likely related to pyrimethamine resistance: S58R (corresponding to C59R in P. falciparum and S58R in Plasmodium vivax; observed in one Malagasy sample) and S114N (corresponding to S108N in P. falciparum and S117N in P. vivax; observed in three Cambodian samples).

  14. Reduced Impact of Pyrimethamine Drug Pressure on Plasmodium malariae Dihydrofolate Reductase Gene

    PubMed Central

    Khim, Nimol; Kim, Saorin; Bouchier, Christiane; Tichit, Magali; Ariey, Frédéric; Fandeur, Thierry; Chim, Pheaktra; Ke, Sopheakvatey; Sum, Sarorn; Man, Somnang; Ratsimbasoa, Arsène; Durand, Rémy

    2012-01-01

    Molecular investigations performed following the emergence of sulfadoxine-pyrimethamine (SP) resistance in Plasmodium falciparum have allowed the identification of the dihydrofolate reductase (DHFR) enzyme as the target of pyrimethamine. Although clinical cases of Plasmodium malariae are not usually treated with antifolate therapy, incorrect diagnosis and the high frequency of undetected mixed infections has probably exposed non-P. falciparum parasites to antifolate therapy in many areas. In this context, we aimed to assess the worldwide genetic diversity of the P. malariae dhfr gene in 123 samples collected in Africa and Asia, areas with different histories of SP use. Among the 10 polymorphic sites found, we have observed 7 new mutations (K55E, S58R, S59A, F168S, N194S, D207G, and T221A), which led us to describe 6 new DHFR proteins. All isolates from African countries were classified as wild type, while new mutations and haplotypes were recognized as exclusive to Madagascar (except for the double mutations at nucleotides 341 and 342 [S114N] found in one Cambodian isolate). Among these nonsynonymous mutations, two were likely related to pyrimethamine resistance: S58R (corresponding to C59R in P. falciparum and S58R in Plasmodium vivax; observed in one Malagasy sample) and S114N (corresponding to S108N in P. falciparum and S117N in P. vivax; observed in three Cambodian samples). PMID:22123682

  15. Interaction of dihydrofolate reductase with methotrexate: Ensemble and single-molecule kinetics

    NASA Astrophysics Data System (ADS)

    Rajagopalan, P. T. Ravi; Zhang, Zhiquan; McCourt, Lynn; Dwyer, Mary; Benkovic, Stephen J.; Hammes, Gordon G.

    2002-10-01

    The thermodynamics and kinetics of the interaction of dihydrofolate reductase (DHFR) with methotrexate have been studied by using fluorescence, stopped-flow, and single-molecule methods. DHFR was modified to permit the covalent addition of a fluorescent molecule, Alexa 488, and a biotin at the N terminus of the molecule. The fluorescent molecule was placed on a protein loop that closes over methotrexate when binding occurs, thus causing a quenching of the fluorescence. The biotin was used to attach the enzyme in an active form to a glass surface for single-molecule studies. The equilibrium dissociation constant for the binding of methotrexate to the enzyme is 9.5 nM. The stopped-flow studies revealed that methotrexate binds to two different conformations of the enzyme, and the association and dissociation rate constants were determined. The single-molecule investigation revealed a conformational change in the enzyme-methotrexate complex that was not observed in the stopped-flow studies. The ensemble averaged rate constants for this conformation change in both directions is about 2-4 s1 and is attributed to the opening and closing of the enzyme loop over the bound methotrexate. Thus the mechanism of methotrexate binding to DHFR involves multiple steps and protein conformational changes.

  16. Dynamics of Immobilized and Native Escherichia coli Dihydrofolate Reductase by Quasielastic Neutron Scattering. Biophysical Journal

    SciTech Connect

    Tehei, M; Smith, Jeremy C; Monk, C; Olliver, J; Oettl, M; Kurkal-Siebert, V; Finney, J.L.; Daniel, R. M.

    2005-10-01

    The internal dynamics of native and immobilized Escherichia coli dihydrofolate reductase (DHFR) have been examined using incoherent quasielastic neutron scattering. These results reveal no difference between the high frequency vibration mean-square displacement of the native and the immobilized E. coli DHFR. However, length-scale-dependent, picosecond dynamical changes are found. On longer length scales, the dynamics are comparable for both DHFR samples. On shorter length scales, the dynamics is dominated by local jump motions over potential barriers. The residence time for the protons to stay in a potential well is {tau}=7.95{+-}1.02ps for the native DHFR and {tau}=20.36{+-}1.80ps for the immobilized DHFR. The average height of the potential barrier to the local motions is increased in the immobilized DHFR, and may increase the activation energy for the activity reaction, decreasing the rate as observed experimentally. These results suggest that the local motions on the picosecond timescale may act as a lubricant for those associated with DHFR activity occurring on a slower millisecond timescale. Experiments indicate a significantly slower catalytic reaction rate for the immobilized E. coli DHFR. However, the immobilization of the DHFR is on the exterior of the enzyme and essentially distal to the active site, thus this phenomenon has broad implications for the action of drugs distal to the active site.

  17. Chemical Ligation and Isotope Labeling to Locate Dynamic Effects during Catalysis by Dihydrofolate Reductase.

    PubMed

    Luk, Louis Y P; Ruiz-Pernía, J Javier; Adesina, Aduragbemi S; Loveridge, E Joel; Tuñón, Iñaki; Moliner, Vincent; Allemann, Rudolf K

    2015-07-27

    Chemical ligation has been used to alter motions in specific regions of dihydrofolate reductase from E. coli and to investigate the effects of localized motional changes on enzyme catalysis. Two isotopic hybrids were prepared; one with the mobile N-terminal segment containing heavy isotopes ((2) H, (13) C, (15) N) and the remainder of the protein with natural isotopic abundance, and the other one with only the C-terminal segment isotopically labeled. Kinetic investigations indicated that isotopic substitution of the N-terminal segment affected only a physical step of catalysis, whereas the enzyme chemistry was affected by protein motions from the C-terminal segment. QM/MM studies support the idea that dynamic effects on catalysis mostly originate from the C-terminal segment. The use of isotope hybrids provides insights into the microscopic mechanism of dynamic coupling, which is difficult to obtain with other studies, and helps define the dynamic networks of intramolecular interactions central to enzyme catalysis.

  18. Evidence for two interconverting protein isomers in the methotrexate complex of dihydrofolate reductase from Escherichia coli

    SciTech Connect

    Falzone, C.J.; Benkovic, S.J. ); Wright, P.E. )

    1991-02-26

    Two-dimensional {sup 1}H NMR methods and a knowledge of the X-ray crystal structure have been used to make resonance assignments for the amino acid side chains of dihydrofolate reductase from Escherichia coli complexed with methotrexate. The H7 proton on the pteridine ring of methotrexate was found to have NOEs to the methyl protons of Leu-28 which were assigned by using the L28F mutant. These NOEs indicated that the orientation of the methotrexate pteridine ring is similar in both solution and crystal structures. During the initial assignment process, it became evident that many of the resonances in this complex, unlike those of the folate complex, are severally broadened or doubled. The observation of two distinct sets of resonances in a ratio of approximately 2:1 was attributed to the presence of two protein isomers. Many of the side chains with clearly doubled resonances were located in the {beta}-sheet and the active site. Preliminary studies on the apoprotein also revealed doubled resonances in the absence of the inhibitor, indicating the existence of the protein isomers prior to methotrexate binding. In contrast to the methotrexate complex, the binary complex with folate and the ternary MTX-NADPH-DHFR complex presented a single enzyme form. These results are proposed to reflect the ability of folate and NADPH to bind predominantly to one protein isomer.

  19. The HIP1 binding site is required for growth regulation of the dihydrofolate reductase gene promoter.

    PubMed Central

    Means, A L; Slansky, J E; McMahon, S L; Knuth, M W; Farnham, P J

    1992-01-01

    The transcription rate of the dihydrofolate reductase (DHFR) gene increases at the G1/S boundary of the proliferative cell cycle. Through analysis of transiently and stably transfected NIH 3T3 cells, we have now demonstrated that DHFR promoter sequences extending from -270 to +20 are sufficient to confer similar regulation on a reporter gene. Mutation of a protein binding site that spans sequences from -16 to +11 in the DHFR promoter resulted in loss of the transcriptional increase at the G1/S boundary. Purification of an activity from HeLa nuclear extract that binds to this region enriched for a 180-kDa polypeptide (HIP1). Using this HIP1 preparation, we have identified specific positions within the binding site that are critical for efficient protein-DNA interactions. An analysis of association and dissociation rates suggests that bound HIP1 protein can exchange rapidly with free protein. This rapid exchange may facilitate the burst of transcriptional activity from the DHFR promoter at the G1/S boundary. Images PMID:1545788

  20. Effect of pH on hydride transfer by Escherichia coli dihydrofolate reductase.

    PubMed

    Loveridge, E Joel; Allemann, Rudolf K

    2011-05-16

    The kinetic isotope effect (KIE) on hydride transfer in the reaction catalysed by dihydrofolate reductase from Escherichia coli (EcDHFR) is known to be temperature dependent at pH 7, but essentially independent of temperature at elevated pH. Here, we show that the transition from the temperature-dependent regime to the temperature-independent regime occurs sharply between pH 7.5 and 8. The activation energy for hydride transfer is independent of pH. The mechanism leading to the change in behaviour of the KIEs is not clear, but probably involves a conformational change in the enzyme brought about by deprotonation of a key residue (or residues) at high pH. The KIE on hydride transfer at low pH suggests that the rate constant for the reaction is not limited by a conformational change to the enzyme under these conditions. The effect of pH on the temperature dependence of the rate constants and KIEs for hydride transfer catalysed by EcDHFR suggests that enzyme motions and conformational changes do not directly influence the chemistry, but that the reaction conditions affect the conformational ensemble of the enzyme prior to reaction and control the reaction though this route.

  1. Virtual ligand screening against Escherichia coli dihydrofolate reductase: improving docking enrichment using physics-based methods.

    PubMed

    Bernacki, Katarzyna; Kalyanaraman, Chakrapani; Jacobson, Matthew P

    2005-10-01

    Motivated by their participation in the McMaster Data-Mining and Docking Competition, the authors developed 2 new computational technologies and applied them to docking against Escherichia coli dihydrofolate reductase: a receptor preparation procedure that incorporates rotamer optimization of side chains and a physics-based rescoring procedure for estimating relative binding affinities of the protein-ligand complexes. Both methods use the same energy function, consisting of the all-atom OPLS-AA force field and a generalized Born solvent model, which treats the protein receptor and small-molecule ligands in a consistent manner. Thus, the energy function is similar to that used in more sophisticated approaches, such as free-energy perturbation and the molecular mechanics Poisson-Boltzmann/surface area, but sampling during the rescoring procedure is limited to simple energy minimization of the ligand. The use of a highly efficient minimization algorithm permitted the authors to apply this rescoring procedure to hundreds of thousands of protein-ligand complexes during the competition, using a modest Linux cluster. To test these methods, they used the 12 competitive inhibitors identified in the training set, plus methotrexate, as positive controls in enrichment studies with both the training and test sets, each containing 50,000 compounds. The key conclusion is that combining the receptor preparation and rescoring methods makes it possible to identify most of the positive controls within the top few tenths of a percent of the rank-ordered training and test set libraries.

  2. Catalysis by dihydrofolate reductase and other enzymes arises from electrostatic preorganization, not conformational motions.

    PubMed

    Adamczyk, Andrew J; Cao, Jie; Kamerlin, Shina C L; Warshel, Arieh

    2011-08-23

    The proposal that enzymatic catalysis is due to conformational fluctuations has been previously promoted by means of indirect considerations. However, recent works have focused on cases where the relevant motions have components toward distinct conformational regions, whose population could be manipulated by mutations. In particular, a recent work has claimed to provide direct experimental evidence for a dynamical contribution to catalysis in dihydrofolate reductase, where blocking a relevant conformational coordinate was related to the suppression of the motion toward the occluded conformation. The present work utilizes computer simulations to elucidate the true molecular basis for the experimentally observed effect. We start by reproducing the trend in the measured change in catalysis upon mutations (which was assumed to arise as a result of a "dynamical knockout" caused by the mutations). This analysis is performed by calculating the change in the corresponding activation barriers without the need to invoke dynamical effects. We then generate the catalytic landscape of the enzyme and demonstrate that motions in the conformational space do not help drive catalysis. We also discuss the role of flexibility and conformational dynamics in catalysis, once again demonstrating that their role is negligible and that the largest contribution to catalysis arises from electrostatic preorganization. Finally, we point out that the changes in the reaction potential surface modify the reorganization free energy (which includes entropic effects), and such changes in the surface also alter the corresponding motion. However, this motion is never the reason for catalysis, but rather simply a reflection of the shape of the reaction potential surface.

  3. New small-molecule inhibitors of dihydrofolate reductase inhibit Streptococcus mutans

    PubMed Central

    Zhang, Qiong; Nguyen, Thao; McMichael, Megan; Velu, Sandanandan; Zou, Jing; Zhou, Xuedong; Wu, Hui

    2015-01-01

    Streptococcus mutans is a major aetiological agent of dental caries. Formation of biofilms is a key virulence factor of S. mutans. Drugs that inhibit S. mutans biofilms may have therapeutic potential. Dihydrofolate reductase (DHFR) plays a critical role in regulating the metabolism of folate. DHFR inhibitors are thus potent drugs and have been explored as anticancer and antimicrobial agents. In this study, a library of analogues based on a DHFR inhibitor, trimetrexate (TMQ), an FDA-approved drug, was screened and three new analogues that selectively inhibited S. mutans were identified. The most potent inhibitor had a 50% inhibitory concentration (IC50) of 454.0 ± 10.2 nM for the biofilm and 8.7 ± 1.9 nM for DHFR of S. mutans. In contrast, the IC50 of this compound for human DHFR was ca. 1000 nM, a >100-fold decrease in its potency, demonstrating the high selectivity of the analogue. An analogue that exhibited the least potency for the S. mutans biofilm also had the lowest activity towards inhibiting S. mutans DHFR, further indicating that inhibition of biofilms is related to reduced DHFR activity. These data, along with docking of the potent analogue to the modelled DHFR structure, suggested that the TMQ analogues indeed selectively inhibited S. mutans through targeting DHFR. These potent and selective small molecules are thus promising lead compounds to develop new effective therapeutics to prevent and treat dental caries. PMID:26022931

  4. The Tail Wagging the Dog: Insights into Catalysis in R67 Dihydrofolate Reductase

    SciTech Connect

    Kamath, Ganesh K; Agarwal, Pratul K

    2010-01-01

    Plasmid-encoded R67 dihydrofolate reductase (DHFR) catalyzes a hydride transfer reaction between substrate dihydrofolate (DHF) and its cofactor, nicotinamide adenine dinucleotide phosphate (NADPH). R67 DHFR is a homotetramer that exhibits numerous characteristics of a primitive enzyme, including promiscuity in binding of substrate and cofactor, formation of nonproductive complexes, and the absence of a conserved acid in its active site. Furthermore, R67's active site is a pore, which is mostly accessible by bulk solvent. This study uses a computational approach to characterize the mechanism of hydride transfer. Not surprisingly, NADPH remains fixed in one-half of the active site pore using numerous interactions with R67. Also, stacking between the nicotinamide ring of the cofactor and the pteridine ring of the substrate, DHF, at the hourglass center of the pore, holds the reactants in place. However, large movements of the p-aminobenzoylglutamate tail of DHF occur in the other half of the pore because of ion pair switching between symmetry-related K32 residues from two subunits. This computational result is supported by experimental results that the loss of these ion pair interactions (located >13 {angstrom} from the center of the pore) by addition of salt or in asymmetric K32M mutants leads to altered enzyme kinetics [Hicks, S. N., et al. (2003) Biochemistry 42, 10569-10578; Hicks, S. N., et al. (2004) J. Biol. Chem. 279, 46995?47002]. The tail movement at the edge of the active site, coupled with the fixed position of the pteridine ring in the center of the pore, leads to puckering of the pteridine ring and promotes formation of the transition state. Flexibility coupled to R67 function is unusual as it contrasts with the paradigm that enzymes use increased rigidity to facilitate attainment of their transition states. A comparison with chromosomal DHFR indicates a number of similarities, including puckering of the nicotinamide ring and changes in the DHF tail

  5. Defining the binding site of homotetrameric R67 dihydrofolate reductase and correlating binding enthalpy with catalysis.

    PubMed

    Strader, Michael Brad; Chopra, Shaileja; Jackson, Michael; Smiley, R Derike; Stinnett, Lori; Wu, Jun; Howell, Elizabeth E

    2004-06-15

    R67 dihydrofolate reductase (DHFR) is a novel protein that possesses 222 symmetry. A single active site pore traverses the length of the homotetramer. Although the 222 symmetry implies that four symmetry-related binding sites should exist for each substrate as well as each cofactor, isothermal titration calorimetry (ITC) studies indicate only two molecules bind. Three possible combinations include two dihydrofolate molecules, two NADPH molecules, or one substrate with one cofactor. The latter is the productive ternary complex. To evaluate the roles of A36, Y46, T51, G64, and V66 residues in binding and catalysis, a site-directed mutagenesis approach was employed. One mutation per gene produces four mutations per active site pore, which often result in large cumulative effects. Conservative mutations at these positions either eliminate the ability of the gene to confer trimethoprim resistance or have no effect on catalysis. This result, in conjunction with previous mutagenesis studies on K32, K33, S65, Q67, I68, and Y69 [Strader, M. B., et al. (2001) Biochemistry 40, 11344-11352; Hicks, S. N., et al. (2003) Biochemistry 42, 10569-10578; Park, H., et al. (1997) Protein Eng. 10, 1415-1424], allows mapping of the active site surface. Residues for which conservative mutations have large effects on binding and catalysis include K32, Q67, I68, and Y69. These residues form a stripe that establishes the ligand binding surface. Residues that accommodate conservative mutations that do not greatly affect catalysis include K33, Y46, T51, S65, and V66. Isothermal titration calorimetry studies were also conducted on many of the mutants described above to determine the enthalpy of folate binding to the R67 DHFR.NADPH complex. A linear correlation between this DeltaH value and log k(cat)/K(m) is observed. Since structural tightness appears to be correlated with the exothermicity of the binding interaction, this leads to the hypothesis that enthalpy-driven formation of the ternary

  6. Circularly permuted dihydrofolate reductase possesses all the properties of the molten globule state, but can resume functional tertiary structure by interaction with its ligands.

    PubMed Central

    Uversky, V. N.; Kutyshenko, V. P.; Protasova NYu; Rogov, V. V.; Vassilenko, K. S.; Gudkov, A. T.

    1996-01-01

    It is obvious that functional activity of a protein molecule is closely related to its structure. On the other hand, the understanding of structure-function relationship still remains one of the intriguing problems of molecular biology. There is widespread belief that mutagenesis presents a real way to solve this problem. Following this assumption, we have investigated the effect of circular permutation in dihydrofolate reductase from E. coli on protein structure and functioning. It has been shown that in the absence of ligands two circularly permuted variants of dihydrofolate reductase possess all the properties of the molten globule state. However, after addition of ligands they gain the native-like structural properties and specific activity. This means that the in vitro folding of permuted dihydrofolate reductase is terminated at the stage of the molten globule formation. Interaction of permuted protein with ligands leads to the structural adjustment and formation of active protein molecules. PMID:8880908

  7. A-to-I RNA Editing Up-regulates Human Dihydrofolate Reductase in Breast Cancer.

    PubMed

    Nakano, Masataka; Fukami, Tatsuki; Gotoh, Saki; Nakajima, Miki

    2017-03-24

    Dihydrofolate reductase (DHFR) plays a key role in folate metabolism and is a target molecule of methotrexate. An increase in the cellular expression level of DHFR is one of the mechanisms of tumor resistance to methotrexate. The present study investigated the possibility that adenosine-to-inosine RNA editing, which causes nucleotide conversion by adenosine deaminase acting on RNA (ADAR) enzymes, might modulate DHFR expression. In human breast adenocarcinoma-derived MCF-7 cells, 26 RNA editing sites were identified in the 3'-UTR of DHFR. Knockdown of ADAR1 decreased the RNA editing levels of DHFR and resulted in a decrease in the DHFR mRNA and protein levels, indicating that ADAR1 up-regulates DHFR expression. Using a computational analysis, miR-25-3p and miR-125a-3p were predicted to bind to the non-edited 3'-UTR of DHFR but not to the edited sequence. The decrease in DHFR expression by the knockdown of ADAR1 was restored by transfection of antisense oligonucleotides for these miRNAs, suggesting that RNA editing mediated up-regulation of DHFR requires the function of these miRNAs. Interestingly, we observed that the knockdown of ADAR1 decreased cell viability and increased the sensitivity of MCF-7 cells to methotrexate. ADAR1 expression levels and the RNA editing levels in the 3'-UTR of DHFR in breast cancer tissues were higher than those in adjacent normal tissues. Collectively, the present study demonstrated that ADAR1 positively regulates the expression of DHFR by editing the miR-25-3p and miR-125a-3p binding sites in the 3'-UTR of DHFR, enhancing cellular proliferation and resistance to methotrexate.

  8. Dihydrofolate Reductase and Thymidylate Synthase Transgenes Resistant to Methotrexate Interact to Permit Novel Transgene Regulation*

    PubMed Central

    Rushworth, David; Mathews, Amber; Alpert, Amir; Cooper, Laurence J. N.

    2015-01-01

    Methotrexate (MTX) is an anti-folate that inhibits de novo purine and thymidine nucleotide synthesis. MTX induces death in rapidly replicating cells and is used in the treatment of multiple cancers. MTX inhibits thymidine synthesis by targeting dihydrofolate reductase (DHFR) and thymidylate synthase (TYMS). The use of MTX to treat cancer also causes bone marrow suppression and inhibits the immune system. This has led to the development of an MTX-resistant DHFR, DHFR L22F, F31S (DHFRFS), to rescue healthy cells. 5-Fluorouracil-resistant TYMS T51S, G52S (TYMSSS) is resistant to MTX and improves MTX resistance of DHFRFS in primary T cells. Here we find that a known mechanism of MTX-induced increase in DHFR expression persists with DHFRFS and cis-expressed transgenes. We also find that TYMSSS expression of cis-expressed transgenes is similarly decreased in an MTX-inducible manner. MTX-inducible changes in DHFRFS and TYMSSS expression changes are lost when both genes are expressed together. In fact, expression of the DHFRFS and TYMSSS cis-expressed transgenes becomes correlated. These findings provide the basis for an unrecognized post-transcriptional mechanism that functionally links expression of DHFR and TYMS. These findings were made in genetically modified primary human T cells and have a clear potential for use in clinical applications where gene expression needs to be regulated by drug or maintained at a specific expression level. We demonstrate a potential application of this system in the controlled expression of systemically toxic cytokine IL-12. PMID:26242737

  9. Protein Mass-Modulated Effects in the Catalytic Mechanism of Dihydrofolate Reductase: Beyond Promoting Vibrations

    PubMed Central

    2015-01-01

    The role of fast protein dynamics in enzyme catalysis has been of great interest in the past decade. Recent “heavy enzyme” studies demonstrate that protein mass-modulated vibrations are linked to the energy barrier for the chemical step of catalyzed reactions. However, the role of fast dynamics in the overall catalytic mechanism of an enzyme has not been addressed. Protein mass-modulated effects in the catalytic mechanism of Escherichia coli dihydrofolate reductase (ecDHFR) are explored by isotopic substitution (13C, 15N, and non-exchangeable 2H) of the wild-type ecDHFR (l-DHFR) to generate a vibrationally perturbed “heavy ecDHFR” (h-DHFR). Steady-state, pre-steady-state, and ligand binding kinetics, intrinsic kinetic isotope effects (KIEint) on the chemical step, and thermal unfolding experiments of both l- and h-DHFR show that the altered protein mass affects the conformational ensembles and protein–ligand interactions, but does not affect the hydride transfer at physiological temperatures (25–45 °C). Below 25 °C, h-DHFR shows altered transition state (TS) structure and increased barrier-crossing probability of the chemical step compared with l-DHFR, indicating temperature-dependent protein vibrational coupling to the chemical step. Protein mass-modulated vibrations in ecDHFR are involved in TS interactions at cold temperatures and are linked to dynamic motions involved in ligand binding at physiological temperatures. Thus, mass effects can affect enzymatic catalysis beyond alterations in promoting vibrations linked to chemistry. PMID:24820793

  10. A molecular model of the folate binding site of Pneumocystis carinii dihydrofolate reductase

    NASA Astrophysics Data System (ADS)

    Southerland, William M.

    1994-04-01

    The inhibition of Pneumocystis carinii dihydrofolate reductase (DHFR) continues to be the major treatment strategy for P. carinii pneumonia (PCP). The design of new anti-pneumocystis agents would be significantly enhanced by the availability of a 3D model of the methotrexate (MTX) binding site of the P. carinii DHFR. However, an X-ray crystal structure of the P. carinii DHFR is not yet available. Alignment of the amino acid sequences of P. carinii and Lactobacillus casei DHFRs indicates that the two proteins show approximately 80% homology among MTX binding-site residues. This high level of homology suggests that the L. casei DHFR MTX binding-site structure could serve as a structural template in developing a model of the P. carinii DHFR MTX binding site. Therefore, the X-ray crystal structure of L. casei DHFR was used to develop a 3D model of the methotrexate binding site of P. carinii DHFR. The molecular modeling and dynamics software QUANTA/CHARMm was used. Amino acid residue mutations and deletions were performed using QUANTA and macromolecular minimizations were achieved with CHARMm. The MTX binding-site residues of L. casei DHFR were mutated to the corresponding residues of the P. carinii DHFR sequence. The resulting structure was extensively minimized. The resulting P. carinii MTX binding-site model showed significant differences in hydrogen-bonding patterns from the L. casei MTX binding site. Also, the P. carinii site is more hydrophobic than the corresponding L. casei site. Analysis of atom-to-atom close contacts between methotrexate and protein binding-site residues indicates that the P. carinii MTX binding-site complex is primarily stabilized by hydrophobic interactions, while the L. casei complex is mostly stabilized by electrostatic interactions. The model is consistent with the observed increased sensitivity of P. carinii DHFR to lipid-soluble inhibitors and provides a rational basis for the design of new anti-pneumocystis agents.

  11. Pivotal role of dihydrofolate reductase knockdown in the anticancer activity of 2-hydroxyoleic acid

    PubMed Central

    Lladó, Victoria; Terés, Silvia; Higuera, Mónica; Álvarez, Rafael; Noguera-Salva, Maria Antònia; Halver, John E.; Escribá, Pablo V.; Busquets, Xavier

    2009-01-01

    α-Hydroxy-9-cis-octadecenoic acid, a synthetic fatty acid that modifies the composition and structure of lipid membranes. 2-Hydroxyoleic acid (HOA) generated interest due to its potent, yet nontoxic, anticancer activity. It induces cell cycle arrest in human lung cancer (A549) cells and apoptosis in human leukemia (Jurkat) cells. These two pathways may explain how HOA induces regression of a variety of cancers. We showed that HOA repressed the expression of dihydrofolate reductase (DHFR), the enzyme responsible for tetrahydrofolate (THF) synthesis. Folinic acid, which readily produces THF without the participation of DHFR, reverses the antitumor effects of HOA in A549 and Jurkat cells, as well as the inhibitory influence on cyclin D and cdk2 in A549 cells, and on DNA and PARP degradation in Jurkat cells. This effect was very specific, because either elaidic acid (an analog of HOA) or other lipids, failed to alter A549 or Jurkat cell growth. THF is a cofactor necessary for DNA synthesis. Thus, impairment of DNA synthesis appears to be a common mechanism involved in the different responses elicited by cancer cells following treatment with HOA, namely cell cycle arrest or apoptosis. Compared with other antifolates, such as methotrexate, HOA did not directly inhibit DHFR but rather, it repressed its expression, a mode of action that offers certain therapeutic advantages. These results not only demonstrate the effect of a fatty acid on the expression of DHFR, but also emphasize the potential of HOA to be used as a wide-spectrum drug against cancer. PMID:19666584

  12. Thermal Stabilization of Dihydrofolate Reductase Using Monte Carlo Unfolding Simulations and Its Functional Consequences

    PubMed Central

    Whitney, Anna; Shakhnovich, Eugene I.

    2015-01-01

    Design of proteins with desired thermal properties is important for scientific and biotechnological applications. Here we developed a theoretical approach to predict the effect of mutations on protein stability from non-equilibrium unfolding simulations. We establish a relative measure based on apparent simulated melting temperatures that is independent of simulation length and, under certain assumptions, proportional to equilibrium stability, and we justify this theoretical development with extensive simulations and experimental data. Using our new method based on all-atom Monte-Carlo unfolding simulations, we carried out a saturating mutagenesis of Dihydrofolate Reductase (DHFR), a key target of antibiotics and chemotherapeutic drugs. The method predicted more than 500 stabilizing mutations, several of which were selected for detailed computational and experimental analysis. We find a highly significant correlation of r = 0.65–0.68 between predicted and experimentally determined melting temperatures and unfolding denaturant concentrations for WT DHFR and 42 mutants. The correlation between energy of the native state and experimental denaturation temperature was much weaker, indicating the important role of entropy in protein stability. The most stabilizing point mutation was D27F, which is located in the active site of the protein, rendering it inactive. However for the rest of mutations outside of the active site we observed a weak yet statistically significant positive correlation between thermal stability and catalytic activity indicating the lack of a stability-activity tradeoff for DHFR. By combining stabilizing mutations predicted by our method, we created a highly stable catalytically active E. coli DHFR mutant with measured denaturation temperature 7.2°C higher than WT. Prediction results for DHFR and several other proteins indicate that computational approaches based on unfolding simulations are useful as a general technique to discover stabilizing

  13. Elucidating features that drive the design of selective antifolates using crystal structures of human dihydrofolate reductase.

    PubMed

    Lamb, Kristen M; G-Dayanandan, Narendran; Wright, Dennis L; Anderson, Amy C

    2013-10-15

    The pursuit of antimicrobial drugs that target dihydrofolate reductase (DHFR) exploits differences in sequence and dynamics between the pathogenic and human enzymes. Here, we present five crystal structures of human DHFR bound to a new class of antimicrobial agents, the propargyl-linked antifolates (PLAs), with a range of potency (IC50 values of 0.045-1.07 μM) for human DHFR. These structures reveal that interactions between the ligands and Asn 64, Phe 31, and Phe 34 are important for increased affinity for human DHFR and that loop residues 58-64 undergo ligand-induced conformational changes. The utility of these structural studies was demonstrated through the design of three new ligands that reduce the number of contacts with Asn 64, Phe 31, and Phe 34. Synthesis and evaluation show that one of the designed inhibitors exhibits the lowest affinity for human DHFR of any of the PLAs (2.64 μM). Comparisons of structures of human and Staphylococcus aureus DHFR bound to the same PLA reveal a conformational change in the ligand that enhances interactions with residues Phe 92 (Val 115 in huDHFR) and Ile 50 (Ile 60 in huDHFR) in S. aureus DHFR, yielding selectivity. Likewise, comparisons of human and Candida glabrata DHFR bound to the same ligand show that hydrophobic interactions with residues Ile 121 and Phe 66 (Val 115 and Asn 64 in human DHFR) yield selective inhibitors. The identification of residue substitutions that are important for selectivity and the observation of active site flexibility will help guide antimicrobial antifolate development for the inhibition of pathogenic species.

  14. Down-regulation of dihydrofolate reductase inhibits the growth of endothelial EA.hy926 cell through induction of G1 cell cycle arrest via up-regulating p53 and p21(waf1/cip1) expression.

    PubMed

    Fei, Zhewei; Gao, Yong; Qiu, Mingke; Qi, Xianqin; Dai, Yuxin; Wang, Shuqing; Quan, Zhiwei; Liu, Yingbin; Ou, Jingmin

    2016-03-01

    Folic acid supplementation may meliorate cardiovascular disease risk by improving vascular endothelial structure and function. However, the underlying mechanisms are still lack of a global understanding. To be used, folic acid must be converted to 7,8-dihydrofolate by dihydrofolate reductase to generate one-carbon derivatives serving as important cellular cofactors in the synthesis of nucleotides and amino acids required for cell growth. Therefore, this study explored the effect of dihydrofolate reductase knockdown on endothelial EA.hy926 cell growth and the mechanism involved. We found that down-regulation of dihydrofolate reductase inhibited EA.hy926 cell proliferation, and induced G1 phase arrest. Meanwhile, the expression of regulators necessary for G1/S phase transition, such as cyclin-dependent kinases CDK2, CDK4 and CDK6, were remarkably down-regulated; by contrast, the cell cycle inhibitors p21(waf/cip1), p27(Kip1) and p53 were significantly up-regulated after dihydrofolate reductase knockdown. Furthermore, supplementation of 5-methyltetrahydrofolate to the dihydrofolate reductase knockdown cells could weaken the inhibitory effect of dihydrofolate reductase knockdown on cell proliferation, simultaneously, inducing the expression of p53 and p21(waf/cip1) falling back moderately. Our findings suggest that attenuating dihydrofolate reductase may cause imbalanced expression of cell cycle regulators, especially up-regulation of p53-p21(waf/cip1) pathway, leading to G1 cell cycle arrest, thereby inhibiting the growth of endothelial EA.hy926 cells.

  15. Induction of methotrexate resistance by retroviral-mediated transfer of a mutant dihydrofolate reductase gene

    SciTech Connect

    Ricciardone, M.D.

    1986-01-01

    Methotrexate (MTX), a folate analog which inhibits the enzyme dihydrofolate reductase (DHFR), is an effective antineoplastic drug. However, MTX-induced myelosuppression limits the effectiveness of this agent. Selective induction of MTX resistance in bone marrow stem cells, prior to treatment with MTX, might prevent this toxicity and improve the therapeutic index of the drug. In these studies drug resistance was transferred to mouse and human bone marrow stem cells by retroviral expression vectors containing coding sequences of a mutant DHFR with a decreased affinity for MTX. Three retroviral expression vectors were analyzed. The CIS DR vector contained the mutant DHFR gene inserted into the replication-defective amphotropic 4070 virus, Cistor. The other vectors contained the mutant DHFR inserted into either the env region (SDHT1) or gag-pol region (SDHT2) of a replication-defective spleen focus-forming virus. All three constructs induced approximately a 200-fold resistance to MTX when transfected into NIH3T3 cells. Amphotropic infectious retroviruses were obtained by transfecting the mutant DHFR vectors into a packaging cell line, which supplied the gag, pol, and env proteins for virus production. Virus titers of 4.5 x 10/sup 3/ colony-forming units (CFU)/ml (CIS DR), 1.5 x 10/sup 4/ CFU/ml (SDHT2), and 5 x 10/sup 5/ CFU/ml (SDHT1) were measured by the transfer of MTX resistance to NIH3T3 cells. The amphotropic SDHT1 virus efficiently induced MTX resistance in cells of several species, including mouse NIH3T3 cells (5 x 10/sup 5/ CFU/ml), monkey CV1 cells (4 x 10/sup 3/ CFU/ml), and human MCF-7 cells (6 x 10/sup 4/ CFU/ml). When cocultured with SDHT1 virus-producing cells, both mouse and human bone marrow cells could be infected and rendered resistant to MTX. Mouse cytotoxic T lymphocytes and mouse helper T lymphocytes can also be made resistant to MTX.

  16. X-ray structure of the ternary MTX·NADPH complex of the anthrax dihydrofolate reductase: A pharmacophore for dual-site inhibitor design

    SciTech Connect

    Bennett, Brad C.; Wan, Qun; Ahmad, Md Faiz; Langan, Paul; Dealwis, Chris G.

    2009-11-18

    For reasons of bioterrorism and drug resistance, it is imperative to identify and develop new molecular points of intervention against anthrax. Dihydrofolate reductase (DHFR) is a highly conserved enzyme and an established target in a number of species for a variety of chemotherapeutic programs. Recently, the crystal structure of B. anthracis DHFR (baDHFR) in complex with methotrexate (MTX) was determined and, based on the structure, proposals were made for drug design strategies directed against the substrate binding site. However, little is gleaned about the binding site for NADPH, the cofactor responsible for hydride transfer in the catalytic mechanism. In the present study, X-ray crystallography at 100 K was used to determine the structure of baDHFR in complex with MTX and NADPH. Although the NADPH binding mode is nearly identical to that seen in other DHFR ternary complex structures, the adenine moiety adopts an off-plane tilt of nearly 90 deg. and this orientation is stabilized by hydrogen bonds to functionally conserved Arg residues. A comparison of the binding site, focusing on this region, between baDHFR and the human enzyme is discussed, with an aim at designing species-selective therapeutics. Indeed, the ternary model, refined to 2.3{angstrom} resolution, provides an accurate template for testing the feasibility of identifying dual-site inhibitors, compounds that target both the substrate and cofactor binding site. With the ternary model in hand, using in silico methods, several compounds were identified which could potentially form key bonding contacts in the substrate and cofactor binding sites. Ultimately, two structurally distinct compounds were verified that inhibit baDHFR at low {mu}M concentrations. The apparent K{sub d} for one of these, (2-(3-(2-(hydroxyimino)-2-(pyridine-4-yl)-6,7-dimethylquinoxalin-2-yl)-1-(pyridine-4-yl)ethanone oxime), was measured by fluorescence spectroscopy to be 5.3 {mu}M.

  17. X-ray structure of the ternary MTX•NADPH complex of the anthrax dihydrofolate reductase: a pharmacophore for dual-site inhibitor design

    PubMed Central

    Bennett, Brad C.; Wan, Qun; Ahmad, Md Faiz; Dealwis, Chris G.

    2009-01-01

    For reasons of bioterrorism and drug resistance, it is imperative to identify and develop new molecular points of intervention against anthrax. Dihydrofolate reductase (DHFR) is a highly conserved enzyme and an established target in a number of species for a variety of chemotherapeutic programs. Recently, the crystal structure of B. anthracis DHFR (baDHFR) in complex with methotrexate (MTX) was determined and, based on the structure, proposals were made for drug design strategies directed against the substrate binding site. However, little is gleaned about the binding site for NADPH, the cofactor responsible for hydride transfer in the catalytic mechanism. In the present study, X-ray crystallography at 100 K was used to determine the structure of baDHFR in complex with MTX and NADPH. Although the NADPH binding mode is nearly identical to that seen in other DHFR ternary complex structures, the adenine moiety adopts an off-plane tilt of nearly 90° and this orientation is stabilized by hydrogen bonds to functionally conserved Arg residues. A comparison of the binding site, focusing on this region, between baDHFR and the human enzyme is discussed, with an aim at designing species-selective therapeutics. Indeed, the ternary model, refined to 2.3Å resolution, provides an accurate template for testing the feasibility of identifying dual-site inhibitors, compounds that target both the substrate and cofactor binding site. With the ternary model in hand, using in silico methods, several compounds were identified which could potentially form key bonding contacts in the substrate and cofactor binding sites. Ultimately, two structurally distinct compounds were verified that inhibit baDHFR at low μM concentrations. The apparent Kd for one of these, (2-(3-(2-(hydroxyimino)-2-(pyridine-4-yl)-6,7-dimethylquinoxalin-2-yl)-1-(pyridine-4-yl)ethanone oxime), was measured by fluorescence spectroscopy to be 5.3 μM. PMID:19374017

  18. A 19-base pair deletion polymorphism in dihydrofolate reductase is associated with increased unmetabolized folic acid in plasma and decreased red blood cell folate

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Dihydrofolate reductase (DHFR) catalyzes the reduction of folic acid to tetrahydrofolate (THF). A 19-bp noncoding deletion allele maps to intron 1, beginning 60 bases from the splice donor site, and has been implicated in neural tube defects and cancer, presumably by influencing folate metabolism. T...

  19. Escherichia coli dihydrofolate reductase catalyzed proton and hydride transfers: Temporal order and the roles of Asp27 and Tyr100

    PubMed Central

    Liu, C. Tony; Francis, Kevin; Layfield, Joshua P.; Huang, Xinyi; Hammes-Schiffer, Sharon; Kohen, Amnon; Benkovic, Stephen J.

    2014-01-01

    The reaction catalyzed by Escherichia coli dihydrofolate reductase (ecDHFR) has become a model for understanding enzyme catalysis, and yet several details of its mechanism are still unresolved. Specifically, the mechanism of the chemical step, the hydride transfer reaction, is not fully resolved. We found, unexpectedly, the presence of two reactive ternary complexes [enzyme:NADPH:7,8-dihydrofolate (E:NADPH:DHF)] separated by one ionization event. Furthermore, multiple kinetic isotope effect (KIE) studies revealed a stepwise mechanism in which protonation of the DHF precedes the hydride transfer from the nicotinamide cofactor (NADPH) for both reactive ternary complexes of the WT enzyme. This mechanism was supported by the pH- and temperature-independent intrinsic KIEs for the C-H→C hydride transfer between NADPH and the preprotonated DHF. Moreover, we showed that active site residues D27 and Y100 play a synergistic role in facilitating both the proton transfer and subsequent hydride transfer steps. Although D27 appears to have a greater effect on the overall rate of conversion of DHF to tetrahydrofolate, Y100 plays an important electrostatic role in modulating the pKa of the N5 of DHF to enable the preprotonation of DHF by an active site water molecule. PMID:25453098

  20. Evidence that a ‘dynamic knockout’ in Escherichia coli dihydrofolate reductase does not affect the chemical step of catalysis

    NASA Astrophysics Data System (ADS)

    Loveridge, E. Joel; Behiry, Enas M.; Guo, Jiannan; Allemann, Rudolf K.

    2012-04-01

    The question of whether protein motions play a role in the chemical step of enzymatic catalysis has generated much controversy in recent years. Debate has recently reignited over possible dynamic contributions to catalysis in dihydrofolate reductase, following conflicting conclusions from studies of the N23PP/S148A variant of the Escherichia coli enzyme. By investigating the temperature dependence of kinetic isotope effects, we present evidence that the reduction in the hydride transfer rate constants in this variant is not a direct result of impairment of conformational fluctuations. Instead, the conformational state of the enzyme immediately before hydride transfer, which determines the electrostatic environment of the active site, affects the rate constant for the reaction. Although protein motions are clearly important for binding and release of substrates and products, there appears to be no detectable dynamic coupling of protein motions to the hydride transfer step itself.

  1. Mycobacterium tuberculosis dihydrofolate reductase reveals two conformational states and a possible low affinity mechanism to antifolate drugs.

    PubMed

    Dias, Marcio Vinicius Bertacine; Tyrakis, Petros; Domingues, Romenia Ramos; Paes Leme, Adriana Franco; Blundell, Tom L

    2014-01-07

    Inhibition of the biosynthesis of tetrahydrofolate (THF) has long been a focus in the treatment of both cancer and infectious diseases. Dihydrofolate reductase (DHFR), which catalyzes the last step, is one of the most thoroughly explored targets of this pathway, but there are no DHFR inhibitors used for tuberculosis treatment. Here, we report a structural, site-directed mutagenesis and calorimetric analysis of Mycobacterium tuberculosis DHFR (MtDHFR) in complex with classical DHFR inhibitors. Our study provides insights into the weak inhibition of MtDHFR by trimethoprim and other antifolate drugs, such as pyrimethamine and cycloguanil. The construction of the mutant Y100F, together with calorimetric studies, gives insights into low affinity of MtDHFR for classical DHFR inhibitors. Finally, the structures of MtDHFR in complex with pyrimethamine and cycloguanil define important interactions in the active site and provide clues to the more effective design of antibiotics targeted against MtDHFR.

  2. Beyond Thymidylate Synthase and Dihydrofolate Reductase: Impact of Non-coding microRNAs in Anticancer Chemoresistance.

    PubMed

    Ju, Jingfang

    2012-09-01

    Chemoresistance is one of the major reasons for the failure of anticancer chemotherapy in treating advanced stage cancer. The mechanism of chemoresistance to fluoropyrimidines and antifolates has been extensively investigated in the past 40 years. It has been well established that thymidylate synthase (TYMS, TS) and dihydrofolate reductase (DHFR) are two major targets for fluoropyrimidines and antifolates, respectively. The regulatory mechanism of TS and DHFR expression is rather complex involving transcriptional, post-transcriptional and translational regulations. Our recent understanding of the chemoresistance mechanism has been extended beyond the simple one target/drug view. In this review, we will focus on the recent advancement of non-coding microRNAs (miRNAs) in contributing to the regulations of TS and DHFR expression, and to the chemoresistance mechanism of fluoropyrimidines and antifolates.

  3. Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element.

    PubMed Central

    Frayne, E G; Kellems, R E

    1986-01-01

    Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element. Images PMID:3714472

  4. Toward resolving the catalytic mechanism of dihydrofolate reductase using neutron and ultrahigh-resolution X-ray crystallography [Neutron and ultrahigh resolution X-ray crystallography reveals water as the proton donor in the catalytic mechanism of dihydrofolate reductase

    SciTech Connect

    Wan, Qun; Bennett, Brad C.; Wilson, Mark A.; Kovalevsky, Andrey; Langan, Paul; Howell, Elizabeth E.; Dealwis, Chris

    2014-12-01

    Dihydrofolate reductase (DHFR) catalyzes the NADPH-dependent reduction of dihydrofolate (DHF) to tetrahydrofolate (THF). An important step in the mechanism involves proton donation to the N5 atom of DHF. The inability to determine the protonation states of active site residues and substrate has led to the lack of consensus on a catalytic mechanism. To resolve this ambiguity, we conducted neutron and ultrahigh resolution X-ray crystallographic studies of the pseudo-Michaelis ternary complex of DHFR with folate and NADP+ from E. coli. The neutron data were collected to 2.0 Å resolution using a 3.6 mm3 crystal with the quasi-Laue technique, and the structure reveals that the N3 atom of folate is protonated while Asp27 is negatively charged. Previous mechanisms have proposed a keto-to-enol tautomerization of the substrate to facilitate protonation of the N5 atom. The structure supports the existence of the keto tautomer due to protonation of the N3 atom, suggesting tautomerization is unnecessary for catalysis. In the 1.05 Å resolution X-ray structure of the ternary complex, conformational disorder of the Met20 side chain is coupled to electron density for a partially occupied water within hydrogen-bonding distance of the N5 atom of folate; this suggests direct protonation of substrate by solvent. We propose a catalytic mechanism for DHFR that involves stabilization of the keto tautomer of the substrate, elevation of the pKa of the N5 atom of DHF by Asp27, and protonation of N5 by water whose access to the active site is gated by fluctuation of the Met20 side chain even though the Met-20 loop is closed.

  5. Toward resolving the catalytic mechanism of dihydrofolate reductase using neutron and ultrahigh-resolution X-ray crystallography [Neutron and ultrahigh resolution X-ray crystallography reveals water as the proton donor in the catalytic mechanism of dihydrofolate reductase

    DOE PAGES

    Wan, Qun; Bennett, Brad C.; Wilson, Mark A.; ...

    2014-12-01

    Dihydrofolate reductase (DHFR) catalyzes the NADPH-dependent reduction of dihydrofolate (DHF) to tetrahydrofolate (THF). An important step in the mechanism involves proton donation to the N5 atom of DHF. The inability to determine the protonation states of active site residues and substrate has led to the lack of consensus on a catalytic mechanism. To resolve this ambiguity, we conducted neutron and ultrahigh resolution X-ray crystallographic studies of the pseudo-Michaelis ternary complex of DHFR with folate and NADP+ from E. coli. The neutron data were collected to 2.0 Å resolution using a 3.6 mm3 crystal with the quasi-Laue technique, and the structuremore » reveals that the N3 atom of folate is protonated while Asp27 is negatively charged. Previous mechanisms have proposed a keto-to-enol tautomerization of the substrate to facilitate protonation of the N5 atom. The structure supports the existence of the keto tautomer due to protonation of the N3 atom, suggesting tautomerization is unnecessary for catalysis. In the 1.05 Å resolution X-ray structure of the ternary complex, conformational disorder of the Met20 side chain is coupled to electron density for a partially occupied water within hydrogen-bonding distance of the N5 atom of folate; this suggests direct protonation of substrate by solvent. We propose a catalytic mechanism for DHFR that involves stabilization of the keto tautomer of the substrate, elevation of the pKa of the N5 atom of DHF by Asp27, and protonation of N5 by water whose access to the active site is gated by fluctuation of the Met20 side chain even though the Met-20 loop is closed.« less

  6. Toward resolving the catalytic mechanism of dihydrofolate reductase using neutron and ultrahigh-resolution X-ray crystallography

    PubMed Central

    Wan, Qun; Bennett, Brad C.; Wilson, Mark A.; Kovalevsky, Andrey; Langan, Paul; Howell, Elizabeth E.; Dealwis, Chris

    2014-01-01

    Dihydrofolate reductase (DHFR) catalyzes the NADPH-dependent reduction of dihydrofolate (DHF) to tetrahydrofolate (THF). An important step in the mechanism involves proton donation to the N5 atom of DHF. The inability to determine the protonation states of active site residues and substrate has led to a lack of consensus regarding the catalytic mechanism involved. To resolve this ambiguity, we conducted neutron and ultrahigh-resolution X-ray crystallographic studies of the pseudo-Michaelis ternary complex of Escherichia coli DHFR with folate and NADP+. The neutron data were collected to 2.0-Å resolution using a 3.6-mm3 crystal with the quasi-Laue technique. The structure reveals that the N3 atom of folate is protonated, whereas Asp27 is negatively charged. Previous mechanisms have proposed a keto-to-enol tautomerization of the substrate to facilitate protonation of the N5 atom. The structure supports the existence of the keto tautomer owing to protonation of the N3 atom, suggesting that tautomerization is unnecessary for catalysis. In the 1.05-Å resolution X-ray structure of the ternary complex, conformational disorder of the Met20 side chain is coupled to electron density for a partially occupied water within hydrogen-bonding distance of the N5 atom of folate; this suggests direct protonation of substrate by solvent. We propose a catalytic mechanism for DHFR that involves stabilization of the keto tautomer of the substrate, elevation of the pKa value of the N5 atom of DHF by Asp27, and protonation of N5 by water that gains access to the active site through fluctuation of the Met20 side chain even though the Met20 loop is closed. PMID:25453083

  7. Structural comparison of chromosomal and exogenous dihydrofolate reductase from Staphylococcus aureus in complex with the potent inhibitor trimethoprim

    SciTech Connect

    Heaslet, Holly; Harris, Melissa; Fahnoe, Kelly; Sarver, Ronald; Putz, Henry; Chang, Jeanne; Subramanyam, Chakrapani; Barreiro, Gabriela; Miller, J. Richard; Pfizer

    2010-09-02

    Dihydrofolate reductase (DHFR) is the enzyme responsible for the NADPH-dependent reduction of 5,6-dihydrofolate to 5,6,7,8-tetrahydrofolate, an essential cofactor in the synthesis of purines, thymidylate, methionine, and other key metabolites. Because of its importance in multiple cellular functions, DHFR has been the subject of much research targeting the enzyme with anticancer, antibacterial, and antimicrobial agents. Clinically used compounds targeting DHFR include methotrexate for the treatment of cancer and diaminopyrimidines (DAPs) such as trimethoprim (TMP) for the treatment of bacterial infections. DAP inhibitors of DHFR have been used clinically for >30 years and resistance to these agents has become widespread. Methicillin-resistant Staphylococcus aureus (MRSA), the causative agent of many serious nosocomial and community acquired infections, and other gram-positive organisms can show resistance to DAPs through mutation of the chromosomal gene or acquisition of an alternative DHFR termed 'S1 DHFR.' To develop new therapies for health threats such as MRSA, it is important to understand the molecular basis of DAP resistance. Here, we report the crystal structure of the wild-type chromosomal DHFR from S. aureus in complex with NADPH and TMP. We have also solved the structure of the exogenous, TMP resistant S1 DHFR, apo and in complex with TMP. The structural and thermodynamic data point to important molecular differences between the two enzymes that lead to dramatically reduced affinity of DAPs to S1 DHFR. These differences in enzyme binding affinity translate into reduced antibacterial activity against strains of S. aureus that express S1 DHFR.

  8. Biosynthetic incorporation of telluromethionine into dihydrofolate reductase and crystallographic analysis of the distribution of tellurium atoms in the protein molecule

    SciTech Connect

    Kunkle, M.G.; Lewinski, K.; Boles, J.O.; Dunlap, R.B.; Odom, J.D.; Lebioda, L.

    1994-12-01

    Recent successes in crystallographic studies of proteins with methionine (Met) residues replaced with SeMet, pioneered by Hendrickson and coworkers, inspired us to replace Met with TeMet in Escherichia coli dihydrofolate reductase (DHFR). E. coli DHFR, which catalyzes the NADPH-dependent reduction of dihydrofolate to tetrahydrofolate, consists of 159 residues, 5 of which are Met. TeMet was incorporated into DHFR using the Met auxotroph, E. coli DL41, carrying the expression vector pWT8 with an IPTG inducible promoter and ampicillin resistance gene. The enzyme was purified by successive chromatography on Q-Sepharose and PHenyl Sepharose resins, yielding milligram quantities of homogeneous enzyme with a specific activity of 40 units/mg. TeMet DHFR exhibits kinetic properties similar to those of wt DHFR. Amino acid analysis indicated 3 authentic Met residues in TeMet DHFR, whereas atomic absorption spectroscopy detected 2 Te per protein molecule. Amino acid sequence analysis results suggested that only authentic Met was present in the first three Met positions (1,16,and 20). Crystals of Te-DHFR were grown in the presence of methotrexate from PEG 4000 and were isomorphous with wt-DHFR crystals grown from ethanol. Difference Fourier maps and restrained least-squares refinement show very little, if any, Te in the first three Met positions: Met{sup 1}, Met{sup 16}, and Met{sup 20}, whereas the occupancy of Te in positions 42 and 92 is 0.64. Apparently, the process of folding, subsequent purification, and crystallization select DHFR molecules with Te in Met{sup 42} and Met{sup 92}. Replacing Met with TeMet provides an internal probe that should facilitate structural and mechanistic studies of proteins.

  9. Functional nucleotide excision repair is required for the preferential removal of N-ethylpurines from the transcribed strand of the dihydrofolate reductase gene of Chinese hamster ovary cells.

    PubMed Central

    Sitaram, A; Plitas, G; Wang, W; Scicchitano, D A

    1997-01-01

    Transcription-coupled repair of DNA adducts is an essential factor that must be considered when one is elucidating biological endpoints resulting from exposure to genotoxic agents. Alkylating agents comprise one group of chemical compounds which modify DNA by reacting with oxygen and nitrogen atoms in the bases of the double helix. To discern the role of transcription-coupled DNA repair of N-ethylpurines present in discrete genetic domains, Chinese hamster ovary cells were exposed to N-ethyl-N-nitrosourea, and the clearance of the damage from the dihydrofolate reductase gene was investigated. The results indicate that N-ethylpurines were removed from the dihydrofolate reductase gene of nucleotide excision repair-proficient Chinese hamster ovary cells; furthermore, when repair rates in the individual strands were determined, a statistically significant bias in the removal of ethyl-induced, alkali-labile sites was observed, with clearance occurring 30% faster from the transcribed strand than from its nontranscribed counterpart at early times after exposure. In contrast, removal of N-ethylpurines was observed in the dihydrofolate reductase locus in cells that lacked nucleotide excision repair, but both strands were repaired at the same rate, indicating that transcription-coupled clearance of these lesions requires the presence of active nucleotide excision repair. PMID:9001209

  10. Design and Synthesis of Aryl Ether Inhibitors of the Bacillus Anthracis Enoyl–ACP Reductase

    PubMed Central

    Tipparaju, Suresh K.; Mulhearn, Debbie C.; Klein, Gary M.; Chen, Yufeng; Tapadar, Subhasish; Bishop, Molly H.; Yang, Shuo; Chen, Juan; Ghassemi, Mahmood; Santarsiero, Bernard D.; Cook, James L.; Johlfs, Mary; Mesecar, Andrew D.; Johnson, Michael E.; Kozikowski, Alan P.

    2009-01-01

    The problem of increasing bacterial resistance to the current generation of antibiotics is well documented. This includes such pathogens as methicillin–resistant Staphylococcus aureus and the potential for developing drug–resistant pathogens for use as bioweapons, such as Bacillus anthracis. The biphenyl ether, antibacterial triclosan exhibits broad–spectrum activity and provides a potential scaffold for the development of new, broad–spectrum antibiotics targeting the fatty acid biosynthetic pathway, via inhibition of enoyl–acyl carrier protein reductase (ENR). We have utilized a structure–based approach to develop novel aryl ether analogs of triclosan that target ENR, the product of the FabI gene, from Bacillus anthracis (BaENR). Structure–based design methods were used for the expansion of the compound series including X-ray crystal structure determination, molecular docking, and QSAR methods. Structural modifications were made to both phenyl rings of the 2-phenoxyphenyl core. A number of compounds were derived that exhibited improved potency against BaENR and increased efficacy against both the Sterne strain of B. anthracis and the methicillin–resistant strain of S. aureus. X-ray crystal structures of BaENR in complex with triclosan and two other compounds help explain the improved efficacy of the new compounds and suggest future rounds of optimisation that might be used to improve their potency. PMID:18663709

  11. Design and synthesis of aryl ether inhibitors of the Bacillus anthracis enoyl-ACP reductase.

    PubMed

    Tipparaju, Suresh K; Mulhearn, Debbie C; Klein, Gary M; Chen, Yufeng; Tapadar, Subhasish; Bishop, Molly H; Yang, Shuo; Chen, Juan; Ghassemi, Mahmood; Santarsiero, Bernard D; Cook, James L; Johlfs, Mary; Mesecar, Andrew D; Johnson, Michael E; Kozikowski, Alan P

    2008-08-01

    The problem of increasing bacterial resistance to the current generation of antibiotics is well documented. Known resistant pathogens such as methicillin-resistant Staphylococcus aureus are becoming more prevalent, while the potential exists for developing drug-resistant pathogens for use as bioweapons, such as Bacillus anthracis. The biphenyl ether antibacterial agent, triclosan, exhibits broad-spectrum activity by targeting the fatty acid biosynthetic pathway through inhibition of enoyl-acyl carrier protein reductase (ENR) and provides a potential scaffold for the development of new, broad-spectrum antibiotics. We used a structure-based approach to develop novel aryl ether analogues of triclosan that target ENR, the product of the fabI gene, from B. anthracis (BaENR). Structure-based design methods were used for the expansion of the compound series including X-ray crystal structure determination, molecular docking, and QSAR methods. Structural modifications were made to both phenyl rings of the 2-phenoxyphenyl core. A number of compounds exhibited improved potency against BaENR and increased efficacy against both the Sterne strain of B. anthracis and the methicillin-resistant strain of S. aureus. X-ray crystal structures of BaENR in complex with triclosan and two other compounds help explain the improved efficacy of the new compounds and suggest future rounds of optimization that might be used to improve their potency.

  12. Molecular cloning of Chinese hamster dihydrofolate reductase-specific cDNA and the identification of multiple dihydrofolate reductase mRNAs in antifolate-resistant Chinese hamster lung fibroblasts.

    PubMed Central

    Lewis, J A; Kurtz, D T; Melera, P W

    1981-01-01

    ds cDNA from antifolate-resistant Chinese hamster lung fibroblast subline DC-3F/MQ19 was ligated to Eco RI and Sal I oligonucleotide linkers and cloned into Eco RI and Sal I digested pBR322. Transformed colonies containing dihydrofolate reductase (DHFR)-specific recombinant plasmid were identified by Grunstein Hogness assay using a Chinese hamster DHFR-specific cDNA probe. A recombinant plasmid, pDHFR6, containing a 650 bp HFR insert was isolated and analyzed. This plasmid was used as a molecular probe in a Northern blot analysis of both cytoplasmic and polysomal DHFR, poly A+ mRNAs of the DC-3F/MQ19 subline, which over-produces a 20,000d DHFR 150-fold, and DC-3F/A3 subline, which over-produces a 21,000d DHFR 170-fold. This analysis revealed the presence of three DHFR mRNA species of 1350, 2200, and 3300 nucleotides in both independently-derived cell lines. The relative abundance of each species however varied strikingly between the two cell lines. Images PMID:6262725

  13. Design and synthesis of 2-pyridones as novel inhibitors of the Bacillus anthracis enoyl-ACP reductase.

    PubMed

    Tipparaju, Suresh K; Joyasawal, Sipak; Forrester, Sara; Mulhearn, Debbie C; Pegan, Scott; Johnson, Michael E; Mesecar, Andrew D; Kozikowski, Alan P

    2008-06-15

    Enoyl-ACP reductase (ENR), the product of the FabI gene, from Bacillus anthracis (BaENR) is responsible for catalyzing the final step of bacterial fatty acid biosynthesis. A number of novel 2-pyridone derivatives were synthesized and shown to be potent inhibitors of BaENR.

  14. Assessment of Folic Acid Supplementation in Pregnant Women by Estimation of Serum Levels of Tetrahydrofolic Acid, Dihydrofolate Reductase, and Homocysteine.

    PubMed

    Naithani, Manisha; Saxena, Vartika; Mirza, Anissa Atif; Kumari, Ranjeeta; Sharma, Kapil; Bharadwaj, Jyoti

    2016-01-01

    Background. Status of folic acid use in pregnant women of the hilly regions in North India was little known. This study was carried out to assess the folic acid use and estimate folate metabolites in pregnant women of this region. Materials and Methods. This cross-sectional study is comprised of 76 pregnant women, whose folic acid supplementation was assessed by a questionnaire and serum levels of homocysteine, tetrahydrofolic acid (THFA), and dihydrofolate reductase (DHFR) were estimated using Enzyme Linked Immunoassays. Results. The study data revealed awareness of folic acid use during pregnancy was present in 46.1% and 23.7% were taking folic acid supplements. The study depicted that there was no statistically significant difference between serum levels of THFA and DHFR in pregnant women with and without folic acid supplements (p = 0.790). Hyperhomocysteinemia was present in 15.78% of the participants. Conclusion. Less awareness about folic acid supplementation and low use of folic acid by pregnant women were observed in this region. Sufficient dietary ingestion may suffice for the escalated requirements in pregnancy, but since this cannot be ensured, hence folic acid supplementation should be made as an integral part of education and reproductive health programs for its better metabolic use, growth, and development of fetus.

  15. Assessment of Folic Acid Supplementation in Pregnant Women by Estimation of Serum Levels of Tetrahydrofolic Acid, Dihydrofolate Reductase, and Homocysteine

    PubMed Central

    Saxena, Vartika; Mirza, Anissa Atif; Kumari, Ranjeeta; Sharma, Kapil; Bharadwaj, Jyoti

    2016-01-01

    Background. Status of folic acid use in pregnant women of the hilly regions in North India was little known. This study was carried out to assess the folic acid use and estimate folate metabolites in pregnant women of this region. Materials and Methods. This cross-sectional study is comprised of 76 pregnant women, whose folic acid supplementation was assessed by a questionnaire and serum levels of homocysteine, tetrahydrofolic acid (THFA), and dihydrofolate reductase (DHFR) were estimated using Enzyme Linked Immunoassays. Results. The study data revealed awareness of folic acid use during pregnancy was present in 46.1% and 23.7% were taking folic acid supplements. The study depicted that there was no statistically significant difference between serum levels of THFA and DHFR in pregnant women with and without folic acid supplements (p = 0.790). Hyperhomocysteinemia was present in 15.78% of the participants. Conclusion. Less awareness about folic acid supplementation and low use of folic acid by pregnant women were observed in this region. Sufficient dietary ingestion may suffice for the escalated requirements in pregnancy, but since this cannot be ensured, hence folic acid supplementation should be made as an integral part of education and reproductive health programs for its better metabolic use, growth, and development of fetus. PMID:27064332

  16. Sulfa and trimethoprim-like drugs - antimetabolites acting as carbonic anhydrase, dihydropteroate synthase and dihydrofolate reductase inhibitors.

    PubMed

    Capasso, Clemente; Supuran, Claudiu T

    2014-06-01

    Recent advances in microbial genomics, synthetic organic chemistry and X-ray crystallography provided opportunities to identify novel antibacterial targets for the development of new classes of antibiotics and to design more potent antimicrobial compounds derived from existing antibiotics in clinical use for decades. The antimetabolites, sulfa drugs and trimethoprim (TMP)-like agents, are inhibitors of three families of enzymes. One family belongs to the carbonic anhydrases, which catalyze a simple but physiologically relevant reaction in all life kingdoms, carbon dioxide hydration to bicarbonate and protons. The other two enzyme families are involved in the synthesis of tetrahydrofolate (THF), i.e. dihydropteroate synthase (DHPS) and dihydrofolate reductase. The antibacterial agents belonging to the THF and DHPS inhibitors were developed decades ago and present significant bacterial resistance problems. However, the molecular mechanisms of drug resistance both to sulfa drugs and TMP-like inhibitors were understood in detail only recently, when several X-ray crystal structures of such enzymes in complex with their inhibitors were reported. Here, we revue the state of the art in the field of antibacterials based on inhibitors of these three enzyme families.

  17. Human dihydrofolate reductase and thymidylate synthase form a complex in vitro and co-localize in normal and cancer cells.

    PubMed

    Antosiewicz, Anna; Jarmuła, Adam; Przybylska, Dorota; Mosieniak, Grażyna; Szczepanowska, Joanna; Kowalkowska, Anna; Rode, Wojciech; Cieśla, Joanna

    2016-08-05

    Enzymes involved in thymidylate biosynthesis, thymidylate synthase (TS), and dihydrofolate reductase (DHFR) are well-known targets in cancer chemotherapy. In this study, we demonstrated for the first time, that human TS and DHFR form a strong complex in vitro and co-localize in human normal and colon cancer cell cytoplasm and nucleus. Treatment of cancer cells with methotrexate or 5-fluorouracil did not affect the distribution of either enzyme within the cells. However, 5-FU, but not MTX, lowered the presence of DHFR-TS complex in the nucleus by 2.5-fold. The results may suggest the sequestering of TS by FdUMP in the cytoplasm and thereby affecting the translocation of DHFR-TS complex to the nucleus. Providing a strong likelihood of DHFR-TS complex formation in vivo, the latter complex is a potential new drug target in cancer therapy. In this paper, known 3D structures of human TS and human DHFR, and some protozoan bifunctional DHFR-TS structures as templates, are used to build an in silico model of human DHFR-TS complex structure, consisting of one TS dimer and two DHFR monomers. This complex structure may serve as an initial 3D drug target model for prospective inhibitors targeting interfaces between the DHFR and TS enzymes.

  18. Comparative study on dihydrofolate reductases from Shewanella species living in deep-sea and ambient atmospheric-pressure environments.

    PubMed

    Murakami, Chiho; Ohmae, Eiji; Tate, Shin-ichi; Gekko, Kunihiko; Nakasone, Kaoru; Kato, Chiaki

    2011-03-01

    To examine whether dihydrofolate reductase (DHFR) from deep-sea bacteria has undergone molecular evolution to adapt to high-pressure environments, we cloned eight DHFRs from Shewanella species living in deep-sea and ambient atmospheric-pressure environments, and subsequently purified six proteins to compare their structures, stabilities, and functions. The DHFRs showed 74-90% identity in primary structure to DHFR from S. violacea, but only 55% identity to DHFR from Escherichia coli (ecDHFR). Far-ultraviolet circular dichroism and fluorescence spectra suggested that the secondary and tertiary structures of these DHFRs were similar. In addition, no significant differences were found in structural stability as monitored by urea-induced unfolding and the kinetic parameters, K(m) and k(cat); although the DHFRs from Shewanella species were less stable and more active (2- to 4-fold increases in k(cat)/K(m)) than ecDHFR. Interestingly, the pressure effects on enzyme activity revealed that DHFRs from ambient-atmospheric species are not necessarily incompatible with high pressure, and DHFRs from deep-sea species are not necessarily tolerant of high pressure. These results suggest that the DHFR molecule itself has not evolved to adapt to high-pressure environments, but rather, those Shewanella species with enzymes capable of retaining functional activity under high pressure migrated into the deep-sea.

  19. Towards the Understanding of Resistance Mechanisms in Clinically Isolated Trimethoprim-resistant, Methicillin-resistant Staphylococcus aureus Dihydrofolate Reductase

    SciTech Connect

    Frey, K.; Lombardo, M; Wright, D; Anderson, A

    2010-01-01

    Resistance to therapeutics such as trimethoprim-sulfamethoxazole has become an increasing problem in strains of methicillin-resistant Staphylococcus aureus (MRSA). Clinically isolated trimethoprim-resistant strains reveal a double mutation, H30N/F98Y, in dihydrofolate reductase (DHFR). In order to develop novel and effective therapeutics against these resistant strains, we evaluated a series of propargyl-linked antifolate lead compounds for inhibition of the mutant enzyme. For the propargyl-linked antifolates, the F98Y mutation generates minimal (between 1.2- and 6-fold) losses of affinity and the H30N mutation generates greater losses (between 2.4- and 48-fold). Conversely, trimethoprim affinity is largely diminished by the F98Y mutation (36-fold) and is not affected by the H30N mutation. In order to elucidate a mechanism of resistance, we determined a crystal structure of a complex of this double mutant with a lead propargyl-linked antifolate. This structure suggests a resistance mechanism consistent both for the propargyl-linked class of antifolates and for trimethoprim that is based on the loss of a conserved water-mediated hydrogen bond.

  20. Computation of affinity and selectivity: Binding of 2,4-diaminopteridine and 2,4-diaminoquinazoline inhibitors to dihydrofolate reductases

    NASA Astrophysics Data System (ADS)

    Marelius, John; Graffner-Nordberg, Malin; Hansson, Tomas; Hallberg, Anders; Åqvist, Johan

    1998-03-01

    Binding energy calculations for complexes of mutant and wild-type human dihydrofolate reductases with 2,4-diaminopteridine and 2,4-diaminoquinazoline inhibitors are reported. Quantitative insight into binding energetics of these molecules is obtained from calculations based on force field energy evaluation and thermal sampling by molecular dynamics simulations. The calculated affinity of methotrexate for wild-type and mutant enzymes is reasonably well reproduced. Truncation of the methotrexate glutamate tail results in a loss of affinity by several orders of magnitude. No major difference in binding strength is predicted between the pteridines and the quinazolines, while the N-methyl group present in methotrexate appears to confer significantly stronger binding. The recent improvement, which is used here, of our linear interaction energy method for binding affinity prediction, as well as problems with treating charged and flexible ligands are discussed. This approach should be suitable in a drug discovery context for prediction of binding energies of new inhibitors prior to their synthesis, when some information about the binding mode is available.

  1. Simulations of Remote Mutants of Dihydrofolate Reductase Reveal the Nature of a Network of Residues Coupled to Hydride Transfer

    PubMed Central

    Roston, Daniel; Kohen, Amnon; Doron, Dvir; Major, Dan T.

