Protective antigens from El Tor vibrios
Watanabe, Yoshikazu; Verwey, W. F.
1965-01-01
A biochemically and immunologically homogeneous antigenic fraction having the properties of a lipopolysaccharide has been isolated from the culture supernatant of an El Tor vibrio (Ogawa subtype). This antigen was very specifically protective for mice challenged with Ogawa strains of either El Tor vibrios or Vibrio cholerae. Rabbit antisera prepared against the antigen were passively protective for mice and highly vibriocidal but had little agglutinating activity. However, the antigen was able specifically to absorb agglutinins, as well as mouse-protective and vibriocidal antibody from serum prepared against whole bacterial cells. The specific protective activity of this lipopolysaccharide was much greater than that of vaccines made from whole bacterial cells, and its toxicity in animals was about equivalent to that of whole cells. The relationship of activity to toxicity therefore represented an improvement over the vaccines that were studied. ImagesFIG. 1FIG. 3FIG. 4FIG. 5 PMID:5294306
A Novel Protective Vaccine Antigen from the Core Escherichia coli Genome
Moriel, Danilo G.; Tan, Lendl; Goh, Kelvin G. K.; Ipe, Deepak S.; Lo, Alvin W.; Peters, Kate M.
2016-01-01
ABSTRACT Escherichia coli is a versatile pathogen capable of causing intestinal and extraintestinal infections that result in a huge burden of global human disease. The diversity of E. coli is reflected by its multiple different pathotypes and mosaic genome composition. E. coli strains are also a major driver of antibiotic resistance, emphasizing the urgent need for new treatment and prevention measures. Here, we used a large data set comprising 1,700 draft and complete genomes to define the core and accessory genome of E. coli and demonstrated the overlapping relationship between strains from different pathotypes. In combination with proteomic investigation, this analysis revealed core genes that encode surface-exposed or secreted proteins that represent potential broad-coverage vaccine antigens. One of these antigens, YncE, was characterized as a conserved immunogenic antigen able to protect against acute systemic infection in mice after vaccination. Overall, this work provides a genomic blueprint for future analyses of conserved and accessory E. coli genes. The work also identified YncE as a novel antigen that could be exploited in the development of a vaccine against all pathogenic E. coli strains—an important direction given the high global incidence of infections caused by multidrug-resistant strains for which there are few effective antibiotics. IMPORTANCE E. coli is a multifaceted pathogen of major significance to global human health and an important contributor to increasing antibiotic resistance. Given the paucity of therapies still effective against multidrug-resistant pathogenic E. coli strains, novel treatment and prevention strategies are urgently required. In this study, we defined the core and accessory components of the E. coli genome by examining a large collection of draft and completely sequenced strains available from public databases. This data set was mined by employing a reverse-vaccinology approach in combination with proteomics
Genetic Mapping Identifies Novel Highly Protective Antigens for an Apicomplexan Parasite
Blake, Damer P.; Billington, Karen J.; Copestake, Susan L.; Oakes, Richard D.; Quail, Michael A.; Wan, Kiew-Lian; Shirley, Martin W.; Smith, Adrian L.
2011-01-01
Apicomplexan parasites are responsible for a myriad of diseases in humans and livestock; yet despite intensive effort, development of effective sub-unit vaccines remains a long-term goal. Antigenic complexity and our inability to identify protective antigens from the pool that induce response are serious challenges in the development of new vaccines. Using a combination of parasite genetics and selective barriers with population-based genetic fingerprinting, we have identified that immunity against the most important apicomplexan parasite of livestock (Eimeria spp.) was targeted against a few discrete regions of the genome. Herein we report the identification of six genomic regions and, within two of those loci, the identification of true protective antigens that confer immunity as sub-unit vaccines. The first of these is an Eimeria maxima homologue of apical membrane antigen-1 (AMA-1) and the second is a previously uncharacterised gene that we have termed ‘immune mapped protein-1’ (IMP-1). Significantly, homologues of the AMA-1 antigen are protective with a range of apicomplexan parasites including Plasmodium spp., which suggest that there may be some characteristic(s) of protective antigens shared across this diverse group of parasites. Interestingly, homologues of the IMP-1 antigen, which is protective against E. maxima infection, can be identified in Toxoplasma gondii and Neospora caninum. Overall, this study documents the discovery of novel protective antigens using a population-based genetic mapping approach allied with a protection-based screen of candidate genes. The identification of AMA-1 and IMP-1 represents a substantial step towards development of an effective anti-eimerian sub-unit vaccine and raises the possibility of identification of novel antigens for other apicomplexan parasites. Moreover, validation of the parasite genetics approach to identify effective antigens supports its adoption in other parasite systems where legitimate protective
Cloning and Expressing Recombinant Protective Antigen Domains of B. anthracis
2011-09-01
future predictive modeling toolkits. 1 1. Introduction The use of Bacillus anthracis as a bio - weapon in the United States in 2001 affirmed the need...for improved sensing and detection of biological weapons of mass destruction (WMD). Protective Antigen (PA) protein of Bacillus anthracis is the...Cloning and Expressing Recombinant Protective Antigen Domains of B. anthracis by Deborah A. Sarkes, Joshua M. Kogot, Irene Val-Addo
Verma, Anita; Ngundi, Miriam M; Price, Gregory A; Takeda, Kazuyo; Yu, James; Burns, Drusilla L
2018-02-27
Toxin neutralizing antibodies represent the major mode of protective immunity against a number of toxin-mediated bacterial diseases, including anthrax; however, the cellular mechanisms that lead to optimal neutralizing antibody responses remain ill defined. Here we show that the cellular binding pathway of anthrax protective antigen (PA), the binding component of anthrax toxin, determines the toxin neutralizing antibody response to this antigen. PA, which binds cellular receptors and efficiently enters antigen-presenting cells by receptor-mediated endocytosis, was found to elicit robust anti-PA IgG and toxin neutralizing antibody responses. In contrast, a receptor binding-deficient mutant of PA, which does not bind receptors and only inefficiently enters antigen-presenting cells by macropinocytosis, elicited very poor antibody responses. A chimeric protein consisting of the receptor binding-deficient PA mutant tethered to the binding subunit of cholera toxin, which efficiently enters cells using the cholera toxin receptor rather than the PA receptor, elicited an anti-PA IgG antibody response similar to that elicited by wild-type PA; however, the chimeric protein elicited a poor toxin neutralizing antibody response. Taken together, our results demonstrate that the antigen capture pathway can dictate the magnitudes of the total IgG and toxin neutralizing antibody responses to PA as well as the ratio of the two responses. IMPORTANCE Neutralizing antibodies provide protection against a number of toxin-mediated bacterial diseases by inhibiting toxin action. Therefore, many bacterial vaccines are designed to induce a toxin neutralizing antibody response. We have used protective antigen (PA), the binding component of anthrax toxin, as a model antigen to investigate immune mechanisms important for the induction of robust toxin neutralizing antibody responses. We found that the pathway used by antigen-presenting cells to capture PA dictates the robustness of the
Little, S F; Leppla, S H; Cora, E
1988-01-01
Thirty-six monoclonal antibodies to the protective antigen protein of Bacillus anthracis exotoxin have been characterized for affinity, antibody subtype, competitive binding to antigenic regions, and ability to neutralize lethal and edema toxin activities. At least 23 antigenic regions were detected on protective antigen by a blocking, enzyme-linked immunosorbent assay. Two clones, 3B6 and 14B7, competed for a single antigenic region and neutralized the activity of both the lethal toxin in vivo (Fisher 344 rat) and the edema toxin in vitro (CHO cells). These two antibodies blocked the binding of 125I-labeled protective antigen to FRL-103 cells. Our results support the proposal that binding of protective antigen to cell receptors is required for expression of toxicity. Images PMID:3384478
2011-11-28
New Reprint Screening of Peptide Libraries against Protective Antigen of Bacillus anthracis in a Disposable Microfluidic Cartridge W911NF-09-D-0001...against Protective Antigen of Bacillus anthracis in a Disposable Microfluidic Cartridge Report Title ABSTRACT See attached. Screening of Peptide...Libraries against Protective Antigen of Bacillus anthracis in a Disposable Microfluidic Cartridge Joshua M. Kogot1, Yanting Zhang2, Stephen J. Moore3
Vorobiev, D S; Semenova, I B; Volokh, Yu V; Romanenko, E E; Baturo, A P; Mikhailova, N A
2015-01-01
Study protective activity of protein-containing antigens of pneumococcus, obtained from serotypes 6B, 10A, 14, 19F, 23F and 36R, against infection with heterologous strains of S. pneumoniae. S. pneumoniae strains of serotypes 3, 6B, 10A, 14, 19F, 23F and 36R, obtained from the collection of pneumococcus strains of Mechnikov RIVS, were used in the study. Protein-containing antigens of S. pneumoniae were isolated by acetone precipitations of supernatant fraction of culture medium. Protective activity of preparations of protein-containing antigens of pneumococcus as studied in experiments of active protection of BALb/c line mice. The data obtained give evidence, that protein-containing antigens of pneumococcus, isolated from serotypes 6B, 10A, 14, 19F and 23F, effectively protect animals from subsequent infection with a heterologous S. pneumoniae strain of serotype 3 No. 11/56. Protection was noted at a level from 80 to 100% (p ≤ 0.05). Similar protective effect was detected in another experiment in a group of mice, immunized with preparations of protein-containing antigens of pneumococcus, obtained from serotypes 6B and 36R, against infection with a heterologous S. pneumoniae strain of serotype 3 No. 11/56. Protection was noted at a level of 90% (p ≤ 0.05). The results of the experiments carried out allow to assume, that the main role in formation of cross-protection in experiments in animals is played by pneumococcus, proteins, that are a part of the studied preparations, and not polysaccharide antigens.
Recombinant protective antigen 102 (rPA102): profile of a second-generation anthrax vaccine.
Keitel, Wendy A
2006-08-01
Recent terrorist attacks involving the use of Bacillus anthracis spores have stimulated interest in the development of new vaccines for anthrax prevention. Studies of the pathogenesis of anthrax and of the immune responses following infection and immunization underscore the pivotal role that antibodies to the protective antigen play in protection. The most promising vaccine candidates contain purified recombinant protective antigen. Clinical trials of one of these, recombinant protective antigen (rPA)102, are underway. Initial results suggest that rPA102 is well tolerated and immunogenic. Additional trials are necessary to identify optimal formulations and immunization regimens for pre- and postexposure prophylaxis. Future licensure of these and other candidate vaccines will depend on their safety and immunogenicity profiles in humans, and their ability to confer protection in animal models of inhalational anthrax.
Leary, S E; Griffin, K F; Galyov, E E; Hewer, J; Williamson, E D; Holmström, A; Forsberg, A; Titball, R W
1999-03-01
The pathogenic Yersiniae produce a range of virulence proteins, encoded by a 70 kb plasmid, which are essential for infection, and also form part of a contact-dependent virulence mechanism. One of these proteins, V antigen, has been shown to confer a high level of protection against parenteral infection with Y. pestis in murine models, and is considered to be a protective antigen. In this study, the protective efficacy of V antigen has been compared in the same model with that of other proteins (YopE, YopK and YopN), which are part of the contact-dependent virulence mechanism. Mice immunised with two intraperitoneal doses of V antigen or each of the Yops, administered with either Alhydrogel or interleukin-12, produced high antigen-specific serum IgG titres. As shown in previous studies, V+Alhydrogel was fully protective, and 5/5 mice survived a subcutaneous challenge with 90 or 9x10(3) LD50's of Y. pestis GB. In addition, these preliminary studies also showed that V+IL-12 was partially protective: 4/5 or 3/5 mice survived a challenge with 90 or 9x10(3) LD50's, respectively. In contrast, none of the mice immunised with the Yops survived the challenges, and there was no significant delay in the mean time to death compared to mice receiving a control protein. These results show that using two different vaccine regimens, Yops E, K and N, failed to elicit protective immune responses in a murine model of plague, whereas under the same conditions, V antigen was fully or partially protective. Copyright 1999 Academic Press.
High Antigen Dose Is Detrimental to Post-Exposure Vaccine Protection against Tuberculosis.
Billeskov, Rolf; Lindenstrøm, Thomas; Woodworth, Joshua; Vilaplana, Cristina; Cardona, Pere-Joan; Cassidy, Joseph P; Mortensen, Rasmus; Agger, Else Marie; Andersen, Peter
2017-01-01
Mycobacterium tuberculosis (Mtb), the etiologic agent of tuberculosis (TB), causes 1.8M deaths annually. The current vaccine, BCG, has failed to eradicate TB leaving 25% of the world's population with latent Mtb infection (LTBI), and 5-10% of these people will reactivate and develop active TB. An efficient therapeutic vaccine targeting LTBI could have an enormous impact on global TB incidence, and could be an important aid in fighting multidrug resistance, which is increasing globally. Here we show in a mouse model using the H56 (Ag85B-ESAT-6-Rv2660) TB vaccine candidate that post-exposure, but not preventive, vaccine protection requires low vaccine antigen doses for optimal protection. Loss of protection from high dose post-exposure vaccination was not associated with a loss of overall vaccine response magnitude, but rather with greater differentiation and lower functional avidity of vaccine-specific CD4 T cells. High vaccine antigen dose also led to a decreased ability of vaccine-specific CD4 T cells to home into the Mtb-infected lung parenchyma, a recently discovered important feature of T cell protection in mice. These results underscore the importance of T cell quality rather than magnitude in TB-vaccine protection, and the significant role that antigen dosing plays in vaccine-mediated protection.
Haddad, Diana; Bilcikova, Erika; Witney, Adam A.; Carlton, Jane M.; White, Charles E.; Blair, Peter L.; Chattopadhyay, Rana; Russell, Joshua; Abot, Esteban; Charoenvit, Yupin; Aguiar, Joao C.; Carucci, Daniel J.; Weiss, Walter R.
2004-01-01
We describe a novel approach for identifying target antigens for preerythrocytic malaria vaccines. Our strategy is to rapidly test hundreds of DNA vaccines encoding exons from the Plasmodium yoelii yoelii genomic sequence. In this antigen identification method, we measure reduction in parasite burden in the liver after sporozoite challenge in mice. Orthologs of protective P. y. yoelii genes can then be identified in the genomic databases of Plasmodium falciparum and Plasmodium vivax and investigated as candidate antigens for a human vaccine. A pilot study to develop the antigen identification method approach used 192 P. y. yoelii exons from genes expressed during the sporozoite stage of the life cycle. A total of 182 (94%) exons were successfully cloned into a DNA immunization vector with the Gateway cloning technology. To assess immunization strategies, mice were vaccinated with 19 of the new DNA plasmids in addition to the well-characterized protective plasmid encoding P. y. yoelii circumsporozoite protein. Single plasmid immunization by gene gun identified a novel vaccine target antigen which decreased liver parasite burden by 95% and which has orthologs in P. vivax and P. knowlesi but not P. falciparum. Intramuscular injection of DNA plasmids produced a different pattern of protective responses from those seen with gene gun immunization. Intramuscular immunization with plasmid pools could reduce liver parasite burden in mice despite the fact that none of the plasmids was protective when given individually. We conclude that high-throughput cloning of exons into DNA vaccines and their screening is feasible and can rapidly identify new malaria vaccine candidate antigens. PMID:14977966
Potentiation of anthrax vaccines using protective antigen-expressing viral replicon vectors.
Wang, Hai-Chao; An, Huai-Jie; Yu, Yun-Zhou; Xu, Qing
2015-02-01
DNA vaccines require improvement for human use because they are generally weak stimulators of the immune system in humans. The efficacy of DNA vaccines can be improved using a viral replicon as vector to administer antigen of pathogen. In this study, we comprehensively evaluated the conventional non-viral DNA, viral replicon DNA or viral replicon particles (VRP) vaccines encoding different forms of anthrax protective antigen (PA) for specific immunity and protective potency against anthrax. Our current results clearly suggested that these viral replicon DNA or VRP vaccines derived from Semliki Forest virus (SFV) induced stronger PA-specific immune responses than the conventional non-viral DNA vaccines when encoding the same antigen forms, which resulted in potent protection against challenge with the Bacillus anthracis strain A16R. Additionally, the naked PA-expressing SFV replicon DNA or VRP vaccines without the need for high doses or demanding particular delivery regimens elicited robust immune responses and afforded completely protective potencies, which indicated the potential of the SFV replicon as vector of anthrax vaccines for use in clinical application. Therefore, our results suggest that these PA-expressing SFV replicon DNA or VRP vaccines may be suitable as candidate vaccines against anthrax. Copyright © 2015 Elsevier B.V. All rights reserved.
Sakhatskyy, Pavlo; Wang, Shixia; Zhang, Chuanyou; Chou, Te-Hui; Kishko, Michael; Lu, Shan
2008-01-01
The viral strain responsible for smallpox infection is variola major (VARV). As a result of the successful eradication of smallpox with the vaccinia virus (VACV), the general population is no longer required to receive a smallpox vaccine, and will have no protection against smallpox. This lack of immunity is a concern due to the potential for use of smallpox as a biological weapon. Considerable progress has been made in the development of subunit-based smallpox vaccines resulting from the identification of VACV protective antigens. It also offers the possibility of using antigens from VARV to formulate the next generation subunit-based smallpox vaccines. Here, we show that codon-optimized DNA vaccines expressing three VARV antigens (A30, B7 and F8) and their recombinant protein counterparts elicited high-titer, cross-reactive, VACV neutralizing antibody responses in mice. Vaccinated mice were protected from intraperitoneal and intranasal challenges with VACV. These results suggest the feasibility of a subunit smallpox vaccine based on the VARV antigen sequences to induce immunity against poxvirus infection. PMID:17950773
Sakhatskyy, Pavlo; Wang, Shixia; Zhang, Chuanyou; Chou, Te-Hui; Kishko, Michael; Lu, Shan
2008-02-05
The viral strain responsible for smallpox infection is variola major (VARV). As a result of the successful eradication of smallpox with the vaccinia virus (VACV), the general population is no longer required to receive a smallpox vaccine, and will have no protection against smallpox. This lack of immunity is a concern due to the potential for use of smallpox as a biological weapon. Considerable progress has been made in the development of subunit-based smallpox vaccines resulting from the identification of VACV protective antigens. It also offers the possibility of using antigens from VARV to formulate the next generation subunit-based smallpox vaccines. Here, we show that codon-optimized DNA vaccines expressing three VARV antigens (A30, B7 and F8) and their recombinant protein counterparts elicited high-titer, cross-reactive, VACV neutralizing antibody responses in mice. Vaccinated mice were protected from intraperitoneal and intranasal challenges with VACV. These results suggest the feasibility of a subunit smallpox vaccine based on VARV antigen sequences to induce immunity against poxvirus infection.
High Antigen Dose Is Detrimental to Post-Exposure Vaccine Protection against Tuberculosis
Billeskov, Rolf; Lindenstrøm, Thomas; Woodworth, Joshua; Vilaplana, Cristina; Cardona, Pere-Joan; Cassidy, Joseph P.; Mortensen, Rasmus; Agger, Else Marie; Andersen, Peter
2018-01-01
Mycobacterium tuberculosis (Mtb), the etiologic agent of tuberculosis (TB), causes 1.8M deaths annually. The current vaccine, BCG, has failed to eradicate TB leaving 25% of the world’s population with latent Mtb infection (LTBI), and 5–10% of these people will reactivate and develop active TB. An efficient therapeutic vaccine targeting LTBI could have an enormous impact on global TB incidence, and could be an important aid in fighting multidrug resistance, which is increasing globally. Here we show in a mouse model using the H56 (Ag85B-ESAT-6-Rv2660) TB vaccine candidate that post-exposure, but not preventive, vaccine protection requires low vaccine antigen doses for optimal protection. Loss of protection from high dose post-exposure vaccination was not associated with a loss of overall vaccine response magnitude, but rather with greater differentiation and lower functional avidity of vaccine-specific CD4 T cells. High vaccine antigen dose also led to a decreased ability of vaccine-specific CD4 T cells to home into the Mtb-infected lung parenchyma, a recently discovered important feature of T cell protection in mice. These results underscore the importance of T cell quality rather than magnitude in TB-vaccine protection, and the significant role that antigen dosing plays in vaccine-mediated protection. PMID:29379507
Oscherwitz, Jon; Yu, Fen; Jacobs, Jana L; Cease, Kemp B
2013-03-01
We previously showed that a multiple antigenic peptide (MAP) vaccine displaying amino acids (aa) 304 to 319 from the 2β2-2β3 loop of protective antigen was capable of protecting rabbits from an aerosolized spore challenge with Bacillus anthracis Ames strain. Antibodies to this sequence, referred to as the loop-neutralizing determinant (LND), are highly potent at neutralizing lethal toxin yet are virtually absent in rabbit and human protective antigen (PA) antiserum. While the MAP vaccine was protective against anthrax, it contains a single heterologous helper T cell epitope which may be suboptimal for stimulating an outbred human population. We therefore engineered a recombinant vaccine (Rec-LND) containing two tandemly repeated copies of the LND fused to maltose binding protein, with enhanced immunogenicity resulting from the p38/P4 helper T cell epitope from Schistosoma mansoni. Rec-LND was found to be highly immunogenic in four major histocompatibility complex (MHC)-diverse strains of mice. All (7/7) rabbits immunized with Rec-LND developed high-titer antibody, 6 out of 7 developed neutralizing antibody, and all rabbits were protected from an aerosolized spore challenge of 193 50% lethal doses (LD(50)) of the B. anthracis Ames strain. Survivor serum from Rec-LND-immunized rabbits revealed significantly increased neutralization titers and specific activity compared to prechallenge levels yet lacked PA or lethal factor (LF) antigenemia. Control rabbits immunized with PA, which were also completely protected, appeared sterilely immune, exhibiting significant declines in neutralization titer and specific activity compared to prechallenge levels. We conclude that Rec-LND may represent a prototype anthrax vaccine for use alone or potentially combined with PA-containing vaccines.
Feinen, Brandon; Petrovsky, Nikolai; Verma, Anita
2014-01-01
Subunit vaccines against anthrax based on recombinant protective antigen (PA) potentially offer more consistent and less reactogenic anthrax vaccines but require adjuvants to achieve optimal immunogenicity. This study sought to determine in a murine model of pulmonary anthrax infection whether the polysaccharide adjuvant Advax or the innate immune adjuvant murabutide alone or together could enhance PA immunogenicity by comparison to an alum adjuvant. A single immunization with PA plus Advax adjuvant afforded significantly greater protection against aerosolized Bacillus anthracis Sterne strain 7702 than three immunizations with PA alone. Murabutide had a weaker adjuvant effect than Advax when used alone, but when murabutide was formulated together with Advax, an additive effect on immunogenicity and protection was observed, with complete protection after just two doses. The combined adjuvant formulation stimulated a robust, long-lasting B-cell memory response that protected mice against an aerosol challenge 18 months postimmunization with acceleration of the kinetics of the anamnestic IgG response to B. anthracis as reflected by ∼4-fold-higher anti-PA IgG titers by day 2 postchallenge versus mice that received PA with Alhydrogel. In addition, the combination of Advax plus murabutide induced approximately 3-fold-less inflammation than Alhydrogel as measured by in vivo imaging of cathepsin cleavage resulting from injection of ProSense 750. Thus, the combination of Advax and murabutide provided enhanced protection against inhalational anthrax with reduced localized inflammation, making this a promising next-generation anthrax vaccine adjuvanting strategy. PMID:24554695
Feinen, Brandon; Petrovsky, Nikolai; Verma, Anita; Merkel, Tod J
2014-04-01
Subunit vaccines against anthrax based on recombinant protective antigen (PA) potentially offer more consistent and less reactogenic anthrax vaccines but require adjuvants to achieve optimal immunogenicity. This study sought to determine in a murine model of pulmonary anthrax infection whether the polysaccharide adjuvant Advax or the innate immune adjuvant murabutide alone or together could enhance PA immunogenicity by comparison to an alum adjuvant. A single immunization with PA plus Advax adjuvant afforded significantly greater protection against aerosolized Bacillus anthracis Sterne strain 7702 than three immunizations with PA alone. Murabutide had a weaker adjuvant effect than Advax when used alone, but when murabutide was formulated together with Advax, an additive effect on immunogenicity and protection was observed, with complete protection after just two doses. The combined adjuvant formulation stimulated a robust, long-lasting B-cell memory response that protected mice against an aerosol challenge 18 months postimmunization with acceleration of the kinetics of the anamnestic IgG response to B. anthracis as reflected by ∼4-fold-higher anti-PA IgG titers by day 2 postchallenge versus mice that received PA with Alhydrogel. In addition, the combination of Advax plus murabutide induced approximately 3-fold-less inflammation than Alhydrogel as measured by in vivo imaging of cathepsin cleavage resulting from injection of ProSense 750. Thus, the combination of Advax and murabutide provided enhanced protection against inhalational anthrax with reduced localized inflammation, making this a promising next-generation anthrax vaccine adjuvanting strategy.
Disaccharides Protect Antigens from Drying-Induced Damage in Routinely Processed Tissue Sections
Boi, Giovanna; Scalia, Carla Rossana; Gendusa, Rossella; Ronchi, Susanna; Cattoretti, Giorgio
2015-01-01
Drying of the tissue section, partial or total, during immunostaining negatively affects both the staining of tissue antigens and the ability to remove previously deposited antibody layers, particularly during sequential rounds of de-staining and re-staining for multiple antigens. The cause is a progressive loss of the protein-associated water up to the removal of the non-freezable water, a step which abolishes the immunoavailability of the epitope. In order to describe and prevent these adverse effects, we tested, among other substances, sugars, which are known to protect unicellular organisms from freezing and dehydration, and stabilize drugs and reagents in solid state form in medical devices. Disaccharides (lactose, sucrose) prevented the air drying-induced antigen masking and protected tissue-bound antigens and antibodies from air drying-induced damage. Complete removal of the bound antibody layers by chemical stripping was permitted if lactose was present during air drying. Lactose, sucrose and other disaccharides prevent air drying artifacts, allow homogeneous, consistent staining and the reuse of formalin-fixed, paraffin-embedded tissue sections for repeated immunostaining rounds by guaranteeing constant staining quality in suboptimal hydration conditions. PMID:26487185
Vance, David J.; Rong, Yinghui; Brey, Robert N.; Mantis, Nicholas J.
2014-01-01
In an effort to develop combination vaccines for biodefense, we evaluated a ricin subunit antigen, RiVax, given in conjunction with an anthrax protective antigen, DNI. The combination led to high endpoint titer antibody response, neutralizing antibodies, and protective immunity against ricin and anthrax lethal toxin. This is a natural combination vaccine, since both antigens are recombinant subunit proteins that would be given to the same target population. PMID:25475957
Boyer, Julie L.; Sofer-Podesta, Carolina; Ang, John; Hackett, Neil R.; Chiuchiolo, Maria J.; Senina, Svetlana; Perlin, David
2010-01-01
Abstract The aerosol form of the bacterium Yersinia pestis causes pneumonic plague, a rapidly fatal disease that is a biothreat if deliberately released. At present, no plague vaccines are available for use in the United States, but subunit vaccines based on the Y. pestis V antigen and F1 capsular protein show promise when administered with adjuvants. In the context that adenovirus (Ad) gene transfer vectors have a strong adjuvant potential related to the ability to directly infect dendritic cells, we hypothesized that modification of the Ad5 capsid to display either the Y. pestis V antigen or the F1 capsular antigen on the virion surface would elicit high V antigen- or F1-specific antibody titers, permit boosting with the same Ad serotype, and provide better protection against a lethal Y. pestis challenge than immunization with equivalent amounts of V or F1 recombinant protein plus conventional adjuvant. We constructed AdYFP-pIX/V and AdLacZ-pIX/F1, E1–, E3– serotype 5 Ad gene transfer vectors containing a fusion of the sequence for either the Y. pestis V antigen or the F1 capsular antigen to the carboxy-terminal sequence of pIX, a capsid protein that can accommodate the entire V antigen (37 kDa) or F1 protein (15 kDa) without disturbing Ad function. Immunization with AdYFP-pIX/V followed by a single repeat administration of the same vector at the same dose resulted in significantly better protection of immunized animals compared with immunization with a molar equivalent amount of purified recombinant V antigen plus Alhydrogel adjuvant. Similarly, immunization with AdLacZ-pIX/F1 in a prime–boost regimen resulted in significantly enhanced protection of immunized animals compared with immunization with a molar-equivalent amount of purified recombinant F1 protein plus adjuvant. These observations demonstrate that Ad vaccine vectors containing pathogen-specific antigens fused to the pIX capsid protein have strong adjuvant properties and stimulate more robust
Greenhouse, Bryan; Ho, Benjamin; Hubbard, Alan; Njama-Meya, Denise; Narum, David L; Lanar, David E; Dutta, Sheetij; Rosenthal, Philip J; Dorsey, Grant; John, Chandy C
2011-07-01
Associations between antibody responses to Plasmodium falciparum antigens and protection against symptomatic malaria have been difficult to ascertain, in part because antibodies are potential markers of both exposure to P. falciparum and protection against disease. We measured IgG responses to P. falciparum circumsporozoite protein, liver-stage antigen 1, apical-membrane antigen 1 (AMA-1), and merozoite surface proteins (MSP) 1 and 3, in children in Kampala, Uganda, and measured incidence of malaria before and after antibody measurement. Stronger responses to all 5 antigens were associated with an increased risk of clinical malaria (P < .01) because of confounding with prior exposure to P. falciparum. However, with use of another assessment, risk of clinical malaria once parasitemic, stronger responses to AMA-1, MSP-1, and MSP-3 were associated with protection (odds ratios, 0.34, 0.36, and 0.31, respectively, per 10-fold increase; P < .01). Analyses assessing antibodies in combination suggested that any protective effect of antibodies was overestimated by associations between individual responses and protection. Using the risk of symptomatic malaria once parasitemic as an outcome may improve detection of associations between immune responses and protection from disease. Immunoepidemiology studies designed to detect mechanisms of immune protection should integrate prior exposure into the analysis and evaluate multiple immune responses.
Vance, David J; Rong, Yinghui; Brey, Robert N; Mantis, Nicholas J
2015-01-09
In an effort to develop combination vaccines for biodefense, we evaluated a ricin subunit antigen, RiVax, given in conjunction with an anthrax protective antigen, DNI. The combination led to high endpoint titer antibody response, neutralizing antibodies, and protective immunity against ricin and anthrax lethal toxin. This is a natural combination vaccine, since both antigens are recombinant subunit proteins that would be given to the same target population. Copyright © 2014 Elsevier Ltd. All rights reserved.
Morrison, W I
2007-08-19
The evolution of antigenically distinct pathogen strains that fail to cross-protect is well documented for pathogens controlled primarily by humoral immune responses. Unlike antibodies, which recognise native proteins, protective T cells can potentially recognise epitopes in a variety of proteins that are not necessarily displayed on the pathogen surface. Moreover, individual hosts of different MHC genotypes generally respond to different sets of epitopes. It is therefore less easy to envisage how strain restricted immunity can arise for pathogens controlled by T cell responses, particularly in antigenically complex parasites. Nevertheless, strain restricted immunity is clearly a feature of a number of parasitic infections, where immunity is known to be mediated by T cell responses. One such parasite is Theileria parva which induces potent CD8 T cell responses that play an important role in immunity. CD8 T cells specific for parasitized lymphoblasts exhibit strain specificity, which appears to correlate with the ability of parasite strains to cross-protect. Studies using recently identified T. parva antigens recognised by CD8 T cells have shown that the strain restricted nature of immunity is a consequence of the CD8 T cell response in individual animals being focused on a limited number of dominant polymorphic antigenic determinants. Responses in animals of different MHC genotypes are often directed to different parasite antigens, indicating that, at the host population level, a larger number of parasite proteins can serve as targets for the protective T cell response. Nevertheless, the finding that parasite strains show overlapping antigenic profiles, probably as a consequence of sexual recombination, suggests that induction of responses to an extended but limited set of antigens in individual animals may overcome the strain restricted nature of immunity.
Garmory, Helen S; Griffin, Kate F; Brown, Katherine A; Titball, Richard W
2003-06-20
Bubonic and pneumonic plague are caused by the bacterium Yersinia pestis. The V antigen of Y. pestis is a protective antigen against plague. In this study, an aroA attenuated strain of Salmonella enterica serovar Typhimurium (SL3261) has been used to deliver the Y. pestis V antigen as a candidate oral plague vaccine. SL3261 was transformed with the expression plasmid pTrc-LcrV, containing the lcrV gene encoding V antigen. Immunoblot analysis showed V antigen expression in SL3261 in vitro and intragastric immunisation of mice with the recombinant Salmonella resulted in the induction of V antigen-specific serum antibody responses and afforded protection against Y. pestis challenge. However, the antibody responses induced by the recombinant Salmonella did not correlate with the protection afforded, indicating that immune responses other than antibody may play a role in the protection afforded against plague by this candidate vaccine.
Evseev, V A; Avdeeva, Zh I; Kondrashov, G I
1975-12-01
Experiments were conducted on mice. A study was made of the protective properties of the cytoplasmic fraction of streptococcus, group A, Type 1 and of an antigen isolated from it by sedimentation with ammonium sulfate, in comparison with M-protein partially purified by the method of Lancefield and Perlman. Cytoplasmic antigen was not inferior by immunogenicity in comparison with M-protein. In difference from the latter, it was thermolabile and sensitive to the action of hydrochloric acid. The protective antigen was revealed in the cytoplasm not only of the virulent, but also of avirulent strains of streptococcus devoid of M-protein.
Hubbard, Alan; Njama-Meya, Denise; Narum, David L.; Lanar, David E.; Dutta, Sheetij; Rosenthal, Philip J.; Dorsey, Grant; John, Chandy C.
2011-01-01
(See the article by Bejon et al, on pages 9–18, and Bousema et al, on pages 1–3.) Background. Associations between antibody responses to Plasmodium falciparum antigens and protection against symptomatic malaria have been difficult to ascertain, in part because antibodies are potential markers of both exposure to P. falciparum and protection against disease. Methods. We measured IgG responses to P. falciparum circumsporozoite protein, liver-stage antigen 1, apical-membrane antigen 1 (AMA-1), and merozoite surface proteins (MSP) 1 and 3, in children in Kampala, Uganda, and measured incidence of malaria before and after antibody measurement. Results. Stronger responses to all 5 antigens were associated with an increased risk of clinical malaria (P < .01) because of confounding with prior exposure to P. falciparum. However, with use of another assessment, risk of clinical malaria once parasitemic, stronger responses to AMA-1, MSP-1, and MSP-3 were associated with protection (odds ratios, 0.34, 0.36, and 0.31, respectively, per 10-fold increase; P < .01). Analyses assessing antibodies in combination suggested that any protective effect of antibodies was overestimated by associations between individual responses and protection. Conclusions. Using the risk of symptomatic malaria once parasitemic as an outcome may improve detection of associations between immune responses and protection from disease. Immunoepidemiology studies designed to detect mechanisms of immune protection should integrate prior exposure into the analysis and evaluate multiple immune responses. PMID:21628654
Blake, Damer P; Hesketh, Patricia; Archer, Andrew; Carroll, Fionnadh; Smith, Adrian L; Shirley, Martin W
2004-11-01
The genomes of protozoan parasites encode thousands of gene products and identification of the subset that stimulates a protective immune response is a daunting task. Most screens for vaccine candidates identify molecules by capacity to induce immune responses rather than protection. This paper describes the core findings of a strategy developed with the coccidial parasite Eimeria maxima to rationally identify loci within its genome that encode immunoprotective antigens. Our strategy uses a novel combination of parasite genetics, DNA fingerprinting, drug-resistance and strain-specific immunity and centres on two strains of E. maxima that each induce a lethal strain-specific protective immune response in the host and show a differential response to anti-Eimeria chemotherapy. Through classical mating studies with these strains we have demonstrated that loci encoding molecules stimulating strain-specific protective immunity or resistance to the anti-coccidial drug robenidine segregate independently. Furthermore, passage of populations of recombinant parasites in the face of killing in the immune host was accompanied by the elimination of some polymorphic DNA markers defining the parent strain used to immunise the host. Consideration of the numbers of parasites recombinant for the two traits implicates very few antigen-encoding loci. Our data provide a potential strategy to identify putative antigen-encoding loci in other parasites.
Rabies virus glycoprotein as a carrier for anthrax protective antigen
DOE Office of Scientific and Technical Information (OSTI.GOV)
Smith, Mary Ellen; Koser, Martin; Xiao Sa
2006-09-30
Live viral vectors expressing foreign antigens have shown great promise as vaccines against viral diseases. However, safety concerns remain a major problem regarding the use of even highly attenuated viral vectors. Using the rabies virus (RV) envelope protein as a carrier molecule, we show here that inactivated RV particles can be utilized to present Bacillus anthracis protective antigen (PA) domain-4 in the viral membrane. In addition to the RV glycoprotein (G) transmembrane and cytoplasmic domains, a portion of the RV G ectodomain was required to express the chimeric RV G anthrax PA on the cell surface. The novel antigen wasmore » also efficiently incorporated into RV virions. Mice immunized with the inactivated recombinant RV virions exhibited seroconversion against both RV G and anthrax PA, and a second inoculation greatly increased these responses. These data demonstrate that a viral envelope protein can carry a bacterial protein and that a viral carrier can display whole polypeptides compared to the limited epitope presentation of previous viral systems.« less
Chichester, Jessica A; Manceva, Slobodanka D; Rhee, Amy; Coffin, Megan V; Musiychuk, Konstantin; Mett, Vadim; Shamloul, Moneim; Norikane, Joey; Streatfield, Stephen J; Yusibov, Vidadi
2013-03-01
The potential use of Bacillus anthracis as a bioterrorism weapon threatens the security of populations globally, requiring the immediate availability of safe, efficient and easily delivered anthrax vaccine for mass vaccination. Extensive research efforts have been directed toward the development of recombinant subunit vaccines based on protective antigen (PA), the principal virulence factor of B. anthracis. Among the emerging technologies for the production of these vaccine antigens is our launch vector-based plant transient expression system. Using this system, we have successfully engineered, expressed, purified and characterized full-length PA (pp-PA83) in Nicotiana benthamiana plants using agroinfiltration. This plant-produced antigen elicited high toxin neutralizing antibody titers in mice and rabbits after two vaccine administrations with Alhydrogel. In addition, immunization with this vaccine candidate protected 100% of rabbits from a lethal aerosolized B. anthracis challenge. The vaccine effects were dose-dependent and required the presence of Alhydrogel adjuvant. In addition, the vaccine antigen formulated with Alhydrogel was stable and retained immunogenicity after two-week storage at 4°C, the conditions intended for clinical use. These results support the testing of this vaccine candidate in human volunteers and the utility of our plant expression system for the production of a recombinant anthrax vaccine.
Wang, Ping-ping; Pian, Ya-ya; Yuan, Yuan; Zheng, Yu-ling; Jiang, Yong-qiang; Xiong, Zheng-ying
2012-02-01
To amplify the mrp gene of Streptococcus suis type 2 05ZYH33, express it in E.coli BL21 in order to acquire high purity recombinant protein MRP, then evaluate the protective antigen of recombinant protein MRP. Using PCR technology to obtain the product of mrp gene of 05ZYH33, and then cloned it into the expression vector pET28a(+). The recombinant protein was purified by affinity chromatography, later immunized New Zealand rabbit to gain anti-serum, then test the anti-serum titer by ELISA. The opsonophagocytic killing test demonstrated the abilities of protective antigen of MRP. The truncated of MRP recombinant protein in E.coli BL21 expressed by inclusion bodies, and purified it in high purity. After immunoprotection, the survival condition of CD-1 was significantly elevated. The survival rate of wild-type strain 05ZYH33 in blood was apparently decreased after anti-serum opsonophagocyticed, but the mutant delta; MRP showed no differences. MRP represent an important protective antigen activity.
Burmakina, G; Malogolovkin, A; Tulman, E R; Zsak, L; Delhon, G; Diel, D G; Shobogorov, N M; Morgunov, Yu P; Morgunov, S Yu; Kutish, G F; Kolbasov, D; Rock, D L
2016-07-01
African swine fever (ASF) is an emerging disease threat for the swine industry worldwide. No ASF vaccine is available and progress is hindered by lack of knowledge concerning the extent of ASFV strain diversity and the viral antigens conferring type-specific protective immunity in pigs. Available data from vaccination/challenge experiments in pigs indicate that ASF protective immunity may be haemadsorption inhibition (HAI) serotype-specific. Recently, we have shown that two ASFV proteins, CD2v (EP402R) and C-type lectin (EP153R), are necessary and sufficient for mediating HAI serological specificity (Malogolovkin et al., 2015).. Here, using ASFV inter-serotypic chimeric viruses and vaccination/challenge experiments in pigs, we demonstrate that serotype-specific CD2v and/or C-type lectin proteins are important for protection against homologous ASFV infection. Thus, these viral proteins represent significant protective antigens for ASFV that should be targeted in future vaccine design and development. Additionally, these data support the concept of HAI serotype-specific protective immunity.
Dinga, J N; Gamua, S D; Titanji, V P K
2017-08-01
It has been shown that covalently linking two antigens could enhance the immunogenicity of the chimeric construct. To prioritize such a chimera for malaria vaccine development, it is necessary to demonstrate that naturally acquired antibodies against the chimera are associated with protection from malaria. Here, we probe the ability of a chimeric construct of UB05 and UB09 antigens (UB05-09) to better differentiate between acquired immune protection and susceptibility to malaria. In a cross-sectional study, recombinant UB05-09 chimera and the constituent antigens were used to probe for specific antibodies in the plasma from children and adults resident in a malaria-endemic zone, using the enzyme-linked immunosorbent assay (ELISA). Anti-UB05-09 antibody levels doubled that of its constituent antigens, UB09 and UB05, and this correlated with protection against malaria. The presence of enhanced UB05-09-specific antibody correlated with the absence of fever and parasitaemia, which are the main symptoms of malaria infection. The chimera is more effective in detecting and distinguishing acquired protective immunity against malaria than any of its constituents taken alone. Online B-cell epitope prediction tools confirmed the presence of B-cell epitopes in the study antigens. UB05-09 chimera is a marker of protective immunity against malaria that needs to be studied further. © 2017 John Wiley & Sons Ltd.
Yao, Yushi; Li, Hui; Ding, Jie; Xia, Yixin; Wang, Lei
2017-11-01
Pregnant women and animals have increased susceptibility to a variety of intracellular pathogens including Listeria monocytogenes (LM), which has been associated with significantly increased level of sex hormones such as progesterone. CD8 T memory(Tm) cell-mediated antigen-non-specific IFN-γ responses are critically required in the host defense against LM. However, whether and how increased progesterone during pregnancy modulates CD8 Tm cell-mediated antigen-non-specific IFN-γ production and immune protection against LM remain poorly understood. Here we show in pregnant women that increased serum progesterone levels are associated with DNA hypermethylation of IFN-γ gene promoter region and decreased IFN-γ production in CD8 Tm cells upon antigen-non-specific stimulation ex vivo. Moreover, IFN-γ gene hypermethylation and significantly reduced IFN-γ production post LM infection in antigen-non-specific CD8 Tm cells are also observed in pregnant mice or progesterone treated non-pregnant female mice, which is a reversible phenotype following demethylation treatment. Importantly, antigen-non-specific CD8 Tm cells from progesterone treated mice have impaired anti-LM protection when adoptive transferred in either pregnant wild type mice or IFN-γ-deficient mice, and demethylation treatment rescues the adoptive protection of such CD8 Tm cells. These data demonstrate that increased progesterone impairs immune protective functions of antigen-non-specific CD8 Tm cells via inducing IFN-γ gene hypermethylation. Our findings thus provide insights into a new mechanism through which increased female sex hormone regulate CD8 Tm cell functions during pregnancy.
