Science.gov

Sample records for anthracis dihydrofolate reductase

  1. Synthetic and Crystallographic Studies of a New Inhibitor Series Targeting Bacillus anthracis Dihydrofolate Reductase

    SciTech Connect

    Beierlein, J.; Frey, K; Bolstad, D; Pelphrey, P; Joska, T; Smith, A; Priestley, N; Wright, D; Anderson, A

    2008-01-01

    Bacillus anthracis, the causative agent of anthrax, poses a significant biodefense danger. Serious limitations in approved therapeutics and the generation of resistance have produced a compelling need for new therapeutic agents against this organism. Bacillus anthracis is known to be insensitive to the clinically used antifolate, trimethoprim, because of a lack of potency against the dihydrofolate reductase enzyme. Herein, we describe a novel lead series of B. anthracis dihydrofolate reductase inhibitors characterized by an extended trimethoprim-like scaffold. The best lead compound adds only 22 Da to the molecular weight and is 82-fold more potent than trimethoprim. An X-ray crystal structure of this lead compound bound to B. anthracis dihydrofolate reductase in the presence of NADPH was determined to 2.25 A resolution. The structure reveals several features that can be exploited for further development of this lead series.

  2. Synthetic and Crystallographic Studies of a New Inhibitor Series Targeting Bacillus anthracis Dihydrofolate Reductase

    PubMed Central

    Beierlein, Jennifer M.; Frey, Kathleen M.; Bolstad, David B.; Pelphrey, Phillip M.; Joska, Tammy M.; Smith, Adrienne E.; Priestley, Nigel D.; Wright, Dennis L.; Anderson, Amy C.

    2008-01-01

    Bacillus anthracis, the causative agent of anthrax, poses a significant biodefense danger. Serious limitations in approved therapeutics and the generation of resistance have produced a compelling need for new therapeutic agents against this organism. Bacillus anthracis is known to be insensitive to the clinically used antifolate, trimethoprim, because of a lack of potency against the dihydrofolate reductase enzyme. Herein, we describe a novel lead series of B. anthracis dihydrofolate reductase inhibitors characterized by an extended trimethoprim-like scaffold. The best lead compound adds only 22 Da to the molecular weight and is 82-fold more potent than trimethoprim. An X-ray crystal structure of this lead compound bound to B. anthracis dihydrofolate reductase in the presence of NADPH was determined to 2.25 Å resolution. The structure reveals several features that can be exploited for further development of this lead series. PMID:19007108

  3. Molecular modeling toward selective inhibitors of dihydrofolate reductase from the biological warfare agent Bacillus anthracis.

    PubMed

    Giacoppo, Juliana O S; Mancini, Daiana T; Guimarães, Ana P; Gonçalves, Arlan S; da Cunha, Elaine F F; França, Tanos C C; Ramalho, Teodorico C

    2015-02-16

    In the present work, we applied docking and molecular dynamics techniques to study 11 compounds inside the enzymes dihydrofolate reductase (DHFR) from the biological warfare agent Bacillus anthracis (BaDHFR) and Homo sapiens sapiens (HssDHFR). Six of these compounds were selected for a study with the mutant BaF96IDHFR. Our results corroborated with experimental data and allowed the proposition of a new molecule with potential activity and better selectivity for BaDHFR.

  4. Structure-activity relationship for enantiomers of potent inhibitors of B. anthracis dihydrofolate reductase

    PubMed Central

    Bourne, Christina R.; Wakeham, Nancy; Nammalwar, Baskar; Tseitin, Vladimir; Bourne, Philip C.; Barrow, Esther W.; Mylvaganam, Shankari; Ramnarayan, Kal; Bunce, Richard A.; Berlin, K. Darrell; Barrow, William W.

    2012-01-01

    Background Bacterial resistance to antibiotic therapies is increasing and new treatment options are badly needed. There is an overlap between these resistant bacteria and organisms classified as likely bioterror weapons. For example, Bacillus anthracis is innately resistant to the anti-folate trimethoprim due to sequence changes found in the dihydrofolate reductase enzyme. Development of new inhibitors provides an opportunity to enhance the current arsenal of anti-folate antibiotics while also expanding the coverage of the anti-folate class. Methods We have characterized inhibitors of Bacillus anthracis dihydrofolate reductase by measuring the Ki and MIC values and calculating the energetics of binding. This series contains a core diaminopyrimidine ring, a central dimethoxybenzyl ring, and a dihydrophthalazine moiety. We have altered the chemical groups extended from a chiral center on the dihydropyridazine ring of the phthalazine moiety. The interactions for the most potent compounds were visualized by X-ray structure determination. Results We find that the potency of individual enantiomers is divergent with clear preference for the S-enantiomer, while maintaining a high conservation of contacts within the binding site. The preference for enantiomers seems to be predicated largely by differential interactions with protein residues Leu29, Gln30 and Arg53. Conclusions These studies have clarified the activity of modifications and of individual enantiomers, and highlighted the role of the less-active R-enantiomer in effectively diluting the more active S-enantiomer in racemic solutions. This directly contributes to the development of new antimicrobials, combating trimethoprim resistance, and treatment options for potential bioterrorism agents. PMID:22999981

  5. Targeted Mutations of Bacillus anthracis Dihydrofolate Reductase Condense Complex Structure-Activity Relationships

    SciTech Connect

    J Beierlein; N Karri; A Anderson

    2011-12-31

    Several antifolates, including trimethoprim (TMP) and a series of propargyl-linked analogues, bind dihydrofolate reductase from Bacillus anthracis (BaDHFR) with lower affinity than is typical in other bacterial species. To guide lead optimization for BaDHFR, we explored a new approach to determine structure-activity relationships whereby the enzyme is altered and the analogues remain constant, essentially reversing the standard experimental design. Active site mutants of the enzyme, Ba(F96I)DHFR and Ba(Y102F)DHFR, were created and evaluated with enzyme inhibition assays and crystal structures. The affinities of the antifolates increase up to 60-fold with the Y102F mutant, suggesting that interactions with Tyr 102 are critical for affinity. Crystal structures of the enzymes bound to TMP and propargyl-linked inhibitors reveal the basis of TMP resistance and illuminate the influence of Tyr 102 on the lipophilic linker between the pyrimidine and aryl rings. Two new inhibitors test and validate these conclusions and show the value of the technique for providing new directions during lead optimization.

  6. Modified 2,4-diaminopyrimidine-based dihydrofolate reductase inhibitors as potential drug scaffolds against Bacillus anthracis

    PubMed Central

    Nammalwar, Baskar; Bourne, Christina R.; Wakeham, Nancy; Bourne, Philip C.; Barrow, Esther W.; Muddala, N. Prasad; Bunce, Richard A.; Berlin, K. Darrell; Barrow, William W.

    2014-01-01

    The current paper describes the synthesis and biological evaluation of dihydrophthalazine-appended 2,4-diaminopyrimidine (DAP) inhibitors (1) oxidized at the methylene bridge linking the DAP ring to the central aromatic ring and (2) modified at the central ring ether groups. Structures 4a-b incorporating an oxidized methylene bridge showed a decrease in activity, while slightly larger alkyl groups (CH2CH3 versus CH3) on the central ring oxygen atoms (R2 and R3) had a minimal impact on the inhibition. Comparison of the potency data for previously reported RAB1 and BN-53 with the most potent of the new derivatives (19b and 20a-b) showed similar values for inhibition of cellular growth and direct enzymatic inhibition (MICs 0.5-2 μg/mL). Compounds 29-34 with larger ester and ether groups containing substituted aromatic rings at R3 exhibited slightly reduced activity (MICs 2-16 μg/mL). One explanation for this attenuated activity could be encroachment of the extended R3 into the neighboring NADPH co-factor. These results indicate that modest additions to the central ring oxygen atoms are well tolerated, while larger modifications have the potential to act as dual-site inhibitors of dihydrofolate reductase (DHFR). PMID:25435253

  7. Control of dihydrofolate reductase messenger ribonucleic acid production

    SciTech Connect

    Leys, E.J.; Kellems, R.E.

    1981-11-01

    The authors used methotrexate-resistant mouse cells in which dihydrofolate reductase levels are approximately 500 times normal to study the effect of growth stimulation on dihydrofolate reductase gene expression. As a result of growth stimulation, the relative rate of dihydrofolate reductase protein synthesis increased threefold, reaching a maximum between 25 and 30 h after stimulation. The relative rate of dihydrofolate reductase messenger ribonucleic acid production (i.e., the appearance of dihydrofolate reductase messenger ribonucleic acid in the cytoplasm) increased threefold after growth stimulation and was accompanied by a corresponding increase in the relative steady-state level of dihydrofolate reductase ribonucleic acid in the nucleus. However, the increase in the nuclear level of dihydrofolate reductase ribonucleic acid was not accompanied by a significant increase in the relative rate of transcription of the dihydrofolate reductase genes. These data indicated that the relative rate of appearance of dihydrofolate reductase messenger ribonucleic acid in the cytoplasm depends on the relative stability of the dihydrofolate reductase ribonucleic acid sequences in the nucleus and is not dependent on the relative rate of transcription of the dihydrofolate reductase genes.

  8. Tales of Dihydrofolate Binding to R67 Dihydrofolate Reductase

    PubMed Central

    2015-01-01

    Homotetrameric R67 dihydrofolate reductase possesses 222 symmetry and a single active site pore. This situation results in a promiscuous binding site that accommodates either the substrate, dihydrofolate (DHF), or the cofactor, NADPH. NADPH interacts more directly with the protein as it is larger than the substrate. In contrast, the p-aminobenzoyl-glutamate tail of DHF, as monitored by nuclear magnetic resonance and crystallography, is disordered when bound. To explore whether smaller active site volumes (which should decrease the level of tail disorder by confinement effects) alter steady state rates, asymmetric mutations that decreased the half-pore volume by ∼35% were constructed. Only minor effects on kcat were observed. To continue exploring the role of tail disorder in catalysis, 1-ethyl-3-[3-(dimethylamino)propyl]carbodiimide-mediated cross-linking between R67 DHFR and folate was performed. A two-folate, one-tetramer complex results in the loss of enzyme activity where two symmetry-related K32 residues in the protein are cross-linked to the carboxylates of two bound folates. The tethered folate could be reduced, although with a ≤30-fold decreased rate, suggesting decreased dynamics and/or suboptimal positioning of the cross-linked folate for catalysis. Computer simulations that restrain the dihydrofolate tail near K32 indicate that cross-linking still allows movement of the p-aminobenzoyl ring, which allows the reaction to occur. Finally, a bis-ethylene-diamine-α,γ-amide folate adduct was synthesized; both negatively charged carboxylates in the glutamate tail were replaced with positively charged amines. The Ki for this adduct was ∼9-fold higher than for folate. These various results indicate a balance between folate tail disorder, which helps the enzyme bind substrate while dynamics facilitates catalysis. PMID:26637016

  9. Vibrational structure of dihydrofolate bound to R67 dihydrofolate reductase.

    PubMed

    Deng, H; Callender, R; Howell, E

    2001-12-28

    R67 is a Type II dihydrofolate reductase (DHFR) that catalyzes the reduction of dihydrofolate (DHF) to tetrahydrofolate by facilitating the addition of a proton to N5 of DHF and the transfer of a hydride ion from NADPH to C6. Because this enzyme is a plasmid-encoded DHFR from trimethoprim-resistant bacteria, extensive studies on R67 with various methods have been performed to elucidate its reaction mechanism. Here, Raman difference measurements, conducted on the ternary complex of R67.NADP(+).DHF believed to be an accurate mimic of the productive DHFR.NADPH.DHF complex, show that the pK(a) of N5 in the complex is less than 4. This is in clear contrast to the behavior observed in Escherichia coli DHFR, a substantially more efficient enzyme, where the pK(a) of bound DHF at N5 is increased to 6.5 compared with its solution value of 2.6. A comparison of the ternary complexes in R67 and E. coli DHFRs suggests that enzymic raising of the pK(a) at N5 can significantly increase the catalytic efficiency of the hydride transfer step. However, R67 shows that even without such a strategy an effective DHFR can still be designed.

  10. Microsecond subdomain folding in dihydrofolate reductase.

    PubMed

    Arai, Munehito; Iwakura, Masahiro; Matthews, C Robert; Bilsel, Osman

    2011-07-08

    The characterization of microsecond dynamics in the folding of multisubdomain proteins has been a major challenge in understanding their often complex folding mechanisms. Using a continuous-flow mixing device coupled with fluorescence lifetime detection, we report the microsecond folding dynamics of dihydrofolate reductase (DHFR), a two-subdomain α/β/α sandwich protein known to begin folding in this time range. The global dimensions of early intermediates were monitored by Förster resonance energy transfer, and the dynamic properties of the local Trp environments were monitored by fluorescence lifetime detection. We found that substantial collapse occurs in both the locally connected adenosine binding subdomain and the discontinuous loop subdomain within 35 μs of initiation of folding from the urea unfolded state. During the fastest observable ∼550 μs phase, the discontinuous loop subdomain further contracts, concomitant with the burial of Trp residue(s), as both subdomains achieve a similar degree of compactness. Taken together with previous studies in the millisecond time range, a hierarchical assembly of DHFR--in which each subdomain independently folds, subsequently docks, and then anneals into the native conformation after an initial heterogeneous global collapse--emerges. The progressive acquisition of structure, beginning with a continuously connected subdomain and spreading to distal regions, shows that chain entropy is a significant organizing principle in the folding of multisubdomain proteins and single-domain proteins. Subdomain folding also provides a rationale for the complex kinetics often observed.

  11. Dihydrofolate reductase: A potential drug target in trypanosomes and leishmania

    NASA Astrophysics Data System (ADS)

    Zuccotto, Fabio; Martin, Andrew C. R.; Laskowski, Roman A.; Thornton, Janet M.; Gilbert, Ian H.

    1998-05-01

    Dihydrofolate reductase has successfully been used as a drug target in the area of anti-cancer, anti-bacterial and anti-malarial chemotherapy. Little has been done to evaluate it as a drug target for treatment of the trypanosomiases and leishmaniasis. A crystal structure of Leishmania major dihydrofolate reductase has been published. In this paper, we describe the modelling of Trypanosoma cruzi and Trypanosoma brucei dihydrofolate reductases based on this crystal structure. These structures and models have been used in the comparison of protozoan, bacterial and human enzymes in order to highlight the different features that can be used in the design of selective anti-protozoan agents. Comparison has been made between residues present in the active site, the accessibility of these residues, charge distribution in the active site, and the shape and size of the active sites. Whilst there is a high degree of similarity between protozoan, human and bacterial dihydrofolate reductase active sites, there are differences that provide potential for selective drug design. In particular, we have identified a set of residues which may be important for selective drug design and identified a larger binding pocket in the protozoan than the human and bacterial enzymes.

  12. Dihydrofolate Reductase Activity in Strains of Streptococcus faecium var. durans Resistant to Methasquin and Amethopterin1

    PubMed Central

    Rader, Jeanne I.; Hutchison, Dorris J.

    1972-01-01

    Resistance to the antifolates methasquin and amethopterin has been studied in new strains of Streptococcus faecium var. durans. Two methasquin-resistant strains (SF/MQ, SF/MQT) and an amethopterin-resistant strain (SF/AM) were selected independently from the wild-type S. faecium var. durans (SF/O). SF/MQT is a thymine auxotroph. Total dihydrofolate reductase activity was elevated in each of the resistant strains. The greatest increase (36-fold) was observed in extracts of SF/AM. The methasquin-resistant strains, SF/MQ and SF/MQT, had 29-fold and 8-fold, respectively, more dihydrofolate reductase activity than the parental strain. Total dihydrofolate reductase activity of SF/O was separable by gel filtration into two components: a folate reductase (11%) and a specific dihydrofolate reductase (89%). Folate reductase activity was associated with 88% of the total dihydrofolate reductase activity of SF/MQT, with specific dihydrofolate reductase activity accounting for the remaining 12%. In SF/MQ and SF/AM, folate reductase activity was associated with 97% of the total dihydrofolate reductase activity. Studies of the inhibition by methasquin and amethopterin of partially purified folate reductase and specific dihydrofolate reductase of the mutant strains suggested that resistance was not accompanied by changes in the affinities of these enzymes for either antifolate. PMID:4401600

  13. The dynamic energy landscape of dihydrofolate reductase catalysis.

    PubMed

    Boehr, David D; McElheny, Dan; Dyson, H Jane; Wright, Peter E

    2006-09-15

    We used nuclear magnetic resonance relaxation dispersion to characterize higher energy conformational substates of Escherichia coli dihydrofolate reductase. Each intermediate in the catalytic cycle samples low-lying excited states whose conformations resemble the ground-state structures of preceding and following intermediates. Substrate and cofactor exchange occurs through these excited substates. The maximum hydride transfer and steady-state turnover rates are governed by the dynamics of transitions between ground and excited states of the intermediates. Thus, the modulation of the energy landscape by the bound ligands funnels the enzyme through its reaction cycle along a preferred kinetic path.

  14. Fluorescent analogues of methotrexate: characterization and interaction with dihydrofolate reductase.

    PubMed

    Kumar, A A; Kempton, R J; Anstead, G M; Freisheim, J H

    1983-01-18

    The dansylated derivatives of lysine and ornithine analogues of methotrexate exhibit fluorescence properties characteristic of the dansyl moiety with an excitation at 328 nm and an emission maximum at 580 nm in aqueous media. As in the case of dansyl amino acids, the fluorescence emission is dependent upon the polarity of the medium. In solvents of low dielectric constant there is an enhancement of the dansyl fluorescence intensity as well as a shift to shorter wavelengths. The dansylated analogues show a reduction in the quantum yields as compared to N epsilon-dansyl-L-lysine and 5-(N,N-dimethylamino)-1-naphthalenesulfonic acid. The absorption spectra of the two dansyl analogues are similar to the spectra of the parent basic amino acid precursors but with reduced molar extinction values. The two fluorescent analogues of methotrexate were found to be potent inhibitors of purified dihydrofolate reductases from Lactobacillus casei and from chicken liver. The binding of these fluorescent analogues to either dihydrofolate reductase resulted in 10-15-nm blue shift of the ligand emission maxima and a 2-5-fold enhancement of the emission. These fluorescent properties of the bound ligands indicate a possible interaction of the dansyl moiety with a region on the enzyme molecule which is more hydrophobic relative to the surrounding solvent.

  15. Optical observation of correlated motions in dihydrofolate reductase

    NASA Astrophysics Data System (ADS)

    Xu, Mengyang; Niessen, Katherine; Pace, James; Cody, Vivian; Markelz, Andrea

    2015-03-01

    Enzyme function relies on its structural flexibility to make conformational changes for substrate binding and product release. An example of a metabolic enzyme where such structural changes are vital is dihydrofolate reductase (DHFR). DHFR is essential in both prokaryotes and eukaryotes for the nucleotide biosynthesis by catalyzing the reduction of dihydrofolate to tetrahydrofolate. NMR dynamical measurements found large amplitude fast dynamics that could indicate rigid-body, twisting-hinge motion for ecDHFR that may mediate flux. The role of such long-range correlated motions in function was suggested by the observed sharp decrease in enzyme activity for the single point mutation G121V, which is remote from active sites. This decrease in activity may be caused by the mutation interfering with the long-range intramolecular vibrations necessary for rapid access to functional configurations. We use our new technique of crystal anisotropy terahertz microscopy (CATM), to observe correlated motions in ecDHFR crystals with the bonding of NADPH and methotrexate. We compare the measured intramolecular vibrational spectrum with calculations using normal mode analysis.

  16. Structure and kinetics assays of recombinant Schistosoma mansoni dihydrofolate reductase.

    PubMed

    Serrão, Vitor Hugo Balasco; Romanello, Larissa; Cassago, Alexandre; de Souza, Juliana Roberta Torini; Cheleski, Juliana; DeMarco, Ricardo; Brandão-Neto, José; Pereira, Humberto D'Muniz

    2017-03-11

    The parasite Schistosoma mansoni possesses all pathways for pyrimidine biosynthesis, in which dihydrofolate reductase (DHFR), thymidylate cycle participants, is essential for nucleotide metabolism to obtain energy and structural nucleic acids. Thus, DHFRs have been widely suggested as therapeutic targets for the treatment of infectious diseases. In this study, we expressed recombinant SmDHFR in a heterologous manner to obtain structural, biochemical and kinetic information. X-ray diffraction of recombinant SmDHFR at 1.95Å resolution showed that the structure exhibited the canonical DHFR fold. Isothermal titration calorimetry was used to determine the kinetic constants for NADP(+) and dihydrofolate. Moreover, inhibition assays were performed using the commercial folate analogs methotrexate and aminopterin; these analogs are recognized as folate competitors and are used as chemotherapeutic agents in cancer and autoimmune diseases. This study provides information that may prove useful for the future discovery of novel drugs and for understanding these metabolic steps from this pathway of S. mansoni, thus aiding in our understanding of the function of these essential pathways for parasite metabolism.

  17. Correlated Protein Motion Measurements of Dihydrofolate Reductase Crystals

    NASA Astrophysics Data System (ADS)

    Xu, Mengyang; Niessen, Katherine; Pace, James; Cody, Vivian; Markelz, Andrea

    2014-03-01

    We report the first direct measurements of the long range structural vibrational modes in dihydrofolate reductase (DHFR). DHFR is a universal housekeeping enzyme that catalyzes the reduction of 7,8-dihydrofolate to 5,6,7,8-tetra-hydrofolate, with the aid of coenzyme nicotinamide adenine dinucleotide phosphate (NADPH). This crucial enzymatic role as the target for anti-cancer [methotrexate (MTX)], and other clinically useful drugs, has made DHFR a long-standing target of enzymological studies. The terahertz (THz) frequency range (5-100 cm-1), corresponds to global correlated protein motions. In our lab we have developed Crystal Anisotropy Terahertz Microscopy (CATM), which directly measures these large scale intra-molecular protein vibrations, by removing the relaxational background of the solvent and residue side chain librational motions. We demonstrate narrowband features in the anisotropic absorbance for mouse DHFR with the ligand binding of NADPH and MTX single crystals as well as Escherichia coli DHFR with the ligand binding of NADPH and MTX single crystals. This work is supported by NSF grant MRI2 grant DBI2959989.

  18. Kinetic and Structural Characterization of Dihydrofolate Reductase from Streptococcus pneumoniae

    PubMed Central

    Lee, Jeeyeon; Yennawar, Neela H.; Gam, Jongsik; Benkovic, Stephen J.

    2013-01-01

    Drug resistance associated with dihydrofolate reductase (DHFR) has emerged as a critical issue in the treatment of bacterial infections. In our efforts to understand the mechanism of a drug-resistant dihydrofolate reductase (DHFR) from a pathogenic bacterial source, we report the first kinetic characterization of Streptococcus pneumoniae DHFR (spDHFR) along with its X-ray structure. This study revealed that the kinetic properties of spDHFR were significantly different from E. coli DHFR. The product (tetrahydrofolate) dissociation step that is the rate limiting step in the E. coli DHFR is significantly accelerated in spDHFR so that hydride transfer or a preceding step is rate limiting. Comparison of the binding parameters of this enzyme to a mutant spDHFR (Sp9) confirmed that the Leu100 residue in spDHFR is the critical element for the trimethoprim (TMP) resistance. Steady-state kinetics exhibited a pH dependence in kcat, which prompted us to elucidate the role of the new catalytic residue (His33) in the active site of spDHFR. Structural data of the Sp9 mutant in complex with NADPH and methotrexate confirmed the participation of His33 in a hydrogen bonding network involving a water molecule, the hydroxyl group of Thr119, and carboxylate ion of Glu30. Sequence analysis of the DHFR superfamily revealed that the His residue is the major amino acid component at this position and is found mostly in pathogenic bacterial DHFRs. A mutation of Val100 to Leu demonstrated a steric clash of the leucine side chain with the side chains of Ile8 and Phe34, rationalizing weaker binding of trimethoprim to Leu100 DHFR. Understanding the role of specific amino acids in the active site coupled with detailed structural analysis will inform us on how to better design inhibitors targeting drug resistant pathogenic bacterial DHFRs. PMID:19950924

  19. Amplification and loss of dihydrofolate reductase genes in a Chinese hamster ovary cell line

    SciTech Connect

    Kaufman, R.J.; Schimke, R.T.

    1981-12-01

    During stepwise increases in the methotrexate concentration in culture medium, the authors selected Chinese hamster ovary cells that contained elevated dihydrofolate reductase levels which were proportional to the number of dihydrofolate reductase gene copies (i.e., gene amplification). The authors studied the dihydrofolate reductase levels in individual cells that underwent the initial steps of methotrexate resistance by using the fluorescence-activated cell sorter technique. Such cells constituted a heterogeneous population with differing dihydrofolate reductase levels, and they characteristically lost the elevated enzyme levels when they were grown in the absence of methotrexate. The progeny of individual cells with high enzyme levels behaved differently and could lose all or variable numbers of the amplified genes.

  20. Methotrexate-resistant form of dihydrofolate reductase protects transgenic murine embryos from teratogenic effects of methotrexate.

    PubMed

    Sutton, C; McIvor, R S; Vagt, M; Doggett, B; Kapur, R P

    1998-01-01

    Methotrexate, a potent inhibitor of the ubiquitously expressed enzyme dihydrofolate reductase, induces limb and facial anomalies that resemble vascular disruptions in their evolution and final outcome. Previous studies suggest that inhibition of dihydrofolate reductase is responsible for methotrexate-induced embryopathy, although specific sites of methotrexate activity have not been well defined. In this report, we show that constitutive expression of a methotrexate-resistant form of dihydrofolate reductase in transgenic embryos and their placentas ameliorates methotrexate teratogenicity. However, expression of the transgene in maternal tissues had no significant protective effect. The results confirm the role of dihydrofolate reductase inhibition in the pathogenesis of methotrexate-induced birth defects and provide a foundation for future studies of targeted transgene expression in select embryonic or placental cell populations.

  1. Hydride transfer during catalysis by dihydrofolate reductase from Thermotoga maritima.

    PubMed Central

    Maglia, Giovanni; Javed, Masood H; Allemann, Rudolf K

    2003-01-01

    DHFR (dihydrofolate reductase) catalyses the metabolically important reduction of 7,8-dihydrofolate by NADPH. DHFR from the hyperthermophilic bacterium Thermotoga maritima (TmDHFR), which shares similarity with DHFR from Escherichia coli, has previously been characterized structurally. Its tertiary structure is similar to that of DHFR from E. coli but it is the only DHFR characterized so far that relies on dimerization for stability. The midpoint of the thermal unfolding of TmDHFR was at approx. 83 degrees C, which was 30 degrees C higher than the melting temperature of DHFR from E. coli. The turnover and the hydride-transfer rates in the kinetic scheme of TmDHFR were derived from measurements of the steady-state and pre-steady-state kinetics using absorbance and stopped-flow fluorescence spectroscopy. The rate constant for hydride transfer was found to depend strongly on the temperature and the pH of the solution. Hydride transfer was slow (0.14 s(-1) at 25 degrees C) and at least partially rate limiting at low temperatures but increased dramatically with temperature. At 80 degrees C the hydride-transfer rate of TmDHFR was 20 times lower than that observed for the E. coli enzyme at its physiological temperature. Hydride transfer depended on ionization of a single group in the active site with a p K(a) of 6.0. While at 30 degrees C, turnover of substrate by TmDHFR was almost two orders of magnitude slower than by DHFR from E. coli; the steady-state rates of the two enzymes differed only 8-fold at their respective working temperatures. PMID:12765545

  2. Inhibition of Bacterial Dihydrofolate Reductase by 6-Alkyl-2,4-diaminopyrimidines

    PubMed Central

    Nammalwar, Baskar; Bourne, Christina R.; Bunce, Richard A.; Wakeham, Nancy; Bourne, Philip C.; Ramnarayan, Kal; Mylvaganam, Shankari; Berlin, K. Darrell; Barrow, Esther W.; Barrow, William W.

    2012-01-01

    A series of (±)-6-alkyl-2,4-diaminopyrimidine-based inhibitors of bacterial dihydrofolate reductase (DHFR) have been prepared and evaluated for biological potency against Bacillus anthracis and Staphylococcus aureus. Biological studies reveal attenuated activity relative to earlier structures lacking substitution at C6 of the diaminopyrimidine moiety, though minimum inhibitory concentration (MIC) values are in the 0.125–8 μg/mL range for both organisms. This effect was rationalized from previous three-dimensional X-ray structure studies that indicate the presence of a side pocket containing two water molecules adjacent to the main binding pocket. Because of the hydrophobic nature of the substitutions at C6 the main interactions are with protein residues Leu20 and Leu28. These interactions lead to a minor conformational change in the protein, which opens the pocket containing these waters such that it is continuous with the main binding pocket. These water molecules are reported to play a critical role in the catalytic reaction. This highlights a new area for inhibitor expansion within the limited architectural variation at the catalytic site of bacterial DHFR. PMID:22930550

  3. Lausannevirus Encodes a Functional Dihydrofolate Reductase Susceptible to Proguanil

    PubMed Central

    Mueller, L.; Hauser, P. M.; Gauye, F.

    2017-01-01

    ABSTRACT Lausannevirus belongs to the family Marseilleviridae within the group of nucleocytoplasmic large DNA viruses (NCLDVs). These giant viruses exhibit unique features, including a large genome, ranging from 100 kb to 2.5 Mb and including from 150 to more than 2,500 genes, as well as the presence of genes coding for proteins involved in transcription and translation. The large majority of Lausannevirus open reading frames have unknown functions. Interestingly, a bifunctional dihydrofolate reductase-thymidylate synthase (DHFR-TS) is encoded in the Lausannevirus genome. The enzyme plays central roles in DNA precursor biosynthesis. DHFR is the pharmacological target of antifolates, such as trimethoprim, pyrimethamine, and proguanil. First, the functionality of Lausannevirus DHFR-TS was demonstrated by the successful complementation of a DHFR-deficient Saccharomyces cerevisiae strain with a plasmid expressing the heterologous gene. Additionally, using this heterologous expression system, we demonstrated the in vitro susceptibility of Lausannevirus DHFR-TS to proguanil and its resistance to pyrimethamine and trimethoprim. Proguanil may provide a unique and useful treatment if Lausannevirus proves to be a human pathogen. To our knowledge, this is the first time that a DHFR-TS has been described and characterized in an NCLDV. PMID:28137801

  4. Ligand-Dependent Conformational Dynamics of Dihydrofolate Reductase

    PubMed Central

    Reddish, Michael J.; Vaughn, Morgan B.; Fu, Rong; Dyer, R. Brian

    2016-01-01

    Enzymes are known to change among several conformational states during turnover. The role of such dynamic structural changes in catalysis is not fully understood. The influence of dynamics in catalysis can be inferred, but not proven, by comparison of equilibrium structures of protein variants and protein–ligand complexes. A more direct way to establish connections between protein dynamics and the catalytic cycle is to probe the kinetics of specific protein motions in comparison to progress along the reaction coordinate. We have examined the enzyme model system dihydrofolate reductase (DHFR) from Escherichia coli with tryptophan fluorescence-probed temperature-jump spectroscopy. We aimed to observe the kinetics of the ligand binding and ligand-induced conformational changes of three DHFR complexes to establish the relationship among these catalytic steps. Surprisingly, in all three complexes, the observed kinetics do not match a simple sequential two-step process. Through analysis of the relationship between ligand concentration and observed rate, we conclude that the observed kinetics correspond to the ligand binding step of the reaction and a noncoupled enzyme conformational change. The kinetics of the conformational change vary with the ligand's identity and presence but do not appear to be directly related to progress along the reaction coordinate. These results emphasize the need for kinetic studies of DHFR with highly specific spectroscopic probes to determine which dynamic events are coupled to the catalytic cycle and which are not. PMID:26901612

  5. A second target of benzamide riboside: dihydrofolate reductase.

    PubMed

    Roussel, Breton; Johnson-Farley, Nadine; Kerrigan, John E; Scotto, Kathleen W; Banerjee, Debabrata; Felczak, Krzysztof; Pankiewicz, Krzysztof W; Gounder, Murugesan; Lin, HongXia; Abali, Emine Ercikan; Bertino, Joseph R

    2012-11-01

    Dihydrofolate reductase (DHFR) is an essential enzyme involved in de novo purine and thymidine biosynthesis. For several decades, selective inhibition of DHFR has proven to be a potent therapeutic approach in the treatment of various cancers including acute lymphoblastic leukemia, non-Hodgkin's lymphoma, osteogenic sarcoma, carcinoma of the breast, and head and neck cancer. Therapeutic success with DHFR inhibitor methotrexate (MTX) has been compromised in the clinic, which limits the success of MTX treatment by both acquired and intrinsic resistance mechanisms. We report that benzamide riboside (BR), via anabolism to benzamide adenine dinucleotide (BAD) known to potently inhibit inosine monophosphate dehydrogenase (IMPDH), also inhibits cell growth through a mechanism involving downregulation of DHFR protein. Evidence to support this second site of action of BR includes the finding that CCRF-CEM/R human T-cell lymphoblasic leukemia cells, resistant to MTX as a consequence of gene amplification and overexpression of DHFR, are more resistant to BR than are parental cells. Studies of the mechanism by which BR lowers DHFR showed that BR, through its metabolite BAD, reduced NADP and NADPH cellular levels by inhibiting nicotinamide adenine dinucleotide kinase (NADK). As consequence of the lack of NADPH, DHFR was shown to be destabilized. We suggest that, inhibition of NADK is a new approach to downregulate DHFR and to inhibit cell growth.

  6. Solvent effects on catalysis by Escherichia coli dihydrofolate reductase.

    PubMed

    Loveridge, E Joel; Tey, Lai-Hock; Allemann, Rudolf K

    2010-01-27

    Hydride transfer catalyzed by dihydrofolate reductase (DHFR) has been described previously within an environmentally coupled model of hydrogen tunneling, where protein motions control binding of substrate and cofactor to generate a tunneling ready conformation and modulate the width of the activation barrier and hence the reaction rate. Changes to the composition of the reaction medium are known to perturb protein motions. We have measured kinetic parameters of the reaction catalyzed by DHFR from Escherichia coli in the presence of various cosolvents and cosolutes and show that the dielectric constant, but not the viscosity, of the reaction medium affects the rate of reaction. Neither the primary kinetic isotope effect on the reaction nor its temperature dependence were affected by changes to the bulk solvent properties. These results are in agreement with our previous report on the effect of solvent composition on catalysis by DHFR from the hyperthermophile Thermotoga maritima. However, the effect of solvent on the temperature dependence of the kinetic isotope effect on hydride transfer catalyzed by E. coli DHFR is difficult to explain within a model, in which long-range motions couple to the chemical step of the reaction, but may indicate the existence of a short-range promoting vibration or the presence of multiple nearly isoenergetic conformational substates of enzymes with similar but distinct catalytic properties.

  7. Recombinant bovine dihydrofolate reductase produced by mutagenesis and nested PCR of murine dihydrofolate reductase cDNA.

    PubMed

    Cody, Vivian; Mao, Qilong; Queener, Sherry F

    2008-11-01

    Recent reports of the slow-tight binding inhibition of bovine liver dihydrofolate reductase (bDHFR) in the presence of polyphenols isolated from green tea leaves has spurred renewed interest in the biochemical properties of bDHFR. Earlier studies were done with native bDHFR but in order to validate models of polyphenol binding to bDHFR, larger quantities of bDHFR are necessary to support structural studies. Bovine DHFR differs from its closest sequence homologue, murine DHFR, by 19 amino acids. To obtain the bDHFR cDNA, murineDHFR cDNA was transformed by a series of nested PCRs to reproduce the amino acid coding sequence for bovine DHFR. The bovine liver DHFR cDNA has an open reading frame of 561 base pairs encoding a protein of 187 amino acids that has a high level of conservation at the primary sequence level with other DHFR enzymes, and more so for the amino acid residues in the active site of the mammalian DHFR enzymes. Expression of the bovine DHFR cDNA in bacterial cells produced a stable recombinant protein with high enzymatic activity and kinetic properties similar to those previously reported for the native protein.

  8. A DFT-based QSAR study on inhibition of human dihydrofolate reductase.

    PubMed

    Karabulut, Sedat; Sizochenko, Natalia; Orhan, Adnan; Leszczynski, Jerzy

    2016-11-01

    Diaminopyrimidine derivatives are frequently used as inhibitors of human dihydrofolate reductase, for example in treatment of patients whose immune system are affected by human immunodeficiency virus. Forty-seven dicyclic and tricyclic potential inhibitors of human dihydrofolate reductase were analyzed using the quantitative structure-activity analysis supported by DFT-based and DRAGON-based descriptors. The developed model yielded an RMSE deviation of 1.1 a correlation coefficient of 0.81. The prediction set was characterized by R(2)=0.60 and RMSE=3.59. Factors responsible for inhibition process were identified and discussed. The resulting model was validated via cross validation and Y-scrambling procedure. From the best model, we found several mass-related descriptors and Sanderson electronegativity-related descriptors that have the best correlations with the investigated inhibitory concentration. These descriptors reflect results from QSAR studies based on characteristics of human dihydrofolate reductase inhibitors.

  9. Human endothelial dihydrofolate reductase low activity limits vascular tetrahydrobiopterin recycling.

    PubMed

    Whitsett, Jennifer; Rangel Filho, Artur; Sethumadhavan, Savitha; Celinska, Joanna; Widlansky, Michael; Vasquez-Vivar, Jeannette

    2013-10-01

    Tetrahydrobiopterin (BH₄) is required for NO synthesis and inhibition of superoxide release from endothelial NO synthase. Clinical trials using BH₄ to treat endothelial dysfunction have produced mixed results. Poor outcomes may be explained by the rapid systemic and cellular oxidation of BH₄. One of the oxidation products of BH₄, 7,8-dihydrobiopterin (7,8-BH₂), is recycled back to BH₄ by dihydrofolate reductase (DHFR). This enzyme is ubiquitously distributed and shows a wide range of activity depending on species-specific factors and cell type. Information about the kinetics and efficiency of BH4 recycling in human endothelial cells receiving BH₄ treatment is lacking. To characterize this reaction, we applied a novel multielectrode coulometric HPLC method that enabled the direct quantification of 7,8-BH₂ and BH₄, which is not possible with fluorescence-based methodologies. We found that basal untreated BH₄ and 7,8-BH₂ concentrations in human endothelial cells (ECs) are lower than in bovine and murine endothelioma cells. Treatment of human ECs with BH₄ transiently increased intracellular BH₄ while accumulating the more stable 7,8-BH₂. This was different from bovine or murine ECs, which resulted in preferential BH₄ increase. Using BH₄ diastereomers, 6S-BH₄ and 6R-BH₄, the narrow contribution of enzymatic DHFR recycling to total intracellular BH₄ was demonstrated. Reduction of 7,8-BH₂ to BH₄ occurs at very slow rates in cells and needs supraphysiological levels of 7,8-BH₂, indicating this reaction is kinetically limited. Activity assays verified that human DHFR has very low affinity for 7,8-BH₂ (DHF7,8-BH₂) and folic acid inhibits 7,8-BH₂ recycling. We conclude that low activity of endothelial DHFR is an important factor limiting the benefits of BH4 therapies, which may be further aggravated by folate supplements.

  10. Environmental Adaptation of Dihydrofolate Reductase from Deep-Sea Bacteria.

    PubMed

    Ohmae, Eiji; Gekko, Kunihiko; Kato, Chiaki

    2015-01-01

    In order to elucidate the molecular adaptation mechanisms of enzymes to the high hydrostatic pressure of the deep sea, we cloned, purified, and characterized more than ten dihydrofolate reductases (DHFRs) from bacteria living in deep-sea and ambient atmospheric pressure environments. The nucleotide and amino acid sequences of these DHFRs indicate the deep-sea bacteria are adapted to their environments after the differentiation of their genus from ancestors inhabiting atmospheric pressure environments. In particular, the backbone structure of the deep-sea DHFR from Moritella profunda (mpDHFR) almost overlapped with the normal homolog from Escherichia coli (ecDHFR). Thus, those of other DHFRs would also overlap on the basis of their sequence similarities. However, the structural stability of both DHFRs was quite different: compared to ecDHFR, mpDHFR was more thermally stable but less stable against urea and pressure unfolding. The smaller volume changes due to unfolding suggest that the native structure of mpDHFR has a smaller cavity and/or enhanced hydration compared to ecDHFR. High hydrostatic pressure reduced the enzymatic activity of many DHFRs, but three deep-sea DHFRs and the D27E mutant of ecDHFR exhibited pressure-dependent activation. The inverted activation volumes from positive to negative values indicate the modification of their structural dynamics, conversion of the rate-determining step of the enzymatic reaction, and different contributions of the cavity and hydration to the transition-state structure. Since the cavity and hydration depend on amino acid side chains, DHFRs would adapt to the deep-sea environment by regulating the cavity and hydration by substituting their amino acid side chains without altering their backbone structure. The results of this study clearly indicate that the cavity and hydration play important roles in the adaptation of enzymes to the deep-sea environment.

  11. The Effect of Protein Mass Modulation on Human Dihydrofolate Reductase

    PubMed Central

    Francis, Kevin; Sapienza, Paul J.; Lee, Andrew L.; Kohen, Amnon

    2016-01-01

    Dihydrofolate reductase (DHFR) from Escherichia coli has long served as a model enzyme with which to elucidate possible links between protein dynamics and the catalyzed reaction. Such physical properties of its human counterpart have not been rigorously studied so far, but recent computer-based simulations suggest that these two DHFRs differ significantly in how closely coupled the protein dynamics and the catalyzed C-H→C hydride transfer step are. To test this prediction, two contemporary probes for studying the effect of protein dynamics on catalysis were combined here: temperature dependence of intrinsic kinetic isotope effects (KIEs) that are sensitive to the physical nature of the chemical step, and protein mass-modulation that slows down fast dynamics (femto- to picosecond timescale) throughout the protein. The intrinsic H/T KIEs of human DHFR, like those of E. coli DHFR, are shown to be temperature-independent in the range from 5–45 °C, indicating fast sampling of donor and acceptor distances (DADs) at the reaction’s transition state (or tunneling ready state – TRS). Mass modulation of these enzymes through isotopic labeling with 13C, 15N, and 2H at nonexchangeable hydrogens yield an 11% heavier enzyme. The additional mass has no effect on the intrinsic KIEs of the human enzyme. This finding indicates that the mass-modulation of the human DHFR affects neither DAD distribution nor the DAD’s conformational sampling dynamics. Furthermore, reduction in the enzymatic turnover number and the dissociation rate constant for the product indicate that the isotopic substitution affects kinetic steps that are not the catalyzed C-H→C hydride transfer. The findings are discussed in terms of fast dynamics and their role in catalysis, the comparison of calculations and experiments, and the interpretation of isotopically-modulated heavy enzymes in general. PMID:26813442

  12. Endothelial human dihydrofolate reductase low activity limits vascular tetrahydrobiopterin recycling

    PubMed Central

    Whitsett, Jennifer; Filho, Artur Rangel; Sethumadhavan, Savitha; Celinska, Joanna; Widlansky, Michael; Vásquez-Vivar, Jeannette

    2013-01-01

    Tetrahydrobiopterin (BH4) is required for NO synthesis and inhibition of superoxide release from eNOS. Clinical trials using BH4 to treat endothelial dysfunction have produced mixed results. Poor outcomes may be explained by the rapid systemic and cellular oxidation of BH4. One of the oxidation products of BH4, 7,8-dihydrobiopterin (7,8-BH2), is recycled back to BH4 by dihydrofolate reductase (DHFR). This enzyme is ubiquitously distributed and shows a wide range of activity depending on species-specific factors and cell type. Information about the kinetics and efficiency of BH4 recycling in human endothelial cells receiving BH4 treatment is lacking. To characterize this reaction, we applied a novel multi-electrode coulometric HPLC method that enabled the direct quantification of 7,8-BH2 and BH4 which is not possible with fluorescent-based methodologies. We found that basal untreated BH4 and 7,8-BH2 concentrations in human ECs is lower than bovine and murine endothelioma cells. Treatment of human ECs with BH4 transiently increased intracellular BH4 while accumulating the more stable 7,8-BH2. This was different from bovine or murine ECs that resulted in preferential BH4 increase. Using BH4 diastereomers, 6S-BH4 and 6R-BH4, the narrow contribution of enzymatic DHFR recycling to total intracellular BH4 was demonstrated. Reduction of 7,8-BH2 to BH4 occurs at very slow rates in cells and needs supra-physiological levels of 7,8-BH2, indicating this reaction is kinetically limited. Activity assays verified that hDHFR has very low affinity for 7,8-BH2 (DHF7,8-BH2) and folic acid inhibits 7,8-BH2 recycling. We conclude that low activity of endothelial DHFR is an important factor limiting the benefits of BH4 therapies which may be further aggravated by folate supplements. PMID:23707606

  13. The crystal structure of dihydrofolate reductase from Thermotoga maritima: molecular features of thermostability.

    PubMed

    Dams, T; Auerbach, G; Bader, G; Jacob, U; Ploom, T; Huber, R; Jaenicke, R

    2000-03-31

    Two high-resolution structures have been obtained for dihydrofolate reductase from the hyperthermophilic bacterium Thermotoga maritima in its unliganded state, and in its ternary complex with the cofactor NADPH and the inhibitor, methotrexate. While the overall fold of the hyperthermophilic enzyme is closely similar to monomeric mesophilic dihydrofolate reductase molecules, its quaternary structure is exceptional, in that T. maritima dihydrofolate reductase forms a highly stable homodimer. Here, the molecular reasons for the high intrinsic stability of the enzyme are elaborated and put in context with the available data on the physical parameters governing the folding reaction. The molecule is extremely rigid, even with respect to structural changes during substrate binding and turnover. Subunit cooperativity can be excluded from structural and biochemical data. Major contributions to the high intrinsic stability of the enzyme result from the formation of the dimer. Within the monomer, only subtle stabilizing interactions are detectable, without clear evidence for any of the typical increments of thermal stabilization commonly reported for hyperthermophilic proteins. The docking of the subunits is optimized with respect to high packing density in the dimer interface, additional salt-bridges and beta-sheets. The enzyme does not show significant structural changes upon binding its coenzyme, NADPH, and the inhibitor, methotrexate. The active-site loop, which is known to play an important role in catalysis in mesophilic dihydrofolate reductase molecules, is rearranged, participating in the association of the subunits; it no longer participates in catalysis.

  14. Loss and stabilization of amplified dihydrofolate reductase genes in mouse sarcoma S-180 cell lines

    SciTech Connect

    Kaufman, R.J.; Brown, P.C.; Schimke, R.T.

    1981-12-01

    The authors studied the loss and stabilization of dihydrofolate reductase genes in clones of a methotrexate-resistant murine S-180 cell line. These cells contained multiple copies of the dihydrofolate reductase gene which were associated with double minute chromosomes. The growth rate of these cells in the absence of methotrexate was inversely related to the degree of gene amplification (number of double minute chromosomes). Cells could both gain and lose genes as a result of an unequal distribution of double minute chromosomes into daughter cells at mitosis. The loss of amplified dihydrofolate reductase genes during growth in the absence of methotrexate resulted from the continual generation of cells containing lower numbers of double minute chromosomes. Because of the growth advantage of these cells, they became dominant in the population. They also studied an unstably resistant S-180 cell line (clone) that, after 3 years of continuous growth in methotrexate, generated cells containing stably amplified dihydrofolate reductase genes. These genes were present on one or more chromosomes, and they were retained in a stable state.

  15. Assignment of the human dihydrofolate reductase gene to the q11. -->. q22 region of chromosome 5

    SciTech Connect

    Funanage, V.L.; Myoda, T.T.; Moses, P.A.; Cowell, H.R.

    1984-10-01

    Cells from a dihydrofolate reductase-deficit Chinese hamster ovary cell line were hybridized to human fetal skin fibroblast cells. Nineteen dihydrofolate reductase-positive hybrid clones were isolated and characterized. Cytogenetic and biochemical analyses of these clones have shown that the human dihydrofolate reductase (DHFR) gene is located on chromosome 5. Three of these hybrid cell lines contained different terminal deletions of chromosome 5. An analysis of the breakpoints of these deletions has demonstrated that the DHFR gene resides in the q11..-->..q22 region.

  16. A qualitative and quantitative cytochemical assay of dihydrofolate reductase in erythroid cells.

    PubMed

    Nano, R; Gerzeli, G; Invernizzi, R; Supino, R

    1989-01-01

    The distribution and intensity of dihydrofolate reductase (DHFR) cytochemically demonstrable was studied in erythroid cells. Cells of normal human bone marrow, of human erythroleukaemia (M6), and cells of the Friend (MEL) clone 745A murine erythroleukaemia (also after differentiation with dimethylsulphoxide, DMSO) were stained according to Gerzeli and de Piceis Polver (1969) technique; quantification of the reaction product was made using a Vickers M86 microdensitometer. The enzyme activity progressively decreased during the normal differentiation of the erythropoietic series while persisted at high levels in erythroleukaemia cells. It can be suggested that in the 1st case, the cytochemical pattern of dihydrofolate reductase may be a useful added tool for studying the erythroid differentiation. In the 2nd case, the increased level of this enzyme may be related to an amplification of the gene of DHFR in the malignant transformation.

  17. Dihydrofolate reductase as a model for studies of enzyme dynamics and catalysis

    PubMed Central

    Kohen, Amnon

    2015-01-01

    Dihydrofolate reductase from Escherichia coli (ecDHFR) serves as a model system for investigating the role of protein dynamics in enzyme catalysis. We discuss calculations predicting a network of dynamic motions that is coupled to the chemical step catalyzed by this enzyme. Kinetic studies testing these predictions are presented, and their potential use in better understanding the role of these dynamics in enzyme catalysis is considered. The cumulative results implicate motions across the entire protein in catalysis. PMID:26918149

  18. How native-state topology affects the folding of dihydrofolate reductase and interleukin-1

    NASA Astrophysics Data System (ADS)

    Clementi, Cecilia; Jennings, Patricia A.; Onuchic, José N.

    2000-05-01

    The overall structure of the transition-state and intermediate ensembles observed experimentally for dihydrofolate reductase and interleukin-1 can be obtained by using simplified models that have almost no energetic frustration. The predictive power of these models suggests that, even for these very large proteins with completely different folding mechanisms and functions, real protein sequences are sufficiently well designed, and much of the structural heterogeneity observed in the intermediates and the transition-state ensembles is determined by topological effects.

  19. Functional significance of evolving protein sequence in dihydrofolate reductase from bacteria to humans.

    PubMed

    Liu, C Tony; Hanoian, Philip; French, Jarrod B; Pringle, Thomas H; Hammes-Schiffer, Sharon; Benkovic, Stephen J

    2013-06-18

    With the rapidly growing wealth of genomic data, experimental inquiries on the functional significance of important divergence sites in protein evolution are becoming more accessible. Here we trace the evolution of dihydrofolate reductase (DHFR) and identify multiple key divergence sites among 233 species between humans and bacteria. We connect these sites, experimentally and computationally, to changes in the enzyme's binding properties and catalytic efficiency. One of the identified evolutionarily important sites is the N23PP modification (∼mid-Devonian, 415-385 Mya), which alters the conformational states of the active site loop in Escherichia coli dihydrofolate reductase and negatively impacts catalysis. This enzyme activity was restored with the inclusion of an evolutionarily significant lid domain (G51PEKN in E. coli enzyme; ∼2.4 Gya). Guided by this evolutionary genomic analysis, we generated a human-like E. coli dihydrofolate reductase variant through three simple mutations despite only 26% sequence identity between native human and E. coli DHFRs. Molecular dynamics simulations indicate that the overall conformational motions of the protein within a common scaffold are retained throughout evolution, although subtle changes to the equilibrium conformational sampling altered the free energy barrier of the enzymatic reaction in some cases. The data presented here provide a glimpse into the evolutionary trajectory of functional DHFR through its protein sequence space that lead to the diverged binding and catalytic properties of the E. coli and human enzymes.

  20. Over-production of dihydrofolate reductase leads to sulfa-dihydropteroate resistance in yeast.

    PubMed

    Patel, Onisha; Karnik, Kuldeep; Macreadie, Ian G

    2004-07-15

    Dihydropteroate synthase (DHPS) can metabolise sulfa drugs into sulfa-dihydropteroate (sulfa-DHP), which inhibits cell growth through competition with dihydrofolate (DHF), possibly indicating dihydrofolate reductase (DHFR) as the target of sulfa-DHP. The effect of over-production of DHFR on sulfa-DHP resistance was examined in Saccharomyces cerevisiae using a strain that requires DHF for growth. This strain was transformed with a plasmid which encodes over-production of DHFR in the presence of CuSO4. Over-production led to resistance to sulfa-DHP suggesting that sulfa-DHP targets DHFR. Spontaneous mutants hyper-resistant to sulfa-DHP did not show any changes within DHFR.

  1. Relationship of amplified dihydrofolate reductase genes to double minute chromosomes in unstably resistant mouse fibroblast cell lines.

    PubMed Central

    Brown, P C; Beverley, S M; Schimke, R T

    1981-01-01

    Murine 3T6 selected in increasing concentrations of methotrexate were unstable with respect to dihydrofolate reductase overproduction and methotrexate resistance when they are cultured in the absence of methotrexate. An analysis of the karyotypes of these resistant cells revealed the presence of numerous double minute chromosomes. We observed essentially identical kinetics of loss of dihydrofolate reductase gene sequences in total deoxyribonucleic acid and in deoxyribonucleic acid from fractions enriched in double minute chromosomes and in the numbers of double minute chromosomes per cell during reversion to methotrexate sensitivity, and this suggested that unstably amplified gene sequences were localized on double minute chromosomes. This conclusion ws also supported by an analysis of cell populations sorted according to dihydrofolate reductase enzyme contents, in which relative gene amplification and double minute chromosome content were related proportionally. Images PMID:6287217

  2. Enhancement of methotrexate resistance and dihydrofolate reductase gene amplification by treatment of mouse 3T6 cells with hydroxyurea.

    PubMed Central

    Brown, P C; Tlsty, T D; Schimke, R T

    1983-01-01

    We investigated various parameters associated with the initial selection of mouse 3T6 cells for resistance to single concentrations of methotrexate and characterized resistant colonies for the presence of additional (amplified) copies of the dihydrofolate reductase gene. Our results indicate that the frequency of occurrence of dihydrofolate reductase gene amplification varies with the selecting concentration of methotrexate and is highly variable between clonally derived sublines of mouse 3T6 cells. Second, we increased the frequency of occurrence of cells with amplified dihydrofolate reductase genes by transiently inhibiting DNA synthesis with hydroxyurea before the selection of cells in single concentrations of methotrexate. This effect was dependent on the concentration of hydroxyurea, the time of exposure to the drug, and the time interval between the removal of hydroxyurea and the selection of cells in methotrexate. Images PMID:6877240

  3. [Comparison of Physico-chemical Aspects between E. coli and Human Dihydrofolate Reductase: an Equilibrium Unfolding Study].

    PubMed

    Thapliyal, Charu; Jain, Neha; Chaudhuri, Pratima

    2015-01-01

    A protein, differing in origin, may exhibit variable physicochemical behaviour, difference in sequence homology, fold and function. Thus studying structure-function relationship of proteins from altered sources is meaningful in the sense that it may give rise to comparative aspects of their sequence-structure-function relationship. Dihydrofolate reductase is an enzyme involved in cell cycle regulation. It is a significant enzyme as.a target for developing anticancer drugs. Hence, detailed understanding of structure-function relationships of wide variants of the enzyme dihydrofolate reductase would be important for developing an inhibitor or an antagonist against the enzyme involved in the cellular developmental processes. In this communication, we have reported the comparative structure-function relationship between E. coli and human dihydrofolate reductase. The differences in the unfolding behaviour of these two proteins have been investigated to understand various properties of these two proteins like relative' stability differences and variation in conformational changes under identical denaturing conditions. The equilibrium unfolding mechanism of dihydrofolate reductase proteins using guanidine hydrochloride as a denaturant in the presence of various types of osmolytes has been monitored using loss in enzymatic activity, intrinsic tryptophan fluorescence and an extrinsic fluorophore 8-anilino-1-naphthalene-sulfonic acid as probes. It has been observed that osmolytes, such as 1M sucrose, and 30% glycerol, provided enhanced stability to both variants of dihydrofolate reductase. Their level of stabilisation has been observed to be dependent on intrinsic protein stability. It was observed that 100 mM proline does not show any 'significant stabilisation to either of dihydrofolate reductases. In the present study, it has been observed that the human protein is relatively less stable than the E.coli counterpart.

  4. Quinazolinone-benzimidazole conjugates: Synthesis, characterization, dihydrofolate reductase inhibition, DNA and protein binding properties.

    PubMed

    Singla, Prinka; Luxami, Vijay; Paul, Kamaldeep

    2017-03-01

    Quinazolinone and benzimidazole represent as important and abundant classes of fused nitrogen-containing heterocycle. A series of two isomeric quinazolinone-benzimidazole conjugates is synthesized and substitutes with different aromatic rings. These compounds are well characterized by (1)H and (13)C NMR as well as mass spectrometry. Compounds are then evaluated by dihydrofolate reductase inhibitory activity. In vitro assay shows that some compounds are exhibiting significant dihydrofolate reductase inhibitory activities. Compound 14 shows comparable or even superior inhibitory activity with IC50 value of 0.011μM in contrast to methotrexate (IC50=0.02μM). The preliminary interactive investigation of compound 14 is studied with calf thymus DNA by UV-visible and fluorescence spectroscopy. It reveals that compound 14 is effectively intercalated with ct-DNA to form 14.DNA complex which is further supported by ethidium bromide (EB) displacement studies. The compound 14 also shows strong interaction with bovine serum albumin that can helpful in the design, modification and screening of drug molecules. The binding interactions of compound 14 with bovine serum albumin demonstrate that hydrogen bonds and van der Waals forces play important roles in the strong association of compound 14.BSA. These compounds can be considered as useful templates for future development and further derivatization or modification will be helpful to obtain more potent compounds. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Synthesis and characterization of potent inhibitors of Trypanosoma cruzi dihydrofolate reductase

    SciTech Connect

    Schormann, Norbert; Velu, Sadanandan E.; Murugesan, Srinivasan; Senkovich, Olga; Walker, Kiera; Chenna, Bala C.; Shinkre, Bidhan; Desai, Amar; Chattopadhyay, Debasish

    2010-09-17

    Dihydrofolate reductase (DHFR) of the parasite Trypanosoma cruzi (T. cruzi) is a potential target for developing drugs to treat Chagas disease. We have undertaken a detailed structure-activity study of this enzyme. We report here synthesis and characterization of six potent inhibitors of the parasitic enzyme. Inhibitory activity of each compound was determined against T. cruzi and human DHFR. One of these compounds, ethyl 4-(5-[(2,4-diamino-6-quinazolinyl)methyl]amino-2-methoxyphenoxy)butanoate (6b) was co-crystallized with the bifunctional dihydrofolate reductase-thymidylate synthase enzyme of T. cruzi and the crystal structure of the ternary enzyme:cofactor:inhibitor complex was determined. Molecular docking was used to analyze the potential interactions of all inhibitors with T. cruzi DHFR and human DHFR. Inhibitory activities of these compounds are discussed in the light of enzyme-ligand interactions. Binding affinities of each inhibitor for the respective enzymes were calculated based on the experimental or docked binding mode. An estimated 60-70% of the total binding energy is contributed by the 2,4-diaminoquinazoline scaffold.

  6. Inhibitor-bound complexes of dihydrofolate reductase-thymidylate synthase from Babesia bovis

    PubMed Central

    Begley, Darren W.; Edwards, Thomas E.; Raymond, Amy C.; Smith, Eric R.; Hartley, Robert C.; Abendroth, Jan; Sankaran, Banumathi; Lorimer, Donald D.; Myler, Peter J.; Staker, Bart L.; Stewart, Lance J.

    2011-01-01

    Babesiosis is a tick-borne disease caused by eukaryotic Babesia parasites which are morphologically similar to Plasmodium falciparum, the causative agent of malaria in humans. Like Plasmodium, different species of Babesia are tuned to infect different mammalian hosts, including rats, dogs, horses and cattle. Most species of Plasmodium and Babesia possess an essential bifunctional enzyme for nucleotide synthesis and folate metabolism: dihydrofolate reductase-thymidylate synthase. Although thymidylate synthase is highly conserved across organisms, the bifunctional form of this enzyme is relatively uncommon in nature. The structural characterization of dihydrofolate reductase-thymidylate synthase in Babesia bovis, the causative agent of babesiosis in livestock cattle, is reported here. The apo state is compared with structures that contain dUMP, NADP and two different antifolate inhibitors: pemetrexed and raltitrexed. The complexes reveal modes of binding similar to that seen in drug-resistant malaria strains and point to the utility of applying structural studies with proven cancer chemotherapies towards infectious disease research. PMID:21904052

  7. Dihydrofolate reductase: low-resolution mass-spectrometric analysis of an elastase digest as a sequencing tool (Short Communication)

    PubMed Central

    Morris, Howard R.; Batley, Karen E.; Harding, Nigel G. L.; Bjur, Richard A.; Dann, John G.; King, Rodney W.

    1974-01-01

    An elastase digest of a protein of unknown structure, dihydrofolate reductase, was studied by mass spectrometry. This soluble digest contained a large number of small peptides in different yields, within the ideal molecular-weight range (200–1200) for mixture-analysis mass spectrometry. Sequences of the major component peptides in the digest are reported. PMID:4207389

  8. A study of chromosomal changes associated with amplified dihydrofolate reductase genes in rat hepatoma cells and their dedifferentiated variants

    PubMed Central

    1984-01-01

    We have examined the karyological consequences of dihydrofolate reductase gene amplification in a series of six rat hepatoma cell lines, all derived from the same clone. Cells of three of these lines express a series of liver-specific functions whereas those of three others fail to express these functions. Cells of each line have been subjected to stepwise selection for methotrexate resistance and, in most cases, resistance is associated with a 40-50-fold amplification of sequences hybridizing to a dihydrofolate reductase cDNA probe. In one line no modified chromosome is observed, whereas in two others the amplified genes are associated with an expanded chromosomal region. R- banding analysis of these karyotypes showed that few changes have occurred. These observations apply to two of the well-differentiated lines, and to a variant able to revert to the differentiated state. In contrast, in the two stably dedifferentiated hepatoma cell lines, amplified dihydrofolate reductase genes are found on large chromosomes of variable size, on ring chromosomes, and on chromosomes containing terminal, median, or multiple centromeres. We conclude that the nature of the chromosomal changes associated with dihydrofolate reductase gene amplification are the result of differences in cell lines rather than in the protocols employed for selection. PMID:6746737

  9. Role of Lysine-54 in determining cofactor specificity and binding in human dihydrofolate reductase

    SciTech Connect

    Huang, Shaoming; Tan, Xuehai; Thompson, P.D.; Freisheim, J.H. ); Appleman, J.R.; Blakley, R.L. ); Sheridan, R.P.; Venkataraghavan, R. )

    1990-09-04

    Lysine-54 of human dihydrofolate reductase (hDHFR) appears to be involved in the interaction with the 2{prime}-phosphate of NADPH and is conserved as a basic residue in other species. Studies have suggested that in Lactobacillus casei dihydrofolate reductase Arg-43, the homologous residue at this position, plays an important role in the binding of NADPH and in the differentiation of K{sub m} values for NADPH and NADH. A Lys-54 to Gln-54 mutant (K54Q) of hDHFR has been constructed by oligodeoxynucleotide-directed mutagenesis in order to study the role of Lys-54 in differentiating K{sub m} and k{sub cat} values for NADPH and NADH as well as in other functions of hDHFR. The purpose of this paper is to delineate in quantitative terms the magnitude of the effect of the Lys-54 to Gln-54 replacement on the various kinetic parameters of hDHFR. Such quantitative effects cannot be predicted solely on the basis of X-ray structures. The ratio of K{sub m}(NADH)/K{sub m}(NADPH) decreases from 69 in the wild-type enzyme to 4.7 in the K54Q enzyme, suggesting that Lys-54, among other interactions between protein side-chain residues and the 2{prime}-phosphate, makes a major contribution in terms of binding energy and differentiation of K{sub m} values for NADPH and NADH. Agents at concentrations that show activating effects on the wild-type enzyme such as potassium chloride and urea all inactivate the K54Q enzyme. There appear to be no gross conformational differences between wild-type and K54Q enzyme molecules as judged by competitive ELISA using peptide-specific antibodies against human dihydrofolate reductase and from protease susceptibility studies on both wild-type and K54Q mutant enzymes. The pH-rate profiles using NADPH for K54Q and wild-type enzymes show divergences at certain pH values, suggesting the possibility of alteration(s) in the steps of the catalytic pathway for the K54Q enzyme.

  10. Pharmacoinformatic Study on the Selective Inhibition of the Protozoan Dihydrofolate Reductase Enzymes.

    PubMed

    Sharma, Vishnu K; Abbat, Sheenu; Bharatam, P V

    2017-06-12

    Dihydrofolate reductase (DHFR) is an essential enzyme of the folate metabolic pathway in protozoa and it is a validated, potential drug target in many infectious diseases. Information about unique conserved residues of the DHFR enzyme is required to understand residual selectivity of the protozoan DHFR enzyme. The three dimensional crystal structures are not available for all the protozoan DHFR enzymes. Enzyme-substrate/inhibitor interaction information is required for the binding mode characterization in protozoan DHFR for selective inhibitor design. In this work, multiple sequence analysis was carried out in all the studied species. Homology models were built for protozoan DHFR enzymes, for which 3D structures are not available in PDB. The molecular docking and Prime-MMGBSA calculations of the natural substrate (dihydrofolate, DHF) and classical DHFR inhibitor (methotrexate, MTX) were performed in protozoan DHFR enzymes. Comparative sequence analysis showed that an overall sequence identity between the studied species ranging from 22.94 % (CfDHFR-BgDHFR) to 94.61 % (LdDHFR-LmDHFR). Interestingly, it was observed that most of the active site residues were conserved in all the cases and all the enzymes exhibit similar key binding interactions with DHF and MTX in molecular docking analysis, but there are a few key binding residues which differ in protozoan species that makes it suitable for target selectivity. This information can be used to design selective and potent protozoan DHFR enzyme inhibitors. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Dihydrofolate Reductase Gene Variations in Susceptibility to Disease and Treatment Outcomes

    PubMed Central

    Askari, Bahram S.; Krajinovic, Maja

    2010-01-01

    Dihydrofolate reductase (DHFR) catalyzes the reduction of dihydrofolate to tetrahydrofolate (THF). THF is needed for the action of folate-dependent enzymes and is thus essential for DNA synthesis and methylation. The importance of this reaction is demonstrated by the effectiveness of antifolate medications used to treat cancer by inhibiting DHFR, thereby depleting THF and slowing DNA synthesis and cell proliferation. Due to the pivotal role that DHFR plays in folate metabolism and cancer treatment, changes in the level of DHFR expression can affect susceptibility to a variety of diseases dependent on folate status such as spina bifida and cancer. Likewise, variability in DHFR expression can affect sensitivity to anti-cancer drugs such as the folate antagonist methotrexate. Alterations in DHFR expression can be due to polymorphisms in the DHFR gene. Several variations have recently been described in DHFR, including promoter polymorphisms, the 19-bp deletion allele and variations in 3’UTR. These polymorphisms seem to be functional, affecting mRNA levels through various interesting mechanisms, including regulation through RNA interference. Several groups have assessed the association of these polymorphisms with folate levels, risk of cancer and spina bifida as well as the outcome of diseases treated with MTX. The latter may lead to different treatment schedules, improving treatment efficacy and/or allowing for a reduction in drug side effects. This review will summarize present knowledge regarding the predictive potential of DHFR polymorphisms in disease and treatment. PMID:21629435

  12. Dihydrofolate reductase gene variations in susceptibility to disease and treatment outcomes.

    PubMed

    Askari, Bahram S; Krajinovic, Maja

    2010-12-01

    Dihydrofolate reductase (DHFR) catalyzes the reduction of dihydrofolate to tetrahydrofolate (THF). THF is needed for the action of folate-dependent enzymes and is thus essential for DNA synthesis and methylation. The importance of this reaction is demonstrated by the effectiveness of antifolate medications used to treat cancer by inhibiting DHFR, thereby depleting THF and slowing DNA synthesis and cell proliferation. Due to the pivotal role that DHFR plays in folate metabolism and cancer treatment, changes in the level of DHFR expression can affect susceptibility to a variety of diseases dependent on folate status such as spina bifida and cancer. Likewise, variability in DHFR expression can affect sensitivity to anti-cancer drugs such as the folate antagonist methotrexate. Alterations in DHFR expression can be due to polymorphisms in the DHFR gene. Several variations have recently been described in DHFR, including promoter polymorphisms, the 19-bp deletion allele and variations in 3'UTR. These polymorphisms seem to be functional, affecting mRNA levels through various interesting mechanisms, including regulation through RNA interference. Several groups have assessed the association of these polymorphisms with folate levels, risk of cancer and spina bifida as well as the outcome of diseases treated with MTX. The latter may lead to different treatment schedules, improving treatment efficacy and/or allowing for a reduction in drug side effects. This review will summarize present knowledge regarding the predictive potential of DHFR polymorphisms in disease and treatment.

  13. Barrier crossing in dihydrofolate reductase does not involve a rate-promoting vibration

    NASA Astrophysics Data System (ADS)

    Dametto, Mariangela; Antoniou, Dimitri; Schwartz, Steven D.

    2012-05-01

    We have studied atomic motions during the chemical reaction catalysed by the enzyme dihydrofolate reductase of Escherichia coli (EcDHFR), an important enzyme for nucleic acid synthesis. In our earlier work on the enzymes human lactate dehydrogenase and purine nucleoside phosphorylase, we had identified fast sub-ps motions that are part of the reaction coordinate. We employed Transition Path Sampling (TPS) and our recently developed reaction coordinate identification methodology to investigate if such fast motions couple to the reaction in DHFR on the barrier-crossing timescale. While we identified some protein motions near the barrier crossing event, these motions do not constitute a compressive promoting vibration, and do not appear as a clearly identifiable protein component in reaction.

  14. Comparative stability of dihydrofolate reductase mutants in vitro and in vivo.

    PubMed

    Leontiev, V V; Uversky, V N; Gudkov, A T

    1993-01-01

    Dihydrofolate reductase mutants with amino acid replacements in the active center (Thr35-->Asp mutant, Arg57-->His mutant and the mutant with triple replacement Thr35-->Asp, Asn37-->Ser, Arg57-->His) were obtained by site-directed mutagenesis. The stabilization effect of trimethoprim and NADP.H on the protein tertiary structure in vitro has been investigated. In the case of mutants with a 'weak' tertiary structure (Thr35-->Asp35 and the triple mutant) the separate addition of ligands does not affect their stability. The simultaneous addition of these ligands to Thr35-->Asp35 and the triple mutant leads to the large increase in their stability. A distinct correlation was found between the in vitro studied stability of the mutant proteins to the urea- or heat-induced denaturation and the level of proteolytic degradation of these mutants previously observed in vivo.

  15. Triazine-benzimidazole hybrids: anticancer activity, DNA interaction and dihydrofolate reductase inhibitors.

    PubMed

    Singla, Prinka; Luxami, Vijay; Paul, Kamaldeep

    2015-04-15

    A new series of triazine-benzimidazole hybrids has been synthesized with different substitution of primary and secondary amines at one of the position of triazine in moderate to good yields. These compounds were evaluated for their inhibitory activities over 60 human tumor cell lines at one dose and five dose concentrations. Compounds 6b, 8 and 9 showed broad spectrum of antitumor activities with GI50 values of 9.79, 2.58 and 3.81μM, respectively. DNA binding studies also indicated strong interaction properties of these compounds. These synthesized compounds also showed inhibition of mammalian dihydrofolate reductase (DHFR). Compound 6b was depicted as the most active member of DHFR inhibitor with IC50 value of 1.05μM. Molecular modelling studies were used to identify the stabilized interactions of Compound 6b within the active site of enzyme for DHFR.

  16. Thermal Adaptation of Dihydrofolate Reductase from the Moderate Thermophile Geobacillus stearothermophilus

    PubMed Central

    2014-01-01

    The thermal melting temperature of dihydrofolate reductase from Geobacillus stearothermophilus (BsDHFR) is ∼30 °C higher than that of its homologue from the psychrophile Moritella profunda. Additional proline residues in the loop regions of BsDHFR have been proposed to enhance the thermostability of BsDHFR, but site-directed mutagenesis studies reveal that these proline residues contribute only minimally. Instead, the high thermal stability of BsDHFR is partly due to removal of water-accessible thermolabile residues such as glutamine and methionine, which are prone to hydrolysis or oxidation at high temperatures. The extra thermostability of BsDHFR can be obtained by ligand binding, or in the presence of salts or cosolvents such as glycerol and sucrose. The sum of all these incremental factors allows BsDHFR to function efficiently in the natural habitat of G. stearothermophilus, which is characterized by temperatures that can reach 75 °C. PMID:24730604

  17. The Lactone form of stachybotrydial: a new inhibitor of dihydrofolate reductase from stachybotrys sp. FN298.

    PubMed

    Kwon, Yun-Ju; Sohn, Mi-Jin; Kim, Hyun-Ju; Kim, Won-Gon

    2014-01-01

    Dihydrofolate reductase (DHFR) has been confirmed to be a novel target for antibacterial drug development. In this study, we determined that a fungal metabolite from Stachybotrys sp. FN298 can inhibit the DHFR of Staphylococcus aureus. Its structure was identified as a lactone form of stachybotrydial using mass spectrometry and nuclear magnetic resonance analysis. This compound inhibited S. aureus DHFR with a half-maximal inhibitory concentration of 41 µM. It also prevented the growth of S. aureus and methicillin-resistant S. aureus (MRSA) with a minimum inhibitory concentration of 32 µg·mL(-1). To our knowledge, this is the first description of a DHFR inhibitor of microbial origin. The inhibitory function of the lactone form of stachybotrydial highlights its potential for development into a new broad-spectrum antibacterial agent and as an agent against MRSA.

  18. Structure-Guided Development of Efficacious Antifungal Agents Targeting Candida Glabrata Dihydrofolate Reductase

    SciTech Connect

    Liu, J.; Bolstad, D; Smith, A; Priestley, N; Wright, D; Anderson, A

    2008-01-01

    Candida glabrata is a lethal fungal pathogen resistant to many antifungal agents and has emerged as a critical target for drug discovery. Over the past several years, we have been developing a class of propargyl-linked antifolates as antimicrobials and hypothesized that these compounds could be effective inhibitors of dihydrofolate reductase (DHFR) from C. glabrata. We initially screened a small collection of these inhibitors and found modest levels of potency. Subsequently, we determined the crystal structure of C. glabrata DHFR bound to a representative inhibitor with data to 1.6 A resolution. Using this structure, we designed and synthesized second-generation inhibitors. These inhibitors bind the C. glabrata DHFR enzyme with subnanomolar potency, display greater than 2000-fold levels of selectivity over the human enzyme, and inhibit the growth of C. glabrata at levels observed with clinically employed therapeutics.

  19. Discovery of Potent and Selective Leads against Toxoplasma gondii Dihydrofolate Reductase via Structure-Based Design.

    PubMed

    Welsch, Matthew E; Zhou, Jian; Gao, Yueqiang; Yan, Yunqing; Porter, Gene; Agnihotri, Gautam; Li, Yingjie; Lu, Henry; Chen, Zhongguo; Thomas, Stephen B

    2016-12-08

    Current treatment of toxoplasmosis targets the parasite's folate metabolism through inhibition of dihydrofolate reductase (DHFR). The most widely used DHFR antagonist, pyrimethamine, was introduced over 60 years ago and is associated with toxicity that can be largely attributed to a similar affinity for parasite and human DHFR. Computational analysis of biochemical differences between Toxoplasma gondii and human DHFR enabled the design of inhibitors with both improved potency and selectivity. The approach described herein yielded TRC-19, a promising lead with an IC50 of 9 nM and 89-fold selectivity in favor of Toxoplasma gondii DHFR, as well as crystallographic data to substantiate in silico methodology. Overall, 50% of synthesized in silico designs met hit threshold criteria of IC50 < 10 μM and >2-fold selectivity favoring Toxoplasma gondii, further demonstrating the efficiency of our structure-based drug design approach.

  20. Malaria antifolate resistance with contrasting Plasmodium falciparum dihydrofolate reductase (DHFR) polymorphisms in humans and Anopheles mosquitoes

    PubMed Central

    Mharakurwa, Sungano; Kumwenda, Taida; Mkulama, Mtawa A. P.; Musapa, Mulenga; Chishimba, Sandra; Shiff, Clive J.; Sullivan, David J.; Thuma, Philip E.; Liu, Kun; Agre, Peter

    2011-01-01

    Surveillance for drug-resistant parasites in human blood is a major effort in malaria control. Here we report contrasting antifolate resistance polymorphisms in Plasmodium falciparum when parasites in human blood were compared with parasites in Anopheles vector mosquitoes from sleeping huts in rural Zambia. DNA encoding P. falciparum dihydrofolate reductase (EC 1.5.1.3) was amplified by PCR with allele-specific restriction enzyme digestions. Markedly prevalent pyrimethamine-resistant mutants were evident in human P. falciparum infections—S108N (>90%), with N51I, C59R, and 108N+51I+59R triple mutants (30–80%). This resistance level may be from selection pressure due to decades of sulfadoxine/pyrimethamine use in the region. In contrast, cycloguanil-resistant mutants were detected in very low frequency in parasites from human blood samples—S108T (13%), with A16V and 108T+16V double mutants (∼4%). Surprisingly, pyrimethamine-resistant mutants were of very low prevalence (2–12%) in the midguts of Anopheles arabiensis vector mosquitoes, but cycloguanil-resistant mutants were highly prevalent—S108T (90%), with A16V and the 108T+16V double mutant (49–57%). Structural analysis of the dihydrofolate reductase by in silico modeling revealed a key difference in the enzyme within the NADPH binding pocket, predicting the S108N enzyme to have reduced stability but the S108T enzyme to have increased stability. We conclude that P. falciparum can bear highly host-specific drug-resistant polymorphisms, most likely reflecting different selective pressures found in humans and mosquitoes. Thus, it may be useful to sample both human and mosquito vector infections to accurately ascertain the epidemiological status of drug-resistant alleles. PMID:22065788

  1. Cancer metabolism and oxidative stress: Insights into carcinogenesis and chemotherapy via the non-dihydrofolate reductase effects of methotrexate

    PubMed Central

    Hess, Joshua A.; Khasawneh, Mohamad K.

    2015-01-01

    Methotrexate has been in use as an anti-cancer agent for over 60 years. Though inhibition of dihydrofolate reductase is its best known mechanisms of action, its non-dihydrofolate reductase dependent mechanisms disrupt metabolic pathways resulting in a depletion of NAD(P)H and increasing oxidative stress. These mechanisms highlight a novel dependence of cancer cells on their metabolic abnormalities to buffer oxidative stress and chemotherapeutic agents interfere with these cellular abilities. Mitochondria appear to play a significant role in maintaining cancer cell viability and alterations in metabolism seen in cancer cells aid this mitochondrial ability. Further research is needed to understand the effects of other chemotherapeutic agents on these pathways. PMID:26674389

  2. Sequence-specific sup 1 H and sup 15 N resonance assignments for human dihydrofolate reductase in solution

    SciTech Connect

    Stockman, B.J.; Nirmala, N.R.; Wagner, G. ); Delcamp, T.J.; DeYarman, M.T.; Freisheim, J.H. )

    1992-01-14

    Dihydrofolate reductase is an intracellular target enzyme for folate antagonists, including the anticancer drug methotrexate. In order to design novel drugs with altered binding properties, a detailed description of protein-drug interactions in solution is desirable to understand the specificity of drug binding. As a first step in this process, heteronuclear three-dimensional NMR spectroscopy has been used to make sequential resonance assignments for more than 90% of the residues in human dihydrofolate reductase complexed with methotrexate. Uniform enrichment of the 21.5-kDa protein with {sup 15}N was required to obtain the resonance assignments via heteronuclear 3D NMR spectroscopy since homonuclear 2D spectra did not provide sufficient {sup 1}H resonance dispersion. Medium- and long-range NOE's have been used to characterize the secondary structure of the binary ligand-enzyme complex in solution.

  3. Kinetic and Chemical Mechanism of the Dihydrofolate Reductase from Mycobacterium tuberculosis

    PubMed Central

    Czekster, Clarissa M.; Vandemeulebroucke, An; Blanchard, John S.

    2010-01-01

    Dihydrofolate reductase from Mycobacterium tuberculosis catalyzes the NAD(P)H dependent reduction of dihydrofolate, yielding NAD(P)+ and tetrahydrofolate, the primary one carbon unit carrier in biology. Tetrahydrofolate needs to be recycled so that reactions involved in dTMP synthesis and purine metabolism are maintained. In this work, we report the kinetic characterization of the MtDHFR. This enzyme has a sequential steady-state random kinetic mechanism, probably with a preferred pathway with NADPH binding first. A pKa value for an enzymic acid of approximately 7.0 was identified from the pH dependence of V, and the analysis of the primary kinetic isotope effects revealed that the hydride transfer step is at least partly rate limiting throughout the pH range analyzed. Additionally, the determination and analysis of solvent, and multiple kinetic isotope effects was conducted, and equilibrium isotope effects were measured on the equilibrium constant. D2OV and D2OV/K[4R-4-2H]-NADH were slightly inverse at pH 6.0, and inverse values for D2OV[4R-4-2H]-NADH and D2OV/K[4R-4-2H]-NADH suggested that a pre-equilibrium protonation is occurring before the hydride transfer step, indicating a stepwise mechanism for proton and hydride transfer. The same value was obtained for DkH at pH values of 5.5 and 7.5, reaffirming the rate-limiting nature of the hydride transfer step. A chemical mechanism is proposed based on the results obtained here. PMID:21138249

  4. Osmolyte induced enhancement of expression and solubility of human dihydrofolate reductase: An in vivo study.

    PubMed

    Rashid, Naira; Thapliyal, Charu; Chaudhuri Chattopadhyay, Pratima

    2017-10-01

    The process of recombinant protein production in E. coli system is often hampered by the formation of insoluble aggregates. Human Dihydrofolate reductase (hDHFR), an enzyme involved in the synthesis of purine, thymidilate and several other amino acids like glycine, methionine and serine is highly aggregation prone. It catalyzes the reduction of dihydrofolate (H2F) in order to regenerate tetrahydrofolate (H4F) utilizing NADPH as a cofactor. We have attempted to ameliorate the production of soluble and functional protein by growing and inducing the cells under osmotic stress condition, in the presence of various osmolytes like glycerol, sorbitol, TMAO, proline and glycine at 37°C. The expression and yield of functional hDHFR protein were highly enhanced in the presence of these osmolytes. The specific activity of the purified recombinant hDHFR protein has also been increased to a cogent level in the presence of osmolytes. We also observed that protein expressed in presence of the osmolytes was stable in the denaturing conditions as compared to the protein expressed in absence of an osmolyte. We also observed using the intrinsic fluorescence spectroscopy that the osmolytes didn't interfere with the structure of the protein and in denaturing conditions the protein expressed in presence of osmolytes had more stability. Our study is consequential in increasing the production of functional and soluble protein in the cell extract and will also be appropriate to find a therapeutic agent against many neurodegenerative diseases. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Crystal structure of a Type II dihydrofolate reductase catalytic ternary complex

    PubMed Central

    Krahn, Joseph M.; Jackson, Michael R.; DeRose, Eugene F.; Howell, Elizabeth E.; London, Robert E.