    2014-01-01

    Recent experimental and theoretical studies have proposed that enzymes involve networks of coupled residues throughout the protein that participate in motions accompanying chemical barrier crossing. Here we have examined portions of a proposed network in dihydrofolate reductase (DHFR) using quantum mechanics/molecular mechanics simulations. The simulations employ a hybrid quantum mechanics-molecular mechanics approach with a recently developed semi-empirical AM1-SRP Hamiltonian that provides accurate results for this reaction. The simulations reproduce experimentally determined catalytic rates for the wild type and distant mutants of E. coli DHFR, underscoring the accuracy of the simulation protocol. Additionally the simulations provide detailed insight into how residues remote from the active site affect the catalyzed chemistry, through changes in the thermally averaged properties along the reaction coordinate. The mutations do not greatly affect the structure of the transition state near the bond activation, but we observe differences somewhat removed from the point of C-H cleavage that affect the rate. The mutations have global effects on the thermally averaged structure that propagate throughout the enzyme and the current simulations highlight several interactions that appear to be particularly important. PMID:24798860

  2. Survival and risk of relapse of acute lymphoblastic leukemia in a Mexican population is affected by dihydrofolate reductase gene polymorphisms

    PubMed Central

    GÓMEZ-GÓMEZ, YAZMÍN; ORGANISTA-NAVA, JORGE; SAAVEDRA-HERRERA, MÓNICA VIRGINIA; RIVERA-RAMÍREZ, ANA BERTHA; TERÁN-PORCAYO, MARCO ANTONIO; DEL CARMEN ALARCÓN-ROMERO, LUZ; ILLADES-AGUIAR, BERENICE; LEYVA-VÁZQUEZ, MARCO ANTONIO

    2012-01-01

    Dihydrofolate reductase (DHFR) is the major target of methotrexate, a key component in childhood acute lymphoblastic leukemia (ALL) treatment. Polymorphisms in the gene coding for DHFR have been associated with adverse event treatment. This study evaluated the effect of the -A317G and C829T polymorphisms in the DHFR gene on survival and risk of relapse of ALL. Seventy patients with ALL and 100 healthy individuals were genotyped by the polymerase chain reaction-restriction fragment length polymorphism method. An association between the polymorphisms and the risk of relapse was found (p<0.05); patients with the -317G/G genotype were found to have an 8.55 (95% CI 1.84–39.70) higher chance of relapse and carriers of the 829T/T genotype had a 14.0 (95% CI 1.13–172.63) higher chance of relapse. Other variables, such as age and leukocyte count, were associated (p<0.05) with the risk of relapse of the disease. Individuals with the G/G and T/T genotype of the -A317G and C829T polymorphisms had poorer survival compared to other genotype groups (log-rank test; p<0.05). Although preliminary, these data seem to suggest a role for the DHFR polymorphisms in the risk of relapse of ALL and the mortality risk in these patients. PMID:22969948

  3. A nanotherapy strategy significantly enhances anticryptosporidial activity of an inhibitor of bifunctional thymidylate synthase-dihydrofolate reductase from Cryptosporidium.

    PubMed

    Mukerjee, Anindita; Iyidogan, Pinar; Castellanos-Gonzalez, Alejandro; Cisneros, José A; Czyzyk, Daniel; Ranjan, Amalendu Prakash; Jorgensen, William L; White, A Clinton; Vishwanatha, Jamboor K; Anderson, Karen S

    2015-01-01

    Cryptosporidiosis, a gastrointestinal disease caused by protozoans of the genus Cryptosporidium, is a common cause of diarrheal diseases and often fatal in immunocompromised individuals. Bifunctional thymidylate synthase-dihydrofolate reductase (TS-DHFR) from Cryptosporidium hominis (C. hominis) has been a molecular target for inhibitor design. C. hominis TS-DHFR inhibitors with nM potency at a biochemical level have been developed however drug delivery to achieve comparable antiparasitic activity in Cryptosporidium infected cell culture has been a major hurdle for designing effective therapies. Previous mechanistic and structural studies have identified compound 906 as a nM C. hominis TS-DHFR inhibitor in vitro, having μM antiparasitic activity in cell culture. In this work, proof of concept studies are presented using a nanotherapy approach to improve drug delivery and the antiparasitic activity of 906 in cell culture. We utilized PLGA nanoparticles that were loaded with 906 (NP-906) and conjugated with antibodies to the Cryptosporidium specific protein, CP2, on the nanoparticle surface in order to specifically target the parasite. Our results indicate that CP2 labeled NP-906 (CP2-NP-906) reduces the level of parasites by 200-fold in cell culture, while NP-906 resulted in 4.4-fold decrease. Moreover, the anticryptosporidial potency of 906 improved 15 to 78-fold confirming the utility of the antibody conjugated nanoparticles as an effective drug delivery strategy.

  4. 2,4-Diaminothieno[2,3-d]pyrimidine lipophilic antifolates as inhibitors of Pneumocystis carinii and Toxoplasma gondii dihydrofolate reductase.

    PubMed

    Rosowsky, A; Papoulis, A T; Queener, S F

    1997-10-24

    Ten previously unreported 2,4-diaminothieno[2,3-d]pyrimidine lipophilic dihydrofolate reductase inhibitors were synthesized as potential inhibitors of Pneumocystis carinii and Toxoplasma gondii dihydrofolate reductase. Pivaloylation of 2,4-diamino-5-methylthieno[2,3-d]pyrimidine followed by dibromination with N-bromosuccinimide in the presence of benzoyl peroxide gave 2,4-bis(pivaloylamino)-6-bromo-5-(bromomethyl)thieno[2,3-d]pyrimid ine, which after condensation with substituted anilines or N-methylanilines and deprotection with base yielded 2,4-diamino-6-bromo-5-[(substituted anilino)methyl]thieno[2,3-d]pyrimidines. Removal of the 6-bromo substituent was accomplished with sodium borohydride and palladium chloride. The reaction yields were generally good to excellent. The products were tested as inhibitors of dihydrofolate reductase (DHFR) from P. carinii, T. gondii, and rat liver. Although the IC50 could not be reached for the 6-unsubstituted compounds because of their extremely poor solubility, three of the five 6-bromo derivatives were soluble enough to allow the IC50 to be determined against all three enzymes. 2,4-Diamino-5-[3,5-dichloro-4-(1-pyrrolo)anilino]methyl]- 6-bromothieno[2,3-d]pyrimidine was the most active of the 6-bromo derivatives, with an IC50 of 7.5 microM against P. carinii DHFR, but showed no selectivity for either P. carinii or T. gondii DHFR relative to the enzyme from rat liver.

  5. The structure and competitive substrate inhibition of dihydrofolate reductase from Enterococcus faecalis reveal restrictions to cofactor docking.

    PubMed

    Bourne, Christina R; Wakeham, Nancy; Webb, Nicole; Nammalwar, Baskar; Bunce, Richard A; Berlin, K Darrell; Barrow, William W

    2014-02-25

    We are addressing bacterial resistance to antibiotics by repurposing a well-established classic antimicrobial target, the dihydrofolate reductase (DHFR) enzyme. In this work, we have focused on Enterococcus faecalis, a nosocomial pathogen that frequently harbors antibiotic resistance determinants leading to complicated and difficult-to-treat infections. An inhibitor series with a hydrophobic dihydrophthalazine heterocycle was designed from the anti-folate trimethoprim. We have examined the potency of this inhibitor series based on inhibition of DHFR enzyme activity and bacterial growth, including in the presence of the exogenous product analogue folinic acid. The resulting preferences were rationalized using a cocrystal structure of the DHFR from this organism with a propyl-bearing series member (RAB-propyl). In a companion apo structure, we identify four buried waters that act as placeholders for a conserved hydrogen-bonding network to the substrate and indicate an important role in protein stability during catalytic cycling. In these structures, the nicotinamide of the nicotinamide adenine dinucleotide phosphate cofactor is visualized outside of its binding pocket, which is exacerbated by RAB-propyl binding. Finally, homology models of the TMP(R) sequences dfrK and dfrF were constructed. While the dfrK-encoded protein shows clear sequence changes that would be detrimental to inhibitor binding, the dfrF-encoded protein model suggests the protein would be relatively unstable. These data suggest a utility for anti-DHFR compounds for treating infections arising from E. faecalis. They also highlight a role for water in stabilizing the DHFR substrate pocket and for competitive substrate inhibitors that may gain advantages in potency by the perturbation of cofactor dynamics.

  6. Cloning and characterization of a novel, plasmid-encoded trimethoprim-resistant dihydrofolate reductase from Staphylococcus haemolyticus MUR313.

    PubMed

    Dale, G E; Langen, H; Page, M G; Then, R L; Stüber, D

    1995-09-01

    In recent years resistance to the antibacterial agent trimethoprim (Tmp) has become more widespread, and several trimethoprim-resistant (Tmpr) dihydrofolate reductases (DHFRs) have been described from gram-negative bacteria. In staphylococci, only one Tmpr DHFR has been described, the type S1 DHFR, which is encoded by the dfrA gene found on transposon Tn4003. In order to investigate the coincidence of high-level Tmp resistance and the presence of dfrA, we analyzed the DNAs from various Tmpr staphylococci for the presence of dfrA sequences by PCR with primers specific for the thyE-dfrA genes from Tn4003. We found that 30 or 33 isolates highly resistant to Tmp (MICs, > or = 512 micrograms/ml) contained dfrA sequences, whereas among the Tmpr (MICs, < or = 256 micrograms/ml) and Tmps isolates only the Staphylococcus epidermidis isolates (both Tmpr and Tmps) seemed to contain the dfrA gene. Furthermore, we have cloned and characterized a novel, plasmid-encoded Tmpr DHFR from Staphylococcus haemolyticus MUR313. The dfrD gene of plasmid pABU17 is preceded by two putative Shine-Dalgarno sequences potentially allowing for the start of translation at two triplets separated by nine nucleotides. The predicted protein of 166 amino acids, designated S2DHFR, encoded by the longer open reading frame was overproduced in Escherichia coli, purified, and characterized. The molecular size of the recombinant S2DHFR was determined by ion spray mass spectrometry to be 19,821.2 +/- 2 Da, which is in agreement with the theoretical value of 19,822 Da. In addition, the recombinant S2DHFR was shown to exhibit DHFR activity and to be highly resistant to Tmp.

  7. Free energy force field (FEFF) 3D-QSAR analysis of a set of Plasmodium falciparum dihydrofolate reductase inhibitors

    NASA Astrophysics Data System (ADS)

    Santos-Filho, Osvaldo A.; Mishra, Rama K.; Hopfinger, A. J.

    2001-09-01

    Free energy force field (FEFF) 3D-QSAR analysis was used to construct ligand-receptor binding models for a set of 18 structurally diverse antifolates including pyrimethamine, cycloguanil, methotrexate, aminopterin and trimethoprim, and 13 pyrrolo[2,3-d]pyrimidines. The molecular target (`receptor') used was a 3D-homology model of a specific mutant type of Plasmodium falciparum (Pf) dihydrofolate reductase (DHFR). The dependent variable of the 3D-QSAR models is the IC50 inhibition constant for the specific mutant type of PfDHFR. The independent variables of the 3D-QSAR models (the descriptors) are scaled energy terms of a modified first-generation AMBER force field combined with a hydration shell aqueous solvation model and a collection of 2D-QSAR descriptors often used in QSAR studies. Multiple temperature molecular dynamics simulation (MDS) and the genetic function approximation (GFA) were employed using partial least square (PLS) and multidimensional linear regressions as the fitting functions to develop FEFF 3D-QSAR models for the binding process. The significant FEFF energy terms in the best 3D-QSAR models include energy contributions of the direct ligand-receptor interaction. Some changes in conformational energy terms of the ligand due to binding to the enzyme are also found to be important descriptors. The FEFF 3D-QSAR models indicate some structural features perhaps relevant to the mechanism of resistance of the PfDHFR to current antimalarials. The FEFF 3D-QSAR models are also compared to receptor-independent (RI) 4D-QSAR models developed in an earlier study and subsequently refined using recently developed generalized alignment rules.

  8. Mapping and characterization of mutations induced by benzo[a]pyrene diol epoxide at dihydrofolate reductase locus in CHO cells.

    PubMed

    Carothers, A M; Urlaub, G; Grunberger, D; Chasin, L A

    1988-03-01

    Chinese hamster ovary cells were mutagenized with benzo[a]pyrene diol epoxide (BPDE), an aromatic hydrocarbon carcinogen, and mutants at the dihydrofolate reductase (dhfr) locus were isolated. Of 15 mutants analyzed by Southern blotting, one contained a large deletion that spanned all six exons of the 25-kb dhfr gene; the remaining mutants exhibited no detectable changes. Three of these putative point mutations were localized by the loss of a restriction site: a SacI site in exon III, an MspI site in exon III, and a KpnI site in exon VI. The affected regions in two of these mutants were cloned and sequenced. The SacI- mutant was caused by a G:C----T:A transversion resulting in an amber termination codon. In the MspI- mutant, the deletion of a single C:G resulted in a frameshift and a downstream ochre termination codon. On the basis of overlapping restriction site sequences, the KpnI- mutant was deduced to be a splicing mutant involving the most 3' G in intron V. The location of these and the remaining 11 putative point mutations was sought using RNA heteroduplex mapping. Mismatched bases between riboprobes complementary to wild-type dhfr mRNA and mutant mRNA molecules were detected in 10 of the 14 mutants analyzed. These mutations mapped to four of the six exons or exon splice sites. Surprisingly, over half of these mutants exhibited greatly reduced (approximately 10-fold) steady-state levels of dhfr mRNA.

  9. Organization and genesis of dihydrofolate reductase amplicons in the genome of a methotrexate-resistant Chinese hamster ovary cell line.

    PubMed

    Ma, C; Looney, J E; Leu, T H; Hamlin, J L

    1988-06-01

    We have recently isolated overlapping recombinant cosmids that represent the equivalent of two complete dihydrofolate reductase (dhfr) amplicon types from the methotrexate-resistant Chinese hamster ovary (CHO) cell line CHOC 400. In the work described in this report, we used pulse-field gradient gel electrophoresis to analyze large SfiI restriction fragments arising from the amplified dhfr domains. The junction between the 260-kilobase type I amplicons (which are arranged in head-to-tail configurations in the genome) has been localized, allowing the construction of a linear map of the parental dhfr locus. We also show that the 220-kilobase type II amplicons are arranged as inverted repeat structures in the CHOC 400 genome and arose from the type I sequence relatively early in the amplification process. Our data indicate that there are a number of minor amplicon types in the CHOC 400 cell line that were not detected in previous studies; however, the type II amplicons represent ca. 75% of all the amplicons in the CHOC 400 genome. Both the type I and type II amplicons are shown to be composed entirely of sequences that were present in the parental dhfr locus. Studies of less resistant cell lines show that initial amplicons can be larger than those observed in CHOC 400. Once established, a given amplicon type appears to be relatively stable throughout subsequent amplification steps. We also present a modification of an in-gel renaturation method that gives a relatively complete picture of the size and variability of amplicons in the genome.

  10. Molecular epidemiology of malaria in Cameroon. XXII. Geographic mapping and distribution of Plasmodium falciparum dihydrofolate reductase (dhfr) mutant alleles.

    PubMed

    Tahar, Rachida; Basco, Leonardo K

    2006-09-01

    Sulfadoxine-pyrimethamine (SP) is still a useful drug to combat chloroquine-resistant Plasmodium falciparum malaria in Cameroon. Because of several disadvantages of the in vivo test and in vitro drug sensitivity assays, molecular assays are an alternative laboratory tool to monitor the evolution of antifolate resistance, especially over the entire country that is characterized by several epidemiologic strata and malaria transmission patterns. In this study, 1,430 blood samples from either symptomatic children or asymptomatic carriers were collected from 14 sites throughout the country between 1999 and 2003 for the analysis of dihydrofolate reductase (dhfr) sequence. Of 1,368 samples (95.7%) that were successfully amplified, 1,180 were analyzed by direct sequencing of the polymerase chain reaction product, and 188 were analyzed by restriction enzymes. The prevalences of the wild-type, single Asn-108 mutation, double Arg-59/Asn-108 mutations, double Ile-51/Asn-108 mutations, triple Ile-51/Arg-59/Asn-108 mutations, and mixed alleles were 20.8%, 2.8%, 5.7%, 0.8%, 62.2%, and 7.6%, respectively. The proportions of triple dhfr mutations were > 60% at all study sites, with the exception of the eastern province (42% triple mutants in Bertoua in 1999) and the northern provinces (11-35% triple mutants in Ngaoundere, Garoua, and Maroua). In these two provinces, the proportion of mutant parasites increased significantly (P < 0.05) over the period of 2-4 years. Furthermore, there was a higher proportion (P < 0.05) of wild-type parasites in the northern provinces, compared with the rest of the country. The geographic mapping of molecular markers offers a novel tool for monitoring the epidemiology of drug-resistant malaria.

  11. The Structure and Competitive Substrate Inhibition of Dihydrofolate Reductase from Enterococcus faecalis Reveal Restrictions to Cofactor Docking

    PubMed Central

    2015-01-01

    We are addressing bacterial resistance to antibiotics by repurposing a well-established classic antimicrobial target, the dihydrofolate reductase (DHFR) enzyme. In this work, we have focused on Enterococcus faecalis, a nosocomial pathogen that frequently harbors antibiotic resistance determinants leading to complicated and difficult-to-treat infections. An inhibitor series with a hydrophobic dihydrophthalazine heterocycle was designed from the anti-folate trimethoprim. We have examined the potency of this inhibitor series based on inhibition of DHFR enzyme activity and bacterial growth, including in the presence of the exogenous product analogue folinic acid. The resulting preferences were rationalized using a cocrystal structure of the DHFR from this organism with a propyl-bearing series member (RAB-propyl). In a companion apo structure, we identify four buried waters that act as placeholders for a conserved hydrogen-bonding network to the substrate and indicate an important role in protein stability during catalytic cycling. In these structures, the nicotinamide of the nicotinamide adenine dinucleotide phosphate cofactor is visualized outside of its binding pocket, which is exacerbated by RAB-propyl binding. Finally, homology models of the TMPR sequences dfrK and dfrF were constructed. While the dfrK-encoded protein shows clear sequence changes that would be detrimental to inhibitor binding, the dfrF-encoded protein model suggests the protein would be relatively unstable. These data suggest a utility for anti-DHFR compounds for treating infections arising from E. faecalis. They also highlight a role for water in stabilizing the DHFR substrate pocket and for competitive substrate inhibitors that may gain advantages in potency by the perturbation of cofactor dynamics. PMID:24495113

  12. Construction of a modular dihydrofolate reductase cDNA gene: Analysis of signals utilized for efficient expression

    SciTech Connect

    Kaufman, J.; Sharp, P.A.

    1982-11-01

    Dihydrofolate reductase (DHFR) modular genes have been constructed with segments containing the adenovirus major late promoter, a 3' splice site from a variable region immunoglobulin gene, a DHFR cDNA, and portions of the simian virus 40 (SV40) genome, DNA-mediated transfer of these genes transformed Chinese hamster ovary DHFR/sup -/ cells to the DHFR/sup +/ phenotype. Transformants contained one to several copies of the transfected DNA integrated into the host genome. Clones subjected to growth in increasing concentrations of methotrexate eventually gave rise to lines containing several hundred copies of the transforming DNA. Analysis of the DHFr mRNA produced in amplified lines indicated the following: (i) All clones utilize the adenovirus major late promoter for transcription initiation. (ii) A hybrid intron formed by the 5' splice site of the adenovirus major late leader and a 3' splice site from a variable-region immunoglobulin gene is properly excised. (iii) The mRNA is not efficiently polyadenylated at sequences in the 3' end of the DHFR cDNA but rather uses polyadenylation signals downstream from the DHFR cDNA. Three independent clones produce a DHFR mRNA containing SV40 or pBR322 and SV40 sequences, and the RNA is polyadenylated at the SV40 late polyadenylation site. Another clone has recombined into cellular DNA and apparently uses a cellular sequence for polyadenylation. Introduction of a segment containing the SV40 early polyadenylation signal into the 3' end of the DHFR cDNA generated a recombinant capable of transforming cells to the DHFR/sup +/ phenotype with at least a 10-fold increase in efficiency, demonstrating the necessity for an efficient polyadenylation signal. Attachment of a DNA segment containing the transcription enhancer 72-base pair repeat) of SV40 further increased the biological activity of the modular DHFR gene 50- to 100-fold.

  13. Identification and characterization of a gene that is coamplified with dihydrofolate reductase in a methotrexate-resistant CHO cell line

    SciTech Connect

    Foreman, P.K.; Hamlin, J.L. . School of Medicine)

    1989-03-01

    As part of an effort to characterize the spatial and functional relationships among genetic elements within the amplified dihydrofolate reductase (DHFR) domain in Chinese hamster cells, the authors have used a variation of the differential hybridization approach to identify cDNA clones whose genes are coamplified with DHFR in the methotrexate-resistant cell line, CHOC 400. Their initial screen was successful in isolating both DHFR and non-DHFR cDNAs. One of the non-DHFR cDNA clones, 2BE2121, hybridizes on Northern (RNA) blots to abundant 1,200- and 1,500-nucleotide (nt) transcripts which differ in the lengths of their 3' untranslated regions. The clone 2BE2121 contains a 789-nt open reading frame but does not appear to be related to any members of the protein or nucleic acid sequence databases. A second larger non-DHFR cDNA, II-19-211, was isolated that is transcribed from the same gene as 2BE2121 but contains only a small carboxyl-terminal portion of the open reading frame. II-19-211 may, therefore, represent either a splicing intermediate or an mRNA transcribed from a cryptic intragenic promoter. Hybridization to cosmids from DHFr domain shows that 2BE2121 is encoded by a gene --34 kilobases (kb) long. The 5'-most genomic fragment is less than 4 kb from an interamplicon injection. The 3' end of the 2BE2121 gene lies --75 kb downstream from the DHFR gene and --25 kb downstream from the proximal replication initiation site, and the transcriptional polarity is opposite to that of the leading strand of replication. Thus, both the DHFR and 2BE2121 genes are exceptions to the theory that transcription proceeds in the same direction as the leading strand of the replication fork.

  14. Identification and characterization of a gene that is coamplified with dihydrofolate reductase in a methotrexate-resistant CHO cell line.

    PubMed Central

    Foreman, P K; Hamlin, J L

    1989-01-01

    As part of an effort to characterize the spatial and functional relationships among genetic elements within the amplified dihydrofolate reductase (DHFR) domain in Chinese hamster cells, we have used a variation of the differential hybridization approach to identify cDNA clones whose genes are coamplified with DHFR in the methotrexate-resistant cell line, CHOC 400. Our initial screen was successful in isolating both DHFR and non-DHFR cDNAs. One of the non-DHFR cDNA clones, 2BE2121, hybridizes on Northern (RNA) blots to abundant 1,200- and 1,500-nucleotide (nt) transcripts which differ in the lengths of their 3' untranslated regions. The clone 2BE2121 contains a 789-nt open reading frame but does not appear to be related to any members of the protein or nucleic acid sequence databases. A second larger non-DHFR cDNA, II-19-211, was isolated that is transcribed from the same gene as 2BE2121 but contains only a small carboxyl-terminal portion of the open reading frame. II-19-211 may, therefore, represent either a splicing intermediate or an mRNA transcribed from a cryptic intragenic promoter. Hybridization to cosmids from the DHFR domain shows that 2BE2121 is encoded by a gene approximately 34 kilobases (kb) long. The 5'-most genomic fragment is less than 4 kb from an interamplicon junction. The 3' end of the 2BE2121 gene lies approximately 75 kb downstream from the DHFR gene and approximately 25 kb downstream from the proximal replication initiation site, and the transcriptional polarity is opposite to that of the leading strand of replication. Thus, both the DHFR and 2BE2121 genes are exceptions to the theory that transcription proceeds in the same direction as the leading strand of the replication fork. Images PMID:2725490

  15. Incorporation of β-amino acids into dihydrofolate reductase by ribosomes having modifications in the peptidyltransferase center.

    PubMed

    Maini, Rumit; Nguyen, Dan T; Chen, Shengxi; Dedkova, Larisa M; Chowdhury, Sandipan Roy; Alcala-Torano, Rafael; Hecht, Sidney M

    2013-03-01

    Ribosomes containing modifications in three regions of 23S rRNA, all of which are in proximity to the ribosomal peptidyltransferase center (PTC), were utilized previously as a source of S-30 preparations for in vitro protein biosynthesis experiments. When utilized in the presence of mRNAs containing UAG codons at predetermined positions+β-alanyl-tRNA(CUA), the modified ribosomes produced enhanced levels of full length proteins via UAG codon suppression. In the present study, these earlier results have been extended by the use of substituted β-amino acids, and direct evidence for β-amino acid incorporation is provided. Presently, five of the clones having modified ribosomes are used in experiments employing four substituted β-amino acids, including α-methyl-β-alanine, β,β-dimethyl-β-alanine, β-phenylalanine, and β-(p-bromophenyl)alanine. The β-amino acids were incorporated into three different positions (10, 18 and 49) of Escherichia coli dihydrofolate reductase (DHFR) and their efficiencies of suppression of the UAG codons were compared with those of β-alanine and representative α-l-amino acids. The isolated proteins containing the modified β-amino acids were subjected to proteolytic digestion, and the derived fragments were characterized by mass spectrometry, establishing that the β-amino acids had been incorporated into DHFR, and that they were present exclusively in the anticipated peptide fragments. DHFR contains glutamic acid in position 17, and it has been shown previously that Glu-C endoproteinase can hydrolyze DHFR between amino acids residues 17 and 18. The incorporation of β,β-dimethyl-β-alanine into position 18 of DHFR prevented this cleavage, providing further evidence for the position of incorporation of the β-amino acid.

  16. sup 13 C and sup 15 N nuclear magnetic resonance evidence of the ionization state of substrates bound to bovine dihydrofolate reductase

    SciTech Connect

    Selinsky, B.S.; Perlman, M.E.; London, R.E. ); Unkefer, C.J. ); Mitchell, J. ); Blakley, R.L. Univ. of Tennessee, Memphis )

    1990-02-06

    The state of protonation of substrates bound to mammalian dihydrofolate reductase (DHFR) has significance for the mechanism of catalysis. To investigate this, dihydrofolate and dihydropteroylpentaglutamate have been synthesized with {sup 15}N enrichment at N-5. {sup 15}N NMR studies have been performed on the binary complexes formed by bovine DHFR with these compounds and with (5-{sup 15}N)dihydrobiopterin. The results indicate that there is no protonation at N-5 in the binary complexes, and this was confirmed by {sup 13}C NMR studies with folate and dihydrofolate synthesized with {sup 13}C enrichment at C-6. The chemical shift displacements produced by complex formation are in the same direction as those which result from deprotonation of the N-3/C-4-O amide group and are consistent with at least partial loss of the proton from N-3. This would be possible if, as crystallographic data indicate, there is interaction of N-3 and the 2-amino group of the bound ligands with the carboxylate of the active site glutamate residue (Glu{sup 30}).

  17. Study on Folate Binding Domain of Dihydrofolate Reductase in Different Plant species and Human beings.

    PubMed

    Samanta, Aveek; Datta, Animesh Kumar; Datta, Siraj

    2014-01-01

    Data base (NCBI and TIGR) searches are made to retrieve protein sequences of different plant species namely Medicago truncatula, Pisum sativum, Ricinus communis, Arabidopsis thaliana, Vitis vinifera, Glycine max, Daucus carota, Oryza sativa Japonica Group, Arabidopsis lyrata subsp. lyrata, Brachypodium distachyon, Oryza sativa Indica Group, Zea mays and careful alignment of derived sequences shows 95% or higher identity. Similarly, DHFR sequence of human being is also retrieved from NCBI. A phylogenetic tree is constructed from different plant and human DHFR domain using the Neighbour - Joining method in MEGA 5.05. Conservation score is performed by using PARALINE. Result suggests that folate binding domain of dihydrofolare reductase is conserved (score 8.06) and excepting some minor variations the basic structure of the domain in both plant species and human being is rather similar. Human DHFR domain contains PEKN sequence near active site, though proline is common for all the selected organisms but the other sequences are different in plants. The plant domain is always associated with TS (Thymidylate synthase). Plant based system is predicted to be an effective model for assessment of MTX (Methotrexate) and other antifolate drugs.

  18. Photoaffinity analogues of methotrexate as folate antagonist binding probes. 1. Photoaffinity labeling of murine L1210 dihydrofolate reductase and amino acid sequence of the binding region

    SciTech Connect

    Price, E.M.; Smith, P.L.; Klein, T.E.; Freisheim, J.H.

    1987-07-28

    N/sup ..cap alpha../-(4-Amino-4-deoxy-10-methylpteroyl)-N/sup epsilon/-(4-azido-5-(/sup 125/I)iodosalicylyl)-L-lysine, a photoaffinity analogue of methotrexate, is only 2-fold less potent than methotrexate in the inhibition of murine L1210 dihydrofolate reductase. Irradiation of the enzyme in the presence of an equimolar concentration of the /sup 125/I-labeled analogue ultimately leads to an 8% incorporation of the photoprobe. A 100-fold molar excess of methotrexate essentially blocks this incorporation. Cyanogen bromide digestion of the labeled enzyme, followed by high-pressure liquid chromatography purification of the generated peptides, indicates that greater than 85% of the total radioactivity is incorporated into a single cyanogen bromide peptide. Sequence analysis revealed this peptide to be residues 53-111, with a majority of the radioactivity centered around residues 63-65 (Lys-Asn-Arg). These data demonstrate that the photoaffinity analogue specifically binds to dihydrofolate reductase and covalently modifies the enzyme following irradiation and is therefore a photolabeling agent useful for probing the inhibitor binding domain of the enzyme.

  19. Splicing mutants and their second-site suppressors at the dihydrofolate reductase locus in Chinese hamster ovary cells.

    PubMed

    Carothers, A M; Urlaub, G; Grunberger, D; Chasin, L A

    1993-08-01

    Point mutants induced with a variety of mutagens at the dihydrofolate reductase (dhfr) locus in Chinese hamster ovary (CHO) cells were screened for aberrantly spliced dhfr mRNA by RNase protection and/or reverse transcriptase coupled with cDNA amplification by the polymerase chain reaction (PCR). Of 115 mutants screened, 28 were found to be affected in splicing. All exhibited less than 1% correct splicing, probably because the selection procedure was stringent. All 26 unique mutations were located within the consensus splice sequences; changes were found at 9 of 10 possible sites in this 25-kb six-exon gene. Mutations at the sites flanking the first and last exons resulted in the efficient recruitment of a cryptic site within each exon. In contrast, mutations bordering internal exons caused predominantly exon skipping. In many cases, multiple exons were skipped, suggesting the clustering of adjacent exons prior to actual splicing. Six mutations fell outside the well-conserved GU and AG dinucleotides. All but one were donor site single-base substitutions that decreased the agreement with the consensus and resulted in little or no correct splicing. Starting with five of these donor site mutants, we isolated 31 DHFR+ revertants. Most revertants carried a single-base substitution at a site other than that of the original mutation, and most had only partially regained the ability to splice correctly. The second-site suppression occurred through a variety of mechanisms: (i) a second change within the consensus sequence that produced a better agreement with the consensus; (ii) a change close to but beyond the consensus boundaries, as far as 8 bases upstream in the exon or 28 bases downstream in the intron; (iii) mutations in an apparent pseudo 5' site in the intron, 84 and 88 bases downstream of a donor site; and (iv) mutations that improved the upstream acceptor site of the affected exon. Taken together, these second-site suppressor mutations extend the definition of a

  20. Partial sup 1 H NMR assignments of the Escherichia coli dihydrofolate reductase complex with folate: Evidence for a unique conformation of bound folate

    SciTech Connect

    Falzone, C.J.; Benkovic, S.J. ); Wright, P.E. )

    1990-10-01

    Sequence-specific {sup 1}H assignments have been made for over 25% of the amino acid side chains of Escherichia coli dihydrofolate reductase complexed with folate by using a variety of two-dimensional techniques. Proton resonances were assigned by using a combination of site-directed mutagenesis and a knowledge of the X-ray crystal structure. Unique sets of NOE connectivities present in hydrophobic pockets were matched with the X-ray structure and used to assign many of the residues. Other residues, particularly those near or in the active site, were assigned by site-directed mutagenesis. The ability to assign unambiguosly the proton resonances of these catalytically important residues allowed for extensive networks of NOE connectivities to follow from these assignments. As a consequence of these assignments, the orientation of the pterin ring of folate could be determined, and its conformation is similar to that of the productive dihydrofolate complex. Under these experimental conditions, only one bound form of the pterin ring could be detected.

  1. Structures of dihydrofolate reductase-thymidylate synthase of Trypanosoma cruzi in the folate-free state and in complex with two antifolate drugs, trimetrexate and methotrexate

    SciTech Connect

    Senkovich, Olga; Schormann, Norbert; Chattopadhyay, Debasish

    2010-11-22

    The flagellate protozoan parasite Trypanosoma cruzi is the pathogenic agent of Chagas disease (also called American trypanosomiasis), which causes approximately 50 000 deaths annually. The disease is endemic in South and Central America. The parasite is usually transmitted by a blood-feeding insect vector, but can also be transmitted via blood transfusion. In the chronic form, Chagas disease causes severe damage to the heart and other organs. There is no satisfactory treatment for chronic Chagas disease and no vaccine is available. There is an urgent need for the development of chemotherapeutic agents for the treatment of T. cruzi infection and therefore for the identification of potential drug targets. The dihydrofolate reductase activity of T. cruzi, which is expressed as part of a bifunctional enzyme, dihydrofolate reductase-thymidylate synthase (DHFR-TS), is a potential target for drug development. In order to gain a detailed understanding of the structure-function relationship of T. cruzi DHFR, the three-dimensional structure of this protein in complex with various ligands is being studied. Here, the crystal structures of T. cruzi DHFR-TS with three different compositions of the DHFR domain are reported: the folate-free state, the complex with the lipophilic antifolate trimetrexate (TMQ) and the complex with the classical antifolate methotrexate (MTX). These structures reveal that the enzyme is a homodimer with substantial interactions between the two TS domains of neighboring subunits. In contrast to the enzymes from Cryptosporidium hominis and Plasmodium falciparum, the DHFR and TS active sites of T. cruzi lie on the same side of the monomer. As in other parasitic DHFR-TS proteins, the N-terminal extension of the T. cruzi enzyme is involved in extensive interactions between the two domains. The DHFR active site of the T. cruzi enzyme shows subtle differences compared with its human counterpart. These differences may be exploited for the development of

  2. 2,4-Diamino-6,7-dihydro-5H-cyclopenta[d]pyrimidine analogues of trimethoprim as inhibitors of Pneumocystis carinii and Toxoplasma gondii dihydrofolate reductase.

    PubMed

    Rosowsky, A; Papoulis, A T; Queener, S F

    1998-03-12

    Three previously unreported (R,S)-2,4-diamino-5-[(3,4,5-trimethoxyphenyl) alkyl]-6,7-dihydro-5H-cyclopenta[d]pyrimidines 15a-c were synthesized as analogues of trimethoprim (TMP) and were tested as inhibitors of Pneumocystis carinii, Toxoplasma gondii, and rat liver dihydrofolate reductase (DHFR). The length of the alkyl bridge between the cyclopenta[d]pyrimidine and trimethoxyphenyl moiety ranged from one in 15a to three carbons in 15c. The products were tested as competitive inhibitors of the reduction of dihydrofolate by Pneumocystis carinii, Toxoplasma gondii, and rat liver DHFR. Compounds 15a-c had IC50 values of > 32, 1.8 and 1.3 microM, respectively, against P. carinii DHFR, as compared to 12 microM for TMP. Against the T. gondii enzyme, 15a-c had IC50 values of 21, 0.14 and 0.14 microM, respectively, as compared to 2.7 microM for TMP. Inhibitors 15b and 15c with two- and three-carbon bridges were significantly more potent than 15a against all three enzymes. Unlike TMP, 15b and 15c were better inhibitors of the rat liver enzyme than of the microbial enzymes. The potency of 15b and 15c against rat liver DHFR was less than has been reported for the corresponding 6,7-dihydro-5H-cyclopenta[d]pyrimidines with a classical p-aminobenzoyl-L-glutamate side chain as inhibitors of bovine, murine, and human DHFR.

  3. Kinetics of the inhibition of bovine liver dihydrofolate reductase by tea catechins: origin of slow-binding inhibition and pH studies.

    PubMed

    Navarro-Perán, Enma; Cabezas-Herrera, Juan; Hiner, Alexander N P; Sadunishvili, Tinatin; García-Cánovas, Francisco; Rodríguez-López, José Neptuno

    2005-05-24

    Dihydrofolate reductase (DHFR) is the subject of intensive investigation since it appears to be the primary target enzyme for "antifolate" drugs, such as methotrexate and trimethoprim. Fluorescence quenching and stopped-flow fluorimetry show that the ester bond-containing tea polyphenols (-)-epigallocatechin gallate (EGCG) and (-)-epicatechin gallate (ECG) are potent and specific inhibitors of DHFR with inhibition constants (K(I)) of 120 and 82 nM, respectively. Both tea compounds showed the characteristics of slow-binding inhibitors of bovine liver DHFR. In this work, we have determined a complete kinetic scheme to explain the slow-binding inhibition and the pH effects observed during the inhibition of bovine liver DHFR by these tea polyphenols. Experimental data, based on fluorimetric titrations, and transient phase and steady-state kinetic studies confirm that EGCG and ECG are competitive inhibitors with respect to 7,8-dihydrofolate, which bind preferentially to the free form of the enzyme. The origin of their slow-binding inhibition is proposed to be the formation of a slow dissociation ternary complex by the reaction of NADPH with the enzyme-inhibitor complex. The pH controls both the ionization of critical catalytic residues of the enzyme and the protonation state of the inhibitors. At acidic pH, EGCG and ECG are mainly present as protonated species, whereas near neutrality, they evolve toward deprotonated species due to ionization of the ester-bonded gallate moiety (pK = 7.8). Although DHFR exhibits different affinities for the protonated and deprotonated forms of EGCG and ECG, it appears that the ionization state of Glu-30 in DHFR is critical for its inhibition. The physiological implications of these pH dependencies are also discussed.

  4. Momentum Distribution as a Fingerprint of Quantum Delocalization in Enzymatic Reactions: Open-Chain Path-Integral Simulations of Model Systems and the Hydride Transfer in Dihydrofolate Reductase.

    PubMed

    Engel, Hamutal; Doron, Dvir; Kohen, Amnon; Major, Dan Thomas

    2012-04-10

    The inclusion of nuclear quantum effects such as zero-point energy and tunneling is of great importance in studying condensed phase chemical reactions involving the transfer of protons, hydrogen atoms, and hydride ions. In the current work, we derive an efficient quantum simulation approach for the computation of the momentum distribution in condensed phase chemical reactions. The method is based on a quantum-classical approach wherein quantum and classical simulations are performed separately. The classical simulations use standard sampling techniques, whereas the quantum simulations employ an open polymer chain path integral formulation which is computed using an efficient Monte Carlo staging algorithm. The approach is validated by applying it to a one-dimensional harmonic oscillator and symmetric double-well potential. Subsequently, the method is applied to the dihydrofolate reductase (DHFR) catalyzed reduction of 7,8-dihydrofolate by nicotinamide adenine dinucleotide phosphate hydride (NADPH) to yield S-5,6,7,8-tetrahydrofolate and NADP(+). The key chemical step in the catalytic cycle of DHFR involves a stereospecific hydride transfer. In order to estimate the amount of quantum delocalization, we compute the position and momentum distributions for the transferring hydride ion in the reactant state (RS) and transition state (TS) using a recently developed hybrid semiempirical quantum mechanics-molecular mechanics potential energy surface. Additionally, we examine the effect of compression of the donor-acceptor distance (DAD) in the TS on the momentum distribution. The present results suggest differential quantum delocalization in the RS and TS, as well as reduced tunneling upon DAD compression.

  5. Two crystal structures of dihydrofolate reductase-thymidylate synthase from Cryptosporidium hominis reveal protein–ligand interactions including a structural basis for observed antifolate resistance

    SciTech Connect

    Anderson, Amy C.

    2005-03-01

    An analysis of the protein–ligand interactions in two crystal structures of DHFR-TS from C. hominis reveals a possible structural basis for observed antifolate resistance in C. hominis DHFR. A comparison with the structure of human DHFR reveals residue substitutions that may be exploited for the design of species-selective inhibitors. Cryptosporidium hominis is a protozoan parasite that causes acute gastrointestinal illness. There are no effective therapies for cryptosporidiosis, highlighting the need for new drug-lead discovery. An analysis of the protein–ligand interactions in two crystal structures of dihydrofolate reductase-thymidylate synthase (DHFR-TS) from C. hominis, determined at 2.8 and 2.87 Å resolution, reveals that the interactions of residues Ile29, Thr58 and Cys113 in the active site of C. hominis DHFR provide a possible structural basis for the observed antifolate resistance. A comparison with the structure of human DHFR reveals active-site differences that may be exploited for the design of species-selective inhibitors.

  6. Dihydrofolate Reductase Deficiency Due to a Homozygous DHFR Mutation Causes Megaloblastic Anemia and Cerebral Folate Deficiency Leading to Severe Neurologic Disease

    PubMed Central

    Cario, Holger; Smith, Desirée E.C.; Blom, Henk; Blau, Nenad; Bode, Harald; Holzmann, Karlheinz; Pannicke, Ulrich; Hopfner, Karl-Peter; Rump, Eva-Maria; Ayric, Zuleya; Kohne, Elisabeth; Debatin, Klaus-Michael; Smulders, Yvo; Schwarz, Klaus

    2011-01-01

    The importance of intracellular folate metabolism is illustrated by the severity of symptoms and complications caused by inborn disorders of folate metabolism or by folate deficiency. We examined three children of healthy, distantly related parents presenting with megaloblastic anemia and cerebral folate deficiency causing neurologic disease with atypical childhood absence epilepsy. Genome-wide homozygosity mapping revealed a candidate region on chromosome 5 including the dihydrofolate reductase (DHFR) locus. DHFR sequencing revealed a homozygous DHFR mutation, c.458A>T (p.Asp153Val), in all siblings. The patients' folate profile in red blood cells (RBC), plasma, and cerebrospinal fluid (CSF), analyzed by liquid chromatography tandem mass spectrometry, was compatible with DHFR deficiency. DHFR activity and fluorescein-labeled methotrexate (FMTX) binding were severely reduced in EBV-immortalized lymphoblastoid cells of all patients. Heterozygous cells displayed intermediate DHFR activity and FMTX binding. RT-PCR of DHFR mRNA revealed no differences between wild-type and DHFR mutation-carrying cells, whereas protein expression was reduced in cells with the DHFR mutation. Treatment with folinic acid resulted in the resolution of hematological abnormalities, normalization of CSF folate levels, and improvement of neurological symptoms. In conclusion, the homozygous DHFR mutation p.Asp153Val causes DHFR deficiency and leads to a complex hematological and neurological disease that can be successfully treated with folinic acid. DHFR is necessary for maintaining sufficient CSF and RBC folate levels, even in the presence of adequate nutritional folate supply and normal plasma folate. PMID:21310277

  7. Use of bacterial surrogates as a tool to explore antimalarial drug interaction: Synergism between inhibitors of malarial dihydrofolate reductase and dihydropteroate synthase.

    PubMed

    Talawanich, Yuwadee; Kamchonwongpaisan, Sumalee; Sirawaraporn, Worachart; Yuthavong, Yongyuth

    2015-09-01

    Interaction between antimalarial drugs is important in determining the outcome of chemotherapy using drug combinations. Inhibitors of dihydrofolate reductase (DHFR) such as pyrimethamine and of dihydropteroate synthase (DHPS) such as sulfa drugs are known to have synergistic interactions. However, studies of the synergism are complicated by the fact that the malaria parasite can also salvage exogenous folates, and the salvage may also be affected by the drugs. It is desirable to have a convenient system to study interaction of DHFR and DHPS inhibitors without such complications. Here, we describe the use of Escherichia coli transformed with malarial DHFR and DHPS, while its own corresponding genes have been inactivated by optimal concentration of trimethoprim and genetic knockout, respectively, to study the interaction of the inhibitors. Marked synergistic effects are observed for all combinations of pyrimethamine and sulfa inhibitors in the presence of trimethoprim. At 0.05μM trimethoprim, sum of fractional inhibitory concentrations, ΣFIC of pyrimethamine with sulfadoxine, pyrimethamine with sulfathiazole, pyrimethamine with sulfamethoxazole, and pyrimethamine with dapsone are in the range of 0.24-0.41. These results show synergism between inhibitors of the two enzymes even in the absence of folate transport and uptake. This bacterial surrogate system should be useful as a tool for assessing the interactions of drug combinations between the DHFR and DHPS inhibitors.

  8. Short hairpin RNA targeted to dihydrofolate reductase enhances the immunoglobulin G expression in gene-amplified stable Chinese hamster ovary cells.

    PubMed

    Wu, Suh-Chin; Hong, Willy W L; Liu, Jin-Hwang

    2008-09-08

    The dihydrofolate reductase (dhfr)/methotrexate (MTX) selection is a common method to conduct gene amplification in stable clones of Chinese hamster ovary (CHO) cells. We previously reported the use of a short hairpin RNA (shRNA) vector targeted to the dhfr gene resulted in improving the intracellular antigen expression in gene-amplified stable CHO cells [Hong, W.W., Wu, S.C., 2007. A novel RNA silencing vector to improve antigen expression and stability in Chinese hamster ovary cells. Vaccine 25 (20), 4103-4111]. Here we investigated the use of the dhfr-targeted shRNA vector for immunoglobulin G (IgG) expression in gene-amplified stable CHO cells. With the use of the dhfr-targeted shRNA vector, the gene-amplified CHO/dhFr(-) cells were found to increase IgG expression at 1.0 microM MTX by more than 100% and to improve the genomic stability of IgG expression in MTX-free cultures by approximately 30%. The use of the dhfr-targeted shRNA vector can enhance the IgG expression in the gene-amplified stable CHO cells and uphold the IgG expression in MTX-free cultures. Utilizing the dhfr-targeted shRNA vector may provide an alternative way to maneuver CHO cell factories for IgG production in cultures.

  9. Increased incidence of cycloguanil resistance in malaria cases entering France from Africa, determined as point mutations in the parasites' dihydrofolate-reductase genes.

    PubMed

    Durand, R; di Piazza, J P; Longuet, C; Sécardin, Y; Clain, J; le Bras, J

    1999-01-01

    The incidence of cycloguanil resistance in 501 Plasmodium falciparum isolates from individuals entering France from Africa was estimated by a method based on PCR-restriction-fragment-length polymorphisms. None of the subjects had taken antifol prophylaxis. Annual incidence of the resistance, detected as a point mutation at codon 108 in the parasite's dihydrofolate-reductase gene, increased from 19.8% in 1995 to 43.6% in 1997 (P < 0.001). The proportion of isolates found to be susceptible (i.e. wild-type) among travellers returning from the African countries known as Group 2 in France (i.e. Burkina Faso, Côte d'Ivoire, Gambia, Ghana, Guinea, Liberia, Madagascar, Mali, Mauritania, Niger, Senegal, Sierra Leone, Tchad and Togo) was reasonably high (62.9%) and much higher than in the other subjects returning from other identifiable countries in Africa (35.3%). The antimalarial prophylaxis recommended in France to those travelling to Group-2 countries, chloroquine-proguanil, therefore still seems reasonable, although cycloguanil resistance may seriously undermine the efficacy of this drug combination in the future.

  10. Study of reactivity of cyanoacetohydrazonoethyl-N-ethyl-N-methyl benzenesulfonamide: preparation of novel anticancer and antimicrobial active heterocyclic benzenesulfonamide derivatives and their molecular docking against dihydrofolate reductase.

    PubMed

    Debbabi, Khaled F; Al-Harbi, Sami A; Al-Saidi, Hamed M; Aljuhani, Enas H; Abd El-Gilil, Shimaa M; Bashandy, Mahmoud S

    2016-01-01

    This article describes the synthesis of some novel heterocyclic sulfonamides having biologically active thiophene 3, 4, 5, 6, coumarin 8, benzocoumarin 9, thiazole 7, piperidine 10, pyrrolidine 11, pyrazole 14 and pyridine 12, 13. Starting with 4-(1-(2-(2-cyanoacetyl)hydrazono)ethyl)-N-ethyl-N-methylbenzenesulfonamide (2), which was prepared from condensation of acetophenone derivative 1 with 2-cyanoacetohydrazide. The structures of the newly synthesized compounds were confirmed by elemental analysis, IR, (1)H NMR, (13)C NMR, (19)F NMR and MS spectral data. All the newly synthesized heterocyclic sulfonamides were evaluated as in-vitro anti-breast cancer cell line (MCF7) and as in-vitro antimicrobial agents. Compounds 8, 5 and 11 were more active than MTX reference drug and compounds 12, 7, 4, 14, 5 and 8 were highly potent against Klebsiella pneumonia. Molecular operating environment performed virtual screening using molecular docking studies of the synthesized compounds. The results indicated that some prepared compounds are suitable inhibitor against dihydrofolate reductase (DHFR) enzyme (PDBSD:4DFR) with further modification.

  11. A search for sources of drug resistance by the 4D-QSAR analysis of a set of antimalarial dihydrofolate reductase inhibitors

    NASA Astrophysics Data System (ADS)

    Santos-Filho, Osvaldo Andrade; Hopfinger, Anton J.

    2001-01-01

    A set of 18 structurally diverse antifolates including pyrimethamine, cycloguanil, methotrexate, aminopterin and trimethoprim, and 13 pyrrolo[2,3-d]pyrimidines were studied using four-dimensional quantitative structure-activity relationship (4D-QSAR) analysis. The corresponding biological activities of these compounds include IC50 inhibition constants for both the wild type, and a specific mutant type of Plasmodium falciparum dihydrofolate reductase (DHFR). Two thousand conformations of each analog were sampled to generate a conformational ensemble profile (CEP) from a molecular dynamics simulation (MDS) of 100,000 conformer trajectory states. Each sampled conformation was placed in a 1 Å cubic grid cell lattice for each of five trial alignments. The frequency of occupation of each grid cell was computed for each of six types of pharmacophore groups of atoms of each compound. These grid cell occupancy descriptors (GCODs) were then used as a descriptor pool to construct 4D-QSAR models. Models for inhibition of both the `wild' type and the mutant enzyme were generated which provide detailed spatial pharmacophore requirements for inhibition in terms of atom types and their corresponding relative locations in space. The 4D-QSAR models indicate some structural features perhaps relevant to the mechanism of resistance of the Plasmodium falciparum DHFR to current antimalarials. One feature identified is a slightly different binding alignment of the ligands to the mutant form of the enzyme as compared to the wild type.

  12. Orientation and structure-building role of the water molecules bound at the contact surface of the dihydrofolate reductase-methotrexate complex

    NASA Astrophysics Data System (ADS)

    Nagy, P.

    1988-04-01

    Orientation of ten water molecules bound strongly at the contact surface of the dihydrofolate reductase-methotrexate enzyme-inhibitor complex was determined theoretically. To optimize the orientation of the water molecules, a recent method based on a simple electrostatic model was applied. The electrostatic complementarity in the binary complex was investigated using the lock-and-key model, considering the effect of the water molecules as well. The strongly bound water molecules improve the electrostatic fit in the pteridine region of methotrexate. Their role in the benzoic amide and γ-glutamate region is to decrease the internal energy by creating water bridges among remote polar sites making it possible to form H-bonds. Some modifications in the inhibitor structure were proposed for achieving greater inhibitor potency. The presumably enhanced effect is ascribed to the free energy gain in repelling the water molecules from the contact surface to the bulk of the solvent, and, in other cases, to internal energy decreases due to better electrostatic fit in the enzyme-inhibitor complex.

  13. The Chinese hamster dihydrofolate reductase replication origin decision point follows activation of transcription and suppresses initiation of replication within transcription units.

    PubMed

    Sasaki, Takayo; Ramanathan, Sunita; Okuno, Yukiko; Kumagai, Chiharu; Shaikh, Seemab S; Gilbert, David M

    2006-02-01

    Chinese hamster ovary (CHO) cells select specific replication origin sites within the dihydrofolate reductase (DHFR) locus at a discrete point during G1 phase, the origin decision point (ODP). Origin selection is sensitive to transcription but not protein synthesis inhibitors, implicating a pretranslational role for transcription in origin specification. We have constructed a DNA array covering 121 kb surrounding the DHFR locus, to comprehensively investigate replication initiation and transcription in this region. When nuclei isolated within the first 3 h of G1 phase were stimulated to initiate replication in Xenopus egg extracts, replication initiated without any detectable preference for specific sites. At the ODP, initiation became suppressed from within the Msh3, DHFR, and 2BE2121 transcription units. Active transcription was mostly confined to these transcription units, and inhibition of transcription by alpha-amanitin resulted in the initiation of replication within transcription units, indicating that transcription is necessary to limit initiation events to the intergenic region. However, the resumption of DHFR transcription after mitosis took place prior to the ODP and so is not on its own sufficient to suppress initiation of replication. Together, these results demonstrate a remarkable flexibility in sequence selection for initiating replication and implicate transcription as one important component of origin specification at the ODP.

  14. Replication in the amplified dihydrofolate reductase domain in CHO cells may initiate at two distinct sites, one of which is a repetitive sequence element.

    PubMed

    Anachkova, B; Hamlin, J L

    1989-02-01

    To study initiation of DNA replication in mammalian chromosomes, we have established a methotrexate-resistant Chinese hamster ovary cell line (CHOC 400) that contains approximately 1,000 copies of the early replicating dihydrofolate reductase (DHFR) domain. We have previously shown that DNA replication in the prevalent 243-kilobase (kb) amplicon type in this cell line initiates somewhere within a 28-kb region located downstream from the DHFR gene. In an attempt to localize the origin of replication with more precision, we blocked the progress of replication forks emanating from origins at the beginning of the S phase by the introduction of trioxsalen cross-links at 1- to 5-kb intervals in the parental double-stranded DNA. The small DNA fragments synthesized under these conditions (which should be centered around replication origins) were then used as hybridization probes on digests of cosmids and plasmids from the DHFR domain. These studies suggested that in cells synchronized by this regimen, DNA replication initiates at two separate sites within the previously defined 28-kb replication initiation locus, in general agreement with results described in the accompanying paper (T.-H. Leu and J. L. Hamlin, Mol. Cell. Biol. 9:523-531, 1989). One of these sites contains a repeated DNA sequence element that is found at or near many other initiation sites in the genome, since it was also highly enriched in the early replicating DNA isolated from cross-linked CHO cells that contain only two copies of the DHFR domain.

  15. The Chinese Hamster Dihydrofolate Reductase Replication Origin Decision Point Follows Activation of Transcription and Suppresses Initiation of Replication within Transcription Units

    PubMed Central

    Sasaki, Takayo; Ramanathan, Sunita; Okuno, Yukiko; Kumagai, Chiharu; Shaikh, Seemab S.; Gilbert, David M.

    2006-01-01

    Chinese hamster ovary (CHO) cells select specific replication origin sites within the dihydrofolate reductase (DHFR) locus at a discrete point during G1 phase, the origin decision point (ODP). Origin selection is sensitive to transcription but not protein synthesis inhibitors, implicating a pretranslational role for transcription in origin specification. We have constructed a DNA array covering 121 kb surrounding the DHFR locus, to comprehensively investigate replication initiation and transcription in this region. When nuclei isolated within the first 3 h of G1 phase were stimulated to initiate replication in Xenopus egg extracts, replication initiated without any detectable preference for specific sites. At the ODP, initiation became suppressed from within the Msh3, DHFR, and 2BE2121 transcription units. Active transcription was mostly confined to these transcription units, and inhibition of transcription by alpha-amanitin resulted in the initiation of replication within transcription units, indicating that transcription is necessary to limit initiation events to the intergenic region. However, the resumption of DHFR transcription after mitosis took place prior to the ODP and so is not on its own sufficient to suppress initiation of replication. Together, these results demonstrate a remarkable flexibility in sequence selection for initiating replication and implicate transcription as one important component of origin specification at the ODP. PMID:16428457

  16. Molecular epidemiology of malaria in Cameroon. XI. Geographic distribution of Plasmodium falciparum isolates with dihydrofolate reductase gene mutations in southern and central Cameroon.

    PubMed

    Basco, Leonardo K; Ndounga, Mathieu; Tejiokem, Mathurin; Ngane, Vincent Foumane; Youmba, Jean-Christian; Ringwald, Pascal; Soula, Georges

    2002-10-01

    The DNA sequence of the dihydrofolate reductase (dhfr) gene, a molecular marker for pyrimethamine resistance, was determined for 178 field isolates of Plasmodium falciparum collected along the east-west axis in southern Cameroon. The proportion of isolates having the wild-type dhfr allele varied from 48.1% in the east (city of Bertoua) to 11.3-15.7% in central provinces (Yaounde and Eseka) and 0% in the littoral region (port city of Douala). Isolates with a single Asn-108 mutation or double mutations (Ile-51 or Arg-59 and Asn-108) constituted approximately 10% of the samples. Isolates with triple mutations (Ile-51, Arg-59, and Asn-108) were present in an equal proportion (48.1%) as the wild-type isolates in the east (Bertoua), while triple mutations predominated in Yaounde (62.3%), Eseka (62.7%), and Douala (78.9%). The distribution of triple dhfr mutations along the east-west axis in southern Cameroon suggests the presence of a decreasing gradient from the west coastal region to the central region and then to the east towards the interior of the country.

  17. Towards understanding the origins of the different specificities of binding the reduced (NADPH) and oxidised (NADP +) forms of nicotinamide adenine dinucleotide phosphate coenzyme to dihydrofolate reductase

    NASA Astrophysics Data System (ADS)

    Polshakov, Vladimir I.; Biekofsky, Rodolfo R.; Birdsall, Berry; Feeney, James

    2002-01-01

    Lactobacillus casei dihydrofolate reductase (DHFR) binds more than a thousand times tighter to NADPH than to NADP +. The origins of the difference in binding affinity to DHFR between NADPH and NADP + are investigated in the present study using experimental NMR data and hybrid density functional, B3LYP, calculations. Certain protein residues (Ala 6, Gln 7, Ile 13 and Gly 14) that are directly involved in hydrogen bonding with the nicotinamide carboxamide group show consistent differences in 1H and 15N chemical shift between NADPH and NADP + in a variety of ternary complexes. B3LYP calculations in model systems of protein-coenzyme interactions show differences in the H-bond geometry and differences in charge distribution between the oxidised and reduced forms of the nicotinamide ring. GIAO isotropic nuclear shieldings calculated for nuclei in these systems reproduce the experimentally observed trends in magnitudes and signs of the chemical shifts. The experimentally observed reduction in binding of NADP + compared with NADPH results partly from NADP + having to change its nicotinamide amide group from a cis- to a trans-conformation on binding and partly from the oxidised nicotinamide ring of NADP + being unable to take up its optimal hydrogen bonding geometry in its interactions with protein residues.

  18. Dihydrofolate reductase deficiency due to a homozygous DHFR mutation causes megaloblastic anemia and cerebral folate deficiency leading to severe neurologic disease.

    PubMed

    Cario, Holger; Smith, Desirée E C; Blom, Henk; Blau, Nenad; Bode, Harald; Holzmann, Karlheinz; Pannicke, Ulrich; Hopfner, Karl-Peter; Rump, Eva-Maria; Ayric, Zuleya; Kohne, Elisabeth; Debatin, Klaus-Michael; Smulders, Yvo; Schwarz, Klaus

    2011-02-11

    The importance of intracellular folate metabolism is illustrated by the severity of symptoms and complications caused by inborn disorders of folate metabolism or by folate deficiency. We examined three children of healthy, distantly related parents presenting with megaloblastic anemia and cerebral folate deficiency causing neurologic disease with atypical childhood absence epilepsy. Genome-wide homozygosity mapping revealed a candidate region on chromosome 5 including the dihydrofolate reductase (DHFR) locus. DHFR sequencing revealed a homozygous DHFR mutation, c.458A>T (p.Asp153Val), in all siblings. The patients' folate profile in red blood cells (RBC), plasma, and cerebrospinal fluid (CSF), analyzed by liquid chromatography tandem mass spectrometry, was compatible with DHFR deficiency. DHFR activity and fluorescein-labeled methotrexate (FMTX) binding were severely reduced in EBV-immortalized lymphoblastoid cells of all patients. Heterozygous cells displayed intermediate DHFR activity and FMTX binding. RT-PCR of DHFR mRNA revealed no differences between wild-type and DHFR mutation-carrying cells, whereas protein expression was reduced in cells with the DHFR mutation. Treatment with folinic acid resulted in the resolution of hematological abnormalities, normalization of CSF folate levels, and improvement of neurological symptoms. In conclusion, the homozygous DHFR mutation p.Asp153Val causes DHFR deficiency and leads to a complex hematological and neurological disease that can be successfully treated with folinic acid. DHFR is necessary for maintaining sufficient CSF and RBC folate levels, even in the presence of adequate nutritional folate supply and normal plasma folate.

  19. Trypanosoma brucei DHFR-TS Revisited: Characterisation of a Bifunctional and Highly Unstable Recombinant Dihydrofolate Reductase-Thymidylate Synthase

    PubMed Central

    Gibson, Marc W.; Dewar, Simon; Ong, Han B.; Sienkiewicz, Natasha

    2016-01-01

    Bifunctional dihydrofolate reductase–thymidylate synthase (DHFR-TS) is a chemically and genetically validated target in African trypanosomes, causative agents of sleeping sickness in humans and nagana in cattle. Here we report the kinetic properties and sensitivity of recombinant enzyme to a range of lipophilic and classical antifolate drugs. The purified recombinant enzyme, expressed as a fusion protein with elongation factor Ts (Tsf) in ThyA- Escherichia coli, retains DHFR activity, but lacks any TS activity. TS activity was found to be extremely unstable (half-life of 28 s) following desalting of clarified bacterial lysates to remove small molecules. Stability could be improved 700-fold by inclusion of dUMP, but not by other pyrimidine or purine (deoxy)-nucleosides or nucleotides. Inclusion of dUMP during purification proved insufficient to prevent inactivation during the purification procedure. Methotrexate and trimetrexate were the most potent inhibitors of DHFR (Ki 0.1 and 0.6 nM, respectively) and FdUMP and nolatrexed of TS (Ki 14 and 39 nM, respectively). All inhibitors showed a marked drop-off in potency of 100- to 1,000-fold against trypanosomes grown in low folate medium lacking thymidine. The most potent inhibitors possessed a terminal glutamate moiety suggesting that transport or subsequent retention by polyglutamylation was important for biological activity. Supplementation of culture medium with folate markedly antagonised the potency of these folate-like inhibitors, as did thymidine in the case of the TS inhibitors raltitrexed and pemetrexed. PMID:27175479

  20. Changes in dihydrofolate reductase (DHFR) mRNA levels can account fully for changes in DHFR synthesis rates during terminal differentiation in a highly amplified myogenic cell line.

    PubMed Central

    Schmidt, E E; Merrill, G F

    1991-01-01

    Dihydrofolate reductase (DHFR) enzyme is preferentially synthesized in proliferative cells. A mouse muscle cell line resistant to 300 microM methotrexate was developed to investigate the molecular levels at which DHFR is down-regulated during myogenic withdrawal from the cell cycle. H- alpha R300T cells contained 540 copies of the endogenous DHFR gene and overexpressed DHFR mRNA and DHFR protein. Despite DHFR gene amplification, the cells remained diploid. As H- alpha R300T myoblasts withdrew from the cell cycle and committed to terminal differentiation, DHFR mRNA levels and DHFR synthesis rates decreased with closely matched kinetics. After 15 to 24 h, committed cells contained 5% the proliferative level of DHFR mRNA (80 molecules per committed cell) and synthesized DHFR protein at 6% the proliferative rate. At no point during the commitment process did the decrease in DHFR synthesis rate exceed the decrease in DHFR message. The decrease in DHFR mRNA levels during commitment was sufficient to account fully for the decrease in rates of DHFR synthesis. Furthermore, DHFR mRNA remained polysomal, and the average number of ribosomes per message remained constant (five to six ribosomes per DHFR mRNA). The constancy of polysome size, along with the uniform rate of DHFR synthesis per message, indicated that DHFR mRNA was efficiently translated in postreplicative cells. The results support a model wherein replication-dependent changes in DHFR synthesis rates are determined exclusively by changes in DHFR mRNA levels. Images PMID:2046674

  1. An innovative strategy for dual inhibitor design and its application in dual inhibition of human thymidylate synthase and dihydrofolate reductase enzymes.

    PubMed

    Arooj, Mahreen; Sakkiah, Sugunadevi; Cao, Guang ping; Lee, Keun Woo

    2013-01-01

    Due to the diligence of inherent redundancy and robustness in many biological networks and pathways, multitarget inhibitors present a new prospect in the pharmaceutical industry for treatment of complex diseases. Nevertheless, to design multitarget inhibitors is concurrently a great challenge for medicinal chemists. We have developed a novel computational approach by integrating the affinity predictions from structure-based virtual screening with dual ligand-based pharmacophore to discover potential dual inhibitors of human Thymidylate synthase (hTS) and human dihydrofolate reductase (hDHFR). These are the key enzymes in folate metabolic pathway that is necessary for the biosynthesis of RNA, DNA, and protein. Their inhibition has found clinical utility as antitumor, antimicrobial, and antiprotozoal agents. A druglike database was utilized to perform dual-target docking studies. Hits identified through docking experiments were mapped over a dual pharmacophore which was developed from experimentally known dual inhibitors of hTS and hDHFR. Pharmacophore mapping procedure helped us in eliminating the compounds which do not possess basic chemical features necessary for dual inhibition. Finally, three structurally diverse hit compounds that showed key interactions at both active sites, mapped well upon the dual pharmacophore, and exhibited lowest binding energies were regarded as possible dual inhibitors of hTS and hDHFR. Furthermore, optimization studies were performed for final dual hit compound and eight optimized dual hits demonstrating excellent binding features at target systems were also regarded as possible dual inhibitors of hTS and hDHFR. In general, the strategy used in the current study could be a promising computational approach and may be generally applicable to other dual target drug designs.

  2. Synthesis and molecular docking against dihydrofolate reductase of novel pyridin-N-ethyl-N-methylbenzenesulfonamides as efficient anticancer and antimicrobial agents

    NASA Astrophysics Data System (ADS)

    Debbabi, Khaled F.; Bashandy, Mahmoud S.; Al-Harbi, Sami A.; Aljuhani, Enas H.; Al-Saidi, Hamed M.

    2017-03-01

    This article describes the synthesis of some novel sulfonamides having biologically active pyridine 21-28. Starting with 4-(1-(2-(2-cyanoacetyl)hydrazono)ethyl)-N-ethyl-N-methylbenzenesulfonamide (2), which was prepared from condensation of acetophenone derivative 1 with 2-cyanoacetohydrazide. Interaction of compound 2 with different aldehydes namely 4-fluorobenzaldehyde, 4-hydroxybenzaldehyde and 4-N,N-dimethylbenzaldehyde afforded the corresponding hydrazono-ethyl-N-ethyl-N-methylbenzene sulfonamides 18-20 respectively, which when reacted with malononitrile and ethyl cyanoacetate afforded compounds 21-26 respectively. These compounds 21-26 can be prepared by another reaction route by interaction of compounds 2 with arylidine malononitrile and arylidine ethyl cyanoacetate in refluxing dioxane in the presence of trimethylamine as catalyst. Interaction of compound 2 with malononitrile and ethyl cyanoacetate afforded oxopyridine derivatives 27 and 28 respectively. All the new prepared compounds were evaluated for their antitumor activities against the cell lines MCF-7 in comparison with the reference drug Doxorubicin using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) colorimetric assay. Compounds 25, 21, 23 with SI values of 9.72, 9.71, 8.81 respectively, exhibited better activity than doxorubicin (Dox) as a reference drug with SI value of 8.49. In addition, compounds 25, 27 and 22 exhibited anti-bacterial activity against gram-negative bacteria (Klebsiella pneumoniae) with inhibition zones 22.6, 20.3 and 19.3 mm respectively, which were more active than gentamicin as a reference drug with inhibition zone 17.3 mm. Molecular Operating Environment (MOE) performed virtual screening using molecular docking studies of the synthesized compounds. The results indicated that some synthesized compounds suitable inhibitor against dihydrofolate reductase (DHFR) enzyme (PDB SD: 4DFR) with further modification.

  3. Preliminary in vitro studies on two potent, water-soluble trimethoprim analogues with exceptional species selectivity against dihydrofolate reductase from Pneumocystis carinii and Mycobacterium avium.

    PubMed

    Forsch, Ronald A; Queener, Sherry F; Rosowsky, Andre

    2004-04-05

    2,4-Diamino-5-[3',4'-dimethoxy-5'-(5-carboxy-1-pentynyl)]benzylpyrimidine (6) and 2,4-diamino-5-[3',4'-dimethoxy-5'-(4-carboxyphenylethynyl)benzylpyrimidine (7) were synthesized from 2,4-diamino-5-(5'-iodo-3',4'-dimethoxybenzyl)pyrimidine (9) via a Sonogashira reaction with appropriate acetylenic esters followed by saponification, and were tested as inhibitors of dihydrofolate reductase (DHFR) from Pneumocystis carinii (Pc), Toxoplasma gondii (Tg), Mycobacterium avium (Ma), and rat in comparison with the widely used antibacterial agent 2,4-diamino-5-(3',4',5'-trimethoxybenzyl)pyrimidine (trimethoprim, TMP). The selectivity index (SI) for each compound was calculated by dividing its 50% inhibitory concentration (IC(50)) against rat DHFR by its IC(50) against Pc, Tg, or Ma DHFR. The IC(50) of 6 against Pc DHFR was 1.0 nM, with an SI of 5000. Compound 7 had an IC(50) of 8.2 nM against Ma DHFR, with an SI of 11000. By comparison, the IC(50) of TMP was 12000 nM against Pc, 300 nM against Ma, and 180000 against rat DHFR. The potency and selectivity values of 6 and 7 were not as high against Tg as they were against Pc or Ma DHFR, but nonetheless exceeded those of TMP. Because of the outstanding selectivity of 6 against Pc and of 7 against Ma DHFR, these novel analogues may be viewed as promising leads for further structure-activity optimization.

  4. Structure-based approach to pharmacophore identification, in silico screening, and three-dimensional quantitative structure-activity relationship studies for inhibitors of Trypanosoma cruzi dihydrofolate reductase function

    SciTech Connect

    Schormann, N.; Senkovich, O.; Walker, K.; Wright, D.L.; Anderson, A.C.; Rosowsky, A.; Ananthan, S.; Shinkre, B.; Velu, S.; Chattopadhyay, D.

    2009-07-10

    We have employed a structure-based three-dimensional quantitative structure-activity relationship (3D-QSAR) approach to predict the biochemical activity for inhibitors of T. cruzi dihydrofolate reductase-thymidylate synthase (DHFR-TS). Crystal structures of complexes of the enzyme with eight different inhibitors of the DHFR activity together with the structure in the substrate-free state (DHFR domain) were used to validate and refine docking poses of ligands that constitute likely active conformations. Structural information from these complexes formed the basis for the structure-based alignment used as input for the QSAR study. Contrary to indirect ligand-based approaches the strategy described here employs a direct receptor-based approach. The goal is to generate a library of selective lead inhibitors for further development as antiparasitic agents. 3D-QSAR models were obtained for T. cruzi DHFR-TS (30 inhibitors in learning set) and human DHFR (36 inhibitors in learning set) that show a very good agreement between experimental and predicted enzyme inhibition data. For crossvalidation of the QSAR model(s), we have used the 10% leave-one-out method. The derived 3D-QSAR models were tested against a few selected compounds (a small test set of six inhibitors for each enzyme) with known activity, which were not part of the learning set, and the quality of prediction of the initial 3D-QSAR models demonstrated that such studies are feasible. Further refinement of the models through integration of additional activity data and optimization of reliable docking poses is expected to lead to an improved predictive ability.

  5. Structure-based approach to pharmacophore identification, in silico screening, and three-dimensional quantitative structure-activity relationship studies for inhibitors of Trypanosoma cruzi dihydrofolate reductase function.