Yao, Yushi; Li, Hui; Ding, Jie; Xia, Yixin
2017-01-01
Pregnant women and animals have increased susceptibility to a variety of intracellular pathogens including Listeria monocytogenes (LM), which has been associated with significantly increased level of sex hormones such as progesterone. CD8 T memory(Tm) cell-mediated antigen-non-specific IFN-γ responses are critically required in the host defense against LM. However, whether and how increased progesterone during pregnancy modulates CD8 Tm cell-mediated antigen-non-specific IFN-γ production and immune protection against LM remain poorly understood. Here we show in pregnant women that increased serum progesterone levels are associated with DNA hypermethylation of IFN-γ gene promoter region and decreased IFN-γ production in CD8 Tm cells upon antigen-non-specific stimulation ex vivo. Moreover, IFN-γ gene hypermethylation and significantly reduced IFN-γ production post LM infection in antigen-non-specific CD8 Tm cells are also observed in pregnant mice or progesterone treated non-pregnant female mice, which is a reversible phenotype following demethylation treatment. Importantly, antigen-non-specific CD8 Tm cells from progesterone treated mice have impaired anti-LM protection when adoptive transferred in either pregnant wild type mice or IFN-γ-deficient mice, and demethylation treatment rescues the adoptive protection of such CD8 Tm cells. These data demonstrate that increased progesterone impairs immune protective functions of antigen-non-specific CD8 Tm cells via inducing IFN-γ gene hypermethylation. Our findings thus provide insights into a new mechanism through which increased female sex hormone regulate CD8 Tm cell functions during pregnancy. PMID:29155896
Rocke, Tonie E.; Kingstad-Bakke, Brock; Berlier, Willy; Osorio, Jorge E.
2014-01-01
In previous studies, we demonstrated in mice and prairie dogs that simultaneous administration of two recombinant raccoon poxviruses (rRCN) expressing Yersinia pestis antigens (F1 and V307—a truncated version of the V protein) provided superior protection against plague challenge compared to individual single antigen constructs. To reduce costs of vaccine production and facilitate implementation of a sylvatic plague vaccine (SPV) control program for prairie dogs, a dual antigen construct is more desirable. Here we report the construction and characterization of a novel RCN-vectored vaccine that simultaneously expresses both F1 and V307 antigens. This dual antigen vaccine provided similar levels of protection against plague in both mice and prairie dogs as compared to simultaneous administration of the two single antigen constructs and was also shown to protect mice against an F1 negative strain of Y. pestis. The equivalent safety, immunogenicity and efficacy profile of the dual RCN-F1/V307 construct warrants further evaluation in field efficacy studies in sylvatic plague endemic areas. PMID:26344891
Rocke, Tonie E.; Kingstad-Bakke, B; Berlier, W; Osorio, J.E.
2014-01-01
In previous studies, we demonstrated in mice and prairie dogs that simultaneous administration of two recombinant raccoon poxviruses (rRCN) expressing Yersinia pestis antigens (F1 and V307-a truncated version of the V protein) provided superior protection against plague challenge compared to individual single antigen constructs. To reduce costs of vaccine production and facilitate implementation of a sylvatic plague vaccine (SPV) control program for prairie dogs, a dual antigen construct is more desirable. Here we report the construction and characterization of a novel RCN-vectored vaccine that simultaneously expresses both F1 and V307 antigens. This dual antigen vaccine provided similar levels of protection against plague in both mice and prairie dogs as compared to simultaneous administration of the two single antigen constructs and was also shown to protect mice against an F1 negative strain of Y. pestis.. The equivalent safety, immunogenicity and efficacy profile of the dual RCN-F1/V307 construct warrants further evaluation in field efficacy studies in sylvatic plague endemic areas.
Merkel, Tod J; Perera, Pin-Yu; Lee, Gloria M; Verma, Anita; Hiroi, Toyoko; Yokote, Hiroyuki; Waldmann, Thomas A; Perera, Liyanage P
2013-01-01
An intense effort has been launched to develop improved anthrax vaccines that confer rapid, long lasting protection preferably with an extended stability profile amenable for stockpiling. Protective antigen (PA)-based vaccines are most favored as immune responses directed against PA are singularly protective, although the actual protective mechanism remains to be unraveled. Herein we show that contrary to the prevailing view, an efficacious PA-based vaccine confers protection against inhalation anthrax by preventing the establishment of a toxin-releasing systemic infection. Equally importantly, antibodies measured by the in vitro lethal toxin neutralization activity assay (TNA) that is considered as a reliable correlate of protection, especially for PA protein-based vaccines adjuvanted with aluminum salts appear to be not absolutely essential for this protective immune response. PMID:23787486
Merkel, Tod J; Perera, Pin-Yu; Lee, Gloria M; Verma, Anita; Hiroi, Toyoko; Yokote, Hiroyuki; Waldmann, Thomas A; Perera, Liyanage P
2013-09-01
An intense effort has been launched to develop improved anthrax vaccines that confer rapid, long lasting protection preferably with an extended stability profile amenable for stockpiling. Protective antigen (PA)-based vaccines are most favored as immune responses directed against PA are singularly protective, although the actual protective mechanism remains to be unraveled. Herein we show that contrary to the prevailing view, an efficacious PA-based vaccine confers protection against inhalation anthrax by preventing the establishment of a toxin-releasing systemic infection. Equally importantly, antibodies measured by the in vitro lethal toxin neutralization activity assay (TNA) that is considered as a reliable correlate of protection, especially for PA protein-based vaccines adjuvanted with aluminum salts appear to be not absolutely essential for this protective immune response.
Reed, Matthew D; Wilder, Julie A; Mega, William M; Hutt, Julie A; Kuehl, Philip J; Valderas, Michelle W; Chew, Lawrence L; Liang, Bertrand C; Squires, Charles H
2015-01-01
Protective antigen (PA), one of the components of the anthrax toxin, is the major component of human anthrax vaccine (Biothrax). Human anthrax vaccines approved in the United States and Europe consist of an alum-adsorbed or precipitated (respectively) supernatant material derived from cultures of toxigenic, non-encapsulated strains of Bacillus anthracis. Approved vaccination schedules in humans with either of these vaccines requires several booster shots and occasionally causes adverse injection site reactions. Mutant derivatives of the protective antigen that will not form the anthrax toxins have been described. We have cloned and expressed both mutant (PA SNKE167-ΔFF-315-E308D) and native PA molecules recombinantly and purified them. In this study, both the mutant and native PA molecules, formulated with alum (Alhydrogel), elicited high titers of anthrax toxin neutralizing anti-PA antibodies in New Zealand White rabbits. Both mutant and native PA vaccine preparations protected rabbits from lethal, aerosolized, B. anthracis spore challenge subsequent to two immunizations at doses of less than 1 μg.
Tai, Dar-Fu; Jhang, Ming-Hong; Chen, Guan-Yu; Wang, Sue-Chen; Lu, Kuo-Hao; Lee, Yu-Der; Liu, Hsin-Tzu
2010-03-15
A molecularly imprinted film was fabricated, in the presence of epitope-peptides, onto a quartz crystal microbalance (QCM) chip. These five peptides are known linear or conformational epitopes of the anthrax protective antigen PA(83). Imprinting resulted in an epitope-cavity with affinity for the corresponding template. With the use of a basic monomer, the binding-effect was further enhanced increasing the affinity to nanomolar levels. The affinities of the peptide to their corresponding molecularly induced polymers (MIPs) were more closely related to the molecular weight of the analyte than to the number of residues. All epitope-cavities differentiated their epitope region on the protective antigen PA(83) as well as the corresponding furin cleavage fragments PA(63) and PA(20). The QCM chip differential response to the protective antigen fragment was observed in the picomolar range, thus demonstrating a method to manipulate protein on the surface with defined orientation.
Antigen-specific T-cell lines transfer protective immunity against Trichinella spiralis in vivo.
Riedlinger, J; Grencis, R K; Wakelin, D
1986-01-01
T-cell lines specific for infective muscle larvae antigens of the intestinal nematode Trichinella spiralis have been generated in vitro. These antigen-specific T-cell lines express the L3T4+ Ly2- phenotype and secrete the lymphokines IL-2, IL-3 and gamma-IFN. They are stable in culture for up to 15 weeks and are protective when adoptively transferred into naive recipients. As few as 2 x 10(5) T. spiralis-specific tract. In addition, intestinal mastocytosis and peripheral blood eosinophilia were accelerated after adoptive transfer of T. spiralis-specific T-cell lines. PMID:2423438
Cross-specificity of protective human antibodies against Klebsiella pneumoniae LPS O-antigen.
Rollenske, Tim; Szijarto, Valeria; Lukasiewicz, Jolanta; Guachalla, Luis M; Stojkovic, Katarina; Hartl, Katharina; Stulik, Lukas; Kocher, Simone; Lasitschka, Felix; Al-Saeedi, Mohammed; Schröder-Braunstein, Jutta; von Frankenberg, Moritz; Gaebelein, Gereon; Hoffmann, Peter; Klein, Sabrina; Heeg, Klaus; Nagy, Eszter; Nagy, Gabor; Wardemann, Hedda
2018-06-01
Humoral immune responses to microbial polysaccharide surface antigens can prevent bacterial infection but are typically strain specific and fail to mediate broad protection against different serotypes. Here we describe a panel of affinity-matured monoclonal human antibodies from peripheral blood immunoglobulin M-positive (IgM + ) and IgA + memory B cells and clonally related intestinal plasmablasts, directed against the lipopolysaccharide (LPS) O-antigen of Klebsiella pneumoniae, an opportunistic pathogen and major cause of antibiotic-resistant nosocomial infections. The antibodies showed distinct patterns of in vivo cross-specificity and protection against different clinically relevant K. pneumoniae serotypes. However, cross-specificity was not limited to K. pneumoniae, as K. pneumoniae-specific antibodies recognized diverse intestinal microbes and neutralized not only K. pneumoniae LPS but also non-K. pneumoniae LPS. Our data suggest that the recognition of minimal glycan epitopes abundantly expressed on microbial surfaces might serve as an efficient humoral immunological mechanism to control invading pathogens and the large diversity of the human microbiota with a limited set of cross-specific antibodies.
Ho, L-P; Chang, C-J; Liu, H-C; Yang, H-L; Lin, J H-Y
2014-01-01
Cobia, Rachycentron canadum L., is a very important aquatic fish that faces the risk of infection with the bacterial pathogen Photobacterium damselae ssp. piscicida, and there are few protective approaches available that use multiple antigens. In the present study, potent bivalent antigens from P. damselae ssp. piscicida showed more efficient protection than did single antigens used in isolation. In preparations of three antigens that included recombinant heat shock protein 60 (rHSP60), recombinant α-enolase (rENOLASE) and recombinant glyceraldehyde-3-phosphate dehydrogenase (rGAPDH), we analysed the doses that elicited the best immune responses and found that this occurred at a total of 30 μg of antigen per fish. Subsequently, vaccination of fish with rHSP60, rENOLASE and rGAPDH achieved 46.9, 52 and 25% relative per cent survival (RPS), respectively. In addition, bivalent subunit vaccines--combination I (rHSP60 + rENOLASE), combination II (rENOLASE + rGAPDH) and combination III (rHSP60 + rGAPDH)--were administered and the RPS in these groups (65.6, 64.0 and 48.4%, respectively), was higher than that achieved with single-antigen administration. Finally, in combination IV, the trivalent vaccine rHSP60 + rENOLASE + rGAPDH, the RPS was 1.6%. Taken together, our results suggest that combinations of two antigens may achieve a better efficiency than monovalent or trivalent antigens, and this may provide new insights into pathogen prevention strategies. © 2013 John Wiley & Sons Ltd.
Moustafa, Dina A.; Scarff, Jennifer M.; Garcia, Preston P.; Cassidy, Sara K. B.; DiGiandomenico, Antonio; Waag, David M.; Inzana, Thomas J.; Goldberg, Joanna B.
2015-01-01
Burkholderia pseudomallei and Burkholderia mallei are the etiologic agents of melioidosis and glanders, respectively. These bacteria are highly infectious via the respiratory route and can cause severe and often fatal diseases in humans and animals. Both species are considered potential agents of biological warfare; they are classified as category B priority pathogens. Currently there are no human or veterinary vaccines available against these pathogens. Consequently efforts are directed towards the development of an efficacious and safe vaccine. Lipopolysaccharide (LPS) is an immunodominant antigen and potent stimulator of host immune responses. B. mallei express LPS that is structurally similar to that expressed by B. pseudomallei, suggesting the possibility of constructing a single protective vaccine against melioidosis and glanders. Previous studies of others have shown that antibodies against B. mallei or B. pseudomallei LPS partially protect mice against subsequent lethal virulent Burkholderia challenge. In this study, we evaluated the protective efficacy of recombinant Salmonella enterica serovar Typhimurium SL3261 expressing B. mallei O antigen against lethal intranasal infection with Burkholderia thailandensis, a surrogate for biothreat Burkholderia spp. in a murine model that mimics melioidosis and glanders. All vaccine-immunized mice developed a specific antibody response to B. mallei and B. pseudomallei O antigen and to B. thailandensis and were significantly protected against challenge with a lethal dose of B. thailandensis. These results suggest that live-attenuated SL3261 expressing B. mallei O antigen is a promising platform for developing a safe and effective vaccine. PMID:26148026
Moustafa, Dina A; Scarff, Jennifer M; Garcia, Preston P; Cassidy, Sara K B; DiGiandomenico, Antonio; Waag, David M; Inzana, Thomas J; Goldberg, Joanna B
2015-01-01
Burkholderia pseudomallei and Burkholderia mallei are the etiologic agents of melioidosis and glanders, respectively. These bacteria are highly infectious via the respiratory route and can cause severe and often fatal diseases in humans and animals. Both species are considered potential agents of biological warfare; they are classified as category B priority pathogens. Currently there are no human or veterinary vaccines available against these pathogens. Consequently efforts are directed towards the development of an efficacious and safe vaccine. Lipopolysaccharide (LPS) is an immunodominant antigen and potent stimulator of host immune responses. B. mallei express LPS that is structurally similar to that expressed by B. pseudomallei, suggesting the possibility of constructing a single protective vaccine against melioidosis and glanders. Previous studies of others have shown that antibodies against B. mallei or B. pseudomallei LPS partially protect mice against subsequent lethal virulent Burkholderia challenge. In this study, we evaluated the protective efficacy of recombinant Salmonella enterica serovar Typhimurium SL3261 expressing B. mallei O antigen against lethal intranasal infection with Burkholderia thailandensis, a surrogate for biothreat Burkholderia spp. in a murine model that mimics melioidosis and glanders. All vaccine-immunized mice developed a specific antibody response to B. mallei and B. pseudomallei O antigen and to B. thailandensis and were significantly protected against challenge with a lethal dose of B. thailandensis. These results suggest that live-attenuated SL3261 expressing B. mallei O antigen is a promising platform for developing a safe and effective vaccine.
Mitchell, G B; Armour, J
1980-11-01
Calves were vaccinated intramuscularly against the tapeworm Taenia saginata using excretory/secretory (ES) antigens from short and long term periods of in vitro cultivation of the larval stage of the parasite, four weeks before challenge with 5000 T saginata onchospheres. Neither immunisation regime employed afforded significant protection against challenge. It was considered that this may have been due to a reduction in concentration of, or detrimental effects to, potential immunogens during vaccine production. Elucidation of the nature of the protective ES antigens necessary for standardization of the technique has yet to be achieved in helminths.
Chi, Xiangyang; Li, Jianmin; Liu, Weicen; Wang, Xiaolin; Yin, Kexin; Liu, Ju; Zai, Xiaodong; Li, Liangliang; Song, Xiaohong; Zhang, Jun; Zhang, Xiaopeng; Yin, Ying; Fu, Ling; Xu, Junjie; Yu, Changming; Chen, Wei
2015-05-01
The anthrax protective antigen (PA) is the central component of the three-part anthrax toxin, and it is the primary immunogenic component in the approved AVA anthrax vaccine and the "next-generation" recombinant PA (rPA) anthrax vaccines. Animal models have indicated that PA-specific antibodies (AB) are sufficient to protect against infection with Bacillus anthracis. In this study, we investigated the PA domain specificity, affinity, mechanisms of neutralization, and synergistic effects of PA-specific antibodies from a single donor following vaccination with the rPA vaccine. Antibody-secreting cells were isolated 7 days after the donor received a boost vaccination, and 34 fully human monoclonal antibodies (hMAb) were identified. Clones 8H6, 4A3, and 22F1 were able to neutralize lethal toxin (LeTx) both in vitro and in vivo. Clone 8H6 neutralized LeTx by preventing furin cleavage of PA in a dose-dependent manner. Clone 4A3 enhanced degradation of nicked PA, thereby interfering with PA oligomerization. The mechanism of 22F1 is still unclear. A fourth clone, 2A6, that was protective only in vitro was found to be neutralizing in vivo in combination with a toxin-enhancing antibody, 8A7, which binds to domain 3 of PA and PA oligomers. These results provide novel insights into the antibody response elicited by the rPA vaccine and may be useful for PA-based vaccine and immunotherapeutic cocktail design. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Fan, Xionglin; Yu, Qi; Jing, Yukai; Wang, Weihua; Li, Li; Zhou, Zijie
2016-01-01
There is an urgent need for a vaccine against tuberculosis (TB) that is more effective than the current sole licensed option. However, target antigens of Mycobacterium tuberculosis with the vaccine potential remain elusive. Five immunodominant antigens with characteristic expressions at the stages of primary infection (Ag85A), the regulation of nutrition and metabolism when transferring from rapid growth to latency (PhoY2 and Rv3407), latency (Rv2626c), and reactivation (RpfB) were selected to construct the fusion polyprotein WH121, which has better immunogenicity and protection than each multistage antigen. DMT adjuvanted WH121 vaccinated C57BL/6 mice could confer persistent and significant protection against the respiratory challenge with 80 CFU of virulent M. tuberculosis H37Rv at 9 and 18 weeks after immunization, as the BCG vaccine did. Moreover, WH121/DMT could boost the BCG primed mice against post-exposure infection, and more significantly inhibit the growth of M. tuberculosis in the spleen than BCG repeat vaccination. The protection elicited by WH121/DMT is attributed to the WH121-specific Th1-type biased immune responses, characterized by increased antigen-specific IgG2a/IgG1 ratio and high levels of IFN-γ secreted by the splenocytes of vaccinated mice. In particular, high levels of IFN-γ+ TEM cells in the spleen are an effective biomarker for the vaccine-induced early protection, and the persistent protection mainly depends on the increasing IL-2+IFN-γ+CD4+ and CD8+ T cells, especially IL-2+ TCM cells. These findings demonstrate that multistage-specific antigens might be promising targets for the next generation TB vaccine, and a combination of these antigens such as WH121/DMT is required for further preclinical evaluation. PMID:27566581
Abraham, David; Hess, Jessica A; Mejia, Rojelio; Nolan, Thomas J; Lok, James B; Lustigman, Sara; Nutman, Thomas B
2011-10-19
Human intestinal infections with the nematode Strongyloides stercoralis remain a significant problem worldwide and a vaccine would be a useful addition to the tools available to prevent and control this infection. The goal of this study was to test single antigens for their efficacy in a vaccine against S. stercoralis larvae in mice. Alum was used as the adjuvant in these studies and antigens selected for analysis were either recognized by protective human IgG (Ss-TMY-1, Ss-EAT-6, and Ss-LEC-5) or were known to be highly immunogenic in humans (Ss-NIE-1 and Ss-IR). Only mice immunized with the Ss-IR antigen demonstrated a significant decrease of approximately 80% in the survival of larval parasites in the challenge infection. Antibodies, recovered from mice with protective immunity to S. stercoralis after immunization with Ss-IR, were used to locate the antigen in the larvae. Confocal microscopy revealed that IgG from mice immunized with Ss-IR bound to the surface of the parasites and observations by electron microscopy indicated that IgG bound to granules in the glandular esophagus. Serum collected from mice immunized with Ss-IR passively transferred immunity to naïve mice. These studies demonstrate that Ss-IR, in combination with alum, induces high levels of protective immunity through an antibody dependent mechanism and may therefore be suitable for further development as a vaccine against human strongyloidiasis. Copyright © 2011 Elsevier Ltd. All rights reserved.
Deans, J. A.; Cohen, S.
1979-01-01
The identification of malarial antigens that induce protective immunity could provide a rational basis for developing an effective antimalarial vaccine as well as specific serodiagnostic tests indicative of clinical immune status. Since protective immunity is probably induced by stage-dependent rather than stage-independent antigens, the antigenic composition of different stages of Plasmodium knowlesi has been compared, and a limited chemical characterization undertaken. This information should provide some insight into the types of preparative procedure appropriate for the purification of functionally important malarial antigens. PMID:120777
Classification of reflection-symmetry-protected topological semimetals and nodal superconductors
NASA Astrophysics Data System (ADS)
Chiu, Ching-Kai; Schnyder, Andreas P.
2014-11-01
While the topological classification of insulators, semimetals, and superconductors in terms of nonspatial symmetries is well understood, less is known about topological states protected by crystalline symmetries, such as mirror reflections and rotations. In this work, we systematically classify topological semimetals and nodal superconductors that are protected, not only by nonspatial (i.e., global) symmetries, but also by a crystal reflection symmetry. We find that the classification crucially depends on (i) the codimension of the Fermi surface (nodal line or point) of the semimetal (superconductor), (ii) whether the mirror symmetry commutes or anticommutes with the nonspatial symmetries, and (iii) how the Fermi surfaces (nodal lines or points) transform under the mirror reflection and nonspatial symmetries. The classification is derived by examining all possible symmetry-allowed mass terms that can be added to the Bloch or Bogoliubov-de Gennes Hamiltonian in a given symmetry class and by explicitly deriving topological invariants. We discuss several examples of reflection-symmetry-protected topological semimetals and nodal superconductors, including topological crystalline semimetals with mirror Z2 numbers and topological crystalline nodal superconductors with mirror winding numbers.
Seo, Ki-Weon; Kim, Dong-Heon; Kim, Ah Hyun; Yoo, Han-Sang; Lee, Kyung-Yeol; Jang, Yong-Suk
2011-01-01
Actinobacillus pleuropneumoniae is the causative agent of porcine pleuropneumonia. Among the virulence factors of the pathogen, ApxIIA, a bacterial exotoxin, is expressed by many serotypes and presents a plausible target for vaccine development. We characterized the region within ApxIIA that induces a protective immune response against bacterial infection using mouse challenge model. Recombinant proteins spanning the length of ApxIIA were produced and antiserum to the full-length ApxIIA was induced in mice. This antiserum recognized fragments #2, #3 and #5 with high binding specificity, but showed poor recognition for fragments #1 and #4. Of the antisera induced in mice by injection of each fragments, only the antiserum to fragment #4 failed to efficiently recognize the full-length antigen, although the individual antisera recognized their cognate antigens with almost equal efficiency. The protective potency of the immunogenic proteins against a challenge injection of bacteria in vivo correlated well with the antibody titer. Fragment #5 induced the highest level of protective activity, comparable to that by the full-length protein. These results support the use of fragment #5 to produce a vaccine against A. pleuropneumoniae challenge, since the small antigen peptide is easier to handle than is the full-length protein and can be expressed efficiently in heterologous expression systems.
Devera, T Scott; Prusator, Dawn K; Joshi, Sunil K; Ballard, Jimmy D; Lang, Mark L
2015-06-25
Protective immunity against anthrax is inferred from measurement of vaccine antigen-specific neutralizing antibody titers in serum samples. In animal models, in vivo challenges with toxin and/or spores can also be performed. However, neither of these approaches considers toxin-induced damage to specific organ systems. It is therefore important to determine to what extent anthrax vaccines and existing or candidate adjuvants can provide organ-specific protection against intoxication. We therefore compared the ability of Alum, CpG DNA and the CD1d ligand α-galactosylceramide (αGC) to enhance protective antigen-specific antibody titers, to protect mice against challenge with lethal toxin, and to block cardiotoxicity and hepatotoxicity. By measurement of serum cardiac Troponin I (cTnI), and hepatic alanine aminotransferase (ALT), and aspartate aminotransferase (AST), it was apparent that neither vaccine modality prevented hepatic intoxication, despite high Ab titers and ultimate survival of the subject. In contrast, cardiotoxicity was greatly diminished by prior immunization. This shows that a vaccine that confers survival following toxin exposure may still have an associated morbidity. We propose that organ-specific intoxication should be monitored routinely during research into new vaccine modalities.
Hill, Jim; Copse, Catherine; Leary, Sophie; Stagg, Anthony J; Williamson, E Diane; Titball, Richard W
2003-04-01
Monoclonal antibodies specific for Yersinia pestis V antigen and F1 antigen, administered singly or in combination, protected mice in models of bubonic and pneumonic plague. Antibodies showed synergy when administered prophylactically and as a therapy 48 h postinfection. Monoclonal antibodies therefore have potential as a treatment for plague.
Santi, Luca; Giritch, Anatoli; Roy, Chad J.; Marillonnet, Sylvestre; Klimyuk, Victor; Gleba, Yuri; Webb, Robert; Arntzen, Charles J.; Mason, Hugh S.
2006-01-01
Plague is still an endemic disease in different regions of the world. Increasing reports of incidence, the discovery of antibiotic resistance strains, and concern about a potential use of the causative bacteria Yersinia pestis as an agent of biological warfare have highlighted the need for a safe, efficacious, and rapidly producible vaccine. The use of F1 and V antigens and the derived protein fusion F1-V has shown great potential as a protective vaccine in animal studies. Plants have been extensively studied for the production of pharmaceutical proteins as an inexpensive and scalable alternative to common expression systems. In the current study the recombinant plague antigens F1, V, and fusion protein F1-V were produced by transient expression in Nicotiana benthamiana by using a deconstructed tobacco mosaic virus-based system that allowed very rapid and extremely high levels of expression. All of the plant-derived purified antigens, administered s.c. to guinea pigs, generated systemic immune responses and provided protection against an aerosol challenge of virulent Y. pestis. PMID:16410352
Discovering naturally processed antigenic determinants that confer protective T cell immunity
Gilchuk, Pavlo; Spencer, Charles T.; Conant, Stephanie B.; Hill, Timothy; Gray, Jennifer J.; Niu, Xinnan; Zheng, Mu; Erickson, John J.; Boyd, Kelli L.; McAfee, K. Jill; Oseroff, Carla; Hadrup, Sine R.; Bennink, Jack R.; Hildebrand, William; Edwards, Kathryn M.; Crowe, James E.; Williams, John V.; Buus, Søren; Sette, Alessandro; Schumacher, Ton N.M.; Link, Andrew J.; Joyce, Sebastian
2013-01-01
CD8+ T cells (TCD8) confer protective immunity against many infectious diseases, suggesting that microbial TCD8 determinants are promising vaccine targets. Nevertheless, current T cell antigen identification approaches do not discern which epitopes drive protective immunity during active infection — information that is critical for the rational design of TCD8-targeted vaccines. We employed a proteomics-based approach for large-scale discovery of naturally processed determinants derived from a complex pathogen, vaccinia virus (VACV), that are presented by the most frequent representatives of four major HLA class I supertypes. Immunologic characterization revealed that many previously unidentified VACV determinants were recognized by smallpox-vaccinated human peripheral blood cells in a variegated manner. Many such determinants were recognized by HLA class I–transgenic mouse immune TCD8 too and elicited protective TCD8 immunity against lethal intranasal VACV infection. Notably, efficient processing and stable presentation of immune determinants as well as the availability of naive TCD8 precursors were sufficient to drive a multifunctional, protective TCD8 response. Our approach uses fundamental insights into T cell epitope processing and presentation to define targets of protective TCD8 immunity within human pathogens that have complex proteomes, suggesting that this approach has general applicability in vaccine sciences. PMID:23543059
Discovering naturally processed antigenic determinants that confer protective T cell immunity.
Gilchuk, Pavlo; Spencer, Charles T; Conant, Stephanie B; Hill, Timothy; Gray, Jennifer J; Niu, Xinnan; Zheng, Mu; Erickson, John J; Boyd, Kelli L; McAfee, K Jill; Oseroff, Carla; Hadrup, Sine R; Bennink, Jack R; Hildebrand, William; Edwards, Kathryn M; Crowe, James E; Williams, John V; Buus, Søren; Sette, Alessandro; Schumacher, Ton N M; Link, Andrew J; Joyce, Sebastian
2013-05-01
CD8+ T cells (TCD8) confer protective immunity against many infectious diseases, suggesting that microbial TCD8 determinants are promising vaccine targets. Nevertheless, current T cell antigen identification approaches do not discern which epitopes drive protective immunity during active infection - information that is critical for the rational design of TCD8-targeted vaccines. We employed a proteomics-based approach for large-scale discovery of naturally processed determinants derived from a complex pathogen, vaccinia virus (VACV), that are presented by the most frequent representatives of four major HLA class I supertypes. Immunologic characterization revealed that many previously unidentified VACV determinants were recognized by smallpox-vaccinated human peripheral blood cells in a variegated manner. Many such determinants were recognized by HLA class I-transgenic mouse immune TCD8 too and elicited protective TCD8 immunity against lethal intranasal VACV infection. Notably, efficient processing and stable presentation of immune determinants as well as the availability of naive TCD8 precursors were sufficient to drive a multifunctional, protective TCD8 response. Our approach uses fundamental insights into T cell epitope processing and presentation to define targets of protective TCD8 immunity within human pathogens that have complex proteomes, suggesting that this approach has general applicability in vaccine sciences.
USDA-ARS?s Scientific Manuscript database
African swine fever (ASF) is an emerging disease threat for the swine industry worldwide. No ASF vaccine is available and progress is hindered by lack of knowledge concerning the extent of African swine fever virus (ASFV) strain diversity and the viral antigens conferring type specific protective im...
Obolo-Mvoulouga, Prosper; Oleaga, Ana; Manzano-Román, Raúl; Pérez-Sánchez, Ricardo
2018-04-30
The African argasid tick Ornithodoros moubata transmits two important pathogens, the African swine fever virus and the spirochete Borrelia duttoni, the cause of human relapsing fever. To date, only conventional control measures such as widespread application of acaricides, strict control measures, and animal movement restrictions have been implemented to confine these diseases. Vaccines against tick infestations have the potential to be among the most efficacious interventions for the management of these diseases. Plasma membrane-associated proteins upregulated in tick midgut cells in response to blood feeding and digestion are thought to play vital functions in tick physiology and in the transmission of tick-borne pathogens. In addition, their antigenic extracellular regions are easily accessible to antibodies synthesised by immunised hosts, which makes them interesting targets for tick vaccine design. The mialomes (midgut transcriptomes and proteomes) of unfed O. moubata females and of engorged females at 48 h post-feeding have recently been obtained, providing a wealth of predicted midgut protein sequences. In the current study, these mialomes were screened using in silico tools to select predicted antigenic transmembrane proteins that were upregulated after feeding (516 proteins). The functionally annotatable proteins from this list (396 proteins) were then manually inspected following additional criteria in order to select a finite and easy-manageable number of candidate antigens for tick vaccine design. The extracellular antigenic regions of five of these candidates were obtained either as truncated recombinant proteins or as KLH-conjugated synthetic peptides, formulated in Freund's adjuvant, and individually administered to rabbits to assess their immunogenicity and protective potential against infestations by O. moubata and the Iberian species Ornithodoros erraticus. All candidates were highly immunogenic, but provided low protection against the O
Lee, Lian Ni; Ronan, Edward O; de Lara, Catherine; Franken, Kees L M C; Ottenhoff, Tom H M; Tchilian, Elma Z; Beverley, Peter C L
2011-08-01
Convincing correlates of protective immunity against tuberculosis have been elusive. In BALB/c mice, intranasal immunization with a replication-deficient recombinant adenovirus expressing Mycobacterium tuberculosis antigen 85A (adenovirus-85A) induces protective lower respiratory tract immunity against pulmonary challenge with Mycobacterium tuberculosis, while intradermal immunization with adenovirus-85A does not. Here we report that intranasal immunization with adenovirus-85A induces expression of the chemokine receptor CXCR6 on lung CD8 T lymphocytes, which is maintained for at least 3 months. CXCR6-positive antigen-specific T cell numbers are increased among bronchoalveolar lavage-recoverable cells. Similarly, intranasal immunization with recombinant antigen 85A with adjuvant induces CXCR6 expression on lung CD4 cells in BALB/c and C57BL/6 mice, while a synthetic ESAT6(1-20) peptide with adjuvant induces CXCR6 expression in C57BL/6 mice. Parenteral immunization fails to do so. Upregulation of CXCR6 is accompanied by a transient elevation of serum CXCL16 after intranasal immunization, and lung cells cultured ex vivo from mice immunized intranasally show increased production of CXCL16. Administration of CXCL16 and cognate antigen intranasally to mice previously immunized parenterally increases the number of antigen-specific T lymphocytes in the bronchoalveolar lavage-recoverable population, which mediates inhibition of the early growth of Mycobacterium tuberculosis after challenge. We conclude that expression of CXCR6 on lung T lymphocytes is a correlate of local protective immunity against Mycobacterium tuberculosis after intranasal immunization and that CXCR6 and CXCL16 play an important role in the localization of T cells within lung tissue and the bronchoalveolar lavage-recoverable compartment.
Lee, Lian Ni; Ronan, Edward O.; de Lara, Catherine; Franken, Kees L. M. C.; Ottenhoff, Tom H. M.; Tchilian, Elma Z.; Beverley, Peter C. L.
2011-01-01
Convincing correlates of protective immunity against tuberculosis have been elusive. In BALB/c mice, intranasal immunization with a replication-deficient recombinant adenovirus expressing Mycobacterium tuberculosis antigen 85A (adenovirus-85A) induces protective lower respiratory tract immunity against pulmonary challenge with Mycobacterium tuberculosis, while intradermal immunization with adenovirus-85A does not. Here we report that intranasal immunization with adenovirus-85A induces expression of the chemokine receptor CXCR6 on lung CD8 T lymphocytes, which is maintained for at least 3 months. CXCR6-positive antigen-specific T cell numbers are increased among bronchoalveolar lavage-recoverable cells. Similarly, intranasal immunization with recombinant antigen 85A with adjuvant induces CXCR6 expression on lung CD4 cells in BALB/c and C57BL/6 mice, while a synthetic ESAT61–20 peptide with adjuvant induces CXCR6 expression in C57BL/6 mice. Parenteral immunization fails to do so. Upregulation of CXCR6 is accompanied by a transient elevation of serum CXCL16 after intranasal immunization, and lung cells cultured ex vivo from mice immunized intranasally show increased production of CXCL16. Administration of CXCL16 and cognate antigen intranasally to mice previously immunized parenterally increases the number of antigen-specific T lymphocytes in the bronchoalveolar lavage-recoverable population, which mediates inhibition of the early growth of Mycobacterium tuberculosis after challenge. We conclude that expression of CXCR6 on lung T lymphocytes is a correlate of local protective immunity against Mycobacterium tuberculosis after intranasal immunization and that CXCR6 and CXCL16 play an important role in the localization of T cells within lung tissue and the bronchoalveolar lavage-recoverable compartment. PMID:21628524
Ma, Yan-bing; Xie, Tian-hong; Zhang, Guang-ming; Li, Chun-hong; Dai, Xie-Jie; Dai, Chang-bai; Sun, Mao-sheng; Lu, Jian; Bi, Sheng-li
2002-12-01
To observe anti-HEV IgG response to vaccination of recombinant antigen fragments and evaluate its protection from Hepatitis E Virus infection in rhesus monkeys (Macaca mulatta). Twelve monkeys were divided into three groups and immunized respectively with three different recombinant antigens: namely Ag1 (carboxyl terminal 431 amino acids of ORF2), Ag2 (128aa fragment at the carboxyl terminal of ORF2), and Ag3 (full length ORF3 ligated with two ORF2 fragments encoded by 6743-7126nt and 6287-6404nt). The monkeys were challenged intravenously with fecal suspension from experimentally infected rhesus monkeys, and the other three monkeys served as the placebo group for challenge with HEV. The dynamic changes of the levels of ALT and anti-HEV IgG were examined. Pathological changes of liver tissue were observed by light microscope. Excretion of virus was detected by RT-nPCR. Hepatic histopathology of two monkeys in the placebo group was consistent with acute viral hepatitis, and ALT was elevated 3-4 weeks after inoculated with virus, up to 10-20 times higher than normal level. The liver tissue of monkeys immunized with antigen kept normal, ALT in several monkeys elevated mildly, and anti-HEV IgG conversation occurred at 1-2 weeks after vaccination, with the titer reaching 1:12,800. The virus RNA could be detected by RT-nPCR from days 7 to 50 in monkeys of control group, and from days 7 to 21 in vaccinated monkeys after challenged with virus. The recombinant antigens could induce the production of anti-HEV IgG, which protected rhesus monkeys from acute Hepatitis symptoms related to HEV infection.
Dobos, Karen M.; Lucas, Megan; Spencer, John S.; Fang, Sunan; McDonald, Melissa A.; Pohl, Jan; Birkness, Kristin; Chamcha, Venkateswarlu; Ramirez, Melissa V.; Plikaytis, Bonnie B.; Posey, James E.; Amara, Rama Rao
2013-01-01
Glycosylation is the most abundant post-translational polypeptide chain modification in nature. Although carbohydrate modification of protein antigens from many microbial pathogens constitutes important components of B cell epitopes, the role in T cell immunity is not completely understood. Here, using ELISPOT and polychromatic flow cytometry, we show that O-mannosylation of the adhesin, Apa, of Mycobacterium tuberculosis (Mtb) is crucial for its T cell antigenicity in humans and mice after infection. However, subunit vaccination with both mannosylated and non-mannosylated Apa induced a comparable magnitude and quality of T cell response and imparted similar levels of protection against Mtb challenge in mice. Both forms equally improved waning BCG vaccine-induced protection in elderly mice after subunit boosting. Thus, O-mannosylation of Apa is required for antigenicity but appears to be dispensable for its immunogenicity and protective efficacy in mice. These results have implications for the development of subunit vaccines using post-translationally modified proteins such as glycoproteins against infectious diseases like tuberculosis. PMID:24130497
Nandakumar, Subhadra; Kannanganat, Sunil; Dobos, Karen M; Lucas, Megan; Spencer, John S; Fang, Sunan; McDonald, Melissa A; Pohl, Jan; Birkness, Kristin; Chamcha, Venkateswarlu; Ramirez, Melissa V; Plikaytis, Bonnie B; Posey, James E; Amara, Rama Rao; Sable, Suraj B
2013-01-01
Glycosylation is the most abundant post-translational polypeptide chain modification in nature. Although carbohydrate modification of protein antigens from many microbial pathogens constitutes important components of B cell epitopes, the role in T cell immunity is not completely understood. Here, using ELISPOT and polychromatic flow cytometry, we show that O-mannosylation of the adhesin, Apa, of Mycobacterium tuberculosis (Mtb) is crucial for its T cell antigenicity in humans and mice after infection. However, subunit vaccination with both mannosylated and non-mannosylated Apa induced a comparable magnitude and quality of T cell response and imparted similar levels of protection against Mtb challenge in mice. Both forms equally improved waning BCG vaccine-induced protection in elderly mice after subunit boosting. Thus, O-mannosylation of Apa is required for antigenicity but appears to be dispensable for its immunogenicity and protective efficacy in mice. These results have implications for the development of subunit vaccines using post-translationally modified proteins such as glycoproteins against infectious diseases like tuberculosis.
O'Flaherty, Sarah; Klaenhammer, Todd R
2016-10-15
Clostridium botulinum and Bacillus anthracis produce potent toxins that cause severe disease in humans. New and improved vaccines are needed for both of these pathogens. For mucosal vaccine delivery using lactic acid bacteria, chromosomal expression of antigens is preferred over plasmid-based expression systems, as chromosomal expression circumvents plasmid instability and the need for antibiotic pressure. In this study, we constructed three strains of Lactobacillus acidophilus NCFM expressing from the chromosome (i) the nontoxic host receptor-binding domain of the heavy chain of Clostridium botulinum serotype A neurotoxin (BoNT/A-Hc), (ii) the anthrax protective antigen (PA), and (iii) both the BoNT/A-Hc and the PA. The BoNT/A-Hc vaccine cassette was engineered to contain the signal peptide from the S-layer protein A from L. acidophilus and a dendritic-cell-targeting peptide. A chromosomal region downstream of lba0889 carrying a highly expressed enolase gene was selected for insertion of the vaccine cassettes. Western blot analysis confirmed the heterologous expression of the two antigens from plasmid and chromosome locations. Stability assays demonstrated loss of the vaccine cassettes from expression plasmids without antibiotic maintenance. RNA sequencing showed high expression of each antigen and that insertion of the vaccine cassettes had little to no effect on the transcription of other genes in the chromosome. This study demonstrated that chromosomal integrative recombinant strains are promising vaccine delivery vehicles when targeted into high-expression chromosomal regions. Levels of expression match high-copy-number plasmids and eliminate the requirement for antibiotic selective maintenance of recombinant plasmids. Clostridium botulinum and Bacillus anthracis produce potent neurotoxins that pose a biochemical warfare concern; therefore, effective vaccines against these bacteria are required. Chromosomal expression of antigens is preferred over plasmid
Klaenhammer, Todd R.
2016-01-01
ABSTRACT Clostridium botulinum and Bacillus anthracis produce potent toxins that cause severe disease in humans. New and improved vaccines are needed for both of these pathogens. For mucosal vaccine delivery using lactic acid bacteria, chromosomal expression of antigens is preferred over plasmid-based expression systems, as chromosomal expression circumvents plasmid instability and the need for antibiotic pressure. In this study, we constructed three strains of Lactobacillus acidophilus NCFM expressing from the chromosome (i) the nontoxic host receptor-binding domain of the heavy chain of Clostridium botulinum serotype A neurotoxin (BoNT/A-Hc), (ii) the anthrax protective antigen (PA), and (iii) both the BoNT/A-Hc and the PA. The BoNT/A-Hc vaccine cassette was engineered to contain the signal peptide from the S-layer protein A from L. acidophilus and a dendritic-cell-targeting peptide. A chromosomal region downstream of lba0889 carrying a highly expressed enolase gene was selected for insertion of the vaccine cassettes. Western blot analysis confirmed the heterologous expression of the two antigens from plasmid and chromosome locations. Stability assays demonstrated loss of the vaccine cassettes from expression plasmids without antibiotic maintenance. RNA sequencing showed high expression of each antigen and that insertion of the vaccine cassettes had little to no effect on the transcription of other genes in the chromosome. This study demonstrated that chromosomal integrative recombinant strains are promising vaccine delivery vehicles when targeted into high-expression chromosomal regions. Levels of expression match high-copy-number plasmids and eliminate the requirement for antibiotic selective maintenance of recombinant plasmids. IMPORTANCE Clostridium botulinum and Bacillus anthracis produce potent neurotoxins that pose a biochemical warfare concern; therefore, effective vaccines against these bacteria are required. Chromosomal expression of antigens is
Juárez-Rodríguez, María Dolores; Yang, Jiseon; Kader, Rebin; Alamuri, Praveen; Curtiss, Roy
2012-01-01
Live recombinant attenuated Salmonella vaccine (RASV) strains have great potential to induce protective immunity against Mycobacterium tuberculosis by delivering M. tuberculosis antigens. Recently, we reported that, in orally immunized mice, RASV strains delivering the M. tuberculosis early secreted antigenic target 6-kDa (ESAT-6) protein and culture filtrate protein 10 (CFP-10) antigens via the Salmonella type III secretion system (SopE amino-terminal region residues 1 to 80 with two copies of ESAT-6 and one copy of CFP-10 [SopENt80-E2C]) afforded protection against aerosol challenge with M. tuberculosis. Here, we constructed and evaluated an improved Salmonella vaccine against M. tuberculosis. We constructed translational fusions for the synthesis of two copies of ESAT-6 plus CFP-10 fused to the OmpC signal sequence (OmpCSS-E2C) and amino acids 44 to 338 of antigen 85A (Ag85A294) flanked by the signal sequence (SS) and C-terminal peptide (CT) of β-lactamase (BlaSS-Ag85A294-BlaCT) to enable delivery via the Salmonella type II secretion system. The genes expressing these proteins were cloned as an operon transcribed from Ptrc into isogenic Asd+/MurA+ pYA3681 lysis vector derivatives with different replication origins (pBR, p15A, pSC101), resulting in pYA4890, pYA4891, and pYA4892 for SopENt80-E2C/Ag85A294 synthesis and pYA4893 and pYA4894 for OmpCSS-E2C/Ag85A294 synthesis. Mice orally immunized with the RASV χ11021 strain engineered to display regulated delayed lysis and regulated delayed antigen synthesis in vivo and harboring pYA4891, pYA4893, or pYA4894 elicited significantly greater humoral and cellular immune responses, and the RASV χ11021 strain afforded a greater degree of protection against M. tuberculosis aerosol challenge in mice than RASVs harboring any other Asd+/MurA+ lysis plasmid and immunization with M. bovis BCG, demonstrating that RASV strains displaying regulated delayed lysis with delayed antigen synthesis resulted in highly immunogenic
Stokes, Margaret G M; Titball, Richard W; Neeson, Brendan N; Galen, James E; Walker, Nicola J; Stagg, Anthony J; Jenner, Dominic C; Thwaite, Joanne E; Nataro, James P; Baillie, Leslie W J; Atkins, Helen S
2007-04-01
Bacillus anthracis is the causative agent of anthrax, a disease that affects wildlife, livestock, and humans. Protection against anthrax is primarily afforded by immunity to the B. anthracis protective antigen (PA), particularly PA domains 4 and 1. To further the development of an orally delivered human vaccine for mass vaccination against anthrax, we produced Salmonella enterica serovar Typhimurium expressing full-length PA, PA domains 1 and 4, or PA domain 4 using codon-optimized PA DNA fused to the S. enterica serovar Typhi ClyA and under the control of the ompC promoter. Oral immunization of A/J mice with Salmonella expressing full-length PA protected five of six mice against a challenge with 10(5) CFU of aerosolized B. anthracis STI spores, whereas Salmonella expressing PA domains 1 and 4 provided only 25% protection (two of eight mice), and Salmonella expressing PA domain 4 or a Salmonella-only control afforded no measurable protection. However, a purified recombinant fusion protein of domains 1 and 4 provided 100% protection, and purified recombinant 4 provided protection in three of eight immunized mice. Thus, we demonstrate for the first time the efficacy of an oral S. enterica-based vaccine against aerosolized B. anthracis spores.