    2013-01-01

    Type II dihydrofolate reductase (DHFR) is a plasmid-encoded enzyme that confers resistance to bacterial DHFR-targeted antifolate drugs. It forms a symmetric homotetramer with a central pore which functions as the active site. Its unusual structure, which results in a promiscuous binding surface that accommodates either the Dihydrofolate (DHF) substrate or the NADPH cofactor, has constituted a significant limitation to efforts to understand its substrate specificity and reaction mechanism. We describe here the first structure of a ternary R67 DHFR•DHF•NADP+ catalytic complex, resolved to1.26 Å. This structure provides the first clear picture of how this enzyme, which lacks the active site carboxyl residue that is ubiquitous in Type I DHFRs, is able to function. In the catalytic complex, the polar backbone atoms of two symmetry-related I68 residues provide recognition motifs that interact with the carboxamide on the nicotinamide ring, and the N3-O4 amide function on the pteridine. This set of interactions orients the aromatic rings of substrate and cofactor in a relative endo geometry in which the reactive centers are held in close proximity. Additionally, a central, hydrogen-bonded network consisting of two pairs of Y69-Q67-Q67′-Y69′ residues provides an unusually tight interface, which appears to serve as a “molecular clamp” holding the substrates in place in an orientation conducive to hydride transfer. In addition to providing the first clear insight regarding how this extremely unusual enzyme is able to function, the structure of the ternary complex provides general insights into how a mutationally-challenged enzyme, i.e., an enzyme whose evolution is restricted to four-residues-at-a-time active site mutations, overcomes this fundamental limitation. PMID:18052202

  6. Chemical Ligation and Isotope Labeling to Locate Dynamic Effects during Catalysis by Dihydrofolate Reductase.

    PubMed

    Luk, Louis Y P; Ruiz-Pernía, J Javier; Adesina, Aduragbemi S; Loveridge, E Joel; Tuñón, Iñaki; Moliner, Vincent; Allemann, Rudolf K

    2015-07-27

    Chemical ligation has been used to alter motions in specific regions of dihydrofolate reductase from E. coli and to investigate the effects of localized motional changes on enzyme catalysis. Two isotopic hybrids were prepared; one with the mobile N-terminal segment containing heavy isotopes ((2) H, (13) C, (15) N) and the remainder of the protein with natural isotopic abundance, and the other one with only the C-terminal segment isotopically labeled. Kinetic investigations indicated that isotopic substitution of the N-terminal segment affected only a physical step of catalysis, whereas the enzyme chemistry was affected by protein motions from the C-terminal segment. QM/MM studies support the idea that dynamic effects on catalysis mostly originate from the C-terminal segment. The use of isotope hybrids provides insights into the microscopic mechanism of dynamic coupling, which is difficult to obtain with other studies, and helps define the dynamic networks of intramolecular interactions central to enzyme catalysis. © 2015 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.

  7. A Rapid Analysis of Variations in Conformational Behavior during Dihydrofolate Reductase Catalysis.

    PubMed

    Hughes, Robert L; Johnson, Luke A; Behiry, Enas M; Loveridge, E Joel; Allemann, Rudolf K

    2017-04-18

    Protein flexibility is central to enzyme catalysis, yet it remains challenging both to predict conformational behavior on the basis of analysis of amino acid sequence and protein structure and to provide the necessary breadth of experimental support to any such predictions. Here a generic and rapid procedure for identifying conformational changes during dihydrofolate reductase (DHFR) catalysis is described. Using DHFR from Escherichia coli (EcDHFR), selective side-chain (13)C labeling of methionine and tryptophan residues is shown to be sufficient to detect the closed-to-occluded conformational transition that follows the chemical step in the catalytic cycle, with clear chemical shift perturbations found for both methionine methyl and tryptophan indole groups. In contrast, no such perturbations are seen for the DHFR from the psychrophile Moritella profunda, where the equivalent conformational change is absent. Like EcDHFR, Salmonella enterica DHFR shows experimental evidence of a large-scale conformational change following hydride transfer that relies on conservation of a key hydrogen bonding interaction between the M20 and GH loops, directly comparable to the closed-to-occluded conformational change observed in EcDHFR. For the hyperthermophile Thermotoga maritima, no chemical shift perturbations were observed, suggesting that no major conformational change occurs during the catalytic cycle. In spite of their conserved tertiary structures, DHFRs display variations in conformational sampling that occurs concurrently with catalysis.

  8. Effect of pH on hydride transfer by Escherichia coli dihydrofolate reductase.

    PubMed

    Loveridge, E Joel; Allemann, Rudolf K

    2011-05-16

    The kinetic isotope effect (KIE) on hydride transfer in the reaction catalysed by dihydrofolate reductase from Escherichia coli (EcDHFR) is known to be temperature dependent at pH 7, but essentially independent of temperature at elevated pH. Here, we show that the transition from the temperature-dependent regime to the temperature-independent regime occurs sharply between pH 7.5 and 8. The activation energy for hydride transfer is independent of pH. The mechanism leading to the change in behaviour of the KIEs is not clear, but probably involves a conformational change in the enzyme brought about by deprotonation of a key residue (or residues) at high pH. The KIE on hydride transfer at low pH suggests that the rate constant for the reaction is not limited by a conformational change to the enzyme under these conditions. The effect of pH on the temperature dependence of the rate constants and KIEs for hydride transfer catalysed by EcDHFR suggests that enzyme motions and conformational changes do not directly influence the chemistry, but that the reaction conditions affect the conformational ensemble of the enzyme prior to reaction and control the reaction though this route.

  9. Interaction of dihydrofolate reductase with methotrexate: Ensemble and single-molecule kinetics

    NASA Astrophysics Data System (ADS)

    Rajagopalan, P. T. Ravi; Zhang, Zhiquan; McCourt, Lynn; Dwyer, Mary; Benkovic, Stephen J.; Hammes, Gordon G.

    2002-10-01

    The thermodynamics and kinetics of the interaction of dihydrofolate reductase (DHFR) with methotrexate have been studied by using fluorescence, stopped-flow, and single-molecule methods. DHFR was modified to permit the covalent addition of a fluorescent molecule, Alexa 488, and a biotin at the N terminus of the molecule. The fluorescent molecule was placed on a protein loop that closes over methotrexate when binding occurs, thus causing a quenching of the fluorescence. The biotin was used to attach the enzyme in an active form to a glass surface for single-molecule studies. The equilibrium dissociation constant for the binding of methotrexate to the enzyme is 9.5 nM. The stopped-flow studies revealed that methotrexate binds to two different conformations of the enzyme, and the association and dissociation rate constants were determined. The single-molecule investigation revealed a conformational change in the enzyme-methotrexate complex that was not observed in the stopped-flow studies. The ensemble averaged rate constants for this conformation change in both directions is about 2-4 s1 and is attributed to the opening and closing of the enzyme loop over the bound methotrexate. Thus the mechanism of methotrexate binding to DHFR involves multiple steps and protein conformational changes.

  10. Evidence for two interconverting protein isomers in the methotrexate complex of dihydrofolate reductase from Escherichia coli

    SciTech Connect

    Falzone, C.J.; Benkovic, S.J. ); Wright, P.E. )

    1991-02-26

    Two-dimensional {sup 1}H NMR methods and a knowledge of the X-ray crystal structure have been used to make resonance assignments for the amino acid side chains of dihydrofolate reductase from Escherichia coli complexed with methotrexate. The H7 proton on the pteridine ring of methotrexate was found to have NOEs to the methyl protons of Leu-28 which were assigned by using the L28F mutant. These NOEs indicated that the orientation of the methotrexate pteridine ring is similar in both solution and crystal structures. During the initial assignment process, it became evident that many of the resonances in this complex, unlike those of the folate complex, are severally broadened or doubled. The observation of two distinct sets of resonances in a ratio of approximately 2:1 was attributed to the presence of two protein isomers. Many of the side chains with clearly doubled resonances were located in the {beta}-sheet and the active site. Preliminary studies on the apoprotein also revealed doubled resonances in the absence of the inhibitor, indicating the existence of the protein isomers prior to methotrexate binding. In contrast to the methotrexate complex, the binary complex with folate and the ternary MTX-NADPH-DHFR complex presented a single enzyme form. These results are proposed to reflect the ability of folate and NADPH to bind predominantly to one protein isomer.

  11. The HIP1 binding site is required for growth regulation of the dihydrofolate reductase gene promoter.

    PubMed Central

    Means, A L; Slansky, J E; McMahon, S L; Knuth, M W; Farnham, P J

    1992-01-01

    The transcription rate of the dihydrofolate reductase (DHFR) gene increases at the G1/S boundary of the proliferative cell cycle. Through analysis of transiently and stably transfected NIH 3T3 cells, we have now demonstrated that DHFR promoter sequences extending from -270 to +20 are sufficient to confer similar regulation on a reporter gene. Mutation of a protein binding site that spans sequences from -16 to +11 in the DHFR promoter resulted in loss of the transcriptional increase at the G1/S boundary. Purification of an activity from HeLa nuclear extract that binds to this region enriched for a 180-kDa polypeptide (HIP1). Using this HIP1 preparation, we have identified specific positions within the binding site that are critical for efficient protein-DNA interactions. An analysis of association and dissociation rates suggests that bound HIP1 protein can exchange rapidly with free protein. This rapid exchange may facilitate the burst of transcriptional activity from the DHFR promoter at the G1/S boundary. Images PMID:1545788

  12. Temporal and topological clustering of diverged residues among enterobacterial dihydrofolate reductases.

    PubMed

    Garvin, L D; Hardies, S C

    1991-09-01

    The complete nucleotide and encoded amino acid sequences were determined for the dihydrofolate reductase (DHFR) from the bacteria Enterobacter aerogenes and Citrobacter freundii. These were compared with the closely related Escherichia coli DHFR sequence. The ancestral DHFR sequence common to these three species was reconstructed. Since that ancestor there have been seven, nine, and one amino acid replacements in E. coli, E. aerogenes, and C. freundii, respectively. In E. coli, five of its seven replacements were located in the beta-sheet portion of the protein, and all seven were located in a single restricted region of the protein. In E. aerogenes, all nine of its replacements were located within surface residues, with five clustered in a region topologically distinct from the E. coli cluster. The replaced side chains are sometimes in direct contact but more often are separated by an intervening side chain. It is argued that the temporal clustering of replacements is typical for the evolution of most proteins and that the associated topological clustering gives a picture of how evolutionary change is accommodated by protein structure.

  13. Genetic variations of the dihydrofolate reductase gene of Plasmodium vivax in Mandalay Division, Myanmar.

    PubMed

    Na, Byoung-Kuk; Lee, Hyeong-Woo; Moon, Sung-Ung; In, Tae-Suk; Lin, Khin; Maung, Maung; Chung, Gyung-Tae; Lee, Jong-Koo; Kim, Tong-Soo; Kong, Yoon

    2005-07-01

    Dihydrofolate reductase (DHFR; EC1.5.1.3) is a known target enzyme for antifolate agents, which are used as alternative chemotherapeutics for chloroquine-resistant malaria. Mutations in the dhfr gene of Plasmodium vivax are thought to be associated with resistance to the antifolate drugs. In this study, we have analyzed genetic variations in the dhfr genes of clinical isolates of P. vivax (n=21) in Myanmar, to monitor antifolate resistance in this country. Sequence variations within the entire dhfr gene were highly restricted to codons from 57 to 117, and the GGDN tandem repeat region. Double (S58R and S117N/T) or quadruple mutations (F57L/I, S58R, T61M, and S117N/T), which may be closely related to the drug resistance, were recognized in most of the isolates (20/21 cases). Our results suggest that antifolate-resistant P. vivax is becoming widespread in Myanmar, as it also is in the neighboring countries in Southeast Asia. It appears that the drug resistance situation may be worsening in the country.

  14. Dynamics of immobilized and native Escherichia coli dihydrofolate reductase by quasielastic neutron scattering.

    PubMed

    Tehei, M; Smith, J C; Monk, C; Ollivier, J; Oettl, M; Kurkal, V; Finney, J L; Daniel, R M

    2006-02-01

    The internal dynamics of native and immobilized Escherichia coli dihydrofolate reductase (DHFR) have been examined using incoherent quasielastic neutron scattering. These results reveal no difference between the high frequency vibration mean-square displacement of the native and the immobilized E. coli DHFR. However, length-scale-dependent, picosecond dynamical changes are found. On longer length scales, the dynamics are comparable for both DHFR samples. On shorter length scales, the dynamics is dominated by local jump motions over potential barriers. The residence time for the protons to stay in a potential well is tau = 7.95 +/- 1.02 ps for the native DHFR and tau = 20.36 +/- 1.80 ps for the immobilized DHFR. The average height of the potential barrier to the local motions is increased in the immobilized DHFR, and may increase the activation energy for the activity reaction, decreasing the rate as observed experimentally. These results suggest that the local motions on the picosecond timescale may act as a lubricant for those associated with DHFR activity occurring on a slower millisecond timescale. Experiments indicate a significantly slower catalytic reaction rate for the immobilized E. coli DHFR. However, the immobilization of the DHFR is on the exterior of the enzyme and essentially distal to the active site, thus this phenomenon has broad implications for the action of drugs distal to the active site.

  15. New small-molecule inhibitors of dihydrofolate reductase inhibit Streptococcus mutans.

    PubMed

    Zhang, Qiong; Nguyen, Thao; McMichael, Megan; Velu, Sadanandan E; Zou, Jing; Zhou, Xuedong; Wu, Hui

    2015-08-01

    Streptococcus mutans is a major aetiological agent of dental caries. Formation of biofilms is a key virulence factor of S. mutans. Drugs that inhibit S. mutans biofilms may have therapeutic potential. Dihydrofolate reductase (DHFR) plays a critical role in regulating the metabolism of folate. DHFR inhibitors are thus potent drugs and have been explored as anticancer and antimicrobial agents. In this study, a library of analogues based on a DHFR inhibitor, trimetrexate (TMQ), an FDA-approved drug, was screened and three new analogues that selectively inhibited S. mutans were identified. The most potent inhibitor had a 50% inhibitory concentration (IC50) of 454.0±10.2nM for the biofilm and 8.7±1.9nM for DHFR of S. mutans. In contrast, the IC50 of this compound for human DHFR was ca. 1000nM, a >100-fold decrease in its potency, demonstrating the high selectivity of the analogue. An analogue that exhibited the least potency for the S. mutans biofilm also had the lowest activity towards inhibiting S. mutans DHFR, further indicating that inhibition of biofilms is related to reduced DHFR activity. These data, along with docking of the most potent analogue to the modelled DHFR structure, suggested that the TMQ analogues indeed selectively inhibited S. mutans through targeting DHFR. These potent and selective small molecules are thus promising lead compounds to develop new effective therapeutics to prevent and treat dental caries.

  16. Site specific polarization transfer from a hyperpolarized ligand of dihydrofolate reductase

    PubMed Central

    Wang, Yunyi; Ragavan, Mukundan; Hilty, Christian

    2016-01-01

    Protein–ligand interaction is often characterized using polarization transfer by the intermolecular nuclear Overhauser effect (NOE). For such NOE experiments, hyperpolarization of nuclear spins presents the opportunity to increase the spin magnetization, which is transferred, by several orders of magnitude. Here, folic acid, a ligand of dihydrofolate reductase (DHFR), was hyperpolarized on 1H spins using dissolution dynamic nuclear polarization (D-DNP). Mixing hyperpolarized ligand with protein resulted in observable increases in protein 1H signal predominantly in the methyl group region of the spectra. Using 13C single quantum selection in a series of one-dimensional spectra, the carbon chemical shift ranges of the corresponding methyl groups can be elucidated. Signals observed in these hyperpolarized spectra could be confirmed using 3D isotope filtered NOESY spectra, although the hyperpolarized spectra were obtained in single scans. By further correlating the signal intensities observed in the D-DNP experiments with the occurrence of short distances in the crystal structure of the protein–ligand complex, the observed methyl proton signals could be matched to the chemical shifts of six amino acids in the active site of DHFR-folic acid binary complex. These data demonstrate that 13C chemical shift selection of protein resonances, combined with the intrinsic selectivity towards magnetization originating from the initially hyperpolarized spins, can be used for site specific characterization of protein–ligand interactions. PMID:27189223

  17. In Vitro Generation of Novel Pyrimethamine Resistance Mutations in the Toxoplasma gondii Dihydrofolate Reductase

    PubMed Central

    Reynolds, Mary G.; Oh, Jung; Roos, David S.

    2001-01-01

    Pyrimethamine is a potent inhibitor of dihydrofolate reductase and is widely used in the treatment of opportunistic infections caused by the protozoan parasite Toxoplasma gondii. In order to assess the potential role of dhfr sequence polymorphisms in drug treatment failures, we examined the dhfr-ts genes of representative isolates for T. gondii virulence types I, II, and III. These strains exhibit differences in their sensitivities to pyrimethamine but no differences in predicted dhfr-ts protein sequences. To assess the potential for pyrimethamine-resistant dhfr mutants to emerge, three drug-sensitive variants of the T. gondii dhfr-ts gene (the wild-type T. gondii sequence and two mutants engineered to reflect polymorphisms observed in drug-sensitive Plasmodium falciparum) were subjected to random mutagenesis and transfected into either wild-type T. gondii parasites or dhfr-deficient Saccharomyces cerevisiae under pyrimethamine selection. Three resistance mutations were identified, at amino acid residues 25 (Trp→Arg), 98 (Leu→Ser), and 134 (Leu→His). PMID:11257045

  18. Reduced Impact of Pyrimethamine Drug Pressure on Plasmodium malariae Dihydrofolate Reductase Gene

    PubMed Central

    Khim, Nimol; Kim, Saorin; Bouchier, Christiane; Tichit, Magali; Ariey, Frédéric; Fandeur, Thierry; Chim, Pheaktra; Ke, Sopheakvatey; Sum, Sarorn; Man, Somnang; Ratsimbasoa, Arsène; Durand, Rémy

    2012-01-01

    Molecular investigations performed following the emergence of sulfadoxine-pyrimethamine (SP) resistance in Plasmodium falciparum have allowed the identification of the dihydrofolate reductase (DHFR) enzyme as the target of pyrimethamine. Although clinical cases of Plasmodium malariae are not usually treated with antifolate therapy, incorrect diagnosis and the high frequency of undetected mixed infections has probably exposed non-P. falciparum parasites to antifolate therapy in many areas. In this context, we aimed to assess the worldwide genetic diversity of the P. malariae dhfr gene in 123 samples collected in Africa and Asia, areas with different histories of SP use. Among the 10 polymorphic sites found, we have observed 7 new mutations (K55E, S58R, S59A, F168S, N194S, D207G, and T221A), which led us to describe 6 new DHFR proteins. All isolates from African countries were classified as wild type, while new mutations and haplotypes were recognized as exclusive to Madagascar (except for the double mutations at nucleotides 341 and 342 [S114N] found in one Cambodian isolate). Among these nonsynonymous mutations, two were likely related to pyrimethamine resistance: S58R (corresponding to C59R in P. falciparum and S58R in Plasmodium vivax; observed in one Malagasy sample) and S114N (corresponding to S108N in P. falciparum and S117N in P. vivax; observed in three Cambodian samples). PMID:22123682

  19. Reduced impact of pyrimethamine drug pressure on Plasmodium malariae dihydrofolate reductase gene.

    PubMed

    Khim, Nimol; Kim, Saorin; Bouchier, Christiane; Tichit, Magali; Ariey, Frédéric; Fandeur, Thierry; Chim, Pheaktra; Ke, Sopheakvatey; Sum, Sarorn; Man, Somnang; Ratsimbasoa, Arsène; Durand, Rémy; Ménard, Didier

    2012-02-01

    Molecular investigations performed following the emergence of sulfadoxine-pyrimethamine (SP) resistance in Plasmodium falciparum have allowed the identification of the dihydrofolate reductase (DHFR) enzyme as the target of pyrimethamine. Although clinical cases of Plasmodium malariae are not usually treated with antifolate therapy, incorrect diagnosis and the high frequency of undetected mixed infections has probably exposed non-P. falciparum parasites to antifolate therapy in many areas. In this context, we aimed to assess the worldwide genetic diversity of the P. malariae dhfr gene in 123 samples collected in Africa and Asia, areas with different histories of SP use. Among the 10 polymorphic sites found, we have observed 7 new mutations (K55E, S58R, S59A, F168S, N194S, D207G, and T221A), which led us to describe 6 new DHFR proteins. All isolates from African countries were classified as wild type, while new mutations and haplotypes were recognized as exclusive to Madagascar (except for the double mutations at nucleotides 341 and 342 [S114N] found in one Cambodian isolate). Among these nonsynonymous mutations, two were likely related to pyrimethamine resistance: S58R (corresponding to C59R in P. falciparum and S58R in Plasmodium vivax; observed in one Malagasy sample) and S114N (corresponding to S108N in P. falciparum and S117N in P. vivax; observed in three Cambodian samples).

  20. Dihydrofolate reductase is required for the development of heart and outflow tract in zebrafish.

    PubMed

    Sun, Shuna; Gui, Yonghao; Jiang, Qiu; Song, Houyan

    2011-12-01

    Folic acid is very important for embryonic development and folic acid inhibition can cause congenital heart defects in vertebrates. Dihydrofolate reductase (DHFR) is a key enzyme in folate-mediated metabolism. The dysfunction of DHFR disrupts the key biological processes which folic acid participates in. DHFR gene is conserved during vertebrate evolution. It is important to investigate the roles of DHFR in cardiac developments. In this study, we showed that DHFR knockdown resulted in the abnormal developments of zebrafish embryos in the early stages. Obvious malformations in heart and outflow tract (OFT) were also observed in DHFR knockdown embryos. DHFR overexpression rescued the abnormal phenotypes in the DHFR knockdown group. DHFR knockdown had negative impacts on the expressions of NKX2.5 (NK2 transcription factor-related 5), MEF2C (myocyte-specific enhancer factor 2C), TBX20 (T-box 20), and TBX1 (T-box 1) which are important transcriptional factors during cardiac development process, while DHFR overexpression had positive effects. DHFR was required for Hedgehog pathway. DHFR knockdown caused reduced cell proliferation and increased apoptosis, while its overexpression promoted cell proliferation and inhibited apoptosis. Taken together, our study suggested that DHFR plays crucial roles in the development of heart and OFT in zebrafish by regulating gene transcriptions and affecting cell proliferation and apoptosis.

  1. Point mutations in dihydrofolate reductase and dihydropteroate synthase genes of Plasmodium falciparum isolates from Venezuela.

    PubMed

    Urdaneta, L; Plowe, C; Goldman, I; Lal, A A

    1999-09-01

    The present study was designed to characterize mutations in dihydrofolate reductase (DHFR) and dihydropteroate synthase (DHPS) genes of Plasmodium falciparum in the Bolivar region of Venezuela, where high levels of clinical resistance to sulfadoxine-pyrimethamine (SP, Fansidar; F. Hoffman-La Roche, Basel, Switzerland) has been documented. We used a nested mutation-specific polymerase chain reaction and restriction digestion methods to measure 1) the prevalence of DHFR mutations at 16, 50, 51, 59, 108, and 164 codon positions, and 2) the prevalence of mutations in the 436, 437, 581, and 613 codon sites in DHPS gene. In the case of the DHFR gene, of the 54 parasite isolates analyzed, we detected the presence of Asn-108 and Ile-51 in 96% of the isolates and Arg-50 mutation in 64% of the isolates. Each of these mutations has been associated with high level of resistance to pyrimethamine. Only 2 samples (4%) showed the wild type Ser-108 mutation and none showed Thr-108 and Val-16 mutations that are specific for resistance to cycloguanil. In the case of DHPS gene, we found a mutation at position 437 (Gly) in 100% of the isolates and Gly-581 in 96% of the isolates. The simultaneous presence of mutations Asn-108 and Ile-51 in the DHFR gene and Gly-437 and Gly-581 in the DHPS gene in 96% of the samples tested suggested that a cumulative effect of mutations could be the major mechanism conferring high SP resistance in this area.

  2. Dynamics of Immobilized and Native Escherichia coli Dihydrofolate Reductase by Quasielastic Neutron Scattering. Biophysical Journal

    SciTech Connect

    Tehei, M; Smith, Jeremy C; Monk, C; Olliver, J; Oettl, M; Kurkal-Siebert, V; Finney, J.L.; Daniel, R. M.

    2005-10-01

    The internal dynamics of native and immobilized Escherichia coli dihydrofolate reductase (DHFR) have been examined using incoherent quasielastic neutron scattering. These results reveal no difference between the high frequency vibration mean-square displacement of the native and the immobilized E. coli DHFR. However, length-scale-dependent, picosecond dynamical changes are found. On longer length scales, the dynamics are comparable for both DHFR samples. On shorter length scales, the dynamics is dominated by local jump motions over potential barriers. The residence time for the protons to stay in a potential well is {tau}=7.95{+-}1.02ps for the native DHFR and {tau}=20.36{+-}1.80ps for the immobilized DHFR. The average height of the potential barrier to the local motions is increased in the immobilized DHFR, and may increase the activation energy for the activity reaction, decreasing the rate as observed experimentally. These results suggest that the local motions on the picosecond timescale may act as a lubricant for those associated with DHFR activity occurring on a slower millisecond timescale. Experiments indicate a significantly slower catalytic reaction rate for the immobilized E. coli DHFR. However, the immobilization of the DHFR is on the exterior of the enzyme and essentially distal to the active site, thus this phenomenon has broad implications for the action of drugs distal to the active site.

  3. NMR studies of multiple conformations in complexes of Lactobacillus casei dihydrofolate reductase with analogues of pyrimethamine

    SciTech Connect

    Birdsall, B.; Tendler, S.J.B.; Feeney, J.; Carr, M.D. ); Arnold, J.R.P.; Thomas, J.A.; Roberts, G.C.K. ); Griffin, R.J.; Stevens, M.F.G. )

    1990-10-01

    {sup 1}H and {sup 19}F NMR signals from bound ligands have been assigned in one- and two-dimensional NMR spectra of complexes of Lactobacillus casei dihydrofolate reductase with various pyrimethamine analogues. The signals were identified mainly by correlating signals from bound and free ligands by using 2D exchange experiments. Analogues with symmetrically substituted phenyl rings give rise to {sup 1}H signals from four nonequivalent aromatic protons, clearly indicating the presence of hindered rotation about the pyrimidine-phenyl bond. Analogues with symmetrically substituted phenyl rings give rise to {sup 1}H signals from four nonequivalent aromatic protons, clearly indicating the presence of hindered rotation about the pyrimidine-phenyl bond. Analogues containing asymmetrically substituted aromatic rings exist as mixtures of two rotational isomers (an enantiomeric pair) because of this hindered rotation and the NMR spectra revealed that both isomers (forms A and B) bind to the enzyme with comparable, though unequal, binding energies. In this case two complete sets of bound proton signals were observed. The relative orientations of the two forms have been determined from NOE through-space connections between protons on the ligand and protein. Ternary complexes with NADP{sup {plus}} were also examined.

  4. Increased Dynamic Effects in a Catalytically Compromised Variant of Escherichia coli Dihydrofolate Reductase

    PubMed Central

    2013-01-01

    Isotopic substitution (15N, 13C, 2H) of a catalytically compromised variant of Escherichia coli dihydrofolate reductase, EcDHFR-N23PP/S148A, has been used to investigate the effect of these mutations on catalysis. The reduction of the rate constant of the chemical step in the EcDHFR-N23PP/S148A catalyzed reaction is essentially a consequence of an increase of the quasi-classical free energy barrier and to a minor extent of an increased number of recrossing trajectories on the transition state dividing surface. Since the variant enzyme is less well set up to catalyze the reaction, a higher degree of active site reorganization is needed to reach the TS. Although millisecond active site motions are lost in the variant, there is greater flexibility on the femtosecond time scale. The “dynamic knockout” EcDHFR-N23PP/S148A is therefore a “dynamic knock-in” at the level of the chemical step, and the increased dynamic coupling to the chemical coordinate is in fact detrimental to catalysis. This finding is most likely applicable not just to hydrogen transfer in EcDHFR but also to other enzymatic systems. PMID:24252106

  5. Catalysis by dihydrofolate reductase and other enzymes arises from electrostatic preorganization, not conformational motions.

    PubMed

    Adamczyk, Andrew J; Cao, Jie; Kamerlin, Shina C L; Warshel, Arieh

    2011-08-23

    The proposal that enzymatic catalysis is due to conformational fluctuations has been previously promoted by means of indirect considerations. However, recent works have focused on cases where the relevant motions have components toward distinct conformational regions, whose population could be manipulated by mutations. In particular, a recent work has claimed to provide direct experimental evidence for a dynamical contribution to catalysis in dihydrofolate reductase, where blocking a relevant conformational coordinate was related to the suppression of the motion toward the occluded conformation. The present work utilizes computer simulations to elucidate the true molecular basis for the experimentally observed effect. We start by reproducing the trend in the measured change in catalysis upon mutations (which was assumed to arise as a result of a "dynamical knockout" caused by the mutations). This analysis is performed by calculating the change in the corresponding activation barriers without the need to invoke dynamical effects. We then generate the catalytic landscape of the enzyme and demonstrate that motions in the conformational space do not help drive catalysis. We also discuss the role of flexibility and conformational dynamics in catalysis, once again demonstrating that their role is negligible and that the largest contribution to catalysis arises from electrostatic preorganization. Finally, we point out that the changes in the reaction potential surface modify the reorganization free energy (which includes entropic effects), and such changes in the surface also alter the corresponding motion. However, this motion is never the reason for catalysis, but rather simply a reflection of the shape of the reaction potential surface.

  6. Virtual ligand screening against Escherichia coli dihydrofolate reductase: improving docking enrichment using physics-based methods.

    PubMed

    Bernacki, Katarzyna; Kalyanaraman, Chakrapani; Jacobson, Matthew P

    2005-10-01

    Motivated by their participation in the McMaster Data-Mining and Docking Competition, the authors developed 2 new computational technologies and applied them to docking against Escherichia coli dihydrofolate reductase: a receptor preparation procedure that incorporates rotamer optimization of side chains and a physics-based rescoring procedure for estimating relative binding affinities of the protein-ligand complexes. Both methods use the same energy function, consisting of the all-atom OPLS-AA force field and a generalized Born solvent model, which treats the protein receptor and small-molecule ligands in a consistent manner. Thus, the energy function is similar to that used in more sophisticated approaches, such as free-energy perturbation and the molecular mechanics Poisson-Boltzmann/surface area, but sampling during the rescoring procedure is limited to simple energy minimization of the ligand. The use of a highly efficient minimization algorithm permitted the authors to apply this rescoring procedure to hundreds of thousands of protein-ligand complexes during the competition, using a modest Linux cluster. To test these methods, they used the 12 competitive inhibitors identified in the training set, plus methotrexate, as positive controls in enrichment studies with both the training and test sets, each containing 50,000 compounds. The key conclusion is that combining the receptor preparation and rescoring methods makes it possible to identify most of the positive controls within the top few tenths of a percent of the rank-ordered training and test set libraries.

  7. New small-molecule inhibitors of dihydrofolate reductase inhibit Streptococcus mutans

    PubMed Central

    Zhang, Qiong; Nguyen, Thao; McMichael, Megan; Velu, Sandanandan; Zou, Jing; Zhou, Xuedong; Wu, Hui

    2015-01-01

    Streptococcus mutans is a major aetiological agent of dental caries. Formation of biofilms is a key virulence factor of S. mutans. Drugs that inhibit S. mutans biofilms may have therapeutic potential. Dihydrofolate reductase (DHFR) plays a critical role in regulating the metabolism of folate. DHFR inhibitors are thus potent drugs and have been explored as anticancer and antimicrobial agents. In this study, a library of analogues based on a DHFR inhibitor, trimetrexate (TMQ), an FDA-approved drug, was screened and three new analogues that selectively inhibited S. mutans were identified. The most potent inhibitor had a 50% inhibitory concentration (IC50) of 454.0 ± 10.2 nM for the biofilm and 8.7 ± 1.9 nM for DHFR of S. mutans. In contrast, the IC50 of this compound for human DHFR was ca. 1000 nM, a >100-fold decrease in its potency, demonstrating the high selectivity of the analogue. An analogue that exhibited the least potency for the S. mutans biofilm also had the lowest activity towards inhibiting S. mutans DHFR, further indicating that inhibition of biofilms is related to reduced DHFR activity. These data, along with docking of the potent analogue to the modelled DHFR structure, suggested that the TMQ analogues indeed selectively inhibited S. mutans through targeting DHFR. These potent and selective small molecules are thus promising lead compounds to develop new effective therapeutics to prevent and treat dental caries. PMID:26022931

  8. Defining the binding site of homotetrameric R67 dihydrofolate reductase and correlating binding enthalpy with catalysis.

    PubMed

    Strader, Michael Brad; Chopra, Shaileja; Jackson, Michael; Smiley, R Derike; Stinnett, Lori; Wu, Jun; Howell, Elizabeth E

    2004-06-15

    R67 dihydrofolate reductase (DHFR) is a novel protein that possesses 222 symmetry. A single active site pore traverses the length of the homotetramer. Although the 222 symmetry implies that four symmetry-related binding sites should exist for each substrate as well as each cofactor, isothermal titration calorimetry (ITC) studies indicate only two molecules bind. Three possible combinations include two dihydrofolate molecules, two NADPH molecules, or one substrate with one cofactor. The latter is the productive ternary complex. To evaluate the roles of A36, Y46, T51, G64, and V66 residues in binding and catalysis, a site-directed mutagenesis approach was employed. One mutation per gene produces four mutations per active site pore, which often result in large cumulative effects. Conservative mutations at these positions either eliminate the ability of the gene to confer trimethoprim resistance or have no effect on catalysis. This result, in conjunction with previous mutagenesis studies on K32, K33, S65, Q67, I68, and Y69 [Strader, M. B., et al. (2001) Biochemistry 40, 11344-11352; Hicks, S. N., et al. (2003) Biochemistry 42, 10569-10578; Park, H., et al. (1997) Protein Eng. 10, 1415-1424], allows mapping of the active site surface. Residues for which conservative mutations have large effects on binding and catalysis include K32, Q67, I68, and Y69. These residues form a stripe that establishes the ligand binding surface. Residues that accommodate conservative mutations that do not greatly affect catalysis include K33, Y46, T51, S65, and V66. Isothermal titration calorimetry studies were also conducted on many of the mutants described above to determine the enthalpy of folate binding to the R67 DHFR.NADPH complex. A linear correlation between this DeltaH value and log k(cat)/K(m) is observed. Since structural tightness appears to be correlated with the exothermicity of the binding interaction, this leads to the hypothesis that enthalpy-driven formation of the ternary

  9. The Tail Wagging the Dog: Insights into Catalysis in R67 Dihydrofolate Reductase

    SciTech Connect

    Kamath, Ganesh K; Agarwal, Pratul K

    2010-01-01

    Plasmid-encoded R67 dihydrofolate reductase (DHFR) catalyzes a hydride transfer reaction between substrate dihydrofolate (DHF) and its cofactor, nicotinamide adenine dinucleotide phosphate (NADPH). R67 DHFR is a homotetramer that exhibits numerous characteristics of a primitive enzyme, including promiscuity in binding of substrate and cofactor, formation of nonproductive complexes, and the absence of a conserved acid in its active site. Furthermore, R67's active site is a pore, which is mostly accessible by bulk solvent. This study uses a computational approach to characterize the mechanism of hydride transfer. Not surprisingly, NADPH remains fixed in one-half of the active site pore using numerous interactions with R67. Also, stacking between the nicotinamide ring of the cofactor and the pteridine ring of the substrate, DHF, at the hourglass center of the pore, holds the reactants in place. However, large movements of the p-aminobenzoylglutamate tail of DHF occur in the other half of the pore because of ion pair switching between symmetry-related K32 residues from two subunits. This computational result is supported by experimental results that the loss of these ion pair interactions (located >13 {angstrom} from the center of the pore) by addition of salt or in asymmetric K32M mutants leads to altered enzyme kinetics [Hicks, S. N., et al. (2003) Biochemistry 42, 10569-10578; Hicks, S. N., et al. (2004) J. Biol. Chem. 279, 46995?47002]. The tail movement at the edge of the active site, coupled with the fixed position of the pteridine ring in the center of the pore, leads to puckering of the pteridine ring and promotes formation of the transition state. Flexibility coupled to R67 function is unusual as it contrasts with the paradigm that enzymes use increased rigidity to facilitate attainment of their transition states. A comparison with chromosomal DHFR indicates a number of similarities, including puckering of the nicotinamide ring and changes in the DHF tail

  10. Multiple Mutations Modulate the Function of Dihydrofolate Reductase in Trimethoprim-Resistant Streptococcus pneumoniae

    PubMed Central

    Maskell, Jeffrey P.; Sefton, Armine M.; Hall, Lucinda M. C.

    2001-01-01

    Trimethoprim resistance in Streptococcus pneumoniae can be conferred by a single amino acid substitution (I100-L) in dihydrofolate reductase (DHFR), but resistant clinical isolates usually carry multiple DHFR mutations. DHFR genes from five trimethoprim-resistant isolates from the United Kingdom were compared to susceptible isolates and used to transform a susceptible control strain (CP1015). All trimethoprim-resistant isolates and transformants contained the I100-L mutation. The properties of DHFRs from transformants with different combinations of mutations were compared. In a transformant with only the I100-L mutation (R12/T2) and a D92-A mutation also found in the DHFRs of susceptible isolates, the enzyme was much more resistant to trimethoprim inhibition (50% inhibitory concentration [IC50], 4.2 μM) than was the DHFR from strain CP1015 (IC50, 0.09 μM). However, Km values indicated a lower affinity for the enzyme's natural substrates (Km for dihydrofolate [DHF], 3.1 μM for CP1015 and 27.5 μM for R12/T2) and a twofold decrease in the specificity constant. In transformants with additional mutations in the C-terminal portion of the enzyme, Km values for DHF were reduced (9.2 to 15.2 μM), indicating compensation for the lower affinity generated by I100-L. Additional mutations in the N-terminal portion of the enzyme were associated with up to threefold-increased resistance to trimethoprim (IC50 of up to 13.7 μM). It is postulated that carriage of the mutation M53-I—which, like I100-L, corresponds to a trimethoprim binding site in the Escherichia coli DHFR—is responsible for this increase. This study demonstrates that although the I100-L mutation alone may give rise to trimethoprim resistance, additional mutations serve to enhance resistance and modulate the effects of existing mutations on the affinity of DHFR for its natural substrates. PMID:11257022

  11. The tail wagging the dog: insights into catalysis in R67 dihydrofolate reductase.

    PubMed

    Kamath, Ganesh; Howell, Elizabeth E; Agarwal, Pratul K

    2010-10-26

    Plasmid-encoded R67 dihydrofolate reductase (DHFR) catalyzes a hydride transfer reaction between substrate dihydrofolate (DHF) and its cofactor, nicotinamide adenine dinucleotide phosphate (NADPH). R67 DHFR is a homotetramer that exhibits numerous characteristics of a primitive enzyme, including promiscuity in binding of substrate and cofactor, formation of nonproductive complexes, and the absence of a conserved acid in its active site. Furthermore, R67's active site is a pore, which is mostly accessible by bulk solvent. This study uses a computational approach to characterize the mechanism of hydride transfer. Not surprisingly, NADPH remains fixed in one-half of the active site pore using numerous interactions with R67. Also, stacking between the nicotinamide ring of the cofactor and the pteridine ring of the substrate, DHF, at the hourglass center of the pore, holds the reactants in place. However, large movements of the p-aminobenzoylglutamate tail of DHF occur in the other half of the pore because of ion pair switching between symmetry-related K32 residues from two subunits. This computational result is supported by experimental results that the loss of these ion pair interactions (located >13 Å from the center of the pore) by addition of salt or in asymmetric K32M mutants leads to altered enzyme kinetics [Hicks, S. N., et al. (2003) Biochemistry 42, 10569-10578; Hicks, S. N., et al. (2004) J. Biol. Chem. 279, 46995-47002]. The tail movement at the edge of the active site, coupled with the fixed position of the pteridine ring in the center of the pore, leads to puckering of the pteridine ring and promotes formation of the transition state. Flexibility coupled to R67 function is unusual as it contrasts with the paradigm that enzymes use increased rigidity to facilitate attainment of their transition states. A comparison with chromosomal DHFR indicates a number of similarities, including puckering of the nicotinamide ring and changes in the DHF tail angle

  12. Circularly permuted dihydrofolate reductase possesses all the properties of the molten globule state, but can resume functional tertiary structure by interaction with its ligands.

    PubMed Central

    Uversky, V. N.; Kutyshenko, V. P.; Protasova NYu; Rogov, V. V.; Vassilenko, K. S.; Gudkov, A. T.

    1996-01-01

    It is obvious that functional activity of a protein molecule is closely related to its structure. On the other hand, the understanding of structure-function relationship still remains one of the intriguing problems of molecular biology. There is widespread belief that mutagenesis presents a real way to solve this problem. Following this assumption, we have investigated the effect of circular permutation in dihydrofolate reductase from E. coli on protein structure and functioning. It has been shown that in the absence of ligands two circularly permuted variants of dihydrofolate reductase possess all the properties of the molten globule state. However, after addition of ligands they gain the native-like structural properties and specific activity. This means that the in vitro folding of permuted dihydrofolate reductase is terminated at the stage of the molten globule formation. Interaction of permuted protein with ligands leads to the structural adjustment and formation of active protein molecules. PMID:8880908

  13. NMR studies of multiple conformations in complexes of Lactobacillus casei dihydrofolate reductase with analogues of pyrimethamine.

    PubMed

    Birdsall, B; Tendler, S J; Arnold, J R; Feeney, J; Griffin, R J; Carr, M D; Thomas, J A; Roberts, G C; Stevens, M F

    1990-10-16

    1H and 19F NMR signals from bound ligands have been assigned in one- and two-dimensional NMR spectra of complexes of Lactobacillus casei dihydrofolate reductase with various pyrimethamine analogues (including pyrimethamine [1, 2,4-diamino-5-(4'-chlorophenyl)-6-ethylpyrimidine], fluoropyrimethamine [2, 2,4-diamino-5-(4'-fluorophenyl)-6-ethylpyrimidine], fluoronitropyrimethamine [3, 2,4-diamino-5-(4'-fluoro-3'-nitrophenyl) -6-ethylpyrimidine], and methylbenzoprim [4, 2,4-diamino-5-[4'- (methylbenzylamino)-3'-nitrophenyl]-6-ethylpyrimidine]). The signals were identified mainly by correlating signals from bound and free ligands by using 2D exchange experiments. Analogues (such as 1 and 2) with symmetrically substituted phenyl rings give rise to 1H signals from four nonequivalent aromatic protons, clearly indicating the presence of hindered rotation about the pyrimidine-phenyl bond. Analogues containing asymmetrically substituted aromatic rings (such as 3 and 4) exist as mixtures of two rotational isomers (an enantiomeric pair) because of this hindered rotation and the NMR spectra revealed that both isomers (forms A and B) bind to the enzyme with comparable, though unequal, binding energies. In this case two complete sets of bound proton signals were observed. The phenyl ring protons in each of the two forms experience essentially the same protein environment (same shielding) as that experienced by the corresponding protons in bound pyrimethamine: this confirms that forms A and B correspond to two rotational isomers resulting from approximately 180 degrees rotation about the pyrimidine-phenyl bond, with the 2,4-diaminopyrimidine ring being bound similarly in both forms. The relative orientations of the two forms have been determined from NOE through-space connections between protons on the ligand and protein.(ABSTRACT TRUNCATED AT 250 WORDS)

  14. Identifying antimalarial compounds targeting dihydrofolate reductase-thymidylate synthase (DHFR-TS) by chemogenomic profiling.

    PubMed

    Aroonsri, Aiyada; Akinola, Olugbenga; Posayapisit, Navaporn; Songsungthong, Warangkhana; Uthaipibull, Chairat; Kamchonwongpaisan, Sumalee; Gbotosho, Grace O; Yuthavong, Yongyuth; Shaw, Philip J

    2016-07-01

    The mode of action of many antimalarial drugs is unknown. Chemogenomic profiling is a powerful method to address this issue. This experimental approach entails disruption of gene function and phenotypic screening for changes in sensitivity to bioactive compounds. Here, we describe the application of reverse genetics for chemogenomic profiling in Plasmodium. Plasmodium falciparum parasites harbouring a transgenic insertion of the glmS ribozyme downstream of the dihydrofolate reductase-thymidylate synthase (DHFR-TS) gene were used for chemogenomic profiling of antimalarial compounds to identify those which target DHFR-TS. DHFR-TS expression can be attenuated by exposing parasites to glucosamine. Parasites with attenuated DHFR-TS expression were significantly more sensitive to antifolate drugs known to target DHFR-TS. In contrast, no change in sensitivity to other antimalarial drugs with different modes of action was observed. Chemogenomic profiling was performed using the Medicines for Malaria Venture (Switzerland) Malaria Box compound library, and two compounds were identified as novel DHFR-TS inhibitors. We also tested the glmS ribozyme in Plasmodium berghei, a rodent malaria parasite. The expression of reporter genes with downstream glmS ribozyme could be attenuated in transgenic parasites comparable with that obtained in P. falciparum. The chemogenomic profiling method was applied in a P. berghei line expressing a pyrimethamine-resistant Toxoplasma gondii DHFR-TS reporter gene under glmS ribozyme control. Parasites with attenuated expression of this gene were significantly sensitised to antifolates targeting DHFR-TS, but not other drugs with different modes of action. In conclusion, these data show that the glmS ribozyme reverse genetic tool can be applied for identifying primary targets of antimalarial compounds in human and rodent malaria parasites. Copyright © 2016 Australian Society for Parasitology. Published by Elsevier Ltd. All rights reserved.

  15. Pivotal role of dihydrofolate reductase knockdown in the anticancer activity of 2-hydroxyoleic acid

    PubMed Central

    Lladó, Victoria; Terés, Silvia; Higuera, Mónica; Álvarez, Rafael; Noguera-Salva, Maria Antònia; Halver, John E.; Escribá, Pablo V.; Busquets, Xavier

    2009-01-01

    α-Hydroxy-9-cis-octadecenoic acid, a synthetic fatty acid that modifies the composition and structure of lipid membranes. 2-Hydroxyoleic acid (HOA) generated interest due to its potent, yet nontoxic, anticancer activity. It induces cell cycle arrest in human lung cancer (A549) cells and apoptosis in human leukemia (Jurkat) cells. These two pathways may explain how HOA induces regression of a variety of cancers. We showed that HOA repressed the expression of dihydrofolate reductase (DHFR), the enzyme responsible for tetrahydrofolate (THF) synthesis. Folinic acid, which readily produces THF without the participation of DHFR, reverses the antitumor effects of HOA in A549 and Jurkat cells, as well as the inhibitory influence on cyclin D and cdk2 in A549 cells, and on DNA and PARP degradation in Jurkat cells. This effect was very specific, because either elaidic acid (an analog of HOA) or other lipids, failed to alter A549 or Jurkat cell growth. THF is a cofactor necessary for DNA synthesis. Thus, impairment of DNA synthesis appears to be a common mechanism involved in the different responses elicited by cancer cells following treatment with HOA, namely cell cycle arrest or apoptosis. Compared with other antifolates, such as methotrexate, HOA did not directly inhibit DHFR but rather, it repressed its expression, a mode of action that offers certain therapeutic advantages. These results not only demonstrate the effect of a fatty acid on the expression of DHFR, but also emphasize the potential of HOA to be used as a wide-spectrum drug against cancer. PMID:19666584

  16. A molecular model of the folate binding site of Pneumocystis carinii dihydrofolate reductase

    NASA Astrophysics Data System (ADS)

    Southerland, William M.

    1994-04-01

    The inhibition of Pneumocystis carinii dihydrofolate reductase (DHFR) continues to be the major treatment strategy for P. carinii pneumonia (PCP). The design of new anti-pneumocystis agents would be significantly enhanced by the availability of a 3D model of the methotrexate (MTX) binding site of the P. carinii DHFR. However, an X-ray crystal structure of the P. carinii DHFR is not yet available. Alignment of the amino acid sequences of P. carinii and Lactobacillus casei DHFRs indicates that the two proteins show approximately 80% homology among MTX binding-site residues. This high level of homology suggests that the L. casei DHFR MTX binding-site structure could serve as a structural template in developing a model of the P. carinii DHFR MTX binding site. Therefore, the X-ray crystal structure of L. casei DHFR was used to develop a 3D model of the methotrexate binding site of P. carinii DHFR. The molecular modeling and dynamics software QUANTA/CHARMm was used. Amino acid residue mutations and deletions were performed using QUANTA and macromolecular minimizations were achieved with CHARMm. The MTX binding-site residues of L. casei DHFR were mutated to the corresponding residues of the P. carinii DHFR sequence. The resulting structure was extensively minimized. The resulting P. carinii MTX binding-site model showed significant differences in hydrogen-bonding patterns from the L. casei MTX binding site. Also, the P. carinii site is more hydrophobic than the corresponding L. casei site. Analysis of atom-to-atom close contacts between methotrexate and protein binding-site residues indicates that the P. carinii MTX binding-site complex is primarily stabilized by hydrophobic interactions, while the L. casei complex is mostly stabilized by electrostatic interactions. The model is consistent with the observed increased sensitivity of P. carinii DHFR to lipid-soluble inhibitors and provides a rational basis for the design of new anti-pneumocystis agents.

  17. Protein Mass-Modulated Effects in the Catalytic Mechanism of Dihydrofolate Reductase: Beyond Promoting Vibrations

    PubMed Central

    2015-01-01

    The role of fast protein dynamics in enzyme catalysis has been of great interest in the past decade. Recent “heavy enzyme” studies demonstrate that protein mass-modulated vibrations are linked to the energy barrier for the chemical step of catalyzed reactions. However, the role of fast dynamics in the overall catalytic mechanism of an enzyme has not been addressed. Protein mass-modulated effects in the catalytic mechanism of Escherichia coli dihydrofolate reductase (ecDHFR) are explored by isotopic substitution (13C, 15N, and non-exchangeable 2H) of the wild-type ecDHFR (l-DHFR) to generate a vibrationally perturbed “heavy ecDHFR” (h-DHFR). Steady-state, pre-steady-state, and ligand binding kinetics, intrinsic kinetic isotope effects (KIEint) on the chemical step, and thermal unfolding experiments of both l- and h-DHFR show that the altered protein mass affects the conformational ensembles and protein–ligand interactions, but does not affect the hydride transfer at physiological temperatures (25–45 °C). Below 25 °C, h-DHFR shows altered transition state (TS) structure and increased barrier-crossing probability of the chemical step compared with l-DHFR, indicating temperature-dependent protein vibrational coupling to the chemical step. Protein mass-modulated vibrations in ecDHFR are involved in TS interactions at cold temperatures and are linked to dynamic motions involved in ligand binding at physiological temperatures. Thus, mass effects can affect enzymatic catalysis beyond alterations in promoting vibrations linked to chemistry. PMID:24820793

  18. A-to-I RNA Editing Up-regulates Human Dihydrofolate Reductase in Breast Cancer.

    PubMed

    Nakano, Masataka; Fukami, Tatsuki; Gotoh, Saki; Nakajima, Miki

    2017-03-24

    Dihydrofolate reductase (DHFR) plays a key role in folate metabolism and is a target molecule of methotrexate. An increase in the cellular expression level of DHFR is one of the mechanisms of tumor resistance to methotrexate. The present study investigated the possibility that adenosine-to-inosine RNA editing, which causes nucleotide conversion by adenosine deaminase acting on RNA (ADAR) enzymes, might modulate DHFR expression. In human breast adenocarcinoma-derived MCF-7 cells, 26 RNA editing sites were identified in the 3'-UTR of DHFR. Knockdown of ADAR1 decreased the RNA editing levels of DHFR and resulted in a decrease in the DHFR mRNA and protein levels, indicating that ADAR1 up-regulates DHFR expression. Using a computational analysis, miR-25-3p and miR-125a-3p were predicted to bind to the non-edited 3'-UTR of DHFR but not to the edited sequence. The decrease in DHFR expression by the knockdown of ADAR1 was restored by transfection of antisense oligonucleotides for these miRNAs, suggesting that RNA editing mediated up-regulation of DHFR requires the function of these miRNAs. Interestingly, we observed that the knockdown of ADAR1 decreased cell viability and increased the sensitivity of MCF-7 cells to methotrexate. ADAR1 expression levels and the RNA editing levels in the 3'-UTR of DHFR in breast cancer tissues were higher than those in adjacent normal tissues. Collectively, the present study demonstrated that ADAR1 positively regulates the expression of DHFR by editing the miR-25-3p and miR-125a-3p binding sites in the 3'-UTR of DHFR, enhancing cellular proliferation and resistance to methotrexate.

  19. Detection of dihydrofolate reductase conformational change by FRET using two fluorescent amino acids.

    PubMed

    Chen, Shengxi; Fahmi, Nour Eddine; Wang, Lin; Bhattacharya, Chandrabali; Benkovic, Stephen J; Hecht, Sidney M

    2013-09-04

    Two fluorescent amino acids, including the novel fluorescent species 4-biphenyl-l-phenylalanine (1), have been incorporated at positions 17 and 115 of dihydrofolate reductase (DHFR) to enable a study of conformational changes associated with inhibitor binding. Unlike most studies involving fluorescently labeled proteins, the fluorophores were incorporated into the amino acid side chains, and both probes [1 and L-(7-hydroxycoumarin-4-yl)ethylglycine (2)] were smaller than fluorophores typically used for such studies. The DHFR positions were chosen as potentially useful for Förster resonance energy transfer (FRET) measurements on the basis of their estimated separation (17-18 Å) and the expected change in distance along the reaction coordinate. Also of interest was the steric accessibility of the two sites: Glu17 is on the surface of DHFR, while Ile115 is within a folded region of the protein. Modified DHFR I (1 at position 17; 2 at position 115) and DHFR II (2 at position 17; 1 at position 115) were both catalytically competent. However, DHFR II containing the potentially rotatable biphenylphenylalanine moiety at sterically encumbered position 115 was significantly more active than DHFR I. Irradiation of the modified DHFRs at 280 nm effected excitation of 1, energy transfer to 2, and emission by 2 at 450 nm. However, the energy transfer was substantially more efficient in DHFR II. The effect of inhibitor binding was also measured. Trimethoprim mediated concentration-dependent diminution of the emission observed at 450 nm for DHFR II but not for DHFR I. These findings demonstrate that amino acids containing small fluorophores can be introduced into DHFR with minimal disruption of function and in a fashion that enables sensitive monitoring of changes in DHFR conformation.

  20. Dihydrofolate Reductase and Thymidylate Synthase Transgenes Resistant to Methotrexate Interact to Permit Novel Transgene Regulation*

    PubMed Central

    Rushworth, David; Mathews, Amber; Alpert, Amir; Cooper, Laurence J. N.

    2015-01-01

    Methotrexate (MTX) is an anti-folate that inhibits de novo purine and thymidine nucleotide synthesis. MTX induces death in rapidly replicating cells and is used in the treatment of multiple cancers. MTX inhibits thymidine synthesis by targeting dihydrofolate reductase (DHFR) and thymidylate synthase (TYMS). The use of MTX to treat cancer also causes bone marrow suppression and inhibits the immune system. This has led to the development of an MTX-resistant DHFR, DHFR L22F, F31S (DHFRFS), to rescue healthy cells. 5-Fluorouracil-resistant TYMS T51S, G52S (TYMSSS) is resistant to MTX and improves MTX resistance of DHFRFS in primary T cells. Here we find that a known mechanism of MTX-induced increase in DHFR expression persists with DHFRFS and cis-expressed transgenes. We also find that TYMSSS expression of cis-expressed transgenes is similarly decreased in an MTX-inducible manner. MTX-inducible changes in DHFRFS and TYMSSS expression changes are lost when both genes are expressed together. In fact, expression of the DHFRFS and TYMSSS cis-expressed transgenes becomes correlated. These findings provide the basis for an unrecognized post-transcriptional mechanism that functionally links expression of DHFR and TYMS. These findings were made in genetically modified primary human T cells and have a clear potential for use in clinical applications where gene expression needs to be regulated by drug or maintained at a specific expression level. We demonstrate a potential application of this system in the controlled expression of systemically toxic cytokine IL-12. PMID:26242737

  1. Thermal Stabilization of Dihydrofolate Reductase Using Monte Carlo Unfolding Simulations and Its Functional Consequences

    PubMed Central

    Whitney, Anna; Shakhnovich, Eugene I.

    2015-01-01

    Design of proteins with desired thermal properties is important for scientific and biotechnological applications. Here we developed a theoretical approach to predict the effect of mutations on protein stability from non-equilibrium unfolding simulations. We establish a relative measure based on apparent simulated melting temperatures that is independent of simulation length and, under certain assumptions, proportional to equilibrium stability, and we justify this theoretical development with extensive simulations and experimental data. Using our new method based on all-atom Monte-Carlo unfolding simulations, we carried out a saturating mutagenesis of Dihydrofolate Reductase (DHFR), a key target of antibiotics and chemotherapeutic drugs. The method predicted more than 500 stabilizing mutations, several of which were selected for detailed computational and experimental analysis. We find a highly significant correlation of r = 0.65–0.68 between predicted and experimentally determined melting temperatures and unfolding denaturant concentrations for WT DHFR and 42 mutants. The correlation between energy of the native state and experimental denaturation temperature was much weaker, indicating the important role of entropy in protein stability. The most stabilizing point mutation was D27F, which is located in the active site of the protein, rendering it inactive. However for the rest of mutations outside of the active site we observed a weak yet statistically significant positive correlation between thermal stability and catalytic activity indicating the lack of a stability-activity tradeoff for DHFR. By combining stabilizing mutations predicted by our method, we created a highly stable catalytically active E. coli DHFR mutant with measured denaturation temperature 7.2°C higher than WT. Prediction results for DHFR and several other proteins indicate that computational approaches based on unfolding simulations are useful as a general technique to discover stabilizing

  2. Elucidating features that drive the design of selective antifolates using crystal structures of human dihydrofolate reductase.

    PubMed

    Lamb, Kristen M; G-Dayanandan, Narendran; Wright, Dennis L; Anderson, Amy C

    2013-10-15

    The pursuit of antimicrobial drugs that target dihydrofolate reductase (DHFR) exploits differences in sequence and dynamics between the pathogenic and human enzymes. Here, we present five crystal structures of human DHFR bound to a new class of antimicrobial agents, the propargyl-linked antifolates (PLAs), with a range of potency (IC50 values of 0.045-1.07 μM) for human DHFR. These structures reveal that interactions between the ligands and Asn 64, Phe 31, and Phe 34 are important for increased affinity for human DHFR and that loop residues 58-64 undergo ligand-induced conformational changes. The utility of these structural studies was demonstrated through the design of three new ligands that reduce the number of contacts with Asn 64, Phe 31, and Phe 34. Synthesis and evaluation show that one of the designed inhibitors exhibits the lowest affinity for human DHFR of any of the PLAs (2.64 μM). Comparisons of structures of human and Staphylococcus aureus DHFR bound to the same PLA reveal a conformational change in the ligand that enhances interactions with residues Phe 92 (Val 115 in huDHFR) and Ile 50 (Ile 60 in huDHFR) in S. aureus DHFR, yielding selectivity. Likewise, comparisons of human and Candida glabrata DHFR bound to the same ligand show that hydrophobic interactions with residues Ile 121 and Phe 66 (Val 115 and Asn 64 in human DHFR) yield selective inhibitors. The identification of residue substitutions that are important for selectivity and the observation of active site flexibility will help guide antimicrobial antifolate development for the inhibition of pathogenic species.

  3. Probing the Electrostatics of Active Site Microenvironments along the Catalytic Cycle for Escherichia coli Dihydrofolate Reductase

    PubMed Central

    2015-01-01

    Electrostatic interactions play an important role in enzyme catalysis by guiding ligand binding and facilitating chemical reactions. These electrostatic interactions are modulated by conformational changes occurring over the catalytic cycle. Herein, the changes in active site electrostatic microenvironments are examined for all enzyme complexes along the catalytic cycle of Escherichia coli dihydrofolate reductase (ecDHFR) by incorporation of thiocyanate probes at two site-specific locations in the active site. The electrostatics and degree of hydration of the microenvironments surrounding the probes are investigated with spectroscopic techniques and mixed quantum mechanical/molecular mechanical (QM/MM) calculations. Changes in the electrostatic microenvironments along the catalytic environment lead to different nitrile (CN) vibrational stretching frequencies and 13C NMR chemical shifts. These environmental changes arise from protein conformational rearrangements during catalysis. The QM/MM calculations reproduce the experimentally measured vibrational frequency shifts of the thiocyanate probes across the catalyzed hydride transfer step, which spans the closed and occluded conformations of the enzyme. Analysis of the molecular dynamics trajectories provides insight into the conformational changes occurring between these two states and the resulting changes in classical electrostatics and specific hydrogen-bonding interactions. The electric fields along the CN axes of the probes are decomposed into contributions from specific residues, ligands, and solvent molecules that make up the microenvironments around the probes. Moreover, calculation of the electric field along the hydride donor–acceptor axis, along with decomposition of this field into specific contributions, indicates that the cofactor and substrate, as well as the enzyme, impose a substantial electric field that facilitates hydride transfer. Overall, experimental and theoretical data provide evidence for

  4. Probing the electrostatics of active site microenvironments along the catalytic cycle for Escherichia coli dihydrofolate reductase.

    PubMed

    Liu, C Tony; Layfield, Joshua P; Stewart, Robert J; French, Jarrod B; Hanoian, Philip; Asbury, John B; Hammes-Schiffer, Sharon; Benkovic, Stephen J

    2014-07-23

    Electrostatic interactions play an important role in enzyme catalysis by guiding ligand binding and facilitating chemical reactions. These electrostatic interactions are modulated by conformational changes occurring over the catalytic cycle. Herein, the changes in active site electrostatic microenvironments are examined for all enzyme complexes along the catalytic cycle of Escherichia coli dihydrofolate reductase (ecDHFR) by incorporation of thiocyanate probes at two site-specific locations in the active site. The electrostatics and degree of hydration of the microenvironments surrounding the probes are investigated with spectroscopic techniques and mixed quantum mechanical/molecular mechanical (QM/MM) calculations. Changes in the electrostatic microenvironments along the catalytic environment lead to different nitrile (CN) vibrational stretching frequencies and (13)C NMR chemical shifts. These environmental changes arise from protein conformational rearrangements during catalysis. The QM/MM calculations reproduce the experimentally measured vibrational frequency shifts of the thiocyanate probes across the catalyzed hydride transfer step, which spans the closed and occluded conformations of the enzyme. Analysis of the molecular dynamics trajectories provides insight into the conformational changes occurring between these two states and the resulting changes in classical electrostatics and specific hydrogen-bonding interactions. The electric fields along the CN axes of the probes are decomposed into contributions from specific residues, ligands, and solvent molecules that make up the microenvironments around the probes. Moreover, calculation of the electric field along the hydride donor-acceptor axis, along with decomposition of this field into specific contributions, indicates that the cofactor and substrate, as well as the enzyme, impose a substantial electric field that facilitates hydride transfer. Overall, experimental and theoretical data provide evidence for

  5. Down-regulation of dihydrofolate reductase inhibits the growth of endothelial EA.hy926 cell through induction of G1 cell cycle arrest via up-regulating p53 and p21(waf1/cip1) expression.

    PubMed

    Fei, Zhewei; Gao, Yong; Qiu, Mingke; Qi, Xianqin; Dai, Yuxin; Wang, Shuqing; Quan, Zhiwei; Liu, Yingbin; Ou, Jingmin

    2016-03-01

    Folic acid supplementation may meliorate cardiovascular disease risk by improving vascular endothelial structure and function. However, the underlying mechanisms are still lack of a global understanding. To be used, folic acid must be converted to 7,8-dihydrofolate by dihydrofolate reductase to generate one-carbon derivatives serving as important cellular cofactors in the synthesis of nucleotides and amino acids required for cell growth. Therefore, this study explored the effect of dihydrofolate reductase knockdown on endothelial EA.hy926 cell growth and the mechanism involved. We found that down-regulation of dihydrofolate reductase inhibited EA.hy926 cell proliferation, and induced G1 phase arrest. Meanwhile, the expression of regulators necessary for G1/S phase transition, such as cyclin-dependent kinases CDK2, CDK4 and CDK6, were remarkably down-regulated; by contrast, the cell cycle inhibitors p21(waf/cip1), p27(Kip1) and p53 were significantly up-regulated after dihydrofolate reductase knockdown. Furthermore, supplementation of 5-methyltetrahydrofolate to the dihydrofolate reductase knockdown cells could weaken the inhibitory effect of dihydrofolate reductase knockdown on cell proliferation, simultaneously, inducing the expression of p53 and p21(waf/cip1) falling back moderately. Our findings suggest that attenuating dihydrofolate reductase may cause imbalanced expression of cell cycle regulators, especially up-regulation of p53-p21(waf/cip1) pathway, leading to G1 cell cycle arrest, thereby inhibiting the growth of endothelial EA.hy926 cells.

  6. Large-scale purification and characterization of dihydrofolate reductase from a methotrexate-resistant strain of Lactobacillus casei.

    PubMed Central

    Dann, J G; Ostler, G; Bjur, R A; King, R W; Scudder, P; Turner, P C; Roberts, G C; Burgen, A S

    1976-01-01

    Dihydrofolate reductase has been purified from a methotrexate-resistant strain of Lactobacillus casei NCB 6375. By careful attention to growth conditions, up to 2.5 g of enzyme is obtained from a 400 litre culture. The purification procedure, involving poly-ethyleneimine treatment, DEAE-cellulose chromatography and affinity chromatography on methotrexate-aminohexyl-Sepharose, operates on the gram scale, with overall yields of 50-60%. Elution of the affinity column by reverse (upward) flow was used, as it led to recovery of the enzyme in a much smaller volume. The enzyme obtained appears to be more than 98% pure, as judged by gel electrophoresis, isoelectric focusing, and gel filtration. It has a mol.wt. of approx. 17900 and a turnover number of 4s-1 (50mM-triethanolamine/400mM-KCl, pH 7.2, 25 degrees C) with dihydrofolate and NADPH as substrates. The turnover number for folate is 0.02s-1. Michaelis constants for a variety of substrates have been measured by using a new fluorimetric assay (0.36 muM-dihydrofolate; 0.78 muM-NADPH), and binding constants determined by using the quenching of protein fluorescence (dihydrofolate, 2.25 X 10(6)M-1; NADPH, greater than 10(8)M-1). The pH/activity profile shows a single maximum at pH 7.3; at this pH, marked activation by 0.5M-NaCl is observed. PMID:10886

  7. Structural studies provide clues for analog design of specific inhibitors of Cryptosporidium hominis thymidylate synthase-dihydrofolate reductase.

    PubMed

    Kumar, Vidya P; Cisneros, Jose A; Frey, Kathleen M; Castellanos-Gonzalez, Alejandro; Wang, Yiqiang; Gangjee, Aleem; White, A Clinton; Jorgensen, William L; Anderson, Karen S

    2014-09-01

    Cryptosporidium is the causative agent of a gastrointestinal disease, cryptosporidiosis, which is often fatal in immunocompromised individuals and children. Thymidylate synthase (TS) and dihydrofolate reductase (DHFR) are essential enzymes in the folate biosynthesis pathway and are well established as drug targets in cancer, bacterial infections, and malaria. Cryptosporidium hominis has a bifunctional thymidylate synthase and dihydrofolate reductase enzyme, compared to separate enzymes in the host. We evaluated lead compound 1 from a novel series of antifolates, 2-amino-4-oxo-5-substituted pyrrolo[2,3-d]pyrimidines as an inhibitor of Cryptosporidium hominis thymidylate synthase with selectivity over the human enzyme. Complementing the enzyme inhibition compound 1 also has anti-cryptosporidial activity in cell culture. A crystal structure with compound 1 bound to the TS active site is discussed in terms of several van der Waals, hydrophobic and hydrogen bond interactions with the protein residues and the substrate analog 5-fluorodeoxyuridine monophosphate (TS), cofactor NADPH and inhibitor methotrexate (DHFR). Another crystal structure in complex with compound 1 bound in both the TS and DHFR active sites is also reported here. The crystal structures provide clues for analog design and for the design of ChTS-DHFR specific inhibitors. Copyright © 2014. Published by Elsevier Ltd.

  8. Probing the Active Site of Candida Glabrata Dihydrofolate Reductase with High Resolution Crystal Structures and the Synthesis of New Inhibitors

    SciTech Connect

    Liu, J.; Bolstad, D; Smith, A; Priestley, N; Wright, D; Anderson, A

    2009-01-01

    Candida glabrata, a fungal strain resistant to many commonly administered antifungal agents, has become an emerging threat to human health. In previous work, we validated that the essential enzyme, dihydrofolate reductase, is a drug target in C. glabrata. Using a crystal structure of dihydrofolate reductase from C. glabrata bound to an initial lead compound, we designed a class of biphenyl antifolates that potently and selectively inhibit both the enzyme and the growth of the fungal culture. In this work, we explore the structure-activity relationships of this class of antifolates with four new high resolution crystal structures of enzyme:inhibitor complexes and the synthesis of four new inhibitors. The designed inhibitors are intended to probe key hydrophobic pockets visible in the crystal structure. The crystal structures and an evaluation of the new compounds reveal that methyl groups at the meta and para positions of the distal phenyl ring achieve the greatest number of interactions with the pathogenic enzyme and the greatest degree of selectivity over the human enzyme. Additionally, antifungal activity can be tuned with substitution patterns at the propargyl and para-phenyl positions.

  9. Induction of methotrexate resistance by retroviral-mediated transfer of a mutant dihydrofolate reductase gene

    SciTech Connect

    Ricciardone, M.D.

    1986-01-01

    Methotrexate (MTX), a folate analog which inhibits the enzyme dihydrofolate reductase (DHFR), is an effective antineoplastic drug. However, MTX-induced myelosuppression limits the effectiveness of this agent. Selective induction of MTX resistance in bone marrow stem cells, prior to treatment with MTX, might prevent this toxicity and improve the therapeutic index of the drug. In these studies drug resistance was transferred to mouse and human bone marrow stem cells by retroviral expression vectors containing coding sequences of a mutant DHFR with a decreased affinity for MTX. Three retroviral expression vectors were analyzed. The CIS DR vector contained the mutant DHFR gene inserted into the replication-defective amphotropic 4070 virus, Cistor. The other vectors contained the mutant DHFR inserted into either the env region (SDHT1) or gag-pol region (SDHT2) of a replication-defective spleen focus-forming virus. All three constructs induced approximately a 200-fold resistance to MTX when transfected into NIH3T3 cells. Amphotropic infectious retroviruses were obtained by transfecting the mutant DHFR vectors into a packaging cell line, which supplied the gag, pol, and env proteins for virus production. Virus titers of 4.5 x 10/sup 3/ colony-forming units (CFU)/ml (CIS DR), 1.5 x 10/sup 4/ CFU/ml (SDHT2), and 5 x 10/sup 5/ CFU/ml (SDHT1) were measured by the transfer of MTX resistance to NIH3T3 cells. The amphotropic SDHT1 virus efficiently induced MTX resistance in cells of several species, including mouse NIH3T3 cells (5 x 10/sup 5/ CFU/ml), monkey CV1 cells (4 x 10/sup 3/ CFU/ml), and human MCF-7 cells (6 x 10/sup 4/ CFU/ml). When cocultured with SDHT1 virus-producing cells, both mouse and human bone marrow cells could be infected and rendered resistant to MTX. Mouse cytotoxic T lymphocytes and mouse helper T lymphocytes can also be made resistant to MTX.

  10. X-ray structure of the ternary MTX·NADPH complex of the anthrax dihydrofolate reductase: A pharmacophore for dual-site inhibitor design

    SciTech Connect

    Bennett, Brad C.; Wan, Qun; Ahmad, Md Faiz; Langan, Paul; Dealwis, Chris G.

    2009-11-18

    For reasons of bioterrorism and drug resistance, it is imperative to identify and develop new molecular points of intervention against anthrax. Dihydrofolate reductase (DHFR) is a highly conserved enzyme and an established target in a number of species for a variety of chemotherapeutic programs. Recently, the crystal structure of B. anthracis DHFR (baDHFR) in complex with methotrexate (MTX) was determined and, based on the structure, proposals were made for drug design strategies directed against the substrate binding site. However, little is gleaned about the binding site for NADPH, the cofactor responsible for hydride transfer in the catalytic mechanism. In the present study, X-ray crystallography at 100 K was used to determine the structure of baDHFR in complex with MTX and NADPH. Although the NADPH binding mode is nearly identical to that seen in other DHFR ternary complex structures, the adenine moiety adopts an off-plane tilt of nearly 90 deg. and this orientation is stabilized by hydrogen bonds to functionally conserved Arg residues. A comparison of the binding site, focusing on this region, between baDHFR and the human enzyme is discussed, with an aim at designing species-selective therapeutics. Indeed, the ternary model, refined to 2.3{angstrom} resolution, provides an accurate template for testing the feasibility of identifying dual-site inhibitors, compounds that target both the substrate and cofactor binding site. With the ternary model in hand, using in silico methods, several compounds were identified which could potentially form key bonding contacts in the substrate and cofactor binding sites. Ultimately, two structurally distinct compounds were verified that inhibit baDHFR at low {mu}M concentrations. The apparent K{sub d} for one of these, (2-(3-(2-(hydroxyimino)-2-(pyridine-4-yl)-6,7-dimethylquinoxalin-2-yl)-1-(pyridine-4-yl)ethanone oxime), was measured by fluorescence spectroscopy to be 5.3 {mu}M.

  11. X-ray structure of the ternary MTX•NADPH complex of the anthrax dihydrofolate reductase: a pharmacophore for dual-site inhibitor design

    PubMed Central

    Bennett, Brad C.; Wan, Qun; Ahmad, Md Faiz; Dealwis, Chris G.

    2009-01-01

    For reasons of bioterrorism and drug resistance, it is imperative to identify and develop new molecular points of intervention against anthrax. Dihydrofolate reductase (DHFR) is a highly conserved enzyme and an established target in a number of species for a variety of chemotherapeutic programs. Recently, the crystal structure of B. anthracis DHFR (baDHFR) in complex with methotrexate (MTX) was determined and, based on the structure, proposals were made for drug design strategies directed against the substrate binding site. However, little is gleaned about the binding site for NADPH, the cofactor responsible for hydride transfer in the catalytic mechanism. In the present study, X-ray crystallography at 100 K was used to determine the structure of baDHFR in complex with MTX and NADPH. Although the NADPH binding mode is nearly identical to that seen in other DHFR ternary complex structures, the adenine moiety adopts an off-plane tilt of nearly 90° and this orientation is stabilized by hydrogen bonds to functionally conserved Arg residues. A comparison of the binding site, focusing on this region, between baDHFR and the human enzyme is discussed, with an aim at designing species-selective therapeutics. Indeed, the ternary model, refined to 2.3Å resolution, provides an accurate template for testing the feasibility of identifying dual-site inhibitors, compounds that target both the substrate and cofactor binding site. With the ternary model in hand, using in silico methods, several compounds were identified which could potentially form key bonding contacts in the substrate and cofactor binding sites. Ultimately, two structurally distinct compounds were verified that inhibit baDHFR at low μM concentrations. The apparent Kd for one of these, (2-(3-(2-(hydroxyimino)-2-(pyridine-4-yl)-6,7-dimethylquinoxalin-2-yl)-1-(pyridine-4-yl)ethanone oxime), was measured by fluorescence spectroscopy to be 5.3 μM. PMID:19374017

  12. A 19-base pair deletion polymorphism in dihydrofolate reductase is associated with increased unmetabolized folic acid in plasma and decreased red blood cell folate

    USDA-ARS?s Scientific Manuscript database

    Dihydrofolate reductase (DHFR) catalyzes the reduction of folic acid to tetrahydrofolate (THF). A 19-bp noncoding deletion allele maps to intron 1, beginning 60 bases from the splice donor site, and has been implicated in neural tube defects and cancer, presumably by influencing folate metabolism. T...

  13. Accurate and Sensitive Detection of Plasmodium Species in Humans by Use of the Dihydrofolate Reductase-Thymidylate Synthase Linker Region▿ †

    PubMed Central

    Tanomsing, Naowarat; Imwong, Mallika; Theppabutr, Sasikrit; Pukrittayakamee, Sasithon; Day, Nicholas P. J.; White, Nicholas J.; Snounou, Georges

    2010-01-01

    A nested-PCR protocol based on the linker region of the Plasmodium dihydrofolate reductase-thymidylate synthase gene (dhfr-ts) was developed. This provides highly sensitive specific detection and identification of the five parasite species that infect humans. PMID:20702666

  14. Escherichia coli dihydrofolate reductase catalyzed proton and hydride transfers: Temporal order and the roles of Asp27 and Tyr100

    PubMed Central

    Liu, C. Tony; Francis, Kevin; Layfield, Joshua P.; Huang, Xinyi; Hammes-Schiffer, Sharon; Kohen, Amnon; Benkovic, Stephen J.

    2014-01-01

    The reaction catalyzed by Escherichia coli dihydrofolate reductase (ecDHFR) has become a model for understanding enzyme catalysis, and yet several details of its mechanism are still unresolved. Specifically, the mechanism of the chemical step, the hydride transfer reaction, is not fully resolved. We found, unexpectedly, the presence of two reactive ternary complexes [enzyme:NADPH:7,8-dihydrofolate (E:NADPH:DHF)] separated by one ionization event. Furthermore, multiple kinetic isotope effect (KIE) studies revealed a stepwise mechanism in which protonation of the DHF precedes the hydride transfer from the nicotinamide cofactor (NADPH) for both reactive ternary complexes of the WT enzyme. This mechanism was supported by the pH- and temperature-independent intrinsic KIEs for the C-H→C hydride transfer between NADPH and the preprotonated DHF. Moreover, we showed that active site residues D27 and Y100 play a synergistic role in facilitating both the proton transfer and subsequent hydride transfer steps. Although D27 appears to have a greater effect on the overall rate of conversion of DHF to tetrahydrofolate, Y100 plays an important electrostatic role in modulating the pKa of the N5 of DHF to enable the preprotonation of DHF by an active site water molecule. PMID:25453098

  15. CoMFA/CoMSIA 3D-QSAR of pyrimidine inhibitors of Pneumocystis carinii dihydrofolate reductase.

    PubMed

    Santos-Filho, Osvaldo A; Forge, Delphine; Hoelz, Lucas V B; de Freitas, Guilherme B L; Marinho, Thiago O; Araújo, Jocley Q; Albuquerque, Magaly G; de Alencastro, Ricardo B; Boechat, Nubia

    2012-09-01

    Pneumocystis carinii is typically a non-pathogenic fungus found in the respiratory tract of healthy humans. However, it may cause P. carinii pneumonia (PCP) in people with immune deficiency, affecting mainly premature babies, cancer patients and transplant recipients, and people with acquired immunodeficiency syndrome (AIDS). In the latter group, PCP occurs in approximately 80% of patients, a major cause of death. Currently, there are many available therapies to treat PCP patients, including P. carinii dihydrofolate reductase (PcDHFR) inhibitors, such as trimetrexate (TMX), piritrexim (PTX), trimethoprim (TMP), and pyrimethamine (PMT). Nevertheless, the high percentage of adverse side effects and the limited therapeutic success of the current drug therapy justify the search for new drugs rationally planned against PCP. This work focuses on the study of pyrimidine inhibitors of PcDHFR, using both CoMFA and CoMSIA 3D-QSAR methods.

  16. Mycobacterium tuberculosis dihydrofolate reductase reveals two conformational states and a possible low affinity mechanism to antifolate drugs.

    PubMed

    Dias, Marcio Vinicius Bertacine; Tyrakis, Petros; Domingues, Romenia Ramos; Paes Leme, Adriana Franco; Blundell, Tom L

    2014-01-07

    Inhibition of the biosynthesis of tetrahydrofolate (THF) has long been a focus in the treatment of both cancer and infectious diseases. Dihydrofolate reductase (DHFR), which catalyzes the last step, is one of the most thoroughly explored targets of this pathway, but there are no DHFR inhibitors used for tuberculosis treatment. Here, we report a structural, site-directed mutagenesis and calorimetric analysis of Mycobacterium tuberculosis DHFR (MtDHFR) in complex with classical DHFR inhibitors. Our study provides insights into the weak inhibition of MtDHFR by trimethoprim and other antifolate drugs, such as pyrimethamine and cycloguanil. The construction of the mutant Y100F, together with calorimetric studies, gives insights into low affinity of MtDHFR for classical DHFR inhibitors. Finally, the structures of MtDHFR in complex with pyrimethamine and cycloguanil define important interactions in the active site and provide clues to the more effective design of antibiotics targeted against MtDHFR.

  17. Quantitative structure-activity relationships by evolved neural networks for the inhibition of dihydrofolate reductase by pyrimidines.

    PubMed

    Landavazo, Dana G; Fogel, Gary B; Fogel, David B

    2002-02-01

    Evolutionary computation provides a useful method for training neural networks in the face of multiple local optima. This paper begins with a description of methods for quantitative structure activity relationships (QSAR). An overview of artificial neural networks for pattern recognition problems such as QSAR is presented and extended with the description of how evolutionary computation can be used to evolve neural networks. Experiments are conducted to examine QSAR for the inhibition of dihydrofolate reductase by pyrimidines using evolved neural networks. Results indicate the utility of evolutionary algorithms and neural networks for the predictive task at hand. Furthermore, results that are comparable or perhaps better than those published previously were obtained using only a small fraction of the previously required degrees of freedom.