    PubMed

    Schormann, N; Senkovich, O; Walker, K; Wright, D L; Anderson, A C; Rosowsky, A; Ananthan, S; Shinkre, B; Velu, S; Chattopadhyay, D

    2008-12-01

    We have employed a structure-based three-dimensional quantitative structure-activity relationship (3D-QSAR) approach to predict the biochemical activity for inhibitors of T. cruzi dihydrofolate reductase-thymidylate synthase (DHFR-TS). Crystal structures of complexes of the enzyme with eight different inhibitors of the DHFR activity together with the structure in the substrate-free state (DHFR domain) were used to validate and refine docking poses of ligands that constitute likely active conformations. Structural information from these complexes formed the basis for the structure-based alignment used as input for the QSAR study. Contrary to indirect ligand-based approaches the strategy described here employs a direct receptor-based approach. The goal is to generate a library of selective lead inhibitors for further development as antiparasitic agents. 3D-QSAR models were obtained for T. cruzi DHFR-TS (30 inhibitors in learning set) and human DHFR (36 inhibitors in learning set) that show a very good agreement between experimental and predicted enzyme inhibition data. For crossvalidation of the QSAR model(s), we have used the 10% leave-one-out method. The derived 3D-QSAR models were tested against a few selected compounds (a small test set of six inhibitors for each enzyme) with known activity, which were not part of the learning set, and the quality of prediction of the initial 3D-QSAR models demonstrated that such studies are feasible. Further refinement of the models through integration of additional activity data and optimization of reliable docking poses is expected to lead to an improved predictive ability.

  6. Crystal Structures of Wild-type and Mutant Methicillin-resistant Staphylococcus aureus Dihydrofolate Reductase Reveal an Alternative Conformation of NADPH that may be Linked to Trimethoprim Resistance

    SciTech Connect

    Frey, K.; Liu, J; Lombardo, M; Bolstad, D; Wright, D; Anderson, A

    2009-01-01

    Both hospital- and community-acquired Staphylococcus aureus infections have become major health concerns in terms of morbidity, suffering and cost. Trimethoprim-sulfamethoxazole (TMP-SMZ) is an alternative treatment for methicillin-resistant S. aureus (MRSA) infections. However, TMP-resistant strains have arisen with point mutations in dihydrofolate reductase (DHFR), the target for TMP. A single point mutation, F98Y, has been shown biochemically to confer the majority of this resistance to TMP. Using a structure-based approach, we have designed a series of novel propargyl-linked DHFR inhibitors that are active against several trimethoprim-resistant enzymes. We screened this series against wild-type and mutant (F98Y) S. aureus DHFR and found that several are active against both enzymes and specifically that the meta-biphenyl class of these inhibitors is the most potent. In order to understand the structural basis of this potency, we determined eight high-resolution crystal structures: four each of the wild-type and mutant DHFR enzymes bound to various propargyl-linked DHFR inhibitors. In addition to explaining the structure-activity relationships, several of the structures reveal a novel conformation for the cofactor, NADPH. In this new conformation that is predominantly associated with the mutant enzyme, the nicotinamide ring is displaced from its conserved location and three water molecules complete a network of hydrogen bonds between the nicotinamide ring and the protein. In this new position, NADPH has reduced interactions with the inhibitor. An equilibrium between the two conformations of NADPH, implied by their occupancies in the eight crystal structures, is influenced both by the ligand and the F98Y mutation. The mutation induced equilibrium between two NADPH-binding conformations may contribute to decrease TMP binding and thus may be responsible for TMP resistance.

  7. An Innovative Strategy for Dual Inhibitor Design and Its Application in Dual Inhibition of Human Thymidylate Synthase and Dihydrofolate Reductase Enzymes

    PubMed Central

    Arooj, Mahreen; Sakkiah, Sugunadevi; Cao, Guang ping; Lee, Keun Woo

    2013-01-01

    Due to the diligence of inherent redundancy and robustness in many biological networks and pathways, multitarget inhibitors present a new prospect in the pharmaceutical industry for treatment of complex diseases. Nevertheless, to design multitarget inhibitors is concurrently a great challenge for medicinal chemists. We have developed a novel computational approach by integrating the affinity predictions from structure-based virtual screening with dual ligand-based pharmacophore to discover potential dual inhibitors of human Thymidylate synthase (hTS) and human dihydrofolate reductase (hDHFR). These are the key enzymes in folate metabolic pathway that is necessary for the biosynthesis of RNA, DNA, and protein. Their inhibition has found clinical utility as antitumor, antimicrobial, and antiprotozoal agents. A druglike database was utilized to perform dual-target docking studies. Hits identified through docking experiments were mapped over a dual pharmacophore which was developed from experimentally known dual inhibitors of hTS and hDHFR. Pharmacophore mapping procedure helped us in eliminating the compounds which do not possess basic chemical features necessary for dual inhibition. Finally, three structurally diverse hit compounds that showed key interactions at both active sites, mapped well upon the dual pharmacophore, and exhibited lowest binding energies were regarded as possible dual inhibitors of hTS and hDHFR. Furthermore, optimization studies were performed for final dual hit compound and eight optimized dual hits demonstrating excellent binding features at target systems were also regarded as possible dual inhibitors of hTS and hDHFR. In general, the strategy used in the current study could be a promising computational approach and may be generally applicable to other dual target drug designs. PMID:23577115

  8. Molecular epidemiology of malaria in Cameroon. XXVII. Clinical and parasitological response to sulfadoxine-pyrimethamine treatment and Plasmodium falciparum dihydrofolate reductase and dihydropteroate synthase alleles in Cameroonian children.

    PubMed

    Tahar, Rachida; Basco, Leonardo K

    2007-08-01

    The rapidly changing epidemiology of antifolate-resistant Plasmodium falciparum in Africa requires monitoring. The present study was designed to assess the degree of association between the clinical and parasitological response to sulfadoxine-pyrimethamine and allelic combinations of dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) genes. Of 357 children who completed the 14-day follow-up, an adequate clinical and parasitological response was observed in 316 patients (88.5%) and early and late failures occurred in 18 (5%) and 23 (6.4%, mostly due to recrudescence) patients, respectively. The majority of clinical isolates were characterized as "quadruple" (n=196, 55.2%; N51I-C59R-S108N in DHFR and A437G in DHPS) or "triple" mutants (n=97, 27.3%; N51I-C59R-S108N in DHFR and wild-type DHPS; S108N+N51I or C59R in DHFR and A437G in DHPS). Wild-type, single mutation, and double mutation were observed in 29, 20, and 13 parasites, respectively. The comparison of different sets of mutations and early or late failures did not reveal any molecular marker associated with treatment outcome when the follow-up period was limited to 14 days (P>0.05). In this study, the determination of dhfr-dhps genotypes was of limited value to predict the treatment outcome in individual patients, mostly due to few treatment failures and few wild-type haplotypes. Further monitoring will be required to define the relationship between clinical response to SP therapy and parasite genotypes in our epidemiological setting.

  9. A 19-base pair deletion polymorphism in dihydrofolate reductase is associated with increased unmetabolized folic acid in plasma and decreased red blood cell folate.

    PubMed

    Kalmbach, Renee D; Choumenkovitch, Silvina F; Troen, Aron P; Jacques, Paul F; D'Agostino, Ralph; Selhub, Jacob

    2008-12-01

    Dihydrofolate reductase (DHFR) catalyzes the reduction of folic acid to tetrahydrofolate (THF). A 19-bp noncoding deletion allele maps to intron 1, beginning 60 bases from the splice donor site, and has been implicated in neural tube defects and cancer, presumably by influencing folate metabolism. The functional impact of this polymorphism has not yet been demonstrated. The objective of this research was to determine the effects of the DHFR mutation with respect to folate status and assess influence of folic acid intake on these relations. The relationship between DHFR genotype and plasma concentrations of circulating folic acid, total folate, total homocysteine, and concentrations of RBC folate was determined in 1215 subjects from the Framingham Offspring Study. There was a significant interaction between DHFR genotype and folic acid intake with respect to the prevalence of high circulating unmetabolized folic acid (defined as >85th percentile). Folic acid intake of >or=500 microg/d increased the prevalence of high circulating unmetabolized folic acid in subjects with the deletion (del/del genotype (47.0%) compared with the wild type (WT)/del (21.4%) and wild type (WT)/WT genotypes (24.4%) (P for interaction = 0.03). Interaction between the DHFR polymorphism and folic acid intake was also seen with respect to RBC folate (P for interaction = 0.01). When folic acid intake was <250 microg/d, the del/del genotype was associated with significantly lower RBC folate (732.3 nmol/L) compared with the WT/WT genotype (844.4 nmol/L). Our results suggest the del/del polymorphism in DHFR is a functional polymorphism, because it limits assimilation of folic acid into cellular folate stores at high and low folic acid intakes.

  10. Expression, Purification and Characterization of Recombinant Mouse Translation Initiation factor eIF-4E as a Dihydrofolate Reductase (DHFR) Fusion Protein

    PubMed Central

    Ghosh, Phalguni; Cheng, Jilin; Chou, Tsui-Fen; Jia, Yan; Avdulov, Svetlana; Bitterman, Peter B.; Polunovsky, Vitaly A.; Wagner, Carston R.

    2008-01-01

    One of the earliest steps in translation initiation is recognition of the mRNA cap structure (m7GpppX) by the initiation factor eIF4E. Studies of interactions between purified eIF4E and its binding partners provide important information for understanding mechanisms underlying translational control in normal and cancer cells. Numerous impediments of the available methods used for eIF4E purification led us to develop a novel methodology for obtaining fractions of eIF4E free from undesired by-products. Herein we report methods for bacterial expression of eIF4E tagged with mutant dihydrofolate reductase (DHFR) followed by isolation and purification of the DHFR-eIF4E protein by using affinity and anion-exchange chromatography. Fluorescence quenching experiments indicated the cap analogue, 7MeGTP, bound to DHFR-eIF4E and eIF4E with a dissociation constant (Kd) of 6±5 and 10±3 nM, respectively. Recombinant eIF4E and DHFR-eIF4E were both shown to significantly enhance in vitro translation in dose dependent manner by 75% at 0.5 uM. Nevertheless increased concentrations of eIF4E and DHFR-eIF4E significantly inhibited translation in a dose dependent manner by a maximum at 2 uM of 60% and 90%, respectively. Thus, we have demonstrated that we have developed an expression system for fully functional recombinant eIF4E. We have also shown that the fusion protein DHFR-eIF4E is functional and thus may be useful for cell based affinity tag studies with fluorescently labeled trimethoprim analogs. PMID:18479935

  11. Disagreement in genotyping results of drug resistance alleles of the Plasmodium falciparum dihydrofolate reductase (Pfdhfr) gene by allele-specific PCR (ASPCR) assays and Sanger sequencing.

    PubMed

    Sharma, Divya; Lather, Manila; Dykes, Cherry L; Dang, Amita S; Adak, Tridibes; Singh, Om P

    2016-01-01

    The rapid spread of antimalarial drug resistance in Plasmodium falciparum over the past few decades has necessitated intensive monitoring of such resistance for an effective malaria control strategy. P. falciparum dihydropteroate synthase (Pfdhps) and P. falciparum dihydrofolate reductase (Pfdhfr) genes act as molecular markers for resistance against the antimalarial drugs sulphadoxine and pyrimethamine, respectively. Resistance to pyrimethamine which is used as a partner drug in artemisinin combination therapy (ACT) is associated with several mutations in the Pfdhfr gene, namely A16V, N51I, C59R, S108N/T and I164L. Therefore, routine monitoring of Pfdhfr-drug-resistant alleles in a population may help in effective drug resistance management. Allele-specific PCR (ASPCR) is one of the commonly used methods for molecular genotyping of these alleles. In this study, we genotyped 55 samples of P. falciparum for allele discrimination at four codons of Pfdhfr (N51, C59, S108 and I164) by ASPCR using published methods and by Sanger's DNA sequencing method. We found that the ASPCR identified a significantly higher number of mutant alleles as compared to the DNA sequencing method. Such discrepancies arise due to the non-specificity of some of the allele-specific primer sets and due to the lack of sensitivity of Sanger's DNA sequencing method to detect minor alleles present in multiple clone infections. This study reveals the need of a highly specific and sensitive method for genotyping and detecting minor drug-resistant alleles present in multiple clonal infections.

  12. A clinically-identified emergent source of antibiotic resistance: the integron-associated DfrB4, a previously uncharacterized member of the trimethoprim-resistant dihydrofolate reductase B family.

    PubMed

    Toulouse, Jacynthe L; Edens, Thaddeus J; Alejaldre, Lorea; Manges, Amee R; Pelletier, Joelle N

    2017-02-27

    Whole genome sequencing of trimethoprim-resistant E. coli clinical isolates has identified a member of the trimethoprim-resistant type II dihydrofolate reductase gene family (dfrB). The dfrB4 gene was located within a class I integron flanked by multiple resistance genes. This arrangement was previously reported in a 130.6 kb multi-resistance plasmid. The DfrB4 protein conferred a > 2,000-fold increased trimethoprim resistance upon overexpression in E. coli Our results are consistent with dfrB4 contributing to clinical trimethoprim resistance.

  13. Structure-based design of selective inhibitors of dihydrofolate reductase: synthesis and antiparasitic activity of 2, 4-diaminopteridine analogues with a bridged diarylamine side chain.

    PubMed

    Rosowsky, A; Cody, V; Galitsky, N; Fu, H; Papoulis, A T; Queener, S F

    1999-11-18

    As part of a larger search for potent as well as selective inhibitors of dihydrofolate reductase (DHFR) enzymes from opportunistic pathogens found in patients with AIDS and other immune disorders, N-[(2,4-diaminopteridin-6-yl)methyl]dibenz[b,f]azepine (4a) and the corresponding dihydrodibenz[b,f]azepine, dihydroacridine, phenoxazine, phenothiazine, carbazole, and diphenylamine analogues were synthesized from 2, 4-diamino-6-(bromomethyl)pteridine in 50-75% yield by reaction with the sodium salts of the amines in dry tetrahydrofuran at room temperature. The products were tested for the ability to inhibit DHFR from Pneumocystis carinii (pcDHFR), Toxoplasma gondii (tgDHFR), Mycobacterium avium (maDHFR), and rat liver (rlDHFR). The member of the series with the best combination of potency and species selectivity was 4a, with IC(50) values against the four enzymes of 0. 21, 0.043, 0.012, and 4.4 microM, respectively. The dihydroacridine, phenothiazine, and carbazole analogues were also potent, but nonselective. Of the compounds tested, 4a was the only one to successfully combine the potency of trimetrexate with the selectivity of trimethoprim. Molecular docking simulations using published 3D structural coordinates for the crystalline ternary complexes of pcDHFR and hDHFR suggested a possible structural interpretation for the binding selectivity of 4a and the lack of selectivity of the other compounds. According to this model, 4a is selective because of a unique propensity of the seven-membered ring in the dibenz[b,f]azepine moiety to adopt a puckered orientation that allows it to fit more comfortably into the active site of the P. carinii enzyme than into the active site of the human enzyme. Compound 4a was also evaluated for the ability to be taken up into, and retard the growth of, P. carinii and T. gondii in culture. The IC(50) of 4a against P. carinii trophozoites after 7 days of continuous drug treatment was 1.9 microM as compared with previously observed IC(50

  14. Dihydrofolate reductase 19-bp deletion polymorphism modifies the association of folate status with memory in a cross-sectional multi-ethnic study of adults123

    PubMed Central

    Philip, Dana; Buch, Assaf; Moorthy, Denish; Scott, Tammy M; Parnell, Laurence D; Lai, Chao-Qiang; Ordovás, José M; Selhub, Jacob; Rosenberg, Irwin H; Tucker, Katherine L; Troen, Aron M

    2015-01-01

    Background: Folate status has been positively associated with cognitive function in many studies; however, some studies have observed associations of poor cognitive outcomes with high folate. In search of an explanation, we hypothesized that the association of folate with cognition would be modified by the interaction of high-folate status with a common 19-bp deletion polymorphism in the dihydrofolate reductase (DHFR) gene. To our knowledge, the cognitive effects of this gene have not been studied previously. Objective: We examined the association between cognitive outcomes with the 19-bp deletion DHFR polymorphism, folate status, and their interaction with high or normal plasma folate. Design: This was a pooled cross-sectional study of the following 2 Boston-based cohorts of community living adults: the Boston Puerto Rican Health Study and the Nutrition, Aging, and Memory in Elders study. Individuals were genotyped for the DHFR 19-bp deletion genotype, and plasma folate status was determined. Cognitive outcomes included the Mini-Mental State Examination, Center for Epidemiologic Studies Depression Scale, and factor scores for the domains of memory, executive function, and attention from a set of cognitive tests. Results: The prevalence of the homozygous deletion (del/del) genotype was 23%. In a multivariable analysis, high folate status (>17.8 ng/mL) was associated with better memory scores than was normal-folate status (fourth–fifth quintiles compared with first–third quintiles: β ± SE = −0.22 ± 0.06, P < 0.01). Carriers of the DHFR del/del genotype had worse memory scores (β ± SE = −0.24 ± 0.10, P < 0.05) and worse executive scores (β = −0.19, P < 0.05) than did those with the del/ins and ins/ins genotypes. Finally, we observed an interaction such that carriers of the del/del genotype with high folate had significantly worse memory scores than those of both noncarriers with high-folate and del/del carriers with normal-folate (β-interaction = 0

  15. Pyridine Nucleotide Complexes with Bacillus anthracis Coenzyme A-Disulfide Reductase: A Structural Analysis of Dual NAD(P)H Specificity

    SciTech Connect

    Wallen,J.; Paige, C.; Mallett, T.; Karplus, P.; Claiborne, A.

    2008-01-01

    We have recently reported that CoASH is the major low-molecular weight thiol in Bacillus anthracis, and we have now characterized the kinetic and redox properties of the B. anthracis coenzyme A-disulfide reductase (CoADR, BACoADR) and determined the crystal structure at 2.30 Angstroms resolution. While the Staphylococcus aureus and Borrelia burgdorferi CoADRs exhibit strong preferences for NADPH and NADH, respectively, B. anthracis CoADR can use either pyridine nucleotide equally well. Sequence elements within the respective NAD(P)H-binding motifs correctly reflect the preferences for S. aureus and Bo. burgdorferi CoADRs, but leave questions as to how BACoADR can interact with both pyridine nucleotides. The structures of the NADH and NADPH complexes at ca. 2.3 Angstroms resolution reveal that a loop consisting of residues Glu180-Thr187 becomes ordered and changes conformation on NAD(P)H binding. NADH and NADPH interact with nearly identical conformations of this loop; the latter interaction, however, involves a novel binding mode in which the 2'-phosphate of NADPH points out toward solvent. In addition, the NAD(P)H-reduced BACoADR structures provide the first view of the reduced form (Cys42-SH/CoASH) of the Cys42-SSCoA redox center. The Cys42-SH side chain adopts a new conformation in which the conserved Tyr367'-OH and Tyr425'-OH interact with the nascent thiol(ate) on the flavin si-face. Kinetic data with Y367F, Y425F, and Y367, 425F BACoADR mutants indicate that Tyr425' is the primary proton donor in catalysis, with Tyr367' functioning as a cryptic alternate donor in the absence of Tyr425'.

  16. Comparative hydrogen-deuterium exchange for a mesophilic vs thermophilic dihydrofolate reductase at 25 °C: identification of a single active site region with enhanced flexibility in the mesophilic protein.

    PubMed

    Oyeyemi, Olayinka A; Sours, Kevin M; Lee, Thomas; Kohen, Amnon; Resing, Katheryn A; Ahn, Natalie G; Klinman, Judith P

    2011-09-27

    The technique of hydrogen-deuterium exchange coupled to mass spectrometry (HDX-MS) has been applied to a mesophilic (E. coli) dihydrofolate reductase under conditions that allow direct comparison to a thermophilic (B. stearothermophilus) ortholog, Ec-DHFR and Bs-DHFR, respectively. The analysis of hydrogen-deuterium exchange patterns within proteolytically derived peptides allows spatial resolution, while requiring a series of controls to compare orthologous proteins with only ca. 40% sequence identity. These controls include the determination of primary structure effects on intrinsic rate constants for HDX as well as the use of existing 3-dimensional structures to evaluate the distance of each backbone amide hydrogen to the protein surface. Only a single peptide from the Ec-DHFR is found to be substantially more flexible than the Bs-DHFR at 25 °C in a region located within the protein interior at the intersection of the cofactor and substrate-binding sites. The surrounding regions of the enzyme are either unchanged or more flexible in the thermophilic DHFR from B. stearothermophilus. The region with increased flexibility in Ec-DHFR corresponds to one of two regions previously proposed to control the enthalpic barrier for hydride transfer in Bs-DHFR [Oyeyemi et al. (2010) Proc. Natl. Acad. Sci. U.S.A. 107, 10074].

  17. Molecular epidemiology of malaria in Cameroon. XXX. sequence analysis of Plasmodium falciparum ATPase 6, dihydrofolate reductase, and dihydropteroate synthase resistance markers in clinical isolates from children treated with an artesunate-sulfadoxine-pyrimethamine combination.

    PubMed

    Menemedengue, Virginie; Sahnouni, Khalifa; Basco, Leonardo; Tahar, Rachida

    2011-07-01

    Plasmodium falciparum dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) genes are reliable molecular markers for antifolate resistance. The P. falciparum ATPase 6 (pfatp6) gene has been proposed to be a potential marker for artemisinin resistance. In our previous clinical study, we showed that artesunate-sulfadoxine-pyrimethamine is highly effective against uncomplicated malaria in Yaoundé, Cameroon. In the present study, dhfr, dhps, and pfatp6 mutations in P. falciparum isolates obtained from children treated with artesunate-sulfadoxine-pyrimethamine were determined. All 61 isolates had wild-type Pfatp6 263, 623, and 769 alleles, and 11 (18%) had a single E431K substitution. Three additional mutations, E643Q, E432K, and E641Q, were detected. The results did not indicate any warning signal of serious concern (i.e., no parasites were seen with quintuple dhfr-dhps, DHFR Ile164Leu, or pfatp6 mutations), as confirmed by the high clinical efficacy of artesunate-sulfadoxine-pyrimethamine. Further studies are required to identify a molecular marker that reliably predicts artemisinin resistance.

  18. An affinity selection-mass spectrometry method for the identification of small molecule ligands from self-encoded combinatorial libraries: Discovery of a novel antagonist of E. coli dihydrofolate reductase

    NASA Astrophysics Data System (ADS)

    Annis, D. Allen; Athanasopoulos, John; Curran, Patrick J.; Felsch, Jason S.; Kalghatgi, Krishna; Lee, William H.; Nash, Huw M.; Orminati, Jean-Paul A.; Rosner, Kristin E.; Shipps, Gerald W., Jr.; Thaddupathy, G. R. A.; Tyler, Andrew N.; Vilenchik, Lev; Wagner, Carston R.; Wintner, Edward A.

    2004-11-01

    The NeoGenesis Automated Ligand Identification System (ALIS), an affinity selection-mass spectrometry (AS-MS) process consisting of a rapid size-exclusion chromatography stage integrated with reverse-phase chromatography, electrospray mass spectrometry, and novel data searching algorithms, was used to screen mass-encoded, 2500-member combinatorial libraries, leading to the discovery of a novel, bioactive ligand for the anti-infective target Escherichia coli dihydrofolate reductase (DHFR). Synthesis of the mass-encoded, ligand-containing library, discussion of the deconvolution process for verifying the structure of the ligand through independent synthesis and screening in a small mixture (sub-library) format, and ALIS-MS/MS techniques to assign its regioisomeric connectivity are presented. ALIS-based competition experiments between the newly discovered ligand and other, known DHFR ligands, and biological activity assessments with stereo- and regioisomers of the hit compound confirm its DHFR-specific biological activity. The method described requires no foreknowledge of the structure or biochemistry of the protein target, consumes less than 1 [mu]g protein to screen >2500 compounds in a single experiment, and enables screening of >250,000 compounds per system per day. These advantages highlight the potential of the ALIS method for drug discovery against genomic targets with unknown biological function, as well as validated targets for which traditional discovery efforts have failed.

  19. Structural analysis of a holoenzyme complex of mouse dihydrofolate reductase with NADPH and a ternary complex with the potent and selective inhibitor 2, 4-diamino-6-(2′-hydroxydibenz[b, f]azepin-5-yl)methylpteridine

    SciTech Connect

    Cody, Vivian; Pace, Jim; Rosowsky, Andre

    2008-09-01

    The structures of mouse DHFR holo enzyme and a ternary complex with NADPH and a potent inhibitor are described. It has been shown that 2, 4-diamino-6-arylmethylpteridines and 2, 4-diamino-5-arylmethylpyrimidines containing an O-carboxylalkyloxy group in the aryl moiety are potent and selective inhibitors of the dihydrofolate reductase (DHFR) from opportunistic pathogens such as Pneumocystis carinii, the causative agent of Pneumocystis pneumonia in HIV/AIDS patients. In order to understand the structure–activity profile observed for a series of substituted dibenz[b, f]azepine antifolates, the crystal structures of mouse DHFR (mDHFR; a mammalian homologue) holo and ternary complexes with NADPH and the inhibitor 2, 4-diamino-6-(2′-hydroxydibenz[b, f]azepin-5-yl)methylpteridine were determined to 1.9 and 1.4 Å resolution, respectively. Structural data for the ternary complex with the potent O-(3-carboxypropyl) inhibitor PT684 revealed no electron density for the O-carboxylalkyloxy side chain. The side chain was either cleaved or completely disordered. The electron density fitted the less potent hydroxyl compound PT684a. Additionally, cocrystallization of mDHFR with NADPH and the less potent 2′-(4-carboxybenzyl) inhibitor PT682 showed no electron density for the inhibitor and resulted in the first report of a holoenzyme complex despite several attempts at crystallization of a ternary complex. Modeling data of PT682 in the active site of mDHFR and P. carinii DHFR (pcDHFR) indicate that binding would require ligand-induced conformational changes to the enzyme for the inhibitor to fit into the active site or that the inhibitor side chain would have to adopt an alternative binding mode to that observed for other carboxyalkyloxy inhibitors. These data also show that the mDHFR complexes have a decreased active-site volume as reflected in the relative shift of helix C (residues 59–64) by 0.6 Å compared with pcDHFR ternary complexes. These data are consistent with the

  20. Structural Analysis of a Holoenzyme Complex of Mouse Dihydrofolate Reductase With NADPH And a Ternary Complex With the Potent And Selective Inhibitor 2,4-Diamino-6-(2'-Hydroxydibenz[b,F]azepin-5-YI)

    SciTech Connect

    Cody, V.; Pace, J.; Rosowsky, A.

    2009-05-12

    It has been shown that 2,4-diamino-6-arylmethylpteridines and 2,4-diamino-5-arylmethylpyrimidines containing an O-carboxylalkyloxy group in the aryl moiety are potent and selective inhibitors of the dihydrofolate reductase (DHFR) from opportunistic pathogens such as Pneumocystis carinii, the causative agent of Pneumocystis pneumonia in HIV/AIDS patients. In order to understand the structure-activity profile observed for a series of substituted dibenz[b,f]azepine antifolates, the crystal structures of mouse DHFR (mDHFR; a mammalian homologue) holo and ternary complexes with NADPH and the inhibitor 2,4-diamino-6-(2{prime}-hydroxydibenz[b,f]azepin-5-yl)methylpteridine were determined to 1.9 and 1.4 A resolution, respectively. Structural data for the ternary complex with the potent O-(3-carboxypropyl) inhibitor PT684 revealed no electron density for the O-carboxylalkyloxy side chain. The side chain was either cleaved or completely disordered. The electron density fitted the less potent hydroxyl compound PT684a. Additionally, cocrystallization of mDHFR with NADPH and the less potent 2{prime}-(4-carboxybenzyl) inhibitor PT682 showed no electron density for the inhibitor and resulted in the first report of a holoenzyme complex despite several attempts at crystallization of a ternary complex. Modeling data of PT682 in the active site of mDHFR and P. carinii DHFR (pcDHFR) indicate that binding would require ligand-induced conformational changes to the enzyme for the inhibitor to fit into the active site or that the inhibitor side chain would have to adopt an alternative binding mode to that observed for other carboxyalkyloxy inhibitors. These data also show that the mDHFR complexes have a decreased active-site volume as reflected in the relative shift of helix C (residues 59-64) by 0.6 A compared with pcDHFR ternary complexes. These data are consistent with the greater inhibitory potency against pcDHFR.

  1. Bacillus anthracis

    PubMed Central

    Spencer, R C

    2003-01-01

    The events of 11 September 2001 and the subsequent anthrax outbreaks have shown that the West needs to be prepared for an increasing number of terrorist attacks, which may include the use of biological warfare. Bacillus anthracis has long been considered a potential biological warfare agent, and this review will discuss the history of its use as such. It will also cover the biology of this organism and the clinical features of the three disease forms that it can produce: cutaneous, gastrointestinal, and inhalation anthrax. In addition, treatment and vaccination strategies will be reviewed. PMID:12610093

  2. Ligand binding studies, preliminary structure-activity relationship and detailed mechanistic characterization of 1-phenyl-6,6-dimethyl-1,3,5-triazine-2,4-diamine derivatives as inhibitors of Escherichia coli dihydrofolate reductase

    PubMed Central

    Srinivasan, Bharath; Tonddast-Navaei, Sam; Skolnick, Jeffrey

    2015-01-01

    Gram-negative bacteria are implicated in the causation of life-threatening hospital-acquired infections. They acquire rapid resistance to multiple drugs and available antibiotics. Hence, there is the need to discover new antibacterial agents with novel scaffolds. For the first time, this study explores the 1,3,5-triazine-2,4-diamine and 1,2,4-triazine-2,4-diamine group of compounds as potential inhibitors of E. coli DHFR, a pivotal enzyme in the thymidine and purine synthesis pathway. Using differential scanning fluorimetry, DSF, fifteen compounds with various substitutions on either the 3rd or 4th positions on the benzene group of 6,6-dimethyl-1-(benzene)-1,3,5-triazine-2,4-diamine were shown to bind to the enzyme with varying affinities. Then, the dose dependence of inhibition by these compounds was determined. Preliminary quantitative structure-activity relationship analysis and docking studies implicate the alkyl linker group and the sulfonyl fluoride group in increasing the potency of inhibition. 4-[4-[3-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenyl]butyl]benzenesulfonyl fluoride (NSC120927), the best hit from the study and a molecule with no reported inhibition of E. coli DHFR, potently inhibits the enzyme with a Ki value of 42.50 ± 5.34 nM, followed by 4-[6-[4-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenyl]hexyl]benzenesulfonyl fluoride(NSC132279), with a Ki value of 100.9 ± 12.7 nM. Detailed kinetic characterization of the inhibition brought about by five small-molecule hits shows that these inhibitors bind to the dihydrofolate binding site with preferential binding to the NADPH-bound binary form of the enzyme. Furthermore, in search of novel diaminotriazine scaffolds, it is shown that lamotrigine, a 1,2,4-triazine-3,5-diamine and a sodium-ion channel blocker class of antiepileptic drug, also inhibits E. coli DHFR. This is the first comprehensive study on the binding and inhibition brought about by diaminotriazines of a gram

  3. Ruling Out Bacillus anthracis

    PubMed Central

    Papaparaskevas, Joseph; Houhoula, Dimitra P.; Papadimitriou, Maria; Saroglou, Georgios; Legakis, Nicholas J.

    2004-01-01

    Optimization of methods for ruling out Bacillus anthracis leads to increased yields, faster turnaround times, and a lighter workload. We used 72 environmental non–B. anthracis bacilli to validate methods for ruling out B. anthracis. Most effective were horse blood agar, motility testing after a 2-h incubation in trypticase soy broth, and screening with a B. anthracis–selective agar. PMID:15200872

  4. Mutation and repair induced by the carcinogen 2-(hydroxyamino)-1-methyl-6-phenylimidazo[4,5-b]pyridine (N-OH-PhIP) in the dihydrofolate reductase gene of Chinese hamster ovary cells and conformational modeling of the dG-C8-PhIP adduct in DNA.

    PubMed

    Carothers, A M; Yuan, W; Hingerty, B E; Broyde, S; Grunberger, D; Snyderwine, E G

    1994-01-01

    Three experiments using 20 microM 2-(hydroxyamino)-1-methyl-6-phenylimidazo[4,5-b]pyridine (N-OH-PhIP) were performed to induce mutations in the dihydrofolate reductase (DHFR) gene of a hemizygous Chinese hamster ovary (CHO) cell line (UA21). Metabolized forms of this chemical primarily bind at the C-8 position of guanine in DNA. In total, 21 independent induced mutants were isolated and 20 were characterized. DNA sequencing showed that the preferred mutation type found in 75% of the induced DHFR- clones was G.C-->T.A single and tandem double transversions. In addition to base substitutions, one mutant carried a-1 frameshift and another one had lost the entire locus by deletion. The induced changes affected purine targets on the nontranscribed strand of the gene in nearly all of the mutants sequenced (18/19). At the time that the first two experiments were performed, the initial adduct levels were quantitated in treated cells at the mutagenic dose by 32P-postlabeling. While the induced frequency of mutation was relatively low (approximately 5 x 10(-6), the adduct levels after a 1-h exposure of UA21 cells to 20 microM N-OH-PhIP were relatively high (13 adducts x 10(-6) nucleotides). This latter method was then employed to learn if the induced mutation frequency correlated with rapid overall genome repair of PhIP-DNA adducts. Total adduct levels, determined using DNA samples from treated cells collected after intervals of time, were reduced by about 50% after 6 h, and about 70% after 24 h. Since overall genome repair in CHO cells is relatively slow compared with preferential gene repair, the removal of dG-C8-PhIP adducts was apparently efficient. In order to better understand the mutational and repair results, we performed computational modeling to determine the lowest energy structure for the major dG-C8-PhIP adduct in a repetitively mutated duplex sequence opposite dA. Results of this analysis indicate that the PhIP-modified base resembles previous structural

  5. Unraveling the role of protein dynamics in dihydrofolate reductase catalysis

    PubMed Central

    Luk, Louis Y. P.; Javier Ruiz-Pernía, J.; Dawson, William M.; Roca, Maite; Loveridge, E. Joel; Glowacki, David R.; Harvey, Jeremy N.; Mulholland, Adrian J.; Tuñón, Iñaki; Moliner, Vicent; Allemann, Rudolf K.

    2013-01-01

    Protein dynamics have controversially been proposed to be at the heart of enzyme catalysis, but identification and analysis of dynamical effects in enzyme-catalyzed reactions have proved very challenging. Here, we tackle this question by comparing an enzyme with its heavy (15N, 13C, 2H substituted) counterpart, providing a subtle probe of dynamics. The crucial hydride transfer step of the reaction (the chemical step) occurs more slowly in the heavy enzyme. A combination of experimental results, quantum mechanics/molecular mechanics simulations, and theoretical analyses identify the origins of the observed differences in reactivity. The generally slightly slower reaction in the heavy enzyme reflects differences in environmental coupling to the hydride transfer step. Importantly, the barrier and contribution of quantum tunneling are not affected, indicating no significant role for “promoting motions” in driving tunneling or modulating the barrier. The chemical step is slower in the heavy enzyme because protein motions coupled to the reaction coordinate are slower. The fact that the heavy enzyme is only slightly less active than its light counterpart shows that protein dynamics have a small, but measurable, effect on the chemical reaction rate. PMID:24065822

  6. Macrophage Responses to B. Anthracis

    DTIC Science & Technology

    2006-08-14

    LPS were reflective of a profound rophage responses to close relatives like Bacillus cereus as well change in cellular signaling, and in general these...published (attached) in 2005 [Bergman, et al. Murine Macrophage Transcriptional Responses to Bacillus I Final Report anthracis Infection and Intoxication...Macrophage Transcriptional Responses to Bacillus anthracis Infection and Intoxication. Infection & Immunity. 73:1069-1079. Parallel to the mRNA data

  7. Capsule Depolymerase Overexpression Reduces Bacillus anthracis Virulence

    DTIC Science & Technology

    2010-01-01

    Friedlander, A. M. (2004). The NheA component of the non- hemolytic enterotoxin of Bacillus cereus is produced by Bacillus anthracis but is not required for...Capsule depolymerase overexpression reduces Bacillus anthracis virulence Angelo Scorpio,3 Donald J. Chabot, William A. Day,4 Timothy A. Hoover and...depolymerase (CapD) is a c-glutamyl transpeptidase and a product of the Bacillus anthracis capsule biosynthesis operon. In this study, we examined the

  8. Chemical Ligation and Isotope Labeling to Locate Dynamic Effects during Catalysis by Dihydrofolate Reductase†

    PubMed Central

    Luk, Louis Y. P.; Ruiz‐Pernía, J. Javier; Adesina, Aduragbemi S.; Loveridge, E. Joel

    2015-01-01

    Abstract Chemical ligation has been used to alter motions in specific regions of dihydrofolate reductase from E. coli and to investigate the effects of localized motional changes on enzyme catalysis. Two isotopic hybrids were prepared; one with the mobile N‐terminal segment containing heavy isotopes (2H, 13C, 15N) and the remainder of the protein with natural isotopic abundance, and the other one with only the C‐terminal segment isotopically labeled. Kinetic investigations indicated that isotopic substitution of the N‐terminal segment affected only a physical step of catalysis, whereas the enzyme chemistry was affected by protein motions from the C‐terminal segment. QM/MM studies support the idea that dynamic effects on catalysis mostly originate from the C‐terminal segment. The use of isotope hybrids provides insights into the microscopic mechanism of dynamic coupling, which is difficult to obtain with other studies, and helps define the dynamic networks of intramolecular interactions central to enzyme catalysis. PMID:26079622

  9. Thioredoxin reductase.

    PubMed Central

    Mustacich, D; Powis, G

    2000-01-01

    The mammalian thioredoxin reductases (TrxRs) are a family of selenium-containing pyridine nucleotide-disulphide oxidoreductases with mechanistic and sequence identity, including a conserved -Cys-Val-Asn-Val-Gly-Cys- redox catalytic site, to glutathione reductases. TrxRs catalyse the NADPH-dependent reduction of the redox protein thioredoxin (Trx), as well as of other endogenous and exogenous compounds. The broad substrate specificity of mammalian TrxRs is due to a second redox-active site, a C-terminal -Cys-SeCys- (where SeCys is selenocysteine), that is not found in glutathione reductase or Escherichia coli TrxR. There are currently two confirmed forms of mammalian TrxRs, TrxR1 and TrxR2, and it is possible that other forms will be identified. The availability of Se is a key factor determining TrxR activity both in cell culture and in vivo, and the mechanism(s) for the incorporation of Se into TrxRs, as well as the regulation of TrxR activity, have only recently begun to be investigated. The importance of Trx to many aspects of cell function make it likely that TrxRs also play a role in protection against oxidant injury, cell growth and transformation, and the recycling of ascorbate from its oxidized form. Since TrxRs are able to reduce a number of substrates other than Trx, it is likely that additional biological effects will be discovered for TrxR. Furthermore, inhibiting TrxR with drugs may lead to new treatments for human diseases such as cancer, AIDS and autoimmune diseases. PMID:10657232

  10. Simultaneous identification and verification of Bacillus anthracis.

    PubMed

    Krishnamurthy, Thaiya; Hewel, Johannes; Bonzagni, Neil J; Dabbs, Jason; Bull, Robert L; Yates, John R

    2006-01-01

    Specific identification of Bacillus anthracis (B. anthracis) is vital for the accurate treatment of afflicted personnel during biological warfare situations and civilian terrorist attacks. In order to accomplish this, we have subjected the lysates from B. anthracis to affinity purification using monoclonal antibodies for the selected antigenic protein present in the bacteria. The bound antigenic protein was identified by multi-dimensional protein identification technology (MudPIT) to be a surface layer protein EA1. The same antigen was identified from the lysates from a few strains of B. anthracis demonstrating the observation to be common for B. anthracis strains. Hence, this presents an effective pathway for the identification of the bacteria present in unknown samples of various origins. Generation of a database containing the EA1 protein has been found to be useful in the database search of unknown samples.

  11. Structure of the dihydrofolate reductase gene in Chinese hamster ovary cells.

    PubMed

    Carothers, A M; Urlaub, G; Ellis, N; Chasin, L A

    1983-04-11

    Overlapping recombinant lambda 1059 phages carrying regions of the dhfr locus from the amplified Chinese hamster ovary (CHO) cell clone MK42 have been isolated. In addition, dhfr cDNAs from this cell line have been cloned into plasmid pBR322. Restriction analysis of these recombinant molecules has led to a map of the Chinese hamster dhfr gene. This gene has a minimum size of 26 kb and contains six exons as defined by hybridization to a combination of mouse and CHO cDNA probes. The latter probes reveal 3' exonic sequences that are not present in mouse cDNA. The CHO dhfr gene thus extends about 700 bp further 3' than in the mouse, consistent with the larger size of the hamster mRNA. At least five intervening sequences are present, of approximate sizes: 0.3, 2.5, 8.6, 2.6 and 9.4 kb. Four sequences from highly repeated families are situated in introns within the dhfr gene. The overall structure of this gene is strikingly similar to that of the mouse. Evolutionary conservation of interrupted gene structure among mammals thus extends to genes that code for household enzymes as well as specialized or structural proteins.

  12. Real-Time PCR for Dihydrofolate Reductase Gene Single-Nucleotide Polymorphisms in Plasmodium vivax Isolates

    PubMed Central

    Brega, Sara; de Monbrison, Frédérique; Severini, Carlo; Udomsangpetch, Rachanee; Sutanto, Inge; Ruckert, Paul; Peyron, François; Picot, Stéphane

    2004-01-01

    Mutations in the dhfr gene of Plasmodium vivax (pvdhfr) are associated with resistance to the antifolate antimalarial drugs. Polymorphisms in the pvdhfr gene were assessed by hybridization probe technology on the LightCycler instrument with 134 P. vivax-infected blood samples from Turkey (n = 24), Azerbaijan (n = 39), Thailand (n = 16), Indonesia (n = 53), and travelers (n = 19). Double mutations (S58R and S117N) or quadruple mutations (F57L/I, S58R, T61M, and S117N) in the pvdhfr genes were found in all Thai samples (100%). pvdhfr mutant-type alleles were significantly more common in samples from travelers (42%) than in those from patients from Indonesia (5%). Surprisingly, the pvdhfr single-mutation allele (S117N) was identified at a high frequency in parasites from Turkey and Azerbaijan (71 and 36%, respectively), where sulfadoxine-pyrimethamine is not recommended for the treatment of P. vivax malaria by the World Health Organization and the Malaria National Programs. PMID:15215112

  13. Mutations in Plasmodium falciparum dihydrofolate reductase and dihydropteroate synthase genes in Senegal.

    PubMed

    Ndiaye, D; Daily, J P; Sarr, O; Ndir, O; Gaye, O; Mboup, S; Wirth, D F

    2005-11-01

    Senegal recently (2004) switched to sulfadoxine-pyrimethamine (SP) with amodiaquine as first line therapy for malaria in response to increasing chloroquine resistance. In anticipation of emerging resistance to SP as a result of this change in drug pressure, we set out to define the baseline prevalence of SP-associated mutations in the dhfr and dhps genes in Plasmodium falciparum using geographically diverse and longitudinally collected samples. A total of 153 blood samples were analysed from patients (5 years or older) with mild malaria after informed consent was obtained. Longitudinal samples were collected between 2000 and 2003 in Pikine, a suburb of Dakar. Geographically diverse site sampling was carried out in 2003. The mutation prevalence in DHFR codons 51, 59 and 108 is 65%, 61% and 78% in Pikine, 2003. The overall prevalence of the triple mutation that is associated with high-level pyrimethamine resistance is 61%. The mutation prevalence rate in DHPS codons 436 and 437 is 21% and 40%, respectively. There is significant geographic variation in genotypic resistance, as samples from Pikine in 2003 had higher mutation prevalence in the pfdhfr and pfdhps genes compared to samples from Tambacounda (P < 0.015). In summary, this study demonstrates a high background prevalence of SP resistance mutations already present in P. falciparum in Senegal.

  14. STRUCTURE OF THE TYPE III PANTOTHENATE KINASE FROM Bacillus anthracis AT 2.0 Å RESOLUTION

    PubMed Central

    Nicely, Nathan I.; Parsonage, Derek; Paige, Carleitta; Newton, Gerald L.; Fahey, Robert C.; Leonardi, Roberta; Jackowski, Suzanne; Mallett, T. Conn; Claiborne, Al

    2008-01-01

    Coenzyme A (CoASH) is the major low-molecular weight thiol in Staphylococcus aureus and a number of other bacteria; the crystal structure of the S. aureus coenzyme A-disulfide reductase (CoADR), which maintains the reduced intracellular state of CoASH, has recently been reported [Mallett, T.C., Wallen, J.R., Karplus, P.A., Sakai, H., Tsukihara, T., and Claiborne, A. (2006) Biochemistry 45, 11278-11289]. In this report we demonstrate that CoASH is the major thiol in Bacillus anthracis; a bioinformatics analysis indicates that three of the four proteins responsible for the conversion of pantothenate (Pan) to CoASH in Escherichia coli are conserved in B. anthracis. In contrast, a novel type III pantothenate kinase (PanK) catalyzes the first committed step in the biosynthetic pathway in B. anthracis; unlike the E. coli type I PanK, this enzyme is not subject to feedback inhibition by CoASH. The crystal structure of B. anthracis PanK (BaPanK), solved using multiwavelength anomalous dispersion data and refined at a resolution of 2.0 Å, demonstrates that BaPanK is a new member of the Acetate and Sugar Kinase/Hsc70/Actin (ASKHA) superfamily. The Pan and ATP substrates have been modeled into the active-site cleft; in addition to providing a clear rationale for the absence of CoASH inhibition, analysis of the Pan-binding pocket has led to the development of two new structure-based motifs (the PAN and INTERFACE motifs). Our analyses also suggest that the type III PanK in the spore-forming B. anthracis plays an essential role in the novel thiol/disulfide redox biology of this category A biodefense pathogen. PMID:17323930

  15. Bacillus anthracis factors for phagosomal escape.

    PubMed

    Tonello, Fiorella; Zornetta, Irene

    2012-07-01

    The mechanism of phagosome escape by intracellular pathogens is an important step in the infectious cycle. During the establishment of anthrax, Bacillus anthracis undergoes a transient intracellular phase in which spores are engulfed by local phagocytes. Spores germinate inside phagosomes and grow to vegetative bacilli, which emerge from their resident intracellular compartments, replicate and eventually exit from the plasma membrane. During germination, B. anthracis secretes multiple factors that can help its resistance to the phagocytes. Here the possible role of B. anthracis toxins, phospholipases, antioxidant enzymes and capsules in the phagosomal escape and survival, is analyzed and compared with that of factors of other microbial pathogens involved in the same type of process.

  16. Morphogenesis of the Bacillus anthracis Spore▿

    PubMed Central

    Giorno, Rebecca; Bozue, Joel; Cote, Christopher; Wenzel, Theresa; Moody, Krishna-Sulayman; Mallozzi, Michael; Ryan, Matthew; Wang, Rong; Zielke, Ryszard; Maddock, Janine R.; Friedlander, Arthur; Welkos, Susan; Driks, Adam

    2007-01-01

    Bacillus spp. and Clostridium spp. form a specialized cell type, called a spore, during a multistep differentiation process that is initiated in response to starvation. Spores are protected by a morphologically complex protein coat. The Bacillus anthracis coat is of particular interest because the spore is the infective particle of anthrax. We determined the roles of several B. anthracis orthologues of Bacillus subtilis coat protein genes in spore assembly and virulence. One of these, cotE, has a striking function in B. anthracis: it guides the assembly of the exosporium, an outer structure encasing B. anthracis but not B. subtilis spores. However, CotE has only a modest role in coat protein assembly, in contrast to the B. subtilis orthologue. cotE mutant spores are fully virulent in animal models, indicating that the exosporium is dispensable for infection, at least in the context of a cotE mutation. This has implications for both the pathophysiology of the disease and next-generation therapeutics. CotH, which directs the assembly of an important subset of coat proteins in B. subtilis, also directs coat protein deposition in B. anthracis. Additionally, however, in B. anthracis, CotH effects germination; in its absence, more spores germinate than in the wild type. We also found that SpoIVA has a critical role in directing the assembly of the coat and exosporium to an area around the forespore. This function is very similar to that of the B. subtilis orthologue, which directs the assembly of the coat to the forespore. These results show that while B. anthracis and B. subtilis rely on a core of conserved morphogenetic proteins to guide coat formation, these proteins may also be important for species-specific differences in coat morphology. We further hypothesize that variations in conserved morphogenetic coat proteins may play roles in taxonomic variation among species. PMID:17114257

  17. Specific identification of Bacillus anthracis strains

    NASA Astrophysics Data System (ADS)

    Krishnamurthy, Thaiya; Deshpande, Samir; Hewel, Johannes; Liu, Hongbin; Wick, Charles H.; Yates, John R., III

    2007-01-01

    Accurate identification of human pathogens is the initial vital step in treating the civilian terrorism victims and military personnel afflicted in biological threat situations. We have applied a powerful multi-dimensional protein identification technology (MudPIT) along with newly generated software termed Profiler to identify the sequences of specific proteins observed for few strains of Bacillus anthracis, a human pathogen. Software termed Profiler was created to initially screen the MudPIT data of B. anthracis strains and establish the observed proteins specific for its strains. A database was also generated using Profiler containing marker proteins of B. anthracis and its strains, which in turn could be used for detecting the organism and its corresponding strains in samples. Analysis of the unknowns by our methodology, combining MudPIT and Profiler, led to the accurate identification of the anthracis strains present in samples. Thus, a new approach for the identification of B. anthracis strains in unknown samples, based on the molecular mass and sequences of marker proteins, has been ascertained.

  18. Environmental sampling for spores of Bacillus anthracis.

    PubMed

    Teshale, Eyasu H; Painter, John; Burr, Gregory A; Mead, Paul; Wright, Scott V; Cseh, Larry F; Zabrocki, Ronald; Collins, Rick; Kelley, Kathy A; Hadler, James L; Swerdlow, David L

    2002-10-01

    On November 11, 2001, following the bioterrorism-related anthrax attacks, the U.S. Postal Service collected samples at the Southern Connecticut Processing and Distribution Center; all samples were negative for Bacillus anthracis. After a patient in Connecticut died from inhalational anthrax on November 19, the center was sampled again on November 21 and 25 by using dry and wet swabs. All samples were again negative for B. anthracis. On November 28, guided by information from epidemiologic investigation, we sampled the site extensively with wet wipes and surface vacuum sock samples (using HEPA vacuum). Of 212 samples, 6 (3%) were positive, including one from a highly contaminated sorter. Subsequently B. anthracis was also detected in mail-sorting bins used for the patient's carrier route. These results suggest cross-contaminated mail as a possible source of anthrax for the inhalational anthrax patient in Connecticut. In future such investigations, extensive sampling guided by epidemiologic data is imperative.

  19. Structure-based design of pteridine reductase inhibitors targeting African sleeping sickness and the leishmaniases.

    PubMed

    Tulloch, Lindsay B; Martini, Viviane P; Iulek, Jorge; Huggan, Judith K; Lee, Jeong Hwan; Gibson, Colin L; Smith, Terry K; Suckling, Colin J; Hunter, William N

    2010-01-14

    Pteridine reductase (PTR1) is a target for drug development against Trypanosoma and Leishmania species, parasites that cause serious tropical diseases and for which therapies are inadequate. We adopted a structure-based approach to the design of novel PTR1 inhibitors based on three molecular scaffolds. A series of compounds, most newly synthesized, were identified as inhibitors with PTR1-species specific properties explained by structural differences between the T. brucei and L. major enzymes. The most potent inhibitors target T. brucei PTR1, and two compounds displayed antiparasite activity against the bloodstream form of the parasite. PTR1 contributes to antifolate drug resistance by providing a molecular bypass of dihydrofolate reductase (DHFR) inhibition. Therefore, combining PTR1 and DHFR inhibitors might improve therapeutic efficacy. We tested two new compounds with known DHFR inhibitors. A synergistic effect was observed for one particular combination highlighting the potential of such an approach for treatment of African sleeping sickness.

  20. Bovine Bacillus anthracis in Cameroon ▿ †

    PubMed Central

    Pilo, Paola; Rossano, Alexandra; Bamamga, Hamadou; Abdoulkadiri, Souley; Perreten, Vincent; Frey, Joachim

    2011-01-01

    Bovine Bacillus anthracis isolates from Cameroon were genetically characterized. They showed a strong homogeneity, and they belong, together with strains from Chad, to cluster Aβ, which appears to be predominant in western Africa. However, one strain that belongs to a newly defined clade (D) and cluster (D1) is penicillin resistant and shows certain phenotypes typical of Bacillus cereus. PMID:21705535

  1. Formation of Spheroplasts from Bacillus anthracis

    PubMed Central

    Chatterjee, B. R.; Williams, Robert P.

    1965-01-01

    Chatterjee, B. R. (Baylor University College of Medicine, Houston, Tex.), and Robert P. Williams. Formation of spheroplasts from Bacillus anthracis. J. Bacteriol. 89:1128–1133. 1965.—Spheroplasts were prepared from Bacillus anthracis by combined treatment with lysozyme and glycine. Glycine, at a final concentration of 3%, was added to cultures of B. anthracis in nutrient broth that had grown at 37 C for 16 to 18 hr under 50% CO2. After additional incubation under CO2 for 2 hr, lysozyme, at the appropriate concentration (50 to 100 μg/ml), and sucrose, to a concentration of 15%, were added, and incubation was continued for 2 to 6 hr in CO2. At the end of this period, incubation in CO2 was discontinued. Spheroplasts formed after incubation in air for 6 to 12 hr. Lysozyme alone exhibited the same effect when added at much higher concentrations (500 to 2,000 μg/ml) to cultures growing under CO2. No spheroplasts formed when cultures were treated with glycine alone. Treatment with lysozyme was more effective on smooth strains than rough. Cells from young cultures were more susceptible to lysozyme than older cells. CO2 apparently was essential for formation of spheroplasts from B. anthracis. Images PMID:14276107

  2. Methyl Iodide Fumigation of Bacillus anthracis Spores.

    PubMed

    Sutton, Mark; Kane, Staci R; Wollard, Jessica R

    2015-09-01

    Fumigation techniques such as chlorine dioxide, vaporous hydrogen peroxide, and paraformaldehyde previously used to decontaminate items, rooms, and buildings following contamination with Bacillus anthracis spores are often incompatible with materials (e.g., porous surfaces, organics, and metals), causing damage or residue. Alternative fumigation with methyl bromide is subject to U.S. and international restrictions due to its ozone-depleting properties. Methyl iodide, however, does not pose a risk to the ozone layer and has previously been demonstrated as a fumigant for fungi, insects, and nematodes. Until now, methyl iodide has not been evaluated against Bacillus anthracis. Sterne strain Bacillus anthracis spores were subjected to methyl iodide fumigation at room temperature and at 550C. Efficacy was measured on a log-scale with a 6-log reduction in CFUs being considered successful compared to the U.S. Environmental Protection Agency biocide standard. Such efficacies were obtained after just one hour at 55 °C and after 12 hours at room temperature. No detrimental effects were observed on glassware, PTFE O-rings, or stainless steel. This is the first reported efficacy of methyl iodide in the reduction of Bacillus anthracis spore contamination at ambient and elevated temperatures.

  3. Comparative Secretome Analyses of Three Bacillus anthracis Strains with Variant Plasmid Contents

    PubMed Central

    Lamonica, Janine M.; Wagner, MaryAnn; Eschenbrenner, Michel; Williams, Leanne E.; Miller, Tabbi L.; Patra, Guy; DelVecchio, Vito G.

    2005-01-01

    Bacillus anthracis, the causative agent of anthrax, secretes numerous proteins into the extracellular environment during infection. A comparative proteomic approach was employed to elucidate the differences among the extracellular proteomes (secretomes) of three isogenic strains of B. anthracis that differed solely in their plasmid contents. The strains utilized were the wild-type virulent B. anthracis RA3 (pXO1+ pXO2+) and its two nonpathogenic derivative strains: the toxigenic, nonencapsulated RA3R (pXO1+ pXO2−) and the totally cured, nontoxigenic, nonencapsulated RA3:00 (pXO1− pXO2−). Comparative proteomics using two-dimensional gel electrophoresis followed by computer-assisted gel image analysis was performed to reveal unique, up-regulated, or down-regulated secretome proteins among the strains. In total, 57 protein spots, representing 26 different proteins encoded on the chromosome or pXO1, were identified by peptide mass fingerprinting. S-layer-derived proteins, such as Sap and EA1, were most frequently observed. Many sporulation-associated enzymes were found to be overexpressed in strains containing pXO1+. This study also provides evidence that pXO2 is necessary for the maximal expression of the pXO1-encoded toxins lethal factor (LF), edema factor (EF), and protective antigen (PA). Several newly identified putative virulence factors were observed; these include enolase, a high-affinity zinc uptake transporter, the peroxide stress-related alkyl hydroperoxide reductase, isocitrate lyase, and the cell surface protein A. PMID:15908394

  4. Morphogenesis of the Bacillus anthracis Spore

    DTIC Science & Technology

    2007-02-01

    layers in B. subtilis is unknown. Unlike B. subtilis, in B. anthracis, Bacillus megaterium , and other species, the spore is surrounded by an additional...nonpathogenic species including B. megaterium and Bacillus odysseyi (45, 85), suggesting that their primary role need not be in disease. Nonetheless, the exospo...S. 1994. Prime time for Bacillus megaterium . Microbiology 140:1001– 1013. 86. Warth, A. D., D. F. Ohye, and W. G. Murrell. 1963. The composition and

  5. Fatal meningoencephalitis due to Bacillus anthracis.

    PubMed

    Kwong, K L; Que, T L; Wong, S N; So, K T

    1997-12-01

    We report the first case of fatal anthrax meningoencephalitis in Hong Kong over the past 60 years. A 13 year-old boy presented with right lower quadrant pain, diarrhoea and progressive headache. Lumbar puncture yielded gram positive bacilli initially thought to be Bacillus cereus, a contaminant. He was treated with ampicillin and cefotaxime, but died 3 days after hospitalization. The organism isolated from blood and cerebrospinal fluid was later identified as Bacillus anthracis.

  6. Quinone Reductase 2 Is a Catechol Quinone Reductase

    SciTech Connect

    Fu, Yue; Buryanovskyy, Leonid; Zhang, Zhongtao

    2008-09-05

    The functions of quinone reductase 2 have eluded researchers for decades even though a genetic polymorphism is associated with various neurological disorders. Employing enzymatic studies using adrenochrome as a substrate, we show that quinone reductase 2 is specific for the reduction of adrenochrome, whereas quinone reductase 1 shows no activity. We also solved the crystal structure of quinone reductase 2 in complexes with dopamine and adrenochrome, two compounds that are structurally related to catecholamine quinones. Detailed structural analyses delineate the mechanism of quinone reductase 2 specificity toward catechol quinones in comparison with quinone reductase 1; a side-chain rotational difference between quinone reductase 1 and quinone reductase 2 of a single residue, phenylalanine 106, determines the specificity of enzymatic activities. These results infer functional differences between two homologous enzymes and indicate that quinone reductase 2 could play important roles in the regulation of catecholamine oxidation processes that may be involved in the etiology of Parkinson disease.

  7. Interactions between Bacillus anthracis and Plants May Promote Anthrax Transmission

    PubMed Central

    Ganz, Holly H.; Turner, Wendy C.; Brodie, Eoin L.; Kusters, Martina; Shi, Ying; Sibanda, Heniritha; Torok, Tamas; Getz, Wayne M.

    2014-01-01

    Environmental reservoirs are essential in the maintenance and transmission of anthrax but are poorly characterized. The anthrax agent, Bacillus anthracis was long considered an obligate pathogen that is dormant and passively transmitted in the environment. However, a growing number of laboratory studies indicate that, like some of its close relatives, B. anthracis has some activity outside of its vertebrate hosts. Here we show in the field that B. anthracis has significant interactions with a grass that could promote anthrax spore transmission to grazing hosts. Using a local, virulent strain of B. anthracis, we performed a field experiment in an enclosure within a grassland savanna. We found that B. anthracis increased the rate of establishment of a native grass (Enneapogon desvauxii) by 50% and that grass seeds exposed to blood reached heights that were 45% taller than controls. Further we detected significant effects of E. desvauxii, B. anthracis, and their interaction on soil bacterial taxa richness and community composition. We did not find any evidence for multiplication or increased longevity of B. anthracis in bulk soil associated with grass compared to controls. Instead interactions between B. anthracis and plants may result in increased host grazing and subsequently increased transmission to hosts. PMID:24901846

  8. Genome Sequence of Bacillus anthracis Strain Tangail-1 from Bangladesh

    PubMed Central

    Rume, Farzana Islam; Braun, Peter; Biswas, Paritosh Kumar; Yasmin, Mahmuda; Grass, Gregor; Ahsan, Chowdhury Rafiqul; Hanczaruk, Matthias

    2016-01-01

    Soil was collected in July 2013 at a site where a cow infected with anthrax had been the month before. Selective culturing yielded Bacillus anthracis strain Tangail-1. Here, we report the draft genome sequence of this Bacillus anthracis isolate that belongs to the canonical A.Br.001/002 clade. PMID:27469968

  9. New transposon delivery plasmids for insertional mutagenesis in Bacillus anthracis

    PubMed Central

    Wilson, Adam C.; Perego, Marta; Hoch, James A.

    2007-01-01

    Two new transposon delivery vector systems utilizing Mariner and mini-Tn10 transposons have been developed for in vivo insertional mutagenesis in Bacillus anthracis and other compatible Gram-positive species. The utility of both systems was directly demonstrated through the mutagenesis of a widely used B. anthracis strain. PMID:17931726

  10. Bacillus anthracis aerosolization associated with a contaminated mail sorting machine.

    PubMed

    Dull, Peter M; Wilson, Kathy E; Kournikakis, Bill; Whitney, Ellen A S; Boulet, Camille A; Ho, Jim Y W; Ogston, Jim; Spence, Mel R; McKenzie, Megan M; Phelan, Maureen A; Popovic, Tanja; Ashford, David

    2002-10-01

    On October 12, 2001, two envelopes containing Bacillus anthracis spores passed through a sorting machine in a postal facility in Washington, D.C. When anthrax infection was identified in postal workers 9 days later, the facility was closed. To determine if exposure to airborne B. anthracis spores continued to occur, we performed air sampling around the contaminated sorter. One CFU of B. anthracis was isolated from 990 L of air sampled before the machine was activated. Six CFUs were isolated during machine activation and processing of clean dummy mail. These data indicate that an employee working near this machine might inhale approximately 30 B. anthracis-containing particles during an 8-h work shift. What risk this may have represented to postal workers is not known, but this estimate is approximately 20-fold less than a previous estimate of sub-5 micro m B. anthracis-containing particles routinely inhaled by asymptomatic, unvaccinated workers in a goat-hair mill.

  11. Identifying experimental surrogates for Bacillus anthracis spores: a review

    PubMed Central

    2010-01-01

    Bacillus anthracis, the causative agent of anthrax, is a proven biological weapon. In order to study this threat, a number of experimental surrogates have been used over the past 70 years. However, not all surrogates are appropriate for B. anthracis, especially when investigating transport, fate and survival. Although B. atrophaeus has been widely used as a B. anthracis surrogate, the two species do not always behave identically in transport and survival models. Therefore, we devised a scheme to identify a more appropriate surrogate for B. anthracis. Our selection criteria included risk of use (pathogenicity), phylogenetic relationship, morphology and comparative survivability when challenged with biocides. Although our knowledge of certain parameters remains incomplete, especially with regards to comparisons of spore longevity under natural conditions, we found that B. thuringiensis provided the best overall fit as a non-pathogenic surrogate for B. anthracis. Thus, we suggest focusing on this surrogate in future experiments of spore fate and transport modelling. PMID:21092338

  12. Functional analysis of Plasmodium vivax dihydrofolate reductase-thymidylate synthase genes through stable transformation of Plasmodium falciparum.

    PubMed

    Auliff, Alyson M; Balu, Bharath; Chen, Nanhua; O'Neil, Michael T; Cheng, Qin; Adams, John H

    2012-01-01

    Mechanisms of drug resistance in Plasmodium vivax have been difficult to study partially because of the difficulties in culturing the parasite in vitro. This hampers monitoring drug resistance and research to develop or evaluate new drugs. There is an urgent need for a novel method to study mechanisms of P. vivax drug resistance. In this paper we report the development and application of the first Plasmodium falciparum expression system to stably express P. vivax dhfr-ts alleles. We used the piggyBac transposition system for the rapid integration of wild-type, single mutant (117N) and quadruple mutant (57L/58R/61M/117T) pvdhfr-ts alleles into the P. falciparum genome. The majority (81%) of the integrations occurred in non-coding regions of the genome; however, the levels of pvdhfr transcription driven by the P. falciparum dhfr promoter were not different between integrants of non-coding and coding regions. The integrated quadruple pvdhfr mutant allele was much less susceptible to antifolates than the wild-type and single mutant pvdhfr alleles. The resistance phenotype was stable without drug pressure. All the integrated clones were susceptible to the novel antifolate JPC-2067. Therefore, the piggyBac expression system provides a novel and important tool to investigate drug resistance mechanisms and gene functions in P. vivax.

  13. Structure of the Type III Pantothenate Kinase from Bacillus Anthracis at 2.0 A Resolution: Implications for Coenzyme A-Dependent Redox Biology

    SciTech Connect

    Nicely,N.; Parsonage, D.; Paige, C.; Newton, G.; Fahey, R.; Leonardi, R.; Jackowski, S.; Mallett, T.; Claiborne, A.

    2007-01-01

    Coenzyme A (CoASH) is the major low-molecular weight thiol in Staphylococcus aureus and a number of other bacteria; the crystal structure of the S. aureus coenzyme A-disulfide reductase (CoADR), which maintains the reduced intracellular state of CoASH, has recently been reported [Mallett, T.C., Wallen, J.R., Karplus, P.A., Sakai, H., Tsukihara, T., and Claiborne, A. (2006) Biochemistry 45, 11278-89]. In this report we demonstrate that CoASH is the major thiol in Bacillus anthracis; a bioinformatics analysis indicates that three of the four proteins responsible for the conversion of pantothenate (Pan) to CoASH in Escherichia coli are conserved in B. anthracis. In contrast, a novel type III pantothenate kinase (PanK) catalyzes the first committed step in the biosynthetic pathway in B. anthracis; unlike the E. coli type I PanK, this enzyme is not subject to feedback inhibition by CoASH. The crystal structure of B. anthracis PanK (BaPanK), solved using multiwavelength anomalous dispersion data and refined at a resolution of 2.0 {angstrom}, demonstrates that BaPanK is a new member of the Acetate and Sugar Kinase/Hsc70/Actin (ASKHA) superfamily. The Pan and ATP substrates have been modeled into the active-site cleft; in addition to providing a clear rationale for the absence of CoASH inhibition, analysis of the Pan-binding pocket has led to the development of two new structure-based motifs (the PAN and INTERFACE motifs). Our analyses also suggest that the type III PanK in the spore-forming B. anthracis plays an essential role in the novel thiol/disulfide redox biology of this category A biodefense pathogen.

  14. Real-Time PCR Identification of Unique Bacillus anthracis Sequences.

    PubMed

    Cieślik, P; Knap, J; Kolodziej, M; Mirski, T; Joniec, J; Graniak, G; Zakowska, D; Winnicka, I; Bielawska-Drózd, A

    2015-01-01

    Bacillus anthracis is a spore-forming, Gram-positive microorganism. It is a causative agent of anthrax, a highly infectious disease. It belongs to the "Bacillus cereus group", which contains other closely related species, including Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus weihenstephanensis, and Bacillus pseudomycoides. B. anthracis naturally occurs in soil environments. The BA5345 genetic marker was used for highly specific detection of B. anthracis with TaqMan probes. The detection limit of a real-time PCR assay was estimated at the level of 16.9 copies (CI95% - 37.4 to 37.86, SD = 0.2; SE = 0.118). Oligonucleotides designed for the targeted sequences (within the tested locus) revealed 100 % homology to B. anthracis strain reference sequences deposited in the database (NCBI) and high specificity to all tested B. anthracis strains. Additional in silico analysis of plasmid markers pag and cap genes with B. anthracis strains included in the database was carried out. Our study clearly indicates that the BA5345 marker can be used with success as a chromosomal marker in routine identification of B. anthracis; moreover, detection of plasmid markers indicates virulence of the examined strains.

  15. Inadvertent laboratory exposure to Bacillus anthracis--California, 2004.

    PubMed

    2005-04-01

    On June 9, 2004, the California Department of Health Services (CDHS) was notified of possible inadvertent exposure to Bacillus anthracis spores at Children's Hospital Oakland Research Institute (CHORI), where workers were evaluating the immune response of mice to B. anthracis. This report summarizes the subsequent investigation by CDHS and CDC, including assessment of exposures, administration of postexposure chemoprophylaxis, and serologic testing of potentially exposed workers. The findings underscore the importance of using appropriate biosafety practices and performing adequate sterility testing when working with material believed to contain inactivated B. anthracis organisms.

  16. Murine Macrophages Kill the Vegetative Form of Bacillus anthracis

    DTIC Science & Technology

    2005-08-18

    inhibitor of the germination of B. anthracis and Bacillus cereus spores. It converts L-alanine to D-alanine, an isomer that is not recognized by...nation of Bacillus cereus spores in response to L-alanine and to inosine: the roles of gerL and gerQ operons. Microbiology 148:2089–2095. 5. Dixon, T...anthracis. J. Appl. Bacteriol. 62:269–273. 32. Todd, S. J., A. J. Moir, M. J. Johnson, and A. Moir. 2003. Genes of Bacillus cereus and Bacillus anthracis

  17. Inactivation of Bacillus anthracis Spores in Soil Matrices with ...

    EPA Pesticide Factsheets

    Report This report documents the results of a laboratory study designed to better understand the effectiveness of chlorine dioxide (ClO2) gas to decontaminate soil materials contaminated with Bacillus anthracis spores.

  18. Composite Sampling of a Bacillus anthracis Surrogate with ...

    EPA Pesticide Factsheets

    Journal Article A series of experiments were conducted to explore the utility of composite-based collection of surface samples for the detection of a Bacillus anthracis surrogate using cellulose sponge samplers on a stainless steel surface.

  19. Genetic Characterization of Bacillus anthracis 17 JB strain

    PubMed Central

    Seyed-Mohamadi, Sakineh; Moradi Bidhendi, Soheila; Tadayon, Keyvan; Ghaderi, Rainak

    2015-01-01

    Background and Objectives: Bacillus anthracis is one of the most homogenous bacteria ever described. Some level of diversity. Bacillus anthracis 17JB is a laboratory strain It is broadly used as a challenge strain in guinea pigs for potency test of anthrax vaccine. Material and Methods: This work describes genetic characterization of B. anthracis 17 JB strain using the SNPs and MLVA genotyping. Results and Conclusion: In SNPs typing, the originally French 17JB strain represented the A.Br. 008/009 subgroup. In Levy's genotyping method, 843, 451 and 864 bp long fragments were identified at AA03, AJ03 and AA07 loci, respectively. In the vaccine manufacturer perspective these findings are much valuable on their own account, but similar research is required to extend molecular knowledge of B. anthracis epidemiology in Persia. PMID:26668705

  20. Protocol for Detection of Bacillus anthracis in Environmental Samples

    EPA Pesticide Factsheets

    This pProtocol Method describes proceduresintended for the analyses of swabs, wipes, Sponge-Sticks, vacuum socks and filters, air filters, drinking water, and decontamination waste water for Bacillus anthracis spores.