Fertey, Jasmin; Bayer, Lea; Grunwald, Thomas; Pohl, Alexandra; Beckmann, Jana; Gotzmann, Gaby; Casado, Javier Portillo; Schönfelder, Jessy; Rögner, Frank-Holm; Wetzel, Christiane; Thoma, Martin; Bailer, Susanne M.; Hiller, Ekkehard; Rupp, Steffen; Ulbert, Sebastian
2016-01-01
Inactivated vaccines are commonly produced by incubating pathogens with chemicals such as formaldehyde or β-propiolactone. This is a time-consuming process, the inactivation efficiency displays high variability and extensive downstream procedures are often required. Moreover, application of chemicals alters the antigenic components of the viruses or bacteria, resulting in reduced antibody specificity and therefore stimulation of a less effective immune response. An alternative method for inactivation of pathogens is ionizing radiation. It acts very fast and predominantly damages nucleic acids, conserving most of the antigenic structures. However, currently used irradiation technologies (mostly gamma-rays and high energy electrons) require large and complex shielding constructions to protect the environment from radioactivity or X-rays generated during the process. This excludes them from direct integration into biological production facilities. Here, low-energy electron irradiation (LEEI) is presented as an alternative inactivation method for pathogens in liquid solutions. LEEI can be used in normal laboratories, including good manufacturing practice (GMP)- or high biosafety level (BSL)-environments, as only minor shielding is necessary. We show that LEEI efficiently inactivates different viruses (influenza A (H3N8), porcine reproductive and respiratory syndrome virus (PRRSV), equine herpesvirus 1 (EHV-1)) and bacteria (Escherichia coli) and maintains their antigenicity. Moreover, LEEI-inactivated influenza A viruses elicit protective immune responses in animals, as analyzed by virus neutralization assays and viral load determination upon challenge. These results have implications for novel ways of developing and manufacturing inactivated vaccines with improved efficacy. PMID:27886076
Despommier, D D
1981-01-01
The soluble portion of a large particle fraction which was derived from the muscle larva of T. spiralis was subjected to molecular sizing column chromatography using Sephacryl S-200. Five major peaks of 280 nm absorbing material were obtained. Analysis by immunoelectrophoresis revealed that each peak contained antigens, with the majority of them occurring in peaks 3, 4 and 5. Preliminary studies indicated that peak 4(mol. wt range 20 000--10 000) contained protection-inducing antigens. Crossed-immunoelectrophoretic and single-dimension electrophoretic analysis of peak 4 revealed a minimum of 10 antigens, while analytical isoelectric focusing demonstrated the presence of proteins with widely different pl, ranging from 4.0 to 9.0. Peak 4 was fractionated by preparative flatbed isoelectric focusing (PIEF) using two gradients: one from 3.5 to 9.5 and the other from 3.5 to 5.5. Fused rocket immunoelectrophoretic (FRIEP) analysis of both runs indicated that several antigens were separated from the others: one at pl 4.0 and the other at pl 9.0. The remaining antigens focused between pl 4.3 and 4.9. One hundred micrograms of whole peak 4, pl 9.0 antigen and the group of antigens at pl 4.3--4.9 were each separately injected, along with Freund's complete adjuvant, into mice. In addition, a portion of the pl 4.0 antigen was also assayed for protection. All antigenic preparations induced significant levels of protection. The pl 4.0 was further analysed on high-performance liquid chromatography (HPLC). Two sharp peaks of antigen, as detected by FRIEP, were eluted isocratically with 65% acetonitrile from a C-18 (aliphatic) column. Both peaks of antigen showed complete cross-reactivity on FRIEP and absorbed at 220 nm. Amino acid analysis of each HPLC peak revealed no detectable differences in composition. Each peak contained predominance of aspartic (13 mol%) and glutamic (18 mol%) acid. This antigen did not contain significant quantities of aromatic amino acids, and absorbed
Wadwa, Munisch; Klopfleisch, Robert; Buer, Jan; Westendorf, Astrid M.
2016-01-01
The endocytotic c-type lectin receptor DEC-205 is highly expressed on immature dendritic cells. In previous studies, it was shown that antigen-targeting to DEC-205 is a useful tool for the induction of antigen-specific Foxp3+ regulatory T cells and thereby can prevent inflammatory processes. However, whether this approach is sufficient to mediate tolerance in mucosal tissues like the gut is unknown. In this study, we established a new mouse model in which the adoptive transfer of naive hemagglutinin (HA)-specific CD4+Foxp3– T cells into VILLIN-HA transgenic mice leads to severe colitis. To analyze if antigen-targeting to DEC-205 could protect against inflammation of the gut, VILLIN-HA transgenic mice were injected with an antibody–antigen complex consisting of the immunogenic HA110–120 peptide coupled to an α-DEC-205 antibody (DEC-HA) before adoptive T cell transfer. DEC-HA-treated mice showed significantly less signs of intestinal inflammation as was demonstrated by reduced loss of body weight and histopathology in the gut. Strikingly, abrogated intestinal inflammation was mediated via the conversion of naive HA-specific CD4+Foxp3– T cells into HA-specific CD4+Foxp3+ regulatory T cells. In this study, we provide evidence that antigen-targeting to DEC-205 can be utilized for the induction of tolerance in mucosal organs that are confronted with large numbers of exogenous antigens. PMID:27141310
Petitdidier, Elodie; Pagniez, Julie; Papierok, Gérard; Vincendeau, Philippe; Lemesre, Jean-Loup; Bras-Gonçalves, Rachel
2016-01-01
Preventive vaccination is a highly promising strategy for interrupting leishmaniasis transmission that can, additionally, contribute to elimination. A vaccine formulation based on naturally excreted secreted (ES) antigens was prepared from L. infantum promastigote culture supernatant. This vaccine achieved successful results in Phase III trials and was licensed and marketed as CaniLeish. We recently showed that newly identified ES promastigote surface antigen (PSA), from both viable promastigotes and axenically-grown amastigotes, represented the major constituent and the highly immunogenic antigen of L. infantum and L. amazonensis ES products. We report here that three immunizations with either the recombinant ES LaPSA-38S (rPSA) or its carboxy terminal part LaPSA-12S (Cter-rPSA), combined with QA-21 as adjuvant, confer high levels of protection in naive L. infantum-infected Beagle dogs, as checked by bone marrow parasite absence in respectively 78.8% and 80% of vaccinated dogs at 6 months post-challenge. The parasite burden in infected vaccinated dogs was significantly reduced compared to placebo group, as measured by q-PCR. Moreover, our results reveal humoral and cellular immune response clear-cut differences between vaccinated and control dogs. An early increase in specific IgG2 antibodies was observed in rPSA/QA-21- and Cter-rPSA/QA-21-immunized dogs only. They were found functionally active in vitro and were highly correlated with vaccine protection. In vaccinated protected dogs, IFN-γ and NO productions, as well as anti-leishmanial macrophage activity, were increased. These data strongly suggest that ES PSA or its carboxy-terminal part, in recombinant forms, induce protection in a canine model of zoonotic visceral leishmaniasis by inducing a Th1-dominant immune response and an appropriate specific antibody response. These data suggest that they could be considered as important active components in vaccine candidates. PMID:27223609
Petitdidier, Elodie; Pagniez, Julie; Papierok, Gérard; Vincendeau, Philippe; Lemesre, Jean-Loup; Bras-Gonçalves, Rachel
2016-05-01
Preventive vaccination is a highly promising strategy for interrupting leishmaniasis transmission that can, additionally, contribute to elimination. A vaccine formulation based on naturally excreted secreted (ES) antigens was prepared from L. infantum promastigote culture supernatant. This vaccine achieved successful results in Phase III trials and was licensed and marketed as CaniLeish. We recently showed that newly identified ES promastigote surface antigen (PSA), from both viable promastigotes and axenically-grown amastigotes, represented the major constituent and the highly immunogenic antigen of L. infantum and L. amazonensis ES products. We report here that three immunizations with either the recombinant ES LaPSA-38S (rPSA) or its carboxy terminal part LaPSA-12S (Cter-rPSA), combined with QA-21 as adjuvant, confer high levels of protection in naive L. infantum-infected Beagle dogs, as checked by bone marrow parasite absence in respectively 78.8% and 80% of vaccinated dogs at 6 months post-challenge. The parasite burden in infected vaccinated dogs was significantly reduced compared to placebo group, as measured by q-PCR. Moreover, our results reveal humoral and cellular immune response clear-cut differences between vaccinated and control dogs. An early increase in specific IgG2 antibodies was observed in rPSA/QA-21- and Cter-rPSA/QA-21-immunized dogs only. They were found functionally active in vitro and were highly correlated with vaccine protection. In vaccinated protected dogs, IFN-γ and NO productions, as well as anti-leishmanial macrophage activity, were increased. These data strongly suggest that ES PSA or its carboxy-terminal part, in recombinant forms, induce protection in a canine model of zoonotic visceral leishmaniasis by inducing a Th1-dominant immune response and an appropriate specific antibody response. These data suggest that they could be considered as important active components in vaccine candidates.
Aline, Fleur; Bout, Daniel; Amigorena, Sébastian; Roingeard, Philippe; Dimier-Poisson, Isabelle
2004-01-01
It was previously demonstrated that immunizing mice with spleen dendritic cells (DCs) that had been pulsed ex vivo with Toxoplasma gondii antigens triggers a systemic Th1-biased specific immune response and induces protection against infection. T. gondii can cause severe sequelae in the fetuses of mothers who acquire the infection during pregnancy, as well as life-threatening neuropathy in immunocompromised patients, in particular those with AIDS. Here, we investigate the efficacy of a novel cell-free vaccine composed of DC exosomes, which are secreted antigen-presenting vesicles that express functional major histocompatibility complex class I and II and T-cell-costimulatory molecules. They have already been shown to induce potent antitumor immune responses. We investigated the potential of DC2.4 cell line-derived exosomes to induce protective immunity against toxoplasmosis. Our data show that most adoptively transferred T. gondii-pulsed DC-derived exosomes were transferred to the spleen, elicited a strong systemic Th1-modulated Toxoplasma-specific immune response in vivo, and conferred good protection against infection. These findings support the possibility that DC-derived exosomes can be used for T. gondii immunoprophylaxis and for immunoprophylaxis against many other pathogens. PMID:15213158
Xie, Honglin; Wei, Zigong; Ma, Chunquan; Li, Shun; Liu, Xiaohong; Fu, Qiang
2018-06-01
Streptococcus equi ssp. zooepidemicus (Streptococcus zooepidemicus, SEZ) is a commensal bacterium related to opportunistic infections of many species, including humans, dogs, cats, and pigs. SeseC_01411 has been proven to be immunogenic. However, its protective efficacy remained to be evaluated. In the present study, the purified recombinant SeseC_01411 could elicit a strong humoral antibody response and protect against lethal challenge with virulent SEZ in mice. Our finding confirmed that SeseC_01411 distributes on the surface of SEZ. In addition, the hyperimmune sera against SeseC_01411 could efficiently kill the bacteria in the phagocytosis test. The present study identified the immunogenic protein, SeseC_01411, as a novel surface protective antigen of SEZ. Copyright © 2018 Elsevier Ltd. All rights reserved.
Lynch, Heather E.; Stewart, Shelley M.; Kepler, Thomas B.; Sempowski, Gregory D.; Alam, S. Munir
2014-01-01
Establishment of humoral immunity against pathogens is dependent on events that occur in the germinal center and the subsequent induction of high-affinity neutralizing antibodies. Quantitative assays that allow monitoring of affinity maturation and duration of antibody responses can provide useful information regarding the efficacy of vaccines and adjuvants. Using an anthrax protective antigen (rPA) and alum model antigen/adjuvant system, we describe a methodology for monitoring antigen-specific serum antibody concentration and avidity by surface plasmon resonance during primary and secondary immune responses. Our analyses showed that following a priming dose in mice, rPA-specific antibody concentration and avidity increases over time and reaches a maximal response in about six weeks, but gradually declines in the absence of antigenic boost. Germinal center reactions were observed early with maximal development achieved during the primary response, which coincided with peak antibody avidity responses to primary immunization. Boosting with antigen resulted in a rapid increase in rPA-specific antibody concentration and five-fold increase in avidity, which was not dependent on sustained GC development. The described methodology couples surface plasmon resonance-based plasma avidity measurements with germinal center analysis and provides a novel way to monitor humoral responses that can play a role in facilitating vaccine and adjuvant development. PMID:24316020
Gillis, Thomas P.; Tullius, Michael V.
2014-01-01
Leprosy remains a major global health problem and typically occurs in regions in which tuberculosis is endemic. Vaccines are needed that protect against both infections and do so better than the suboptimal Mycobacterium bovis BCG vaccine. Here, we evaluated rBCG30, a vaccine previously demonstrated to induce protection superior to that of BCG against Mycobacterium tuberculosis and Mycobacterium bovis challenge in animal models, for efficacy against Mycobacterium leprae challenge in a murine model of leprosy. rBCG30 overexpresses the M. tuberculosis 30-kDa major secretory protein antigen 85B, which is 85% homologous with the M. leprae homolog (r30ML). Mice were sham immunized or immunized intradermally with BCG or rBCG30 and challenged 2.5 months later by injection of viable M. leprae into each hind footpad. After 7 months, vaccine efficacy was assessed by enumerating the M. leprae bacteria per footpad. Both BCG and rBCG30 induced significant protection against M. leprae challenge. In the one experiment in which a comparison between BCG and rBCG30 was feasible, rBCG30 induced significantly greater protection than did BCG. Immunization of mice with purified M. tuberculosis or M. leprae antigen 85B also induced protection against M. leprae challenge but less so than BCG or rBCG30. Notably, boosting rBCG30 with M. tuberculosis antigen 85B significantly enhanced r30ML-specific immune responses, substantially more so than boosting BCG, and significantly augmented protection against M. leprae challenge. Thus, rBCG30, a vaccine that induces improved protection against M. tuberculosis, induces cross-protection against M. leprae that is comparable or potentially superior to that induced by BCG, and boosting rBCG30 with antigen 85B further enhances immune responses and protective efficacy. PMID:25001602
Gillis, Thomas P; Tullius, Michael V; Horwitz, Marcus A
2014-09-01
Leprosy remains a major global health problem and typically occurs in regions in which tuberculosis is endemic. Vaccines are needed that protect against both infections and do so better than the suboptimal Mycobacterium bovis BCG vaccine. Here, we evaluated rBCG30, a vaccine previously demonstrated to induce protection superior to that of BCG against Mycobacterium tuberculosis and Mycobacterium bovis challenge in animal models, for efficacy against Mycobacterium leprae challenge in a murine model of leprosy. rBCG30 overexpresses the M. tuberculosis 30-kDa major secretory protein antigen 85B, which is 85% homologous with the M. leprae homolog (r30ML). Mice were sham immunized or immunized intradermally with BCG or rBCG30 and challenged 2.5 months later by injection of viable M. leprae into each hind footpad. After 7 months, vaccine efficacy was assessed by enumerating the M. leprae bacteria per footpad. Both BCG and rBCG30 induced significant protection against M. leprae challenge. In the one experiment in which a comparison between BCG and rBCG30 was feasible, rBCG30 induced significantly greater protection than did BCG. Immunization of mice with purified M. tuberculosis or M. leprae antigen 85B also induced protection against M. leprae challenge but less so than BCG or rBCG30. Notably, boosting rBCG30 with M. tuberculosis antigen 85B significantly enhanced r30ML-specific immune responses, substantially more so than boosting BCG, and significantly augmented protection against M. leprae challenge. Thus, rBCG30, a vaccine that induces improved protection against M. tuberculosis, induces cross-protection against M. leprae that is comparable or potentially superior to that induced by BCG, and boosting rBCG30 with antigen 85B further enhances immune responses and protective efficacy. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Turnbull, P C; Broster, M G; Carman, J A; Manchee, R J; Melling, J
1986-01-01
A competitive inhibition enzyme-linked immunosorbent assay (ELISA) was developed to detect antibodies in serum to the protective antigen (PA) and lethal factor (LF) components of anthrax toxin. Current human vaccination schedules with an acellular vaccine induce predictable and lasting antibody titers to PA and, when present in the vaccine, to LF. Live spore vaccine administered to guinea pigs in a single dose conferred significantly better protection than the human vaccines (P less than 0.001), although they elicited significantly lower (P less than 0.0005) anti-PA and anti-LF titers at time of challenge with virulent Bacillus anthracis. Substantial anti-PA and anti-LF titers may not, therefore, indicate solid protective immunity against anthrax infection. The ELISA system was also shown to be capable of detecting anti-PA and anti-LF antibodies in the sera of individuals with histories of clinical anthrax. The advantage of ELISA over the Ouchterlony gel diffusion test and indirect microhemagglutination assay are demonstrated. There was a highly significant degree of correlation between ELISA and the indirect microhemagglutination assay (P less than 0.0005); but ELISA was markedly superior in terms of reproducibility, reliability, specificity, and simplicity in performance and stability of the bound antigen. PMID:3084381
Immunity to Intracellular Salmonella Depends on Surface-associated Antigens
Claudi, Beatrice; Mazé, Alain; Schemmer, Anne K.; Kirchhoff, Dennis; Schmidt, Alexander; Burton, Neil; Bumann, Dirk
2012-01-01
Invasive Salmonella infection is an important health problem that is worsening because of rising antimicrobial resistance and changing Salmonella serovar spectrum. Novel vaccines with broad serovar coverage are needed, but suitable protective antigens remain largely unknown. Here, we tested 37 broadly conserved Salmonella antigens in a mouse typhoid fever model, and identified antigen candidates that conferred partial protection against lethal disease. Antigen properties such as high in vivo abundance or immunodominance in convalescent individuals were not required for protectivity, but all promising antigen candidates were associated with the Salmonella surface. Surprisingly, this was not due to superior immunogenicity of surface antigens compared to internal antigens as had been suggested by previous studies and novel findings for CD4 T cell responses to model antigens. Confocal microscopy of infected tissues revealed that many live Salmonella resided alone in infected host macrophages with no damaged Salmonella releasing internal antigens in their vicinity. In the absence of accessible internal antigens, detection of these infected cells might require CD4 T cell recognition of Salmonella surface-associated antigens that could be processed and presented even from intact Salmonella. In conclusion, our findings might pave the way for development of an efficacious Salmonella vaccine with broad serovar coverage, and suggest a similar crucial role of surface antigens for immunity to both extracellular and intracellular pathogens. PMID:23093937
[Search for protective antigens in Ixodes persulcatus (ixodidae) salivary gland extracts].
Shtannikov, A V; Reshetniak, T V; Repolovskaia, T V; Panfertsev, E A; Perovskaia, O N; Gutova, V P; Vasil'eva, I S; Ershova, A S; Prilipov, A G; Biketov, S F; Zeidner, N
2010-01-01
RT-PCR evaluation of the activity of eight Ixodes persulcatus salivary gland genes shows clear distinctions in their expression depending of the stage of tick feeding. Out of them, only Salp 10 and Salp 15 proteins may be regarded as candidates for protective antigens to develop anti-tick and anti-Borrelia vaccines. Firstly they play an important role in feeding a tick and modifying a host's immune response. Secondly, the increasing expression of the salp 10 and salp 10 genes begins at early tick feeding stages. Thirdly, the activity of these genes increases with the beginning of feeding by tens and hundreds times and keeps at this level until the third tick feeding stage is over.
Weiss, Walter R.; Kumar, Anita; Jiang, George; Williams, Jackie; Bostick, Anthony; Conteh, Solomon; Fryauff, David; Aguiar, Joao; Singh, Manmohan; O'Hagan, Derek T.; Ulmer, Jeffery B.; Richie, Thomas L.
2007-01-01
Background We have previously described a four antigen malaria vaccine consisting of DNA plasmids boosted by recombinant poxviruses which protects a high percentage of rhesus monkeys against Plasmodium knowlesi (Pk) malaria. This is a multi-stage vaccine that includes two pre-erythrocytic antigens, PkCSP and PkSSP2(TRAP), and two erythrocytic antigens, PkAMA-1 and PkMSP-1(42kD). The present study reports three further experiments where we investigate the effects of DNA dose, timing, and formulation. We also compare vaccines utilizing only the pre-erythrocytic antigens with the four antigen vaccine. Methodology In three experiments, rhesus monkeys were immunized with malaria vaccines using DNA plasmid injections followed by boosting with poxvirus vaccine. A variety of parameters were tested, including formulation of DNA on poly-lactic co-glycolide (PLG) particles, varying the number of DNA injections and the amount of DNA, varying the interval between the last DNA injection to the poxvirus boost from 7 to 21 weeks, and using vaccines with from one to four malaria antigens. Monkeys were challenged with Pk sporozoites given iv 2 to 4 weeks after the poxvirus injection, and parasitemia was measured by daily Giemsa stained blood films. Immune responses in venous blood samples taken after each vaccine injection were measured by ELIspot production of interferon-γ, and by ELISA. Conclusions 1) the number of DNA injections, the formulation of the DNA plasmids, and the interval between the last DNA injection and the poxvirus injection are critical to vaccine efficacy. However, the total dose used for DNA priming is not as important; 2) the blood stage antigens PkAMA-1 and PkMSP-1 were able to protect against high parasitemias as part of a genetic vaccine where antigen folding is not well defined; 3) immunization with PkSSP2 DNA inhibited immune responses to PkCSP DNA even when vaccinations were given into separate legs; and 4) in a counter-intuitive result, higher
Weiss, Shay; Kobiler, David; Levy, Haim; Marcus, Hadar; Pass, Avi; Rothschild, Nili; Altboum, Zeev
2006-01-01
Correlates between immunological parameters and protection against Bacillus anthracis infection in animals vaccinated with protective antigen (PA)-based vaccines could provide surrogate markers to evaluate the putative protective efficiency of immunization in humans. In previous studies we demonstrated that neutralizing antibody levels serve as correlates for protection in guinea pigs (S. Reuveny et al., Infect. Immun. 69:2888-2893, 2001; H. Marcus et al., Infect. Immun. 72:3471-3477, 2004). In this study we evaluated similar correlates for protection by active and passive immunization of New Zealand White rabbits. Full immunization and partial immunization were achieved by single and multiple injections of standard and diluted doses of a PA-based vaccine. Passive immunization was carried out by injection of immune sera from rabbits vaccinated with PA-based vaccine prior to challenge with B. anthracis spores. Immunized rabbits were challenged by intranasal spore instillation with one of two virulent strains (strains Vollum and ATCC 6605). The immune competence was estimated by measuring the level of total anti-PA antibodies, the neutralizing antibody titers, and the conferred protective immunity. The results indicate that total anti-PA antibody titers greater than 1 x 10(5) conferred protection, whereas lower titers (between 10(4) and 10(5)) provided partial protection but failed to predict protection. Neutralizing antibody titers between 500 and 800 provided partial protection, while titers higher than 1,000 conferred protection. In conclusion, this study emphasizes that regardless of the immunization regimen or the time of challenge, neutralizing antibody titers are better predictors of protection than total anti-PA titers.
Tipper, Donald J; Szomolanyi-Tsuda, Eva
2016-01-01
Background. U65, a self-aggregating peptide scaffold, traps fused protein antigens in yeast cells. Conversion to Yeast Cell Particle (YCP) vaccines by partial removal of surface mannoproteins exposes β-glucan, mediating efficient uptake by antigen-presenting cells (APCs). YCP vaccines are inexpensive, capable of rapid large-scale production and have potential for both parenteral and oral use. Results. YCP processing by alkaline hydrolysis exposes up to 20% of the glucan but converts scaffolded antigen and internal yeast proteins into a common aggregate, preventing selective yeast protein removal. For U65-green fluorescent protein (GFP) or U65-Apolipoprotein A1 (ApoA1) subcutaneous vaccines, maximal IgG responses in mice required 10% glucan exposure. IgG responses to yeast proteins were 5-fold lower. Proteolytic mannoprotein removal produced YCPs with only 6% glucan exposure, insufficiently porous for selective removal of even native yeast proteins. Vaccine efficacy was reduced 10-fold. Current YCP formulations, therefore, are not suitable for human use but have considerable potential for use in feed animal vaccines. Significantly, a YCP vaccine expressing a GFP fusion to VP1, the murine polyoma virus major capsid protein, after either oral or subcutaneous administration, protected mice against an intraperitoneal polyoma virus challenge, reducing viral DNA levels in spleen and liver by >98%.
Nisbet, Alasdair J; McNeilly, Tom N; Greer, Andrew W; Bartley, Yvonne; Oliver, E Margaret; Smith, Stephen; Palarea-Albaladejo, Javier; Matthews, Jacqueline B
2016-09-15
Teladorsagiosis is a major production-limiting disease in ruminants in temperate regions throughout the world and one of the key interventions in the management of the disease is the prevention of pasture contamination with Teladorsagia circumcincta eggs by ewes during the periparturient relaxation in immunity which occurs in the period around lambing. Here, we describe the immunisation of twin-bearing ewes with a T. circumcincta recombinant subunit vaccine and the impact that vaccination has on their immune responses and shedding of parasite eggs during a continuous T. circumcincta challenge period spanning late gestation and lactation. In ewes which displayed a clear periparturient relaxation in immunity, vaccination resulted in a 45% reduction in mean cumulative faecal egg count (cFEC, p=0.027) compared to control (immunised with adjuvant only) ewes. Recombinant antigen-specific IgG and IgA, which bound each of the vaccine antigens, were detected in the serum of vaccinated ewes following each immunisation and in colostrum taken from vaccinated ewes post-partum whereas low levels of antigen-specific IgG were detected in serum and colostrum from control ewes. Antigen-specific IgG and IgA levels in blood collected within 48h of birth from lambs largely reflected those in the colostrum of their ewes. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Boyer, Jean D.; Robinson, Tara M.; Kutzler, Michele A.; Vansant, Gordon; Hokey, David A.; Kumar, Sanjeev; Parkinson, Rose; Wu, Ling; Sidhu, Maninder K.; Pavlakis, George N.; Felber, Barbara K.; Brown, Charles; Silvera, Peter; Lewis, Mark G.; Monforte, Joseph; Waldmann, Thomas A.; Eldridge, John; Weiner, David B.
2007-01-01
The cell-mediated immune profile induced by a recombinant DNA vaccine was assessed in the simian/HIV (SHIV) and macaque model. The vaccine strategy included coimmunization of a DNA-based vaccine alone or in combination with an optimized plasmid encoding macaque IL-15 (pmacIL-15). We observed strong induction of vaccine-specific IFN-γ-producing CD8+ and CD4+ effector T cells in the vaccination groups. Animals were subsequently challenged with 89.6p. The vaccine groups were protected from ongoing infection, and the IL-15 covaccinated group showed a more rapidly controlled infection than the group treated with DNA vaccine alone. Lymphocytes isolated from the group covaccinated with pmacIL-15 had higher cellular proliferative responses than lymphocytes isolated from the macaques that received SHIV DNA alone. Vaccine antigen activation of lymphocytes was also studied for a series of immunological molecules. Although mRNA for IFN-γ was up-regulated after antigen stimulation, the inflammatory molecules IL-8 and MMP-9 were down-regulated. These observed immune profiles are potentially reflective of the ability of the different groups to control SHIV replication. This study demonstrates that an optimized IL-15 immune adjuvant delivered with a DNA vaccine can impact the cellular immune profile in nonhuman primates and lead to enhanced suppression of viral replication. PMID:18000037
Thakur, Ankita; Kaur, Harpreet; Kaur, Sukhbir
2015-09-01
Visceral leishmaniasis (VL) caused by Leishmania donovani persists as a major public health issue in tropical and subtropical areas of the world. Current treatment of this disease relies on use of drugs. It is doubtful that chemotherapy can alone eradicate the disease, so there is a need for an effective vaccine. Killed antigen candidates remain a good prospect considering their ease of formulation, stability, low cost and safety. To enhance the efficacy of killed vaccines suitable adjuvant and delivery system are needed. Therefore, the current study was conducted to determine the protective efficacy of freeze-thawed L. donovani antigen in combination with different adjuvants against experimental infection of VL. For this, BALB/c mice were immunized thrice at an interval of two weeks. Challenge infection was given two weeks after last immunization. Mice were sacrificed after last immunization and on different post challenge/infection days. Immunized mice showed significant reduction in parasite burden, enhanced DTH responses with increased levels of Th1 cytokines and lower levels of Th2 cytokines, thus indicating the development of a protective Th1 response. Maximum protection was achieved with liposome encapsulated freeze thawed promastigote (FTP) antigen of L. donovani and it was followed by group immunized with FTP+MPL-A, FTP+saponin, FTP+alum and FTP antigen (alone). The present study highlights greater efficacy of freeze thawed promastigote antigen as a potential vaccine candidate along with effective adjuvant formulations against experimental VL infection. Copyright © 2015 Elsevier GmbH. All rights reserved.
Kleiveland, Charlotte R.; Minic, Rajna; Moen, Lars F.; Øverland, Lise; Tjåland, Rannei; Carlsen, Harald; Lea, Tor; Eijsink, Vincent G. H.
2016-01-01
ABSTRACT Tuberculosis (TB) remains among the most deadly diseases in the world. The only available vaccine against tuberculosis is the bacille Calmette-Guérin (BCG) vaccine, which does not ensure full protection in adults. There is a global urgency for the development of an effective vaccine for preventing disease transmission, and it requires novel approaches. We are exploring the use of lactic acid bacteria (LAB) as a vector for antigen delivery to mucosal sites. Here, we demonstrate the successful expression and surface display of a Mycobacterium tuberculosis fusion antigen (comprising Ag85B and ESAT-6, referred to as AgE6) on Lactobacillus plantarum. The AgE6 fusion antigen was targeted to the bacterial surface using two different anchors, a lipoprotein anchor directing the protein to the cell membrane and a covalent cell wall anchor. AgE6-producing L. plantarum strains using each of the two anchors induced antigen-specific proliferative responses in lymphocytes purified from TB-positive donors. Similarly, both strains induced immune responses in mice after nasal or oral immunization. The impact of the anchoring strategies was reflected in dissimilarities in the immune responses generated by the two L. plantarum strains in vivo. The present study comprises an initial step toward the development of L. plantarum as a vector for M. tuberculosis antigen delivery. IMPORTANCE This work presents the development of Lactobacillus plantarum as a candidate mucosal vaccine against tuberculosis. Tuberculosis remains one of the top infectious diseases worldwide, and the only available vaccine, bacille Calmette-Guérin (BCG), fails to protect adults and adolescents. Direct antigen delivery to mucosal sites is a promising strategy in tuberculosis vaccine development, and lactic acid bacteria potentially provide easy, safe, and low-cost delivery vehicles for mucosal immunization. We have engineered L. plantarum strains to produce a Mycobacterium tuberculosis fusion antigen and
Kuczkowska, Katarzyna; Kleiveland, Charlotte R; Minic, Rajna; Moen, Lars F; Øverland, Lise; Tjåland, Rannei; Carlsen, Harald; Lea, Tor; Mathiesen, Geir; Eijsink, Vincent G H
2017-01-15
Tuberculosis (TB) remains among the most deadly diseases in the world. The only available vaccine against tuberculosis is the bacille Calmette-Guérin (BCG) vaccine, which does not ensure full protection in adults. There is a global urgency for the development of an effective vaccine for preventing disease transmission, and it requires novel approaches. We are exploring the use of lactic acid bacteria (LAB) as a vector for antigen delivery to mucosal sites. Here, we demonstrate the successful expression and surface display of a Mycobacterium tuberculosis fusion antigen (comprising Ag85B and ESAT-6, referred to as AgE6) on Lactobacillus plantarum The AgE6 fusion antigen was targeted to the bacterial surface using two different anchors, a lipoprotein anchor directing the protein to the cell membrane and a covalent cell wall anchor. AgE6-producing L. plantarum strains using each of the two anchors induced antigen-specific proliferative responses in lymphocytes purified from TB-positive donors. Similarly, both strains induced immune responses in mice after nasal or oral immunization. The impact of the anchoring strategies was reflected in dissimilarities in the immune responses generated by the two L. plantarum strains in vivo The present study comprises an initial step toward the development of L. plantarum as a vector for M. tuberculosis antigen delivery. This work presents the development of Lactobacillus plantarum as a candidate mucosal vaccine against tuberculosis. Tuberculosis remains one of the top infectious diseases worldwide, and the only available vaccine, bacille Calmette-Guérin (BCG), fails to protect adults and adolescents. Direct antigen delivery to mucosal sites is a promising strategy in tuberculosis vaccine development, and lactic acid bacteria potentially provide easy, safe, and low-cost delivery vehicles for mucosal immunization. We have engineered L. plantarum strains to produce a Mycobacterium tuberculosis fusion antigen and to anchor this
Zhang, Anding; Chen, Bo; Mu, Xiaofeng; Li, Ran; Zheng, Pei; Zhao, Yaxin; Chen, Huanchun; Jin, Meilin
2009-02-25
Streptococcus suis serotype 2 (SS2) is a porcine and human pathogen with adhesive and invasive properties. The absence of suitable vaccine or virulent marker can be the bottleneck to control SS2 infection. In the present study, a novel immunogenic Enolase identified in the previous study was inducibly overexpressed in Escherichia coli, and the purified recombinant protein could elicit a significant humoral antibody response and confer efficient immunity against challenge with lethal dose of SS2 or SS7 infection in mouse model. The roles Enolase plays in pathogenicity of SS2 were also explored as reasons for which Enolase could be a protective antigen. The Enolase was an in vivo-induced antigen confirmed by the real-time PCR and could adhere to the Hep-2 cells by the indirect immunofluorescent assay and the inhibition assay. These suggested that Enolase could play important roles in pathogenicity and may serve as a novel vaccine candidate against SS2 infection.
Ravindran, Rajesh; Maji, Mithun; Ali, Nahid
2012-01-01
The development of a long-term protective subunit vaccine against visceral leishmaniasis depends on antigens and adjuvants that can induce an appropriate immune response. The immunization of leishmanial antigens alone shows limited efficacy in the absence of an appropriate adjuvant. Earlier we demonstrated sustained protection against Leishmania donovani with leishmanial antigens entrapped in cationic liposomes through an intraperitoneal route. However, this route is not applicable for human administration. Herein, we therefore evaluated the immune response and protection induced by liposomal soluble leishmanial antigen (SLA) formulated with monophosphoryl lipid-trehalose dicorynomycolate (MPL-TDM) through a subcutaneous route. Subcutaneous immunization of BALB/c mice with SLA entrapped in liposomes or with MPL-TDM elicited partial protection against experimental visceral leishmaniasis. In contrast, liposomal SLA adjuvanted with MPL-TDM induced significantly higher levels of protection in liver and spleen in BALB/c mice challenged 10 days post-vaccination. Protection conferred by this formulation was sustained up to 12 weeks of immunization, and infection was controlled for at least 4 months of the challenge, similar to liposomal SLA immunization administered intraperitoneally. An analysis of cellular immune responses of liposomal SLA + MPL-TDM immunized mice demonstrated the induction of IFN-γ and IgG2a antibody production not only 10 days or 12 weeks post-vaccination but also 4 months after the challenge infection and a down regulation of IL-4 production after infection. Moreover, long-term immunity elicited by this formulation was associated with IFN-γ production also by CD8⁺ T cells. Taken together, our results suggest that liposomal SLA + MPL-TDM represent a good vaccine formulation for the induction of durable protection against L. donovani through a human administrable route.
Lange, Stefan; Nygren, Håkan; Svennerholm, Ann-Mari; Holmgren, Jan
1980-01-01
The importance of the mode of antigen presentation (intravenous, oral, or enteral restricted to the lower ileum) in the development of a local immune response and immunological memory for such a response in different parts of the intestine was studied in mice. Cholera toxin was used as antigen and the immune response was assayed by determining both the number of specific antitoxin-containing cells in the lamina propria and protection against experimental cholera. The results showed that all of these routes of antigen presentation could induce significant memory along the entire small intestine. In contrast, the actual production of antitoxin-containing cells or protective immune response elicited by booster immunization was restricted to those parts of the intestine that were directly exposed to antigen; i.e., lower ileum boosting resulted in immunity in the distal ileum but not in the proximal jejunum, whereas oral or intravenous boosting gave a response in both jejunum and ileum. Protection correlated closely with the number of antitoxin-containing cells in the lamina propria (correlation coefficient, 0.88); ≥4,000 antitoxin-containing cells per mm3 conferred solid immunity to cholera toxin-induced diarrhea. The total number of immunoglobulin-containing cells in intestines was not significantly influenced by the specific immunizations. There were four times as many of these cells in the upper jejunum (167,000 cells per mm3) as in the lower ileum, but the proportions of immunoglobulin A-containing cells (80 to 85%), immunoglobulin M-containing cells (14 to 20%), and immunoglobulin G-containing cells (0.4 to 0.9%) were similar in various parts of the intestine. The results indicate a differential dependence on local tissue antigen for the intestinal antibody-secreting cells and their memory cell precursors. PMID:7189747
Yuan, Xuefeng; Teng, Xindong; Jing, Yukai; Ma, Jilei; Tian, Maopeng; Yu, Qi; Zhou, Lei; Wang, Ruibo; Wang, Weihua; Li, Li; Fan, Xionglin
2015-12-01
Tuberculosis (TB) remains one of the most menacing infectious diseases, although attenuated Mycobacterium bovis Bacillus Calmette-Guerin (BCG) vaccine has been widely used to protect children against primary TB. There are increasing evidences that rapid growing and dormant Mycobacterium tuberculosis (M. tuberculosis) coexist in vivo after infection. However, BCG vaccine only elicits cell-mediated immune responses to secretory antigens expressed by rapid growing pathogen. BCG vaccine is thus unable to thwart the reactivation of latent tuberculosis infection (LTBI), and its protection wanes over age after neonatal immunization. In order to extend its ability for a durable protection, a novel recombinant BCG (rBCG) strain, named rBCG::XB, was constructed by overexpressing immunodominant multistage antigens of Ag85B and HspX, which are expressed by both rapid replicating and dormant M. tuberculosis. Long-term protective effect and immunogenicity of rBCG::XB were compared with the parental BCG in vaccinated C57BL/6 mice. Our results demonstrated that rBCG::XB provided the stronger and long-lasting protection against M. tuberculosis H37Rv intranasal infection than BCG. The rBCG::XB not only elicited the more durable multistage antigen-specific CD4(+)Th1-biased immune responses and specific polyfunctional CD4(+)T cells but also augmented the CD8(+) CTL effects against Ag85B in vivo. In particular, higher levels of CD4(+) TEM and CD8(+) TCM cells, dominated by IL2(+) CD4(+) and CD8(+) TCM cells, were obtained in the spleen of rBCG::XB vaccinated mice. Therefore, our findings indicate that rBCG::XB is a promising candidate to improve the efficacy of BCG.
Ruan, Xiaosai; Knudsen, David E; Wollenberg, Katie M; Sack, David A; Zhang, Weiping
2014-02-01
Diarrhea is the second leading cause of death in children younger than 5 years and continues to be a major threat to global health. Enterotoxigenic Escherichia coli (ETEC) strains are the most common bacteria causing diarrhea in developing countries. ETEC strains are able to attach to host small intestinal epithelial cells by using bacterial colonization factor antigen (CFA) adhesins. This attachment helps to initiate the diarrheal disease. Vaccines that induce antiadhesin immunity to block adherence of ETEC strains that express immunologically heterogeneous CFA adhesins are expected to protect against ETEC diarrhea. In this study, we created a CFA multiepitope fusion antigen (MEFA) carrying representative epitopes of CFA/I, CFA/II (CS1, CS2, and CS3), and CFA/IV (CS4, CS5, and CS6), examined its immunogenicity in mice, and assessed the potential of this MEFA as an antiadhesin vaccine against ETEC. Mice intraperitoneally immunized with this CFA MEFA exhibited no adverse effects and developed immune responses to CFA/I, CFA/II, and CFA/IV adhesins. Moreover, after incubation with serum of the immunized mice, ETEC or E. coli strains expressing CFA/I, CFA/II, or CFA/IV adhesins were significantly inhibited in adherence to Caco-2 cells. Our results indicated this CFA MEFA elicited antibodies that not only cross-reacted to CFA/I, CFA/II and CFA/IV adhesins but also broadly inhibited adherence of E. coli strains expressing these seven adhesins and suggested that this CFA MEFA could be a candidate to induce broad-spectrum antiadhesin protection against ETEC diarrhea. Additionally, this antigen construction approach (creating an MEFA) may be generally used in vaccine development against heterogenic pathogens.
Wang, Jin Yuan; Carrasco, Jose A.; Lloyd, Scott A.; Mellado-Sanchez, Gabriela; Diaz-McNair, Jovita; Franco, Olga; Buskirk, Amanda D.; Nataro, James P.; Pasetti, Marcela F.
2014-01-01
Live attenuated bacteria hold great promise as multivalent mucosal vaccines against a variety of pathogens. A major challenge of this approach has been the successful delivery of sufficient amounts of vaccine antigens to adequately prime the immune system without overattenuating the live vaccine. Here we used a live attenuated Salmonella enterica serovar Typhi strain to create a bivalent mucosal plague vaccine that produces both the protective F1 capsular antigen of Yersinia pestis and the LcrV protein required for secretion of virulence effector proteins. To reduce the metabolic burden associated with the coexpression of F1 and LcrV within the live vector, we balanced expression of both antigens by combining plasmid-based expression of F1 with chromosomal expression of LcrV from three independent loci. The immunogenicity and protective efficacy of this novel vaccine were assessed in mice by using a heterologous prime-boost immunization strategy and compared to those of a conventional strain in which F1 and LcrV were expressed from a single low-copy-number plasmid. The serum antibody responses to lipopolysaccharide (LPS) induced by the optimized bivalent vaccine were indistinguishable from those elicited by the parent strain, suggesting an adequate immunogenic capacity maintained through preservation of bacterial fitness; in contrast, LPS titers were 10-fold lower in mice immunized with the conventional vaccine strain. Importantly, mice receiving the optimized bivalent vaccine were fully protected against lethal pulmonary challenge. These results demonstrate the feasibility of distributing foreign antigen expression across both chromosomal and plasmid locations within a single vaccine organism for induction of protective immunity. PMID:25332120
2004-03-01
EAA21673 1,443 — — Xeroderma pigmentosum G N&I region, helix-hairpin-helix class P.f., P.k., P.b., P.v. PY02286 EAA21722 696 — — Hypothetical protein...ND PY01828 Gene gun 0.1 2,560 640 Pos IM 0.1 Neg Neg ND CSP Gene gun 0.1 2,560 Neg Neg IM 2.7* 2,560 Neg ND a Parasite burden in liver is in...negative; Pos , positive; ND, not done. c Sera tested at a single dilution (1:80). VOL. 72, 2004 DISCOVERY OF PROTECTIVE MALARIA PARASITE ANTIGENS 1599
Iacono-Connors, L C; Novak, J; Rossi, C; Mangiafico, J; Ksiazek, T
1994-01-01
We developed an antigen capture enzyme-linked immunosorbent assay (ELISA) which does not require purified protective antigen (PA) for detection of human antibodies to Bacillus anthracis PA. Lysates of Spodoptera frugiperda (Sf-9) cells infected with recombinant baculovirus containing the PA gene were used as the source of PA to develop the ELISA. Recombinant PA from crude Sf-9 cell lysates or PA purified from B. anthracis Sterne strain was captured by an anti-PA monoclonal antibody coated onto microtiter plates. We demonstrated that human serum antibody titers to PA were identical in the ELISA whether we used crude Sf-9 cell lysates containing recombinant baculovirus-expressed PA or purified Sterne PA. Finally, false-positive results observed in a direct ELISA were eliminated with this antigen capture ELISA. Thus, the antigen capture ELISA with crude preparations of baculovirus-expressed PA is reliable, safe, and inexpensive for determining anti-PA antibody levels in human sera. PMID:7496927
Silveira, Eduardo L. V.; Claser, Carla; Haolla, Filipe A. B.; Zanella, Luiz G.; Rodrigues, Mauricio M.