  18. Evidence that a ‘dynamic knockout’ in Escherichia coli dihydrofolate reductase does not affect the chemical step of catalysis

    NASA Astrophysics Data System (ADS)

    Loveridge, E. Joel; Behiry, Enas M.; Guo, Jiannan; Allemann, Rudolf K.

    2012-04-01

    The question of whether protein motions play a role in the chemical step of enzymatic catalysis has generated much controversy in recent years. Debate has recently reignited over possible dynamic contributions to catalysis in dihydrofolate reductase, following conflicting conclusions from studies of the N23PP/S148A variant of the Escherichia coli enzyme. By investigating the temperature dependence of kinetic isotope effects, we present evidence that the reduction in the hydride transfer rate constants in this variant is not a direct result of impairment of conformational fluctuations. Instead, the conformational state of the enzyme immediately before hydride transfer, which determines the electrostatic environment of the active site, affects the rate constant for the reaction. Although protein motions are clearly important for binding and release of substrates and products, there appears to be no detectable dynamic coupling of protein motions to the hydride transfer step itself.

  19. The replication timing of the amplified dihydrofolate reductase genes in the Chinese hamster ovary cell line CHOC 400.

    PubMed

    Caddle, M S; Heintz, N H

    1990-07-16

    We have examined the timing of replication of the amplified dihydrofolate reductase genes in the methotrexate-resistant Chinese hamster ovary cell line CHOC 400 using two synchronization procedures. DNA replicated in the presence of 5-bromodeoxyuridine was collected from cells of various times during the DNA synthesis phase and the extent of replication for defined sequences was determined by Southern blotting analysis of CsCl density gradient fractions. We report that under these conditions the DHFR gene replicates throughout the course of S phase in a mode similar to the bulk of the replicated genomic DNA. This contrasts with previous data that shows the non-amplified DHFR gene replicates during the first quarter of S phase. Therefore, we conclude that gene amplification alters the replication timing of the DHFR gene in CHOC 400 cells.

  20. Structural features of the murine dihydrofolate reductase transcription termination region: identification of a conserved DNA sequence element.

    PubMed Central

    Frayne, E G; Kellems, R E

    1986-01-01

    Structural features of the transcription termination region for the mouse dihydrofolate reductase gene have been determined and compared with those of several other known termination regions for protein coding genes. A common feature identified among these termination regions was the presence of a 20 bp consensus DNA sequence element (ATCAGAATATAGGAAAGTAGCAAT). The results imply that the 20 bp consensus DNA sequence element is important for signaling RNA polymerase II transcription termination at least in the several vertebrate species investigated. Furthermore, the results suggest that for the dhfr gene and possibly for other genes in mice as well, the potential termination consensus sequence can exist as part of a long interspersed repetitive DNA element. Images PMID:3714472

  1. Beyond Thymidylate Synthase and Dihydrofolate Reductase: Impact of Non-coding microRNAs in Anticancer Chemoresistance.

    PubMed

    Ju, Jingfang

    2012-09-01

    Chemoresistance is one of the major reasons for the failure of anticancer chemotherapy in treating advanced stage cancer. The mechanism of chemoresistance to fluoropyrimidines and antifolates has been extensively investigated in the past 40 years. It has been well established that thymidylate synthase (TYMS, TS) and dihydrofolate reductase (DHFR) are two major targets for fluoropyrimidines and antifolates, respectively. The regulatory mechanism of TS and DHFR expression is rather complex involving transcriptional, post-transcriptional and translational regulations. Our recent understanding of the chemoresistance mechanism has been extended beyond the simple one target/drug view. In this review, we will focus on the recent advancement of non-coding microRNAs (miRNAs) in contributing to the regulations of TS and DHFR expression, and to the chemoresistance mechanism of fluoropyrimidines and antifolates.

  2. Design and synthesis of aryl ether inhibitors of the Bacillus anthracis enoyl-ACP reductase.

    PubMed

    Tipparaju, Suresh K; Mulhearn, Debbie C; Klein, Gary M; Chen, Yufeng; Tapadar, Subhasish; Bishop, Molly H; Yang, Shuo; Chen, Juan; Ghassemi, Mahmood; Santarsiero, Bernard D; Cook, James L; Johlfs, Mary; Mesecar, Andrew D; Johnson, Michael E; Kozikowski, Alan P

    2008-08-01

    The problem of increasing bacterial resistance to the current generation of antibiotics is well documented. Known resistant pathogens such as methicillin-resistant Staphylococcus aureus are becoming more prevalent, while the potential exists for developing drug-resistant pathogens for use as bioweapons, such as Bacillus anthracis. The biphenyl ether antibacterial agent, triclosan, exhibits broad-spectrum activity by targeting the fatty acid biosynthetic pathway through inhibition of enoyl-acyl carrier protein reductase (ENR) and provides a potential scaffold for the development of new, broad-spectrum antibiotics. We used a structure-based approach to develop novel aryl ether analogues of triclosan that target ENR, the product of the fabI gene, from B. anthracis (BaENR). Structure-based design methods were used for the expansion of the compound series including X-ray crystal structure determination, molecular docking, and QSAR methods. Structural modifications were made to both phenyl rings of the 2-phenoxyphenyl core. A number of compounds exhibited improved potency against BaENR and increased efficacy against both the Sterne strain of B. anthracis and the methicillin-resistant strain of S. aureus. X-ray crystal structures of BaENR in complex with triclosan and two other compounds help explain the improved efficacy of the new compounds and suggest future rounds of optimization that might be used to improve their potency.

  3. Design and Synthesis of Aryl Ether Inhibitors of the Bacillus Anthracis Enoyl–ACP Reductase

    PubMed Central

    Tipparaju, Suresh K.; Mulhearn, Debbie C.; Klein, Gary M.; Chen, Yufeng; Tapadar, Subhasish; Bishop, Molly H.; Yang, Shuo; Chen, Juan; Ghassemi, Mahmood; Santarsiero, Bernard D.; Cook, James L.; Johlfs, Mary; Mesecar, Andrew D.; Johnson, Michael E.; Kozikowski, Alan P.

    2009-01-01

    The problem of increasing bacterial resistance to the current generation of antibiotics is well documented. This includes such pathogens as methicillin–resistant Staphylococcus aureus and the potential for developing drug–resistant pathogens for use as bioweapons, such as Bacillus anthracis. The biphenyl ether, antibacterial triclosan exhibits broad–spectrum activity and provides a potential scaffold for the development of new, broad–spectrum antibiotics targeting the fatty acid biosynthetic pathway, via inhibition of enoyl–acyl carrier protein reductase (ENR). We have utilized a structure–based approach to develop novel aryl ether analogs of triclosan that target ENR, the product of the FabI gene, from Bacillus anthracis (BaENR). Structure–based design methods were used for the expansion of the compound series including X-ray crystal structure determination, molecular docking, and QSAR methods. Structural modifications were made to both phenyl rings of the 2-phenoxyphenyl core. A number of compounds were derived that exhibited improved potency against BaENR and increased efficacy against both the Sterne strain of B. anthracis and the methicillin–resistant strain of S. aureus. X-ray crystal structures of BaENR in complex with triclosan and two other compounds help explain the improved efficacy of the new compounds and suggest future rounds of optimisation that might be used to improve their potency. PMID:18663709

  4. Toward resolving the catalytic mechanism of dihydrofolate reductase using neutron and ultrahigh-resolution X-ray crystallography [Neutron and ultrahigh resolution X-ray crystallography reveals water as the proton donor in the catalytic mechanism of dihydrofolate reductase

    SciTech Connect

    Wan, Qun; Bennett, Brad C.; Wilson, Mark A.; Kovalevsky, Andrey; Langan, Paul; Howell, Elizabeth E.; Dealwis, Chris

    2014-12-01

    Dihydrofolate reductase (DHFR) catalyzes the NADPH-dependent reduction of dihydrofolate (DHF) to tetrahydrofolate (THF). An important step in the mechanism involves proton donation to the N5 atom of DHF. The inability to determine the protonation states of active site residues and substrate has led to the lack of consensus on a catalytic mechanism. To resolve this ambiguity, we conducted neutron and ultrahigh resolution X-ray crystallographic studies of the pseudo-Michaelis ternary complex of DHFR with folate and NADP+ from E. coli. The neutron data were collected to 2.0 Å resolution using a 3.6 mm3 crystal with the quasi-Laue technique, and the structure reveals that the N3 atom of folate is protonated while Asp27 is negatively charged. Previous mechanisms have proposed a keto-to-enol tautomerization of the substrate to facilitate protonation of the N5 atom. The structure supports the existence of the keto tautomer due to protonation of the N3 atom, suggesting tautomerization is unnecessary for catalysis. In the 1.05 Å resolution X-ray structure of the ternary complex, conformational disorder of the Met20 side chain is coupled to electron density for a partially occupied water within hydrogen-bonding distance of the N5 atom of folate; this suggests direct protonation of substrate by solvent. We propose a catalytic mechanism for DHFR that involves stabilization of the keto tautomer of the substrate, elevation of the pKa of the N5 atom of DHF by Asp27, and protonation of N5 by water whose access to the active site is gated by fluctuation of the Met20 side chain even though the Met-20 loop is closed.

  5. Toward resolving the catalytic mechanism of dihydrofolate reductase using neutron and ultrahigh-resolution X-ray crystallography [Neutron and ultrahigh resolution X-ray crystallography reveals water as the proton donor in the catalytic mechanism of dihydrofolate reductase

    DOE PAGES

    Wan, Qun; Bennett, Brad C.; Wilson, Mark A.; ...

    2014-12-01

    Dihydrofolate reductase (DHFR) catalyzes the NADPH-dependent reduction of dihydrofolate (DHF) to tetrahydrofolate (THF). An important step in the mechanism involves proton donation to the N5 atom of DHF. The inability to determine the protonation states of active site residues and substrate has led to the lack of consensus on a catalytic mechanism. To resolve this ambiguity, we conducted neutron and ultrahigh resolution X-ray crystallographic studies of the pseudo-Michaelis ternary complex of DHFR with folate and NADP+ from E. coli. The neutron data were collected to 2.0 Å resolution using a 3.6 mm3 crystal with the quasi-Laue technique, and the structuremore » reveals that the N3 atom of folate is protonated while Asp27 is negatively charged. Previous mechanisms have proposed a keto-to-enol tautomerization of the substrate to facilitate protonation of the N5 atom. The structure supports the existence of the keto tautomer due to protonation of the N3 atom, suggesting tautomerization is unnecessary for catalysis. In the 1.05 Å resolution X-ray structure of the ternary complex, conformational disorder of the Met20 side chain is coupled to electron density for a partially occupied water within hydrogen-bonding distance of the N5 atom of folate; this suggests direct protonation of substrate by solvent. We propose a catalytic mechanism for DHFR that involves stabilization of the keto tautomer of the substrate, elevation of the pKa of the N5 atom of DHF by Asp27, and protonation of N5 by water whose access to the active site is gated by fluctuation of the Met20 side chain even though the Met-20 loop is closed.« less

  6. Control of synthesis of mRNA's for T4 bacteriophage-specific dihydrofolate reductase and deoxycytidylate hydroxymethylase.

    PubMed Central

    Witmer, H; Baros, A; Ende, D; Dosmar, M

    1976-01-01

    A 30 degrees C, functional messengers for dCMP hydroxymethylase first appeared 3 to 6 min postinfection and reached their maximum levels at 12 min. Chloramphenicol, added before the phage, reduced the rate of mRNA accumulation. When the antibiotic was added 6 min postinfection, mRNA levels increased at their normal rate but there was no obvious repression of messenger accumulation. Delaying the addition of drug until 8 or 12 min had progressively less effect on the pattern of hydroxymethylase mRNA metabolism. When chloramphenicol was present from preinfection times or from 6 min postinfection, all hydroxymethylase mRNA's synthesized were stable; at later times, however, the ability of the drug to stabilize mRNA decreased with its ability to delay the turnoff of mRNA production. An overaccumulation of hydroxymethylase mRNA was also seen when phage-specific DNA synthesis was inhibited either by mutational lesion in an essential viral gene or by 5-fluorodeoxyuridine. By min 20 of a DNA-negative program, hydroxymethylase mRNA synthesis was repressed to the point where it no longer compensated for decay. However, a finite level of hydroxymethylase mRNA synthesis was maintained at later times of a DNA-negative infection. Such results indicate that replication of the phage chromosome is necessary but not sufficient for a complete turnoff of hydroxymethylase mRNA production. Functions controlled by the maturation-defective proteins (the products of genes 55 and 33) played only a minor role in the regulation of hydroxymethylase mRNA, metabolism. Thus, we favor the hypothesis that a complete turnoff of hydroxymethylase messenger production requires one or more new proteins as well as an interval of DNA replication. The absence of DNA synthesis had no particular effect upon dihydrofolate reductase messenger production. The preinfection addition of chloramphenicol likewise had little effect on dihydrofolate reductase messenger metabolism. These latter data imply that prior

  7. Design and synthesis of 2-pyridones as novel inhibitors of the Bacillus anthracis enoyl-ACP reductase.

    PubMed

    Tipparaju, Suresh K; Joyasawal, Sipak; Forrester, Sara; Mulhearn, Debbie C; Pegan, Scott; Johnson, Michael E; Mesecar, Andrew D; Kozikowski, Alan P

    2008-06-15

    Enoyl-ACP reductase (ENR), the product of the FabI gene, from Bacillus anthracis (BaENR) is responsible for catalyzing the final step of bacterial fatty acid biosynthesis. A number of novel 2-pyridone derivatives were synthesized and shown to be potent inhibitors of BaENR.

  8. Structural comparison of chromosomal and exogenous dihydrofolate reductase from Staphylococcus aureus in complex with the potent inhibitor trimethoprim

    SciTech Connect

    Heaslet, Holly; Harris, Melissa; Fahnoe, Kelly; Sarver, Ronald; Putz, Henry; Chang, Jeanne; Subramanyam, Chakrapani; Barreiro, Gabriela; Miller, J. Richard; Pfizer

    2010-09-02

    Dihydrofolate reductase (DHFR) is the enzyme responsible for the NADPH-dependent reduction of 5,6-dihydrofolate to 5,6,7,8-tetrahydrofolate, an essential cofactor in the synthesis of purines, thymidylate, methionine, and other key metabolites. Because of its importance in multiple cellular functions, DHFR has been the subject of much research targeting the enzyme with anticancer, antibacterial, and antimicrobial agents. Clinically used compounds targeting DHFR include methotrexate for the treatment of cancer and diaminopyrimidines (DAPs) such as trimethoprim (TMP) for the treatment of bacterial infections. DAP inhibitors of DHFR have been used clinically for >30 years and resistance to these agents has become widespread. Methicillin-resistant Staphylococcus aureus (MRSA), the causative agent of many serious nosocomial and community acquired infections, and other gram-positive organisms can show resistance to DAPs through mutation of the chromosomal gene or acquisition of an alternative DHFR termed 'S1 DHFR.' To develop new therapies for health threats such as MRSA, it is important to understand the molecular basis of DAP resistance. Here, we report the crystal structure of the wild-type chromosomal DHFR from S. aureus in complex with NADPH and TMP. We have also solved the structure of the exogenous, TMP resistant S1 DHFR, apo and in complex with TMP. The structural and thermodynamic data point to important molecular differences between the two enzymes that lead to dramatically reduced affinity of DAPs to S1 DHFR. These differences in enzyme binding affinity translate into reduced antibacterial activity against strains of S. aureus that express S1 DHFR.

  9. Toward resolving the catalytic mechanism of dihydrofolate reductase using neutron and ultrahigh-resolution X-ray crystallography

    PubMed Central

    Wan, Qun; Bennett, Brad C.; Wilson, Mark A.; Kovalevsky, Andrey; Langan, Paul; Howell, Elizabeth E.; Dealwis, Chris

    2014-01-01

    Dihydrofolate reductase (DHFR) catalyzes the NADPH-dependent reduction of dihydrofolate (DHF) to tetrahydrofolate (THF). An important step in the mechanism involves proton donation to the N5 atom of DHF. The inability to determine the protonation states of active site residues and substrate has led to a lack of consensus regarding the catalytic mechanism involved. To resolve this ambiguity, we conducted neutron and ultrahigh-resolution X-ray crystallographic studies of the pseudo-Michaelis ternary complex of Escherichia coli DHFR with folate and NADP+. The neutron data were collected to 2.0-Å resolution using a 3.6-mm3 crystal with the quasi-Laue technique. The structure reveals that the N3 atom of folate is protonated, whereas Asp27 is negatively charged. Previous mechanisms have proposed a keto-to-enol tautomerization of the substrate to facilitate protonation of the N5 atom. The structure supports the existence of the keto tautomer owing to protonation of the N3 atom, suggesting that tautomerization is unnecessary for catalysis. In the 1.05-Å resolution X-ray structure of the ternary complex, conformational disorder of the Met20 side chain is coupled to electron density for a partially occupied water within hydrogen-bonding distance of the N5 atom of folate; this suggests direct protonation of substrate by solvent. We propose a catalytic mechanism for DHFR that involves stabilization of the keto tautomer of the substrate, elevation of the pKa value of the N5 atom of DHF by Asp27, and protonation of N5 by water that gains access to the active site through fluctuation of the Met20 side chain even though the Met20 loop is closed. PMID:25453083

  10. Rational Design of Novel Allosteric Dihydrofolate Reductase Inhibitors Showing Antibacterial Effects on Drug-Resistant Escherichia coli Escape Variants.

    PubMed

    Srinivasan, Bharath; Rodrigues, João V; Tonddast-Navaei, Sam; Shakhnovich, Eugene; Skolnick, Jeffrey

    2017-07-21

    In drug discovery, systematic variations of substituents on a common scaffold and bioisosteric replacements are often used to generate diversity and obtain molecules with better biological effects. However, this could saturate the small-molecule diversity pool resulting in drug resistance. On the other hand, conventional drug discovery relies on targeting known pockets on protein surfaces leading to drug resistance by mutations of critical pocket residues. Here, we present a two-pronged strategy of designing novel drugs that target unique pockets on a protein's surface to overcome the above problems. Dihydrofolate reductase, DHFR, is a critical enzyme involved in thymidine and purine nucleotide biosynthesis. Several classes of compounds that are structural analogues of the substrate dihydrofolate have been explored for their antifolate activity. Here, we describe 10 novel small-molecule inhibitors of Escherichia coli DHFR, EcDHFR, belonging to the stilbenoid, deoxybenzoin, and chalcone family of compounds discovered by a combination of pocket-based virtual ligand screening and systematic scaffold hopping. These inhibitors show a unique uncompetitive or noncompetitive inhibition mechanism, distinct from those reported for all known inhibitors of DHFR, indicative of binding to a unique pocket distinct from either substrate or cofactor-binding pockets. Furthermore, we demonstrate that rescue mutants of EcDHFR, with reduced affinity to all known classes of DHFR inhibitors, are inhibited at the same concentration as the wild-type. These compounds also exhibit antibacterial activity against E. coli harboring the drug-resistant variant of DHFR. This discovery is the first report on a novel class of inhibitors targeting a unique pocket on EcDHFR.

  11. Biosynthetic incorporation of telluromethionine into dihydrofolate reductase and crystallographic analysis of the distribution of tellurium atoms in the protein molecule

    SciTech Connect

    Kunkle, M.G.; Lewinski, K.; Boles, J.O.; Dunlap, R.B.; Odom, J.D.; Lebioda, L.

    1994-12-01

    Recent successes in crystallographic studies of proteins with methionine (Met) residues replaced with SeMet, pioneered by Hendrickson and coworkers, inspired us to replace Met with TeMet in Escherichia coli dihydrofolate reductase (DHFR). E. coli DHFR, which catalyzes the NADPH-dependent reduction of dihydrofolate to tetrahydrofolate, consists of 159 residues, 5 of which are Met. TeMet was incorporated into DHFR using the Met auxotroph, E. coli DL41, carrying the expression vector pWT8 with an IPTG inducible promoter and ampicillin resistance gene. The enzyme was purified by successive chromatography on Q-Sepharose and PHenyl Sepharose resins, yielding milligram quantities of homogeneous enzyme with a specific activity of 40 units/mg. TeMet DHFR exhibits kinetic properties similar to those of wt DHFR. Amino acid analysis indicated 3 authentic Met residues in TeMet DHFR, whereas atomic absorption spectroscopy detected 2 Te per protein molecule. Amino acid sequence analysis results suggested that only authentic Met was present in the first three Met positions (1,16,and 20). Crystals of Te-DHFR were grown in the presence of methotrexate from PEG 4000 and were isomorphous with wt-DHFR crystals grown from ethanol. Difference Fourier maps and restrained least-squares refinement show very little, if any, Te in the first three Met positions: Met{sup 1}, Met{sup 16}, and Met{sup 20}, whereas the occupancy of Te in positions 42 and 92 is 0.64. Apparently, the process of folding, subsequent purification, and crystallization select DHFR molecules with Te in Met{sup 42} and Met{sup 92}. Replacing Met with TeMet provides an internal probe that should facilitate structural and mechanistic studies of proteins.

  12. Functional nucleotide excision repair is required for the preferential removal of N-ethylpurines from the transcribed strand of the dihydrofolate reductase gene of Chinese hamster ovary cells.

    PubMed Central

    Sitaram, A; Plitas, G; Wang, W; Scicchitano, D A

    1997-01-01

    Transcription-coupled repair of DNA adducts is an essential factor that must be considered when one is elucidating biological endpoints resulting from exposure to genotoxic agents. Alkylating agents comprise one group of chemical compounds which modify DNA by reacting with oxygen and nitrogen atoms in the bases of the double helix. To discern the role of transcription-coupled DNA repair of N-ethylpurines present in discrete genetic domains, Chinese hamster ovary cells were exposed to N-ethyl-N-nitrosourea, and the clearance of the damage from the dihydrofolate reductase gene was investigated. The results indicate that N-ethylpurines were removed from the dihydrofolate reductase gene of nucleotide excision repair-proficient Chinese hamster ovary cells; furthermore, when repair rates in the individual strands were determined, a statistically significant bias in the removal of ethyl-induced, alkali-labile sites was observed, with clearance occurring 30% faster from the transcribed strand than from its nontranscribed counterpart at early times after exposure. In contrast, removal of N-ethylpurines was observed in the dihydrofolate reductase locus in cells that lacked nucleotide excision repair, but both strands were repaired at the same rate, indicating that transcription-coupled clearance of these lesions requires the presence of active nucleotide excision repair. PMID:9001209

  13. Molecular cloning of Chinese hamster dihydrofolate reductase-specific cDNA and the identification of multiple dihydrofolate reductase mRNAs in antifolate-resistant Chinese hamster lung fibroblasts.

    PubMed Central

    Lewis, J A; Kurtz, D T; Melera, P W

    1981-01-01

    ds cDNA from antifolate-resistant Chinese hamster lung fibroblast subline DC-3F/MQ19 was ligated to Eco RI and Sal I oligonucleotide linkers and cloned into Eco RI and Sal I digested pBR322. Transformed colonies containing dihydrofolate reductase (DHFR)-specific recombinant plasmid were identified by Grunstein Hogness assay using a Chinese hamster DHFR-specific cDNA probe. A recombinant plasmid, pDHFR6, containing a 650 bp HFR insert was isolated and analyzed. This plasmid was used as a molecular probe in a Northern blot analysis of both cytoplasmic and polysomal DHFR, poly A+ mRNAs of the DC-3F/MQ19 subline, which over-produces a 20,000d DHFR 150-fold, and DC-3F/A3 subline, which over-produces a 21,000d DHFR 170-fold. This analysis revealed the presence of three DHFR mRNA species of 1350, 2200, and 3300 nucleotides in both independently-derived cell lines. The relative abundance of each species however varied strikingly between the two cell lines. Images PMID:6262725

  14. Assessment of Folic Acid Supplementation in Pregnant Women by Estimation of Serum Levels of Tetrahydrofolic Acid, Dihydrofolate Reductase, and Homocysteine.

    PubMed

    Naithani, Manisha; Saxena, Vartika; Mirza, Anissa Atif; Kumari, Ranjeeta; Sharma, Kapil; Bharadwaj, Jyoti

    2016-01-01

    Background. Status of folic acid use in pregnant women of the hilly regions in North India was little known. This study was carried out to assess the folic acid use and estimate folate metabolites in pregnant women of this region. Materials and Methods. This cross-sectional study is comprised of 76 pregnant women, whose folic acid supplementation was assessed by a questionnaire and serum levels of homocysteine, tetrahydrofolic acid (THFA), and dihydrofolate reductase (DHFR) were estimated using Enzyme Linked Immunoassays. Results. The study data revealed awareness of folic acid use during pregnancy was present in 46.1% and 23.7% were taking folic acid supplements. The study depicted that there was no statistically significant difference between serum levels of THFA and DHFR in pregnant women with and without folic acid supplements (p = 0.790). Hyperhomocysteinemia was present in 15.78% of the participants. Conclusion. Less awareness about folic acid supplementation and low use of folic acid by pregnant women were observed in this region. Sufficient dietary ingestion may suffice for the escalated requirements in pregnancy, but since this cannot be ensured, hence folic acid supplementation should be made as an integral part of education and reproductive health programs for its better metabolic use, growth, and development of fetus.

  15. Assessment of Folic Acid Supplementation in Pregnant Women by Estimation of Serum Levels of Tetrahydrofolic Acid, Dihydrofolate Reductase, and Homocysteine

    PubMed Central

    Saxena, Vartika; Mirza, Anissa Atif; Kumari, Ranjeeta; Sharma, Kapil; Bharadwaj, Jyoti

    2016-01-01

    Background. Status of folic acid use in pregnant women of the hilly regions in North India was little known. This study was carried out to assess the folic acid use and estimate folate metabolites in pregnant women of this region. Materials and Methods. This cross-sectional study is comprised of 76 pregnant women, whose folic acid supplementation was assessed by a questionnaire and serum levels of homocysteine, tetrahydrofolic acid (THFA), and dihydrofolate reductase (DHFR) were estimated using Enzyme Linked Immunoassays. Results. The study data revealed awareness of folic acid use during pregnancy was present in 46.1% and 23.7% were taking folic acid supplements. The study depicted that there was no statistically significant difference between serum levels of THFA and DHFR in pregnant women with and without folic acid supplements (p = 0.790). Hyperhomocysteinemia was present in 15.78% of the participants. Conclusion. Less awareness about folic acid supplementation and low use of folic acid by pregnant women were observed in this region. Sufficient dietary ingestion may suffice for the escalated requirements in pregnancy, but since this cannot be ensured, hence folic acid supplementation should be made as an integral part of education and reproductive health programs for its better metabolic use, growth, and development of fetus. PMID:27064332

  16. Stoichiometric selection of tight-binding inhibitors by wild-type and mutant forms of malarial (Plasmodium falciparum) dihydrofolate reductase.

    PubMed

    Kamchonwongpaisan, Sumalee; Vanichtanankul, Jarunee; Tarnchompoo, Bongkoch; Yuvaniyama, Jirundon; Taweechai, Supannee; Yuthavong, Yongyuth

    2005-03-01

    A simple method for screening combinatorial and other libraries of inhibitors of malarial (Plasmodium falciparum) dihydrofolate reductase (PfDHFR) has been developed, based on the affinities of the inhibitors with the enzyme. In the presence of limiting amounts of the enzyme, a number of inhibitors in the library were bound to extents reflecting the relative binding affinities. Following ultrafiltration and guanidine hydrochloride treatment to release bound inhibitors, the amounts of free and bound inhibitors could be determined by high-performance liquid chromatography and liquid chromatography-mass spectrometry. The differences in the patterns reflected the binding of high-affinity components compared with the other members in the library. A good correlation was found between the inhibition constants (Ki values) and the extent of binding of inhibitors to wild-type, double (C59R+S108N) and quadruple mutant (N51I+C59R+S108N+I164L) of PfDHFR, as well as human DHFR. In addition to identifying lead components of the libraries with high affinities (low Ki values) and stabilities (low k(off) rates), this simple method also provides an alternative way for quickly and accurately calculating enzyme binding affinities of inhibitors in combinatorial chemical libraries.

  17. Structural studies on bioactive compounds. 28. Selective activity of triazenyl-substituted pyrimethamine derivatives against Pneumocystis carinii dihydrofolate reductase.

    PubMed

    Stevens, M F; Phillip, K S; Rathbone, D L; O'Shea, D M; Queener, S F; Schwalbe, C H; Lambert, P A

    1997-06-06

    Triazenyl-substituted pyrimethamine derivatives 10a-s have been prepared by coupling diazotized 2,4-diamino-5-(3-amino-4-chlorophenyl)-6-ethyl pyrimidine (1c) with a series of secondary amines in aqueous sodium carbonate solution. The triazenes which are stable and poorly soluble as free bases form more soluble, but unstable, salts with alkanesulfonic acids. The lead dimethyltriazene 2,4-diamino-5[4-chloro-3-(3,3-dimethyltriazen-1-yl)phenyl]-6-et hylpyrimidine (4a) forms a crystalline ethanesulfonic acid salt (solvated with 2-propanol), which is protonated at the pyrimidine N-1 position, as determined by X-ray crystallography. The ability of these new triazenes to inhibit Pneumocystis carinii dihydrofolate reductase in vitro has been compared to that of triazene 4a. The most potent and selective compound, 2,4-diamino-5-[3-[3-[2-(acetyloxy)ethyl]-3-benzyltriazen-1-y l]-4- chlorophenyl]-6-ethylpyrimidine (14a), has an IC50 value of 0.17 microM against the microbial enzyme and potentially useful selectivity (rat liver IC50/P. carinii IC50 = 114).

  18. Simulations of Remote Mutants of Dihydrofolate Reductase Reveal the Nature of a Network of Residues Coupled to Hydride Transfer

    PubMed Central

    Roston, Daniel; Kohen, Amnon; Doron, Dvir; Major, Dan T.

    2014-01-01

    Recent experimental and theoretical studies have proposed that enzymes involve networks of coupled residues throughout the protein that participate in motions accompanying chemical barrier crossing. Here we have examined portions of a proposed network in dihydrofolate reductase (DHFR) using quantum mechanics/molecular mechanics simulations. The simulations employ a hybrid quantum mechanics-molecular mechanics approach with a recently developed semi-empirical AM1-SRP Hamiltonian that provides accurate results for this reaction. The simulations reproduce experimentally determined catalytic rates for the wild type and distant mutants of E. coli DHFR, underscoring the accuracy of the simulation protocol. Additionally the simulations provide detailed insight into how residues remote from the active site affect the catalyzed chemistry, through changes in the thermally averaged properties along the reaction coordinate. The mutations do not greatly affect the structure of the transition state near the bond activation, but we observe differences somewhat removed from the point of C-H cleavage that affect the rate. The mutations have global effects on the thermally averaged structure that propagate throughout the enzyme and the current simulations highlight several interactions that appear to be particularly important. PMID:24798860

  19. Survival and risk of relapse of acute lymphoblastic leukemia in a Mexican population is affected by dihydrofolate reductase gene polymorphisms

    PubMed Central

    GÓMEZ-GÓMEZ, YAZMÍN; ORGANISTA-NAVA, JORGE; SAAVEDRA-HERRERA, MÓNICA VIRGINIA; RIVERA-RAMÍREZ, ANA BERTHA; TERÁN-PORCAYO, MARCO ANTONIO; DEL CARMEN ALARCÓN-ROMERO, LUZ; ILLADES-AGUIAR, BERENICE; LEYVA-VÁZQUEZ, MARCO ANTONIO

    2012-01-01

    Dihydrofolate reductase (DHFR) is the major target of methotrexate, a key component in childhood acute lymphoblastic leukemia (ALL) treatment. Polymorphisms in the gene coding for DHFR have been associated with adverse event treatment. This study evaluated the effect of the -A317G and C829T polymorphisms in the DHFR gene on survival and risk of relapse of ALL. Seventy patients with ALL and 100 healthy individuals were genotyped by the polymerase chain reaction-restriction fragment length polymorphism method. An association between the polymorphisms and the risk of relapse was found (p<0.05); patients with the -317G/G genotype were found to have an 8.55 (95% CI 1.84–39.70) higher chance of relapse and carriers of the 829T/T genotype had a 14.0 (95% CI 1.13–172.63) higher chance of relapse. Other variables, such as age and leukocyte count, were associated (p<0.05) with the risk of relapse of the disease. Individuals with the G/G and T/T genotype of the -A317G and C829T polymorphisms had poorer survival compared to other genotype groups (log-rank test; p<0.05). Although preliminary, these data seem to suggest a role for the DHFR polymorphisms in the risk of relapse of ALL and the mortality risk in these patients. PMID:22969948

  20. Mutational analysis of Plasmodium falciparum dihydrofolate reductase and dihydropteroate synthase genes in the interior division of Sabah, Malaysia

    PubMed Central

    2013-01-01

    Background The sulphadoxine/pyrimethamine (SDX/PYR) combination had been chosen to treat uncomplicated falciparum malaria in Malaysia for more than 30 years. Non-silent mutations in dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) genes are responsible for the resistance to pyrimethamine and sulphadoxine, respectively. This study reports the mutational analysis of pfdhfr and pfdhps in single Plasmodium falciparum infection isolates from the interior division of Sabah, Malaysian Borneo. Methods A total of 22 P. falciparum single infection isolates collected from two districts of the interior division of Sabah from February to November 2010 were recruited for the mutational study of pfdhfr and pfdhps. Both genes were amplified by nested PCR prior to DNA sequencing and mutational analysis. Results A total of three pfdhfr and four pfdhps alleles were identified. The most prevalent pfdhfr allele is ANRNL (86%) involving triple mutation at position 108(S to N), 59(C to R) and 164(I to L). In pfdhps, two novel alleles, SGTGA (73%) and AAKAA (5%) were identified. Alleles involving triple mutation in both pfdhfr (ANRNL) and pfdhps (SGTGA), which were absent in Sabah in a study conducted about 15 years ago, are now prevalent. Conclusions High prevalence of mutations in SDX/PYR associated drug resistance genes are reported in this study. This mutational study of pfdhps and pfdhfr indicating that SDX/PYR should be discontinued in this region. PMID:24321120

  1. Mutational analysis of Plasmodium falciparum dihydrofolate reductase and dihydropteroate synthase genes in the interior division of Sabah, Malaysia.

    PubMed

    Lau, Tiek Ying; Sylvi, Mersumpin; William, Timothy

    2013-12-10

    The sulphadoxine/pyrimethamine (SDX/PYR) combination had been chosen to treat uncomplicated falciparum malaria in Malaysia for more than 30 years. Non-silent mutations in dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) genes are responsible for the resistance to pyrimethamine and sulphadoxine, respectively. This study reports the mutational analysis of pfdhfr and pfdhps in single Plasmodium falciparum infection isolates from the interior division of Sabah, Malaysian Borneo. A total of 22 P. falciparum single infection isolates collected from two districts of the interior division of Sabah from February to November 2010 were recruited for the mutational study of pfdhfr and pfdhps. Both genes were amplified by nested PCR prior to DNA sequencing and mutational analysis. A total of three pfdhfr and four pfdhps alleles were identified. The most prevalent pfdhfr allele is ANRNL (86%) involving triple mutation at position 108(S to N), 59(C to R) and 164(I to L). In pfdhps, two novel alleles, SGTGA (73%) and AAKAA (5%) were identified. Alleles involving triple mutation in both pfdhfr (ANRNL) and pfdhps (SGTGA), which were absent in Sabah in a study conducted about 15 years ago, are now prevalent. High prevalence of mutations in SDX/PYR associated drug resistance genes are reported in this study. This mutational study of pfdhps and pfdhfr indicating that SDX/PYR should be discontinued in this region.

  2. Computation of affinity and selectivity: Binding of 2,4-diaminopteridine and 2,4-diaminoquinazoline inhibitors to dihydrofolate reductases

    NASA Astrophysics Data System (ADS)

    Marelius, John; Graffner-Nordberg, Malin; Hansson, Tomas; Hallberg, Anders; Åqvist, Johan

    1998-03-01

    Binding energy calculations for complexes of mutant and wild-type human dihydrofolate reductases with 2,4-diaminopteridine and 2,4-diaminoquinazoline inhibitors are reported. Quantitative insight into binding energetics of these molecules is obtained from calculations based on force field energy evaluation and thermal sampling by molecular dynamics simulations. The calculated affinity of methotrexate for wild-type and mutant enzymes is reasonably well reproduced. Truncation of the methotrexate glutamate tail results in a loss of affinity by several orders of magnitude. No major difference in binding strength is predicted between the pteridines and the quinazolines, while the N-methyl group present in methotrexate appears to confer significantly stronger binding. The recent improvement, which is used here, of our linear interaction energy method for binding affinity prediction, as well as problems with treating charged and flexible ligands are discussed. This approach should be suitable in a drug discovery context for prediction of binding energies of new inhibitors prior to their synthesis, when some information about the binding mode is available.

  3. Comparative study on dihydrofolate reductases from Shewanella species living in deep-sea and ambient atmospheric-pressure environments.

    PubMed

    Murakami, Chiho; Ohmae, Eiji; Tate, Shin-ichi; Gekko, Kunihiko; Nakasone, Kaoru; Kato, Chiaki

    2011-03-01

    To examine whether dihydrofolate reductase (DHFR) from deep-sea bacteria has undergone molecular evolution to adapt to high-pressure environments, we cloned eight DHFRs from Shewanella species living in deep-sea and ambient atmospheric-pressure environments, and subsequently purified six proteins to compare their structures, stabilities, and functions. The DHFRs showed 74-90% identity in primary structure to DHFR from S. violacea, but only 55% identity to DHFR from Escherichia coli (ecDHFR). Far-ultraviolet circular dichroism and fluorescence spectra suggested that the secondary and tertiary structures of these DHFRs were similar. In addition, no significant differences were found in structural stability as monitored by urea-induced unfolding and the kinetic parameters, K(m) and k(cat); although the DHFRs from Shewanella species were less stable and more active (2- to 4-fold increases in k(cat)/K(m)) than ecDHFR. Interestingly, the pressure effects on enzyme activity revealed that DHFRs from ambient-atmospheric species are not necessarily incompatible with high pressure, and DHFRs from deep-sea species are not necessarily tolerant of high pressure. These results suggest that the DHFR molecule itself has not evolved to adapt to high-pressure environments, but rather, those Shewanella species with enzymes capable of retaining functional activity under high pressure migrated into the deep-sea.

  4. Human dihydrofolate reductase and thymidylate synthase form a complex in vitro and co-localize in normal and cancer cells.

    PubMed

    Antosiewicz, Anna; Jarmuła, Adam; Przybylska, Dorota; Mosieniak, Grażyna; Szczepanowska, Joanna; Kowalkowska, Anna; Rode, Wojciech; Cieśla, Joanna

    2016-08-05

    Enzymes involved in thymidylate biosynthesis, thymidylate synthase (TS), and dihydrofolate reductase (DHFR) are well-known targets in cancer chemotherapy. In this study, we demonstrated for the first time, that human TS and DHFR form a strong complex in vitro and co-localize in human normal and colon cancer cell cytoplasm and nucleus. Treatment of cancer cells with methotrexate or 5-fluorouracil did not affect the distribution of either enzyme within the cells. However, 5-FU, but not MTX, lowered the presence of DHFR-TS complex in the nucleus by 2.5-fold. The results may suggest the sequestering of TS by FdUMP in the cytoplasm and thereby affecting the translocation of DHFR-TS complex to the nucleus. Providing a strong likelihood of DHFR-TS complex formation in vivo, the latter complex is a potential new drug target in cancer therapy. In this paper, known 3D structures of human TS and human DHFR, and some protozoan bifunctional DHFR-TS structures as templates, are used to build an in silico model of human DHFR-TS complex structure, consisting of one TS dimer and two DHFR monomers. This complex structure may serve as an initial 3D drug target model for prospective inhibitors targeting interfaces between the DHFR and TS enzymes.

  5. Sulfa and trimethoprim-like drugs - antimetabolites acting as carbonic anhydrase, dihydropteroate synthase and dihydrofolate reductase inhibitors.

    PubMed

    Capasso, Clemente; Supuran, Claudiu T

    2014-06-01

    Recent advances in microbial genomics, synthetic organic chemistry and X-ray crystallography provided opportunities to identify novel antibacterial targets for the development of new classes of antibiotics and to design more potent antimicrobial compounds derived from existing antibiotics in clinical use for decades. The antimetabolites, sulfa drugs and trimethoprim (TMP)-like agents, are inhibitors of three families of enzymes. One family belongs to the carbonic anhydrases, which catalyze a simple but physiologically relevant reaction in all life kingdoms, carbon dioxide hydration to bicarbonate and protons. The other two enzyme families are involved in the synthesis of tetrahydrofolate (THF), i.e. dihydropteroate synthase (DHPS) and dihydrofolate reductase. The antibacterial agents belonging to the THF and DHPS inhibitors were developed decades ago and present significant bacterial resistance problems. However, the molecular mechanisms of drug resistance both to sulfa drugs and TMP-like inhibitors were understood in detail only recently, when several X-ray crystal structures of such enzymes in complex with their inhibitors were reported. Here, we revue the state of the art in the field of antibacterials based on inhibitors of these three enzyme families.

  6. Specificity in structure-based drug design: identification of a novel, selective inhibitor of Pneumocystis carinii dihydrofolate reductase.

    PubMed

    Gschwend, D A; Sirawaraporn, W; Santi, D V; Kuntz, I D

    1997-09-01

    Specificity is an important aspect of structure-based drug design. Distinguishing between related targets in different organisms is often the key to therapeutic success. Pneumocystis carinii is a fungal opportunist which causes a crippling pneumonia in immunocompromised individuals. We report the identification of novel inhibitors of P. carinii dihydrofolate reductase (DHFR) that are selective versus inhibition of human DHFR using computational molecular docking techniques. The Fine Chemicals Directory, a database of commercially available compounds, was screened with the DOCK program suite to produce a list of potential P. carinii DHFR inhibitors. We then used a postdocking refinement directed at discerning subtle structural and chemical features that might reflect species specificity. Of 40 compounds predicted to exhibit anti-Pneumocystis DHFR activity, each of novel chemical framework, 13 (33%) show IC50 values better than 150 microM in an enzyme assay. These inhibitors were further assayed against human DHFR: 10 of the 13 (77%) bind preferentially to the fungal enzyme. The most potent compound identified is a 7 microM inhibitor of P. carinii DHFR with 25-fold selectivity. The ability of molecular docking methods to locate selective inhibitors reinforces our view of structure-based drug discovery as a valuable strategy, not only for identifying lead compounds, but also for addressing receptor specificity.

  7. An approximate but efficient method to calculate free energy trends by computer simulation: Application to dihydrofolate reductase-inhibitor complexes

    NASA Astrophysics Data System (ADS)

    Gerber, Paul R.; Mark, Alan E.; van Gunsteren, Wilfred F.

    1993-06-01

    Derivatives of free energy differences have been calculated by molecular dynamics techniques. The systems under study were ternary complexes of Trimethoprim (TMP) with dihydrofolate reductases of E. coli and chicken liver, containing the cofactor NADPH. Derivatives are taken with respect to modification of TMP, with emphasis on altering the 3-, 4- and 5-substituents of the phenyl ring. A linear approximation allows the encompassing of a whole set of modifications in a single simulation, as opposed to a full perturbation calculation, which requires a separate simulation for each modification. In the case considered here, the proposed technique requires a factor of 1000 less computing effort than a full free energy perturbation calculation. For the linear approximation to yield a significant result, one has to find ways of choosing the perturbation evolution, such that the initial trend mirrors the full calculation. The generation of new atoms requires a careful treatment of the singular terms in the non-bonded interaction. The result can be represented by maps of the changed molecule, which indicate whether complex formation is favoured under movement of partial charges and change in atom polarizabilities. Comparison with experimental measurements of inhibition constants reveals fair agreement in the range of values covered. However, detailed comparison fails to show a significant correlation. Possible reasons for the most pronounced deviations are given.

  8. Asymmetric mutations in the tetrameric R67 dihydrofolate reductase reveal high tolerance to active-site substitutions

    PubMed Central

    Ebert, Maximilian C C J C; Morley, Krista L; Volpato, Jordan P; Schmitzer, Andreea R; Pelletier, Joelle N

    2015-01-01

    Type II R67 dihydrofolate reductase (DHFR) is a bacterial plasmid-encoded enzyme that is intrinsically resistant to the widely-administered antibiotic trimethoprim. R67 DHFR is genetically and structurally unrelated to E. coli chromosomal DHFR and has an unusual architecture, in that four identical protomers form a single symmetrical active site tunnel that allows only one substrate binding/catalytic event at any given time. As a result, substitution of an active-site residue has as many as four distinct consequences on catalysis, constituting an atypical model of enzyme evolution. Although we previously demonstrated that no single residue of the native active site is indispensable for function, library selection here revealed a strong bias toward maintenance of two native protomers per mutated tetramer. A variety of such “half-native” tetramers were shown to procure native-like catalytic activity, with similar KM values but kcat values 5- to 33-fold lower, illustrating a high tolerance for active-site substitutions. The selected variants showed a reduced thermal stability (Tm ∼12°C lower), which appears to result from looser association of the protomers, but generally showed a marked increase in resilience to heat denaturation, recovering activity to a significantly greater extent than the variant with no active-site substitutions. Our results suggest that the presence of two native protomers in the R67 DHFR tetramer is sufficient to provide native-like catalytic rate and thus ensure cellular proliferation. PMID:25401264

  9. Towards the Understanding of Resistance Mechanisms in Clinically Isolated Trimethoprim-resistant, Methicillin-resistant Staphylococcus aureus Dihydrofolate Reductase

    SciTech Connect

    Frey, K.; Lombardo, M; Wright, D; Anderson, A

    2010-01-01

    Resistance to therapeutics such as trimethoprim-sulfamethoxazole has become an increasing problem in strains of methicillin-resistant Staphylococcus aureus (MRSA). Clinically isolated trimethoprim-resistant strains reveal a double mutation, H30N/F98Y, in dihydrofolate reductase (DHFR). In order to develop novel and effective therapeutics against these resistant strains, we evaluated a series of propargyl-linked antifolate lead compounds for inhibition of the mutant enzyme. For the propargyl-linked antifolates, the F98Y mutation generates minimal (between 1.2- and 6-fold) losses of affinity and the H30N mutation generates greater losses (between 2.4- and 48-fold). Conversely, trimethoprim affinity is largely diminished by the F98Y mutation (36-fold) and is not affected by the H30N mutation. In order to elucidate a mechanism of resistance, we determined a crystal structure of a complex of this double mutant with a lead propargyl-linked antifolate. This structure suggests a resistance mechanism consistent both for the propargyl-linked class of antifolates and for trimethoprim that is based on the loss of a conserved water-mediated hydrogen bond.

  10. Development of nonpolar surfaces in the folding of Escherichia coli dihydrofolate reductase detected by 1-anilinonaphthalene-8-sulfonate binding.

    PubMed

    Jones, B E; Jennings, P A; Pierre, R A; Matthews, C R

    1994-12-27

    The development of nonpolar surfaces during the folding of Escherichia coli dihydrofolate reductase (DHFR) was studied by monitoring the time-dependent fluorescence of 1-anilinonaphthalene-8-sulfonate (ANS) included in the refolding solution. Stopped-flow refolding experiments demonstrated a rapid increase in fluorescence intensity within the dead time of mixing (5 ms), indicating that the earliest detectable folding intermediate contains hydrophobic surfaces which are capable of binding ANS. A further increase in fluorescence intensity over the next 300 ms coincides with the formation of a set of four intermediates which are known to contain a specific tertiary contact [Kuwajima, K., Garvey, E. P., Finn, B. E., Matthews, C. R., & Sugai, S. (1991) Biochemistry 30, 7693-7703]. Experiments performed in the presence of polar fluorescence quenching agents indicate that the binding sites for ANS in the burst phase species are more exposed to solvent than those in the subsequent set of intermediates. When considered along with the above study of the formation of secondary structure by stopped-flow circular dichroism, these results imply that DHFR initially forms a molten globule intermediate. Subdomains containing specific tertiary structure and more solvent-excluded ANS binding sites then form before ultimately being converted to native or native-like conformations during the rate-limiting steps in the folding of DHFR. The occurrence of similar kinetic phases observed by ANS binding during the folding of a number of other proteins suggests that this may be a common scheme for protein folding reactions.

  11. Combinatorial exploration of the catalytic site of a drug-resistant dihydrofolate reductase: creating alternative functional configurations.

    PubMed

    Schmitzer, Andreea R; Lépine, François; Pelletier, Joelle N

    2004-11-01

    We have applied a global approach to enzyme active site exploration, where multiple mutations were introduced combinatorially at the active site of Type II R67 dihydrofolate reductase (R67 DHFR), creating numerous new active site environments within a constant framework. By this approach, we combinatorially modified all 16 principal amino acids that constitute the active site of this enzyme. This approach is fundamentally different from active site point mutation in that the native active site context is no longer accounted for. Among the 1536 combinatorially mutated active site variants of R67 DHFR we created, we selected and kinetically characterized three variants with highly altered active site compositions. We determined that they are of high fitness, as defined by a complex function consisting jointly of catalytic activity and resistance to trimethoprim. The k(cat) and K(M) values were similar to those for the native enzyme. The favourable Delta(DeltaG) values obtained (ranging from -0.72 to -1.08 kcal/mol) suggest that, despite their complex mutational pattern, no fundamental change in the catalytic mechanism has occurred. We illustrate that combinatorial active site mutagenesis can allow for the creation of compensatory mutations that could not be predicted and thus provides a route for more extensive exploration of functional sequence space than is allowed by point mutation.

  12. Dihydrofolate reductase: Sequential resonance assignments using 2D and 3D NMR and secondary structure determination in solution

    SciTech Connect

    Carr, M.D.; Birdsall, B.; Jimenez-Barbero, J.; Polshakov, V.I.; McCormick, J.E.; Feeney, J.; Frenkiel, T.A.; Bauer, C.J. ); Roberts, G.C.K. )

    1991-06-25

    Three-dimensional (3D) heteronuclear NMR techniques have been used to make sequential {sup 1}H and {sup 15}H resonance assignments for most of the residues of Lactobacillus casei dihydrofolate reductase (DHFR), a monomeric protein of molecular mass 18,300 Da. A uniformly {sup 15}N-labeled sample of the protein was prepared and its complex with methotrexate (MTX) studied by 3D {sup 15}N/{sup 1}H nuclear Overhauserheteronuclear multiple quantum coherence (NOESY-HMQC), Harmann-Hahn-heteronuclear multiple quantum coherence (HOHAHA-HMQC), and HMQC-NOESY-HMQC experiments. These experiments overcame most of the spectral overlap problems caused by chemical shift degeneracies in 2D spectra and allowed the {sup 1}H-{sup 1}H through-space and through-bond connectivities to be identified unambiguously, leading to the resonance assignments. The novel HMQC-NOESY-HMQC experiment allows NOE cross peaks to be detected between NH protons even when their {sup 1}H chemical shifts are degenerate as long as the amide {sup 15}N chemical shifts are nondegenerate. The 3D experiments, in combination with conventional 2D NOESY, COSY, and HOHAHA experiments on unlabelled and selectively deuterated DHFR, provide backbone assignments for 146 of the 162 residues and side-chain assignments for 104 residues of the protein. Data from the NOE-based experiments and identification of the slowly exchanging amide protons provide detailed information about the secondary structure of the binary complex of the protein with methotrexate.

  13. Host dihydrofolate reductase (DHFR)-directed cycloguanil analogues endowed with activity against influenza virus and respiratory syncytial virus.

    PubMed

    Tonelli, Michele; Naesens, Lieve; Gazzarrini, Sabrina; Santucci, Matteo; Cichero, Elena; Tasso, Bruno; Moroni, Anna; Costi, Maria Paola; Loddo, Roberta

    2017-07-28

    We have identified a series of 1-aryl-4,6-diamino-1,2-dihydrotriazines, structurally related to the antimalarial drug cycloguanil, as new inhibitors of influenza A and B virus and respiratory syncytial virus (RSV) via targeting of the host dihydrofolate reductase (DHFR) enzyme. Most analogues proved active against influenza B virus in the low micromolar range, and the best compounds (11, 13, 14 and 16) even reached the sub-micromolar potency of zanamivir (EC50 = 0.060 μM), and markedly exceeded (up to 327 times) the antiviral efficacy of ribavirin. Activity was also observed for two influenza A strains, including a virus with the S31N mutant form of M2 proton channel, which is the most prevalent resistance mutation for amantadine. Importantly, the compounds displayed nanomolar activity against RSV and a superior selectivity index, since the ratio of cytotoxic to antiviral concentration was >10,000 for the three most active compounds 11, 14 and 16 (EC50 ∼0.008 μM), far surpassing the potency and safety profile of the licensed drug ribavirin (EC50 = 5.8 μM, SI > 43). Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  14. DNA variants in region for noncoding interfering transcript of dihydrofolate reductase gene and outcome in childhood acute lymphoblastic leukemia.

    PubMed

    Al-Shakfa, Fidaa; Dulucq, Stéphanie; Brukner, Ivan; Milacic, Iva; Ansari, Marc; Beaulieu, Patrick; Moghrabi, Albert; Laverdière, Caroline; Sallan, Stephen E; Silverman, Lewis B; Neuberg, Donna; Kutok, Jeffery L; Sinnett, Daniel; Krajinovic, Maja

    2009-11-15

    Dihydrofolate reductase (DHFR) is the major target of methotrexate, a key component in childhood acute lymphoblastic leukemia (ALL) treatment. We recently reported an association of DHFR promoter polymorphisms with ALL outcome. Lower event-free survival correlated with haplotype *1, defined by A(-317) and C(-1610) alleles. Haplotype *1 was also associated higher DHFR expression. Here, we analyzed adjacent 400-bp region participating in DHFR regulation as both a major promoter and a noncoding minor transcript. Six polymorphisms were identified, of which five were single nucleotide polymorphisms and one was length polymorphism composed of variable number of 9-bp elements and 9-bp insertion/deletion. Haplotype analysis including all promoter polymorphisms revealed diversification of haplotype *1 into five subtypes (*1a-*1e). DNA variations of major promoter/noncoding transcript region and haplotype *1 subtypes were subsequently analyzed for the association with ALL outcome. Lower event-free survival was associated with an A allele of G(308)A polymorphism (P = 0.02) and with *1b haplotype (P = 0.01). This association was particularly striking in high-risk patients (P = 0.001) and was subsequently confirmed in independent patient cohort (P = 0.02). Haplotype *1b was the only haplotype *1 subtype associated with higher mRNA levels. The study provides a new insight into DHFR regulatory variations predisposing to an event in ALL patients.

  15. Cloning, recombinant expression and inhibitor profiles of dihydrofolate reductase from the Australian sheep blow fly, Lucilia cuprina.

    PubMed

    Kotze, A C; Bagnall, N H; Ruffell, A P; Pearson, R

    2014-09-01

    While dihydrofolate reductase (DHFR) is an important drug target in mammals, bacteria and protozoa, no inhibitors of this enzyme have been developed as commercial insecticides. We therefore examined the potential of this enzyme as a drug target in an important ectoparasite of livestock, the Australian sheep blow fly, Lucilia cuprina (Diptera: Calliphoridae) (Wiedemann). The non-specific DHFR inhibitors aminopterin and methotrexate significantly inhibited the growth of L. cuprina larvae, with IC50 values at µg levels. Trimethoprim and pyrimethamine were 5-30-fold less active. Relative IC50 values for the inhibition of recombinant L. cuprina DHFR by various inhibitors were in accordance with their relative effects on larval growth. The active-site amino acid residues of L. cuprina DHFR differed by between 34% and 50% when compared with two mammalian species, as well as two bacteria and two protozoa. There were significant charge and size differences in specific residues between the blow fly and human DHFR enzymes, notably the L. cuprina Asn21, Lys31 and Lys63 residues. This study provides bioassay evidence to highlight the potential of blow fly DHFR as an insecticide target, and describes differences in active site residues between blow flies and other organisms which could be exploited in the design of blow fly control chemicals. © 2014 The Royal Entomological Society.

  16. A nanotherapy strategy significantly enhances anticryptosporidial activity of an inhibitor of bifunctional thymidylate synthase-dihydrofolate reductase from Cryptosporidium.

    PubMed

    Mukerjee, Anindita; Iyidogan, Pinar; Castellanos-Gonzalez, Alejandro; Cisneros, José A; Czyzyk, Daniel; Ranjan, Amalendu Prakash; Jorgensen, William L; White, A Clinton; Vishwanatha, Jamboor K; Anderson, Karen S

    2015-01-01

    Cryptosporidiosis, a gastrointestinal disease caused by protozoans of the genus Cryptosporidium, is a common cause of diarrheal diseases and often fatal in immunocompromised individuals. Bifunctional thymidylate synthase-dihydrofolate reductase (TS-DHFR) from Cryptosporidium hominis (C. hominis) has been a molecular target for inhibitor design. C. hominis TS-DHFR inhibitors with nM potency at a biochemical level have been developed however drug delivery to achieve comparable antiparasitic activity in Cryptosporidium infected cell culture has been a major hurdle for designing effective therapies. Previous mechanistic and structural studies have identified compound 906 as a nM C. hominis TS-DHFR inhibitor in vitro, having μM antiparasitic activity in cell culture. In this work, proof of concept studies are presented using a nanotherapy approach to improve drug delivery and the antiparasitic activity of 906 in cell culture. We utilized PLGA nanoparticles that were loaded with 906 (NP-906) and conjugated with antibodies to the Cryptosporidium specific protein, CP2, on the nanoparticle surface in order to specifically target the parasite. Our results indicate that CP2 labeled NP-906 (CP2-NP-906) reduces the level of parasites by 200-fold in cell culture, while NP-906 resulted in 4.4-fold decrease. Moreover, the anticryptosporidial potency of 906 improved 15 to 78-fold confirming the utility of the antibody conjugated nanoparticles as an effective drug delivery strategy.

  17. The Structure and Competitive Substrate Inhibition of Dihydrofolate Reductase from Enterococcus faecalis Reveal Restrictions to Cofactor Docking

    PubMed Central

    2015-01-01

    We are addressing bacterial resistance to antibiotics by repurposing a well-established classic antimicrobial target, the dihydrofolate reductase (DHFR) enzyme. In this work, we have focused on Enterococcus faecalis, a nosocomial pathogen that frequently harbors antibiotic resistance determinants leading to complicated and difficult-to-treat infections. An inhibitor series with a hydrophobic dihydrophthalazine heterocycle was designed from the anti-folate trimethoprim. We have examined the potency of this inhibitor series based on inhibition of DHFR enzyme activity and bacterial growth, including in the presence of the exogenous product analogue folinic acid. The resulting preferences were rationalized using a cocrystal structure of the DHFR from this organism with a propyl-bearing series member (RAB-propyl). In a companion apo structure, we identify four buried waters that act as placeholders for a conserved hydrogen-bonding network to the substrate and indicate an important role in protein stability during catalytic cycling. In these structures, the nicotinamide of the nicotinamide adenine dinucleotide phosphate cofactor is visualized outside of its binding pocket, which is exacerbated by RAB-propyl binding. Finally, homology models of the TMPR sequences dfrK and dfrF were constructed. While the dfrK-encoded protein shows clear sequence changes that would be detrimental to inhibitor binding, the dfrF-encoded protein model suggests the protein would be relatively unstable. These data suggest a utility for anti-DHFR compounds for treating infections arising from E. faecalis. They also highlight a role for water in stabilizing the DHFR substrate pocket and for competitive substrate inhibitors that may gain advantages in potency by the perturbation of cofactor dynamics. PMID:24495113

  18. Identification and characterization of a gene that is coamplified with dihydrofolate reductase in a methotrexate-resistant CHO cell line.

    PubMed Central

    Foreman, P K; Hamlin, J L

    1989-01-01

    As part of an effort to characterize the spatial and functional relationships among genetic elements within the amplified dihydrofolate reductase (DHFR) domain in Chinese hamster cells, we have used a variation of the differential hybridization approach to identify cDNA clones whose genes are coamplified with DHFR in the methotrexate-resistant cell line, CHOC 400. Our initial screen was successful in isolating both DHFR and non-DHFR cDNAs. One of the non-DHFR cDNA clones, 2BE2121, hybridizes on Northern (RNA) blots to abundant 1,200- and 1,500-nucleotide (nt) transcripts which differ in the lengths of their 3' untranslated regions. The clone 2BE2121 contains a 789-nt open reading frame but does not appear to be related to any members of the protein or nucleic acid sequence databases. A second larger non-DHFR cDNA, II-19-211, was isolated that is transcribed from the same gene as 2BE2121 but contains only a small carboxyl-terminal portion of the open reading frame. II-19-211 may, therefore, represent either a splicing intermediate or an mRNA transcribed from a cryptic intragenic promoter. Hybridization to cosmids from the DHFR domain shows that 2BE2121 is encoded by a gene approximately 34 kilobases (kb) long. The 5'-most genomic fragment is less than 4 kb from an interamplicon junction. The 3' end of the 2BE2121 gene lies approximately 75 kb downstream from the DHFR gene and approximately 25 kb downstream from the proximal replication initiation site, and the transcriptional polarity is opposite to that of the leading strand of replication. Thus, both the DHFR and 2BE2121 genes are exceptions to the theory that transcription proceeds in the same direction as the leading strand of the replication fork. Images PMID:2725490

  19. Free energy force field (FEFF) 3D-QSAR analysis of a set of Plasmodium falciparum dihydrofolate reductase inhibitors.

    PubMed

    Santos-Filho, O A; Mishra, R K; Hopfinger, A J

    2001-09-01

    Free energy force field (FEFF) 3D-QSAR analysis was used to construct ligand-receptor binding models for a set of 18 structurally diverse antifolates including pyrimethamine, cycloguanil, methotrexate, aminopterin and trimethoprim, and 13 pyrrolo[2,3-d]pyrimidines. The molecular target ('receptor') used was a 3D-homology model of a specific mutant type of Plasmodium falciparum (Pf) dihydrofolate reductase (DHFR). The dependent variable of the 3D-QSAR models is the IC50 inhibition constant for the specific mutant type of PfDHFR. The independent variables of the 3D-QSAR models (the descriptors) are scaled energy terms of a modified first-generation AMBER force field combined with a hydration shell aqueous solvation model and a collection of 2D-QSAR descriptors often used in QSAR studies. Multiple temperature molecular dynamics simulation (MDS) and the genetic function approximation (GFA) were employed using partial least square (PLS) and multidimensional linear regressions as the fitting functions to develop FEFF 3D-QSAR models for the binding process. The significant FEFF energy terms in the best 3D-QSAR models include energy contributions of the direct ligand-receptor interaction. Some changes in conformational energy terms of the ligand due to binding to the enzyme are also found to be important descriptors. The FEFF 3D-QSAR models indicate some structural features perhaps relevant to the mechanism of resistance of the PfDHFR to current antimalarials. The FEFF 3D-QSAR models are also compared to receptor-independent (RI) 4D-QSAR models developed in an earlier study and subsequently refined using recently developed generalized alignment rules.

  20. Mapping and characterization of mutations induced by benzo[a]pyrene diol epoxide at dihydrofolate reductase locus in CHO cells.

    PubMed

    Carothers, A M; Urlaub, G; Grunberger, D; Chasin, L A

    1988-03-01

    Chinese hamster ovary cells were mutagenized with benzo[a]pyrene diol epoxide (BPDE), an aromatic hydrocarbon carcinogen, and mutants at the dihydrofolate reductase (dhfr) locus were isolated. Of 15 mutants analyzed by Southern blotting, one contained a large deletion that spanned all six exons of the 25-kb dhfr gene; the remaining mutants exhibited no detectable changes. Three of these putative point mutations were localized by the loss of a restriction site: a SacI site in exon III, an MspI site in exon III, and a KpnI site in exon VI. The affected regions in two of these mutants were cloned and sequenced. The SacI- mutant was caused by a G:C----T:A transversion resulting in an amber termination codon. In the MspI- mutant, the deletion of a single C:G resulted in a frameshift and a downstream ochre termination codon. On the basis of overlapping restriction site sequences, the KpnI- mutant was deduced to be a splicing mutant involving the most 3' G in intron V. The location of these and the remaining 11 putative point mutations was sought using RNA heteroduplex mapping. Mismatched bases between riboprobes complementary to wild-type dhfr mRNA and mutant mRNA molecules were detected in 10 of the 14 mutants analyzed. These mutations mapped to four of the six exons or exon splice sites. Surprisingly, over half of these mutants exhibited greatly reduced (approximately 10-fold) steady-state levels of dhfr mRNA.

  1. Organization and genesis of dihydrofolate reductase amplicons in the genome of a methotrexate-resistant Chinese hamster ovary cell line.

    PubMed

    Ma, C; Looney, J E; Leu, T H; Hamlin, J L

    1988-06-01

    We have recently isolated overlapping recombinant cosmids that represent the equivalent of two complete dihydrofolate reductase (dhfr) amplicon types from the methotrexate-resistant Chinese hamster ovary (CHO) cell line CHOC 400. In the work described in this report, we used pulse-field gradient gel electrophoresis to analyze large SfiI restriction fragments arising from the amplified dhfr domains. The junction between the 260-kilobase type I amplicons (which are arranged in head-to-tail configurations in the genome) has been localized, allowing the construction of a linear map of the parental dhfr locus. We also show that the 220-kilobase type II amplicons are arranged as inverted repeat structures in the CHOC 400 genome and arose from the type I sequence relatively early in the amplification process. Our data indicate that there are a number of minor amplicon types in the CHOC 400 cell line that were not detected in previous studies; however, the type II amplicons represent ca. 75% of all the amplicons in the CHOC 400 genome. Both the type I and type II amplicons are shown to be composed entirely of sequences that were present in the parental dhfr locus. Studies of less resistant cell lines show that initial amplicons can be larger than those observed in CHOC 400. Once established, a given amplicon type appears to be relatively stable throughout subsequent amplification steps. We also present a modification of an in-gel renaturation method that gives a relatively complete picture of the size and variability of amplicons in the genome.

  2. Free energy force field (FEFF) 3D-QSAR analysis of a set of Plasmodium falciparum dihydrofolate reductase inhibitors

    NASA Astrophysics Data System (ADS)

    Santos-Filho, Osvaldo A.; Mishra, Rama K.; Hopfinger, A. J.

    2001-09-01

    Free energy force field (FEFF) 3D-QSAR analysis was used to construct ligand-receptor binding models for a set of 18 structurally diverse antifolates including pyrimethamine, cycloguanil, methotrexate, aminopterin and trimethoprim, and 13 pyrrolo[2,3-d]pyrimidines. The molecular target (`receptor') used was a 3D-homology model of a specific mutant type of Plasmodium falciparum (Pf) dihydrofolate reductase (DHFR). The dependent variable of the 3D-QSAR models is the IC50 inhibition constant for the specific mutant type of PfDHFR. The independent variables of the 3D-QSAR models (the descriptors) are scaled energy terms of a modified first-generation AMBER force field combined with a hydration shell aqueous solvation model and a collection of 2D-QSAR descriptors often used in QSAR studies. Multiple temperature molecular dynamics simulation (MDS) and the genetic function approximation (GFA) were employed using partial least square (PLS) and multidimensional linear regressions as the fitting functions to develop FEFF 3D-QSAR models for the binding process. The significant FEFF energy terms in the best 3D-QSAR models include energy contributions of the direct ligand-receptor interaction. Some changes in conformational energy terms of the ligand due to binding to the enzyme are also found to be important descriptors. The FEFF 3D-QSAR models indicate some structural features perhaps relevant to the mechanism of resistance of the PfDHFR to current antimalarials. The FEFF 3D-QSAR models are also compared to receptor-independent (RI) 4D-QSAR models developed in an earlier study and subsequently refined using recently developed generalized alignment rules.

  3. Construction of a modular dihydrofolate reductase cDNA gene: Analysis of signals utilized for efficient expression

    SciTech Connect

    Kaufman, J.; Sharp, P.A.

    1982-11-01

    Dihydrofolate reductase (DHFR) modular genes have been constructed with segments containing the adenovirus major late promoter, a 3' splice site from a variable region immunoglobulin gene, a DHFR cDNA, and portions of the simian virus 40 (SV40) genome, DNA-mediated transfer of these genes transformed Chinese hamster ovary DHFR/sup -/ cells to the DHFR/sup +/ phenotype. Transformants contained one to several copies of the transfected DNA integrated into the host genome. Clones subjected to growth in increasing concentrations of methotrexate eventually gave rise to lines containing several hundred copies of the transforming DNA. Analysis of the DHFr mRNA produced in amplified lines indicated the following: (i) All clones utilize the adenovirus major late promoter for transcription initiation. (ii) A hybrid intron formed by the 5' splice site of the adenovirus major late leader and a 3' splice site from a variable-region immunoglobulin gene is properly excised. (iii) The mRNA is not efficiently polyadenylated at sequences in the 3' end of the DHFR cDNA but rather uses polyadenylation signals downstream from the DHFR cDNA. Three independent clones produce a DHFR mRNA containing SV40 or pBR322 and SV40 sequences, and the RNA is polyadenylated at the SV40 late polyadenylation site. Another clone has recombined into cellular DNA and apparently uses a cellular sequence for polyadenylation. Introduction of a segment containing the SV40 early polyadenylation signal into the 3' end of the DHFR cDNA generated a recombinant capable of transforming cells to the DHFR/sup +/ phenotype with at least a 10-fold increase in efficiency, demonstrating the necessity for an efficient polyadenylation signal. Attachment of a DNA segment containing the transcription enhancer 72-base pair repeat) of SV40 further increased the biological activity of the modular DHFR gene 50- to 100-fold.

  4. Identification and characterization of a gene that is coamplified with dihydrofolate reductase in a methotrexate-resistant CHO cell line

    SciTech Connect

    Foreman, P.K.; Hamlin, J.L. . School of Medicine)

    1989-03-01

    As part of an effort to characterize the spatial and functional relationships among genetic elements within the amplified dihydrofolate reductase (DHFR) domain in Chinese hamster cells, the authors have used a variation of the differential hybridization approach to identify cDNA clones whose genes are coamplified with DHFR in the methotrexate-resistant cell line, CHOC 400. Their initial screen was successful in isolating both DHFR and non-DHFR cDNAs. One of the non-DHFR cDNA clones, 2BE2121, hybridizes on Northern (RNA) blots to abundant 1,200- and 1,500-nucleotide (nt) transcripts which differ in the lengths of their 3' untranslated regions. The clone 2BE2121 contains a 789-nt open reading frame but does not appear to be related to any members of the protein or nucleic acid sequence databases. A second larger non-DHFR cDNA, II-19-211, was isolated that is transcribed from the same gene as 2BE2121 but contains only a small carboxyl-terminal portion of the open reading frame. II-19-211 may, therefore, represent either a splicing intermediate or an mRNA transcribed from a cryptic intragenic promoter. Hybridization to cosmids from DHFr domain shows that 2BE2121 is encoded by a gene --34 kilobases (kb) long. The 5'-most genomic fragment is less than 4 kb from an interamplicon injection. The 3' end of the 2BE2121 gene lies --75 kb downstream from the DHFR gene and --25 kb downstream from the proximal replication initiation site, and the transcriptional polarity is opposite to that of the leading strand of replication. Thus, both the DHFR and 2BE2121 genes are exceptions to the theory that transcription proceeds in the same direction as the leading strand of the replication fork.

  5. Cloning and characterization of a novel, plasmid-encoded trimethoprim-resistant dihydrofolate reductase from Staphylococcus haemolyticus MUR313.

    PubMed

    Dale, G E; Langen, H; Page, M G; Then, R L; Stüber, D

    1995-09-01

    In recent years resistance to the antibacterial agent trimethoprim (Tmp) has become more widespread, and several trimethoprim-resistant (Tmpr) dihydrofolate reductases (DHFRs) have been described from gram-negative bacteria. In staphylococci, only one Tmpr DHFR has been described, the type S1 DHFR, which is encoded by the dfrA gene found on transposon Tn4003. In order to investigate the coincidence of high-level Tmp resistance and the presence of dfrA, we analyzed the DNAs from various Tmpr staphylococci for the presence of dfrA sequences by PCR with primers specific for the thyE-dfrA genes from Tn4003. We found that 30 or 33 isolates highly resistant to Tmp (MICs, > or = 512 micrograms/ml) contained dfrA sequences, whereas among the Tmpr (MICs, < or = 256 micrograms/ml) and Tmps isolates only the Staphylococcus epidermidis isolates (both Tmpr and Tmps) seemed to contain the dfrA gene. Furthermore, we have cloned and characterized a novel, plasmid-encoded Tmpr DHFR from Staphylococcus haemolyticus MUR313. The dfrD gene of plasmid pABU17 is preceded by two putative Shine-Dalgarno sequences potentially allowing for the start of translation at two triplets separated by nine nucleotides. The predicted protein of 166 amino acids, designated S2DHFR, encoded by the longer open reading frame was overproduced in Escherichia coli, purified, and characterized. The molecular size of the recombinant S2DHFR was determined by ion spray mass spectrometry to be 19,821.2 +/- 2 Da, which is in agreement with the theoretical value of 19,822 Da. In addition, the recombinant S2DHFR was shown to exhibit DHFR activity and to be highly resistant to Tmp.

  6. The structure and competitive substrate inhibition of dihydrofolate reductase from Enterococcus faecalis reveal restrictions to cofactor docking.

    PubMed

    Bourne, Christina R; Wakeham, Nancy; Webb, Nicole; Nammalwar, Baskar; Bunce, Richard A; Berlin, K Darrell; Barrow, William W

    2014-02-25

    We are addressing bacterial resistance to antibiotics by repurposing a well-established classic antimicrobial target, the dihydrofolate reductase (DHFR) enzyme. In this work, we have focused on Enterococcus faecalis, a nosocomial pathogen that frequently harbors antibiotic resistance determinants leading to complicated and difficult-to-treat infections. An inhibitor series with a hydrophobic dihydrophthalazine heterocycle was designed from the anti-folate trimethoprim. We have examined the potency of this inhibitor series based on inhibition of DHFR enzyme activity and bacterial growth, including in the presence of the exogenous product analogue folinic acid. The resulting preferences were rationalized using a cocrystal structure of the DHFR from this organism with a propyl-bearing series member (RAB-propyl). In a companion apo structure, we identify four buried waters that act as placeholders for a conserved hydrogen-bonding network to the substrate and indicate an important role in protein stability during catalytic cycling. In these structures, the nicotinamide of the nicotinamide adenine dinucleotide phosphate cofactor is visualized outside of its binding pocket, which is exacerbated by RAB-propyl binding. Finally, homology models of the TMP(R) sequences dfrK and dfrF were constructed. While the dfrK-encoded protein shows clear sequence changes that would be detrimental to inhibitor binding, the dfrF-encoded protein model suggests the protein would be relatively unstable. These data suggest a utility for anti-DHFR compounds for treating infections arising from E. faecalis. They also highlight a role for water in stabilizing the DHFR substrate pocket and for competitive substrate inhibitors that may gain advantages in potency by the perturbation of cofactor dynamics.

  7. NMR studies of differences in the conformations and dynamics of ligand complexes formed with mutant dihydrofolate reductases

    SciTech Connect

    Birdsall, B.; Andrews, J.; Ostler, G.; Tendler, S.J.B.; Feeney, J.; Roberts, G.C.K.; Davies, R.W.; Cheung, H.T.A. )

    1989-02-07

    Two mutants of Lactobacillus casei dihydrofolate reductase, Trp 21 {yields} Leu and Asp 26 {yields} Glu, have been prepared by using site-directed mutagenesis methods, and their ligand binding and structural properties have been compared with those of the wild-type enzyme. {sup 1}H, {sup 13}C, and {sup 31}P NMR studies have been carried out to characterize the structural changes in the complexes of the mutant and wild-type enzymes. Replacement of the conserved Trp 21 by a Leu residue causes a decrease in activity of the enzyme and reduces the NADPH binding constant by a factor of 400. The binding of substrates and substrate analogues is only slightly affected. {sup 1}H NMR studies of the Trp 21 {yields} Leu enzyme complexes have confirmed the original resonance assignments for Trp 21. In complexes formed with methotrexate and the mutant enzyme, the results indicate some small changes in conformation occurring as much as 14 {angstrom} away from the site of substitution. For the enzyme-NADPH complexes, the chemical shifts of nuclei in the bound coenzyme indicate that the nicotinamide ring binds differently in complexes with the mutant and the wild-type enzyme. There are complexes where the wild-type enzyme has been shown to exist in solution as a mixture of conformations, and studies on the corresponding complexes with the Trp 21 {yields} Leu mutant indicate that the delicately poised equilibria can be perturbed. Some conformational adjustments are required to allow the carboxylate of Glu 26 to bind effectively to the N1 proton of inhibitors such as methotrexate and trimethoprim.

  8. Endothelial dihydrofolate reductase: critical for nitric oxide bioavailability and role in angiotensin II uncoupling of endothelial nitric oxide synthase.

    PubMed

    Chalupsky, Karel; Cai, Hua

    2005-06-21

    Recent studies demonstrate that oxidative inactivation of tetrahydrobiopterin (H4B) may cause uncoupling of endothelial nitric oxide synthase (eNOS) to produce superoxide (O2*-). H4B was found recyclable from its oxidized form by dihydrofolate reductase (DHFR) in several cell types. Functionality of the endothelial DHFR, however, remains completely unknown. Here we present findings that specific inhibition of endothelial DHFR by RNA interference markedly reduced endothelial H4B and nitric oxide (NO.) bioavailability. Furthermore, angiotensin II (100 nmol/liter for 24 h) caused a H4B deficiency that was mediated by H2O2-dependent down-regulation of DHFR. This response was associated with a significant increase in endothelial O2*- production, which was abolished by eNOS inhibitor N-nitro-L-arginine-methyl ester or H2O2 scavenger polyethylene glycol-conjugated catalase, strongly suggesting H2O2-dependent eNOS uncoupling. Rapid and transient activation of endothelial NAD(P)H oxidases was responsible for the initial burst production of O2* (Rac1 inhibitor NSC 23766 but not an N-nitro-L-arginine-methyl ester-attenuated ESR O2*- signal at 30 min) in response to angiotensin II, preceding a second peak in O2*- production at 24 h that predominantly depended on uncoupled eNOS. Overexpression of DHFR restored NO. production and diminished eNOS production of O2*- in angiotensin II-stimulated cells. In conclusion, these data represent evidence that DHFR is critical for H4B and NO. bioavailability in the endothelium. Endothelial NAD(P)H oxidase-derived H2O2 down-regulates DHFR expression in response to angiotensin II, resulting in H4B deficiency and uncoupling of eNOS. This signaling cascade may represent a universal mechanism underlying eNOS dysfunction under pathophysiological conditions associated with oxidant stress.

  9. Histidine Hydrogen-Deuterium Exchange Mass Spectrometry for Probing the Microenvironment of Histidine Residues in Dihydrofolate Reductase

    PubMed Central

    Ahmad, Md. Faiz; Gokulrangan, Giridharan; Tomechko, Sara E.; Bennett, Brad; Dealwis, Chris

    2011-01-01

    Background Histidine Hydrogen-Deuterium Exchange Mass Spectrometry (His-HDX-MS) determines the HDX rates at the imidazole C2-hydrogen of histidine residues. This method provides not only the HDX rates but also the pKa values of histidine imidazole rings. His-HDX-MS was used to probe the microenvironment of histidine residues of E. coli dihydrofolate reductase (DHFR), an enzyme proposed to undergo multiple conformational changes during catalysis. Methodology/Principal Findings Using His-HDX-MS, the pKa values and the half-lives (t1/2) of HDX reactions of five histidine residues of apo-DHFR, DHFR in complex with methotrexate (DHFR-MTX), DHFR in complex with MTX and NADPH (DHFR-MTX-NADPH), and DHFR in complex with folate and NADP+ (DHFR-folate-NADP+) were determined. The results showed that the two parameters (pKa and t1/2) are sensitive to the changes of the microenvironment around the histidine residues. Although four of the five histidine residues are located far from the active site, ligand binding affected their pKa, t1/2 or both. This is consistent with previous observations of ligand binding-induced distal conformational changes on DHFR. Most of the observed pKa and t1/2 changes could be rationalized using the X-ray structures of apo-DHFR, DHFR-MTX-NADPH, and DHFR-folate-NADP+. The availability of the neutron diffraction structure of DHFR-MTX enabled us to compare the protonation states of histidine imidazole rings. Conclusions/Significance Our results demonstrate the usefulness of His-HDX-MS in probing the microenvironments of histidine residues within proteins. PMID:21359214

  10. Association of dihydrofolate reductase (DHFR) -317AA genotype with poor response to methotrexate in patients with rheumatoid arthritis.

    PubMed

    Milic, Vera; Jekic, Biljana; Lukovic, Ljiljana; Bunjevacki, Vera; Milasin, Jelena; Novakovic, Ivana; Damnjanovic, Tatjana; Popovic, Branka; Maksimovic, Nela; Damjanov, Nemanja; Radunovic, Goran; Pejnovic, Nada; Krajinovic, Maja

    2012-01-01

    Identifying genetic predictors of methotrexate (MTX) treatment response in patients with rheumatoid arthritis (RA) may have great importance for optimising drug doses required for clinical benefit without toxicity. In a group of 125 RA patients treated with MTX we investigated whether selected polymorphisms in genes relevant for MTX action (aminoimidazole-4-carboxiamide ribonucleotide transformylase, ATIC, and dihydrofolate reductase, DHFR) modulate disease activity and/or have impact on therapy side effects. The efficacy of treatment was estimated both by the disease activity score in 28 joints (DAS28), based on EULAR criteria, and relative DAS28 (rDAS28) score. Adverse drug events (ADEs) were also recorded. RA patients were genotyped using the PCR-RFLP method, followed by an association study between ATIC -129T>G, DHFR -216T>C and DHFR -317A>G polymorphisms and the efficacy and toxicity of MTX. According to the EULAR response criteria, 96 RA patients (76.8%) were classified as responders (good/moderate response) and 29 (23.2%) as non-responders (poor response). rDAS28 values ranged from -0.01 to 0.80 (mean value 0.31±0.19). Among 125 patients enrolled in this study 39 experienced at least one side effect. The DHFR -317AA genotype was associated with the less favourable response (reduction in rDAS28 score, p=0.05). None of the analysed polymorphisms was associated with MTX toxicity. RA patients with DHFR-317AA genotype had less favourable response to MTX. Further studies in larger patient populations are necessary to confirm the relationship between the analysed polymorphisms and MTX treatment response.