  1. Inactivation of Bacillus Anthracis Spores Using Carbon Nanotubes

    DTIC Science & Technology

    2014-10-30

    2010 31-May-2014 Approved for Public Release; Distribution Unlimited Final Report: (Life Science Division/Biochemistry) Inactivation of Bacillus ...S) AND ADDRESS (ES) U.S. Army Research Office P.O. Box 12211 Research Triangle Park, NC 27709-2211 Bacillus Anthracis, Spores, Biofilm, Inhibition...Biochemistry) Inactivation of Bacillus Anthracis Spores Using Carbon Nanotubes Report Title The Specific Aims of the project were to investigate: 1) the

  2. Application of paramagnetic beads for purifying Bacillus anthracis protective antigen.

    PubMed

    Zarzecka, A; Bartoszcze, M

    2006-10-01

    Paramagnetic beads coated with Protein G and Tosylactivated-280 dynabeads have been used to purify Bacillus anthracis protective antigen from a liquid culture. The obtained protein was used in the enzyme-linked immunosorbent assay test to detect B. anthracis protective antigen antibodies in human sera collected from immunized individuals. The purification method using paramagnetic beads is very effective. It is fast, easy and may be carried out practically in any laboratory.

  3. Processing, Assembly and Localization of a Bacillus anthracis Spore Protein

    DTIC Science & Technology

    2010-01-01

    anthracis (but not, for example, Bacillus megaterium ), a series of fine hair-like projections, also called a nap, extends from the exosporium (Aronson...3373–3378. Vary, P. S. (1994). Prime time for Bacillus megaterium . Microbiology 140, 1001–1013. Welkos, S. L., Cote, C. K., Rea, K. M. & Gibbs, P. H...Processing, assembly and localization of a Bacillus anthracis spore protein K. L. Moody,13 A. Driks,2 G. L. Rother,1 C. K. Cote,1 E. E. Brueggemann,3

  4. Development of a Manual Threshold Immunoassay for Bacillus anthracis Spores

    DTIC Science & Technology

    2005-11-01

    detected by the LAPS. The MT has been developed to detect several BW agents including ricin, Brucella melitensis (Lee et al., 2000), Venezuelan...and B. globigii. B. anthracis is closely related to B. cereus and B. thuringiensis, and they all produce a structurally similar exosporium (Steichen et...Jr. (2005). Orientation within the exosporium and structural stability of the collagen-like glycoprotein BclA of Bacillus anthracis. J Bacteriol

  5. Microarray-based Resequencing of Multiple Bacillus anthracis Isolates

    DTIC Science & Technology

    2004-12-17

    The major technical challenge facing RA-based resequencing Radial tree showing inferred phylogenetic relationships of B. anthracis strains from this...studyFigure 3 Radial tree showing inferred phylogenetic relationships of B. anthracis strains from this study. The 37 variable positions identified in... Phylogenetic tree inference The 37 variable positions identified in this study were con- catenated together to create artificial sequence types. A DNA

  6. Decontamination after a release of B. anthracis spores.

    PubMed

    Campbell, Chris G; Kirvel, Robert D; Love, Adam H; Bailey, Christopher G; Miles, Robin; Schweickert, Jerry; Sutton, Mark; Raber, Ellen

    2012-03-01

    Decontaminating civilian facilities or large urban areas following an attack with Bacillus anthracis poses daunting challenges because of the lack of resources and proven technologies. Nevertheless, lessons learned from the 2001 cleanups together with advances derived from recent research have improved our understanding of what is required for effective decontamination. This article reviews current decontamination technologies appropriate for use in outdoor environments, on material surfaces, within large enclosed spaces, in water, and on waste contaminated with aerosolized B. anthracis spores.

  7. Phenotypic and functional characterization of Bacillus anthracis biofilms.

    PubMed

    Lee, Keehoon; Costerton, J W; Ravel, Jacques; Auerbach, Raymond K; Wagner, David M; Keim, Paul; Leid, Jeff G

    2007-06-01

    Biofilms, communities of micro-organisms attached to a surface, are responsible for many chronic diseases and are often associated with environmental reservoirs or lifestyles. Bacillus anthracis is a Gram-positive, endospore-forming bacterium and is the aetiological agent of pulmonary, gastrointestinal and cutaneous anthrax. Anthrax infections are part of the natural lifecycle of many ruminants in North America, including cattle and bison, and B. anthracis is thought to be a central part of this ecosystem. However, in endemic areas in which humans and livestock interact, chronic cases of cutaneous anthrax are commonly reported. This suggests that biofilms of B. anthracis exist in the environment and are part of the ecology associated with its lifecycle. Currently, there are few data that account for the importance of the biofilm mode of life in B. anthracis, yet biofilms have been characterized in other pathogenic and non-pathogenic Bacillus species, including Bacillus cereus and Bacillus subtilis, respectively. This study investigated the phenotypic and functional role of biofilms in B. anthracis. The results demonstrate that B. anthracis readily forms biofilms which are inherently resistant to commonly prescribed antibiotics, and that antibiotic resistance is not solely the function of sporulation.

  8. Phosphate starvation enhances the pathogenesis of Bacillus anthracis.

    PubMed

    Aggarwal, Somya; Somani, Vikas Kumar; Bhatnagar, Rakesh

    2015-09-01

    Identifying the factors responsible for survival and virulence of Bacillus anthracis within the host is prerequisite for the development of therapeutics against anthrax. Host provides several stresses as well as many advantages to the invading pathogen. Inorganic phosphate (Pi) starvation within the host has been considered as one of the major contributing factors in the establishment of infection by pathogenic microorganisms. Here, we report for the first time that Pi fluctuation encountered by B. anthracis at different stages of its life cycle within the host, contributes significantly in its pathogenesis. In this study, Pi starvation was found to hasten the onset of infection cycle by promoting spore germination. After germination, it was found to impede cell growth. In addition, phosphate starved bacilli showed more antibiotic tolerance. Interestingly, phosphate starvation enhanced the pathogenicity of B. anthracis by augmenting its invasiveness in macrophages in vitro. B. anthracis grown under phosphate starvation were also found to be more efficient in establishing lethal infections in mouse model as well. Phosphate starvation increased B. anthracis virulence by promoting the secretion of primary virulence factors like protective antigen (PA), lethal factor (LF) and edema factor (EF). Thus, this study affirms that besides other host mediated factors, phosphate limitation may also contribute B. anthracis for successfully establishing itself within the host. This study is a step forward in delineating its pathophysiology that might help in understanding the pathogenesis of anthrax.

  9. Production and Validation of the Use of Gamma Phage for Identification of Bacillus anthracis

    DTIC Science & Technology

    2005-09-01

    Validation of the Use of Gamma Phage for Identification of Bacillus anthracis T. G. Abshire,1 J. E. Brown,2 and J. W. Ezzell1* Diagnostic Systems...Received 5 January 2005/Returned for modification 2 April 2005/Accepted 16 April 2005 Gamma phage specifically lyses vegetative cells of Bacillus anthracis...B. anthracis strains and 49 similar non-B. anthracis Bacillus species, the analytical specificity was >95%, a value that is intentionally low because

  10. Effectiveness of Medical Defense Interventions Against Predicted Battlefield Levels of Bacillus Anthracis

    DTIC Science & Technology

    1993-10-01

    medical interventions such as vaccination and antibiotic therapy . 2 2.0 BACKGROUND 2.1 CHARACTERISTICS OF BACILLUS ANTHRACIS Anthrax is a disease that...physical characteristics of B. anthracis released as an aerosol. , The toxicology of B. anthracis without medical intervention , with antibiotic therapy , or...spores/vegetative cells of B. anthracis; the impact of a protective mask or medical intervention using pre- or post- exposure antibiotic therapy and/or

  11. Transcriptional profiling of Bacillus anthracis during infection of host macrophages.

    PubMed

    Bergman, Nicholas H; Anderson, Erica C; Swenson, Ellen E; Janes, Brian K; Fisher, Nathan; Niemeyer, Matthew M; Miyoshi, Amy D; Hanna, Philip C

    2007-07-01

    The interaction between Bacillus anthracis and the mammalian phagocyte is one of the central stages in the progression of inhalational anthrax, and it is commonly believed that the host cell plays a key role in facilitating germination and dissemination of inhaled B. anthracis spores. Given this, a detailed definition of the survival strategies used by B. anthracis within the phagocyte is critical for our understanding of anthrax. In this study, we report the first genome-wide analysis of B. anthracis gene expression during infection of host phagocytes. We developed a technique for specific isolation of bacterial RNA from within infected murine macrophages, and we used custom B. anthracis microarrays to characterize the expression patterns occurring within intracellular bacteria throughout infection of the host phagocyte. We found that B. anthracis adapts very quickly to the intracellular environment, and our analyses identified metabolic pathways that appear to be important to the bacterium during intracellular growth, as well as individual genes that show significant induction in vivo. We used quantitative reverse transcription-PCR to verify that the expression trends that we observed by microarray analysis were valid, and we chose one gene (GBAA1941, encoding a putative transcriptional regulator) for further characterization. A deletion strain missing this gene showed no phenotype in vitro but was significantly attenuated in a mouse model of inhalational anthrax, suggesting that the microarray data described here provide not only the first comprehensive view of how B. anthracis survives within the host cell but also a number of promising leads for further research in anthrax.

  12. [Isolation and identification of Bacillus anthracis in an accidental case].

    PubMed

    Wang, Zheng-Qiang; He, Jun; Su, Yu-Xin; Zhu, Hong; Duan, Qing

    2006-06-01

    During June to July 2005, a few farmers in Chengde county of Hebei province were got ill after eating beef of sick cattle. The cattle could be infected with Bacillus anthracis. One beef sample and one soil sample contaminated with cattle blood were collected and used for pathogen isolation and identification in laboratory. Two bacteria strains were isolated from beef and soil sample, respectively, and showed typical morphology of Bacillus anthracis on blood agar and under microscope with Gram stain. The two bacteria strains were also positive to standard positive serum of Bacillus anthracis by slide agglutination test. Biochemical characteristics of the two bacteria were tested using API CHB/E strip and analyzed by API software (version 3.3), result showed that the two isolated bacteria were Bacillus anthracis. Polymerase chain reaction (PCR) was used to further characterize the two isolated bacteria strains. Three pairs of primer were designed and used for PCR, and these primers exactly matched the protective antigen gene, edema factor gene and capsule gene, respectively. By analyzed on agarose gel, PCR products were 423bp, 494bp and 397bp, respectively, and this result showed that the two isolated bacteria contained two plasmids, pX01 and pX02, which encoded anthrax toxin and capsule, respectively. Anthrax toxin and capsule were very important virulent factors for Bacillus anthracis. PCR products were purified and then cloned to T vector, positive clone was chose and sequenced. By BLAST with GenBank, sequence of the three genes of the two bacteria strains had a similarity of 99% with Bacillus anthracis A2012 strain, Ames Ancestor strain and A16R strain. Based on results of colonial morphology, serum test and biochemistry characterization, the two bacteria strains are Bacillus anthracis. They can encode anthrax toxin and capsule, and are virulent to animal and human.

  13. Nano-Mechanical Properties of Heat Inactivated Bacillus anthracis and Bacillus thuringiensis Spores

    DTIC Science & Technology

    2008-03-01

    possible simulant for B. anthracis in counter-proliferation studies because it is closely related to B. anthracis and is not harmful to humans. In order...to be a good simulant in counter-proliferation studies, B. thuringiensis spores must have similar properties to B. anthracis spores. In particular...Preparation ......................32 Reflection Amplitude Curves

  14. Wide Area Recovery and Resiliency Program (WARRP) Interim Clearance Strategy for Environments Contaminated with Bacillus anthracis

    DTIC Science & Technology

    2012-07-01

    Interim Clearance Strategy for Environments Contaminated with Bacillus anthracis July 2012...WARRP) Interim Clearance Strategy for Environments Contaminated with Bacillus anthracis 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT...contains color images. 14. ABSTRACT If a Bacillus anthracis incident occurs in the United States or within its territories, the public health and

  15. Fast and Sensitive Detection of Bacillus anthracis Spores by Immunoassay

    PubMed Central

    Volland, Hervé; Dano, Julie; Lamourette, Patricia; Sylvestre, Patricia; Mock, Michèle; Créminon, Christophe

    2012-01-01

    Bacillus anthracis is one of the most dangerous potential biological weapons, and it is essential to develop a rapid and simple method to detect B. anthracis spores in environmental samples. The immunoassay is a rapid and easy-to-use method for the detection of B. anthracis by means of antibodies directed against surface spore antigens. With this objective in view, we have produced a panel of monoclonal antibodies against B. anthracis and developed colorimetric and electrochemiluminescence (ECL) immunoassays. Using Meso Scale Discovery ECL technology, which is based on electrochemiluminescence (ECL) detection utilizing a sulfo-Tag label that emits light upon electrochemical stimulation (using a dedicated ECL plate reader, an electrical current is placed across the microplate with electrodes integrated into the bottom of the plate, resulting in a series of electrically induced reactions leading to a luminescent signal), a detection limit ranging between 0.3 × 103 and 103 CFU/ml (i.e., 30 to 100 spores per test), depending on the B. anthracis strain assayed, was achieved. In complex matrices (5 mg/ml of soil or simulated powder), the detection level (without any sample purification or concentration) was never altered more than 3-fold compared with the results obtained in phosphate-buffered saline. PMID:22773632

  16. Novel giant siphovirus from Bacillus anthracis features unusual genome characteristics.

    PubMed

    Ganz, Holly H; Law, Christina; Schmuki, Martina; Eichenseher, Fritz; Calendar, Richard; Loessner, Martin J; Getz, Wayne M; Korlach, Jonas; Beyer, Wolfgang; Klumpp, Jochen

    2014-01-01

    Here we present vB_BanS-Tsamsa, a novel temperate phage isolated from Bacillus anthracis, the agent responsible for anthrax infections in wildlife, livestock and humans. Tsamsa phage is a giant siphovirus (order Caudovirales), featuring a long, flexible and non-contractile tail of 440 nm (not including baseplate structure) and an isometric head of 82 nm in diameter. We induced Tsamsa phage in samples from two different carcass sites in Etosha National Park, Namibia. The Tsamsa phage genome is the largest sequenced Bacillus siphovirus, containing 168,876 bp and 272 ORFs. The genome features an integrase/recombinase enzyme, indicative of a temperate lifestyle. Among bacterial strains tested, the phage infected only certain members of the Bacillus cereus sensu lato group (B. anthracis, B. cereus and B. thuringiensis) and exhibited moderate specificity for B. anthracis. Tsamsa lysed seven out of 25 B. cereus strains, two out of five B. thuringiensis strains and six out of seven B. anthracis strains tested. It did not lyse B. anthracis PAK-1, an atypical strain that is also resistant to both gamma phage and cherry phage. The Tsamsa endolysin features a broader lytic spectrum than the phage host range, indicating possible use of the enzyme in Bacillus biocontrol.

  17. Bacillus anthracis lethal toxin reduces human alveolar epithelial barrier function.

    PubMed

    Langer, Marybeth; Duggan, Elizabeth Stewart; Booth, John Leland; Patel, Vineet Indrajit; Zander, Ryan A; Silasi-Mansat, Robert; Ramani, Vijay; Veres, Tibor Zoltan; Prenzler, Frauke; Sewald, Katherina; Williams, Daniel M; Coggeshall, Kenneth Mark; Awasthi, Shanjana; Lupu, Florea; Burian, Dennis; Ballard, Jimmy Dale; Braun, Armin; Metcalf, Jordan Patrick

    2012-12-01

    The lung is the site of entry for Bacillus anthracis in inhalation anthrax, the deadliest form of the disease. Bacillus anthracis produces virulence toxins required for disease. Alveolar macrophages were considered the primary target of the Bacillus anthracis virulence factor lethal toxin because lethal toxin inhibits mouse macrophages through cleavage of MEK signaling pathway components, but we have reported that human alveolar macrophages are not a target of lethal toxin. Our current results suggest that, unlike human alveolar macrophages, the cells lining the respiratory units of the lung, alveolar epithelial cells, are a target of lethal toxin in humans. Alveolar epithelial cells expressed lethal toxin receptor protein, bound the protective antigen component of lethal toxin, and were subject to lethal-toxin-induced cleavage of multiple MEKs. These findings suggest that human alveolar epithelial cells are a target of Bacillus anthracis lethal toxin. Further, no reduction in alveolar epithelial cell viability was observed, but lethal toxin caused actin rearrangement and impaired desmosome formation, consistent with impaired barrier function as well as reduced surfactant production. Therefore, by compromising epithelial barrier function, lethal toxin may play a role in the pathogenesis of inhalation anthrax by facilitating the dissemination of Bacillus anthracis from the lung in early disease and promoting edema in late stages of the illness.

  18. Bacillus anthracis Lethal Toxin Reduces Human Alveolar Epithelial Barrier Function

    PubMed Central

    Langer, Marybeth; Duggan, Elizabeth Stewart; Booth, John Leland; Patel, Vineet Indrajit; Zander, Ryan A.; Silasi-Mansat, Robert; Ramani, Vijay; Veres, Tibor Zoltan; Prenzler, Frauke; Sewald, Katherina; Williams, Daniel M.; Coggeshall, Kenneth Mark; Awasthi, Shanjana; Lupu, Florea; Burian, Dennis; Ballard, Jimmy Dale; Braun, Armin

    2012-01-01

    The lung is the site of entry for Bacillus anthracis in inhalation anthrax, the deadliest form of the disease. Bacillus anthracis produces virulence toxins required for disease. Alveolar macrophages were considered the primary target of the Bacillus anthracis virulence factor lethal toxin because lethal toxin inhibits mouse macrophages through cleavage of MEK signaling pathway components, but we have reported that human alveolar macrophages are not a target of lethal toxin. Our current results suggest that, unlike human alveolar macrophages, the cells lining the respiratory units of the lung, alveolar epithelial cells, are a target of lethal toxin in humans. Alveolar epithelial cells expressed lethal toxin receptor protein, bound the protective antigen component of lethal toxin, and were subject to lethal-toxin-induced cleavage of multiple MEKs. These findings suggest that human alveolar epithelial cells are a target of Bacillus anthracis lethal toxin. Further, no reduction in alveolar epithelial cell viability was observed, but lethal toxin caused actin rearrangement and impaired desmosome formation, consistent with impaired barrier function as well as reduced surfactant production. Therefore, by compromising epithelial barrier function, lethal toxin may play a role in the pathogenesis of inhalation anthrax by facilitating the dissemination of Bacillus anthracis from the lung in early disease and promoting edema in late stages of the illness. PMID:23027535

  19. Genetic variation and linkage disequilibrium in Bacillus anthracis.

    PubMed

    Zwick, Michael E; Thomason, Maureen Kiley; Chen, Peter E; Johnson, Henry R; Sozhamannan, Shanmuga; Mateczun, Alfred; Read, Timothy D

    2011-01-01

    We performed whole-genome amplification followed by hybridization of custom-designed resequencing arrays to resequence 303 kb of genomic sequence from a worldwide panel of 39 Bacillus anthracis strains. We used an efficient algorithm contained within a custom software program, UniqueMER, to identify and mask repetitive sequences on the resequencing array to reduce false-positive identification of genetic variation, which can arise from cross-hybridization. We discovered a total of 240 single nucleotide variants (SNVs) and showed that B. anthracis strains have an average of 2.25 differences per 10,000 bases in the region we resequenced. Common SNVs in this region are found to be in complete linkage disequilibrium. These patterns of variation suggest there has been little if any historical recombination among B. anthracis strains since the origin of the pathogen. This pattern of common genetic variation suggests a framework for recognizing new or genetically engineered strains.

  20. Computational Fluid Dynamics Modeling of Bacillus anthracis ...

    EPA Pesticide Factsheets

    Journal Article Three-dimensional computational fluid dynamics and Lagrangian particle deposition models were developed to compare the deposition of aerosolized Bacillus anthracis spores in the respiratory airways of a human with that of the rabbit, a species commonly used in the study of anthrax disease. The respiratory airway geometries for each species were derived from computed tomography (CT) or µCT images. Both models encompassed airways that extended from the external nose to the lung with a total of 272 outlets in the human model and 2878 outlets in the rabbit model. All simulations of spore deposition were conducted under transient, inhalation-exhalation breathing conditions using average species-specific minute volumes. Four different exposure scenarios were modeled in the rabbit based upon experimental inhalation studies. For comparison, human simulations were conducted at the highest exposure concentration used during the rabbit experimental exposures. Results demonstrated that regional spore deposition patterns were sensitive to airway geometry and ventilation profiles. Despite the complex airway geometries in the rabbit nose, higher spore deposition efficiency was predicted in the upper conducting airways of the human at the same air concentration of anthrax spores. This greater deposition of spores in the upper airways in the human resulted in lower penetration and deposition in the tracheobronchial airways and the deep lung than that predict

  1. Use of long-range repetitive element polymorphism-PCR to differentiate Bacillus anthracis strains.

    PubMed

    Brumlik, M J; Szymajda, U; Zakowska, D; Liang, X; Redkar, R J; Patra, G; Del Vecchio, V G

    2001-07-01

    The genome of Bacillus anthracis is extremely monomorphic, and thus individual strains have often proven to be recalcitrant to differentiation at the molecular level. Long-range repetitive element polymorphism-PCR (LR REP-PCR) was used to differentiate various B. anthracis strains. A single PCR primer derived from a repetitive DNA element was able to amplify variable segments of a bacterial genome as large as 10 kb. We were able to characterize five genetically distinct groups by examining 105 B. anthracis strains of diverse geographical origins. All B. anthracis strains produced fingerprints comprising seven to eight bands, referred to as "skeleton" bands, while one to three "diagnostic" bands differentiated between B. anthracis strains. LR REP-PCR fingerprints of B. anthracis strains showed very little in common with those of other closely related species such as B. cereus, B. thuringiensis, and B. mycoides, suggesting relative heterogeneity among the non-B. anthracis strains. Fingerprints from transitional non-B. anthracis strains, which possessed the B. anthracis chromosomal marker Ba813, scarcely resembled those observed for any of the five distinct B. anthracis groups that we have identified. The LR REP-PCR method described in this report provides a simple means of differentiating B. anthracis strains.

  2. Use of Long-Range Repetitive Element Polymorphism-PCR To Differentiate Bacillus anthracis Strains

    PubMed Central

    Brumlik, Michael J.; Szymajda, Urszula; Zakowska, Dorota; Liang, Xudong; Redkar, Rajendra J.; Patra, Guy; Del Vecchio, Vito G.

    2001-01-01

    The genome of Bacillus anthracis is extremely monomorphic, and thus individual strains have often proven to be recalcitrant to differentiation at the molecular level. Long-range repetitive element polymorphism-PCR (LR REP-PCR) was used to differentiate various B. anthracis strains. A single PCR primer derived from a repetitive DNA element was able to amplify variable segments of a bacterial genome as large as 10 kb. We were able to characterize five genetically distinct groups by examining 105 B. anthracis strains of diverse geographical origins. All B. anthracis strains produced fingerprints comprising seven to eight bands, referred to as “skeleton” bands, while one to three “diagnostic” bands differentiated between B. anthracis strains. LR REP-PCR fingerprints of B. anthracis strains showed very little in common with those of other closely related species such as B. cereus, B. thuringiensis, and B. mycoides, suggesting relative heterogeneity among the non-B. anthracis strains. Fingerprints from transitional non-B. anthracis strains, which possessed the B. anthracis chromosomal marker Ba813, scarcely resembled those observed for any of the five distinct B. anthracis groups that we have identified. The LR REP-PCR method described in this report provides a simple means of differentiating B. anthracis strains. PMID:11425716

  3. Detection of the Bacillus anthracis gyrA Gene by Using a Minor Groove Binder Probe

    PubMed Central

    Hurtle, William; Bode, Elizabeth; Kulesh, David A.; Kaplan, Rebecca Susan; Garrison, Jeff; Bridge, Deanna; House, Michelle; Frye, Melissa S.; Loveless, Bonnie; Norwood, David

    2004-01-01

    Identification of chromosomal markers for rapid detection of Bacillus anthracis is difficult because significant chromosomal homology exists among B. anthracis, Bacillus cereus, and Bacillus thuringiensis. We evaluated the bacterial gyrA gene as a potential chromosomal marker for B. anthracis. A real-time PCR assay was developed for the detection of B. anthracis. After analysis of the unique nucleotide sequence of the B. anthracis gyrA gene, a fluorescent 3′ minor groove binding probe was tested with 171 organisms from 29 genera of bacteria, including 102 Bacillus strains. The assay was found to be specific for all 43 strains of B. anthracis tested. In addition, a test panel of 105 samples was analyzed to evaluate the potential diagnostic capability of the assay. The assay showed 100% specificity, demonstrating the usefulness of the gyrA gene as a specific chromosomal marker for B. anthracis. PMID:14715750

  4. Activity of Pera Safe(Trademark) Against Bacillus Anthracis Spores

    DTIC Science & Technology

    2002-01-01

    peroxide and peracetic acid . J.Appl. Bacteriol. 1983,54,417-23. 2. Dietz P., Böhm R.: Results of an experimental study on testing disinfectants with spores...Bacteriol. 1980, 48, 161-90. 5. Hussaini S.N., Ruby K.R.: Sporicidal activity of peracetic acid against Bacillus anthracis spores. Vet. Rec. 1976, 98, 257-9. ...challenging task. There exist a variety of disinfectants that can inactivate Bacillus anthracis spores; however, most of them have negative side effects

  5. Nitrate and periplasmic nitrate reductases

    PubMed Central

    Sparacino-Watkins, Courtney; Stolz, John F.; Basu, Partha

    2014-01-01

    The nitrate anion is a simple, abundant and relatively stable species, yet plays a significant role in global cycling of nitrogen, global climate change, and human health. Although it has been known for quite some time that nitrate is an important species environmentally, recent studies have identified potential medical applications. In this respect the nitrate anion remains an enigmatic species that promises to offer exciting science in years to come. Many bacteria readily reduce nitrate to nitrite via nitrate reductases. Classified into three distinct types – periplasmic nitrate reductase (Nap), respiratory nitrate reductase (Nar) and assimilatory nitrate reductase (Nas), they are defined by their cellular location, operon organization and active site structure. Of these, Nap proteins are the focus of this review. Despite similarities in the catalytic and spectroscopic properties Nap from different Proteobacteria are phylogenetically distinct. This review has two major sections: in the first section, nitrate in the nitrogen cycle and human health, taxonomy of nitrate reductases, assimilatory and dissimilatory nitrate reduction, cellular locations of nitrate reductases, structural and redox chemistry are discussed. The second section focuses on the features of periplasmic nitrate reductase where the catalytic subunit of the Nap and its kinetic properties, auxiliary Nap proteins, operon structure and phylogenetic relationships are discussed. PMID:24141308

  6. Immunoproteomically identified GBAA_0345, alkyl hydroperoxide reductase subunit C is a potential target for multivalent anthrax vaccine.

    PubMed

    Kim, Yeon Hee; Kim, Kyung Ae; Kim, Yu-Ri; Choi, Min Kyung; Kim, Hye Kyeong; Choi, Ki Ju; Chun, Jeong-Hoon; Cha, Kiweon; Hong, Kee-Jong; Lee, Na Gyong; Yoo, Cheon-Kwon; Oh, Hee-Bok; Kim, Tae Sung; Rhie, Gi-eun

    2014-01-01

    Anthrax is caused by the spore-forming bacterium Bacillus anthracis, which has been used as a weapon for bioterrorism. Although current vaccines are effective, they involve prolonged dose regimens and often cause adverse reactions. High rates of mortality associated with anthrax have made the development of an improved vaccine a top priority. To identify novel vaccine candidates, we applied an immunoproteomics approach. Using sera from convalescent guinea pigs or from human patients with anthrax, we identified 34 immunogenic proteins from the virulent B. anthracis H9401. To evaluate vaccine candidates, six were expressed as recombinant proteins and tested in vivo. Two proteins, rGBAA_0345 (alkyl hydroperoxide reductase subunit C) and rGBAA_3990 (malonyl CoA-acyl carrier protein transacylase), have afforded guinea pigs partial protection from a subsequent virulent-spore challenge. Moreover, combined vaccination with rGBAA_0345 and rPA (protective antigen) exhibited an enhanced ability to protect against anthrax mortality. Finally, we demonstrated that GBAA_0345 localizes to anthrax spores and bacilli. Our results indicate that rGBAA_0345 may be a potential component of a multivalent anthrax vaccine, as it enhances the efficacy of rPA vaccination. This is the first time that sera from patients with anthrax have been used to interrogate the proteome of virulent B. anthracis vegetative cells.

  7. Novel and unique diagnostic biomarkers for Bacillus anthracis infection.

    PubMed

    Sela-Abramovich, Sagit; Chitlaru, Theodor; Gat, Orit; Grosfeld, Haim; Cohen, Ofer; Shafferman, Avigdor

    2009-10-01

    A search for bacterium-specific biomarkers in peripheral blood following infection with Bacillus anthracis was carried out with rabbits, using a battery of specific antibodies generated by DNA vaccination against 10 preselected highly immunogenic bacterial antigens which were identified previously by a genomic/proteomic/serologic screen of the B. anthracis secretome. Detection of infection biomarkers in the circulation of infected rabbits could be achieved only after removal of highly abundant serum proteins by chromatography using a random-ligand affinity column. Besides the toxin component protective antigen, the following three secreted proteins were detected in the circulation of infected animals: the chaperone and protease HtrA (BA3660), an NlpC/P60 endopeptidase (BA1952), and a protein of unknown function harboring two SH3 (Src homology 3) domains (BA0796). The three proteins could be detected in plasma samples from infected animals exhibiting 10(3) to 10(5) CFU/ml blood and also in standard blood cultures at 3 to 6 h post-bacterial inoculation at a bacteremic level as low as 10(3) CFU/ml. Furthermore, the three biomarkers appear to be present only in the secretome of B. anthracis, not in those of the related pathogens B. thuringiensis and B. cereus. To the best of our knowledge, this is the first report of direct detection of B. anthracis-specific proteins, other than the toxin components, in the circulation of infected animals.

  8. A selective chromogenic agar that distinguishes Bacillus anthracis from Bacillus cereus and Bacillus thuringiensis.

    PubMed

    Juergensmeyer, Margaret A; Gingras, Bruce A; Restaino, Lawrence; Frampton, Elon W

    2006-08-01

    A selective and differential plating medium, R & F anthracis chromogenic agar (ACA), has been developed for isolating and identifying presumptive colonies of Bacillus anthracis. ACA contains the chromogenic substrate 5-bromo-4-chloro-3-indoxyl-choline phosphate that upon hydrolysis yields teal (blue green) colonies indicating the presence of phosphatidylcholine-specific phospholipase C (PC-PLC) activity. Among seven Bacillus species tested on ACA, only members of the Bacillus cereus group (B. anthracis, B. cereus, and B. thuringiensis) produced teal colonies (PC-PLC positive) having cream rings. Examination of colony morphology in 18 pure culture strains of B. anthracis (15 ATCC strains plus AMES-1-RIID, ANR-1, and AMED-RIID), with one exception, required 48 h at 35 to 37 degrees C for significant color production, whereas only 24 h was required for B. cereus and B. thuringiensis. This differential rate of PC-PLC synthesis in B. anthracis (due to the truncated plcR gene and PlcR regulator in B. anthracis) allowed for the rapid differentiation on ACA of presumptive colonies of B. anthracis from B. cereus and B. thuringiensis in both pure and mixed cultures. Effective recovery of B. anthracis from a variety of matrices having both high (soil and sewage) and low microbial backgrounds (cloth, paper, and blood) spiked with B. anthracis ANR-1 spores suggests the probable utility of ACA plating for B. anthracis recovery in a diversity of applications.

  9. The function of PlcR in Bacillus anthracis vaccine strain A16R.

    PubMed

    Xiaolin, Jia; Dongshu, Wang; Zhiqi, Gao; Erling, Feng; Jiping, Zheng; Hengliang, Wang; Guiying, Guo; Xiankai, Liu

    2015-05-01

    Bacillus anthracis, B. thuringiensis and B. cereus are members of the B. cereus group. They share high genetic similarity. Whereas plcR (Phospholipase C regulator) usually encodes a functional pleiotropic activator protein in B. cereus and B. thuringiensis isolates, a characteristic nonsense mutation is found in all B. anthracis strains investigated, making the gene dysfunctional. To study the function of PlcR in B. anthracis, we used the B. cereus CMCC63301 genome as a template and constructed a recombinant expression plasmid pBE2A-plcR, and introduced it into the B. anthracis vaccine strain A16R, and then analyzed the activity of the hemolysin and sphingomyelinase. The results showed that transformation of B. anthracis with plasmid pBE2A-plcR carrying the native B. cereus plcR gene active the expression of sphingomyelinase gene, but did not activate expression of hemolysin genes of B. anthracis A16R.

  10. Structure and reactivity of Trypanosoma brucei pteridine reductase: inhibition by the archetypal antifolate methotrexate.

    PubMed

    Dawson, Alice; Gibellini, Federica; Sienkiewicz, Natasha; Tulloch, Lindsay B; Fyfe, Paul K; McLuskey, Karen; Fairlamb, Alan H; Hunter, William N

    2006-09-01

    The protozoan Trypanosoma brucei has a functional pteridine reductase (TbPTR1), an NADPH-dependent short-chain reductase that participates in the salvage of pterins, which are essential for parasite growth. PTR1 displays broad-spectrum activity with pterins and folates, provides a metabolic bypass for inhibition of the trypanosomatid dihydrofolate reductase and therefore compromises the use of antifolates for treatment of trypanosomiasis. Catalytic properties of recombinant TbPTR1 and inhibition by the archetypal antifolate methotrexate have been characterized and the crystal structure of the ternary complex with cofactor NADP+ and the inhibitor determined at 2.2 A resolution. This enzyme shares 50% amino acid sequence identity with Leishmania major PTR1 (LmPTR1) and comparisons show that the architecture of the cofactor binding site, and the catalytic centre are highly conserved, as are most interactions with the inhibitor. However, specific amino acid differences, in particular the placement of Trp221 at the side of the active site, and adjustment of the beta6-alpha6 loop and alpha6 helix at one side of the substrate-binding cleft significantly reduce the size of the substrate binding site of TbPTR1 and alter the chemical properties compared with LmPTR1. A reactive Cys168, within the active site cleft, in conjunction with the C-terminus carboxyl group and His267 of a partner subunit forms a triad similar to the catalytic component of cysteine proteases. TbPTR1 therefore offers novel structural features to exploit in the search for inhibitors of therapeutic value against African trypanosomiasis.

  11. Genetic and Physiological Control of Protective Antigen Synthesis by Bacillus Anthracis.

    DTIC Science & Technology

    1980-12-01

    end Identify by block nmber) Bacillus anthracis Anthrax protective antigen Anthrax toxin t 2&. /AV$TMACT (CNIm am reverse f nogee6m7 and IdentifF by...bWoek number) A-rhe primary objective of the research is to improve the yields of protec- tive antigen in culture filtrates of Bacillus anthracis...and/or Dist Special LI Unclassified AD REPORT NUMBER ONE GENETIC AND PHYSIOLOGICAL CONTROL OF PROTECTIVE ANTIGEN SYNTHESIS BY BACILLUS ANTHRACIS ANNUAL

  12. Genetic and Physiological Control of Protective Antigen Synthesis by Bacillus Anthracis

    DTIC Science & Technology

    1981-12-01

    Unclassified AD REPORT NUMBER TWO GENETIC AND PHYSIOLOGICAL CONTROL OF PROTECTIVE ANTIGEN SYNTHESIS BY BACILLUS ANTHRACIS ANNUAL PROGRESS REPORT...Physiological Control of Protective Annual Report Antigen Synthesis by Bacillus anthracis Jan. 1, 1981 - Dec. 31,198 6. PERFORMING ORG. REPORT NUMBER...neceteemy mid Identify by block number) Bacillus anthracis Anthrax protective antigen Anthrax toxin 2Q. ASSMI*ACT (Camnot en r everit stO neneesemy md fd

  13. Sensitivity of Dormant and Germinating B, Anthracis Spores to Polycationic Compound

    DTIC Science & Technology

    2005-06-01

    Protamine was reported to be inhibitory to the growth of Bacillus subtilis and B. licheniformis spores at concentrations ranging from 10- to 50-pug/ml...for rapid inactivation of Bacillus anthracis spores in aqueous suspension. Treatment of spores at the onset of germination with 10-, 100- and 1000-,ug...materials contaminated with the spore form of B. anthracis. 15. SUBJECT TERMS Chemical Defense, Biological Defense, CBD, Water Sampling, Bacillus Anthracis

  14. Photoreactivation of Ultraviolet-Irradiated, Plasmid-Bearing and Plasmid-Free Strains of Bacillus anthracis

    DTIC Science & Technology

    1985-12-19

    NUMBER __ vation Bacillus anthracis) ś 7. AUTHOR(’a) B.KusnShD . CONTRACT OR GRANT NUMBER(a) PERFORMING ORGANIZATION NAME AND ADDRESS 10. PROGRAM ELEMENT... Bacillus anthracis, anthrax, photoreactivation, DNA repair, plasmid A6SSTACT (Cinvt ass,.yme eEb ir "mease wy f dentif by block nlmbaw) Iee. he...effects of toxin- a’nd capsule-encoding plasmids on the kinetics of UIV inactivation of various strains of Bacillus anthracis were investigated. :Z

  15. Allelic Variation on Murine Chromosome 11 Modifies Host Inflammatory Responses and Resistance to Bacillus anthracis

    DTIC Science & Technology

    2011-12-01

    Allelic Variation on Murine Chromosome 11 Modifies Host Inflammatory Responses and Resistance to Bacillus anthracis Jill K. Terra1, Bryan France1...of America Abstract Anthrax is a potentially fatal disease resulting from infection with Bacillus anthracis. The outcome of infection is influenced by...Inflammatory Responses and Resistance to Bacillus anthracis. PLoS Pathog 7(12): e1002469. doi:10.1371/journal.ppat.1002469 Editor: Theresa M. Koehler, The

  16. Evaluation of the Cepheid GeneXpert System for Detecting Bacillus anthracis

    DTIC Science & Technology

    2005-10-25

    ORIGINAL ARTICLE Evaluation of the Cepheid GeneXpert system for detecting Bacillus anthracis M.P. Ulrich1, D.R. Christensen1, S.R. Coyne1, P.D...Knepp et al. 2003). In addition, Keywords anthrax, automated system, Bacillus anthracis, GeneXpert, nucleic acid, real-time PCR, sample processing...system. In this study, the capability of the GeneX- pert to isolate and detect nucleic acid from Bacillus anthracis Ames spores was assessed. Methods

  17. Nosocomial Infection of Serratia marcescens May Induce a Protective Effect of Monkeys Exposed to Bacillus anthracis

    DTIC Science & Technology

    2008-01-01

    toxin " effect in this experiment. The innate immune response may have protected the AGMs from a lethal inhalational dose of B. anthracis spores. 15...SUBJECT TERMS Bacillus anthracis, anthrax, Serratia marcescens, protective effect, Coley’s toxin , efficacy, laboratory animals, nonhuman primates...Coley’s toxin ’’ effect in this experiment. The innate immune response may have protected the AGMs from a lethal inhalational dose of B. anthracis

  18. Strategy for identification of Bacillus cereus and Bacillus thuringiensis strains closely related to Bacillus anthracis.

    PubMed

    Daffonchio, Daniele; Raddadi, Noura; Merabishvili, Maya; Cherif, Ameur; Carmagnola, Lorenzo; Brusetti, Lorenzo; Rizzi, Aurora; Chanishvili, Nina; Visca, Paolo; Sharp, Richard; Borin, Sara

    2006-02-01

    Bacillus cereus strains that are genetically closely related to B. anthracis can display anthrax-like virulence traits (A. R. Hoffmaster et al., Proc. Natl. Acad. Sci. USA 101:8449-8454, 2004). Hence, approaches that rapidly identify these "near neighbors" are of great interest for the study of B. anthracis virulence mechanisms, as well as to prevent the use of such strains for B. anthracis-based bioweapon development. Here, a strategy is proposed for the identification of near neighbors of B. anthracis based on single nucleotide polymorphisms (SNP) in the 16S-23S rRNA intergenic spacer (ITS) containing tRNA genes, characteristic of B. anthracis. By using restriction site insertion-PCR (RSI-PCR) the presence of two SNP typical of B. anthracis was screened in 126 B. cereus group strains of different origin. Two B. cereus strains and one B. thuringiensis strain showed RSI-PCR profiles identical to that of B. anthracis. The sequencing of the entire ITS containing tRNA genes revealed two of the strains to be identical to B. anthracis. The strict relationship with B. anthracis was confirmed by multilocus sequence typing (MLST) of four other independent loci: cerA, plcR, AC-390, and SG-749. The relationship to B. anthracis of the three strains described by MLST was comparable and even higher to that of four B. cereus strains associated with periodontitis in humans and previously reported as the closest known strains to B. anthracis. SNP in ITS containing tRNA genes combined with RSI-PCR provide a very efficient tool for the identification of strains closely related to B. anthracis.

  19. The Early Humoral Immune Response to Bacillus anthracis Toxins in Patients Infected with Cutaneous Anthrax

    DTIC Science & Technology

    2011-01-01

    RESEARCH ARTICLE The early humoral immune response to Bacillus anthracis toxins in patients infected with cutaneous anthrax Karen E. Brenneman 1•2...Editor: Patrick Brennan Keywords anthrax; lethal factor; edema factor; protective antigen. Introduction Abstract Bacillus anthracis, the...Anthrax is a zoonotic disease caused by Bacillus anthracis, a Gram-positive spore-forming microorganism whose mani- festations in humans depend on the

  20. Duration of Protection of Rabbits after Vaccination with Bacillus anthracis Recombinant Protective Antigen Vaccine

    DTIC Science & Technology

    2005-12-27

    against an aerosol spore challenge with the Ames isolate of Bacillus anthracis at 6 and 12 months. At 6 months after the primary injection, survival...vaccine was examined against an aerosol spore challenge with the Ames isolate of Bacillus anthracis at 6 and 12 months. At 6 months after the...Vaccine 24 (2006) 2530–2536 Duration of protection of rabbits after vaccination with Bacillus anthracis recombinant protective antigen vaccine S.F

  1. Duration of Protection of Rabbits after Vaccination with Bacillus anthracis Recombinant Protective Antigen Vaccine

    DTIC Science & Technology

    2005-12-13

    against an aerosol spore challenge with the Ames isolate of Bacillus anthracis at 6 and 12 months. At 6 months after the primary injection, survival...rPA) vaccine was examined against an aerosol spore challenge with the Ames isolate of Bacillus anthracis at 6 and 12 months. At 6 months after the...Vaccine 24 (2006) 2530–2536 Duration of protection of rabbits after vaccination with Bacillus anthracis recombinant protective antigen vaccine S.F

  2. Global gene expression by Bacillus anthracis during growth in mammalian blood.

    PubMed

    Carlson, Paul E; Bourgis, Alexandra E T; Hagan, Ada K; Hanna, Philip C

    2015-11-01

    During the late stages of systemic anthrax, Bacillus anthracis grows rapidly in the host bloodstream. To identify potential genes necessary for this observed rapid growth, we defined the transcriptional profile of B. anthracis during in vitro growth in bovine blood. Genome-wide transcriptome analysis indicated that B. anthracis undergoes significant changes in its transcriptome profile during growth in blood, including the differential regulation of genes associated both with metabolism and known virulence factors. Collectively, these data provide a framework for future studies identifying specific B. anthracis factors required for growth in the mammalian bloodstream.

  3. Crystal Structure and Catalytic Properties of Bacillus anthracis CoADR-RHD: Implications for Flavin-Linked Sulfur Trafficking

    SciTech Connect

    Wallen, J.; Mallett, T; Boles, W; Parsonage, D; Furdui, C; Karplus, A; Claiborne, A

    2009-01-01

    Rhodanese homology domains (RHDs) play important roles in sulfur trafficking mechanisms essential to the biosynthesis of sulfur-containing cofactors and nucleosides. We have now determined the crystal structure at 2.10 {angstrom} resolution for the Bacillus anthracis coenzyme A-disulfide reductase isoform (BaCoADR-RHD) containing a C-terminal RHD domain; this is the first structural representative of the multidomain proteins class of the rhodanese superfamily. The catalytic Cys44 of the CoADR module is separated by 25 {angstrom} from the active-site Cys514' of the RHD domain from the complementary subunit. In stark contrast to the B. anthracis CoADR (Wallen, J. R., Paige, C., Mallett, T. C., Karplus, P. A., and Claiborne, A. (2008) Biochemistry 47, 5182-5193), the BaCoADR-RHD isoform does not catalyze the reduction of coenzyme A-disulfide, although both enzymes conserve the Cys-SSCoA redox center. NADH titrations have been combined with a synchrotron reduction protocol for examination of the structural and redox behavior of the Cys44-SSCoA center. The synchrotron-reduced (Cys44 + CoASH) structure reveals ordered binding for the adenosine 3'-phosphate 5'-pyrophosphate moiety of CoASH, but the absence of density for the pantetheine arm indicates that it is flexible within the reduced active site. Steady-state kinetic analyses with the alternate disulfide substrates methyl methanethiolsulfonate (MMTS) and 5,5'-dithiobis(2-nitrobenzoate) (DTNB), including the appropriate Cys {yields} Ser mutants, demonstrate that MMTS reduction occurs within the CoADR active site. NADH-dependent DTNB reduction, on the other hand, requires communication between Cys44 and Cys514', and we propose that reduction of the Cys44-SSCoA disulfide promotes the transfer of reducing equivalents to the RHD, with the swinging pantetheine arm serving as a ca. 20 {angstrom} bridge.

  4. Zeatin reductase in Phaseolus embryos

    SciTech Connect

    Martin, R.C.; Mok, David, W.S.; Mok, M.C. )

    1989-04-01

    Zeatin was converted to O-xylosylzeatin in embryos of Phaseolus vulgaris . O-xylosyldihydrozeatin was also identified as a zeatin metabolite. Incubation of embryo extracts with {sup 14}C-zeatin and {sup 14}C-O-xylosylzeatin revealed that reduction preceeds the O-xylosylation of zeatin. An enzyme responsible for reducing the N{sup 6}-side chain was isolated and partially purified using ammonium sulfate fractionation and affinity, gel filtration and anion exchange chromatography. The NADPH dependent reductase was zeatin specific and did not recognize cis-zeatin, ribosylzeatin, i{sup 6}Ade or i{sup 6}Ado. Two forms of the reductase could be separated by either gel filtration or anion exchange HPLC. The HMW isozyme (Mr. 55,000) eluted from the anion exchange column later than the LMW isozyme (Mr. 25,000). Interspecific differences in zeatin reductase activity were also detected.

  5. Isolated menthone reductase and nucleic acid molecules encoding same

    DOEpatents

    Croteau, Rodney B; Davis, Edward M; Ringer, Kerry L

    2013-04-23

    The present invention provides isolated menthone reductase proteins, isolated nucleic acid molecules encoding menthone reductase proteins, methods for expressing and isolating menthone reductase proteins, and transgenic plants expressing elevated levels of menthone reductase protein.

  6. DECONTAMINATION ASSESSMENT OF BACILLUS ANTHRACIS, BACILLUS SUBTILIS, AND GEOBACILLUS STEAROTHERMOPHILUS SPORES ON INDOOR SURFACTS USING A HYDROGEN PERIOXIDE GAS GENERATOR

    EPA Science Inventory

    Aims: To evaluate the decontamination of Bacillus anthracis, Bacillus subtilis, and Geobacillus stearothermophilus spores on indoor surface materials using hydrogen peroxide gas. Methods and Results: B. anthracis, B. subtilis, and G. Stearothermophilus spores were dried on seven...

  7. Method for screening inhibitors of the toxicity of Bacillus anthracis

    DOEpatents

    Cirino, Nick M.; Jackson, Paul J.; Lehnert, Bruce E.

    2001-01-01

    The protective antigen (PA) of Bacillus anthracis is integral to the mechanism of anthrax poisoning. The cloning, expression and purification of a 32 kDa B. anthracis PA fragment (PA32) is described. This fragment has also been expressed as a fusion construct to stabilized green fluorescent protein (EGFP-PA32). Both proteins were capable of binding to specific cell surface receptors as determined by fluorescent microscopy and a flow cytometric assay. To confirm binding specificity in the flow cytometric assay, non-fluorescent PA83 or PA32 was used to competitively inhibit fluorescent EGFP-PA32 binding to cell receptors. This assay can be employed as a rapid screen for compounds which disrupts binding of PA to cells. Additionally, the high intracellular expression levels and ease of purification make this recombinant protein an attractive vaccine candidate or therapeutic treatment for anthrax poisoning.

  8. Structure of isochorismate synthase DhbC from Bacillus anthracis.

    PubMed

    Domagalski, M J; Tkaczuk, K L; Chruszcz, M; Skarina, T; Onopriyenko, O; Cymborowski, M; Grabowski, M; Savchenko, A; Minor, W

    2013-09-01

    The isochorismate synthase DhbC from Bacillus anthracis is essential for the biosynthesis of the siderophore bacillibactin by this pathogenic bacterium. The structure of the selenomethionine-substituted protein was determined to 2.4 Å resolution using single-wavelength anomalous diffraction. B. anthracis DhbC bears the strongest resemblance to the Escherichia coli isochorismate synthase EntC, which is involved in the biosynthesis of another siderophore, namely enterobactin. Both proteins adopt the characteristic fold of other chorismate-utilizing enzymes, which are involved in the biosynthesis of various products, including siderophores, menaquinone and tryptophan. The conservation of the active-site residues, as well as their spatial arrangement, suggests that these enzymes share a common Mg(2+)-dependent catalytic mechanism.

  9. Photothermal spectroscopy of Bacillus anthracis and Bacillus cereus with microcantilevers

    SciTech Connect

    Wig, Andrew G; Arakawa, Edward T; Passian, Ali; Ferrell, Thomas L; Thundat, Thomas George

    2006-03-01

    Microcalorimetric optical and infrared spectroscopy is a method of determining the spectral absorption of small quantities of materials over a wide range of incident wavelengths. In this paper, the first spectroscopic results for microcantilevers coated with Bacillus anthracis (BA) are presented. These results, for B. anthracis from 2.5 to 14.5 {micro}m, are compared with results from microcantilevers coated with Bacillus cereus (BC) and standard spectroscopic absorption data. The results demonstrate strong correlation between the deflection measurements and the reference spectroscopic absorption peaks. An advantage of this microcantilever-based method over traditional spectroscopy is that much smaller amounts of material (nanogram quantities) can be detected in comparison with the milligram amounts needed for standard methods. Another advantage is that the complete system can be relatively small without sacrificing spectral resolution.

  10. Structure of isochorismate synthase DhbC from Bacillus anthracis

    PubMed Central

    Domagalski, M. J.; Tkaczuk, K. L.; Chruszcz, M.; Skarina, T.; Onopriyenko, O.; Cymborowski, M.; Grabowski, M.; Savchenko, A.; Minor, W.

    2013-01-01

    The isochorismate synthase DhbC from Bacillus anthracis is essential for the biosynthesis of the siderophore bacillibactin by this pathogenic bacterium. The structure of the selenomethionine-substituted protein was determined to 2.4 Å resolution using single-wavelength anomalous diffraction. B. anthracis DhbC bears the strongest resemblance to the Escherichia coli isochorismate synthase EntC, which is involved in the biosynthesis of another siderophore, namely enterobactin. Both proteins adopt the characteristic fold of other chorismate-utilizing enzymes, which are involved in the biosynthesis of various products, including siderophores, menaquinone and tryptophan. The conservation of the active-site residues, as well as their spatial arrangement, suggests that these enzymes share a common Mg2+-dependent catalytic mechanism. PMID:23989140

  11. Surface Sampling Methods for Bacillus anthracis Spore Contamination

    PubMed Central

    Hein, Misty J.; Taylor, Lauralynn; Curwin, Brian D.; Kinnes, Gregory M.; Seitz, Teresa A.; Popovic, Tanja; Holmes, Harvey T.; Kellum, Molly E.; McAllister, Sigrid K.; Whaley, David N.; Tupin, Edward A.; Walker, Timothy; Freed, Jennifer A.; Small, Dorothy S.; Klusaritz, Brian; Bridges, John H.

    2002-01-01

    During an investigation conducted December 17–20, 2001, we collected environmental samples from a U.S. postal facility in Washington, D.C., known to be extensively contaminated with Bacillus anthracis spores. Because methods for collecting and analyzing B. anthracis spores have not yet been validated, our objective was to compare the relative effectiveness of sampling methods used for collecting spores from contaminated surfaces. Comparison of wipe, wet and dry swab, and HEPA vacuum sock samples on nonporous surfaces indicated good agreement between results with HEPA vacuum and wipe samples. However, results from HEPA vacuum sock and wipe samples agreed poorly with the swab samples. Dry swabs failed to detect spores >75% of the time they were detected by wipe and HEPA vacuum samples. Wipe samples collected after HEPA vacuum samples and HEPA vacuum samples after wipe samples indicated that neither method completely removed spores from the sampled surfaces. PMID:12396930

  12. Historical distribution and molecular diversity of Bacillus anthracis, Kazakhstan.

    PubMed

    Aikembayev, Alim M; Lukhnova, Larissa; Temiraliyeva, Gulnara; Meka-Mechenko, Tatyana; Pazylov, Yerlan; Zakaryan, Sarkis; Denissov, Georgiy; Easterday, W Ryan; Van Ert, Matthew N; Keim, Paul; Francesconi, Stephen C; Blackburn, Jason K; Hugh-Jones, Martin; Hadfield, Ted

    2010-05-01

    To map the distribution of anthrax outbreaks and strain subtypes in Kazakhstan during 1937-2005, we combined geographic information system technology and genetic analysis by using archived cultures and data. Biochemical and genetic tests confirmed the identity of 93 archived cultures in the Kazakhstan National Culture Collection as Bacillus anthracis. Multilocus variable number tandem repeat analysis genotyping identified 12 genotypes. Cluster analysis comparing these genotypes with previously published genotypes indicated that most (n = 78) isolates belonged to the previously described A1.a genetic cluster, 6 isolates belonged to the A3.b cluster, and 2 belonged to the A4 cluster. Two genotypes in the collection appeared to represent novel genetic sublineages; 1 of these isolates was from Krygystan. Our data provide a description of the historical, geographic, and genetic diversity of B. anthracis in this Central Asian region.

  13. Evaluation of PCR Systems for Field Screening of Bacillus anthracis

    PubMed Central

    Ozanich, Richard M.; Colburn, Heather A.; Victry, Kristin D.; Bartholomew, Rachel A.; Arce, Jennifer S.; Heredia-Langner, Alejandro; Jarman, Kristin; Kreuzer, Helen W.

    2017-01-01

    There is little published data on the performance of hand-portable polymerase chain reaction (PCR) systems that can be used by first responders to determine if a suspicious powder contains a potential biothreat agent. We evaluated 5 commercially available hand-portable PCR instruments for detection of Bacillus anthracis. We used a cost-effective, statistically based test plan to evaluate systems at performance levels ranging from 0.85-0.95 lower confidence bound (LCB) of the probability of detection (POD) at confidence levels of 80% to 95%. We assessed specificity using purified genomic DNA from 13 B. anthracis strains and 18 Bacillus near neighbors, potential interference with 22 suspicious powders that are commonly encountered in the field by first responders during suspected biothreat incidents, and the potential for PCR inhibition when B. anthracis spores were spiked into these powders. Our results indicate that 3 of the 5 systems achieved 0.95 LCB of the probability of detection with 95% confidence levels at test concentrations of 2,000 genome equivalents/mL (GE/mL), which is comparable to 2,000 spores/mL. This is more than sufficient sensitivity for screening visible suspicious powders. These systems exhibited no false-positive results or PCR inhibition with common suspicious powders and reliably detected B. anthracis spores spiked into these powders, though some issues with assay controls were observed. Our testing approach enables efficient performance testing using a statistically rigorous and cost-effective test plan to generate performance data that allow users to make informed decisions regarding the purchase and use of field biodetection equipment. PMID:28192050

  14. Role of Superoxide in the Germination of Bacillus Anthracis Endospores

    DTIC Science & Technology

    2005-01-01

    effect on the dormant organism. This study addresses two critical questions. First, can the spore protect the organism from physiologically rel- evant...bailliel@nmrc.navy.mil (L. Baillie).that the spore may play a direct role in virulence. For instance, spore coat extract from two serovars of Bacil- lus...thuringiensis [5], B. cereus [6] and B. anthracis [7]. Preliminary studies have identified proteins in the exosporium that play a role in insect

  15. Measuring the Variability of Treated Bacillus Anthracis Delta Stern Spores

    DTIC Science & Technology

    2011-02-23

    the 35 varied outcomes that can be induced by density gradient purification and post- growth 36 inactivation using gamma irradiation. The responses...and post- growth 36 inactivation using gamma irradiation. The responses using Quantitative Polymerase Chain 37 Reaction, Electrochemiluminescence...neighbor (5,19) Bacillus species (B. cereus 62 group) or avirulent B. anthracis (29) to avoid occupational exposures, and by use of varied 63 growth

  16. Genotype Analysis of Bacillus anthracis Strains Circulating in Bangladesh.

    PubMed

    Rume, Farzana Islam; Affuso, Alessia; Serrecchia, Luigina; Rondinone, Valeria; Manzulli, Viviana; Campese, Emanuele; Di Taranto, Pietro; Biswas, Paritosh Kumar; Ahsan, Chowdhury Rafiqul; Yasmin, Mahmuda; Fasanella, Antonio; Hugh-Jones, Martin

    2016-01-01

    In Bangladesh, anthrax, caused by the bacterium Bacillus anthracis, is considered an endemic disease affecting ruminants with sporadic zoonotic occurrences in humans. Due to the lack of knowledge about risks from an incorrect removal of infected carcasses, the disease is not properly monitored, and because of the socio-economic conditions, the situation is under-reported and under-diagnosed. For sensitive species, anthrax represents a fatal outcome with sudden death and sometimes bleeding from natural orifices. The most common source of infection for ruminants is ingestion of spores during grazing in contaminated pastures or through grass and water contaminated with anthrax spores. Domestic cattle, sheep and goats can also become infected through contaminated bone meal (used as feed) originating from anthrax-infected carcasses. The present investigation was conducted to isolate B. anthracis organisms from 169 samples (73 soil, 1 tissue, 4 bone and 91 bone meal samples) collected from 12 different districts of Bangladesh. The sampling was carried out from 2012 to 2015. Twelve samples resulted positive for B. anthracis. Biomolecular analyses were conducted starting from the Canonical Single Nucleotide Polymorphism (CanSNP) to analyze the phylogenetic origin of strains. The analysis of genotype, obtained through the Multiple Locus Variable Number Tandem Repeat Analysis (MLVA) with the analysis of 15 Variable Number Tandem Repeats (VNTR), demonstrated four different genotypes: two of them were previously identified in the district of Sirajganj. The sub-genotyping, conducted with Single Nucleotide Repeats analysis, revealed the presence of eight subgenotypes. The data of the present study concluded that there was no observed correlation between imported cattle feed and anthrax occurrence in Bangladesh and that the remarkable genetic variations of B. anthracis were found in the soil of numerous outbreaks in this country.

  17. Evaluation of tools for environmental sampling of Bacillus anthracis spores.

    PubMed

    Fujinami, Yoshihito; Hosokawa-Muto, Junji; Mizuno, Natsuko

    2015-12-01

    This study describes the validation of sampling techniques used to detect biological warfare agents used in terror attacks. For this purpose, we tested the efficiencies of different sampling media and extraction solutions for the recovery of bacterial pathogens. We first used Bacillus cereus ATCC 4342 spores as a surrogate for highly pathogenic B. anthracis to compare recovery efficiencies of spores from four different surfaces. We used three different types of sampling swabs and four different solutions to extract spores from the swabs. The most effective sampling method employed rayon swabs moistened with water. The efficencies of the four extraction solutions did not differ significantly, although yields were highest using phosphate-buffered saline containing Tween 80 (PBS-T). Using rayon swabs and sterile water, we recovered B. cereus ATCC 4342 and B. anthracis spores with equivalent efficiencies. These findings indicate that because of its reduced pathogenicity and relative ease in handling (Biosafety Level 1), use of B. cereus ATCC 4342 will facilitate further optimization of techniques to detect B. anthracis.

  18. Multigeneration Cross-Contamination of Mail with Bacillus anthracis Spores.

    PubMed

    Edmonds, Jason; Lindquist, H D Alan; Sabol, Jonathan; Martinez, Kenneth; Shadomy, Sean; Cymet, Tyler; Emanuel, Peter

    2016-01-01

    The release of biological agents, including those which could be used in biowarfare or bioterrorism in large urban areas, has been a concern for governments for nearly three decades. Previous incidents from Sverdlosk and the postal anthrax attack of 2001 have raised questions on the mechanism of spread of Bacillus anthracis spores as an aerosol or contaminant. Prior studies have demonstrated that Bacillus atrophaeus is easily transferred through simulated mail handing, but no reports have demonstrated this ability with Bacillus anthracis spores, which have morphological differences that may affect adhesion properties between spore and formite. In this study, equipment developed to simulate interactions across three generations of envelopes subjected to tumbling and mixing was used to evaluate the potential for cross-contamination of B. anthracis spores in simulated mail handling. In these experiments, we found that the potential for cross-contamination through letter tumbling from one generation to the next varied between generations while the presence of a fluidizer had no statistical impact on the transfer of material. Likewise, the presence or absence of a fluidizer had no statistically significant impact on cross-contamination levels or reaerosolization from letter opening.

  19. Multigeneration Cross-Contamination of Mail with Bacillus anthracis Spores

    PubMed Central

    Edmonds, Jason; Lindquist, H. D. Alan; Sabol, Jonathan; Martinez, Kenneth; Shadomy, Sean; Cymet, Tyler; Emanuel, Peter

    2016-01-01

    The release of biological agents, including those which could be used in biowarfare or bioterrorism in large urban areas, has been a concern for governments for nearly three decades. Previous incidents from Sverdlosk and the postal anthrax attack of 2001 have raised questions on the mechanism of spread of Bacillus anthracis spores as an aerosol or contaminant. Prior studies have demonstrated that Bacillus atrophaeus is easily transferred through simulated mail handing, but no reports have demonstrated this ability with Bacillus anthracis spores, which have morphological differences that may affect adhesion properties between spore and formite. In this study, equipment developed to simulate interactions across three generations of envelopes subjected to tumbling and mixing was used to evaluate the potential for cross-contamination of B. anthracis spores in simulated mail handling. In these experiments, we found that the potential for cross-contamination through letter tumbling from one generation to the next varied between generations while the presence of a fluidizer had no statistical impact on the transfer of material. Likewise, the presence or absence of a fluidizer had no statistically significant impact on cross-contamination levels or reaerosolization from letter opening. PMID:27123934

  20. Setting risk-informed environmental standards for Bacillus anthracis spores.

    PubMed

    Hong, Tao; Gurian, Patrick L; Ward, Nicholas F Dudley

    2010-10-01

    In many cases, human health risk from biological agents is associated with aerosol exposures. Because air concentrations decline rapidly after a release, it may be necessary to use concentrations found in other environmental media to infer future or past aerosol exposures. This article presents an approach for linking environmental concentrations of Bacillus. anthracis (B. anthracis) spores on walls, floors, ventilation system filters, and in human nasal passages with human health risk from exposure to B. anthracis spores. This approach is then used to calculate example values of risk-informed concentration standards for both retrospective risk mitigation (e.g., prophylactic antibiotics) and prospective risk mitigation (e.g., environmental clean up and reoccupancy). A large number of assumptions are required to calculate these values, and the resulting values have large uncertainties associated with them. The values calculated here suggest that documenting compliance with risks in the range of 10(-4) to 10(-6) would be challenging for small diameter (respirable) spore particles. For less stringent risk targets and for releases of larger diameter particles (which are less respirable and hence less hazardous), environmental sampling would be more promising.

  1. Molecular characterization of the circulating Bacillus anthracis in Jordan.

    PubMed

    Aqel, Amin Abdelfattah; Hailat, Ekhlas; Serrecchia, Luigina; Aqel, Suad; Campese, Emanuele; Vicari, Nadia; Fasanella, Antonio

    2015-12-01

    To understand the biomolecular charcteristics of Bacillus anthracis in Jordan, 20 blood smear slides from dead animals with suspected anthrax were analyzed using conventional and molecular approaches. All slides were positive for B. anthracis by conventional staining but no growth of the organism on selective media was detected. However, of the 20 samples, 16 were B. anthracis DNA-positive using polymerase chain reaction (PCR). Seven samples provided enough quantity and quality of DNA, and their multilocus variable tandem repeat analysis (MLVA)-15 loci analysis revealed two different genotypes. All genotypes were belonging to A.B..r. 008/009 which is very common in Asia and Europe. Single nucleotide repeat (SNR) analysis revealed that there were no sub genotypes. Molecular diagnosis of animal anthrax in Jordan is not used routinely; henceforth, official diagnosis of anthrax is based on the observation of the slides by optical microscope and this can often cause reading errors. Therefore, the prevalence of the disease in Jordan might be slightly lower than that reported by the official bodies.

  2. The Bacillus anthracis Exosporium: What's the Big "Hairy" Deal?

    PubMed

    Bozue, Joel A; Welkos, Susan; Cote, Christopher K

    2015-10-01

    In some Bacillus species, including Bacillus subtilis, the coat is the outermost layer of the spore. In others, such as the Bacillus cereus family, there is an additional layer that envelops the coat, called the exosporium. In the case of Bacillus anthracis, a series of fine hair-like projections, also referred to as a "hairy" nap, extends from the exosporium basal layer. The exact role of the exosporium in B. anthracis, or for any of the Bacillus species possessing this structure, remains unclear. However, it has been assumed that the exosporium would play some role in infection for B. anthracis, because it is the outermost structure of the spore and would make initial contact with host and immune cells during infection. Therefore, the exosporium has been a topic of great interest, and over the past decade much progress has been made to understand its composition, biosynthesis, and potential roles. Several key aspects of this spore structure, however, are still debated and remain undetermined. Although insights have been gained on the interaction of exosporium with the host during infection, the exact role and significance of this complex structure remain to be determined. Furthermore, because the exosporium is a highly antigenic structure, future strategies for the next-generation anthrax vaccine should pursue its inclusion as a component to provide protection against the spore itself during the initial stages of anthrax.

  3. Dendritic Cell Targeting of Bacillus anthracis Protective Antigen Expressed by Lactobacillus acidophilus Protects Mice from Lethal Challenge

    DTIC Science & Technology

    2008-10-28

    Dendritic cell targeting of Bacillus anthracis protective antigen expressed by Lactobacillus acidophilus protects mice from lethal challenge M...lethal chal- lenge. A vaccine strategy was established by using Lactobacillus acidophilus to deliver Bacillus anthracis protective antigen (PA) via...4. TITLE AND SUBTITLE Dendritic cell targeting of Bacillus anthracis protective antigen expressed by Lactobacillus acidophilus protects mice

  4. Development of a Rapid and Sensitive Immunoassay for Detection and Subsequent Recovery of Bacillus anthracis Spores in Environmental Samples

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Bacillus anthracis is considered a major threat as an agent of bioterrorism. B. anthracis spores are readily dispersed as aerosols, are very persistent, and are resistant to normal disinfection treatments. Immunoassays have been developed to rapidly detect B. anthracis spores at high concentration...

  5. New aspects of the infection mechanisms of Bacillus anthracis.

    PubMed

    Zakowska, Dorota; Bartoszcze, Michał; Niemcewicz, Marcin; Bielawska-Drózd, Agata; Kocik, Janusz

    2012-01-01

    Articles concerning new aspects of B. anthracis mechanisms of infection were reviewed. It was found, that the hair follicle plays an important role in the spore germination process. The hair follicle represent an important portal of entry in the course of the cutaneous form of disease infections. After mouse exposition to aerosol of spores prepared from B. anthracis strains, an increase in the level of TNF-α cytokines was observed. The TNF-α cytokines were produced after intrusion into the host by the microorganism. This process may play a significant role in the induced migration of infected cells APCs (Antigen Presenting Cells) via chemotactic signals to the lymph nodes. It was explained that IgG, which binds to the spore surface, activates the adaptive immune system response. As a result, the release C3b opsonin from the spore surface, and mediating of C3 protein fragments of B. anthracis spores phagocytosis by human macrophages, was observed. The genes coding germination spores protein in mutant strains of B. anthracis MIGD was a crucial discovery. According to this, it could be assumed that the activity of B. anthracis spores germination process is dependent upon the sleB, cwlJ1 and cwlJ2 genes, which code the GSLEs lithic enzymes. It was also discovered that the specific antibody for PA20, which binds to the PA20 antigenic determinant, are able to block further PA83 proteolytic fission on the surface of cells. This process neutralized PA functions and weakened the activity of free PA20, which is produced during the PA83 enzyme fission process. Interaction between PA63 monomer and LF may be helpful in the PA63 oligomerization and grouping process, and the creation of LF/PA63 complexes may be a part of an alternative process of assembling the anthrax toxin on the surface of cells. It was found that actin-dependent endocytosis plays an important role in the PA heptamerisation process and leads to blocking the toxin activity. Chaperones, a protein derived from

  6. Draft genome sequence of Bacillus anthracis UR-1, isolated from a German heroin user.

    PubMed

    Rückert, Christian; Licht, Katharina; Kalinowski, Jörn; Espírito Santo, Christophe; Antwerpen, Markus; Hanczaruk, Matthias; Reischl, Udo; Holzmann, Thomas; Gessner, André; Tiemann, Carsten; Grass, Gregor

    2012-11-01

    We report the draft genome sequence of Bacillus anthracis UR-1, isolated from a fatal case of injectional anthrax in a German heroin user. Analysis of the genome sequence of strain UR-1 may aid in describing phylogenetic relationships between virulent heroin-associated isolates of B. anthracis isolated in the United Kingdom, Germany, and other European countries.