2008-01-01
Earlier studies have demonstrated in A/Sn mice highly susceptible to Chagas' disease protective immunity against lethal Trypanosoma cruzi infection elicited by vaccination with an open reading frame (ORF) expressed by amastigotes. In our experiments, we used this mouse model to search for other amastigote-expressed ORFs with a similar property. Fourteen ORFs previously determined to be expressed in this developmental stage were individually inserted into a eukaryotic expression vector containing a nucleotide sequence that encoded a mammalian secretory signal peptide. Immunization with 13 of the 14 ORFs induced specific antibodies which recognized the amastigotes. Three of those immune sera also reacted with trypomastigotes and epimastigotes. After a lethal challenge with Y strain trypomastigotes, the vast majority of plasmid-injected mice succumbed to infection. In some cases, a significant delay in mortality was observed. Only two of these ORFs provided protective immunity against the otherwise lethal infection caused by trypomastigotes of the Y or Colombia strain. These ORFs encode members of the trans-sialidase family of surface antigens related to the previously described protective antigen amastigote surface protein 2 (ASP-2). Nevertheless, at the level of antibody recognition, no cross-reactivity was observed between the ORFs and the previously described ASP-2 from the Y strain. In immunofluorescence analyses, we observed the presence of epitopes related to both proteins expressed by amastigotes of seven different strains. In conclusion, our approach allowed us to successfully identify two novel protective ORFs which we consider interesting for future studies on the immune response to Chagas' disease. PMID:18579696
Silveira, Eduardo L V; Claser, Carla; Haolla, Filipe A B; Zanella, Luiz G; Rodrigues, Mauricio M
2008-08-01
Earlier studies have demonstrated in A/Sn mice highly susceptible to Chagas' disease protective immunity against lethal Trypanosoma cruzi infection elicited by vaccination with an open reading frame (ORF) expressed by amastigotes. In our experiments, we used this mouse model to search for other amastigote-expressed ORFs with a similar property. Fourteen ORFs previously determined to be expressed in this developmental stage were individually inserted into a eukaryotic expression vector containing a nucleotide sequence that encoded a mammalian secretory signal peptide. Immunization with 13 of the 14 ORFs induced specific antibodies which recognized the amastigotes. Three of those immune sera also reacted with trypomastigotes and epimastigotes. After a lethal challenge with Y strain trypomastigotes, the vast majority of plasmid-injected mice succumbed to infection. In some cases, a significant delay in mortality was observed. Only two of these ORFs provided protective immunity against the otherwise lethal infection caused by trypomastigotes of the Y or Colombia strain. These ORFs encode members of the trans-sialidase family of surface antigens related to the previously described protective antigen amastigote surface protein 2 (ASP-2). Nevertheless, at the level of antibody recognition, no cross-reactivity was observed between the ORFs and the previously described ASP-2 from the Y strain. In immunofluorescence analyses, we observed the presence of epitopes related to both proteins expressed by amastigotes of seven different strains. In conclusion, our approach allowed us to successfully identify two novel protective ORFs which we consider interesting for future studies on the immune response to Chagas' disease.
2006-12-31
Yersinia pestis capsular F1-V antigen fusion proteins for vaccination against plague Jeremy L. Goodin a,1, David F. Nellis b,1, Bradford S. Powell a, Vinay...USA Received 4 October 2006, and in revised form 19 December 2006 Available online 31 December 2006Abstract The F1-V vaccine antigen, protective...After a two-dose vaccination with 2 · 20 lg of F1-V, respec- tively, 100%, 80%, 80%, and 70% of injected mice survived a subcutaneous lethal plague
Gorantala, Jyotsna; Grover, Sonam; Rahi, Amit; Chaudhary, Prerna; Rajwanshi, Ravi; Sarin, Neera Bhalla; Bhatnagar, Rakesh
2014-04-20
In concern with frequent recurrence of anthrax in endemic areas and inadvertent use of its spores as biological weapon, the development of an effective anthrax vaccine suitable for both human and veterinary needs is highly desirable. A simple oral delivery through expression in plant system could offer promising alternative to the current methods that rely on injectable vaccines extracted from bacterial sources. In the present study, we have expressed protective antigen (PA) gene in Indian mustard by Agrobacterium-mediated transformation and in tobacco by plastid transformation. Putative transgenic lines were verified for the presence of transgene and its expression by molecular analysis. PA expressed in transgenic lines was biologically active as evidenced by macrophage lysis assay. Intraperitoneal (i.p.) and oral immunization with plant PA in murine model indicated high serum PA specific IgG and IgA antibody titers. PA specific mucosal immune response was noted in orally immunized groups. Further, antibodies indicated lethal toxin neutralizing potential in-vitro and conferred protection against in-vivo toxin challenge. Oral immunization experiments demonstrated generation of immunoprotective response in mice. Thus, our study examines the feasibility of oral PA vaccine expressed in an edible plant system against anthrax. Copyright © 2014 Elsevier B.V. All rights reserved.
Liang, Huihuang; Tang, Bin; Zhao, Pengpeng; Deng, Mingyong; Yan, Lili; Zhai, Pan; Wei, Zigong
2018-02-01
Streptococcus equi ssp. zooepidemicus (SEZ) is an important pathogen of swine streptococcal diseases and can infect a wide range of animals as well as human beings. The absence of effective vaccine confounds the control of SEZ infection. Sec_205, a novel protein identified in the previous study, was inducibly over-expressed in Escherichia coli in the present study. The purified recombinant protein could elicit a significant humoral antibody response and provide efficient protection against lethal challenge of SEZ C55138 in mouse model. The protection against SEZ infection was mediated by specific antibodies to Sec_205 to some extent and was identified by the passive protection assay. The Sec_205 was an in vivo-induced antigen confirmed by the real-time PCR and could adhere to the Hep-2 cells by the inhibition assay. These suggest that Sec_205 may play a vital role in pathogenicity and serve as a new vaccine candidate against SEZ infection. Copyright © 2018 Elsevier Ltd. All rights reserved.
Heal, K G; Sheikh, N A; Hollingdale, M R; Morrow, W J; Taylor-Robinson, A W
2001-07-20
We have recently demonstrated that the novel glycoalkaloid tomatine, derived from leaves of the wild tomato Lycopersicon pimpinellifolium, can act as a powerful adjuvant for the elicitation of antigen-specific CD8+ T cell responses. Here, we have extended our previous investigation with the model antigen ovalbumin to an established malaria infection system in mice and evaluated the cellular immune response to a major preerythrocytic stage malaria vaccine candidate antigen when administered with tomatine. The defined MHC H-2kd class I-binding 9-mer peptide (amino acids 252-260) from Plasmodium berghei circumsporozoite (CS) protein was prepared with tomatine to form a molecular aggregate formulation and this used to immunise BALB/c (H-2kd) mice. Antigen-specific IFN-gamma secretion and cytotoxic T lymphocyte activity in vitro were both significantly enhanced compared to responses detected from similarly stimulated splenocytes from naive and tomatine-saline-immunised control mice. Moreover, when challenged with P. berghei sporozoites, mice immunised with the CS 9-mer-tomatine preparation had a significantly delayed onset of erythrocytic infection compared to controls. The data presented validate the use of tomatine to potentiate a cellular immune response to antigenic stimulus by testing in an important biologically relevant system. Specifically, the processing of the P. berghei CS 9-mer as an exogenous antigen and its presentation via MHC class I molecules to CD8+ T cells led to an immune response that is an in vitro correlate of protection against preerythrocytic malaria. This was confirmed by the protective capacity of the 9-mer-tomatine combination upon in vivo immunisation. These findings merit further work to optimise the use of tomatine as an adjuvant in malaria vaccine development.
Andersen, Tor Kristian; Zhou, Fan; Cox, Rebecca; Bogen, Bjarne
2017-01-01
ABSTRACT Zoonotic influenza H7 viral infections have a case fatality rate of about 40%. Currently, no or limited human to human spread has occurred, but we may be facing a severe pandemic threat if the virus acquires the ability to transmit between humans. Novel vaccines that can be rapidly produced for global distribution are urgently needed, and DNA vaccines may be the only type of vaccine that allows for the speed necessary to quench an emerging pandemic. Here, we constructed DNA vaccines encoding the hemagglutinin (HA) from influenza A/chicken/Italy/13474/99 (H7N1). In order to increase the efficacy of DNA vaccination, HA was targeted to either major histocompatibility complex class II molecules or chemokine receptors 1, 3, and 5 (CCR1/3/5) that are expressed on antigen-presenting cells (APC). A single DNA vaccination with APC-targeted HA significantly increased antibody levels in sera compared to nontargeted control vaccines. The antibodies were confirmed neutralizing in an H7 pseudotype-based neutralization assay. Furthermore, the APC-targeted vaccines increased the levels of antigen-specific cytotoxic T cells, and a single DNA vaccination could confer protection against a lethal challenge with influenza A/turkey/Italy/3889/1999 (H7N1) in mice. In conclusion, we have developed a vaccine that rapidly could contribute protection against a pandemic threat from avian influenza. IMPORTANCE Highly pathogenic avian influenza H7 constitute a pandemic threat that can cause severe illness and death in infected individuals. Vaccination is the main method of prophylaxis against influenza, but current vaccine strategies fall short in a pandemic situation due to a prolonged production time and insufficient production capabilities. In contrast, a DNA vaccine can be rapidly produced and deployed to prevent the potential escalation of a highly pathogenic influenza pandemic. We here demonstrate that a single DNA delivery of hemagglutinin from an H7 influenza could mediate full
Rhalem, A; Sahibi, H; Kazanji, M; Laurent, F; Berrag, B; Péry, P
1993-01-01
The transfer of 5 x 10(7) or 10(8) spleen cells from E tenella-infected chickens to virgin animals after 12-20-h in vitro stimulation with whole sporozoite homogenates confers significant protection to recipients. The oocyst contents of ceca on d 7 post-infection with 20,000 E tenella oocysts were (1.33 +/- 1.10) x 10(6) in chickens which received 5 x 10(7) immune cells after 20-h in vitro stimulation and (4.64 +/- 2.85) x 10(6) in chickens receiving 5 x 10(7) stimulated cells from normal chickens (85% protection). Adoptive transfer by spleen cells revealed an asymmetric cross-protection between E tenella and E acervulina. Spleen cells from E tenella immune chickens protected only against a subsequent infection with the same parasite, while spleen cells from E acervulina immune chickens protected against infection with E acervulina (78%) but also against infection with E tenella (68% protection). The common antigen permits better stimulation, but common surface sporozoite antigens purified from E tenella sporozoites via anti-E acervulina biliary antibodies are capable of stimulating both types of cells without, however, changing their properties.
Oscherwitz, Jon; Quinn, Conrad P; Cease, Kemp B
2015-05-11
Epitope-focused immunogens can elicit antibody against the loop neutralizing determinant (LND), a neutralizing epitope found within the 2β2-2β3 loop of protective antigen (PA), which can protect rabbits from high-dose inhalation challenge with Bacillus anthracis Ames strain. Interestingly, data suggests that this epitope is relatively immunosilent in rabbits and non-human primates immunized with full length PA. To determine whether the LND is immunosilent among humans vaccinated with PA, we screened antisera from AVA- or placebo-vaccinees from a clinical trial for antibody reactive with the LND. AVA-vaccinee sera had significant PA-specific antibody compared to placebo-vaccinee sera; however, sera from the two cohorts were indistinguishable with regard to the frequency of individuals with antibody specific for the LND. AVA-vaccinees have a low frequency of antibody reactive with the LND. As with rabbits and non-human primates, the elicitation of LND-specific antibody in humans appears to require immunization with an epitope-focused vaccine. Copyright © 2015 Elsevier Ltd. All rights reserved.
Heath, D G; Anderson, G W; Mauro, J M; Welkos, S L; Andrews, G P; Adamovicz, J; Friedlander, A M
1998-07-01
The current human whole-cell vaccine is ineffective against pneumonic plague caused by typical F1 capsule positive (F1+) strains of Yersinia pestis. The authors found this vaccine to also be ineffective against F1-negative (F1-) Y. pestis strains, which have been isolated from a human case and from rodents. For these reasons, the authors developed a recombinant vaccine composed of a fusion protein of F1 with a second protective immunogen, V antigen. This vaccine protected experimental mice against pneumonic as well as bubonic plague produced by either an F1+ or F1- strain of Y. pestis, gave better protection than F1 or V alone against the F1+ strain, and may provide the basis for an improved human plague vaccine.
Conservation of myeloid surface antigens on primate granulocytes.
Letvin, N L; Todd, R F; Palley, L S; Schlossman, S F; Griffin, J D
1983-02-01
Monoclonal antibodies reactive with myeloid cell surface antigens were used to study evolutionary changes in granulocyte surface antigens from primate species. Certain of these granulocyte membrane antigens are conserved in phylogenetically distant species, indicating the potential functional importance of these structures. The degree of conservation of these antigens reflects the phylogenetic relationship between primate species. Furthermore, species of the same genus show similar patterns of binding to this panel of anti-human myeloid antibodies. This finding of conserved granulocyte surface antigens suggests that non-human primates may provide a model system for exploring uses of monoclonal antibodies in the treatment of human myeloid disorders.
Seed, Kimberley D.; Faruque, Shah M.; Mekalanos, John J.; Calderwood, Stephen B.; Qadri, Firdausi; Camilli, Andrew
2012-01-01
The Vibrio cholerae lipopolysaccharide O1 antigen is a major target of bacteriophages and the human immune system and is of critical importance for vaccine design. We used an O1-specific lytic bacteriophage as a tool to probe the capacity of V. cholerae to alter its O1 antigen and identified a novel mechanism by which this organism can modulate O antigen expression and exhibit intra-strain heterogeneity. We identified two phase variable genes required for O1 antigen biosynthesis, manA and wbeL. manA resides outside of the previously recognized O1 antigen biosynthetic locus, and encodes for a phosphomannose isomerase critical for the initial step in O1 antigen biosynthesis. We determined that manA and wbeL phase variants are attenuated for virulence, providing functional evidence to further support the critical role of the O1 antigen for infectivity. We provide the first report of phase variation modulating O1 antigen expression in V. cholerae, and show that the maintenance of these phase variable loci is an important means by which this facultative pathogen can generate the diverse subpopulations of cells needed for infecting the host intestinal tract and for escaping predation by an O1-specific phage. PMID:23028317
Lopez, Jodie; Bittame, Amina; Massera, Céline; Vasseur, Virginie; Effantin, Grégory; Valat, Anne; Buaillon, Célia; Allart, Sophie; Fox, Barbara A; Rommereim, Leah M; Bzik, David J; Schoehn, Guy; Weissenhorn, Winfried; Dubremetz, Jean-François; Gagnon, Jean; Mercier, Corinne; Cesbron-Delauw, Marie-France; Blanchard, Nicolas
2015-12-15
Apicomplexa parasites such as Toxoplasma gondii target effectors to and across the boundary of their parasitophorous vacuole (PV), resulting in host cell subversion and potential presentation by MHC class I molecules for CD8 T cell recognition. The host-parasite interface comprises the PV limiting membrane and a highly curved, membranous intravacuolar network (IVN) of uncertain function. Here, using a cell-free minimal system, we dissect how membrane tubules are shaped by the parasite effectors GRA2 and GRA6. We show that membrane association regulates access of the GRA6 protective antigen to the MHC I pathway in infected cells. Although insertion of GRA6 in the PV membrane is key for immunogenicity, association of GRA6 with the IVN limits presentation and curtails GRA6-specific CD8 responses in mice. Thus, membrane deformations of the PV regulate access of antigens to the MHC class I pathway, and the IVN may play a role in immune modulation. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.
Luo, Kun; Zhang, Hong; Zavala, Fidel; Biragyn, Arya; Espinosa, Diego A; Markham, Richard B
2014-01-01
Although sterilizing immunity to malaria can be elicited by irradiated sporozoite vaccination, no clinically practical subunit vaccine has been shown to be capable of preventing the approximately 600,000 annual deaths attributed to this infection. DNA vaccines offer several potential advantages for a disease that primarily affects the developing world, but new approaches are needed to improve the immunogenicity of these vaccines. By using a novel, lipid-based adjuvant, Vaxfectin, to attract immune cells to the immunization site, in combination with an antigen-chemokine DNA construct designed to target antigen to immature dendritic cells, we elicited a humoral immune response that provided sterilizing immunity to malaria challenge in a mouse model system. The chemokine, MIP3αCCL20, did not significantly enhance the cellular infiltrate or levels of cytokine or chemokine expression at the immunization site but acted with Vaxfectin to reduce liver stage malaria infection by orders of magnitude compared to vaccine constructs lacking the chemokine component. The levels of protection achieved were equivalent to those observed with irradiated sporozoites, a candidate vaccine undergoing development for further large scale clinical trial. Only vaccination with the combined regimen of adjuvant and chemokine provided 80-100% protection against the development of bloodstream infection. Treating the immunization process as requiring the independent steps of 1) attracting antigen-presenting cells to the site of immunization and 2) specifically directing vaccine antigen to the immature dendritic cells that initiate the adaptive immune response may provide a rational strategy for the development of a clinically applicable malaria DNA vaccine.
Rinchai, Darawan; Presnell, Scott; Vidal, Marta; Dutta, Sheetij; Chauhan, Virander; Cavanagh, David; Moncunill, Gemma; Dobaño, Carlota; Chaussabel, Damien
2017-01-01
Malaria remains a major cause of mortality and morbidity worldwide. Progress has been made in recent years with the development of vaccines that could pave the way towards protection of hundreds of millions of exposed individuals. Here we used a modular repertoire approach to re-analyze a publically available microarray blood transcriptome dataset monitoring the response to malaria vaccination. We report the seminal identification of interferon signatures in the blood of subjects on days 1, 3 and 14 following administration of the third dose of the RTS,S recombinant malaria vaccine. These signatures at day 1 correlate with protection, and at days 3 and 14 to susceptibility to subsequent challenge of study subjects with live parasites. In addition we putatively link the decreased abundance of interferon-inducible transcripts observed at days 3 and 14 post-vaccination with the elicitation of an antigen-specific IgE response in a subset of vaccine recipients that failed to be protected by the RTS,S vaccine. Furthermore, profiling of antigen-specific levels of IgE in a Mozambican cohort of malaria-exposed children vaccinated with RTS,S identified an association between elevated baseline IgE levels and subsequent development of naturally acquired malaria infection during follow up. Taken together these findings warrant further investigation of the role of antigen-specific IgE in conferring susceptibility to malaria infection. PMID:28883910
Wolf, Amaya I.; Mozdzanowska, Krystyna; Williams, Katie L.; Singer, David; Richter, Monique; Hoffmann, Ralf; Caton, Andrew J.; Otvos, Laszlo; Erikson, Jan
2011-01-01
Background The extracellular domain of the influenza A virus protein matrix protein 2 (M2e) is remarkably conserved between various human isolates and thus is a viable target antigen for a universal influenza vaccine. With the goal of inducing protection in multiple mouse haplotypes, M2e-based multiple antigenic peptides (M2e-MAP) were synthesized to contain promiscuous T helper determinants from the Plasmodium falciparum circumsporozoite protein, the hepatitis B virus antigen and the influenza virus hemagglutinin. Here, we investigated the nature of the M2e-MAP-induced B cell response in terms of the distribution of antibody (Ab) secreting cells (ASCs) and Ab isotypes, and tested the protective efficacy in various mouse strains. Methodology/Principal Findings Immunization of BALB/c mice with M2e-MAPs together with potent adjuvants, CpG 1826 oligonucleotides (ODN) and cholera toxin (CT) elicited high M2e-specific serum Ab titers that protected mice against viral challenge. Subcutaneous (s.c.) and intranasal (i.n.) delivery of M2e-MAPs resulted in the induction of IgG in serum and airway secretions, however only i.n. immunization induced anti-M2e IgA ASCs locally in the lungs, correlating with M2-specific IgA in the bronchio-alveolar lavage (BAL). Interestingly, both routes of vaccination resulted in equal protection against viral challenge. Moreover, M2e-MAPs induced cross-reactive and protective responses to diverse M2e peptides and variant influenza viruses. However, in contrast to BALB/c mice, immunization of other inbred and outbred mouse strains did not induce protective Abs. This correlated with a defect in T cell but not B cell responsiveness to the M2e-MAPs. Conclusion/Significance Anti-M2e Abs induced by M2e-MAPs are highly cross-reactive and can mediate protection to variant viruses. Although synthetic MAPs are promising designs for vaccines, future constructs will need to be optimized for use in the genetically heterogeneous human population. PMID
Wolf, Amaya I; Mozdzanowska, Krystyna; Williams, Katie L; Singer, David; Richter, Monique; Hoffmann, Ralf; Caton, Andrew J; Otvos, Laszlo; Erikson, Jan
2011-01-01
The extracellular domain of the influenza A virus protein matrix protein 2 (M2e) is remarkably conserved between various human isolates and thus is a viable target antigen for a universal influenza vaccine. With the goal of inducing protection in multiple mouse haplotypes, M2e-based multiple antigenic peptides (M2e-MAP) were synthesized to contain promiscuous T helper determinants from the Plasmodium falciparum circumsporozoite protein, the hepatitis B virus antigen and the influenza virus hemagglutinin. Here, we investigated the nature of the M2e-MAP-induced B cell response in terms of the distribution of antibody (Ab) secreting cells (ASCs) and Ab isotypes, and tested the protective efficacy in various mouse strains. Immunization of BALB/c mice with M2e-MAPs together with potent adjuvants, CpG 1826 oligonucleotides (ODN) and cholera toxin (CT) elicited high M2e-specific serum Ab titers that protected mice against viral challenge. Subcutaneous (s.c.) and intranasal (i.n.) delivery of M2e-MAPs resulted in the induction of IgG in serum and airway secretions, however only i.n. immunization induced anti-M2e IgA ASCs locally in the lungs, correlating with M2-specific IgA in the bronchio-alveolar lavage (BAL). Interestingly, both routes of vaccination resulted in equal protection against viral challenge. Moreover, M2e-MAPs induced cross-reactive and protective responses to diverse M2e peptides and variant influenza viruses. However, in contrast to BALB/c mice, immunization of other inbred and outbred mouse strains did not induce protective Abs. This correlated with a defect in T cell but not B cell responsiveness to the M2e-MAPs. Anti-M2e Abs induced by M2e-MAPs are highly cross-reactive and can mediate protection to variant viruses. Although synthetic MAPs are promising designs for vaccines, future constructs will need to be optimized for use in the genetically heterogeneous human population.
Antigen Availability Shapes T Cell Differentiation and Function during Tuberculosis.
Moguche, Albanus O; Musvosvi, Munyaradzi; Penn-Nicholson, Adam; Plumlee, Courtney R; Mearns, Helen; Geldenhuys, Hennie; Smit, Erica; Abrahams, Deborah; Rozot, Virginie; Dintwe, One; Hoff, Søren T; Kromann, Ingrid; Ruhwald, Morten; Bang, Peter; Larson, Ryan P; Shafiani, Shahin; Ma, Shuyi; Sherman, David R; Sette, Alessandro; Lindestam Arlehamn, Cecilia S; McKinney, Denise M; Maecker, Holden; Hanekom, Willem A; Hatherill, Mark; Andersen, Peter; Scriba, Thomas J; Urdahl, Kevin B
2017-06-14
CD4 T cells are critical for protective immunity against Mycobacterium tuberculosis (Mtb), the cause of tuberculosis (TB). Yet to date, TB vaccine candidates that boost antigen-specific CD4 T cells have conferred little or no protection. Here we examined CD4 T cell responses to two leading TB vaccine antigens, ESAT-6 and Ag85B, in Mtb-infected mice and in vaccinated humans with and without underlying Mtb infection. In both species, Mtb infection drove ESAT-6-specific T cells to be more differentiated than Ag85B-specific T cells. The ability of each T cell population to control Mtb in the lungs of mice was restricted for opposite reasons: Ag85B-specific T cells were limited by reduced antigen expression during persistent infection, whereas ESAT-6-specific T cells became functionally exhausted due to chronic antigenic stimulation. Our findings suggest that different vaccination strategies will be required to optimize protection mediated by T cells recognizing antigens expressed at distinct stages of Mtb infection. Copyright © 2017 Elsevier Inc. All rights reserved.
Total Leishmania antigens with Poly(I:C) induce Th1 protective response.
Sanchez, M V; Eliçabe, R J; Di Genaro, M S; Germanó, M J; Gea, S; García Bustos, M F; Salomón, M C; Scodeller, E A; Cargnelutti, D E
2017-11-01
Our proposal was to develop a vaccine based on total Leishmania antigens (TLA) adjuvanted with polyinosinic-polycytidylic acid [Poly(I:C)] able to induce a Th1 response which can provide protection against Leishmania infection. Mice were vaccinated with two doses of TLA-Poly(I:C) administered by subcutaneous route at 3-week interval. Humoral and cellular immune responses induced by the immunization were measured. The protective efficacy of the vaccine was evaluated by challenging mice with infective promastigotes of Leishmania (Leishmania) amazonensis into the footpad. Mice vaccinated with TLA-Poly(I:C) showed a high anti-Leishmania IgG titre, as well as increased IgG1 and IgG2a subclass titres compared with mice vaccinated with the TLA alone. The high IgG2a indicated a Th1 bias response induced by the TLA-Poly(I:C) immunization. Accordingly, the cellular immune response elicited by the formulation was characterized by an increased production of IFN-γ and no significant production of IL-4. The TLA-Poly(I:C) immunization elicited good protection, which was associated with decreased footpad swelling, a lower parasite load and a reduced histopathological alteration in the footpad. Our findings demonstrate a promising vaccine against cutaneous leishmaniasis that is relatively economic and easy to develop and which should be taken into account for preventing leishmaniasis in developing countries. © 2017 John Wiley & Sons Ltd.
Gazi, Michal; Caro-Gomez, Erika; Goez, Yenny; Cespedes, Maria A; Hidalgo, Marylin; Correa, Paula; Valbuena, Gustavo
2013-01-01
Rickettsia prowazekii has been tested for biological warfare due to the high mortality that it produces after aerosol transmission of very low numbers of rickettsiae. Epidemic typhus, the infection caused by these obligately intracellular bacteria, continues to be a threat because it is difficult to diagnose due to initial non-specific symptoms and the lack of commercial diagnostic tests that are sensitive and specific during the initial clinical presentation. A vaccine to prevent epidemic typhus would constitute an effective deterrent to the weaponization of R. prowazekii; however, an effective and safe vaccine is not currently available. Due to the cytoplasmic niche of Rickettsia, CD8(+) T-cells are critical effectors of immunity; however, the identification of antigens recognized by these cells has not been systematically addressed. To help close this gap, we designed an antigen discovery strategy that uses cell-based vaccination with antigen presenting cells expressing microbe's proteins targeted to the MHC class I presentation pathway. We report the use of this method to discover a protective T-cell rickettsial antigen, RP884, among a test subset of rickettsial proteins.
Xie, Yi-Ting; Gao, Jiang-Mei; Wu, Ya-Ping; Tang, Petrus; Hide, Geoff; Lai, De-Hua; Lun, Zhao-Rong
2017-02-16
stimulation with the corresponding antigens in vitro. Immunization with both ACT-F and ACT-T could confer partial to complete protection and trigger strong Th1/Th2 mixed humoral and cellular immune responses in the mouse host. This suggested that recombinant α-actinin subunit antigens may be promising vaccine candidates against trichomoniasis.
Li, Xiaoyan; Ni, Runzhou
2016-11-01
There are over 350 million chronic carriers of hepatitis B virus (HBV) in the world, of whom about a third eventually develop severe HBV-related complications. HBV contributes to liver cirrhosis and hepatocellular carcinoma development. Remarkable progress has been made in selective inhibition of HBV replication by nucleoside analogs. However, how to generate protective antibody of HBsAb in HBV-infected patients after HBV-DNA becomes negative still remains a challenge for scientists. In this study, we show that OmpC-HBsAg 'a' epitope chimeric protein vaccine can break HBV tolerance and induce protective immunity in HBV transgenic mice based on mimicking T cell-independent antigen to bypass T cells from the adaptive immune system. The antibodies induced by the vaccine have the ability to prevent HBV virion infection of human hepatocytes.
Patel, Jaina M; Vartabedian, Vincent F; Bozeman, Erica N; Caoyonan, Brianne E; Srivatsan, Sanjay; Pack, Christopher D; Dey, Paulami; D'Souza, Martin J; Yang, Lily; Selvaraj, Periasamy
2016-01-01
Antigen delivered within particulate materials leads to enhanced antigen-specific immunity compared to soluble administration of antigen. However, current delivery approaches for antigen encapsulated in synthetic particulate materials are limited by the complexity of particle production that affects stability and immunogenicity of the antigen. Herein, we describe a protein delivery system that utilizes plasma membrane vesicles (PMVs) derived from biological materials such as cultured cells or isolated tissues and a simple protein transfer technology. We show that these particulate PMVs can be easily modified within 4 h by a protein transfer process to stably incorporate a glycosylphosphatidylinositol (GPI)-anchored form of the breast cancer antigen HER-2 onto the PMV surface. Immunization of mice with GPI-HER-2-modified-PMVs induced strong HER-2-specific antibody responses and protection from tumor challenge in two different breast cancer models. Further incorporation of the immunostimulatory molecules IL-12 and B7-1 onto the PMVs by protein transfer enhanced tumor protection and induced beneficial Th1 and Th2-type HER-2-specific immune responses. Since protein antigens can be easily converted to GPI-anchored forms, these results demonstrate that isolated plasma membrane vesicles can be modified with desired antigens along with immunostimulatory molecules by protein transfer and used as a vaccine delivery vehicle to elicit potent antigen-specific immunity. Copyright © 2015 Elsevier Ltd. All rights reserved.
Cui, Jing; Ren, Hui Jun; Liu, Ruo Dan; Wang, Li; Zhang, Zi Fang; Wang, Zhong Quan
2013-02-06
Trichinellosis is a public health problem and is considered an emerging/re-emerging disease in various countries. The etiological agent of trichinellosis is the nematode Trichinella, which infects humans, domestic animals and wildlife. A veterinary vaccine could be an option to control the disease in domestic animals. Although several vaccine candidates have shown promising results, a vaccine against trichinellosis remains unavailable to date. Phage particles are especially ideal vaccine delivery vehicles because they do not interfere with the immune response against the displayed peptide antigens, and, if anything, are more likely to efficiently direct antigen expression to professional antigen-presenting cells. In this study, Tsp10 polypeptide, which was encoded by a cDNA fragment of Trichinella spiralis intestinal infective larvae and was found to bind to normal mouse intestinal cells, was displayed on the surface of T7 phage. Anti-Tsp10 antibodies were able to recognize the native Tsp10 protein mainly localized to the stichosome of T. spiralis. Mice immunized with the recombinant phage T7-Tsp10 showed a 62.8% reduction in adult worms and a 78.6% reduction in muscle larvae following challenge with T. spiralis muscle larvae. Our results demonstrate that the vaccination with Tsp10 polypeptide displayed by T7 phage elicits the Th2-predominant immune responses and produces a significant protection against T. spiralis infection in mice. These findings suggest that phage display is a simple, efficient, and promising tool to express candidate vaccine antigens for immunization against T. spiralis. Copyright © 2013 Elsevier Ltd. All rights reserved.
Anthrax biosensor, protective antigen ion channel asymmetric blockade.
Halverson, Kelly M; Panchal, Rekha G; Nguyen, Tam L; Gussio, Rick; Little, Stephen F; Misakian, Martin; Bavari, Sina; Kasianowicz, John J
2005-10-07
The significant threat posed by biological agents (e.g. anthrax, tetanus, botulinum, and diphtheria toxins) (Inglesby, T. V., O'Toole, T., Henderson, D. A., Bartlett, J. G., Ascher, M. S., Eitzen, E., Friedlander, A. M., Gerberding, J., Hauer, J., Hughes, J., McDade, J., Osterholm, M. T., Parker, G., Perl, T. M., Russell, P. K., and Tonat, K. (2002) J. Am. Med. Assoc. 287, 2236-2252) requires innovative technologies and approaches to understand the mechanisms of toxin action and to develop better therapies. Anthrax toxins are formed from three proteins secreted by fully virulent Bacillus anthracis, protective antigen (PA, 83 kDa), lethal factor (LF, 90 kDa), and edema factor (EF, 89 kDa). Here we present electrophysiological measurements demonstrating that full-length LF and EF convert the current-voltage relationship of the heptameric PA63 ion channel from slightly nonlinear to highly rectifying and diode-like at pH 6.6. This effect provides a novel method for characterizing functional toxin interactions. The method confirms that a previously well characterized PA63 monoclonal antibody, which neutralizes anthrax lethal toxin in animals in vivo and in vitro, prevents the binding of LF to the PA63 pore. The technique can also detect the presence of anthrax lethal toxin complex from plasma of infected animals. The latter two results suggest the potential application of PA63 nanopore-based biosensors in anthrax therapeutics and diagnostics.
Controlled Release of Antigens for One Dose Immunization
1983-01-01
microencapsulation of antigen coated alum or by microencapsulating clusters of smaller ( microns) microcapsules . Microcapsules under 10 microns in... microencapsulation were studied to determine what criteria must be satisfied to provide a protective immune response to hepatitis B surface antigen... microencapsulated in poly (DL-lactide-co- glycolide) in a form that was too large to be phagocytized and had an antigen release profile similar to that achieved with
Martinez-Campos, Viridiana; Martinez-Vega, Pedro; Ramirez-Sierra, Maria Jesus; Rosado-Vallado, Miguel; Seid, Christopher A; Hudspeth, Elissa M; Wei, Junfei; Liu, Zhuyun; Kwityn, Cliff; Hammond, Molly; Ortega-López, Jaime; Zhan, Bin; Hotez, Peter J; Bottazzi, Maria Elena; Dumonteil, Eric
2015-08-26
The Tc24 calcium binding protein from the flagellar pocket of Trypanosoma cruzi is under evaluation as a candidate vaccine antigen against Chagas disease. Previously, a DNA vaccine encoding Tc24 was shown to be an effective vaccine (both as a preventive and therapeutic intervention) in mice and dogs, as evidenced by reductions in T. cruzi parasitemia and cardiac amastigotes, as well as reduced cardiac inflammation and increased host survival. Here we developed a suitable platform for the large scale production of recombinant Tc24 (rTc24) and show that when rTc24 is combined with a monophosphoryl-lipid A (MPLA) adjuvant, the formulated vaccine induces a Th1-biased immune response in mice, comprised of elevated IgG2a antibody levels and interferon-gamma levels from splenocytes, compared to controls. These immune responses also resulted in statistically significant decreased T. cruzi parasitemia and cardiac amastigotes, as well as increased survival following T. cruzi challenge infections, compared to controls. Partial protective efficacy was shown regardless of whether the antigen was expressed in Escherichia coli or in yeast (Pichia pastoris). While mouse vaccinations will require further modifications in order to optimize protective efficacy, such studies provide a basis for further evaluations of vaccines comprised of rTc24, together with alternative adjuvants and additional recombinant antigens. Copyright © 2015. Published by Elsevier Ltd.
Two SmDLC antigens as potential vaccines against schistosomiasis.
Diniz, Patricia Placoná; Nakajima, Erika; Miyasato, Patricia Aoki; Nakano, Eliana; de Oliveira Rocha, Márcia; Martins, Elizabeth Angelica Leme
2014-12-01
The Schistosoma mansoni transcriptome revealed new members of the dynein light chain family (DLC/LC8). The antigenicity and immunogenicity of these proteins, and their potential as vaccine candidates were investigated. Two DLC genes (DLC12_JI392413.1 and DLC13_JI387686.1) were cloned and the recombinant proteins produced in E. coli. The immunization of mice with the rDLCs, using alhydrogel as adjuvant, resulted in high titers of antibodies, indicated that these proteins are highly immunogenic. The anti-DLCs antibodies presented cross reactivity with both recombinant antigens and also recognized proteins from S. mansoni adult worm extracts. The DLC12 and DLC13 immunized animals were challenged by infection with cercariae and a protective profile was observed in three different assays, with a significant decreased in worm burden, of 43% and 51% respectively, when compared to the non-vaccinated group. The granulomas formation due to egg retention in the hepatic tissues was evaluated 45 days after infection. Smaller granulomas were observed in the liver of DLC immunized animals, up to 70% reduction in comparison to the granulomas size in the non-vaccinated animals. Fifty-five days after infection, the average size of the hepatic granulomas was still 25-35% smaller in the DLCs vaccinated groups. The interference of DLC immunization on the hepatic granuloma formation may reflect the lower worm burden and consequent decrease on the number of eggs retained in the liver, resulting in lower pro-inflammatory level in the tissue. The protective effect of DLCs immunization, decreasing the worm burden and delaying the rate of granuloma formation, suggests that these antigens should be further studied as potential vaccine candidates. Copyright © 2014 Elsevier B.V. All rights reserved.
McComb, Ryan C; Ho, Chi-Lee; Bradley, Kenneth A; Grill, Laurence K; Martchenko, Mikhail
2015-11-27
The current anthrax vaccine requires improvements for rapidly invoking longer-lasting neutralizing antibody responses with fewer doses from a well-defined formulation. Designing antigens that target neutralizing antibody epitopes of anthrax protective antigen, a component of anthrax toxin, may offer a solution for achieving a vaccine that can induce strong and long lasting antibody responses with fewer boosters. Here we report implementation of a strategy for developing epitope focused virus nanoparticle vaccines against anthrax by using immunogenic virus particles to present peptides derived from anthrax toxin previously identified in (1) neutralizing antibody epitope mapping studies, (2) toxin crystal structure analyses to identify functional regions, and (3) toxin mutational analyses. We successfully expressed two of three peptide epitopes from anthrax toxin that, in previous reports, bound antibodies that were partially neutralizing against toxin activity, discovered cross-reactivity between vaccine constructs and toxin specific antibodies raised in goats against native toxin and showed that antibodies induced by our vaccine constructs also cross-react with native toxin. While protection against intoxication in cellular and animal studies were not as effective as in previous studies, partial toxin neutralization was observed in animals, demonstrating the feasibility of using plant-virus nanoparticles as a platform for epitope defined anthrax vaccines. Copyright © 2015 Elsevier Ltd. All rights reserved.
Tang, Xinming; Liu, Xianyong; Yin, Guangwen; Suo, Jingxia; Tao, Geru; Zhang, Sixin; Suo, Xun
2017-01-01
Vaccine delivery is critical in antigen discovery and vaccine efficacy and safety. The diversity of infectious diseases in humans and livestock has required the development of varied delivery vehicles to target different pathogens. In livestock animals, previous strategies for the development of coccidiosis vaccines have encountered several hurdles, limiting the development of multiple species vaccine formulations. Here, we describe a novel vaccine delivery system using transgenic Eimeria tenella expressing immunodominant antigens of Eimeria maxima . In this delivery system, the immune mapped protein 1 of E. maxima (EmIMP1) was delivered by the closely related species of E. tenella to the host immune system during the whole endogenous life cycle. The overexpression of the exogenous antigen did not interfere with the reproduction and immunogenicity of transgenic Eimeria . After immunization with the transgenic parasite, we detected EmIMP1's and E. maxima oocyst antigens' specific humoral and cellular immune responses. In particular, we observed partial protection of chickens immunized with transgenic E. tenella against subsequent E. maxima infections. Our results demonstrate that the transgenic Eimeria parasite is an ideal coccidia antigen delivery vehicle and represents a new type of coccidiosis vaccines. In addition, this model could potentially be used in the development of malaria live sporozoite vaccines, in which antigens from different strains can be expressed in the vaccine strain.
Zimmerman, Shawn M; Dyke, Jeremy S; Jelesijevic, Tomislav P; Michel, Frank; Lafontaine, Eric R; Hogan, Robert J
2017-08-01
Burkholderia mallei , a facultative intracellular bacterium and tier 1 biothreat, causes the fatal zoonotic disease glanders. The organism possesses multiple genes encoding autotransporter proteins, which represent important virulence factors and targets for developing countermeasures in pathogenic Gram-negative bacteria. In the present study, we investigated one of these autotransporters, BatA, and demonstrate that it displays lipolytic activity, aids in intracellular survival, is expressed in vivo , elicits production of antibodies during infection, and contributes to pathogenicity in a mouse aerosol challenge model. A mutation in the batA gene of wild-type strain ATCC 23344 was found to be particularly attenuating, as BALB/c mice infected with the equivalent of 80 median lethal doses cleared the organism. This finding prompted us to test the hypothesis that vaccination with the batA mutant strain elicits protective immunity against subsequent infection with wild-type bacteria. We discovered that not only does vaccination provide high levels of protection against lethal aerosol challenge with B. mallei ATCC 23344, it also protects against infection with multiple isolates of the closely related organism and causative agent of melioidosis, Burkholderia pseudomallei Passive-transfer experiments also revealed that the protective immunity afforded by vaccination with the batA mutant strain is predominantly mediated by IgG antibodies binding to antigens expressed exclusively in vivo Collectively, our data demonstrate that BatA is a target for developing medical countermeasures and that vaccination with a mutant lacking expression of the protein provides a platform to gain insights regarding mechanisms of protective immunity against B. mallei and B. pseudomallei , including antigen discovery. Copyright © 2017 American Society for Microbiology.
Zimmerman, Shawn M.; Dyke, Jeremy S.; Jelesijevic, Tomislav P.; Michel, Frank; Lafontaine, Eric R.
2017-01-01
ABSTRACT Burkholderia mallei, a facultative intracellular bacterium and tier 1 biothreat, causes the fatal zoonotic disease glanders. The organism possesses multiple genes encoding autotransporter proteins, which represent important virulence factors and targets for developing countermeasures in pathogenic Gram-negative bacteria. In the present study, we investigated one of these autotransporters, BatA, and demonstrate that it displays lipolytic activity, aids in intracellular survival, is expressed in vivo, elicits production of antibodies during infection, and contributes to pathogenicity in a mouse aerosol challenge model. A mutation in the batA gene of wild-type strain ATCC 23344 was found to be particularly attenuating, as BALB/c mice infected with the equivalent of 80 median lethal doses cleared the organism. This finding prompted us to test the hypothesis that vaccination with the batA mutant strain elicits protective immunity against subsequent infection with wild-type bacteria. We discovered that not only does vaccination provide high levels of protection against lethal aerosol challenge with B. mallei ATCC 23344, it also protects against infection with multiple isolates of the closely related organism and causative agent of melioidosis, Burkholderia pseudomallei. Passive-transfer experiments also revealed that the protective immunity afforded by vaccination with the batA mutant strain is predominantly mediated by IgG antibodies binding to antigens expressed exclusively in vivo. Collectively, our data demonstrate that BatA is a target for developing medical countermeasures and that vaccination with a mutant lacking expression of the protein provides a platform to gain insights regarding mechanisms of protective immunity against B. mallei and B. pseudomallei, including antigen discovery. PMID:28507073
Original antigenic sin responses to influenza viruses.
Kim, Jin Hyang; Skountzou, Ioanna; Compans, Richard; Jacob, Joshy
2009-09-01
Most immune responses follow Burnet's rule in that Ag recruits specific lymphocytes from a large repertoire and induces them to proliferate and differentiate into effector cells. However, the phenomenon of "original antigenic sin" stands out as a paradox to Burnet's rule of B cell engagement. Humans, upon infection with a novel influenza strain, produce Abs against older viral strains at the expense of responses to novel, protective antigenic determinants. This exacerbates the severity of the current infection. This blind spot of the immune system and the redirection of responses to the "original Ag" rather than to novel epitopes were described fifty years ago. Recent reports have questioned the existence of this phenomenon. Hence, we revisited this issue to determine the extent to which original antigenic sin is induced by variant influenza viruses. Using two related strains of influenza A virus, we show that original antigenic sin leads to a significant decrease in development of protective immunity and recall responses to the second virus. In addition, we show that sequential infection of mice with two live influenza virus strains leads to almost exclusive Ab responses to the first viral strain, suggesting that original antigenic sin could be a potential strategy by which variant influenza viruses subvert the immune system.