  11. Incorporation of β-amino acids into dihydrofolate reductase by ribosomes having modifications in the peptidyltransferase center.

    PubMed

    Maini, Rumit; Nguyen, Dan T; Chen, Shengxi; Dedkova, Larisa M; Chowdhury, Sandipan Roy; Alcala-Torano, Rafael; Hecht, Sidney M

    2013-03-01

    Ribosomes containing modifications in three regions of 23S rRNA, all of which are in proximity to the ribosomal peptidyltransferase center (PTC), were utilized previously as a source of S-30 preparations for in vitro protein biosynthesis experiments. When utilized in the presence of mRNAs containing UAG codons at predetermined positions+β-alanyl-tRNA(CUA), the modified ribosomes produced enhanced levels of full length proteins via UAG codon suppression. In the present study, these earlier results have been extended by the use of substituted β-amino acids, and direct evidence for β-amino acid incorporation is provided. Presently, five of the clones having modified ribosomes are used in experiments employing four substituted β-amino acids, including α-methyl-β-alanine, β,β-dimethyl-β-alanine, β-phenylalanine, and β-(p-bromophenyl)alanine. The β-amino acids were incorporated into three different positions (10, 18 and 49) of Escherichia coli dihydrofolate reductase (DHFR) and their efficiencies of suppression of the UAG codons were compared with those of β-alanine and representative α-l-amino acids. The isolated proteins containing the modified β-amino acids were subjected to proteolytic digestion, and the derived fragments were characterized by mass spectrometry, establishing that the β-amino acids had been incorporated into DHFR, and that they were present exclusively in the anticipated peptide fragments. DHFR contains glutamic acid in position 17, and it has been shown previously that Glu-C endoproteinase can hydrolyze DHFR between amino acids residues 17 and 18. The incorporation of β,β-dimethyl-β-alanine into position 18 of DHFR prevented this cleavage, providing further evidence for the position of incorporation of the β-amino acid.

  12. Molecular epidemiology of malaria in Cameroon. XXII. Geographic mapping and distribution of Plasmodium falciparum dihydrofolate reductase (dhfr) mutant alleles.

    PubMed

    Tahar, Rachida; Basco, Leonardo K

    2006-09-01

    Sulfadoxine-pyrimethamine (SP) is still a useful drug to combat chloroquine-resistant Plasmodium falciparum malaria in Cameroon. Because of several disadvantages of the in vivo test and in vitro drug sensitivity assays, molecular assays are an alternative laboratory tool to monitor the evolution of antifolate resistance, especially over the entire country that is characterized by several epidemiologic strata and malaria transmission patterns. In this study, 1,430 blood samples from either symptomatic children or asymptomatic carriers were collected from 14 sites throughout the country between 1999 and 2003 for the analysis of dihydrofolate reductase (dhfr) sequence. Of 1,368 samples (95.7%) that were successfully amplified, 1,180 were analyzed by direct sequencing of the polymerase chain reaction product, and 188 were analyzed by restriction enzymes. The prevalences of the wild-type, single Asn-108 mutation, double Arg-59/Asn-108 mutations, double Ile-51/Asn-108 mutations, triple Ile-51/Arg-59/Asn-108 mutations, and mixed alleles were 20.8%, 2.8%, 5.7%, 0.8%, 62.2%, and 7.6%, respectively. The proportions of triple dhfr mutations were > 60% at all study sites, with the exception of the eastern province (42% triple mutants in Bertoua in 1999) and the northern provinces (11-35% triple mutants in Ngaoundere, Garoua, and Maroua). In these two provinces, the proportion of mutant parasites increased significantly (P < 0.05) over the period of 2-4 years. Furthermore, there was a higher proportion (P < 0.05) of wild-type parasites in the northern provinces, compared with the rest of the country. The geographic mapping of molecular markers offers a novel tool for monitoring the epidemiology of drug-resistant malaria.

  13. 2,4-Diaminothieno[2,3-d]pyrimidine lipophilic antifolates as inhibitors of Pneumocystis carinii and Toxoplasma gondii dihydrofolate reductase.

    PubMed

    Rosowsky, A; Papoulis, A T; Queener, S F

    1997-10-24

    Ten previously unreported 2,4-diaminothieno[2,3-d]pyrimidine lipophilic dihydrofolate reductase inhibitors were synthesized as potential inhibitors of Pneumocystis carinii and Toxoplasma gondii dihydrofolate reductase. Pivaloylation of 2,4-diamino-5-methylthieno[2,3-d]pyrimidine followed by dibromination with N-bromosuccinimide in the presence of benzoyl peroxide gave 2,4-bis(pivaloylamino)-6-bromo-5-(bromomethyl)thieno[2,3-d]pyrimid ine, which after condensation with substituted anilines or N-methylanilines and deprotection with base yielded 2,4-diamino-6-bromo-5-[(substituted anilino)methyl]thieno[2,3-d]pyrimidines. Removal of the 6-bromo substituent was accomplished with sodium borohydride and palladium chloride. The reaction yields were generally good to excellent. The products were tested as inhibitors of dihydrofolate reductase (DHFR) from P. carinii, T. gondii, and rat liver. Although the IC50 could not be reached for the 6-unsubstituted compounds because of their extremely poor solubility, three of the five 6-bromo derivatives were soluble enough to allow the IC50 to be determined against all three enzymes. 2,4-Diamino-5-[3,5-dichloro-4-(1-pyrrolo)anilino]methyl]- 6-bromothieno[2,3-d]pyrimidine was the most active of the 6-bromo derivatives, with an IC50 of 7.5 microM against P. carinii DHFR, but showed no selectivity for either P. carinii or T. gondii DHFR relative to the enzyme from rat liver.

  14. sup 13 C and sup 15 N nuclear magnetic resonance evidence of the ionization state of substrates bound to bovine dihydrofolate reductase

    SciTech Connect

    Selinsky, B.S.; Perlman, M.E.; London, R.E. ); Unkefer, C.J. ); Mitchell, J. ); Blakley, R.L. Univ. of Tennessee, Memphis )

    1990-02-06

    The state of protonation of substrates bound to mammalian dihydrofolate reductase (DHFR) has significance for the mechanism of catalysis. To investigate this, dihydrofolate and dihydropteroylpentaglutamate have been synthesized with {sup 15}N enrichment at N-5. {sup 15}N NMR studies have been performed on the binary complexes formed by bovine DHFR with these compounds and with (5-{sup 15}N)dihydrobiopterin. The results indicate that there is no protonation at N-5 in the binary complexes, and this was confirmed by {sup 13}C NMR studies with folate and dihydrofolate synthesized with {sup 13}C enrichment at C-6. The chemical shift displacements produced by complex formation are in the same direction as those which result from deprotonation of the N-3/C-4-O amide group and are consistent with at least partial loss of the proton from N-3. This would be possible if, as crystallographic data indicate, there is interaction of N-3 and the 2-amino group of the bound ligands with the carboxylate of the active site glutamate residue (Glu{sup 30}).

  15. Study on Folate Binding Domain of Dihydrofolate Reductase in Different Plant species and Human beings.

    PubMed

    Samanta, Aveek; Datta, Animesh Kumar; Datta, Siraj

    2014-01-01

    Data base (NCBI and TIGR) searches are made to retrieve protein sequences of different plant species namely Medicago truncatula, Pisum sativum, Ricinus communis, Arabidopsis thaliana, Vitis vinifera, Glycine max, Daucus carota, Oryza sativa Japonica Group, Arabidopsis lyrata subsp. lyrata, Brachypodium distachyon, Oryza sativa Indica Group, Zea mays and careful alignment of derived sequences shows 95% or higher identity. Similarly, DHFR sequence of human being is also retrieved from NCBI. A phylogenetic tree is constructed from different plant and human DHFR domain using the Neighbour - Joining method in MEGA 5.05. Conservation score is performed by using PARALINE. Result suggests that folate binding domain of dihydrofolare reductase is conserved (score 8.06) and excepting some minor variations the basic structure of the domain in both plant species and human being is rather similar. Human DHFR domain contains PEKN sequence near active site, though proline is common for all the selected organisms but the other sequences are different in plants. The plant domain is always associated with TS (Thymidylate synthase). Plant based system is predicted to be an effective model for assessment of MTX (Methotrexate) and other antifolate drugs.

  16. Mutations in the Antifolate-Resistance-Associated Genes Dihydrofolate Reductase and Dihydropteroate Synthase in Plasmodium vivax Isolates from Malaria-Endemic Countries

    PubMed Central

    Lu, Feng; Lim, Chae Seung; Nam, Deok Hwa; Kim, Kwonkee; Lin, Khin; Kim, Tong-Soo; Lee, Hyeong-Woo; Chen, Jun-Hu; Wang, Yue; Sattabongkot, Jetsumon; Han, Eun-Taek

    2010-01-01

    Parasite dihydrofolate reductase (DHFR) and dihydropteroate synthase (DHPS) are known target enzymes of antifolate drugs used for the treatment and prophylaxis of persons with malaria. We sequenced the Plasmodium vivax dihydrofolate reductase (pvdhfr) and dihydropteroate synthase (pvdhps) genes to examine the prevalence and extent of point mutations in isolates from malaria-endemic countries. Double mutations (S58R and S117N) or quadruple mutations (F57L/I, S58R, T61M, and S117T) in the pvdhfr gene were found in isolates from Thailand (96.4%) and Myanmar (71.4%), but in only one isolate (1.0%) from Korea, where sulfadoxine-pyrimethamine has never been used. The pvdhfr point mutations correlated strongly with the pvdhps point mutations and ranged from single to triple mutations (S382A, A383G, and A553G), among isolates from Thailand, Myanmar, and Korea. These findings suggests that the prevalence of mutations in pvdhfr and pvdhps in P. vivax isolates from different malaria-endemic countries is associated with selection pressure imposed by sulfadoxine-pyrimethamine. PMID:20810806

  17. Photoaffinity analogues of methotrexate as folate antagonist binding probes. 1. Photoaffinity labeling of murine L1210 dihydrofolate reductase and amino acid sequence of the binding region

    SciTech Connect

    Price, E.M.; Smith, P.L.; Klein, T.E.; Freisheim, J.H.

    1987-07-28

    N/sup ..cap alpha../-(4-Amino-4-deoxy-10-methylpteroyl)-N/sup epsilon/-(4-azido-5-(/sup 125/I)iodosalicylyl)-L-lysine, a photoaffinity analogue of methotrexate, is only 2-fold less potent than methotrexate in the inhibition of murine L1210 dihydrofolate reductase. Irradiation of the enzyme in the presence of an equimolar concentration of the /sup 125/I-labeled analogue ultimately leads to an 8% incorporation of the photoprobe. A 100-fold molar excess of methotrexate essentially blocks this incorporation. Cyanogen bromide digestion of the labeled enzyme, followed by high-pressure liquid chromatography purification of the generated peptides, indicates that greater than 85% of the total radioactivity is incorporated into a single cyanogen bromide peptide. Sequence analysis revealed this peptide to be residues 53-111, with a majority of the radioactivity centered around residues 63-65 (Lys-Asn-Arg). These data demonstrate that the photoaffinity analogue specifically binds to dihydrofolate reductase and covalently modifies the enzyme following irradiation and is therefore a photolabeling agent useful for probing the inhibitor binding domain of the enzyme.

  18. Proton nuclear magnetic resonance studies of the effects of ligand binding on ryptophan residues of selectively deuterated dihydrofolate reductase from Lactobacillus casei

    SciTech Connect

    Feeney, J.; Roberts, G.C.; Thomson, J.W.; King, R.W; Griffiths, D.V.; Burgen, A.S.

    1980-05-01

    We have prepared a selectively deuterated dihydrofolate reductase in which all the aromatic protons except the C(2) protons of tryptophan have been replaced by deuterium and have examined the 1H NMR spectra of its complexes with folate, trimethoprim, methotrexate, NADP+, and NADPH. One of the four Trp C(2)-proton resonance signals (signal P at 3.66 ppm from dioxane) has been asigned to Trp-21 by examining the NMR spectrum of a selectively deuterated N-bromosuccinimide-modified dihydrofolate reductase. This signal is not perturbed by NADPH, indicating that the coenzyme is not binding close to the 2 position of Trp-21. This contrasts markedly with the 19F shift (2.7 ppm) observed for the 19F signal of Trp-21 in the NADPH complex with the 6-fluorotryptophan-labeled enzyme. In fact the crystal structure of the enzyme . methotrexate . NADPH shows that the carboxamide group of the reduced nicotinamide ring is near to the 6 position of Trp-21 but remote from its 2 position. The nonadditivity of the 1H chemical-shift contributions for signals tentatively assigned to Trp-5 and -133 indicates that these residues are influenced by ligand-induced conformational changes.

  19. Characterization of dihydrofolate reductase genes from trimethoprim-susceptible and trimethoprim-resistant strains of Enterococcus faecalis.

    PubMed

    Coque, T M; Singh, K V; Weinstock, G M; Murray, B E

    1999-01-01

    Enterococci are usually susceptible in vitro to trimethoprim; however, high-level resistance (HLR) (MICs, >1,024 microg/ml) has been reported. We studied Enterococcus faecalis DEL, for which the trimethoprim MIC was >1,024 microg/ml. No transfer of resistance was achieved by broth or filter matings. Two different genes that conferred trimethoprim resistance when they were cloned in Escherichia coli (MICs, 128 and >1,024 microg/ml) were studied. One gene that coded for a polypeptide of 165 amino acids (MIC, 128 microg/ml for E. coli) was identical to dfr homologs that we cloned from a trimethoprim-susceptible E. faecalis strain, and it is presumed to be the intrinsic E. faecalis dfr gene (which causes resistance in E. coli when cloned in multiple copies); this gene was designated dfrE. The nucleotide sequence 5' to this dfr gene showed similarity to thymidylate synthetase genes, suggesting that the dfr and thy genes from E. faecalis are located in tandem. The E. faecalis gene that conferred HLR to trimethoprim in E. coli, designated dfrF, codes for a predicted polypeptide of 165 amino acids with 38 to 64% similarity with other dihydrofolate reductases from gram-positive and gram-negative organisms. The nucleotide sequence 5' to dfrF did not show similarity to the thy sequences. A DNA probe for dfrF hybridized under high-stringency conditions only to colony lysates of enterococci for which the trimethoprim MIC was >1,024 microg/ml; there was no hybridization to plasmid DNA from the strain of origin. To confirm that this gene causes trimethoprim resistance in enterococci, we cloned it into the integrative vector pAT113 and electroporated it into RH110 (E. faecalis OG1RF::Tn916DeltaEm) (trimethoprim MIC, 0.5 microg/ml), which resulted in RH110 derivatives for which the trimethoprim MIC was >1, 024 microg/ml. These results indicate that dfrF is an acquired but probably chromosomally located gene which is responsible for in vitro HLR to trimethoprim in E. faecalis.

  20. Evaluation of dihydrofolate reductase and dihydropteroate synthetase genotypes that confer resistance to sulphadoxine-pyrimethamine in Plasmodium falciparum in Haiti

    PubMed Central

    2012-01-01

    Background Malaria caused by Plasmodium falciparum infects roughly 30,000 individuals in Haiti each year. Haiti has used chloroquine (CQ) as a first-line treatment for malaria for many years and as a result there are concerns that malaria parasites may develop resistance to CQ over time. Therefore it is important to prepare for alternative malaria treatment options should CQ resistance develop. In many other malaria-endemic regions, antifolates, particularly pyrimethamine (PYR) and sulphadoxine (SDX) treatment combination (SP), have been used as an alternative when CQ resistance has developed. This study evaluated mutations in the dihydrofolate reductase (dhfr) and dihydropteroate synthetase (dhps) genes that confer PYR and SDX resistance, respectively, in P. falciparum to provide baseline data in Haiti. This study is the first comprehensive study to examine PYR and SDX resistance genotypes in P. falciparum in Haiti. Methods DNA was extracted from dried blood spots and genotyped for PYR and SDX resistance mutations in P. falciparum using PCR and DNA sequencing methods. Sixty-one samples were genotyped for PYR resistance in codons 51, 59, 108 and 164 of the dhfr gene and 58 samples were genotyped for SDX resistance codons 436, 437, 540 of the dhps gene in P. falciparum. Results Thirty-three percent (20/61) of the samples carried a mutation at codon 108 (S108N) of the dhfr gene. No mutations in dhfr at codons 51, 59, 164 were observed in any of the samples. In addition, no mutations were observed in dhps at the three codons (436, 437, 540) examined. No significant difference was observed between samples collected in urban vs rural sites (Welch’s T-test p-value = 0.53 and permutations p-value = 0.59). Conclusion This study has shown the presence of the S108N mutation in P. falciparum that confers low-level PYR resistance in Haiti. However, the absence of SDX resistance mutations suggests that SP resistance may not be present in Haiti. These results have important

  1. Evaluation of dihydrofolate reductase and dihydropteroate synthetase genotypes that confer resistance to sulphadoxine-pyrimethamine in Plasmodium falciparum in Haiti.

    PubMed

    Carter, Tamar E; Warner, Megan; Mulligan, Connie J; Existe, Alexander; Victor, Yves S; Memnon, Gladys; Boncy, Jacques; Oscar, Roland; Fukuda, Mark M; Okech, Bernard A

    2012-08-13

    Malaria caused by Plasmodium falciparum infects roughly 30,000 individuals in Haiti each year. Haiti has used chloroquine (CQ) as a first-line treatment for malaria for many years and as a result there are concerns that malaria parasites may develop resistance to CQ over time. Therefore it is important to prepare for alternative malaria treatment options should CQ resistance develop. In many other malaria-endemic regions, antifolates, particularly pyrimethamine (PYR) and sulphadoxine (SDX) treatment combination (SP), have been used as an alternative when CQ resistance has developed. This study evaluated mutations in the dihydrofolate reductase (dhfr) and dihydropteroate synthetase (dhps) genes that confer PYR and SDX resistance, respectively, in P. falciparum to provide baseline data in Haiti. This study is the first comprehensive study to examine PYR and SDX resistance genotypes in P. falciparum in Haiti. DNA was extracted from dried blood spots and genotyped for PYR and SDX resistance mutations in P. falciparum using PCR and DNA sequencing methods. Sixty-one samples were genotyped for PYR resistance in codons 51, 59, 108 and 164 of the dhfr gene and 58 samples were genotyped for SDX resistance codons 436, 437, 540 of the dhps gene in P. falciparum. Thirty-three percent (20/61) of the samples carried a mutation at codon 108 (S108N) of the dhfr gene. No mutations in dhfr at codons 51, 59, 164 were observed in any of the samples. In addition, no mutations were observed in dhps at the three codons (436, 437, 540) examined. No significant difference was observed between samples collected in urban vs rural sites (Welch's T-test p-value = 0.53 and permutations p-value = 0.59). This study has shown the presence of the S108N mutation in P. falciparum that confers low-level PYR resistance in Haiti. However, the absence of SDX resistance mutations suggests that SP resistance may not be present in Haiti. These results have important implications for ongoing discussions on

  2. Splicing mutants and their second-site suppressors at the dihydrofolate reductase locus in Chinese hamster ovary cells.

    PubMed

    Carothers, A M; Urlaub, G; Grunberger, D; Chasin, L A

    1993-08-01

    Point mutants induced with a variety of mutagens at the dihydrofolate reductase (dhfr) locus in Chinese hamster ovary (CHO) cells were screened for aberrantly spliced dhfr mRNA by RNase protection and/or reverse transcriptase coupled with cDNA amplification by the polymerase chain reaction (PCR). Of 115 mutants screened, 28 were found to be affected in splicing. All exhibited less than 1% correct splicing, probably because the selection procedure was stringent. All 26 unique mutations were located within the consensus splice sequences; changes were found at 9 of 10 possible sites in this 25-kb six-exon gene. Mutations at the sites flanking the first and last exons resulted in the efficient recruitment of a cryptic site within each exon. In contrast, mutations bordering internal exons caused predominantly exon skipping. In many cases, multiple exons were skipped, suggesting the clustering of adjacent exons prior to actual splicing. Six mutations fell outside the well-conserved GU and AG dinucleotides. All but one were donor site single-base substitutions that decreased the agreement with the consensus and resulted in little or no correct splicing. Starting with five of these donor site mutants, we isolated 31 DHFR+ revertants. Most revertants carried a single-base substitution at a site other than that of the original mutation, and most had only partially regained the ability to splice correctly. The second-site suppression occurred through a variety of mechanisms: (i) a second change within the consensus sequence that produced a better agreement with the consensus; (ii) a change close to but beyond the consensus boundaries, as far as 8 bases upstream in the exon or 28 bases downstream in the intron; (iii) mutations in an apparent pseudo 5' site in the intron, 84 and 88 bases downstream of a donor site; and (iv) mutations that improved the upstream acceptor site of the affected exon. Taken together, these second-site suppressor mutations extend the definition of a

  3. Splicing mutants and their second-site suppressors at the dihydrofolate reductase locus in Chinese hamster ovary cells.

    PubMed Central

    Carothers, A M; Urlaub, G; Grunberger, D; Chasin, L A

    1993-01-01

    Point mutants induced with a variety of mutagens at the dihydrofolate reductase (dhfr) locus in Chinese hamster ovary (CHO) cells were screened for aberrantly spliced dhfr mRNA by RNase protection and/or reverse transcriptase coupled with cDNA amplification by the polymerase chain reaction (PCR). Of 115 mutants screened, 28 were found to be affected in splicing. All exhibited less than 1% correct splicing, probably because the selection procedure was stringent. All 26 unique mutations were located within the consensus splice sequences; changes were found at 9 of 10 possible sites in this 25-kb six-exon gene. Mutations at the sites flanking the first and last exons resulted in the efficient recruitment of a cryptic site within each exon. In contrast, mutations bordering internal exons caused predominantly exon skipping. In many cases, multiple exons were skipped, suggesting the clustering of adjacent exons prior to actual splicing. Six mutations fell outside the well-conserved GU and AG dinucleotides. All but one were donor site single-base substitutions that decreased the agreement with the consensus and resulted in little or no correct splicing. Starting with five of these donor site mutants, we isolated 31 DHFR+ revertants. Most revertants carried a single-base substitution at a site other than that of the original mutation, and most had only partially regained the ability to splice correctly. The second-site suppression occurred through a variety of mechanisms: (i) a second change within the consensus sequence that produced a better agreement with the consensus; (ii) a change close to but beyond the consensus boundaries, as far as 8 bases upstream in the exon or 28 bases downstream in the intron; (iii) mutations in an apparent pseudo 5' site in the intron, 84 and 88 bases downstream of a donor site; and (iv) mutations that improved the upstream acceptor site of the affected exon. Taken together, these second-site suppressor mutations extend the definition of a

  4. Partial sup 1 H NMR assignments of the Escherichia coli dihydrofolate reductase complex with folate: Evidence for a unique conformation of bound folate

    SciTech Connect

    Falzone, C.J.; Benkovic, S.J. ); Wright, P.E. )

    1990-10-01

    Sequence-specific {sup 1}H assignments have been made for over 25% of the amino acid side chains of Escherichia coli dihydrofolate reductase complexed with folate by using a variety of two-dimensional techniques. Proton resonances were assigned by using a combination of site-directed mutagenesis and a knowledge of the X-ray crystal structure. Unique sets of NOE connectivities present in hydrophobic pockets were matched with the X-ray structure and used to assign many of the residues. Other residues, particularly those near or in the active site, were assigned by site-directed mutagenesis. The ability to assign unambiguosly the proton resonances of these catalytically important residues allowed for extensive networks of NOE connectivities to follow from these assignments. As a consequence of these assignments, the orientation of the pterin ring of folate could be determined, and its conformation is similar to that of the productive dihydrofolate complex. Under these experimental conditions, only one bound form of the pterin ring could be detected.

  5. Structures of dihydrofolate reductase-thymidylate synthase of Trypanosoma cruzi in the folate-free state and in complex with two antifolate drugs, trimetrexate and methotrexate

    SciTech Connect

    Senkovich, Olga; Schormann, Norbert; Chattopadhyay, Debasish

    2010-11-22

    The flagellate protozoan parasite Trypanosoma cruzi is the pathogenic agent of Chagas disease (also called American trypanosomiasis), which causes approximately 50 000 deaths annually. The disease is endemic in South and Central America. The parasite is usually transmitted by a blood-feeding insect vector, but can also be transmitted via blood transfusion. In the chronic form, Chagas disease causes severe damage to the heart and other organs. There is no satisfactory treatment for chronic Chagas disease and no vaccine is available. There is an urgent need for the development of chemotherapeutic agents for the treatment of T. cruzi infection and therefore for the identification of potential drug targets. The dihydrofolate reductase activity of T. cruzi, which is expressed as part of a bifunctional enzyme, dihydrofolate reductase-thymidylate synthase (DHFR-TS), is a potential target for drug development. In order to gain a detailed understanding of the structure-function relationship of T. cruzi DHFR, the three-dimensional structure of this protein in complex with various ligands is being studied. Here, the crystal structures of T. cruzi DHFR-TS with three different compositions of the DHFR domain are reported: the folate-free state, the complex with the lipophilic antifolate trimetrexate (TMQ) and the complex with the classical antifolate methotrexate (MTX). These structures reveal that the enzyme is a homodimer with substantial interactions between the two TS domains of neighboring subunits. In contrast to the enzymes from Cryptosporidium hominis and Plasmodium falciparum, the DHFR and TS active sites of T. cruzi lie on the same side of the monomer. As in other parasitic DHFR-TS proteins, the N-terminal extension of the T. cruzi enzyme is involved in extensive interactions between the two domains. The DHFR active site of the T. cruzi enzyme shows subtle differences compared with its human counterpart. These differences may be exploited for the development of

  6. Kinetics of the inhibition of bovine liver dihydrofolate reductase by tea catechins: origin of slow-binding inhibition and pH studies.

    PubMed

    Navarro-Perán, Enma; Cabezas-Herrera, Juan; Hiner, Alexander N P; Sadunishvili, Tinatin; García-Cánovas, Francisco; Rodríguez-López, José Neptuno

    2005-05-24

    Dihydrofolate reductase (DHFR) is the subject of intensive investigation since it appears to be the primary target enzyme for "antifolate" drugs, such as methotrexate and trimethoprim. Fluorescence quenching and stopped-flow fluorimetry show that the ester bond-containing tea polyphenols (-)-epigallocatechin gallate (EGCG) and (-)-epicatechin gallate (ECG) are potent and specific inhibitors of DHFR with inhibition constants (K(I)) of 120 and 82 nM, respectively. Both tea compounds showed the characteristics of slow-binding inhibitors of bovine liver DHFR. In this work, we have determined a complete kinetic scheme to explain the slow-binding inhibition and the pH effects observed during the inhibition of bovine liver DHFR by these tea polyphenols. Experimental data, based on fluorimetric titrations, and transient phase and steady-state kinetic studies confirm that EGCG and ECG are competitive inhibitors with respect to 7,8-dihydrofolate, which bind preferentially to the free form of the enzyme. The origin of their slow-binding inhibition is proposed to be the formation of a slow dissociation ternary complex by the reaction of NADPH with the enzyme-inhibitor complex. The pH controls both the ionization of critical catalytic residues of the enzyme and the protonation state of the inhibitors. At acidic pH, EGCG and ECG are mainly present as protonated species, whereas near neutrality, they evolve toward deprotonated species due to ionization of the ester-bonded gallate moiety (pK = 7.8). Although DHFR exhibits different affinities for the protonated and deprotonated forms of EGCG and ECG, it appears that the ionization state of Glu-30 in DHFR is critical for its inhibition. The physiological implications of these pH dependencies are also discussed.

  7. 2,4-Diamino-6,7-dihydro-5H-cyclopenta[d]pyrimidine analogues of trimethoprim as inhibitors of Pneumocystis carinii and Toxoplasma gondii dihydrofolate reductase.

    PubMed

    Rosowsky, A; Papoulis, A T; Queener, S F

    1998-03-12

    Three previously unreported (R,S)-2,4-diamino-5-[(3,4,5-trimethoxyphenyl) alkyl]-6,7-dihydro-5H-cyclopenta[d]pyrimidines 15a-c were synthesized as analogues of trimethoprim (TMP) and were tested as inhibitors of Pneumocystis carinii, Toxoplasma gondii, and rat liver dihydrofolate reductase (DHFR). The length of the alkyl bridge between the cyclopenta[d]pyrimidine and trimethoxyphenyl moiety ranged from one in 15a to three carbons in 15c. The products were tested as competitive inhibitors of the reduction of dihydrofolate by Pneumocystis carinii, Toxoplasma gondii, and rat liver DHFR. Compounds 15a-c had IC50 values of > 32, 1.8 and 1.3 microM, respectively, against P. carinii DHFR, as compared to 12 microM for TMP. Against the T. gondii enzyme, 15a-c had IC50 values of 21, 0.14 and 0.14 microM, respectively, as compared to 2.7 microM for TMP. Inhibitors 15b and 15c with two- and three-carbon bridges were significantly more potent than 15a against all three enzymes. Unlike TMP, 15b and 15c were better inhibitors of the rat liver enzyme than of the microbial enzymes. The potency of 15b and 15c against rat liver DHFR was less than has been reported for the corresponding 6,7-dihydro-5H-cyclopenta[d]pyrimidines with a classical p-aminobenzoyl-L-glutamate side chain as inhibitors of bovine, murine, and human DHFR.

  8. Solvent environments significantly affect the enzymatic function of Escherichia coli dihydrofolate reductase: comparison of wild-type protein and active-site mutant D27E.

    PubMed

    Ohmae, Eiji; Miyashita, Yurina; Tate, Shin-Ichi; Gekko, Kunihiko; Kitazawa, Soichiro; Kitahara, Ryo; Kuwajima, Kunihiro

    2013-12-01

    To investigate the contribution of solvent environments to the enzymatic function of Escherichia coli dihydrofolate reductase (DHFR), the salt-, pH-, and pressure-dependence of the enzymatic function of the wild-type protein were compared with those of the active-site mutant D27E in relation to their structure and stability. The salt concentration-dependence of enzymatic activity indicated that inorganic cations bound to and inhibited the activity of wild-type DHFR at neutral pH. The BaCl2 concentration-dependence of the (1)H-(15)N HSQC spectra of the wild-type DHFR-folate binary complex showed that the cation-binding site was located adjacent to the Met20 loop. The insensitivity of the D27E mutant to univalent cations, the decreased optimal pH for its enzymatic activity, and the increased Km and Kd values for its substrate dihydrofolate suggested that the substrate-binding cleft of the mutant was slightly opened to expose the active-site side chain to the solvent. The marginally increased fluorescence intensity and decreased volume change due to unfolding of the mutant also supported this structural change or the modified cavity and hydration. Surprisingly, the enzymatic activity of the mutant increased with pressurization up to 250MPa together with negative activation volumes of -4.0 or -4.8mL/mol, depending on the solvent system, while that of the wild-type was decreased and had positive activation volumes of 6.1 or 7.7mL/mol. These results clearly indicate that the insertion of a single methylene at the active site could substantially change the enzymatic reaction mechanism of DHFR, and solvent environments play important roles in the function of this enzyme. © 2013.

  9. Momentum Distribution as a Fingerprint of Quantum Delocalization in Enzymatic Reactions: Open-Chain Path-Integral Simulations of Model Systems and the Hydride Transfer in Dihydrofolate Reductase.

    PubMed

    Engel, Hamutal; Doron, Dvir; Kohen, Amnon; Major, Dan Thomas

    2012-04-10

    The inclusion of nuclear quantum effects such as zero-point energy and tunneling is of great importance in studying condensed phase chemical reactions involving the transfer of protons, hydrogen atoms, and hydride ions. In the current work, we derive an efficient quantum simulation approach for the computation of the momentum distribution in condensed phase chemical reactions. The method is based on a quantum-classical approach wherein quantum and classical simulations are performed separately. The classical simulations use standard sampling techniques, whereas the quantum simulations employ an open polymer chain path integral formulation which is computed using an efficient Monte Carlo staging algorithm. The approach is validated by applying it to a one-dimensional harmonic oscillator and symmetric double-well potential. Subsequently, the method is applied to the dihydrofolate reductase (DHFR) catalyzed reduction of 7,8-dihydrofolate by nicotinamide adenine dinucleotide phosphate hydride (NADPH) to yield S-5,6,7,8-tetrahydrofolate and NADP(+). The key chemical step in the catalytic cycle of DHFR involves a stereospecific hydride transfer. In order to estimate the amount of quantum delocalization, we compute the position and momentum distributions for the transferring hydride ion in the reactant state (RS) and transition state (TS) using a recently developed hybrid semiempirical quantum mechanics-molecular mechanics potential energy surface. Additionally, we examine the effect of compression of the donor-acceptor distance (DAD) in the TS on the momentum distribution. The present results suggest differential quantum delocalization in the RS and TS, as well as reduced tunneling upon DAD compression.

  10. Two crystal structures of dihydrofolate reductase-thymidylate synthase from Cryptosporidium hominis reveal protein–ligand interactions including a structural basis for observed antifolate resistance

    SciTech Connect

    Anderson, Amy C.

    2005-03-01

    An analysis of the protein–ligand interactions in two crystal structures of DHFR-TS from C. hominis reveals a possible structural basis for observed antifolate resistance in C. hominis DHFR. A comparison with the structure of human DHFR reveals residue substitutions that may be exploited for the design of species-selective inhibitors. Cryptosporidium hominis is a protozoan parasite that causes acute gastrointestinal illness. There are no effective therapies for cryptosporidiosis, highlighting the need for new drug-lead discovery. An analysis of the protein–ligand interactions in two crystal structures of dihydrofolate reductase-thymidylate synthase (DHFR-TS) from C. hominis, determined at 2.8 and 2.87 Å resolution, reveals that the interactions of residues Ile29, Thr58 and Cys113 in the active site of C. hominis DHFR provide a possible structural basis for the observed antifolate resistance. A comparison with the structure of human DHFR reveals active-site differences that may be exploited for the design of species-selective inhibitors.

  11. Dihydrofolate reductase deficiency due to a homozygous DHFR mutation causes megaloblastic anemia and cerebral folate deficiency leading to severe neurologic disease.

    PubMed

    Cario, Holger; Smith, Desirée E C; Blom, Henk; Blau, Nenad; Bode, Harald; Holzmann, Karlheinz; Pannicke, Ulrich; Hopfner, Karl-Peter; Rump, Eva-Maria; Ayric, Zuleya; Kohne, Elisabeth; Debatin, Klaus-Michael; Smulders, Yvo; Schwarz, Klaus

    2011-02-11

    The importance of intracellular folate metabolism is illustrated by the severity of symptoms and complications caused by inborn disorders of folate metabolism or by folate deficiency. We examined three children of healthy, distantly related parents presenting with megaloblastic anemia and cerebral folate deficiency causing neurologic disease with atypical childhood absence epilepsy. Genome-wide homozygosity mapping revealed a candidate region on chromosome 5 including the dihydrofolate reductase (DHFR) locus. DHFR sequencing revealed a homozygous DHFR mutation, c.458A>T (p.Asp153Val), in all siblings. The patients' folate profile in red blood cells (RBC), plasma, and cerebrospinal fluid (CSF), analyzed by liquid chromatography tandem mass spectrometry, was compatible with DHFR deficiency. DHFR activity and fluorescein-labeled methotrexate (FMTX) binding were severely reduced in EBV-immortalized lymphoblastoid cells of all patients. Heterozygous cells displayed intermediate DHFR activity and FMTX binding. RT-PCR of DHFR mRNA revealed no differences between wild-type and DHFR mutation-carrying cells, whereas protein expression was reduced in cells with the DHFR mutation. Treatment with folinic acid resulted in the resolution of hematological abnormalities, normalization of CSF folate levels, and improvement of neurological symptoms. In conclusion, the homozygous DHFR mutation p.Asp153Val causes DHFR deficiency and leads to a complex hematological and neurological disease that can be successfully treated with folinic acid. DHFR is necessary for maintaining sufficient CSF and RBC folate levels, even in the presence of adequate nutritional folate supply and normal plasma folate.

  12. The Chinese hamster dihydrofolate reductase replication origin decision point follows activation of transcription and suppresses initiation of replication within transcription units.

    PubMed

    Sasaki, Takayo; Ramanathan, Sunita; Okuno, Yukiko; Kumagai, Chiharu; Shaikh, Seemab S; Gilbert, David M

    2006-02-01

    Chinese hamster ovary (CHO) cells select specific replication origin sites within the dihydrofolate reductase (DHFR) locus at a discrete point during G1 phase, the origin decision point (ODP). Origin selection is sensitive to transcription but not protein synthesis inhibitors, implicating a pretranslational role for transcription in origin specification. We have constructed a DNA array covering 121 kb surrounding the DHFR locus, to comprehensively investigate replication initiation and transcription in this region. When nuclei isolated within the first 3 h of G1 phase were stimulated to initiate replication in Xenopus egg extracts, replication initiated without any detectable preference for specific sites. At the ODP, initiation became suppressed from within the Msh3, DHFR, and 2BE2121 transcription units. Active transcription was mostly confined to these transcription units, and inhibition of transcription by alpha-amanitin resulted in the initiation of replication within transcription units, indicating that transcription is necessary to limit initiation events to the intergenic region. However, the resumption of DHFR transcription after mitosis took place prior to the ODP and so is not on its own sufficient to suppress initiation of replication. Together, these results demonstrate a remarkable flexibility in sequence selection for initiating replication and implicate transcription as one important component of origin specification at the ODP.

  13. Replication in the amplified dihydrofolate reductase domain in CHO cells may initiate at two distinct sites, one of which is a repetitive sequence element.

    PubMed

    Anachkova, B; Hamlin, J L

    1989-02-01

    To study initiation of DNA replication in mammalian chromosomes, we have established a methotrexate-resistant Chinese hamster ovary cell line (CHOC 400) that contains approximately 1,000 copies of the early replicating dihydrofolate reductase (DHFR) domain. We have previously shown that DNA replication in the prevalent 243-kilobase (kb) amplicon type in this cell line initiates somewhere within a 28-kb region located downstream from the DHFR gene. In an attempt to localize the origin of replication with more precision, we blocked the progress of replication forks emanating from origins at the beginning of the S phase by the introduction of trioxsalen cross-links at 1- to 5-kb intervals in the parental double-stranded DNA. The small DNA fragments synthesized under these conditions (which should be centered around replication origins) were then used as hybridization probes on digests of cosmids and plasmids from the DHFR domain. These studies suggested that in cells synchronized by this regimen, DNA replication initiates at two separate sites within the previously defined 28-kb replication initiation locus, in general agreement with results described in the accompanying paper (T.-H. Leu and J. L. Hamlin, Mol. Cell. Biol. 9:523-531, 1989). One of these sites contains a repeated DNA sequence element that is found at or near many other initiation sites in the genome, since it was also highly enriched in the early replicating DNA isolated from cross-linked CHO cells that contain only two copies of the DHFR domain.

  14. Selective peptide inhibitors of bifunctional thymidylate synthase-dihydrofolate reductase from Toxoplasma gondii provide insights into domain-domain communication and allosteric regulation.

    PubMed

    Landau, Mark J; Sharma, Hitesh; Anderson, Karen S

    2013-09-01

    The bifunctional enzyme thymidylate synthase-dihydrofolate reductase (TS-DHFR) plays an essential role in DNA synthesis and is unique to several species of pathogenic protozoans, including the parasite Toxoplasma gondii. Infection by T. gondii causes the prevalent disease toxoplasmosis, for which TS-DHFR is a major therapeutic target. Here, we design peptides that target the dimer interface between the TS domains of bifunctional T. gondii TS-DHFR by mimicking β-strands at the interface, revealing a previously unknown allosteric target. The current study shows that these β-strand mimetic peptides bind to the apo-enzyme in a species-selective manner to inhibit both the TS and distal DHFR. Fluorescence spectroscopy was used to monitor conformational switching of the TS domain and demonstrate that these peptides induce a conformational change in the enzyme. Using structure-guided mutagenesis, nonconserved residues in the linker between TS and DHFR were identified that play a key role in domain-domain communication and in peptide inhibition of the DHFR domain. These studies validate allosteric inhibition of apo-TS, specifically at the TS-TS interface, as a potential target for novel, species-specific therapeutics for treating T. gondii parasitic infections and overcoming drug resistance. © 2013 The Protein Society.

  15. The Chinese Hamster Dihydrofolate Reductase Replication Origin Decision Point Follows Activation of Transcription and Suppresses Initiation of Replication within Transcription Units

    PubMed Central

    Sasaki, Takayo; Ramanathan, Sunita; Okuno, Yukiko; Kumagai, Chiharu; Shaikh, Seemab S.; Gilbert, David M.

    2006-01-01

    Chinese hamster ovary (CHO) cells select specific replication origin sites within the dihydrofolate reductase (DHFR) locus at a discrete point during G1 phase, the origin decision point (ODP). Origin selection is sensitive to transcription but not protein synthesis inhibitors, implicating a pretranslational role for transcription in origin specification. We have constructed a DNA array covering 121 kb surrounding the DHFR locus, to comprehensively investigate replication initiation and transcription in this region. When nuclei isolated within the first 3 h of G1 phase were stimulated to initiate replication in Xenopus egg extracts, replication initiated without any detectable preference for specific sites. At the ODP, initiation became suppressed from within the Msh3, DHFR, and 2BE2121 transcription units. Active transcription was mostly confined to these transcription units, and inhibition of transcription by alpha-amanitin resulted in the initiation of replication within transcription units, indicating that transcription is necessary to limit initiation events to the intergenic region. However, the resumption of DHFR transcription after mitosis took place prior to the ODP and so is not on its own sufficient to suppress initiation of replication. Together, these results demonstrate a remarkable flexibility in sequence selection for initiating replication and implicate transcription as one important component of origin specification at the ODP. PMID:16428457

  16. Study of reactivity of cyanoacetohydrazonoethyl-N-ethyl-N-methyl benzenesulfonamide: preparation of novel anticancer and antimicrobial active heterocyclic benzenesulfonamide derivatives and their molecular docking against dihydrofolate reductase.

    PubMed

    Debbabi, Khaled F; Al-Harbi, Sami A; Al-Saidi, Hamed M; Aljuhani, Enas H; Abd El-Gilil, Shimaa M; Bashandy, Mahmoud S

    2016-01-01

    This article describes the synthesis of some novel heterocyclic sulfonamides having biologically active thiophene 3, 4, 5, 6, coumarin 8, benzocoumarin 9, thiazole 7, piperidine 10, pyrrolidine 11, pyrazole 14 and pyridine 12, 13. Starting with 4-(1-(2-(2-cyanoacetyl)hydrazono)ethyl)-N-ethyl-N-methylbenzenesulfonamide (2), which was prepared from condensation of acetophenone derivative 1 with 2-cyanoacetohydrazide. The structures of the newly synthesized compounds were confirmed by elemental analysis, IR, (1)H NMR, (13)C NMR, (19)F NMR and MS spectral data. All the newly synthesized heterocyclic sulfonamides were evaluated as in-vitro anti-breast cancer cell line (MCF7) and as in-vitro antimicrobial agents. Compounds 8, 5 and 11 were more active than MTX reference drug and compounds 12, 7, 4, 14, 5 and 8 were highly potent against Klebsiella pneumonia. Molecular operating environment performed virtual screening using molecular docking studies of the synthesized compounds. The results indicated that some prepared compounds are suitable inhibitor against dihydrofolate reductase (DHFR) enzyme (PDBSD:4DFR) with further modification.

  17. A search for sources of drug resistance by the 4D-QSAR analysis of a set of antimalarial dihydrofolate reductase inhibitors

    NASA Astrophysics Data System (ADS)

    Santos-Filho, Osvaldo Andrade; Hopfinger, Anton J.

    2001-01-01

    A set of 18 structurally diverse antifolates including pyrimethamine, cycloguanil, methotrexate, aminopterin and trimethoprim, and 13 pyrrolo[2,3-d]pyrimidines were studied using four-dimensional quantitative structure-activity relationship (4D-QSAR) analysis. The corresponding biological activities of these compounds include IC50 inhibition constants for both the wild type, and a specific mutant type of Plasmodium falciparum dihydrofolate reductase (DHFR). Two thousand conformations of each analog were sampled to generate a conformational ensemble profile (CEP) from a molecular dynamics simulation (MDS) of 100,000 conformer trajectory states. Each sampled conformation was placed in a 1 Å cubic grid cell lattice for each of five trial alignments. The frequency of occupation of each grid cell was computed for each of six types of pharmacophore groups of atoms of each compound. These grid cell occupancy descriptors (GCODs) were then used as a descriptor pool to construct 4D-QSAR models. Models for inhibition of both the `wild' type and the mutant enzyme were generated which provide detailed spatial pharmacophore requirements for inhibition in terms of atom types and their corresponding relative locations in space. The 4D-QSAR models indicate some structural features perhaps relevant to the mechanism of resistance of the Plasmodium falciparum DHFR to current antimalarials. One feature identified is a slightly different binding alignment of the ligands to the mutant form of the enzyme as compared to the wild type.

  18. Orientation and structure-building role of the water molecules bound at the contact surface of the dihydrofolate reductase-methotrexate complex

    NASA Astrophysics Data System (ADS)

    Nagy, P.

    1988-04-01

    Orientation of ten water molecules bound strongly at the contact surface of the dihydrofolate reductase-methotrexate enzyme-inhibitor complex was determined theoretically. To optimize the orientation of the water molecules, a recent method based on a simple electrostatic model was applied. The electrostatic complementarity in the binary complex was investigated using the lock-and-key model, considering the effect of the water molecules as well. The strongly bound water molecules improve the electrostatic fit in the pteridine region of methotrexate. Their role in the benzoic amide and γ-glutamate region is to decrease the internal energy by creating water bridges among remote polar sites making it possible to form H-bonds. Some modifications in the inhibitor structure were proposed for achieving greater inhibitor potency. The presumably enhanced effect is ascribed to the free energy gain in repelling the water molecules from the contact surface to the bulk of the solvent, and, in other cases, to internal energy decreases due to better electrostatic fit in the enzyme-inhibitor complex.

  19. Short hairpin RNA targeted to dihydrofolate reductase enhances the immunoglobulin G expression in gene-amplified stable Chinese hamster ovary cells.

    PubMed

    Wu, Suh-Chin; Hong, Willy W L; Liu, Jin-Hwang

    2008-09-08

    The dihydrofolate reductase (dhfr)/methotrexate (MTX) selection is a common method to conduct gene amplification in stable clones of Chinese hamster ovary (CHO) cells. We previously reported the use of a short hairpin RNA (shRNA) vector targeted to the dhfr gene resulted in improving the intracellular antigen expression in gene-amplified stable CHO cells [Hong, W.W., Wu, S.C., 2007. A novel RNA silencing vector to improve antigen expression and stability in Chinese hamster ovary cells. Vaccine 25 (20), 4103-4111]. Here we investigated the use of the dhfr-targeted shRNA vector for immunoglobulin G (IgG) expression in gene-amplified stable CHO cells. With the use of the dhfr-targeted shRNA vector, the gene-amplified CHO/dhFr(-) cells were found to increase IgG expression at 1.0 microM MTX by more than 100% and to improve the genomic stability of IgG expression in MTX-free cultures by approximately 30%. The use of the dhfr-targeted shRNA vector can enhance the IgG expression in the gene-amplified stable CHO cells and uphold the IgG expression in MTX-free cultures. Utilizing the dhfr-targeted shRNA vector may provide an alternative way to maneuver CHO cell factories for IgG production in cultures.

  20. Towards understanding the origins of the different specificities of binding the reduced (NADPH) and oxidised (NADP +) forms of nicotinamide adenine dinucleotide phosphate coenzyme to dihydrofolate reductase

    NASA Astrophysics Data System (ADS)

    Polshakov, Vladimir I.; Biekofsky, Rodolfo R.; Birdsall, Berry; Feeney, James

    2002-01-01

    Lactobacillus casei dihydrofolate reductase (DHFR) binds more than a thousand times tighter to NADPH than to NADP +. The origins of the difference in binding affinity to DHFR between NADPH and NADP + are investigated in the present study using experimental NMR data and hybrid density functional, B3LYP, calculations. Certain protein residues (Ala 6, Gln 7, Ile 13 and Gly 14) that are directly involved in hydrogen bonding with the nicotinamide carboxamide group show consistent differences in 1H and 15N chemical shift between NADPH and NADP + in a variety of ternary complexes. B3LYP calculations in model systems of protein-coenzyme interactions show differences in the H-bond geometry and differences in charge distribution between the oxidised and reduced forms of the nicotinamide ring. GIAO isotropic nuclear shieldings calculated for nuclei in these systems reproduce the experimentally observed trends in magnitudes and signs of the chemical shifts. The experimentally observed reduction in binding of NADP + compared with NADPH results partly from NADP + having to change its nicotinamide amide group from a cis- to a trans-conformation on binding and partly from the oxidised nicotinamide ring of NADP + being unable to take up its optimal hydrogen bonding geometry in its interactions with protein residues.

  1. Use of bacterial surrogates as a tool to explore antimalarial drug interaction: Synergism between inhibitors of malarial dihydrofolate reductase and dihydropteroate synthase.

    PubMed

    Talawanich, Yuwadee; Kamchonwongpaisan, Sumalee; Sirawaraporn, Worachart; Yuthavong, Yongyuth

    2015-09-01

    Interaction between antimalarial drugs is important in determining the outcome of chemotherapy using drug combinations. Inhibitors of dihydrofolate reductase (DHFR) such as pyrimethamine and of dihydropteroate synthase (DHPS) such as sulfa drugs are known to have synergistic interactions. However, studies of the synergism are complicated by the fact that the malaria parasite can also salvage exogenous folates, and the salvage may also be affected by the drugs. It is desirable to have a convenient system to study interaction of DHFR and DHPS inhibitors without such complications. Here, we describe the use of Escherichia coli transformed with malarial DHFR and DHPS, while its own corresponding genes have been inactivated by optimal concentration of trimethoprim and genetic knockout, respectively, to study the interaction of the inhibitors. Marked synergistic effects are observed for all combinations of pyrimethamine and sulfa inhibitors in the presence of trimethoprim. At 0.05μM trimethoprim, sum of fractional inhibitory concentrations, ΣFIC of pyrimethamine with sulfadoxine, pyrimethamine with sulfathiazole, pyrimethamine with sulfamethoxazole, and pyrimethamine with dapsone are in the range of 0.24-0.41. These results show synergism between inhibitors of the two enzymes even in the absence of folate transport and uptake. This bacterial surrogate system should be useful as a tool for assessing the interactions of drug combinations between the DHFR and DHPS inhibitors.

  2. Prevailing Plasmodium falciparum dihydrofolate reductase 108-asparagine in Hodeidah, Yemen: a questionable sulfadoxine-pyrimethamine partner within the artemisinin-based combination therapy.

    PubMed

    Abdul-Ghani, Rashad; Farag, Hoda F; Allam, Amal F; Shawky, Sherine M

    2014-04-01

    Given that the evolution and spread of resistance to sulfadoxine-pyrimethamine (SP) have been documented at a quick pace worldwide, the present study investigated the mutant Plasmodium falciparum dihydrofolate reductase 108-asparagine (dhfr 108 N) as a key marker of resistance to the combination among parasite isolates from Hodeidah. The association of parasitologic indices with the dhfr 108 N mutant allele was also studied. Ninety patients with microscopically confirmed P. falciparum infection from Hodeidah were included in the present study. Polymerase chain reaction-restriction fragment length polymorphism approach was adopted for the molecular detection of this marker. The dhfr 108 N was detected among about 61% of P. falciparum isolates, in its pure and mixed-type forms, from Hodeidah. Age, gender and residence of patients were not significant predictors for the presence of the mutant allele among parasite isolates. In contrast, a history of malaria and antimalarial drug intake in the year preceding the study as well as frequent antimalarial drug intake were significantly associated with this mutant allele. The high frequency of dhfr 108 N among parasites isolates makes the role of SP questionable as a partner with outstanding effectiveness within the ACT, at least, in the near future. SP plus artesunate should be monitored for its antimalarial efficacy at regular intervals, preferably through the molecular detection of resistance-associated mutations. Copyright © 2014 Elsevier B.V. All rights reserved.

  3. Dihydrofolate Reductase Deficiency Due to a Homozygous DHFR Mutation Causes Megaloblastic Anemia and Cerebral Folate Deficiency Leading to Severe Neurologic Disease

    PubMed Central

    Cario, Holger; Smith, Desirée E.C.; Blom, Henk; Blau, Nenad; Bode, Harald; Holzmann, Karlheinz; Pannicke, Ulrich; Hopfner, Karl-Peter; Rump, Eva-Maria; Ayric, Zuleya; Kohne, Elisabeth; Debatin, Klaus-Michael; Smulders, Yvo; Schwarz, Klaus

    2011-01-01

    The importance of intracellular folate metabolism is illustrated by the severity of symptoms and complications caused by inborn disorders of folate metabolism or by folate deficiency. We examined three children of healthy, distantly related parents presenting with megaloblastic anemia and cerebral folate deficiency causing neurologic disease with atypical childhood absence epilepsy. Genome-wide homozygosity mapping revealed a candidate region on chromosome 5 including the dihydrofolate reductase (DHFR) locus. DHFR sequencing revealed a homozygous DHFR mutation, c.458A>T (p.Asp153Val), in all siblings. The patients' folate profile in red blood cells (RBC), plasma, and cerebrospinal fluid (CSF), analyzed by liquid chromatography tandem mass spectrometry, was compatible with DHFR deficiency. DHFR activity and fluorescein-labeled methotrexate (FMTX) binding were severely reduced in EBV-immortalized lymphoblastoid cells of all patients. Heterozygous cells displayed intermediate DHFR activity and FMTX binding. RT-PCR of DHFR mRNA revealed no differences between wild-type and DHFR mutation-carrying cells, whereas protein expression was reduced in cells with the DHFR mutation. Treatment with folinic acid resulted in the resolution of hematological abnormalities, normalization of CSF folate levels, and improvement of neurological symptoms. In conclusion, the homozygous DHFR mutation p.Asp153Val causes DHFR deficiency and leads to a complex hematological and neurological disease that can be successfully treated with folinic acid. DHFR is necessary for maintaining sufficient CSF and RBC folate levels, even in the presence of adequate nutritional folate supply and normal plasma folate. PMID:21310277

  4. Design, Synthesis, and X-ray Crystal Structures of 2,4-Diaminofuro[2,3-d]pyrimidines as Multireceptor Tyrosine Kinase and Dihydrofolate Reductase Inhibitors

    PubMed Central

    Gangjee, Aleem; Li, Wei; Lin, Lu; Zeng, Yibin; Ihnat, Michael; Warnke, Linda A.; Green, Dixy W.; Cody, Vivian; Pace, Jim; Queener, Sherry F.

    2009-01-01

    To optimize dual receptor tyrosine kinase (RTK) and dihydrofolate reductase (DHFR) inhibition, the E- and Z-isomers of 5-[2-(2-methoxyphenyl)prop-1-en-1-yl]furo[2,3-d]pyrimidine-2,4-diamines (1a and 1b) were separated by HPLC and the X-ray crystal structures (2.0 Å and 1.4 Å respectively) with mouse DHFR and NADPH as well as 1b with human DHFR (1.5 Å) were determined. The E- and Z-isomers adopt different binding modes when bound to mouse DHFR. A series of 2,4-diaminofuro[2,3-d]pyrimidines 2–13 were designed and synthesized using the X-ray crystal structures of 1a and 1b with DHFR to increase their DHFR inhibitory activity. Wittig reactions of appropriate 2-methoxyphenyl ketones with 2,4-diamino-6-chloromethyl furo[2,3-d]pyrimidine afforded the C8–C9 unsaturated compounds 2–7 and catalytic reduction gave the saturated 8–13. Homologation of the C9-methyl analog maintains DHFR inhibitory activity. In addition, inhibition of EGFR and PDGFR-β were discovered for saturated C9-homologated analogs 9 and 10 that were absent in the saturated C9-methyl analogs. PMID:19748785

  5. Synthesis and antiproliferative activity of a series of novel 6-substituted pyrido[3,2-d]pyrimidines as potential nonclassical lipophilic antifolates targeting dihydrofolate reductase.

    PubMed

    Wang, Meng; Yang, Jiajia; Yuan, Mengmeng; Xue, Liangmin; Li, Hao; Tian, Chao; Wang, Xiaowei; Liu, Junyi; Zhang, Zhili

    2017-03-10

    Dihydrofolate reductase (DHFR) has been a well-recognized target for the treatment of many diseases. Based on 8,10-dideazaminopterins, which are classical antifolates that potently inhibit DHFR, we have designed a series of novel 2,4-diamino-6-substituted pyrido[3,2-d]pyrimidines. By removing the glutamate moiety and introducing lipophilic groups, we hoped to improve passive diffuse through the cell membranes. The target compounds were efficiently synthesized using one-pot procedure and evaluated in vitro for DHFR inhibition and antitumor activity. Compounds 5e, 5h, 5i and 5k were the most potent inhibitors of recombinant human DHFR (rhDHFR) with IC50 values in the range 0.2-1.0 μM. Analysis using flow cytometric indicated that the effect of compound 5k on cell cycle progression was linked to induction of S phase arrest. Compounds 5g, 5h, 5i and 5k showed broad spectrum antitumor activity against four different tumor cell lines, with IC50 values in the range 0.07-23 μM. Molecular docking investigations showed that the trimethoyphenyl ring of compound 5k occupied a position near the cofactor-binding site in the rhDHFR-inhibitor complex, with close intermolecular contacts with Asp21, Phe31, Ser59, Ile60 and Pro61. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  6. Molecular epidemiology of malaria in Cameroon. XI. Geographic distribution of Plasmodium falciparum isolates with dihydrofolate reductase gene mutations in southern and central Cameroon.

    PubMed

    Basco, Leonardo K; Ndounga, Mathieu; Tejiokem, Mathurin; Ngane, Vincent Foumane; Youmba, Jean-Christian; Ringwald, Pascal; Soula, Georges

    2002-10-01

    The DNA sequence of the dihydrofolate reductase (dhfr) gene, a molecular marker for pyrimethamine resistance, was determined for 178 field isolates of Plasmodium falciparum collected along the east-west axis in southern Cameroon. The proportion of isolates having the wild-type dhfr allele varied from 48.1% in the east (city of Bertoua) to 11.3-15.7% in central provinces (Yaounde and Eseka) and 0% in the littoral region (port city of Douala). Isolates with a single Asn-108 mutation or double mutations (Ile-51 or Arg-59 and Asn-108) constituted approximately 10% of the samples. Isolates with triple mutations (Ile-51, Arg-59, and Asn-108) were present in an equal proportion (48.1%) as the wild-type isolates in the east (Bertoua), while triple mutations predominated in Yaounde (62.3%), Eseka (62.7%), and Douala (78.9%). The distribution of triple dhfr mutations along the east-west axis in southern Cameroon suggests the presence of a decreasing gradient from the west coastal region to the central region and then to the east towards the interior of the country.

  7. [Gene polymorphisms in the dihydrofolate reductase ( dhfr ) and dihydropteroate synthase ( dhps ) genes and structural modelling of the dhps gene in Colombian isolates of Toxoplasma gondii].

    PubMed

    Cortés, Liliana Jazmín; Duque, Sofía; López, Miryam Consuelo; Moncada, Diego; Molina, Diego; Gómez-Marín, Jorge Enrique; Gunturiz, María Luz

    2014-01-01

    There are no reports describing polymorphisms in target genes of anti- Toxoplasma drugs in South American isolates. This study sought to perform cloning and sequencing of the dihydrofolate reductase ( dhfr ) and dihydropteroate-synthase ( dhps ) genes of the reference Rh strain and two Colombian isolates of Toxoplasma gondii . Two isolates were obtained from the cerebrospinal fluid of HIV-infected patients with cerebral toxoplasmosis. A DNA extraction technique and PCR assay for the dhfr and dhps genes were standardized, and the products of amplification were cloned into Escherichia coli and sequenced. One polymorphism (A « G) was found at position 235 of exon 2 in the dhps gene. In addition, two polymorphisms (G « C) at positions 259 and 260 and one polymorphism (T « G) at position 371 within exon 4 of the dhps gene were detected. In this last exon, a bioinformatic analysis revealed a non-synonymous polymorphism in the coding region that could lead to the substitution of Glu (CAA or CAG) for His (encoded by codons AAU or AAC). A structural model of the T. gondii DHPS protein was calculated, and the results revealed modifications in secondary structure due to mutations. The methods described in this study can be used as a tool to search for polymorphisms in samples from patients with different clinical manifestations of toxoplasmosis and to examine their relationship with the therapeutic response.

  8. Cyclophilin-promoted folding of mouse dihydrofolate reductase does not include the slow conversion of the late-folding intermediate to the active enzyme.

    PubMed

    von Ahsen, O; Lim, J H; Caspers, P; Martin, F; Schönfeld, H J; Rassow, J; Pfanner, N

    2000-03-31

    Cyclophilins accelerate slow protein folding reactions in vitro by catalyzing the cis/trans isomerization of peptidyl-prolyl bonds. Cyclophilins were reported to be involved in a variety of cellular functions, including the promotion of protein folding by use of the substrate mouse dihydrofolate reductase (DHFR). The interaction of cyclophilin with DHFR has only been studied under limited conditions so far, not taking into account that native DHFR exists in equilibrium with a non-native late-folding intermediate. Here we report a systematic analysis of catalysis of DHFR folding by cyclophilins. The specific ligand methotrexate traps DHFR in its native state, permitting a specific analysis of the action of cyclophilin on both denatured DHFR with non-native prolyl bonds and denatured DHFR with all-native prolyl bonds. Cyclophilins from yeast and Neurospora crassa as well as the related prolyl isomerase b from Escherichia coli promote the folding of different forms of DHFR to the enzymatically active form, demonstrating the generality of cyclophilin-catalyzed folding of DHFR. The slow equilibrium between the late-folding intermediate and native DHFR suggests that prolyl isomerization may be required for this final phase of conversion to native DHFR. However, by reversible trapping of the intermediate, we analyze the slow interconversion between native and late-folding conformations in the backward and forward reactions and show a complete independence of cyclophilin. We conclude that cyclophilin catalyzes folding of DHFR, but surprisingly not in the last slow folding step. Copyright 2000 Academic Press.

  9. Particular interaction between pyrimethamine derivatives and quadruple mutant type dihydrofolate reductase of Plasmodium falciparum: CoMFA and quantum chemical calculations studies.

    PubMed

    Maitarad, Phornphimon; Saparpakorn, Patchreenart; Hannongbua, Supa; Kamchonwongpaisan, Sumalee; Tarnchompoo, Bongkoch; Yuthavong, Yongyuth

    2009-04-01

    Comparative molecular field analysis (CoMFA) was performed on twenty-three pyrimethamine (pyr) derivatives active against quadruple mutant type (Asn51Ile, Cys59Arg, Ser108Asn, Ile164Leu) dihydrofolate reductase of Plasmodium falcipaarum (PfDHFR). The represented CoMFA models were evaluated based on the various three different probe atoms, C(sp3) (+1), O(sp3) (-1) and H (+1), resulting in the best model with combined three types of probe atoms. The statistical results were r(2)(cv) = 0.702, S(press) = 0.608, r(2)(nv) = 0.980, s = 0.156, and r(2)(test-set) = 0.698 which can explain steric contribution of about 50%. In addition, an understanding of particular interaction energy between inhibitor and surrounding residues in the binding pocket was performed by using MP2/6-31G(d,p) quantum chemical calculations. The obtained results clearly demonstrate that Asn108 is the cause of pyr resistance with the highest repulsive interaction energy. Therefore, CoMFA and particular interaction energy analyses can be useful for identifying the structural features of potent pyr derivatives active against quadruple mutant type PfDHFR.

  10. Increased incidence of cycloguanil resistance in malaria cases entering France from Africa, determined as point mutations in the parasites' dihydrofolate-reductase genes.

    PubMed

    Durand, R; di Piazza, J P; Longuet, C; Sécardin, Y; Clain, J; le Bras, J

    1999-01-01

    The incidence of cycloguanil resistance in 501 Plasmodium falciparum isolates from individuals entering France from Africa was estimated by a method based on PCR-restriction-fragment-length polymorphisms. None of the subjects had taken antifol prophylaxis. Annual incidence of the resistance, detected as a point mutation at codon 108 in the parasite's dihydrofolate-reductase gene, increased from 19.8% in 1995 to 43.6% in 1997 (P < 0.001). The proportion of isolates found to be susceptible (i.e. wild-type) among travellers returning from the African countries known as Group 2 in France (i.e. Burkina Faso, Côte d'Ivoire, Gambia, Ghana, Guinea, Liberia, Madagascar, Mali, Mauritania, Niger, Senegal, Sierra Leone, Tchad and Togo) was reasonably high (62.9%) and much higher than in the other subjects returning from other identifiable countries in Africa (35.3%). The antimalarial prophylaxis recommended in France to those travelling to Group-2 countries, chloroquine-proguanil, therefore still seems reasonable, although cycloguanil resistance may seriously undermine the efficacy of this drug combination in the future.

  11. Nuclear magnetic resonance study of interaction of ligands with Streptococcus faecium dihydrofolate reductase labeled with (. gamma. -/sup 13/C)tryptophan

    SciTech Connect

    London, R.E.; Groff, J.P.; Cocco, L.; Blakley, R.L.

    1982-01-01

    Dihydrofolate reductase from Streptococcus faecium has been labeled with (..gamma..-/sup 13/C)tryptophan. We have determined changes occurring in the chemical shifts and line widths of the four resonances of the /sup 13/C NMR spectrum of the labeled enzyme, due to its interaction with various ligands. These include the coenzyme, NPDPH and related nucleotides, folate and its polyglutamate derivatives, and many inhibitors including methotrexate and trimethoprim. In addition, paramagnetic relaxation effects produced by a bound spin-labeled analogue of 2'-phosphoadenosine-5'-diphosphoribose on the tryptophan C/sup ..gamma../ carbons have been measured. Distances calculated from the relaxation data have been compared with corresponding distances in the crystallographic model of the NADPH-methotrexate ternary complex of Lactobacillus casei reductase. The paramagnetic relaxation data indicate that the two downfield resonances (1 and 2) correspond to tryptophans (W/sub A/ and W/sub B/) that are more remote from the catalytic site, and from the crystallographic model these are seen to be Trp-115 and Trp-160. The upfield resonances (3 and 4) that show broadening due to chemical exchange correspond to closer residues (W/sub C/ and W/sub D/), and these are identified with Trp-6 and Trp-22. However, the relaxation data do not permit specific assignments within the nearer and farther pairs. Although resonance 3, which is split due to chemical exchange, was formerly assigned to Trp-6, data obtained for the enzyme in the presence of various ligands are better interpreted if resonance 3 is assigned to Trp-22, which is located on a loop that joins elements of secondary structure and forms one side of the ligand-binding cavity.

  12. Trypanosoma brucei DHFR-TS Revisited: Characterisation of a Bifunctional and Highly Unstable Recombinant Dihydrofolate Reductase-Thymidylate Synthase

    PubMed Central

    Gibson, Marc W.; Dewar, Simon; Ong, Han B.; Sienkiewicz, Natasha

    2016-01-01

    Bifunctional dihydrofolate reductase–thymidylate synthase (DHFR-TS) is a chemically and genetically validated target in African trypanosomes, causative agents of sleeping sickness in humans and nagana in cattle. Here we report the kinetic properties and sensitivity of recombinant enzyme to a range of lipophilic and classical antifolate drugs. The purified recombinant enzyme, expressed as a fusion protein with elongation factor Ts (Tsf) in ThyA- Escherichia coli, retains DHFR activity, but lacks any TS activity. TS activity was found to be extremely unstable (half-life of 28 s) following desalting of clarified bacterial lysates to remove small molecules. Stability could be improved 700-fold by inclusion of dUMP, but not by other pyrimidine or purine (deoxy)-nucleosides or nucleotides. Inclusion of dUMP during purification proved insufficient to prevent inactivation during the purification procedure. Methotrexate and trimetrexate were the most potent inhibitors of DHFR (Ki 0.1 and 0.6 nM, respectively) and FdUMP and nolatrexed of TS (Ki 14 and 39 nM, respectively). All inhibitors showed a marked drop-off in potency of 100- to 1,000-fold against trypanosomes grown in low folate medium lacking thymidine. The most potent inhibitors possessed a terminal glutamate moiety suggesting that transport or subsequent retention by polyglutamylation was important for biological activity. Supplementation of culture medium with folate markedly antagonised the potency of these folate-like inhibitors, as did thymidine in the case of the TS inhibitors raltitrexed and pemetrexed. PMID:27175479

  13. Expression, Purification and Characterization of Recombinant Mouse Translation Initiation factor eIF-4E as a Dihydrofolate Reductase (DHFR) Fusion Protein

    PubMed Central

    Ghosh, Phalguni; Cheng, Jilin; Chou, Tsui-Fen; Jia, Yan; Avdulov, Svetlana; Bitterman, Peter B.; Polunovsky, Vitaly A.; Wagner, Carston R.

    2008-01-01

    One of the earliest steps in translation initiation is recognition of the mRNA cap structure (m7GpppX) by the initiation factor eIF4E. Studies of interactions between purified eIF4E and its binding partners provide important information for understanding mechanisms underlying translational control in normal and cancer cells. Numerous impediments of the available methods used for eIF4E purification led us to develop a novel methodology for obtaining fractions of eIF4E free from undesired by-products. Herein we report methods for bacterial expression of eIF4E tagged with mutant dihydrofolate reductase (DHFR) followed by isolation and purification of the DHFR-eIF4E protein by using affinity and anion-exchange chromatography. Fluorescence quenching experiments indicated the cap analogue, 7MeGTP, bound to DHFR-eIF4E and eIF4E with a dissociation constant (Kd) of 6±5 and 10±3 nM, respectively. Recombinant eIF4E and DHFR-eIF4E were both shown to significantly enhance in vitro translation in dose dependent manner by 75% at 0.5 uM. Nevertheless increased concentrations of eIF4E and DHFR-eIF4E significantly inhibited translation in a dose dependent manner by a maximum at 2 uM of 60% and 90%, respectively. Thus, we have demonstrated that we have developed an expression system for fully functional recombinant eIF4E. We have also shown that the fusion protein DHFR-eIF4E is functional and thus may be useful for cell based affinity tag studies with fluorescently labeled trimethoprim analogs. PMID:18479935

  14. Disagreement in genotyping results of drug resistance alleles of the Plasmodium falciparum dihydrofolate reductase (Pfdhfr) gene by allele-specific PCR (ASPCR) assays and Sanger sequencing.

    PubMed

    Sharma, Divya; Lather, Manila; Dykes, Cherry L; Dang, Amita S; Adak, Tridibes; Singh, Om P

    2016-01-01

    The rapid spread of antimalarial drug resistance in Plasmodium falciparum over the past few decades has necessitated intensive monitoring of such resistance for an effective malaria control strategy. P. falciparum dihydropteroate synthase (Pfdhps) and P. falciparum dihydrofolate reductase (Pfdhfr) genes act as molecular markers for resistance against the antimalarial drugs sulphadoxine and pyrimethamine, respectively. Resistance to pyrimethamine which is used as a partner drug in artemisinin combination therapy (ACT) is associated with several mutations in the Pfdhfr gene, namely A16V, N51I, C59R, S108N/T and I164L. Therefore, routine monitoring of Pfdhfr-drug-resistant alleles in a population may help in effective drug resistance management. Allele-specific PCR (ASPCR) is one of the commonly used methods for molecular genotyping of these alleles. In this study, we genotyped 55 samples of P. falciparum for allele discrimination at four codons of Pfdhfr (N51, C59, S108 and I164) by ASPCR using published methods and by Sanger's DNA sequencing method. We found that the ASPCR identified a significantly higher number of mutant alleles as compared to the DNA sequencing method. Such discrepancies arise due to the non-specificity of some of the allele-specific primer sets and due to the lack of sensitivity of Sanger's DNA sequencing method to detect minor alleles present in multiple clone infections. This study reveals the need of a highly specific and sensitive method for genotyping and detecting minor drug-resistant alleles present in multiple clonal infections.

  15. Site-specific bioconjugation of a murine dihydrofolate reductase enzyme by copper(I)-catalyzed azide-alkyne cycloaddition with retained activity.

    PubMed

    Lim, Sung In; Mizuta, Yukina; Takasu, Akinori; Kim, Yong Hwan; Kwon, Inchan

    2014-01-01

    Cu(I)-catalyzed azide-alkyne cycloaddition (CuAAC) is an efficient reaction linking an azido and an alkynyl group in the presence of copper catalyst. Incorporation of a non-natural amino acid (NAA) containing either an azido or an alkynyl group into a protein allows site-specific bioconjugation in mild conditions via CuAAC. Despite its great potential, bioconjugation of an enzyme has been hampered by several issues including low yield, poor solubility of a ligand, and protein structural/functional perturbation by CuAAC components. In the present study, we incorporated an alkyne-bearing NAA into an enzyme, murine dihydrofolate reductase (mDHFR), in high cell density cultivation of Escherichia coli, and performed CuAAC conjugation with fluorescent azide dyes to evaluate enzyme compatibility of various CuAAC conditions comprising combination of commercially available Cu(I)-chelating ligands and reductants. The condensed culture improves the protein yield 19-fold based on the same amount of non-natural amino acid, and the enzyme incubation under the optimized reaction condition did not lead to any activity loss but allowed a fast and high-yield bioconjugation. Using the established conditions, a biotin-azide spacer was efficiently conjugated to mDHFR with retained activity leading to the site-specific immobilization of the biotin-conjugated mDHFR on a streptavidin-coated plate. These results demonstrate that the combination of reactive non-natural amino acid incorporation and the optimized CuAAC can be used to bioconjugate enzymes with retained enzymatic activity.

  16. Site-Specific Bioconjugation of a Murine Dihydrofolate Reductase Enzyme by Copper(I)-Catalyzed Azide-Alkyne Cycloaddition with Retained Activity

    PubMed Central

    Lim, Sung In; Mizuta, Yukina; Takasu, Akinori; Kim, Yong Hwan; Kwon, Inchan

    2014-01-01

    Cu(I)-catalyzed azide-alkyne cycloaddition (CuAAC) is an efficient reaction linking an azido and an alkynyl group in the presence of copper catalyst. Incorporation of a non-natural amino acid (NAA) containing either an azido or an alkynyl group into a protein allows site-specific bioconjugation in mild conditions via CuAAC. Despite its great potential, bioconjugation of an enzyme has been hampered by several issues including low yield, poor solubility of a ligand, and protein structural/functional perturbation by CuAAC components. In the present study, we incorporated an alkyne-bearing NAA into an enzyme, murine dihydrofolate reductase (mDHFR), in high cell density cultivation of Escherichia coli, and performed CuAAC conjugation with fluorescent azide dyes to evaluate enzyme compatibility of various CuAAC conditions comprising combination of commercially available Cu(I)-chelating ligands and reductants. The condensed culture improves the protein yield 19-fold based on the same amount of non-natural amino acid, and the enzyme incubation under the optimized reaction condition did not lead to any activity loss but allowed a fast and high-yield bioconjugation. Using the established conditions, a biotin-azide spacer was efficiently conjugated to mDHFR with retained activity leading to the site-specific immobilization of the biotin-conjugated mDHFR on a streptavidin-coated plate. These results demonstrate that the combination of reactive non-natural amino acid incorporation and the optimized CuAAC can be used to bioconjugate enzymes with retained enzymatic activity. PMID:24887377

  17. Structure-based approach to pharmacophore identification, in silico screening, and three-dimensional quantitative structure-activity relationship studies for inhibitors of Trypanosoma cruzi dihydrofolate reductase function

    SciTech Connect

    Schormann, N.; Senkovich, O.; Walker, K.; Wright, D.L.; Anderson, A.C.; Rosowsky, A.; Ananthan, S.; Shinkre, B.; Velu, S.; Chattopadhyay, D.

    2009-07-10

    We have employed a structure-based three-dimensional quantitative structure-activity relationship (3D-QSAR) approach to predict the biochemical activity for inhibitors of T. cruzi dihydrofolate reductase-thymidylate synthase (DHFR-TS). Crystal structures of complexes of the enzyme with eight different inhibitors of the DHFR activity together with the structure in the substrate-free state (DHFR domain) were used to validate and refine docking poses of ligands that constitute likely active conformations. Structural information from these complexes formed the basis for the structure-based alignment used as input for the QSAR study. Contrary to indirect ligand-based approaches the strategy described here employs a direct receptor-based approach. The goal is to generate a library of selective lead inhibitors for further development as antiparasitic agents. 3D-QSAR models were obtained for T. cruzi DHFR-TS (30 inhibitors in learning set) and human DHFR (36 inhibitors in learning set) that show a very good agreement between experimental and predicted enzyme inhibition data. For crossvalidation of the QSAR model(s), we have used the 10% leave-one-out method. The derived 3D-QSAR models were tested against a few selected compounds (a small test set of six inhibitors for each enzyme) with known activity, which were not part of the learning set, and the quality of prediction of the initial 3D-QSAR models demonstrated that such studies are feasible. Further refinement of the models through integration of additional activity data and optimization of reliable docking poses is expected to lead to an improved predictive ability.

  18. Structure-based approach to pharmacophore identification, in silico screening, and three-dimensional quantitative structure-activity relationship studies for inhibitors of Trypanosoma cruzi dihydrofolate reductase function.

    PubMed

    Schormann, N; Senkovich, O; Walker, K; Wright, D L; Anderson, A C; Rosowsky, A; Ananthan, S; Shinkre, B; Velu, S; Chattopadhyay, D

    2008-12-01

    We have employed a structure-based three-dimensional quantitative structure-activity relationship (3D-QSAR) approach to predict the biochemical activity for inhibitors of T. cruzi dihydrofolate reductase-thymidylate synthase (DHFR-TS). Crystal structures of complexes of the enzyme with eight different inhibitors of the DHFR activity together with the structure in the substrate-free state (DHFR domain) were used to validate and refine docking poses of ligands that constitute likely active conformations. Structural information from these complexes formed the basis for the structure-based alignment used as input for the QSAR study. Contrary to indirect ligand-based approaches the strategy described here employs a direct receptor-based approach. The goal is to generate a library of selective lead inhibitors for further development as antiparasitic agents. 3D-QSAR models were obtained for T. cruzi DHFR-TS (30 inhibitors in learning set) and human DHFR (36 inhibitors in learning set) that show a very good agreement between experimental and predicted enzyme inhibition data. For crossvalidation of the QSAR model(s), we have used the 10% leave-one-out method. The derived 3D-QSAR models were tested against a few selected compounds (a small test set of six inhibitors for each enzyme) with known activity, which were not part of the learning set, and the quality of prediction of the initial 3D-QSAR models demonstrated that such studies are feasible. Further refinement of the models through integration of additional activity data and optimization of reliable docking poses is expected to lead to an improved predictive ability.

  19. An Innovative Strategy for Dual Inhibitor Design and Its Application in Dual Inhibition of Human Thymidylate Synthase and Dihydrofolate Reductase Enzymes

    PubMed Central

    Arooj, Mahreen; Sakkiah, Sugunadevi; Cao, Guang ping; Lee, Keun Woo

    2013-01-01

    Due to the diligence of inherent redundancy and robustness in many biological networks and pathways, multitarget inhibitors present a new prospect in the pharmaceutical industry for treatment of complex diseases. Nevertheless, to design multitarget inhibitors is concurrently a great challenge for medicinal chemists. We have developed a novel computational approach by integrating the affinity predictions from structure-based virtual screening with dual ligand-based pharmacophore to discover potential dual inhibitors of human Thymidylate synthase (hTS) and human dihydrofolate reductase (hDHFR). These are the key enzymes in folate metabolic pathway that is necessary for the biosynthesis of RNA, DNA, and protein. Their inhibition has found clinical utility as antitumor, antimicrobial, and antiprotozoal agents. A druglike database was utilized to perform dual-target docking studies. Hits identified through docking experiments were mapped over a dual pharmacophore which was developed from experimentally known dual inhibitors of hTS and hDHFR. Pharmacophore mapping procedure helped us in eliminating the compounds which do not possess basic chemical features necessary for dual inhibition. Finally, three structurally diverse hit compounds that showed key interactions at both active sites, mapped well upon the dual pharmacophore, and exhibited lowest binding energies were regarded as possible dual inhibitors of hTS and hDHFR. Furthermore, optimization studies were performed for final dual hit compound and eight optimized dual hits demonstrating excellent binding features at target systems were also regarded as possible dual inhibitors of hTS and hDHFR. In general, the strategy used in the current study could be a promising computational approach and may be generally applicable to other dual target drug designs. PMID:23577115

  20. A 19-base pair deletion polymorphism in dihydrofolate reductase is associated with increased unmetabolized folic acid in plasma and decreased red blood cell folate.

    PubMed

    Kalmbach, Renee D; Choumenkovitch, Silvina F; Troen, Aron P; Jacques, Paul F; D'Agostino, Ralph; Selhub, Jacob

    2008-12-01

    Dihydrofolate reductase (DHFR) catalyzes the reduction of folic acid to tetrahydrofolate (THF). A 19-bp noncoding deletion allele maps to intron 1, beginning 60 bases from the splice donor site, and has been implicated in neural tube defects and cancer, presumably by influencing folate metabolism. The functional impact of this polymorphism has not yet been demonstrated. The objective of this research was to determine the effects of the DHFR mutation with respect to folate status and assess influence of folic acid intake on these relations. The relationship between DHFR genotype and plasma concentrations of circulating folic acid, total folate, total homocysteine, and concentrations of RBC folate was determined in 1215 subjects from the Framingham Offspring Study. There was a significant interaction between DHFR genotype and folic acid intake with respect to the prevalence of high circulating unmetabolized folic acid (defined as >85th percentile). Folic acid intake of >or=500 microg/d increased the prevalence of high circulating unmetabolized folic acid in subjects with the deletion (del/del genotype (47.0%) compared with the wild type (WT)/del (21.4%) and wild type (WT)/WT genotypes (24.4%) (P for interaction = 0.03). Interaction between the DHFR polymorphism and folic acid intake was also seen with respect to RBC folate (P for interaction = 0.01). When folic acid intake was <250 microg/d, the del/del genotype was associated with significantly lower RBC folate (732.3 nmol/L) compared with the WT/WT genotype (844.4 nmol/L). Our results suggest the del/del polymorphism in DHFR is a functional polymorphism, because it limits assimilation of folic acid into cellular folate stores at high and low folic acid intakes.