  7. Evaluation of Three Methods for Discrimination of Bacillus anthracis From Other Bacillus Species

    DTIC Science & Technology

    2003-07-01

    EVALUATION OF THREE METHODS FOR DISCRIMINATION OF BACILLUS ANTHRACIS FROM OTHER BACILLUS SPECIES. Diane L. Dutt Geo-Centers Aberdeen...ABSTRACT Bacillus anthracis shares the same ecological niche with other members of the B. cereus group: especially B. cereus and B. thuringiensis...Techniques that differentiate among Bacillus species using metabolic characteristics can be used to compliment PCR-based methods. These

  8. Real-Time PCR Assay for a Unique Chromosomal Sequence of Bacillus anthracis

    DTIC Science & Technology

    2004-12-01

    33672 Bacillus megaterium ................................................................ NA...Assay for a Unique Chromosomal Sequence of Bacillus anthracis Elizabeth Bode,1 William Hurtle,2† and David Norwood1* United States Army Medical...modification 4 June 2004/Accepted 9 August 2004 Real-time PCR has become an important method for the rapid identification of Bacillus anthracis since the

  9. Determination of the most closely related bacillus isolates to Bacillus anthracis by multilocus sequence typing.

    PubMed Central

    Kim, Kijeong; Cheon, Eunhee; Wheeler, Katherine E.; Youn, Youngchul; Leighton, Terrance J.; Park, Chulmin; Kim, Wonyong; Chung, Sang-In

    2005-01-01

    There have been many efforts to develop Bacillus anthracis detection assays, but the problem of false-positive results has often been encountered. Therefore, to validate an assay for B. anthracis detection, it is critical to examine its specificity with the most closely related Bacillus isolates that are available. To define the most closely related Bacillus isolates to B. anthracis in our Bacillus collections, we analyzed by multilocus sequence typing (MLST) the phylogeny of 77 closely related Bacillus isolates selected from 264 Bacillus isolates. The selection includes all the Bacillus isolates that have been shown in our previous studies to produce false-positive results by some anthrax-detection assays. The MLST phylogenetic analyses revealed that 27 of the non-B. anthracis isolates clustered within the B. anthracis clade, and four of them (three sequence types, STs) had the highest degree of genetic relatedness with B. anthracis, 18 (11 STs) had the second highest, and five (five STs) had the third highest. We anticipate that the inclusion of the 19 ST isolates when analyzing B. anthracis detection assays will prove to be useful for screening for their specificity to detect B. anthracis. PMID:16197725

  10. Genome Sequence of the Soviet/Russian Bacillus anthracis Vaccine Strain 55-VNIIVViM

    PubMed Central

    Kotorashvili, Adam

    2016-01-01

    Bacillus anthracis strain 55-VNIIVViM is a live-attenuated nonencapsulated Soviet/Russian veterinary anthrax vaccine strain. We report here the genome of 55-VNIIVViM and confirm its phylogenetic placement in the global population structure of B. anthracis. PMID:28007853

  11. Wide Area Recovery and Resilency Program (WARRP). Video - Aggressive Air Sampling for B. anthracis Spores

    DTIC Science & Technology

    2012-09-14

    34Systematic Evaluation of Aggressive Air Sampling for Bacillus anthracis Spores", in which aggressive air sampling, used for asbestos fiber detection, was...Sep 2012 Final 01 Feb 2011 - 01 Sep 2012 Wide Area Recovery and Resiliency Program (WARRP) Video - Aggressive Air Sampling for B. anthracis Spores

  12. The Pathogenomic Sequence Analysis of B. cereus and B. Thuringiensis isolates closely related to Bacillus anthracis

    SciTech Connect

    Han, C S; Xie, G; Challacombe, J F; Altherr, M R; Bhotika, S S; Bruce, D; Campbell, C S; Campbell, M L; Chen, J; Chertkov, O; Cleland, C; Dimitrijevic-Bussod, M; Doggett, N A; Fawcett, J J; Glavina, T; Goodwin, L A; Hill, K K; Hitchcock, P; Jackson, P J; Keim, P; Kewalramani, A R; Longmire, J; Lucas, S; Malfatti, S; McMurry, K; Meincke, L J; Misra, M; Moseman, B L; Mundt, M; Munk, A C; Okinaka, R T; Parson-Quintana, B; Reilly, L P; Richardson, P; Robinson, D L; Rubin, E; Saunders, E; Tapia, R; Tesmer, J G; Thayer, N; Thompson, L S; Tice, H; Ticknor, L O; Wills, P L; Gilna, P; Brettin, T S

    2005-10-12

    The sequencing and analysis of two close relatives of Bacillus anthracis are reported. AFLP analysis of over 300 isolates of B. cereus, B. thuringiensis and B. anthracis identified two isolates as being very closely related to B. anthracis. One, a B. cereus, BcE33L, was isolated from a zebra carcass in Nambia; the second, a B. thuringiensis, 97-27, was isolated from a necrotic human wound. The B. cereus appears to be the closest anthracis relative sequenced to date. A core genome of over 3,900 genes was compiled for the Bacillus cereus group, including B anthracis. Comparative analysis of these two genomes with other members of the B. cereus group provides insight into the evolutionary relationships among these organisms. Evidence is presented that differential regulation modulates virulence, rather than simple acquisition of virulence factors. These genome sequences provide insight into the molecular mechanisms contributing to the host range and virulence of this group of organisms.

  13. Dihydrofolate synthetase and folylpolyglutamate synthetase: direct evidence for intervention of acyl phosphate intermediates

    SciTech Connect

    Banerjee, R.V.; Shane, B.; McGuire, J.J.; Coward, J.K.

    1988-12-13

    The transfer of /sup 17/O and/or /sup 18/O from (COOH-/sup 17/O or -/sup 18/O) enriched substrates to inorganic phosphate (P/sub i/) has been demonstrated for two enzyme-catalyzed reactions involved in folate biosynthesis and glutamylation. COOH-/sup 18/O-labeled folate, methotrexate, and dihydropteroate, in addition to (/sup 17/O)-glutamate, were synthesized and used as substrates for folylpolyglutamate synthetase (FPGS) isolated from Escherichia coli, hog liver, and rat liver and for dihydrofolate synthetase (DHFS) isolated from E. coli. P/sub i/ was purified from the reaction mixtures and converted to trimethyl phosphate (TMP), which was then analyzed for /sup 17/O and /sup 18/O enrichment by nuclear magnetic resonance (NMR) spectroscopy and/or mass spectroscopy. In the reactions catalyzed by the E. coli enzymes, both NMR and quantitative mass spectral analyses established that transfer of the oxygen isotope from the substrate /sup 18/O-enriched carboxyl group to P/sub i/ occurred, thereby providing strong evidence for an acyl phosphate intermediate in both the FPGS- and DHFS-catalyzed reactions. Similar oxygen-transfer experiments were carried out by use of two mammalian enzymes. The small amounts of P/sub i/ obtained from reactions catalyzed by these less abundant FPGS proteins precluded the use of NMR techniques. However, mass spectral analysis of the TMP derived from the mammalian FPGS-catalyzed reactions showed clearly that /sup 18/O transfer had occurred.

  14. Bacillus cereus G9241 Makes Anthrax Toxin and Capsule like Highly Virulent B. anthracis Ames but Behaves like Attenuated Toxigenic Nonencapsulated B. anthracis Sterne in Rabbits and Mice

    DTIC Science & Technology

    2011-08-01

    20. Kuroki, R., et al. 2009. Nosocomial bacteremia caused by biofilm-forming Bacillus cereus and Bacillus tlrurin!{iensis. Intern. Med. 48:791-796...Microbiology. All Rights Reserved. Bacillus cereus G9241 Makes Anthrax Toxin and Capsule like Highly Virulent B. anthracis Ames but Behaves like...G9241 for mice requires the presence of both plasmids. The Bacillus cereus group, of which Bacillus anthracis, Bacil- lus thuringiensis, and B

  15. Nitrate reductase from Rhodopseudomonas sphaeroides.

    PubMed Central

    Kerber, N L; Cardenas, J

    1982-01-01

    The facultative phototroph Rhodopseudomonas sphaeroides DSM158 was incapable of either assimilating or dissimilating nitrate, although the organism could reduce it enzymatically to nitrite either anaerobically in the light or aerobically in the dark. Reduction of nitrate was mediated by a nitrate reductase bound to chromatophores that could be easily solubilized and functioned with chemically reduced viologens or photochemically reduced flavins as electron donors. The enzyme was solubilized, and some of its kinetic and molecular parameters were determined. It seemed to be nonadaptive, ammonia did not repress its synthesis, and its activity underwent a rapid decline when the cells entered the stationary growth phase. Studies with inhibitors and with metal antagonists indicated that molybdenum and possibly iron participate in the enzymatic reduction of nitrate. The conjectural significance of this nitrate reductase in phototrophic bacteria is discussed. PMID:6978883

  16. A Novel Multiplex PCR Discriminates Bacillus anthracis and Its Genetically Related Strains from Other Bacillus cereus Group Species

    PubMed Central

    Ogawa, Hirohito; Fujikura, Daisuke; Ohnuma, Miyuki; Ohnishi, Naomi; Hang'ombe, Bernard M.; Mimuro, Hitomi; Ezaki, Takayuki; Mweene, Aaron S.; Higashi, Hideaki

    2015-01-01

    Anthrax is an important zoonotic disease worldwide that is caused by Bacillus anthracis, a spore-forming pathogenic bacterium. A rapid and sensitive method to detect B. anthracis is important for anthrax risk management and control in animal cases to address public health issues. However, it has recently become difficult to identify B. anthracis by using previously reported molecular-based methods because of the emergence of B. cereus, which causes severe extra-intestinal infection, as well as the human pathogenic B. thuringiensis, both of which are genetically related to B. anthracis. The close genetic relation of chromosomal backgrounds has led to complexity of molecular-based diagnosis. In this study, we established a B. anthracis multiplex PCR that can screen for the presence of B. anthracis virulent plasmids and differentiate B. anthracis and its genetically related strains from other B. cereus group species. Six sets of primers targeting a chromosome of B. anthracis and B. anthracis-like strains, two virulent plasmids, pXO1 and pXO2, a bacterial gene, 16S rRNA gene, and a mammalian gene, actin-beta gene, were designed. The multiplex PCR detected approximately 3.0 CFU of B. anthracis DNA per PCR reaction and was sensitive to B. anthracis. The internal control primers also detected all bacterial and mammalian DNAs examined, indicating the practical applicability of this assay as it enables monitoring of appropriate amplification. The assay was also applied for detection of clinical strains genetically related to B. anthracis, which were B. cereus strains isolated from outbreaks of hospital infections in Japan, and field strains isolated in Zambia, and the assay differentiated B. anthracis and its genetically related strains from other B. cereus group strains. Taken together, the results indicate that the newly developed multiplex PCR is a sensitive and practical method for detecting B. anthracis. PMID:25774512

  17. A novel multiplex PCR discriminates Bacillus anthracis and its genetically related strains from other Bacillus cereus group species.

    PubMed

    Ogawa, Hirohito; Fujikura, Daisuke; Ohnuma, Miyuki; Ohnishi, Naomi; Hang'ombe, Bernard M; Mimuro, Hitomi; Ezaki, Takayuki; Mweene, Aaron S; Higashi, Hideaki

    2015-01-01

    Anthrax is an important zoonotic disease worldwide that is caused by Bacillus anthracis, a spore-forming pathogenic bacterium. A rapid and sensitive method to detect B. anthracis is important for anthrax risk management and control in animal cases to address public health issues. However, it has recently become difficult to identify B. anthracis by using previously reported molecular-based methods because of the emergence of B. cereus, which causes severe extra-intestinal infection, as well as the human pathogenic B. thuringiensis, both of which are genetically related to B. anthracis. The close genetic relation of chromosomal backgrounds has led to complexity of molecular-based diagnosis. In this study, we established a B. anthracis multiplex PCR that can screen for the presence of B. anthracis virulent plasmids and differentiate B. anthracis and its genetically related strains from other B. cereus group species. Six sets of primers targeting a chromosome of B. anthracis and B. anthracis-like strains, two virulent plasmids, pXO1 and pXO2, a bacterial gene, 16S rRNA gene, and a mammalian gene, actin-beta gene, were designed. The multiplex PCR detected approximately 3.0 CFU of B. anthracis DNA per PCR reaction and was sensitive to B. anthracis. The internal control primers also detected all bacterial and mammalian DNAs examined, indicating the practical applicability of this assay as it enables monitoring of appropriate amplification. The assay was also applied for detection of clinical strains genetically related to B. anthracis, which were B. cereus strains isolated from outbreaks of hospital infections in Japan, and field strains isolated in Zambia, and the assay differentiated B. anthracis and its genetically related strains from other B. cereus group strains. Taken together, the results indicate that the newly developed multiplex PCR is a sensitive and practical method for detecting B. anthracis.

  18. Nitric oxide as a regulator of B. anthracis pathogenicity

    PubMed Central

    Popova, Taissia G.; Teunis, Allison; Vaseghi, Haley; Zhou, Weidong; Espina, Virginia; Liotta, Lance A.; Popov, Serguei G.

    2015-01-01

    Nitric oxide (NO) is a key physiological regulator in eukaryotic and prokaryotic organisms. It can cause a variety of biological effects by reacting with its targets or/and indirectly inducing oxidative stress. NO can also be produced by bacteria including the pathogenic Bacillus anthracis; however, its role in the infectious process only begins to emerge. NO incapacitates macrophages by S-nitrosylating the intracellular proteins and protects B. anthracis from oxidative stress. It is also implicated in the formation of toxic peroxynitrite. In this study we further assessed the effects of B. anthracis NO produced by the NO synthase (bNOS) on bacterial metabolism and host cells in experiments with the bNOS knockout Sterne strain. The mutation abrogated accumulation of nitrite and nitrate as tracer products of NO in the culture medium and markedly attenuated growth in both aerobic and microaerobic conditions. The regulatory role of NO was also suggested by the abnormally high rate of nitrate denitrification by the mutant in the presence of oxygen. Anaerobic regulation mediated by NO was reflected in reduced fermentation of glucose by the mutant correlating with the reduced toxicity of bacteria toward host cells in culture. The toxic effect of NO required permeabilization of the target cells as well as the activity of fermentation-derived metabolite in the conditions of reduced pH. The host cells demonstrated increased phosphorylation of major survivor protein kinase AKT correlating with reduced toxicity of the mutant in comparison with Sterne. Our global proteomic analysis of lymph from the lymph nodes of infected mice harboring bacteria revealed numerous changes in the pattern and levels of proteins associated with the activity of bNOS influencing key cell physiological processes relevant to energy metabolism, growth, signal transduction, stress response, septic shock, and homeostasis. This is the first in vivo observation of the bacterial NO effect on the lymphatic

  19. Nanomechanical Characterization of Bacillus anthracis Spores by Atomic Force Microscopy

    PubMed Central

    Burggraf, Larry W.; Xing, Yun

    2016-01-01

    ABSTRACT The study of structures and properties of bacterial spores is important to understanding spore formation and biological responses to environmental stresses. While significant progress has been made over the years in elucidating the multilayer architecture of spores, the mechanical properties of the spore interior are not known. Here, we present a thermal atomic force microscopy (AFM) study of the nanomechanical properties of internal structures of Bacillus anthracis spores. We developed a nanosurgical sectioning method in which a stiff diamond AFM tip was used to cut an individual spore, exposing its internal structure, and a soft AFM tip was used to image and characterize the spore interior on the nanometer scale. We observed that the elastic modulus and adhesion force, including their thermal responses at elevated temperatures, varied significantly in different regions of the spore section. Our AFM images indicated that the peptidoglycan (PG) cortex of Bacillus anthracis spores consisted of rod-like nanometer-sized structures that are oriented in the direction perpendicular to the spore surface. Our findings may shed light on the spore architecture and properties. IMPORTANCE A nanosurgical AFM method was developed that can be used to probe the structure and properties of the spore interior. The previously unknown ultrastructure of the PG cortex of Bacillus anthracis spores was observed to consist of nanometer-sized rod-like structures that are oriented in the direction perpendicular to the spore surface. The variations in the nanomechanical properties of the spore section were largely correlated with its chemical composition. Different components of the spore materials showed different thermal responses at elevated temperatures. PMID:26969703

  20. Glycerol monolaurate inhibits virulence factor production in Bacillus anthracis.

    PubMed

    Vetter, Sara M; Schlievert, Patrick M

    2005-04-01

    Anthrax, caused by Bacillus anthracis, has been brought to the public's attention because of the 2001 bioterrorism attacks. However, anthrax is a disease that poses agricultural threats in the United States as well as human populations in Europe, China, Africa, and Australia. Glycerol monolaurate (GML) is a compound that has been shown to inhibit exotoxin production by Staphylococcus aureus and other gram-positive bacteria. Here, we study the effects of GML on growth and toxin production in B. anthracis. The Sterne strain of B. anthracis was grown to post-exponential phase with 0-, 10-, 15-, or 20-microg/ml concentrations of GML and then assayed quantitatively for protective antigen (PA) and lethal factor (LF). After 8 h, GML at concentrations greater than 20 microg/ml was bacteriostatic to growth of the organism. However, a 10-microg/ml concentration of GML was not growth inhibitory, but amounts of PA and LF made were greatly reduced. This effect was not global for all proteins when total secreted protein from culture fluids was examined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Through quantitative reverse transcription-PCR assays, this toxin-inhibitory effect was shown to occur at the transcriptional level, since amounts of mRNA for pagA (PA), lef (LF), and cya (edema factor) were reduced. Surprisingly, mRNA levels of atxA, a regulator of exotoxin gene expression, rose in the presence of GML. These data will be useful in developing therapeutic tools to treat anthrax disease, whether in animals or humans. These results also suggest that mechanisms of virulence regulation exist independent of atxA.

  1. Nucleotide Sequence of the Protective Antigen Gene of Bacillus Anthracis

    DTIC Science & Technology

    1988-02-02

    transcription and translation of the Bacillus megaterium protein C gene. J. Bacteriol. 158:e09-813. 9. Friedlander, A, M. 1986. Macrophages are sensitive to...of the Protective Antigen Gene of Bacillus anthracis 6. pEaltranalO opl. AMPOA’T B*u~iA S. L. Welkos, J. R. Lowe, F. Eden-McCutchan, M. Vodkin, S. M... Bacillus anthracls and the 5’ and 3’ flanking sequences were determined. Protective antigen ie one of three proteins comprising anthrax toxin. The open

  2. Cloning and Expressing Recombinant Protective Antigen Domains of B. anthracis

    DTIC Science & Technology

    2011-09-01

    Bacillus Anthracis in Escherichia Coli . Biochem Biophys Res Commun 2001, 283 (2), 308–15. 15. Ivins, B. E .; Welkos, S. L. Cloning and Expression of the...Buffer 4 and bovine serum albumin (BSA) at 37 ºC for at least 2 h. The enzymes were heat -inactivated for 20 min at 65 ºC. The pET-22b(+) vector was...to the previous reaction. The phosphatase was heat -inactivated for 20 min at 65 ºC prior to ligation. For each ligation, T4 DNA ligase and its

  3. Antimicrobial susceptibility of Bacillus anthracis strains from Hungary.

    PubMed

    Kreizinger, Zsuzsa; Sulyok, Kinga Mária; Makrai, László; Rónai, Zsuzsanna; Fodor, László; Jánosi, Szilárd; Gyuranecz, Miklós

    2016-06-01

    The susceptibility of 29 Bacillus anthracis strains, collected in Hungary between 1933 and 2014, was tested to 10 antibiotics with commercially available minimum inhibitory concentration (MIC) test strips. All strains were susceptible to amoxicillin, ciprofloxacin, clindamycin, doxycycline, gentamicin, penicillin, rifampicin, and vancomycin. Intermediate susceptibility to erythromycin and cefotaxime was detected in 17.2% (5/29) and 58.6% (17/29) of the strains, respectively. Correlations were not observed between the isolation date, location, host species, genotype, and antibiotic susceptibility profile of strains.

  4. The interaction of an ionizing ligand with enzymes having a single ionizing group. Implications for the reaction of folate analogues with dihydrofolate reductase.

    PubMed

    Stone, S R; Morrison, J F

    1983-06-29

    Binding theory has been developed for the reaction of an ionizing enzyme with an ionizing ligand. Consideration has been given to the most general scheme in which all possible reactions and interconversions occur as well as to schemes in which certain interactions do not take place. Equations have been derived in terms of the variation of the apparent dissociation constant (Kiapp) as a function of pH. These equations indicate that plots of pKiapp against pH can be wave-, half-bell- or bell-shaped according to the reactions involved. A wave is obtained whenever there is formation of the enzyme-ligand complexes, ionized enzyme . ionized ligand and protonated enzyme . protonated ligand. The additional formation of singly protonated enzyme-ligand complexes does not affect the wave form of the plot, but can influence the shape of the overall curve. The formation of either ionized enzyme . ionized ligand or protonated enzyme . protonated ligand, with or without singly protonated enzyme-ligand species, gives rise to a half-bell-shaped plot. If only singly protonated enzyme-ligand complexes are formed the plots are bell-shaped, but it is not possible to deduce the ionic forms of the reactants that participate in complex formation. Depending on the reaction pathways, true values for the ionization and dissociation constants may or may not be determined.

  5. Effects of Point Mutations in Plasmodium falciparum Dihydrofolate Reductase and Dihydropterate Synthase Genes on Clinical Outcomes and In Vitro Susceptibility to Sulfadoxine and Pyrimethamine

    DTIC Science & Technology

    2009-08-01

    Alejandro Llanos-Cuentas4, Coralith Garcia4, Lelv Solari4, Dennis Kyle5, Alan J. Magill3 1 Parasitology Program, Naval Medical Research Center...5]. PLoS ONE | www.plosone.org 1 August 2009 | Volume 4 | Issue 8 | e6762 Report Documentation Page Form ApprovedOMB No. 0704-0188 Public reporting...burden for the collection of information is estimated to average 1 hour per response, including the time for reviewing instructions, searching existing

  6. Identification of Bacillus anthracis specific chromosomal sequences by suppressive subtractive hybridization

    PubMed Central

    Dwyer, Kathleen G; Lamonica, Janine M; Schumacher, Jennifer A; Williams, Leanne E; Bishara, Joanne; Lewandowski, Anna; Redkar, Rajendra; Patra, Guy; DelVecchio, Vito G

    2004-01-01

    Background Bacillus anthracis, Bacillus thuringiensis and Bacillus cereus are closely related members of the B. cereus-group of bacilli. Suppressive subtractive hybridization (SSH) was used to identify specific chromosomal sequences unique to B. anthracis. Results Two SSH libraries were generated. Genomic DNA from plasmid-cured B. anthracis was used as the tester DNA in both libraries, while genomic DNA from either B. cereus or B. thuringiensis served as the driver DNA. Progressive screening of the libraries by colony filter and Southern blot analyses identified 29 different clones that were specific for the B. anthracis chromosome relative not only to the respective driver DNAs, but also to seven other different strains of B. cereus and B. thuringiensis included in the process. The nucleotide sequences of the clones were compared with those found in genomic databases, revealing that over half of the clones were located into 2 regions on the B. anthracis chromosome. Conclusions Genes encoding potential cell wall synthesis proteins dominated one region, while bacteriophage-related sequences dominated the other region. The latter supports the hypothesis that acquisition of these bacteriophage sequences occurred during or after speciation of B. anthracis relative to B. cereus and B. thuringiensis. This study provides insight into the chromosomal differences between B. anthracis and its closest phylogenetic relatives. PMID:15028116

  7. Species-Specific Peptide Ligands for the Detection of Bacillus anthracis Spores

    PubMed Central

    Williams, David D.; Benedek, Orsolya; Turnbough, Charles L.

    2003-01-01

    Currently available detectors for spores of Bacillus anthracis, the causative agent of anthrax, are inadequate for frontline use and general monitoring. There is a critical need for simple, rugged, and inexpensive detectors capable of accurate and direct identification of B. anthracis spores. Necessary components in such detectors are stable ligands that bind tightly and specifically to target spores. By screening a phage display peptide library, we identified a family of peptides, with the consensus sequence TYPXPXR, that bind selectively to B. anthracis spores. We extended this work by identifying a peptide variant, ATYPLPIR, with enhanced ability to bind to B. anthracis spores and an additional peptide, SLLPGLP, that preferentially binds to spores of species phylogenetically similar to, but distinct from, B. anthracis. These two peptides were used in tandem in simple assays to rapidly and unambiguously identify B. anthracis spores. We envision that these peptides can be used as sensors in economical and portable B. anthracis spore detectors that are essentially free of false-positive signals due to other environmental Bacillus spores. PMID:14532093

  8. Bacillus anthracis sin Locus and Regulation of Secreted Proteases ▿ †

    PubMed Central

    Pflughoeft, Kathryn J.; Sumby, Paul; Koehler, Theresa M.

    2011-01-01

    Bacillus anthracis shares many regulatory loci with the nonpathogenic Bacillus species Bacillus subtilis. One such locus is sinIR, which in B. subtilis controls sporulation, biofilm formation, motility, and competency. As B. anthracis is not known to be motile, to be naturally competent, or to readily form biofilms, we hypothesized that the B. anthracis sinIR regulon is distinct from that of B. subtilis. A genome-wide expression microarray analysis of B. anthracis parental and sinR mutant strains indicated limited convergence of the B. anthracis and B. subtilis SinR regulons. The B. anthracis regulon includes homologues of some B. subtilis SinR-regulated genes, including the signal peptidase gene sipW near the sinIR locus and the sporulation gene spoIIE. The B. anthracis SinR protein also negatively regulates transcription of genes adjacent to the sinIR locus that are unique to the Bacillus cereus group species. These include calY and inhA1, structural genes for the metalloproteases camelysin and immune inhibitor A1 (InhA1), which have been suggested to be associated with virulence in B. cereus and B. anthracis, respectively. Electrophoretic mobility shift assays revealed direct binding of B. anthracis SinR to promoter DNA from strongly regulated genes, such as calY and sipW, but not to the weakly regulated inhA1 gene. Assessment of camelysin and InhA1 levels in culture supernates from sinR-, inhA1-, and calY-null mutants showed that the concentration of InhA1 in the culture supernatant is inversely proportional to the concentration of camelysin. Our data are consistent with a model in which InhA1 protease levels are controlled at the transcriptional level by SinR and at the posttranslational level by camelysin. PMID:21131488

  9. Fatty acyl-CoA reductase

    SciTech Connect

    Reiser, Steven E.; Somerville, Chris R.

    1998-12-01

    The present invention relates to bacterial enzymes, in particular to an acyl-CoA reductase and a gene encoding an acyl-CoA reductase, the amino acid and nucleic acid sequences corresponding to the reductase polypeptide and gene, respectively, and to methods of obtaining such enzymes, amino acid sequences and nucleic acid sequences. The invention also relates to the use of such sequences to provide transgenic host cells capable of producing fatty alcohols and fatty aldehydes.

  10. Microarray Bactericidal Testing of Natural Products Against Yersinia intermedia and Bacillus anthracis

    DTIC Science & Technology

    2002-01-01

    against B. anthracis and Y. intermedia in Microarray Format AC Plant Source AC Plant Source Cineole Eucalyptus globulus Carvacrol Oregano (Origanum...concentrations (Figure 1, Table 3 ). Only the AC’s thymol, eugenol and carvacrol were effective against both B. anthracis and Y. intermedia (Figures 2, 3, 7...needed for an Overnight Inocula of B. anthracis VNR1-)1 and Y. intermedia Active component MIC (mM) B.A. MIC (mM) Y.I. Carvacrol 1.2 1.0 Thymol 0.3 3.5

  11. Effects of L-Alanine and Inosine Germinants on the Elasticity of Bacillus anthracis Spores

    DTIC Science & Technology

    2010-01-22

    several Bacillus species, such as B. subtilis, B. cereus , B. anthracis, andB. atrophaeus.6,8,12 Inosine is a purine ribonucleoside that has been shown to...Germinants on the Elasticity of Bacillus anthracis Spores Paola A. Pinzon-Arango,† Ramanathan Nagarajan,‡ and Terri A. Camesano*,† †Department of Chemical...surface of dormant Bacillus anthracis spores consists of a multilayer of protein coats and a thick peptidoglycan layer that allow the cells to resist

  12. Bacillus Anthracis Comparative Genome Analysis in Support of the Amerithrax Investigation

    DTIC Science & Technology

    2011-02-02

    strain had been cured of both virulence plasmids, pXO1 and pXO2, by heat (43 °C) and novobiocin treatment, respectively (16). Comparison of the ge- nome... virulent B. anthracis Ames. B. anthracis Ames was isolated in Sarita, TX, from a dead 14- mo-old Beefmaster heifer. It was acquired as a tryptose agar slant...it is an important, fully virulent reference for the Ames genotype (19). This material is hereafter referred to as B. anthracis Ames Ancestor. The

  13. Development of internal controls for PCR detection of Bacillus anthracis.

    PubMed

    Brightwell, G; Pearce, M; Leslie, D

    1998-12-01

    This work describes the development and evaluation of a multiplex polymerase chain reaction (PCR) for the detection of Bacillus anthracis strains harbouring plasmid pX02. The multiplex also incorporated an internal control (IC) to avoid false negative reactions. Internal controls consisted of plasmids containing modified PCR target sequences, corresponding to the capC and BA813 genes of B. anthracis, which were then co-amplified with the original target sequences using the same set of amplimers. The initial IC construct comprised of an internally deleted form of the genomic target sequence cloned into pUC19. A series of nested DNA fragments corresponding to the 23S rRNA sequences of Bacillus cereus were then subcloned into the point of deletion, producing a number of IC constructs with similar sequences but increasing product size on PCR amplification. Neither the presence of IC DNA template or IC PCR product size affected the specificity or non-specific cross-reactivity of the original PCR assay. The concentration of IC was critical, too much IC DNA template would out compete the genomic DNA template, thus giving a false negative result. However, when the concentration of IC was optimal assay sensitivity was not compromised.

  14. Environmental Persistence of Bacillus anthracis and Bacillus subtilis Spores

    PubMed Central

    Wood, Joseph P.; Meyer, Kathryn M.; Kelly, Thomas J.; Choi, Young W.; Rogers, James V.; Riggs, Karen B.; Willenberg, Zachary J.

    2015-01-01

    There is a lack of data for how the viability of biological agents may degrade over time in different environments. In this study, experiments were conducted to determine the persistence of Bacillus anthracis and Bacillus subtilis spores on outdoor materials with and without exposure to simulated sunlight, using ultraviolet (UV)-A/B radiation. Spores were inoculated onto glass, wood, concrete, and topsoil and recovered after periods of 2, 14, 28, and 56 days. Recovery and inactivation kinetics for the two species were assessed for each surface material and UV exposure condition. Results suggest that with exposure to UV, decay of spore viability for both Bacillus species occurs in two phases, with an initial rapid decay, followed by a slower inactivation period. The exception was with topsoil, in which there was minimal loss of spore viability in soil over 56 days, with or without UV exposure. The greatest loss in viable spore recovery occurred on glass with UV exposure, with nearly a four log10 reduction after just two days. In most cases, B. subtilis had a slower rate of decay than B. anthracis, although less B. subtilis was recovered initially. PMID:26372011

  15. Crystal structure of Bacillus anthracis transpeptidase enzyme CapD.

    SciTech Connect

    Wu, R.; Richter, S.; Zhang, R.; Anderson, V. J.; Missiakas, D.; Joachimiak, A.; Biosciences Division; Univ. of Chicago

    2009-09-04

    Bacillus anthracis elaborates a poly-{gamma}-d-glutamic acid capsule that protects bacilli from phagocytic killing during infection. The enzyme CapD generates amide bonds with peptidoglycan cross-bridges to anchor capsular material within the cell wall envelope of B. anthracis. The capsular biosynthetic pathway is essential for virulence during anthrax infections and can be targeted for anti-infective inhibition with small molecules. Here, we present the crystal structures of the {gamma}-glutamyltranspeptidase CapD with and without {alpha}-l-Glu-l-Glu dipeptide, a non-hydrolyzable analog of poly-{gamma}-d-glutamic acid, in the active site. Purified CapD displays transpeptidation activity in vitro, and its structure reveals an active site broadly accessible for poly-{gamma}-glutamate binding and processing. Using structural and biochemical information, we derive a mechanistic model for CapD catalysis whereby Pro{sup 427}, Gly{sup 428}, and Gly{sup 429} activate the catalytic residue of the enzyme, Thr{sup 352}, and stabilize an oxyanion hole via main chain amide hydrogen bonds.

  16. Bacillus anthracis genome organization in light of whole transcriptome sequencing

    SciTech Connect

    Martin, Jeffrey; Zhu, Wenhan; Passalacqua, Karla D.; Bergman, Nicholas; Borodovsky, Mark

    2010-03-22

    Emerging knowledge of whole prokaryotic transcriptomes could validate a number of theoretical concepts introduced in the early days of genomics. What are the rules connecting gene expression levels with sequence determinants such as quantitative scores of promoters and terminators? Are translation efficiency measures, e.g. codon adaptation index and RBS score related to gene expression? We used the whole transcriptome shotgun sequencing of a bacterial pathogen Bacillus anthracis to assess correlation of gene expression level with promoter, terminator and RBS scores, codon adaptation index, as well as with a new measure of gene translational efficiency, average translation speed. We compared computational predictions of operon topologies with the transcript borders inferred from RNA-Seq reads. Transcriptome mapping may also improve existing gene annotation. Upon assessment of accuracy of current annotation of protein-coding genes in the B. anthracis genome we have shown that the transcriptome data indicate existence of more than a hundred genes missing in the annotation though predicted by an ab initio gene finder. Interestingly, we observed that many pseudogenes possess not only a sequence with detectable coding potential but also promoters that maintain transcriptional activity.

  17. Inhibition of Bacillus anthracis Spore Outgrowth by Nisin▿

    PubMed Central

    Gut, Ian M.; Prouty, Angela M.; Ballard, Jimmy D.; van der Donk, Wilfred A.; Blanke, Steven R.

    2008-01-01

    The lantibiotic nisin has previously been reported to inhibit the outgrowth of spores from several Bacillus species. However, the mode of action of nisin responsible for outgrowth inhibition is poorly understood. By using B. anthracis Sterne 7702 as a model, nisin acted against spores with a 50% inhibitory concentration (IC50) and an IC90 of 0.57 μM and 0.90 μM, respectively. Viable B. anthracis organisms were not recoverable from cultures containing concentrations of nisin greater than the IC90. These studies demonstrated that spores lose heat resistance and become hydrated in the presence of nisin, thereby ruling out a possible mechanism of inhibition in which nisin acts to block germination initiation. Rather, germination initiation is requisite for the action of nisin. This study also revealed that nisin rapidly and irreversibly inhibits growth by preventing the establishment of oxidative metabolism and the membrane potential in germinating spores. On the other hand, nisin had no detectable effects on the typical changes associated with the dissolution of the outer spore structures (e.g., the spore coats, cortex, and exosporium). Thus, the action of nisin results in the uncoupling of two critical sequences of events necessary for the outgrowth of spores: the establishment of metabolism and the shedding of the external spore structures. PMID:18809941

  18. Environmental Persistence of Bacillus anthracis and Bacillus subtilis Spores.

    PubMed

    Wood, Joseph P; Meyer, Kathryn M; Kelly, Thomas J; Choi, Young W; Rogers, James V; Riggs, Karen B; Willenberg, Zachary J

    2015-01-01

    There is a lack of data for how the viability of biological agents may degrade over time in different environments. In this study, experiments were conducted to determine the persistence of Bacillus anthracis and Bacillus subtilis spores on outdoor materials with and without exposure to simulated sunlight, using ultraviolet (UV)-A/B radiation. Spores were inoculated onto glass, wood, concrete, and topsoil and recovered after periods of 2, 14, 28, and 56 days. Recovery and inactivation kinetics for the two species were assessed for each surface material and UV exposure condition. Results suggest that with exposure to UV, decay of spore viability for both Bacillus species occurs in two phases, with an initial rapid decay, followed by a slower inactivation period. The exception was with topsoil, in which there was minimal loss of spore viability in soil over 56 days, with or without UV exposure. The greatest loss in viable spore recovery occurred on glass with UV exposure, with nearly a four log10 reduction after just two days. In most cases, B. subtilis had a slower rate of decay than B. anthracis, although less B. subtilis was recovered initially.

  19. [Bacillus anthracis: a molecular look at a famous pathogen].

    PubMed

    Pavan, María E; Pettinari, María J; Cairó, Fabián; Pavan, Esteban E; Cataldi, Angel A

    2011-01-01

    Bacillus anthracis, a gram-positive rod belonging to the Bacillus cereus group, has an extremely monomorphic genome, and presents high structural and physiological similarity with B. cereus and Bacillus thuringiensis. In this work, the new molecular methods for the identification and typing of B. anthracis developed in the last years, based on variable number tandem repeats or on genetic differences detected through sequencing, are described. The molecular aspects of traditional virulence factors: capsule, protective antigen, lethal factor and edema factor are described in depth, together with virulence factors recently proposed, such as the siderophores petrobactin and bacillibactin, the S-layer adhesin and the MntA lipoprotein. It is detailed the molecular organization of megaplasmids pXO1 and pXO2, including the pathogenicity island of pXO1. The genetic skeleton of these plasmids has been observed in related species, and this could be attributed to lateral gene transfer. Finally, the two anthrax toxin protective antigen receptors, ANTXR1/TEM8 and ANTXR2/CMG2, essential for the interaction of the pathogen with the host, are presented. The molecular studies performed in recent years have greatly increased knowledge in different aspects of this microorganism and its relationship with the host, but at the same time they have raised new questions about this noted pathogen.

  20. Characterization of the Sortase Repertoire in Bacillus anthracis

    PubMed Central

    Fouet, Agnès

    2011-01-01

    LPXTG proteins, present in most if not all Gram-positive bacteria, are known to be anchored by sortases to the bacterial peptidoglycan. More than one sortase gene is often encoded in a bacterial species, and each sortase is supposed to specifically anchor given LPXTG proteins, depending of the sequence of the C-terminal cell wall sorting signal (cwss), bearing an LPXTG motif or another recognition sequence. B. anthracis possesses three sortase genes. B. anthracis sortase deleted mutant strains are not affected in their virulence. To determine the sortase repertoires, we developed a genetic screen using the property of the gamma phage to lyse bacteria only when its receptor, GamR, an LPXTG protein, is exposed at the surface. We identified 10 proteins that contain a cell wall sorting signal and are covalently anchored to the peptidoglycan. Some chimeric proteins yielded phage lysis in all sortase mutant strains, suggesting that cwss proteins remained surface accessible in absence of their anchoring sortase, probably as a consequence of membrane localization of yet uncleaved precursor proteins. For definite assignment of the sortase repertoires, we consequently relied on a complementary test, using a biochemical approach, namely immunoblot experiments. The sortase anchoring nine of these proteins has thus been determined. The absence of virulence defect of the sortase mutants could be a consequence of the membrane localization of the cwss proteins. PMID:22076158

  1. Colonic Immune Suppression, Barrier Dysfunction, and Dysbiosis by Gastrointestinal Bacillus anthracis Infection

    PubMed Central

    Sahay, Bikash; Zadeh, Mojgan; Cheng, Sam X.; Wang, Gary P.; Owen, Jennifer L.; Mohamadzadeh, Mansour

    2014-01-01

    Gastrointestinal (GI) anthrax results from the ingestion of Bacillus anthracis. Herein, we investigated the pathogenesis of GI anthrax in animals orally infected with toxigenic non-encapsulated B. anthracis Sterne strain (pXO1+ pXO2−) spores that resulted in rapid animal death. B. anthracis Sterne induced significant breakdown of intestinal barrier function and led to gut dysbiosis, resulting in systemic dissemination of not only B. anthracis, but also of commensals. Disease progression significantly correlated with the deterioration of innate and T cell functions. Our studies provide critical immunologic and physiologic insights into the pathogenesis of GI anthrax infection, whereupon cleavage of mitogen-activated protein kinases (MAPKs) in immune cells may play a central role in promoting dysfunctional immune responses against this deadly pathogen. PMID:24945934

  2. Colonic immune suppression, barrier dysfunction, and dysbiosis by gastrointestinal bacillus anthracis Infection.

    PubMed

    Lightfoot, Yaíma L; Yang, Tao; Sahay, Bikash; Zadeh, Mojgan; Cheng, Sam X; Wang, Gary P; Owen, Jennifer L; Mohamadzadeh, Mansour

    2014-01-01

    Gastrointestinal (GI) anthrax results from the ingestion of Bacillus anthracis. Herein, we investigated the pathogenesis of GI anthrax in animals orally infected with toxigenic non-encapsulated B. anthracis Sterne strain (pXO1+ pXO2-) spores that resulted in rapid animal death. B. anthracis Sterne induced significant breakdown of intestinal barrier function and led to gut dysbiosis, resulting in systemic dissemination of not only B. anthracis, but also of commensals. Disease progression significantly correlated with the deterioration of innate and T cell functions. Our studies provide critical immunologic and physiologic insights into the pathogenesis of GI anthrax infection, whereupon cleavage of mitogen-activated protein kinases (MAPKs) in immune cells may play a central role in promoting dysfunctional immune responses against this deadly pathogen.

  3. ENVIRONMENTAL RESPONSE TO INTENTIONAL DISSEMINATION OF BACILLUS ANTHRACIS SPORES IN THE UNITED STATES--2001

    EPA Science Inventory

    The intentional dissemination of Bacillus anthracis (anthrax) spores at multiple locations in the United States in the Fall of 2001 resulted not only in several deaths and illnesses (including psychological effects), but likely changed lifestyles and attitudes, and increased the ...

  4. Selective detection of 1000 B. anthracis spores within 15 minutes using a peptide functionalized SERS assay.

    PubMed

    Farquharson, Stuart; Shende, Chetan; Smith, Wayne; Huang, Hermes; Inscore, Frank; Sengupta, Atanu; Sperry, Jay; Sickler, Todd; Prugh, Amber; Guicheteau, Jason

    2014-12-21

    A surface-enhanced Raman spectroscopy (SERS) assay has been designed to detect Bacillus anthracis spores. The assay consists of silver nanoparticles embedded in a porous glass structure that have been functionalized with ATYPLPIR, a peptide developed to discriminately bind B. anthracis versus other species of Bacillus. Once bound, acetic acid was used to release the biomarker dipicolinic acid from the spores, which was detected by SERS through the addition of silver colloids. This SERS assay was used to selectively bind B. anthracis with a 100-fold selectivity versus B. cereus, and to detect B. anthracis Ames at concentrations of 1000 spores per mL within 15 minutes. The SERS assay measurements provide a basis for the development of systems that can detect spores collected from the air or from water supplies.

  5. Structures of two superoxide dismutases from Bacillus anthracis reveal a novel active centre

    SciTech Connect

    Boucher, Ian W.; Kalliomaa, Anne K.; Levdikov, Vladimir M.; Blagova, Elena V.; Fogg, Mark J.; Brannigan, James A. Wilson, Keith S.; Wilkinson, Anthony J.

    2005-07-01

    The crystal structures of two manganese superoxide dismutases from B. anthracis were solved by X-ray crystallography using molecular replacement. The BA4499 and BA5696 genes of Bacillus anthracis encode proteins homologous to manganese superoxide dismutase, suggesting that this organism has an expanded repertoire of antioxidant proteins. Differences in metal specificity and quaternary structure between the dismutases of prokaryotes and higher eukaryotes may be exploited in the development of therapeutic antibacterial compounds. Here, the crystal structure of two Mn superoxide dismutases from B. anthracis solved to high resolution are reported. Comparison of their structures reveals that a highly conserved residue near the active centre is substituted in one of the proteins and that this is a characteristic feature of superoxide dismutases from the B. cereus/B. anthracis/B. thuringiensis group of organisms.

  6. FORMALDEHYDE GAS INACTIVATION OF BACILLUS ANTHRACIS, BACILLUS SUBTILIS AND GEOBACILLUS STEAROTHERMOPHILUS SPORES ON INDOOR SURFACE MATERIALS.

    EPA Science Inventory

    Research evaluated the decontamination of Bacillus anthracis, Bacillus subtilis, and Geobacillus stearothermophilus spores on indoor surface material using formaldehyde gas. Spores were dried on seven types of indoor surfaces and exposed to 1100 ppm formaldehyde gas for 10 hr. Fo...

  7. WalRK two component system of Bacillus anthracis responds to temperature and antibiotic stress.

    PubMed

    Dhiman, Alisha; Gopalani, Monisha; Bhatnagar, Rakesh

    2015-04-17

    WalRK Two Component System (TCS) of Bacillus anthracis forms a functional TCS. This report elaborates upon the WalRK genomic architecture, promoter structure, promoter activity and expression under various stress conditions in B. anthracis. 5' RACE located the WalRK functional promoter within 317 bp region upstream of WalR. Reporter gene assays demonstrated maximal promoter activity during early growth phases indicating utility in exponential stages of growth. qRT-PCR showed upregulation of WalRK transcripts during temperature and antibiotic stress. However, WalR overexpression did not affect the tested antibiotic MIC values in B. anthracis. Collectively, these results confirm that WalRK responds to cell envelope stress in B. anthracis.

  8. Nitrate Reductase Regulates Expression of Nitrite Uptake and Nitrite Reductase Activities in Chlamydomonas reinhardtii 1

    PubMed Central

    Galván, Aurora; Cárdenas, Jacobo; Fernández, Emilio

    1992-01-01

    In Chlamydomonas reinhardtii mutants defective at the structural locus for nitrate reductase (nit-1) or at loci for biosynthesis of the molybdopterin cofactor (nit-3, nit-4, or nit-5 and nit-6), both nitrite uptake and nitrite reductase activities were repressed in ammonium-grown cells and expressed at high amounts in nitrogen-free media or in media containing nitrate or nitrite. In contrast, wild-type cells required nitrate induction for expression of high levels of both activities. In mutants defective at the regulatory locus for nitrate reductase (nit-2), very low levels of nitrite uptake and nitrite reductase activities were expressed even in the presence of nitrate or nitrite. Both restoration of nitrate reductase activity in mutants defective at nit-1, nit-3, and nit-4 by isolating diploid strains among them and transformation of a structural mutant upon integration of the wild-type nit-1 gene gave rise to the wild-type expression pattern for nitrite uptake and nitrite reductase activities. Conversely, inactivation of nitrate reductase by tungstate treatment in nitrate, nitrite, or nitrogen-free media made wild-type cells respond like nitrate reductase-deficient mutants with respect to the expression of nitrite uptake and nitrite reductase activities. Our results indicate that nit-2 is a regulatory locus for both the nitrite uptake system and nitrite reductase, and that the nitrate reductase enzyme plays an important role in the regulation of the expression of both enzyme activities. PMID:16668656

  9. Genetic and Physiological Studies of Bacillus Anthracis Related to Development of an Improved Vaccine

    DTIC Science & Technology

    1994-06-29

    AD-A284 565 AD CONTRACT NO: DAMDl7-91-C-1100 TITLE: GENETIC AND PHYSIOLOGICAL STUDIES OF BACILLUS ANTHRACIS RELATED TO DEVELOPMENT OF AN IMPROVED...29 June 1994 Final 30 June 1991-29 June 1994 4. TITLE AND SUBTITLE 5. FUNDING NUMBERS Genetic and Physiological Studies of Bacillus Anthracis Related...they form on agar plates, and th, nss of capsular material in a short period of time resemble polypeptide production by B. licheniformis . Tn917 has been

  10. Genetic and Physiological Control of Protective Antigen Synthesis by Bacillus anthracis

    DTIC Science & Technology

    1982-12-01

    referred to in this report Organism Characteristics and Source* Bacillus licheniformis ATCC 9945A C.E. Thorne collection Bacillus subtilis 168 trpC, C.B...Unclassified AD REPORT NUMBER THREE GENETIC ANL PHYSIOLOGICAL CONTROL OF PROTECTIVE ANTIGEN SYNTHESIS BY BACILLUS ANTHRACIS N ANNUAL PROGRESS REPORT...PERIOD COVERED Genetic and Physiological Control of Protective Annual Report Antigen Synthesis by Bacillus anthracis Jan. 1, 1982-Dec. 31, 1982 6

  11. Genetic and Physiological Studies of Bacillus anthracis Related to Development of an Improved Vaccine

    DTIC Science & Technology

    1987-07-01

    resistance plasmid pBC16 to the Bacillus species anthracis, cereus, K -21- ’./ licheniformis , megateritm, pumilus, subtilis, and thuringiensis. Evidence...Q 1 FILE (PRY AD _ _ GENETIC AND PHYSIOLOGICAL STUDIES OF BACILLUS ANTHRACIS RELATED TO DEVELOPMENT OF AN IMPROVED VACCINE ANNUAL PROGRESS REPORTDTIC...Physiological Studies of Bacillus antihviCls Related to Development /1 of An Improved Vaccine S 12. PERSONAL AUTHOR(S)Cuts .Thre 7 13.. ~ ~ ~ ~ ~ 13, T1EO EOT1b

  12. Genetic and Physiological Studies of Bacillus Anthracis Related to Development of an Improved Vaccine

    DTIC Science & Technology

    1992-12-31

    AD-A260 696 AD________ CONTRACT NO: DAMD17-91-C-1100 TITLE: GENETIC AND PHYSIOLOGICAL STUDIES OF BACILLUS ANTHRACIS RELATED TO DEVELOPMENT OF AN...20. Glutamyl polypeptide synthesis by Bacillus anthracis 4229 UM12 and insertion mutants tp49, tp5O and tp6O ............................... 61 FIG... licheniformis . Tn917 has been shown by DNA-DNA hybridization experiments to be located in the chromosome of tp5O and in the capsule plasmid of tp49 and

  13. Two-Component Direct Fluorescent-Antibody Assay for Rapid Identification of Bacillus Anthracis

    DTIC Science & Technology

    2002-10-01

    Bacillus spp. (n=56) Five closely related Bacillus species—B. cereus (n=23), B. megaterium (n=11), B. subtilis (n=9), B. thuringiensis (n=12), and B...Rapid Identification of Bacillus anthracis Barun K. De,* Sandra L. Bragg,* Gary N. Sanden,* Kathy E. Wilson,* Lois A. Diem,* Chung K. Marston...antibody (DFA) assay, using fluorescein-labeled monoclonal antibodies specific to the Bacillus anthracis cell wall (CW-DFA) and capsule (CAP-DFA

  14. Host-Pathogen Coupled Networks: Model for Bacillus Anthracis Interaction with Host Macrophages

    DTIC Science & Technology

    2015-09-01

    regional lymph nodes where vegetative BA bacteria synthesize protective antigen (PA), lethal factor (LF), and edema factor (EF) for release into...vegetative B. anthracis bacteria synthesize protective antigen (PA), lethal factor (LF), and edema factor (EF) for release into the circulation...proteins to which B. anthracis owes its virulence. These proteins are protective antigen (PA), lethal factor (LF), and edema factor (EF). LF is a

  15. Identification and Validation of Specific Markers of Bacillus anthracis Spores by Proteomics and Genomics Approaches*

    PubMed Central

    Chenau, Jérôme; Fenaille, François; Caro, Valérie; Haustant, Michel; Diancourt, Laure; Klee, Silke R.; Junot, Christophe; Ezan, Eric; Goossens, Pierre L.; Becher, François

    2014-01-01

    Bacillus anthracis is the causative bacteria of anthrax, an acute and often fatal disease in humans. The infectious agent, the spore, represents a real bioterrorism threat and its specific identification is crucial. However, because of the high genomic relatedness within the Bacillus cereus group, it is still a real challenge to identify B. anthracis spores confidently. Mass spectrometry-based tools represent a powerful approach to the efficient discovery and identification of such protein markers. Here we undertook comparative proteomics analyses of Bacillus anthracis, cereus and thuringiensis spores to identify proteoforms unique to B. anthracis. The marker discovery pipeline developed combined peptide- and protein-centric approaches using liquid chromatography coupled to tandem mass spectrometry experiments using a high resolution/high mass accuracy LTQ-Orbitrap instrument. By combining these data with those from complementary bioinformatics approaches, we were able to highlight a dozen novel proteins consistently observed across all the investigated B. anthracis spores while being absent in B. cereus/thuringiensis spores. To further demonstrate the relevance of these markers and their strict specificity to B. anthracis, the number of strains studied was extended to 55, by including closely related strains such as B. thuringiensis 9727, and above all the B. cereus biovar anthracis CI, CA strains that possess pXO1- and pXO2-like plasmids. Under these conditions, the combination of proteomics and genomics approaches confirms the pertinence of 11 markers. Genes encoding these 11 markers are located on the chromosome, which provides additional targets complementary to the commonly used plasmid-encoded markers. Last but not least, we also report the development of a targeted liquid chromatography coupled to tandem mass spectrometry method involving the selection reaction monitoring mode for the monitoring of the 4 most suitable protein markers. Within a proof

  16. Production and Characterization of Monoclonal Antibodies Against the Protective Antigen Component of Bacillus anthracis Toxin

    DTIC Science & Technology

    1988-01-21

    F. Jaquet, P. Luethy, R. Huetter, and D. G. Braun. 1986. Characterization of mcnoclonal antibodies to a crystal protein of Bacillus thuringiensis ...AD-A192 855 UT FILE COPY Production and Characterization of Monoclonal Antibodies Against the Protective Antigen Component of Bacillus anthracis...Author Tel. No. 301-663-7341 1--ac",- 88 3 14 05 6 Krhirty-six monoclonal antibodies to the protective antigen protein of Bacillus anthracis exotoxin

  17. Identification and validation of specific markers of Bacillus anthracis spores by proteomics and genomics approaches.

    PubMed

    Chenau, Jérôme; Fenaille, François; Caro, Valérie; Haustant, Michel; Diancourt, Laure; Klee, Silke R; Junot, Christophe; Ezan, Eric; Goossens, Pierre L; Becher, François

    2014-03-01

    Bacillus anthracis is the causative bacteria of anthrax, an acute and often fatal disease in humans. The infectious agent, the spore, represents a real bioterrorism threat and its specific identification is crucial. However, because of the high genomic relatedness within the Bacillus cereus group, it is still a real challenge to identify B. anthracis spores confidently. Mass spectrometry-based tools represent a powerful approach to the efficient discovery and identification of such protein markers. Here we undertook comparative proteomics analyses of Bacillus anthracis, cereus and thuringiensis spores to identify proteoforms unique to B. anthracis. The marker discovery pipeline developed combined peptide- and protein-centric approaches using liquid chromatography coupled to tandem mass spectrometry experiments using a high resolution/high mass accuracy LTQ-Orbitrap instrument. By combining these data with those from complementary bioinformatics approaches, we were able to highlight a dozen novel proteins consistently observed across all the investigated B. anthracis spores while being absent in B. cereus/thuringiensis spores. To further demonstrate the relevance of these markers and their strict specificity to B. anthracis, the number of strains studied was extended to 55, by including closely related strains such as B. thuringiensis 9727, and above all the B. cereus biovar anthracis CI, CA strains that possess pXO1- and pXO2-like plasmids. Under these conditions, the combination of proteomics and genomics approaches confirms the pertinence of 11 markers. Genes encoding these 11 markers are located on the chromosome, which provides additional targets complementary to the commonly used plasmid-encoded markers. Last but not least, we also report the development of a targeted liquid chromatography coupled to tandem mass spectrometry method involving the selection reaction monitoring mode for the monitoring of the 4 most suitable protein markers. Within a proof

  18. Indirect Detection Of Bacillus Anthracis (Anthrax) Using Amplified Gamma Phage-Based Assays

    DTIC Science & Technology

    2007-11-01

    cells). Both capsule and toxin genes are required for fully virulent B. anthracis [28], and the production of the toxin proteins and the capsule... toxins . Most animal species , if untreated with antibiotics, contain between 10 and 100 million B. anthracis organisms per milliliter of blood at...environment and is found in many foods , it produces toxins that lead to food poisoning within several hours of ingestion. B. thuringiensis is an insect

  19. Verification of Commercial Decontamination Technologies in Bench-Scale Studies Using Bacillus anthracis Spores

    DTIC Science & Technology

    2004-11-17

    12980) • Spore Strips – Bacillus atrophaeus (ATCC 9372) Biological Indicator Spore Strip BUSINESS SENSITIVE Organisms Biological Indicators: SEM Images...BUSINESS SENSITIVE Verification of Commercial Decontamination Technologies in Bench-Scale Studies Using Bacillus anthracis Spores M.L. Taylor, J.V...Commercial Decontamination Technologies in Bench-Scale Studies Using Bacillus anthracis Spores 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM

  20. The Bacillus anthracis chromosome contains four conserved, excision-proficient, putative prophages

    PubMed Central

    Sozhamannan, Shanmuga; Chute, Michael D; McAfee, Farrell D; Fouts, Derrick E; Akmal, Arya; Galloway, Darrell R; Mateczun, Alfred; Baillie, Leslie W; Read, Timothy D

    2006-01-01

    Background Bacillus anthracis is considered to be a recently emerged clone within the Bacillus cereus sensu lato group. The B. anthracis genome sequence contains four putative lambdoid prophages. We undertook this study in order to understand whether the four prophages are unique to B. anthracis and whether they produce active phages. Results More than 300 geographically and temporally divergent isolates of B. anthracis and its near neighbors were screened by PCR for the presence of specific DNA sequences from each prophage region. Every isolate of B. anthracis screened by PCR was found to produce all four phage-specific amplicons whereas none of the non-B. anthracis isolates, produced more than one phage-specific amplicon. Excision of prophages could be detected by a PCR based assay for attP sites on extra-chromosomal phage circles and for attB sites on phage-excised chromosomes. SYBR-green real-time PCR assays indicated that prophage excision occurs at very low frequencies (2 × 10-5 - 8 × 10-8/cell). Induction with mitomycin C increased the frequency of excision of one of the prophages by approximately 250 fold. All four prophages appear to be defective since, mitomycin C induced culture did not release any viable phage particle or lyse the cells or reveal any phage particle under electron microscopic examination. Conclusion The retention of all four putative prophage regions across all tested strains of B. anthracis is further evidence of the very recent emergence of this lineage and the prophage regions may be useful for differentiating the B. anthracis chromosome from that of its neighbors. All four prophages can excise at low frequencies, but are apparently defective in phage production. PMID:16600039

  1. Direct detection of Bacillus anthracis DNA in animals by polymerase chain reaction.

    PubMed Central

    Makino, S I; Iinuma-Okada, Y; Maruyama, T; Ezaki, T; Sasakawa, C; Yoshikawa, M

    1993-01-01

    Bacillus anthracis is a soil pathogen capable of causing anthrax. To establish a method for specifically detecting B. anthracis for practical applications, such as for the inspection of slaughterhouses, the cap region, which is essential for encapsulation in B. anthracis, was used in a DNA hybridization study by polymerase chain reaction (PCR). Oligonucleotide primers were designed to amplify a 288-bp DNA fragment within the capA gene by PCR. The amplified DNA sequence specifically hybridized to the DNA of B. anthracis but not to that of other bacterial strains tested. Since this PCR-based method efficiently and specifically detected the capA sequence of bacteria in blood and spleen samples of mice within 8 h after the administration of live B. anthracis, this PCR system could be used for practical applications. By using lysis methods in preparing the samples for PCR, it was possible to amplify the 288-bp DNA segment from samples containing very few bacteria, as few as only 1 sporeforming unit, indicating that the PCR detection method developed in this study will permit the monitoring of B. anthracis contamination in the environment. Images PMID:8458949

  2. Bacillus anthracis comparative genome analysis in support of the Amerithrax investigation

    PubMed Central

    Rasko, David A.; Worsham, Patricia L.; Abshire, Terry G.; Stanley, Scott T.; Bannan, Jason D.; Wilson, Mark R.; Langham, Richard J.; Decker, R. Scott; Jiang, Lingxia; Read, Timothy D.; Phillippy, Adam M.; Salzberg, Steven L.; Pop, Mihai; Van Ert, Matthew N.; Kenefic, Leo J.; Keim, Paul S.; Fraser-Liggett, Claire M.; Ravel, Jacques

    2011-01-01

    Before the anthrax letter attacks of 2001, the developing field of microbial forensics relied on microbial genotyping schemes based on a small portion of a genome sequence. Amerithrax, the investigation into the anthrax letter attacks, applied high-resolution whole-genome sequencing and comparative genomics to identify key genetic features of the letters’ Bacillus anthracis Ames strain. During systematic microbiological analysis of the spore material from the letters, we identified a number of morphological variants based on phenotypic characteristics and the ability to sporulate. The genomes of these morphological variants were sequenced and compared with that of the B. anthracis Ames ancestor, the progenitor of all B. anthracis Ames strains. Through comparative genomics, we identified four distinct loci with verifiable genetic mutations. Three of the four mutations could be directly linked to sporulation pathways in B. anthracis and more specifically to the regulation of the phosphorylation state of Spo0F, a key regulatory protein in the initiation of the sporulation cascade, thus linking phenotype to genotype. None of these variant genotypes were identified in single-colony environmental B. anthracis Ames isolates associated with the investigation. These genotypes were identified only in B. anthracis morphotypes isolated from the letters, indicating that the variants were not prevalent in the environment, not even the environments associated with the investigation. This study demonstrates the forensic value of systematic microbiological analysis combined with whole-genome sequencing and comparative genomics. PMID:21383169

  3. Real-Time PCR Assay for a Unique Chromosomal Sequence of Bacillus anthracis

    PubMed Central

    Bode, Elizabeth; Hurtle, William; Norwood, David

    2004-01-01

    Real-time PCR has become an important method for the rapid identification of Bacillus anthracis since the 2001 anthrax mailings. Most real-time PCR assays for B. anthracis have been developed to detect virulence genes located on the pXO1 and pXO2 plasmids. In contrast, only two published chromosomal targets exist, the rpoB gene and the gyrA gene. In the present study, subtraction-hybridization with a plasmid-cured B. anthracis tester strain and a Bacillus cereus driver was used to find a unique chromosomal sequence. By targeting this region, a real-time assay was developed with the Ruggedized Advanced Pathogen Identification Device. Further testing has revealed that the assay has 100% sensitivity and 100% specificity, with a limit of detection of 50 fg of DNA. The results of a search for sequences with homology with the BLAST program demonstrated significant alignment to the recently published B. anthracis Ames strain, while an inquiry for protein sequence similarities indicated homology with an abhydrolase from B. anthracis strain A2012. The importance of this chromosomal assay will be to verify the presence of B. anthracis independently of plasmid occurrence. PMID:15583318

  4. Detection of B. anthracis Spores and Vegetative Cells with the Same Monoclonal Antibodies

    PubMed Central

    Wang, Dian-Bing; Yang, Ruifu; Zhang, Zhi-Ping; Bi, Li-Jun; You, Xiang-Yu; Wei, Hong-Ping; Zhou, Ya-Feng; Yu, Ziniu; Zhang, Xian-En

    2009-01-01

    Bacillus anthracis, the causative agent of anthrax disease, could be used as a biothreat reagent. It is vital to develop a rapid, convenient method to detect B. anthracis. In the current study, three high affinity and specificity monoclonal antibodies (mAbs, designated 8G3, 10C6 and 12F6) have been obtained using fully washed B. anthracis spores as an immunogen. These mAbs, confirmed to direct against EA1 protein, can recognize the surface of B. anthracis spores and intact vegetative cells with high affinity and species-specificity. EA1 has been well known as a major S-layer component of B. anthracis vegetative cells, and it also persistently exists in the spore preparations and bind tightly to the spore surfaces even after rigorous washing. Therefore, these mAbs can be used to build a new and rapid immunoassay for detection of both life forms of B. anthracis, either vegetative cells or spores. PMID:19915677

  5. The Secret Life of the Anthrax Agent Bacillus anthracis: Bacteriophage-Mediated Ecological Adaptations

    PubMed Central

    Schuch, Raymond; Fischetti, Vincent A.

    2009-01-01

    Ecological and genetic factors that govern the occurrence and persistence of anthrax reservoirs in the environment are obscure. A central tenet, based on limited and often conflicting studies, has long held that growing or vegetative forms of Bacillus anthracis survive poorly outside the mammalian host and must sporulate to survive in the environment. Here, we present evidence of a more dynamic lifecycle, whereby interactions with bacterial viruses, or bacteriophages, elicit phenotypic alterations in B. anthracis and the emergence of infected derivatives, or lysogens, with dramatically altered survival capabilities. Using both laboratory and environmental B. anthracis strains, we show that lysogeny can block or promote sporulation depending on the phage, induce exopolysaccharide expression and biofilm formation, and enable the long-term colonization of both an artificial soil environment and the intestinal tract of the invertebrate redworm, Eisenia fetida. All of the B. anthracis lysogens existed in a pseudolysogenic-like state in both the soil and worm gut, shedding phages that could in turn infect non-lysogenic B. anthracis recipients and confer survival phenotypes in those environments. Finally, the mechanism behind several phenotypic changes was found to require phage-encoded bacterial sigma factors and the expression of at least one host-encoded protein predicted to be involved in the colonization of invertebrate intestines. The results here demonstrate that during its environmental phase, bacteriophages provide B. anthracis with alternatives to sporulation that involve the activation of soil-survival and endosymbiotic capabilities. PMID:19672290

  6. Plantazolicin is an ultra-narrow spectrum antibiotic that targets the Bacillus anthracis membrane

    PubMed Central

    Molohon, Katie J.; Blair, Patricia M.; Park, Seongjin; Doroghazi, James R.; Maxson, Tucker; Hershfield, Jeremy R.; Flatt, Kristen M.; Schroeder, Nathan E.; Ha, Taekjip; Mitchell, Douglas A.

    2016-01-01

    Plantazolicin (PZN) is a ribosomally synthesized and post-translationally modified natural product from Bacillus methylotrophicus FZB42 and Bacillus pumilus. Extensive tailoring to twelve of the fourteen amino acid residues in the mature natural product endows PZN with not only a rigid, polyheterocyclic structure, but also antibacterial activity. Here we report a remarkably discriminatory activity of PZN toward Bacillus anthracis, which rivals a previously-described gamma (γ) phage lysis assay in distinguishing B. anthracis from other members of the Bacillus cereus group. We evaluate the underlying cause of this selective activity by measuring the RNA expression profile of PZN-treated B. anthracis, which revealed significant upregulation of genes within the cell envelope stress response. PZN depolarizes the B. anthracis membrane like other cell envelope-acting compounds but uniquely localizes to distinct foci within the envelope. Selection and whole-genome sequencing of PZN-resistant mutants of B. anthracis implicate a relationship between the action of PZN and cardiolipin (CL) within the membrane. Exogenous CL increases the potency of PZN in wild type B. anthracis and promotes the incorporation of fluorescently tagged PZN in the cell envelope. We propose that PZN localizes to and exacerbates structurally compromised regions of the bacterial membrane, which ultimately results in cell lysis. PMID:27152321

  7. Plantazolicin is an ultra-narrow spectrum antibiotic that targets the Bacillus anthracis membrane.

    PubMed

    Molohon, Katie J; Blair, Patricia M; Park, Seongjin; Doroghazi, James R; Maxson, Tucker; Hershfield, Jeremy R; Flatt, Kristen M; Schroeder, Nathan E; Ha, Taekjip; Mitchell, Douglas A

    2016-03-10

    Plantazolicin (PZN) is a ribosomally synthesized and post-translationally modified natural product from Bacillus methylotrophicus FZB42 and Bacillus pumilus. Extensive tailoring to twelve of the fourteen amino acid residues in the mature natural product endows PZN with not only a rigid, polyheterocyclic structure, but also antibacterial activity. Here we report a remarkably discriminatory activity of PZN toward Bacillus anthracis, which rivals a previously-described gamma (γ) phage lysis assay in distinguishing B. anthracis from other members of the Bacillus cereus group. We evaluate the underlying cause of this selective activity by measuring the RNA expression profile of PZN-treated B. anthracis, which revealed significant upregulation of genes within the cell envelope stress response. PZN depolarizes the B. anthracis membrane like other cell envelope-acting compounds but uniquely localizes to distinct foci within the envelope. Selection and whole-genome sequencing of PZN-resistant mutants of B. anthracis implicate a relationship between the action of PZN and cardiolipin (CL) within the membrane. Exogenous CL increases the potency of PZN in wild type B. anthracis and promotes the incorporation of fluorescently tagged PZN in the cell envelope. We propose that PZN localizes to and exacerbates structurally compromised regions of the bacterial membrane, which ultimately results in cell lysis.

  8. Comparison of Bacillus Anthracis to the Surrogate Bacillus Atrophaeus for Spore Inactivation on a Novel Antimicrobial Fabric

    DTIC Science & Technology

    2006-05-01

    AFRL-HE-WP-TP-2006-0061 AIR FORCE RESEARCH LABORATORY Comparison of Bacillus Anthracis to the Surrogate Bacillus Atrophaeus for Spore Inactivation on...CONTRACT NUMBER Comparison of Bacillus Anthracis to the Surrogate Bacillus Atrophaeus for Spore Inactivation on a Novel Antimicrobial Fabric 5b. GRANT NUMBER...239.18 Comparison of Bacillus anthracis to the Surrogate Bacillus atrophaeus for Spore Inactivation on a Novel Antimicrobial Fabric Christopher C

  9. Bacillus cereus G9241 makes anthrax toxin and capsule like highly virulent B. anthracis Ames but behaves like attenuated toxigenic nonencapsulated B. anthracis Sterne in rabbits and mice.

    PubMed

    Wilson, Melissa K; Vergis, James M; Alem, Farhang; Palmer, John R; Keane-Myers, Andrea M; Brahmbhatt, Trupti N; Ventura, Christy L; O'Brien, Alison D

    2011-08-01

    Bacillus cereus G9241 was isolated from a welder with a pulmonary anthrax-like illness. The organism contains two megaplasmids, pBCXO1 and pBC218. These plasmids are analogous to the Bacillus anthracis Ames plasmids pXO1 and pXO2 that encode anthrax toxins and capsule, respectively. Here we evaluated the virulence of B. cereus G9241 as well as the contributions of pBCXO1 and pBC218 to virulence. B. cereus G9241 was avirulent in New Zealand rabbits after subcutaneous inoculation and attenuated 100-fold compared to the published 50% lethal dose (LD(50)) values for B. anthracis Ames after aerosol inoculation. A/J and C57BL/6J mice were comparably susceptible to B. cereus G9241 by both subcutaneous and intranasal routes of infection. However, the LD(50)s for B. cereus G9241 in both mouse strains were markedly higher than those reported for B. anthracis Ames and more like those of the toxigenic but nonencapsulated B. anthracis Sterne. Furthermore, B. cereus G9241 spores could germinate and disseminate after intranasal inoculation into A/J mice, as indicated by the presence of vegetative cells in the spleen and blood of animals 48 h after infection. Lastly, B. cereus G9241 derivatives cured of one or both megaplasmids were highly attenuated in A/J mice. We conclude that the presence of the toxin- and capsule-encoding plasmids pBCXO1 and pBC218 in B. cereus G9241 alone is insufficient to render the strain as virulent as B. anthracis Ames. However, like B. anthracis, full virulence of B. cereus G9241 for mice requires the presence of both plasmids.

  10. Gene expression control by Bacillus anthracis purine riboswitches.

    PubMed

    Kirchner, Marion; Schneider, Sabine

    2017-02-16

    In all kingdoms of life, cellular replication relies on the presence of nucleosides and nucleotides, the building blocks of nucleic acids and the main source of energy. In bacteria, the availability of metabolites sometimes directly regulates the expression of enzymes and proteins involved in purine salvage, biosynthesis and uptake through riboswitches. Riboswitches are located in bacterial mRNAs and can control gene expression by conformational changes in response to ligand binding. We have established an inverse reporter gene system in Bacillus subtilis that allows us to monitor riboswitch-controlled gene expression. We used it to investigate the activity of five potential purine riboswitches from B. anthracis in response to different purines and pyrimidines. Furthermore, in vitro studies on the aptamer domains of the riboswitches reveal their variation in guanine binding affinity ranging from nM to µM. These data do not only provide insight into metabolite sensing but can also aid to engineer artificial cell regulatory systems.

  11. Decontamination Options for Drinking Water Contaminated with Bacillus anthracis Spores

    SciTech Connect

    Raber, E; Burklund, A

    2010-02-16

    Five parameters were evaluated with surrogates of Bacillus anthracis spores to determine effective decontamination options for use in a contaminated drinking water supply. The parameters were: (1) type of Bacillus spore surrogate (B. thuringiensis or B. atrophaeus); (2) spore concentration in suspension (10{sup 2} to 10{sup 6} spores/ml); (3) chemical characteristics of decontaminant [sodium dicholor-s-triazinetrione dihydrate (Dichlor), hydrogen peroxide, potassium peroxymonosulfate (Oxone), sodium hypochlorite, and VirkonS{reg_sign}]; (4) decontaminant concentration (0.01% to 5%); and (5) decontaminant exposure time (10 min to 24 hr). Results from 162 suspension tests with appropriate controls are reported. Hydrogen peroxide at a concentration of 5%, and Dichlor and sodium hypochlorite at a concentration of 2%, were effective at spore inactivation regardless of spore type tested, spore exposure time, or spore concentration evaluated. This is the first reported study of Dichlor as an effective decontaminant for B. anthracis spore surrogates. Dichlor's desirable characteristics of high oxidation potential, high level of free chlorine, and more neutral pH than that of other oxidizers evaluated appear to make it an excellent alternative. All three oxidizers were effective against B. atrophaeus spores in meeting EPA's biocide standard of greater than a 6 log kill after a 10-minute exposure time and at lower concentrations than typically reported for biocide use. Solutions of 5% VirkonS{reg_sign} and Oxone were less effective decontaminants than other options evaluated in this study and did not meet the EPA's efficacy standard for biocides. Differences in methods and procedures reported by other investigators make quantitative comparisons among studies difficult.