Van Blarcom, Thomas J.; Sofer-Podesta, Carolina; Ang, John; Boyer, Julie L.; Crystal, Ronald G.; Georgiou, George
2013-01-01
Genetic transfer of neutralizing antibodies has been shown to confer strong and persistent protection against bacterial and viral infectious agents. While it is well established that for many exogenous neutralizing antibodies increased antigen affinity correlates with protection, the effect of antigen affinity on antibodies produced in situ following adenoviral gene transfer has not been examined. The mouse IgG2b monoclonal antibody 2C12.4 recognizes the Yersinia pestis Type III secretion apparatus protein LcrV (V antigen) and confers protection in mice when administered as an IgG intraperitoneally or, following genetic immunization with engineered, replication-defective serotype 5 human adenovirus (Ad) 1. 2C12.4 was expressed as a scFv fragment in E. coli and was shown to display a KD=3.5 nM by surface plasmon resonance (SPR) analysis. The 2C12.4 scFv was subjected to random mutagenesis and variants with increased affinity were isolated by flow cytometry using the Anchored Periplasmic Expression (APEx) bacterial display system. After a single round of mutagenesis, variants displaying up to 35-fold lower KD values (H8, KD=100 pM) were isolated. The variable domains of the H8 scFv were used to replace those of the parental 2C12.4 IgG encoded in the Ad vector, AdαV giving rise to AdαV.H8. The two adenoviral vectors resulted in similar titers of anti-V antigen antibodies 3 days post-immunization with 109, 1010 or 1011 particle units. Following intranasal challenge with 363 LD50Y. pestis CO92, 54% of the mice immunized with 1010 pu of AdαV.H8 survived at the 14 day end point compared to only 15% survivors for the group immunized with AdαV expressing the lower affinity 2C12.4 (P<0.04, AdαV versus AdαV.H8). These results indicate that affinity maturation of a neutralizing antibody delivered by genetic transfer may confer increased protection not only for Y. pestis challenge but possibly for other pathogens. PMID:20393511
Shearer, M H; Bright, R K; Lanford, R E; Kennedy, R C
1993-01-01
In this study, we examined the humoral immune responses and in vivo tumour immunity induced by baculovirus recombinant simian virus 40 (SV40) large tumour antigen (rSV40 T-ag). BALB/c mice immunized with rSV40 T-ag produced antibody responses that recognized SV40 large tumour antigen (T-ag) by ELISA. Analysis of these anti-SV40 T-ag responses indicated that the antibodies recognized epitopes associated with both the carboxy and amino terminus of SV40 T-ag. This pattern of SV40 T-ag epitope recognition was similar to that observed in anti-SV40 T-ag responses induced by inoculation with irradiated SV40-transformed cells. Mice immunized with either rSV40 T-ag or with the inactivated transformed cells were protected from a subsequent in vivo lethal tumour challenge with live SV40-transformed cells. These studies suggest that humoral immune responses induced by rSV40 T-ag are similar in epitope specificity to that induced by inactivated SV40-transformed cells. In addition, recombinant tumour-specific antigens from papovaviruses, such as SV40, can be used to induce tumour immunity which protects from a subsequent lethal tumour challenge. This study may provide insight into the use of recombinant tumour antigens as putative tumour vaccines and in the development of active immunotherapeutic strategies for treating virus-induced cancers. PMID:7679059
Tian, Lu; Li, Wenyu; Huang, Xinmei; Tian, Di; Liu, Jianhua; Yang, Xinchao; Liu, Lianrui; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui; Song, Xiaokai
2017-01-01
Coccidiosis is an intestinal disorder of poultry and often caused by simultaneous infections of several Eimeria species. GAPDH is one of the immunogenic common antigens among Eimeria tenella, E. acervulina, and E. maxima identified in our previous study. The present study was performed to further evaluate its immunogenicity and protective efficacy. The genes of GAPDH cloned from E. acervulina and E. maxima were named as EaGAPDH and EmGAPDH, respectively. The immunogenicity of recombinant proteins of EaGAPDH and EmGAPDH were analyzed by Western blot. The transcription and expression of pVAX-EaGAPDH and pVAX-EmGAPDH in the injected muscles were detected by reverse transcription PCR (RT-PCR) and Western blot, respectively. GAPDH-induced changes of T lymphocytes subpopulation, cytokines production, and antibody were determined using flow cytometry, quantitative real-time PCR (qPCR), and ELISA, respectively. Finally, the protective efficacies of pVAX-EaGAPDH and pVAX-EmGAPDH were evaluated by vaccination and challenge experiments. The results revealed that the recombinant GAPDH proteins reacted with the corresponding chicken antisera. The EaGAPDH genes were successfully transcribed and expressed in the injected muscles. Vaccination with pVAX-EaGAPDH and pVAX-EmGAPDH significantly increased the proportion of CD4+ and CD8+ T lymphocytes, the cytokines productions of IFN-γ, IL-2, IL-4 et al., and IgG antibody levels compared to controls. The vaccination increased the weight gains, decreased the oocyst outputs, alleviate the enteric lesions compared to controls, and induced moderate anti-coccidial index (ACI). In conclusion, the coccidial common antigen of GAPDH induced significant humoral and cellular immune response and effective protection against E. tenella, E. acervulina, E. maxima, and mixed infection of the three Eimeria species. PMID:28769877
Obaldia, Nicanor; Stockelman, Michael G; Otero, William; Cockrill, Jennifer A; Ganeshan, Harini; Abot, Esteban N; Zhang, Jianfeng; Limbach, Keith; Charoenvit, Yupin; Doolan, Denise L; Tang, De-Chu C; Richie, Thomas L
2017-04-01
Malaria is caused by parasites of the genus Plasmodium , which are transmitted to humans by the bites of Anopheles mosquitoes. After the elimination of Plasmodium falciparum , it is predicted that Plasmodium vivax will remain an important cause of morbidity and mortality outside Africa, stressing the importance of developing a vaccine against P. vivax malaria. In this study, we assessed the immunogenicity and protective efficacy of two P. vivax antigens, apical membrane antigen 1 (AMA1) and the 42-kDa C-terminal fragment of merozoite surface protein 1 (MSP1 42 ) in a plasmid recombinant DNA prime/adenoviral (Ad) vector boost regimen in Aotus monkeys. Groups of 4 to 5 monkeys were immunized with plasmid DNA alone, Ad alone, prime/boost regimens with each antigen, prime/boost regimens with both antigens, and empty vector controls and then subjected to blood-stage challenge. The heterologous immunization regimen with the antigen pair was more protective than either antigen alone or both antigens delivered with a single vaccine platform, on the basis of their ability to induce the longest prepatent period and the longest time to the peak level of parasitemia, the lowest peak and mean levels of parasitemia, the smallest area under the parasitemia curve, and the highest self-cure rate. Overall, prechallenge MSP1 42 antibody titers strongly correlated with a decreased parasite burden. Nevertheless, a significant proportion of immunized animals developed anemia. In conclusion, the P. vivax plasmid DNA/Ad serotype 5 vaccine encoding blood-stage parasite antigens AMA1 and MSP1 42 in a heterologous prime/boost immunization regimen provided significant protection against blood-stage challenge in Aotus monkeys, indicating the suitability of these antigens and this regimen for further development. Copyright © 2017 American Society for Microbiology.
Erova, Tatiana E; Rosenzweig, Jason A; Sha, Jian; Suarez, Giovanni; Sierra, Johanna C; Kirtley, Michelle L; van Lier, Christina J; Telepnev, Maxim V; Motin, Vladimir L; Chopra, Ashok K
2013-02-01
Plague caused by Yersinia pestis manifests itself in bubonic, septicemic, and pneumonic forms. Although the U.S. Food and Drug Administration recently approved levofloxacin, there is no approved human vaccine against plague. The capsular antigen F1 and the low-calcium-response V antigen (LcrV) of Y. pestis represent excellent vaccine candidates; however, the inability of the immune responses to F1 and LcrV to provide protection against Y. pestis F1(-) strains or those which harbor variants of LcrV is a significant concern. Here, we show that the passive transfer of hyperimmune sera from rats infected with the plague bacterium and rescued by levofloxacin protected naive animals against pneumonic plague. Furthermore, 10 to 12 protein bands from wild-type (WT) Y. pestis CO92 reacted with the aforementioned hyperimmune sera upon Western blot analysis. Based on mass spectrometric analysis, four of these proteins were identified as attachment invasion locus (Ail/OmpX), plasminogen-activating protease (Pla), outer membrane protein A (OmpA), and F1. The genes encoding these proteins were cloned, and the recombinant proteins purified from Escherichia coli for immunization purposes before challenging mice and rats with either the F1(-) mutant or WT CO92 in bubonic and pneumonic plague models. Although antibodies to Ail and OmpA protected mice against bubonic plague when challenged with the F1(-) CO92 strain, Pla antibodies were protective against pneumonic plague. In the rat model, antibodies to Ail provided protection only against pneumonic plague after WT CO92 challenge. Together, the addition of Y. pestis outer membrane proteins to a new-generation recombinant vaccine could provide protection against a wide variety of Y. pestis strains.
Erova, Tatiana E.; Rosenzweig, Jason A.; Sha, Jian; Suarez, Giovanni; Sierra, Johanna C.; Kirtley, Michelle L.; van Lier, Christina J.; Telepnev, Maxim V.; Motin, Vladimir L.
2013-01-01
Plague caused by Yersinia pestis manifests itself in bubonic, septicemic, and pneumonic forms. Although the U.S. Food and Drug Administration recently approved levofloxacin, there is no approved human vaccine against plague. The capsular antigen F1 and the low-calcium-response V antigen (LcrV) of Y. pestis represent excellent vaccine candidates; however, the inability of the immune responses to F1 and LcrV to provide protection against Y. pestis F1− strains or those which harbor variants of LcrV is a significant concern. Here, we show that the passive transfer of hyperimmune sera from rats infected with the plague bacterium and rescued by levofloxacin protected naive animals against pneumonic plague. Furthermore, 10 to 12 protein bands from wild-type (WT) Y. pestis CO92 reacted with the aforementioned hyperimmune sera upon Western blot analysis. Based on mass spectrometric analysis, four of these proteins were identified as attachment invasion locus (Ail/OmpX), plasminogen-activating protease (Pla), outer membrane protein A (OmpA), and F1. The genes encoding these proteins were cloned, and the recombinant proteins purified from Escherichia coli for immunization purposes before challenging mice and rats with either the F1− mutant or WT CO92 in bubonic and pneumonic plague models. Although antibodies to Ail and OmpA protected mice against bubonic plague when challenged with the F1− CO92 strain, Pla antibodies were protective against pneumonic plague. In the rat model, antibodies to Ail provided protection only against pneumonic plague after WT CO92 challenge. Together, the addition of Y. pestis outer membrane proteins to a new-generation recombinant vaccine could provide protection against a wide variety of Y. pestis strains. PMID:23239803
Antigenic Distance Measurements for Seasonal Influenza Vaccine Selection
Cai, Zhipeng; Zhang, Tong; Wan, Xiu-Feng
2011-01-01
Influenza vaccination is one of the major options to counteract the effects of influenza diseases. Selection of an effective vaccine strain is the key to the success of an effective vaccination program since vaccine protection can only be achieved when the selected influenza vaccine strain matches the antigenic variants causing future outbreaks. Identification of an antigenic variant is the first step to determine whether vaccine strain needs to be updated. Antigenic distance derived from immunological assays, such as hemagglutination inhibition, is commonly used to measure the antigenic closeness between circulating strains and the current influenza vaccine strain. Thus, consensus on an explicit and robust antigenic distance measurement is critical in influenza surveillance. Based on the current seasonal influenza surveillance procedure, we propose and compare three antigenic distance measurements, including Average antigenic distance (A-distance), Mutual antigenic distance (M-distance), and Largest antigenic distance (L-distance). With the assistance of influenza antigenic cartography, our simulation results demonstrated that M-distance is a robust influenza antigenic distance measurement. Experimental results on both simulation and seasonal influenza surveillance data demonstrate that M-distance can be effectively utilized in influenza vaccine strain selection. PMID:22063385
Structural basis for the unfolding of anthrax lethal factor by protective antigen oligomers
Feld, Geoffrey K.; Thoren, Katie L.; Kintzer, Alexander F.; Sterling, Harry J.; Tang, Iok I.; Greenberg, Shoshana G.; Williams, Evan R.; Krantz, Bryan A.
2011-01-01
The protein transporter, anthrax lethal toxin, is comprised of protective antigen (PA), a transmembrane translocase, and lethal factor (LF), a cytotoxic enzyme. Following assembly into holotoxin complexes, PA forms an oligomeric channel that unfolds LF and translocates it into the host cell. We report the crystal structure of the core of a lethal toxin complex to 3.1-Å resolution; the structure contains a PA octamer bound to four LF PA-binding domains (LFN). The first α helix and β strand of each LFN unfold and dock into a deep amphipathic cleft on the surface of the PA octamer, which we call the α clamp. The α clamp possesses nonspecific polypeptide binding activity and is functionally relevant to efficient holotoxin assembly, PA octamer formation, and LF unfolding and translocation. This structure provides insight on the mechanism of translocation-coupled protein unfolding. PMID:21037566
Antigen-Specific CD8+ T Cells and Protective Immunity to Tuberculosis
2017-01-01
The continuing HIV/AIDS epidemic and the spread of multi-drug resistant Mycobacterium tuberculosis has led to the perpetuation of the worldwide tuberculosis epidemic. While M. bovis BCG is widely used as a vaccine, it lacks efficacy in preventing pulmonary tuberculosis in adults [1]. To combat this ongoing scourge, vaccine development for tuberculosis is a global priority. Most infected individuals develop long-lived protective immunity, which controls and contains M. tuberculosis in a T cell-dependent manner. An effective T cells response determines whether the infection resolves or develops into clinically evident disease. Consequently, there is great interest in determining which T cells subsets mediate anti-mycobacterial immunity, delineating their effector functions, and evaluating whether vaccination can elicit these T cells subsets and induce protective immunity. CD4+ T cells are critical for resistance to M. tuberculosis in both humans and rodent models. CD4+ T cells are required to control the initial infection as well as to prevent recrudescence in both humans and mice [2]. While it is generally accepted that class II MHC-restricted CD4+ T cells are essential for immunity to tuberculosis, M. tuberculosis infection elicits CD8+ T cells responses in both people and in experimental animals. CD8+ T cells are also recruited to the lung during M. tuberculosis infection and are found in the granulomas of infected people. Thus, how CD8+ T cells contribute to overall immunity to tuberculosis and whether antigens recognized by CD8+ T cells would enhance the efficacy of vaccine strategies continue to be important questions. PMID:23468108
Corvo, Laura; Garde, Esther; Ramírez, Laura; Iniesta, Virginia; Bonay, Pedro; Gómez-Nieto, Carlos; González, Víctor M.; Martín, M. Elena; Alonso, Carlos; Coelho, Eduardo A. F.; Barral, Aldina; Barral-Netto, Manoel
2015-01-01
Background Highly conserved intracellular proteins from Leishmania have been described as antigens in natural and experimental infected mammals. The present study aimed to evaluate the antigenicity and prophylactic properties of the Leishmania infantum Poly (A) binding proteins (LiPABPs). Methodology/Principal Findings Three different members of the LiPABP family have been described. Recombinant tools based on these proteins were constructed: recombinant proteins and DNA vaccines. The three recombinant proteins were employed for coating ELISA plates. Sera from human and canine patients of visceral leishmaniasis and human patients of mucosal leishmaniasis recognized the three LiPABPs. In addition, the protective efficacy of a DNA vaccine based on the combination of the three Leishmania PABPs has been tested in a model of progressive murine leishmaniasis: BALB/c mice infected with Leishmania major. The induction of a Th1-like response against the LiPABP family by genetic vaccination was able to down-regulate the IL-10 predominant responses elicited by parasite LiPABPs after infection in this murine model. This modulation resulted in a partial protection against L. major infection. LiPABP vaccinated mice showed a reduction on the pathology that was accompanied by a decrease in parasite burdens, in antibody titers against Leishmania antigens and in the IL-4 and IL-10 parasite-specific mediated responses in comparison to control mice groups immunized with saline or with the non-recombinant plasmid. Conclusion/Significance The results presented here demonstrate for the first time the prophylactic properties of a new family of Leishmania antigenic intracellular proteins, the LiPABPs. The redirection of the immune response elicited against the LiPABP family (from IL-10 towards IFN-γ mediated responses) by genetic vaccination was able to induce a partial protection against the development of the disease in a highly susceptible murine model of leishmaniasis. PMID:25955652
Nonclassical T Cells and Their Antigens in Tuberculosis
De Libero, Gennaro; Singhal, Amit; Lepore, Marco; Mori, Lucia
2014-01-01
T cells that recognize nonpeptidic antigens, and thereby are identified as nonclassical, represent important yet poorly characterized effectors of the immune response. They are present in large numbers in circulating blood and tissues and are as abundant as T cells recognizing peptide antigens. Nonclassical T cells exert multiple functions including immunoregulation, tumor control, and protection against infections. They recognize complexes of nonpeptidic antigens such as lipid and glycolipid molecules, vitamin B2 precursors, and phosphorylated metabolites of the mevalonate pathway. Each of these antigens is presented by antigen-presenting molecules other than major histocompatibility complex (MHC), including CD1, MHC class I–related molecule 1 (MR1), and butyrophilin 3A1 (BTN3A1) molecules. Here, we discuss how nonclassical T cells participate in the recognition of mycobacterial antigens and in the mycobacterial-specific immune response. PMID:25059739
Wu, Shipo; Zhang, Zhe; Yu, Rui; Zhang, Jun; Liu, Ying; Song, Xiaohong; Yi, Shaoqiong; Liu, Ju; Chen, Jianqin; Yin, Ying; Xu, Junjie; Hou, Lihua; Chen, Wei
2014-02-01
Developing an effective anthrax vaccine that can induce a rapid and sustained immune response is a priority for the prevention of bioterrorism-associated anthrax infection. Here, we developed a recombinant replication-deficient adenovirus serotype 5-based vaccine expressing the humanized protective antigen (Ad5-PAopt). A single intramuscular injection of Ad5-PAopt resulted in rapid and robust humoral and cellular immune responses in Fisher 344 rats. Animals intramuscularly inoculated with a single dose of 10⁸ infectious units of Ad5-PAopt achieved 100% protection from challenge with 10 times the 50% lethal dose (LD₅₀) of anthrax lethal toxin 7 days after vaccination. Although preexisting intranasally induced immunity to Ad5 slightly weakened the humoral and cellular immune responses to Ad5-PAopt via intramuscular inoculation, 100% protection was achieved 15 days after vaccination in Fisher 344 rats. The protective efficacy conferred by intramuscular vaccination in the presence of preexisting intranasally induced immunity was significantly better than that of intranasal delivery of Ad5-PAopt and intramuscular injection with recombinant PA and aluminum adjuvant without preexisting immunity. As natural Ad5 infection often occurs via the mucosal route, the work here largely illuminates that intramuscular inoculation with Ad5-PAopt can overcome the negative effects of immunity induced by prior adenovirus infection and represents an efficient approach for protecting against emerging anthrax.
Wu, Shipo; Zhang, Zhe; Yu, Rui; Zhang, Jun; Liu, Ying; Song, Xiaohong; Yi, Shaoqiong; Liu, Ju; Chen, Jianqin; Yin, Ying; Xu, Junjie
2014-01-01
Developing an effective anthrax vaccine that can induce a rapid and sustained immune response is a priority for the prevention of bioterrorism-associated anthrax infection. Here, we developed a recombinant replication-deficient adenovirus serotype 5-based vaccine expressing the humanized protective antigen (Ad5-PAopt). A single intramuscular injection of Ad5-PAopt resulted in rapid and robust humoral and cellular immune responses in Fisher 344 rats. Animals intramuscularly inoculated with a single dose of 108 infectious units of Ad5-PAopt achieved 100% protection from challenge with 10 times the 50% lethal dose (LD50) of anthrax lethal toxin 7 days after vaccination. Although preexisting intranasally induced immunity to Ad5 slightly weakened the humoral and cellular immune responses to Ad5-PAopt via intramuscular inoculation, 100% protection was achieved 15 days after vaccination in Fisher 344 rats. The protective efficacy conferred by intramuscular vaccination in the presence of preexisting intranasally induced immunity was significantly better than that of intranasal delivery of Ad5-PAopt and intramuscular injection with recombinant PA and aluminum adjuvant without preexisting immunity. As natural Ad5 infection often occurs via the mucosal route, the work here largely illuminates that intramuscular inoculation with Ad5-PAopt can overcome the negative effects of immunity induced by prior adenovirus infection and represents an efficient approach for protecting against emerging anthrax. PMID:24307239
Tang, Xinming; Liu, Xianyong; Yin, Guangwen; Suo, Jingxia; Tao, Geru; Zhang, Sixin; Suo, Xun
2018-01-01
Vaccine delivery is critical in antigen discovery and vaccine efficacy and safety. The diversity of infectious diseases in humans and livestock has required the development of varied delivery vehicles to target different pathogens. In livestock animals, previous strategies for the development of coccidiosis vaccines have encountered several hurdles, limiting the development of multiple species vaccine formulations. Here, we describe a novel vaccine delivery system using transgenic Eimeria tenella expressing immunodominant antigens of Eimeria maxima. In this delivery system, the immune mapped protein 1 of E. maxima (EmIMP1) was delivered by the closely related species of E. tenella to the host immune system during the whole endogenous life cycle. The overexpression of the exogenous antigen did not interfere with the reproduction and immunogenicity of transgenic Eimeria. After immunization with the transgenic parasite, we detected EmIMP1’s and E. maxima oocyst antigens’ specific humoral and cellular immune responses. In particular, we observed partial protection of chickens immunized with transgenic E. tenella against subsequent E. maxima infections. Our results demonstrate that the transgenic Eimeria parasite is an ideal coccidia antigen delivery vehicle and represents a new type of coccidiosis vaccines. In addition, this model could potentially be used in the development of malaria live sporozoite vaccines, in which antigens from different strains can be expressed in the vaccine strain. PMID:29375584
Closeup view of the reflective insulation protecting the Crew Compartment ...
Close-up view of the reflective insulation protecting the Crew Compartment bulkhead, orbiter structure and landing gear housing in the void created by the removal of the Forward Reaction Control System Module from the forward section of the Orbiter Discovery. This image was taken from the service platform in the Orbiter Processing Facility at Kennedy Space Center. - Space Transportation System, Orbiter Discovery (OV-103), Lyndon B. Johnson Space Center, 2101 NASA Parkway, Houston, Harris County, TX
Antigen-specific T cell therapies for cancer
Manzo, Teresa; Heslop, Helen E.; Rooney, Cliona M.
2015-01-01
Adoptively transferred antigen-specific T cells that recognize tumor antigens through their native receptors have many potential benefits as treatment for virus-associated diseases and malignancies, due to their ability to selectively recognize tumor antigens, expand and persist to provide long-term protection. Infusions of T cells targeting Epstein–Barr virus (EBV) antigens have shown encouraging response rates in patients with post-transplant lymphoproliferative disease as well as EBV-positive lymphomas and nasopharyngeal cancer, although a recent study also showed that human papilloma virus-reactive T cells can induce complete regression of metastatic cervical cancer. This strategy is also being evaluated to target non-viral tumor-associated antigens. Targeting these less immunogenic antigens is more challenging, as tumor antigens are generally weak, and high avidity T cells specific for self-antigens are deleted in the thymus, but tumor responses have been reported. Current research focusses on defining factors that promote in vivo persistence of transferred cells and ameliorate the immunosuppressive microenvironment. To this end, investigators are evaluating the effects of combining adoptive transfer of antigen-specific T cells with other immunotherapy moieties such as checkpoint inhibitors. Genetic modification of infused T cells may also be used to overcome tumor evasion mechanisms, and vaccines may be used to promote in vivo proliferation. PMID:26160910
Hesketh, J; Dobbelaere, D; Griffin, J F; Buchan, G
1993-01-01
The expression of interleukin-2 receptors (IL-2R) and proliferating cell nuclear antigens (PCNA) were compared for their usefulness as markers of lymphocyte activation. Heterologous polyclonal (anti-bovine IL-2R) and monoclonal (anti-human PCNA) antibodies were used to detect the expression of these molecules on activated deer lymphocytes. Both molecules were co-expressed on blast cells which had been activated with mitogen [concanavalin A (Con A)]. There was detectable up-regulation of IL-2R expression in response to antigen [Mycobacterium bovis-derived purified protein derivative (PPD)] stimulation while PCNA expression mimicked lymphocyte transformation (LT) reactivity. PCNA expression was found to more accurately reflect both antigen- and mitogen-activated lymphocyte activation, as estimated by LT activity. The expression of PCNA was used to identify antigen reactive cells from animals exposed to M. bovis. A very low percentage (1.1 +/- 0.4%) of peripheral blood lymphocytes from non-infected animals could be stimulated to express PCNA by in vitro culture with antigen (PPD). Within the infected group both diseased and healthy, 'in-contact', animals expressed significantly higher levels of PCNA upon antigen stimulation. PMID:8104884
Woo, Sun-Je; Kang, Seok-Seong; Park, Sung-Moo; Yang, Jae Seung; Song, Man Ki; Yun, Cheol-Heui; Han, Seung Hyun
2015-10-01
Although intranasal vaccination has been shown to be effective for the protection against inhalational anthrax, establishment of long-term immunity has yet to be achieved. Here, we investigated whether intranasal immunization with recombinant protective antigen (rPA) of Bacillus anthracis induces immunological memory responses in the mucosal and systemic compartments. Intranasal immunization with rPA plus cholera toxin (CT) sustained PA-specific antibody responses for 6 months in lung, nasal washes, and vaginal washes as well as serum. A significant induction of PA-specific memory B cells was observed in spleen, cervical lymph nodes (CLNs) and lung after booster immunization. Furthermore, intranasal immunization with rPA plus CT remarkably generated effector memory CD4(+) T cells in the lung. PA-specific CD4(+) T cells preferentially increased the expression of Th1- and Th17-type cytokines in lung, but not in spleen or CLNs. Collectively, the intranasal immunization with rPA plus CT promoted immunologic memory responses in the mucosal and systemic compartments, providing long-term immunity. Copyright © 2015 Elsevier Ltd. All rights reserved.
Ampomah, Paulina; Stevenson, Liz; Ofori, Michael F.; Barfod, Lea
2014-01-01
Protective immunity to Plasmodium falciparum malaria acquired after natural exposure is largely antibody mediated. IgG-specific P. falciparum EMP1 (PfEMP1) proteins on the infected erythrocyte surface are particularly important. The transient antibody responses and the slowly acquired protective immunity probably reflect the clonal antigenic variation and allelic polymorphism of PfEMP1. However, it is likely that other immune-evasive mechanisms are also involved, such as interference with formation and maintenance of immunological memory. We measured PfEMP1-specific antibody levels by enzyme-linked immunosorbent assay (ELISA) and memory B-cell frequencies by enzyme-linked immunosorbent spot (ELISPOT) assay in a cohort of P. falciparum-exposed nonpregnant Ghanaian women. The antigens used were a VAR2CSA-type PfEMP1 (IT4VAR04) with expression restricted to parasites infecting the placenta, as well as two commonly recognized PfEMP1 proteins (HB3VAR06 and IT4VAR60) implicated in rosetting and not pregnancy restricted. This enabled, for the first time, a direct comparison in the same individuals of immune responses specific for a clinically important parasite antigen expressed only during well-defined periods (pregnancy) to responses specific for comparable antigens expressed independent of pregnancy. Our data indicate that PfEMP1-specific B-cell memory is adequately acquired even when antigen exposure is infrequent (e.g., VAR2CSA-type PfEMP1). Furthermore, immunological memory specific for VAR2CSA-type PfEMP1 can be maintained for many years without antigen reexposure and after circulating antigen-specific IgG has disappeared. The study provides evidence that natural exposure to P. falciparum leads to formation of durable B-cell immunity to clinically important PfEMP1 antigens. This has encouraging implications for current efforts to develop PfEMP1-based vaccines. PMID:24566620
NASA Astrophysics Data System (ADS)
Hoshino, Akiyoshi; Fujioka, Kouki; Yamamoto, Mayu; Manabe, Noriyoshi; Yasuhara, Masato; Suzuki, Kazuo; Yamamoto, Kenji
2005-11-01
Immunological diagnostic methods have been widely performed and showed high performance in molecular and cellular biology, molecular imaging, and medical diagnostics. We have developed novel methods for the fluorescent labeling of several antibodies coupled with fluorescent nanocrystals QDs. In this study we demonstrated that two bacterial toxins, diphtheria toxin and tetanus toxin, were detected simultaneously in the same view field of a cover slip by using directly QD-conjugated antibodies. We have succeeded in detecting bacterial toxins by counting luminescent spots on the evanescent field with using primary antibody conjugated to QDs. In addition, each bacterial toxin in the mixture can be separately detected by single excitation laser with emission band pass filters, and simultaneously in situ pathogen quantification was performed by calculating the luminescent density on the surface of the cover slip. Our results demonstrate that total internal reflection fluorescence microscopy (TIRFM) enables us to distinguish each antigen from mixed samples and can simultaneously quantitate multiple antigens by QD-conjugated antibodies. Bioconjugated QDs could have great potentialities for in practical biomedical applications to develop various high-sensitivity detection systems.
Carrero, J C; Contreras-Rojas, A; Sánchez-Hernández, B; Petrosyan, P; Bobes, R J; Ortiz-Ortiz, L; Laclette, J P
2010-11-01
Entamoeba histolytica antigens recognized by salivary IgA from infected patients include the 29 kDa antigen (Eh29), an alkyl hydroperoxide reductase. Here, we investigate the potential of recombinant Eh29 and an Eh29-cholera toxin subunit B (CTxB) fusion protein to confer protection against intestinal amoebiasis after oral immunization. The purified Eh29-CTxB fusion retained the critical ability to bind ganglioside GM(1), as determined by ELISA. Oral immunization of C3H/HeJ mice with Eh29 administered in combination with a subclinical dose of whole cholera toxin, but not as an Eh29-CTxB fusion, induced elevated levels of intestinal IgA and serum IgG anti-Eh29 antibodies that inhibited trophozoites adherence to MDCK cell monolayers. The 80% of immunized mice seen to develop IgA and IgG immune responses showed no evidence of infection in tissue sections harvested following intracecal challenge with virulent E. histolytica trophozoites. These results suggest that Eh29 is capable of inducing protective anti-amoebic immune responses in mice following oral immunization and could be used in the development of oral vaccines against amoebiasis. (c) 2010 Elsevier Inc. All rights reserved.
NASA Astrophysics Data System (ADS)
Maji, Mithun; Mazumder, Saumyabrata; Bhattacharya, Souparno; Choudhury, Somsubhra Thakur; Sabur, Abdus; Shadab, Md.; Bhattacharya, Pradyot; Ali, Nahid
2016-06-01
The most effective strategy for protection against intracellular infections such as Leishmania is vaccination with live parasites. Use of recombinant proteins avoids the risks associated with live vaccines. However, due to low immunogenicity, they fail to trigger T cell responses particularly of CD8+ cells requisite for persistent immunity. Previously we showed the importance of protein entrapment in cationic liposomes and MPL as adjuvant for elicitation of CD4+ and CD8+ T cell responses for long-term protection. In this study we investigated the role of cationic liposomes on maturation and antigen presentation capacity of dendritic cells (DCs). We observed that cationic liposomes were taken up very efficiently by DCs and transported to different cellular sites. DCs activated with liposomal rgp63 led to efficient presentation of antigen to specific CD4+ and CD8+ T cells. Furthermore, lymphoid CD8+ T cells from liposomal rgp63 immunized mice demonstrated better proliferative ability when co-cultured ex vivo with stimulated DCs. Addition of MPL to vaccine enhanced the antigen presentation by DCs and induced more efficient antigen specific CD8+ T cell responses when compared to free and liposomal antigen. These liposomal formulations presented to CD8+ T cells through TAP-dependent MHC-I pathway offer new possibilities for a safe subunit vaccine.
Sahu, Tejram; Malkov, Vlad; Morrison, Robert; Pei, Ying; Juompan, Laure; Milman, Neta; Zarling, Stasya; Anderson, Charles; Wong-Madden, Sharon; Wendler, Jason; Ishizuka, Andrew; MacMillen, Zachary W.; Garcia, Valentino; Kappe, Stefan H. I.; Krzych, Urszula; Duffy, Patrick E.
2016-01-01
Malaria vaccine development has been hampered by the limited availability of antigens identified through conventional discovery approaches, and improvements are needed to enhance the efficacy of the leading vaccine candidate RTS,S that targets the circumsporozoite protein (CSP) of the infective sporozoite. Here we report a transcriptome-based approach to identify novel pre-erythrocytic vaccine antigens that could potentially be used in combination with CSP. We hypothesized that stage-specific upregulated genes would enrich for protective vaccine targets, and used tiling microarray to identify P. falciparum genes transcribed at higher levels during liver stage versus sporozoite or blood stages of development. We prepared DNA vaccines for 21 genes using the predicted orthologues in P. yoelii and P. berghei and tested their efficacy using different delivery methods against pre-erythrocytic malaria in rodent models. In our primary screen using P. yoelii in BALB/c mice, we found that 16 antigens significantly reduced liver stage parasite burden. In our confirmatory screen using P. berghei in C57Bl/6 mice, we confirmed 6 antigens that were protective in both models. Two antigens, when combined with CSP, provided significantly greater protection than CSP alone in both models. Based on the observations reported here, transcriptional patterns of Plasmodium genes can be useful in identifying novel pre-erythrocytic antigens that induce protective immunity alone or in combination with CSP. PMID:27434123
Speake, Cate; Pichugin, Alexander; Sahu, Tejram; Malkov, Vlad; Morrison, Robert; Pei, Ying; Juompan, Laure; Milman, Neta; Zarling, Stasya; Anderson, Charles; Wong-Madden, Sharon; Wendler, Jason; Ishizuka, Andrew; MacMillen, Zachary W; Garcia, Valentino; Kappe, Stefan H I; Krzych, Urszula; Duffy, Patrick E
2016-01-01
Malaria vaccine development has been hampered by the limited availability of antigens identified through conventional discovery approaches, and improvements are needed to enhance the efficacy of the leading vaccine candidate RTS,S that targets the circumsporozoite protein (CSP) of the infective sporozoite. Here we report a transcriptome-based approach to identify novel pre-erythrocytic vaccine antigens that could potentially be used in combination with CSP. We hypothesized that stage-specific upregulated genes would enrich for protective vaccine targets, and used tiling microarray to identify P. falciparum genes transcribed at higher levels during liver stage versus sporozoite or blood stages of development. We prepared DNA vaccines for 21 genes using the predicted orthologues in P. yoelii and P. berghei and tested their efficacy using different delivery methods against pre-erythrocytic malaria in rodent models. In our primary screen using P. yoelii in BALB/c mice, we found that 16 antigens significantly reduced liver stage parasite burden. In our confirmatory screen using P. berghei in C57Bl/6 mice, we confirmed 6 antigens that were protective in both models. Two antigens, when combined with CSP, provided significantly greater protection than CSP alone in both models. Based on the observations reported here, transcriptional patterns of Plasmodium genes can be useful in identifying novel pre-erythrocytic antigens that induce protective immunity alone or in combination with CSP.
Nolz, Jeffrey C.; Harty, John T.
2011-01-01
SUMMARY Infection or vaccination confers heightened resistance to pathogen re-challenge due to quantitative and qualitative differences between naïve and primary memory T cells. Herein, we show that secondary (boosted) memory CD8+ T cells were better than primary memory CD8+ T cells in controlling some, but not all acute infections with diverse pathogens. However, secondary memory CD8+ T cells were less efficient than an equal number of primary memory cells at preventing chronic LCMV infection and are more susceptible to functional exhaustion. Importantly, localization of memory CD8+ T cells within lymph nodes, which is reduced by antigen re-stimulation, was critical for both viral control in lymph nodes and for the sustained CD8+ T cell response required to prevent chronic LCMV infection. Thus, repeated antigen-stimulation shapes memory CD8+ T cell populations to either enhance or decrease per cell protective immunity in a pathogen-specific manner, a concept of importance in vaccine design against specific diseases. PMID:21549619
The antigenic evolution of influenza: drift or thrift?
Wikramaratna, Paul S.; Sandeman, Michi; Recker, Mario; Gupta, Sunetra
2013-01-01
It is commonly assumed that antibody responses against the influenza virus are polarized in the following manner: strong antibody responses are directed at highly variable antigenic epitopes, which consequently undergo ‘antigenic drift’, while weak antibody responses develop against conserved epitopes. As the highly variable epitopes are in a constant state of flux, current antibody-based vaccine strategies are focused on the conserved epitopes in the expectation that they will provide some level of clinical protection after appropriate boosting. Here, we use a theoretical model to suggest the existence of epitopes of low variability, which elicit a high degree of both clinical and transmission-blocking immunity. We show that several epidemiological features of influenza and its serological and molecular profiles are consistent with this model of ‘antigenic thrift’, and that identifying the protective epitopes of low variability predicted by this model could offer a more viable alternative to regularly update the influenza vaccine than exploiting responses to weakly immunogenic conserved regions. PMID:23382423
Lewis, Nicola S; Anderson, Tavis K; Kitikoon, Pravina; Skepner, Eugene; Burke, David F; Vincent, Amy L
2014-05-01
Swine influenza A virus is an endemic and economically important pathogen in pigs, with the potential to infect other host species. The hemagglutinin (HA) protein is the primary target of protective immune responses and the major component in swine influenza A vaccines. However, as a result of antigenic drift, vaccine strains must be regularly updated to reflect currently circulating strains. Characterizing the cross-reactivity between strains in pigs and seasonal influenza virus strains in humans is also important in assessing the relative risk of interspecies transmission of viruses from one host population to the other. Hemagglutination inhibition (HI) assay data for swine and human H3N2 viruses were used with antigenic cartography to quantify the antigenic differences among H3N2 viruses isolated from pigs in the United States from 1998 to 2013 and the relative cross-reactivity between these viruses and current human seasonal influenza A virus strains. Two primary antigenic clusters were found circulating in the pig population, but with enough diversity within and between the clusters to suggest updates in vaccine strains are needed. We identified single amino acid substitutions that are likely responsible for antigenic differences between the two primary antigenic clusters and between each antigenic cluster and outliers. The antigenic distance between current seasonal influenza virus H3 strains in humans and those endemic in swine suggests that population immunity may not prevent the introduction of human viruses into pigs, and possibly vice versa, reinforcing the need to monitor and prepare for potential incursions. Influenza A virus (IAV) is an important pathogen in pigs and humans. The hemagglutinin (HA) protein is the primary target of protective immune responses and the major target of vaccines. However, vaccine strains must be updated to reflect current strains. Characterizing the differences between seasonal IAV in humans and swine IAV is important in
Lewis, Nicola S.; Anderson, Tavis K.; Kitikoon, Pravina; Skepner, Eugene; Burke, David F.
2014-01-01
ABSTRACT Swine influenza A virus is an endemic and economically important pathogen in pigs, with the potential to infect other host species. The hemagglutinin (HA) protein is the primary target of protective immune responses and the major component in swine influenza A vaccines. However, as a result of antigenic drift, vaccine strains must be regularly updated to reflect currently circulating strains. Characterizing the cross-reactivity between strains in pigs and seasonal influenza virus strains in humans is also important in assessing the relative risk of interspecies transmission of viruses from one host population to the other. Hemagglutination inhibition (HI) assay data for swine and human H3N2 viruses were used with antigenic cartography to quantify the antigenic differences among H3N2 viruses isolated from pigs in the United States from 1998 to 2013 and the relative cross-reactivity between these viruses and current human seasonal influenza A virus strains. Two primary antigenic clusters were found circulating in the pig population, but with enough diversity within and between the clusters to suggest updates in vaccine strains are needed. We identified single amino acid substitutions that are likely responsible for antigenic differences between the two primary antigenic clusters and between each antigenic cluster and outliers. The antigenic distance between current seasonal influenza virus H3 strains in humans and those endemic in swine suggests that population immunity may not prevent the introduction of human viruses into pigs, and possibly vice versa, reinforcing the need to monitor and prepare for potential incursions. IMPORTANCE Influenza A virus (IAV) is an important pathogen in pigs and humans. The hemagglutinin (HA) protein is the primary target of protective immune responses and the major target of vaccines. However, vaccine strains must be updated to reflect current strains. Characterizing the differences between seasonal IAV in humans and swine
Jang, Seung I; Lillehoj, Hyun S; Lee, Sung Hyen; Lee, Kyung Woo; Park, Myeong Seon; Cha, Sung-Rok; Lillehoj, Erik P; Subramanian, B Mohana; Sriraman, R; Srinivasan, V A
2010-04-09
Intestinal infection with Eimeria, the etiologic agent of avian coccidiosis, stimulates protective immunity to subsequent colonization by the homologous parasite, while cross-protection against heterologous species is poor. As a first step toward the development of a broad specificity Eimeria vaccine, this study was designed to assess a purified recombinant protein from Eimeria maxima gametocytes (Gam82) in stimulating immunity against experimental infection with live parasites. Following Gam82 intramuscular immunization and oral parasite challenge, body weight gain, fecal oocyst output, lesion scores, serum antibody response, and cytokine production were assessed to evaluate vaccination efficacy. Animals vaccinated with Gam82 and challenged with E. maxima showed lower oocyst shedding and reduced intestinal pathology compared with non-vaccinated and parasite-challenged animals. Gam82 vaccination also stimulated the production of antigen-specific serum antibodies and induced greater levels of IL-2 and IL-15 mRNAs compared with non-vaccinated controls. These results demonstrate that the Gam82 recombinant protein protects against E. maxima and augments humoral and cell-mediated immunity. Published by Elsevier Ltd.
Piedrafita, David; Preston, Sarah; Kemp, Joanna; de Veer, Michael; Sherrard, Jayne; Kraska, Troy; Elhay, Martin; Meeusen, Els
2013-01-01
It has recently been recognised that vaccine adjuvants play a critical role in directing the nature of a vaccine induced effector response. In the present study, several adjuvants were evaluated for their ability to protect sheep after field vaccination with the larval-specific Haemonchus contortus antigen, HcsL3. Using a suboptimal antigen dose, aluminium adjuvant was shown to reduce the cumulative faecal egg counts (cFEC) and worm burden by 23% and 25% respectively, in agreement with a previous study. The addition of Quil A to the aluminium-adjuvanted vaccine brought cFEC back to control levels. Vaccination with the adjuvant DEAE-dextran almost doubled the protection compared to the aluminium-adjuvanted vaccine resulting in 40% and 41% reduction in cFEC and worm counts compared to controls. Examination of skin responses following i.d. injection of exsheathed L3, revealed that cFEC was negatively correlated with wheal size and tissue eosinophils for the DEAE-dextran and aluminium-adjuvanted groups respectively. These studies have for the first time shown the potential of DEAE-dextran adjuvant for helminth vaccines, and discovered significant cellular correlates of vaccine-induced protection.