  1. Synthesis and molecular docking against dihydrofolate reductase of novel pyridin-N-ethyl-N-methylbenzenesulfonamides as efficient anticancer and antimicrobial agents

    NASA Astrophysics Data System (ADS)

    Debbabi, Khaled F.; Bashandy, Mahmoud S.; Al-Harbi, Sami A.; Aljuhani, Enas H.; Al-Saidi, Hamed M.

    2017-03-01

    This article describes the synthesis of some novel sulfonamides having biologically active pyridine 21-28. Starting with 4-(1-(2-(2-cyanoacetyl)hydrazono)ethyl)-N-ethyl-N-methylbenzenesulfonamide (2), which was prepared from condensation of acetophenone derivative 1 with 2-cyanoacetohydrazide. Interaction of compound 2 with different aldehydes namely 4-fluorobenzaldehyde, 4-hydroxybenzaldehyde and 4-N,N-dimethylbenzaldehyde afforded the corresponding hydrazono-ethyl-N-ethyl-N-methylbenzene sulfonamides 18-20 respectively, which when reacted with malononitrile and ethyl cyanoacetate afforded compounds 21-26 respectively. These compounds 21-26 can be prepared by another reaction route by interaction of compounds 2 with arylidine malononitrile and arylidine ethyl cyanoacetate in refluxing dioxane in the presence of trimethylamine as catalyst. Interaction of compound 2 with malononitrile and ethyl cyanoacetate afforded oxopyridine derivatives 27 and 28 respectively. All the new prepared compounds were evaluated for their antitumor activities against the cell lines MCF-7 in comparison with the reference drug Doxorubicin using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide (MTT) colorimetric assay. Compounds 25, 21, 23 with SI values of 9.72, 9.71, 8.81 respectively, exhibited better activity than doxorubicin (Dox) as a reference drug with SI value of 8.49. In addition, compounds 25, 27 and 22 exhibited anti-bacterial activity against gram-negative bacteria (Klebsiella pneumoniae) with inhibition zones 22.6, 20.3 and 19.3 mm respectively, which were more active than gentamicin as a reference drug with inhibition zone 17.3 mm. Molecular Operating Environment (MOE) performed virtual screening using molecular docking studies of the synthesized compounds. The results indicated that some synthesized compounds suitable inhibitor against dihydrofolate reductase (DHFR) enzyme (PDB SD: 4DFR) with further modification.

  2. Molecular dynamics of interactions between rigid and flexible antifolates and dihydrofolate reductase from pyrimethamine-sensitive and pyrimethamine-resistant Plasmodium falciparum.

    PubMed

    Mokmak, Wanwimon; Chunsrivirot, Surasak; Hannongbua, Supa; Yuthavong, Yongyuth; Tongsima, Sissades; Kamchonwongpaisan, Sumalee

    2014-10-01

    Currently, the usefulness of antimalarials such as pyrimethamine (PYR) is drastically reduced due to the emergence of resistant Plasmodium falciparum (Pf) caused by its dihydrofolate reductase (PfDHFR) mutations, especially the quadruple N51I/C59R/S108N/I164L mutations. The resistance was due to the steric conflict of PYR with S108N. WR99210 (WR), a dihydrotriazine antifolate with a flexible side chain that can avoid such conflict, can overcome this resistance through tight binding with the mutant. To understand factors contributing to different binding affinities of PYR/WR to the wild type (WT) and quadruple mutant (QM), we performed simulations on WR-WT, WR-QM, PYR-WT, and PYR-QM complexes and found that Ile14 and Asp54 were crucial for PYR/WR binding to PfDHFR due to strong hydrogen bonds. The quadruple mutations cause PYR to form, on average, fewer hydrogen bonds with Ile14 and Leu164, and to be displaced from its optimal orientation for Asp54 interaction. The predicted binding affinity ranking (WR-QM ≈ WR-WT ≈ PYR-WT > PYR-QM) reasonably agrees with the inhibition constant (K(i)) ranking. Our results reveal important residues for tight binding of PYR/WR to WT/QM, which may be used to evaluate the inhibition effectiveness of antimalarials and to provide fundamental information for designing new drugs effective against drug-resistant P. falciparum. © 2014 John Wiley & Sons A/S.

  3. Declining trend of Plasmodium falciparum dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) mutant alleles after the withdrawal of Sulfadoxine-Pyrimethamine in North Western Ethiopia.

    PubMed

    Tessema, Sofonias K; Kassa, Moges; Kebede, Amha; Mohammed, Hussein; Leta, Gemechu Tadesse; Woyessa, Adugna; Guma, Geremew Tasew; Petros, Beyene

    2015-01-01

    Antimalarial drug resistance is one of the major challenges in global efforts of malaria control and elimination. In 1998, chloroquine was abandoned and replaced with sulfadoxine/pyrimethamine, which in turn was replaced with artemether/lumefantrine for the treatment of uncomplicated falciparum malaria in 2004. Sulfadoxine/pyrimethamine resistance is associated with mutations in dihydrofolate reductase (Pfdhfr) and dihydropteroate synthase (Pfdhps) genes. The prevalence of mutation in Pfdhfr and Pfdhps genes were evaluated and compared for a total of 159 isolates collected in two different time points, 2005 and 2007/08, from Pawe hospital, in North Western Ethiopia. The frequency of triple Pfdhfr mutation decreased significantly from 50.8% (32/63) to 15.9% (10/63) (P<0.001), while Pfdhps double mutation remained high and changed only marginally from 69.2% (45/65) to 55.4% (40/65) (P = 0.08). The combined Pfdhfr/Pfdhps quintuple mutation, which is strongly associated with sulfadoxine/pyrimethamine resistance, was significantly decreased from 40.7% (24/59) to 13.6% (8/59) (P<0.0001). On the whole, significant decline in mutant alleles and re-emergence of wild type alleles were observed. The change in the frequency is explained by the reduction of residual drug-resistant parasites caused by the strong drug pressure imposed when sulfadoxine/pyrimethamine was the first-line drug, followed by lower fitness of these resistant parasites in the absence of drug pressure. Despite the decrease in the frequency of mutant alleles, higher percentages of mutation remain prevalent in the study area in 2007/08 in both Pfdhfr and Pfdhps genes. Therefore, further multi-centered studies in different parts of the country will be required to assess the re-emergence of sulfadoxine/pyrimethamine sensitive parasites and to monitor and prevent the establishment of multi drug resistant parasites in this region.

  4. Preliminary in vitro studies on two potent, water-soluble trimethoprim analogues with exceptional species selectivity against dihydrofolate reductase from Pneumocystis carinii and Mycobacterium avium.

    PubMed

    Forsch, Ronald A; Queener, Sherry F; Rosowsky, Andre

    2004-04-05

    2,4-Diamino-5-[3',4'-dimethoxy-5'-(5-carboxy-1-pentynyl)]benzylpyrimidine (6) and 2,4-diamino-5-[3',4'-dimethoxy-5'-(4-carboxyphenylethynyl)benzylpyrimidine (7) were synthesized from 2,4-diamino-5-(5'-iodo-3',4'-dimethoxybenzyl)pyrimidine (9) via a Sonogashira reaction with appropriate acetylenic esters followed by saponification, and were tested as inhibitors of dihydrofolate reductase (DHFR) from Pneumocystis carinii (Pc), Toxoplasma gondii (Tg), Mycobacterium avium (Ma), and rat in comparison with the widely used antibacterial agent 2,4-diamino-5-(3',4',5'-trimethoxybenzyl)pyrimidine (trimethoprim, TMP). The selectivity index (SI) for each compound was calculated by dividing its 50% inhibitory concentration (IC(50)) against rat DHFR by its IC(50) against Pc, Tg, or Ma DHFR. The IC(50) of 6 against Pc DHFR was 1.0 nM, with an SI of 5000. Compound 7 had an IC(50) of 8.2 nM against Ma DHFR, with an SI of 11000. By comparison, the IC(50) of TMP was 12000 nM against Pc, 300 nM against Ma, and 180000 against rat DHFR. The potency and selectivity values of 6 and 7 were not as high against Tg as they were against Pc or Ma DHFR, but nonetheless exceeded those of TMP. Because of the outstanding selectivity of 6 against Pc and of 7 against Ma DHFR, these novel analogues may be viewed as promising leads for further structure-activity optimization.

  5. Molecular epidemiology of malaria in Cameroon. XXVII. Clinical and parasitological response to sulfadoxine-pyrimethamine treatment and Plasmodium falciparum dihydrofolate reductase and dihydropteroate synthase alleles in Cameroonian children.

    PubMed

    Tahar, Rachida; Basco, Leonardo K

    2007-08-01

    The rapidly changing epidemiology of antifolate-resistant Plasmodium falciparum in Africa requires monitoring. The present study was designed to assess the degree of association between the clinical and parasitological response to sulfadoxine-pyrimethamine and allelic combinations of dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) genes. Of 357 children who completed the 14-day follow-up, an adequate clinical and parasitological response was observed in 316 patients (88.5%) and early and late failures occurred in 18 (5%) and 23 (6.4%, mostly due to recrudescence) patients, respectively. The majority of clinical isolates were characterized as "quadruple" (n=196, 55.2%; N51I-C59R-S108N in DHFR and A437G in DHPS) or "triple" mutants (n=97, 27.3%; N51I-C59R-S108N in DHFR and wild-type DHPS; S108N+N51I or C59R in DHFR and A437G in DHPS). Wild-type, single mutation, and double mutation were observed in 29, 20, and 13 parasites, respectively. The comparison of different sets of mutations and early or late failures did not reveal any molecular marker associated with treatment outcome when the follow-up period was limited to 14 days (P>0.05). In this study, the determination of dhfr-dhps genotypes was of limited value to predict the treatment outcome in individual patients, mostly due to few treatment failures and few wild-type haplotypes. Further monitoring will be required to define the relationship between clinical response to SP therapy and parasite genotypes in our epidemiological setting.

  6. Crystal Structures of Wild-type and Mutant Methicillin-resistant Staphylococcus aureus Dihydrofolate Reductase Reveal an Alternative Conformation of NADPH that may be Linked to Trimethoprim Resistance

    SciTech Connect

    Frey, K.; Liu, J; Lombardo, M; Bolstad, D; Wright, D; Anderson, A

    2009-01-01

    Both hospital- and community-acquired Staphylococcus aureus infections have become major health concerns in terms of morbidity, suffering and cost. Trimethoprim-sulfamethoxazole (TMP-SMZ) is an alternative treatment for methicillin-resistant S. aureus (MRSA) infections. However, TMP-resistant strains have arisen with point mutations in dihydrofolate reductase (DHFR), the target for TMP. A single point mutation, F98Y, has been shown biochemically to confer the majority of this resistance to TMP. Using a structure-based approach, we have designed a series of novel propargyl-linked DHFR inhibitors that are active against several trimethoprim-resistant enzymes. We screened this series against wild-type and mutant (F98Y) S. aureus DHFR and found that several are active against both enzymes and specifically that the meta-biphenyl class of these inhibitors is the most potent. In order to understand the structural basis of this potency, we determined eight high-resolution crystal structures: four each of the wild-type and mutant DHFR enzymes bound to various propargyl-linked DHFR inhibitors. In addition to explaining the structure-activity relationships, several of the structures reveal a novel conformation for the cofactor, NADPH. In this new conformation that is predominantly associated with the mutant enzyme, the nicotinamide ring is displaced from its conserved location and three water molecules complete a network of hydrogen bonds between the nicotinamide ring and the protein. In this new position, NADPH has reduced interactions with the inhibitor. An equilibrium between the two conformations of NADPH, implied by their occupancies in the eight crystal structures, is influenced both by the ligand and the F98Y mutation. The mutation induced equilibrium between two NADPH-binding conformations may contribute to decrease TMP binding and thus may be responsible for TMP resistance.

  7. An innovative strategy for dual inhibitor design and its application in dual inhibition of human thymidylate synthase and dihydrofolate reductase enzymes.

    PubMed

    Arooj, Mahreen; Sakkiah, Sugunadevi; Cao, Guang ping; Lee, Keun Woo

    2013-01-01

    Due to the diligence of inherent redundancy and robustness in many biological networks and pathways, multitarget inhibitors present a new prospect in the pharmaceutical industry for treatment of complex diseases. Nevertheless, to design multitarget inhibitors is concurrently a great challenge for medicinal chemists. We have developed a novel computational approach by integrating the affinity predictions from structure-based virtual screening with dual ligand-based pharmacophore to discover potential dual inhibitors of human Thymidylate synthase (hTS) and human dihydrofolate reductase (hDHFR). These are the key enzymes in folate metabolic pathway that is necessary for the biosynthesis of RNA, DNA, and protein. Their inhibition has found clinical utility as antitumor, antimicrobial, and antiprotozoal agents. A druglike database was utilized to perform dual-target docking studies. Hits identified through docking experiments were mapped over a dual pharmacophore which was developed from experimentally known dual inhibitors of hTS and hDHFR. Pharmacophore mapping procedure helped us in eliminating the compounds which do not possess basic chemical features necessary for dual inhibition. Finally, three structurally diverse hit compounds that showed key interactions at both active sites, mapped well upon the dual pharmacophore, and exhibited lowest binding energies were regarded as possible dual inhibitors of hTS and hDHFR. Furthermore, optimization studies were performed for final dual hit compound and eight optimized dual hits demonstrating excellent binding features at target systems were also regarded as possible dual inhibitors of hTS and hDHFR. In general, the strategy used in the current study could be a promising computational approach and may be generally applicable to other dual target drug designs.

  8. Changes in dihydrofolate reductase (DHFR) mRNA levels can account fully for changes in DHFR synthesis rates during terminal differentiation in a highly amplified myogenic cell line.

    PubMed Central

    Schmidt, E E; Merrill, G F

    1991-01-01

    Dihydrofolate reductase (DHFR) enzyme is preferentially synthesized in proliferative cells. A mouse muscle cell line resistant to 300 microM methotrexate was developed to investigate the molecular levels at which DHFR is down-regulated during myogenic withdrawal from the cell cycle. H- alpha R300T cells contained 540 copies of the endogenous DHFR gene and overexpressed DHFR mRNA and DHFR protein. Despite DHFR gene amplification, the cells remained diploid. As H- alpha R300T myoblasts withdrew from the cell cycle and committed to terminal differentiation, DHFR mRNA levels and DHFR synthesis rates decreased with closely matched kinetics. After 15 to 24 h, committed cells contained 5% the proliferative level of DHFR mRNA (80 molecules per committed cell) and synthesized DHFR protein at 6% the proliferative rate. At no point during the commitment process did the decrease in DHFR synthesis rate exceed the decrease in DHFR message. The decrease in DHFR mRNA levels during commitment was sufficient to account fully for the decrease in rates of DHFR synthesis. Furthermore, DHFR mRNA remained polysomal, and the average number of ribosomes per message remained constant (five to six ribosomes per DHFR mRNA). The constancy of polysome size, along with the uniform rate of DHFR synthesis per message, indicated that DHFR mRNA was efficiently translated in postreplicative cells. The results support a model wherein replication-dependent changes in DHFR synthesis rates are determined exclusively by changes in DHFR mRNA levels. Images PMID:2046674

  9. The Dihydrofolate Reductase 19 bp Polymorphism Is Not Associated with Biomarkers of Folate Status in Healthy Young Adults, Irrespective of Folic Acid Intake.

    PubMed

    Ozaki, Mari; Molloy, Anne M; Mills, James L; Fan, Ruzong; Wang, Yifan; Gibney, Eileen R; Shane, Barry; Brody, Lawrence C; Parle-McDermott, Anne

    2015-10-01

    Dihydrofolate reductase (DHFR) is essential for the conversion of folic acid to active folate needed for one-carbon metabolism. Common genetic variation within DHFR is restricted to the noncoding regions, and previous studies have focused on a 19 bp deletion/insertion polymorphism (rs70991108) within intron 1. Reports of an association between this polymorphism and blood folate biomarker concentrations are conflicting. In this study, we evaluated whether the DHFR 19 bp deletion/insertion polymorphism affects circulating folate biomarkers in, to our knowledge, the largest cohort to address this question to date. Healthy young Irish individuals (n = 2507) between 19 and 36 y of age were recruited between February 2003 and February 2004. Folic acid intake from supplements and fortified foods was assessed with the use of a customized food intake questionnaire. Concentrations of serum folate and vitamin B-12, red blood cell (RBC) folate, and plasma total homocysteine (tHcy) were measured. Data were analyzed with the use of linear regression models. Folic acid intake was positively associated with serum (P < 0.0001) and RBC (P = 0.0005) folate concentration and was inversely associated with plasma tHcy (P = 0.001) as expected. The DHFR 19 bp polymorphism was not significantly associated with either serum (P = 0.82) or RBC (P = 0.21) folate, or plasma tHcy (P = 0.20), even in those within the highest quintile of folic acid intake (>326 μg folic acid/d; P = 0.96). A nonsignificant trend toward lower RBC folate by genotype (P = 0.09) was observed in the lowest folic acid intake quintile (0-51 μg/d). In this cohort of healthy young individuals, the DHFR 19 bp deletion allele did not significantly affect circulating folate status, irrespective of folic acid intake. Our data rule out a strong functional effect from this polymorphism on blood folate concentrations. © 2015 American Society for Nutrition.

  10. A clinically-identified emergent source of antibiotic resistance: the integron-associated DfrB4, a previously uncharacterized member of the trimethoprim-resistant dihydrofolate reductase B family.

    PubMed

    Toulouse, Jacynthe L; Edens, Thaddeus J; Alejaldre, Lorea; Manges, Amee R; Pelletier, Joelle N

    2017-02-27

    Whole genome sequencing of trimethoprim-resistant E. coli clinical isolates has identified a member of the trimethoprim-resistant type II dihydrofolate reductase gene family (dfrB). The dfrB4 gene was located within a class I integron flanked by multiple resistance genes. This arrangement was previously reported in a 130.6 kb multi-resistance plasmid. The DfrB4 protein conferred a > 2,000-fold increased trimethoprim resistance upon overexpression in E. coli Our results are consistent with dfrB4 contributing to clinical trimethoprim resistance.

  11. Towards an understanding of the mechanism of pyrimethamine-sulfadoxine resistance in Plasmodium falciparum: genotyping of dihydrofolate reductase and dihydropteroate synthase of Kenyan parasites.

    PubMed

    Nzila, A M; Mberu, E K; Sulo, J; Dayo, H; Winstanley, P A; Sibley, C H; Watkins, W M

    2000-04-01

    The antifolate combination of pyrimethamine (PM) and sulfadoxine (SD) is the last affordable drug combination available for wide-scale treatment of falciparum malaria in Africa. Wherever this combination has been used, drug-resistant parasites have been selected rapidly. A study of PM-SD effectiveness carried out between 1997 and 1999 at Kilifi on the Kenyan coast has shown the emergence of RI and RII resistance to PM-SD (residual parasitemia 7 days after treatment) in 39 out of 240 (16.25%) patients. To understand the mechanism that underlies resistance to PM-SD, we have analyzed the dihydrofolate reductase (DHFR) and dihydropteroate synthase (DHPS) genotypes of 81 patients. Fifty-one samples were obtained, before treatment, from patients who remained parasite free for at least 7 days after treatment. For a further 20 patients, samples were obtained before treatment and again when they returned to the clinic with parasites 7 days after PM-SD treatment. Ten additional isolates were obtained from patients who were parasitemic 7 days after treatment but who were not sampled before treatment. More than 65% of the isolates (30 of 46) in the initial group had wild-type or double mutant DHFR alleles, and all but 7 of the 47 (85%) had wild-type DHPS alleles. In the paired (before and after treatment) samples, the predominant combinations of DHFR and DHPS alleles before treatment were of triple mutant DHFR and double mutant DHPS (41% [7 of 17]) and of double mutant DHFR and double mutant DHPS (29% [5 of 17]). All except one of the posttreatment isolates had triple mutations in DHFR, and most of these were "pure" triple mutants. In these isolates, the combination of a triple mutant DHFR and wild-type DHPS was detected in 6 of 29 cases (20.7%), the combination of a triple mutant DHFR and a single mutant (A437G) DHPS was detected in 4 of 29 cases (13.8%), and the combination of a triple mutant DHFR and a double mutant (A437G, L540E) DHPS was detected in 16 of 29 cases (55

  12. Anti-folate drug resistance in Africa: meta-analysis of reported dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) mutant genotype frequencies in African Plasmodium falciparum parasite populations.

    PubMed

    Sridaran, Sankar; McClintock, Shannon K; Syphard, Luke M; Herman, Karen M; Barnwell, John W; Udhayakumar, Venkatachalam

    2010-08-30

    Mutations in the dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) genes of Plasmodium falciparum are associated with resistance to anti-folate drugs, most notably sulphadoxine-pyrimethamine (SP). Molecular studies document the prevalence of these mutations in parasite populations across the African continent. However, there is no systematic review examining the collective epidemiological significance of these studies. This meta-analysis attempts to: 1) summarize genotype frequency data that are critical for molecular surveillance of anti-folate resistance and 2) identify the specific challenges facing the development of future molecular databases. This review consists of 220 studies published prior to 2009 that report the frequency of select dhfr and dhps mutations in 31 African countries. Maps were created to summarize the location and prevalence of the highly resistant dhfr triple mutant (N51I, C59R, S108N) genotype and dhps double mutant (A437G and K540E) genotype in Africa. A hierarchical mixed effects logistic regression was used to examine the influence of various factors on reported mutant genotype frequency. These factors include: year and location of study, age and clinical status of sampled population, and reporting conventions for mixed genotype data. A database consisting of dhfr and dhps mutant genotype frequencies from all African studies that met selection criteria was created for this analysis. The map illustrates particularly high prevalence of both the dhfr triple and dhps double mutant genotypes along the Kenya-Tanzania border and Malawi. The regression model shows a statistically significant increase in the prevalence of both the dhfr triple and dhps double mutant genotypes in Africa. Increasing prevalence of the dhfr triple mutant and dhps double mutant genotypes in Africa are consistent with the loss of efficacy of SP for treatment of clinical malaria in most parts of this continent. Continued assessment of the effectiveness

  13. Structure-based design of selective inhibitors of dihydrofolate reductase: synthesis and antiparasitic activity of 2, 4-diaminopteridine analogues with a bridged diarylamine side chain.

    PubMed

    Rosowsky, A; Cody, V; Galitsky, N; Fu, H; Papoulis, A T; Queener, S F

    1999-11-18

    As part of a larger search for potent as well as selective inhibitors of dihydrofolate reductase (DHFR) enzymes from opportunistic pathogens found in patients with AIDS and other immune disorders, N-[(2,4-diaminopteridin-6-yl)methyl]dibenz[b,f]azepine (4a) and the corresponding dihydrodibenz[b,f]azepine, dihydroacridine, phenoxazine, phenothiazine, carbazole, and diphenylamine analogues were synthesized from 2, 4-diamino-6-(bromomethyl)pteridine in 50-75% yield by reaction with the sodium salts of the amines in dry tetrahydrofuran at room temperature. The products were tested for the ability to inhibit DHFR from Pneumocystis carinii (pcDHFR), Toxoplasma gondii (tgDHFR), Mycobacterium avium (maDHFR), and rat liver (rlDHFR). The member of the series with the best combination of potency and species selectivity was 4a, with IC(50) values against the four enzymes of 0. 21, 0.043, 0.012, and 4.4 microM, respectively. The dihydroacridine, phenothiazine, and carbazole analogues were also potent, but nonselective. Of the compounds tested, 4a was the only one to successfully combine the potency of trimetrexate with the selectivity of trimethoprim. Molecular docking simulations using published 3D structural coordinates for the crystalline ternary complexes of pcDHFR and hDHFR suggested a possible structural interpretation for the binding selectivity of 4a and the lack of selectivity of the other compounds. According to this model, 4a is selective because of a unique propensity of the seven-membered ring in the dibenz[b,f]azepine moiety to adopt a puckered orientation that allows it to fit more comfortably into the active site of the P. carinii enzyme than into the active site of the human enzyme. Compound 4a was also evaluated for the ability to be taken up into, and retard the growth of, P. carinii and T. gondii in culture. The IC(50) of 4a against P. carinii trophozoites after 7 days of continuous drug treatment was 1.9 microM as compared with previously observed IC(50

  14. Dihydrofolate reductase 19-bp deletion polymorphism modifies the association of folate status with memory in a cross-sectional multi-ethnic study of adults123

    PubMed Central

    Philip, Dana; Buch, Assaf; Moorthy, Denish; Scott, Tammy M; Parnell, Laurence D; Lai, Chao-Qiang; Ordovás, José M; Selhub, Jacob; Rosenberg, Irwin H; Tucker, Katherine L; Troen, Aron M

    2015-01-01

    Background: Folate status has been positively associated with cognitive function in many studies; however, some studies have observed associations of poor cognitive outcomes with high folate. In search of an explanation, we hypothesized that the association of folate with cognition would be modified by the interaction of high-folate status with a common 19-bp deletion polymorphism in the dihydrofolate reductase (DHFR) gene. To our knowledge, the cognitive effects of this gene have not been studied previously. Objective: We examined the association between cognitive outcomes with the 19-bp deletion DHFR polymorphism, folate status, and their interaction with high or normal plasma folate. Design: This was a pooled cross-sectional study of the following 2 Boston-based cohorts of community living adults: the Boston Puerto Rican Health Study and the Nutrition, Aging, and Memory in Elders study. Individuals were genotyped for the DHFR 19-bp deletion genotype, and plasma folate status was determined. Cognitive outcomes included the Mini-Mental State Examination, Center for Epidemiologic Studies Depression Scale, and factor scores for the domains of memory, executive function, and attention from a set of cognitive tests. Results: The prevalence of the homozygous deletion (del/del) genotype was 23%. In a multivariable analysis, high folate status (>17.8 ng/mL) was associated with better memory scores than was normal-folate status (fourth–fifth quintiles compared with first–third quintiles: β ± SE = −0.22 ± 0.06, P < 0.01). Carriers of the DHFR del/del genotype had worse memory scores (β ± SE = −0.24 ± 0.10, P < 0.05) and worse executive scores (β = −0.19, P < 0.05) than did those with the del/ins and ins/ins genotypes. Finally, we observed an interaction such that carriers of the del/del genotype with high folate had significantly worse memory scores than those of both noncarriers with high-folate and del/del carriers with normal-folate (β-interaction = 0

  15. Frequencies distribution of dihydrofolate reductase and dihydropteroate synthetase mutant alleles associated with sulfadoxine-pyrimethamine resistance in Plasmodium falciparum population from Hadhramout Governorate, Yemen.

    PubMed

    Bamaga, Omar A A; Mahdy, Mohammed A K; Lim, Yvonne A L

    2015-12-22

    Malaria in Yemen is mainly caused by Plasmodium falciparum and 25% of the population is at high risk. Sulfadoxine-pyrimethamine (SP) had been used as monotherapy against P. falciparum. Emergence of chloroquine resistance led to the shift in anti-malarial treatment policy in Yemen to artemisinin-based combination therapy, that is artesunate (AS) plus SP as first-line therapy for uncomplicated malaria and artemether-lumefantrine as second-line treatment. This study aimed to screen mutations in the dihydrofolate reductase (dhfr) and dihydropteroate synthetase (dhps) genes associated with SP resistance among P. falciparum population in Hadhramout governorate, Yemen. Genomic DNA was extracted from dried blood spots of 137 P. falciparum isolates collected from a community-based study. DNA was amplified using nested polymerase chain reaction (PCR) and subsequently sequenced for Pfdhfr and Pfdhps genes. Sequences were analysed for mutations in Pfdhfr gene codons 51, 59, 108, and 164 and in Pfdhps gene codons 436, 437, and 540. A total of 128 and 114 P. falciparum isolates were successfully sequenced for Pfdhfr and Pfdhps genes, respectively. Each Pfdhfr mutant allele (I51 and N108) in P. falciparum population had a frequency of 84%. Pfdhfr R59 mutant allele was detected in one isolate. Mutation at codon 437 (G437) in the Pfdhps gene was detected in 44.7% of falciparum malaria isolates. Frequencies of Pfdhfr double mutant genotype (I51C59N108I164) and Pfdhfr/Pfdhps triple mutant genotype (I51C59N108I164-S436G437K540) were 82.8 and 39.3%, respectively. One isolate harboured Pfdhfr triple mutant genotype (I51, R59, N108, I164) and Pfdhfr/Pfdhps quadruple mutant genotype (I51R59N108I164-S436G437K540). High frequencies of Pfdhfr and Pfdhps mutant alleles and genotypes in P. falciparum population in Hadhramout, Yemen, highlight the risk of developing resistance for SP, the partner drug of AS, which subsequently will expose the parasite to AS monotherapy increasing then the

  16. Anti-folate drug resistance in Africa: meta-analysis of reported dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) mutant genotype frequencies in African Plasmodium falciparum parasite populations

    PubMed Central

    2010-01-01

    Background Mutations in the dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) genes of Plasmodium falciparum are associated with resistance to anti-folate drugs, most notably sulphadoxine-pyrimethamine (SP). Molecular studies document the prevalence of these mutations in parasite populations across the African continent. However, there is no systematic review examining the collective epidemiological significance of these studies. This meta-analysis attempts to: 1) summarize genotype frequency data that are critical for molecular surveillance of anti-folate resistance and 2) identify the specific challenges facing the development of future molecular databases. Methods This review consists of 220 studies published prior to 2009 that report the frequency of select dhfr and dhps mutations in 31 African countries. Maps were created to summarize the location and prevalence of the highly resistant dhfr triple mutant (N51I, C59R, S108N) genotype and dhps double mutant (A437G and K540E) genotype in Africa. A hierarchical mixed effects logistic regression was used to examine the influence of various factors on reported mutant genotype frequency. These factors include: year and location of study, age and clinical status of sampled population, and reporting conventions for mixed genotype data. Results A database consisting of dhfr and dhps mutant genotype frequencies from all African studies that met selection criteria was created for this analysis. The map illustrates particularly high prevalence of both the dhfr triple and dhps double mutant genotypes along the Kenya-Tanzania border and Malawi. The regression model shows a statistically significant increase in the prevalence of both the dhfr triple and dhps double mutant genotypes in Africa. Conclusion Increasing prevalence of the dhfr triple mutant and dhps double mutant genotypes in Africa are consistent with the loss of efficacy of SP for treatment of clinical malaria in most parts of this continent

  17. Structural comparison of complexes of methotrexate analogues with Lactobacillus casei dihydrofolate reductase by two-dimensional /sup 1/H NMR at 500 MHz

    SciTech Connect

    Hammond, S.J.; Birdsall, B.; Feeney, J.; Searle, M.S.; Roberts, G.C.K.; Cheung, H.T.A.

    1987-12-29

    The authors have used two-dimensional (2D) NMR methods to examine complexes of Lactobacillus casei dihydrofolate reductase and methotrexate (MTX) analogues having structural modifications of the benzoyl ring and also the glutamic acid moiety. Assignments of the /sup 1/H signals in the spectra of the various complexes were made by comparison of their 2D spectra with those complexes containing methotrexate where we have previously assigned resonances from 32 of the 162 amino acid residues. In the complexes formed with the dihalomethotrexate analogues, the glutamic acid and pteridine ring moieties were shown to bind to the enzyme in a manner similar to that found in the methotrexate-enzyme complex. Perturbations in /sup 1/H chemical shifts of protons in Phe-49, Leu-54, and Leu-27 and the methotrexate H7 and NMe protons were observed in the different complexes and were accounted for by changes in orientation of the benzoyl ring in the various complexes. Binding of oxidized or reduced coenzyme to the binary complexes did not result in different shifts for Leu-27, Leu-54, or Leu-19 protons, and thus, the orientation of the benzoyl ring of the methotrexate analogues is not perturbed greatly by the presence of either oxidized or reduced coenzyme. In the complex with the ..gamma..-monoamide analog, the /sup 1/H signals of assigned residues in the protein had almost identical shifts with the corresponding protons in the methotrexate-enzyme complex for all residues except His-28 and, to a lesser extent, Leu-27. This indicates that while the His-28 interaction with the MTX ..gamma..-CO/sub 2//sup -/ is no longer present in this complex with the ..gamma..-amide, there has not been a major change in the overall structure of the two complexes. This behavior contrasts to that of the ..cap alpha..-amide complex where /sup 1/H signals from protons in several amino acid residues are different compared with their values in the complex formed with methotrexate.

  18. Structure-activity correlations for three pyrido[2,3-d]pyrimidine antifolates binding to human and Pneumocystis carinii dihydrofolate reductase.

    PubMed

    Cody, Vivian; Pace, Jim; Namjoshi, Ojas A; Gangjee, Aleem

    2015-06-01

    To further define the interactions that enhance the selectivity of binding and to directly compare the binding of the most potent analogue {N(6)-methyl-N(6)-(3,4,5-trifluorophenyl)pyrido[2,3-d]pyrimidine-2,4,6-triamine; compound 26} in the series of bicyclic pyrido[2,3-d]pyrimidine analogues of piritrexim (PTX) with native human (h), Pneumocystis carinii (pc) and Pneumocystis jirovecii (pj) dihydrofolate reductase (DHFR) enzymes, the crystal structures of hDHFR complexed with N(6)-methyl-N(6)-(4-isopropylphenyl)pyrido[2,3-d]pyrimidine-2,4,6-triamine (compound 22), of hDHFR complexed with compound 26 and of pcDHFR complexed with N(6)-methyl-N(6)-1-naphthylpyrido[2,3-d]pyrimidine-2,4,6-triamine (compound 24) are reported as ternary complexes with NADPH. This series of bicyclic pyrido[2,3-d]pyrimidines were designed in which there was a transposition of the 5-methyl group of PTX to the N9 position of the pyrido[2,3-d]pyrimidine. It was hypothesized that the N9-methyl group would preferentially interact with Ile123 of pcDHFR (and Ile123 of pjDHFR), but not with the shorter Val115 in hDHFR. Structure-activity data for this series of antifolates revealed that a trifluoro derivative (26) was the most selective against pjDHFR compared with mammalian DHFR (h/pj = 35.7). Structural data for the hDHFR-26 complex revealed that 26 binds in a different conformation from that observed in the pcDHFR-26 complex. In the hDHFR-26 complex the trifluorophenyl ring of 26 occupies a position near the cofactor-binding site, with close intermolecular contacts with Asp21, Ser59 and Ile60, whereas this ring in the pcDHFR-26 complex is positioned away from the cofactor site and near Ile65, with weaker contacts with Ile65, Phe69 and Ile123. Comparison of the intermolecular contacts between the N9-methyl group with Val115/Ile123 validates the hypothesis that the N9-methyl substituent preferentially interacts with Ile123 compared with Val115 of hDHFR, as the weaker contact with Val115 in the h

  19. Pyridine Nucleotide Complexes with Bacillus anthracis Coenzyme A-Disulfide Reductase: A Structural Analysis of Dual NAD(P)H Specificity

    SciTech Connect

    Wallen,J.; Paige, C.; Mallett, T.; Karplus, P.; Claiborne, A.

    2008-01-01

    We have recently reported that CoASH is the major low-molecular weight thiol in Bacillus anthracis, and we have now characterized the kinetic and redox properties of the B. anthracis coenzyme A-disulfide reductase (CoADR, BACoADR) and determined the crystal structure at 2.30 Angstroms resolution. While the Staphylococcus aureus and Borrelia burgdorferi CoADRs exhibit strong preferences for NADPH and NADH, respectively, B. anthracis CoADR can use either pyridine nucleotide equally well. Sequence elements within the respective NAD(P)H-binding motifs correctly reflect the preferences for S. aureus and Bo. burgdorferi CoADRs, but leave questions as to how BACoADR can interact with both pyridine nucleotides. The structures of the NADH and NADPH complexes at ca. 2.3 Angstroms resolution reveal that a loop consisting of residues Glu180-Thr187 becomes ordered and changes conformation on NAD(P)H binding. NADH and NADPH interact with nearly identical conformations of this loop; the latter interaction, however, involves a novel binding mode in which the 2'-phosphate of NADPH points out toward solvent. In addition, the NAD(P)H-reduced BACoADR structures provide the first view of the reduced form (Cys42-SH/CoASH) of the Cys42-SSCoA redox center. The Cys42-SH side chain adopts a new conformation in which the conserved Tyr367'-OH and Tyr425'-OH interact with the nascent thiol(ate) on the flavin si-face. Kinetic data with Y367F, Y425F, and Y367, 425F BACoADR mutants indicate that Tyr425' is the primary proton donor in catalysis, with Tyr367' functioning as a cryptic alternate donor in the absence of Tyr425'.

  20. Comparative hydrogen-deuterium exchange for a mesophilic vs thermophilic dihydrofolate reductase at 25 °C: identification of a single active site region with enhanced flexibility in the mesophilic protein.

    PubMed

    Oyeyemi, Olayinka A; Sours, Kevin M; Lee, Thomas; Kohen, Amnon; Resing, Katheryn A; Ahn, Natalie G; Klinman, Judith P

    2011-09-27

    The technique of hydrogen-deuterium exchange coupled to mass spectrometry (HDX-MS) has been applied to a mesophilic (E. coli) dihydrofolate reductase under conditions that allow direct comparison to a thermophilic (B. stearothermophilus) ortholog, Ec-DHFR and Bs-DHFR, respectively. The analysis of hydrogen-deuterium exchange patterns within proteolytically derived peptides allows spatial resolution, while requiring a series of controls to compare orthologous proteins with only ca. 40% sequence identity. These controls include the determination of primary structure effects on intrinsic rate constants for HDX as well as the use of existing 3-dimensional structures to evaluate the distance of each backbone amide hydrogen to the protein surface. Only a single peptide from the Ec-DHFR is found to be substantially more flexible than the Bs-DHFR at 25 °C in a region located within the protein interior at the intersection of the cofactor and substrate-binding sites. The surrounding regions of the enzyme are either unchanged or more flexible in the thermophilic DHFR from B. stearothermophilus. The region with increased flexibility in Ec-DHFR corresponds to one of two regions previously proposed to control the enthalpic barrier for hydride transfer in Bs-DHFR [Oyeyemi et al. (2010) Proc. Natl. Acad. Sci. U.S.A. 107, 10074].

  1. Molecular Epidemiology of Malaria in Cameroon. XXX. Sequence Analysis of Plasmodium falciparum ATPase 6, Dihydrofolate Reductase, and Dihydropteroate Synthase Resistance Markers in Clinical Isolates from Children Treated with an Artesunate-Sulfadoxine-Pyrimethamine Combination

    PubMed Central

    Menemedengue, Virginie; Sahnouni, Khalifa; Basco, Leonardo; Tahar, Rachida

    2011-01-01

    Plasmodium falciparum dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) genes are reliable molecular markers for antifolate resistance. The P. falciparum ATPase 6 (pfatp6) gene has been proposed to be a potential marker for artemisinin resistance. In our previous clinical study, we showed that artesunate-sulfadoxine-pyrimethamine is highly effective against uncomplicated malaria in Yaoundé, Cameroon. In the present study, dhfr, dhps, and pfatp6 mutations in P. falciparum isolates obtained from children treated with artesunate-sulfadoxine-pyrimethamine were determined. All 61 isolates had wild-type Pfatp6 263, 623, and 769 alleles, and 11 (18%) had a single E431K substitution. Three additional mutations, E643Q, E432K, and E641Q, were detected. The results did not indicate any warning signal of serious concern (i.e., no parasites were seen with quintuple dhfr-dhps, DHFR Ile164Leu, or pfatp6 mutations), as confirmed by the high clinical efficacy of artesunate-sulfadoxine-pyrimethamine. Further studies are required to identify a molecular marker that reliably predicts artemisinin resistance. PMID:21734119

  2. Design, synthesis, biological evaluation and X-ray crystal structure of novel classical 6,5,6-tricyclic benzo[4,5]thieno[2,3-d]pyrimidines as dual thymidylate synthase and dihydrofolate reductase inhibitors

    PubMed Central

    Zhang, Xin; Zhou, Xilin; L.Kisliuk, Roy; Piraino, Jennifer; Cody, Vivian

    2011-01-01

    Classical antifolates (4-7) with a tricyclic benzo[4,5]thieno[2,3-d]pyrimidine scaffold and a flexible and rigid benzoylglutamate were synthesized as dual thymidylate synthase (TS) and dihydrofolate reductase (DHFR) inhibitors. Oxidative aromatization of ethyl 2-amino-4-methyl-4,5,6,7-tetrahydro-1-benzothiophene-3-carboxylate (±)-9 to ethyl 2-amino-4-methyl-1-benzothiophene-3-carboxylate 10 with 10% Pd/C was a key synthetic step. Compounds with 2-CH3 substituents inhibited human (h) TS (IC50 = 0.26-0.8 μM), but not hDHFR. Substitution of the 2-CH3 with a 2-NH2 increases hTS inhibition by more than 10-fold and also affords excellent hDHFR inhibition (IC50 = 0.09-0.1 μM). This study shows that the tricyclic benzo[4,5]thieno[2,3-d]pyrimidine scaffold is highly conducive to single hTS or dual hTS-hDHFR inhibition depending on the 2-position substituents. The X-ray crystal structures of 6 and 7 with hDHFR reveal, for the first time, that tricyclics 6 and 7 bind with the benzo[4,5]thieno[2,3-d]pyrimidine ring in the folate binding mode with the thieno S mimicking the 4-amino of methotrexate. PMID:21550809

  3. Screening for dihydrofolate reductase inhibitors using MOLPRINT 2D, a fast fragment-based method employing the naïve Bayesian classifier: limitations of the descriptor and the importance of balanced chemistry in training and test sets.

    PubMed

    Bender, Andreas; Mussa, Hamse Y; Glen, Robert C

    2005-10-01

    A fragment-based similarity searching method, MOLPRINT 2D, was employed for virtual screening of Escherichia coli dihydrofolate reductase inhibitors. Using the original training set of 50,000 compounds, only marginal enrichment factors (between 1 and 3) could be achieved on the test library. The active structures contained in the training and test libraries represented different types of "chemistry", that is, different substructural features associated with activity. Training and test sets were pooled in a 2nd step and randomly split into training and test of equal size, with the objective of smoothing out the different chemical characteristics of both libraries. In a 10-fold cross-validation study on the new training and test sets, typically 10-fold enrichment could be found in the first 96 positions, 4-fold enrichment in the first 384 positions, and 3-fold enrichment in the first 1536 positions, corresponding to 6, 10, and 28 hits, respectively (out of a total of 307; activity defined as average residual activity of less than 80%). The conclusions are 2-fold. On one hand, the exact fragment-matching similarity searching method employed here is not capable of finding completely novel hit structures. On the other hand, this study emphasizes the requirement for a comparable distribution of chemical features of the training and test sets. MOLPRINT 2D is freely downloadable from http://www.cheminformatics.org.

  4. Molecular epidemiology of malaria in Cameroon. XXX. sequence analysis of Plasmodium falciparum ATPase 6, dihydrofolate reductase, and dihydropteroate synthase resistance markers in clinical isolates from children treated with an artesunate-sulfadoxine-pyrimethamine combination.

    PubMed

    Menemedengue, Virginie; Sahnouni, Khalifa; Basco, Leonardo; Tahar, Rachida

    2011-07-01

    Plasmodium falciparum dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) genes are reliable molecular markers for antifolate resistance. The P. falciparum ATPase 6 (pfatp6) gene has been proposed to be a potential marker for artemisinin resistance. In our previous clinical study, we showed that artesunate-sulfadoxine-pyrimethamine is highly effective against uncomplicated malaria in Yaoundé, Cameroon. In the present study, dhfr, dhps, and pfatp6 mutations in P. falciparum isolates obtained from children treated with artesunate-sulfadoxine-pyrimethamine were determined. All 61 isolates had wild-type Pfatp6 263, 623, and 769 alleles, and 11 (18%) had a single E431K substitution. Three additional mutations, E643Q, E432K, and E641Q, were detected. The results did not indicate any warning signal of serious concern (i.e., no parasites were seen with quintuple dhfr-dhps, DHFR Ile164Leu, or pfatp6 mutations), as confirmed by the high clinical efficacy of artesunate-sulfadoxine-pyrimethamine. Further studies are required to identify a molecular marker that reliably predicts artemisinin resistance.

  5. Dihydrofolate-Reductase Mutations in Plasmodium knowlesi Appear Unrelated to Selective Drug Pressure from Putative Human-To-Human Transmission in Sabah, Malaysia.

    PubMed

    Grigg, Matthew J; Barber, Bridget E; Marfurt, Jutta; Imwong, Mallika; William, Timothy; Bird, Elspeth; Piera, Kim A; Aziz, Ammar; Boonyuen, Usa; Drakeley, Christopher J; Cox, Jonathan; White, Nicholas J; Cheng, Qin; Yeo, Tsin W; Auburn, Sarah; Anstey, Nicholas M

    2016-01-01

    Malaria caused by zoonotic Plasmodium knowlesi is an emerging threat in Eastern Malaysia. Despite demonstrated vector competency, it is unknown whether human-to-human (H-H) transmission is occurring naturally. We sought evidence of drug selection pressure from the antimalarial sulfadoxine-pyrimethamine (SP) as a potential marker of H-H transmission. The P. knowlesi dihdyrofolate-reductase (pkdhfr) gene was sequenced from 449 P. knowlesi malaria cases from Sabah (Malaysian Borneo) and genotypes evaluated for association with clinical and epidemiological factors. Homology modelling using the pvdhfr template was used to assess the effect of pkdhfr mutations on the pyrimethamine binding pocket. Fourteen non-synonymous mutations were detected, with the most common being at codon T91P (10.2%) and R34L (10.0%), resulting in 21 different genotypes, including the wild-type, 14 single mutants, and six double mutants. One third of the P. knowlesi infections were with pkdhfr mutants; 145 (32%) patients had single mutants and 14 (3%) had double-mutants. In contrast, among the 47 P. falciparum isolates sequenced, three pfdhfr genotypes were found, with the double mutant 108N+59R being fixed and the triple mutants 108N+59R+51I and 108N+59R+164L occurring with frequencies of 4% and 8%, respectively. Two non-random spatio-temporal clusters were identified with pkdhfr genotypes. There was no association between pkdhfr mutations and hyperparasitaemia or malaria severity, both hypothesized to be indicators of H-H transmission. The orthologous loci associated with resistance in P. falciparum were not mutated in pkdhfr. Subsequent homology modelling of pkdhfr revealed gene loci 13, 53, 120, and 173 as being critical for pyrimethamine binding, however, there were no mutations at these sites among the 449 P. knowlesi isolates. Although moderate diversity was observed in pkdhfr in Sabah, there was no evidence this reflected selective antifolate drug pressure in humans.

  6. Dihydrofolate-Reductase Mutations in Plasmodium knowlesi Appear Unrelated to Selective Drug Pressure from Putative Human-To-Human Transmission in Sabah, Malaysia

    PubMed Central

    Imwong, Mallika; William, Timothy; Bird, Elspeth; Piera, Kim A.; Aziz, Ammar; Boonyuen, Usa; Drakeley, Christopher J.; Cox, Jonathan; White, Nicholas J.; Cheng, Qin; Yeo, Tsin W.; Auburn, Sarah; Anstey, Nicholas M.

    2016-01-01

    Background Malaria caused by zoonotic Plasmodium knowlesi is an emerging threat in Eastern Malaysia. Despite demonstrated vector competency, it is unknown whether human-to-human (H-H) transmission is occurring naturally. We sought evidence of drug selection pressure from the antimalarial sulfadoxine-pyrimethamine (SP) as a potential marker of H-H transmission. Methods The P. knowlesi dihdyrofolate-reductase (pkdhfr) gene was sequenced from 449 P. knowlesi malaria cases from Sabah (Malaysian Borneo) and genotypes evaluated for association with clinical and epidemiological factors. Homology modelling using the pvdhfr template was used to assess the effect of pkdhfr mutations on the pyrimethamine binding pocket. Results Fourteen non-synonymous mutations were detected, with the most common being at codon T91P (10.2%) and R34L (10.0%), resulting in 21 different genotypes, including the wild-type, 14 single mutants, and six double mutants. One third of the P. knowlesi infections were with pkdhfr mutants; 145 (32%) patients had single mutants and 14 (3%) had double-mutants. In contrast, among the 47 P. falciparum isolates sequenced, three pfdhfr genotypes were found, with the double mutant 108N+59R being fixed and the triple mutants 108N+59R+51I and 108N+59R+164L occurring with frequencies of 4% and 8%, respectively. Two non-random spatio-temporal clusters were identified with pkdhfr genotypes. There was no association between pkdhfr mutations and hyperparasitaemia or malaria severity, both hypothesized to be indicators of H-H transmission. The orthologous loci associated with resistance in P. falciparum were not mutated in pkdhfr. Subsequent homology modelling of pkdhfr revealed gene loci 13, 53, 120, and 173 as being critical for pyrimethamine binding, however, there were no mutations at these sites among the 449 P. knowlesi isolates. Conclusion Although moderate diversity was observed in pkdhfr in Sabah, there was no evidence this reflected selective antifolate drug

  7. Contributions of tryptophan 24 and glutamate 30 to binding long-lived water molecules in the ternary complex of human dihydrofolate reductase with methotrexate and NADPH studied by site-directed mutagenesis and nuclear magnetic resonance spectroscopy.

    PubMed

    Meiering, E M; Li, H; Delcamp, T J; Freisheim, J H; Wagner, G

    1995-03-24

    Previous NMR studies on the ternary complex of human dihydrofolate reductase (hDHFR) with methotrexate (MTX) and NADPH detected six long-lived bound water molecules. Two of the water molecules, WatA and WatB, stabilize the structure of the protein while the other four, WatC, WatD, WatE and WatF, are involved in substrate binding and specificity. WatE may also act as a proton shuttle during catalysis. Here, the contributions of individual residues to the binding of these water molecules are investigated by performing NMR experiments on ternary complexes of mutant enzymes, W24F, E30A and E30Q. W24 and E30 are conserved residues that form hydrogen bonds with WatE in crystal structures of DHFR. Nuclear Overhauser effects (NOEs) are detected between WatE and the protein in all the mutant complexes, hence WatE still has a long lifetime bound to the complex when one of its hydrogen-bonding partners is deleted or altered by mutagenesis. The NOEs for WatE are much weaker, however, in the mutants than in wild-type. The NOEs for the other water molecules in and near the active site, WatA, WatC, WatD and WatF, also tend to be weaker in the mutant complexes. Little or no change is apparent in the NOEs for WatB, which is located outside the active site, farthest from the mutated residues. The decreased NOE intensities for the bound water molecules could be caused by changes in the positions and/or lifetimes of the water molecules. Chemical shift and NOE data indicate that the mutants have structures very similar to that of wild-type hDHFR, with possible conformational changes occurring only near the mutated residues. Based on the lack of structural change in the protein and evidence for increased structural fluctuations in the active sites of the mutant enzymes, it is likely that the NOE changes are caused, at least in part, by decreases in the lifetimes of the bound water molecules.

  8. Further studies on 2,4-diamino-5-(2',5'-disubstituted benzyl)pyrimidines as potent and selective inhibitors of dihydrofolate reductases from three major opportunistic pathogens of AIDS.

    PubMed

    Rosowsky, Andre; Forsch, Ronald A; Queener, Sherry F

    2003-04-24

    As part of an ongoing effort to discover novel small-molecule antifolates combining the enzyme-binding species selectivity of trimethoprim (TMP) with the potency of piritrexim (PTX), 10 previously unreported 2,4-diamino-5-(2'-methoxy-5'-substituted)benzylpyrimidines (2-11) containing a carboxyl group at the distal end of the 5'-substituent were synthesized and tested as inhibitors of dihydrofolate reductase (DHFR) from Pneumocystis carinii (Pc), Toxoplasma gondii (Tg), and Mycobacterium avium (Ma), three of the opportunistic pathogens frequently responsible for life-threatening illness in people with impaired immune systems as a result of HIV infection or immunosuppressive chemotherapy. The selectivity index of DHFR inhibition was evaluated by comparing the potency of each compound against the parasite enzymes with its potency against rat liver DHFR. 2,4-Diamino-5-[5'-(5-carboxy-1-pentynyl)-2'-methoxybenzyl]pyrimidine (3) inhibited Pc DHFR with a selectivity index of 79 and was 430 times more potent than TMP. 2,4-Diamino-5-[5'-(4-carboxy-1-butynyl)-2'-methoxybenzyl]pyrimidine (2), with one less carbon than 3 in the side chain, had a selectivity index of 910 against Ma DHFR and was 43 times more potent than TMP. 2,4-Diamino-5-[5'-(5-carboxypentyl)-2'-methoxybenzyl]pyrimidine (6) had a selectivity index of 490 against Tg DHFR and was 320 times more potent than TMP. 2,4-Diamino-5-[5'-(6-carboxy-1-hexynyl)-2'-methoxybenzyl]pyrimidine (4), with one more carbon than 3, was less potent against all three of the parasite enzymes than either 3 or 6 and also had a lower selectivity index than 3 against the Pc enzyme. However, 4 was the only member of the series with a selectivity index of >300 against both Tg and Ma DHFR. Given that PTX is at least 10 times more potent against rat DHFR than against P. carinii or T. gondii DHFR and that the selectivity index of several of the compounds matches or exceeds that of TMP as well as PTX, our results suggest that it may be possible

  9. Design, synthesis, and antifolate activity of new analogues of piritrexim and other diaminopyrimidine dihydrofolate reductase inhibitors with omega-carboxyalkoxy or omega-carboxy-1-alkynyl substitution in the side chain.

    PubMed

    Chan, David C M; Fu, Hongning; Forsch, Ronald A; Queener, Sherry F; Rosowsky, Andre

    2005-06-30

    As part of a search for dihydrofolate reductase (DHFR) inhibitors combining the high potency of piritrexim (PTX) with the high antiparasitic vs mammalian selectivity of trimethoprim (TMP), the heretofore undescribed 2,4-diamino-6-(2',5'-disubstituted benzyl)pyrido[2,3-d]pyrimidines 6-14 with O-(omega-carboxyalkyl) or omega-carboxy-1-alkynyl groups on the benzyl moiety were synthesized and tested against Pneumocystis carinii, Toxoplasma gondii, and Mycobacterium avium DHFR vs rat DHFR. Three N-(2,4-diaminopteridin-6-yl)methyl)-2'-(omega-carboxy-1-alkynyl)dibenz[b,f]azepines (19-21) were also synthesized and tested. The pyridopyrimidine with the best combination of potency and selectivity was 2,4-diamino-5-methyl-6-[2'-(5-carboxy-1-butynyl)-5'-methoxy]benzyl]pyrimidine (13), with an IC(50) value of 0.65 nM against P. carinii DHFR, 0.57 nM against M. avium DHFR, and 55 nM against rat DHFR. The potency of 13 against P. carinii DHFR was 20-fold greater than that of PTX (IC(50) = 13 nM), and its selectivity index (SI) relative to rat DHFR was 85, whereas PTX was nonselective. The activity of 13 against P. carinii DHFR was 20 000 times greater than that of TMP, with an SI of 96, whereas that of TMP was only 14. However 13 was no more potent than PTX against M. avium DHFR, and its SI was no better than that of TMP. Molecular modeling dynamics studies using compounds 10 and 13 indicated a slight binding preference for the latter, in qualitative agreement with the IC(50) data. Among the pteridines, the most potent against P. carinii DHFR and M. avium DHFR was the 2'-(5-carboxy-1-butynyl)dibenz[b,f]azepinyl derivative 20 (IC(50) = 2.9 nM), whereas the most selective was the 2'-(5-carboxy-1-pentynyl) analogue 21, with SI values of >100 against both P. carinii and M. avium DHFR relative to rat DHFR. The final compound, 2,4-diamino-5-[3'-(4-carboxy-1-butynyl)-4'-bromo-5'-methoxybenzyl]pyrimidine (22), was both potent and selective against M. avium DHFR (IC(50) = 0.47 nM, SI

  10. Structural analysis of a holoenzyme complex of mouse dihydrofolate reductase with NADPH and a ternary complex with the potent and selective inhibitor 2, 4-diamino-6-(2′-hydroxydibenz[b, f]azepin-5-yl)methylpteridine

    SciTech Connect

    Cody, Vivian; Pace, Jim; Rosowsky, Andre

    2008-09-01

    The structures of mouse DHFR holo enzyme and a ternary complex with NADPH and a potent inhibitor are described. It has been shown that 2, 4-diamino-6-arylmethylpteridines and 2, 4-diamino-5-arylmethylpyrimidines containing an O-carboxylalkyloxy group in the aryl moiety are potent and selective inhibitors of the dihydrofolate reductase (DHFR) from opportunistic pathogens such as Pneumocystis carinii, the causative agent of Pneumocystis pneumonia in HIV/AIDS patients. In order to understand the structure–activity profile observed for a series of substituted dibenz[b, f]azepine antifolates, the crystal structures of mouse DHFR (mDHFR; a mammalian homologue) holo and ternary complexes with NADPH and the inhibitor 2, 4-diamino-6-(2′-hydroxydibenz[b, f]azepin-5-yl)methylpteridine were determined to 1.9 and 1.4 Å resolution, respectively. Structural data for the ternary complex with the potent O-(3-carboxypropyl) inhibitor PT684 revealed no electron density for the O-carboxylalkyloxy side chain. The side chain was either cleaved or completely disordered. The electron density fitted the less potent hydroxyl compound PT684a. Additionally, cocrystallization of mDHFR with NADPH and the less potent 2′-(4-carboxybenzyl) inhibitor PT682 showed no electron density for the inhibitor and resulted in the first report of a holoenzyme complex despite several attempts at crystallization of a ternary complex. Modeling data of PT682 in the active site of mDHFR and P. carinii DHFR (pcDHFR) indicate that binding would require ligand-induced conformational changes to the enzyme for the inhibitor to fit into the active site or that the inhibitor side chain would have to adopt an alternative binding mode to that observed for other carboxyalkyloxy inhibitors. These data also show that the mDHFR complexes have a decreased active-site volume as reflected in the relative shift of helix C (residues 59–64) by 0.6 Å compared with pcDHFR ternary complexes. These data are consistent with the

  11. Structural Analysis of a Holoenzyme Complex of Mouse Dihydrofolate Reductase With NADPH And a Ternary Complex With the Potent And Selective Inhibitor 2,4-Diamino-6-(2'-Hydroxydibenz[b,F]azepin-5-YI)

    SciTech Connect

    Cody, V.; Pace, J.; Rosowsky, A.

    2009-05-12

    It has been shown that 2,4-diamino-6-arylmethylpteridines and 2,4-diamino-5-arylmethylpyrimidines containing an O-carboxylalkyloxy group in the aryl moiety are potent and selective inhibitors of the dihydrofolate reductase (DHFR) from opportunistic pathogens such as Pneumocystis carinii, the causative agent of Pneumocystis pneumonia in HIV/AIDS patients. In order to understand the structure-activity profile observed for a series of substituted dibenz[b,f]azepine antifolates, the crystal structures of mouse DHFR (mDHFR; a mammalian homologue) holo and ternary complexes with NADPH and the inhibitor 2,4-diamino-6-(2{prime}-hydroxydibenz[b,f]azepin-5-yl)methylpteridine were determined to 1.9 and 1.4 A resolution, respectively. Structural data for the ternary complex with the potent O-(3-carboxypropyl) inhibitor PT684 revealed no electron density for the O-carboxylalkyloxy side chain. The side chain was either cleaved or completely disordered. The electron density fitted the less potent hydroxyl compound PT684a. Additionally, cocrystallization of mDHFR with NADPH and the less potent 2{prime}-(4-carboxybenzyl) inhibitor PT682 showed no electron density for the inhibitor and resulted in the first report of a holoenzyme complex despite several attempts at crystallization of a ternary complex. Modeling data of PT682 in the active site of mDHFR and P. carinii DHFR (pcDHFR) indicate that binding would require ligand-induced conformational changes to the enzyme for the inhibitor to fit into the active site or that the inhibitor side chain would have to adopt an alternative binding mode to that observed for other carboxyalkyloxy inhibitors. These data also show that the mDHFR complexes have a decreased active-site volume as reflected in the relative shift of helix C (residues 59-64) by 0.6 A compared with pcDHFR ternary complexes. These data are consistent with the greater inhibitory potency against pcDHFR.

  12. A study on the inhibition of dihydrofolate reductase (DHFR) from Escherichia coli by gold(i) phosphane compounds. X-ray crystal structures of (4,5-dichloro-1H-imidazolate-1-yl)-triphenylphosphane-gold(i) and (4,5-dicyano-1H-imidazolate-1-yl)-triphenylphosphane-gold(i).

    PubMed

    Galassi, Rossana; Oumarou, Camille Simon; Burini, Alfredo; Dolmella, Alessandro; Micozzi, Daniela; Vincenzetti, Silvia; Pucciarelli, Stefania

    2015-02-21

    An unprecedented study on the inhibitory activities of a class of phosphane gold(i) complexes on E. coli dihydrofolate reductase (DHFR) is reported. The gold(i) complexes considered in this work consist of azolate or chloride ligands and phosphane as co-ligands. The ligands have been functionalized with polar groups (-COOH, -COO(-), NO2, Cl, CN) to obtain better solubility in polar media. Neutral, anionic and cationic gold(i) complexes have been tested as DHFR inhibitors by means of a continuous direct spectrophotometric method. X-ray structural characterizations were performed on ((triphenylphosphine)-gold(i)-(4,5-dicyanoimidazolyl-1H-1yl) and on the analog (triphenylphosphine)-gold(i)-(4,5-dichloroimidazolyl-1H-1yl). The inhibition constants obtained from the enzyme tests range from 20 μM to 63 nM (auranofin) and are conducive to promoting these compounds as potential DHFR inhibitors.

  13. Bacillus anthracis

    PubMed Central

    Spencer, R C

    2003-01-01

    The events of 11 September 2001 and the subsequent anthrax outbreaks have shown that the West needs to be prepared for an increasing number of terrorist attacks, which may include the use of biological warfare. Bacillus anthracis has long been considered a potential biological warfare agent, and this review will discuss the history of its use as such. It will also cover the biology of this organism and the clinical features of the three disease forms that it can produce: cutaneous, gastrointestinal, and inhalation anthrax. In addition, treatment and vaccination strategies will be reviewed. PMID:12610093

  14. Ruling Out Bacillus anthracis

    PubMed Central

    Papaparaskevas, Joseph; Houhoula, Dimitra P.; Papadimitriou, Maria; Saroglou, Georgios; Legakis, Nicholas J.

    2004-01-01

    Optimization of methods for ruling out Bacillus anthracis leads to increased yields, faster turnaround times, and a lighter workload. We used 72 environmental non–B. anthracis bacilli to validate methods for ruling out B. anthracis. Most effective were horse blood agar, motility testing after a 2-h incubation in trypticase soy broth, and screening with a B. anthracis–selective agar. PMID:15200872

  15. Ligand binding studies, preliminary structure-activity relationship and detailed mechanistic characterization of 1-phenyl-6,6-dimethyl-1,3,5-triazine-2,4-diamine derivatives as inhibitors of Escherichia coli dihydrofolate reductase

    PubMed Central

    Srinivasan, Bharath; Tonddast-Navaei, Sam; Skolnick, Jeffrey

    2015-01-01

    Gram-negative bacteria are implicated in the causation of life-threatening hospital-acquired infections. They acquire rapid resistance to multiple drugs and available antibiotics. Hence, there is the need to discover new antibacterial agents with novel scaffolds. For the first time, this study explores the 1,3,5-triazine-2,4-diamine and 1,2,4-triazine-2,4-diamine group of compounds as potential inhibitors of E. coli DHFR, a pivotal enzyme in the thymidine and purine synthesis pathway. Using differential scanning fluorimetry, DSF, fifteen compounds with various substitutions on either the 3rd or 4th positions on the benzene group of 6,6-dimethyl-1-(benzene)-1,3,5-triazine-2,4-diamine were shown to bind to the enzyme with varying affinities. Then, the dose dependence of inhibition by these compounds was determined. Preliminary quantitative structure-activity relationship analysis and docking studies implicate the alkyl linker group and the sulfonyl fluoride group in increasing the potency of inhibition. 4-[4-[3-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenyl]butyl]benzenesulfonyl fluoride (NSC120927), the best hit from the study and a molecule with no reported inhibition of E. coli DHFR, potently inhibits the enzyme with a Ki value of 42.50 ± 5.34 nM, followed by 4-[6-[4-(4,6-diamino-2,2-dimethyl-1,3,5-triazin-1-yl)phenyl]hexyl]benzenesulfonyl fluoride(NSC132279), with a Ki value of 100.9 ± 12.7 nM. Detailed kinetic characterization of the inhibition brought about by five small-molecule hits shows that these inhibitors bind to the dihydrofolate binding site with preferential binding to the NADPH-bound binary form of the enzyme. Furthermore, in search of novel diaminotriazine scaffolds, it is shown that lamotrigine, a 1,2,4-triazine-3,5-diamine and a sodium-ion channel blocker class of antiepileptic drug, also inhibits E. coli DHFR. This is the first comprehensive study on the binding and inhibition brought about by diaminotriazines of a gram

  16. Mutation and repair induced by the carcinogen 2-(hydroxyamino)-1-methyl-6-phenylimidazo[4,5-b]pyridine (N-OH-PhIP) in the dihydrofolate reductase gene of Chinese hamster ovary cells and conformational modeling of the dG-C8-PhIP adduct in DNA.

    PubMed

    Carothers, A M; Yuan, W; Hingerty, B E; Broyde, S; Grunberger, D; Snyderwine, E G

    1994-01-01

    Three experiments using 20 microM 2-(hydroxyamino)-1-methyl-6-phenylimidazo[4,5-b]pyridine (N-OH-PhIP) were performed to induce mutations in the dihydrofolate reductase (DHFR) gene of a hemizygous Chinese hamster ovary (CHO) cell line (UA21). Metabolized forms of this chemical primarily bind at the C-8 position of guanine in DNA. In total, 21 independent induced mutants were isolated and 20 were characterized. DNA sequencing showed that the preferred mutation type found in 75% of the induced DHFR- clones was G.C-->T.A single and tandem double transversions. In addition to base substitutions, one mutant carried a-1 frameshift and another one had lost the entire locus by deletion. The induced changes affected purine targets on the nontranscribed strand of the gene in nearly all of the mutants sequenced (18/19). At the time that the first two experiments were performed, the initial adduct levels were quantitated in treated cells at the mutagenic dose by 32P-postlabeling. While the induced frequency of mutation was relatively low (approximately 5 x 10(-6), the adduct levels after a 1-h exposure of UA21 cells to 20 microM N-OH-PhIP were relatively high (13 adducts x 10(-6) nucleotides). This latter method was then employed to learn if the induced mutation frequency correlated with rapid overall genome repair of PhIP-DNA adducts. Total adduct levels, determined using DNA samples from treated cells collected after intervals of time, were reduced by about 50% after 6 h, and about 70% after 24 h. Since overall genome repair in CHO cells is relatively slow compared with preferential gene repair, the removal of dG-C8-PhIP adducts was apparently efficient. In order to better understand the mutational and repair results, we performed computational modeling to determine the lowest energy structure for the major dG-C8-PhIP adduct in a repetitively mutated duplex sequence opposite dA. Results of this analysis indicate that the PhIP-modified base resembles previous structural

  17. Preferential selection of isomer binding from chiral mixtures: alternate binding modes observed for the E and Z isomers of a series of 5-substituted 2,4-­diaminofuro[2,3-d]pyrimidines as ternary complexes with NADPH and human dihydrofolate reductase

    PubMed Central

    Cody, Vivian; Piraino, Jennifer; Pace, Jim; Li, Wei; Gangjee, Aleem

    2010-01-01

    The crystal structures of six human dihydrofolate reductase (hDHFR) ternary complexes with NADPH and a series of mixed E/Z isomers of 5-substituted 5-[2-(2-methoxyphenyl)-prop-1-en-1-yl]furo[2,3-d]pyrimidine-2,4-diamines substituted at the C9 position with propyl, isopropyl, cyclopropyl, butyl, isobutyl and sec-butyl (E2–E7, Z3) were determined and the results were compared with the resolved E and Z isomers of the C9-methyl parent compound. The configuration of all of the inhibitors, save one, was observed as the E isomer, in which the binding of the furopyrimidine ring is flipped such that the 4-­amino group binds in the 4-oxo site of folate. The Z3 isomer of the C9-isopropyl analog has the normal 2,4-diamino­pyrimidine ring binding geometry, with the furo oxygen near Glu30 and the 4-amino group interacting near the cofactor nicotinamide ring. Electron-density maps for these structures revealed the binding of only one isomer to hDHFR, despite the fact that chiral mixtures (E:Z ratios of 2:1, 3:1 and 3:2) of the inhibitors were incubated with hDHFR prior to crystallization. Superposition of the hDHFR com­plexes with E2 and Z3 shows that the 2′-methoxyphenyl ring of E2 is perpendicular to that of Z3. The most potent inhibitor in this series is the isopropyl analog Z3 and the least potent is the isobutyl analog E6, consistent with data that show that the Z isomer makes the most favorable interactions with the active-site residues. The isobutyl moiety of E6 is observed in two orientations and the resultant steric crowding of the E6 analog is consistent with its weaker activity. The alternative binding modes observed for the furopyrimidine ring in these E/Z isomers suggest that new templates can be designed to probe these binding regions of the DHFR active site. PMID:21123866

  18. Unraveling the role of protein dynamics in dihydrofolate reductase catalysis

    PubMed Central

    Luk, Louis Y. P.; Javier Ruiz-Pernía, J.; Dawson, William M.; Roca, Maite; Loveridge, E. Joel; Glowacki, David R.; Harvey, Jeremy N.; Mulholland, Adrian J.; Tuñón, Iñaki; Moliner, Vicent; Allemann, Rudolf K.

    2013-01-01

    Protein dynamics have controversially been proposed to be at the heart of enzyme catalysis, but identification and analysis of dynamical effects in enzyme-catalyzed reactions have proved very challenging. Here, we tackle this question by comparing an enzyme with its heavy (15N, 13C, 2H substituted) counterpart, providing a subtle probe of dynamics. The crucial hydride transfer step of the reaction (the chemical step) occurs more slowly in the heavy enzyme. A combination of experimental results, quantum mechanics/molecular mechanics simulations, and theoretical analyses identify the origins of the observed differences in reactivity. The generally slightly slower reaction in the heavy enzyme reflects differences in environmental coupling to the hydride transfer step. Importantly, the barrier and contribution of quantum tunneling are not affected, indicating no significant role for “promoting motions” in driving tunneling or modulating the barrier. The chemical step is slower in the heavy enzyme because protein motions coupled to the reaction coordinate are slower. The fact that the heavy enzyme is only slightly less active than its light counterpart shows that protein dynamics have a small, but measurable, effect on the chemical reaction rate. PMID:24065822

  19. Inactivation of Bacillus anthracis Spores

    PubMed Central

    Whitney, Ellen A. Spotts; Beatty, Mark E.; Taylor, Thomas H.; Weyant, Robbin; Sobel, Jeremy; Arduino, Matthew J.

    2003-01-01

    After the intentional release of Bacillus anthracis through the U.S. Postal Service in the fall of 2001, many environments were contaminated with B. anthracis spores, and frequent inquiries were made regarding the science of destroying these spores. We conducted a survey of the literature that had potential application to the inactivation of B. anthracis spores. This article provides a tabular summary of the results. PMID:12780999

  20. Application of In Vivo Induced Antigen Technology (IVIAT) to Bacillus anthracis

    PubMed Central

    Rollins, Sean M.; Peppercorn, Amanda; Young, John S.; Drysdale, Melissa; Baresch, Andrea; Bikowski, Margaret V.; Ashford, David A.; Quinn, Conrad P.; Handfield, Martin; Hillman, Jeffrey D.; Lyons, C. Rick; Koehler, Theresa M.; Calderwood, Stephen B.; Ryan, Edward T.

    2008-01-01

    In vivo induced antigen technology (IVIAT) is an immuno-screening technique that identifies bacterial antigens expressed during infection and not during standard in vitro culturing conditions. We applied IVIAT to Bacillus anthracis and identified PagA, seven members of a N-acetylmuramoyl-L-alanine amidase autolysin family, three P60 family lipoproteins, two transporters, spore cortex lytic protein SleB, a penicillin binding protein, a putative prophage holin, respiratory nitrate reductase NarG, and three proteins of unknown function. Using quantitative real-time PCR comparing RNA isolated from in vitro cultured B. anthracis to RNA isolated from BALB/c mice infected with virulent Ames strain B. anthracis, we confirmed induced expression in vivo for a subset of B. anthracis genes identified by IVIAT, including L-alanine amidases BA3767, BA4073, and amiA (pXO2-42); the bacteriophage holin gene BA4074; and pagA (pXO1-110). The exogenous addition of two purified putative autolysins identified by IVIAT, N-acetylmuramoyl-L-alanine amidases BA0485 and BA2446, to vegetative B. anthracis cell suspensions induced a species-specific change in bacterial morphology and reduction in viable bacterial cells. Many of the proteins identified in our screen are predicted to affect peptidoglycan re-modeling, and our results support significant cell wall structural remodeling activity during B. anthracis infection. Identification of L-alanine amidases with B. anthracis specificity may suggest new potential therapeutic targets. PMID:18350160

  1. Application of in vivo induced antigen technology (IVIAT) to Bacillus anthracis.

    PubMed

    Rollins, Sean M; Peppercorn, Amanda; Young, John S; Drysdale, Melissa; Baresch, Andrea; Bikowski, Margaret V; Ashford, David A; Quinn, Conrad P; Handfield, Martin; Hillman, Jeffrey D; Lyons, C Rick; Koehler, Theresa M; Calderwood, Stephen B; Ryan, Edward T

    2008-03-19

    In vivo induced antigen technology (IVIAT) is an immuno-screening technique that identifies bacterial antigens expressed during infection and not during standard in vitro culturing conditions. We applied IVIAT to Bacillus anthracis and identified PagA, seven members of a N-acetylmuramoyl-L-alanine amidase autolysin family, three P60 family lipoproteins, two transporters, spore cortex lytic protein SleB, a penicillin binding protein, a putative prophage holin, respiratory nitrate reductase NarG, and three proteins of unknown function. Using quantitative real-time PCR comparing RNA isolated from in vitro cultured B. anthracis to RNA isolated from BALB/c mice infected with virulent Ames strain B. anthracis, we confirmed induced expression in vivo for a subset of B. anthracis genes identified by IVIAT, including L-alanine amidases BA3767, BA4073, and amiA (pXO2-42); the bacteriophage holin gene BA4074; and pagA (pXO1-110). The exogenous addition of two purified putative autolysins identified by IVIAT, N-acetylmuramoyl-L-alanine amidases BA0485 and BA2446, to vegetative B. anthracis cell suspensions induced a species-specific change in bacterial morphology and reduction in viable bacterial cells. Many of the proteins identified in our screen are predicted to affect peptidoglycan re-modeling, and our results support significant cell wall structural remodeling activity during B. anthracis infection. Identification of L-alanine amidases with B. anthracis specificity may suggest new potential therapeutic targets.

  2. Macrophage Responses to B. Anthracis

    DTIC Science & Technology

    2006-08-14

    anthracis pathogenesis as well as potential leads for the development of new diagnostic and therapeutic options. Bacillus anthracis is a gram ...in Baldwin et a[. (3). In brief, this was done by sub- Cells were visualized by Diff-Quick staining (Baxter Scientific). tracting the log j2) of the...1.25% agarose gels, stained with ethidium bromide, corporated aminoallyl-dUTP was removed with a OlAquick column (Oiagen). and visualized under UV

  3. Purification and properties of the dihydrofolate synthetase from Serratia indica.

    PubMed

    Ikeda, M; Kazuo, I

    1976-01-01

    The dihydrofolate synthetase (EC 6.3.2.12) responsible for catalyzing the synthesis of dihydrofolic acid from dihydropteroic acid and L-glutamic acid was purified about 130-fold from extracts of Serratia indica IFO 3759 by ammonium sulfate fractionation, DEAE-Sephadex column chromatography, Sephadex G-200 gel filtration, and DEAE-cellulose column chromatography. The enzyme preparation obtained was shown to be homogeneous by DEAE-cellulose column chromatography and ultracentrifugal analysis. The sedimentation coefficient of this enzyme was 3.9 S, and the molecular weight was determined to be about 47,000 by Sephadex G-100. The optimum pH for the reaction was 9.0. The enzymatic reaction required dihydropteroate, L-glutamate and ATP as substrates, and Mg2+ and K+ as cofactors. gamma-L-Glutamyl-L-glutamic acid cannot replace L-glutamic acid as the substrate. Neither pteroic acid nor tetrahydropteroic acid can be used as the substrate. ATP was partially replaced by ITP or GTP. The enzyme reaction was inhibited by the addition of AD, but not by AMP. One mole of dihydrofolate, 1 mole of ADP and 1 mole of orthophosphate were produced from each 1 mole of dihydropteroic acid, L-glutamic acid, and ATP by the following equation: 7,8-Dihydropteroic acid ml-Glutamic acid matp Mg2+, K+ leads to Dihydrofolic acid + ADP + Pi. These results suggest that the systematic name for the dihydrofolate synthetase is 7,8-dihydropteroate: L-glutamate ligase (ADP).

  4. Simultaneous identification and verification of Bacillus anthracis.

    PubMed

    Krishnamurthy, Thaiya; Hewel, Johannes; Bonzagni, Neil J; Dabbs, Jason; Bull, Robert L; Yates, John R

    2006-01-01

    Specific identification of Bacillus anthracis (B. anthracis) is vital for the accurate treatment of afflicted personnel during biological warfare situations and civilian terrorist attacks. In order to accomplish this, we have subjected the lysates from B. anthracis to affinity purification using monoclonal antibodies for the selected antigenic protein present in the bacteria. The bound antigenic protein was identified by multi-dimensional protein identification technology (MudPIT) to be a surface layer protein EA1. The same antigen was identified from the lysates from a few strains of B. anthracis demonstrating the observation to be common for B. anthracis strains. Hence, this presents an effective pathway for the identification of the bacteria present in unknown samples of various origins. Generation of a database containing the EA1 protein has been found to be useful in the database search of unknown samples.

  5. Chemical Ligation and Isotope Labeling to Locate Dynamic Effects during Catalysis by Dihydrofolate Reductase†

    PubMed Central

    Luk, Louis Y. P.; Ruiz‐Pernía, J. Javier; Adesina, Aduragbemi S.; Loveridge, E. Joel

    2015-01-01

    Abstract Chemical ligation has been used to alter motions in specific regions of dihydrofolate reductase from E. coli and to investigate the effects of localized motional changes on enzyme catalysis. Two isotopic hybrids were prepared; one with the mobile N‐terminal segment containing heavy isotopes (2H, 13C, 15N) and the remainder of the protein with natural isotopic abundance, and the other one with only the C‐terminal segment isotopically labeled. Kinetic investigations indicated that isotopic substitution of the N‐terminal segment affected only a physical step of catalysis, whereas the enzyme chemistry was affected by protein motions from the C‐terminal segment. QM/MM studies support the idea that dynamic effects on catalysis mostly originate from the C‐terminal segment. The use of isotope hybrids provides insights into the microscopic mechanism of dynamic coupling, which is difficult to obtain with other studies, and helps define the dynamic networks of intramolecular interactions central to enzyme catalysis. PMID:26079622

  6. STRUCTURE OF THE TYPE III PANTOTHENATE KINASE FROM Bacillus anthracis AT 2.0 Å RESOLUTION

    PubMed Central

    Nicely, Nathan I.; Parsonage, Derek; Paige, Carleitta; Newton, Gerald L.; Fahey, Robert C.; Leonardi, Roberta; Jackowski, Suzanne; Mallett, T. Conn; Claiborne, Al

    2008-01-01

    Coenzyme A (CoASH) is the major low-molecular weight thiol in Staphylococcus aureus and a number of other bacteria; the crystal structure of the S. aureus coenzyme A-disulfide reductase (CoADR), which maintains the reduced intracellular state of CoASH, has recently been reported [Mallett, T.C., Wallen, J.R., Karplus, P.A., Sakai, H., Tsukihara, T., and Claiborne, A. (2006) Biochemistry 45, 11278-11289]. In this report we demonstrate that CoASH is the major thiol in Bacillus anthracis; a bioinformatics analysis indicates that three of the four proteins responsible for the conversion of pantothenate (Pan) to CoASH in Escherichia coli are conserved in B. anthracis. In contrast, a novel type III pantothenate kinase (PanK) catalyzes the first committed step in the biosynthetic pathway in B. anthracis; unlike the E. coli type I PanK, this enzyme is not subject to feedback inhibition by CoASH. The crystal structure of B. anthracis PanK (BaPanK), solved using multiwavelength anomalous dispersion data and refined at a resolution of 2.0 Å, demonstrates that BaPanK is a new member of the Acetate and Sugar Kinase/Hsc70/Actin (ASKHA) superfamily. The Pan and ATP substrates have been modeled into the active-site cleft; in addition to providing a clear rationale for the absence of CoASH inhibition, analysis of the Pan-binding pocket has led to the development of two new structure-based motifs (the PAN and INTERFACE motifs). Our analyses also suggest that the type III PanK in the spore-forming B. anthracis plays an essential role in the novel thiol/disulfide redox biology of this category A biodefense pathogen. PMID:17323930

  7. Bacillus anthracis factors for phagosomal escape.

    PubMed

    Tonello, Fiorella; Zornetta, Irene

    2012-07-01

    The mechanism of phagosome escape by intracellular pathogens is an important step in the infectious cycle. During the establishment of anthrax, Bacillus anthracis undergoes a transient intracellular phase in which spores are engulfed by local phagocytes. Spores germinate inside phagosomes and grow to vegetative bacilli, which emerge from their resident intracellular compartments, replicate and eventually exit from the plasma membrane. During germination, B. anthracis secretes multiple factors that can help its resistance to the phagocytes. Here the possible role of B. anthracis toxins, phospholipases, antioxidant enzymes and capsules in the phagosomal escape and survival, is analyzed and compared with that of factors of other microbial pathogens involved in the same type of process.