  12. Neuroprotective role for carbonyl reductase?

    PubMed

    Maser, Edmund

    2006-02-24

    Oxidative stress is increasingly implicated in neurodegenerative disorders including Alzheimer's, Parkinson's, Huntington's, and Creutzfeld-Jakob diseases or amyotrophic lateral sclerosis. Reactive oxygen species seem to play a significant role in neuronal cell death in that they generate reactive aldehydes from membrane lipid peroxidation. Several neuronal diseases are associated with increased accumulation of abnormal protein adducts of reactive aldehydes, which mediate oxidative stress-linked pathological events, including cellular growth inhibition and apoptosis induction. Combining findings on neurodegeneration and oxidative stress in Drosophila with studies on the metabolic characteristics of the human enzyme carbonyl reductase (CR), it is clear now that CR has a potential physiological role for neuroprotection in humans. Several lines of evidence suggest that CR represents a significant pathway for the detoxification of reactive aldehydes derived from lipid peroxidation and that CR in humans is essential for neuronal cell survival and to confer protection against oxidative stress-induced brain degeneration.

  13. Capsules, Toxins and AtxA as Virulence Factors of Emerging Bacillus cereus Biovar anthracis

    PubMed Central

    Corre, Jean-Philippe; Lander, Angelika; Franz, Tatjana; Monot, Marc; Couture-Tosi, Evelyne; Jouvion, Gregory; Leendertz, Fabian H.; Grunow, Roland; Mock, Michèle E.; Klee, Silke R.; Goossens, Pierre L.

    2015-01-01

    Emerging B. cereus strains that cause anthrax-like disease have been isolated in Cameroon (CA strain) and Côte d’Ivoire (CI strain). These strains are unusual, because their genomic characterisation shows that they belong to the B. cereus species, although they harbour two plasmids, pBCXO1 and pBCXO2, that are highly similar to the pXO1 and pXO2 plasmids of B. anthracis that encode the toxins and the polyglutamate capsule respectively. The virulence factors implicated in the pathogenicity of these B. cereus bv anthracis strains remain to be characterised. We tested their virulence by cutaneous and intranasal delivery in mice and guinea pigs; they were as virulent as wild-type B. anthracis. Unlike as described for pXO2-cured B. anthracis, the CA strain cured of the pBCXO2 plasmid was still highly virulent, showing the existence of other virulence factors. Indeed, these strains concomitantly expressed a hyaluronic acid (HA) capsule and the B. anthracis polyglutamate (PDGA) capsule. The HA capsule was encoded by the hasACB operon on pBCXO1, and its expression was regulated by the global transcription regulator AtxA, which controls anthrax toxins and PDGA capsule in B. anthracis. Thus, the HA and PDGA capsules and toxins were co-regulated by AtxA. We explored the respective effect of the virulence factors on colonisation and dissemination of CA within its host by constructing bioluminescent mutants. Expression of the HA capsule by itself led to local multiplication and, during intranasal infection, to local dissemination to the adjacent brain tissue. Co-expression of either toxins or PDGA capsule with HA capsule enabled systemic dissemination, thus providing a clear evolutionary advantage. Protection against infection by B. cereus bv anthracis required the same vaccination formulation as that used against B. anthracis. Thus, these strains, at the frontier between B. anthracis and B. cereus, provide insight into how the monomorphic B. anthracis may have emerged. PMID

  14. Capsules, toxins and AtxA as virulence factors of emerging Bacillus cereus biovar anthracis.

    PubMed

    Brézillon, Christophe; Haustant, Michel; Dupke, Susann; Corre, Jean-Philippe; Lander, Angelika; Franz, Tatjana; Monot, Marc; Couture-Tosi, Evelyne; Jouvion, Gregory; Leendertz, Fabian H; Grunow, Roland; Mock, Michèle E; Klee, Silke R; Goossens, Pierre L

    2015-04-01

    Emerging B. cereus strains that cause anthrax-like disease have been isolated in Cameroon (CA strain) and Côte d'Ivoire (CI strain). These strains are unusual, because their genomic characterisation shows that they belong to the B. cereus species, although they harbour two plasmids, pBCXO1 and pBCXO2, that are highly similar to the pXO1 and pXO2 plasmids of B. anthracis that encode the toxins and the polyglutamate capsule respectively. The virulence factors implicated in the pathogenicity of these B. cereus bv anthracis strains remain to be characterised. We tested their virulence by cutaneous and intranasal delivery in mice and guinea pigs; they were as virulent as wild-type B. anthracis. Unlike as described for pXO2-cured B. anthracis, the CA strain cured of the pBCXO2 plasmid was still highly virulent, showing the existence of other virulence factors. Indeed, these strains concomitantly expressed a hyaluronic acid (HA) capsule and the B. anthracis polyglutamate (PDGA) capsule. The HA capsule was encoded by the hasACB operon on pBCXO1, and its expression was regulated by the global transcription regulator AtxA, which controls anthrax toxins and PDGA capsule in B. anthracis. Thus, the HA and PDGA capsules and toxins were co-regulated by AtxA. We explored the respective effect of the virulence factors on colonisation and dissemination of CA within its host by constructing bioluminescent mutants. Expression of the HA capsule by itself led to local multiplication and, during intranasal infection, to local dissemination to the adjacent brain tissue. Co-expression of either toxins or PDGA capsule with HA capsule enabled systemic dissemination, thus providing a clear evolutionary advantage. Protection against infection by B. cereus bv anthracis required the same vaccination formulation as that used against B. anthracis. Thus, these strains, at the frontier between B. anthracis and B. cereus, provide insight into how the monomorphic B. anthracis may have emerged.

  15. Detection of Bacillus anthracis DNA in Complex Soil and Air Samples Using Next-Generation Sequencing

    PubMed Central

    Be, Nicholas A.; Thissen, James B.; Gardner, Shea N.; McLoughlin, Kevin S.; Fofanov, Viacheslav Y.; Koshinsky, Heather; Ellingson, Sally R.; Brettin, Thomas S.; Jackson, Paul J.; Jaing, Crystal J.

    2013-01-01

    Bacillus anthracis is the potentially lethal etiologic agent of anthrax disease, and is a significant concern in the realm of biodefense. One of the cornerstones of an effective biodefense strategy is the ability to detect infectious agents with a high degree of sensitivity and specificity in the context of a complex sample background. The nature of the B. anthracis genome, however, renders specific detection difficult, due to close homology with B. cereus and B. thuringiensis. We therefore elected to determine the efficacy of next-generation sequencing analysis and microarrays for detection of B. anthracis in an environmental background. We applied next-generation sequencing to titrated genome copy numbers of B. anthracis in the presence of background nucleic acid extracted from aerosol and soil samples. We found next-generation sequencing to be capable of detecting as few as 10 genomic equivalents of B. anthracis DNA per nanogram of background nucleic acid. Detection was accomplished by mapping reads to either a defined subset of reference genomes or to the full GenBank database. Moreover, sequence data obtained from B. anthracis could be reliably distinguished from sequence data mapping to either B. cereus or B. thuringiensis. We also demonstrated the efficacy of a microbial census microarray in detecting B. anthracis in the same samples, representing a cost-effective and high-throughput approach, complementary to next-generation sequencing. Our results, in combination with the capacity of sequencing for providing insights into the genomic characteristics of complex and novel organisms, suggest that these platforms should be considered important components of a biosurveillance strategy. PMID:24039948

  16. Strain-specific single-nucleotide polymorphism assays for the Bacillus anthracis Ames strain.

    PubMed

    Van Ert, Matthew N; Easterday, W Ryan; Simonson, Tatum S; U'Ren, Jana M; Pearson, Talima; Kenefic, Leo J; Busch, Joseph D; Huynh, Lynn Y; Dukerich, Megan; Trim, Carla B; Beaudry, Jodi; Welty-Bernard, Amy; Read, Timothy; Fraser, Claire M; Ravel, Jacques; Keim, Paul

    2007-01-01

    Highly precise diagnostics and forensic assays can be developed through a combination of evolutionary analysis and the exhaustive examination of genomic sequences. In Bacillus anthracis, whole-genome sequencing efforts revealed ca. 3,500 single-nucleotide polymorphisms (SNPs) among eight different strains and evolutionary analysis provides the identification of canonical SNPs. We have previously shown that SNPs are highly evolutionarily stable, and the clonal nature of B. anthracis makes them ideal signatures for subtyping this pathogen. Here we identified SNPs that define the lineage of B. anthracis that contains the Ames strain, the strain used in the 2001 bioterrorist attacks in the United States. Sequencing and real-time PCR were used to validate these SNPs across B. anthracis strains, including (i) 88 globally and genetically diverse isolates; (ii) isolates that were shown to be genetic relatives of the Ames strain by multiple-locus variable number tandem repeat analysis (MLVA); and (iii) several different lab stocks of the Ames strain, including a clinical isolate from the 2001 letter attack. Six SNPs were found to be highly specific for the Ames strain; four on the chromosome, one on the pX01 plasmid, and one on the pX02 plasmid. All six SNPs differentiated the B. anthracis Ames strain from the 88 unique B. anthracis strains, while five of the six separated Ames from its close genetic relatives. The use of these SNPs coupled with real-time PCR allows specific and sensitive (<100 fg of template DNA) identification of the Ames strain. This evolutionary and genomics-based approach provides an effective means for the discovery of strain-specific SNPs in B. anthracis.

  17. Rapid Detection of Bacillus anthracis in Complex Food Matrices Using Phage-Mediated Bioluminescence.

    PubMed

    Sharp, Natasha J; Vandamm, Joshua P; Molineux, Ian J; Schofield, David A

    2015-05-01

    Bacillus anthracis, the causative agent of anthrax, is considered a high-priority agent that may be used in a food-related terrorist attack because it can be contracted by ingestion and it also forms spores with heat and chemical resistance. Thus, novel surveillance methodologies to detect B. anthracis on adulterated foods are important for bioterrorism preparedness. We describe the development of a phage-based bioluminescence assay for the detection of B. anthracis on deliberately contaminated foods. We previously engineered the B. anthracis phage Wβ with genes encoding bacterial luciferase (luxA and luxB) to create a "light-tagged" reporter (Wβ::luxAB) that is able to rapidly detect B. anthracis by transducing a bioluminescent signal response. Here, we investigate the ability of Wβ::luxAB to detect B. anthracis Sterne, an attenuated select agent strain, in inoculated food (ground beef) and milk (2%, baby formula, and half and half) matrices after incubation with spores for 72 h at 4°C as per AOAC testing guidelines. The majority of B. anthracis bacilli remained in spore form, and thus were potentially infectious, within each of the liquid matrices for 14 days. Detection limits were 80 CFU/ml after 7 h of enrichment; sensitivity of detection increased to 8 CFU/ml when enrichment was extended to 16 h. The limit of detection in ground beef was 3.2 × 10(3) CFU/g after 7 h of enrichment, improving to 3.2 × 10(2) CFU/g after 16 h. Because the time to result is rapid and minimal processing is required, and because gastrointestinal anthrax can be fatal, the reporter technology displays promise for the protection of our food supply following a deliberate release of this priority pathogen.

  18. Performance of a Handheld PCR Instrument in the Detection of Bacillus anthracis, Francisella tularensis, and Yersinia pestis: Sensitivity, Specificity, and Effect of Interferents on Assay Results

    DTIC Science & Technology

    2004-12-01

    1 PERFORMANCE OF A HANDHELD PCR INSTRUMENT IN THE DETECTION OF BACILLUS ANTHRACIS, FRANCISELLA TULARENSIS, AND YERSINIA PESTIS: SENSITIVITY...fluorogenic PCR assay reagents for the detection of three biological threat agents, Bacillus anthracis (BA), Francisella tularensis (FT), and Yersinia...TITLE AND SUBTITLE Performance Of A Handheld Pcr Instrument In The Detection Of Bacillus Anthracis, Francisella Tularensis, And Yersinia Pestis

  19. Genetics Home Reference: 5-alpha reductase deficiency

    MedlinePlus

    ... About half of these individuals adopt a male gender role in adolescence or early adulthood. Related Information ... 1730-5. Citation on PubMed Cohen-Kettenis PT. Gender change in 46,XY persons with 5alpha-reductase- ...

  20. A dissimilatory nitrite reductase in Paracoccus halodenitrificans

    NASA Technical Reports Server (NTRS)

    Grant, M. A.; Hochstein, L. I.

    1984-01-01

    Paracoccus halodenitrificans produced a membrane-associated nitrite reductase. Spectrophotometric analysis showed it to be associated with a cd-cytochrome and located on the inner side of the cytoplasmic membrane. When supplied with nitrite, membrane preparations produced nitrous oxide and nitric oxide in different ratios depending on the electron donor employed. The nitrite reductase was maximally active at relatively low concentrations of sodium chloride and remained attached to the membranes at 100 mM sodium chloride.

  1. Novel Sample Preparation Method for Safe and Rapid Detection of Bacillus anthracis Spores in Environmental Powders and Nasal Swabs

    PubMed Central

    Luna, Vicki A.; King, Debra; Davis, Carisa; Rycerz, Tony; Ewert, Matthew; Cannons, Andrew; Amuso, Philip; Cattani, Jacqueline

    2003-01-01

    Bacillus anthracis spores have been used as a biological weapon in the United States. We wanted to develop a safe, rapid method of sample preparation that provided safe DNA for the detection of spores in environmental and clinical specimens. Our method reproducibly detects B. anthracis in samples containing <10 spores. PMID:12624060

  2. Development and validation of a real-time quantitative PCR assay for rapid identification of Bacillus anthracis in environmental samples.

    PubMed

    Irenge, Léonid M; Durant, Jean-François; Tomaso, Herbert; Pilo, Paola; Olsen, Jaran S; Ramisse, Vincent; Mahillon, Jacques; Gala, Jean-Luc

    2010-11-01

    A real-time polymerase chain reaction (PCR) assay was developed for rapid identification of Bacillus anthracis in environmental samples. These samples often harbor Bacillus cereus bacteria closely related to B. anthracis, which may hinder its specific identification by resulting in false positive signals. The assay consists of two duplex real-time PCR: the first PCR allows amplification of a sequence specific of the B. cereus group (B. anthracis, B. cereus, Bacillus thuringiensis, Bacillus weihenstephanensis, Bacillus pseudomycoides, and Bacillus mycoides) within the phosphoenolpyruvate/sugar phosphotransferase system I gene and a B. anthracis specific single nucleotide polymorphism within the adenylosuccinate synthetase gene. The second real-time PCR assay targets the lethal factor gene from virulence plasmid pXO1 and the capsule synthesis gene from virulence plasmid pXO2. Specificity of the assay is enhanced by the use of minor groove binding probes and/or locked nucleic acids probes. The assay was validated on 304 bacterial strains including 37 B. anthracis, 67 B. cereus group, 54 strains of non-cereus group Bacillus, and 146 Gram-positive and Gram-negative bacteria strains. The assay was performed on various environmental samples spiked with B. anthracis or B. cereus spores. The assay allowed an accurate identification of B. anthracis in environmental samples. This study provides a rapid and reliable method for improving rapid identification of B. anthracis in field operational conditions.

  3. Characterization of thyroidal glutathione reductase

    SciTech Connect

    Raasch, R.J.

    1989-01-01

    Glutathione levels were determined in bovine and rat thyroid tissue by enzymatic conjugation with 1-chloro-2,4-dinitrobenzene using glutathione S-transferase. Bovine thyroid tissue contained 1.31 {+-} 0.04 mM reduced glutathione (GSH) and 0.14 {+-} 0.02 mM oxidized glutathione (GSSG). In the rat, the concentration of GSH was 2.50 {+-} 0.05 mM while GSSG was 0.21 {+-} 0.03 mM. Glutathione reductase (GR) was purified from bovine thyroid to electrophoretic homogeneity by ion exchange, affinity and molecular exclusion chromatography. A molecular weight range of 102-109 kDa and subunit size of 55 kDa were determined for GR. Thyroidal GR was shown to be a favoprotein with one FAD per subunit. The Michaelis constants of bovine thyroidal GR were determined to be 21.8 {mu}M for NADPH and 58.8 {mu}M for GSSG. The effect of thyroid stimulating hormone (TSH) and thyroxine (T{sub 4}) on in vivo levels of GR and glucose 6-phosphate dehydrogenase were determined in rat thyroid homogenates. Both enzymes were stimulated by TSH treatment and markedly reduced following T{sub 4} treatment. Lysosomal hydrolysis of ({sup 125}I)-labeled and unlabeled thyroglobulin was examined using size exclusion HPLC.

  4. Rapid detection of Bacillus anthracis by γ phage amplification and lateral flow immunochromatography.

    PubMed

    Cox, Christopher R; Jensen, Kirk R; Mondesire, Roy R; Voorhees, Kent J

    2015-11-01

    New, rapid point-of-need diagnostic methods for Bacillus anthracis detection can enhance civil and military responses to accidental or deliberate dispersal of anthrax as a biological weapon. Current laboratory-based methods for clinical identification of B. anthracis require 12 to 120h, and are confirmed by plaque assay using the well-characterized γ typing phage, which requires an additional minimum of 24h for bacterial culture. To reduce testing time, the natural specificity of γ phage amplification was investigated in combination with lateral flow immunochromatography (LFI) for rapid, point-of-need B. anthracis detection. Phage-based LFI detection of B. anthracis Sterne was validated over a range of bacterial and phage concentrations with optimal detection achieved in as little as 2h from the onset of amplification with a threshold sensitivity of 2.5×10(4)cfu/mL. The novel use of γ phage amplification detected with a simple, inexpensive LFI assay provides a rapid, sensitive, highly accurate, and field-deployable method for diagnostic ID of B. anthracis in a fraction of the time required by conventional techniques, and without the need for extensive laboratory culture.

  5. Decontamination Efficacy and Skin Toxicity of Two Decontaminants against Bacillus anthracis.

    PubMed

    Stratilo, Chad W; Crichton, Melissa K F; Sawyer, Thomas W

    2015-01-01

    Decontamination of bacterial endospores such as Bacillus anthracis has traditionally required the use of harsh or caustic chemicals. The aim of this study was to evaluate the efficacy of a chlorine dioxide decontaminant in killing Bacillus anthracis spores in solution and on a human skin simulant (porcine cadaver skin), compared to that of commonly used sodium hypochlorite or soapy water decontamination procedures. In addition, the relative toxicities of these decontaminants were compared in human skin keratinocyte primary cultures. The chlorine dioxide decontaminant was similarly effective to sodium hypochlorite in reducing spore numbers of Bacillus anthracis Ames in liquid suspension after a 10 minute exposure. After five minutes, the chlorine dioxide product was significantly more efficacious. Decontamination of isolated swine skin contaminated with Bacillus anthracis Sterne with the chlorine dioxide product resulted in no viable spores sampled. The toxicity of the chlorine dioxide decontaminant was up to two orders of magnitude less than that of sodium hypochlorite in human skin keratinocyte cultures. In summary, the chlorine dioxide based decontaminant efficiently killed Bacillus anthracis spores in liquid suspension, as well as on isolated swine skin, and was less toxic than sodium hypochlorite in cultures of human skin keratinocytes.

  6. Decontamination Efficacy and Skin Toxicity of Two Decontaminants against Bacillus anthracis

    PubMed Central

    Stratilo, Chad W.; Crichton, Melissa K. F.; Sawyer, Thomas W.

    2015-01-01

    Decontamination of bacterial endospores such as Bacillus anthracis has traditionally required the use of harsh or caustic chemicals. The aim of this study was to evaluate the efficacy of a chlorine dioxide decontaminant in killing Bacillus anthracis spores in solution and on a human skin simulant (porcine cadaver skin), compared to that of commonly used sodium hypochlorite or soapy water decontamination procedures. In addition, the relative toxicities of these decontaminants were compared in human skin keratinocyte primary cultures. The chlorine dioxide decontaminant was similarly effective to sodium hypochlorite in reducing spore numbers of Bacillus anthracis Ames in liquid suspension after a 10 minute exposure. After five minutes, the chlorine dioxide product was significantly more efficacious. Decontamination of isolated swine skin contaminated with Bacillus anthracis Sterne with the chlorine dioxide product resulted in no viable spores sampled. The toxicity of the chlorine dioxide decontaminant was up to two orders of magnitude less than that of sodium hypochlorite in human skin keratinocyte cultures. In summary, the chlorine dioxide based decontaminant efficiently killed Bacillus anthracis spores in liquid suspension, as well as on isolated swine skin, and was less toxic than sodium hypochlorite in cultures of human skin keratinocytes. PMID:26394165

  7. The phenotypic and genotypic characterization of Bacillus anthracis isolates from Iran.

    PubMed

    Jula, Gholamreza Moazeni; Sattari, Morteza; Banihashemi, Reza; Razzaz, Hossein; Sanchouli, Alireza; Tadayon, Keyvan

    2011-03-01

    To understand epidemiology of Bacillus anthracis in Iran, the morphological, biochemical, and virulence specifications of 32 B. anthracis isolates, collected from human, sheep, cattle, goat, and environmental specimens obtained from throughout Iran were examined by conventional and molecular approaches. B. anthracis isolates were characterized in multiple ways: (1) capsule formation both on bicarbonate agar and in defibrinated horse blood, (2) motility of vegetative forms, (3) hemolysis on 5% sheep blood agar, (4) penicillin G susceptibility, (5) lecithinase production on egg yolk agar, (6) gelatin hydrolysis, (7) ability to develop "string of pearls" on tryptose agar, and (8) capability to develop mucoid colonies in presence of CO(2) were assessed. In addition, biochemical properties such as indole, methyl red, catalase, citrate utilization, and finally nitrate reduction tests were used. All the tested isolates produced identical morphological and biochemical patterns with those of the vaccine strain B. anthracis 34F2 Sterne. In order to assess potential virulence of isolates at genomic level, PCR protocols assaying for the pXO1 and pXO2 loci were employed. The intriguing high level of phenotypic similarity between Iranian isolates of B. anthracis and the 34F2 Sterne strain deserves further studies at genomic level.

  8. Bacillus anthracis interacts with plasmin(ogen) to evade C3b-dependent innate immunity.

    PubMed

    Chung, Myung-Chul; Tonry, Jessica H; Narayanan, Aarthi; Manes, Nathan P; Mackie, Ryan S; Gutting, Bradford; Mukherjee, Dhritiman V; Popova, Taissia G; Kashanchi, Fatah; Bailey, Charles L; Popov, Serguei G

    2011-03-25

    The causative agent of anthrax, Bacillus anthracis, is capable of circumventing the humoral and innate immune defense of the host and modulating the blood chemistry in circulation to initiate a productive infection. It has been shown that the pathogen employs a number of strategies against immune cells using secreted pathogenic factors such as toxins. However, interference of B. anthracis with the innate immune system through specific interaction of the spore surface with host proteins such as the complement system has heretofore attracted little attention. In order to assess the mechanisms by which B. anthracis evades the defense system, we employed a proteomic analysis to identify human serum proteins interacting with B. anthracis spores, and found that plasminogen (PLG) is a major surface-bound protein. PLG efficiently bound to spores in a lysine- and exosporium-dependent manner. We identified α-enolase and elongation factor tu as PLG receptors. PLG-bound spores were capable of exhibiting anti-opsonic properties by cleaving C3b molecules in vitro and in rabbit bronchoalveolar lavage fluid, resulting in a decrease in macrophage phagocytosis. Our findings represent a step forward in understanding the mechanisms involved in the evasion of innate immunity by B. anthracis through recruitment of PLG resulting in the enhancement of anti-complement and anti-opsonization properties of the pathogen.

  9. Growth characteristics of Bacillus anthracis compared to other Bacillus spp. on the selective nutrient media Anthrax Blood Agar and Cereus Ident Agar.

    PubMed

    Tomaso, Herbert; Bartling, Carsten; Al Dahouk, Sascha; Hagen, Ralf M; Scholz, Holger C; Beyer, Wolfgang; Neubauer, Heinrich

    2006-01-01

    Anthrax Blood Agar (ABA) and Cereus Ident Agar (CEI) were evaluated as selective growth media for the isolation of Bacillus anthracis using 92 B. anthracis and 132 other Bacillus strains from 30 species. The positive predictive values for the identification of B. anthracis on ABA, CEI, and the combination of both were 72%, 71%, and 90%, respectively. Thus, less than 10% of all species were misidentified using both nutrient media. Species which might be misidentified as B. anthracis were B. cereus, B. mycoides, and B. thuringiensis. Particularly, 30% of B. weihenstephanensis strains were misidentified as B. anthracis.

  10. The aldo-keto reductase superfamily homepage.

    PubMed

    Hyndman, David; Bauman, David R; Heredia, Vladi V; Penning, Trevor M

    2003-02-01

    The aldo-keto reductases (AKRs) are one of the three enzyme superfamilies that perform oxidoreduction on a wide variety of natural and foreign substrates. A systematic nomenclature for the AKR superfamily was adopted in 1996 and was updated in September 2000 (visit www.med.upenn.edu/akr). Investigators have been diligent in submitting sequences of functional proteins to the Web site. With the new additions, the superfamily contains 114 proteins expressed in prokaryotes and eukaryotes that are distributed over 14 families (AKR1-AKR14). The AKR1 family contains the aldose reductases, the aldehyde reductases, the hydroxysteroid dehydrogenases and steroid 5beta-reductases, and is the largest. Other families of interest include AKR6, which includes potassium channel beta-subunits, and AKR7 the aflatoxin aldehyde reductases. Two new families include AKR13 (yeast aldose reductase) and AKR14 (Escherichia coli aldehyde reductase). Crystal structures of many AKRs and their complexes with ligands are available in the PDB and accessible through the Web site. Each structure has the characteristic (alpha/beta)(8)-barrel motif of the superfamily, a conserved cofactor binding site and a catalytic tetrad, and variable loop structures that define substrate specificity. Although the majority of AKRs are monomeric proteins of about 320 amino acids in length, the AKR2, AKR6 and AKR7 family may form multimers. To expand the nomenclature to accommodate multimers, we recommend that the composition and stoichiometry be listed. For example, AKR7A1:AKR7A4 (1:3) would designate a tetramer of the composition indicated. The current nomenclature is recognized by the Human Genome Project (HUGO) and the Web site provides a link to genomic information including chromosomal localization, gene boundaries, human ESTs and SNPs and much more.

  11. Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis—One Species on the Basis of Genetic Evidence

    PubMed Central

    Helgason, Erlendur; Økstad, Ole Andreas; Caugant, Dominique A.; Johansen, Henning A.; Fouet, Agnes; Mock, Michéle; Hegna, Ida; Kolstø, Anne-Brit

    2000-01-01

    Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis are members of the Bacillus cereus group of bacteria, demonstrating widely different phenotypes and pathological effects. B. anthracis causes the acute fatal disease anthrax and is a potential biological weapon due to its high toxicity. B. thuringiensis produces intracellular protein crystals toxic to a wide number of insect larvae and is the most commonly used biological pesticide worldwide. B. cereus is a probably ubiquitous soil bacterium and an opportunistic pathogen that is a common cause of food poisoning. In contrast to the differences in phenotypes, we show by multilocus enzyme electrophoresis and by sequence analysis of nine chromosomal genes that B. anthracis should be considered a lineage of B. cereus. This determination is not only a formal matter of taxonomy but may also have consequences with respect to virulence and the potential of horizontal gene transfer within the B. cereus group. PMID:10831447

  12. Structure of purine nucleoside phosphorylase (DeoD) from Bacillus anthracis

    SciTech Connect

    Grenha, Rosa; Levdikov, Vladimir M.; Fogg, Mark J.; Blagova, Elena V.; Brannigan, James A. Wilkinson, Anthony J.; Wilson, Keith S.

    2005-05-01

    The crystal structure of purine nucleoside phosphorylase (DeoD) from B. anthracis was solved by X-ray crystallography using molecular replacement and refined at a resolution of 2.24 Å. Protein structures from the causative agent of anthrax (Bacillus anthracis) are being determined as part of a structural genomics programme. Amongst initial candidates for crystallographic analysis are enzymes involved in nucleotide biosynthesis, since these are recognized as potential targets in antibacterial therapy. Purine nucleoside phosphorylase is a key enzyme in the purine-salvage pathway. The crystal structure of purine nucleoside phosphorylase (DeoD) from B. anthracis has been solved by molecular replacement at 2.24 Å resolution and refined to an R factor of 18.4%. This is the first report of a DeoD structure from a Gram-positive bacterium.

  13. Proteolytic Degradation of Human Antimicrobial Peptide LL-37 by Bacillus anthracis May Contribute to Virulence

    PubMed Central

    Thwaite, Joanne E.; Hibbs, Stephen; Titball, Richard W.; Atkins, Timothy P.

    2006-01-01

    In this paper we report on the susceptibilities of a range of Bacillus species to the human antimicrobial peptide LL-37. B. subtilis showed a low level of resistance to killing by LL-37 (50% growth-inhibitory concentration [GI50], 1 μg/ml). B. cereus and B. thuringiensis showed intermediate levels of resistance to killing (GI50s, 33 μg/ml and 37 μg/ml, respectively). B. anthracis showed the highest level of resistance (GI50s, 40 to 66 μg/ml). The degradation of LL-37 by B. anthracis culture supernatant was blocked by the metalloprotease inhibitors EDTA and 1,10-phenanthroline, and the gene encoding the protease responsible for LL-37 degradation was not plasmid borne. Our findings suggest that alongside the classical plasmid-based virulence determinants, extracellular metalloproteases of B. anthracis may play a role in survival in the host. PMID:16801407

  14. Simultaneous real-time PCR detection of Bacillus anthracis, Francisella tularensis and Yersinia pestis.

    PubMed

    Skottman, T; Piiparinen, H; Hyytiäinen, H; Myllys, V; Skurnik, M; Nikkari, S

    2007-03-01

    This report describes the development of in-house real-time PCR assays using minor groove binding probes for simultaneous detection of the Bacillus anthracis pag and cap genes, the Francisella tularensis 23 KDa gene, as well as the Yersinia pestis pla gene. The sensitivities of these assays were at least 1 fg, except for the assay targeting the Bacillus anthracis cap gene, which showed a sensitivity of 10 fg when total DNA was used as a template in a serial dilution. The clinical value of the Bacillus anthracis- and Francisella tularensis-specific assays was demonstrated by successful amplification of DNA from cases of cow anthrax and hare tularemia, respectively. No cross-reactivity between these species-specific assays or with 39 other bacterial species was noted. These assays may provide a rapid tool for the simultaneous detection and identification of the three category A bacterial species listed as biological threats by the Centers for Disease Control and Prevention.

  15. Structure of 5-formyltetrahydrofolate cyclo-ligase from Bacillus anthracis (BA4489)

    SciTech Connect

    Meier, Christoph; Carter, Lester G.; Winter, Graeme; Owens, Ray J.; Stuart, David I.; Esnouf, Robert M.

    2007-03-01

    The structure of 5-formyltetrahydrofolate cyclo-ligase from B. anthracis determined by X-ray crystallography at a resolution of 1.6 Å is described. Bacillus anthracis is a spore-forming bacterium and the causative agent of the disease anthrax. The Oxford Protein Production Facility has been targeting proteins from B. anthracis in order to develop high-throughput technologies within the Structural Proteomics in Europe project. As part of this work, the structure of 5-formyltetrahydrofolate cyclo-ligase (BA4489) has been determined by X-ray crystallography to 1.6 Å resolution. The structure, solved in complex with magnesium-ion-bound ADP and phosphate, gives a detailed picture of the proposed catalytic mechanism of the enzyme. Chemical differences from other cyclo-ligase structures close to the active site that could be exploited to design specific inhibitors are also highlighted.

  16. Chicken muscle aldose reductase: purification, properties and relationship to other chicken aldo/keto reductases.

    PubMed

    Murphy, D G; Davidson, W S

    1986-01-01

    An enzyme that catalyzes the NADPH-dependent reduction of a wide range of aromatic and hydroxy-aliphatic aldehydes was purified from chicken breast muscle. This enzyme shares many properties with mammalian aldose reductases including molecular weight, relative substrate specificity, Michaelis constants, an inhibitor specificity. Therefore, it seems appropriate to call this enzyme an aldose reductase (EC 1.1.1.21). Chicken muscle aldose reductase appears to be kinetically identical to an aldose reductase that has been purified from chicken kidney (Hara et al., Eur. J. Biochem. 133, 207-214) and to hen muscle L-glycol dehydrogenase (Bernado et al., Biochim. biophys. Acta 659, 189-198). The association of this aldose reductase with muscular dystrophy in the chick is discussed.

  17. Bacillus anthracis Edema Toxin Impairs Neutrophil Actin-Based Motility▿

    PubMed Central

    Szarowicz, Sarah E.; During, Russell L.; Li, Wei; Quinn, Conrad P.; Tang, Wei-Jen; Southwick, Frederick S.

    2009-01-01

    Inhalation anthrax results in high-grade bacteremia and is accompanied by a delay in the rise of the peripheral polymorphonuclear neutrophil (PMN) count and a paucity of PMNs in the infected pleural fluid and mediastinum. Edema toxin (ET) is one of the major Bacillus anthracis virulence factors and consists of the adenylate cyclase edema factor (EF) and protective antigen (PA). Relatively low concentrations of ET (100 to 500 ng/ml of PA and EF) significantly impair human PMN chemokinesis, chemotaxis, and ability to polarize. These changes are accompanied by a reduction in chemoattractant-stimulated PMN actin assembly. ET also causes a significant decrease in Listeria monocytogenes intracellular actin-based motility within HeLa cells. These defects in actin assembly are accompanied by a >50-fold increase in intracellular cyclic AMP and a >4-fold increase in the phosphorylation of protein kinase A. We have previously shown that anthrax lethal toxin (LT) also impairs neutrophil actin-based motility (R. L. During, W. Li, B. Hao, J. M. Koenig, D. S. Stephens, C. P. Quinn, and F. S. Southwick, J. Infect. Dis. 192:837-845, 2005), and we now find that LT combined with ET causes an additive inhibition of PMN chemokinesis, polarization, chemotaxis, and FMLP (N-formyl-met-leu-phe)-induced actin assembly. We conclude that ET alone or combined with LT impairs PMN actin assembly, resulting in paralysis of PMN chemotaxis. PMID:19349425

  18. Glyconanobiotics: Novel carbohydrated nanoparticle antibiotics for MRSA and Bacillus anthracis

    PubMed Central

    Abeylath, Sampath C.; Turos, Edward; Dickey, Sonja; Limb, Daniel V.

    2008-01-01

    This report describes the synthesis and evaluation of glycosylated polyacrylate nanoparticles that have covalently-bound antibiotics within their framework. The requisite glycosylated drug monomers were prepared from one of three known antibiotics, an N-sec-butylthio β-lactam, ciprofloxacin, and a penicillin, by acylation with 3-O-acryloyl-1,2-O-isopropylidene-5,6 bis((chlorosuccinyl)oxy)-D-glucofuranose (7) or 6-O-acetyl-3-O-acryloyl-1,2-O-isopropylidene-5-(chlorosuccinyl)oxy-α-D-glucofuranose (10). These acrylated monomers were subjected to emulsion polymerization in a 7:3 (w:w) mixture of butyl acrylate-styrene in the presence of sodium dodecyl sulfate as surfactant (3 weight %) and potassium persulfate as a radical initiator (1 weight %). The resulting nanoparticle emulsions were characterized by dynamic light scattering and found to have similar diameters (~40 nm) and size distributions to those of our previously studied systems. Microbiological testing showed that the N-sec-butylthio β-lactam and ciprofloxacin nanoparticles both have powerful in vitro activities against methicillin-resistant Staphylococcus aureus and Bacillus anthracis, while the penicillin-bound nanoparticles have no antimicrobial activity. This indicates the need for matching a suitable antibiotic with the nanoparticle carrier. Overall, the study shows that even relatively large, polar acrylate monomers (MW>1000 amu) can be efficiently incorporated into the nanoparticle matrix by emulsion polymerization, providing opportunities for further advances in nanomedicine. PMID:18063370

  19. Structure of nicotinic acid mononucleotide adenylyltransferase from Bacillus anthracis

    SciTech Connect

    Lu, S.; Smith, C.; Yang, Z.; Pruett, P.; Nagy, L.; McCombs, D; DeLucas, L.; Brouillette, W.; Brouillette, C.

    2008-11-25

    Nicotinic acid mononucleotide adenylyltransferase (NaMNAT; EC 2.7.7.18) is the penultimate enzyme in the biosynthesis of NAD{sup +} and catalyzes the adenylation of nicotinic acid mononucleotide (NaMN) by ATP to form nicotinic acid adenine dinucleotide (NaAD). This enzyme is regarded as a suitable candidate for antibacterial drug development; as such, Bacillus anthracis NaMNAT (BA NaMNAT) was heterologously expressed in Escherichia coli for the purpose of inhibitor discovery and crystallography. The crystal structure of BA NaMNAT was determined by molecular replacement, revealing two dimers per asymmetric unit, and was refined to an R factor and R{sub free} of 0.228 and 0.263, respectively, at 2.3 {angstrom} resolution. The structure is very similar to that of B. subtilis NaMNAT (BS NaMNAT), which is also a dimer, and another independently solved structure of BA NaMNAT recently released from the PDB along with two ligated forms. Comparison of these and other less related bacterial NaMNAT structures support the presence of considerable conformational heterogeneity and flexibility in three loops surrounding the substrate-binding area.

  20. Microbial forensics: fiber optic microarray subtyping of Bacillus anthracis

    NASA Astrophysics Data System (ADS)

    Shepard, Jason R. E.

    2009-05-01

    The past decade has seen increased development and subsequent adoption of rapid molecular techniques involving DNA analysis for detection of pathogenic microorganisms, also termed microbial forensics. The continued accumulation of microbial sequence information in genomic databases now better positions the field of high-throughput DNA analysis to proceed in a more manageable fashion. The potential to build off of these databases exists as technology continues to develop, which will enable more rapid, cost effective analyses. This wealth of genetic information, along with new technologies, has the potential to better address some of the current problems and solve the key issues involved in DNA analysis of pathogenic microorganisms. To this end, a high density fiber optic microarray has been employed, housing numerous DNA sequences simultaneously for detection of various pathogenic microorganisms, including Bacillus anthracis, among others. Each organism is analyzed with multiple sequences and can be sub-typed against other closely related organisms. For public health labs, real-time PCR methods have been developed as an initial preliminary screen, but culture and growth are still considered the gold standard. Technologies employing higher throughput than these standard methods are better suited to capitalize on the limitless potential garnered from the sequence information. Microarray analyses are one such format positioned to exploit this potential, and our array platform is reusable, allowing repetitive tests on a single array, providing an increase in throughput and decrease in cost, along with a certainty of detection, down to the individual strain level.

  1. Whole genome protein microarrays for serum profiling of immunodominant antigens of Bacillus anthracis

    PubMed Central

    Kempsell, Karen E.; Kidd, Stephen P.; Lewandowski, Kuiama; Elmore, Michael J.; Charlton, Sue; Yeates, Annemarie; Cuthbertson, Hannah; Hallis, Bassam; Altmann, Daniel M.; Rogers, Mitch; Wattiau, Pierre; Ingram, Rebecca J.; Brooks, Tim; Vipond, Richard

    2015-01-01

    A commercial Bacillus anthracis (Anthrax) whole genome protein microarray has been used to identify immunogenic Anthrax proteins (IAP) using sera from groups of donors with (a) confirmed B. anthracis naturally acquired cutaneous infection, (b) confirmed B. anthracis intravenous drug use-acquired infection, (c) occupational exposure in a wool-sorters factory, (d) humans and rabbits vaccinated with the UK Anthrax protein vaccine and compared to naïve unexposed controls. Anti-IAP responses were observed for both IgG and IgA in the challenged groups; however the anti-IAP IgG response was more evident in the vaccinated group and the anti-IAP IgA response more evident in the B. anthracis-infected groups. Infected individuals appeared somewhat suppressed for their general IgG response, compared with other challenged groups. Immunogenic protein antigens were identified in all groups, some of which were shared between groups whilst others were specific for individual groups. The toxin proteins were immunodominant in all vaccinated, infected or other challenged groups. However, a number of other chromosomally-located and plasmid encoded open reading frame proteins were also recognized by infected or exposed groups in comparison to controls. Some of these antigens e.g., BA4182 are not recognized by vaccinated individuals, suggesting that there are proteins more specifically expressed by live Anthrax spores in vivo that are not currently found in the UK licensed Anthrax Vaccine (AVP). These may perhaps be preferentially expressed during infection and represent expression of alternative pathways in the B. anthracis “infectome.” These may make highly attractive candidates for diagnostic and vaccine biomarker development as they may be more specifically associated with the infectious phase of the pathogen. A number of B. anthracis small hypothetical protein targets have been synthesized, tested in mouse immunogenicity studies and validated in parallel using human sera from

  2. Evaluation of Immunoassays and General Biological Indicator Tests for Field Screening of Bacillus anthracis and Ricin

    PubMed Central

    Bartholomew, Rachel A.; Ozanich, Richard M.; Arce, Jennifer S.; Engelmann, Heather E.; Heredia-Langner, Alejandro; Hofstad, Beth A.; Hutchison, Janine R.; Jarman, Kristin; Melville, Angela M.; Victry, Kristin D.

    2017-01-01

    There is little published data on the performance of biological indicator tests and immunoassays that could be used by first responders to determine if a suspicious powder contains a potential biothreat agent. We evaluated a range of biological indicator tests, including 3 protein tests, 2 ATP tests, 1 DNA test, and 1 FTIR spectroscopy instrument for their ability to screen suspicious powders for Bacillus anthracis (B. anthracis) spores and ricin. We also evaluated 12 immunoassays (mostly lateral flow immunoassays) for their ability to screen for B. anthracis and ricin. We used a cost-effective, statistically based test plan that allows instruments to be evaluated at performance levels ranging from 0.85 to 0.95 lower confidence bound of the probability of detection at confidence levels of 80% to 95%. We also assessed interference with 22 common suspicious powders encountered in the field. The detection reproducibility for the biological indicators was evaluated at 108 B. anthracis spores and 62.5 μg ricin, and the immunoassay detection reproducibility was evaluated at 107 spores/mL (B. anthracis) and 0.1 μg/mL (ricin). Seven out of 12 immunoassays met our most stringent criteria for B. anthracis detection, while 9 out of 12 met our most stringent test criteria for ricin detection. Most of the immunoassays also detected ricin in 3 different crude castor seed preparations. Our testing results varied across products and sample preparations, indicating the importance of reviewing performance data for specific instruments and sample types of interest for the application in order to make informed decisions regarding the selection of biodetection equipment for field use. PMID:28192054

  3. Bacillus anthracis tagO Is Required for Vegetative Growth and Secondary Cell Wall Polysaccharide Synthesis

    PubMed Central

    Lunderberg, J. Mark; Liszewski Zilla, Megan; Missiakas, Dominique

    2015-01-01

    ABSTRACT Bacillus anthracis elaborates a linear secondary cell wall polysaccharide (SCWP) that retains surface (S)-layer and associated proteins via their S-layer homology (SLH) domains. The SCWP is comprised of trisaccharide repeats [→4)-β-ManNAc-(1→4)-β-GlcNAc-(1→6)-α-GlcNAc-(1→] and tethered via acid-labile phosphodiester bonds to peptidoglycan. Earlier work identified UDP-GlcNAc 2-epimerases GneY (BAS5048) and GneZ (BAS5117), which act as catalysts of ManNAc synthesis, as well as a polysaccharide deacetylase (BAS5051), as factors contributing to SCWP synthesis. Here, we show that tagO (BAS5050), which encodes a UDP-N-acetylglucosamine:undecaprenyl-P N-acetylglucosaminyl 1-P transferase, the enzyme that initiates the synthesis of murein linkage units, is required for B. anthracis SCWP synthesis and S-layer assembly. Similar to gneY-gneZ mutants, B. anthracis strains lacking tagO cannot maintain cell shape or support vegetative growth. In contrast, mutations in BAS5051 do not affect B. anthracis cell shape, vegetative growth, SCWP synthesis, or S-layer assembly. These data suggest that TagO-mediated murein linkage unit assembly supports SCWP synthesis and attachment to the peptidoglycan via acid-labile phosphodiester bonds. Further, B. anthracis variants unable to synthesize SCWP trisaccharide repeats cannot sustain cell shape and vegetative growth. IMPORTANCE Bacillus anthracis elaborates an SCWP to support vegetative growth and envelope assembly. Here, we show that some, but not all, SCWP synthesis is dependent on tagO-derived murein linkage units and subsequent attachment of SCWP to peptidoglycan. The data implicate secondary polymer modifications of peptidoglycan and subcellular distributions as a key feature of the cell cycle in Gram-positive bacteria and establish foundations for work on the molecular functions of the SCWP and on inhibitors with antibiotic attributes. PMID:26324447

  4. Genetic and Physiological Studies of Bacillus Anthracis Related to Development of An Improved Vaccine

    DTIC Science & Technology

    1988-07-01

    N imIC FILE COPY 0 AD GENETIC AND PHYSIOLOGICAL STUDIES OF BACILLUS ANTHRACIS RELATED TO DEVELOPMENT OF AN IMPROVED VACCINE ANNUAL PROGRESS REPORT...3M161. NO. AA ACCESSION NO 61102A I102BS12 106 11. T17LE (include Security Classificatir~n) (U) Genetic and Physiological Studies of Bacillus 3nthracis...Continue on reverse if nece ry anti identify by block number) FIELD GROUP SUB-GROUP Bacillus anthracis RAI Anthrax protective afitiger 06 1.3 B

  5. Genetic and Physiological Studies of Bacillus anthracis Related to Development of an Improved Vaccine

    DTIC Science & Technology

    1986-07-01

    Unolassified AD GENETtC AND PHYSIOLOGICAL STUDIES O0 BACILLUS ANTHFACIS RELATED TO DEVELOPMENT OF IMPROVED VACCINE ANNUAL PROGRESS REPORT t...0.3M16. NO. CESSiON Mo 1’.TILI kxjg Seur Clwf~)61102A 1102BS12 AA M 1 06.1. TTLo2InsA Seat/Oewooon (U) Genetic and Physiological Studies of Bacillus ...Confrmpe an ovmem ,f nmcvueay and x*nMf by bkoc* nvmur) F ,IELO GROUP SU@-CROUP Bacillus anthracis B, anthracis plassids 06 13 Anthrax protective antigen

  6. Differentiation of Bacillus Anthracis and Other Bacillus Species by Use of Lectins

    DTIC Science & Technology

    1983-07-18

    GlcNAc Ulex eurpaes ( UEA - I ) a-L- Fuc Ulex europaeus ( UEA -1I) (V- PlcNAc) > 0--D-GlcNAc 2 ý-Specificities of all lectins werE obtained from E-Y...from B. anthracis and the related OD ~YI 113 EITIO OP NOV61 I OSSL~rtUNCLASSIFIED’ Y 8 3 7 2 03 9 SECUR4TY CLASSIFICATION OF rthS PAGE (w7bma Daie d...Institute of Infectious Diseases, Ft. Detrick, MD 21701 Aoaession For Short title: Lectin -1B. anthracis interaction I RA *Correspondent author (502

  7. PCR Assay To Detect Bacillus anthracis Spores in Heat-Treated Specimens

    PubMed Central

    Fasanella, A.; Losito, S.; Adone, R.; Ciuchini, F.; Trotta, T.; Altamura, S. A.; Chiocco, D.; Ippolito, G.

    2003-01-01

    Recent interest in anthrax is due to its potential use in bioterrorism and as a biowarfare agent against civilian populations. The development of rapid and sensitive techniques to detect anthrax spores in suspicious specimens is the most important aim for public health. With a view to preventing exposure of laboratory workers to viable Bacillus anthracis spores, this study evaluated the suitability of PCR assays for detecting anthrax spores previously inactivated at 121°C for 45 min. The results indicate that heat treatment ensures the complete inactivation of B. anthracis spores without significantly affecting the efficiency of PCR assays. PMID:12574311

  8. Identification of a Bacillus anthracis specific indel in the yeaC gene and development of a rapid pyrosequencing assay for distinguishing B. anthracis from the B. cereus group.

    PubMed

    Ahmod, Nadia Z; Gupta, Radhey S; Shah, Haroun N

    2011-12-01

    Bacillus anthracis, the causative agent of anthrax, is a potential source of bioterrorism. The existing assays for its identification lack specificity due to the close genetic relationship it exhibits to other members of the B. cereus group. Our comparative analyses of protein sequences from Bacillus species have identified a 24 amino acid deletion in a conserved region of the YeaC protein that is uniquely present in B. anthracis. PCR primers based on conserved regions flanking this indel in the Bacillus cereus group of species (viz. Bacillus cereus, B. anthracis, B. thuringiensis, B. mycoides, B. weihenstephnensis and B. pseudomycoides) specifically amplified a 282 bp fragment from all six reference B. anthracis strains, whereas a 354 bp fragment was amplified from 15 other B. cereus group of species/strains. These fragments, due to large size difference, are readily distinguished by means of agarose gel electrophoresis. In contrast to the B. cereus group, no PCR amplification was observed with any of the non-B. cereus group of species/strains. This indel was also used for developing a rapid pyrosequencing assay for the identification of B. anthracis. Its performance was evaluated by examining the presence or absence of this indel in a panel of 81 B. cereus-like isolates from various sources that included 39 B. anthracis strains. Based upon the sequence data from the pyrograms, the yeaC indel was found to be a distinctive characteristic of various B. anthracis strains tested and not found in any other species/strains from these samples. Therefore, this B. anthracis specific indel provides a robust and highly-specific chromosomal marker for the identification of this high-risk pathogen from other members of the B. cereus group independent of a strain's virulence. The pyrosequencing platform also allows for the rapid and simultaneous screening of multiple samples for the presence of this B. anthracis-specific marker.

  9. Respiratory arsenate reductase as a bidirectional enzyme

    USGS Publications Warehouse

    Richey, C.; Chovanec, P.; Hoeft, S.E.; Oremland, R.S.; Basu, P.; Stolz, J.F.

    2009-01-01

    The haloalkaliphilic bacterium Alkalilimnicola ehrlichii is capable of anaerobic chemolithoautotrophic growth by coupling the oxidation of arsenite (As(III)) to the reduction of nitrate and carbon dioxide. Analysis of its complete genome indicates that it lacks a conventional arsenite oxidase (Aox), but instead possesses two operons that each encode a putative respiratory arsenate reductase (Arr). Here we show that one homolog is expressed under chemolithoautotrophic conditions and exhibits both arsenite oxidase and arsenate reductase activity. We also demonstrate that Arr from two arsenate respiring bacteria, Alkaliphilus oremlandii and Shewanella sp. strain ANA-3, is also biochemically reversible. Thus Arr can function as a reductase or oxidase. Its physiological role in a specific organism, however, may depend on the electron potentials of the molybdenum center and [Fe–S] clusters, additional subunits, or constitution of the electron transfer chain. This versatility further underscores the ubiquity and antiquity of microbial arsenic metabolism.

  10. Effects of endogenous D-alanine synthesis and autoinhibition of Bacillus anthracis germination on in vitro and in vivo infections.

    PubMed

    McKevitt, Matthew T; Bryant, Katie M; Shakir, Salika M; Larabee, Jason L; Blanke, Steven R; Lovchik, Julie; Lyons, C Rick; Ballard, Jimmy D

    2007-12-01

    Bacillus anthracis transitions from a dormant spore to a vegetative bacillus through a series of structural and biochemical changes collectively referred to as germination. The timing of germination is important during early steps in infection and may determine if B. anthracis survives or succumbs to responsive macrophages. In the current study experiments determined the contribution of endogenous D-alanine production to the efficiency and timing of B. anthracis spore germination under in vitro and in vivo conditions. Racemase-mediated production of endogenous D-alanine by B. anthracis altered the kinetics for initiation of germination over a range of spore densities and exhibited a threshold effect wherein small changes in spore number resulted in major changes in germination efficiency. This threshold effect correlated with D-alanine production, was prevented by an alanine racemase inhibitor, and required L-alanine. Interestingly, endogenous production of inhibitory levels of D-alanine was detected under experimental conditions that did not support germination and in a germination-deficient mutant of B. anthracis. Racemase-dependent production of D-alanine enhanced survival of B. anthracis during interaction with murine macrophages, suggesting a role for inhibition of germination during interaction with these cells. Finally, in vivo experiments revealed an approximately twofold decrease in the 50% lethal dose of B. anthracis spores administered in the presence of D-alanine, indicating that rates of germination may be directly influenced by the levels of this amino acid during early stages of disease.

  11. Evaluation of the Efficacy of Methyl Bromide in the Decontamination of Building and Interior Materials Contaminated with Bacillus anthracis Spores

    PubMed Central

    Wendling, Morgan; Richter, William; Lastivka, Andrew; Mickelsen, Leroy

    2016-01-01

    The primary goal of this study was to determine the conditions required for the effective inactivation of Bacillus anthracis spores on materials by using methyl bromide (MeBr) gas. Another objective was to obtain comparative decontamination efficacy data with three avirulent microorganisms to assess their potential for use as surrogates for B. anthracis Ames. Decontamination tests were conducted with spores of B. anthracis Ames and Geobacillus stearothermophilus, B. anthracis NNR1Δ1, and B. anthracis Sterne inoculated onto six different materials. Experimental variables included temperature, relative humidity (RH), MeBr concentration, and contact time. MeBr was found to be an effective decontaminant under a number of conditions. This study highlights the important role that RH has when fumigation is performed with MeBr. There were no tests in which a ≥6-log10 reduction (LR) of B. anthracis Ames was achieved on all materials when fumigation was done at 45% RH. At 75% RH, an increase in the temperature, the MeBr concentration, or contact time generally improved the efficacy of fumigation with MeBr. This study provides new information for the effective use of MeBr at temperatures and RH levels lower than those that have been recommended previously. The study also provides data to assist with the selection of an avirulent surrogate for B. anthracis Ames spores when additional tests with MeBr are conducted. PMID:26801580

  12. Evaluation of the Efficacy of Methyl Bromide in the Decontamination of Building and Interior Materials Contaminated with Bacillus anthracis Spores.

    PubMed

    Wood, Joseph P; Wendling, Morgan; Richter, William; Lastivka, Andrew; Mickelsen, Leroy

    2016-01-22

    The primary goal of this study was to determine the conditions required for the effective inactivation of Bacillus anthracis spores on materials by using methyl bromide (MeBr) gas. Another objective was to obtain comparative decontamination efficacy data with three avirulent microorganisms to assess their potential for use as surrogates for B. anthracis Ames. Decontamination tests were conducted with spores of B. anthracis Ames and Geobacillus stearothermophilus, B. anthracis NNR1Δ1, and B. anthracis Sterne inoculated onto six different materials. Experimental variables included temperature, relative humidity (RH), MeBr concentration, and contact time. MeBr was found to be an effective decontaminant under a number of conditions. This study highlights the important role that RH has when fumigation is performed with MeBr. There were no tests in which a ≥6-log10 reduction (LR) of B. anthracis Ames was achieved on all materials when fumigation was done at 45% RH. At 75% RH, an increase in the temperature, the MeBr concentration, or contact time generally improved the efficacy of fumigation with MeBr. This study provides new information for the effective use of MeBr at temperatures and RH levels lower than those that have been recommended previously. The study also provides data to assist with the selection of an avirulent surrogate for B. anthracis Ames spores when additional tests with MeBr are conducted.

  13. The tyrosyl free radical in ribonucleotide reductase.

    PubMed Central

    Gräslund, A; Sahlin, M; Sjöberg, B M

    1985-01-01

    The enzyme, ribonucleotide reductase, catalyses the formation of deoxyribonucleotides from ribonucleotides, a reaction essential for DNA synthesis in all living cells. The Escherichia coli ribonucleotide reductase, which is the prototype of all known eukaryotic and virus-coded enzymes, consists of two nonidentical subunits, proteins B1 and B2. The B2 subunit contains an antiferromagnetically coupled pair of ferric ions and a stable tyrosyl free radical. EPR studies show that the tyrosyl radical, formed by loss of ferric ions and a stable tyrosyl free radical. EPR studies show that the tyrosyl radical, formed by loss of an electron, has its unpaired spin density delocalized in the aromatic ring of tyrosine. Effects of iron-radical interaction indicate a relatively close proximity between the iron center and the radical. The EPR signal of the radical can be studied directly in frozen packed cells of E. coli or mammalian origin, if the cells are made to overproduce ribonucleotide reductase. The hypothetic role of the tyrosyl free radical in the enzymatic reaction is not yet elucidated, except in the reaction with the inhibiting substrate analogue 2'-azido-CDP. In this case, the normal tyrosyl radical is destroyed with concomitant appearance of a 2'-azido-CDP-localized radical intermediate. Attempts at spin trapping of radical reaction intermediates have turned out negative. In E. coli the activity of ribonucleotide reductase may be regulated by enzymatic activities that interconvert a nonradical containing form and the fully active protein B2. In synchronized mammalian cells, however, the cell cycle variation of ribonucleotide reductase, studied by EPR, was shown to be due to de novo protein synthesis. Inhibitors of ribonucleotide reductase are of medical interest because of their ability to control DNA synthesis. One example is hydroxyurea, used in cancer therapy, which selectively destroys the tyrosyl free radical. PMID:3007085

  14. Immunomagnetic capture of Bacillus anthracis spores from food.

    PubMed

    Shields, Michael J; Hahn, Kristen R; Janzen, Timothy W; Goji, Noriko; Thomas, Matthew C; Kingombe, Cesar Bin I; Paquet, Chantal; Kell, Arnold J; Amoako, Kingsley K

    2012-07-01

    Food is a vulnerable target for potential bioterrorist attacks; therefore, a critical mitigation strategy is needed for the rapid concentration and detection of biothreat agents from food matrices. Magnetic beads offer a unique advantage in that they have a large surface area for efficient capture of bacteria. We have demonstrated the efficient capture and concentration of Bacillus anthracis (Sterne) spores using immunomagnetic beads for a potential food application. Magnetic beads from three different sources, with varying sizes and surface chemistries, were functionalized with monoclonal antibodies and polyclonal antibodies from commercial sources and used to capture and concentrate anthrax spores from spiked food matrices, including milk, apple juice, bagged salad, processed meat, and bottled water. The results indicated that the Pathatrix beads were more effective in the binding and capture of anthrax spores than the other two bead types investigated. Furthermore, it was observed that the use of polyclonal antibodies resulted in a more efficient recovery of anthrax spores than the use of monoclonal antibodies. Three different magnetic capture methods, inversion, the Pathatrix Auto system, and the new i CropTheBug system, were investigated. The i CropTheBug system yielded a much higher recovery of spores than the Pathatrix Auto system. Spore recoveries ranged from 80 to 100% for the i CropTheBug system when using pure spore preparations, whereas the Pathatrix Auto system had recoveries from 20 to 30%. Spore capture from food samples inoculated at a level of 1 CFU/ml resulted in 80 to 100% capture for milk, bottled water, and juice samples and 60 to 80% for processed meat and bagged salad when using the i CropTheBug system. This efficient capture of anthrax spores at very low concentrations without enrichment has the potential to enhance the sensitivity of downstream detection technologies and will be a useful method in a foodborne bioterrorism response.

  15. Evaluation of nitrate reductase activity in Rhizobium japonicum

    SciTech Connect

    Streeter, J.G.; DeVine, P.J.

    1983-08-01

    Nitrate reductase activity was evaluated by four approaches, using four strains of Rhizobium japonicum and 11 chlorate-resistant mutants of the four strains. It was concluded that in vitro assays with bacteria or bacteroids provide the most simple and reliable assessment of the presence or absence of nitrate reductase. Nitrite reductase activity with methyl viologen and dithionite was found, but the enzyme activity does not confound the assay of nitrate reductase. 18 references

  16. A Simple Luminescent Adenylate-Cyclase Functional Assay for Evaluation of Bacillus anthracis Edema Factor Activity

    PubMed Central

    Israeli, Ma’ayan; Rotem, Shahar; Elia, Uri; Bar-Haim, Erez; Cohen, Ofer; Chitlaru, Theodor

    2016-01-01

    Edema Factor (EF), the toxic sub-unit of the Bacillus anthracis Edema Toxin (ET) is a calmodulin-dependent adenylate cyclase whose detrimental activity in the infected host results in severe edema. EF is therefore a major virulence factor of B. anthracis. We describe a simple, rapid and reliable functional adenylate-cyclase assay based on inhibition of a luciferase-mediated luminescence reaction. The assay exploits the efficient adenylate cyclase-mediated depletion of adenosine tri-phosphate (ATP), and the strict dependence on ATP of the light-emitting luciferase-catalyzed luciferin-conversion to oxyluciferin, which can be easily visualized. The assay exhibits a robust EF-dose response decrease in luminescence, which may be specifically reverted by anti-EF antibodies. The application of the assay is exemplified in: (a) determining the presence of EF in B. anthracis cultures, or its absence in cultures of EF-defective strains; (b) evaluating the anti-EF humoral response in experimental animals infected/vaccinated with B. anthracis; and (c) rapid discrimination between EF producing and non-producing bacterial colonies. Furthermore, the assay may be amenable with high-throughput screening for EF inhibitory molecules. PMID:27548219

  17. Decontamination of a hospital room using gaseous chlorine dioxide: Bacillus anthracis, Francisella tularensis, and Yersinia pestis.

    PubMed

    Lowe, John J; Gibbs, Shawn G; Iwen, Peter C; Smith, Philip W; Hewlett, Angela L

    2013-01-01

    This study assessed the efficacy of gaseous chlorine dioxide for inactivation of Bacillus anthracis, Francisella tularensis, and Yersinia pestis in a hospital patient care suite. Spore and vegetative cells of Bacillus anthracis Sterne 34F2, spores of Bacillus atrophaeus ATCC 9372 and vegetative cells of both Francisella tularensis ATCC 6223 and Yersinia pestis A1122 were exposed to gaseous chlorine dioxide in a patient care suite. Organism inactivation was then assessed by log reduction in viable organisms postexposure to chlorine dioxide gas compared to non-exposed control organism. Hospital room decontamination protocols utilizing chlorine dioxide gas concentrations of 377 to 385 ppm maintained to exposures of 767 ppm-hours with 65% relative humidity consistently achieved complete inactivation of B. anthracis and B. atrophaeus spores, as well as vegetative cells of B. anthracis, F. tularensis, and Y. pestis. Decrease in exposure (ppm-hours) and relative humidity (<65%) or restricting airflow reduced inactivation but achieved >8 log reductions in organisms. Up to 10-log reductions were achieved in a hospital room with limited impact on adjacent areas, indicating chlorine dioxide concentrations needed for decontamination of highly concentrated (>6 logs) organisms can be achieved throughout a hospital room. This study translates laboratory chlorine dioxide fumigation studies applied in a complex clinical environment.

  18. An outbreak of infection with Bacillus anthracis in injecting drug users in Scotland.

    PubMed

    Ramsay, C N; Stirling, A; Smith, J; Hawkins, G; Brooks, T; Hood, J; Penrice, G; Browning, L M; Ahmed, S

    2010-01-14

    An investigation is currently underway to explore and control an outbreak of Bacillus anthracis among drug users (mainly injecting) in Scotland. Contaminated heroin or a contaminated cutting agent mixed with the heroin is considered to be the most likely source and vehicle of infection. Heroin users have been advised of the risk. The risk to the general public is regarded as very low.

  19. Anthrax Toxins in Context of Bacillus anthracis Spores and Spore Germination

    PubMed Central

    Cote, Christopher K.; Welkos, Susan L.

    2015-01-01

    The interaction of anthrax toxin or toxin components with B. anthracis spores has been demonstrated. Germinating spores can produce significant amounts of toxin components very soon after the initiation of germination. In this review, we will summarize the work performed that has led to our understanding of toxin and spore interactions and discuss the complexities associated with these interactions. PMID:26287244

  20. Lethality of Bacillus Anthracis Spores Due to Short Duration Heating Measured Using Infrared Spectroscopy

    DTIC Science & Technology

    2005-03-01

    wavelengths were these differences distinguished. Individual bacterial endospores from four species of Bacillus (cereus, megaterium , subtilis, and... Bacillus (cereus, megaterium , and subtilis) at various wavelengths. Spectral comparisons were made between spores and vegetative cells. Results...LETHALITY OF BACILLUS ANTHRACIS SPORES DUE TO SHORT DURATION HEATING MEASURED USING INFRARED SPECTROSCOPY THESIS Kristina M

  1. Identification of Bacillus anthracis spore component antigens conserved across diverse Bacillus cereus sensu lato strains.

    PubMed

    Mukhopadhyay, Sanghamitra; Akmal, Arya; Stewart, Andrew C; Hsia, Ru-Ching; Read, Timothy D

    2009-06-01

    We sought to identify proteins in the Bacillus anthracis spore, conserved in other strains of the closely related Bacillus cereus group, that elicit an immune response in mammals. Two high throughput approaches were used. First, an in silico screening identified 200 conserved putative B. anthracis spore components. A total of 192 of those candidate genes were expressed and purified in vitro, 75 of which reacted with the rabbit immune sera generated against B. anthracis spores. The second approach was to screen for cross-reacting antigens in the spore proteome of 10 diverse B. cereus group strains. Two-dimensional electrophoresis resolved more than 200 protein spots in each spore preparation. About 72% of the protein spots were found in all the strains. 18 of these conserved proteins reacted against anti-B. anthracis spore rabbit immune sera, two of which (alanine racemase, Dal-1 and the methionine transporter, MetN) overlapped the set of proteins identified using the in silico screen. A conserved repeat domain protein (Crd) was the most immunoreactive protein found broadly across B. cereus sensu lato strains. We have established an approach for finding conserved targets across a species using population genomics and proteomics. The results of these screens suggest the possibility of a multiepitope antigen for broad host range diagnostics or therapeutics against Bacillus spore infection.

  2. Identification and characterization of Bacillus anthracis by multiplex PCR on DNA chip.

    PubMed

    Wang, Shi-Hua; Wen, Ji-Kai; Zhou, Ya-Feng; Zhang, Zhi-Ping; Yang, Rui-Fu; Zhang, Ji-Bin; Chen, Jia; Zhang, Xian-En

    2004-11-01

    Bacillus anthracis can be identified by detecting virulence factor genes located on two plasmids, pXO1 and pXO2. Combining multiplex PCR with arrayed anchored primer PCR and biotin-avidin alkaline phosphatase indicator system, we developed a qualitative DNA chip method for characterization of B. anthracis, and simultaneous confirmation of the species identity independent of plasmid contents. The assay amplifies pag gene (in pXO1), cap gene (in pXO2) and Ba813 gene (a B. anthracis specific chromosomal marker), and the results were indicated by an easy-to-read profile based on the color reaction of alkaline phosphatase. About 1 pg of specific DNA fragments on the chip wells could be detected after PCR. With the proposed method, the avirulent (pXO1+/2-, pXO1-/2+ and pXO1-/2-) strains of B. anthracis and distinguished 'anthrax-like' strains from other B. cereus group bacteria were unambiguously identified, while the genera other than Bacillus gave no positive signal.

  3. Anthrax Lethal Toxin Impairs Innate Immune Functions of Alveolar Macrophages and Facilitates Bacillus anthracis Survival

    DTIC Science & Technology

    2006-06-14

    germinate into vegetative bacteria (10, 23), which are capable of secreting anthrax lethal toxin (LT) and edema toxin . In the lymph nodes, bacteria ...inability of AM to completely eradicate bacteria suggests that intracellularly secreted lethal FIG. 5. Lethal toxin impairs bactericidal activity but...Microbiology. All Rights Reserved. Anthrax Lethal Toxin Impairs Innate Immune Functions of Alveolar Macrophages and Facilitates Bacillus anthracis

  4. Responding to detection of aerosolized Bacillus anthracis by autonomous detection systems in the workplace.

    PubMed

    Meehan, Patrick J; Rosenstein, Nancy E; Gillen, Matthew; Meyer, Richard F; Kiefer, Max J; Deitchman, Scott; Besser, Richard E; Ehrenberg, Richard L; Edwards, Kathleen M; Martinez, Kenneth F

    2004-06-04

    Autonomous detection systems (ADSs) are under development to detect agents of biologic and chemical terror in the environment. These systems will eventually be able to detect biologic and chemical hazards reliably and provide approximate real-time alerts that an agent is present. One type of ADS that tests specifically for Bacillus anthracis is being deployed in hundreds of postal distribution centers across the United States. Identification of aerosolized B. anthracis spores in an air sample can facilitate prompt on-site decontamination of workers and subsequent administration of postexposure prophylaxis to prevent inhalational anthrax. Every employer who deploys an ADS should develop detailed plans for responding to a positive signal. Responding to ADS detection of B. anthracis involves coordinating responses with community partners and should include drills and exercises with these partners. This report provides guidelines in the following six areas: 1) response and consequence management planning, including the minimum components of a facility response plan; 2) immediate response and evacuation; 3) decontamination of potentially exposed workers to remove spores from clothing and skin and prevent introduction of B. anthracis into the worker's home and conveyances; 4) laboratory confirmation of an ADS signal; 5) steps for evaluating potentially contaminated environments; and 6) postexposure prophylaxis and follow-up.

  5. Bacillus anthracis diagnostic detection and rapid antibiotic susceptibility determination using 'bioluminescent' reporter phage.

    PubMed

    Schofield, David A; Sharp, Natasha J; Vandamm, Joshua; Molineux, Ian J; Spreng, Krista A; Rajanna, Chythanya; Westwater, Caroline; Stewart, George C

    2013-11-01

    Genetically modified phages have the potential to detect pathogenic bacteria from clinical, environmental, or food-related sources. Herein we assess an engineered 'bioluminescent' reporter phage (Wß::luxAB) as a clinical diagnostic tool for Bacillus anthracis, the etiological agent of anthrax. Wß::luxAB is able to rapidly (within minutes) detect a panel of B. anthracis strains by transducing a bioluminescent phenotype. The reporter phage displays species specificity by its inability, or significantly reduced ability, to detect members of the closely related Bacillus cereus group and other common bacterial pathogens. Using spiked clinical specimens, Wß::luxAB detects B. anthracis within 5 h at clinically relevant concentrations, and provides antibiotic susceptibility information that mirrors the CLSI method, except that data are obtained at least 5-fold faster. Although anthrax is a treatable disease, a positive patient prognosis is dependent on timely diagnosis and appropriate therapy. Wß::luxAB rapidly detects B. anthracis and determines antibiotic efficacy, properties that will help patient outcome.

  6. Genome Sequence of a Bacillus anthracis Outbreak Strain from Zambia, 2011.

    PubMed

    Ohnishi, Naomi; Maruyama, Fumito; Ogawa, Hirohito; Kachi, Hirokazu; Yamada, Shunsuke; Fujikura, Daisuke; Nakagawa, Ichiro; Hang'ombe, Mudenda B; Thomas, Yuka; Mweene, Aaron S; Higashi, Hideaki

    2014-03-06

    In August 2011, an anthrax outbreak occurred among Hippopotamus amphibius hippopotamuses and humans in Zambia. Here, we report the draft genome sequence of the Bacillus anthracis outbreak strain CZC5, isolated from tissues of H. amphibius hippopotamuses that had died in the outbreak area.