Piedrafita, David; Preston, Sarah; Kemp, Joanna; de Veer, Michael; Sherrard, Jayne; Kraska, Troy; Elhay, Martin; Meeusen, Els
2013-01-01
It has recently been recognised that vaccine adjuvants play a critical role in directing the nature of a vaccine induced effector response. In the present study, several adjuvants were evaluated for their ability to protect sheep after field vaccination with the larval-specific Haemonchus contortus antigen, HcsL3. Using a suboptimal antigen dose, aluminium adjuvant was shown to reduce the cumulative faecal egg counts (cFEC) and worm burden by 23% and 25% respectively, in agreement with a previous study. The addition of Quil A to the aluminium-adjuvanted vaccine brought cFEC back to control levels. Vaccination with the adjuvant DEAE-dextran almost doubled the protection compared to the aluminium-adjuvanted vaccine resulting in 40% and 41% reduction in cFEC and worm counts compared to controls. Examination of skin responses following i.d. injection of exsheathed L3, revealed that cFEC was negatively correlated with wheal size and tissue eosinophils for the DEAE-dextran and aluminium-adjuvanted groups respectively. These studies have for the first time shown the potential of DEAE-dextran adjuvant for helminth vaccines, and discovered significant cellular correlates of vaccine-induced protection. PMID:24205209
Zeng, Xun; Wei, Yu-ling; Huang, Jun; Newell, Evan W.; Yu, Hongxiang; Kidd, Brian A.; Kuhns, Michael S.; Waters, Ray W.; Davis, Mark M.; Weaver, Casey T.; Chien, Yueh-hsiu
2012-01-01
Summary γδ T cells contribute uniquely to host immune defense. However, how they function remains an enigma. Although it is unclear what most γδ T cells recognize, common dogma asserts that they recognize self-antigens. While they are the major initial Interleukin-17 (IL-17) producers in infections, it is unclear what is required to trigger these cells to act. Here, we report that a noted B cell antigen, the algae protein-phycoerythrin (PE) is an antigen for murine and human γδ T cells. PE also stained specific bovine γδ T cells. Employing this specificity, we demonstrated that antigen recognition, but not extensive clonal expansion, was required to activate naïve γδ T cells to make IL-17. In this activated state, γδ T cells gained the ability to respond to cytokine signals that perpetuated the IL-17 production. These results underscore the adaptability of lymphocyte antigen receptors and suggest a previously unrecognized antigen-driven rapid response in protective immunity prior to the maturation of classical adaptive immunity. PMID:22960222
McComb, Ryan C; Martchenko, Mikhail
2016-01-02
Anthrax is defined by the Centers for Disease Control and Prevention as a Category A pathogen for its potential use as a bioweapon. Current prevention treatments include Anthrax Vaccine Adsorbed (AVA). AVA is an undefined formulation of Bacillus anthracis culture supernatant adsorbed to aluminum hydroxide. It has an onerous vaccination schedule, is slow and cumbersome to produce and is slightly reactogenic. Next-generation vaccines are focused on producing recombinant forms of anthrax toxin in a well-defined formulation but these vaccines have been shown to lose potency as they are stored. In addition, studies have shown that a proportion of the antibody response against these vaccines is focused on non-functional, non-neutralizing regions of the anthrax toxin while some essential functional regions are shielded from eliciting an antibody response. Rational vaccinology is a developing field that focuses on designing vaccine antigens based on structural information provided by neutralizing antibody epitope mapping, crystal structure analysis, and functional mapping through amino acid mutations. This information provides an opportunity to design antigens that target only functionally important and conserved regions of a pathogen in order to make a more optimal vaccine product. This review provides an overview of the literature related to functional and neutralizing antibody epitope mapping of the Protective Antigen (PA) component of anthrax toxin. Copyright © 2015 Elsevier Ltd. All rights reserved.
Immunization against Rabies with Plant-Derived Antigen
NASA Astrophysics Data System (ADS)
Modelska, Anna; Dietzschold, Bernard; Sleysh, N.; Fu, Zhen Fang; Steplewski, Klaudia; Hooper, D. Craig; Koprowski, Hilary; Yusibov, Vidadi
1998-03-01
We previously demonstrated that recombinant plant virus particles containing a chimeric peptide representing two rabies virus epitopes stimulate virus neutralizing antibody synthesis in immunized mice. We show here that mice immunized intraperitoneally or orally (by gastric intubation or by feeding on virus-infected spinach leaves) with engineered plant virus particles containing rabies antigen mount a local and systemic immune response. After the third dose of antigen, given intraperitoneally, 40% of the mice were protected against challenge infection with a lethal dose of rabies virus. Oral administration of the antigen stimulated serum IgG and IgA synthesis and ameliorated the clinical signs caused by intranasal infection with an attenuated rabies virus strain.
Okwumabua, Ogi; Chinnapapakkagari, Sharmila
2005-04-01
In our continued effort to search for a Streptococcus suis protein(s) that can serve as a vaccine candidate or a diagnostic reagent, we constructed and screened a gene library with a polyclonal antibody raised against the whole-cell protein of S. suis type 2. A clone that reacted with the antibody was identified and characterized. Analysis revealed that the gene encoding the protein is localized within a 2.0-kbp EcoRI DNA fragment. The nucleotide sequence contained an open reading frame that encoded a polypeptide of 445 amino acid residues with a calculated molecular mass of 46.4 kDa. By in vitro protein synthesis and Western blot experiments, the protein exhibited an electrophoretic mobility of approximately 38 kDa. At the amino acid level the deduced primary sequence shared homology with sequences of unknown function from Streptococcus pneumoniae (89%), Streptococcus mutans (86%), Lactococcus lactis (80%), Listeria monocytogenes (74%), and Clostridium perfringens (64%). Except for strains of serotypes 20, 26, 32, and 33, Southern hybridization analysis revealed the presence of the gene in strains of other S. suis serotypes and demonstrated restriction fragment length differences caused by a point mutation in the EcoRI recognition sequence. We confirmed expression of the 38-kDa protein in the hybridization-positive isolates using specific antiserum against the purified protein. The recombinant protein was reactive with serum from pigs experimentally infected with virulent strains of S. suis type 2, suggesting that the protein is immunogenic and may serve as an antigen of diagnostic importance for the detection of most S. suis infections. Pigs immunized with the recombinant 38-kDa protein mounted antibody responses to the protein and were completely protected against challenge with a strain of a homologous serotype, the wild-type virulent strain of S. suis type 2, suggesting that it may be a good candidate for the development of a vaccine that can be used as
Cywes-Bentley, Colette; Skurnik, David; Zaidi, Tanweer; Roux, Damien; DeOliveira, Rosane B.; Garrett, Wendy S.; Lu, Xi; O’Malley, Jennifer; Kinzel, Kathryn; Zaidi, Tauqeer; Rey, Astrid; Perrin, Christophe; Fichorova, Raina N.; Kayatani, Alexander K. K.; Maira-Litràn, Tomas; Gening, Marina L.; Tsvetkov, Yury E.; Nifantiev, Nikolay E.; Bakaletz, Lauren O.; Pelton, Stephen I.; Golenbock, Douglas T.; Pier, Gerald B.
2013-01-01
Microbial capsular antigens are effective vaccines but are chemically and immunologically diverse, resulting in a major barrier to their use against multiple pathogens. A β-(1→6)–linked poly-N-acetyl-d-glucosamine (PNAG) surface capsule is synthesized by four proteins encoded in genetic loci designated intercellular adhesion in Staphylococcus aureus or polyglucosamine in selected Gram-negative bacterial pathogens. We report that many microbial pathogens lacking an identifiable intercellular adhesion or polyglucosamine locus produce PNAG, including Gram-positive, Gram-negative, and fungal pathogens, as well as protozoa, e.g., Trichomonas vaginalis, Plasmodium berghei, and sporozoites and blood-stage forms of Plasmodium falciparum. Natural antibody to PNAG is common in humans and animals and binds primarily to the highly acetylated glycoform of PNAG but is not protective against infection due to lack of deposition of complement opsonins. Polyclonal animal antibody raised to deacetylated glycoforms of PNAG and a fully human IgG1 monoclonal antibody that both bind to native and deacetylated glycoforms of PNAG mediated complement-dependent opsonic or bactericidal killing and protected mice against local and/or systemic infections by Streptococcus pyogenes, Streptococcus pneumoniae, Listeria monocytogenes, Neisseria meningitidis serogroup B, Candida albicans, and P. berghei ANKA, and against colonic pathology in a model of infectious colitis. PNAG is also a capsular polysaccharide for Neisseria gonorrhoeae and nontypable Hemophilus influenzae, and protects cells from environmental stress. Vaccination targeting PNAG could contribute to immunity against serious and diverse prokaryotic and eukaryotic pathogens, and the conserved production of PNAG suggests that it is a critical factor in microbial biology. PMID:23716675
Immunogenetic Mechanisms Driving Norovirus GII.4 Antigenic Variation
Donaldson, Eric F.; Corti, Davide; Swanstrom, Jesica; Debbink, Kari; Lanzavecchia, Antonio; Baric, Ralph S.
2012-01-01
Noroviruses are the principal cause of epidemic gastroenteritis worldwide with GII.4 strains accounting for 80% of infections. The major capsid protein of GII.4 strains is evolving rapidly, resulting in new epidemic strains with altered antigenic potentials. To test if antigenic drift may contribute to GII.4 persistence, human memory B cells were immortalized and the resulting human monoclonal antibodies (mAbs) characterized for reactivity to a panel of time-ordered GII.4 virus-like particles (VLPs). Reflecting the complex exposure history of the volunteer, human anti-GII.4 mAbs grouped into three VLP reactivity patterns; ancestral (1987–1997), contemporary (2004–2009), and broad (1987–2009). NVB 114 reacted exclusively to the earliest GII.4 VLPs by EIA and blockade. NVB 97 specifically bound and blocked only contemporary GII.4 VLPs, while NBV 111 and 43.9 exclusively reacted with and blocked variants of the GII.4.2006 Minerva strain. Three mAbs had broad GII.4 reactivity. Two, NVB 37.10 and 61.3, also detected other genogroup II VLPs by EIA but did not block any VLP interactions with carbohydrate ligands. NVB 71.4 cross-neutralized the panel of time-ordered GII.4 VLPs, as measured by VLP-carbohydrate blockade assays. Using mutant VLPs designed to alter predicted antigenic epitopes, two evolving, GII.4-specific, blockade epitopes were mapped. Amino acids 294–298 and 368–372 were required for binding NVB 114, 111 and 43.9 mAbs. Amino acids 393–395 were essential for binding NVB 97, supporting earlier correlations between antibody blockade escape and carbohydrate binding variation. These data inform VLP vaccine design, provide a strategy for expanding the cross-blockade potential of chimeric VLP vaccines, and identify an antibody with broadly neutralizing therapeutic potential for the treatment of human disease. Moreover, these data support the hypothesis that GII.4 norovirus evolution is heavily influenced by antigenic variation of neutralizing epitopes
De Benedetto, G; Alfini, R; Cescutti, P; Caboni, M; Lanzilao, L; Necchi, F; Saul, A; MacLennan, C A; Rondini, S; Micoli, F
2017-01-11
Invasive nontyphoidal Salmonella disease (iNTS) is a leading cause of death and morbidity in Africa. The most common pathogens are Salmonella enterica serovars Typhimurium and Enteritidis. The O-antigen portion of their lipopolysaccharide is a target of protective immunity and vaccines targeting O-antigen are currently in development. Here we investigate the use of Generalized Modules for Membrane Antigens (GMMA) as delivery system for S. Typhimurium and S. Enteritidis O-antigen. Gram-negative bacteria naturally shed outer membrane in a blebbing process. By deletion of the tolR gene, the level of shedding was greatly enhanced. Further genetic modifications were introduced into the GMMA-producing strains in order to reduce reactogenicity, by detoxifying the lipid A moiety of lipopolysaccharide. We found that genetic mutations can impact on expression of O-antigen chains. All S. Enteritidis GMMA characterized had an O-antigen to protein w/w ratio higher than 0.6, while the ratio was 0.7 for S. Typhimurium ΔtolR GMMA, but decreased to less than 0.1 when further mutations for lipid A detoxification were introduced. Changes were also observed in O-antigen chain length and level and/or position of O-acetylation. When tested in mice, the GMMA induced high levels of anti-O-antigen-specific IgG functional antibodies, despite variation in density and O-antigen structural modifications. In conclusion, simplicity of manufacturing process and low costs of production, coupled with encouraging immunogenicity data, make GMMA an attractive strategy to further investigate for the development of a vaccine against iNTS. Copyright © 2016. Published by Elsevier Ltd.
Xin, Wei; Wanda, Soo-Young; Zhang, Xiangmin; Santander, Javier; Scarpellini, Giorgio; Ellis, Karen; Alamuri, Praveen; Curtiss, Roy
2012-10-01
We developed means to deliver multiple heterologous antigens on dual plasmids with non-antibiotic-resistance markers in a single recombinant attenuated vaccine strain of Salmonella enterica serotype Typhimurium. The first component of this delivery system is a strain of S. Typhimurium carrying genomic deletions in alr, dadB, and asd, resulting in obligate requirements for diaminopimelic acid (DAP) and d-alanine for growth. The second component is the Asd(+)-DadB(+) plasmid pair carrying wild-type copies of asdA and dadB, respectively, to complement the mutations. To evaluate the protection efficacy of the dual-plasmid vaccine, S. Typhimurium strain χ9760 (a strain with multiple attenuating mutations: Δasd Δalr ΔdadB ΔrecF) was transformed with Asd(+) and DadB(+) plasmids specifying pneumococcal antigens PspA and PspC, respectively. Both plasmids were stable in χ9760 for 50 generations when grown in nonselective medium. This was significantly (P < 0.05) greater than the stability seen in its recF(+) counterpart χ9590 and could be attributed to reduced interplasmid recombination in χ9760. Oral immunization of BALB/c mice with 1 × 10(9) CFU of χ9760 (carrying Asd(+)-PspA and DadB(+)-PspC plasmids) elicited a dominant Th1-type serum IgG response against both antigens and protected mice against intraperitoneal challenge with 200 50% lethal doses (LD(50)s) of virulent Streptococcus pneumoniae strain WU2 or intravenous challenge with 100 LD(50)s of virulent S. pneumoniae strain L81905 or intranasal challenge with a lethal dose of S. pneumoniae A66.1 in a pneumonia model. Protection offered by χ9760 was superior to that offered by the mixture of two strains, χ9828 (Asd(+)-PspA) and χ11026 (DadB(+)-PspC). This novel dual-plasmid system marks a remarkable improvement in the development of live bacterial vaccines.
Xin, Wei; Wanda, Soo-Young; Zhang, Xiangmin; Santander, Javier; Scarpellini, Giorgio; Ellis, Karen; Alamuri, Praveen
2012-01-01
We developed means to deliver multiple heterologous antigens on dual plasmids with non-antibiotic-resistance markers in a single recombinant attenuated vaccine strain of Salmonella enterica serotype Typhimurium. The first component of this delivery system is a strain of S. Typhimurium carrying genomic deletions in alr, dadB, and asd, resulting in obligate requirements for diaminopimelic acid (DAP) and d-alanine for growth. The second component is the Asd+-DadB+ plasmid pair carrying wild-type copies of asdA and dadB, respectively, to complement the mutations. To evaluate the protection efficacy of the dual-plasmid vaccine, S. Typhimurium strain χ9760 (a strain with multiple attenuating mutations: Δasd Δalr ΔdadB ΔrecF) was transformed with Asd+ and DadB+ plasmids specifying pneumococcal antigens PspA and PspC, respectively. Both plasmids were stable in χ9760 for 50 generations when grown in nonselective medium. This was significantly (P < 0.05) greater than the stability seen in its recF+ counterpart χ9590 and could be attributed to reduced interplasmid recombination in χ9760. Oral immunization of BALB/c mice with 1 × 109 CFU of χ9760 (carrying Asd+-PspA and DadB+-PspC plasmids) elicited a dominant Th1-type serum IgG response against both antigens and protected mice against intraperitoneal challenge with 200 50% lethal doses (LD50s) of virulent Streptococcus pneumoniae strain WU2 or intravenous challenge with 100 LD50s of virulent S. pneumoniae strain L81905 or intranasal challenge with a lethal dose of S. pneumoniae A66.1 in a pneumonia model. Protection offered by χ9760 was superior to that offered by the mixture of two strains, χ9828 (Asd+-PspA) and χ11026 (DadB+-PspC). This novel dual-plasmid system marks a remarkable improvement in the development of live bacterial vaccines. PMID:22868499
Hybrid Diffuse Reflectance Spectroscopy: Non-Erythemal in vivo Testing of Sun Protection Factor.
Rohr, Mathias; Ernst, Nikolai; Schrader, Andreas
2018-01-01
In order to define a label sun protection factor (SPF) of topically applied sunscreens, in vivo test methods like ISO 24444, FDA guideline, or the Australian standard are used worldwide. The basis of all these methods is provoking an erythemal skin reaction by UV irradiation to find the level of unprotected and protected minimal erythemal doses (MED). In vitro methods replacing the human skin by any kind of non-human material are still not available. Thus, offering the new hybrid diffuse reflectance spectroscopy (HDRS) technique that is able to stay on an in vivo level for SPF testing but meanwhile neglecting the UV-dose-related erythemal skin reaction is a perfect combination to take care of sun protection and any ethical concerns in SPF testing nowadays. HDRS is a combination of in vivo diffuse reflectance spectroscopy (DRS) measurements on the skin and in vitro transmission measurements of a sunscreen on a roughened polymethylmethacrylate plate. By this technique, the in vivo behavior of the investigated sunscreen on the skin is measured as well as the UVB absorption, which is still non-visible in the reflectance technique. In order to establish an alternative method for in vivo SPF testing, a huge number of sunscreens (80 samples) was measured by HDRS and compared to the worldwide accepted standard ISO 24444. The variety of sunscreens measured reflects a wide range of different types of formulations as well as a wide range of SPFs (5-120) to validate this new alternative SPF testing procedure. The applied quantity of product as well as skin color dependencies of signal generation are shown to support any basic correlation of DRS signal generation and sun protection expectations. Far-reaching statistical data analyses show an excellent link of the new non-erythemally driven HDRS-SPF technique and ISO 24444 results. In the same way, HDRS-UVA-PF results can be correlated with UVA-PF values calculated from ISO 24443. Due to the elimination of any erythemal relevant
James, Lisa M; Christova, Peka; Lewis, Scott M; Engdahl, Brian E; Georgopoulos, Angeliki; Georgopoulos, Apostolos P
2018-03-01
Reduction of brain volume (brain atrophy) during healthy brain aging is well documented and dependent on genetic, lifestyle and environmental factors. Here we investigated the possible dependence of brain gray matter volume reduction in the absence of the Human Leukocyte Antigen (HLA) allele DRB1*13:02 which prevents brain atrophy in Gulf War Illness (James et al., 2017). Seventy-one cognitively healthy women (32-69years old) underwent a structural Magnetic Resonance Imaging (sMRI) scan to measure the volumes of total gray matter, cerebrocortical gray matter, and subcortical gray matter. Participants were assigned to two groups, depending on whether they lacked the DRB1*13:02 allele (No DRB1*13:02 group, N=60) or carried the DRB1*13:02 allele (N=11). We assessed the change of brain gray matter volume with age in each group by performing a linear regression where the brain volume (adjusted for total intracranial volume) was the dependent variable and age was the independent variable. In the No DRB1*13:02 group, the volumes of total gray matter, cerebrocortical gray matter, and subcortical gray matter were reduced highly significantly. In contrast, none of these volumes showed a statistically significant reduction with age in the DRB1*13:02 group. These findings document the protective effect of DRB1*13:02 on age-dependent reduction of brain gray matter in healthy individuals. Since the role of this allele is to connect to matching epitopes of external antigens for the subsequent production of antibodies and elimination of the offending antigen, we hypothesize that its protective effect may be due to the successful elimination of such antigens to which we are exposed during the lifespan, antigens that otherwise would persist causing gradual brain atrophy. In addition, we consider a possible beneficial role of DRB1*13:02 attributed to its binding to cathepsin S, a known harmful substance in brain aging (Wendt et al., 2008). Of course, other factors covarying with the
Protection against anthrax and plague by a combined vaccine in mice and rabbits.
Ren, Jun; Dong, Dayong; Zhang, Jinlong; Zhang, Jun; Liu, Shuling; Li, Bing; Fu, Ling; Xu, Junjie; Yu, Changming; Hou, Lihua; Li, Jianmin; Chen, Wei
2009-12-09
The protective antigen (PA) of Bacillus anthracis and the Fraction 1 Capsular Antigen (F1 antigen), V antigen of Yersinia pestis have been demonstrated to be potential immunogens and candidate vaccine sub-units against anthrax and plague respectively. In this study, the authors have investigated the antibody responses and the protective efficacy when the antigens were administered separately or in combination intramuscularly formulation adsorbed to an aluminum hydroxide adjuvant. Results show that immunized rF1 + rV and rPA antigen together was as effective as separately for induction of serological antibody response, and these titers were maintained for over 1 year in mice. An isotype analysis of the serum indicates that the co-administration of these antigens did not influence the antigen-specific IgG1/IgG2a ratio which was consistent with a Th2 bias. Furthermore, the combined vaccine comprising the protein antigens rF1 + rV + rPA has been demonstrated to protect mice from subcutaneous challenge with 10(7) colony-forming units (CFU) virulent Y. pestis strain, and to fully protect rabbit against subcutaneous challenge with 1.2x10(5) colony-forming units (CFU) virulent B. anthracis spores. These data show that the protective efficacy was unaffected when the antigens were administered in combination.
Anderson, G W; Leary, S E; Williamson, E D; Titball, R W; Welkos, S L; Worsham, P L; Friedlander, A M
1996-11-01
The purified recombinant V antigen from Yersinia pestis, expressed in Escherichia coli and adsorbed to aluminum hydroxide, an adjuvant approved for human use, was used to immunize outbred Hsd:ND4 mice subcutaneously. Immunization protected mice from lethal bubonic and pneumonic plague caused by CO92, a wild-type F1+ strain, or by the isogenic F1- strain C12. This work demonstrates that a subunit plague vaccine formulated for human use provides significant protection against bubonic plague caused by an F1- strain (C12) or against substantial aerosol challenges from either F1+ (CO92) or F1-(C12) Y. pestis.
Mother-Newborn Pairs in Malawi Have Similar Antibody Repertoires to Diverse Malaria Antigens.
Boudová, Sarah; Walldorf, Jenny A; Bailey, Jason A; Divala, Titus; Mungwira, Randy; Mawindo, Patricia; Pablo, Jozelyn; Jasinskas, Algis; Nakajima, Rie; Ouattara, Amed; Adams, Matthew; Felgner, Philip L; Plowe, Christopher V; Travassos, Mark A; Laufer, Miriam K
2017-10-01
Maternal antibodies may play a role in protecting newborns against malaria disease. Plasmodium falciparum parasite surface antigens are diverse, and protection from infection requires allele-specific immunity. Although malaria-specific antibodies have been shown to cross the placenta, the extent to which antibodies that respond to the full repertoire of diverse antigens are transferred from the mother to the infant has not been explored. Understanding the breadth of maternal antibody responses and to what extent these antibodies are transferred to the child can inform vaccine design and evaluation. We probed plasma from cord blood and serum from mothers at delivery using a customized protein microarray that included variants of malaria vaccine target antigens to assess the intensity and breadth of seroreactivity to three malaria vaccine candidate antigens in mother-newborn pairs in Malawi. Among the 33 paired specimens that were assessed, mothers and newborns had similar intensity and repertoire of seroreactivity. Maternal antibody levels against vaccine candidate antigens were the strongest predictors of infant antibody levels. Placental malaria did not significantly impair transplacental antibody transfer. However, mothers with placental malaria had significantly higher antibody levels against these blood-stage antigens than mothers without placental malaria. The repertoire and levels of infant antibodies against a wide range of malaria vaccine candidate antigen variants closely mirror maternal levels in breadth and magnitude regardless of evidence of placental malaria. Vaccinating mothers with an effective malaria vaccine during pregnancy may induce high and potentially protective antibody repertoires in newborns. Copyright © 2017 American Society for Microbiology.
Targeting of plant-derived vaccine antigens to immunoresponsive mucosal sites.
Rigano, M Manuela; Sala, Francesco; Arntzen, Charles J; Walmsley, Amanda M
2003-01-30
Most pathogenic microorganisms enter their host via the mucosal surfaces lining the digestive, respiratory and urino-reproductive tracts of the body. The most efficient means of protecting these surfaces is through mucosal immunization. Transgenic plants are safe and inexpensive vehicles to produce and mucosally deliver protective antigens. However, the application of this technology is limited by the poor response of the immune system to non-particulate, subunit vaccines. Co-delivery of therapeutic proteins with targeting proteins, such as the B subunit of the Escherichia coli heat labile enterotoxin (LTB), could increase the effectiveness of such antigens.
Molecular recognition of microbial lipid-based antigens by T cells.
Gras, Stephanie; Van Rhijn, Ildiko; Shahine, Adam; Le Nours, Jérôme
2018-05-01
The immune system has evolved to protect hosts from pathogens. T cells represent a critical component of the immune system by their engagement in host defence mechanisms against microbial infections. Our knowledge of the molecular recognition by T cells of pathogen-derived peptidic antigens that are presented by the major histocompatibility complex glycoproteins is now well established. However, lipids represent an additional, distinct chemical class of molecules that when presented by the family of CD1 antigen-presenting molecules can serve as antigens, and be recognized by specialized subsets of T cells leading to antigen-specific activation. Over the past decades, numerous CD1-presented self- and bacterial lipid-based antigens have been isolated and characterized. However, our understanding at the molecular level of T cell immunity to CD1 molecules presenting microbial lipid-based antigens is still largely unexplored. Here, we review the insights and the molecular basis underpinning the recognition of microbial lipid-based antigens by T cells.
Moayeri, Mahtab; Tremblay, Jacqueline M; Debatis, Michelle; Dmitriev, Igor P; Kashentseva, Elena A; Yeh, Anthony J; Cheung, Gordon Y C; Curiel, David T; Leppla, Stephen; Shoemaker, Charles B
2016-01-06
Bacillus anthracis, the causative agent of anthrax, secretes three polypeptides, which form the bipartite lethal and edema toxins (LT and ET, respectively). The common component in these toxins, protective antigen (PA), is responsible for binding to cellular receptors and translocating the lethal factor (LF) and edema factor (EF) enzymatic moieties to the cytosol. Antibodies against PA protect against anthrax. We previously isolated toxin-neutralizing variable domains of camelid heavy-chain-only antibodies (VHHs) and demonstrated their in vivo efficacy. In this work, gene therapy with an adenoviral (Ad) vector (Ad/VNA2-PA) (VNA, VHH-based neutralizing agents) promoting the expression of a bispecific VHH-based neutralizing agent (VNA2-PA), consisting of two linked VHHs targeting different PA-neutralizing epitopes, was tested in two inbred mouse strains, BALB/cJ and C57BL/6J, and found to protect mice against anthrax toxin challenge and anthrax spore infection. Two weeks after a single treatment with Ad/VNA2-PA, serum VNA2-PA levels remained above 1 μg/ml, with some as high as 10 mg/ml. The levels were 10- to 100-fold higher and persisted longer in C57BL/6J than in BALB/cJ mice. Mice were challenged with a lethal dose of LT or spores at various times after Ad/VNA2-PA administration. The majority of BALB/cJ mice having serum VNA2-PA levels of >0.1 μg/ml survived LT challenge, and 9 of 10 C57BL/6J mice with serum levels of >1 μg/ml survived spore challenge. Our findings demonstrate the potential for genetic delivery of VNAs as an effective method for providing prophylactic protection from anthrax. We also extend prior findings of mouse strain-based differences in transgene expression and persistence by adenoviral vectors. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Development of Yersinia pestis F1 antigen-loaded microspheres vaccine against plague
Huang, Shih-shiung; Li, I-Hsun; Hong, Po-da; Yeh, Ming-kung
2014-01-01
Yersinia pestis F1 antigen-loaded poly(DL-lactide-co-glycolide)/polyethylene glycol (PEG) (PLGA/PEG) microspheres were produced using a water-in-oil-in-water emulsion/solvent extraction technique and assayed for their percent yield, entrapment efficiency, surface morphology, particle size, zeta potential, in vitro release properties, and in vivo animal protect efficacy. The Y. pestis F1 antigen-loaded microspheres (mean particle size 3.8 μm) exhibited a high loading capacity (4.5% w/w), yield (85.2%), and entrapment efficiency (38.1%), and presented a controlled in vitro release profile with a low initial burst (18.5%), then continued to release Y. pestis F1 antigen over 70 days. The distribution (%) of Y. pestis F1 on the microspheres surface, outer layer, and core was 3.1%, 28.9%, and 60.7%, respectively. A steady release rate was noticed to be 0.55 μg Y. pestis F1 antigen/mg microspheres/day of Y. pestis F1 antigen release maintained for 42 days. The cumulative release amount at the 1st, 28th, and 42nd days was 8.2, 26.7, and 31.0 μg Y. pestis F1 antigen/mg microspheres, respectively. The 100 times median lethal dose 50% (LD50) of Y. pestis Yokohama-R strain by intraperitoneal injection challenge in mice test, in which mice received one dose of 40 μg F1 antigen content of PLGA/PEG microspheres, F1 antigen in Al(OH)3, and in comparison with F1 antigen in Al(OH)3 vaccine in two doses, was evaluated after given by subcutaneous immunization of BALB/c mice. The study results show that the greatest survival was observed in the group of mice immunized with one dose of F1 antigen-loaded PLGA/PEG microspheres, and two doses of F1 antigen in Al(OH)3 vaccine (100%). In vivo vaccination studies also demonstrated that F1 vaccines microspheres had a protective ability; its steady-state IgG immune protection in mice plasma dramatic increased from 2 weeks (18,764±3,124) to 7 weeks (126,468±19,176) after vaccination. These findings strongly suggest that F1-antigen loaded
Iacono-Connors, L C; Schmaljohn, C S; Dalrymple, J M
1990-01-01
The gene encoding Bacillus anthracis protective antigen (PA) was modified by site-directed mutagenesis, subcloned into baculovirus and vaccinia virus plasmid transfer vectors (pAcYM1 and pSC-11, respectively), and inserted via homologous recombinations into baculovirus Autographa californica nuclear polyhedrosis virus or vaccinia virus (strains WR and Connaught). Expression of PA was detected in both systems by immunofluorescence assays with antisera from rabbits immunized with B. anthracis PA. Western blot (immunoblot) analysis showed that the expressed product of both systems was slightly larger (86 kilodaltons) than B. anthracis-produced PA (83.5 kilodaltons). Analysis of trypsin digests of virus-expressed and authentic PA suggested that the size difference was due to the presence of a signal sequence remaining with the virus-expressed protein. Immunization of mice with either recombinant baculovirus-infected Spodoptera frugiperda cells or with vaccinia virus recombinants elicited a high-titer, anti-PA antibody response. Images PMID:2105271
Santana, Vinicius C; Diniz, Mariana O; Cariri, Francisco A M O; Ventura, Armando M; Cunha-Neto, Edécio; Almeida, Rafael R; Campos, Marco A; Lima, Graciela K; Ferreira, Luís C S
2013-01-01
Millions of people worldwide are currently infected with human papillomavirus (HPV), herpes simplex virus (HSV) or human immunodeficiency virus (HIV). For this enormous contingent of people, the search for preventive and therapeutic immunological approaches represents a hope for the eradication of latent infection and/or virus-associated cancer. To date, attempts to develop vaccines against these viruses have been mainly based on a monovalent concept, in which one or more antigens of a virus are incorporated into a vaccine formulation. In the present report, we designed and tested an immunization strategy based on DNA vaccines that simultaneously encode antigens for HIV, HSV and HPV. With this purpose in mind, we tested two bicistronic DNA vaccines (pIRES I and pIRES II) that encode the HPV-16 oncoprotein E7 and the HIV protein p24 both genetically fused to the HSV-1 gD envelope protein. Mice i.m. immunized with the DNA vaccines mounted antigen-specific CD8⁺ T cell responses, including in vivo cytotoxic responses, against the three antigens. Under experimental conditions, the vaccines conferred protective immunity against challenges with a vaccinia virus expressing the HIV-derived protein Gag, an HSV-1 virus strain and implantation of tumor cells expressing the HPV-16 oncoproteins. Altogether, our results show that the concept of a trivalent HIV, HSV, and HPV vaccine capable to induce CD8⁺ T cell-dependent responses is feasible and may aid in the development of preventive and/or therapeutic approaches for the control of diseases associated with these viruses.
Gorantala, Jyotsna; Grover, Sonam; Goel, Divya; Rahi, Amit; Jayadev Magani, Sri Krishna; Chandra, Subhash; Bhatnagar, Rakesh
2011-06-15
The currently available anthrax vaccines are limited by being incompletely characterized, potentially reactogenic and have an expanded dosage schedule. Plant based vaccines offer safe alternative for vaccine production. In the present study, we expressed domain IV of Bacillus anthracis protective antigen gene [PA(dIV)] in planta (by nuclear agrobacterium and chloroplast transformation) and E. coli [rPA(dIV)]. The presence of transgene and the expression of PA(dIV) in planta was confirmed by molecular analysis. Expression levels up to 5.3% of total soluble protein (TSP) were obtained with AT rich (71.8% AT content) PA(dIV) gene in transplastomic plants while 0.8% of TSP was obtained in nuclear transformants. Further, we investigated the protective response of plant and E. coli derived PA(dIV) in mice by intraperitoneal (i.p.) and oral immunizations with or without adjuvant. Antibody titers of >10(4) were induced upon i.p. and oral immunizations with plant derived PA(dIV) and oral immunization with E. coli derived PA(dIV). Intraperitoneal injections with adjuvanted E. coli derived PA(dIV), generated highest antibody titers of >10(5). All the immunized groups demonstrated predominant IgG1 titers over IgG2a indicating a polarized Th2 type response. We also evaluated the mucosal antibody response in orally immunized groups. When fecal extracts were analyzed, low sIgA titer was demonstrated in adjuvanted plant and E. coli derived PA(dIV) groups. Further, PA(dIV) antisera enhanced B. anthracis spore uptake by macrophages in vitro and also demonstrated an anti-germinating effect suggesting a potent role at mucosal surfaces. The antibodies from various groups were efficient in neutralizing the lethal toxin in vitro. When mice were challenged with B. anthracis, mice immunized with adjuvanted plant PA(dIV) imparted 60% and 40% protection while E. coli derived PA(dIV) conferred 100% and 80% protection upon i.p. and oral immunizations. Thus, our study is the first attempt in
Boyd, Amy C.; Ruiz-Hernandez, Raul; Peroval, Marylene Y.; Carson, Connor; Balkissoon, Devanand; Staines, Karen; Turner, Alison V.; Hill, Adrian V.S.; Gilbert, Sarah C.; Butter, Colin
2013-01-01
Current vaccines targeting surface proteins can drive antigenic variation resulting either in the emergence of more highly pathogenic viruses or of antigenically distinct viruses that escape control by vaccination and thereby persist in the host population. Influenza vaccines typically target the highly mutable surface proteins and do not provide protection against heterologous challenge. Vaccines which induce immune responses against conserved influenza epitopes may confer protection against heterologous challenge. We report here the results of vaccination with recombinant modified Vaccinia virus Ankara (MVA) and Adenovirus (Ad) expressing a fusion construct of nucleoprotein and matrix protein (NP + M1). Prime and boost vaccination regimes were trialled in different ages of chicken and were found to be safe and immunogenic. Interferon-γ (IFN-γ) ELISpot was used to assess the cellular immune response post secondary vaccination. In ovo Ad prime followed by a 4 week post hatch MVA boost was identified as the most immunogenic regime in one outbred and two inbred lines of chicken. Following vaccination, one inbred line (C15I) was challenged with low pathogenic avian influenza (LPAI) H7N7 (A/Turkey/England/1977). Birds receiving a primary vaccination with Ad-NP + M1 and a secondary vaccination with MVA-NP + M1 exhibited reduced cloacal shedding as measured by plaque assay at 7 days post infection compared with birds vaccinated with recombinant viruses containing irrelevant antigen. This preliminary indication of efficacy demonstrates proof of concept in birds; induction of T cell responses in chickens by viral vectors containing internal influenza antigens may be a productive strategy for the development of vaccines to induce heterologous protection against influenza in poultry. PMID:23200938
Firouzmand, Hengameh; Badiee, Ali; Khamesipour, Ali; Heravi Shargh, Vahid; Alavizadeh, Seyedeh Hoda; Abbasi, Azam; Jaafari, Mahmoud Reza
2013-12-01
A suitable adjuvant and delivery system are needed to develop an effective vaccine against leishmaniasis. To induce a Th1 type of response and protection in BALB/c mice against Leishmania major infection, 1,2-dioleoyl-3-trimethylammonium-propane (DOTAP) nanoliposomes bearing an intrinsic adjuvanticity, were used as an antigen delivery system and immunoadjuvant for soluble Leishmania antigens (SLA). DOTAP liposomes containing different concentrations of SLA were prepared by using lipid film method followed by sonication. The prepared vesicles showed a diameter of about 100nm, a positive zeta potential and approximately 70% encapsulation efficiency of SLA. BALB/c mice were immunized subcutaneously (SC), three times in a 3-week interval with different concentrations of liposomal SLA (12.5, 25, and 50μg of SLA/50μl/mice), free SLA and as well as free liposome. The group of mice received 50μg of SLA in DOTAP-nanoliposomes showed a significantly (p<0.001) smaller footpad swelling and the lowest spleen and footpad parasite burden after the challenge. This group also showed the highest IFN-γ production compared to the other groups, lower IL-4 level and higher IgG2a antibody titer. Taken together, the results indicated that simple DOTAP nanoliposome containing 1μg/μl SLA are appropriate delivery systems to induce a Th1 type of immune response and protection against L. major infection in BALB/c mice. Copyright © 2013 Elsevier B.V. All rights reserved.
Oral Vaccination of Fish – Antigen Preparations, Uptake, and Immune Induction
Mutoloki, Stephen; Munang’andu, Hetron Mweemba; Evensen, Øystein
2015-01-01
The oral route offers the most attractive approach of immunization of fish for a number of reasons: the ease of administration of antigens, it is less stressful than parenteral delivery and in principle, it is applicable to small and large sized fish; it also provides a procedure for oral boosting during grow-out periods in cages or ponds. There are, however, not many commercial vaccines available at the moment due to lack of efficacy and challenges associated with production of large quantities of antigens. These are required to stimulate an effective immune response locally and systemically, and need to be protected against degradation before they reach the sites where immune induction occurs. The hostile stomach environment is believed to be particularly important with regard to degradation of antigens in certain species. There is also a poor understanding about the requirements for proper immune induction following oral administration on one side, and the potential for induction of tolerance on the other. To what extent primary immunization via the oral route will elicit both local and systemic responses is not understood in detail. Furthermore, to what extent parenteral delivery will protect mucosal/gut surfaces and vice-versa is also not fully understood. We review the work that has been done on the subject and discuss it in light of recent advances that include mass production of antigens, including the use of plant systems. Different encapsulation techniques that have been developed in the quest to protect antigens against digestive degradation, as well as to target them for appropriate immune induction are also highlighted. PMID:26539192
Kurihara, Chieko; Cho, Kunwoo; Toohey, Richard E
2016-12-01
The International Commission on Radiological Protection (ICRP) has established Task Group 94 (TG94) to develop a publication to clarify the ethical foundations of the radiological protection system it recommends. This TG identified four core ethical values which structure the system: beneficence and non-maleficence, prudence, justice, and dignity. Since the ICRP is an international organization, its recommendations and guidance should be globally applicable and acceptable. Therefore, first this paper presents the basic principles of the ICRP radiological protection system and its core ethical values, along with a reflection on the variation of these values in Western and Eastern cultural traditions. Secondly, this paper reflects upon how these values can be applied in difficult ethical dilemmas as in the case of the emergency and post-accident phases of a nuclear power plant accident, using the Fukushima case to illustrate the challenges at stake. We found that the core ethical values underlying the ICRP system of radiological protection seem to be quite common throughout the world, although there are some variations among various cultural contexts. Especially we found that 'prudence' would call for somewhat different implementation in each cultural context, balancing and integrating sometime conflicting values, but always with objectives to achieve the well-being of people, which is itself the ultimate aim of the radiological protection system.
Macfarlane, Anne; Mondragon-Gonzalez, Rafael; Vega-Lopez, Francisco; Wieles, Brigitte; de Pena, Josefina; Rodriguez, Obdulia; Suarez y de la Torre, Raul; de Vries, Rene R. P.; Ottenhoff, Tom H. M.; Dockrell, Hazel M.
2001-01-01
The ability of the 45-kDa serine-rich Mycobacterium leprae antigen to stimulate peripheral blood mononuclear cell (PBMC) proliferation and gamma interferon (IFN-γ) production was measured in leprosy patients, household contacts, and healthy controls from areas of endemicity in Mexico. Almost all the tuberculoid leprosy patients gave strong PBMC proliferation responses to the M. leprae 45-kDa antigen (92.8%; n = 14). Responses were lower in lepromatous leprosy patients (60.6%; n = 34), but some responses to the 45-kDa antigen were detected in patients unresponsive to M. leprae sonicate. The proportion of positive responses to the M. leprae 45-kDa antigen was much higher in leprosy contacts (88%; n = 17) than in controls from areas of endemicity (10%; n = 20). None of 15 patients with pulmonary tuberculosis gave a positive proliferation response to the 45-kDa antigen. The 45-kDa antigen induced IFN-γ secretion similar to that induced by the native Mycobacterium tuberculosis 30/31-kDa antigen in tuberculoid leprosy patients and higher responses than those induced by the other recombinant antigens (M. leprae 10- and 65-kDa antigens, thioredoxin, and thioredoxin reductase); in patients with pulmonary tuberculosis it induced lower IFN-γ secretion than the other recombinant antigens. These results suggest that the M. leprae 45-kDa antigen is a potent T-cell antigen which is M. leprae specific in these Mexican donors. This antigen may therefore have diagnostic potential as a new skin test reagent or as an antigen in a simple whole-blood cytokine test. PMID:11329466
Reed, Steven G.
2017-01-01
ABSTRACT From experimental models and the analyses of patients, it is well documented that antigen-specific T cells are critical for protection against Leishmania infection. Effective vaccines require both targeting to the pathogen and an immune stimulant to induce maturation of appropriate immune responses. While a great number of antigens have been examined as vaccine candidates against various Leishmania species, few have advanced to human or canine clinical trials. With emphasis on antigen expression, in this minireview we discuss some of the vaccine platforms that are currently being explored for the development of Leishmania vaccines. It is clear that the vaccine platform of choice can have a significant impact upon the level of protection induced by particular antigens, and we provide and highlight some examples for which the vaccine system used has impacted the protective efficacy imparted. PMID:28515135
Duthie, Malcolm S; Reed, Steven G
2017-07-01
From experimental models and the analyses of patients, it is well documented that antigen-specific T cells are critical for protection against Leishmania infection. Effective vaccines require both targeting to the pathogen and an immune stimulant to induce maturation of appropriate immune responses. While a great number of antigens have been examined as vaccine candidates against various Leishmania species, few have advanced to human or canine clinical trials. With emphasis on antigen expression, in this minireview we discuss some of the vaccine platforms that are currently being explored for the development of Leishmania vaccines. It is clear that the vaccine platform of choice can have a significant impact upon the level of protection induced by particular antigens, and we provide and highlight some examples for which the vaccine system used has impacted the protective efficacy imparted. Copyright © 2017 American Society for Microbiology.
Beauvais, Anne; Beau, Remi; Candoni, Anna; Maertens, Johan; Rossi, Giulio; Morselli, Monica; Zanetti, Eleonora; Quadrelli, Chiara; Codeluppi, Mauro; Guaraldi, Giovanni; Pagano, Livio; Caira, Morena; Giovane, Cinzia Del; Maccaferri, Monica; Stefani, Alessandro; Morandi, Uliano; Tazzioli, Giovanni; Girardis, Massimo; Delia, Mario; Specchia, Giorgina; Longo, Giuseppe; Marasca, Roberto; Narni, Franco; Merli, Francesco; Imovilli, Annalisa; Apolone, Giovanni; Carvalho, Agostinho; Comoli, Patrizia; Romani, Luigina; Latgè, Jean Paul; Luppi, Mario
2013-01-01
Several studies in mouse model of invasive aspergillosis (IA) and in healthy donors have shown that different Aspergillus antigens may stimulate different adaptive immune responses. However, the occurrence of Aspergillus-specific T cells have not yet been reported in patients with the disease. In patients with IA, we have investigated during the infection: a) whether and how specific T-cell responses to different Aspergillus antigens occur and develop; b) which antigens elicit the highest frequencies of protective immune responses and, c) whether such protective T cells could be expanded ex-vivo. Forty hematologic patients have been studied, including 22 patients with IA and 18 controls. Specific T cells producing IL-10, IFN-γ, IL-4 and IL-17A have been characterized through enzyme linked immunospot and cytokine secretion assays on 88 peripheral blood (PB) samples, by using the following recombinant antigens: GEL1p, CRF1p, PEP1p, SOD1p, α1–3glucan, β1–3glucan, galactomannan. Specific T cells were expanded through short term culture. Aspergillus-specific T cells producing non-protective interleukin-10 (IL-10) and protective interferon-gamma (IFN-γ) have been detected to all the antigens only in IA patients. Lower numbers of specific T cells producing IL-4 and IL-17A have also been shown. Protective T cells targeted predominantly Aspergillus cell wall antigens, tended to increase during the IA course and to be associated with a better clinical outcome. Aspergillus-specific T cells could be successfully generated from the PB of 8 out of 8 patients with IA and included cytotoxic subsets able to lyse Aspergillus hyphae. Aspergillus specific T-cell responses contribute to the clearance of the pathogen in immunosuppressed patients with IA and Aspergillus cell wall antigens are those mainly targeted by protective immune responses. Cytotoxic specific T cells can be expanded from immunosuppressed patients even during the infection by using the above mentioned
Antigen-Specific CD8+ T Cells Fail To Respond to Shigella flexneri ▿
Jehl, Stephanie P.; Doling, Amy M.; Giddings, Kara S.; Phalipon, Armelle; Sansonetti, Philippe J.; Goldberg, Marcia B.; Starnbach, Michael N.