  8. Thioredoxin reductase.

    PubMed Central

    Mustacich, D; Powis, G

    2000-01-01

    The mammalian thioredoxin reductases (TrxRs) are a family of selenium-containing pyridine nucleotide-disulphide oxidoreductases with mechanistic and sequence identity, including a conserved -Cys-Val-Asn-Val-Gly-Cys- redox catalytic site, to glutathione reductases. TrxRs catalyse the NADPH-dependent reduction of the redox protein thioredoxin (Trx), as well as of other endogenous and exogenous compounds. The broad substrate specificity of mammalian TrxRs is due to a second redox-active site, a C-terminal -Cys-SeCys- (where SeCys is selenocysteine), that is not found in glutathione reductase or Escherichia coli TrxR. There are currently two confirmed forms of mammalian TrxRs, TrxR1 and TrxR2, and it is possible that other forms will be identified. The availability of Se is a key factor determining TrxR activity both in cell culture and in vivo, and the mechanism(s) for the incorporation of Se into TrxRs, as well as the regulation of TrxR activity, have only recently begun to be investigated. The importance of Trx to many aspects of cell function make it likely that TrxRs also play a role in protection against oxidant injury, cell growth and transformation, and the recycling of ascorbate from its oxidized form. Since TrxRs are able to reduce a number of substrates other than Trx, it is likely that additional biological effects will be discovered for TrxR. Furthermore, inhibiting TrxR with drugs may lead to new treatments for human diseases such as cancer, AIDS and autoimmune diseases. PMID:10657232

  9. Morphogenesis of the Bacillus anthracis Spore

    DTIC Science & Technology

    2007-02-01

    major layers: a darkly staining outer layer and a lighter- staining inner layer (1, 86). In contrast, the Bacillus anthracis coat appears thin and...pyruvate. Spore survival was measured by in vitro assays, and spores were observed within macrophages by staining as described previously by Welkos et al...proteins. Spore extracts were fractionated on 15% polyacrylamide gels and stained with Coomassie brilliant blue. Lanes: 1, Sterne strain of B. anthracis

  10. Structure of the dihydrofolate reductase gene in Chinese hamster ovary cells.

    PubMed

    Carothers, A M; Urlaub, G; Ellis, N; Chasin, L A

    1983-04-11

    Overlapping recombinant lambda 1059 phages carrying regions of the dhfr locus from the amplified Chinese hamster ovary (CHO) cell clone MK42 have been isolated. In addition, dhfr cDNAs from this cell line have been cloned into plasmid pBR322. Restriction analysis of these recombinant molecules has led to a map of the Chinese hamster dhfr gene. This gene has a minimum size of 26 kb and contains six exons as defined by hybridization to a combination of mouse and CHO cDNA probes. The latter probes reveal 3' exonic sequences that are not present in mouse cDNA. The CHO dhfr gene thus extends about 700 bp further 3' than in the mouse, consistent with the larger size of the hamster mRNA. At least five intervening sequences are present, of approximate sizes: 0.3, 2.5, 8.6, 2.6 and 9.4 kb. Four sequences from highly repeated families are situated in introns within the dhfr gene. The overall structure of this gene is strikingly similar to that of the mouse. Evolutionary conservation of interrupted gene structure among mammals thus extends to genes that code for household enzymes as well as specialized or structural proteins.

  11. Mutations in Plasmodium falciparum dihydrofolate reductase and dihydropteroate synthase genes in Senegal.

    PubMed

    Ndiaye, D; Daily, J P; Sarr, O; Ndir, O; Gaye, O; Mboup, S; Wirth, D F

    2005-11-01

    Senegal recently (2004) switched to sulfadoxine-pyrimethamine (SP) with amodiaquine as first line therapy for malaria in response to increasing chloroquine resistance. In anticipation of emerging resistance to SP as a result of this change in drug pressure, we set out to define the baseline prevalence of SP-associated mutations in the dhfr and dhps genes in Plasmodium falciparum using geographically diverse and longitudinally collected samples. A total of 153 blood samples were analysed from patients (5 years or older) with mild malaria after informed consent was obtained. Longitudinal samples were collected between 2000 and 2003 in Pikine, a suburb of Dakar. Geographically diverse site sampling was carried out in 2003. The mutation prevalence in DHFR codons 51, 59 and 108 is 65%, 61% and 78% in Pikine, 2003. The overall prevalence of the triple mutation that is associated with high-level pyrimethamine resistance is 61%. The mutation prevalence rate in DHPS codons 436 and 437 is 21% and 40%, respectively. There is significant geographic variation in genotypic resistance, as samples from Pikine in 2003 had higher mutation prevalence in the pfdhfr and pfdhps genes compared to samples from Tambacounda (P < 0.015). In summary, this study demonstrates a high background prevalence of SP resistance mutations already present in P. falciparum in Senegal.

  12. Real-Time PCR for Dihydrofolate Reductase Gene Single-Nucleotide Polymorphisms in Plasmodium vivax Isolates

    PubMed Central

    Brega, Sara; de Monbrison, Frédérique; Severini, Carlo; Udomsangpetch, Rachanee; Sutanto, Inge; Ruckert, Paul; Peyron, François; Picot, Stéphane

    2004-01-01

    Mutations in the dhfr gene of Plasmodium vivax (pvdhfr) are associated with resistance to the antifolate antimalarial drugs. Polymorphisms in the pvdhfr gene were assessed by hybridization probe technology on the LightCycler instrument with 134 P. vivax-infected blood samples from Turkey (n = 24), Azerbaijan (n = 39), Thailand (n = 16), Indonesia (n = 53), and travelers (n = 19). Double mutations (S58R and S117N) or quadruple mutations (F57L/I, S58R, T61M, and S117N) in the pvdhfr genes were found in all Thai samples (100%). pvdhfr mutant-type alleles were significantly more common in samples from travelers (42%) than in those from patients from Indonesia (5%). Surprisingly, the pvdhfr single-mutation allele (S117N) was identified at a high frequency in parasites from Turkey and Azerbaijan (71 and 36%, respectively), where sulfadoxine-pyrimethamine is not recommended for the treatment of P. vivax malaria by the World Health Organization and the Malaria National Programs. PMID:15215112

  13. Transposon Tn916 mutagenesis in Bacillus anthracis.

    PubMed Central

    Ivins, B E; Welkos, S L; Knudson, G B; Leblanc, D J

    1988-01-01

    Mutagenesis of Bacillus anthracis by the streptococcal tetracycline resistance transposon Tn916 is described. Tn916 was transferred from Streptococcus faecalis DS16C1 to B. anthracis VNR-1 by conjugation in a standard filter mating procedure. Tetracycline-resistant (Tcr) transconjugants were obtained at a frequency of 1.6 X 10(-8) per donor CFU. When donor and recipient cells were treated with nafcillin before conjugation, the frequency was increased nearly 10-fold. Nafcillin pretreatment of donor and recipient strains was used in all subsequent conjugation experiments. S.faecalis CG110, containing multiple chromosomal insertions of Tn916, transferred the transposon to B. anthracis VNR-1 at a frequency of 9.3 x 10(-5). A Tcr B. anthracis transconjugant, strain VNR-1-tet-1, transferred Tn916 to B. anthracis UM23-1 and Bacillus subtilis BST1 at frequencies of 2.1 x 10(-4) and 5.8 X 10(-6), respectively. The transfer of Tn916 occurred only on membrane filters, since no Tcr transconjugants were obtained when strains VNR-1-tet-1 and UM23-1 were mixed and incubated in broth culture. The presence of the Tn916-associated tetM gene in Tcr B. anthracis and B. subtilis transconjugants was confirmed in hybridization experiments by using a 5-kilobase-pair DNA fragment containing the tetM gene as a probe. Of 3,000 B. anthracis UM23-1 Tcr transconjugants tested, 21 were phenylalanine auxotrophs and 2 were auxotrophic for phenylalanine, tyrosine, and tryptophan. Images PMID:2826334

  14. Morphogenesis of the Bacillus anthracis Spore▿

    PubMed Central

    Giorno, Rebecca; Bozue, Joel; Cote, Christopher; Wenzel, Theresa; Moody, Krishna-Sulayman; Mallozzi, Michael; Ryan, Matthew; Wang, Rong; Zielke, Ryszard; Maddock, Janine R.; Friedlander, Arthur; Welkos, Susan; Driks, Adam

    2007-01-01

    Bacillus spp. and Clostridium spp. form a specialized cell type, called a spore, during a multistep differentiation process that is initiated in response to starvation. Spores are protected by a morphologically complex protein coat. The Bacillus anthracis coat is of particular interest because the spore is the infective particle of anthrax. We determined the roles of several B. anthracis orthologues of Bacillus subtilis coat protein genes in spore assembly and virulence. One of these, cotE, has a striking function in B. anthracis: it guides the assembly of the exosporium, an outer structure encasing B. anthracis but not B. subtilis spores. However, CotE has only a modest role in coat protein assembly, in contrast to the B. subtilis orthologue. cotE mutant spores are fully virulent in animal models, indicating that the exosporium is dispensable for infection, at least in the context of a cotE mutation. This has implications for both the pathophysiology of the disease and next-generation therapeutics. CotH, which directs the assembly of an important subset of coat proteins in B. subtilis, also directs coat protein deposition in B. anthracis. Additionally, however, in B. anthracis, CotH effects germination; in its absence, more spores germinate than in the wild type. We also found that SpoIVA has a critical role in directing the assembly of the coat and exosporium to an area around the forespore. This function is very similar to that of the B. subtilis orthologue, which directs the assembly of the coat to the forespore. These results show that while B. anthracis and B. subtilis rely on a core of conserved morphogenetic proteins to guide coat formation, these proteins may also be important for species-specific differences in coat morphology. We further hypothesize that variations in conserved morphogenetic coat proteins may play roles in taxonomic variation among species. PMID:17114257

  15. Specific identification of Bacillus anthracis strains

    NASA Astrophysics Data System (ADS)

    Krishnamurthy, Thaiya; Deshpande, Samir; Hewel, Johannes; Liu, Hongbin; Wick, Charles H.; Yates, John R., III

    2007-01-01

    Accurate identification of human pathogens is the initial vital step in treating the civilian terrorism victims and military personnel afflicted in biological threat situations. We have applied a powerful multi-dimensional protein identification technology (MudPIT) along with newly generated software termed Profiler to identify the sequences of specific proteins observed for few strains of Bacillus anthracis, a human pathogen. Software termed Profiler was created to initially screen the MudPIT data of B. anthracis strains and establish the observed proteins specific for its strains. A database was also generated using Profiler containing marker proteins of B. anthracis and its strains, which in turn could be used for detecting the organism and its corresponding strains in samples. Analysis of the unknowns by our methodology, combining MudPIT and Profiler, led to the accurate identification of the anthracis strains present in samples. Thus, a new approach for the identification of B. anthracis strains in unknown samples, based on the molecular mass and sequences of marker proteins, has been ascertained.

  16. Environmental sampling for spores of Bacillus anthracis.

    PubMed

    Teshale, Eyasu H; Painter, John; Burr, Gregory A; Mead, Paul; Wright, Scott V; Cseh, Larry F; Zabrocki, Ronald; Collins, Rick; Kelley, Kathy A; Hadler, James L; Swerdlow, David L

    2002-10-01

    On November 11, 2001, following the bioterrorism-related anthrax attacks, the U.S. Postal Service collected samples at the Southern Connecticut Processing and Distribution Center; all samples were negative for Bacillus anthracis. After a patient in Connecticut died from inhalational anthrax on November 19, the center was sampled again on November 21 and 25 by using dry and wet swabs. All samples were again negative for B. anthracis. On November 28, guided by information from epidemiologic investigation, we sampled the site extensively with wet wipes and surface vacuum sock samples (using HEPA vacuum). Of 212 samples, 6 (3%) were positive, including one from a highly contaminated sorter. Subsequently B. anthracis was also detected in mail-sorting bins used for the patient's carrier route. These results suggest cross-contaminated mail as a possible source of anthrax for the inhalational anthrax patient in Connecticut. In future such investigations, extensive sampling guided by epidemiologic data is imperative.

  17. Genetic variability of Bacillus anthracis and related species.

    PubMed Central

    Harrell, L J; Andersen, G L; Wilson, K H

    1995-01-01

    We evaluated the abilities of pulsed-field gel electrophoresis (PFGE) and sequences of intergenic spacer regions (ISRs) between two highly conserved genes, 16S-23S rDNA and gyrB-gyrA ISRs, to detect variation in strains of Bacillus anthracis as well as two closely related species, B. cereus ATCC 14579 and B. mycoides ATCC 6462. For each restriction enzyme, (NotI, SfiI, and SmaI), the PFGE banding patterns for three B. anthracis strains (Ames, Vollum, and Sterne) were identical. However, closely related species could be differentiated from B. anthracis and from each other. PCR amplification of the 16S-23S rDNA ISR yielded a 143- to 144-bp fragment, showing identical sequences for B. anthracis strains, one nucleotide deletion between B. cerus and B. anthracis, and 13 nucleotide differences between B. mycoides and B. anthracis. The gyrase ISR sequences (121 bp) in B. anthracis strains were also identical, but those in B. cereus and B. mycoides differed from that in B. anthracis by 1 and 2 nucleotides, respectively, and from each other by only 1 nucleotide. Given the diverse geographic origins of these B. anthracis strains, this species is very homogenous. We conclude that methods such as PFGE and sequences of ISRs may be useful in separating B. anthracis from closely related species, but more sensitive methods are needed for strain identification of B. anthracis. PMID:7665658

  18. Methyl Iodide Fumigation of Bacillus anthracis Spores.

    PubMed

    Sutton, Mark; Kane, Staci R; Wollard, Jessica R

    2015-09-01

    Fumigation techniques such as chlorine dioxide, vaporous hydrogen peroxide, and paraformaldehyde previously used to decontaminate items, rooms, and buildings following contamination with Bacillus anthracis spores are often incompatible with materials (e.g., porous surfaces, organics, and metals), causing damage or residue. Alternative fumigation with methyl bromide is subject to U.S. and international restrictions due to its ozone-depleting properties. Methyl iodide, however, does not pose a risk to the ozone layer and has previously been demonstrated as a fumigant for fungi, insects, and nematodes. Until now, methyl iodide has not been evaluated against Bacillus anthracis. Sterne strain Bacillus anthracis spores were subjected to methyl iodide fumigation at room temperature and at 550C. Efficacy was measured on a log-scale with a 6-log reduction in CFUs being considered successful compared to the U.S. Environmental Protection Agency biocide standard. Such efficacies were obtained after just one hour at 55 °C and after 12 hours at room temperature. No detrimental effects were observed on glassware, PTFE O-rings, or stainless steel. This is the first reported efficacy of methyl iodide in the reduction of Bacillus anthracis spore contamination at ambient and elevated temperatures.

  19. Formation of Spheroplasts from Bacillus anthracis

    PubMed Central

    Chatterjee, B. R.; Williams, Robert P.

    1965-01-01

    Chatterjee, B. R. (Baylor University College of Medicine, Houston, Tex.), and Robert P. Williams. Formation of spheroplasts from Bacillus anthracis. J. Bacteriol. 89:1128–1133. 1965.—Spheroplasts were prepared from Bacillus anthracis by combined treatment with lysozyme and glycine. Glycine, at a final concentration of 3%, was added to cultures of B. anthracis in nutrient broth that had grown at 37 C for 16 to 18 hr under 50% CO2. After additional incubation under CO2 for 2 hr, lysozyme, at the appropriate concentration (50 to 100 μg/ml), and sucrose, to a concentration of 15%, were added, and incubation was continued for 2 to 6 hr in CO2. At the end of this period, incubation in CO2 was discontinued. Spheroplasts formed after incubation in air for 6 to 12 hr. Lysozyme alone exhibited the same effect when added at much higher concentrations (500 to 2,000 μg/ml) to cultures growing under CO2. No spheroplasts formed when cultures were treated with glycine alone. Treatment with lysozyme was more effective on smooth strains than rough. Cells from young cultures were more susceptible to lysozyme than older cells. CO2 apparently was essential for formation of spheroplasts from B. anthracis. Images PMID:14276107

  20. Bovine Bacillus anthracis in Cameroon ▿ †

    PubMed Central

    Pilo, Paola; Rossano, Alexandra; Bamamga, Hamadou; Abdoulkadiri, Souley; Perreten, Vincent; Frey, Joachim

    2011-01-01

    Bovine Bacillus anthracis isolates from Cameroon were genetically characterized. They showed a strong homogeneity, and they belong, together with strains from Chad, to cluster Aβ, which appears to be predominant in western Africa. However, one strain that belongs to a newly defined clade (D) and cluster (D1) is penicillin resistant and shows certain phenotypes typical of Bacillus cereus. PMID:21705535

  1. Bacillus anthracis spore decontamination in food grease.

    PubMed

    Amoako, Kingsley K; Santiago-Mateo, Kristina; Shields, Michael J; Rohonczy, Elizabeth

    2013-04-01

    Bacillus anthracis Sterne strain spores were analyzed for their resistance against five disinfectants: commercial sodium hypochlorite, Spor-Klenz Ready-to-Use Cold Sterilant, accelerated hydrogen peroxide (AHP), Virkon, and surface decontamination foam (SDF). The aim of this study was to find an effective disinfectant that would reduce the viability of B. anthracis Sterne spores at ≥6 log in the presence of variables such as animal grease and fat, stainless steel, and temperature (room temperature and 4 °C). SDF and 10% sodium hypochlorite consistently reduced the growth of viable B. anthracis Sterne spores after 5 min in the presence of stainless steel at room temperature. It took at least 10 min of contact time for AHP to consistently reduce spore growth by ≥6 log, while it took at least 20 min for 5% bleach and Spor-Klenz to consistently inactivate ≥6 log spores in the presence of stainless steel at room temperature. AHP was the only disinfectant that reduced the viability of B. anthracis Sterne spores at ≥6 log in the presence of stainless steel and animal grease, both at room temperature and 4 °C after 24 h of contact time.

  2. Demonstration of a Capsule Plasmid in Bacillus anthracis,

    DTIC Science & Technology

    1984-11-16

    certain avirulent strains of Bacillus anthracis harbor a plasmid, designated pXO2, which is involved in the synthesis of capsules. Two classes of rougv...ABSTRACT (cont’d) acquired pXO2 produced capsules under the same conditions required for capsule synthesis by B. anthracis. SEUIYCASFCTO.FTMSP4~e mmEtrd a...4 ABSTRACT irulent and certain avirulent strains of Bacillus anthracis harbor a plasmid, designated pXO2, which is involved in the synthesis of

  3. Comparative Secretome Analyses of Three Bacillus anthracis Strains with Variant Plasmid Contents

    PubMed Central

    Lamonica, Janine M.; Wagner, MaryAnn; Eschenbrenner, Michel; Williams, Leanne E.; Miller, Tabbi L.; Patra, Guy; DelVecchio, Vito G.

    2005-01-01

    Bacillus anthracis, the causative agent of anthrax, secretes numerous proteins into the extracellular environment during infection. A comparative proteomic approach was employed to elucidate the differences among the extracellular proteomes (secretomes) of three isogenic strains of B. anthracis that differed solely in their plasmid contents. The strains utilized were the wild-type virulent B. anthracis RA3 (pXO1+ pXO2+) and its two nonpathogenic derivative strains: the toxigenic, nonencapsulated RA3R (pXO1+ pXO2−) and the totally cured, nontoxigenic, nonencapsulated RA3:00 (pXO1− pXO2−). Comparative proteomics using two-dimensional gel electrophoresis followed by computer-assisted gel image analysis was performed to reveal unique, up-regulated, or down-regulated secretome proteins among the strains. In total, 57 protein spots, representing 26 different proteins encoded on the chromosome or pXO1, were identified by peptide mass fingerprinting. S-layer-derived proteins, such as Sap and EA1, were most frequently observed. Many sporulation-associated enzymes were found to be overexpressed in strains containing pXO1+. This study also provides evidence that pXO2 is necessary for the maximal expression of the pXO1-encoded toxins lethal factor (LF), edema factor (EF), and protective antigen (PA). Several newly identified putative virulence factors were observed; these include enolase, a high-affinity zinc uptake transporter, the peroxide stress-related alkyl hydroperoxide reductase, isocitrate lyase, and the cell surface protein A. PMID:15908394

  4. Fatal meningoencephalitis due to Bacillus anthracis.

    PubMed

    Kwong, K L; Que, T L; Wong, S N; So, K T

    1997-12-01

    We report the first case of fatal anthrax meningoencephalitis in Hong Kong over the past 60 years. A 13 year-old boy presented with right lower quadrant pain, diarrhoea and progressive headache. Lumbar puncture yielded gram positive bacilli initially thought to be Bacillus cereus, a contaminant. He was treated with ampicillin and cefotaxime, but died 3 days after hospitalization. The organism isolated from blood and cerebrospinal fluid was later identified as Bacillus anthracis.

  5. Structure-based design of pteridine reductase inhibitors targeting African sleeping sickness and the leishmaniases.

    PubMed

    Tulloch, Lindsay B; Martini, Viviane P; Iulek, Jorge; Huggan, Judith K; Lee, Jeong Hwan; Gibson, Colin L; Smith, Terry K; Suckling, Colin J; Hunter, William N

    2010-01-14

    Pteridine reductase (PTR1) is a target for drug development against Trypanosoma and Leishmania species, parasites that cause serious tropical diseases and for which therapies are inadequate. We adopted a structure-based approach to the design of novel PTR1 inhibitors based on three molecular scaffolds. A series of compounds, most newly synthesized, were identified as inhibitors with PTR1-species specific properties explained by structural differences between the T. brucei and L. major enzymes. The most potent inhibitors target T. brucei PTR1, and two compounds displayed antiparasite activity against the bloodstream form of the parasite. PTR1 contributes to antifolate drug resistance by providing a molecular bypass of dihydrofolate reductase (DHFR) inhibition. Therefore, combining PTR1 and DHFR inhibitors might improve therapeutic efficacy. We tested two new compounds with known DHFR inhibitors. A synergistic effect was observed for one particular combination highlighting the potential of such an approach for treatment of African sleeping sickness.

  6. New transposon delivery plasmids for insertional mutagenesis in Bacillus anthracis

    PubMed Central

    Wilson, Adam C.; Perego, Marta; Hoch, James A.

    2007-01-01

    Two new transposon delivery vector systems utilizing Mariner and mini-Tn10 transposons have been developed for in vivo insertional mutagenesis in Bacillus anthracis and other compatible Gram-positive species. The utility of both systems was directly demonstrated through the mutagenesis of a widely used B. anthracis strain. PMID:17931726

  7. Genome Sequence of Bacillus anthracis Strain Tangail-1 from Bangladesh

    PubMed Central

    Rume, Farzana Islam; Braun, Peter; Biswas, Paritosh Kumar; Yasmin, Mahmuda; Grass, Gregor; Ahsan, Chowdhury Rafiqul; Hanczaruk, Matthias

    2016-01-01

    Soil was collected in July 2013 at a site where a cow infected with anthrax had been the month before. Selective culturing yielded Bacillus anthracis strain Tangail-1. Here, we report the draft genome sequence of this Bacillus anthracis isolate that belongs to the canonical A.Br.001/002 clade. PMID:27469968

  8. Interactions between Bacillus anthracis and Plants May Promote Anthrax Transmission

    PubMed Central

    Ganz, Holly H.; Turner, Wendy C.; Brodie, Eoin L.; Kusters, Martina; Shi, Ying; Sibanda, Heniritha; Torok, Tamas; Getz, Wayne M.

    2014-01-01

    Environmental reservoirs are essential in the maintenance and transmission of anthrax but are poorly characterized. The anthrax agent, Bacillus anthracis was long considered an obligate pathogen that is dormant and passively transmitted in the environment. However, a growing number of laboratory studies indicate that, like some of its close relatives, B. anthracis has some activity outside of its vertebrate hosts. Here we show in the field that B. anthracis has significant interactions with a grass that could promote anthrax spore transmission to grazing hosts. Using a local, virulent strain of B. anthracis, we performed a field experiment in an enclosure within a grassland savanna. We found that B. anthracis increased the rate of establishment of a native grass (Enneapogon desvauxii) by 50% and that grass seeds exposed to blood reached heights that were 45% taller than controls. Further we detected significant effects of E. desvauxii, B. anthracis, and their interaction on soil bacterial taxa richness and community composition. We did not find any evidence for multiplication or increased longevity of B. anthracis in bulk soil associated with grass compared to controls. Instead interactions between B. anthracis and plants may result in increased host grazing and subsequently increased transmission to hosts. PMID:24901846

  9. Identifying experimental surrogates for Bacillus anthracis spores: a review

    PubMed Central

    2010-01-01

    Bacillus anthracis, the causative agent of anthrax, is a proven biological weapon. In order to study this threat, a number of experimental surrogates have been used over the past 70 years. However, not all surrogates are appropriate for B. anthracis, especially when investigating transport, fate and survival. Although B. atrophaeus has been widely used as a B. anthracis surrogate, the two species do not always behave identically in transport and survival models. Therefore, we devised a scheme to identify a more appropriate surrogate for B. anthracis. Our selection criteria included risk of use (pathogenicity), phylogenetic relationship, morphology and comparative survivability when challenged with biocides. Although our knowledge of certain parameters remains incomplete, especially with regards to comparisons of spore longevity under natural conditions, we found that B. thuringiensis provided the best overall fit as a non-pathogenic surrogate for B. anthracis. Thus, we suggest focusing on this surrogate in future experiments of spore fate and transport modelling. PMID:21092338

  10. Bacillus anthracis aerosolization associated with a contaminated mail sorting machine.

    PubMed

    Dull, Peter M; Wilson, Kathy E; Kournikakis, Bill; Whitney, Ellen A S; Boulet, Camille A; Ho, Jim Y W; Ogston, Jim; Spence, Mel R; McKenzie, Megan M; Phelan, Maureen A; Popovic, Tanja; Ashford, David

    2002-10-01

    On October 12, 2001, two envelopes containing Bacillus anthracis spores passed through a sorting machine in a postal facility in Washington, D.C. When anthrax infection was identified in postal workers 9 days later, the facility was closed. To determine if exposure to airborne B. anthracis spores continued to occur, we performed air sampling around the contaminated sorter. One CFU of B. anthracis was isolated from 990 L of air sampled before the machine was activated. Six CFUs were isolated during machine activation and processing of clean dummy mail. These data indicate that an employee working near this machine might inhale approximately 30 B. anthracis-containing particles during an 8-h work shift. What risk this may have represented to postal workers is not known, but this estimate is approximately 20-fold less than a previous estimate of sub-5 micro m B. anthracis-containing particles routinely inhaled by asymptomatic, unvaccinated workers in a goat-hair mill.

  11. Real-Time PCR Identification of Unique Bacillus anthracis Sequences.

    PubMed

    Cieślik, P; Knap, J; Kolodziej, M; Mirski, T; Joniec, J; Graniak, G; Zakowska, D; Winnicka, I; Bielawska-Drózd, A

    2015-01-01

    Bacillus anthracis is a spore-forming, Gram-positive microorganism. It is a causative agent of anthrax, a highly infectious disease. It belongs to the "Bacillus cereus group", which contains other closely related species, including Bacillus cereus, Bacillus thuringiensis, Bacillus mycoides, Bacillus weihenstephanensis, and Bacillus pseudomycoides. B. anthracis naturally occurs in soil environments. The BA5345 genetic marker was used for highly specific detection of B. anthracis with TaqMan probes. The detection limit of a real-time PCR assay was estimated at the level of 16.9 copies (CI95% - 37.4 to 37.86, SD = 0.2; SE = 0.118). Oligonucleotides designed for the targeted sequences (within the tested locus) revealed 100 % homology to B. anthracis strain reference sequences deposited in the database (NCBI) and high specificity to all tested B. anthracis strains. Additional in silico analysis of plasmid markers pag and cap genes with B. anthracis strains included in the database was carried out. Our study clearly indicates that the BA5345 marker can be used with success as a chromosomal marker in routine identification of B. anthracis; moreover, detection of plasmid markers indicates virulence of the examined strains.

  12. Structure of the Type III Pantothenate Kinase from Bacillus Anthracis at 2.0 A Resolution: Implications for Coenzyme A-Dependent Redox Biology

    SciTech Connect

    Nicely,N.; Parsonage, D.; Paige, C.; Newton, G.; Fahey, R.; Leonardi, R.; Jackowski, S.; Mallett, T.; Claiborne, A.

    2007-01-01

    Coenzyme A (CoASH) is the major low-molecular weight thiol in Staphylococcus aureus and a number of other bacteria; the crystal structure of the S. aureus coenzyme A-disulfide reductase (CoADR), which maintains the reduced intracellular state of CoASH, has recently been reported [Mallett, T.C., Wallen, J.R., Karplus, P.A., Sakai, H., Tsukihara, T., and Claiborne, A. (2006) Biochemistry 45, 11278-89]. In this report we demonstrate that CoASH is the major thiol in Bacillus anthracis; a bioinformatics analysis indicates that three of the four proteins responsible for the conversion of pantothenate (Pan) to CoASH in Escherichia coli are conserved in B. anthracis. In contrast, a novel type III pantothenate kinase (PanK) catalyzes the first committed step in the biosynthetic pathway in B. anthracis; unlike the E. coli type I PanK, this enzyme is not subject to feedback inhibition by CoASH. The crystal structure of B. anthracis PanK (BaPanK), solved using multiwavelength anomalous dispersion data and refined at a resolution of 2.0 {angstrom}, demonstrates that BaPanK is a new member of the Acetate and Sugar Kinase/Hsc70/Actin (ASKHA) superfamily. The Pan and ATP substrates have been modeled into the active-site cleft; in addition to providing a clear rationale for the absence of CoASH inhibition, analysis of the Pan-binding pocket has led to the development of two new structure-based motifs (the PAN and INTERFACE motifs). Our analyses also suggest that the type III PanK in the spore-forming B. anthracis plays an essential role in the novel thiol/disulfide redox biology of this category A biodefense pathogen.

  13. The crystal structure of the bifunctional deaminase/reductase RibD of the riboflavin biosynthetic pathway in Escherichia coli: implications for the reductive mechanism.

    PubMed

    Stenmark, Pål; Moche, Martin; Gurmu, Daniel; Nordlund, Pär

    2007-10-12

    We have determined the crystal structure of the bi-functional deaminase/reductase enzyme from Escherichia coli (EcRibD) that catalyzes two consecutive reactions during riboflavin biosynthesis. The polypeptide chain of EcRibD is folded into two domains where the 3D structure of the N-terminal domain (1-145) is similar to cytosine deaminase and the C-terminal domain (146-367) is similar to dihydrofolate reductase. We showed that EcRibD is dimeric and compared our structure to tetrameric RibG, an ortholog from Bacillus subtilis (BsRibG). We have also determined the structure of EcRibD in two binary complexes with the oxidized cofactor (NADP(+)) and with the substrate analogue ribose-5-phosphate (RP5) and superposed these two in order to mimic the ternary complex. Based on this superposition we propose that the invariant Asp200 initiates the reductive reaction by abstracting a proton from the bound substrate and that the pro-R proton from C4 of the cofactor is transferred to C1 of the substrate. A highly flexible loop is found in the reductase active site (159-173) that appears to control cofactor and substrate binding to the reductase active site and was therefore compared to the corresponding Met20 loop of E. coli dihydrofolate reductase (EcDHFR). Lys152, identified by comparing substrate analogue (RP5) coordination in the reductase active site of EcRibD with the homologous reductase from Methanocaldococcus jannaschii (MjaRED), is invariant among bacterial RibD enzymes and could contribute to the various pathways taken during riboflavin biosynthesis in bacteria and yeast.

  14. Murine Macrophages Kill the Vegetative Form of Bacillus anthracis

    DTIC Science & Technology

    2005-08-18

    inhibitor of the germination of B. anthracis and Bacillus cereus spores. It converts L-alanine to D-alanine, an isomer that is not recognized by...nation of Bacillus cereus spores in response to L-alanine and to inosine: the roles of gerL and gerQ operons. Microbiology 148:2089–2095. 5. Dixon, T...anthracis. J. Appl. Bacteriol. 62:269–273. 32. Todd, S. J., A. J. Moir, M. J. Johnson, and A. Moir. 2003. Genes of Bacillus cereus and Bacillus anthracis

  15. Inadvertent laboratory exposure to Bacillus anthracis--California, 2004.

    PubMed

    2005-04-01

    On June 9, 2004, the California Department of Health Services (CDHS) was notified of possible inadvertent exposure to Bacillus anthracis spores at Children's Hospital Oakland Research Institute (CHORI), where workers were evaluating the immune response of mice to B. anthracis. This report summarizes the subsequent investigation by CDHS and CDC, including assessment of exposures, administration of postexposure chemoprophylaxis, and serologic testing of potentially exposed workers. The findings underscore the importance of using appropriate biosafety practices and performing adequate sterility testing when working with material believed to contain inactivated B. anthracis organisms.

  16. Quinone Reductase 2 Is a Catechol Quinone Reductase

    SciTech Connect

    Fu, Yue; Buryanovskyy, Leonid; Zhang, Zhongtao

    2008-09-05

    The functions of quinone reductase 2 have eluded researchers for decades even though a genetic polymorphism is associated with various neurological disorders. Employing enzymatic studies using adrenochrome as a substrate, we show that quinone reductase 2 is specific for the reduction of adrenochrome, whereas quinone reductase 1 shows no activity. We also solved the crystal structure of quinone reductase 2 in complexes with dopamine and adrenochrome, two compounds that are structurally related to catecholamine quinones. Detailed structural analyses delineate the mechanism of quinone reductase 2 specificity toward catechol quinones in comparison with quinone reductase 1; a side-chain rotational difference between quinone reductase 1 and quinone reductase 2 of a single residue, phenylalanine 106, determines the specificity of enzymatic activities. These results infer functional differences between two homologous enzymes and indicate that quinone reductase 2 could play important roles in the regulation of catecholamine oxidation processes that may be involved in the etiology of Parkinson disease.

  17. Agar Diffusion Method for the Differentiation of Bacillus anthracis

    PubMed Central

    Angelety, Lorell H.; Wright, George G.

    1971-01-01

    A method was developed for identification of Bacillus anthracis based on elaboration of protective antigen by individual colonies and its detection by double-diffusion precipitation in agar plates. Images PMID:4993230

  18. Inactivation of Bacillus anthracis Spores in Soil Matrices with ...

    EPA Pesticide Factsheets

    Report This report documents the results of a laboratory study designed to better understand the effectiveness of chlorine dioxide (ClO2) gas to decontaminate soil materials contaminated with Bacillus anthracis spores.

  19. Genetic Characterization of Bacillus anthracis 17 JB strain.

    PubMed

    Seyed-Mohamadi, Sakineh; Moradi Bidhendi, Soheila; Tadayon, Keyvan; Ghaderi, Rainak

    2015-06-01

    Bacillus anthracis is one of the most homogenous bacteria ever described. Some level of diversity. Bacillus anthracis 17JB is a laboratory strain It is broadly used as a challenge strain in guinea pigs for potency test of anthrax vaccine. This work describes genetic characterization of B. anthracis 17 JB strain using the SNPs and MLVA genotyping. In SNPs typing, the originally French 17JB strain represented the A.Br. 008/009 subgroup. In Levy's genotyping method, 843, 451 and 864 bp long fragments were identified at AA03, AJ03 and AA07 loci, respectively. In the vaccine manufacturer perspective these findings are much valuable on their own account, but similar research is required to extend molecular knowledge of B. anthracis epidemiology in Persia.

  20. Genetic Characterization of Bacillus anthracis 17 JB strain

    PubMed Central

    Seyed-Mohamadi, Sakineh; Moradi Bidhendi, Soheila; Tadayon, Keyvan; Ghaderi, Rainak

    2015-01-01

    Background and Objectives: Bacillus anthracis is one of the most homogenous bacteria ever described. Some level of diversity. Bacillus anthracis 17JB is a laboratory strain It is broadly used as a challenge strain in guinea pigs for potency test of anthrax vaccine. Material and Methods: This work describes genetic characterization of B. anthracis 17 JB strain using the SNPs and MLVA genotyping. Results and Conclusion: In SNPs typing, the originally French 17JB strain represented the A.Br. 008/009 subgroup. In Levy's genotyping method, 843, 451 and 864 bp long fragments were identified at AA03, AJ03 and AA07 loci, respectively. In the vaccine manufacturer perspective these findings are much valuable on their own account, but similar research is required to extend molecular knowledge of B. anthracis epidemiology in Persia. PMID:26668705

  1. Protocol for Detection of Bacillus anthracis in Environmental Samples

    EPA Pesticide Factsheets

    This pProtocol Method describes proceduresintended for the analyses of swabs, wipes, Sponge-Sticks, vacuum socks and filters, air filters, drinking water, and decontamination waste water for Bacillus anthracis spores.

  2. Composite Sampling of a Bacillus anthracis Surrogate with ...

    EPA Pesticide Factsheets

    Journal Article A series of experiments were conducted to explore the utility of composite-based collection of surface samples for the detection of a Bacillus anthracis surrogate using cellulose sponge samplers on a stainless steel surface.

  3. Microarray-based Resequencing of Multiple Bacillus anthracis Isolates

    DTIC Science & Technology

    2004-12-17

    The major technical challenge facing RA-based resequencing Radial tree showing inferred phylogenetic relationships of B. anthracis strains from this...studyFigure 3 Radial tree showing inferred phylogenetic relationships of B. anthracis strains from this study. The 37 variable positions identified in... Phylogenetic tree inference The 37 variable positions identified in this study were con- catenated together to create artificial sequence types. A DNA

  4. Development of a Manual Threshold Immunoassay for Bacillus anthracis Spores

    DTIC Science & Technology

    2005-11-01

    detected by the LAPS. The MT has been developed to detect several BW agents including ricin, Brucella melitensis (Lee et al., 2000), Venezuelan...and B. globigii. B. anthracis is closely related to B. cereus and B. thuringiensis, and they all produce a structurally similar exosporium (Steichen et...Jr. (2005). Orientation within the exosporium and structural stability of the collagen-like glycoprotein BclA of Bacillus anthracis. J Bacteriol

  5. Processing, Assembly and Localization of a Bacillus anthracis Spore Protein

    DTIC Science & Technology

    2010-01-01

    burden, to Washington Headquarters Services , Directorate for Information Operations and Reports, 1215 Jefferson Davis Highway, Suite 1204, Arlington VA...2003). The genome sequence of Bacillus anthracis Ames and comparison to closely related bacteria . Nature 423, 81–86. Redmond, C., Baillie, L. W., Hibbs...Sylvestre, P., Couture -Tosi, E. & Mock, M. (2003). Polymorphism in the collagen-like region of the Bacillus anthracis BclA protein leads to variation in

  6. Application of paramagnetic beads for purifying Bacillus anthracis protective antigen.

    PubMed

    Zarzecka, A; Bartoszcze, M

    2006-10-01

    Paramagnetic beads coated with Protein G and Tosylactivated-280 dynabeads have been used to purify Bacillus anthracis protective antigen from a liquid culture. The obtained protein was used in the enzyme-linked immunosorbent assay test to detect B. anthracis protective antigen antibodies in human sera collected from immunized individuals. The purification method using paramagnetic beads is very effective. It is fast, easy and may be carried out practically in any laboratory.

  7. Decontamination after a release of B. anthracis spores.

    PubMed

    Campbell, Chris G; Kirvel, Robert D; Love, Adam H; Bailey, Christopher G; Miles, Robin; Schweickert, Jerry; Sutton, Mark; Raber, Ellen

    2012-03-01

    Decontaminating civilian facilities or large urban areas following an attack with Bacillus anthracis poses daunting challenges because of the lack of resources and proven technologies. Nevertheless, lessons learned from the 2001 cleanups together with advances derived from recent research have improved our understanding of what is required for effective decontamination. This article reviews current decontamination technologies appropriate for use in outdoor environments, on material surfaces, within large enclosed spaces, in water, and on waste contaminated with aerosolized B. anthracis spores.

  8. Phosphate starvation enhances the pathogenesis of Bacillus anthracis.

    PubMed

    Aggarwal, Somya; Somani, Vikas Kumar; Bhatnagar, Rakesh

    2015-09-01

    Identifying the factors responsible for survival and virulence of Bacillus anthracis within the host is prerequisite for the development of therapeutics against anthrax. Host provides several stresses as well as many advantages to the invading pathogen. Inorganic phosphate (Pi) starvation within the host has been considered as one of the major contributing factors in the establishment of infection by pathogenic microorganisms. Here, we report for the first time that Pi fluctuation encountered by B. anthracis at different stages of its life cycle within the host, contributes significantly in its pathogenesis. In this study, Pi starvation was found to hasten the onset of infection cycle by promoting spore germination. After germination, it was found to impede cell growth. In addition, phosphate starved bacilli showed more antibiotic tolerance. Interestingly, phosphate starvation enhanced the pathogenicity of B. anthracis by augmenting its invasiveness in macrophages in vitro. B. anthracis grown under phosphate starvation were also found to be more efficient in establishing lethal infections in mouse model as well. Phosphate starvation increased B. anthracis virulence by promoting the secretion of primary virulence factors like protective antigen (PA), lethal factor (LF) and edema factor (EF). Thus, this study affirms that besides other host mediated factors, phosphate limitation may also contribute B. anthracis for successfully establishing itself within the host. This study is a step forward in delineating its pathophysiology that might help in understanding the pathogenesis of anthrax.

  9. Production of functional soluble Dectin-1 glycoprotein using an IRES-linked destabilized-dihydrofolate reductase expression vector.

    PubMed

    Ng, Say Kong; Tan, Tessa Rui Min; Wang, Yang; Ng, Daniel; Goh, Lin-Tang; Bardor, Muriel; Wong, Victor Vai Tak; Lam, Kong Peng

    2012-01-01

    Dectin-1 (CLEC7A) is a C-type lectin receptor that binds to β-glucans found in fungal cell walls to act as a major pattern recognition receptor (PRR). Since β-glucans epitope is not present in human cells, we are of the opinion that Dectin-1 can have therapeutic functions against fungal infections. We thus set out to produce a soluble extracellular domain of murine Dectin-1 (called sDectin-1) in sufficient titers to facilitate such studies in mouse models. Since sDectin-1 has previously been shown to be glycosylated, we chose to produce this protein using Chinese Hamster Ovary (CHO) cells, a mammalian host cell line suitable for the high-titer production of recombinant glycoproteins. To ensure a high titer production of sDectin-1 and minimize the effects of gene fragmentation, we constructed a mammalian expression vector with a PEST-destabilized dhfr amplifiable marker downstream of an attenuated IRES element, which was in turn downstream of the sDectin-1 gene and a CMV IE promoter. Stably transfected and MTX-amplified cell pools were generated using this vector, and maximum sDectin-1 titers of 246 mg/l and 598 mg/l were obtained in shake flask batch culture and bioreactor fed-batch culture respectively. The purified recombinant sDectin-1 was shown to be glycosylated. Protein functionality was also demonstrated by its ability to bind to zymosan particles and to the cell wall of Saccharomyces cerevisiae. We describe for the first time the use of an attenuated IRES-linked PEST-destabilized dhfr amplifiable marker for the production of recombinant proteins with stably amplified cell pools. With our process, we reached the highest reported titer for producing recombinant proteins smaller than 50 kDa in cell pools. sDectin-1 protein produced is glycosylated and functional. This vector design can thus be used efficiently for the high-titer production of functional recombinant proteins.

  10. Functional analysis of Plasmodium vivax dihydrofolate reductase-thymidylate synthase genes through stable transformation of Plasmodium falciparum.

    PubMed

    Auliff, Alyson M; Balu, Bharath; Chen, Nanhua; O'Neil, Michael T; Cheng, Qin; Adams, John H

    2012-01-01

    Mechanisms of drug resistance in Plasmodium vivax have been difficult to study partially because of the difficulties in culturing the parasite in vitro. This hampers monitoring drug resistance and research to develop or evaluate new drugs. There is an urgent need for a novel method to study mechanisms of P. vivax drug resistance. In this paper we report the development and application of the first Plasmodium falciparum expression system to stably express P. vivax dhfr-ts alleles. We used the piggyBac transposition system for the rapid integration of wild-type, single mutant (117N) and quadruple mutant (57L/58R/61M/117T) pvdhfr-ts alleles into the P. falciparum genome. The majority (81%) of the integrations occurred in non-coding regions of the genome; however, the levels of pvdhfr transcription driven by the P. falciparum dhfr promoter were not different between integrants of non-coding and coding regions. The integrated quadruple pvdhfr mutant allele was much less susceptible to antifolates than the wild-type and single mutant pvdhfr alleles. The resistance phenotype was stable without drug pressure. All the integrated clones were susceptible to the novel antifolate JPC-2067. Therefore, the piggyBac expression system provides a novel and important tool to investigate drug resistance mechanisms and gene functions in P. vivax.

  11. Distribution of dihydrofolate reductase (dhfr) and dihydropteroate synthase (dhps) mutant alleles in Plasmodium vivax isolates from Thailand.

    PubMed

    Thongdee, Pimwan; Kuesap, Jiraporn; Rungsihirunrat, Kanchana; Tippawangkosol, Pongsri; Mungthin, Mathirut; Na-Bangchang, Kesara

    2013-10-01

    The analysis of prevalence and distribution of pvdhfr and pvdhps mutations were performed in 169 samples collected from patients with Plasmodium vivax infection who attended the malaria clinics in the provinces along the three international borders of Thailand (Thai-Myanmar, Thai-Cambodian, and Thai-Malaysian borders). SNP-haplotypes of the pvdhfr at amino acid positions 13, 33, 57, 58, 61, 117, and 173 and of the pvdhps at positions 383 and 553 were examined by nested PCR-RFLP. Significant differences in the prevalence and distribution of pvdhfr and pvdhps combination alleles were observed in P. vivax isolates collected from all the three border areas. The most prevalent combination alleles were triple mutant pvdhfr 57L/58R/117T alleles/double wild-type pvdhps alleles (n=18), double mutant pvdhfr 58R/117N alleles/double wild-type pvdhps alleles (n=10), and triple mutant pvdhfr 58R/61M/117N alleles/double wild-type pvdhps alleles (n=52) or with single mutant pvdhps 383G allele (n=28), respectively. These information on prevalence and patterns of pvdhfr and pvdhps polymorphisms obtained from the present study suggest the presence of SP pressure on P. vivax isolates in Thailand which could be linked to the introduction of malaria from neighboring countries. Results did not support the application of SP for P. vivax control program in Thailand as well as the neighboring countries. Copyright © 2013 Elsevier B.V. All rights reserved.

  12. Functional Analysis of Plasmodium vivax Dihydrofolate Reductase-Thymidylate Synthase Genes through Stable Transformation of Plasmodium falciparum

    PubMed Central

    Auliff, Alyson M.; Balu, Bharath; Chen, Nanhua; O’Neil, Michael T.; Cheng, Qin; Adams, John H.

    2012-01-01

    Mechanisms of drug resistance in Plasmodium vivax have been difficult to study partially because of the difficulties in culturing the parasite in vitro. This hampers monitoring drug resistance and research to develop or evaluate new drugs. There is an urgent need for a novel method to study mechanisms of P. vivax drug resistance. In this paper we report the development and application of the first Plasmodium falciparum expression system to stably express P. vivax dhfr-ts alleles. We used the piggyBac transposition system for the rapid integration of wild-type, single mutant (117N) and quadruple mutant (57L/58R/61M/117T) pvdhfr-ts alleles into the P. falciparum genome. The majority (81%) of the integrations occurred in non-coding regions of the genome; however, the levels of pvdhfr transcription driven by the P. falciparum dhfr promoter were not different between integrants of non-coding and coding regions. The integrated quadruple pvdhfr mutant allele was much less susceptible to antifolates than the wild-type and single mutant pvdhfr alleles. The resistance phenotype was stable without drug pressure. All the integrated clones were susceptible to the novel antifolate JPC-2067. Therefore, the piggyBac expression system provides a novel and important tool to investigate drug resistance mechanisms and gene functions in P. vivax. PMID:22792308

  13. Production and Validation of the Use of Gamma Phage for Identification of Bacillus anthracis

    DTIC Science & Technology

    2005-09-01

    Validation of the Use of Gamma Phage for Identification of Bacillus anthracis T. G. Abshire,1 J. E. Brown,2 and J. W. Ezzell1* Diagnostic Systems...Received 5 January 2005/Returned for modification 2 April 2005/Accepted 16 April 2005 Gamma phage specifically lyses vegetative cells of Bacillus anthracis...B. anthracis strains and 49 similar non-B. anthracis Bacillus species, the analytical specificity was >95%, a value that is intentionally low because

  14. Transcriptional profiling of Bacillus anthracis during infection of host macrophages.

    PubMed

    Bergman, Nicholas H; Anderson, Erica C; Swenson, Ellen E; Janes, Brian K; Fisher, Nathan; Niemeyer, Matthew M; Miyoshi, Amy D; Hanna, Philip C

    2007-07-01

    The interaction between Bacillus anthracis and the mammalian phagocyte is one of the central stages in the progression of inhalational anthrax, and it is commonly believed that the host cell plays a key role in facilitating germination and dissemination of inhaled B. anthracis spores. Given this, a detailed definition of the survival strategies used by B. anthracis within the phagocyte is critical for our understanding of anthrax. In this study, we report the first genome-wide analysis of B. anthracis gene expression during infection of host phagocytes. We developed a technique for specific isolation of bacterial RNA from within infected murine macrophages, and we used custom B. anthracis microarrays to characterize the expression patterns occurring within intracellular bacteria throughout infection of the host phagocyte. We found that B. anthracis adapts very quickly to the intracellular environment, and our analyses identified metabolic pathways that appear to be important to the bacterium during intracellular growth, as well as individual genes that show significant induction in vivo. We used quantitative reverse transcription-PCR to verify that the expression trends that we observed by microarray analysis were valid, and we chose one gene (GBAA1941, encoding a putative transcriptional regulator) for further characterization. A deletion strain missing this gene showed no phenotype in vitro but was significantly attenuated in a mouse model of inhalational anthrax, suggesting that the microarray data described here provide not only the first comprehensive view of how B. anthracis survives within the host cell but also a number of promising leads for further research in anthrax.

  15. [Isolation and identification of Bacillus anthracis in an accidental case].

    PubMed

    Wang, Zheng-Qiang; He, Jun; Su, Yu-Xin; Zhu, Hong; Duan, Qing

    2006-06-01

    During June to July 2005, a few farmers in Chengde county of Hebei province were got ill after eating beef of sick cattle. The cattle could be infected with Bacillus anthracis. One beef sample and one soil sample contaminated with cattle blood were collected and used for pathogen isolation and identification in laboratory. Two bacteria strains were isolated from beef and soil sample, respectively, and showed typical morphology of Bacillus anthracis on blood agar and under microscope with Gram stain. The two bacteria strains were also positive to standard positive serum of Bacillus anthracis by slide agglutination test. Biochemical characteristics of the two bacteria were tested using API CHB/E strip and analyzed by API software (version 3.3), result showed that the two isolated bacteria were Bacillus anthracis. Polymerase chain reaction (PCR) was used to further characterize the two isolated bacteria strains. Three pairs of primer were designed and used for PCR, and these primers exactly matched the protective antigen gene, edema factor gene and capsule gene, respectively. By analyzed on agarose gel, PCR products were 423bp, 494bp and 397bp, respectively, and this result showed that the two isolated bacteria contained two plasmids, pX01 and pX02, which encoded anthrax toxin and capsule, respectively. Anthrax toxin and capsule were very important virulent factors for Bacillus anthracis. PCR products were purified and then cloned to T vector, positive clone was chose and sequenced. By BLAST with GenBank, sequence of the three genes of the two bacteria strains had a similarity of 99% with Bacillus anthracis A2012 strain, Ames Ancestor strain and A16R strain. Based on results of colonial morphology, serum test and biochemistry characterization, the two bacteria strains are Bacillus anthracis. They can encode anthrax toxin and capsule, and are virulent to animal and human.

  16. Wide Area Recovery and Resiliency Program (WARRP) Interim Clearance Strategy for Environments Contaminated with Bacillus anthracis

    DTIC Science & Technology

    2012-07-01

    Interim Clearance Strategy for Environments Contaminated with Bacillus anthracis July 2012...WARRP) Interim Clearance Strategy for Environments Contaminated with Bacillus anthracis 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM ELEMENT...contains color images. 14. ABSTRACT If a Bacillus anthracis incident occurs in the United States or within its territories, the public health and

  17. Histochemical demonstration of folic acid metabolism, some lysosomal activities and NADH2-cytochrome-C-reductase in corpora mammillaria in the ageing process.

    PubMed

    Onicescu, D; Popescu, M

    1993-01-01

    In bovine corpora mammillaria of young animals, a folic acid positive reaction was found in the neurons and in the neuroglia, in parallel with high dihydrofolate-reductase activity in the nerve cells. In old animals, folate and lysosome enzymes were different in the lateral and in medial nucleus, the highest amount being observed in the lateral nucleus; in the glial cells the lysosomal enzymes increased and in the nerve cells the concentration of folic acid increased. In the medial nucleus only relatively few enzyme modifications in the process of senescence were noticed.

  18. Bacillus anthracis lethal toxin reduces human alveolar epithelial barrier function.

    PubMed

    Langer, Marybeth; Duggan, Elizabeth Stewart; Booth, John Leland; Patel, Vineet Indrajit; Zander, Ryan A; Silasi-Mansat, Robert; Ramani, Vijay; Veres, Tibor Zoltan; Prenzler, Frauke; Sewald, Katherina; Williams, Daniel M; Coggeshall, Kenneth Mark; Awasthi, Shanjana; Lupu, Florea; Burian, Dennis; Ballard, Jimmy Dale; Braun, Armin; Metcalf, Jordan Patrick

    2012-12-01

    The lung is the site of entry for Bacillus anthracis in inhalation anthrax, the deadliest form of the disease. Bacillus anthracis produces virulence toxins required for disease. Alveolar macrophages were considered the primary target of the Bacillus anthracis virulence factor lethal toxin because lethal toxin inhibits mouse macrophages through cleavage of MEK signaling pathway components, but we have reported that human alveolar macrophages are not a target of lethal toxin. Our current results suggest that, unlike human alveolar macrophages, the cells lining the respiratory units of the lung, alveolar epithelial cells, are a target of lethal toxin in humans. Alveolar epithelial cells expressed lethal toxin receptor protein, bound the protective antigen component of lethal toxin, and were subject to lethal-toxin-induced cleavage of multiple MEKs. These findings suggest that human alveolar epithelial cells are a target of Bacillus anthracis lethal toxin. Further, no reduction in alveolar epithelial cell viability was observed, but lethal toxin caused actin rearrangement and impaired desmosome formation, consistent with impaired barrier function as well as reduced surfactant production. Therefore, by compromising epithelial barrier function, lethal toxin may play a role in the pathogenesis of inhalation anthrax by facilitating the dissemination of Bacillus anthracis from the lung in early disease and promoting edema in late stages of the illness.

  19. Bacillus anthracis Lethal Toxin Reduces Human Alveolar Epithelial Barrier Function

    PubMed Central

    Langer, Marybeth; Duggan, Elizabeth Stewart; Booth, John Leland; Patel, Vineet Indrajit; Zander, Ryan A.; Silasi-Mansat, Robert; Ramani, Vijay; Veres, Tibor Zoltan; Prenzler, Frauke; Sewald, Katherina; Williams, Daniel M.; Coggeshall, Kenneth Mark; Awasthi, Shanjana; Lupu, Florea; Burian, Dennis; Ballard, Jimmy Dale; Braun, Armin

    2012-01-01

    The lung is the site of entry for Bacillus anthracis in inhalation anthrax, the deadliest form of the disease. Bacillus anthracis produces virulence toxins required for disease. Alveolar macrophages were considered the primary target of the Bacillus anthracis virulence factor lethal toxin because lethal toxin inhibits mouse macrophages through cleavage of MEK signaling pathway components, but we have reported that human alveolar macrophages are not a target of lethal toxin. Our current results suggest that, unlike human alveolar macrophages, the cells lining the respiratory units of the lung, alveolar epithelial cells, are a target of lethal toxin in humans. Alveolar epithelial cells expressed lethal toxin receptor protein, bound the protective antigen component of lethal toxin, and were subject to lethal-toxin-induced cleavage of multiple MEKs. These findings suggest that human alveolar epithelial cells are a target of Bacillus anthracis lethal toxin. Further, no reduction in alveolar epithelial cell viability was observed, but lethal toxin caused actin rearrangement and impaired desmosome formation, consistent with impaired barrier function as well as reduced surfactant production. Therefore, by compromising epithelial barrier function, lethal toxin may play a role in the pathogenesis of inhalation anthrax by facilitating the dissemination of Bacillus anthracis from the lung in early disease and promoting edema in late stages of the illness. PMID:23027535

  20. Novel giant siphovirus from Bacillus anthracis features unusual genome characteristics.

    PubMed

    Ganz, Holly H; Law, Christina; Schmuki, Martina; Eichenseher, Fritz; Calendar, Richard; Loessner, Martin J; Getz, Wayne M; Korlach, Jonas; Beyer, Wolfgang; Klumpp, Jochen

    2014-01-01

    Here we present vB_BanS-Tsamsa, a novel temperate phage isolated from Bacillus anthracis, the agent responsible for anthrax infections in wildlife, livestock and humans. Tsamsa phage is a giant siphovirus (order Caudovirales), featuring a long, flexible and non-contractile tail of 440 nm (not including baseplate structure) and an isometric head of 82 nm in diameter. We induced Tsamsa phage in samples from two different carcass sites in Etosha National Park, Namibia. The Tsamsa phage genome is the largest sequenced Bacillus siphovirus, containing 168,876 bp and 272 ORFs. The genome features an integrase/recombinase enzyme, indicative of a temperate lifestyle. Among bacterial strains tested, the phage infected only certain members of the Bacillus cereus sensu lato group (B. anthracis, B. cereus and B. thuringiensis) and exhibited moderate specificity for B. anthracis. Tsamsa lysed seven out of 25 B. cereus strains, two out of five B. thuringiensis strains and six out of seven B. anthracis strains tested. It did not lyse B. anthracis PAK-1, an atypical strain that is also resistant to both gamma phage and cherry phage. The Tsamsa endolysin features a broader lytic spectrum than the phage host range, indicating possible use of the enzyme in Bacillus biocontrol.

  1. Fast and Sensitive Detection of Bacillus anthracis Spores by Immunoassay

    PubMed Central

    Volland, Hervé; Dano, Julie; Lamourette, Patricia; Sylvestre, Patricia; Mock, Michèle; Créminon, Christophe

    2012-01-01

    Bacillus anthracis is one of the most dangerous potential biological weapons, and it is essential to develop a rapid and simple method to detect B. anthracis spores in environmental samples. The immunoassay is a rapid and easy-to-use method for the detection of B. anthracis by means of antibodies directed against surface spore antigens. With this objective in view, we have produced a panel of monoclonal antibodies against B. anthracis and developed colorimetric and electrochemiluminescence (ECL) immunoassays. Using Meso Scale Discovery ECL technology, which is based on electrochemiluminescence (ECL) detection utilizing a sulfo-Tag label that emits light upon electrochemical stimulation (using a dedicated ECL plate reader, an electrical current is placed across the microplate with electrodes integrated into the bottom of the plate, resulting in a series of electrically induced reactions leading to a luminescent signal), a detection limit ranging between 0.3 × 103 and 103 CFU/ml (i.e., 30 to 100 spores per test), depending on the B. anthracis strain assayed, was achieved. In complex matrices (5 mg/ml of soil or simulated powder), the detection level (without any sample purification or concentration) was never altered more than 3-fold compared with the results obtained in phosphate-buffered saline. PMID:22773632

  2. Computational Fluid Dynamics Modeling of Bacillus anthracis ...

    EPA Pesticide Factsheets

    Journal Article Three-dimensional computational fluid dynamics and Lagrangian particle deposition models were developed to compare the deposition of aerosolized Bacillus anthracis spores in the respiratory airways of a human with that of the rabbit, a species commonly used in the study of anthrax disease. The respiratory airway geometries for each species were derived from computed tomography (CT) or µCT images. Both models encompassed airways that extended from the external nose to the lung with a total of 272 outlets in the human model and 2878 outlets in the rabbit model. All simulations of spore deposition were conducted under transient, inhalation-exhalation breathing conditions using average species-specific minute volumes. Four different exposure scenarios were modeled in the rabbit based upon experimental inhalation studies. For comparison, human simulations were conducted at the highest exposure concentration used during the rabbit experimental exposures. Results demonstrated that regional spore deposition patterns were sensitive to airway geometry and ventilation profiles. Despite the complex airway geometries in the rabbit nose, higher spore deposition efficiency was predicted in the upper conducting airways of the human at the same air concentration of anthrax spores. This greater deposition of spores in the upper airways in the human resulted in lower penetration and deposition in the tracheobronchial airways and the deep lung than that predict

  3. Computational Fluid Dynamics Modeling of Bacillus anthracis ...

    EPA Pesticide Factsheets

    Journal Article Three-dimensional computational fluid dynamics and Lagrangian particle deposition models were developed to compare the deposition of aerosolized Bacillus anthracis spores in the respiratory airways of a human with that of the rabbit, a species commonly used in the study of anthrax disease. The respiratory airway geometries for each species were derived from computed tomography (CT) or µCT images. Both models encompassed airways that extended from the external nose to the lung with a total of 272 outlets in the human model and 2878 outlets in the rabbit model. All simulations of spore deposition were conducted under transient, inhalation-exhalation breathing conditions using average species-specific minute volumes. Four different exposure scenarios were modeled in the rabbit based upon experimental inhalation studies. For comparison, human simulations were conducted at the highest exposure concentration used during the rabbit experimental exposures. Results demonstrated that regional spore deposition patterns were sensitive to airway geometry and ventilation profiles. Despite the complex airway geometries in the rabbit nose, higher spore deposition efficiency was predicted in the upper conducting airways of the human at the same air concentration of anthrax spores. This greater deposition of spores in the upper airways in the human resulted in lower penetration and deposition in the tracheobronchial airways and the deep lung than that predict

  4. Genetic variation and linkage disequilibrium in Bacillus anthracis.

    PubMed

    Zwick, Michael E; Thomason, Maureen Kiley; Chen, Peter E; Johnson, Henry R; Sozhamannan, Shanmuga; Mateczun, Alfred; Read, Timothy D

    2011-01-01

    We performed whole-genome amplification followed by hybridization of custom-designed resequencing arrays to resequence 303 kb of genomic sequence from a worldwide panel of 39 Bacillus anthracis strains. We used an efficient algorithm contained within a custom software program, UniqueMER, to identify and mask repetitive sequences on the resequencing array to reduce false-positive identification of genetic variation, which can arise from cross-hybridization. We discovered a total of 240 single nucleotide variants (SNVs) and showed that B. anthracis strains have an average of 2.25 differences per 10,000 bases in the region we resequenced. Common SNVs in this region are found to be in complete linkage disequilibrium. These patterns of variation suggest there has been little if any historical recombination among B. anthracis strains since the origin of the pathogen. This pattern of common genetic variation suggests a framework for recognizing new or genetically engineered strains.

  5. Use of long-range repetitive element polymorphism-PCR to differentiate Bacillus anthracis strains.

    PubMed

    Brumlik, M J; Szymajda, U; Zakowska, D; Liang, X; Redkar, R J; Patra, G; Del Vecchio, V G

    2001-07-01

    The genome of Bacillus anthracis is extremely monomorphic, and thus individual strains have often proven to be recalcitrant to differentiation at the molecular level. Long-range repetitive element polymorphism-PCR (LR REP-PCR) was used to differentiate various B. anthracis strains. A single PCR primer derived from a repetitive DNA element was able to amplify variable segments of a bacterial genome as large as 10 kb. We were able to characterize five genetically distinct groups by examining 105 B. anthracis strains of diverse geographical origins. All B. anthracis strains produced fingerprints comprising seven to eight bands, referred to as "skeleton" bands, while one to three "diagnostic" bands differentiated between B. anthracis strains. LR REP-PCR fingerprints of B. anthracis strains showed very little in common with those of other closely related species such as B. cereus, B. thuringiensis, and B. mycoides, suggesting relative heterogeneity among the non-B. anthracis strains. Fingerprints from transitional non-B. anthracis strains, which possessed the B. anthracis chromosomal marker Ba813, scarcely resembled those observed for any of the five distinct B. anthracis groups that we have identified. The LR REP-PCR method described in this report provides a simple means of differentiating B. anthracis strains.

  6. Use of Long-Range Repetitive Element Polymorphism-PCR To Differentiate Bacillus anthracis Strains

    PubMed Central

    Brumlik, Michael J.; Szymajda, Urszula; Zakowska, Dorota; Liang, Xudong; Redkar, Rajendra J.; Patra, Guy; Del Vecchio, Vito G.

    2001-01-01

    The genome of Bacillus anthracis is extremely monomorphic, and thus individual strains have often proven to be recalcitrant to differentiation at the molecular level. Long-range repetitive element polymorphism-PCR (LR REP-PCR) was used to differentiate various B. anthracis strains. A single PCR primer derived from a repetitive DNA element was able to amplify variable segments of a bacterial genome as large as 10 kb. We were able to characterize five genetically distinct groups by examining 105 B. anthracis strains of diverse geographical origins. All B. anthracis strains produced fingerprints comprising seven to eight bands, referred to as “skeleton” bands, while one to three “diagnostic” bands differentiated between B. anthracis strains. LR REP-PCR fingerprints of B. anthracis strains showed very little in common with those of other closely related species such as B. cereus, B. thuringiensis, and B. mycoides, suggesting relative heterogeneity among the non-B. anthracis strains. Fingerprints from transitional non-B. anthracis strains, which possessed the B. anthracis chromosomal marker Ba813, scarcely resembled those observed for any of the five distinct B. anthracis groups that we have identified. The LR REP-PCR method described in this report provides a simple means of differentiating B. anthracis strains. PMID:11425716

  7. Detection of the Bacillus anthracis gyrA Gene by Using a Minor Groove Binder Probe

    PubMed Central

    Hurtle, William; Bode, Elizabeth; Kulesh, David A.; Kaplan, Rebecca Susan; Garrison, Jeff; Bridge, Deanna; House, Michelle; Frye, Melissa S.; Loveless, Bonnie; Norwood, David

    2004-01-01

    Identification of chromosomal markers for rapid detection of Bacillus anthracis is difficult because significant chromosomal homology exists among B. anthracis, Bacillus cereus, and Bacillus thuringiensis. We evaluated the bacterial gyrA gene as a potential chromosomal marker for B. anthracis. A real-time PCR assay was developed for the detection of B. anthracis. After analysis of the unique nucleotide sequence of the B. anthracis gyrA gene, a fluorescent 3′ minor groove binding probe was tested with 171 organisms from 29 genera of bacteria, including 102 Bacillus strains. The assay was found to be specific for all 43 strains of B. anthracis tested. In addition, a test panel of 105 samples was analyzed to evaluate the potential diagnostic capability of the assay. The assay showed 100% specificity, demonstrating the usefulness of the gyrA gene as a specific chromosomal marker for B. anthracis. PMID:14715750

  8. [Clustered regularly interspaced short palindromic repeats (CRISPR) site in Bacillus anthracis].

    PubMed

    Gao, Zhiqi; Wang, Dongshu; Feng, Erling; Wang, Bingxiang; Hui, Yiming; Han, Shaobo; Jiao, Lei; Liu, Xiankai; Wang, Hengliang

    2014-11-04

    To investigate the polymorphism of clustered regularly interspaced short palindromic repeats (CRISPR) in Bacillu santhracis and the application to molecular typing based on the polymorphism of CRISPR in B. anthracis. We downloaded the whole genome sequence of 6 B. anthracis strains and extracted the CRISPR sites. We designed the primers of CRISPR sites and amplified the CRISPR fragments in 193 B. anthracis strains by PCR and sequenced these fragments. In order to reveal the polymorphism of CRISPR in B. anthracis, wealigned all the extracted sequences and sequenced results by local blasting. At the same time, we also analyzed the CRISPR sites in B. cereus and B. thuringiensis. We did not find any polymorphism of CRISPR in B. anthracis. The molecular typing approach based on CRISPR polymorphism is not suitable for B. anthracis, but it is possible for us to distinguish B. anthracis from B. cereus and B. thuringiensis.

  9. Activity of Pera Safe(Trademark) Against Bacillus Anthracis Spores

    DTIC Science & Technology

    2002-01-01

    peroxide and peracetic acid . J.Appl. Bacteriol. 1983,54,417-23. 2. Dietz P., Böhm R.: Results of an experimental study on testing disinfectants with spores...Bacteriol. 1980, 48, 161-90. 5. Hussaini S.N., Ruby K.R.: Sporicidal activity of peracetic acid against Bacillus anthracis spores. Vet. Rec. 1976, 98, 257-9. ...challenging task. There exist a variety of disinfectants that can inactivate Bacillus anthracis spores; however, most of them have negative side effects

  10. Cloning of the Protective Antigen Gene of Bacillus anthracis

    DTIC Science & Technology

    1983-09-01

    homologous system as B. anthracis Vector (W=R22 and anthrax plasmid (pSAl) DNAs were digested to can produce up to 10 jig PA/mid culture supernatant...of B. anthracis. At least two oflus. These proteins interact in animal test systems in the recombinant E. coli clones in the library code for...chal- determined by electron microscopy. For purposes of clon- leIge by Wre organisms. In later reports PA has been ing, a Barn HI digest with a pattern

  11. Natural Dissemination of Bacillus anthracis Spores in Northern Canada

    PubMed Central

    Dragon, D. C.; Bader, D. E.; Mitchell, J.; Woollen, N.

    2005-01-01

    Soil samples were collected from around fresh and year-old bison carcasses and areas not associated with known carcasses in Wood Buffalo National Park during an active anthrax outbreak in the summer of 2001. Sample selection with a grid provided the most complete coverage of a site. Soil samples were screened for viable Bacillus anthracis spores via selective culture, phenotypic analysis, and PCR. Bacillus anthracis spores were isolated from 28.4% of the samples. The highest concentrations of B. anthracis spores were found directly adjacent to fresh carcasses and invariably corresponded to locations where the soil had been saturated with body fluids escaping the carcass through either natural body orifices or holes torn by scavengers. The majority of positive samples were found within 2 m of both year-old and fresh carcasses and probably originated from scavengers churning up and spreading the body fluid-saturated soil as they fed. Trails of lesser contamination radiating from the carcasses probably resulted from spore dissemination through adhesion to scavengers and through larger scavengers dragging away disarticulated limbs. Comparison of samples from minimally scavenged and fully necropsied carcass sites revealed no statistically significant difference in the level of B. anthracis spore contamination. Therefore, the immediate area around a suspected anthrax carcass should be considered substantially contaminated regardless of the condition of the carcass. PMID:15746366

  12. Role of superoxide in the germination of Bacillus anthracis endospores.

    PubMed

    Baillie, Les; Hibbs, Stephen; Tsai, Pei; Cao, Guan-Liang; Rosen, Gerald M

    2005-04-01

    The spore forming Gram-positive bacterium Bacillus anthracis, the causative agent of anthrax, has achieved notoriety due to its use as a bioterror agent. In the environment, B. anthracis exists as a dormant endospore. Germination of endospores during their internalization within the myeloid phagocyte, and the ability of those endospores to survive exposure to antibacterial killing mechanisms such as superoxide (O(2)*-, is a key initial event in the infective process. We report herein that endospores exposed to fluxes of O(2)*- typically found in stimulated phagocytes had no effect on viability. Further endospores of the Sterne strain of B. anthracis were found to scavenge O(2)*-, which may enhance the ability of the bacterium to survive within the hostile environment of the phagolysosome. Most intriguing was the observation that endospore germination was stimulated by a flux of O(2)*- as low as 1 microM/min. Data presented herein suggest that B. anthracis may co-opt O(2)*- which is produced by stimulated myeloid phagocytes and is an essential element of host immunity, as a necessary step in productive infection of the host.

  13. Novel and unique diagnostic biomarkers for Bacillus anthracis infection.

    PubMed

    Sela-Abramovich, Sagit; Chitlaru, Theodor; Gat, Orit; Grosfeld, Haim; Cohen, Ofer; Shafferman, Avigdor

    2009-10-01

    A search for bacterium-specific biomarkers in peripheral blood following infection with Bacillus anthracis was carried out with rabbits, using a battery of specific antibodies generated by DNA vaccination against 10 preselected highly immunogenic bacterial antigens which were identified previously by a genomic/proteomic/serologic screen of the B. anthracis secretome. Detection of infection biomarkers in the circulation of infected rabbits could be achieved only after removal of highly abundant serum proteins by chromatography using a random-ligand affinity column. Besides the toxin component protective antigen, the following three secreted proteins were detected in the circulation of infected animals: the chaperone and protease HtrA (BA3660), an NlpC/P60 endopeptidase (BA1952), and a protein of unknown function harboring two SH3 (Src homology 3) domains (BA0796). The three proteins could be detected in plasma samples from infected animals exhibiting 10(3) to 10(5) CFU/ml blood and also in standard blood cultures at 3 to 6 h post-bacterial inoculation at a bacteremic level as low as 10(3) CFU/ml. Furthermore, the three biomarkers appear to be present only in the secretome of B. anthracis, not in those of the related pathogens B. thuringiensis and B. cereus. To the best of our knowledge, this is the first report of direct detection of B. anthracis-specific proteins, other than the toxin components, in the circulation of infected animals.

  14. A selective chromogenic agar that distinguishes Bacillus anthracis from Bacillus cereus and Bacillus thuringiensis.

    PubMed

    Juergensmeyer, Margaret A; Gingras, Bruce A; Restaino, Lawrence; Frampton, Elon W

    2006-08-01

    A selective and differential plating medium, R & F anthracis chromogenic agar (ACA), has been developed for isolating and identifying presumptive colonies of Bacillus anthracis. ACA contains the chromogenic substrate 5-bromo-4-chloro-3-indoxyl-choline phosphate that upon hydrolysis yields teal (blue green) colonies indicating the presence of phosphatidylcholine-specific phospholipase C (PC-PLC) activity. Among seven Bacillus species tested on ACA, only members of the Bacillus cereus group (B. anthracis, B. cereus, and B. thuringiensis) produced teal colonies (PC-PLC positive) having cream rings. Examination of colony morphology in 18 pure culture strains of B. anthracis (15 ATCC strains plus AMES-1-RIID, ANR-1, and AMED-RIID), with one exception, required 48 h at 35 to 37 degrees C for significant color production, whereas only 24 h was required for B. cereus and B. thuringiensis. This differential rate of PC-PLC synthesis in B. anthracis (due to the truncated plcR gene and PlcR regulator in B. anthracis) allowed for the rapid differentiation on ACA of presumptive colonies of B. anthracis from B. cereus and B. thuringiensis in both pure and mixed cultures. Effective recovery of B. anthracis from a variety of matrices having both high (soil and sewage) and low microbial backgrounds (cloth, paper, and blood) spiked with B. anthracis ANR-1 spores suggests the probable utility of ACA plating for B. anthracis recovery in a diversity of applications.

  15. The function of PlcR in Bacillus anthracis vaccine strain A16R.

    PubMed

    Xiaolin, Jia; Dongshu, Wang; Zhiqi, Gao; Erling, Feng; Jiping, Zheng; Hengliang, Wang; Guiying, Guo; Xiankai, Liu

    2015-05-01

    Bacillus anthracis, B. thuringiensis and B. cereus are members of the B. cereus group. They share high genetic similarity. Whereas plcR (Phospholipase C regulator) usually encodes a functional pleiotropic activator protein in B. cereus and B. thuringiensis isolates, a characteristic nonsense mutation is found in all B. anthracis strains investigated, making the gene dysfunctional. To study the function of PlcR in B. anthracis, we used the B. cereus CMCC63301 genome as a template and constructed a recombinant expression plasmid pBE2A-plcR, and introduced it into the B. anthracis vaccine strain A16R, and then analyzed the activity of the hemolysin and sphingomyelinase. The results showed that transformation of B. anthracis with plasmid pBE2A-plcR carrying the native B. cereus plcR gene active the expression of sphingomyelinase gene, but did not activate expression of hemolysin genes of B. anthracis A16R.

  16. Evaluation of the Cepheid GeneXpert System for Detecting Bacillus anthracis

    DTIC Science & Technology

    2005-10-25

    ORIGINAL ARTICLE Evaluation of the Cepheid GeneXpert system for detecting Bacillus anthracis M.P. Ulrich1, D.R. Christensen1, S.R. Coyne1, P.D...Knepp et al. 2003). In addition, Keywords anthrax, automated system, Bacillus anthracis, GeneXpert, nucleic acid, real-time PCR, sample processing...system. In this study, the capability of the GeneX- pert to isolate and detect nucleic acid from Bacillus anthracis Ames spores was assessed. Methods

  17. Strategy for identification of Bacillus cereus and Bacillus thuringiensis strains closely related to Bacillus anthracis.

    PubMed

    Daffonchio, Daniele; Raddadi, Noura; Merabishvili, Maya; Cherif, Ameur; Carmagnola, Lorenzo; Brusetti, Lorenzo; Rizzi, Aurora; Chanishvili, Nina; Visca, Paolo; Sharp, Richard; Borin, Sara

    2006-02-01

    Bacillus cereus strains that are genetically closely related to B. anthracis can display anthrax-like virulence traits (A. R. Hoffmaster et al., Proc. Natl. Acad. Sci. USA 101:8449-8454, 2004). Hence, approaches that rapidly identify these "near neighbors" are of great interest for the study of B. anthracis virulence mechanisms, as well as to prevent the use of such strains for B. anthracis-based bioweapon development. Here, a strategy is proposed for the identification of near neighbors of B. anthracis based on single nucleotide polymorphisms (SNP) in the 16S-23S rRNA intergenic spacer (ITS) containing tRNA genes, characteristic of B. anthracis. By using restriction site insertion-PCR (RSI-PCR) the presence of two SNP typical of B. anthracis was screened in 126 B. cereus group strains of different origin. Two B. cereus strains and one B. thuringiensis strain showed RSI-PCR profiles identical to that of B. anthracis. The sequencing of the entire ITS containing tRNA genes revealed two of the strains to be identical to B. anthracis. The strict relationship with B. anthracis was confirmed by multilocus sequence typing (MLST) of four other independent loci: cerA, plcR, AC-390, and SG-749. The relationship to B. anthracis of the three strains described by MLST was comparable and even higher to that of four B. cereus strains associated with periodontitis in humans and previously reported as the closest known strains to B. anthracis. SNP in ITS containing tRNA genes combined with RSI-PCR provide a very efficient tool for the identification of strains closely related to B. anthracis.

  18. Duration of Protection of Rabbits after Vaccination with Bacillus anthracis Recombinant Protective Antigen Vaccine

    DTIC Science & Technology

    2005-12-27

    against an aerosol spore challenge with the Ames isolate of Bacillus anthracis at 6 and 12 months. At 6 months after the primary injection, survival...vaccine was examined against an aerosol spore challenge with the Ames isolate of Bacillus anthracis at 6 and 12 months. At 6 months after the...Vaccine 24 (2006) 2530–2536 Duration of protection of rabbits after vaccination with Bacillus anthracis recombinant protective antigen vaccine S.F

  19. Duration of Protection of Rabbits after Vaccination with Bacillus anthracis Recombinant Protective Antigen Vaccine

    DTIC Science & Technology

    2005-12-13

    against an aerosol spore challenge with the Ames isolate of Bacillus anthracis at 6 and 12 months. At 6 months after the primary injection, survival...rPA) vaccine was examined against an aerosol spore challenge with the Ames isolate of Bacillus anthracis at 6 and 12 months. At 6 months after the...Vaccine 24 (2006) 2530–2536 Duration of protection of rabbits after vaccination with Bacillus anthracis recombinant protective antigen vaccine S.F

  20. Immunoproteomically identified GBAA_0345, alkyl hydroperoxide reductase subunit C is a potential target for multivalent anthrax vaccine.

    PubMed

    Kim, Yeon Hee; Kim, Kyung Ae; Kim, Yu-Ri; Choi, Min Kyung; Kim, Hye Kyeong; Choi, Ki Ju; Chun, Jeong-Hoon; Cha, Kiweon; Hong, Kee-Jong; Lee, Na Gyong; Yoo, Cheon-Kwon; Oh, Hee-Bok; Kim, Tae Sung; Rhie, Gi-eun

    2014-01-01

    Anthrax is caused by the spore-forming bacterium Bacillus anthracis, which has been used as a weapon for bioterrorism. Although current vaccines are effective, they involve prolonged dose regimens and often cause adverse reactions. High rates of mortality associated with anthrax have made the development of an improved vaccine a top priority. To identify novel vaccine candidates, we applied an immunoproteomics approach. Using sera from convalescent guinea pigs or from human patients with anthrax, we identified 34 immunogenic proteins from the virulent B. anthracis H9401. To evaluate vaccine candidates, six were expressed as recombinant proteins and tested in vivo. Two proteins, rGBAA_0345 (alkyl hydroperoxide reductase subunit C) and rGBAA_3990 (malonyl CoA-acyl carrier protein transacylase), have afforded guinea pigs partial protection from a subsequent virulent-spore challenge. Moreover, combined vaccination with rGBAA_0345 and rPA (protective antigen) exhibited an enhanced ability to protect against anthrax mortality. Finally, we demonstrated that GBAA_0345 localizes to anthrax spores and bacilli. Our results indicate that rGBAA_0345 may be a potential component of a multivalent anthrax vaccine, as it enhances the efficacy of rPA vaccination. This is the first time that sera from patients with anthrax have been used to interrogate the proteome of virulent B. anthracis vegetative cells.

  1. Global gene expression by Bacillus anthracis during growth in mammalian blood.

    PubMed

    Carlson, Paul E; Bourgis, Alexandra E T; Hagan, Ada K; Hanna, Philip C

    2015-11-01

    During the late stages of systemic anthrax, Bacillus anthracis grows rapidly in the host bloodstream. To identify potential genes necessary for this observed rapid growth, we defined the transcriptional profile of B. anthracis during in vitro growth in bovine blood. Genome-wide transcriptome analysis indicated that B. anthracis undergoes significant changes in its transcriptome profile during growth in blood, including the differential regulation of genes associated both with metabolism and known virulence factors. Collectively, these data provide a framework for future studies identifying specific B. anthracis factors required for growth in the mammalian bloodstream.