  7. Genome Sequence of a Bacillus anthracis Outbreak Strain from Zambia, 2011

    PubMed Central

    Ohnishi, Naomi; Maruyama, Fumito; Ogawa, Hirohito; Kachi, Hirokazu; Yamada, Shunsuke; Fujikura, Daisuke; Nakagawa, Ichiro; Hang’ombe, Mudenda B.; Thomas, Yuka; Mweene, Aaron S.

    2014-01-01

    In August 2011, an anthrax outbreak occurred among Hippopotamus amphibius hippopotamuses and humans in Zambia. Here, we report the draft genome sequence of the Bacillus anthracis outbreak strain CZC5, isolated from tissues of H. amphibius hippopotamuses that had died in the outbreak area. PMID:24604644

  8. Functional characterization of WalRK: A two-component signal transduction system from Bacillus anthracis.

    PubMed

    Dhiman, Alisha; Bhatnagar, Sonika; Kulshreshtha, Parul; Bhatnagar, Rakesh

    2014-01-01

    Two-component signal transduction systems (TCS), consisting of a sensor histidine protein kinase and its cognate response regulator, are an important mode of environmental sensing in bacteria. Additionally, they have been found to regulate virulence determinants in several pathogens. Bacillus anthracis, the causative agent of anthrax and a bioterrorism agent, harbours 41 pairs of TCS. However, their role in its pathogenicity has remained largely unexplored. Here, we show that WalRK of B. anthracis forms a functional TCS which exhibits some species-specific functions. Biochemical studies showed that domain variants of WalK, the histidine kinase, exhibit classical properties of autophosphorylation and phosphotransfer to its cognate response regulator WalR. Interestingly, these domain variants also show phosphatase activity towards phosphorylated WalR, thereby making WalK a bifunctional histidine kinase/phosphatase. An in silico regulon determination approach, using a consensus binding sequence from Bacillus subtilis, provided a list of 30 genes that could form a putative WalR regulon in B. anthracis. Further, electrophoretic mobility shift assay was used to show direct binding of purified WalR to the upstream regions of three putative regulon candidates, an S-layer protein EA1, a cell division ABC transporter FtsE and a sporulation histidine kinase KinB3. Our work lends insight into the species-specific functions and mode of action of B. anthracis WalRK.

  9. Biochemical Characterization of β-Lactamases Bla1 and Bla2 from Bacillus anthracis

    PubMed Central

    Materon, Isabel C.; Queenan, Anne Marie; Koehler, Theresa M.; Bush, Karen; Palzkill, Timothy

    2003-01-01

    The Sterne and Ames strains of Bacillus anthracis carry chromosomal genes bla1 and bla2, which confer β-lactam resistance when expressed in Escherichia coli. MIC measurements and steady-state kinetic analyses indicate that Bla1 possesses penicillinase activity while Bla2 possesses penicillinase, cephalosporinase, and carbapenem-hydrolyzing activities. PMID:12760895

  10. Anthrax Toxins in Context of Bacillus anthracis Spores and Spore Germination.

    PubMed

    Cote, Christopher K; Welkos, Susan L

    2015-08-17

    The interaction of anthrax toxin or toxin components with B. anthracis spores has been demonstrated. Germinating spores can produce significant amounts of toxin components very soon after the initiation of germination. In this review, we will summarize the work performed that has led to our understanding of toxin and spore interactions and discuss the complexities associated with these interactions.

  11. clpC operon regulates cell architecture and sporulation in Bacillus anthracis.

    PubMed

    Singh, Lalit K; Dhasmana, Neha; Sajid, Andaleeb; Kumar, Prasun; Bhaduri, Asani; Bharadwaj, Mitasha; Gandotra, Sheetal; Kalia, Vipin C; Das, Taposh K; Goel, Ajay K; Pomerantsev, Andrei P; Misra, Richa; Gerth, Ulf; Leppla, Stephen H; Singh, Yogendra

    2015-03-01

    The clpC operon is known to regulate several processes such as genetic competence, protein degradation and stress survival in bacteria. Here, we describe the role of clpC operon in Bacillus anthracis. We generated knockout strains of the clpC operon genes to investigate the impact of CtsR, McsA, McsB and ClpC deletion on essential processes of B. anthracis. We observed that growth, cell division, sporulation and germination were severely affected in mcsB and clpC deleted strains, while none of deletions affected toxin secretion. Growth defect in these strains was pronounced at elevated temperature. The growth pattern gets restored on complementation of mcsB and clpC in respective mutants. Electron microscopic examination revealed that mcsB and clpC deletion also causes defect in septum formation leading to cell elongation. These vegetative cell deformities were accompanied by inability of mutant strains to generate morphologically intact spores. Higher levels of polyhydroxybutyrate granules accumulation were also observed in these deletion strains, indicating a defect in sporulation process. Our results demonstrate, for the first time, the vital role played by McsB and ClpC in physiology of B. anthracis and open up further interest on this operon, which might be of importance to success of B. anthracis as pathogen.

  12. Virulence plasmid stability in environmentally occurring Bacillus anthracis from North East Turkey.

    PubMed

    Cooper, Callum; Buyuk, Fatih; Schelkle, Bettina; Saglam, Aliye Gulmez; Celik, Elif; Celebi, Ozgur; Sahin, Mitat; Hawkyard, Tom; Baillie, Les

    2017-01-01

    The Bacillus anthracis virulence plasmid pXO2, which encodes for a polypeptide capsule, can be lost during long term laboratory storage. To determine if pXO2 is lost in nature we screened B. anthracis isolates obtained from B. anthracis spores from contaminated animal burial sites in Turkey for their ability to express a capsule upon primary culture. A total of 672 B. anthracis colonies were examined of which ten produced a mixed mucoid (capsule +ve)/non-mucoid (capsule -ve) phenotype and a further one colony yielded non-mucoid colonies upon repeated culture. Screening by PCR using pXO2 specific primers revealed that seven of these isolates had eliminated the plasmid. Of the four colonies which were positive by PCR, one regained the ability to express a capsule upon repeated culture suggesting that the defect was reversible. This is an important observation as capsule expression is a principal marker of virulence and in the absence of PCR serves as a key diagnostic marker. The results of this preliminary study suggest that pXO2 is lost in nature and that further studies are need to determine the mechanisms by which this occurs.

  13. Identification of Bacillus anthracis PurE inhibitors with antimicrobial activity.

    PubMed

    Kim, Anna; Wolf, Nina M; Zhu, Tian; Johnson, Michael E; Deng, Jiangping; Cook, James L; Fung, Leslie W-M

    2015-04-01

    N(5)-carboxy-amino-imidazole ribonucleotide (N(5)-CAIR) mutase (PurE), a bacterial enzyme in the de novo purine biosynthetic pathway, has been suggested to be a target for antimicrobial agent development. We have optimized a thermal shift method for high-throughput screening of compounds binding to Bacillus anthracis PurE. We used a low ionic strength buffer condition to accentuate the thermal shift stabilization induced by compound binding to Bacillus anthracis PurE. The compounds identified were then subjected to computational docking to the active site to further select compounds likely to be inhibitors. A UV-based enzymatic activity assay was then used to select inhibitory compounds. Minimum inhibitory concentration (MIC) values were subsequently obtained for the inhibitory compounds against Bacillus anthracis (ΔANR strain), Escherichia coli (BW25113 strain, wild-type and ΔTolC), Francisella tularensis, Staphylococcus aureus (both methicillin susceptible and methicillin-resistant strains) and Yersinia pestis. Several compounds exhibited excellent (0.05-0.15μg/mL) MIC values against Bacillus anthracis. A common core structure was identified for the compounds exhibiting low MIC values. The difference in concentrations for inhibition and MIC suggest that another enzyme(s) is also targeted by the compounds that we identified.

  14. The two CcdA proteins of Bacillus anthracis differentially affect virulence gene expression and sporulation.

    PubMed

    Han, Hesong; Wilson, Adam C

    2013-12-01

    The cytochrome c maturation system influences the expression of virulence factors in Bacillus anthracis. B. anthracis carries two copies of the ccdA gene, encoding predicted thiol-disulfide oxidoreductases that contribute to cytochrome c maturation, while the closely related organism Bacillus subtilis carries only one copy of ccdA. To investigate the roles of the two ccdA gene copies in B. anthracis, strains were constructed without each ccdA gene, and one strain was constructed without both copies simultaneously. Loss of both ccdA genes results in a reduction of cytochrome c production, an increase in virulence factor expression, and a reduction in sporulation efficiency. Complementation and expression analyses indicate that ccdA2 encodes the primary CcdA in B. anthracis, active in all three pathways. While CcdA1 retains activity in cytochrome c maturation and virulence control, it has completely lost its activity in the sporulation pathway. In support of this finding, expression of ccdA1 is strongly reduced when cells are grown under sporulation-inducing conditions. When the activities of CcdA1 and CcdA2 were analyzed in B. subtilis, neither protein retained activity in cytochrome c maturation, but CcdA2 could still function in sporulation. These observations reveal the complexities of thiol-disulfide oxidoreductase function in pathways relevant to virulence and physiology.

  15. Removal of Bacillus anthracis sterne spore from commercial unpasteurized liquid egg white using crossflow microfiltration

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Current pasteurization technology used by the egg industry is ineffective for destruction of spores such as those of Bacillus anthracis (BA). The validity of a cross-flow microfiltration (MF) process for separation of the attenuated strain of BA (Sterne) spores from commercial unpasteurized liquid ...

  16. Carbon microarrays for the direct impedimetric detection of Bacillus anthracis using Gamma phages as probes.

    PubMed

    Shabani, Arghavan; Marquette, Christophe A; Mandeville, Rosemonde; Lawrence, Marcus F

    2013-03-07

    A direct and efficient impedimetric method is presented for the detection of Bacillus anthracis Sterne vegetative cells, using Gamma phages as probes attached to screen-printed carbon electrode microarrays. The carbon electrodes were initially functionalized through cyclic-voltammetric reduction of a nitro-aryl diazonium moiety, followed by further reduction of nitro groups to amino groups, and finally by treatment with glutaraldehyde. Functionalization (probe immobilization) using Gamma phages was verified by XPS and TOF-SIM experiments. The Gamma phage-modified microarrays were then used to detect B. anthracis Sterne bacteria in aqueous electrolyte media. Faradaic impedimetric detection of bacteria in KCl solution containing the ferri/ferro cyanide redox couple shows a gradual increase in Z' (real impedance) values, taken from the extrapolation of the linear portion of Nyquist plots in the low frequency range, for sensors placed in contact with increasing concentrations of B. anthracis. ΔZ' values vary from 700 to 5300 Ohms for bacteria concentrations ranging from 10(2) to 10(8) cfu mL(-1). These shifts in Z' are attributed to a decrease in diffusion controlled charge transfer to the electrode surface following capture of intact B. anthracis. No significant ΔZ' was observed for control experiments using E. coli. K12 as a non-specific target, even at a concentration of 10(8) cfu mL(-1).

  17. Genomic characterization of the Bacillus cereus sensu lato species: backdrop to the evolution of Bacillus anthracis.

    PubMed

    Zwick, Michael E; Joseph, Sandeep J; Didelot, Xavier; Chen, Peter E; Bishop-Lilly, Kimberly A; Stewart, Andrew C; Willner, Kristin; Nolan, Nichole; Lentz, Shannon; Thomason, Maureen K; Sozhamannan, Shanmuga; Mateczun, Alfred J; Du, Lei; Read, Timothy D

    2012-08-01

    The key genes required for Bacillus anthracis to cause anthrax have been acquired recently by horizontal gene transfer. To understand the genetic background for the evolution of B. anthracis virulence, we obtained high-redundancy genome sequences of 45 strains of the Bacillus cereus sensu lato (s.l.) species that were chosen for their genetic diversity within the species based on the existing multilocus sequence typing scheme. From the resulting data, we called more than 324,000 new genes representing more than 12,333 new gene families for this group. The core genome size for the B. cereus s.l. group was ∼1750 genes, with another 2150 genes found in almost every genome constituting the extended core. There was a paucity of genes specific and conserved in any clade. We found no evidence of recent large-scale gene loss in B. anthracis or for unusual accumulation of nonsynonymous DNA substitutions in the chromosome; however, several B. cereus genomes isolated from soil and not previously associated with human disease were degraded to various degrees. Although B. anthracis has undergone an ecological shift within the species, its chromosome does not appear to be exceptional on a macroscopic scale compared with close relatives.

  18. Biochemical characterization of beta-lactamases Bla1 and Bla2 from Bacillus anthracis.

    PubMed

    Materon, Isabel C; Queenan, Anne Marie; Koehler, Theresa M; Bush, Karen; Palzkill, Timothy

    2003-06-01

    The Sterne and Ames strains of Bacillus anthracis carry chromosomal genes bla1 and bla2, which confer beta-lactam resistance when expressed in Escherichia coli. MIC measurements and steady-state kinetic analyses indicate that Bla1 possesses penicillinase activity while Bla2 possesses penicillinase, cephalosporinase, and carbapenem-hydrolyzing activities.

  19. PRACTICAL EXPERIENCES WITH TECHNOLOGIES FOR DECONTAMINATION OF B. ANTHRACIS IN LARGE BUILDINGS.

    EPA Science Inventory

    In the Fall of 2001 a number of buildings were contaminated with B. anthracis (B.A.) from letters processed through United States Postal Service and other mail handling facilities. All of the buildings have now been decontaminated using a variety of technologies. In a number of...

  20. Isolation, sequence identification and tissue expression profile of two novel soybean (glycine max) genes-vestitone reductase and chalcone reductase.

    PubMed

    Liu, G Y

    2009-09-01

    The complete mRNA sequences of two soybean (glycine max) genes-vestitone reductase and chalcone reductase, were amplified using the rapid amplification of cDNA ends methods. The sequence analysis of these two genes revealed that soybean vestitone reductase gene encodes a protein of 327 amino acids which has high homology with the vestitone reductase of Medicago sativa (77%). The soybean chalcone reductase gene encodes a protein of 314 amino acids that has high homology with the chalcone reductase of kudzu vine (88%) and medicago sativa (83%). The expression profiles of the soybean vestitone reductase and chalcone reductase genes were studied and the results indicated that these two soybean genes were differentially expressed in detected soybean tissues including leaves, stems, roots, inflorescences, embryos and endosperm. Our experiment established the foundation for further research on these two soybean genes.

  1. Post-translational Regulation of Nitrate Reductase

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Nitrate reductase (NR) catalyzes the reduction of nitrate to nitrite, which is the first step in the nitrate assimilation pathway, but can also reduce nitrite to nitric oxide (NO), an important signaling molecule that is thought to mediate a wide array of of developmental and physiological processes...

  2. Fumarate Reductase Activity of Streptococcus faecalis

    PubMed Central

    Aue, B. J.; Diebel, R. H.

    1967-01-01

    Some characteristics of a fumarate reductase from Streptococcus faecalis are described. The enzyme had a pH optimum of 7.4; optimal activity was observed when the ionic strength of the phosphate buffer was adjusted to 0.088. The Km value of the enzyme for reduced flavin mononucleotide was 2 × 10−4 m as determined with a 26-fold preparation. In addition to fumarate, the enzyme reduced maleate and mesaconate. No succinate dehydrogenase activity was detected, but succinate did act as an inhibitor of the fumarate reductase activity. Other inhibitors were malonate, citraconate, and trans-, trans-muconate. Metal-chelating agents did not inhibit the enzyme. A limited inhibition by sulfhydryl-binding agents was observed, and the preparations were sensitive to air oxidation and storage. Glycine, alanine, histidine, and possibly lysine stimulated fumarate reductase activity in the cell-free extracts. However, growth in media supplemented with glycine did not enhance fumarate reductase activity. The enzymatic activity appears to be constitutive. PMID:4960892

  3. Inactivation of Bacillus anthracis Spores during Laboratory-Scale Composting of Feedlot Cattle Manure

    PubMed Central

    Xu, Shanwei; Harvey, Amanda; Barbieri, Ruth; Reuter, Tim; Stanford, Kim; Amoako, Kingsley K.; Selinger, Leonard B.; McAllister, Tim A.

    2016-01-01

    Anthrax outbreaks in livestock have social, economic and health implications, altering farmer’s livelihoods, impacting trade and posing a zoonotic risk. Our study investigated the survival of Bacillus thuringiensis and B. anthracis spores sporulated at 15, 20, or 37°C, over 33 days of composting. Spores (∼7.5 log10 CFU g-1) were mixed with manure and composted in laboratory scale composters. After 15 days, the compost was mixed and returned to the composter for a second cycle. Temperatures peaked at 71°C on day 2 and remained ≥55°C for an average of 7 days in the first cycle, but did not exceed 55°C in the second. For B. thuringiensis, spores generated at 15 and 21°C exhibited reduced (P < 0.05) viability of 2.7 and 2.6 log10 CFU g-1 respectively, as compared to a 0.6 log10 CFU g-1 reduction for those generated at 37°C. For B. anthracis, sporulation temperature did not impact spore survival as there was a 2.5, 2.2, and 2.8 log10 CFU g-1 reduction after composting for spores generated at 15, 21, and 37°C, respectively. For both species, spore viability declined more rapidly (P < 0.05) in the first as compared to the second composting cycle. Our findings suggest that the duration of thermophilic exposure (≥55°C) is the main factor influencing survival of B. anthracis spores in compost. As sporulation temperature did not influence survival of B. anthracis, composting may lower the viability of spores associated with carcasses infected with B. anthracis over a range of sporulation temperatures. PMID:27303388

  4. Antimicrobial effects of interferon-inducible CXC chemokines against Bacillus anthracis spores and bacilli.

    PubMed

    Crawford, Matthew A; Zhu, Yinghua; Green, Candace S; Burdick, Marie D; Sanz, Patrick; Alem, Farhang; O'Brien, Alison D; Mehrad, Borna; Strieter, Robert M; Hughes, Molly A

    2009-04-01

    Based on previous studies showing that host chemokines exert antimicrobial activities against bacteria, we sought to determine whether the interferon-inducible Glu-Leu-Arg-negative CXC chemokines CXCL9, CXCL10, and CXCL11 exhibit antimicrobial activities against Bacillus anthracis. In vitro analysis demonstrated that all three CXC chemokines exerted direct antimicrobial effects against B. anthracis spores and bacilli including marked reductions in spore and bacillus viability as determined using a fluorometric assay of bacterial viability and CFU determinations. Electron microscopy studies revealed that CXCL10-treated spores failed to undergo germination as judged by an absence of cytological changes in spore structure that occur during the process of germination. Immunogold labeling of CXCL10-treated spores demonstrated that the chemokine was located internal to the exosporium in association primarily with the spore coat and its interface with the cortex. To begin examining the potential biological relevance of chemokine-mediated antimicrobial activity, we used a murine model of inhalational anthrax. Upon spore challenge, the lungs of C57BL/6 mice (resistant to inhalational B. anthracis infection) had significantly higher levels of CXCL9, CXCL10, and CXCL11 than did the lungs of A/J mice (highly susceptible to infection). Increased CXC chemokine levels were associated with significantly reduced levels of spore germination within the lungs as determined by in vivo imaging. Taken together, our data demonstrate a novel antimicrobial role for host chemokines against B. anthracis that provides unique insight into host defense against inhalational anthrax; these data also support the notion for an innovative approach in treating B. anthracis infection as well as infections caused by other spore-forming organisms.

  5. The Use of Germinants to Potentiate the Sensitivity of Bacillus anthracis Spores to Peracetic Acid.

    PubMed

    Celebi, Ozgur; Buyuk, Fatih; Pottage, Tom; Crook, Ant; Hawkey, Suzanna; Cooper, Callum; Bennett, Allan; Sahin, Mitat; Baillie, Leslie

    2016-01-01

    Elimination of Bacillus anthracis spores from the environment is a difficult and costly process due in part to the toxicity of current sporicidal agents. For this reason we investigated the ability of the spore germinants L-alanine (100 mM) and inosine (5 mM) to reduce the concentration of peracetic acid (PAA) required to inactivate B. anthracis spores. While L-alanine significantly enhanced (p = 0.0085) the bactericidal activity of 500 ppm PAA the same was not true for inosine suggesting some form of negative interaction. In contrast the germinant combination proved most effective at 100 ppm PAA (p = 0.0009). To determine if we could achieve similar results in soil we treated soil collected from the burial site of an anthrax infected animal which had been supplemented with spores of the Sterne strain of B. anthracis to increase the level of contamination to 10(4) spores/g. Treatment with germinants followed 1 h later by 5000 ppm PAA eliminated all of the spores. In contrast direct treatment of the animal burial site using this approach delivered using a back pack sprayer had no detectable effect on the level of B. anthracis contamination or on total culturable bacterial numbers over the course of the experiment. It did trigger a significant, but temporary, reduction (p < 0.0001) in the total spore count suggesting that germination had been triggered under real world conditions. In conclusion, we have shown that the application of germinants increase the sensitivity of bacterial spores to PAA. While the results of the single field trial were inconclusive, the study highlighted the potential of this approach and the challenges faced when attempting to perform real world studies on B. anthracis spores contaminated sites.

  6. The Use of Germinants to Potentiate the Sensitivity of Bacillus anthracis Spores to Peracetic Acid

    PubMed Central

    Celebi, Ozgur; Buyuk, Fatih; Pottage, Tom; Crook, Ant; Hawkey, Suzanna; Cooper, Callum; Bennett, Allan; Sahin, Mitat; Baillie, Leslie

    2016-01-01

    Elimination of Bacillus anthracis spores from the environment is a difficult and costly process due in part to the toxicity of current sporicidal agents. For this reason we investigated the ability of the spore germinants L-alanine (100 mM) and inosine (5 mM) to reduce the concentration of peracetic acid (PAA) required to inactivate B. anthracis spores. While L-alanine significantly enhanced (p = 0.0085) the bactericidal activity of 500 ppm PAA the same was not true for inosine suggesting some form of negative interaction. In contrast the germinant combination proved most effective at 100 ppm PAA (p = 0.0009). To determine if we could achieve similar results in soil we treated soil collected from the burial site of an anthrax infected animal which had been supplemented with spores of the Sterne strain of B. anthracis to increase the level of contamination to 104 spores/g. Treatment with germinants followed 1 h later by 5000 ppm PAA eliminated all of the spores. In contrast direct treatment of the animal burial site using this approach delivered using a back pack sprayer had no detectable effect on the level of B. anthracis contamination or on total culturable bacterial numbers over the course of the experiment. It did trigger a significant, but temporary, reduction (p < 0.0001) in the total spore count suggesting that germination had been triggered under real world conditions. In conclusion, we have shown that the application of germinants increase the sensitivity of bacterial spores to PAA. While the results of the single field trial were inconclusive, the study highlighted the potential of this approach and the challenges faced when attempting to perform real world studies on B. anthracis spores contaminated sites. PMID:26858699

  7. Evaluation of the rapid analyte measurement platform (RAMP) for the detection of Bacillus anthracis at a crime scene.

    PubMed

    Hoile, Rebecca; Yuen, Marion; James, Gregory; Gilbert, Gwendolyn L

    2007-08-24

    The aim of this study was to evaluate the accuracy and reliability of the rapid analyte measurement platform (RAMP) for presumptive identification of Bacillus anthracis spores. Test samples consisted of serial dilutions of spore preparations of several Bacillus species, including B. anthracis, which were tested, using the RAMP Anthrax test cartridge, according to the manufacturer's instructions. The fluorescence labelled antibody-antigen complexes were detected in the portable reader after 15 min following sample addition. Dilutions of common environmental and household powders were also tested to identify possible false positive results. B. anthracis spores were identified reliably in test samples containing more than 6000 spores. The test kits were highly specific, showing no cross reactivity with other Bacillus species or any environmental powders tested. The RAMP system for detection of B. anthracis spores, from environmental samples, showed consistent results under a variety of analytical conditions, enabling the trained user to provide a rapid, accurate preliminary risk assessment of a suspected bioterrorism incident.

  8. The Pathogenomic Sequence Analysis of B. cereus and B.thuringiensis Isolates Closely Related to Bacillus anthracis

    SciTech Connect

    Han, Cliff S.; Xie, Gary; Challacombe, Jean F.; Altherr, MichaelR.; Smriti, B.; Bruce, David; Campbell, Connie S.; Campbell, Mary L.; Chen, Jin; Chertkov, Olga; Cleland, Cathy; Dimitrijevic-Bussod, M.; Doggett, Norman A.; Fawcett, John J.; Glavina, Tijana; Goodwin, Lynne A.; Hill, Karen K.; Hitchcock, Penny; Jackson, Paul J.; Keim, Paul; Kewalramani, Avinash Ramesh; Longmire, Jon; Lucas, Susan; Malfatti,Stephanie; McMurry, Kim; Meincke, Linda J.; Misra, Monica; Moseman,Bernice L.; Mundt, Mark; Munk, A. Christine; Okinaka, Richard T.; Parson-Quintana, B.; Reilly, Lee P.; Richardson, Paul; Robinson, DonnaL.; Rubin, Eddy; Saunders, Elizabeth; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Ticknor, Lawrence O.; Wills, Patti L.; Gilna, Payl; Brettin, Thomas S.

    2005-08-18

    The sequencing and analysis of two close relatives of Bacillus anthracis are reported. AFLP analysis of over 300 isolates of B.cereus, B. thuringiensis and B. anthracis identified two isolates as being very closely related to B. anthracis. One, a B. cereus, BcE33L, was isolated from a zebra carcass in Nambia; the second, a B. thuringiensis, 97-27, was isolated from a necrotic human wound. The B. cereus appears to be the closest anthracis relative sequenced to date. A core genome of over 3,900 genes was compiled for the Bacillus cereus group, including Banthracis. Comparative analysis of these two genomes with other members of the B. cereus group provides insight into the evolutionary relationships among these organisms. Evidence is presented that differential regulation modulates virulence, rather than simple acquisition of virulence factors. These genome sequences provide insight into the molecular mechanisms contributing to the host range and virulence of this group of organisms.

  9. Augmentation of CFTR maturation by S-nitrosoglutathione reductase

    PubMed Central

    Sawczak, Victoria; Zaidi, Atiya; Butler, Maya; Bennett, Deric; Getsy, Paulina; Zeinomar, Maryam; Greenberg, Zivi; Forbes, Michael; Rehman, Shagufta; Jyothikumar, Vinod; DeRonde, Kim; Sattar, Abdus; Smith, Laura; Corey, Deborah; Straub, Adam; Sun, Fei; Palmer, Lisa; Periasamy, Ammasi; Randell, Scott; Kelley, Thomas J.; Lewis, Stephen J.

    2015-01-01

    S-nitrosoglutathione (GSNO) reductase regulates novel endogenous S-nitrosothiol signaling pathways, and mice deficient in GSNO reductase are protected from airways hyperreactivity. S-nitrosothiols are present in the airway, and patients with cystic fibrosis (CF) tend to have low S-nitrosothiol levels that may be attributed to upregulation of GSNO reductase activity. The present study demonstrates that 1) GSNO reductase activity is increased in the cystic fibrosis bronchial epithelial (CFBE41o−) cells expressing mutant F508del-cystic fibrosis transmembrane regulator (CFTR) compared with the wild-type CFBE41o− cells, 2) GSNO reductase expression level is increased in the primary human bronchial epithelial cells expressing mutant F508del-CFTR compared with the wild-type cells, 3) GSNO reductase colocalizes with cochaperone Hsp70/Hsp90 organizing protein (Hop; Stip1) in human airway epithelial cells, 4) GSNO reductase knockdown with siRNA increases the expression and maturation of CFTR and decreases Stip1 expression in human airway epithelial cells, 5) increased levels of GSNO reductase cause a decrease in maturation of CFTR, and 6) a GSNO reductase inhibitor effectively reverses the effects of GSNO reductase on CFTR maturation. These studies provide a novel approach to define the subcellular location of the interactions between Stip1 and GSNO reductase and the role of S-nitrosothiols in these interactions. PMID:26637637

  10. Assessment of a Solid Phase Matrix for the Neutralization and Real-Time PCR Detection of Bacillus anthracis

    DTIC Science & Technology

    2006-12-01

    for the Neutralization and Real - Time PCR Detection of Bacillus anthracis D.E. Bader, G.R. Fisher and C.W. Stratilo DRDC Suffield Technical Memorandum...Matrix for the Neutralization and Real - Time PCR Detection of Bacillus anthracis D.E. Bader, G.R. Fisher, and C.W. Stratilo Defence R&D Canada - Suffield...evaluated for their neutralization ability, based on cell culture analysis, and were also analyzed using real - time PCR detection assays designed to

  11. A Reaction Path Study of the Catalysis and Inhibition of the Bacillus anthracis CapD gamma-Glutamyl Transpeptidase

    DTIC Science & Technology

    2014-10-21

    A Reaction Path Study of the Catalysis and Inhibition of the Bacillus anthracis CapD γ‑Glutamyl Transpeptidase Ilja V. Khavrutskii,*,† Patricia M...Research Institute of Infectious Diseases, Fort Detrick, Maryland 21702, United States *S Supporting Information ABSTRACT: The CapD enzyme of Bacillus ...nature of CapD, the enzyme cleaved the amide bond of capsidin by attacking it on the opposite side compared to pDGA. Bacillus anthracis is a Gram-positive

  12. Bacillus Anthracis Spore Interactions with Mammalian Cells: Relationship Between Germination State and the Outcome of in Vitro Infections

    DTIC Science & Technology

    2011-02-28

    germinant receptors in vitro. J Bacteriol 2005, 187(23):8055-8062. 42. Barlass PJ, Houston CW, Clements MO, Moir A: Germination of Bacillus cereus spores...available soon. Bacillus anthracis spore interactions with mammalian cells: Relationship between germination state and the outcome of in vitro infections...00-2011 to 00-00-2011 4. TITLE AND SUBTITLE Bacillus Anthracis Spore Interactions With Mammalian Cells: Relationship Between Germination State And

  13. Characterization of Bacillus anthracis-like bacteria isolated from wild great apes from Cote d'Ivoire and Cameroon.

    PubMed

    Klee, Silke R; Ozel, Muhsin; Appel, Bernd; Boesch, Christophe; Ellerbrok, Heinz; Jacob, Daniela; Holland, Gudrun; Leendertz, Fabian H; Pauli, Georg; Grunow, Roland; Nattermann, Herbert

    2006-08-01

    We present the microbiological and molecular characterization of bacteria isolated from four chimpanzees and one gorilla thought to have died of an anthrax-like disease in Côte d'Ivoire and Cameroon. These isolates differed significantly from classic Bacillus anthracis by the following criteria: motility, resistance to the gamma phage, and, for isolates from Cameroon, resistance to penicillin G. A capsule was expressed not only after induction by CO(2) and bicarbonate but also under normal growth conditions. Subcultivation resulted in beta-hemolytic activity and gamma phage susceptibility in some subclones, suggesting differences in gene regulation compared to classic B. anthracis. The isolates from Côte d'Ivoire and Cameroon showed slight differences in their biochemical characteristics and MICs of different antibiotics but were identical in all molecular features and sequences analyzed. PCR and Southern blot analyses confirmed the presence of both the toxin and the capsule plasmid, with sizes corresponding to the B. anthracis virulence plasmids pXO1 and pXO2. Protective antigen was expressed and secreted into the culture supernatant. The isolates possessed variants of the Ba813 marker and the SG-749 fragment differing from that of classic B. anthracis strains. Multilocus sequence typing revealed a close relationship of our atypical isolates with both classic B. anthracis strains and two uncommonly virulent Bacillus cereus and Bacillus thuringiensis isolates. We propose that the newly discovered atypical B. anthracis strains share a common ancestor with classic B. anthracis or that they emerged recently by transfer of the B. anthracis plasmids to a strain of the B. cereus group.

  14. Microarray Analysis of Transposon Insertion Mutants in Bacillus Anthracis: Global Identification of Genes Required for Sporulation and Germination

    DTIC Science & Technology

    2007-02-01

    Gilois, M. Rose, and D. Lereclus. 2001. Oligopep- tide permease is required for expression of the Bacillus thuringiensis plcR regulon and for...non- toxin gene expression in Bacillus anthracis. Infect. Immun. 65:3091–3099. 10. Ikeda, R. A., C. M. Ligman, and S. Warshamana. 1992. T7 promoter con...nontoxi- genic Bacillus anthracis spore vaccines based on strains expressing mutant vari- ants of lethal toxin components. Vaccine 23:5688–5697. 17. Read

  15. Molecular characterization of a variant of Bacillus anthracis-specific phage AP50 with improved bacteriolytic activity.

    PubMed

    Sozhamannan, Shanmuga; McKinstry, Michael; Lentz, Shannon M; Jalasvuori, Matti; McAfee, Farrell; Smith, Angela; Dabbs, Jason; Ackermann, Hans-W; Bamford, Jaana K H; Mateczun, Alfred; Read, Timothy D

    2008-11-01

    The genome sequence of a Bacillus anthracis-specific clear plaque mutant phage, AP50c, contains 31 open reading frames spanning 14,398 bp, has two mutations compared to wild-type AP50t, and has a colinear genome architecture highly similar to that of gram-positive Tectiviridae phages. Spontaneous AP50c-resistant B. anthracis mutants exhibit a mucoid colony phenotype.

  16. Discerning Viable from Nonviable Yersinia pestis pgm- and Bacillus anthracis Sterne using Propidium Monoazide in the Presence of White Powders

    SciTech Connect

    Hess, Becky M.; Kaiser, Brooke LD; Sydor, Michael A.; Wunschel, David S.; Bruckner-Lea, Cindy J.; Hutchison, Janine R.

    2015-12-23

    ABSTRACT Aims To develop and optimize an assay to determine viability status of Bacillus anthracis Sterne and Yersinia pestis pgm- strains in the presence of white powders by coupling propidium monoazide (PMA) treatment with real-time PCR (qPCR) analysis. Methods and Results PMA selectively enters nonviable cells and binds DNA, thereby increasing qPCR assay cycle threshold (CT) values compared to untreated samples. Dye concentration, cell number and fitness, incubation time, inactivation methods, and assay buffer were optimized for B. anthracis Sterne and Y. pestis pgm-. Differences in CT values in nonviable cells compared to untreated samples were consistently > 9 for both B. anthracis Sterne vegetative cells and Y. pestis pgm- in the presence and absence of three different white powders. Our method eliminates the need for a DNA extraction step prior to detection by qPCR. Conclusions The developed assay enables simultaneous identification and viability assessment for B. anthracis Sterne and Y. pestis pgm- under laboratory conditions, even in the presence of white powders. Eliminating the DNA extraction step that is typically used reduces total assay time and labor requirements for sample analysis. Significance and Impact of the Study The method developed for simultaneous detection and viability assessment for B. anthracis and Y. pestis can be employed in forming decisions about the severity of a biothreat event or the safety of food. Keywords Bacillus anthracis, Yersinia pestis, Propidium Monoazide, qPCR, White Powders, Rapid Viability Detection

  17. FRUCTOSE-6-PHOSPHATE REDUCTASE FROM SALMONELLA GALLINARUM

    PubMed Central

    Zancan, Glaci T.; Bacila, Metry

    1964-01-01

    Zancan, Glaci T. (Universidade do Paraná, Curitiba, Paraná, Brazil), and Metry Bacila. Fructose-6-phosphate reductase from Salmonella gallinarum. J. Bacteriol. 87:614–618. 1964.—A fructose-6-phosphate reductase present in cell-free extracts of Salmonella gallinarum was purified approximately 42 times. The optimal pH for this enzyme is 8.0. The enzyme is specific for fructose-6-phosphate and reduced nicotinamide adenine dinucleotide (NADH). The dissociation constants are 1.78 × 10−4m for fructose-6-phosphate and 8.3 × 10−5m for NADH. The Q10, reaction order, and equilibrium constant were determined. The enzyme is sensitive to p-chloromercuribenzoic acid, but not to o-iodosobenzoic acid nor to N-ethylmaleimide. PMID:14127579

  18. Characterization of erythrose reductases from filamentous fungi

    PubMed Central

    2013-01-01

    Proteins with putative erythrose reductase activity have been identified in the filamentous fungi Trichoderma reesei, Aspergillus niger, and Fusarium graminearum by in silico analysis. The proteins found in T. reesei and A. niger had earlier been characterized as glycerol dehydrogenase and aldehyde reductase, respectively. Corresponding genes from all three fungi were cloned, heterologously expressed in Escherichia coli, and purified. Subsequently, they were used to establish optimal enzyme assay conditions. All three enzymes strictly require NADPH as cofactor, whereas with NADH no activity could be observed. The enzymatic characterization of the three enzymes using ten substrates revealed high substrate specificity and activity with D-erythrose and D-threose. The enzymes from T. reesei and A. niger herein showed comparable activities, whereas the one from F. graminearum reached only about a tenth of it for all tested substrates. In order to proof in vivo the proposed enzyme function, we overexpressed the erythrose reductase-encoding gene in T. reesei. An increased production of erythritol by the recombinant strain compared to the parental strain could be detected. PMID:23924507

  19. A Ferredoxin Disulfide Reductase Delivers Electrons to the Methanosarcina barkeri Class III Ribonucleotide Reductase

    PubMed Central

    2015-01-01

    Two subtypes of class III anaerobic ribonucleotide reductases (RNRs) studied so far couple the reduction of ribonucleotides to the oxidation of formate, or the oxidation of NADPH via thioredoxin and thioredoxin reductase. Certain methanogenic archaea contain a phylogenetically distinct third subtype of class III RNR, with distinct active-site residues. Here we report the cloning and recombinant expression of the Methanosarcina barkeri class III RNR and show that the electrons required for ribonucleotide reduction can be delivered by a [4Fe-4S] protein ferredoxin disulfide reductase, and a conserved thioredoxin-like protein NrdH present in the RNR operon. The diversity of class III RNRs reflects the diversity of electron carriers used in anaerobic metabolism. PMID:26536144

  20. GroEL provides protection against Bacillus anthracis infection in BALB/c mice.

    PubMed

    Sinha, Kanchan; Bhatnagar, Rakesh

    2010-01-01

    Heat shock proteins (Hsps) of the HSP60 and HSP70 family are highly conserved and essential to all living organisms. Hsps are immunodominant in numerous microbial infections and have been investigated for their vaccine potential. We investigated the immunogenicity and protective efficacy of GroEL and DnaK of B. anthracis in murine model. Both Hsps were found to be highly immunogenic with mixed antibody response (both IgG1 and IgG2a), indicating stimulation of both humoral and cell-mediated immunity. Cytokine profile also confirmed robust T-cell response with increase in lymphocyte proliferation. Immunization with GroEL conferred 100% protection to mice against B. anthracis infection whereas DnaK couldn't provide protection.

  1. Host immunity to Bacillus anthracis lethal factor and other immunogens: implications for vaccine design.

    PubMed

    Altmann, Daniel M

    2015-03-01

    Infections of humans with Bacillus anthracis are an issue with respect to the biothreat both to civilians and military personnel, infections of individuals by infected livestock in endemic regions and, recently, infections of intravenous drug users injecting anthrax-contaminated heroin. Existing vaccination regimens are reliant on protective antigen neutralization induced by repeated boosts with the AVA or AVP vaccines. However, there is ongoing interest in updated approaches in light of the intensive booster regime and extent of reactogenicity inherent in the current protocols. Several other immunogens from the B. anthracis proteome have been characterized in recent years, including lethal factor. Lethal factor induces strong CD4 T-cell immunity and encompasses immunodominant epitopes of relevance across diverse HLA polymorphisms. Taken together, recent studies emphasize the potential benefits of vaccines able to confer synergistic immunity to protective antigen and to other immunogens, targeting both B-cell and T-cell repertoires.

  2. The Ba813 chromosomal DNA sequence effectively traces the whole Bacillus anthracis community.

    PubMed

    Ramisse, V; Patra, G; Vaissaire, J; Mock, M

    1999-08-01

    Plasmid genes that are responsible for virulence of Bacillus anthracis are important targets for the DNA-based detection of anthrax. We evaluated the distribution of the Ba813 chromosomal DNA sequence (Ba813) within closely related Bacillus species. Ba813 was systematically identified from 47 strains or isolates of B. anthracis tested, thus indicating its reliability as a tracer for that species. From the 60 strains of closely related Bacillus spp. examined, three bona fide B. cereus and one bona fide B. thuringiensis were found to harbour Ba813. This marker was also detected in Bacillus sp. isolates that were present at high levels in soil samples collected in a place where an anthrax outbreak had occurred. The significance and the possible function of the Ba813 locus is discussed.

  3. A genetic approach for the identification of exosporium assembly determinants of Bacillus anthracis

    PubMed Central

    Spreng, Krista A.; Thompson, Brian M.; Stewart, George C.

    2013-01-01

    The exosporium is the outermost layer of spores of the zoonotic pathogen Bacillus anthracis. The composition of the exosporium and its functions are only partly understood. Because this outer spore layer is refractive to traditional biochemical analysis, a genetic approach is needed in order to define the proteins which comprise this important spore layer and its assembly pathway. We have created a novel genetic screening system for the identification and isolation of mutants with defects in exosporium assembly during B. anthracis spore maturation. The system is based on the targeting sequence of the BclA exosporium nap layer glycoprotein and a fluorescent reporter. By utilizing this screening system and gene inactivation with Tn916, several novel putative exosporium-associated determinants were identified. A sampling of the mutants obtained was further characterized, confirming their exosporium defect and validating the utility of this screen to identify novel spore determinants in the genome of this pathogen. PMID:23411372

  4. Penicillin-Susceptible, Oxidase-Negative, Nonhemolytic, Nonmotile Bacillus megaterium in Disguise of Bacillus anthracis

    PubMed Central

    2017-01-01

    Bacillus anthracis is a bacterial pathogen of major concern. The spores of this bacteria can survive harsh environmental conditions for extended periods and are well recognized as a potential bioterror weapon with significant implications. Accurate and timely identification of this Bacillus species in the diagnostic laboratory is essential for disease and public health management. Biosafety Level 3 measures and ciprofloxacin treatment were instituted when B. anthracis was suspected from a patient with gangrenous foot. 16S rDNA sequencing was performed to accurately identify the suspected bacterium, due to the superiority of this method to accurately identify clinically isolated bacteria. B. megaterium was identified as the causative agent and the organism was subsequently treated as a Biosafety Level 2 pathogen. PMID:28331641

  5. Laboratory Studies on Surface Sampling of Bacillus anthracis Contamination: Summary, Gaps, and Recommendations

    SciTech Connect

    Piepel, Gregory F.; Amidan, Brett G.; Hu, Rebecca

    2011-11-28

    This report summarizes previous laboratory studies to characterize the performance of methods for collecting, storing/transporting, processing, and analyzing samples from surfaces contaminated by Bacillus anthracis or related surrogates. The focus is on plate culture and count estimates of surface contamination for swab, wipe, and vacuum samples of porous and nonporous surfaces. Summaries of the previous studies and their results were assessed to identify gaps in information needed as inputs to calculate key parameters critical to risk management in biothreat incidents. One key parameter is the number of samples needed to make characterization or clearance decisions with specified statistical confidence. Other key parameters include the ability to calculate, following contamination incidents, the (1) estimates of Bacillus anthracis contamination, as well as the bias and uncertainties in the estimates, and (2) confidence in characterization and clearance decisions for contaminated or decontaminated buildings. Gaps in knowledge and understanding identified during the summary of the studies are discussed and recommendations are given for future studies.

  6. Variable Lymphocyte Receptor Recognition of the Immunodominant Glycoprotein of Bacillus anthracis Spores

    SciTech Connect

    Kirchdoerfer, Robert N.; Herrin, Brantley R.; Han, Byung Woo; Turnbough, Jr., Charles L.; Cooper, Max D.; Wilson, Ian A.

    2012-07-25

    Variable lymphocyte receptors (VLRs) are the adaptive immune receptors of jawless fish, which evolved adaptive immunity independent of other vertebrates. In lieu of the immunoglobulin fold-based T and B cell receptors, lymphocyte-like cells of jawless fish express VLRs (VLRA, VLRB, or VLRC) composed of leucine-rich repeats and are similar to toll-like receptors (TLRs) in structure, but antibodies (VLRB) and T cell receptors (VLRA and VLRC) in function. Here, we present the structural and biochemical characterization of VLR4, a VLRB, in complex with BclA, the immunodominant glycoprotein of Bacillus anthracis spores. Using a combination of crystallography, mutagenesis, and binding studies, we delineate the mode of antigen recognition and binding between VLR4 and BclA, examine commonalities in VLRB recognition of antigens, and demonstrate the potential of VLR4 as a diagnostic tool for the identification of B. anthracis spores.

  7. Occurrence and genetic diversity of Bacillus anthracis strains isolated in an active wool-cleaning factory.

    PubMed

    Wattiau, Pierre; Klee, Silke R; Fretin, David; Van Hessche, Mieke; Ménart, Marie; Franz, Tatjana; Chasseur, Camille; Butaye, Patrick; Imberechts, Hein

    2008-07-01

    Culturable microorganisms from various samples taken at an active factory performing wool and goat hair cleaning were isolated and analyzed. Bacillus anthracis was found in air filter dust, wastewater, and goat hairs, where it accounted for approximately 1% of the total counts of viable bacteria. Consistent with the countries of origin of the processed material (South Caucasian and Middle Eastern), all B. anthracis isolates belonged to the same phylogenetic cluster, as determined by variable-number tandem repeat (VNTR) typing at eight loci. Within this cluster, five closely related VNTR subtypes could be identified, of which two were previously unreported. Additional diversity was observed when more sensitive genetic markers were assayed, demonstrating the multifocal nature of goat hair contamination. Goat hair originating from areas where anthrax is endemic remains a material with high biological risk for modern woolworkers.

  8. Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro.

    PubMed Central

    Pyne, C; Bognar, A L

    1992-01-01

    The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products. Images PMID:1548226

  9. Evaluation of Levofloxacin Pharmacodynamics in a Mouse Model of Inhalational Bacillus anthracis

    DTIC Science & Technology

    2005-10-01

    Cipro Levo vs. B. anthracis 0 2 4 6 8 0 1 2 3 4 5 6 Time (days) l o g C F U Control Levo Human AUC/MIC = 300 Cipro AUC/MIC = 256 QD Cipro AUC/MIC = 128...challenge with Levo/ Cipro Rx is taking place currently • Good protection is being seen with “Humanized” levofloxacin dosing • The hollow fiber model

  10. Modeling the potential distribution of Bacillus anthracis under multiple climate change scenarios for Kazakhstan.

    PubMed

    Joyner, Timothy Andrew; Lukhnova, Larissa; Pazilov, Yerlan; Temiralyeva, Gulnara; Hugh-Jones, Martin E; Aikimbayev, Alim; Blackburn, Jason K

    2010-03-09

    Anthrax, caused by the bacterium Bacillus anthracis, is a zoonotic disease that persists throughout much of the world in livestock, wildlife, and secondarily infects humans. This is true across much of Central Asia, and particularly the Steppe region, including Kazakhstan. This study employed the Genetic Algorithm for Rule-set Prediction (GARP) to model the current and future geographic distribution of Bacillus anthracis in Kazakhstan based on the A2 and B2 IPCC SRES climate change scenarios using a 5-variable data set at 55 km(2) and 8 km(2) and a 6-variable BioClim data set at 8 km(2). Future models suggest large areas predicted under current conditions may be reduced by 2050 with the A2 model predicting approximately 14-16% loss across the three spatial resolutions. There was greater variability in the B2 models across scenarios predicting approximately 15% loss at 55 km(2), approximately 34% loss at 8 km(2), and approximately 30% loss with the BioClim variables. Only very small areas of habitat expansion into new areas were predicted by either A2 or B2 in any models. Greater areas of habitat loss are predicted in the southern regions of Kazakhstan by A2 and B2 models, while moderate habitat loss is also predicted in the northern regions by either B2 model at 8 km(2). Anthrax disease control relies mainly on livestock vaccination and proper carcass disposal, both of which require adequate surveillance. In many situations, including that of Kazakhstan, vaccine resources are limited, and understanding the geographic distribution of the organism, in tandem with current data on livestock population dynamics, can aid in properly allocating doses. While speculative, contemplating future changes in livestock distributions and B. anthracis spore promoting environments can be useful for establishing future surveillance priorities. This study may also have broader applications to global public health surveillance relating to other diseases in addition to B. anthracis.

  11. Allelic variation on murine chromosome 11 modifies host inflammatory responses and resistance to Bacillus anthracis.

    PubMed

    Terra, Jill K; France, Bryan; Cote, Christopher K; Jenkins, Amy; Bozue, Joel A; Welkos, Susan L; Bhargava, Ragini; Ho, Chi-Lee; Mehrabian, Margarete; Pan, Calvin; Lusis, Aldons J; Davis, Richard C; LeVine, Steven M; Bradley, Kenneth A

    2011-12-01

    Anthrax is a potentially fatal disease resulting from infection with Bacillus anthracis. The outcome of infection is influenced by pathogen-encoded virulence factors such as lethal toxin (LT), as well as by genetic variation within the host. To identify host genes controlling susceptibility to anthrax, a library of congenic mice consisting of strains with homozygous chromosomal segments from the LT-responsive CAST/Ei strain introgressed on a LT-resistant C57BL/6 (B6) background was screened for response to LT. Three congenic strains containing CAST/Ei regions of chromosome 11 were identified that displayed a rapid inflammatory response to LT similar to, but more severe than that driven by a LT-responsive allele of the inflammasome constituent NRLP1B. Importantly, increased response to LT in congenic mice correlated with greater resistance to infection by the Sterne strain of B. anthracis. The genomic region controlling the inflammatory response to LT was mapped to 66.36-74.67 Mb on chromosome 11, a region that encodes the LT-responsive CAST/Ei allele of Nlrp1b. However, known downstream effects of NLRP1B activation, including macrophage pyroptosis, cytokine release, and leukocyte infiltration could not fully explain the response to LT or the resistance to B. anthracis Sterne in congenic mice. Further, the exacerbated response in congenic mice is inherited in a recessive manner while the Nlrp1b-mediated response to LT is dominant. Finally, congenic mice displayed increased responsiveness in a model of sepsis compared with B6 mice. In total, these data suggest that allelic variation of one or more chromosome 11 genes in addition to Nlrp1b controls the severity of host response to multiple inflammatory stimuli and contributes to resistance to B. anthracis Sterne. Expression quantitative trait locus analysis revealed 25 genes within this region as high priority candidates for contributing to the host response to LT.

  12. Roles of the Bacillus anthracis Spore Protein ExsK in Exosporium Maturation and Germination

    DTIC Science & Technology

    2009-12-01

    Bacillus thuringiensis and the nonpathogenic bac- teria Bacillus megaterium and Bacillus odysseyi, have an addi- tional structure called the...exosporium. J. Bacte- riol. 185:3373–3378. 47. Vary, P. S. 1994. Prime time for Bacillus megaterium . Microbiology 140:1001– 1013. 48. Weaver, J., T. J...Microbiology. All Rights Reserved. Roles of the Bacillus anthracis Spore Protein ExsK in Exosporium Maturation and Germination Kari M. Severson,1

  13. Recombinant expression and purification of a tumor-targeted toxin in Bacillus anthracis

    SciTech Connect

    Bachran, Christopher; Abdelazim, Suzanne; Fattah, Rasem J.; Liu, Shihui; Leppla, Stephen H.

    2013-01-04

    Highlights: Black-Right-Pointing-Pointer Non-infectious and protease-deficient Bacillus anthracis protein expression system. Black-Right-Pointing-Pointer Successful expression and purification of a tumor-targeted fusion protein drug. Black-Right-Pointing-Pointer Very low endotoxin contamination of purified protein. Black-Right-Pointing-Pointer Efficient protein secretion simplifies purification. Black-Right-Pointing-Pointer Functional anti-tumor fusion protein purified. -- Abstract: Many recombinant therapeutic proteins are purified from Escherichia coli. While expression in E. coli is easily achieved, some disadvantages such as protein aggregation, formation of inclusion bodies, and contamination of purified proteins with the lipopolysaccharides arise. Lipopolysaccharides have to be removed to prevent inflammatory responses in patients. Use of the Gram-positive Bacillus anthracis as an expression host offers a solution to circumvent these problems. Using the multiple protease-deficient strain BH460, we expressed a fusion of the N-terminal 254 amino acids of anthrax lethal factor (LFn), the N-terminal 389 amino acids of diphtheria toxin (DT389) and human transforming growth factor alpha (TGF{alpha}). The resulting fusion protein was constitutively expressed and successfully secreted by B. anthracis into the culture supernatant. Purification was achieved by anion exchange chromatography and proteolytic cleavage removed LFn from the desired fusion protein (DT389 fused to TGF{alpha}). The fusion protein showed the intended specific cytotoxicity to epidermal growth factor receptor-expressing human head and neck cancer cells. Final analyses showed low levels of lipopolysaccharides, originating most likely from contamination during the purification process. Thus, the fusion to LFn for protein secretion and expression in B. anthracis BH460 provides an elegant tool to obtain high levels of lipopolysaccharide-free recombinant protein.

  14. A Bacillus anthracis Genome Sequence from the Sverdlovsk 1979 Autopsy Specimens

    PubMed Central

    Sahl, Jason W.; Pearson, Talima; Okinaka, Richard; Schupp, James M.; Gillece, John D.; Heaton, Hannah; Birdsell, Dawn; Hepp, Crystal; Fofanov, Viacheslav; Noseda, Ramón; Fasanella, Antonio; Hoffmaster, Alex; Wagner, David M.

    2016-01-01

    ABSTRACT Anthrax is a zoonotic disease that occurs naturally in wild and domestic animals but has been used by both state-sponsored programs and terrorists as a biological weapon. A Soviet industrial production facility in Sverdlovsk, USSR, proved deficient in 1979 when a plume of spores was accidentally released and resulted in one of the largest known human anthrax outbreaks. In order to understand this outbreak and others, we generated a Bacillus anthracis population genetic database based upon whole-genome analysis to identify all single-nucleotide polymorphisms (SNPs) across a reference genome. Phylogenetic analysis has defined three major clades (A, B, and C), B and C being relatively rare compared to A. The A clade has numerous subclades, including a major polytomy named the trans-Eurasian (TEA) group. The TEA radiation is a dominant evolutionary feature of B. anthracis, with many contemporary populations having resulted from a large spatial dispersal of spores from a single source. Two autopsy specimens from the Sverdlovsk outbreak were deep sequenced to produce draft B. anthracis genomes. This allowed the phylogenetic placement of the Sverdlovsk strain into a clade with two Asian live vaccine strains, including the Russian Tsiankovskii strain. The genome was examined for evidence of drug resistance manipulation or other genetic engineering, but none was found. The Soviet Sverdlovsk strain genome is consistent with a wild-type strain from Russia that had no evidence of genetic manipulation during its industrial production. This work provides insights into the world’s largest biological weapons program and provides an extensive B. anthracis phylogenetic reference. PMID:27677796

  15. Bacillus anthracis Edema Toxin Inhibits Staphylococcus aureus Enterotoxin B Effects in Vitro: A Potential Protein Therapeutic?

    DTIC Science & Technology

    2005-10-01

    involved in numerous human/animal diseases that include skin-linked maladies such as cutaneous anthrax, carbuncles, impetigo, and scalded-skin...contrast to Vibrio cholerae cholera toxin, which activates host adenylate cyclase, intracellular amounts of cAMP elicited by B. anthracis edema toxin rise...increase TNF- levels from PBMC. Such results are also similar to those previously reported for mouse macrophages with ele- vated cAMP due to cholera

  16. Inactivation of Bacillus Anthracis Spores in Drinking Water by Mixed Oxidant Solution

    DTIC Science & Technology

    2005-10-01

    calcium hypochlorite is used as a water disinfectant, a high free available chlorine concentration (FAC) is required to kill B. anthracis spores...Ground Chemistry ! FAC is the concentration of Cl2 + HOCl + OCl- (expressed as Cl2) and is the most chemically reactive and biocidal form of chlorine ...hypochlorite ion (OCl- + H+). ! OCl- is about 1/100 as effective a biocide as is HOCl, but still effective. ! HOCl at pH < 4 forms chlorine gas (Cl2

  17. Rapid Detection of Viable Bacillus anthracis Spores in Environmental Samples by Using Engineered Reporter Phages

    PubMed Central

    Sharp, Natasha J.; Molineux, Ian J.; Page, Martin A.

    2016-01-01

    Bacillus anthracis, the causative agent of anthrax, was utilized as a bioterrorism agent in 2001 when spores were distributed via the U.S. postal system. In responding to this event, the Federal Bureau of Investigation used traditional bacterial culture viability assays to ascertain the extent of contamination of the postal facilities within 24 to 48 h of environmental sample acquisition. Here, we describe a low-complexity, second-generation reporter phage assay for the rapid detection of viable B. anthracis spores in environmental samples. The assay uses an engineered B. anthracis reporter phage (Wβ::luxAB-2) which transduces bioluminescence to infected cells. To facilitate low-level environmental detection and maximize the signal response, expression of luxAB in an earlier version of the reporter phage (Wβ::luxAB-1) was optimized. These alterations prolonged signal kinetics, increased light output, and improved assay sensitivity. Using Wβ::luxAB-2, detection of B. anthracis spores was 1 CFU in 8 h from pure cultures and as low as 10 CFU/g in sterile soil but increased to 105 CFU/g in unprocessed soil due to an unstable signal and the presence of competing bacteria. Inclusion of semiselective medium, mediated by a phage-expressed antibiotic resistance gene, maintained signal stability and enabled the detection of 104 CFU/g in 6 h. The assay does not require spore extraction and relies on the phage infecting germinating cells directly in the soil sample. This reporter phage displays promise for the rapid detection of low levels of spores on clean surfaces and also in grossly contaminated environmental samples from complex matrices such as soils. PMID:26873316

  18. Bacillus anthracis Capsular Conjugates Elicit Chimpanzee Polyclonal Antibodies That Protect Mice from Pulmonary Anthrax.

    PubMed

    Chen, Zhaochun; Schneerson, Rachel; Lovchik, Julie A; Dai, Zhongdong; Kubler-Kielb, Joanna; Agulto, Liane; Leppla, Stephen H; Purcell, Robert H

    2015-08-01

    The immunogenicity of Bacillus anthracis capsule (poly-γ-D-glutamic acid [PGA]) conjugated to recombinant B. anthracis protective antigen (rPA) or to tetanus toxoid (TT) was evaluated in two anthrax-naive juvenile chimpanzees. In a previous study of these conjugates, highly protective monoclonal antibodies (MAbs) against PGA were generated. This study examines the polyclonal antibody response of the same animals. Preimmune antibodies to PGA with titers of >10(3) were detected in the chimpanzees. The maximal titer of anti-PGA was induced within 1 to 2 weeks following the 1st immunization, with no booster effects following the 2nd and 3rd immunizations. Thus, the anti-PGA response in the chimpanzees resembled a secondary immune response. Screening of sera from nine unimmunized chimpanzees and six humans revealed antibodies to PGA in all samples, with an average titer of 10(3). An anti-PA response was also observed following immunization with PGA-rPA conjugate, similar to that seen following immunization with rPA alone. However, in contrast to anti-PGA, preimmune anti-PA antibody titers and those following the 1st immunization were ≤300, with the antibodies peaking above 10(4) following the 2nd immunization. The polyclonal anti-PGA shared the MAb 11D epitope and, similar to the MAbs, exerted opsonophagocytic killing of B. anthracis. Most important, the PGA-TT-induced antibodies protected mice from a lethal challenge with virulent B. anthracis spores. Our data support the use of PGA conjugates, especially PGA-rPA targeting both toxin and capsule, as expanded-spectrum anthrax vaccines.

  19. Analysis of a Novel Spore Antigen in Bacillus anthracis That Contributes to Spore Opsonization

    DTIC Science & Technology

    2008-01-01

    primarily on production of antibodies against the protective antigen component of the anthrax toxins, which are secreted by the bacilli. It has been... production . A spore-associated protein was identified that was specific to the B. cereus group of bacteria and referred to as spore opsonization-associated...in the Ames strain of B. anthracis appeared to increase the phagocytic uptake of the spores in the presence of anti-spore antibodies , since, unlike

  20. Rapid Detection of Viable Bacillus anthracis Spores in Environmental Samples by Using Engineered Reporter Phages.

    PubMed

    Sharp, Natasha J; Molineux, Ian J; Page, Martin A; Schofield, David A

    2016-04-01

    Bacillus anthracis, the causative agent of anthrax, was utilized as a bioterrorism agent in 2001 when spores were distributed via the U.S. postal system. In responding to this event, the Federal Bureau of Investigation used traditional bacterial culture viability assays to ascertain the extent of contamination of the postal facilities within 24 to 48 h of environmental sample acquisition. Here, we describe a low-complexity, second-generation reporter phage assay for the rapid detection of viableB. anthracis spores in environmental samples. The assay uses an engineered B. anthracis reporter phage (Wβ::luxAB-2) which transduces bioluminescence to infected cells. To facilitate low-level environmental detection and maximize the signal response, expression of luxABin an earlier version of the reporter phage (Wβ::luxAB-1) was optimized. These alterations prolonged signal kinetics, increased light output, and improved assay sensitivity. Using Wβ::luxAB-2, detection of B. anthracis spores was 1 CFU in 8 h from pure cultures and as low as 10 CFU/g in sterile soil but increased to 10(5)CFU/g in unprocessed soil due to an unstable signal and the presence of competing bacteria. Inclusion of semiselective medium, mediated by a phage-expressed antibiotic resistance gene, maintained signal stability and enabled the detection of 10(4)CFU/g in 6 h. The assay does not require spore extraction and relies on the phage infecting germinating cells directly in the soil sample. This reporter phage displays promise for the rapid detection of low levels of spores on clean surfaces and also in grossly contaminated environmental samples from complex matrices such as soils.

  1. Impedance Measurements Could Accelerate Phage-Based Identification of Bacillus anthracis and Other Bacteria

    DTIC Science & Technology

    2016-09-01

    isolates. However, phage assays generally require that suspect colonies be sub- cultured onto a fresh agar plate to generate a dense lawn against...consume valuable time. Researchers have shown that temporal changes in the dielectric permittivity of bacterial micro- cultures differ for chemically or...to detect ɣ phage-induced stress in susceptible B. anthracis micro- cultures and thereby reduce both the time and biomass required to perform phage

  2. Sequence and Analysis of the DNA Encoding Protective Antigen of Bacillus anthracis

    DTIC Science & Technology

    1988-01-01

    fractionating the toxin J.A. (Eds.), Molecular Cloning and Gene Regulation in Bacilli. of Bacillus anthracis. J. Bacteriol. 83 (1962) 274-1280. Academic...Maniatis, T., Fritsch, E.F. and Sambrook, J.: Molecular Cloning . Friedlander, A.M.: Macrophages are sensitive to anthrax lethal A Laboratory Manual... Molecular cloning and the nucleotide sequence of region of Bacillus subtiis a-amylase gene cloned in pUB I10. the Mr 28000 crystal protein gene of

  3. Identification of a region of genetic variability among Bacillus anthracis strains and related species.

    PubMed Central

    Andersen, G L; Simchock, J M; Wilson, K H

    1996-01-01

    The identification of a region of sequence variability among individual isolates of Bacillus anthracis as well as the two closely related species, Bacillus cereus and Bacillus mycoides, has made a sequence-based approach for the rapid differentiation among members of this group possible. We have identified this region of sequence divergence by comparison of arbitrarily primed (AP)-PCR "fingerprints" generated by an M13 bacteriophage-derived primer and sequencing the respective forms of the only polymorphic fragment observed. The 1,480-bp fragment derived from genomic DNA of the Sterne strain of B. anthracis contained four consecutive repeats of CAATATCAACAA. The same fragment from the Vollum strain was identical except that two of these repeats were deleted. The Ames strain of B. anthracis differed from the Sterne strain by a single-nucleotide deletion. More than 150 nucleotide differences separated B. cereus and B. mycoides from B. anthracis in pairwise comparisons. The nucleotide sequence of the variable fragment from each species contained one complete open reading frame (ORF) (designated vrrA, for variable region with repetitive sequence), encoding a potential 30-kDa protein located between the carboxy terminus of an upstream ORF (designated orf1) and the amino terminus of a downstream ORF (designated lytB). The sequence variation was primarily in vrrA, which was glutamine- and proline-rich (30% of total) and contained repetitive regions. A large proportion of the nucleotide substitutions between species were synonymous. vrrA has 35% identity with the microfilarial sheath protein shp2 of the parasitic worm Litomosoides carinii. PMID:8550456

  4. Inactivation of Bacillus anthracis Spores by Liquid Biocides in the Presence of Food Residue▿

    PubMed Central

    Hilgren, J.; Swanson, K. M. J.; Diez-Gonzalez, F.; Cords, B.

    2007-01-01

    Biocide inactivation of Bacillus anthracis spores in the presence of food residues after a 10-min treatment time was investigated. Spores of nonvirulent Bacillus anthracis strains 7702, ANR-1, and 9131 were mixed with water, flour paste, whole milk, or egg yolk emulsion and dried onto stainless-steel carriers. The carriers were exposed to various concentrations of peroxyacetic acid, sodium hypochlorite (NaOCl), or hydrogen peroxide (H2O2) for 10 min at 10, 20, or 30°C, after which time the survivors were quantified. The relationship between peroxyacetic acid concentration, H2O2 concentration, and spore inactivation followed a sigmoid curve that was accurately described using a four-parameter logistic model. At 20°C, the minimum concentrations of peroxyacetic acid, H2O2, and NaOCl (as total available chlorine) predicted to inactivate 6 log10 CFU of B. anthracis spores with no food residue present were 1.05, 23.0, and 0.78%, respectively. At 10°C, sodium hypochlorite at 5% total available chlorine did not inactivate more than 4 log10 CFU. The presence of the food residues had only a minimal effect on peroxyacetic acid and H2O2 sporicidal efficacy, but the efficacy of sodium hypochlorite was markedly inhibited by whole-milk and egg yolk residues. Sodium hypochlorite at 5% total available chlorine provided no greater than a 2-log10 CFU reduction when spores were in the presence of egg yolk residue. This research provides new information regarding the usefulness of peroxygen biocides for B. anthracis spore inactivation when food residue is present. This work also provides guidance for adjusting decontamination procedures for food-soiled and cold surfaces. PMID:17720823

  5. Methionine sulfoxide reductase contributes to meeting dietary methionine requirements

    PubMed Central

    Zhao, Hang; Kim, Geumsoo; Levine, Rodney L.

    2012-01-01

    Methionine sulfoxide reductases are present in all aerobic organisms. They contribute to antioxidant defenses by reducing methionine sulfoxide in proteins back to methionine. However, the actual in vivo roles of these reductases are not well defined. Since methionine is an essential amino acid in mammals, we hypothesized that methionine sulfoxide reductases may provide a portion of the dietary methionine requirement by recycling methionine sulfoxide. We used a classical bioassay, the growth of weanling mice fed diets varying in methionine, and applied it to mice genetically engineered to alter the levels of methionine sulfoxide reductase A or B1. Mice of all genotypes were growth retarded when raised on chow containing 0.10% methionine instead of the standard 0.45% methionine. Retardation was significantly greater in knockout mice lacking both reductases. We conclude that the methionine sulfoxide reductases can provide methionine for growth in mice with limited intake of methionine, such as may occur in the wild. PMID:22521563

  6. Prevalence of Bacillus anthracis-Like Organisms and Bacteriophages in the Intestinal Tract of the Earthworm Eisenia fetida▿ †

    PubMed Central

    Schuch, R.; Pelzek, A. J.; Kan, S.; Fischetti, V. A.

    2010-01-01

    Stable infection of Bacillus anthracis laboratory strains with environmental bacteriophages confers survival phenotypes in soil and earthworm intestinal niches (R. Schuch and V. A. Fischetti, PLoS One 4:e6532, 2009). Here, the natural occurrence of two such B. anthracis-infective bacteriophages, Wip1 and Wip4, was examined in the intestines of Eisenia fetida earthworms as part of a 6-year longitudinal study at a Pennsylvania forest site. The Wip1 tectivirus was initially dominant before being supplanted by the Wip4 siphovirus, which was then dominant for the next 3 years. In a host range analysis of a wide-ranging group of Bacillus species and related organisms, Wip1 and Wip4 were both infective only toward B. anthracis and certain B. cereus strains. The natural host of Wip4 remained constant for 3 years and was a B. cereus strain that expressed a B. anthracis-like surface polysaccharide at septal positions on the cell surface. Next, a novel metagenomic approach was used to determine the extent to which such B. cereus- and B. anthracis-like strains are found in worms from two geographical locations. Three different enrichment strategies were used for metagenomic DNA isolation, based either on the ability of B. cereus sensu lato to form heat-resistant spores, the sensitivity of B. anthracis to the PlyG lysin, or the selective amplification of environmental phages cocultured with B. anthracis. Findings from this work indicate that B. cereus sensu lato and its phages are common inhabitants of earthworm intestines. PMID:20118353

  7. Prevalence of Bacillus anthracis-like organisms and bacteriophages in the intestinal tract of the earthworm Eisenia fetida.

    PubMed

    Schuch, R; Pelzek, A J; Kan, S; Fischetti, V A

    2010-04-01

    Stable infection of Bacillus anthracis laboratory strains with environmental bacteriophages confers survival phenotypes in soil and earthworm intestinal niches (R. Schuch and V. A. Fischetti, PLoS One 4:e6532, 2009). Here, the natural occurrence of two such B. anthracis-infective bacteriophages, Wip1 and Wip4, was examined in the intestines of Eisenia fetida earthworms as part of a 6-year longitudinal study at a Pennsylvania forest site. The Wip1 tectivirus was initially dominant before being supplanted by the Wip4 siphovirus, which was then dominant for the next 3 years. In a host range analysis of a wide-ranging group of Bacillus species and related organisms, Wip1 and Wip4 were both infective only toward B. anthracis and certain B. cereus strains. The natural host of Wip4 remained constant for 3 years and was a B. cereus strain that expressed a B. anthracis-like surface polysaccharide at septal positions on the cell surface. Next, a novel metagenomic approach was used to determine the extent to which such B. cereus- and B. anthracis-like strains are found in worms from two geographical locations. Three different enrichment strategies were used for metagenomic DNA isolation, based either on the ability of B. cereus sensu lato to form heat-resistant spores, the sensitivity of B. anthracis to the PlyG lysin, or the selective amplification of environmental phages cocultured with B. anthracis. Findings from this work indicate that B. cereus sensu lato and its phages are common inhabitants of earthworm intestines.

  8. Optimization of a sample processing protocol for recovery of Bacillus anthracis spores from soil

    USGS Publications Warehouse

    Silvestri, Erin E.; Feldhake, David; Griffin, Dale; Lisle, John T.; Nichols, Tonya L.; Shah, Sanjiv; Pemberton, A; Schaefer III, Frank W

    2016-01-01

    Following a release of Bacillus anthracis spores into the environment, there is a potential for lasting environmental contamination in soils. There is a need for detection protocols for B. anthracis in environmental matrices. However, identification of B. anthracis within a soil is a difficult task. Processing soil samples helps to remove debris, chemical components, and biological impurities that can interfere with microbiological detection. This study aimed to optimize a previously used indirect processing protocol, which included a series of washing and centrifugation steps. Optimization of the protocol included: identifying an ideal extraction diluent, variation in the number of wash steps, variation in the initial centrifugation speed, sonication and shaking mechanisms. The optimized protocol was demonstrated at two laboratories in order to evaluate the recovery of spores from loamy and sandy soils. The new protocol demonstrated an improved limit of detection for loamy and sandy soils over the non-optimized protocol with an approximate matrix limit of detection at 14 spores/g of soil. There were no significant differences overall between the two laboratories for either soil type, suggesting that the processing protocol will be robust enough to use at multiple laboratories while achieving comparable recoveries.