2011-01-01
CD8+ T lymphocytes often play a primary role in adaptive immunity to cytosolic microbial pathogens. Surprisingly, CD8+ T cells are not required for protective immunity to the enteric pathogen Shigella flexneri, despite the ability of Shigella to actively secrete proteins into the host cytoplasm, a location from which antigenic peptides are processed for presentation to CD8+ T cells. To determine why CD8+ T cells fail to play a role in adaptive immunity to S. flexneri, we investigated whether antigen-specific CD8+ T cells are primed during infection but are unable to confer protection or, alternatively, whether T cells fail to be primed. To test whether Shigella is capable of stimulating an antigen-specific CD8+ T-cell response, we created an S. flexneri strain that constitutively secretes a viral CD8+ T-cell epitope via the Shigella type III secretion system and characterized the CD8+ T-cell response to this strain both in mice and in cultured cells. Surprisingly, no T cells specific for the viral epitope were stimulated in mice infected with this strain, and cells infected with the recombinant strain were not targeted by epitope-specific T cells. Additionally, we found that the usually robust T-cell response to antigens artificially introduced into the cytoplasm of cultured cells was significantly reduced when the antigen-presenting cell was infected with Shigella. Collectively, these results suggest that antigen-specific CD8+ T cells are not primed during S. flexneri infection and, as a result, afford little protection to the host during primary or subsequent infection. PMID:21357720
Strategies to induce broadly protective antibody responses to viral glycoproteins.
Krammer, F
2017-05-01
Currently, several universal/broadly protective influenza virus vaccine candidates are under development. Many of these vaccines are based on strategies to induce protective antibody responses against the surface glycoproteins of antigenically and genetically diverse influenza viruses. These strategies might also be applicable to surface glycoproteins of a broad range of other important viral pathogens. Areas covered: Common strategies include sequential vaccination with divergent antigens, multivalent approaches, vaccination with glycan-modified antigens, vaccination with minimal antigens and vaccination with antigens that have centralized/optimized sequences. Here we review these strategies and the underlying concepts. Furthermore, challenges, feasibility and applicability to other viral pathogens are discussed. Expert commentary: Several broadly protective/universal influenza virus vaccine strategies will be tested in humans in the coming years. If successful in terms of safety and immunological readouts, they will move forward into efficacy trials. In the meantime, successful vaccine strategies might also be applied to other antigenically diverse viruses of concern.
AntigenMap 3D: an online antigenic cartography resource.
Barnett, J Lamar; Yang, Jialiang; Cai, Zhipeng; Zhang, Tong; Wan, Xiu-Feng
2012-05-01
Antigenic cartography is a useful technique to visualize and minimize errors in immunological data by projecting antigens to 2D or 3D cartography. However, a 2D cartography may not be sufficient to capture the antigenic relationship from high-dimensional immunological data. AntigenMap 3D presents an online, interactive, and robust 3D antigenic cartography construction and visualization resource. AntigenMap 3D can be applied to identify antigenic variants and vaccine strain candidates for pathogens with rapid antigenic variations, such as influenza A virus. http://sysbio.cvm.msstate.edu/AntigenMap3D
Wright, Terry W.; Malone, Jane E.; Haidaris, Constantine G.; Harber, Martha; Sant, Andrea J.; Nayak, Jennifer L.
2016-01-01
ABSTRACT Pneumocystis pneumonia (PcP) is a life-threatening infection that affects immunocompromised individuals. Nearly half of all PcP cases occur in those prescribed effective chemoprophylaxis, suggesting that additional preventive methods are needed. To this end, we have identified a unique mouse Pneumocystis surface protein, designated Pneumocystis cross-reactive antigen 1 (Pca1), as a potential vaccine candidate. Mice were immunized with a recombinant fusion protein containing Pca1. Subsequently, CD4+ T cells were depleted, and the mice were exposed to Pneumocystis murina. Pca1 immunization completely protected nearly all mice, similar to immunization with whole Pneumocystis organisms. In contrast, all immunized negative-control mice developed PcP. Unexpectedly, Pca1 immunization generated cross-reactive antibody that recognized Pneumocystis jirovecii and Pneumocystis carinii. Potential orthologs of Pca1 have been identified in P. jirovecii. Such cross-reactivity is rare, and our findings suggest that Pca1 is a conserved antigen and potential vaccine target. The evaluation of Pca1-elicited antibodies in the prevention of PcP in humans deserves further investigation. PMID:28031260
Tesini, Brenda L; Wright, Terry W; Malone, Jane E; Haidaris, Constantine G; Harber, Martha; Sant, Andrea J; Nayak, Jennifer L; Gigliotti, Francis
2017-04-01
Pneumocystis pneumonia (PcP) is a life-threatening infection that affects immunocompromised individuals. Nearly half of all PcP cases occur in those prescribed effective chemoprophylaxis, suggesting that additional preventive methods are needed. To this end, we have identified a unique mouse Pneumocystis surface protein, designated Pneumocystis cross-reactive antigen 1 (Pca1), as a potential vaccine candidate. Mice were immunized with a recombinant fusion protein containing Pca1. Subsequently, CD4 + T cells were depleted, and the mice were exposed to Pneumocystis murina Pca1 immunization completely protected nearly all mice, similar to immunization with whole Pneumocystis organisms. In contrast, all immunized negative-control mice developed PcP. Unexpectedly, Pca1 immunization generated cross-reactive antibody that recognized Pneumocystis jirovecii and Pneumocystis carinii Potential orthologs of Pca1 have been identified in P. jirovecii Such cross-reactivity is rare, and our findings suggest that Pca1 is a conserved antigen and potential vaccine target. The evaluation of Pca1-elicited antibodies in the prevention of PcP in humans deserves further investigation. Copyright © 2017 American Society for Microbiology.
Immune responses to baculovirus-displayed enterovirus 71 VP1 antigen.
Kiener, Tanja K; Premanand, Balraj; Kwang, Jimmy
2013-04-01
The increased distribution and neurovirulence of enterovirus 71 is an important health threat for young children in Asia Pacific. Vaccine design has concentrated on inactivated virus with the most advanced undergoing Phase III clinical trials. By using a subunit vaccine approach, production costs could be reduced by lowering the need for biocontainment. In addition, novel mutations could be rapidly incorporated to reflect the emergence of new enterovirus 71 subgenogroups. To circumvent the problems associated with conventional subunit vaccines, the antigen can be displayed on a viral vector that conveys stability and facilitates purification. Additional advantages of viral-vectored subunit vaccines are their ability to stimulate the innate immune system by transducing cells and the possibility of oral or nasal delivery, which dispenses with the need for syringes and medical personnel. Baculovirus-displayed VP1 combines all these benefits with protection that is as efficient as inactivated virus.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lucius, R.; Textor, G.; Kern, A.
1991-08-01
Jirds (Meriones unguiculatus) were immunized with irradiated (35 krad) stage-3 larvae (L3) of Acanthocheilonema viteae. The induced resistance against homologous challenge infection and the antibody response of the animals were studied. Immunization with 3, 2, or 1 dose of 50 irradiated L3 induced approximately 90% resistance. Immunization with a single dose of only 5 irradiated L3 resulted in 60.8% protection while immunization with a single dose of 25 L3 induced 94.1% protection. The protection induced with 3 doses of 50 irradiated L3 did not decrease significantly during a period of 6 months. Sera of a proportion, but not all resistantmore » jirds, contained antibodies against the surface of vector derived L3 as defined by IFAT. No surface antigens of microfilariae or adult worms were recognized by the sera. Vaccinated animals had antibody responses against antigens in the inner organs of L3 and in the cuticle and reproductive organs of adult worms as shown by IFAT. Immunoblotting with SDS-PAGE-separated L3 antigens and L3-CSN revealed that all sera contained antibodies against two exported antigens of 205 and 68 kDa, and against a nonexported antigen of 18 kDa. The 205-kDa antigen easily degraded into fragments of 165, 140, 125, and 105 kDa which were recognized by resistant jird sera. Various antigens of adult worms, but relatively few antigens of microfilariae, were also recognized. To test the relevance of exported antigens of L3 to resistance, jirds were immunized with L3-CSN together with a mild adjuvant. This immunization induced 67.7% resistance against challenge infection and sera of the immunized animals recognized the 205- and 68-kDa antigens of L3.« less
Newcastle disease virus vectored vaccines as bivalent or antigen delivery vaccines
2017-01-01
Recent advances in reverse genetics techniques make it possible to manipulate the genome of RNA viruses such as Newcastle disease virus (NDV). Several NDV vaccine strains have been used as vaccine vectors in poultry, mammals, and humans to express antigens of different pathogens. The safety, immunogenicity, and protective efficacy of these NDV-vectored vaccines have been evaluated in pre-clinical and clinical studies. The vaccines are safe in mammals, humans, and poultry. Bivalent NDV-vectored vaccines against pathogens of economic importance to the poultry industry have been developed. These bivalent vaccines confer solid protective immunity against NDV and other foreign antigens. In most cases, NDV-vectored vaccines induce strong local and systemic immune responses against the target foreign antigen. This review summarizes the development of NDV-vectored vaccines and their potential use as a base for designing other effective vaccines for veterinary and human use. PMID:28775971
Genotypic evolution and antigenicity of H9N2 influenza viruses in Shanghai, China.
Ge, Feifei; Li, Xin; Ju, Houbin; Yang, Dequan; Liu, Jian; Qi, Xinyong; Wang, Jian; Yang, Xianchao; Qiu, Yafeng; Liu, Peihong; Zhou, Jinping
2016-06-01
H9N2 influenza viruses have been circulating in China since 1994, but a systematic investigation of H9N2 in Shanghai has not previously been undertaken. Here, using 14 viruses we isolated from poultry and pigs in Shanghai during 2002 and 2006-2014, together with the commercial vaccine A/chicken/Shanghai/F/1998 (Ck/SH/F/98), we analyzed the evolution of H9N2 influenza viruses in Shanghai and showed that all 14 isolates originated from Ck/SH/F/98 antigenically. We evaluated the immune protection efficiency of the vaccine. Our findings demonstrate that H9N2 viruses in Shanghai have undergone extensive reassortment. Various genotypes emerged in 2002, 2006 and 2007, while during 2009-2014 only one genotype was found. Four antigenic groups, A-D, could be identified among the 14 isolates and a variety of antigenically distinct H9N2-virus-derived avian influenza viruses (AIVs) circulated simultaneously in Shanghai during this period. Challenge experiments using vaccinated chickens indicated that the vaccine prevented shedding of antigenic group A and B viruses, but not those of the more recent groups C and D. Genetic analysis showed that compared to the vaccine strain, representative viruses of antigenic groups C and D possess greater numbers of amino acid substitutions in the hemagglutinin (HA) protein than viruses in antigenic groups A and B. Many of these substitutions are located in antigenic sites. Our results indicate that the persistence of H9N2 AIV in China might be due to incomplete vaccine protection and that the avian influenza vaccine should be regularly evaluated and updated to maintain optimal protection.
Ferreirinha, Pedro; Dias, Joana; Correia, Alexandra; Pérez-Cabezas, Begoña; Santos, Carlos; Teixeira, Luzia; Ribeiro, Adília; Rocha, António; Vilanova, Manuel
2014-01-01
Neospora caninum is an Apicomplexa parasite that in the last two decades was acknowledged as the main pathogenic agent responsible for economic losses in the cattle industry. In the present study, the effectiveness of intranasal immunization with N. caninum membrane antigens plus CpG adjuvant was assessed in a murine model of intragastrically established neosporosis. Immunized mice presented a lower parasitic burden in the brain on infection with 5 × 107 tachyzoites, showing that significant protection was achieved by this immunization strategy. Intestinal IgA antibodies raised by immunization markedly agglutinated live N. caninum tachyzoites whereas previous opsonization with IgG antibodies purified from immunized mice sera reduced parasite survival within macrophage cells. Although an IgG1 : IgG2a ratio < 1 was detected in the immunized mice before and after infection, indicative of a predominant T helper type 1 immune response, no increased production of interferon-γ was detected in the spleen or mesenteric lymph nodes of the immunized mice. Altogether, these results show that mucosal immunization with N. caninum membrane proteins plus CpG adjuvant protect against intragastrically established neosporosis and indicate that parasite-specific mucosal and circulating antibodies have a protective role against this parasitic infection. PMID:24128071
Bertran, Kateri; Thomas, Colleen; Guo, Xuan; Bublot, Michel; Pritchard, Nikki; Regan, Jeffrey T; Cox, Kevin M; Gasdaska, John R; Dickey, Lynn F; Kapczynski, Darrell R; Swayne, David E
2015-07-09
A synthetic hemagglutinin (HA) gene from the highly pathogenic avian influenza (HPAI) virus A/chicken/Indonesia/7/2003 (H5N1) (Indo/03) was expressed in aquatic plant Lemna minor (rLemna-HA). In Experiment 1, efficacy of rLemna-HA was tested on birds immunized with 0.2μg or 2.3 μg HA and challenged with 10(6) mean chicken embryo infectious doses (EID50) of homologous virus strain. Both dosages of rLemna-HA conferred clinical protection and dramatically reduced viral shedding. Almost all the birds immunized with either dosage of rLemna-HA elicited HA antibody titers against Indo/03 antigen, suggesting an association between levels of anti-Indo/03 antibodies and protection. In Experiment 2, efficacy of rLemna-HA was tested on birds immunized with 0.9 μg or 2.2 μg HA and challenged with 10(6) EID50 of heterologous H5N1 virus strains A/chicken/Vietnam/NCVD-421/2010 (VN/10) or A/chicken/West Java/PWT-WIJ/2006 (PWT/06). Birds challenged with VN/10 exhibited 100% survival regardless of immunization dosage, while birds challenged with PWT/06 had 50% and 30% mortality at 0.9 μg HA and 2.2 μg HA, respectively. For each challenge virus, viral shedding titers from 2.2 μg HA vaccinated birds were significantly lower than those from 0.9μg HA vaccinated birds, and titers from both immunized groups were in turn significantly lower than those from sham vaccinated birds. Even if immunized birds elicited HA titers against the vaccine antigen Indo/03, only the groups challenged with VN/10 developed humoral immunity against the challenge antigen. None (rLemna-HA 0.9 μg HA) and 40% (rLemna-HA 2.2 μg HA) of the immunized birds challenged with PWT/06 elicited pre-challenge antibody titers, respectively. In conclusion, Lemna-expressed HA demonstrated complete protective immunity against homologous challenge and suboptimal protection against heterologous challenge, the latter being similar to results from inactivated whole virus vaccines. Transgenic duckweed-derived HA could be a
Pham, Giang H; Iglesias, Bibiana V; Gosselin, Edmund J
2014-09-08
Dendritic cells (DCs) play a critical role in the generation of adaptive immunity via the efficient capture, processing, and presentation of antigen (Ag) to naïve T cells. Administration of Ag-pulsed DCs is also an effective strategy for enhancing immunity to tumors and infectious disease organisms. Studies have also demonstrated that targeting Ags to Fcγ receptors (FcγR) on Ag presenting cells can enhance humoral and cellular immunity in vitro and in vivo. Specifically, our studies using a Francisella tularensis (Ft) infectious disease vaccine model have demonstrated that targeting immunogens to FcγR via intranasal (i.n.) administration of monoclonal antibody (mAb)-inactivated Ft (iFt) immune complexes (ICs) enhances protection against Ft challenge. Ft is the causative agent of tularemia, a debilitating disease of humans and other mammals and a category A biothreat agent for which there is no approved vaccine. Therefore, using iFt Ag as a model immunogen, we sought to determine if ex vivo targeting of iFt to FcγR on DCs would enhance the potency of i.n. administered iFt-pulsed DCs. In this study, bone marrow-derived DCs (BMDCs) were pulsed ex vivo with iFt or mAb-iFt ICs. Intranasal administration of mAb-iFt-pulsed BMDCs enhanced humoral and cellular immune responses, as well as protection against Ft live vaccine strain (LVS) challenge. Increased protection correlated with increased iFt loading on the BMDC surface as a consequence of FcγR-targeting. However, the inhibitory FcγRIIB had no impact on this enhancement. In conclusion, targeting Ag ex vivo to FcγR on DCs provides a method for enhanced Ag loading of DCs ex vivo, thereby reducing the amount of Ag required, while also avoiding the inhibitory impact of FcγRIIB. Thus, this represents a simple and less invasive strategy for increasing the potency of ex vivo-pulsed DC vaccines against chronic infectious diseases and cancer. Copyright © 2014 Elsevier Ltd. All rights reserved.
Pham, Giang H.; Iglesias, Bibiana V.; Gosselin, Edmund J.
2014-01-01
Dendritic cells (DCs) play a critical role in the generation of adaptive immunity via the efficient capture, processing, and presentation of antigen (Ag) to naïve T cells. Administration of Ag-pulsed DCs is also an effective strategy for enhancing immunity to tumors and infectious disease organisms. Studies have also demonstrated that targeting Ags to Fcγ receptors (FcγR) on Ag presenting cells can enhance humoral and cellular immunity in vitro and in vivo. Specifically, our studies using an F. tularensis (Ft) infectious disease vaccine model have demonstrated that targeting immunogens to FcγR via intranasal (i.n.) administration of monoclonal antibody (mAb)-inactivated Ft (iFt) immune complexes (ICs) enhances protection against Ft challenge. Ft is the causative agent of tularemia, a debilitating disease of humans and other mammals and a category A biothreat agent for which there is no approved vaccine. Therefore, using iFt Ag as a model immunogen, we sought to determine if ex vivo targeting of iFt to FcγR on DCs would enhance the potency of i.n. administered iFt-pulsed DCs. In this study, bone marrow-derived DCs (BMDCs) were pulsed ex vivo with iFt or mAb-iFt ICs. Intranasal administration of mAb-iFt-pulsed BMDCs enhanced humoral and cellular immune responses, as well as protection against Ft live vaccine strain (LVS) challenge. Increased protection correlated with increased iFt loading on the BMDC surface as a consequence of FcγR targeting. However, the inhibitory FcγRIIB had no impact on this enhancement. In conclusion, targeting Ag ex vivo to FcγR on DCs provides a method for enhanced Ag loading of DCs ex vivo, thereby reducing the amount of Ag required, while also avoiding the inhibitory impact of FcγRIIB. Thus, this represents a simple and less invasive strategy for increasing the potency of ex vivo-pulsed DC vaccines against chronic infectious diseases and cancer. PMID:25068496
Murray, Sandra L.; Pinkus, Rebecca T.; Holmes, John G.; Harris, Brianna; Gomillion, Sarah; Aloni, Maya; Derrick, Jaye L.; Leder, Sadie
2011-01-01
A dual process model is proposed to explain how automatic evaluative associations to the partner (i.e., impulsive trust) and deliberative expectations of partner caring (i.e., reflective trust) interact to govern self-protection in romantic relationships. Experimental and correlational studies of dating and marital relationships supported the model. Subliminally conditioning more positive evaluative associations to the partner increased confidence in the partner’s caring, suggesting that trust has an impulsive basis. Being high on impulsive trust (i.e., more positive evaluative associations to the partner on the IAT) also reduced the automatic inclination to distance in response to doubts about the partner’s trustworthiness. It similarly reduced self-protective behavioral reactions to these reflective trust concerns. The studies further revealed that the effects of impulsive trust depend on working memory capacity: Being high on impulsive trust inoculated against reflective trust concerns for people low on working memory capacity. PMID:21443370
Mini-review: Strategies for Variation and Evolution of Bacterial Antigens
Foley, Janet
2015-01-01
Across the eubacteria, antigenic variation has emerged as a strategy to evade host immunity. However, phenotypic variation in some of these antigens also allows the bacteria to exploit variable host niches as well. The specific mechanisms are not shared-derived characters although there is considerable convergent evolution and numerous commonalities reflecting considerations of natural selection and biochemical restraints. Unlike in viruses, mechanisms of antigenic variation in most bacteria involve larger DNA movement such as gene conversion or DNA rearrangement, although some antigens vary due to point mutations or modified transcriptional regulation. The convergent evolution that promotes antigenic variation integrates various evolutionary forces: these include mutations underlying variant production; drift which could remove alleles especially early in infection or during life history phases in arthropod vectors (when the bacterial population size goes through a bottleneck); selection not only for any particular variant but also for the mechanism for the production of variants (i.e., selection for mutability); and overcoming negative selection against variant production. This review highlights the complexities of drivers of antigenic variation, in particular extending evaluation beyond the commonly cited theory of immune evasion. A deeper understanding of the diversity of purpose and mechanisms of antigenic variation in bacteria will contribute to greater insight into bacterial pathogenesis, ecology and coevolution with hosts. PMID:26288700
Hepler, Robert W; Kelly, Rosemarie; McNeely, Tessie B; Fan, Hongxia; Losada, Maria C; George, Hugh A; Woods, Andrea; Cope, Leslie D; Bansal, Alka; Cook, James C; Zang, Gina; Cohen, Steven L; Wei, Xiaorong; Keller, Paul M; Leffel, Elizabeth; Joyce, Joseph G; Pitt, Louise; Schultz, Loren D; Jansen, Kathrin U; Kurtz, Myra
2006-03-06
Infection by Bacillus anthracis is preventable by prophylactic vaccination with several naturally derived and recombinant vaccine preparations. Existing data suggests that protection is mediated by antibodies directed against the protective antigen (PA) component of the anthrax toxin complex. PA is an 83-kDa protein cleaved in vivo to yield a biologically active 63-kDa protein. In an effort to evaluate the potential of yeast as an expression system for the production of recombinant PA, and to determine if the yeast-purified rPA63 can protect from a lethal inhalational challenge, the sequence of the 63-kDa form of PA was codon-optimized and expressed in the yeast Saccharomyces cerevisiae. Highly purified rPA63 isolated from Saccharomyces under denaturing conditions demonstrated reduced biological activity in a macrophage-killing assay compared to non-denatured rPA83 purified from Escherichia coli. Rabbits and non-human primates (NHP) immunized with rPA63 and later challenged with a lethal dose of B. anthracis spores were generally protected from infection. These results indicate that epitopes present in the 63-kDa from of PA can protect rabbits and non-human primates from a lethal spore challenge, and further suggest that a fully functional rPA63 is not required in order to provide these epitopes.
Andrews, S J; Hole, N J; Munn, E A; Rolph, T P
1995-07-01
Pregnant ewes were immunised with a fraction highly enriched in the membrane glycoprotein antigen H11, isolated from the intestinal brush border of adult Haemonchus contortus. Immunity induced by immunisation was able to abolish almost completely (98-99%) the worm egg output from pregnant ewes challenged with ca. 10,000 infective larvae of H. contortus during the last trimester. Furthermore, lambs born and reared on vaccinated ewes had substantial antibody levels to H11 derived from maternal transfer. This antibody conferred moderate protection against a bolus challenge of ca. 3000 infective larvae of H. contortus in 5-week-old lambs.
Strategic evaluation of vaccine candidate antigens for the prevention of Visceral Leishmaniasis.
Duthie, Malcolm S; Favila, Michelle; Hofmeyer, Kimberley A; Tutterrow, Yeung L; Reed, Steven J; Laurance, John D; Picone, Alessandro; Guderian, Jeffrey; Bailor, H Remy; Vallur, Aarthy C; Liang, Hong; Mohamath, Raodoh; Vergara, Julie; Howard, Randall F; Coler, Rhea N; Reed, Steven G
2016-05-27
Infection with Leishmania parasites results in a range of clinical manifestations and outcomes, the most severe of which is visceral leishmaniasis (VL). Vaccination will likely provide the most effective long-term control strategy, as the large number of vectors and potential infectious reservoirs renders sustained interruption of Leishmania parasite transmission extremely difficult. Selection of the best vaccine is complicated because, although several vaccine antigen candidates have been proposed, they have emerged following production in different platforms. To consolidate the information that has been generated into a single vaccine platform, we expressed seven candidates as recombinant proteins in E. coli. After verifying that each recombinant protein could be recognized by VL patients, we evaluated their protective efficacy against experimental L. donovani infection of mice. Administration in formulation with the Th1-potentiating adjuvant GLA-SE indicated that each antigen could elicit antigen-specific Th1 responses that were protective. Considering the ability to reduce parasite burden along with additional factors such as sequence identity across Leishmania species, we then generated a chimeric fusion protein comprising a combination of the 8E, p21 and SMT proteins. This E. coli -expressed fusion protein was also demonstrated to protect against L. donovani infection. These data indicate a novel recombinant vaccine antigen with the potential for use in VL control programs. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Lacasta, Anna; Mwalimu, Stephen; Kibwana, Elisabeth; Saya, Rosemary; Awino, Elias; Njoroge, Thomas; Poole, Jane; Ndiwa, Nicholas; Pelle, Roger; Nene, Vishvanath; Steinaa, Lucilla
2018-03-07
East Coast fever (ECF) is a lymphoproliferative disease caused by the tick-transmitted protozoan parasite Theileria parva. ECF is one of the most serious cattle tick-borne diseases in Sub-Saharan Africa. We have previously demonstrated that three doses of the C-terminal part of the sporozoite protein p67 (p67C) adjuvanted with ISA206VG confers partial protection against ECF at a herd level. We have tested the efficacy of two doses of this experimental vaccine, as reducing the vaccination regimen would facilitate its deployment in the field. We reconfirm that three antigen doses gave a significant level of protection to severe disease (46%, ECF score < 6) when compared with the control group, while two doses did not (23%). Animals receiving three doses of p67C developed higher antibody titers and CD4 + T-cell proliferation indices, than those which received two doses. A new panel of immune parameters were tested in order to identify factors correlating with protection: CD4 + proliferation index, total IgG, IgG1, IgG2 and IgM half maximal titers and neutralization capacity of the sera with and without complement. We show that some of the cellular and humoral immune responses provide preliminary correlates of protection. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.
Antigenicity and Immunogenicity in HIV-1 Antibody-Based Vaccine Design
Kong, Leopold; Sattentau, Quentin J
2012-01-01
Neutralizing antibodies can protect from infection by immunodeficiency viruses. However, the induction by active vaccination of antibodies that can potently neutralize a broad range of circulating virus strains is a goal not yet achieved, despite more than 2 decades of research. Here we review progress made in the field, from early empirical studies to today’s rational structure-based vaccine antigen design. We discuss the existence of broadly neutralizing antibodies, their implications for epitope discovery and recent progress made in antigen design. Finally, we consider the relationship between antigenicity and immunogenicity for B cell recognition and antibody production, a major hurdle for rational vaccine design to overcome. PMID:23227445
Eickhoff, Christopher S; Zhang, Xiuli; Vasconcelos, Jose R; Motz, R Geoffrey; Sullivan, Nicole L; O'Shea, Kelly; Pozzi, Nicola; Gohara, David W; Blase, Jennifer R; Di Cera, Enrico; Hoft, Daniel F
2016-09-01
Trypanosoma cruzi infection is controlled but not eliminated by host immunity. The T. cruzi trans-sialidase (TS) gene superfamily encodes immunodominant protective antigens, but expression of altered peptide ligands by different TS genes has been hypothesized to promote immunoevasion. We molecularly defined TS epitopes to determine their importance for protection versus parasite persistence. Peptide-pulsed dendritic cell vaccination experiments demonstrated that one pair of immunodominant CD4+ and CD8+ TS peptides alone can induce protective immunity (100% survival post-lethal parasite challenge). TS DNA vaccines have been shown by us (and others) to protect BALB/c mice against T. cruzi challenge. We generated a new TS vaccine in which the immunodominant TS CD8+ epitope MHC anchoring positions were mutated, rendering the mutant TS vaccine incapable of inducing immunity to the immunodominant CD8 epitope. Immunization of mice with wild type (WT) and mutant TS vaccines demonstrated that vaccines encoding enzymatically active protein and the immunodominant CD8+ T cell epitope enhance subdominant pathogen-specific CD8+ T cell responses. More specifically, CD8+ T cells from WT TS DNA vaccinated mice were responsive to 14 predicted CD8+ TS epitopes, while T cells from mutant TS DNA vaccinated mice were responsive to just one of these 14 predicted TS epitopes. Molecular and structural biology studies revealed that this novel costimulatory mechanism involves CD45 signaling triggered by enzymatically active TS. This enhancing effect on subdominant T cells negatively regulates protective immunity. Using peptide-pulsed DC vaccination experiments, we have shown that vaccines inducing both immunodominant and subdominant epitope responses were significantly less protective than vaccines inducing only immunodominant-specific responses. These results have important implications for T. cruzi vaccine development. Of broader significance, we demonstrate that increasing breadth of T
Chakraborty, Subhra; Randall, Arlo; Vickers, Tim J; Molina, Doug; Harro, Clayton D; DeNearing, Barbara; Brubaker, Jessica; Sack, David A; Bourgeois, A Louis; Felgner, Philip L; Liang, Xiaowu; Mani, Sachin; Wenzel, Heather; Townsend, R Reid; Gilmore, Petra E; Darsley, Michael J; Rasko, David A; Fleckenstein, James M
2018-05-24
Enterotoxigenic Escherichia coli (ETEC) is a major cause of diarrheal illness in the developing world. ETEC vaccinology has been challenged by genetic diversity and heterogeneity of canonical antigens. Examination of the antigenic breadth of immune responses associated with protective immunity could afford new avenues for vaccine development. Antibody lymphocyte supernatants (ALS) and sera from 20 naïve human volunteers challenged with ETEC strain H10407 and from 10 volunteers re-challenged 4-6 weeks later with the same strain (9 of whom were completely protected on re-challenge) were tested against ETEC proteome microarrays containing 957 antigens. ETEC challenge stimulated robust serum and mucosal (ALS) responses to canonical vaccine antigens (CFA/I, and the B subunit of LT) as well as a small number of antigens not presently targeted in ETEC vaccines. These included pathovar-specific secreted proteins (EtpA, EatA) as well as highly conserved E. coli antigens including YghJ, flagellin (FliC), and pertactin-like autotransporter proteins, all of which have previously afforded protection against ETEC infection in preclinical studies. Collectively, studies reported here suggest that immune responses following ETEC infection involve traditional vaccine targets as well as a select number of more recently identified protein antigens that could offer additional avenues for vaccine development for these pathogens.
Vulliez-Le Normand, B; Saul, F A; Phalipon, A; Bélot, F; Guerreiro, C; Mulard, L A; Bentley, G A
2008-07-22
The anti-LPS IgG mAb F22-4, raised against Shigella flexneri serotype 2a bacteria, protects against homologous, but not heterologous, challenge in an experimental animal model. We report the crystal structures of complexes formed between Fab F22-4 and two synthetic oligosaccharides, a decasaccharide and a pentadecasaccharide that were previously shown to be both immunogenic and antigenic mimics of the S. flexneri serotype 2a O-antigen. F22-4 binds to an epitope contained within two consecutive 2a serotype pentasaccharide repeat units (RU). Six sugar residues from a contiguous nine-residue segment make direct contacts with the antibody, including the nonreducing rhamnose and both branching glucosyl residues from the two RUs. The glucosyl residue, whose position of attachment to the tetrasaccharide backbone of the RU defines the serotype 2a O-antigen, is critical for recognition by F22-4. Although the complete decasaccharide is visible in the electron density maps, the last four pentadecasaccharide residues from the reducing end, which do not contact the antibody, could not be traced. Although considerable mobility in the free oligosaccharides can thus be expected, the conformational similarity between the individual RUs, both within and between the two complexes, suggests that short-range transient ordering to a helical conformation might occur in solution. Although the observed epitope includes the terminal nonreducing residue, binding to internal epitopes within the polysaccharide chain is not precluded. Our results have implications for vaccine development because they suggest that a minimum of two RUs of synthetic serotype 2a oligosaccharide is required for optimal mimicry of O-Ag epitopes.
Vulliez-Le Normand, B.; Saul, F. A.; Phalipon, A.; Bélot, F.; Guerreiro, C.; Mulard, L. A.; Bentley, G. A.
2008-01-01
The anti-LPS IgG mAb F22-4, raised against Shigella flexneri serotype 2a bacteria, protects against homologous, but not heterologous, challenge in an experimental animal model. We report the crystal structures of complexes formed between Fab F22-4 and two synthetic oligosaccharides, a decasaccharide and a pentadecasaccharide that were previously shown to be both immunogenic and antigenic mimics of the S. flexneri serotype 2a O-antigen. F22-4 binds to an epitope contained within two consecutive 2a serotype pentasaccharide repeat units (RU). Six sugar residues from a contiguous nine-residue segment make direct contacts with the antibody, including the nonreducing rhamnose and both branching glucosyl residues from the two RUs. The glucosyl residue, whose position of attachment to the tetrasaccharide backbone of the RU defines the serotype 2a O-antigen, is critical for recognition by F22-4. Although the complete decasaccharide is visible in the electron density maps, the last four pentadecasaccharide residues from the reducing end, which do not contact the antibody, could not be traced. Although considerable mobility in the free oligosaccharides can thus be expected, the conformational similarity between the individual RUs, both within and between the two complexes, suggests that short-range transient ordering to a helical conformation might occur in solution. Although the observed epitope includes the terminal nonreducing residue, binding to internal epitopes within the polysaccharide chain is not precluded. Our results have implications for vaccine development because they suggest that a minimum of two RUs of synthetic serotype 2a oligosaccharide is required for optimal mimicry of O-Ag epitopes. PMID:18621718
Chapanian, Rafi; Constantinescu, Iren; Rossi, Nicholas A A; Medvedev, Nadia; Brooks, Donald E; Scott, Mark D; Kizhakkedathu, Jayachandran N
2012-11-01
Hyperbranched polyglycerol (HPG) and polyethylene glycol (PEG) polymers with similar hydrodynamic sizes in solution were grafted to red blood cells (RBCs) to investigate the impact of polymer architecture on the cell structure and function. The hydrodynamic sizes of polymers were calculated from the diffusion coefficients measured by pulsed field gradient NMR. The hydration of the HPG and PEG was determined by differential scanning calorimetry analyses. RBCs grafted with linear PEG had different properties compared to the compact HPG grafted RBCs. HPG grafted RBCs showed much higher electrophoretic mobility values than PEG grafted RBCs at similar grafting concentrations and hydrodynamic sizes indicating differences in the structure of the polymer exclusion layer on the cell surface. PEG grafting impacted the deformation properties of the membrane to a greater degree than HPG. The complement mediated lysis of the grafted RBCs was dependent on the type of polymer, grafting concentration and molecular size of grafted chains. At higher molecular weights and graft concentrations both HPG and PEG triggered complement activation. The magnitude of activation was higher with HPG possibly due to the presence of many hydroxyl groups per molecule. HPG grafted RBCs showed significantly higher levels of CD47 self-protein accessibility than PEG grafted RBCs at all grafting concentrations and molecular sizes. PEG grafted polymers provided, in general, a better shielding and protection to ABO and minor antigens from antibody recognition than HPG polymers, however, the compact HPGs provided greater protection of certain antigens on the RBC surface. Our data showed that HPG 20 kDa and HPG 60 kDa grafted RBCs exhibited properties that are more comparable to the native RBC than PEG 5 kDa and PEG 10 kDa grafted RBCs of comparable hydrodynamic sizes. The study shows that small compact polymers such as HPG 20 kDa have a greater potential in the generation of functional RBC for therapeutic
Parreiras, P M; Sirota, L A; Wagner, L D; Menzies, S L; Arciniega, J L
2009-07-16
Complexities of lethal challenge models have prompted the investigation of immunogenicity assays as potency tests of anthrax vaccines. An ELISA and a lethal toxin neutralization assay (TNA) were used to measure antibody response to Protective Antigen (PA) in mice immunized once with either a commercial or a recombinant PA (rPA) vaccine formulated in-house. Even though ELISA and TNA results showed correlation, ELISA results may not be able to accurately predict TNA results in this single immunization model.
Sloat, Brian R.; Sandoval, Michael A.; Hau, Andrew M.; He, Yongqun; Cui, Zhengrong
2009-01-01
An accumulation of research over the years has demonstrated the utility of nanoparticles as antigen carriers with adjuvant activity. Herein we defined the adjuvanticity of a novel lecithin-based nanoparticle engineered from emulsions. The nanoparticles were spheres of around 200 nm. Model protein antigens, bovine serum albumin (BSA) or Bacillus anthracis protective antigen (PA) protein, were covalently conjugated onto the nanoparticles. Mice immunized with the BSA-conjugated nanoparticles developed strong anti-BSA antibody responses comparable to that induced by BSA adjuvanted with incomplete Freund's adjuvant and 6.5-fold stronger than that induced by BSA adsorbed onto aluminum hydroxide. Immunization of mice with the PA-conjugated nanoparticles elicited a quick, strong, and durable anti-PA antibody response that afforded protection of the mice against a lethal dose of anthrax lethal toxin challenge. The potent adjuvanticity of the nanoparticles was likely due to their ability to move the antigens into local draining lymph nodes, to enhance the uptake of the antigens by antigen-presenting cells (APCs), and to activate APCs. This novel nanoparticle system has the potential to serve as a universal protein-based vaccine carrier capable of inducing strong immune responses. PMID:19729045
Bartley, Kathryn; Nisbet, Alasdair J; Offer, Jill E; Sparks, Nicholas H C; Wright, Harry W; Huntley, John F
2009-03-01
A cDNA encoding a 174-amino-acid orthologue of a tick histamine release factor (HRF) was identified from the haematophagous poultry red mite Dermanyssus gallinae. The predicted D. gallinae HRF protein (Dg-HRF-1) sequence is highly conserved with the tick HRFs (identity 52-54%) and to a lesser degree with translationally controlled tumour proteins (TCTP) from mammals and other invertebrates (range 38-47%). Phylogenetically, Dg-HRF-1 partitions with the tick HRF clade suggesting a shared linage and potentially similar function(s). A recombinant Dg-HRF-1 protein (rDg-HRF-1) was produced and shown to induce degranulation of rat peritoneal mast cells in vitro, confirming conservation of the histamine-releasing function in D. gallinae. Polyclonal antibodies were generated in rabbits and hens to rDg-HRF-1. Western blotting demonstrated that native Dg-HRF is a soluble protein and immunohistochemical staining of mite sections revealed that the distribution of Dg-HRF, although ubiquitous, is more common in mite reproductive, digestive and synganglion tissues. A survey of hens housed continuously in a mite-infested commercial poultry unit failed to identify IgY specific for recombinant or native Dg-HRF, indicating that Dg-HRF is not exposed to the host during infestation/feeding and may therefore have potential as a vaccine using the concealed antigen approach. To test the protective capability of rDg-HRF-1, fresh heparinised chicken blood was enriched with yolk-derived anti-Dg-HRF IgY antibodies and fed to semi-starved mites using an in vitro feeding system. A statistically significant increase in mortality was shown (P=0.004) in mites fed with anti-Dg-HRF IgY after just one blood meal. The work presented here demonstrates, to our knowledge for the first time, the feasibility of vaccinating hens with recombinant D. gallinae antigens to control mite infestation and the potential of rDg-HRF-1 as a vaccine antigen.
Xu, Ying; Yang, Enzhuo; Wang, Jianguang; Li, Rui; Li, Guanghua; Liu, Guoyuan; Song, Na; Huang, Qi; Kong, Cong; Wang, Honghai
2014-10-01
To prevent the global spread of tuberculosis (TB), more effective vaccines and vaccination strategies are urgently needed. As a result of the success of bacillus Calmette-Guérin (BCG) in protecting children against miliary and meningeal TB, the majority of individuals will have been vaccinated with BCG; hence, boosting BCG-primed immunity will probably be a key component of future vaccine strategies. In this study, we compared the ability of DNA-, protein- and lentiviral vector-based vaccines that express the antigens Ag85B and Rv3425 to boost the effects of BCG in the context of immunity and protection against Mycobacterium tuberculosis in C57BL/6 mice. Our results demonstrated that prime-boost BCG vaccination with a lentiviral vector expressing the antigens Ag85B and Rv3425 significantly enhanced immune responses, including T helper type 1 and CD8(+) cytotoxic T lymphocyte responses, compared with DNA- and protein-based vaccines. However, lentivirus-vectored and DNA-based vaccines greatly improved the protective efficacy of BCG against M. tuberculosis, as indicated by a lack of weight loss and significantly reduced bacterial loads and histological damage in the lung. Our study suggests that the use of lentiviral or DNA vaccines containing the antigens Ag85B and Rv3425 to boost BCG is a good choice for the rational design of an efficient vaccination strategy against TB. © 2014 John Wiley & Sons Ltd.
Phillips, Aaron T; Schountz, Tony; Toth, Ann M; Rico, Amber B; Jarvis, Donald L; Powers, Ann M; Olson, Ken E
2014-02-01
Alphaviruses are mosquito-borne viruses that cause significant disease in animals and humans. Western equine encephalitis virus (WEEV) and eastern equine encephalitis virus (EEEV), two New World alphaviruses, can cause fatal encephalitis, and EEEV is a select agent of concern in biodefense. However, we have no antiviral therapies against alphaviral disease, and current vaccine strategies target only a single alphavirus species. In an effort to develop new tools for a broader response to outbreaks, we designed and tested a novel alphavirus vaccine comprised of cationic lipid nucleic acid complexes (CLNCs) and the ectodomain of WEEV E1 protein (E1ecto). Interestingly, we found that the CLNC component, alone, had therapeutic efficacy, as it increased survival of CD-1 mice following lethal WEEV infection. Immunization with the CLNC-WEEV E1ecto mixture (lipid-antigen-nucleic acid complexes [LANACs]) using a prime-boost regimen provided 100% protection in mice challenged with WEEV subcutaneously, intranasally, or via mosquito. Mice immunized with LANACs mounted a strong humoral immune response but did not produce neutralizing antibodies. Passive transfer of serum from LANAC E1ecto-immunized mice to nonimmune CD-1 mice conferred protection against WEEV challenge, indicating that antibody is sufficient for protection. In addition, the LANAC E1ecto immunization protocol significantly increased survival of mice following intranasal or subcutaneous challenge with EEEV. In summary, our LANAC formulation has therapeutic potential and is an effective vaccine strategy that offers protection against two distinct species of alphavirus irrespective of the route of infection. We discuss plausible mechanisms as well the potential utility of our LANAC formulation as a pan-alphavirus vaccine.
Gramzinski, Robert A.; Doolan, Denise L.; Sedegah, Martha; Davis, Heather L.; Krieg, Arthur M.; Hoffman, Stephen L.