  2. Nitrate and periplasmic nitrate reductases

    PubMed Central

    Sparacino-Watkins, Courtney; Stolz, John F.; Basu, Partha

    2014-01-01

    The nitrate anion is a simple, abundant and relatively stable species, yet plays a significant role in global cycling of nitrogen, global climate change, and human health. Although it has been known for quite some time that nitrate is an important species environmentally, recent studies have identified potential medical applications. In this respect the nitrate anion remains an enigmatic species that promises to offer exciting science in years to come. Many bacteria readily reduce nitrate to nitrite via nitrate reductases. Classified into three distinct types – periplasmic nitrate reductase (Nap), respiratory nitrate reductase (Nar) and assimilatory nitrate reductase (Nas), they are defined by their cellular location, operon organization and active site structure. Of these, Nap proteins are the focus of this review. Despite similarities in the catalytic and spectroscopic properties Nap from different Proteobacteria are phylogenetically distinct. This review has two major sections: in the first section, nitrate in the nitrogen cycle and human health, taxonomy of nitrate reductases, assimilatory and dissimilatory nitrate reduction, cellular locations of nitrate reductases, structural and redox chemistry are discussed. The second section focuses on the features of periplasmic nitrate reductase where the catalytic subunit of the Nap and its kinetic properties, auxiliary Nap proteins, operon structure and phylogenetic relationships are discussed. PMID:24141308

  3. Virtual screening identification of nonfolate compounds, including a CNS drug, as antiparasitic agents inhibiting pteridine reductase.

    PubMed

    Ferrari, Stefania; Morandi, Federica; Motiejunas, Domantas; Nerini, Erika; Henrich, Stefan; Luciani, Rosaria; Venturelli, Alberto; Lazzari, Sandra; Calò, Samuele; Gupta, Shreedhara; Hannaert, Veronique; Michels, Paul A M; Wade, Rebecca C; Costi, M Paola

    2011-01-13

    Folate analogue inhibitors of Leishmania major pteridine reductase (PTR1) are potential antiparasitic drug candidates for combined therapy with dihydrofolate reductase (DHFR) inhibitors. To identify new molecules with specificity for PTR1, we carried out a virtual screening of the Available Chemicals Directory (ACD) database to select compounds that could interact with L. major PTR1 but not with human DHFR. Through two rounds of drug discovery, we successfully identified eighteen drug-like molecules with low micromolar affinities and high in vitro specificity profiles. Their efficacy against Leishmania species was studied in cultured cells of the promastigote stage, using the compounds both alone and in combination with 1 (pyrimethamine; 5-(4-chlorophenyl)-6-ethylpyrimidine-2,4-diamine). Six compounds showed efficacy only in combination. In toxicity tests against human fibroblasts, several compounds showed low toxicity. One compound, 5c (riluzole; 6-(trifluoromethoxy)-1,3-benzothiazol-2-ylamine), a known drug approved for CNS pathologies, was active in combination and is suitable for early preclinical evaluation of its potential for label extension as a PTR1 inhibitor and antiparasitic drug candidate.

  4. Crystal structure and catalytic properties of Bacillus anthracis CoADR-RHD: implications for flavin-linked sulfur trafficking.

    PubMed

    Wallen, Jamie R; Mallett, T Conn; Boles, William; Parsonage, Derek; Furdui, Cristina M; Karplus, P Andrew; Claiborne, Al

    2009-10-13

    Rhodanese homology domains (RHDs) play important roles in sulfur trafficking mechanisms essential to the biosynthesis of sulfur-containing cofactors and nucleosides. We have now determined the crystal structure at 2.10 A resolution for the Bacillus anthracis coenzyme A-disulfide reductase isoform (BaCoADR-RHD) containing a C-terminal RHD domain; this is the first structural representative of the multidomain proteins class of the rhodanese superfamily. The catalytic Cys44 of the CoADR module is separated by 25 A from the active-site Cys514' of the RHD domain from the complementary subunit. In stark contrast to the B. anthracis CoADR [Wallen, J. R., Paige, C., Mallett, T. C., Karplus, P. A., and Claiborne, A. (2008) Biochemistry 47, 5182-5193], the BaCoADR-RHD isoform does not catalyze the reduction of coenzyme A-disulfide, although both enzymes conserve the Cys-SSCoA redox center. NADH titrations have been combined with a synchrotron reduction protocol for examination of the structural and redox behavior of the Cys44-SSCoA center. The synchrotron-reduced (Cys44 + CoASH) structure reveals ordered binding for the adenosine 3'-phosphate 5'-pyrophosphate moiety of CoASH, but the absence of density for the pantetheine arm indicates that it is flexible within the reduced active site. Steady-state kinetic analyses with the alternate disulfide substrates methyl methanethiolsulfonate (MMTS) and 5,5'-dithiobis(2-nitrobenzoate) (DTNB), including the appropriate Cys --> Ser mutants, demonstrate that MMTS reduction occurs within the CoADR active site. NADH-dependent DTNB reduction, on the other hand, requires communication between Cys44 and Cys514', and we propose that reduction of the Cys44-SSCoA disulfide promotes the transfer of reducing equivalents to the RHD, with the swinging pantetheine arm serving as a ca. 20 A bridge.

  5. Crystal Structure and Catalytic Properties of Bacillus anthracis CoADR-RHD: Implications for Flavin-Linked Sulfur Trafficking

    SciTech Connect

    Wallen, J.; Mallett, T; Boles, W; Parsonage, D; Furdui, C; Karplus, A; Claiborne, A

    2009-01-01

    Rhodanese homology domains (RHDs) play important roles in sulfur trafficking mechanisms essential to the biosynthesis of sulfur-containing cofactors and nucleosides. We have now determined the crystal structure at 2.10 {angstrom} resolution for the Bacillus anthracis coenzyme A-disulfide reductase isoform (BaCoADR-RHD) containing a C-terminal RHD domain; this is the first structural representative of the multidomain proteins class of the rhodanese superfamily. The catalytic Cys44 of the CoADR module is separated by 25 {angstrom} from the active-site Cys514' of the RHD domain from the complementary subunit. In stark contrast to the B. anthracis CoADR (Wallen, J. R., Paige, C., Mallett, T. C., Karplus, P. A., and Claiborne, A. (2008) Biochemistry 47, 5182-5193), the BaCoADR-RHD isoform does not catalyze the reduction of coenzyme A-disulfide, although both enzymes conserve the Cys-SSCoA redox center. NADH titrations have been combined with a synchrotron reduction protocol for examination of the structural and redox behavior of the Cys44-SSCoA center. The synchrotron-reduced (Cys44 + CoASH) structure reveals ordered binding for the adenosine 3'-phosphate 5'-pyrophosphate moiety of CoASH, but the absence of density for the pantetheine arm indicates that it is flexible within the reduced active site. Steady-state kinetic analyses with the alternate disulfide substrates methyl methanethiolsulfonate (MMTS) and 5,5'-dithiobis(2-nitrobenzoate) (DTNB), including the appropriate Cys {yields} Ser mutants, demonstrate that MMTS reduction occurs within the CoADR active site. NADH-dependent DTNB reduction, on the other hand, requires communication between Cys44 and Cys514', and we propose that reduction of the Cys44-SSCoA disulfide promotes the transfer of reducing equivalents to the RHD, with the swinging pantetheine arm serving as a ca. 20 {angstrom} bridge.

  6. DECONTAMINATION ASSESSMENT OF BACILLUS ANTHRACIS, BACILLUS SUBTILIS, AND GEOBACILLUS STEAROTHERMOPHILUS SPORES ON INDOOR SURFACTS USING A HYDROGEN PERIOXIDE GAS GENERATOR

    EPA Science Inventory

    Aims: To evaluate the decontamination of Bacillus anthracis, Bacillus subtilis, and Geobacillus stearothermophilus spores on indoor surface materials using hydrogen peroxide gas. Methods and Results: B. anthracis, B. subtilis, and G. Stearothermophilus spores were dried on seven...

  7. Method for screening inhibitors of the toxicity of Bacillus anthracis

    SciTech Connect

    Cirino, Nick M.; Jackson, Paul J.; Lehnert, Bruce E.

    2001-01-01

    The protective antigen (PA) of Bacillus anthracis is integral to the mechanism of anthrax poisoning. The cloning, expression and purification of a 32 kDa B. anthracis PA fragment (PA32) is described. This fragment has also been expressed as a fusion construct to stabilized green fluorescent protein (EGFP-PA32). Both proteins were capable of binding to specific cell surface receptors as determined by fluorescent microscopy and a flow cytometric assay. To confirm binding specificity in the flow cytometric assay, non-fluorescent PA83 or PA32 was used to competitively inhibit fluorescent EGFP-PA32 binding to cell receptors. This assay can be employed as a rapid screen for compounds which disrupts binding of PA to cells. Additionally, the high intracellular expression levels and ease of purification make this recombinant protein an attractive vaccine candidate or therapeutic treatment for anthrax poisoning.

  8. Structure of isochorismate synthase DhbC from Bacillus anthracis.

    PubMed

    Domagalski, M J; Tkaczuk, K L; Chruszcz, M; Skarina, T; Onopriyenko, O; Cymborowski, M; Grabowski, M; Savchenko, A; Minor, W

    2013-09-01

    The isochorismate synthase DhbC from Bacillus anthracis is essential for the biosynthesis of the siderophore bacillibactin by this pathogenic bacterium. The structure of the selenomethionine-substituted protein was determined to 2.4 Å resolution using single-wavelength anomalous diffraction. B. anthracis DhbC bears the strongest resemblance to the Escherichia coli isochorismate synthase EntC, which is involved in the biosynthesis of another siderophore, namely enterobactin. Both proteins adopt the characteristic fold of other chorismate-utilizing enzymes, which are involved in the biosynthesis of various products, including siderophores, menaquinone and tryptophan. The conservation of the active-site residues, as well as their spatial arrangement, suggests that these enzymes share a common Mg(2+)-dependent catalytic mechanism.

  9. Historical Distribution and Molecular Diversity of Bacillus anthracis, Kazakhstan

    PubMed Central

    Aikembayev, Alim M.; Lukhnova, Larissa; Temiraliyeva, Gulnara; Meka-Mechenko, Tatyana; Pazylov, Yerlan; Zakaryan, Sarkis; Denissov, Georgiy; Easterday, W. Ryan; Van Ert, Matthew N.; Keim, Paul; Francesconi, Stephen C.; Blackburn, Jason K.; Hadfield, Ted

    2010-01-01

    To map the distribution of anthrax outbreaks and strain subtypes in Kazakhstan during 1937–2005, we combined geographic information system technology and genetic analysis by using archived cultures and data. Biochemical and genetic tests confirmed the identity of 93 archived cultures in the Kazakhstan National Culture Collection as Bacillus anthracis. Multilocus variable number tandem repeat analysis genotyping identified 12 genotypes. Cluster analysis comparing these genotypes with previously published genotypes indicated that most (n = 78) isolates belonged to the previously described A1.a genetic cluster, 6 isolates belonged to the A3.b cluster, and 2 belonged to the A4 cluster. Two genotypes in the collection appeared to represent novel genetic sublineages; 1 of these isolates was from Krygystan. Our data provide a description of the historical, geographic, and genetic diversity of B. anthracis in this Central Asian region. PMID:20409368

  10. Structure of isochorismate synthase DhbC from Bacillus anthracis

    PubMed Central

    Domagalski, M. J.; Tkaczuk, K. L.; Chruszcz, M.; Skarina, T.; Onopriyenko, O.; Cymborowski, M.; Grabowski, M.; Savchenko, A.; Minor, W.

    2013-01-01

    The isochorismate synthase DhbC from Bacillus anthracis is essential for the biosynthesis of the siderophore bacillibactin by this pathogenic bacterium. The structure of the selenomethionine-substituted protein was determined to 2.4 Å resolution using single-wavelength anomalous diffraction. B. anthracis DhbC bears the strongest resemblance to the Escherichia coli isochorismate synthase EntC, which is involved in the biosynthesis of another siderophore, namely enterobactin. Both proteins adopt the characteristic fold of other chorismate-utilizing enzymes, which are involved in the biosynthesis of various products, including siderophores, menaquinone and tryptophan. The conservation of the active-site residues, as well as their spatial arrangement, suggests that these enzymes share a common Mg2+-dependent catalytic mechanism. PMID:23989140

  11. Photothermal spectroscopy of Bacillus anthracis and Bacillus cereus with microcantilevers

    SciTech Connect

    Wig, Andrew G; Arakawa, Edward T; Passian, Ali; Ferrell, Thomas L; Thundat, Thomas George

    2006-03-01

    Microcalorimetric optical and infrared spectroscopy is a method of determining the spectral absorption of small quantities of materials over a wide range of incident wavelengths. In this paper, the first spectroscopic results for microcantilevers coated with Bacillus anthracis (BA) are presented. These results, for B. anthracis from 2.5 to 14.5 {micro}m, are compared with results from microcantilevers coated with Bacillus cereus (BC) and standard spectroscopic absorption data. The results demonstrate strong correlation between the deflection measurements and the reference spectroscopic absorption peaks. An advantage of this microcantilever-based method over traditional spectroscopy is that much smaller amounts of material (nanogram quantities) can be detected in comparison with the milligram amounts needed for standard methods. Another advantage is that the complete system can be relatively small without sacrificing spectral resolution.

  12. Historical distribution and molecular diversity of Bacillus anthracis, Kazakhstan.

    PubMed

    Aikembayev, Alim M; Lukhnova, Larissa; Temiraliyeva, Gulnara; Meka-Mechenko, Tatyana; Pazylov, Yerlan; Zakaryan, Sarkis; Denissov, Georgiy; Easterday, W Ryan; Van Ert, Matthew N; Keim, Paul; Francesconi, Stephen C; Blackburn, Jason K; Hugh-Jones, Martin; Hadfield, Ted

    2010-05-01

    To map the distribution of anthrax outbreaks and strain subtypes in Kazakhstan during 1937-2005, we combined geographic information system technology and genetic analysis by using archived cultures and data. Biochemical and genetic tests confirmed the identity of 93 archived cultures in the Kazakhstan National Culture Collection as Bacillus anthracis. Multilocus variable number tandem repeat analysis genotyping identified 12 genotypes. Cluster analysis comparing these genotypes with previously published genotypes indicated that most (n = 78) isolates belonged to the previously described A1.a genetic cluster, 6 isolates belonged to the A3.b cluster, and 2 belonged to the A4 cluster. Two genotypes in the collection appeared to represent novel genetic sublineages; 1 of these isolates was from Krygystan. Our data provide a description of the historical, geographic, and genetic diversity of B. anthracis in this Central Asian region.

  13. Surface Sampling Methods for Bacillus anthracis Spore Contamination

    PubMed Central

    Hein, Misty J.; Taylor, Lauralynn; Curwin, Brian D.; Kinnes, Gregory M.; Seitz, Teresa A.; Popovic, Tanja; Holmes, Harvey T.; Kellum, Molly E.; McAllister, Sigrid K.; Whaley, David N.; Tupin, Edward A.; Walker, Timothy; Freed, Jennifer A.; Small, Dorothy S.; Klusaritz, Brian; Bridges, John H.

    2002-01-01

    During an investigation conducted December 17–20, 2001, we collected environmental samples from a U.S. postal facility in Washington, D.C., known to be extensively contaminated with Bacillus anthracis spores. Because methods for collecting and analyzing B. anthracis spores have not yet been validated, our objective was to compare the relative effectiveness of sampling methods used for collecting spores from contaminated surfaces. Comparison of wipe, wet and dry swab, and HEPA vacuum sock samples on nonporous surfaces indicated good agreement between results with HEPA vacuum and wipe samples. However, results from HEPA vacuum sock and wipe samples agreed poorly with the swab samples. Dry swabs failed to detect spores >75% of the time they were detected by wipe and HEPA vacuum samples. Wipe samples collected after HEPA vacuum samples and HEPA vacuum samples after wipe samples indicated that neither method completely removed spores from the sampled surfaces. PMID:12396930

  14. Structure and Composition of the Bacillus anthracis Capsule

    PubMed Central

    Avakyan, A. A.; Katz, L. N.; Levina, K. N.; Pavlova, I. B.

    1965-01-01

    Avakyan, A. A. (Academy of Medical Sciences, Moscow, USSR), L. N. Katz, K. N. Levina, and I. B. Pavlova. Structure and composition of the Bacillus anthracis capsule. J. Bacteriol. 90:1082–1095. 1965.—Observations by various methods of light microscopy (phase contrast, dark-field, and fluorescence) revealed the complex structure of the Bacillus anthracis capsule, which changes regularly during the growth cycle of the culture. Special cytological methods of staining the capsule made it possible to study its fine structure, which is not revealed by negative staining with India ink. For example, the capsule shows a membranelike outline, fine transverse lines, and interruptions and transverse septa traversing the entire capsule. By using cytochemical methods, it was found that the capsule has a stratified structure and that the various layers of the capsule differ as to the value of the isoelectric point, metachromatic ability, sensitivity to various enzymes, and, consequently, chemical composition. It was thus shown that the membranelike outline of the capsule consists of peptides and neutral mucopolysaccharides. The middle part of the capsule consists of a complex of substances of both polysaccharide and protein nature, and the inner part consists of acid mucopolysaccharides. Observation of the capsular forms of B. anthracis by means of an electron microscope revealed differences in the osmiophilia and submicroscopic structure of the membranelike outline and the middle and inner parts of the capsule. Immunochemical studies conducted by the fluorescent-antibody method revealed localization of antigens in different parts of the capsule, and made it possible to differentiate the capsular antigens according to their serum-staining ability and according of their relations to enzymes, i.e., their chemical composition. This paper concerns the possibility of studying the fine structure of bacterial capsules in fixed preparations, and the differences and similarities of

  15. Genotype Analysis of Bacillus anthracis Strains Circulating in Bangladesh.

    PubMed

    Rume, Farzana Islam; Affuso, Alessia; Serrecchia, Luigina; Rondinone, Valeria; Manzulli, Viviana; Campese, Emanuele; Di Taranto, Pietro; Biswas, Paritosh Kumar; Ahsan, Chowdhury Rafiqul; Yasmin, Mahmuda; Fasanella, Antonio; Hugh-Jones, Martin

    2016-01-01

    In Bangladesh, anthrax, caused by the bacterium Bacillus anthracis, is considered an endemic disease affecting ruminants with sporadic zoonotic occurrences in humans. Due to the lack of knowledge about risks from an incorrect removal of infected carcasses, the disease is not properly monitored, and because of the socio-economic conditions, the situation is under-reported and under-diagnosed. For sensitive species, anthrax represents a fatal outcome with sudden death and sometimes bleeding from natural orifices. The most common source of infection for ruminants is ingestion of spores during grazing in contaminated pastures or through grass and water contaminated with anthrax spores. Domestic cattle, sheep and goats can also become infected through contaminated bone meal (used as feed) originating from anthrax-infected carcasses. The present investigation was conducted to isolate B. anthracis organisms from 169 samples (73 soil, 1 tissue, 4 bone and 91 bone meal samples) collected from 12 different districts of Bangladesh. The sampling was carried out from 2012 to 2015. Twelve samples resulted positive for B. anthracis. Biomolecular analyses were conducted starting from the Canonical Single Nucleotide Polymorphism (CanSNP) to analyze the phylogenetic origin of strains. The analysis of genotype, obtained through the Multiple Locus Variable Number Tandem Repeat Analysis (MLVA) with the analysis of 15 Variable Number Tandem Repeats (VNTR), demonstrated four different genotypes: two of them were previously identified in the district of Sirajganj. The sub-genotyping, conducted with Single Nucleotide Repeats analysis, revealed the presence of eight subgenotypes. The data of the present study concluded that there was no observed correlation between imported cattle feed and anthrax occurrence in Bangladesh and that the remarkable genetic variations of B. anthracis were found in the soil of numerous outbreaks in this country.

  16. Inactivation of Bacillus Anthracis Spores Using Carbon Nanotubes

    DTIC Science & Technology

    2014-10-30

    Institute of Biological Engineering (IBE) 2013 Annual Meeting , March 7-9, Cary, NC. (poster) 3. Liju Yang. 2013.Carbon Nanotubes Interfacing...Bacillus anthracis Spores The Institute of Biological Engineering (IBE) 2013 Annual Meeting , March 7-9, Cary, NC. (Oral) 4. Xiuli Dong1, Yongan...2013 Annual Meeting , March 7-9, Cary, NC. 5. Xiuli Dong1, Yongan Tang2, Marvin Wu2, Branislav Vlahovic2, Liju Yang1. 2012. Dual effects of Single

  17. Evaluation of PCR Systems for Field Screening of Bacillus anthracis

    PubMed Central

    Ozanich, Richard M.; Colburn, Heather A.; Victry, Kristin D.; Bartholomew, Rachel A.; Arce, Jennifer S.; Heredia-Langner, Alejandro; Jarman, Kristin; Kreuzer, Helen W.

    2017-01-01

    There is little published data on the performance of hand-portable polymerase chain reaction (PCR) systems that can be used by first responders to determine if a suspicious powder contains a potential biothreat agent. We evaluated 5 commercially available hand-portable PCR instruments for detection of Bacillus anthracis. We used a cost-effective, statistically based test plan to evaluate systems at performance levels ranging from 0.85-0.95 lower confidence bound (LCB) of the probability of detection (POD) at confidence levels of 80% to 95%. We assessed specificity using purified genomic DNA from 13 B. anthracis strains and 18 Bacillus near neighbors, potential interference with 22 suspicious powders that are commonly encountered in the field by first responders during suspected biothreat incidents, and the potential for PCR inhibition when B. anthracis spores were spiked into these powders. Our results indicate that 3 of the 5 systems achieved 0.95 LCB of the probability of detection with 95% confidence levels at test concentrations of 2,000 genome equivalents/mL (GE/mL), which is comparable to 2,000 spores/mL. This is more than sufficient sensitivity for screening visible suspicious powders. These systems exhibited no false-positive results or PCR inhibition with common suspicious powders and reliably detected B. anthracis spores spiked into these powders, though some issues with assay controls were observed. Our testing approach enables efficient performance testing using a statistically rigorous and cost-effective test plan to generate performance data that allow users to make informed decisions regarding the purchase and use of field biodetection equipment. PMID:28192050

  18. Molecular characterization of the circulating Bacillus anthracis in Jordan.

    PubMed

    Aqel, Amin Abdelfattah; Hailat, Ekhlas; Serrecchia, Luigina; Aqel, Suad; Campese, Emanuele; Vicari, Nadia; Fasanella, Antonio

    2015-12-01

    To understand the biomolecular charcteristics of Bacillus anthracis in Jordan, 20 blood smear slides from dead animals with suspected anthrax were analyzed using conventional and molecular approaches. All slides were positive for B. anthracis by conventional staining but no growth of the organism on selective media was detected. However, of the 20 samples, 16 were B. anthracis DNA-positive using polymerase chain reaction (PCR). Seven samples provided enough quantity and quality of DNA, and their multilocus variable tandem repeat analysis (MLVA)-15 loci analysis revealed two different genotypes. All genotypes were belonging to A.B..r. 008/009 which is very common in Asia and Europe. Single nucleotide repeat (SNR) analysis revealed that there were no sub genotypes. Molecular diagnosis of animal anthrax in Jordan is not used routinely; henceforth, official diagnosis of anthrax is based on the observation of the slides by optical microscope and this can often cause reading errors. Therefore, the prevalence of the disease in Jordan might be slightly lower than that reported by the official bodies.

  19. The Bacillus anthracis Exosporium: What's the Big "Hairy" Deal?

    PubMed

    Bozue, Joel A; Welkos, Susan; Cote, Christopher K

    2015-10-01

    In some Bacillus species, including Bacillus subtilis, the coat is the outermost layer of the spore. In others, such as the Bacillus cereus family, there is an additional layer that envelops the coat, called the exosporium. In the case of Bacillus anthracis, a series of fine hair-like projections, also referred to as a "hairy" nap, extends from the exosporium basal layer. The exact role of the exosporium in B. anthracis, or for any of the Bacillus species possessing this structure, remains unclear. However, it has been assumed that the exosporium would play some role in infection for B. anthracis, because it is the outermost structure of the spore and would make initial contact with host and immune cells during infection. Therefore, the exosporium has been a topic of great interest, and over the past decade much progress has been made to understand its composition, biosynthesis, and potential roles. Several key aspects of this spore structure, however, are still debated and remain undetermined. Although insights have been gained on the interaction of exosporium with the host during infection, the exact role and significance of this complex structure remain to be determined. Furthermore, because the exosporium is a highly antigenic structure, future strategies for the next-generation anthrax vaccine should pursue its inclusion as a component to provide protection against the spore itself during the initial stages of anthrax.

  20. Multigeneration Cross-Contamination of Mail with Bacillus anthracis Spores.

    PubMed

    Edmonds, Jason; Lindquist, H D Alan; Sabol, Jonathan; Martinez, Kenneth; Shadomy, Sean; Cymet, Tyler; Emanuel, Peter

    2016-01-01

    The release of biological agents, including those which could be used in biowarfare or bioterrorism in large urban areas, has been a concern for governments for nearly three decades. Previous incidents from Sverdlosk and the postal anthrax attack of 2001 have raised questions on the mechanism of spread of Bacillus anthracis spores as an aerosol or contaminant. Prior studies have demonstrated that Bacillus atrophaeus is easily transferred through simulated mail handing, but no reports have demonstrated this ability with Bacillus anthracis spores, which have morphological differences that may affect adhesion properties between spore and formite. In this study, equipment developed to simulate interactions across three generations of envelopes subjected to tumbling and mixing was used to evaluate the potential for cross-contamination of B. anthracis spores in simulated mail handling. In these experiments, we found that the potential for cross-contamination through letter tumbling from one generation to the next varied between generations while the presence of a fluidizer had no statistical impact on the transfer of material. Likewise, the presence or absence of a fluidizer had no statistically significant impact on cross-contamination levels or reaerosolization from letter opening.

  1. Multigeneration Cross-Contamination of Mail with Bacillus anthracis Spores

    PubMed Central

    Edmonds, Jason; Lindquist, H. D. Alan; Sabol, Jonathan; Martinez, Kenneth; Shadomy, Sean; Cymet, Tyler; Emanuel, Peter

    2016-01-01

    The release of biological agents, including those which could be used in biowarfare or bioterrorism in large urban areas, has been a concern for governments for nearly three decades. Previous incidents from Sverdlosk and the postal anthrax attack of 2001 have raised questions on the mechanism of spread of Bacillus anthracis spores as an aerosol or contaminant. Prior studies have demonstrated that Bacillus atrophaeus is easily transferred through simulated mail handing, but no reports have demonstrated this ability with Bacillus anthracis spores, which have morphological differences that may affect adhesion properties between spore and formite. In this study, equipment developed to simulate interactions across three generations of envelopes subjected to tumbling and mixing was used to evaluate the potential for cross-contamination of B. anthracis spores in simulated mail handling. In these experiments, we found that the potential for cross-contamination through letter tumbling from one generation to the next varied between generations while the presence of a fluidizer had no statistical impact on the transfer of material. Likewise, the presence or absence of a fluidizer had no statistically significant impact on cross-contamination levels or reaerosolization from letter opening. PMID:27123934

  2. Assembly and Function of the Bacillus anthracis S-Layer.

    PubMed

    Missiakas, Dominique; Schneewind, Olaf

    2017-09-08

    Bacillus anthracis, the anthrax agent, is a member of the Bacillus cereus sensu lato group, which includes invasive pathogens of mammals or insects as well as nonpathogenic environmental strains. The genes for anthrax pathogenesis are located on two large virulence plasmids. Similar virulence plasmids have been acquired by other B. cereus strains and enable the pathogenesis of anthrax-like diseases. Among the virulence factors of B. anthracis is the S-layer-associated protein BslA, which endows bacilli with invasive attributes for mammalian hosts. BslA surface display and function are dependent on the bacterial S-layer, whose constituents assemble by binding to the secondary cell wall polysaccharide (SCWP) via S-layer homology (SLH) domains. B. anthracis and other pathogenic B. cereus isolates harbor genes for the secretion of S-layer proteins, for S-layer assembly, and for synthesis of the SCWP. We review here recent insights into the assembly and function of the S-layer and the SCWP.

  3. Evaluation of tools for environmental sampling of Bacillus anthracis spores.

    PubMed

    Fujinami, Yoshihito; Hosokawa-Muto, Junji; Mizuno, Natsuko

    2015-12-01

    This study describes the validation of sampling techniques used to detect biological warfare agents used in terror attacks. For this purpose, we tested the efficiencies of different sampling media and extraction solutions for the recovery of bacterial pathogens. We first used Bacillus cereus ATCC 4342 spores as a surrogate for highly pathogenic B. anthracis to compare recovery efficiencies of spores from four different surfaces. We used three different types of sampling swabs and four different solutions to extract spores from the swabs. The most effective sampling method employed rayon swabs moistened with water. The efficencies of the four extraction solutions did not differ significantly, although yields were highest using phosphate-buffered saline containing Tween 80 (PBS-T). Using rayon swabs and sterile water, we recovered B. cereus ATCC 4342 and B. anthracis spores with equivalent efficiencies. These findings indicate that because of its reduced pathogenicity and relative ease in handling (Biosafety Level 1), use of B. cereus ATCC 4342 will facilitate further optimization of techniques to detect B. anthracis.

  4. Development of a Rapid and Sensitive Immunoassay for Detection and Subsequent Recovery of Bacillus anthracis Spores in Environmental Samples

    USDA-ARS?s Scientific Manuscript database

    Bacillus anthracis is considered a major threat as an agent of bioterrorism. B. anthracis spores are readily dispersed as aerosols, are very persistent, and are resistant to normal disinfection treatments. Immunoassays have been developed to rapidly detect B. anthracis spores at high concentration...

  5. Dendritic Cell Targeting of Bacillus anthracis Protective Antigen Expressed by Lactobacillus acidophilus Protects Mice from Lethal Challenge

    DTIC Science & Technology

    2008-10-28

    Dendritic cell targeting of Bacillus anthracis protective antigen expressed by Lactobacillus acidophilus protects mice from lethal challenge M...lethal chal- lenge. A vaccine strategy was established by using Lactobacillus acidophilus to deliver Bacillus anthracis protective antigen (PA) via...4. TITLE AND SUBTITLE Dendritic cell targeting of Bacillus anthracis protective antigen expressed by Lactobacillus acidophilus protects mice

  6. Genes Required for Bacillus anthracis Secondary Cell Wall Polysaccharide Synthesis

    PubMed Central

    Oh, So-Young; Lunderberg, J. Mark; Chateau, Alice; Schneewind, Olaf

    2016-01-01

    ABSTRACT The secondary cell wall polysaccharide (SCWP) is thought to be essential for vegetative growth and surface (S)-layer assembly in Bacillus anthracis; however, the genetic determinants for the assembly of its trisaccharide repeat structure are not known. Here, we report that WpaA (BAS0847) and WpaB (BAS5274) share features with membrane proteins involved in the assembly of O-antigen lipopolysaccharide in Gram-negative bacteria and propose that WpaA and WpaB contribute to the assembly of the SCWP in B. anthracis. Vegetative forms of the B. anthracis wpaA mutant displayed increased lengths of cell chains, a cell separation defect that was attributed to mislocalization of the S-layer-associated murein hydrolases BslO, BslS, and BslT. The wpaB mutant was defective in vegetative replication during early logarithmic growth and formed smaller colonies. Deletion of both genes, wpaA and wpaB, did not yield viable bacilli, and when depleted of both wpaA and wpaB, B. anthracis could not maintain cell shape, support vegetative growth, or assemble SCWP. We propose that WpaA and WpaB fulfill overlapping glycosyltransferase functions of either polymerizing repeat units or transferring SCWP polymers to linkage units prior to LCP-mediated anchoring of the polysaccharide to peptidoglycan. IMPORTANCE The secondary cell wall polysaccharide (SCWP) is essential for Bacillus anthracis growth, cell shape, and division. SCWP is comprised of trisaccharide repeats (→4)-β-ManNAc-(1→4)-β-GlcNAc-(1→6)-α-GlcNAc-(1→) with α-Gal and β-Gal substitutions; however, the genetic determinants and enzymes for SCWP synthesis are not known. Here, we identify WpaA and WpaB and report that depletion of these factors affects vegetative growth, cell shape, and S-layer assembly. We hypothesize that WpaA and WpaB are involved in the assembly of SCWP prior to transfer of this polymer onto peptidoglycan. PMID:27795328

  7. New aspects of the infection mechanisms of Bacillus anthracis.

    PubMed

    Zakowska, Dorota; Bartoszcze, Michał; Niemcewicz, Marcin; Bielawska-Drózd, Agata; Kocik, Janusz

    2012-01-01

    Articles concerning new aspects of B. anthracis mechanisms of infection were reviewed. It was found, that the hair follicle plays an important role in the spore germination process. The hair follicle represent an important portal of entry in the course of the cutaneous form of disease infections. After mouse exposition to aerosol of spores prepared from B. anthracis strains, an increase in the level of TNF-α cytokines was observed. The TNF-α cytokines were produced after intrusion into the host by the microorganism. This process may play a significant role in the induced migration of infected cells APCs (Antigen Presenting Cells) via chemotactic signals to the lymph nodes. It was explained that IgG, which binds to the spore surface, activates the adaptive immune system response. As a result, the release C3b opsonin from the spore surface, and mediating of C3 protein fragments of B. anthracis spores phagocytosis by human macrophages, was observed. The genes coding germination spores protein in mutant strains of B. anthracis MIGD was a crucial discovery. According to this, it could be assumed that the activity of B. anthracis spores germination process is dependent upon the sleB, cwlJ1 and cwlJ2 genes, which code the GSLEs lithic enzymes. It was also discovered that the specific antibody for PA20, which binds to the PA20 antigenic determinant, are able to block further PA83 proteolytic fission on the surface of cells. This process neutralized PA functions and weakened the activity of free PA20, which is produced during the PA83 enzyme fission process. Interaction between PA63 monomer and LF may be helpful in the PA63 oligomerization and grouping process, and the creation of LF/PA63 complexes may be a part of an alternative process of assembling the anthrax toxin on the surface of cells. It was found that actin-dependent endocytosis plays an important role in the PA heptamerisation process and leads to blocking the toxin activity. Chaperones, a protein derived from

  8. Wide Area Recovery and Resilency Program (WARRP). Video - Aggressive Air Sampling for B. anthracis Spores

    DTIC Science & Technology

    2012-09-14

    34Systematic Evaluation of Aggressive Air Sampling for Bacillus anthracis Spores", in which aggressive air sampling, used for asbestos fiber detection, was...Sep 2012 Final 01 Feb 2011 - 01 Sep 2012 Wide Area Recovery and Resiliency Program (WARRP) Video - Aggressive Air Sampling for B. anthracis Spores

  9. Real-Time PCR Assay for a Unique Chromosomal Sequence of Bacillus anthracis

    DTIC Science & Technology

    2004-12-01

    33672 Bacillus megaterium ................................................................ NA...Assay for a Unique Chromosomal Sequence of Bacillus anthracis Elizabeth Bode,1 William Hurtle,2† and David Norwood1* United States Army Medical...modification 4 June 2004/Accepted 9 August 2004 Real-time PCR has become an important method for the rapid identification of Bacillus anthracis since the

  10. Determination of the most closely related bacillus isolates to Bacillus anthracis by multilocus sequence typing.

    PubMed Central

    Kim, Kijeong; Cheon, Eunhee; Wheeler, Katherine E.; Youn, Youngchul; Leighton, Terrance J.; Park, Chulmin; Kim, Wonyong; Chung, Sang-In

    2005-01-01

    There have been many efforts to develop Bacillus anthracis detection assays, but the problem of false-positive results has often been encountered. Therefore, to validate an assay for B. anthracis detection, it is critical to examine its specificity with the most closely related Bacillus isolates that are available. To define the most closely related Bacillus isolates to B. anthracis in our Bacillus collections, we analyzed by multilocus sequence typing (MLST) the phylogeny of 77 closely related Bacillus isolates selected from 264 Bacillus isolates. The selection includes all the Bacillus isolates that have been shown in our previous studies to produce false-positive results by some anthrax-detection assays. The MLST phylogenetic analyses revealed that 27 of the non-B. anthracis isolates clustered within the B. anthracis clade, and four of them (three sequence types, STs) had the highest degree of genetic relatedness with B. anthracis, 18 (11 STs) had the second highest, and five (five STs) had the third highest. We anticipate that the inclusion of the 19 ST isolates when analyzing B. anthracis detection assays will prove to be useful for screening for their specificity to detect B. anthracis. PMID:16197725

  11. Genome Sequence of the Soviet/Russian Bacillus anthracis Vaccine Strain 55-VNIIVViM

    PubMed Central

    Kotorashvili, Adam

    2016-01-01

    Bacillus anthracis strain 55-VNIIVViM is a live-attenuated nonencapsulated Soviet/Russian veterinary anthrax vaccine strain. We report here the genome of 55-VNIIVViM and confirm its phylogenetic placement in the global population structure of B. anthracis. PMID:28007853

  12. Draft genome sequence of Bacillus anthracis UR-1, isolated from a German heroin user.

    PubMed

    Rückert, Christian; Licht, Katharina; Kalinowski, Jörn; Espírito Santo, Christophe; Antwerpen, Markus; Hanczaruk, Matthias; Reischl, Udo; Holzmann, Thomas; Gessner, André; Tiemann, Carsten; Grass, Gregor

    2012-11-01

    We report the draft genome sequence of Bacillus anthracis UR-1, isolated from a fatal case of injectional anthrax in a German heroin user. Analysis of the genome sequence of strain UR-1 may aid in describing phylogenetic relationships between virulent heroin-associated isolates of B. anthracis isolated in the United Kingdom, Germany, and other European countries.

  13. The Pathogenomic Sequence Analysis of B. cereus and B. Thuringiensis isolates closely related to Bacillus anthracis

    SciTech Connect

    Han, C S; Xie, G; Challacombe, J F; Altherr, M R; Bhotika, S S; Bruce, D; Campbell, C S; Campbell, M L; Chen, J; Chertkov, O; Cleland, C; Dimitrijevic-Bussod, M; Doggett, N A; Fawcett, J J; Glavina, T; Goodwin, L A; Hill, K K; Hitchcock, P; Jackson, P J; Keim, P; Kewalramani, A R; Longmire, J; Lucas, S; Malfatti, S; McMurry, K; Meincke, L J; Misra, M; Moseman, B L; Mundt, M; Munk, A C; Okinaka, R T; Parson-Quintana, B; Reilly, L P; Richardson, P; Robinson, D L; Rubin, E; Saunders, E; Tapia, R; Tesmer, J G; Thayer, N; Thompson, L S; Tice, H; Ticknor, L O; Wills, P L; Gilna, P; Brettin, T S

    2005-10-12

    The sequencing and analysis of two close relatives of Bacillus anthracis are reported. AFLP analysis of over 300 isolates of B. cereus, B. thuringiensis and B. anthracis identified two isolates as being very closely related to B. anthracis. One, a B. cereus, BcE33L, was isolated from a zebra carcass in Nambia; the second, a B. thuringiensis, 97-27, was isolated from a necrotic human wound. The B. cereus appears to be the closest anthracis relative sequenced to date. A core genome of over 3,900 genes was compiled for the Bacillus cereus group, including B anthracis. Comparative analysis of these two genomes with other members of the B. cereus group provides insight into the evolutionary relationships among these organisms. Evidence is presented that differential regulation modulates virulence, rather than simple acquisition of virulence factors. These genome sequences provide insight into the molecular mechanisms contributing to the host range and virulence of this group of organisms.

  14. Structure and reactivity of Trypanosoma brucei pteridine reductase: inhibition by the archetypal antifolate methotrexate.

    PubMed

    Dawson, Alice; Gibellini, Federica; Sienkiewicz, Natasha; Tulloch, Lindsay B; Fyfe, Paul K; McLuskey, Karen; Fairlamb, Alan H; Hunter, William N

    2006-09-01

    The protozoan Trypanosoma brucei has a functional pteridine reductase (TbPTR1), an NADPH-dependent short-chain reductase that participates in the salvage of pterins, which are essential for parasite growth. PTR1 displays broad-spectrum activity with pterins and folates, provides a metabolic bypass for inhibition of the trypanosomatid dihydrofolate reductase and therefore compromises the use of antifolates for treatment of trypanosomiasis. Catalytic properties of recombinant TbPTR1 and inhibition by the archetypal antifolate methotrexate have been characterized and the crystal structure of the ternary complex with cofactor NADP+ and the inhibitor determined at 2.2 A resolution. This enzyme shares 50% amino acid sequence identity with Leishmania major PTR1 (LmPTR1) and comparisons show that the architecture of the cofactor binding site, and the catalytic centre are highly conserved, as are most interactions with the inhibitor. However, specific amino acid differences, in particular the placement of Trp221 at the side of the active site, and adjustment of the beta6-alpha6 loop and alpha6 helix at one side of the substrate-binding cleft significantly reduce the size of the substrate binding site of TbPTR1 and alter the chemical properties compared with LmPTR1. A reactive Cys168, within the active site cleft, in conjunction with the C-terminus carboxyl group and His267 of a partner subunit forms a triad similar to the catalytic component of cysteine proteases. TbPTR1 therefore offers novel structural features to exploit in the search for inhibitors of therapeutic value against African trypanosomiasis.

  15. Bacillus cereus G9241 Makes Anthrax Toxin and Capsule like Highly Virulent B. anthracis Ames but Behaves like Attenuated Toxigenic Nonencapsulated B. anthracis Sterne in Rabbits and Mice

    DTIC Science & Technology

    2011-08-01

    20. Kuroki, R., et al. 2009. Nosocomial bacteremia caused by biofilm-forming Bacillus cereus and Bacillus tlrurin!{iensis. Intern. Med. 48:791-796...Microbiology. All Rights Reserved. Bacillus cereus G9241 Makes Anthrax Toxin and Capsule like Highly Virulent B. anthracis Ames but Behaves like...G9241 for mice requires the presence of both plasmids. The Bacillus cereus group, of which Bacillus anthracis, Bacil- lus thuringiensis, and B

  16. A Novel Multiplex PCR Discriminates Bacillus anthracis and Its Genetically Related Strains from Other Bacillus cereus Group Species

    PubMed Central

    Ogawa, Hirohito; Fujikura, Daisuke; Ohnuma, Miyuki; Ohnishi, Naomi; Hang'ombe, Bernard M.; Mimuro, Hitomi; Ezaki, Takayuki; Mweene, Aaron S.; Higashi, Hideaki

    2015-01-01

    Anthrax is an important zoonotic disease worldwide that is caused by Bacillus anthracis, a spore-forming pathogenic bacterium. A rapid and sensitive method to detect B. anthracis is important for anthrax risk management and control in animal cases to address public health issues. However, it has recently become difficult to identify B. anthracis by using previously reported molecular-based methods because of the emergence of B. cereus, which causes severe extra-intestinal infection, as well as the human pathogenic B. thuringiensis, both of which are genetically related to B. anthracis. The close genetic relation of chromosomal backgrounds has led to complexity of molecular-based diagnosis. In this study, we established a B. anthracis multiplex PCR that can screen for the presence of B. anthracis virulent plasmids and differentiate B. anthracis and its genetically related strains from other B. cereus group species. Six sets of primers targeting a chromosome of B. anthracis and B. anthracis-like strains, two virulent plasmids, pXO1 and pXO2, a bacterial gene, 16S rRNA gene, and a mammalian gene, actin-beta gene, were designed. The multiplex PCR detected approximately 3.0 CFU of B. anthracis DNA per PCR reaction and was sensitive to B. anthracis. The internal control primers also detected all bacterial and mammalian DNAs examined, indicating the practical applicability of this assay as it enables monitoring of appropriate amplification. The assay was also applied for detection of clinical strains genetically related to B. anthracis, which were B. cereus strains isolated from outbreaks of hospital infections in Japan, and field strains isolated in Zambia, and the assay differentiated B. anthracis and its genetically related strains from other B. cereus group strains. Taken together, the results indicate that the newly developed multiplex PCR is a sensitive and practical method for detecting B. anthracis. PMID:25774512

  17. A novel multiplex PCR discriminates Bacillus anthracis and its genetically related strains from other Bacillus cereus group species.

    PubMed

    Ogawa, Hirohito; Fujikura, Daisuke; Ohnuma, Miyuki; Ohnishi, Naomi; Hang'ombe, Bernard M; Mimuro, Hitomi; Ezaki, Takayuki; Mweene, Aaron S; Higashi, Hideaki

    2015-01-01

    Anthrax is an important zoonotic disease worldwide that is caused by Bacillus anthracis, a spore-forming pathogenic bacterium. A rapid and sensitive method to detect B. anthracis is important for anthrax risk management and control in animal cases to address public health issues. However, it has recently become difficult to identify B. anthracis by using previously reported molecular-based methods because of the emergence of B. cereus, which causes severe extra-intestinal infection, as well as the human pathogenic B. thuringiensis, both of which are genetically related to B. anthracis. The close genetic relation of chromosomal backgrounds has led to complexity of molecular-based diagnosis. In this study, we established a B. anthracis multiplex PCR that can screen for the presence of B. anthracis virulent plasmids and differentiate B. anthracis and its genetically related strains from other B. cereus group species. Six sets of primers targeting a chromosome of B. anthracis and B. anthracis-like strains, two virulent plasmids, pXO1 and pXO2, a bacterial gene, 16S rRNA gene, and a mammalian gene, actin-beta gene, were designed. The multiplex PCR detected approximately 3.0 CFU of B. anthracis DNA per PCR reaction and was sensitive to B. anthracis. The internal control primers also detected all bacterial and mammalian DNAs examined, indicating the practical applicability of this assay as it enables monitoring of appropriate amplification. The assay was also applied for detection of clinical strains genetically related to B. anthracis, which were B. cereus strains isolated from outbreaks of hospital infections in Japan, and field strains isolated in Zambia, and the assay differentiated B. anthracis and its genetically related strains from other B. cereus group strains. Taken together, the results indicate that the newly developed multiplex PCR is a sensitive and practical method for detecting B. anthracis.

  18. Nitric oxide as a regulator of B. anthracis pathogenicity

    PubMed Central

    Popova, Taissia G.; Teunis, Allison; Vaseghi, Haley; Zhou, Weidong; Espina, Virginia; Liotta, Lance A.; Popov, Serguei G.

    2015-01-01

    Nitric oxide (NO) is a key physiological regulator in eukaryotic and prokaryotic organisms. It can cause a variety of biological effects by reacting with its targets or/and indirectly inducing oxidative stress. NO can also be produced by bacteria including the pathogenic Bacillus anthracis; however, its role in the infectious process only begins to emerge. NO incapacitates macrophages by S-nitrosylating the intracellular proteins and protects B. anthracis from oxidative stress. It is also implicated in the formation of toxic peroxynitrite. In this study we further assessed the effects of B. anthracis NO produced by the NO synthase (bNOS) on bacterial metabolism and host cells in experiments with the bNOS knockout Sterne strain. The mutation abrogated accumulation of nitrite and nitrate as tracer products of NO in the culture medium and markedly attenuated growth in both aerobic and microaerobic conditions. The regulatory role of NO was also suggested by the abnormally high rate of nitrate denitrification by the mutant in the presence of oxygen. Anaerobic regulation mediated by NO was reflected in reduced fermentation of glucose by the mutant correlating with the reduced toxicity of bacteria toward host cells in culture. The toxic effect of NO required permeabilization of the target cells as well as the activity of fermentation-derived metabolite in the conditions of reduced pH. The host cells demonstrated increased phosphorylation of major survivor protein kinase AKT correlating with reduced toxicity of the mutant in comparison with Sterne. Our global proteomic analysis of lymph from the lymph nodes of infected mice harboring bacteria revealed numerous changes in the pattern and levels of proteins associated with the activity of bNOS influencing key cell physiological processes relevant to energy metabolism, growth, signal transduction, stress response, septic shock, and homeostasis. This is the first in vivo observation of the bacterial NO effect on the lymphatic

  19. Nanomechanical Characterization of Bacillus anthracis Spores by Atomic Force Microscopy

    PubMed Central

    Burggraf, Larry W.; Xing, Yun

    2016-01-01

    ABSTRACT The study of structures and properties of bacterial spores is important to understanding spore formation and biological responses to environmental stresses. While significant progress has been made over the years in elucidating the multilayer architecture of spores, the mechanical properties of the spore interior are not known. Here, we present a thermal atomic force microscopy (AFM) study of the nanomechanical properties of internal structures of Bacillus anthracis spores. We developed a nanosurgical sectioning method in which a stiff diamond AFM tip was used to cut an individual spore, exposing its internal structure, and a soft AFM tip was used to image and characterize the spore interior on the nanometer scale. We observed that the elastic modulus and adhesion force, including their thermal responses at elevated temperatures, varied significantly in different regions of the spore section. Our AFM images indicated that the peptidoglycan (PG) cortex of Bacillus anthracis spores consisted of rod-like nanometer-sized structures that are oriented in the direction perpendicular to the spore surface. Our findings may shed light on the spore architecture and properties. IMPORTANCE A nanosurgical AFM method was developed that can be used to probe the structure and properties of the spore interior. The previously unknown ultrastructure of the PG cortex of Bacillus anthracis spores was observed to consist of nanometer-sized rod-like structures that are oriented in the direction perpendicular to the spore surface. The variations in the nanomechanical properties of the spore section were largely correlated with its chemical composition. Different components of the spore materials showed different thermal responses at elevated temperatures. PMID:26969703

  20. Unveiling the Novel Dual Specificity Protein Kinases in Bacillus anthracis

    PubMed Central

    Arora, Gunjan; Sajid, Andaleeb; Arulanandh, Mary Diana; Singhal, Anshika; Mattoo, Abid R.; Pomerantsev, Andrei P.; Leppla, Stephen H.; Maiti, Souvik; Singh, Yogendra

    2012-01-01

    Dual specificity protein kinases (DSPKs) are unique enzymes that can execute multiple functions in the cell, which are otherwise performed exclusively by serine/threonine and tyrosine protein kinases. In this study, we have characterized the protein kinases Bas2152 (PrkD) and Bas2037 (PrkG) from Bacillus anthracis. Transcriptional analyses of these kinases showed that they are expressed in all phases of growth. In a serendipitous discovery, both kinases were found to be DSPKs. PrkD was found to be similar to the eukaryotic dual specificity Tyr phosphorylation-regulated kinase class of dual specificity kinases, which autophosphorylates on Ser, Thr, and Tyr residues and phosphorylates Ser and Thr residues on substrates. PrkG was found to be a bona fide dual specificity protein kinase that mediates autophosphorylation and substrate phosphorylation on Ser, Thr, and Tyr residues. The sites of phosphorylation in both of the kinases were identified through mass spectrometry. Phosphorylation on Tyr residues regulates the kinase activity of PrkD and PrkG. PrpC, the only known Ser/Thr protein phosphatase, was also found to possess dual specificity. Genistein, a known Tyr kinase inhibitor, was found to inhibit the activities of PrkD and PrkG and affect the growth of B. anthracis cells, indicating a possible role of these kinases in cell growth and development. In addition, the glycolytic enzyme pyruvate kinase was found to be phosphorylated by PrkD on Ser and Thr residues but not by PrkG. Thus, this study provides the first evidence of DSPKs in B. anthracis that belong to different classes and have different modes of regulation. PMID:22711536

  1. Improvements to a Markerless Allelic Exchange System for Bacillus anthracis

    PubMed Central

    Plaut, Roger D.; Stibitz, Scott

    2015-01-01

    A system was previously developed for conducting I-SceI-mediated allelic exchange in Bacillus anthracis. In this system, recombinational loss of a chromosomally-integrated allelic exchange vector is stimulated by creation of a double-stranded break within the vector by the homing endonuclease I-SceI. Although this system is reasonably efficient and represents an improvement in the tools available for allelic exchange in B. anthracis, researchers are nonetheless required to “pick and patch” colonies in order to identify candidate "exchangeants." In the present study, a number of improvements have been made to this system: 1) an improved I-SceI-producing plasmid includes oriT so that both plasmids can now be introduced by conjugation, thus avoiding the need for preparing electro-competent cells of each integration intermediate; 2) antibiotic markers have been changed to allow the use of the system in select agent strains; and 3) both plasmids have been marked with fluorescent proteins, allowing the visualization of plasmid segregation on a plate and obviating the need for “picking and patching.” These modifications have made the process easier, faster, and more efficient, allowing for parallel construction of larger numbers of mutant strains. Using this improved system, the genes encoding the tripartite anthrax toxin were deleted singly and in combination from plasmid pXO1 of Sterne strain 34F2. In the course of this study, we determined that DNA transfer to B. anthracis could be accomplished by conjugation directly from a methylation-competent E. coli strain. PMID:26624016

  2. Glycerol monolaurate inhibits virulence factor production in Bacillus anthracis.

    PubMed

    Vetter, Sara M; Schlievert, Patrick M

    2005-04-01

    Anthrax, caused by Bacillus anthracis, has been brought to the public's attention because of the 2001 bioterrorism attacks. However, anthrax is a disease that poses agricultural threats in the United States as well as human populations in Europe, China, Africa, and Australia. Glycerol monolaurate (GML) is a compound that has been shown to inhibit exotoxin production by Staphylococcus aureus and other gram-positive bacteria. Here, we study the effects of GML on growth and toxin production in B. anthracis. The Sterne strain of B. anthracis was grown to post-exponential phase with 0-, 10-, 15-, or 20-microg/ml concentrations of GML and then assayed quantitatively for protective antigen (PA) and lethal factor (LF). After 8 h, GML at concentrations greater than 20 microg/ml was bacteriostatic to growth of the organism. However, a 10-microg/ml concentration of GML was not growth inhibitory, but amounts of PA and LF made were greatly reduced. This effect was not global for all proteins when total secreted protein from culture fluids was examined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Through quantitative reverse transcription-PCR assays, this toxin-inhibitory effect was shown to occur at the transcriptional level, since amounts of mRNA for pagA (PA), lef (LF), and cya (edema factor) were reduced. Surprisingly, mRNA levels of atxA, a regulator of exotoxin gene expression, rose in the presence of GML. These data will be useful in developing therapeutic tools to treat anthrax disease, whether in animals or humans. These results also suggest that mechanisms of virulence regulation exist independent of atxA.

  3. Zeatin reductase in Phaseolus embryos

    SciTech Connect

    Martin, R.C.; Mok, David, W.S.; Mok, M.C. )

    1989-04-01

    Zeatin was converted to O-xylosylzeatin in embryos of Phaseolus vulgaris . O-xylosyldihydrozeatin was also identified as a zeatin metabolite. Incubation of embryo extracts with {sup 14}C-zeatin and {sup 14}C-O-xylosylzeatin revealed that reduction preceeds the O-xylosylation of zeatin. An enzyme responsible for reducing the N{sup 6}-side chain was isolated and partially purified using ammonium sulfate fractionation and affinity, gel filtration and anion exchange chromatography. The NADPH dependent reductase was zeatin specific and did not recognize cis-zeatin, ribosylzeatin, i{sup 6}Ade or i{sup 6}Ado. Two forms of the reductase could be separated by either gel filtration or anion exchange HPLC. The HMW isozyme (Mr. 55,000) eluted from the anion exchange column later than the LMW isozyme (Mr. 25,000). Interspecific differences in zeatin reductase activity were also detected.

  4. Isolated menthone reductase and nucleic acid molecules encoding same

    DOEpatents

    Croteau, Rodney B; Davis, Edward M; Ringer, Kerry L

    2013-04-23

    The present invention provides isolated menthone reductase proteins, isolated nucleic acid molecules encoding menthone reductase proteins, methods for expressing and isolating menthone reductase proteins, and transgenic plants expressing elevated levels of menthone reductase protein.

  5. Antimicrobial susceptibility of Bacillus anthracis strains from Hungary.

    PubMed

    Kreizinger, Zsuzsa; Sulyok, Kinga Mária; Makrai, László; Rónai, Zsuzsanna; Fodor, László; Jánosi, Szilárd; Gyuranecz, Miklós

    2016-06-01

    The susceptibility of 29 Bacillus anthracis strains, collected in Hungary between 1933 and 2014, was tested to 10 antibiotics with commercially available minimum inhibitory concentration (MIC) test strips. All strains were susceptible to amoxicillin, ciprofloxacin, clindamycin, doxycycline, gentamicin, penicillin, rifampicin, and vancomycin. Intermediate susceptibility to erythromycin and cefotaxime was detected in 17.2% (5/29) and 58.6% (17/29) of the strains, respectively. Correlations were not observed between the isolation date, location, host species, genotype, and antibiotic susceptibility profile of strains.

  6. Measuring the Variability of Treated Bacillus Anthracis Delta Stern Spores

    DTIC Science & Technology

    2011-02-23

    information, including suggestions for reducing this burden to Department of Defense, Washington Headquarters Services , Directorate for Information...agent of the potentially fatal 49 disease “anthrax” (9,7). B. anthracis is the gram-positive, non-motile, non-chemolytic, spore-50 forming bacteria ...Sterne, lacks both the pXO1 and 93 the pXO2 plasmids (11) (pXO1 - , pXO2 - ), and is a spore forming bacteria of the B. cereus group. 94 5 The

  7. Cloning and Expressing Recombinant Protective Antigen Domains of B. anthracis

    DTIC Science & Technology

    2011-09-01

    Bacillus Anthracis in Escherichia Coli . Biochem Biophys Res Commun 2001, 283 (2), 308–15. 15. Ivins, B. E .; Welkos, S. L. Cloning and Expression of the...Buffer 4 and bovine serum albumin (BSA) at 37 ºC for at least 2 h. The enzymes were heat -inactivated for 20 min at 65 ºC. The pET-22b(+) vector was...to the previous reaction. The phosphatase was heat -inactivated for 20 min at 65 ºC prior to ligation. For each ligation, T4 DNA ligase and its

  8. Histochemical localization of nitrate reductase.

    PubMed

    Vaughn, K C; Duke, S O

    1981-01-01

    NADH-dependent nitrate reductase (E.C. 1.6.6.1) was ultrastructurally localized in norflurazon-treated and control soybean cotyledons [Glycine max (L.) Merr.] by a method based upon the increase in osmiophilia due to the formation of an azo dye. The reaction product was observed in small vesicles throughout the cytoplasm. An apparent transport of nitrite to the plastid, the site of nitrite reduction, may occur through fusion of the nitrite-containing vesicles with the chloroplast envelope. Plants grown in tungstate lacked nitrate reductase activity as measured by standard assay procedures, and showed no increase in osmiophilia, suggesting a degree of specificity of this cytochemical procedure.

  9. Species-Specific Peptide Ligands for the Detection of Bacillus anthracis Spores

    PubMed Central

    Williams, David D.; Benedek, Orsolya; Turnbough, Charles L.

    2003-01-01

    Currently available detectors for spores of Bacillus anthracis, the causative agent of anthrax, are inadequate for frontline use and general monitoring. There is a critical need for simple, rugged, and inexpensive detectors capable of accurate and direct identification of B. anthracis spores. Necessary components in such detectors are stable ligands that bind tightly and specifically to target spores. By screening a phage display peptide library, we identified a family of peptides, with the consensus sequence TYPXPXR, that bind selectively to B. anthracis spores. We extended this work by identifying a peptide variant, ATYPLPIR, with enhanced ability to bind to B. anthracis spores and an additional peptide, SLLPGLP, that preferentially binds to spores of species phylogenetically similar to, but distinct from, B. anthracis. These two peptides were used in tandem in simple assays to rapidly and unambiguously identify B. anthracis spores. We envision that these peptides can be used as sensors in economical and portable B. anthracis spore detectors that are essentially free of false-positive signals due to other environmental Bacillus spores. PMID:14532093

  10. Identification of Bacillus anthracis specific chromosomal sequences by suppressive subtractive hybridization

    PubMed Central

    Dwyer, Kathleen G; Lamonica, Janine M; Schumacher, Jennifer A; Williams, Leanne E; Bishara, Joanne; Lewandowski, Anna; Redkar, Rajendra; Patra, Guy; DelVecchio, Vito G

    2004-01-01

    Background Bacillus anthracis, Bacillus thuringiensis and Bacillus cereus are closely related members of the B. cereus-group of bacilli. Suppressive subtractive hybridization (SSH) was used to identify specific chromosomal sequences unique to B. anthracis. Results Two SSH libraries were generated. Genomic DNA from plasmid-cured B. anthracis was used as the tester DNA in both libraries, while genomic DNA from either B. cereus or B. thuringiensis served as the driver DNA. Progressive screening of the libraries by colony filter and Southern blot analyses identified 29 different clones that were specific for the B. anthracis chromosome relative not only to the respective driver DNAs, but also to seven other different strains of B. cereus and B. thuringiensis included in the process. The nucleotide sequences of the clones were compared with those found in genomic databases, revealing that over half of the clones were located into 2 regions on the B. anthracis chromosome. Conclusions Genes encoding potential cell wall synthesis proteins dominated one region, while bacteriophage-related sequences dominated the other region. The latter supports the hypothesis that acquisition of these bacteriophage sequences occurred during or after speciation of B. anthracis relative to B. cereus and B. thuringiensis. This study provides insight into the chromosomal differences between B. anthracis and its closest phylogenetic relatives. PMID:15028116

  11. Germination and persistence of Bacillus anthracis and Bacillus thuringiensis in soil microcosms.

    PubMed

    Bishop, A H

    2014-11-01

    Decontaminating large, outdoor spaces of Bacillus anthracis spores presents significant problems, particularly in soil. Proof was sought that the addition of germinant chemicals could cause spores of B. anthracis and Bacillus thuringiensis, a commonly used simulant of the threat agent, to convert to the less resistant vegetative form in a microcosm. Nonsterile plant/soil microcosms were inoculated with spores of B. thuringiensis and two nonpathogenic strains of B. anthracis. A combination of L-alanine (100 mmol l(-1)) and inosine (10 mmol l(-1)) resulted in a 6 log decrease in spore numbers in both strains of B. anthracis over 2 weeks at 22°C; a 3 log decrease in B. anthracis Sterne spore numbers was observed after incubation for 2 weeks at 10°C. Negligible germination nor a decrease in viable count occurred in either strain when the concentration of L-alanine was decreased to 5 mmol l(-1). Germinated spores of B. thuringiensis were able to persist in vegetative form in the microcosms, whereas those of B. anthracis rapidly disappeared. The pleiotropic regulator PlcR, which B. anthracis lacks, does not contribute to the persistence of B. thuringiensis in vegetative form in soil. The principle of adding germinants to soil to trigger the conversion of spores to vegetative form has been demonstrated. Bacillus anthracis failed to persist in vegetative form or resporulate in the microcosms after it had been induced to germinate. The large scale, outdoor decontamination of B. anthracis spores may be facilitated by the application of simple, defined combinations of germinants. © 2014 Crown Copyright. Journal of Applied Microbiology © 2014 Society for Applied Microbiology This article is Published with the permission of the Controller of HMSO and Queen's Printer for Scotland.

  12. Bacillus anthracis sin Locus and Regulation of Secreted Proteases ▿ †

    PubMed Central

    Pflughoeft, Kathryn J.; Sumby, Paul; Koehler, Theresa M.

    2011-01-01

    Bacillus anthracis shares many regulatory loci with the nonpathogenic Bacillus species Bacillus subtilis. One such locus is sinIR, which in B. subtilis controls sporulation, biofilm formation, motility, and competency. As B. anthracis is not known to be motile, to be naturally competent, or to readily form biofilms, we hypothesized that the B. anthracis sinIR regulon is distinct from that of B. subtilis. A genome-wide expression microarray analysis of B. anthracis parental and sinR mutant strains indicated limited convergence of the B. anthracis and B. subtilis SinR regulons. The B. anthracis regulon includes homologues of some B. subtilis SinR-regulated genes, including the signal peptidase gene sipW near the sinIR locus and the sporulation gene spoIIE. The B. anthracis SinR protein also negatively regulates transcription of genes adjacent to the sinIR locus that are unique to the Bacillus cereus group species. These include calY and inhA1, structural genes for the metalloproteases camelysin and immune inhibitor A1 (InhA1), which have been suggested to be associated with virulence in B. cereus and B. anthracis, respectively. Electrophoretic mobility shift assays revealed direct binding of B. anthracis SinR to promoter DNA from strongly regulated genes, such as calY and sipW, but not to the weakly regulated inhA1 gene. Assessment of camelysin and InhA1 levels in culture supernates from sinR-, inhA1-, and calY-null mutants showed that the concentration of InhA1 in the culture supernatant is inversely proportional to the concentration of camelysin. Our data are consistent with a model in which InhA1 protease levels are controlled at the transcriptional level by SinR and at the posttranslational level by camelysin. PMID:21131488

  13. Microarray Bactericidal Testing of Natural Products Against Yersinia intermedia and Bacillus anthracis

    DTIC Science & Technology

    2002-01-01

    against B. anthracis and Y. intermedia in Microarray Format AC Plant Source AC Plant Source Cineole Eucalyptus globulus Carvacrol Oregano (Origanum...concentrations (Figure 1, Table 3 ). Only the AC’s thymol, eugenol and carvacrol were effective against both B. anthracis and Y. intermedia (Figures 2, 3, 7...needed for an Overnight Inocula of B. anthracis VNR1-)1 and Y. intermedia Active component MIC (mM) B.A. MIC (mM) Y.I. Carvacrol 1.2 1.0 Thymol 0.3 3.5

  14. Bacillus Anthracis Comparative Genome Analysis in Support of the Amerithrax Investigation

    DTIC Science & Technology

    2011-02-02

    strain had been cured of both virulence plasmids, pXO1 and pXO2, by heat (43 °C) and novobiocin treatment, respectively (16). Comparison of the ge- nome... virulent B. anthracis Ames. B. anthracis Ames was isolated in Sarita, TX, from a dead 14- mo-old Beefmaster heifer. It was acquired as a tryptose agar slant...it is an important, fully virulent reference for the Ames genotype (19). This material is hereafter referred to as B. anthracis Ames Ancestor. The

  15. Characterization of the Sortase Repertoire in Bacillus anthracis

    PubMed Central

    Fouet, Agnès

    2011-01-01

    LPXTG proteins, present in most if not all Gram-positive bacteria, are known to be anchored by sortases to the bacterial peptidoglycan. More than one sortase gene is often encoded in a bacterial species, and each sortase is supposed to specifically anchor given LPXTG proteins, depending of the sequence of the C-terminal cell wall sorting signal (cwss), bearing an LPXTG motif or another recognition sequence. B. anthracis possesses three sortase genes. B. anthracis sortase deleted mutant strains are not affected in their virulence. To determine the sortase repertoires, we developed a genetic screen using the property of the gamma phage to lyse bacteria only when its receptor, GamR, an LPXTG protein, is exposed at the surface. We identified 10 proteins that contain a cell wall sorting signal and are covalently anchored to the peptidoglycan. Some chimeric proteins yielded phage lysis in all sortase mutant strains, suggesting that cwss proteins remained surface accessible in absence of their anchoring sortase, probably as a consequence of membrane localization of yet uncleaved precursor proteins. For definite assignment of the sortase repertoires, we consequently relied on a complementary test, using a biochemical approach, namely immunoblot experiments. The sortase anchoring nine of these proteins has thus been determined. The absence of virulence defect of the sortase mutants could be a consequence of the membrane localization of the cwss proteins. PMID:22076158

  16. [Bacillus anthracis: a molecular look at a famous pathogen].

    PubMed

    Pavan, María E; Pettinari, María J; Cairó, Fabián; Pavan, Esteban E; Cataldi, Angel A

    2011-01-01

    Bacillus anthracis, a gram-positive rod belonging to the Bacillus cereus group, has an extremely monomorphic genome, and presents high structural and physiological similarity with B. cereus and Bacillus thuringiensis. In this work, the new molecular methods for the identification and typing of B. anthracis developed in the last years, based on variable number tandem repeats or on genetic differences detected through sequencing, are described. The molecular aspects of traditional virulence factors: capsule, protective antigen, lethal factor and edema factor are described in depth, together with virulence factors recently proposed, such as the siderophores petrobactin and bacillibactin, the S-layer adhesin and the MntA lipoprotein. It is detailed the molecular organization of megaplasmids pXO1 and pXO2, including the pathogenicity island of pXO1. The genetic skeleton of these plasmids has been observed in related species, and this could be attributed to lateral gene transfer. Finally, the two anthrax toxin protective antigen receptors, ANTXR1/TEM8 and ANTXR2/CMG2, essential for the interaction of the pathogen with the host, are presented. The molecular studies performed in recent years have greatly increased knowledge in different aspects of this microorganism and its relationship with the host, but at the same time they have raised new questions about this noted pathogen.

  17. Crystal structure of Bacillus anthracis transpeptidase enzyme CapD.

    SciTech Connect

    Wu, R.; Richter, S.; Zhang, R.; Anderson, V. J.; Missiakas, D.; Joachimiak, A.; Biosciences Division; Univ. of Chicago

    2009-09-04

    Bacillus anthracis elaborates a poly-{gamma}-d-glutamic acid capsule that protects bacilli from phagocytic killing during infection. The enzyme CapD generates amide bonds with peptidoglycan cross-bridges to anchor capsular material within the cell wall envelope of B. anthracis. The capsular biosynthetic pathway is essential for virulence during anthrax infections and can be targeted for anti-infective inhibition with small molecules. Here, we present the crystal structures of the {gamma}-glutamyltranspeptidase CapD with and without {alpha}-l-Glu-l-Glu dipeptide, a non-hydrolyzable analog of poly-{gamma}-d-glutamic acid, in the active site. Purified CapD displays transpeptidation activity in vitro, and its structure reveals an active site broadly accessible for poly-{gamma}-glutamate binding and processing. Using structural and biochemical information, we derive a mechanistic model for CapD catalysis whereby Pro{sup 427}, Gly{sup 428}, and Gly{sup 429} activate the catalytic residue of the enzyme, Thr{sup 352}, and stabilize an oxyanion hole via main chain amide hydrogen bonds.

  18. Inhibition of Bacillus anthracis Spore Outgrowth by Nisin▿

    PubMed Central

    Gut, Ian M.; Prouty, Angela M.; Ballard, Jimmy D.; van der Donk, Wilfred A.; Blanke, Steven R.

    2008-01-01

    The lantibiotic nisin has previously been reported to inhibit the outgrowth of spores from several Bacillus species. However, the mode of action of nisin responsible for outgrowth inhibition is poorly understood. By using B. anthracis Sterne 7702 as a model, nisin acted against spores with a 50% inhibitory concentration (IC50) and an IC90 of 0.57 μM and 0.90 μM, respectively. Viable B. anthracis organisms were not recoverable from cultures containing concentrations of nisin greater than the IC90. These studies demonstrated that spores lose heat resistance and become hydrated in the presence of nisin, thereby ruling out a possible mechanism of inhibition in which nisin acts to block germination initiation. Rather, germination initiation is requisite for the action of nisin. This study also revealed that nisin rapidly and irreversibly inhibits growth by preventing the establishment of oxidative metabolism and the membrane potential in germinating spores. On the other hand, nisin had no detectable effects on the typical changes associated with the dissolution of the outer spore structures (e.g., the spore coats, cortex, and exosporium). Thus, the action of nisin results in the uncoupling of two critical sequences of events necessary for the outgrowth of spores: the establishment of metabolism and the shedding of the external spore structures. PMID:18809941

  19. Bacillus anthracis genome organization in light of whole transcriptome sequencing

    SciTech Connect

    Martin, Jeffrey; Zhu, Wenhan; Passalacqua, Karla D.; Bergman, Nicholas; Borodovsky, Mark

    2010-03-22

    Emerging knowledge of whole prokaryotic transcriptomes could validate a number of theoretical concepts introduced in the early days of genomics. What are the rules connecting gene expression levels with sequence determinants such as quantitative scores of promoters and terminators? Are translation efficiency measures, e.g. codon adaptation index and RBS score related to gene expression? We used the whole transcriptome shotgun sequencing of a bacterial pathogen Bacillus anthracis to assess correlation of gene expression level with promoter, terminator and RBS scores, codon adaptation index, as well as with a new measure of gene translational efficiency, average translation speed. We compared computational predictions of operon topologies with the transcript borders inferred from RNA-Seq reads. Transcriptome mapping may also improve existing gene annotation. Upon assessment of accuracy of current annotation of protein-coding genes in the B. anthracis genome we have shown that the transcriptome data indicate existence of more than a hundred genes missing in the annotation though predicted by an ab initio gene finder. Interestingly, we observed that many pseudogenes possess not only a sequence with detectable coding potential but also promoters that maintain transcriptional activity.

  20. Environmental Persistence of Bacillus anthracis and Bacillus subtilis Spores

    PubMed Central

    Wood, Joseph P.; Meyer, Kathryn M.; Kelly, Thomas J.; Choi, Young W.; Rogers, James V.; Riggs, Karen B.; Willenberg, Zachary J.

    2015-01-01

    There is a lack of data for how the viability of biological agents may degrade over time in different environments. In this study, experiments were conducted to determine the persistence of Bacillus anthracis and Bacillus subtilis spores on outdoor materials with and without exposure to simulated sunlight, using ultraviolet (UV)-A/B radiation. Spores were inoculated onto glass, wood, concrete, and topsoil and recovered after periods of 2, 14, 28, and 56 days. Recovery and inactivation kinetics for the two species were assessed for each surface material and UV exposure condition. Results suggest that with exposure to UV, decay of spore viability for both Bacillus species occurs in two phases, with an initial rapid decay, followed by a slower inactivation period. The exception was with topsoil, in which there was minimal loss of spore viability in soil over 56 days, with or without UV exposure. The greatest loss in viable spore recovery occurred on glass with UV exposure, with nearly a four log10 reduction after just two days. In most cases, B. subtilis had a slower rate of decay than B. anthracis, although less B. subtilis was recovered initially. PMID:26372011

  1. Development of internal controls for PCR detection of Bacillus anthracis.

    PubMed

    Brightwell, G; Pearce, M; Leslie, D

    1998-12-01

    This work describes the development and evaluation of a multiplex polymerase chain reaction (PCR) for the detection of Bacillus anthracis strains harbouring plasmid pX02. The multiplex also incorporated an internal control (IC) to avoid false negative reactions. Internal controls consisted of plasmids containing modified PCR target sequences, corresponding to the capC and BA813 genes of B. anthracis, which were then co-amplified with the original target sequences using the same set of amplimers. The initial IC construct comprised of an internally deleted form of the genomic target sequence cloned into pUC19. A series of nested DNA fragments corresponding to the 23S rRNA sequences of Bacillus cereus were then subcloned into the point of deletion, producing a number of IC constructs with similar sequences but increasing product size on PCR amplification. Neither the presence of IC DNA template or IC PCR product size affected the specificity or non-specific cross-reactivity of the original PCR assay. The concentration of IC was critical, too much IC DNA template would out compete the genomic DNA template, thus giving a false negative result. However, when the concentration of IC was optimal assay sensitivity was not compromised.

  2. Environmental Persistence of Bacillus anthracis and Bacillus subtilis Spores.

    PubMed

    Wood, Joseph P; Meyer, Kathryn M; Kelly, Thomas J; Choi, Young W; Rogers, James V; Riggs, Karen B; Willenberg, Zachary J

    2015-01-01

    There is a lack of data for how the viability of biological agents may degrade over time in different environments. In this study, experiments were conducted to determine the persistence of Bacillus anthracis and Bacillus subtilis spores on outdoor materials with and without exposure to simulated sunlight, using ultraviolet (UV)-A/B radiation. Spores were inoculated onto glass, wood, concrete, and topsoil and recovered after periods of 2, 14, 28, and 56 days. Recovery and inactivation kinetics for the two species were assessed for each surface material and UV exposure condition. Results suggest that with exposure to UV, decay of spore viability for both Bacillus species occurs in two phases, with an initial rapid decay, followed by a slower inactivation period. The exception was with topsoil, in which there was minimal loss of spore viability in soil over 56 days, with or without UV exposure. The greatest loss in viable spore recovery occurred on glass with UV exposure, with nearly a four log10 reduction after just two days. In most cases, B. subtilis had a slower rate of decay than B. anthracis, although less B. subtilis was recovered initially.

  3. Dihydrofolate synthetase and folylpolyglutamate synthetase: direct evidence for intervention of acyl phosphate intermediates

    SciTech Connect

    Banerjee, R.V.; Shane, B.; McGuire, J.J.; Coward, J.K.

    1988-12-13

    The transfer of /sup 17/O and/or /sup 18/O from (COOH-/sup 17/O or -/sup 18/O) enriched substrates to inorganic phosphate (P/sub i/) has been demonstrated for two enzyme-catalyzed reactions involved in folate biosynthesis and glutamylation. COOH-/sup 18/O-labeled folate, methotrexate, and dihydropteroate, in addition to (/sup 17/O)-glutamate, were synthesized and used as substrates for folylpolyglutamate synthetase (FPGS) isolated from Escherichia coli, hog liver, and rat liver and for dihydrofolate synthetase (DHFS) isolated from E. coli. P/sub i/ was purified from the reaction mixtures and converted to trimethyl phosphate (TMP), which was then analyzed for /sup 17/O and /sup 18/O enrichment by nuclear magnetic resonance (NMR) spectroscopy and/or mass spectroscopy. In the reactions catalyzed by the E. coli enzymes, both NMR and quantitative mass spectral analyses established that transfer of the oxygen isotope from the substrate /sup 18/O-enriched carboxyl group to P/sub i/ occurred, thereby providing strong evidence for an acyl phosphate intermediate in both the FPGS- and DHFS-catalyzed reactions. Similar oxygen-transfer experiments were carried out by use of two mammalian enzymes. The small amounts of P/sub i/ obtained from reactions catalyzed by these less abundant FPGS proteins precluded the use of NMR techniques. However, mass spectral analysis of the TMP derived from the mammalian FPGS-catalyzed reactions showed clearly that /sup 18/O transfer had occurred.

  4. An integrated approach towards the discovery of novel non-nucleoside Leishmania major pteridine reductase 1 inhibitors.

    PubMed

    Leite, Franco Henrique Andrade; Froes, Thamires Quadros; da Silva, Suellen Gonçalves; de Souza, Evandro Italo Macêdo; Vital-Fujii, Drielli Gomes; Trossini, Gustavo Henrique Goulart; Pita, Samuel Silva da Rocha; Castilho, Marcelo Santos

    2017-05-26

    Despite the fact that Leishmania ssp are pteridine auxotrophs, Dihydrofolate Reductase-Thymidylate Synthase (DHFR-TS) inhibitors are ineffective against Leishmania major. On the other hand Pteridine Reductase 1 (PTR1) inhibitors proved to be lethal to the parasite. Aiming at identifying hits that lie outside the chemical space of known PTR1 inhibitors, pharmacophore models that differentiate true-binders from decoys and explain the structure-activity relationships of known inhibitors were employed to virtually screen the lead-like subset of ZINC database. This approach leads to the identification of Z80393 (IC50 = 32.31 ± 1.18 μM), whose inhibition mechanism was investigated by Thermal Shift Assays. This experimental result supports a competitive mechanism and was crucial to establish the docking search space as well as select the best pose, which was then investigated by molecular dynamics studies that corroborate the hit putative binding profile towards LmPTR1. The information gathered from such studies shall be useful to design more potent non-nucleoside LmPTR1 inhibitors. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  5. WalRK two component system of Bacillus anthracis responds to temperature and antibiotic stress.

    PubMed

    Dhiman, Alisha; Gopalani, Monisha; Bhatnagar, Rakesh

    2015-04-17

    WalRK Two Component System (TCS) of Bacillus anthracis forms a functional TCS. This report elaborates upon the WalRK genomic architecture, promoter structure, promoter activity and expression under various stress conditions in B. anthracis. 5' RACE located the WalRK functional promoter within 317 bp region upstream of WalR. Reporter gene assays demonstrated maximal promoter activity during early growth phases indicating utility in exponential stages of growth. qRT-PCR showed upregulation of WalRK transcripts during temperature and antibiotic stress. However, WalR overexpression did not affect the tested antibiotic MIC values in B. anthracis. Collectively, these results confirm that WalRK responds to cell envelope stress in B. anthracis.

  6. ENVIRONMENTAL RESPONSE TO INTENTIONAL DISSEMINATION OF BACILLUS ANTHRACIS SPORES IN THE UNITED STATES--2001

    EPA Science Inventory

    The intentional dissemination of Bacillus anthracis (anthrax) spores at multiple locations in the United States in the Fall of 2001 resulted not only in several deaths and illnesses (including psychological effects), but likely changed lifestyles and attitudes, and increased the ...

  7. FORMALDEHYDE GAS INACTIVATION OF BACILLUS ANTHRACIS, BACILLUS SUBTILIS AND GEOBACILLUS STEAROTHERMOPHILUS SPORES ON INDOOR SURFACE MATERIALS.

    EPA Science Inventory

    Research evaluated the decontamination of Bacillus anthracis, Bacillus subtilis, and Geobacillus stearothermophilus spores on indoor surface material using formaldehyde gas. Spores were dried on seven types of indoor surfaces and exposed to 1100 ppm formaldehyde gas for 10 hr. Fo...

  8. Structures of two superoxide dismutases from Bacillus anthracis reveal a novel active centre

    SciTech Connect

    Boucher, Ian W.; Kalliomaa, Anne K.; Levdikov, Vladimir M.; Blagova, Elena V.; Fogg, Mark J.; Brannigan, James A. Wilson, Keith S.; Wilkinson, Anthony J.

    2005-07-01

    The crystal structures of two manganese superoxide dismutases from B. anthracis were solved by X-ray crystallography using molecular replacement. The BA4499 and BA5696 genes of Bacillus anthracis encode proteins homologous to manganese superoxide dismutase, suggesting that this organism has an expanded repertoire of antioxidant proteins. Differences in metal specificity and quaternary structure between the dismutases of prokaryotes and higher eukaryotes may be exploited in the development of therapeutic antibacterial compounds. Here, the crystal structure of two Mn superoxide dismutases from B. anthracis solved to high resolution are reported. Comparison of their structures reveals that a highly conserved residue near the active centre is substituted in one of the proteins and that this is a characteristic feature of superoxide dismutases from the B. cereus/B. anthracis/B. thuringiensis group of organisms.

  9. ENVIRONMENTAL RESPONSE TO INTENTIONAL DISSEMINATION OF BACILLUS ANTHRACIS SPORES IN THE UNITED STATES--2001

    EPA Science Inventory

    The intentional dissemination of Bacillus anthracis (anthrax) spores at multiple locations in the United States in the Fall of 2001 resulted not only in several deaths and illnesses (including psychological effects), but likely changed lifestyles and attitudes, and increased the ...