  9. Cloning, purification and crystallization of Bacillus anthracis class C acid phosphatase

    SciTech Connect

    Felts, Richard L.; Reilly, Thomas J.; Calcutt, Michael J.; Tanner, John J.

    2006-07-01

    Crystallization of a surface-localized acid phosphatase from Bacillus anthracis is reported. Flash annealing increased the high-resolution limit of usable data from 1.8 to 1.6 Å. Cloning, expression, purification and crystallization studies of a recombinant class C acid phosphatase from the Category A pathogen Bacillus anthracis are reported. Large diffraction-quality crystals were grown in the presence of HEPES and Jeffamine ED-2001 at pH 7.0. The crystals belong to space group P2{sub 1}2{sub 1}2{sub 1}, with unit-cell parameters a = 53.4, b = 90.1, c = 104.2 Å. The asymmetric unit is predicted to contain two protein molecules with a solvent content of 38%. Two native data sets were collected from the same crystal before and after flash-annealing. The first data set had a mosaicity of 1.6° and a high-resolution limit of 1.8 Å. After flash-annealing, the apparent mosaicity decreased to 0.9° and the high-resolution limit of usable data increased to 1.6 Å. This crystal form is currently being used to determine the structure of B. anthracis class C acid phosphatase with experimental phasing techniques.

  10. Requirements for the Development of Bacillus Anthracis Spore Reference Materials Used to Test Detection Systems

    PubMed Central

    Almeida, Jamie L.; Wang, Lili; Morrow, Jayne B.; Cole, Kenneth D.

    2006-01-01

    Bacillus anthracis spores have been used as biological weapons and the possibility of their further use requires surveillance systems that can accurately and reliably detect their presence in the environment. These systems must collect samples from a variety of matrices, process the samples, and detect the spores. The processing of the sample may include removal of inhibitors, concentration of the target, and extraction of the target in a form suitable for detection. Suitable reference materials will allow the testing of each of these steps to determine the sensitivity and specificity of the detection systems. The development of uniform and well-characterized reference materials will allow the comparison of different devices and technologies as well as assure the continued performance of detection systems. This paper discusses the special requirements of reference materials for Bacillus anthracis spores that could be used for testing detection systems. The detection of Bacillus anthracis spores is based on recognition of specific characteristics (markers) on either the spore surface or in the nucleic acids (DNA). We have reviewed the specific markers and their relevance to characterization of reference materials. We have also included the approach for the characterization of candidate reference materials that we are developing at the NIST laboratories. Additional applications of spore reference materials would include testing sporicidal treatments, techniques for sampling the environment, and remediation of spore-contaminated environments. PMID:27274929

  11. Storage Effects on Sample Integrity of Environmental Surface Sampling Specimens with Bacillus anthracis Spores.

    PubMed

    Perry, K Allison; O'Connell, Heather A; Rose, Laura J; Noble-Wang, Judith A; Arduino, Matthew J

    The effect of packaging, shipping temperatures and storage times on recovery of Bacillus anthracis. Sterne spores from swabs was investigated. Macrofoam swabs were pre-moistened, inoculated with Bacillus anthracis spores, and packaged in primary containment or secondary containment before storage at -15°C, 5°C, 21°C, or 35°C for 0-7 days. Swabs were processed according to validated Centers for Disease Control/Laboratory Response Network culture protocols, and the percent recovery relative to a reference sample (T0) was determined for each variable. No differences were observed in recovery between swabs held at -15° and 5°C, (p ≥ 0.23). These two temperatures provided significantly better recovery than swabs held at 21°C or 35°C (all 7 days pooled, p ≤ 0.04). The percent recovery at 5°C was not significantly different if processed on days 1, 2 or 4, but was significantly lower on day 7 (day 2 vs. 7, 5°C, 10(2), p=0.03). Secondary containment provided significantly better percent recovery than primary containment, regardless of storage time (5°C data, p ≤ 0.008). The integrity of environmental swab samples containing Bacillus anthracis spores shipped in secondary containment was maintained when stored at -15°C or 5°C and processed within 4 days to yield the optimum percent recovery of spores.

  12. Novel Role for the yceGH Tellurite Resistance Genes in the Pathogenesis of Bacillus anthracis

    PubMed Central

    Franks, Sarah E.; Ebrahimi, Celia; Hollands, Andrew; Okumura, Cheryl Y.; Aroian, Raffi V.; Nizet, Victor

    2014-01-01

    Bacillus anthracis, the causative agent of anthrax, relies on multiple virulence factors to subvert the host immune defense. Using Caenorhabditis elegans as an infection model, we screened approximately 5,000 transposon mutants of B. anthracis Sterne for decreased virulence. One of the attenuated mutants resulted in loss of expression of yceG and yceH, the last two genes in a six-gene cluster of tellurite resistance genes. We generated an analogous insertional mutant to confirm the phenotype and characterize the role of yceGH in resistance to host defenses. Loss of yceGH rendered the mutants more sensitive to tellurite toxicity as well as to host defenses such as reactive oxygen species and the cathelicidin family of antimicrobial peptides. Additionally, we see decreased survival in mammalian models of infection, including human whole blood and in mice. We identify a novel role for the yceGH genes in B. anthracis Sterne virulence and suggest that C. elegans is a useful infection model to study anthrax pathogenesis. PMID:24366250

  13. Potential role of autophagy in the bactericidal activity of human PMNs for Bacillus anthracis

    PubMed Central

    Ramachandran, Girish; Gade, Padmaja; Tsai, Pei; Lu, Wuyuan; Kalvakolanu, Dhananjaya V.; Rosen, Gerald M.; Cross, Alan S.

    2015-01-01

    Bacillus anthracis, the causative agent of anthrax, is acquired by mammalian hosts from the environment, as quiescent endospores. These endospores must germinate inside host cells, forming vegetative bacilli, before they can express the virulence factors that enable them to evade host defenses and disseminate throughout the body. While the role of macrophages and dendritic cells in this initial interaction has been established, the role of polymorphonuclear leukocytes (PMNs) has not been adequately defined. We discovered that while B. anthracis 34F2 Sterne endospores germinate poorly within non-activated human PMNs, these phagocytes exhibit rapid microbicidal activity toward the outgrown vegetative bacilli, independent of superoxide and nitric oxide. These findings suggest that a non-free radical pathway kills B. anthracis bacilli. We also find in PMNs an autophagic mechanism of bacterial killing based on the rapid induction of LC-3 conversion, beclin-1 expression, sequestosome 1 (SQSTM1) degradation and inhibition of bactericidal activity by the inhibitor, 3-methyladenine. These findings extend to PMNs an autophagic bactericidal mechanism previously described for other phagocytes. PMID:26424808

  14. Sample collection of virulent and non-virulent B. anthracis and Y. pestis for bioforensics analysis

    SciTech Connect

    Hong-geller, Elizabeth; Valdez, Yolanda E; Shou, Yulin; Yoshida, Thomas M; Marrone, Babetta L; Dunbar, John

    2009-01-01

    Validated sample collection methods are needed for recovery of microbial evidence in the event of accidental or intentional release of biological agents into the environment. To address this need, we evaluated the sample recovery efficiencies of two collection methods -- swabs and wipes -- for both non-virulent and virulent strains of B. anthracis and Y. pestis from four types of non-porous surfaces: two hydrophilic surfaces, stainless steel and glass, and two hydrophobic surfaces, vinyl and plastic. Sample recovery was quantified using Real-time qPCR to assay for intact DNA signatures. We found no consistent difference in collection efficiency between swabs or wipes. Furthermore, collection efficiency was more surface-dependent for virulent strains than non-virulent strains. For the two non-virulent strains, B. anthracis Sterne and Y. pestis A1122, collection efficiency was approximately 100% and 1 %, respectively, from all four surfaces. In contrast, recovery of B. anthracis Ames spores and Y. pestis C092 from vinyl and plastic was generally lower compared to collection from glass or stainless steel, suggesting that surface hydrophobicity may playa role in the strength of pathogen adhesion. The surface-dependent collection efficiencies observed with the virulent strains may arise from strain-specific expression of capsular material or other cell surface receptors that alter cell adhesion to specific surfaces. These findings contribute to validation of standard bioforensics procedures and emphasize the importance of specific strain and surface interactions in pathogen detection.

  15. Bacillus anthracis TIR Domain-Containing Protein Localises to Cellular Microtubule Structures and Induces Autophagy

    PubMed Central

    Carlsson, Emil; Thwaite, Joanne E.; Jenner, Dominic C.; Spear, Abigail M.; Flick-Smith, Helen; Atkins, Helen S.; Ding, Jeak Ling

    2016-01-01

    Toll-like receptors (TLRs) recognise invading pathogens and mediate downstream immune signalling via Toll/IL-1 receptor (TIR) domains. TIR domain proteins (Tdps) have been identified in multiple pathogenic bacteria and have recently been implicated as negative regulators of host innate immune activation. A Tdp has been identified in Bacillus anthracis, the causative agent of anthrax. Here we present the first study of this protein, designated BaTdp. Recombinantly expressed and purified BaTdp TIR domain interacted with several human TIR domains, including that of the key TLR adaptor MyD88, although BaTdp expression in cultured HEK293 cells had no effect on TLR4- or TLR2- mediated immune activation. During expression in mammalian cells, BaTdp localised to microtubular networks and caused an increase in lipidated cytosolic microtubule-associated protein 1A/1B-light chain 3 (LC3), indicative of autophagosome formation. In vivo intra-nasal infection experiments in mice showed that a BaTdp knockout strain colonised host tissue faster with higher bacterial load within 4 days post-infection compared to the wild type B. anthracis. Taken together, these findings indicate that BaTdp does not play an immune suppressive role, but rather, its absence increases virulence. BaTdp present in wild type B. anthracis plausibly interact with the infected host cell, which undergoes autophagy in self-defence. PMID:27391310

  16. Endospore surface properties of commonly used Bacillus anthracis surrogates vary in aqueous solution.

    PubMed

    White, Colin P; Popovici, Jonathan; Lytle, Darren A; Rice, Eugene W

    2014-08-01

    The hydrophobic character and electrophoretic mobility (EPM) of microorganisms are vital aspects of understanding their interactions with the environment. These properties are fundamental in fate-and-transport, physiological, and virulence studies, and thus integral in surrogate selection. Hydrophobic and electrostatic forces are significant contributors to particle and microorganism mobility in the environment. Herein, the surface properties of commonly used Bacillus anthracis surrogate endospores were tested under comparable conditions with respect to culture, endospore purification, buffer type and strength. Additionally, data is presented of endospores suspended in dechlorinated tap water to evaluate the surrogates in regard to a breach of water infrastructure security. The surface properties of B. anthracis were found to be the most hydrophobic and least electronegative among the six Bacillus species tested across buffer strength. The effect of EPM on hydrophobicity varies in a species-specific manner. This study demonstrates that surrogate surface properties differ and care must be taken when choosing the most suitable surrogate. Moreover, it is shown that Bacillus thuringensis best represents Bacillus anthracis-Sterne with respect to both EPM and hydrophobicity across all test buffers.

  17. Structural study and thermodynamic characterization of inhibitor binding to lumazine synthase from Bacillus anthracis

    SciTech Connect

    Morgunova, Ekaterina; Illarionov, Boris; Saller, Sabine; Popov, Aleksander; Sambaiah, Thota; Bacher, Adelbert; Cushman, Mark; Fischer, Markus; Ladenstein, Rudolf

    2010-09-01

    Crystallographic studies of lumazine synthase, the penultimate enzyme of the riboflavin-biosynthetic pathway in B. anthracis, provide a structural framework for the design of antibiotic inhibitors, together with calorimetric and kinetic investigations of inhibitor binding. The crystal structure of lumazine synthase from Bacillus anthracis was solved by molecular replacement and refined to R{sub cryst} = 23.7% (R{sub free} = 28.4%) at a resolution of 3.5 Å. The structure reveals the icosahedral symmetry of the enzyme and specific features of the active site that are unique in comparison with previously determined orthologues. The application of isothermal titration calorimetry in combination with enzyme kinetics showed that three designed pyrimidine derivatives bind to lumazine synthase with micromolar dissociation constants and competitively inhibit the catalytic reaction. Structure-based modelling suggested the binding modes of the inhibitors in the active site and allowed an estimation of the possible contacts formed upon binding. The results provide a structural framework for the design of antibiotics active against B. anthracis.

  18. Ca-asp bound X-ray structure and inhibition of Bacillus anthracis dihydroorotase (DHOase).

    PubMed

    Rice, Amy J; Lei, Hao; Santarsiero, Bernard D; Lee, Hyun; Johnson, Michael E

    2016-10-01

    Dihydroorotase (DHOase) is the third enzyme in the de novo pyrimidine synthesis pathway and is responsible for the reversible cyclization of carbamyl-aspartate (Ca-asp) to dihydroorotate (DHO). DHOase is further divided into two classes based on several structural characteristics, one of which is the length of the flexible catalytic loop that interacts with the substrate, Ca-asp, regulating the enzyme activity. Here, we present the crystal structure of Class I Bacillus anthracis DHOase with Ca-asp in the active site, which shows the peptide backbone of glycine in the shorter loop forming the necessary hydrogen bonds with the substrate, in place of the two threonines found in Class II DHOases. Despite the differences in the catalytic loop, the structure confirms that the key interactions between the substrate and active site residues are similar between Class I and Class II DHOase enzymes, which we further validated by mutagenesis studies. B. anthracis DHOase is also a potential antibacterial drug target. In order to identify prospective inhibitors, we performed high-throughput screening against several libraries using a colorimetric enzymatic assay and an orthogonal fluorescence thermal binding assay. Surface plasmon resonance was used for determining binding affinity (KD) and competition analysis with Ca-asp. Our results highlight that the primary difference between Class I and Class II DHOase is the catalytic loop. We also identify several compounds that can potentially be further optimized as potential B. anthracis inhibitors.

  19. Genetic diversity of Bacillus anthracis in Europe: genotyping methods in forensic and epidemiologic investigations.

    PubMed

    Derzelle, Sylviane; Thierry, Simon

    2013-09-01

    Bacillus anthracis, the etiological agent of anthrax, a zoonosis relatively common throughout the world, can be used as an agent of bioterrorism. In naturally occurring outbreaks and in criminal release of this pathogen, a fast and accurate diagnosis is crucial to an effective response. Microbiological forensics and epidemiologic investigations increasingly rely on molecular markers, such as polymorphisms in DNA sequence, to obtain reliable information regarding the identification or source of a suspicious strain. Over the past decade, significant research efforts have been undertaken to develop genotyping methods with increased power to differentiate B. anthracis strains. A growing number of DNA signatures have been identified and used to survey B. anthracis diversity in nature, leading to rapid advances in our understanding of the global population of this pathogen. This article provides an overview of the different phylogenetic subgroups distributed across the world, with a particular focus on Europe. Updated information on the anthrax situation in Europe is reported. A brief description of some of the work in progress in the work package 5.1 of the AniBioThreat project is also presented, including (1) the development of a robust typing tool based on a suspension array technology and multiplexed single nucleotide polymorphisms scoring and (2) the typing of a collection of DNA from European isolates exchanged between the partners of the project. The know-how acquired will contribute to improving the EU's ability to react rapidly when the identity and real origin of a strain need to be established.

  20. Structural Elucidation of Chalcone Reductase and Implications for Deoxychalcone Biosynthesis

    PubMed Central

    Bomati, Erin K.; Austin, Michael B.; Bowman, Marianne E.; Dixon, Richard A.; Noel, Joseph P.

    2010-01-01

    4,2′,4′,6′-tetrahydroxychalcone (chalcone) and 4,2′,4′-trihydroxychalcone (deoxychalcone) serve as precursors of ecologically important flavonoids and isoflavonoids. Deoxychalcone formation depends on chalcone synthase and chalcone reductase; however, the identity of the chalcone reductase substrate out of the possible substrates formed during the multistep reaction catalyzed by chalcone synthase remains experimentally elusive. We report here the three-dimensional structure of alfalfa chalcone reductase bound to the NADP+ cofactor and propose the identity and binding mode of its substrate, namely the non-aromatized coumaryl-trione intermediate of the chalcone synthase-catalyzed cyclization of the fully extended coumaryl-tetraketide thioester intermediate. In the absence of a ternary complex, the quality of the refined NADP+-bound chalcone reductase structure serves as a template for computer-assisted docking to evaluate the likelihood of possible substrates. Interestingly, chalcone reductase adopts the three-dimensional structure of the aldo/keto reductase superfamily. The aldo/keto reductase fold is structurally distinct from all known ketoreductases of fatty acid biosynthesis, which instead belong to the short-chain dehydrogenase/reductase superfamily. The results presented here provide structural support for convergent functional evolution of these two ketoreductases that share similar roles in the biosynthesis of fatty acids/polyketides. In addition, the chalcone reductase structure represents the first protein structure of a member of the aldo/ketoreductase 4 family. Therefore, the chalcone reductase structure serves as a template for the homology modeling of other aldo/ketoreductase 4 family members, including the reductase involved in morphine biosynthesis, namely codeinone reductase. PMID:15970585

  1. Limited proteolysis of the nitrate reductase from spinach leaves.

    PubMed

    Kubo, Y; Ogura, N; Nakagawa, H

    1988-12-25

    The functional structure of assimilatory NADH-nitrate reductase from spinach leaves was studied by limited proteolysis experiments. After incubation of purified nitrate reductase with trypsin, two stable products of 59 and 45 kDa were observed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The fragment of 45 kDa was purified by Blue Sepharose chromatography. NADH-ferricyanide reductase and NADH-cytochrome c reductase activities were associated with this 45-kDa fragment which contains FAD, heme, and NADH binding fragment. After incubation of purified nitrate reductase with Staphylococcus aureus V8 protease, two major peaks were observed by high performance liquid chromatography size exclusion gel filtration. FMNH2-nitrate reductase and reduced methyl viologen-nitrate reductase activities were associated with the first peak of 170 kDa which consists of two noncovalently associated (75-90-kDa) fragments. NADH-ferricyanide reductase activity, however, was associated with the second peak which consisted of FAD and NADH binding sites. Incubation of the 45-kDa fragment with S. aureus V8 protease produced two major fragments of 28 and 14 kDa which contained FAD and heme, respectively. These results indicate that the molybdenum, heme, and FAD components of spinach nitrate reductase are contained in distinct domains which are covalently linked by exposed hinge regions. The molybdenum domain appears to be important in the maintenance of subunit interactions in the enzyme complex.

  2. Bacillus anthracis-Like Bacteria and Other B. cereus Group Members in a Microbial Community Within the International Space Station: A Challenge for Rapid and Easy Molecular Detection of Virulent B. anthracis

    PubMed Central

    van Tongeren, Sandra P.; Roest, Hendrik I. J.; Degener, John E.; Harmsen, Hermie J. M.

    2014-01-01

    For some microbial species, such as Bacillus anthracis, the etiologic agent of the disease anthrax, correct detection and identification by molecular methods can be problematic. The detection of virulent B. anthracis is challenging due to multiple virulence markers that need to be present in order for B. anthracis to be virulent and its close relationship to Bacillus cereus and other members of the B. cereus group. This is especially the case in environments where build-up of Bacillus spores can occur and several representatives of the B. cereus group may be present, which increases the chance for false-positives. In this study we show the presence of B. anthracis-like bacteria and other members of the B. cereus group in a microbial community within the human environment of the International Space Station and their preliminary identification by using conventional culturing as well as molecular techniques including 16S rDNA sequencing, PCR and real-time PCR. Our study shows that when monitoring the microbial hygiene in a given human environment, health risk assessment is troublesome in the case of virulent B. anthracis, especially if this should be done with rapid, easy to apply and on-site molecular methods. PMID:24945323

  3. Bacillus anthracis-like bacteria and other B. cereus group members in a microbial community within the International Space Station: a challenge for rapid and easy molecular detection of virulent B. anthracis.

    PubMed

    van Tongeren, Sandra P; Roest, Hendrik I J; Degener, John E; Harmsen, Hermie J M

    2014-01-01

    For some microbial species, such as Bacillus anthracis, the etiologic agent of the disease anthrax, correct detection and identification by molecular methods can be problematic. The detection of virulent B. anthracis is challenging due to multiple virulence markers that need to be present in order for B. anthracis to be virulent and its close relationship to Bacillus cereus and other members of the B. cereus group. This is especially the case in environments where build-up of Bacillus spores can occur and several representatives of the B. cereus group may be present, which increases the chance for false-positives. In this study we show the presence of B. anthracis-like bacteria and other members of the B. cereus group in a microbial community within the human environment of the International Space Station and their preliminary identification by using conventional culturing as well as molecular techniques including 16S rDNA sequencing, PCR and real-time PCR. Our study shows that when monitoring the microbial hygiene in a given human environment, health risk assessment is troublesome in the case of virulent B. anthracis, especially if this should be done with rapid, easy to apply and on-site molecular methods.

  4. Developing an integrated proteo-genomic approach for the characterisation of biomarkers for the identification of Bacillus anthracis.

    PubMed

    Misra, Raju V; Ahmod, Nadia Z; Parker, Robert; Fang, Min; Shah, Haroun; Gharbia, Saheer

    2012-02-01

    Bacillus anthracis is the causative agent of anthrax, an acute and often fatal disease in humans. Due to the high genomic relatedness within the Bacillus cereus group of species it is a challenge to identify B. anthracis consistently. Alternative strategies such as proteomics coupled with mass spectrometry (MS) provide a powerful approach for biomarker discovery. However, validating and evaluating these markers, particularly for genetically homogeneous species such as B. anthracis are challenging. The objective of this study is to develop a robust biomarker discovery and validation pipeline, using proteomic methodology combined with in silico and molecular approaches, to determine a biomarker list, using B. anthracis as a model. In this exploratory study we profiled the proteome of B. anthracis and genetically related species using GeLC-Liquid Chromatography MS/MS (GeLC-LC MS/MS), identifying peptides that could be used to detect B. anthracis. Peptides were filtered to remove low quality identifications. Using comparative bioinformatic approaches, matching and searching against genomic sequence data a shortlist of peptide biomarkers was determined and validated using DNA sequencing, against a panel of closely related strains, to determine marker specificity. Further validation was performed using MS quantitation methods to assess sensitivity and specificity. A biomarker discovery pipeline was successfully developed in this study, comprising four distinct stages: proteome profiling, comparative bioinformatic validation, DNA sequencing and MS validation. Using the pipeline, 5379 peptides specific for Bacillus species and 36 peptides specific for B. anthracis were identified and validated. The 36 peptides, representing 30 proteins were derived from over 15 different clusters of orthologous group categories, including proteins involved in transcription, energy production/conservation as well as multifunctional proteins. We demonstrated that the peptide biomarkers

  5. Utilization of the rpoB Gene as a Specific Chromosomal Marker for Real-Time PCR Detection of Bacillus anthracis

    PubMed Central

    Qi, Yuan; Patra, Guy; Liang, Xudong; Williams, Leanne E.; Rose, Sharon; Redkar, Rajendra J.; DelVecchio, Vito G.

    2001-01-01

    The potential use of Bacillus anthracis as a weapon of mass destruction poses a threat to humans, domesticated animals, and wildlife and necessitates the need for a rapid and highly specific detection assay. We have developed a real-time PCR-based assay for the specific detection of B. anthracis by taking advantage of the unique nucleotide sequence of the B. anthracis rpoB gene. Variable region 1 of the rpoB gene was sequenced from 36 Bacillus strains, including 16 B. anthracis strains and 20 other related bacilli, and four nucleotides specific for B. anthracis were identified. PCR primers were selected so that two B. anthracis-specific nucleotides were at their 3′ ends, whereas the remaining bases were specific to the probe region. This format permitted the PCR reactions to be performed on a LightCycler via fluorescence resonance energy transfer (FRET). The assay was found to be specific for 144 B. anthracis strains from different geographical locations and did not cross-react with other related bacilli (175 strains), with the exception of one strain. The PCR assay can be performed on isolated DNA as well as crude vegetative cell lysates in less than 1 h. Therefore, the rpoB-FRET assay could be used as a new chromosomal marker for rapid detection of B. anthracis. PMID:11472954

  6. Draft Genome Sequence of the Nonpathogenic, Thermotolerant, and Exopolysaccharide-Producing Bacillus anthracis Strain PFAB2 from Panifala Hot Water Spring in West Bengal, India

    PubMed Central

    Banerjee, Aparna; Halder, Urmi; Chaudhry, Vasvi; Varshney, Rajeev K.; Mantri, Shrikant

    2016-01-01

    Bacillus anthracis is the causative agent of fatal anthrax in both animals and humans. It is prevalently pathogenic. Here, we present a Bacillus anthracis PFAB2 strain from a relatively unexplored Panifala hot water spring in West Bengal, India. It is nonpathogenic, exopolysaccharide producing, and thermotolerant in nature. PMID:28007848

  7. Draft Genome Sequence of the Nonpathogenic, Thermotolerant, and Exopolysaccharide-Producing Bacillus anthracis Strain PFAB2 from Panifala Hot Water Spring in West Bengal, India.

    PubMed

    Banerjee, Aparna; Halder, Urmi; Chaudhry, Vasvi; Varshney, Rajeev K; Mantri, Shrikant; Bandopadhyay, Rajib

    2016-12-22

    Bacillus anthracis is the causative agent of fatal anthrax in both animals and humans. It is prevalently pathogenic. Here, we present a Bacillus anthracis PFAB2 strain from a relatively unexplored Panifala hot water spring in West Bengal, India. It is nonpathogenic, exopolysaccharide producing, and thermotolerant in nature.

  8. BslA, the S-layer adhesin of B. anthracis, is a virulence factor for anthrax pathogenesis.

    PubMed

    Kern, Justin; Schneewind, Olaf

    2010-01-01

    Microbial pathogens use adhesive surface proteins to bind to and interact with host tissues, events that are universal for the pathogenesis of infectious diseases. A surface adhesin of Bacillus anthracis, the causative agent of anthrax, required to mediate these steps has not been discovered. Previous work identified BslA, an S-layer protein, to be necessary and sufficient for adhesion of the anthrax vaccine strain, Bacillus anthracis Sterne, to host cells. Here we asked whether encapsulated bacilli require BslA for anthrax pathogenesis in guinea pigs. Compared with the highly virulent parent strain B. anthracis Ames, bslA mutants displayed a dramatic increase in the lethal dose and in mean time-to-death. Whereas all tissues of animals infected with B. anthracis Ames contained high numbers of bacilli, only few vegetative forms could be recovered from internal organs of animals infected with the bslA mutant. Surface display of BslA occurred at the poles of encapsulated bacilli and enabled the binding of vegetative forms to host cells. Together these results suggest that BslA functions as the surface adhesin of the anthrax pathogen B. anthracis strain Ames.

  9. Bacillus cereus Biovar Anthracis Causing Anthrax in Sub-Saharan Africa—Chromosomal Monophyly and Broad Geographic Distribution

    PubMed Central

    Mabon, Philip; Zimmermann, Fee; Lankester, Felix; Peller, Tianna; Feistner, Anna; Todd, Angelique; Herbinger, Ilka; de Nys, Hélène M.; Muyembe-Tamfun, Jean-Jacques; Karhemere, Stomy; Wittig, Roman M.; Couacy-Hymann, Emmanuel; Grunow, Roland; Calvignac-Spencer, Sébastien; Corbett, Cindi R.; Klee, Silke R.; Leendertz, Fabian H.

    2016-01-01

    Through full genome analyses of four atypical Bacillus cereus isolates, designated B. cereus biovar anthracis, we describe a distinct clade within the B. cereus group that presents with anthrax-like disease, carrying virulence plasmids similar to those of classic Bacillus anthracis. We have isolated members of this clade from different mammals (wild chimpanzees, gorillas, an elephant and goats) in West and Central Africa (Côte d’Ivoire, Cameroon, Central African Republic and Democratic Republic of Congo). The isolates shared several phenotypic features of both B. anthracis and B. cereus, but differed amongst each other in motility and their resistance or sensitivity to penicillin. They all possessed the same mutation in the regulator gene plcR, different from the one found in B. anthracis, and in addition, carry genes which enable them to produce a second capsule composed of hyaluronic acid. Our findings show the existence of a discrete clade of the B. cereus group capable of causing anthrax-like disease, found in areas of high biodiversity, which are possibly also the origin of the worldwide distributed B. anthracis. Establishing the impact of these pathogenic bacteria on threatened wildlife species will require systematic investigation. Furthermore, the consumption of wildlife found dead by the local population and presence in a domestic animal reveal potential sources of exposure to humans. PMID:27607836

  10. Bacillus anthracis Virulence in Guinea Pigs Vaccinated with Anthrax Vaccine Adsorbed Is Linked to Plasmid Quantities and Clonality

    PubMed Central

    Coker, Pamala R.; Smith, Kimothy L.; Fellows, Patricia F.; Rybachuck, Galena; Kousoulas, Konstantin G.; Hugh-Jones, Martin E.

    2003-01-01

    Bacillus anthracis is a bacterial pathogen of great importance, both historically and in the present. This study presents data collected from several investigations and indicates that B. anthracis virulence is associated with the clonality and virulence of plasmids pXO1 and pXO2. Guinea pigs vaccinated with Anthrax Vaccine Adsorbed were challenged with 20 B. anthracis isolates representative of worldwide genetic diversity. These same isolates were characterized with respect to plasmid copy number by using a novel method of quantitative PCR developed for rapid and efficient detection of B. anthracis from environmental samples. We found that the copy numbers for both pXO1 and pXO2 differed from those in previously published reports. By combining the data on survival, plasmid copy numbers, and clonality, we developed a model predicting virulence. This model was validated by using a randomly chosen set of 12 additional B. anthracis isolates. Results from this study will be helpful in future efforts to elucidate the basis for variation in the virulence of this important pathogen. PMID:12624053

  11. Cross-contamination of clinical specimens with Bacillus anthracis during a laboratory proficiency test--Idaho, 2006.

    PubMed

    2008-09-12

    On July 18, 2006, the Utah Department of Health notified epidemiologists at the Idaho Department of Health and Welfare that Bacillus anthracis, the causative agent for anthrax, had been isolated from a patient. On the same day, the Idaho epidemiologists were notified by the Idaho Bureau of Laboratories of a specimen from a second patient received for anthrax testing. The two reports resulted briefly in alerts to the Federal Bureau of Investigation (FBI) and precautionary treatment of one of the patients for anthrax. Subsequent investigation revealed that, during July 2006, the Idaho Bureau of Laboratories had been conducting a sentinel laboratory proficiency testing exercise among Idaho's hospital laboratories. The exercise included specimens with the Sterne strain of B. anthracis, a nonvirulent strain. Subsequent laboratory testing of the two patient isolates detected the Sterne strain of B. anthracis; neither patient had signs or symptoms consistent with B. anthracis infection. Further investigation revealed that the Idaho hospital laboratories that tested the two specimens had been conducting the laboratory proficiency testing exercise simultaneously, but the Idaho epidemiologists were not aware of the exercise. The two specimens had become cross-contaminated with B. anthracis in the laboratories. The findings in this report underscore the need to follow proper laboratory practices to minimize cross-contamination. In addition, to guard against false reports of anthrax, public health epidemiologists who monitor reportable diseases should be notified of upcoming proficiency testing of high-priority bioterrorism agents.

  12. N-Acetylglucosamine Deacetylases Modulate the Anchoring of the Gamma-Glutamyl Capsule to the Cell Wall of Bacillus anthracis

    PubMed Central

    Candela, Thomas; Balomenou, Stavroula; Aucher, Willy; Bouriotis, Vassilis; Simore, Jean-Pierre; Fouet, Agnes

    2014-01-01

    Bacillus anthracis has a complex cell wall structure composed of a peptidoglycan (PG) layer to which major structures are anchored such as a neutral polysaccharide, an S-layer, and a poly-γ-D-glutamate (PDGA) capsule. Many of these structures have central roles in the biology of B. anthracis, particularly, in virulence. However, little attention has been devoted to structurally study the PG and how it is modified in the presence of these secondary cell wall components. We present here the fine structure of the PG of the encapsulated RPG1 strain harboring both pXO1 and pXO2 virulence plasmids. We show that B. anthracis has a high degree of cross-linking and its GlcNAc residues are highly modified by N-deacetylation. The PG composition is not dependent on the presence of either LPXTG proteins or the capsule. Using NMR analysis of the PG-PDGA complex, we provide evidence for the anchoring of the PDGA to the glucosamine residues. We show that anchoring of the PDGA capsule is impaired in two PG N-deacetylase mutants, Ba1961 and Ba3679. Thus, these multiple N-deactylase activities would constitute excellent drug targets in B. anthracis by simultaneously affecting its resistance to lysozyme and to phagocytosis impairing B. anthracis survival in the host. PMID:24833281

  13. A New Generation Microarray for the Simultaneous Detection and Identification of Yersinia pestis and Bacillus anthracis in Food

    PubMed Central

    Goji, Noriko; MacMillan, Trevor; Amoako, Kingsley Kwaku

    2012-01-01

    The use of microarrays as a multiple analytic system has generated increased interest and provided a powerful analytical tool for the simultaneous detection of pathogens in a single experiment. A wide array of applications for this technology has been reported. A low density oligonucleotide microarray was generated from the genetic sequences of Y. pestis and B. anthracis and used to fabricate a microarray chip. The new generation chip, consisting of 2,240 spots in 4 quadrants with the capability of stripping/rehybridization, was designated as “Y-PESTIS/B-ANTHRACIS 4x2K Array.” The chip was tested for specificity using DNA from a panel of bacteria that may be potentially present in food. In all, 37 unique Y. pestis-specific and 83 B. anthracis-specific probes were identified. The microarray assay distinguished Y. pestis and B. anthracis from the other bacterial species tested and correctly identified the Y. pestis-specific oligonucleotide probes using DNA extracted from experimentally inoculated milk samples. Using a whole genome amplification method, the assay was able to detect as low as 1 ng genomic DNA as the start sample. The results suggest that oligonucleotide microarray can specifically detect and identify Y. pestis and B. anthracis and may be a potentially useful diagnostic tool for detecting and confirming the organisms in food during a bioterrorism event. PMID:23125935

  14. Redefining the Australian Anthrax Belt: Modeling the Ecological Niche and Predicting the Geographic Distribution of Bacillus anthracis.

    PubMed

    Barro, Alassane S; Fegan, Mark; Moloney, Barbara; Porter, Kelly; Muller, Janine; Warner, Simone; Blackburn, Jason K

    2016-06-01

    The ecology and distribution of B. anthracis in Australia is not well understood, despite the continued occurrence of anthrax outbreaks in the eastern states of the country. Efforts to estimate the spatial extent of the risk of disease have been limited to a qualitative definition of an anthrax belt extending from southeast Queensland through the centre of New South Wales and into northern Victoria. This definition of the anthrax belt does not consider the role of environmental conditions in the distribution of B. anthracis. Here, we used the genetic algorithm for rule-set prediction model system (GARP), historical anthrax outbreaks and environmental data to model the ecological niche of B. anthracis and predict its potential geographic distribution in Australia. Our models reveal the niche of B. anthracis in Australia is characterized by a narrow range of ecological conditions concentrated in two disjunct corridors. The most dominant corridor, used to redefine a new anthrax belt, parallels the Eastern Highlands and runs from north Victoria to central east Queensland through the centre of New South Wales. This study has redefined the anthrax belt in eastern Australia and provides insights about the ecological factors that limit the distribution of B. anthracis at the continental scale for Australia. The geographic distributions identified can help inform anthrax surveillance strategies by public and veterinary health agencies.

  15. Development of a Rapid and Sensitive Immunoassay for Detection and Subsequent Recovery of Bacillus anthracis Spores in Environmental Samples

    PubMed Central

    Hang, Jun; Sundaram, Appavu K.; Zhu, Peixuan; Shelton, Daniel R.; Karns, Jeffrey S.; Martin, Phyllis A W.; Li, Shuhong; Amstutz, Platte; Tang, Cha-Mei

    2008-01-01

    Bacillusanthracis is considered a major threat as an agent of bioterrorism. B. anthracis spores are readily dispersed as aerosols, are very persistent, and are resistant to normal disinfection treatments. Immunoassays have been developed to rapidly detect B. anthracis spores at high concentrations. However, detection of B. anthracis spores at lower concentrations is problematic due to the fact that closely related Bacillus species (e.g., B. thuringiensis) can cross react with anti-B. anthracis antibodies, resulting in false positive detections. Subsequent polymerase chain reaction (PCR) analysis is required to differentiate virulent strains. We report here on a protocol for the rapid, sensitive detection of B. anthracis spore using the Integrating Waveguide Biosensor followed by a method for the rapid release and germination of immunocaptured spores. A detection limit of ca. 103 spores was achieved by incubating spores simultaneously with capture and detection antibodies (‘liquid-phase” assay) prior to capture on capillary tubes/waveguides. Subsequent incubation with BHI broth directly in capillary tubes allowed for rapid germination, outgrowth, and release of spores, resulting in vegetative cells for PCR analysis. PMID:18395279

  16. A New Generation Microarray for the Simultaneous Detection and Identification of Yersinia pestis and Bacillus anthracis in Food.

    PubMed

    Goji, Noriko; Macmillan, Trevor; Amoako, Kingsley Kwaku

    2012-01-01

    The use of microarrays as a multiple analytic system has generated increased interest and provided a powerful analytical tool for the simultaneous detection of pathogens in a single experiment. A wide array of applications for this technology has been reported. A low density oligonucleotide microarray was generated from the genetic sequences of Y. pestis and B. anthracis and used to fabricate a microarray chip. The new generation chip, consisting of 2,240 spots in 4 quadrants with the capability of stripping/rehybridization, was designated as "Y-PESTIS/B-ANTHRACIS 4x2K Array." The chip was tested for specificity using DNA from a panel of bacteria that may be potentially present in food. In all, 37 unique Y. pestis-specific and 83 B. anthracis-specific probes were identified. The microarray assay distinguished Y. pestis and B. anthracis from the other bacterial species tested and correctly identified the Y. pestis-specific oligonucleotide probes using DNA extracted from experimentally inoculated milk samples. Using a whole genome amplification method, the assay was able to detect as low as 1 ng genomic DNA as the start sample. The results suggest that oligonucleotide microarray can specifically detect and identify Y. pestis and B. anthracis and may be a potentially useful diagnostic tool for detecting and confirming the organisms in food during a bioterrorism event.

  17. Redefining the Australian Anthrax Belt: Modeling the Ecological Niche and Predicting the Geographic Distribution of Bacillus anthracis

    PubMed Central

    Barro, Alassane S.; Fegan, Mark; Moloney, Barbara; Porter, Kelly; Muller, Janine; Warner, Simone; Blackburn, Jason K.

    2016-01-01

    The ecology and distribution of B. anthracis in Australia is not well understood, despite the continued occurrence of anthrax outbreaks in the eastern states of the country. Efforts to estimate the spatial extent of the risk of disease have been limited to a qualitative definition of an anthrax belt extending from southeast Queensland through the centre of New South Wales and into northern Victoria. This definition of the anthrax belt does not consider the role of environmental conditions in the distribution of B. anthracis. Here, we used the genetic algorithm for rule-set prediction model system (GARP), historical anthrax outbreaks and environmental data to model the ecological niche of B. anthracis and predict its potential geographic distribution in Australia. Our models reveal the niche of B. anthracis in Australia is characterized by a narrow range of ecological conditions concentrated in two disjunct corridors. The most dominant corridor, used to redefine a new anthrax belt, parallels the Eastern Highlands and runs from north Victoria to central east Queensland through the centre of New South Wales. This study has redefined the anthrax belt in eastern Australia and provides insights about the ecological factors that limit the distribution of B. anthracis at the continental scale for Australia. The geographic distributions identified can help inform anthrax surveillance strategies by public and veterinary health agencies. PMID:27280981

  18. Rapid detection of Bacillus anthracis spores using a super-paramagnetic lateral-flow immunological detection system.

    PubMed

    Wang, Dian-Bing; Tian, Bo; Zhang, Zhi-Ping; Deng, Jiao-Yu; Cui, Zong-Qiang; Yang, Rui-Fu; Wang, Xu-Ying; Wei, Hong-Ping; Zhang, Xian-En

    2013-04-15

    There is an urgent need for convenient, sensitive, and specific methods to detect the spores of Bacillus anthracis, the causative agent of anthrax, because of the bioterrorism threat posed by this bacterium. In this study, we firstly develop a super-paramagnetic lateral-flow immunological detection system for B. anthracis spores. This system involves the use of a portable magnetic assay reader, super-paramagnetic iron oxide particles, lateral-flow strips and two different monoclonal antibodies directed against B. anthracis spores. This detection system specifically recognises as few as 400 pure B. anthracis spores in 30 min. This system has a linear range of 4×10³-10⁶ CFU ml⁻¹ and reproducible detection limits of 200 spores mg⁻¹ milk powder and 130 spores mg⁻¹ soil for simulated samples. In addition, this approach shows no obvious cross-reaction with other related Bacillus spores, even at high concentrations, and has no significant dependence on the duration of the storage of the immunological strips. Therefore, this super-paramagnetic lateral-flow immunological detection system is a promising tool for the rapid and sensitive detection of Bacillus anthracis spores under field conditions.

  19. Late-Exponential Gene Expression in codY-Deficient Bacillus anthracis in a Host-Like Environment.

    PubMed

    Kim, Se Kye; Jung, Kyoung Hwa; Yoon, Sung Nyo; Kim, Yun Ki; Chai, Young Gyu

    2016-11-01

    CodY is a pleiotropic regulator commonly found in Gram-positive bacteria and regulates various biological processes during the stringent response in a nutrient-limiting environment. CodY also participates in virulence factor expression in many low G+C Gram-positive pathogens, as observed in Bacillus anthracis. However, the mechanism by which B. anthracis CodY regulates metabolism and virulence factors in response to environmental changes is unclear. Here, we attempted to identify the link between CodY and B. anthracis regulation with codY-deficient and codY-overexpressing mutants using high-throughput transcriptional analysis. Growth pattern analyses of codY mutants in both rich and minimal media showed defects in early cell proliferation, with opposite patterns in the early stationary phase: CodY overexpression prolonged bacterial growth, whereas deletion inhibited growth. RNA sequencing of codY-deficient B. anthracis showed both positive and negative changes in the gene expression of proteases and virulence factors as well as genes related to stringent response-related metabolism and biosynthetic processing. We also found that changes in codY expression could alter virulence gene expression of B. anthracis, suggesting modes of regulation in its virulence in a CodY concentration-dependent manner. Collectively, we conclude from these results that CodY can both positively and negatively regulate its regulon via direct and/or indirect approaches, and that its mode of regulation may be concentration dependent.

  20. N-acetylglucosamine deacetylases modulate the anchoring of the gamma-glutamyl capsule to the cell wall of Bacillus anthracis.

    PubMed

    Candela, Thomas; Balomenou, Stavroula; Aucher, Willy; Bouriotis, Vassilis; Simore, Jean-Pierre; Fouet, Agnes; Boneca, Ivo G

    2014-06-01

    Bacillus anthracis has a complex cell wall structure composed of a peptidoglycan (PG) layer to which major structures are anchored such as a neutral polysaccharide, an S-layer, and a poly-γ-D-glutamate (PDGA) capsule. Many of these structures have central roles in the biology of B. anthracis, particularly, in virulence. However, little attention has been devoted to structurally study the PG and how it is modified in the presence of these secondary cell wall components. We present here the fine structure of the PG of the encapsulated RPG1 strain harboring both pXO1 and pXO2 virulence plasmids. We show that B. anthracis has a high degree of cross-linking and its GlcNAc residues are highly modified by N-deacetylation. The PG composition is not dependent on the presence of either LPXTG proteins or the capsule. Using NMR analysis of the PG-PDGA complex, we provide evidence for the anchoring of the PDGA to the glucosamine residues. We show that anchoring of the PDGA capsule is impaired in two PG N-deacetylase mutants, Ba1961 and Ba3679. Thus, these multiple N-deactylase activities would constitute excellent drug targets in B. anthracis by simultaneously affecting its resistance to lysozyme and to phagocytosis impairing B. anthracis survival in the host.

  1. LytR-CpsA-Psr enzymes as determinants of Bacillus anthracis secondary cell wall polysaccharide assembly.

    PubMed

    Liszewski Zilla, Megan; Chan, Yvonne G Y; Lunderberg, Justin Mark; Schneewind, Olaf; Missiakas, Dominique

    2015-01-01

    Bacillus anthracis, the causative agent of anthrax, replicates as chains of vegetative cells by regulating the separation of septal peptidoglycan. Surface (S)-layer proteins and associated proteins (BSLs) function as chain length determinants and bind to the secondary cell wall polysaccharide (SCWP). In this study, we identified the B. anthracis lcpD mutant, which displays increased chain length and S-layer assembly defects due to diminished SCWP attachment to peptidoglycan. In contrast, the B. anthracis lcpB3 variant displayed reduced cell size and chain length, which could be attributed to increased deposition of BSLs. In other bacteria, LytR-CpsA-Psr (LCP) proteins attach wall teichoic acid (WTA) and polysaccharide capsule to peptidoglycan. B. anthracis does not synthesize these polymers, yet its genome encodes six LCP homologues, which, when expressed in S. aureus, promote WTA attachment. We propose a model whereby B. anthracis LCPs promote attachment of SCWP precursors to discrete locations in the peptidoglycan, enabling BSL assembly and regulated separation of septal peptidoglycan.

  2. Molecular epidemiological study of Bacillus anthracis isolated in Mongolia by multiple-locus variable-number tandem-repeat analysis for 8 loci (MLVA-8).

    PubMed

    Okutani, Akiko; Tungalag, Hurelsukh; Boldbaatar, Bazartseren; Yamada, Akio; Tserennorov, Damdindorj; Otgonchimeg, Ishtsog; Erdenebat, Adiya; Otgonbaatar, Dashdavaa; Inoue, Satoshi

    2011-01-01

    The incidence of anthrax, which is caused by Bacillus anthracis, in the human and animal population of Mongolia has increased recently, and control of this infection is a nationwide concern. In this study, 29 isolates obtained from animals and various regions in Mongolia from 2001 to 2007 were analyzed by performing multiple-locus variable-number tandem-repeat analysis for 8 loci (MLVA-8) to understand the genetic relationship between the Mongolian B. anthracis isolates. We found that all the Mongolian isolates can be classified into A3 cluster along with the Japanese and the Chinese B. anthracis isolates. Our data revealed that MLVA-8 is useful for studying the molecular epidemiology of the Mongolian B. anthracis isolates and would help characterize B. anthracis infections in Mongolia.

  3. Enzyme toolbox: novel enantiocomplementary imine reductases.

    PubMed

    Scheller, Philipp N; Fademrecht, Silvia; Hofelzer, Sebastian; Pleiss, Jürgen; Leipold, Friedemann; Turner, Nicholas J; Nestl, Bettina M; Hauer, Bernhard

    2014-10-13

    Reducing reactions are among the most useful transformations for the generation of chiral compounds in the fine-chemical industry. Because of their exquisite selectivities, enzymatic approaches have emerged as the method of choice for the reduction of C=O and activated C=C bonds. However, stereoselective enzymatic reduction of C=N bonds is still in its infancy-it was only recently described after the discovery of enzymes capable of imine reduction. In our work, we increased the spectrum of imine-reducing enzymes by database analysis. By combining the currently available knowledge about the function of imine reductases with the experimentally uncharacterized diversity stored in protein sequence databases, three novel imine reductases with complementary enantiopreference were identified along with amino acids important for catalysis. Furthermore, their reducing capability was demonstrated by the reduction of the pharmaceutically relevant prochiral imine 2-methylpyrroline. These novel enzymes exhibited comparable to higher catalytic efficiencies than previously described enzymes, and their biosynthetic potential is highlighted by the full conversion of 2-methylpyrroline in whole cells with excellent selectivities.

  4. Soluble ascorbate free radical reductase in the human lens.

    PubMed

    Bando, M; Obazawa, H

    1994-01-01

    A major and a minor ascorbate free radical (AFR) reductase were separated from the soluble fraction in the human lens cortex by DEAE-cellulose ion-exchange column chromatography. These AFR reductases also exhibited diaphorase activity using dichlorophenolindophenol and ferricyanide as electron acceptors. The major AFR reductase was partially purified by 5'AMP-Sepharose 4B affinity column chromatography. This partially purified AFR reductase showed a single band of diaphorase activity in native polyacrylamide disc gel electrophoresis. This activity band corresponded to the major protein observed in protein staining by Coomassie Brilliant Blue. However, the protein staining by Coomassie Brilliant Blue showed this activity band surrounded by diffused staining. Molecular weight of the partially purified AFR reductase was determined to be 32 kDa by gel filtration, and the apparent Km value for AFR was about 15 microM. This major lens AFR reductase could be distinguished from soluble Neurospora, Euglena and cucumber AFR reductases, and from two ubiquitous enzymes with reduction activity of AFR and/or foreign compounds, ie, NADH-cytochrome b5 reductase and DT-diaphorase, by their molecular weights, Km values and/or ion-exchange chromatographic behaviors.

  5. Functional and Phylogenetic Divergence of Fungal Adenylate-Forming Reductases

    PubMed Central

    Kalb, Daniel; Lackner, Gerald

    2014-01-01

    A key step in fungal l-lysine biosynthesis is catalyzed by adenylate-forming l-α-aminoadipic acid reductases, organized in domains for adenylation, thiolation, and the reduction step. However, the genomes of numerous ascomycetes and basidiomycetes contain an unexpectedly large number of additional genes encoding similar but functionally distinct enzymes. Here, we describe the functional in vitro characterization of four reductases which were heterologously produced in Escherichia coli. The Ceriporiopsis subvermispora serine reductase Nps1 features a terminal ferredoxin-NADP+ reductase (FNR) domain and thus belongs to a hitherto undescribed class of fungal multidomain enzymes. The second major class is characterized by the canonical terminal short-chain dehydrogenase/reductase domain and represented by Ceriporiopsis subvermispora Nps3 as the first biochemically characterized l-α-aminoadipic acid reductase of basidiomycete origin. Aspergillus flavus l-tyrosine reductases LnaA and LnbA are members of a distinct phylogenetic clade. Phylogenetic analysis supports the view that fungal adenylate-forming reductases are more diverse than previously recognized and belong to four distinct classes. PMID:25085485

  6. Genetic diversity among Bacillus anthracis, Bacillus cereus and Bacillus thuringiensis strains using repetitive element polymorphism-PCR.

    PubMed

    Brumlik, Michael J; Bielawska-Drózd, Agata; Zakowska, Dorota; Liang, Xudong; Spalletta, Ronald A; Patra, Guy; Delvecchio, Vito G

    2004-01-01

    Repetitive element polymorphism-PCR (REP-PCR) is one of the tools that has been used to elucidate genetic diversity of related microorganisms. Using the MB1 primer, REP-PCR fingerprints from 110 Bacillus strains within the "B. cereus group" have identified eighteen distinct categories, while other more distantly related bacterial species fell within six additional categories. All Bacillus anthracis strains tested were found to be monomorphic by fluorophore-enhanced REP-PCR (FERP) fingerprinting using the MB1 primer. In contrast, other non- B. anthracis isolates displayed a high degree of polymorphism. Dendrogramic analysis revealed that the non- B. anthracis strains possessing the Ba813 chromosomal marker were divided into two clusters. One of the clusters shared identity with the B. cereus strains examined.

  7. A Randomly Amplified Polymorphic DNA Marker Specific for the Bacillus cereus Group Is Diagnostic for Bacillus anthracis

    PubMed Central

    Daffonchio, Daniele; Borin, Sara; Frova, Giuseppe; Gallo, Romina; Mori, Elena; Fani, Renato; Sorlini, Claudia

    1999-01-01

    Aiming to develop a DNA marker specific for Bacillus anthracis and able to discriminate this species from Bacillus cereus, Bacillus thuringiensis, and Bacillus mycoides, we applied the randomly amplified polymorphic DNA (RAPD) fingerprinting technique to a collection of 101 strains of the genus Bacillus, including 61 strains of the B. cereus group. An 838-bp RAPD marker (SG-850) specific for B. cereus, B. thuringiensis, B. anthracis, and B. mycoides was identified. This fragment included a putative (366-nucleotide) open reading frame highly homologous to the ypuA gene of Bacillus subtilis. The restriction analysis of the SG-850 fragment with AluI distinguished B. anthracis from the other species of the B. cereus group. PMID:10049896

  8. In silico and in vitro evaluation of PCR-based assays for the detection of Bacillus anthracis chromosomal signature sequences

    PubMed Central

    Ågren, Joakim; Hamidjaja, Raditijo A; Hansen, Trine; Ruuls, Robin; Thierry, Simon; Vigre, Håkan; Janse, Ingmar; Sundström, Anders; Segerman, Bo; Koene, Miriam; Löfström, Charlotta; Van Rotterdam, Bart; Derzelle, Sylviane

    2013-01-01

    Bacillus anthracis, the causative agent of anthrax, is a zoonotic pathogen that is relatively common throughout the world and may cause life threatening diseases in animals and humans. There are many PCR-based assays in use for the detection of B. anthracis. While most of the developed assays rely on unique markers present on virulence plasmids pXO1 and pXO2, relatively few assays incorporate chromosomal DNA markers due to the close relatedness of B. anthracis to the B. cereus group strains. For the detection of chromosomal DNA, different genes have been used, such as BA813, rpoB, gyrA, plcR, S-layer, and prophage-lambda. Following a review of the literature, an in silico analysis of all signature sequences reported for identification of B. anthracis was conducted. Published primer and probe sequences were compared for specificity against 134 available Bacillus spp. genomes. Although many of the chromosomal targets evaluated are claimed to be specific to B. anthracis, cross-reactions with closely related B. cereus and B. thuringiensis strains were often observed. Of the 35 investigated PCR assays, only 4 were 100% specific for the B. anthracis chromosome. An interlaboratory ring trial among five European laboratories was then performed to evaluate six assays, including the WHO recommended procedures, using a collection of 90 Bacillus strains. Three assays performed adequately, yielding no false positive or negative results. All three assays target chromosomal markers located within the lambdaBa03 prophage region (PL3, BA5345, and BA5357). Detection limit was further assessed for one of these highly specific assays. PMID:24005110

  9. In silico and in vitro evaluation of PCR-based assays for the detection of Bacillus anthracis chromosomal signature sequences.

    PubMed

    Ågren, Joakim; Hamidjaja, Raditijo A; Hansen, Trine; Ruuls, Robin; Thierry, Simon; Vigre, Håkan; Janse, Ingmar; Sundström, Anders; Segerman, Bo; Koene, Miriam; Löfström, Charlotta; Van Rotterdam, Bart; Derzelle, Sylviane

    2013-11-15

    Bacillus anthracis, the causative agent of anthrax, is a zoonotic pathogen that is relatively common throughout the world and may cause life threatening diseases in animals and humans. There are many PCR-based assays in use for the detection of B. anthracis. While most of the developed assays rely on unique markers present on virulence plasmids pXO1 and pXO2, relatively few assays incorporate chromosomal DNA markers due to the close relatedness of B. anthracis to the B. cereus group strains. For the detection of chromosomal DNA, different genes have been used, such as BA813, rpoB, gyrA, plcR, S-layer, and prophage-lambda. Following a review of the literature, an in silico analysis of all signature sequences reported for identification of B. anthracis was conducted. Published primer and probe sequences were compared for specificity against 134 available Bacillus spp. genomes. Although many of the chromosomal targets evaluated are claimed to be specific to B. anthracis, cross-reactions with closely related B. cereus and B. thuringiensis strains were often observed. Of the 35 investigated PCR assays, only 4 were 100% specific for the B. anthracis chromosome. An interlaboratory ring trial among five European laboratories was then performed to evaluate six assays, including the WHO recommended procedures, using a collection of 90 Bacillus strains. Three assays performed adequately, yielding no false positive or negative results. All three assays target chromosomal markers located within the lambdaBa03 prophage region (PL3, BA5345, and BA5357). Detection limit was further assessed for one of these highly specific assays.

  10. Bacillus anthracis Virulent Plasmid pX02 Genes Found in Large Plasmids of Two Other Bacillus Species

    PubMed Central

    Luna, Vicki A.; King, Debra S.; Peak, K. Kealy; Reeves, Frank; Heberlein-Larson, Lea; Veguilla, William; Heller, L.; Duncan, Kathleen E.; Cannons, Andrew C.; Amuso, Philip; Cattani, Jacqueline

    2006-01-01

    In order to cause the disease anthrax, Bacillus anthracis requires two plasmids, pX01 and pX02, which carry toxin and capsule genes, respectively, that are used as genetic targets in the laboratory detection of the bacterium. Clinical, forensic, and environmental samples that test positive by PCR protocols established by the Centers for Disease Control and Prevention for B. anthracis are considered to be potentially B. anthracis until confirmed by culture and a secondary battery of tests. We report the presence of 10 genes (acpA, capA, capB, capC, capR, capD, IS1627, ORF 48, ORF 61, and repA) and the sequence for the capsule promoter normally found on pX02 in Bacillus circulans and a Bacillus species closely related to Bacillus luciferensis. Tests revealed these sequences to be present on a large plasmid in each isolate. The 11 sequences consistently matched to B. anthracis plasmid pX02, GenBank accession numbers AF188935.1, AE011191.1, and AE017335.3. The percent nucleotide identities for capD and the capsule promoter were 99.9% and 99.7%, respectively, and for the remaining nine genes, the nucleotide identity was 100% for both isolates. The presence of these genes, which are usually associated with the pX02 plasmid, in two soil Bacillus species unrelated to B. anthracis alerts us to the necessity of identifying additional sequences that will signal the presence of B. anthracis in clinical, forensic, and environmental samples. PMID:16825351

  11. A Bacillus anthracis strain deleted for six proteases serves as an effective host for production of recombinant proteins.

    PubMed

    Pomerantsev, Andrei P; Pomerantseva, Olga M; Moayeri, Mahtab; Fattah, Rasem; Tallant, Cynthia; Leppla, Stephen H

    2011-11-01

    Bacillus anthracis produces a number of extracellular proteases that impact the integrity and yield of other proteins in the B. anthracis secretome. In this study we show that anthrolysin O (ALO) and the three anthrax toxin proteins, protective antigen (PA), lethal factor (LF), and edema factor (EF), produced from the B. anthracis Ames 35 strain (pXO1⁺, pXO2⁻), are completely degraded at the onset of stationary phase due to the action of proteases. An improved Cre-loxP gene knockout system was used to sequentially delete the genes encoding six proteases (InhA1, InhA2, camelysin, TasA, NprB, and MmpZ). The role of each protease in degradation of the B. anthracis toxin components and ALO was demonstrated. Levels of the anthrax toxin components and ALO in the supernatant of the sporulation defective, pXO1⁺ A35HMS mutant strain deleted for the six proteases were significantly increased and remained stable over 24 h. A pXO1-free variant of this six-protease mutant strain, designated BH460, provides an improved host strain for the preparation of recombinant proteins. As an example, BH460 was used to produce recombinant EF, which previously has been difficult to obtain from B. anthracis. The EF protein produced from BH460 had the highest in vivo potency of any EF previously purified from B. anthracis or Escherichia coli hosts. BH460 is recommended as an effective host strain for recombinant protein production, typically yielding greater than 10mg pure protein per liter of culture.

  12. Fate of Bacillus anthracis during production of laboratory-scale cream cheese and homemade-style yoghurt.

    PubMed

    Mertens, Katja; Schneider, Oda; Schmoock, Gernot; Melzer, Falk; Elschner, Mandy C

    2015-04-01

    The viability of Bacillus anthracis during production and storage of cream cheese and yoghurt was evaluated. Experimental cheeses were manufactured from whole milk inoculated with a suspension of B. anthracis vegetative cells and spores at a final concentration of 10(4) cfu/ml. Lactic acid bacteria (LAB) and lab ferment were used to induce milk ripening and milk coagulation. The pH-value of the contaminated milk dropped below 4.5 within the first 6 h and the amount of LAB increased by approximately 2-logs. During cheese production and storage at 5-9 °C for 24 days no growth of B. anthracis was observed. The amount of vegetative cells and spores fluctuated by 1-log. Inoculation of whole milk with heat-treated spores at 10(4) cfu/ml resulted in a slight increase of vegetative cell counts during the first 6 h. This indicated that germination occurred, but replication of vegetative cells was still inhibited in the produced cheese. Incubation of cheeses at room temperature or heating after milk coagulation strongly reduced the amount of LAB but had no effect on the growth behaviour of B. anthracis. The vegetative cell and spore content remained steady at 10(4) cfu/100 mg. During yoghurt production the pH-value decreased within 5 h below 5 and growth of B. anthracis was inhibited throughout storage. A pH-value of 5 or less is likely a critical factor to control the growth of B. anthracis. However, spores remained viable in experimental cream cheeses and yoghurts and are a potential risk of infection.

  13. In Vitro and In Vivo Activity of Omadacycline Against Two Biothreat Pathogens: Bacillus anthracis and Yersinia pestis.

    PubMed

    Steenbergen, Judith; Tanaka, S Ken; Miller, Lynda L; Halasohoris, Stephanie A; Hershfield, Jeremy R

    2017-02-21

    Introduction: The in vitro activity and in vivo efficacy of omadacycline (OMC) were evaluated against the causative pathogens of anthrax and plague, Bacillus anthracis and Yersinia pestis, respectively.Methods: Minimum inhibitory concentrations (MICs) of OMC were determined by microbroth dilution according to CLSI guidelines for 30 isolates each of Y. pestis and B. anthracis The in vivo efficacy of omadacycline was studied at a range of dosages in both a post exposure prophylaxis (PEP) murine model of anthrax and plague as well as in a delayed treatment model of inhalational anthrax.Results: Omadacycline was active in vitro against Y. pestis (MIC90=1 mcg/mL) and B. anthracis (MIC90=0.06 mcg/mL). Omadacycline was less active in vitro than ciprofloxacin (CIP) against Y. pestis (CIP MIC90=0.03 mcg/mL), but more potent in vitro against B. anthracis (CIP MIC90=0.12 mcg/mL). In the mouse model of infection, the survival curves for all treatment cohorts differed significantly from the vehicle control (p=0.004). The median survival for the vehicle-treated controls was 6 days post-challenge while all antibiotic-treated mice survived the entire study. Omadacycline treatment with 5, 10 or 20 mg/kg twice daily for 14 days had significant efficacy over the vehicle control in the treatment of aerosolized B. anthracis Additionally, for post exposure prophylaxis treatment of mice infected with Y. pestis, the survival curves for omadacycline (40 mg/kg twice daily), ciprofloxacin, and doxycycline cohorts differed significantly from the vehicle control (p<0.0001).Conclusions: Omadacycline is potent and demonstrates efficacy against both B. anthracis and Y. pestis The well-characterized oral and IV pharmacokinetics, safety and tolerability, warrant further assessment of the potential utility of omadacycline in combating these serious biothreat organisms.

  14. [Application of the multiplex PCR and PCR-RFLP method in the identification of the Bacillus anthracis].

    PubMed

    Szymajda, Urszula; Bartoszcze, Michał

    2005-01-01

    The aim of this study was to apply the multiplex PCR and PCR-RFLP method for the identification of the B. anthracis strains and to distinguish those bacteria from other members of the Bacillus cereus group. The multiplex PCR method enables to detect the virulence factors, i.e. the toxin and the capsule in B. anthracis strains. To do that, the authors have used 5 primer pairs specific for the fragments of lef, cya, pag genes which are present in the pXO1 plasmid and encode the toxin, the cap gene, which is present in the pXO2 plasmid and encodes the capsule, and the Ba813 chromosomal sequence. Among the four B. anthracis strains examined, three contained two plasmids and the Ba813 chromosomal sequence, while the fourth one contained the pXO1 plasmid only, together and the Ba813 chromosomal sequence. Other bacterial species, belonging to the B. cereus group, were also examined: 6 strains of B. cereus, 4 strains of B. thuringiensis and one strain of B. mycoides. The presence of Ba813 chromosomal sequence has been detected in two B. cereus strains. Neither plasmids nor Ba813 chromosomal sequence have been discovered in other B. cereus, B. thuringiensis and B. mycoides strains. The results of the survey indicate that the Ba813 chromosomal sequence does not occur solely in B. anthracis strains. The PCR-RFLP method with the use of SG-749f and SG-749r primers enabled to demonstrate the presence of DNA sequence (SG-749) in B. anthracis, B. cereus, B. thuringiensis and B. mycoides strains. Restriction analysis with enzyme AluI of the SG-749 sequence, has shown the presence of two DNA fragments at the size of about 90 and 660 bp in all B. anthracis strains. The restriction profile obtained was characteristic for B. anthracis strains and it did not occur in other investigated bacterial species belonging to the B. cereus group. It was not observed even in such B. cereus strains in which the presence of Ba813 sequence was discovered and it enabled to differentiate between B

  15. [Valuation for usefulness of selected chromosomal markers for Bacillus anthracis identification. II. Valuation for markers SSH and rpoB].

    PubMed

    Zasada, Aleksandra Anna; Jagielski, Marek

    2006-01-01

    The article presents results of valuation for B. anthracis-specificity and usefulness for its identification obtained for different chromosomal markers. In the second part of the study markers SSH241, SSH196, SSH163, SSH133 as well as a fragment of the house-keeping gene rpoB were analyzed. For the investigation MSSCP and multiplex-PCR assays were used. There were also tested different techniques of electrophoresis. The results gave an information about specificity of tested markers and their usefulness for B. anthracis identification.

  16. Transcripts of anthocyanidin reductase and leucoanthocyanidin reductase and measurement of catechin and epicatechin in tartary buckwheat.

    PubMed

    Kim, Yeon Bok; Thwe, Aye Aye; Kim, Yeji; Li, Xiaohua; Cho, Jin Woong; Park, Phun Bum; Valan Arasu, Mariadhas; Abdullah Al-Dhabi, Naif; Kim, Sun-Ju; Suzuki, Tastsuro; Hyun Jho, Kwang; Park, Sang Un

    2014-01-01

    Anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR) play an important role in the monomeric units biosynthesis of proanthocyanidins (PAs) such as catechin and epicatechin in several plants. The aim of this study was to clone ANR and LAR genes involved in PAs biosynthesis and examine the expression of these two genes in different organs under different growth conditions in two tartary buckwheat cultivars, Hokkai T8 and T10. Gene expression was carried out by quantitative real-time RT-PCR, and catechin and epicatechin content was analyzed by high performance liquid chromatography. The expression pattern of ANR and LAR did not match the accumulation pattern of PAs in different organs of two cultivars. Epicatechin content was the highest in the flowers of both cultivars and it was affected by light in only Hokkai T8 sprouts. ANR and LAR levels in tartary buckwheat might be regulated by different mechanisms for catechin and epicatechin biosynthesis under light and dark conditions.

  17. Docking and molecular dynamics studies at trypanothione reductase and glutathione reductase active sites.

    PubMed

    Iribarne, Federico; Paulino, Margot; Aguilera, Sara; Murphy, Miguel; Tapia, Orlando

    2002-05-01

    A theoretical docking study on the active sites of trypanothione reductase (TR) and glutathione reductase (GR) with the corresponding natural substrates, trypanothione disulfide (T[S]2) and glutathione disulfide (GSSG), is reported. Molecular dynamics simulations were carried out in order to check the robustness of the docking results. The energetic results are in agreement with previous experimental findings and show the crossed complexes have lower stabilization energies than the natural ones. To test DOCK3.5, four nitro furanic compounds, previously designed as potentially active anti-chagasic molecules, were docked at the GR and TR active sites with the DOCK3.5 procedure. A good correlation was found between differential inhibitory activity and relative interaction energy (affinity). The results provide a validation test for the use of DOCK3.5 in connection with the design of anti-chagasic drugs.

  18. Transcripts of Anthocyanidin Reductase and Leucoanthocyanidin Reductase and Measurement of Catechin and Epicatechin in Tartary Buckwheat

    PubMed Central

    Kim, Yeon Bok; Thwe, Aye Aye; Kim, YeJi; Li, Xiaohua; Cho, Jin Woong; Park, Phun Bum; Valan Arasu, Mariadhas; Abdullah Al-Dhabi, Naif; Kim, Sun-Ju; Suzuki, Tastsuro; Hyun Jho, Kwang; Park, Sang Un

    2014-01-01

    Anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR) play an important role in the monomeric units biosynthesis of proanthocyanidins (PAs) such as catechin and epicatechin in several plants. The aim of this study was to clone ANR and LAR genes involved in PAs biosynthesis and examine the expression of these two genes in different organs under different growth conditions in two tartary buckwheat cultivars, Hokkai T8 and T10. Gene expression was carried out by quantitative real-time RT-PCR, and catechin and epicatechin content was analyzed by high performance liquid chromatography. The expression pattern of ANR and LAR did not match the accumulation pattern of PAs in different organs of two cultivars. Epicatechin content was the highest in the flowers of both cultivars and it was affected by light in only Hokkai T8 sprouts. ANR and LAR levels in tartary buckwheat might be regulated by different mechanisms for catechin and epicatechin biosynthesis under light and dark conditions. PMID:24605062

  19. Rapid-Viability PCR Method for Detection of Live, Virulent Bacillus anthracis in Environmental Samples ▿

    PubMed Central

    Létant, Sonia E.; Murphy, Gloria A.; Alfaro, Teneile M.; Avila, Julie R.; Kane, Staci R.; Raber, Ellen; Bunt, Thomas M.; Shah, Sanjiv R.

    2011-01-01

    In the event of a biothreat agent release, hundreds of samples would need to be rapidly processed to characterize the extent of contamination and determine the efficacy of remediation activities. Current biological agent identification and viability determination methods are both labor- and time-intensive such that turnaround time for confirmed results is typically several days. In order to alleviate this issue, automated, high-throughput sample processing methods were developed in which real-time PCR analysis is conducted on samples before and after incubation. The method, referred to as rapid-viability (RV)-PCR, uses the change in cycle threshold after incubation to detect the presence of live organisms. In this article, we report a novel RV-PCR method for detection of live, virulent Bacillus anthracis, in which the incubation time was reduced from 14 h to 9 h, bringing the total turnaround time for results below 15 h. The method incorporates a magnetic bead-based DNA extraction and purification step prior to PCR analysis, as well as specific real-time PCR assays for the B. anthracis chromosome and pXO1 and pXO2 plasmids. A single laboratory verification of the optimized method applied to the detection of virulent B. anthracis in environmental samples was conducted and showed a detection level of 10 to 99 CFU/sample with both manual and automated RV-PCR methods in the presence of various challenges. Experiments exploring the relationship between the incubation time and the limit of detection suggest that the method could be further shortened by an additional 2 to 3 h for relatively clean samples. PMID:21764960

  20. Sensing and inactivation of Bacillus anthracis Sterne by polymer-bromine complexes.

    PubMed

    D'Angelo, Paola A; Bromberg, Lev; Hatton, T Alan; Wilusz, Eugene

    2016-08-01

    We report on the performance of brominated poly(N-vinylpyrrolidone) (PVP-Br), brominated poly(ethylene glycol) (PEG-Br), and brominated poly(allylamine-co-4-aminopyridine) (PAAm-APy-Br) for their ability to decontaminate Bacillus anthracis Sterne spores in solution while also allowing for the sensing of the spores. The polymers were brominated by bromine using carbon tetrachloride or potassium tribromide as solvents, with bromine loadings ranging from 1.6 to 4.2 mEq/g of polymer. B. anthracis Sterne spores were exposed to increasing concentrations of brominated polymers for 5 min, while the kinetics of the sporicidal activity was assessed. All brominated polym