  10. Colonic Immune Suppression, Barrier Dysfunction, and Dysbiosis by Gastrointestinal Bacillus anthracis Infection

    PubMed Central

    Sahay, Bikash; Zadeh, Mojgan; Cheng, Sam X.; Wang, Gary P.; Owen, Jennifer L.; Mohamadzadeh, Mansour

    2014-01-01

    Gastrointestinal (GI) anthrax results from the ingestion of Bacillus anthracis. Herein, we investigated the pathogenesis of GI anthrax in animals orally infected with toxigenic non-encapsulated B. anthracis Sterne strain (pXO1+ pXO2−) spores that resulted in rapid animal death. B. anthracis Sterne induced significant breakdown of intestinal barrier function and led to gut dysbiosis, resulting in systemic dissemination of not only B. anthracis, but also of commensals. Disease progression significantly correlated with the deterioration of innate and T cell functions. Our studies provide critical immunologic and physiologic insights into the pathogenesis of GI anthrax infection, whereupon cleavage of mitogen-activated protein kinases (MAPKs) in immune cells may play a central role in promoting dysfunctional immune responses against this deadly pathogen. PMID:24945934

  11. Colonic immune suppression, barrier dysfunction, and dysbiosis by gastrointestinal bacillus anthracis Infection.

    PubMed

    Lightfoot, Yaíma L; Yang, Tao; Sahay, Bikash; Zadeh, Mojgan; Cheng, Sam X; Wang, Gary P; Owen, Jennifer L; Mohamadzadeh, Mansour

    2014-01-01

    Gastrointestinal (GI) anthrax results from the ingestion of Bacillus anthracis. Herein, we investigated the pathogenesis of GI anthrax in animals orally infected with toxigenic non-encapsulated B. anthracis Sterne strain (pXO1+ pXO2-) spores that resulted in rapid animal death. B. anthracis Sterne induced significant breakdown of intestinal barrier function and led to gut dysbiosis, resulting in systemic dissemination of not only B. anthracis, but also of commensals. Disease progression significantly correlated with the deterioration of innate and T cell functions. Our studies provide critical immunologic and physiologic insights into the pathogenesis of GI anthrax infection, whereupon cleavage of mitogen-activated protein kinases (MAPKs) in immune cells may play a central role in promoting dysfunctional immune responses against this deadly pathogen.

  12. Selective detection of 1000 B. anthracis spores within 15 minutes using a peptide functionalized SERS assay.

    PubMed

    Farquharson, Stuart; Shende, Chetan; Smith, Wayne; Huang, Hermes; Inscore, Frank; Sengupta, Atanu; Sperry, Jay; Sickler, Todd; Prugh, Amber; Guicheteau, Jason

    2014-12-21

    A surface-enhanced Raman spectroscopy (SERS) assay has been designed to detect Bacillus anthracis spores. The assay consists of silver nanoparticles embedded in a porous glass structure that have been functionalized with ATYPLPIR, a peptide developed to discriminately bind B. anthracis versus other species of Bacillus. Once bound, acetic acid was used to release the biomarker dipicolinic acid from the spores, which was detected by SERS through the addition of silver colloids. This SERS assay was used to selectively bind B. anthracis with a 100-fold selectivity versus B. cereus, and to detect B. anthracis Ames at concentrations of 1000 spores per mL within 15 minutes. The SERS assay measurements provide a basis for the development of systems that can detect spores collected from the air or from water supplies.

  13. Evaluation of Three Methods for Discrimination of Bacillus anthracis From Other Bacillus Species

    DTIC Science & Technology

    2003-07-01

    Unidentified 0/5 Bacillus licheniformis B. licheniformis 2/2 Bacillus mycoides Unidentified 0/5 Bacillus pumilus B. pumilus 2/6 Bacillus ...EVALUATION OF THREE METHODS FOR DISCRIMINATION OF BACILLUS ANTHRACIS FROM OTHER BACILLUS SPECIES. Diane L. Dutt Geo-Centers Aberdeen...ABSTRACT Bacillus anthracis shares the same ecological niche with other members of the B. cereus group: especially B. cereus and B. thuringiensis

  14. Identification and validation of specific markers of Bacillus anthracis spores by proteomics and genomics approaches.

    PubMed

    Chenau, Jérôme; Fenaille, François; Caro, Valérie; Haustant, Michel; Diancourt, Laure; Klee, Silke R; Junot, Christophe; Ezan, Eric; Goossens, Pierre L; Becher, François

    2014-03-01

    Bacillus anthracis is the causative bacteria of anthrax, an acute and often fatal disease in humans. The infectious agent, the spore, represents a real bioterrorism threat and its specific identification is crucial. However, because of the high genomic relatedness within the Bacillus cereus group, it is still a real challenge to identify B. anthracis spores confidently. Mass spectrometry-based tools represent a powerful approach to the efficient discovery and identification of such protein markers. Here we undertook comparative proteomics analyses of Bacillus anthracis, cereus and thuringiensis spores to identify proteoforms unique to B. anthracis. The marker discovery pipeline developed combined peptide- and protein-centric approaches using liquid chromatography coupled to tandem mass spectrometry experiments using a high resolution/high mass accuracy LTQ-Orbitrap instrument. By combining these data with those from complementary bioinformatics approaches, we were able to highlight a dozen novel proteins consistently observed across all the investigated B. anthracis spores while being absent in B. cereus/thuringiensis spores. To further demonstrate the relevance of these markers and their strict specificity to B. anthracis, the number of strains studied was extended to 55, by including closely related strains such as B. thuringiensis 9727, and above all the B. cereus biovar anthracis CI, CA strains that possess pXO1- and pXO2-like plasmids. Under these conditions, the combination of proteomics and genomics approaches confirms the pertinence of 11 markers. Genes encoding these 11 markers are located on the chromosome, which provides additional targets complementary to the commonly used plasmid-encoded markers. Last but not least, we also report the development of a targeted liquid chromatography coupled to tandem mass spectrometry method involving the selection reaction monitoring mode for the monitoring of the 4 most suitable protein markers. Within a proof

  15. The Bacillus anthracis chromosome contains four conserved, excision-proficient, putative prophages

    PubMed Central

    Sozhamannan, Shanmuga; Chute, Michael D; McAfee, Farrell D; Fouts, Derrick E; Akmal, Arya; Galloway, Darrell R; Mateczun, Alfred; Baillie, Leslie W; Read, Timothy D

    2006-01-01

    Background Bacillus anthracis is considered to be a recently emerged clone within the Bacillus cereus sensu lato group. The B. anthracis genome sequence contains four putative lambdoid prophages. We undertook this study in order to understand whether the four prophages are unique to B. anthracis and whether they produce active phages. Results More than 300 geographically and temporally divergent isolates of B. anthracis and its near neighbors were screened by PCR for the presence of specific DNA sequences from each prophage region. Every isolate of B. anthracis screened by PCR was found to produce all four phage-specific amplicons whereas none of the non-B. anthracis isolates, produced more than one phage-specific amplicon. Excision of prophages could be detected by a PCR based assay for attP sites on extra-chromosomal phage circles and for attB sites on phage-excised chromosomes. SYBR-green real-time PCR assays indicated that prophage excision occurs at very low frequencies (2 × 10-5 - 8 × 10-8/cell). Induction with mitomycin C increased the frequency of excision of one of the prophages by approximately 250 fold. All four prophages appear to be defective since, mitomycin C induced culture did not release any viable phage particle or lyse the cells or reveal any phage particle under electron microscopic examination. Conclusion The retention of all four putative prophage regions across all tested strains of B. anthracis is further evidence of the very recent emergence of this lineage and the prophage regions may be useful for differentiating the B. anthracis chromosome from that of its neighbors. All four prophages can excise at low frequencies, but are apparently defective in phage production. PMID:16600039

  16. Verification of Commercial Decontamination Technologies in Bench-Scale Studies Using Bacillus anthracis Spores

    DTIC Science & Technology

    2004-11-17

    12980) • Spore Strips – Bacillus atrophaeus (ATCC 9372) Biological Indicator Spore Strip BUSINESS SENSITIVE Organisms Biological Indicators: SEM Images...BUSINESS SENSITIVE Verification of Commercial Decontamination Technologies in Bench-Scale Studies Using Bacillus anthracis Spores M.L. Taylor, J.V...Commercial Decontamination Technologies in Bench-Scale Studies Using Bacillus anthracis Spores 5a. CONTRACT NUMBER 5b. GRANT NUMBER 5c. PROGRAM

  17. Identification and Validation of Specific Markers of Bacillus anthracis Spores by Proteomics and Genomics Approaches*

    PubMed Central

    Chenau, Jérôme; Fenaille, François; Caro, Valérie; Haustant, Michel; Diancourt, Laure; Klee, Silke R.; Junot, Christophe; Ezan, Eric; Goossens, Pierre L.; Becher, François

    2014-01-01

    Bacillus anthracis is the causative bacteria of anthrax, an acute and often fatal disease in humans. The infectious agent, the spore, represents a real bioterrorism threat and its specific identification is crucial. However, because of the high genomic relatedness within the Bacillus cereus group, it is still a real challenge to identify B. anthracis spores confidently. Mass spectrometry-based tools represent a powerful approach to the efficient discovery and identification of such protein markers. Here we undertook comparative proteomics analyses of Bacillus anthracis, cereus and thuringiensis spores to identify proteoforms unique to B. anthracis. The marker discovery pipeline developed combined peptide- and protein-centric approaches using liquid chromatography coupled to tandem mass spectrometry experiments using a high resolution/high mass accuracy LTQ-Orbitrap instrument. By combining these data with those from complementary bioinformatics approaches, we were able to highlight a dozen novel proteins consistently observed across all the investigated B. anthracis spores while being absent in B. cereus/thuringiensis spores. To further demonstrate the relevance of these markers and their strict specificity to B. anthracis, the number of strains studied was extended to 55, by including closely related strains such as B. thuringiensis 9727, and above all the B. cereus biovar anthracis CI, CA strains that possess pXO1- and pXO2-like plasmids. Under these conditions, the combination of proteomics and genomics approaches confirms the pertinence of 11 markers. Genes encoding these 11 markers are located on the chromosome, which provides additional targets complementary to the commonly used plasmid-encoded markers. Last but not least, we also report the development of a targeted liquid chromatography coupled to tandem mass spectrometry method involving the selection reaction monitoring mode for the monitoring of the 4 most suitable protein markers. Within a proof

  18. Ecological Niche Modelling of the Bacillus anthracis A1.a sub-lineage in Kazakhstan

    PubMed Central

    2011-01-01

    Background Bacillus anthracis, the causative agent of anthrax, is a globally distributed zoonotic pathogen that continues to be a veterinary and human health problem in Central Asia. We used a database of anthrax outbreak locations in Kazakhstan and a subset of genotyped isolates to model the geographic distribution and ecological associations of B. anthracis in Kazakhstan. The aims of the study were to test the influence of soil variables on a previous ecological niche based prediction of B. anthracis in Kazakhstan and to determine if a single sub-lineage of B. anthracis occupies a unique ecological niche. Results The addition of soil variables to the previously developed ecological niche model did not appreciably alter the limits of the predicted geographic or ecological distribution of B. anthracis in Kazakhstan. The A1.a experiment predicted the sub-lineage to be present over a larger geographic area than did the outbreak based experiment containing multiple lineages. Within the geographic area predicted to be suitable for B. anthracis by all ten best subset models, the A1.a sub-lineage was associated with a wider range of ecological tolerances than the outbreak-soil experiment. Analysis of rule types showed that logit rules predominate in the outbreak-soil experiment and range rules in the A1.a sub-lineage experiment. Random sub-setting of locality points suggests that models of B. anthracis distribution may be sensitive to sample size. Conclusions Our analysis supports careful consideration of the taxonomic resolution of data used to create ecological niche models. Further investigations into the environmental affinities of individual lineages and sub-lineages of B. anthracis will be useful in understanding the ecology of the disease at large and small scales. With model based predictions serving as approximations of disease risk, these efforts will improve the efficacy of public health interventions for anthrax prevention and control. PMID:22152056

  19. Two-Component Direct Fluorescent-Antibody Assay for Rapid Identification of Bacillus Anthracis

    DTIC Science & Technology

    2002-10-01

    Bacillus spp. (n=56) Five closely related Bacillus species—B. cereus (n=23), B. megaterium (n=11), B. subtilis (n=9), B. thuringiensis (n=12), and B...Rapid Identification of Bacillus anthracis Barun K. De,* Sandra L. Bragg,* Gary N. Sanden,* Kathy E. Wilson,* Lois A. Diem,* Chung K. Marston...antibody (DFA) assay, using fluorescein-labeled monoclonal antibodies specific to the Bacillus anthracis cell wall (CW-DFA) and capsule (CAP-DFA

  20. Production and Characterization of Monoclonal Antibodies Against the Protective Antigen Component of Bacillus anthracis Toxin

    DTIC Science & Technology

    1988-01-21

    F. Jaquet, P. Luethy, R. Huetter, and D. G. Braun. 1986. Characterization of mcnoclonal antibodies to a crystal protein of Bacillus thuringiensis ...AD-A192 855 UT FILE COPY Production and Characterization of Monoclonal Antibodies Against the Protective Antigen Component of Bacillus anthracis...Author Tel. No. 301-663-7341 1--ac",- 88 3 14 05 6 Krhirty-six monoclonal antibodies to the protective antigen protein of Bacillus anthracis exotoxin

  1. Plantazolicin is an ultra-narrow spectrum antibiotic that targets the Bacillus anthracis membrane.

    PubMed

    Molohon, Katie J; Blair, Patricia M; Park, Seongjin; Doroghazi, James R; Maxson, Tucker; Hershfield, Jeremy R; Flatt, Kristen M; Schroeder, Nathan E; Ha, Taekjip; Mitchell, Douglas A

    2016-03-10

    Plantazolicin (PZN) is a ribosomally synthesized and post-translationally modified natural product from Bacillus methylotrophicus FZB42 and Bacillus pumilus. Extensive tailoring to twelve of the fourteen amino acid residues in the mature natural product endows PZN with not only a rigid, polyheterocyclic structure, but also antibacterial activity. Here we report a remarkably discriminatory activity of PZN toward Bacillus anthracis, which rivals a previously-described gamma (γ) phage lysis assay in distinguishing B. anthracis from other members of the Bacillus cereus group. We evaluate the underlying cause of this selective activity by measuring the RNA expression profile of PZN-treated B. anthracis, which revealed significant upregulation of genes within the cell envelope stress response. PZN depolarizes the B. anthracis membrane like other cell envelope-acting compounds but uniquely localizes to distinct foci within the envelope. Selection and whole-genome sequencing of PZN-resistant mutants of B. anthracis implicate a relationship between the action of PZN and cardiolipin (CL) within the membrane. Exogenous CL increases the potency of PZN in wild type B. anthracis and promotes the incorporation of fluorescently tagged PZN in the cell envelope. We propose that PZN localizes to and exacerbates structurally compromised regions of the bacterial membrane, which ultimately results in cell lysis.

  2. The Secret Life of the Anthrax Agent Bacillus anthracis: Bacteriophage-Mediated Ecological Adaptations

    PubMed Central

    Schuch, Raymond; Fischetti, Vincent A.

    2009-01-01

    Ecological and genetic factors that govern the occurrence and persistence of anthrax reservoirs in the environment are obscure. A central tenet, based on limited and often conflicting studies, has long held that growing or vegetative forms of Bacillus anthracis survive poorly outside the mammalian host and must sporulate to survive in the environment. Here, we present evidence of a more dynamic lifecycle, whereby interactions with bacterial viruses, or bacteriophages, elicit phenotypic alterations in B. anthracis and the emergence of infected derivatives, or lysogens, with dramatically altered survival capabilities. Using both laboratory and environmental B. anthracis strains, we show that lysogeny can block or promote sporulation depending on the phage, induce exopolysaccharide expression and biofilm formation, and enable the long-term colonization of both an artificial soil environment and the intestinal tract of the invertebrate redworm, Eisenia fetida. All of the B. anthracis lysogens existed in a pseudolysogenic-like state in both the soil and worm gut, shedding phages that could in turn infect non-lysogenic B. anthracis recipients and confer survival phenotypes in those environments. Finally, the mechanism behind several phenotypic changes was found to require phage-encoded bacterial sigma factors and the expression of at least one host-encoded protein predicted to be involved in the colonization of invertebrate intestines. The results here demonstrate that during its environmental phase, bacteriophages provide B. anthracis with alternatives to sporulation that involve the activation of soil-survival and endosymbiotic capabilities. PMID:19672290

  3. Real-Time PCR Assay for a Unique Chromosomal Sequence of Bacillus anthracis

    PubMed Central

    Bode, Elizabeth; Hurtle, William; Norwood, David

    2004-01-01

    Real-time PCR has become an important method for the rapid identification of Bacillus anthracis since the 2001 anthrax mailings. Most real-time PCR assays for B. anthracis have been developed to detect virulence genes located on the pXO1 and pXO2 plasmids. In contrast, only two published chromosomal targets exist, the rpoB gene and the gyrA gene. In the present study, subtraction-hybridization with a plasmid-cured B. anthracis tester strain and a Bacillus cereus driver was used to find a unique chromosomal sequence. By targeting this region, a real-time assay was developed with the Ruggedized Advanced Pathogen Identification Device. Further testing has revealed that the assay has 100% sensitivity and 100% specificity, with a limit of detection of 50 fg of DNA. The results of a search for sequences with homology with the BLAST program demonstrated significant alignment to the recently published B. anthracis Ames strain, while an inquiry for protein sequence similarities indicated homology with an abhydrolase from B. anthracis strain A2012. The importance of this chromosomal assay will be to verify the presence of B. anthracis independently of plasmid occurrence. PMID:15583318

  4. Detection of B. anthracis Spores and Vegetative Cells with the Same Monoclonal Antibodies

    PubMed Central

    Wang, Dian-Bing; Yang, Ruifu; Zhang, Zhi-Ping; Bi, Li-Jun; You, Xiang-Yu; Wei, Hong-Ping; Zhou, Ya-Feng; Yu, Ziniu; Zhang, Xian-En

    2009-01-01

    Bacillus anthracis, the causative agent of anthrax disease, could be used as a biothreat reagent. It is vital to develop a rapid, convenient method to detect B. anthracis. In the current study, three high affinity and specificity monoclonal antibodies (mAbs, designated 8G3, 10C6 and 12F6) have been obtained using fully washed B. anthracis spores as an immunogen. These mAbs, confirmed to direct against EA1 protein, can recognize the surface of B. anthracis spores and intact vegetative cells with high affinity and species-specificity. EA1 has been well known as a major S-layer component of B. anthracis vegetative cells, and it also persistently exists in the spore preparations and bind tightly to the spore surfaces even after rigorous washing. Therefore, these mAbs can be used to build a new and rapid immunoassay for detection of both life forms of B. anthracis, either vegetative cells or spores. PMID:19915677

  5. Bacillus anthracis comparative genome analysis in support of the Amerithrax investigation

    PubMed Central

    Rasko, David A.; Worsham, Patricia L.; Abshire, Terry G.; Stanley, Scott T.; Bannan, Jason D.; Wilson, Mark R.; Langham, Richard J.; Decker, R. Scott; Jiang, Lingxia; Read, Timothy D.; Phillippy, Adam M.; Salzberg, Steven L.; Pop, Mihai; Van Ert, Matthew N.; Kenefic, Leo J.; Keim, Paul S.; Fraser-Liggett, Claire M.; Ravel, Jacques

    2011-01-01

    Before the anthrax letter attacks of 2001, the developing field of microbial forensics relied on microbial genotyping schemes based on a small portion of a genome sequence. Amerithrax, the investigation into the anthrax letter attacks, applied high-resolution whole-genome sequencing and comparative genomics to identify key genetic features of the letters’ Bacillus anthracis Ames strain. During systematic microbiological analysis of the spore material from the letters, we identified a number of morphological variants based on phenotypic characteristics and the ability to sporulate. The genomes of these morphological variants were sequenced and compared with that of the B. anthracis Ames ancestor, the progenitor of all B. anthracis Ames strains. Through comparative genomics, we identified four distinct loci with verifiable genetic mutations. Three of the four mutations could be directly linked to sporulation pathways in B. anthracis and more specifically to the regulation of the phosphorylation state of Spo0F, a key regulatory protein in the initiation of the sporulation cascade, thus linking phenotype to genotype. None of these variant genotypes were identified in single-colony environmental B. anthracis Ames isolates associated with the investigation. These genotypes were identified only in B. anthracis morphotypes isolated from the letters, indicating that the variants were not prevalent in the environment, not even the environments associated with the investigation. This study demonstrates the forensic value of systematic microbiological analysis combined with whole-genome sequencing and comparative genomics. PMID:21383169

  6. Plantazolicin is an ultra-narrow spectrum antibiotic that targets the Bacillus anthracis membrane

    PubMed Central

    Molohon, Katie J.; Blair, Patricia M.; Park, Seongjin; Doroghazi, James R.; Maxson, Tucker; Hershfield, Jeremy R.; Flatt, Kristen M.; Schroeder, Nathan E.; Ha, Taekjip; Mitchell, Douglas A.

    2016-01-01

    Plantazolicin (PZN) is a ribosomally synthesized and post-translationally modified natural product from Bacillus methylotrophicus FZB42 and Bacillus pumilus. Extensive tailoring to twelve of the fourteen amino acid residues in the mature natural product endows PZN with not only a rigid, polyheterocyclic structure, but also antibacterial activity. Here we report a remarkably discriminatory activity of PZN toward Bacillus anthracis, which rivals a previously-described gamma (γ) phage lysis assay in distinguishing B. anthracis from other members of the Bacillus cereus group. We evaluate the underlying cause of this selective activity by measuring the RNA expression profile of PZN-treated B. anthracis, which revealed significant upregulation of genes within the cell envelope stress response. PZN depolarizes the B. anthracis membrane like other cell envelope-acting compounds but uniquely localizes to distinct foci within the envelope. Selection and whole-genome sequencing of PZN-resistant mutants of B. anthracis implicate a relationship between the action of PZN and cardiolipin (CL) within the membrane. Exogenous CL increases the potency of PZN in wild type B. anthracis and promotes the incorporation of fluorescently tagged PZN in the cell envelope. We propose that PZN localizes to and exacerbates structurally compromised regions of the bacterial membrane, which ultimately results in cell lysis. PMID:27152321

  7. Direct detection of Bacillus anthracis DNA in animals by polymerase chain reaction.

    PubMed Central

    Makino, S I; Iinuma-Okada, Y; Maruyama, T; Ezaki, T; Sasakawa, C; Yoshikawa, M

    1993-01-01

    Bacillus anthracis is a soil pathogen capable of causing anthrax. To establish a method for specifically detecting B. anthracis for practical applications, such as for the inspection of slaughterhouses, the cap region, which is essential for encapsulation in B. anthracis, was used in a DNA hybridization study by polymerase chain reaction (PCR). Oligonucleotide primers were designed to amplify a 288-bp DNA fragment within the capA gene by PCR. The amplified DNA sequence specifically hybridized to the DNA of B. anthracis but not to that of other bacterial strains tested. Since this PCR-based method efficiently and specifically detected the capA sequence of bacteria in blood and spleen samples of mice within 8 h after the administration of live B. anthracis, this PCR system could be used for practical applications. By using lysis methods in preparing the samples for PCR, it was possible to amplify the 288-bp DNA segment from samples containing very few bacteria, as few as only 1 sporeforming unit, indicating that the PCR detection method developed in this study will permit the monitoring of B. anthracis contamination in the environment. Images PMID:8458949

  8. Antimicrobial Effects of Gold/Copper Sulphide (Au/Cus) Core/Shell Nanoparticles on Bacillus Anthracis Spores and Cells

    DTIC Science & Technology

    2013-01-01

    SECURITY CLASSIFICATION OF: Bacillus anthracis is a gram positive, rod shaped and spore forming bacteria. It causes anthrax, a deadly human and animal...BACILLUS ANTHRACIS SPORES AND CELLS Report Title Bacillus anthracis is a gram positive, rod shaped and spore forming bacteria. It causes anthrax, a...a gram positive, rod shaped and spore forming bacteria. It causes anthrax, a deadly human and animal disease that can kill its victims in three days

  9. Comparison of Bacillus Anthracis to the Surrogate Bacillus Atrophaeus for Spore Inactivation on a Novel Antimicrobial Fabric

    DTIC Science & Technology

    2006-05-01

    AFRL-HE-WP-TP-2006-0061 AIR FORCE RESEARCH LABORATORY Comparison of Bacillus Anthracis to the Surrogate Bacillus Atrophaeus for Spore Inactivation on...CONTRACT NUMBER Comparison of Bacillus Anthracis to the Surrogate Bacillus Atrophaeus for Spore Inactivation on a Novel Antimicrobial Fabric 5b. GRANT NUMBER...239.18 Comparison of Bacillus anthracis to the Surrogate Bacillus atrophaeus for Spore Inactivation on a Novel Antimicrobial Fabric Christopher C

  10. Nitrate reductase from Rhodopseudomonas sphaeroides.

    PubMed Central

    Kerber, N L; Cardenas, J

    1982-01-01

    The facultative phototroph Rhodopseudomonas sphaeroides DSM158 was incapable of either assimilating or dissimilating nitrate, although the organism could reduce it enzymatically to nitrite either anaerobically in the light or aerobically in the dark. Reduction of nitrate was mediated by a nitrate reductase bound to chromatophores that could be easily solubilized and functioned with chemically reduced viologens or photochemically reduced flavins as electron donors. The enzyme was solubilized, and some of its kinetic and molecular parameters were determined. It seemed to be nonadaptive, ammonia did not repress its synthesis, and its activity underwent a rapid decline when the cells entered the stationary growth phase. Studies with inhibitors and with metal antagonists indicated that molybdenum and possibly iron participate in the enzymatic reduction of nitrate. The conjectural significance of this nitrate reductase in phototrophic bacteria is discussed. PMID:6978883

  11. Bacillus cereus G9241 makes anthrax toxin and capsule like highly virulent B. anthracis Ames but behaves like attenuated toxigenic nonencapsulated B. anthracis Sterne in rabbits and mice.

    PubMed

    Wilson, Melissa K; Vergis, James M; Alem, Farhang; Palmer, John R; Keane-Myers, Andrea M; Brahmbhatt, Trupti N; Ventura, Christy L; O'Brien, Alison D

    2011-08-01

    Bacillus cereus G9241 was isolated from a welder with a pulmonary anthrax-like illness. The organism contains two megaplasmids, pBCXO1 and pBC218. These plasmids are analogous to the Bacillus anthracis Ames plasmids pXO1 and pXO2 that encode anthrax toxins and capsule, respectively. Here we evaluated the virulence of B. cereus G9241 as well as the contributions of pBCXO1 and pBC218 to virulence. B. cereus G9241 was avirulent in New Zealand rabbits after subcutaneous inoculation and attenuated 100-fold compared to the published 50% lethal dose (LD(50)) values for B. anthracis Ames after aerosol inoculation. A/J and C57BL/6J mice were comparably susceptible to B. cereus G9241 by both subcutaneous and intranasal routes of infection. However, the LD(50)s for B. cereus G9241 in both mouse strains were markedly higher than those reported for B. anthracis Ames and more like those of the toxigenic but nonencapsulated B. anthracis Sterne. Furthermore, B. cereus G9241 spores could germinate and disseminate after intranasal inoculation into A/J mice, as indicated by the presence of vegetative cells in the spleen and blood of animals 48 h after infection. Lastly, B. cereus G9241 derivatives cured of one or both megaplasmids were highly attenuated in A/J mice. We conclude that the presence of the toxin- and capsule-encoding plasmids pBCXO1 and pBC218 in B. cereus G9241 alone is insufficient to render the strain as virulent as B. anthracis Ames. However, like B. anthracis, full virulence of B. cereus G9241 for mice requires the presence of both plasmids.

  12. Gene expression control by Bacillus anthracis purine riboswitches.

    PubMed

    Kirchner, Marion; Schneider, Sabine

    2017-02-16

    In all kingdoms of life, cellular replication relies on the presence of nucleosides and nucleotides, the building blocks of nucleic acids and the main source of energy. In bacteria, the availability of metabolites sometimes directly regulates the expression of enzymes and proteins involved in purine salvage, biosynthesis and uptake through riboswitches. Riboswitches are located in bacterial mRNAs and can control gene expression by conformational changes in response to ligand binding. We have established an inverse reporter gene system in Bacillus subtilis that allows us to monitor riboswitch-controlled gene expression. We used it to investigate the activity of five potential purine riboswitches from B. anthracis in response to different purines and pyrimidines. Furthermore, in vitro studies on the aptamer domains of the riboswitches reveal their variation in guanine binding affinity ranging from nM to µM. These data do not only provide insight into metabolite sensing but can also aid to engineer artificial cell regulatory systems.

  13. Decontamination Options for Drinking Water Contaminated with Bacillus anthracis Spores

    SciTech Connect

    Raber, E; Burklund, A

    2010-02-16

    Five parameters were evaluated with surrogates of Bacillus anthracis spores to determine effective decontamination options for use in a contaminated drinking water supply. The parameters were: (1) type of Bacillus spore surrogate (B. thuringiensis or B. atrophaeus); (2) spore concentration in suspension (10{sup 2} to 10{sup 6} spores/ml); (3) chemical characteristics of decontaminant [sodium dicholor-s-triazinetrione dihydrate (Dichlor), hydrogen peroxide, potassium peroxymonosulfate (Oxone), sodium hypochlorite, and VirkonS{reg_sign}]; (4) decontaminant concentration (0.01% to 5%); and (5) decontaminant exposure time (10 min to 24 hr). Results from 162 suspension tests with appropriate controls are reported. Hydrogen peroxide at a concentration of 5%, and Dichlor and sodium hypochlorite at a concentration of 2%, were effective at spore inactivation regardless of spore type tested, spore exposure time, or spore concentration evaluated. This is the first reported study of Dichlor as an effective decontaminant for B. anthracis spore surrogates. Dichlor's desirable characteristics of high oxidation potential, high level of free chlorine, and more neutral pH than that of other oxidizers evaluated appear to make it an excellent alternative. All three oxidizers were effective against B. atrophaeus spores in meeting EPA's biocide standard of greater than a 6 log kill after a 10-minute exposure time and at lower concentrations than typically reported for biocide use. Solutions of 5% VirkonS{reg_sign} and Oxone were less effective decontaminants than other options evaluated in this study and did not meet the EPA's efficacy standard for biocides. Differences in methods and procedures reported by other investigators make quantitative comparisons among studies difficult.

  14. Distribution and Molecular Evolution of Bacillus anthracis Genotypes in Namibia

    PubMed Central

    Beyer, Wolfgang; Bellan, Steve; Eberle, Gisela; Ganz, Holly H.; Getz, Wayne M.; Haumacher, Renate; Hilss, Karen A.; Kilian, Werner; Lazak, Judith; Turner, Wendy C.; Turnbull, Peter C. B.

    2012-01-01

    The recent development of genetic markers for Bacillus anthracis has made it possible to monitor the spread and distribution of this pathogen during and between anthrax outbreaks. In Namibia, anthrax outbreaks occur annually in the Etosha National Park (ENP) and on private game and livestock farms. We genotyped 384 B. anthracis isolates collected between 1983–2010 to identify the possible epidemiological correlations of anthrax outbreaks within and outside the ENP and to analyze genetic relationships between isolates from domestic and wild animals. The isolates came from 20 animal species and from the environment and were genotyped using a 31-marker multi-locus-VNTR-analysis (MLVA) and, in part, by twelve single nucleotide polymorphism (SNP) markers and four single nucleotide repeat (SNR) markers. A total of 37 genotypes (GT) were identified by MLVA, belonging to four SNP-groups. All GTs belonged to the A-branch in the cluster- and SNP-analyses. Thirteen GTs were found only outside the ENP, 18 only within the ENP and 6 both inside and outside. Genetic distances between isolates increased with increasing time between isolations. However, genetic distance between isolates at the beginning and end of the study period was relatively small, indicating that while the majority of GTs were only found sporadically, three genetically close GTs, accounting for more than four fifths of all the ENP isolates, appeared dominant throughout the study period. Genetic distances among isolates were significantly greater for isolates from different host species, but this effect was small, suggesting that while species-specific ecological factors may affect exposure processes, transmission cycles in different host species are still highly interrelated. The MLVA data were further used to establish a model of the probable evolution of GTs within the endemic region of the ENP. SNR-analysis was helpful in correlating an isolate with its source but did not elucidate epidemiological

  15. Effects of Point Mutations in Plasmodium falciparum Dihydrofolate Reductase and Dihydropterate Synthase Genes on Clinical Outcomes and In Vitro Susceptibility to Sulfadoxine and Pyrimethamine

    DTIC Science & Technology

    2009-08-01

    Alejandro Llanos-Cuentas4, Coralith Garcia4, Lelv Solari4, Dennis Kyle5, Alan J. Magill3 1 Parasitology Program, Naval Medical Research Center...5]. PLoS ONE | www.plosone.org 1 August 2009 | Volume 4 | Issue 8 | e6762 Report Documentation Page Form ApprovedOMB No. 0704-0188 Public reporting...burden for the collection of information is estimated to average 1 hour per response, including the time for reviewing instructions, searching existing

  16. The interaction of an ionizing ligand with enzymes having a single ionizing group. Implications for the reaction of folate analogues with dihydrofolate reductase.

    PubMed

    Stone, S R; Morrison, J F

    1983-06-29

    Binding theory has been developed for the reaction of an ionizing enzyme with an ionizing ligand. Consideration has been given to the most general scheme in which all possible reactions and interconversions occur as well as to schemes in which certain interactions do not take place. Equations have been derived in terms of the variation of the apparent dissociation constant (Kiapp) as a function of pH. These equations indicate that plots of pKiapp against pH can be wave-, half-bell- or bell-shaped according to the reactions involved. A wave is obtained whenever there is formation of the enzyme-ligand complexes, ionized enzyme . ionized ligand and protonated enzyme . protonated ligand. The additional formation of singly protonated enzyme-ligand complexes does not affect the wave form of the plot, but can influence the shape of the overall curve. The formation of either ionized enzyme . ionized ligand or protonated enzyme . protonated ligand, with or without singly protonated enzyme-ligand species, gives rise to a half-bell-shaped plot. If only singly protonated enzyme-ligand complexes are formed the plots are bell-shaped, but it is not possible to deduce the ionic forms of the reactants that participate in complex formation. Depending on the reaction pathways, true values for the ionization and dissociation constants may or may not be determined.

  17. Capsules, Toxins and AtxA as Virulence Factors of Emerging Bacillus cereus Biovar anthracis

    PubMed Central

    Corre, Jean-Philippe; Lander, Angelika; Franz, Tatjana; Monot, Marc; Couture-Tosi, Evelyne; Jouvion, Gregory; Leendertz, Fabian H.; Grunow, Roland; Mock, Michèle E.; Klee, Silke R.; Goossens, Pierre L.

    2015-01-01

    Emerging B. cereus strains that cause anthrax-like disease have been isolated in Cameroon (CA strain) and Côte d’Ivoire (CI strain). These strains are unusual, because their genomic characterisation shows that they belong to the B. cereus species, although they harbour two plasmids, pBCXO1 and pBCXO2, that are highly similar to the pXO1 and pXO2 plasmids of B. anthracis that encode the toxins and the polyglutamate capsule respectively. The virulence factors implicated in the pathogenicity of these B. cereus bv anthracis strains remain to be characterised. We tested their virulence by cutaneous and intranasal delivery in mice and guinea pigs; they were as virulent as wild-type B. anthracis. Unlike as described for pXO2-cured B. anthracis, the CA strain cured of the pBCXO2 plasmid was still highly virulent, showing the existence of other virulence factors. Indeed, these strains concomitantly expressed a hyaluronic acid (HA) capsule and the B. anthracis polyglutamate (PDGA) capsule. The HA capsule was encoded by the hasACB operon on pBCXO1, and its expression was regulated by the global transcription regulator AtxA, which controls anthrax toxins and PDGA capsule in B. anthracis. Thus, the HA and PDGA capsules and toxins were co-regulated by AtxA. We explored the respective effect of the virulence factors on colonisation and dissemination of CA within its host by constructing bioluminescent mutants. Expression of the HA capsule by itself led to local multiplication and, during intranasal infection, to local dissemination to the adjacent brain tissue. Co-expression of either toxins or PDGA capsule with HA capsule enabled systemic dissemination, thus providing a clear evolutionary advantage. Protection against infection by B. cereus bv anthracis required the same vaccination formulation as that used against B. anthracis. Thus, these strains, at the frontier between B. anthracis and B. cereus, provide insight into how the monomorphic B. anthracis may have emerged. PMID

  18. Capsules, toxins and AtxA as virulence factors of emerging Bacillus cereus biovar anthracis.

    PubMed

    Brézillon, Christophe; Haustant, Michel; Dupke, Susann; Corre, Jean-Philippe; Lander, Angelika; Franz, Tatjana; Monot, Marc; Couture-Tosi, Evelyne; Jouvion, Gregory; Leendertz, Fabian H; Grunow, Roland; Mock, Michèle E; Klee, Silke R; Goossens, Pierre L

    2015-04-01

    Emerging B. cereus strains that cause anthrax-like disease have been isolated in Cameroon (CA strain) and Côte d'Ivoire (CI strain). These strains are unusual, because their genomic characterisation shows that they belong to the B. cereus species, although they harbour two plasmids, pBCXO1 and pBCXO2, that are highly similar to the pXO1 and pXO2 plasmids of B. anthracis that encode the toxins and the polyglutamate capsule respectively. The virulence factors implicated in the pathogenicity of these B. cereus bv anthracis strains remain to be characterised. We tested their virulence by cutaneous and intranasal delivery in mice and guinea pigs; they were as virulent as wild-type B. anthracis. Unlike as described for pXO2-cured B. anthracis, the CA strain cured of the pBCXO2 plasmid was still highly virulent, showing the existence of other virulence factors. Indeed, these strains concomitantly expressed a hyaluronic acid (HA) capsule and the B. anthracis polyglutamate (PDGA) capsule. The HA capsule was encoded by the hasACB operon on pBCXO1, and its expression was regulated by the global transcription regulator AtxA, which controls anthrax toxins and PDGA capsule in B. anthracis. Thus, the HA and PDGA capsules and toxins were co-regulated by AtxA. We explored the respective effect of the virulence factors on colonisation and dissemination of CA within its host by constructing bioluminescent mutants. Expression of the HA capsule by itself led to local multiplication and, during intranasal infection, to local dissemination to the adjacent brain tissue. Co-expression of either toxins or PDGA capsule with HA capsule enabled systemic dissemination, thus providing a clear evolutionary advantage. Protection against infection by B. cereus bv anthracis required the same vaccination formulation as that used against B. anthracis. Thus, these strains, at the frontier between B. anthracis and B. cereus, provide insight into how the monomorphic B. anthracis may have emerged.

  19. Fatty acyl-CoA reductase

    SciTech Connect

    Reiser, Steven E.; Somerville, Chris R.

    1998-12-01

    The present invention relates to bacterial enzymes, in particular to an acyl-CoA reductase and a gene encoding an acyl-CoA reductase, the amino acid and nucleic acid sequences corresponding to the reductase polypeptide and gene, respectively, and to methods of obtaining such enzymes, amino acid sequences and nucleic acid sequences. The invention also relates to the use of such sequences to provide transgenic host cells capable of producing fatty alcohols and fatty aldehydes.

  20. Strain-specific single-nucleotide polymorphism assays for the Bacillus anthracis Ames strain.

    PubMed

    Van Ert, Matthew N; Easterday, W Ryan; Simonson, Tatum S; U'Ren, Jana M; Pearson, Talima; Kenefic, Leo J; Busch, Joseph D; Huynh, Lynn Y; Dukerich, Megan; Trim, Carla B; Beaudry, Jodi; Welty-Bernard, Amy; Read, Timothy; Fraser, Claire M; Ravel, Jacques; Keim, Paul

    2007-01-01

    Highly precise diagnostics and forensic assays can be developed through a combination of evolutionary analysis and the exhaustive examination of genomic sequences. In Bacillus anthracis, whole-genome sequencing efforts revealed ca. 3,500 single-nucleotide polymorphisms (SNPs) among eight different strains and evolutionary analysis provides the identification of canonical SNPs. We have previously shown that SNPs are highly evolutionarily stable, and the clonal nature of B. anthracis makes them ideal signatures for subtyping this pathogen. Here we identified SNPs that define the lineage of B. anthracis that contains the Ames strain, the strain used in the 2001 bioterrorist attacks in the United States. Sequencing and real-time PCR were used to validate these SNPs across B. anthracis strains, including (i) 88 globally and genetically diverse isolates; (ii) isolates that were shown to be genetic relatives of the Ames strain by multiple-locus variable number tandem repeat analysis (MLVA); and (iii) several different lab stocks of the Ames strain, including a clinical isolate from the 2001 letter attack. Six SNPs were found to be highly specific for the Ames strain; four on the chromosome, one on the pX01 plasmid, and one on the pX02 plasmid. All six SNPs differentiated the B. anthracis Ames strain from the 88 unique B. anthracis strains, while five of the six separated Ames from its close genetic relatives. The use of these SNPs coupled with real-time PCR allows specific and sensitive (<100 fg of template DNA) identification of the Ames strain. This evolutionary and genomics-based approach provides an effective means for the discovery of strain-specific SNPs in B. anthracis.

  1. Rapid Detection of Bacillus anthracis in Complex Food Matrices Using Phage-Mediated Bioluminescence.

    PubMed

    Sharp, Natasha J; Vandamm, Joshua P; Molineux, Ian J; Schofield, David A

    2015-05-01

    Bacillus anthracis, the causative agent of anthrax, is considered a high-priority agent that may be used in a food-related terrorist attack because it can be contracted by ingestion and it also forms spores with heat and chemical resistance. Thus, novel surveillance methodologies to detect B. anthracis on adulterated foods are important for bioterrorism preparedness. We describe the development of a phage-based bioluminescence assay for the detection of B. anthracis on deliberately contaminated foods. We previously engineered the B. anthracis phage Wβ with genes encoding bacterial luciferase (luxA and luxB) to create a "light-tagged" reporter (Wβ::luxAB) that is able to rapidly detect B. anthracis by transducing a bioluminescent signal response. Here, we investigate the ability of Wβ::luxAB to detect B. anthracis Sterne, an attenuated select agent strain, in inoculated food (ground beef) and milk (2%, baby formula, and half and half) matrices after incubation with spores for 72 h at 4°C as per AOAC testing guidelines. The majority of B. anthracis bacilli remained in spore form, and thus were potentially infectious, within each of the liquid matrices for 14 days. Detection limits were 80 CFU/ml after 7 h of enrichment; sensitivity of detection increased to 8 CFU/ml when enrichment was extended to 16 h. The limit of detection in ground beef was 3.2 × 10(3) CFU/g after 7 h of enrichment, improving to 3.2 × 10(2) CFU/g after 16 h. Because the time to result is rapid and minimal processing is required, and because gastrointestinal anthrax can be fatal, the reporter technology displays promise for the protection of our food supply following a deliberate release of this priority pathogen.

  2. Detection of Bacillus anthracis DNA in Complex Soil and Air Samples Using Next-Generation Sequencing

    PubMed Central

    Be, Nicholas A.; Thissen, James B.; Gardner, Shea N.; McLoughlin, Kevin S.; Fofanov, Viacheslav Y.; Koshinsky, Heather; Ellingson, Sally R.; Brettin, Thomas S.; Jackson, Paul J.; Jaing, Crystal J.

    2013-01-01

    Bacillus anthracis is the potentially lethal etiologic agent of anthrax disease, and is a significant concern in the realm of biodefense. One of the cornerstones of an effective biodefense strategy is the ability to detect infectious agents with a high degree of sensitivity and specificity in the context of a complex sample background. The nature of the B. anthracis genome, however, renders specific detection difficult, due to close homology with B. cereus and B. thuringiensis. We therefore elected to determine the efficacy of next-generation sequencing analysis and microarrays for detection of B. anthracis in an environmental background. We applied next-generation sequencing to titrated genome copy numbers of B. anthracis in the presence of background nucleic acid extracted from aerosol and soil samples. We found next-generation sequencing to be capable of detecting as few as 10 genomic equivalents of B. anthracis DNA per nanogram of background nucleic acid. Detection was accomplished by mapping reads to either a defined subset of reference genomes or to the full GenBank database. Moreover, sequence data obtained from B. anthracis could be reliably distinguished from sequence data mapping to either B. cereus or B. thuringiensis. We also demonstrated the efficacy of a microbial census microarray in detecting B. anthracis in the same samples, representing a cost-effective and high-throughput approach, complementary to next-generation sequencing. Our results, in combination with the capacity of sequencing for providing insights into the genomic characteristics of complex and novel organisms, suggest that these platforms should be considered important components of a biosurveillance strategy. PMID:24039948

  3. Development and validation of a real-time quantitative PCR assay for rapid identification of Bacillus anthracis in environmental samples.

    PubMed

    Irenge, Léonid M; Durant, Jean-François; Tomaso, Herbert; Pilo, Paola; Olsen, Jaran S; Ramisse, Vincent; Mahillon, Jacques; Gala, Jean-Luc

    2010-11-01

    A real-time polymerase chain reaction (PCR) assay was developed for rapid identification of Bacillus anthracis in environmental samples. These samples often harbor Bacillus cereus bacteria closely related to B. anthracis, which may hinder its specific identification by resulting in false positive signals. The assay consists of two duplex real-time PCR: the first PCR allows amplification of a sequence specific of the B. cereus group (B. anthracis, B. cereus, Bacillus thuringiensis, Bacillus weihenstephanensis, Bacillus pseudomycoides, and Bacillus mycoides) within the phosphoenolpyruvate/sugar phosphotransferase system I gene and a B. anthracis specific single nucleotide polymorphism within the adenylosuccinate synthetase gene. The second real-time PCR assay targets the lethal factor gene from virulence plasmid pXO1 and the capsule synthesis gene from virulence plasmid pXO2. Specificity of the assay is enhanced by the use of minor groove binding probes and/or locked nucleic acids probes. The assay was validated on 304 bacterial strains including 37 B. anthracis, 67 B. cereus group, 54 strains of non-cereus group Bacillus, and 146 Gram-positive and Gram-negative bacteria strains. The assay was performed on various environmental samples spiked with B. anthracis or B. cereus spores. The assay allowed an accurate identification of B. anthracis in environmental samples. This study provides a rapid and reliable method for improving rapid identification of B. anthracis in field operational conditions.

  4. Effect of pH on the Electrophoretic Mobility of Spores of Bacillus anthracis and Its Surrogates in Aqueous Solutions

    PubMed Central

    Popovici, Jonathan; Lytle, Darren A.; Adcock, Noreen J.; Rice, Eugene W.

    2012-01-01

    The electrophoretic mobility (EPM) of endospores of Bacillus anthracis and surrogates was measured in aqueous solution across a broad pH range and several ionic strengths. EPM values trended around phylogenetic clustering based on the 16S rRNA gene. Measurements reported here provide new insight for Bacillus anthracis surrogate selection and for attachment/detachment and transport studies. PMID:23001659

  5. Novel Sample Preparation Method for Safe and Rapid Detection of Bacillus anthracis Spores in Environmental Powders and Nasal Swabs

    PubMed Central

    Luna, Vicki A.; King, Debra; Davis, Carisa; Rycerz, Tony; Ewert, Matthew; Cannons, Andrew; Amuso, Philip; Cattani, Jacqueline

    2003-01-01

    Bacillus anthracis spores have been used as a biological weapon in the United States. We wanted to develop a safe, rapid method of sample preparation that provided safe DNA for the detection of spores in environmental and clinical specimens. Our method reproducibly detects B. anthracis in samples containing <10 spores. PMID:12624060

  6. Rapid detection of Bacillus anthracis by γ phage amplification and lateral flow immunochromatography.

    PubMed

    Cox, Christopher R; Jensen, Kirk R; Mondesire, Roy R; Voorhees, Kent J

    2015-11-01

    New, rapid point-of-need diagnostic methods for Bacillus anthracis detection can enhance civil and military responses to accidental or deliberate dispersal of anthrax as a biological weapon. Current laboratory-based methods for clinical identification of B. anthracis require 12 to 120h, and are confirmed by plaque assay using the well-characterized γ typing phage, which requires an additional minimum of 24h for bacterial culture. To reduce testing time, the natural specificity of γ phage amplification was investigated in combination with lateral flow immunochromatography (LFI) for rapid, point-of-need B. anthracis detection. Phage-based LFI detection of B. anthracis Sterne was validated over a range of bacterial and phage concentrations with optimal detection achieved in as little as 2h from the onset of amplification with a threshold sensitivity of 2.5×10(4)cfu/mL. The novel use of γ phage amplification detected with a simple, inexpensive LFI assay provides a rapid, sensitive, highly accurate, and field-deployable method for diagnostic ID of B. anthracis in a fraction of the time required by conventional techniques, and without the need for extensive laboratory culture.

  7. Decontamination Efficacy and Skin Toxicity of Two Decontaminants against Bacillus anthracis.

    PubMed

    Stratilo, Chad W; Crichton, Melissa K F; Sawyer, Thomas W

    2015-01-01

    Decontamination of bacterial endospores such as Bacillus anthracis has traditionally required the use of harsh or caustic chemicals. The aim of this study was to evaluate the efficacy of a chlorine dioxide decontaminant in killing Bacillus anthracis spores in solution and on a human skin simulant (porcine cadaver skin), compared to that of commonly used sodium hypochlorite or soapy water decontamination procedures. In addition, the relative toxicities of these decontaminants were compared in human skin keratinocyte primary cultures. The chlorine dioxide decontaminant was similarly effective to sodium hypochlorite in reducing spore numbers of Bacillus anthracis Ames in liquid suspension after a 10 minute exposure. After five minutes, the chlorine dioxide product was significantly more efficacious. Decontamination of isolated swine skin contaminated with Bacillus anthracis Sterne with the chlorine dioxide product resulted in no viable spores sampled. The toxicity of the chlorine dioxide decontaminant was up to two orders of magnitude less than that of sodium hypochlorite in human skin keratinocyte cultures. In summary, the chlorine dioxide based decontaminant efficiently killed Bacillus anthracis spores in liquid suspension, as well as on isolated swine skin, and was less toxic than sodium hypochlorite in cultures of human skin keratinocytes.

  8. Whole-building decontamination of Bacillus anthracis Sterne spores by methyl bromide fumigation.

    PubMed

    Serre, S; Mickelsen, L; Calfee, M W; Wood, J P; Gray, M S; Scheffrahn, R H; Perez, R; Kern, W H; Daniell, N

    2016-01-01

    To evaluate the field inactivation of Bacillus anthracis Sterne spores with methyl bromide (MB) using commercial fumigation techniques. Eighty-seven wood and 87 glass coupons each containing ca. 1 × 10(6) B. anthracis Sterne spores, were placed in 22 locations inside a 1444 m(3) conference building. Four additional 12-coupon sets (six wood, six glass) were removed from the building at 16, 24, 32 and 40 h during fumigation. The building was sealed under two tarpaulins and fumigated with MB at ≥225 g m(-3) mean concentration for 48 h at 28°C and 83% RH. All B. anthracis spores fumigated for more than 16 h were inactivated. A single wood coupon from the 16-h set yielded ca. 2 × 10(3)  CFU. No damage to the building or its contents was observed. MB fumigation is a rapid, economical and effective whole-structure decontamination method for B. anthracis spores. MB fumigation offers a method of whole-structure B. anthracis decontamination without removal of materials, damage to sensitive electronics, costly indoor retrofitting. Published 2015. This article is a U.S. Government work and is in the public domain in the USA.

  9. A simple decontamination approach using hydrogen peroxide vapour for Bacillus anthracis spore inactivation.

    PubMed

    Wood, J P; Calfee, M W; Clayton, M; Griffin-Gatchalian, N; Touati, A; Ryan, S; Mickelsen, L; Smith, L; Rastogi, V

    2016-12-01

    To evaluate the use of relatively low levels of hydrogen peroxide vapour (HPV) for the inactivation of Bacillus anthracis spores within an indoor environment. Laboratory-scale decontamination tests were conducted using bacterial spores of both B. anthracis Ames and Bacillus atrophaeus inoculated onto several types of materials. Pilot-scale tests were also conducted using a larger chamber furnished as an indoor office. Commercial off-the-shelf (COTS) humidifiers filled with aqueous solutions of 3 or 8% hydrogen peroxide (H2 O2 ) were used to generate the HPV inside the mock office. The spores were exposed to HPV for periods ranging from 8 h up to 1 week. Four- to seven-day exposures to low levels of HPV (average air concentrations of approx. 5-10 parts per million) were effective in inactivating B. anthracis spores on multiple materials. The HPV can be generated with COTS humidifiers and household H2 O2 solutions. With the exception of one test/material, B. atrophaeus spores were equally or more resistant to HPV inactivation compared to those from B. anthracis Ames. This simple and effective decontamination method is another option that could be widely applied in the event of a B. anthracis spore release. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

  10. Decontamination Efficacy and Skin Toxicity of Two Decontaminants against Bacillus anthracis

    PubMed Central

    Stratilo, Chad W.; Crichton, Melissa K. F.; Sawyer, Thomas W.

    2015-01-01

    Decontamination of bacterial endospores such as Bacillus anthracis has traditionally required the use of harsh or caustic chemicals. The aim of this study was to evaluate the efficacy of a chlorine dioxide decontaminant in killing Bacillus anthracis spores in solution and on a human skin simulant (porcine cadaver skin), compared to that of commonly used sodium hypochlorite or soapy water decontamination procedures. In addition, the relative toxicities of these decontaminants were compared in human skin keratinocyte primary cultures. The chlorine dioxide decontaminant was similarly effective to sodium hypochlorite in reducing spore numbers of Bacillus anthracis Ames in liquid suspension after a 10 minute exposure. After five minutes, the chlorine dioxide product was significantly more efficacious. Decontamination of isolated swine skin contaminated with Bacillus anthracis Sterne with the chlorine dioxide product resulted in no viable spores sampled. The toxicity of the chlorine dioxide decontaminant was up to two orders of magnitude less than that of sodium hypochlorite in human skin keratinocyte cultures. In summary, the chlorine dioxide based decontaminant efficiently killed Bacillus anthracis spores in liquid suspension, as well as on isolated swine skin, and was less toxic than sodium hypochlorite in cultures of human skin keratinocytes. PMID:26394165

  11. The phenotypic and genotypic characterization of Bacillus anthracis isolates from Iran.

    PubMed

    Jula, Gholamreza Moazeni; Sattari, Morteza; Banihashemi, Reza; Razzaz, Hossein; Sanchouli, Alireza; Tadayon, Keyvan

    2011-03-01

    To understand epidemiology of Bacillus anthracis in Iran, the morphological, biochemical, and virulence specifications of 32 B. anthracis isolates, collected from human, sheep, cattle, goat, and environmental specimens obtained from throughout Iran were examined by conventional and molecular approaches. B. anthracis isolates were characterized in multiple ways: (1) capsule formation both on bicarbonate agar and in defibrinated horse blood, (2) motility of vegetative forms, (3) hemolysis on 5% sheep blood agar, (4) penicillin G susceptibility, (5) lecithinase production on egg yolk agar, (6) gelatin hydrolysis, (7) ability to develop "string of pearls" on tryptose agar, and (8) capability to develop mucoid colonies in presence of CO(2) were assessed. In addition, biochemical properties such as indole, methyl red, catalase, citrate utilization, and finally nitrate reduction tests were used. All the tested isolates produced identical morphological and biochemical patterns with those of the vaccine strain B. anthracis 34F2 Sterne. In order to assess potential virulence of isolates at genomic level, PCR protocols assaying for the pXO1 and pXO2 loci were employed. The intriguing high level of phenotypic similarity between Iranian isolates of B. anthracis and the 34F2 Sterne strain deserves further studies at genomic level.

  12. Bacillus anthracis interacts with plasmin(ogen) to evade C3b-dependent innate immunity.

    PubMed

    Chung, Myung-Chul; Tonry, Jessica H; Narayanan, Aarthi; Manes, Nathan P; Mackie, Ryan S; Gutting, Bradford; Mukherjee, Dhritiman V; Popova, Taissia G; Kashanchi, Fatah; Bailey, Charles L; Popov, Serguei G

    2011-03-25

    The causative agent of anthrax, Bacillus anthracis, is capable of circumventing the humoral and innate immune defense of the host and modulating the blood chemistry in circulation to initiate a productive infection. It has been shown that the pathogen employs a number of strategies against immune cells using secreted pathogenic factors such as toxins. However, interference of B. anthracis with the innate immune system through specific interaction of the spore surface with host proteins such as the complement system has heretofore attracted little attention. In order to assess the mechanisms by which B. anthracis evades the defense system, we employed a proteomic analysis to identify human serum proteins interacting with B. anthracis spores, and found that plasminogen (PLG) is a major surface-bound protein. PLG efficiently bound to spores in a lysine- and exosporium-dependent manner. We identified α-enolase and elongation factor tu as PLG receptors. PLG-bound spores were capable of exhibiting anti-opsonic properties by cleaving C3b molecules in vitro and in rabbit bronchoalveolar lavage fluid, resulting in a decrease in macrophage phagocytosis. Our findings represent a step forward in understanding the mechanisms involved in the evasion of innate immunity by B. anthracis through recruitment of PLG resulting in the enhancement of anti-complement and anti-opsonization properties of the pathogen.

  13. Bacillus anthracis Interacts with Plasmin(ogen) to Evade C3b-Dependent Innate Immunity

    PubMed Central

    Chung, Myung-Chul; Tonry, Jessica H.; Narayanan, Aarthi; Manes, Nathan P.; Mackie, Ryan S.; Gutting, Bradford; Mukherjee, Dhritiman V.; Popova, Taissia G.; Kashanchi, Fatah; Bailey, Charles L.; Popov, Serguei G.

    2011-01-01

    The causative agent of anthrax, Bacillus anthracis, is capable of circumventing the humoral and innate immune defense of the host and modulating the blood chemistry in circulation to initiate a productive infection. It has been shown that the pathogen employs a number of strategies against immune cells using secreted pathogenic factors such as toxins. However, interference of B. anthracis with the innate immune system through specific interaction of the spore surface with host proteins such as the complement system has heretofore attracted little attention. In order to assess the mechanisms by which B. anthracis evades the defense system, we employed a proteomic analysis to identify human serum proteins interacting with B. anthracis spores, and found that plasminogen (PLG) is a major surface-bound protein. PLG efficiently bound to spores in a lysine- and exosporium-dependent manner. We identified α-enolase and elongation factor tu as PLG receptors. PLG-bound spores were capable of exhibiting anti-opsonic properties by cleaving C3b molecules in vitro and in rabbit bronchoalveolar lavage fluid, resulting in a decrease in macrophage phagocytosis. Our findings represent a step forward in understanding the mechanisms involved in the evasion of innate immunity by B. anthracis through recruitment of PLG resulting in the enhancement of anti-complement and anti-opsonization properties of the pathogen. PMID:21464960

  14. Carbohydrates and glycoproteins of Bacillus anthracis and related bacilli: targets for biodetection.

    PubMed

    Fox, Alvin; Stewart, George C; Waller, Lashanda N; Fox, Karen F; Harley, William M; Price, Robert L

    2003-08-01

    The spore is the form released in a bioterrorism attack. There is a real need for definition of new targets for Bacillus anthracis that might be incorporated into emerging biodetection technologies. Particularly of interest are macromolecules found in B. anthracis that are (1) spore-specific, (2) readily accessible on the spore surface and (3) distinct from those present in related organisms. One of the few biochemical methods to identify the spores of B. anthracis is based on the presence of rhamnose and 3-O-methyl rhamnose as determined by gas chromatography-mass spectrometry. Related organisms additionally contain 2-O-methyl rhamnose and fucose. Carbohydrates and glycoproteins of the B. cereus group of organisms and the related B. subilis group are reviewed here. It is hypothesized that the spore-specific carbohydrate is a component of the newly described glycoprotein of the exosporium of B. anthracis. Further work to define the protein and carbohydrate components of the glycoprotein of B. anthracis could be highly useful in developing new technologies for rapid biodetection.

  15. Nitrate Reductase Regulates Expression of Nitrite Uptake and Nitrite Reductase Activities in Chlamydomonas reinhardtii 1

    PubMed Central

    Galván, Aurora; Cárdenas, Jacobo; Fernández, Emilio

    1992-01-01

    In Chlamydomonas reinhardtii mutants defective at the structural locus for nitrate reductase (nit-1) or at loci for biosynthesis of the molybdopterin cofactor (nit-3, nit-4, or nit-5 and nit-6), both nitrite uptake and nitrite reductase activities were repressed in ammonium-grown cells and expressed at high amounts in nitrogen-free media or in media containing nitrate or nitrite. In contrast, wild-type cells required nitrate induction for expression of high levels of both activities. In mutants defective at the regulatory locus for nitrate reductase (nit-2), very low levels of nitrite uptake and nitrite reductase activities were expressed even in the presence of nitrate or nitrite. Both restoration of nitrate reductase activity in mutants defective at nit-1, nit-3, and nit-4 by isolating diploid strains among them and transformation of a structural mutant upon integration of the wild-type nit-1 gene gave rise to the wild-type expression pattern for nitrite uptake and nitrite reductase activities. Conversely, inactivation of nitrate reductase by tungstate treatment in nitrate, nitrite, or nitrogen-free media made wild-type cells respond like nitrate reductase-deficient mutants with respect to the expression of nitrite uptake and nitrite reductase activities. Our results indicate that nit-2 is a regulatory locus for both the nitrite uptake system and nitrite reductase, and that the nitrate reductase enzyme plays an important role in the regulation of the expression of both enzyme activities. PMID:16668656

  16. Growth characteristics of Bacillus anthracis compared to other Bacillus spp. on the selective nutrient media Anthrax Blood Agar and Cereus Ident Agar.

    PubMed

    Tomaso, Herbert; Bartling, Carsten; Al Dahouk, Sascha; Hagen, Ralf M; Scholz, Holger C; Beyer, Wolfgang; Neubauer, Heinrich

    2006-01-01

    Anthrax Blood Agar (ABA) and Cereus Ident Agar (CEI) were evaluated as selective growth media for the isolation of Bacillus anthracis using 92 B. anthracis and 132 other Bacillus strains from 30 species. The positive predictive values for the identification of B. anthracis on ABA, CEI, and the combination of both were 72%, 71%, and 90%, respectively. Thus, less than 10% of all species were misidentified using both nutrient media. Species which might be misidentified as B. anthracis were B. cereus, B. mycoides, and B. thuringiensis. Particularly, 30% of B. weihenstephanensis strains were misidentified as B. anthracis.

  17. Glyconanobiotics: Novel carbohydrated nanoparticle antibiotics for MRSA and Bacillus anthracis

    PubMed Central

    Abeylath, Sampath C.; Turos, Edward; Dickey, Sonja; Limb, Daniel V.

    2008-01-01

    This report describes the synthesis and evaluation of glycosylated polyacrylate nanoparticles that have covalently-bound antibiotics within their framework. The requisite glycosylated drug monomers were prepared from one of three known antibiotics, an N-sec-butylthio β-lactam, ciprofloxacin, and a penicillin, by acylation with 3-O-acryloyl-1,2-O-isopropylidene-5,6 bis((chlorosuccinyl)oxy)-D-glucofuranose (7) or 6-O-acetyl-3-O-acryloyl-1,2-O-isopropylidene-5-(chlorosuccinyl)oxy-α-D-glucofuranose (10). These acrylated monomers were subjected to emulsion polymerization in a 7:3 (w:w) mixture of butyl acrylate-styrene in the presence of sodium dodecyl sulfate as surfactant (3 weight %) and potassium persulfate as a radical initiator (1 weight %). The resulting nanoparticle emulsions were characterized by dynamic light scattering and found to have similar diameters (~40 nm) and size distributions to those of our previously studied systems. Microbiological testing showed that the N-sec-butylthio β-lactam and ciprofloxacin nanoparticles both have powerful in vitro activities against methicillin-resistant Staphylococcus aureus and Bacillus anthracis, while the penicillin-bound nanoparticles have no antimicrobial activity. This indicates the need for matching a suitable antibiotic with the nanoparticle carrier. Overall, the study shows that even relatively large, polar acrylate monomers (MW>1000 amu) can be efficiently incorporated into the nanoparticle matrix by emulsion polymerization, providing opportunities for further advances in nanomedicine. PMID:18063370

  18. Microbial forensics: fiber optic microarray subtyping of Bacillus anthracis

    NASA Astrophysics Data System (ADS)

    Shepard, Jason R. E.

    2009-05-01

    The past decade has seen increased development and subsequent adoption of rapid molecular techniques involving DNA analysis for detection of pathogenic microorganisms, also termed microbial forensics. The continued accumulation of microbial sequence information in genomic databases now better positions the field of high-throughput DNA analysis to proceed in a more manageable fashion. The potential to build off of these databases exists as technology continues to develop, which will enable more rapid, cost effective analyses. This wealth of genetic information, along with new technologies, has the potential to better address some of the current problems and solve the key issues involved in DNA analysis of pathogenic microorganisms. To this end, a high density fiber optic microarray has been employed, housing numerous DNA sequences simultaneously for detection of various pathogenic microorganisms, including Bacillus anthracis, among others. Each organism is analyzed with multiple sequences and can be sub-typed against other closely related organisms. For public health labs, real-time PCR methods have been developed as an initial preliminary screen, but culture and growth are still considered the gold standard. Technologies employing higher throughput than these standard methods are better suited to capitalize on the limitless potential garnered from the sequence information. Microarray analyses are one such format positioned to exploit this potential, and our array platform is reusable, allowing repetitive tests on a single array, providing an increase in throughput and decrease in cost, along with a certainty of detection, down to the individual strain level.

  19. Structure of nicotinic acid mononucleotide adenylyltransferase from Bacillus anthracis

    SciTech Connect

    Lu, S.; Smith, C.; Yang, Z.; Pruett, P.; Nagy, L.; McCombs, D; DeLucas, L.; Brouillette, W.; Brouillette, C.

    2008-11-25

    Nicotinic acid mononucleotide adenylyltransferase (NaMNAT; EC 2.7.7.18) is the penultimate enzyme in the biosynthesis of NAD{sup +} and catalyzes the adenylation of nicotinic acid mononucleotide (NaMN) by ATP to form nicotinic acid adenine dinucleotide (NaAD). This enzyme is regarded as a suitable candidate for antibacterial drug development; as such, Bacillus anthracis NaMNAT (BA NaMNAT) was heterologously expressed in Escherichia coli for the purpose of inhibitor discovery and crystallography. The crystal structure of BA NaMNAT was determined by molecular replacement, revealing two dimers per asymmetric unit, and was refined to an R factor and R{sub free} of 0.228 and 0.263, respectively, at 2.3 {angstrom} resolution. The structure is very similar to that of B. subtilis NaMNAT (BS NaMNAT), which is also a dimer, and another independently solved structure of BA NaMNAT recently released from the PDB along with two ligated forms. Comparison of these and other less related bacterial NaMNAT structures support the presence of considerable conformational heterogeneity and flexibility in three loops surrounding the substrate-binding area.

  20. Bacillus anthracis Edema Toxin Impairs Neutrophil Actin-Based Motility▿

    PubMed Central

    Szarowicz, Sarah E.; During, Russell L.; Li, Wei; Quinn, Conrad P.; Tang, Wei-Jen; Southwick, Frederick S.

    2009-01-01

    Inhalation anthrax results in high-grade bacteremia and is accompanied by a delay in the rise of the peripheral polymorphonuclear neutrophil (PMN) count and a paucity of PMNs in the infected pleural fluid and mediastinum. Edema toxin (ET) is one of the major Bacillus anthracis virulence factors and consists of the adenylate cyclase edema factor (EF) and protective antigen (PA). Relatively low concentrations of ET (100 to 500 ng/ml of PA and EF) significantly impair human PMN chemokinesis, chemotaxis, and ability to polarize. These changes are accompanied by a reduction in chemoattractant-stimulated PMN actin assembly. ET also causes a significant decrease in Listeria monocytogenes intracellular actin-based motility within HeLa cells. These defects in actin assembly are accompanied by a >50-fold increase in intracellular cyclic AMP and a >4-fold increase in the phosphorylation of protein kinase A. We have previously shown that anthrax lethal toxin (LT) also impairs neutrophil actin-based motility (R. L. During, W. Li, B. Hao, J. M. Koenig, D. S. Stephens, C. P. Quinn, and F. S. Southwick, J. Infect. Dis. 192:837-845, 2005), and we now find that LT combined with ET causes an additive inhibition of PMN chemokinesis, polarization, chemotaxis, and FMLP (N-formyl-met-leu-phe)-induced actin assembly. We conclude that ET alone or combined with LT impairs PMN actin assembly, resulting in paralysis of PMN chemotaxis. PMID:19349425

  1. Proteolytic Degradation of Human Antimicrobial Peptide LL-37 by Bacillus anthracis May Contribute to Virulence

    PubMed Central

    Thwaite, Joanne E.; Hibbs, Stephen; Titball, Richard W.; Atkins, Timothy P.

    2006-01-01

    In this paper we report on the susceptibilities of a range of Bacillus species to the human antimicrobial peptide LL-37. B. subtilis showed a low level of resistance to killing by LL-37 (50% growth-inhibitory concentration [GI50], 1 μg/ml). B. cereus and B. thuringiensis showed intermediate levels of resistance to killing (GI50s, 33 μg/ml and 37 μg/ml, respectively). B. anthracis showed the highest level of resistance (GI50s, 40 to 66 μg/ml). The degradation of LL-37 by B. anthracis culture supernatant was blocked by the metalloprotease inhibitors EDTA and 1,10-phenanthroline, and the gene encoding the protease responsible for LL-37 degradation was not plasmid borne. Our findings suggest that alongside the classical plasmid-based virulence determinants, extracellular metalloproteases of B. anthracis may play a role in survival in the host. PMID:16801407

  2. Simultaneous real-time PCR detection of Bacillus anthracis, Francisella tularensis and Yersinia pestis.

    PubMed

    Skottman, T; Piiparinen, H; Hyytiäinen, H; Myllys, V; Skurnik, M; Nikkari, S

    2007-03-01

    This report describes the development of in-house real-time PCR assays using minor groove binding probes for simultaneous detection of the Bacillus anthracis pag and cap genes, the Francisella tularensis 23 KDa gene, as well as the Yersinia pestis pla gene. The sensitivities of these assays were at least 1 fg, except for the assay targeting the Bacillus anthracis cap gene, which showed a sensitivity of 10 fg when total DNA was used as a template in a serial dilution. The clinical value of the Bacillus anthracis- and Francisella tularensis-specific assays was demonstrated by successful amplification of DNA from cases of cow anthrax and hare tularemia, respectively. No cross-reactivity between these species-specific assays or with 39 other bacterial species was noted. These assays may provide a rapid tool for the simultaneous detection and identification of the three category A bacterial species listed as biological threats by the Centers for Disease Control and Prevention.

  3. Structure of 5-formyltetrahydrofolate cyclo-ligase from Bacillus anthracis (BA4489)

    SciTech Connect

    Meier, Christoph; Carter, Lester G.; Winter, Graeme; Owens, Ray J.; Stuart, David I.; Esnouf, Robert M.

    2007-03-01

    The structure of 5-formyltetrahydrofolate cyclo-ligase from B. anthracis determined by X-ray crystallography at a resolution of 1.6 Å is described. Bacillus anthracis is a spore-forming bacterium and the causative agent of the disease anthrax. The Oxford Protein Production Facility has been targeting proteins from B. anthracis in order to develop high-throughput technologies within the Structural Proteomics in Europe project. As part of this work, the structure of 5-formyltetrahydrofolate cyclo-ligase (BA4489) has been determined by X-ray crystallography to 1.6 Å resolution. The structure, solved in complex with magnesium-ion-bound ADP and phosphate, gives a detailed picture of the proposed catalytic mechanism of the enzyme. Chemical differences from other cyclo-ligase structures close to the active site that could be exploited to design specific inhibitors are also highlighted.

  4. Structure of purine nucleoside phosphorylase (DeoD) from Bacillus anthracis

    SciTech Connect

    Grenha, Rosa; Levdikov, Vladimir M.; Fogg, Mark J.; Blagova, Elena V.; Brannigan, James A. Wilkinson, Anthony J.; Wilson, Keith S.

    2005-05-01

    The crystal structure of purine nucleoside phosphorylase (DeoD) from B. anthracis was solved by X-ray crystallography using molecular replacement and refined at a resolution of 2.24 Å. Protein structures from the causative agent of anthrax (Bacillus anthracis) are being determined as part of a structural genomics programme. Amongst initial candidates for crystallographic analysis are enzymes involved in nucleotide biosynthesis, since these are recognized as potential targets in antibacterial therapy. Purine nucleoside phosphorylase is a key enzyme in the purine-salvage pathway. The crystal structure of purine nucleoside phosphorylase (DeoD) from B. anthracis has been solved by molecular replacement at 2.24 Å resolution and refined to an R factor of 18.4%. This is the first report of a DeoD structure from a Gram-positive bacterium.

  5. Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis—One Species on the Basis of Genetic Evidence

    PubMed Central

    Helgason, Erlendur; Økstad, Ole Andreas; Caugant, Dominique A.; Johansen, Henning A.; Fouet, Agnes; Mock, Michéle; Hegna, Ida; Kolstø, Anne-Brit

    2000-01-01

    Bacillus anthracis, Bacillus cereus, and Bacillus thuringiensis are members of the Bacillus cereus group of bacteria, demonstrating widely different phenotypes and pathological effects. B. anthracis causes the acute fatal disease anthrax and is a potential biological weapon due to its high toxicity. B. thuringiensis produces intracellular protein crystals toxic to a wide number of insect larvae and is the most commonly used biological pesticide worldwide. B. cereus is a probably ubiquitous soil bacterium and an opportunistic pathogen that is a common cause of food poisoning. In contrast to the differences in phenotypes, we show by multilocus enzyme electrophoresis and by sequence analysis of nine chromosomal genes that B. anthracis should be considered a lineage of B. cereus. This determination is not only a formal matter of taxonomy but may also have consequences with respect to virulence and the potential of horizontal gene transfer within the B. cereus group. PMID:10831447

  6. Human aldose reductase and human small intestine aldose reductase are efficient retinal reductases: consequences for retinoid metabolism.

    PubMed

    Crosas, Bernat; Hyndman, David J; Gallego, Oriol; Martras, Sílvia; Parés, Xavier; Flynn, T Geoffrey; Farrés, Jaume

    2003-08-01

    Aldo-keto reductases (AKRs) are NAD(P)H-dependent oxidoreductases that catalyse the reduction of a variety of carbonyl compounds, such as carbohydrates, aliphatic and aromatic aldehydes and steroids. We have studied the retinal reductase activity of human aldose reductase (AR), human small-intestine (HSI) AR and pig aldehyde reductase. Human AR and HSI AR were very efficient in the reduction of all- trans -, 9- cis - and 13- cis -retinal ( k (cat)/ K (m)=1100-10300 mM(-1).min(-1)), constituting the first cytosolic NADP(H)-dependent retinal reductases described in humans. Aldehyde reductase showed no activity with these retinal isomers. Glucose was a poor inhibitor ( K (i)=80 mM) of retinal reductase activity of human AR, whereas tolrestat, a classical AKR inhibitor used pharmacologically to treat diabetes, inhibited retinal reduction by human AR and HSI AR. All- trans -retinoic acid failed to inhibit both enzymes. In this paper we present the AKRs as an emergent superfamily of retinal-active enzymes, putatively involved in the regulation of retinoid biological activity through the assimilation of retinoids from beta-carotene and the control of retinal bioavailability.

  7. Evaluation of DNA extraction methods for Bacillus anthracis spores isolated from spiked food samples.

    PubMed

    Thomas, M C; Shields, M J; Hahn, K R; Janzen, T W; Goji, N; Amoako, K K

    2013-07-01

    Nine commercial DNA extraction kits were evaluated for the isolation of DNA from 10-fold serial dilutions of Bacillus anthracis spores using quantitative real-time PCR (qPCR). The three kits determined by qPCR to yield the most sensitive and consistent detection (Epicenter MasterPure Gram Positive; MoBio PowerFood; ABI PrepSeq) were subsequently tested for their ability to isolate DNA from trace amounts of B. anthracis spores (approx. 6·5 × 10(1) and 1·3 × 10(2)  CFU in 25 ml or 50 g of food sample) spiked into complex food samples including apple juice, ham, whole milk and bagged salad and recovered with immunomagnetic separation (IMS). The MasterPure kit effectively and consistently isolated DNA from low amounts of B. anthracis spores captured from food samples. Detection was achieved from apple juice, ham, whole milk and bagged salad from as few as 65 ± 14, 68 ± 8, 66 ± 4 and 52 ± 16 CFU, respectively, and IMS samples were demonstrated to be free of PCR inhibitors. Detection of B. anthracis spores isolated from food by IMS differs substantially between commercial DNA extraction kits; however, sensitive results can be obtained with the MasterPure Gram Positive kit. The extraction protocol identified herein combined with IMS is novel for B. anthracis and allows detection of low levels of B. anthracis spores from contaminated food samples. © Her Majesty the Queen in Right of Canada [2013]. Reproduced with the permission of the Canadian Food Inspection Agency.

  8. Hydrophobic properties and extraction of Bacillus anthracis spores from liquid foods.

    PubMed

    Leishman, Oriana N; Labuza, Theodore P; Diez-Gonzalez, Francisco

    2010-08-01

    The objectives of this study were to characterize the hydrophobic properties of three strains of Bacillus anthracis using the microbial adherence to hydrocarbons (MATH) assay and determine the recovery of spores by hexadecane extraction from water, milk and orange juice using a modified version of this assay. In water mixtures, the hydrophobicity of B. anthracis spores ranged from 5 to 80% as the concentration of hexadecane and the mixing time increased. Two of the three strains showed significantly different hydrophobicity values. Increased pre-incubation temperature of the spore suspension had inconsistent effects on hydrophobicity across the three strains. The hydrophobicity of spores did not change significantly during storage at 4 degrees C. However, recovery of spores in the hexadecane fraction from aqueous mixtures was always less than 5% even at conditions in which the hydrophobicity values were greater than 40%. The recovery of spores in the hexadecane fraction increased to almost 20% when the hexadecane was mixed with milk or orange juice, although the majority of spores remained in the aqueous phase. The B. anthracis spores were relatively hydrophobic according to the MATH assay, but this test was not a good predictor of the partitioning of B. anthracis spores to hexadecane. The separation of B. anthracis from food matrices using hexadecane extraction was ineffective. Although the modified MATH assay was not able to efficiently extract B. anthracis from various food media, development of methods for rapid concentration and separation of this and other select agents from food remains vital to food defense. Copyright 2010 Elsevier Ltd. All rights reserved.

  9. Transient lipopolysaccharide-induced resistance to aerosolized Bacillus anthracis in New Zealand white rabbits.

    PubMed

    Yee, Steven B; Dyer, David N; Twenhafel, Nancy A; Pitt, M Louise M

    2013-06-01

    Previous studies have demonstrated that prior infection by various bacterial pathogens induces nonspecific resistance to subsequent infection by other gram-negative and gram-positive bacterial pathogens. In the present study, we evaluated whether underlying inflammation enhanced host resistance to inhalational Bacillus anthracis infection in New Zealand White rabbits (SPF; Bordetella- and Pasteurella-free). Accordingly, rabbits were pretreated with either the inflammagen bacterial LPS (60,000 EU/kg), a component of the outer membrane of gram-negative bacteria, or saline (vehicle). Administration of LPS resulted in brief pyrexia and a significant increase in the proinflammatory cytokine TNFα, thus confirming LPS-induced inflammation. At 24 h after LPS treatment, rabbits were exposed to aerosolized B. anthracis spores (Ames strain; approximately 300 LD50). Blood samples collected at various times after challenge were cultured. Compared with their saline-pretreated counterparts, LPS-pretreated, B. anthracis challenged rabbits exhibited delays in 2 biomarkers of B. anthracis infection-anthrax-induced pyrexia (25 h versus 66 h after challenge, respectively) and bacteremia (26 h versus 63 h, respectively)-and survived longer (41 h versus 90 h, respectively). Similar to control animals, all LPS-pretreated, B. anthracis-challenged rabbits exhibited pathology consistent with inhalational anthrax. Taken together, these results suggest that prior or underlying stimulation of the innate immune system induces transient host resistance to subsequent B. anthracis infection in SPF New Zealand white rabbits. In particular, our results emphasize the importance of using animals that are free of underlying infections to prevent confounding data in studies for inhalational anthrax characterization and medical countermeasure evaluation.

  10. Whole genome protein microarrays for serum profiling of immunodominant antigens of Bacillus anthracis

    PubMed Central

    Kempsell, Karen E.; Kidd, Stephen P.; Lewandowski, Kuiama; Elmore, Michael J.; Charlton, Sue; Yeates, Annemarie; Cuthbertson, Hannah; Hallis, Bassam; Altmann, Daniel M.; Rogers, Mitch; Wattiau, Pierre; Ingram, Rebecca J.; Brooks, Tim; Vipond, Richard

    2015-01-01

    A commercial Bacillus anthracis (Anthrax) whole genome protein microarray has been used to identify immunogenic Anthrax proteins (IAP) using sera from groups of donors with (a) confirmed B. anthracis naturally acquired cutaneous infection, (b) confirmed B. anthracis intravenous drug use-acquired infection, (c) occupational exposure in a wool-sorters factory, (d) humans and rabbits vaccinated with the UK Anthrax protein vaccine and compared to naïve unexposed controls. Anti-IAP responses were observed for both IgG and IgA in the challenged groups; however the anti-IAP IgG response was more evident in the vaccinated group and the anti-IAP IgA response more evident in the B. anthracis-infected groups. Infected individuals appeared somewhat suppressed for their general IgG response, compared with other challenged groups. Immunogenic protein antigens were identified in all groups, some of which were shared between groups whilst others were specific for individual groups. The toxin proteins were immunodominant in all vaccinated, infected or other challenged groups. However, a number of other chromosomally-located and plasmid encoded open reading frame proteins were also recognized by infected or exposed groups in comparison to controls. Some of these antigens e.g., BA4182 are not recognized by vaccinated individuals, suggesting that there are proteins more specifically expressed by live Anthrax spores in vivo that are not currently found in the UK licensed Anthrax Vaccine (AVP). These may perhaps be preferentially expressed during infection and represent expression of alternative pathways in the B. anthracis “infectome.” These may make highly attractive candidates for diagnostic and vaccine biomarker development as they may be more specifically associated with the infectious phase of the pathogen. A number of B. anthracis small hypothetical protein targets have been synthesized, tested in mouse immunogenicity studies and validated in parallel using human sera from