2001-01-01
Unmethylated CpG dinucleotides in bacterial DNA or synthetic oligodeoxynucleotides (ODNs) cause B-cell proliferation and immunoglobulin secretion, monocyte cytokine secretion, and activation of natural killer (NK) cell lytic activity and gamma interferon (IFN-γ) secretion in vivo and in vitro. The potent Th1-like immune activation by CpG ODNs suggests a possible utility for enhancing innate immunity against infectious pathogens. We therefore investigated whether the innate immune response could protect against malaria. Treatment of mice with CpG ODN 1826 (TCCATGACGTTCCTGACGTT, with the CpG dinucleotides underlined) or 1585 (ggGGTCAACGTTGAgggggG, with g representing diester linkages and phosphorothioate linkages being to the right of lowercase letters) in the absence of antigen 1 to 2 days prior to challenge with Plasmodium yoelii sporozoites conferred sterile protection against infection. A higher level of protection was consistently induced by CpG ODN 1826 compared with CpG ODN 1585. The protective effects of both CpG ODNs were dependent on interleukin-12, as well as IFN-γ. Moreover, CD8+ T cells (but not CD4+ T cells), NK cells, and nitric oxide were implicated in the CpG ODN 1585-induced protection. These data establish that the protective mechanism induced by administration of CpG ODN 1585 in the absence of parasite antigen is similar in nature to the mechanism induced by immunization with radiation-attenuated P. yoelii sporozoites or with plasmid DNA encoding preerythrocytic-stage P. yoelii antigens. We were unable to confirm whether CD8+ T cells, NK cells, or nitric oxide were required for the CpG ODN 1826-induced protection, but this may reflect differences in the potency of the ODNs rather than a real difference in the mechanism of action of the two ODNs. This is the first report that stimulation of the innate immune system by CpG immunostimulatory motifs can confer sterile protection against malaria. PMID:11179339
Bortolussi, R; Ferrier, P
1980-04-01
The protective value of antibody to the K1 capsular polysaccharide antigen of Escherichia coli was investigated in a newborn rat model of E. coli K1 infection. Pregnant rats were immunized intravenously with E. coli, and the agglutinating titer to meningococcal group B polysaccharide, which is identical to K1 polysaccharide, was measured in the serum of rats and their offspring. Convalescent serum from rat mothers showed an increased antibody titer in animals injected twice but not once with E. coli K1. Although no agglutinating antibody was detected in the serum of rat pups, animals suckled by mothers having a meningococcal group B agglutinating titer of 1:8 or greater had reduced infection and mortality rates after intraperitoneal injection with E. coli K1 compared with animals suckled by mothers having a low titer of agglutinating antibody (P less than 0.05). In addition, greater protection could be conferred on rat sucklings by oral supplementation with a horse serum rich in antibody to meningococcal group B polysaccharide, suggesting that antibody was abosorbed from the gastrointestinal tract and by itself could be protective. These studies demonstrated that antibody to the capsular polysaccharide of E. coli K1 altered the severity of E. coli K1 infection. Final clearance of bacteria from the blood appeared to await the maturation of other host defense systems in the newborn rat.
Peachman, Kristina K; Li, Qin; Matyas, Gary R; Shivachandra, Sathish B; Lovchik, Julie; Lyons, Rick C; Alving, Carl R; Rao, Venigalla B; Rao, Mangala
2012-01-01
In an effort to develop an improved anthrax vaccine that shows high potency, five different anthrax protective antigen (PA)-adjuvant vaccine formulations that were previously found to be efficacious in a nonhuman primate model were evaluated for their efficacy in a rabbit pulmonary challenge model using Bacillus anthracis Ames strain spores. The vaccine formulations include PA adsorbed to Alhydrogel, PA encapsulated in liposomes containing monophosphoryl lipid A, stable liposomal PA oil-in-water emulsion, PA displayed on bacteriophage T4 by the intramuscular route, and PA mixed with Escherichia coli heat-labile enterotoxin administered by the needle-free transcutaneous route. Three of the vaccine formulations administered by the intramuscular or the transcutaneous route as a three-dose regimen induced 100% protection in the rabbit model. One of the formulations, liposomal PA, also induced significantly higher lethal toxin neutralizing antibodies than PA-Alhydrogel. Even 5 months after the second immunization of a two-dose regimen, rabbits vaccinated with liposomal PA were 100% protected from lethal challenge with Ames strain spores. In summary, the needle-free skin delivery and liposomal formulation that were found to be effective in two different animal model systems appear to be promising candidates for next-generation anthrax vaccine development.
Bayer, Wibke; Tenbusch, Matthias; Lietz, Ruth; Johrden, Lena; Schimmer, Simone; Uberla, Klaus; Dittmer, Ulf; Wildner, Oliver
2010-02-01
We present a new type of adenoviral vector that both encodes and displays a vaccine antigen on the capsid, thus combining in itself gene-based and protein vaccination; this vector resulted in an improved vaccination outcome in the Friend virus (FV) model. For presentation of the envelope protein gp70 of Friend murine leukemia virus on the adenoviral capsid, gp70 was fused to the adenovirus capsid protein IX. When compared to vaccination with conventional FV Env- and Gag-encoding adenoviral vectors, vaccination with the adenoviral vector that encodes and displays pIX-gp70 combined with an FV Gag-encoding vector resulted in significantly improved protection against systemic FV challenge infection, with highly controlled viral loads in plasma and spleen. This improved protection correlated with improved neutralizing antibody titers and stronger CD4(+) T-cell responses. Using a vector that displays gp70 without encoding it, we found that while the antigen display on the capsid alone was sufficient to induce high levels of binding antibodies, in vivo expression was necessary for the induction of neutralizing antibodies. This new type of adenovirus-based vaccine could be a valuable tool for vaccination.
The Protective Antigen Component of Anthrax Toxin Forms Functional Octameric Complexes
Kintzer, Alexander F.; Thoren, Katie L.; Sterling, Harry J.; Dong, Ken C.; Feld, Geoffrey K.; Tang, Iok I.; Zhang, Teri T.; Williams, Evan R.; Berger, James M.; Krantz, Bryan A.
2009-01-01
The assembly of bacterial toxins and virulence factors is critical to their function, but the regulation of assembly during infection has not been studied. We begin to address this question using anthrax toxin as a model. The protective antigen (PA) component of the toxin assembles into ring-shaped homooligomers that bind the two other enzyme components of the toxin, lethal factor (LF) and edema factor (EF), to form toxic complexes. To disrupt the host, these toxic complexes are endocytosed, such that the PA oligomer forms a membrane-spanning channel that LF and EF translocate through to enter the cytosol. We show using single-channel electrophysiology that PA channels contain two populations of conductance states, which correspond with two different PA pre-channel oligomers observed by electron microscopy—the well-described heptamer and a novel octamer. Mass spectrometry demonstrates that the PA octamer binds four LFs, and assembly routes leading to the octamer are populated with even-numbered, dimeric and tetrameric, PA intermediates. Both heptameric and octameric PA complexes can translocate LF and EF with similar rates and efficiencies. Here we also report a 3.2-Å crystal structure of the PA octamer. The octamer comprises ∼20−30% of the oligomers on cells, but outside of the cell, the octamer is more stable than the heptamer under physiological pH. Thus the PA octamer is a physiological, stable, and active assembly state capable of forming lethal toxins that may withstand the hostile conditions encountered in the bloodstream. This assembly mechanism may provide a novel means to control cytotoxicity. PMID:19627991
Electrostatic Ratchet in the Protective Antigen Channel Promotes Anthrax Toxin Translocation*
Wynia-Smith, Sarah L.; Brown, Michael J.; Chirichella, Gina; Kemalyan, Gigi; Krantz, Bryan A.
2012-01-01
Central to the power-stroke and Brownian-ratchet mechanisms of protein translocation is the process through which nonequilibrium fluctuations are rectified or ratcheted by the molecular motor to transport substrate proteins along a specific axis. We investigated the ratchet mechanism using anthrax toxin as a model. Anthrax toxin is a tripartite toxin comprised of the protective antigen (PA) component, a homooligomeric transmembrane translocase, which translocates two other enzyme components, lethal factor (LF) and edema factor (EF), into the cytosol of the host cell under the proton motive force (PMF). The PA-binding domains of LF and EF (LFN and EFN) possess identical folds and similar solution stabilities; however, EFN translocates ∼10–200-fold slower than LFN, depending on the electrical potential (Δψ) and chemical potential (ΔpH) compositions of the PMF. From an analysis of LFN/EFN chimera proteins, we identified two 10-residue cassettes comprised of charged sequence that were responsible for the impaired translocation kinetics of EFN. These cassettes have nonspecific electrostatic requirements: one surprisingly prefers acidic residues when driven by either a Δψ or a ΔpH; the second requires basic residues only when driven by a Δψ. Through modeling and experiment, we identified a charged surface in the PA channel responsible for charge selectivity. The charged surface latches the substrate and promotes PMF-driven transport. We propose an electrostatic ratchet in the channel, comprised of opposing rings of charged residues, enforces directionality by interacting with charged cassettes in the substrate, thereby generating forces sufficient to drive unfolding. PMID:23115233
Liu, Tingqi; Huang, Jingwei; Li, Yanlin; Ehsan, Muhammad; Wang, Shuai; Zhou, Zhouyang; Song, Xiaokai; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui
2018-05-30
Coccidiosis is recognised as a major parasitic disease in chickens. Eimeria maxima is considered as a highly immunoprotective species within the Eimeria spp. family that infects chickens. In the present research, the surface antigen gene of E. maxima (EmSAG) was cloned, and the ability of EmSAG to stimulate protection against E. maxima was evaluated. Prokaryotic and eukaryotic plasmids expressing EmSAG were constructed. The EmSAG transcription and expression in vivo was performed based on the RT-PCR and immunoblot analysis. The expression of EmSAG in sporozoites and merozoites was detected through immunofluorescence analyses. The immune protection was assessed based on challenge experiments. Flow cytometry assays were used to determine the T cell subpopulations. The serum antibody and cytokine levels were evaluated by ELISA. The open reading frame (ORF) of EmSAG gene contained 645 bp encoding 214 amino acid residues. The immunoblot and RT-PCR analyses indicated that the EmSAG gene were transcribed and expressed in vivo. The EmSAG proteins were expressed in sporozoite and merozoite stages of E. maxima by the immunofluorescence assay. Challenge experiments showed that both pVAX1-SAG and the recombinant EmSAG (rEmSAG) proteins were successful in alleviating jejunal lesions, decreasing loss of body weight and the oocyst ratio. Additionally, these experiments possessed anticoccidial indices (ACI) of more than 170. Higher percentages of CD4 + and CD8 + T cells were detected in both EmSAG-inoculated birds than those of the negative control groups (P < 0.05). The EmSAG-specific antibody concentrations of both the rEmSAG and pVAX1-EmSAG groups were much higher than those of the negative controls (P < 0.05). Higher concentrations of IL-4, IFN-γ, TGF-β1 and IL-17 were observed more in both the rEmSAG protein and pVAX1-SAG inoculated groups than those of negative controls (P < 0.05). Our findings suggest that EmSAG is capable of eliciting a moderate immune
Strategies to alleviate original antigenic sin responses to influenza viruses.
Kim, Jin Hyang; Davis, William G; Sambhara, Suryaprakash; Jacob, Joshy
2012-08-21
Original antigenic sin is a phenomenon wherein sequential exposure to closely related influenza virus variants reduces antibody (Ab) response to novel antigenic determinants in the second strain and, consequently, impairs the development of immune memory. This could pose a risk to the development of immune memory in persons previously infected with or vaccinated against influenza. Here, we explored strategies to overcome original antigenic sin responses in mice sequentially exposed to two closely related hemagglutinin 1 neuraminidase 1 (H1N1) influenza strains A/PR/8/34 and A/FM/1/47. We found that dendritic cell-activating adjuvants [Bordetella pertussis toxin (PT) or CpG ODN or a squalene-based oil-in-water nanoemulsion (NE)], upon administration during the second viral exposure, completely protected mice from a lethal challenge and enhanced neutralizing-Ab titers against the second virus. Interestingly, PT and NE adjuvants when administered during the first immunization even prevented original antigenic sin in subsequent immunization without any adjuvants. As an alternative to using adjuvants, we also found that repeated immunization with the second viral strain relieved the effects of original antigenic sin. Taken together, our studies provide at least three ways of overcoming original antigenic sin.
Cervantes-Villagrana, Alberto R.; Hernández-Pando, Rogelio; Biragyn, Arya; Castañeda-Delgado, Julio; Bodogai, Monica; Martínez-Fierro, Margarita; Sada, Eduardo; Trujillo, Valentin; Enciso-Moreno, Antonio; Rivas-Santiago, Bruno
2018-01-01
The World Health Organization (WHO) has estimated that there are about 8 million new cases annually of active Tuberculosis (TB). Despite its irregular effectiveness (0–89%), the Bacillus Calmette-Guérin) BCG is the only vaccine available worldwide for prevention of TB; thus, the design is important of novel and more efficient vaccination strategies. Considering that β-defensin-2 is an antimicrobial peptide that induces dendritic cell maturation through the TLR-4 receptor and that both ESAT-6 and Ag85B are immunodominant mycobacterial antigens and efficient activators of the protective immune response, we constructed two DNA vaccines by the fusion of the gene encoding β-defensin-2 and antigens ESAT6 (pDE) and 85B (pDA). After confirming efficient local antigen expression that induced high and stable Interferon gamma (IFN-γ) production in intramuscular (i.m.) vaccinated Balb/c mice, groups of mice were vaccinated with DNA vaccines in a prime-boost regimen with BCG and with BCG alone, and 2 months later were challenged with the mild virulence reference strain H37Rv and the highly virulent clinical isolate LAM 5186. The level of protection was evaluated by survival, lung bacilli burdens, and extension of tissue damage (pneumonia). Vaccination with both DNA vaccines showed similar protection to that of BCG. After the challenge with the highly virulent Mycobacterium tuberculosis strain, animals that were prime-boosted with BCG and then boosted with both DNA vaccines showed significant higher survival and less tissue damage than mice vaccinated only with BCG. These results suggest that improvement of BCG vaccination, such as the prime-boost DNA vaccine, represents a more efficient vaccination scheme against TB. PMID:23196205
Cervantes-Villagrana, Alberto R; Hernández-Pando, Rogelio; Biragyn, Arya; Castañeda-Delgado, Julio; Bodogai, Monica; Martínez-Fierro, Margarita; Sada, Eduardo; Trujillo, Valentin; Enciso-Moreno, Antonio; Rivas-Santiago, Bruno
2013-01-11
The World Health Organization (WHO) has estimated that there are about 8 million new cases annually of active Tuberculosis (TB). Despite its irregular effectiveness (0-89%), the Bacillus Calmette-Guérin) BCG is the only vaccine available worldwide for prevention of TB; thus, the design is important of novel and more efficient vaccination strategies. Considering that β-defensin-2 is an antimicrobial peptide that induces dendritic cell maturation through the TLR-4 receptor and that both ESAT-6 and Ag85B are immunodominant mycobacterial antigens and efficient activators of the protective immune response, we constructed two DNA vaccines by the fusion of the gene encoding β-defensin-2 and antigens ESAT6 (pDE) and 85B (pDA). After confirming efficient local antigen expression that induced high and stable Interferon gamma (IFN-γ) production in intramuscular (i.m.) vaccinated Balb/c mice, groups of mice were vaccinated with DNA vaccines in a prime-boost regimen with BCG and with BCG alone, and 2 months later were challenged with the mild virulence reference strain H37Rv and the highly virulent clinical isolate LAM 5186. The level of protection was evaluated by survival, lung bacilli burdens, and extension of tissue damage (pneumonia). Vaccination with both DNA vaccines showed similar protection to that of BCG. After the challenge with the highly virulent Mycobacterium tuberculosis strain, animals that were prime-boosted with BCG and then boosted with both DNA vaccines showed significant higher survival and less tissue damage than mice vaccinated only with BCG. These results suggest that improvement of BCG vaccination, such as the prime-boost DNA vaccine, represents a more efficient vaccination scheme against TB. Copyright © 2012 Elsevier Ltd. All rights reserved.
A scalable method for O-antigen purification applied to various Salmonella serovars
Micoli, F.; Rondini, S.; Gavini, M.; Pisoni, I.; Lanzilao, L.; Colucci, A.M.; Giannelli, C.; Pippi, F.; Sollai, L.; Pinto, V.; Berti, F.; MacLennan, C.A.; Martin, L.B.; Saul, A.
2014-01-01
The surface lipopolysaccharide of gram-negative bacteria is both a virulence factor and a B cell antigen. Antibodies against O-antigen of lipopolysaccharide may confer protection against infection, and O-antigen conjugates have been designed against multiple pathogens. Here, we describe a simplified methodology for extraction and purification of the O-antigen core portion of Salmonella lipopolysaccharide, suitable for large-scale production. Lipopolysaccharide extraction and delipidation are performed by acetic acid hydrolysis of whole bacterial culture and can take place directly in a bioreactor, without previous isolation and inactivation of bacteria. Further O-antigen core purification consists of rapid filtration and precipitation steps, without using enzymes or hazardous chemicals. The process was successfully applied to various Salmonella enterica serovars (Paratyphi A, Typhimurium, and Enteritidis), obtaining good yields of high-quality material, suitable for conjugate vaccine preparations. PMID:23142430
Costa, Lourena Emanuele; Goulart, Luiz Ricardo; Pereira, Nathália Cristina de Jesus; Lima, Mayara Ingrid Sousa; Duarte, Mariana Costa; Martins, Vivian Tamietti; Lage, Paula Sousa; Menezes-Souza, Daniel; Ribeiro, Tatiana Gomes; Melo, Maria Norma; Fernandes, Ana Paula; Soto, Manuel; Tavares, Carlos Alberto Pereira; Chávez-Fumagalli, Miguel Angel; Coelho, Eduardo Antonio Ferraz
2014-01-01
Background The development of cost-effective prophylactic strategies to prevent leishmaniasis has become a high-priority. The present study has used the phage display technology to identify new immunogens, which were evaluated as vaccines in the murine model of visceral leishmaniasis (VL). Epitope-based immunogens, represented by phage-fused peptides that mimic Leishmania infantum antigens, were selected according to their affinity to antibodies from asymptomatic and symptomatic VL dogs' sera. Methodology/Main Findings Twenty phage clones were selected after three selection cycles, and were evaluated by means of in vitro assays of the immune stimulation of spleen cells derived from naive and chronically infected with L. infantum BALB/c mice. Clones that were able to induce specific Th1 immune response, represented by high levels of IFN-γ and low levels of IL-4 were selected, and based on their selectivity and specificity, two clones, namely B10 and C01, were further employed in the vaccination protocols. BALB/c mice vaccinated with clones plus saponin showed both a high and specific production of IFN-γ, IL-12, and GM-CSF after in vitro stimulation with individual clones or L. infantum extracts. Additionally, these animals, when compared to control groups (saline, saponin, wild-type phage plus saponin, or non-relevant phage clone plus saponin), showed significant reductions in the parasite burden in the liver, spleen, bone marrow, and paws' draining lymph nodes. Protection was associated with an IL-12-dependent production of IFN-γ, mainly by CD8+ T cells, against parasite proteins. These animals also presented decreased parasite-mediated IL-4 and IL-10 responses, and increased levels of parasite-specific IgG2a antibodies. Conclusions/Significance This study describes two phage clones that mimic L. infantum antigens, which were directly used as immunogens in vaccines and presented Th1-type immune responses, and that significantly reduced the parasite burden. This
Costa, Lourena Emanuele; Goulart, Luiz Ricardo; Pereira, Nathália Cristina de Jesus; Lima, Mayara Ingrid Sousa; Duarte, Mariana Costa; Martins, Vivian Tamietti; Lage, Paula Sousa; Menezes-Souza, Daniel; Ribeiro, Tatiana Gomes; Melo, Maria Norma; Fernandes, Ana Paula; Soto, Manuel; Tavares, Carlos Alberto Pereira; Chávez-Fumagalli, Miguel Angel; Coelho, Eduardo Antonio Ferraz
2014-01-01
The development of cost-effective prophylactic strategies to prevent leishmaniasis has become a high-priority. The present study has used the phage display technology to identify new immunogens, which were evaluated as vaccines in the murine model of visceral leishmaniasis (VL). Epitope-based immunogens, represented by phage-fused peptides that mimic Leishmania infantum antigens, were selected according to their affinity to antibodies from asymptomatic and symptomatic VL dogs' sera. Twenty phage clones were selected after three selection cycles, and were evaluated by means of in vitro assays of the immune stimulation of spleen cells derived from naive and chronically infected with L. infantum BALB/c mice. Clones that were able to induce specific Th1 immune response, represented by high levels of IFN-γ and low levels of IL-4 were selected, and based on their selectivity and specificity, two clones, namely B10 and C01, were further employed in the vaccination protocols. BALB/c mice vaccinated with clones plus saponin showed both a high and specific production of IFN-γ, IL-12, and GM-CSF after in vitro stimulation with individual clones or L. infantum extracts. Additionally, these animals, when compared to control groups (saline, saponin, wild-type phage plus saponin, or non-relevant phage clone plus saponin), showed significant reductions in the parasite burden in the liver, spleen, bone marrow, and paws' draining lymph nodes. Protection was associated with an IL-12-dependent production of IFN-γ, mainly by CD8+ T cells, against parasite proteins. These animals also presented decreased parasite-mediated IL-4 and IL-10 responses, and increased levels of parasite-specific IgG2a antibodies. This study describes two phage clones that mimic L. infantum antigens, which were directly used as immunogens in vaccines and presented Th1-type immune responses, and that significantly reduced the parasite burden. This is the first study that describes phage-displayed peptides as
The RAG2 C-terminus and ATM protect genome integrity by controlling antigen receptor gene cleavage
Chaumeil, Julie; Micsinai, Mariann; Ntziachristos, Panagiotis; Roth, David B.; Aifantis, Iannis; Kluger, Yuval; Deriano, Ludovic; Skok, Jane A.
2013-01-01
Tight control of antigen-receptor gene rearrangement is required to preserve genome integrity and prevent the occurrence of leukemia and lymphoma. Nonetheless, mistakes can happen, leading to the generation of aberrant rearrangements, such as Tcra/d-Igh inter-locus translocations that are a hallmark of ATM deficiency. Current evidence indicates that these translocations arise from the persistence of unrepaired breaks converging at different stages of thymocyte differentiation. Here we show that a defect in feedback control of RAG2 activity gives rise to bi-locus breaks and damage on Tcra/d and Igh in the same T cell at the same developmental stage, which provides a direct mechanism for generating these inter-locus rearrangements. Both the RAG2 C-terminus and ATM prevent bi-locus RAG-mediated cleavage through modulation of 3D conformation (higher order loops) and nuclear organization of the two loci. This limits the number of potential substrates for translocation and provides an important mechanism for protecting genome stability. PMID:23900513
Johnson, Bill J.; Briggs, Robert E.; Ridpath, Julia F.; Saliki, Jeremiah T.; Confer, Anthony W.; Burge, Lurinda J.; Step, Douglas L.; Walker, Derek A.; Payton, Mark E.
2006-01-01
Abstract Calves persistently infected (PI) with Bovine viral diarrhea virus (BVDV) represent an important source of infection for susceptible cattle. We evaluated vaccine efficacy using calves PI with noncytopathic BVDV2a for the challenge and compared tests to detect BVDV in acutely or transiently infected calves versus PI calves. Vaccination with 2 doses of modified live virus vaccine containing BVDV1a and BVDV2a protected the calves exposed to the PI calves: neither viremia nor nasal shedding occurred. An immunohistochemistry test on formalin-fixed ear notches and an antigen-capture enzyme-linked immunosorbent assay on fresh notches in phosphate-buffered saline did not detect BVDV antigen in any of the acutely or transiently infected calves, whereas both tests had positive results in all the PI calves. PMID:16639944
Guo, Jingjing; Sun, Xiahui; Yin, Huiquan; Wang, Ting; Li, Yan; Zhou, Chunxue; Zhou, Huaiyu; He, Shenyi; Cong, Hua
2018-01-01
Multiple antigenic peptide (MAP) vaccines have advantages over traditional Toxoplasma gondii vaccines, but are more susceptible to enzymatic degradation. As an effective delivery system, chitosan microspheres (CS) can overcome this obstacle and act as a natural adjuvant to promote T helper 1 (Th1) cellular immune responses. In this study, we use chitosan microparticles to deliver multiple antigenic epitopes from GRA10 (G10E), containing three dominant epitopes. When G10E was entrapped within chitosan microparticles (G10E-CS), adequate peptides for eliciting immune response were loaded in the microsphere core and this complex released G10E peptides stably. The efficiency of G10E-CS was detected both in vitro , via cell culture, and through in vivo mouse immunization. In vitro , G10E-CS activated Dendritic Cells (DC) and T lymphocytes by upregulating the secretion of costimulatory molecules (CD40 and CD86). In vivo , Th1 biased cellular and humoral immune responses were activated in mice vaccinated with G10E-CS, accompanied by significantly increased production of IFN-γ, IL-2, and IgG, and decreases in IL-4, IL-10, and IgG1. Immunization with G10E-CS conferred significant protection with prolonged survival in mice model of acute toxoplasmosis and statistically significant decreases in cyst burden in murine chronic toxoplasmosis. The results from this study indicate that chitosan microspheres used as an effective system to deliver a linked antigenic peptides is a promising strategy for the development of efficient vaccine against T. gondii .
Gilchuk, Pavlo; Knight, Frances C; Wilson, John T; Joyce, Sebastian
2017-01-01
CD8+ cytotoxic T lymphocytes confer protection against infectious diseases caused by viruses, bacteria, and parasites. Hence, significant efforts have been invested into devising ways to generate CD8+ T cell-targeted vaccines. Generation of microbe-free protein subunit vaccines requires a thorough knowledge of protective target antigens. Such antigens are proteolytically processed peptides presented by MHC class I molecules. To induce a robust antigen-specific CD8+ T cell response through vaccination, it is essential to formulate the antigen with an effective adjuvant. Here, we describe a versatile method for generating high-frequency antigen-specific CD8+ T cells through immunization of mice using the invariant natural killer T cell agonist α-galactosylceramide as the adjuvant.
Li, Geng; Ali, Selman A; McArdle, Stephanie E B; Mian, Shahid; Ahmad, Murrium; Miles, Amanda; Rees, Robert C
2005-01-01
During the last decade, a large number of human tumour antigens have been identified. These antigens are classified as tumour-specific shared antigens, tissue-specific differentiation antigens, overexpressed antigens, tumour antigens resulting from mutations, viral antigens and fusion proteins. Antigens recognised by effectors of immune system are potential targets for antigen-specific cancer immunotherapy. However, most tumour antigens are self-proteins and are generally of low immunogenicity and the immune response elicited towards these tumour antigens is not always effective. Strategies to induce and enhance the tumour antigen-specific response are needed. This review will summarise the approaches to discovery of tumour antigens, the current status of tumour antigens, and their potential application to cancer treatment.
Gonzalez, Luis Miguel; Bonay, Pedro; Benitez, Laura; Ferrer, Elizabeth; Harrison, Leslie J S; Parkhouse, R Michael E; Garate, Teresa
2007-02-01
Two clones from an activated Taenia saginata oncosphere cDNA library, Ts45W and Ts45S, were isolated and sequenced. Both of these genes belong to the Taenia ovis 45W gene family. The Ts45W and Ts45S cDNAs are 997- and 1,004-bp-long, each corresponding to 255 amino acids and with theoretical molecular masses of 27.8 and 27.7 kDa, respectively. Southern blot profiles obtained with Ts45W cDNA as a probe suggest that these two genes are members of a multigene family with tandem organization. The full genomic sequence was determined for the Ts45W gene and a new family member, the Ts45W/2 gene. The genomic sequences of the T. saginata Ts45W and Ts45W/2 genes were at least 2.2 kb in length with four exons separated by three introns. Exons 1 and 4 coded for hydrophobic domains, while, importantly, exons 2 and 3 coded for fibronectin homologous domains. These domains are presumably responsible for the demonstrated cell adhesion and, perhaps, the protective nature of this family of molecules and the acronym TAF (Taenia adhesion family) is proposed for this group of genes. We hypothesize that these TAF proteins and another T. saginata-protective antigen, HP6, have evolved the dual functions of facilitating tissue invasion and stimulating protective immunity to first ensure primary infection and subsequently to establish a concomitant protective immunity to protect the host from death or debilitation through superinfection by subsequent infections and thus help ensure parasite survival.
Henning, Lisa N; Carpenter, Sarah; Stark, Gregory V; Serbina, Natalya V
2018-02-01
The recommended management of inhalational anthrax, a high-priority bioterrorist threat, includes antibiotics and antitoxins. Obiltoxaximab, a chimeric monoclonal antibody against anthrax protective antigen (PA), is licensed under the U.S. Food and Drug Administration's (FDA's) Animal Rule for the treatment of inhalational anthrax. Because of spore latency, disease reemergence after treatment cessation is a concern, and there is a need to understand the development of endogenous protective immune responses following antitoxin-containing anthrax treatment regimens. Here, acquired protective immunity was examined in New Zealand White (NZW) rabbits challenged with a targeted lethal dose of Bacillus anthracis spores and treated with antibiotics, obiltoxaximab, or a combination of both. Survivors of the primary challenge were rechallenged 9 months later and monitored for survival. Survival rates after primary and rechallenge for controls and animals treated with obiltoxaximab, levofloxacin, or a combination of both were 0, 65, 100, and 95%, and 0, 100, 95, and 89%, respectively. All surviving immune animals had circulating antibodies to PA and serum toxin-neutralizing titers prior to rechallenge. Following rechallenge, systemic bacteremia and toxemia were not detected in most animals, and the levels of circulating anti-PA IgG titers increased starting at 5 days postrechallenge. We conclude that treatment with obiltoxaximab, alone or combined with antibiotics, significantly improves the survival of rabbits that received a lethal inhalation B. anthracis spore challenge dose and does not interfere with the development of immunity. Survivors of primary challenge are protected against reexposure, have rare incidents of systemic bacteremia and toxemia, and have evidence of an anamnestic response. Copyright © 2018 Henning et al.
Liu, Qingfeng; Zheng, Xiaoyao; Zhang, Chi; Shao, Xiayan; Zhang, Xi; Zhang, Qizhi; Jiang, Xinguo
2015-11-01
As one of the most serious infectious respiratory diseases, influenza A (H1N1) is a great threat to human health, and it has created an urgent demand for effective vaccines. Nasal immunization can induce both systemic and mucosal immune responses against viruses, and it can serve as an ideal route for vaccination. However, the low immunogenicity of antigens on nasal mucosa is a high barrier for the development of nasal vaccines. In this study, we covalently conjugated an influenza A (H1N1) antigen to the surface of N-trimethylaminoethylmethacrylate chitosan (TMC) nanoparticles (H1N1-TMC/NP) through thioester bonds to increase the immunogenicity of the antigen after nasal administration. SDS-PAGE revealed that most of the antigen was conjugated on TMC nanoparticles, and an in vitro biological activity assay confirmed the stability of the antigen after conjugation. After three nasal immunizations, the H1N1-TMC/NP induced significantly higher levels of serum IgG and mucosal sIgA compared with free antigen. A hemagglutination inhibition assay showed that H1N1-TMC/NP induced much more protective antibodies than antigen-encapsulated nanoparticles or alum-precipitated antigen (I.M.). In the mechanistic study, H1N1-TMC/NP was shown to stimulate macrophages to produce IL-1β and IL-6 and to stimulate spleen lymphocytes to produce IL-2 and IFN-γ. These results indicated that H1N1-TMC/NP may be an effective vaccine against influenza A (H1N1) viruses for use in nasal immunization. © 2015 Wiley Periodicals, Inc.
Brown, W C; Zhao, S; Logan, K S; Grab, D J; Rice-Ficht, A C
1995-03-01
Current vaccines for bovine hemoparasites utilize live attenuated organisms or virulent organisms administered concurrently with antiparasitic drugs. Although such vaccines can be effective, for most hemoparasites the mechanisms of acquired resistance to challenge infection with heterologous parasite isolates have not been clearly defined. Selection of potentially protective antigens has traditionally made use of antibodies to identify immunodominant proteins. However, numerous studies have indicated that induction of high antibody titers neither predicts the ability of an antigen to confer protective immunity nor correlates with protection. Because successful parasites have evolved antibody evasion tactics, alternative strategies to identify protective immunogens should be used. Through the elaboration of cytokines, T helper 1-(Th1)-like T cells and macrophages mediate protective immunity against many intracellular parasites, and therefore most likely play an important role in protective immunity against bovine hemoparasites. CD4+ T cell clones specific for soluble or membrane antigens of either Theileria parva schizonts or Babesia bovis merozoites were therefore employed to identify parasite antigens that elicit strong Th cell responses in vitro. Soluble cytosolic parasite antigen was fractionated by gel filtration, anion exchange chromatography or hydroxylapatite chromatography, or a combination thereof, and fractions were tested for the ability to induce proliferation of Th cell clones. This procedure enabled the identification of stimulatory fractions containing T. parva proteins of approximately 10 and 24 kDa. Antisera raised against the purified 24 kDa band reacted with a native schizont protein of approximately 30 kDa. Babesia bovis-specific Th cell clones tested against fractionated soluble Babesia bovis merozoite antigen revealed the presence of at least five distinct antigenic epitopes. Proteins separated by gel filtration revealed four patterns of
Parody, N; Soto, M; Requena, J M; Alonso, C
2004-01-01
It has been shown that vaccination with three doses of the Leishmania infantum poly-protein Q containing five genetically fused antigenic determinants from the Lip2a, Lip2b, H2A and P0 proteins, mixed with BCG induces clearance of parasites in 9 out of 10 Leishmania infantum-infected Beagle dogs, in addition to clinical protection. In the present paper we analysed the immunogenic potential of the poly-protein Q and the specificity and polarization of the response against the antigenic determinants of Q when mixed with various adjuvants. The data showed that the Q protein had high intrinsic immunogenic potential and that it was able to induce a long-lasting IgG response. The IgM immunogenic potential of the poly-protein was mainly due to the LiP2a and LiP2b determinants, whereas the IgG immunogenic potential was mainly due to the LiP2a component. It was observed that the protein itself elicited a mixed IgG2a/IgG1 response and that the determinants of Q were endowed with different IgG2a/IgG1 potential. It was also observed that the adjuvants did not influence the intensity or specificity of the IgM response but that they modulated the intensity, the specificity and the polarization of the IgG response against the determinants of Q. CpG-ODN motifs or double-stranded DNA plasmids containing CpG motifs when mixed with Q induced a predominant IgG2a response mainly observed at early stages post-immunization. The data showed that a CpG + Q mix induced significant protection against L. infantum infection in Balb/c mice.
Weber, Christopher; Büchner, Sarah M; Schnierle, Barbara S
2015-04-01
The mosquito-borne Chikungunya virus (CHIKV) causes high fever and severe joint pain in humans. It is expected to spread in the future to Europe and has recently reached the USA due to globalization, climate change and vector switch. Despite this, little is known about the virus life cycle and, so far, there is no specific treatment or vaccination against Chikungunya infections. We aimed here to identify small antigenic determinants of the CHIKV E2 protein able to induce neutralizing immune responses. E2 enables attachment of the virus to target cells and a humoral immune response against E2 should protect from CHIKV infections. Seven recombinant proteins derived from E2 and consisting of linear and/or structural antigens were created, and were expressed in and purified from E. coli. BALB/c mice were vaccinated with these recombinant proteins and the mouse sera were screened for neutralizing antibodies. Whereas a linear N-terminally exposed peptide (L) and surface-exposed parts of the E2 domain A (sA) alone did not induce neutralizing antibodies, a construct containing domain B and a part of the β-ribbon (called B+) was sufficient to induce neutralizing antibodies. Furthermore, domain sA fused to B+ (sAB+) induced the highest amount of neutralizing antibodies. Therefore, the construct sAB+ was used to generate a recombinant modified vaccinia virus Ankara (MVA), MVA-CHIKV-sAB+. Mice were vaccinated with MVA-CHIKV-sAB+ and/or the recombinant protein sAB+ and were subsequently challenged with wild-type CHIKV. Whereas four vaccinations with MVA-CHIKV-sAB+ were not sufficient to protect mice from a CHIKV infection, protein vaccination with sAB+ markedly reduced the viral titers of vaccinated mice. The recombinant protein sAB+ contains important structural antigens for a neutralizing antibody response in mice and its formulation with appropriate adjuvants might lead to a future CHIKV vaccine.
Heravi Shargh, Vahid; Jaafari, Mahmoud Reza; Khamesipour, Ali; Jalali, Seyed Amir; Firouzmand, Hengameh; Abbasi, Azam; Badiee, Ali
2012-07-01
Development of an effective vaccine against leishmaniasis is possible due to the fact that individuals cured from cutaneous leishmaniasis (CL) are protected from further infection. First generation Leishmania vaccines consisting of whole killed parasites reached to phase 3 clinical trials but failed to show enough efficacies mainly due to the lack of an appropriate adjuvant. In this study, an efficient liposomal protein-based vaccine against Leishmania major infection was developed using soluble Leishmania antigens (SLA) as a first generation vaccine and cytidine phosphate guanosine oligodeoxynucleotides (CpG ODNs) as an immunostimulatory adjuvant. 1, 2-Dioleoyl-3-trimethylammonium-propane was used as a cationic lipid to prepare the liposomes due to its intrinsic adjuvanticity. BALB/c mice were immunized subcutaneously (SC), three times in 2-week intervals, with Lip-SLA-CpG, Lip-SLA, SLA + CpG, SLA, or HEPES buffer. As criteria for protection, footpad swelling at the site of challenge and spleen parasite loads were assessed, and the immune responses were evaluated by determination of IFN-γ and IL-4 levels of cultured splenocytes, and IgG subtypes. The group of mice that received Lip-SLA-CpG showed a significantly smaller footpad swelling, lower spleen parasite burden, higher IgG2a antibody, and lower IL-4 level compared to the control groups. It is concluded that cationic liposomes containing SLA and CpG ODNs are appropriate to induce Th1 type of immune response and protection against leishmaniasis.
Ji, Xianliang; Ren, Zhiguang; Xu, Na; Meng, Lingnan; Yu, Zhijun; Feng, Na; Sang, Xiaoyu; Li, Shengnan; Li, Yuanguo; Wang, Tiecheng; Zhao, Yongkun; Wang, Hualei; Zheng, Xuexing; Jin, Hongli; Li, Nan; Yang, Songtao; Cao, Jinshan; Liu, Wensen; Gao, Yuwei; Xia, Xianzhu
2016-04-21
Vaccination is the most effective means to prevent influenza virus infection, although current approaches are associated with suboptimal efficacy. Here, we generated virus-like particles (VLPs) composed of the hemagglutinin (HA), neuraminidase (NA) and matrix protein (M1) of A/Changchun/01/2009 (H1N1) with or without either membrane-anchored cholera toxin B (CTB) or ricin toxin B (RTB) as molecular adjuvants. The intranasal immunization of mice with VLPs containing membrane-anchored CTB or RTB elicited stronger humoral and cellular immune responses when compared to mice immunized with VLPs alone. Administration of VLPs containing CTB or RTB significantly enhanced virus-specific systemic and mucosal antibody responses, hemagglutination inhibiting antibody titers, virus neutralizing antibody titers, and the frequency of virus-specific IFN-γ and IL-4 secreting splenocytes. VLPs with and without CTB or RTB conferred complete protection against lethal challenge with a mouse-adapted homologous virus. When challenged with an antigenically distinct H1N1 virus, all mice immunized with VLPs containing CTB or RTB survived whereas mice immunized with VLPs alone showed only partial protection (80% survival). Our results suggest that membrane-anchored CTB and RTB possess strong adjuvant properties when incorporated into an intranasally-delivered influenza VLP vaccine. Chimeric influenza VLPs containing CTB or RTB may represent promising vaccine candidates for improved immunological protection against homologous and antigenically distinct influenza viruses.
Ji, Xianliang; Ren, Zhiguang; Xu, Na; Meng, Lingnan; Yu, Zhijun; Feng, Na; Sang, Xiaoyu; Li, Shengnan; Li, Yuanguo; Wang, Tiecheng; Zhao, Yongkun; Wang, Hualei; Zheng, Xuexing; Jin, Hongli; Li, Nan; Yang, Songtao; Cao, Jinshan; Liu, Wensen; Gao, Yuwei; Xia, Xianzhu
2016-01-01
Vaccination is the most effective means to prevent influenza virus infection, although current approaches are associated with suboptimal efficacy. Here, we generated virus-like particles (VLPs) composed of the hemagglutinin (HA), neuraminidase (NA) and matrix protein (M1) of A/Changchun/01/2009 (H1N1) with or without either membrane-anchored cholera toxin B (CTB) or ricin toxin B (RTB) as molecular adjuvants. The intranasal immunization of mice with VLPs containing membrane-anchored CTB or RTB elicited stronger humoral and cellular immune responses when compared to mice immunized with VLPs alone. Administration of VLPs containing CTB or RTB significantly enhanced virus-specific systemic and mucosal antibody responses, hemagglutination inhibiting antibody titers, virus neutralizing antibody titers, and the frequency of virus-specific IFN-γ and IL-4 secreting splenocytes. VLPs with and without CTB or RTB conferred complete protection against lethal challenge with a mouse-adapted homologous virus. When challenged with an antigenically distinct H1N1 virus, all mice immunized with VLPs containing CTB or RTB survived whereas mice immunized with VLPs alone showed only partial protection (80% survival). Our results suggest that membrane-anchored CTB and RTB possess strong adjuvant properties when incorporated into an intranasally-delivered influenza VLP vaccine. Chimeric influenza VLPs containing CTB or RTB may represent promising vaccine candidates for improved immunological protection against homologous and antigenically distinct influenza viruses. PMID:27110810
Bröde, Peter; Kuklane, Kalev; Candas, Victor; Den Hartog, Emiel A; Griefahn, Barbara; Holmér, Ingvar; Meinander, Harriet; Nocker, Wolfgang; Richards, Mark; Havenith, George
2010-01-01
The heat transferred through protective clothing under long wave radiation compared to a reference condition without radiant stress was determined in thermal manikin experiments. The influence of clothing insulation and reflectivity, and the interaction with wind and wet underclothing were considered. Garments with different outer materials and colours and additionally an aluminised reflective suit were combined with different number and types of dry and pre-wetted underwear layers. Under radiant stress, whole body heat loss decreased, i.e., heat gain occurred compared to the reference. This heat gain increased with radiation intensity, and decreased with air velocity and clothing insulation. Except for the reflective outer layer that showed only minimal heat gain over the whole range of radiation intensities, the influence of the outer garments' material and colour was small with dry clothing. Wetting the underclothing for simulating sweat accumulation, however, caused differing effects with higher heat gain in less permeable garments.
Sloat, Brian R.; Sandoval, Michael A.; Cui, Zhengrong
2010-01-01
Nanoparticles are an attractive vaccine carrier with potent adjuvant activity. Data from our previous studies showed that immunization of mice with lecithin/glyceryl monostearate-based nanoparticles with protein antigens conjugated onto their surface induced a strong, quick, and long-lasting antigen-specific immune response. In the present study, we evaluated the feasibility of preserving the immunogenicity of protein antigens carried by nanoparticles without refrigeration using these antigen-conjugated nanoparticles as a model. The nanoparticles were lyophilized, and the immunogenicity of the antigens was evaluated in a mouse model using bovine serum albumin or the Bacillus anthracis protective antigen protein as model antigens. With proper excipients, the nanoparticles can be lyophilized while maintaining the immunogenicity of the antigens. Moreover, the immunogenicity of the model antigen conjugated onto the nanoparticles was undamaged after a relatively extended period of storage at room temperature or under accelerated conditions (37°C) when the nanoparticles were lyophilized with 5% mannitol plus 1% polyvinylpyrrolidone. To our knowledge, the present study represents an early attempt to preserve the immunogenicity of the protein antigens carried by nanoparticles without refrigeration. PMID:20416366
Reinhardt, Anika; Yang, You; Claus, Heike; Pereira, Claney L; Cox, Andrew D; Vogel, Ulrich; Anish, Chakkumkal; Seeberger, Peter H
2015-01-22
Neisseria meningitidis is a leading cause of bacterial meningitis worldwide. We studied the potential of synthetic lipopolysaccharide (LPS) inner core structures as broadly protective antigens against N. meningitidis. Based on the specific reactivity of human serum antibodies to synthetic LPS cores, we selected a highly conserved LPS core tetrasaccharide as a promising antigen. This LPS inner core tetrasaccharide induced a robust IgG response in mice when formulated as an immunogenic glycoconjugate. Binding of raised mouse serum to a broad collection of N. meningitidis strains demonstrated the accessibility of the LPS core on viable bacteria. The distal trisaccharide was identified as the crucial epitope, whereas the proximal Kdo moiety was immunodominant and induced mainly nonprotective antibodies that are responsible for lack of functional protection in polyclonal serum. Our results identified key antigenic determinants of LPS core glycan and, hence, may aid the design of a broadly protective immunization against N. meningitidis. Copyright © 2015 Elsevier Ltd. All rights reserved.
Beck, Bo Ram; Lee, Soon Ho; Kim, Daniel; Park, Ji Hye; Lee, Hyun Kyung; Kwon, San-Sung; Lee, Kwan Hee; Lee, Jae Il; Song, Seong Kyu
2017-09-01
Edwardsiellosis is a major fish disease that causes a significant economic damage in the aquaculture industry. Here, we assessed vaccine efficacy after feeding oral vaccines to olive flounder (Paralichthys olivaceus), either L. lactis BFE920 expressing Edwardsiella tarda outer membrane protein A (OmpA), flagellar hook protein D (FlgD), or a fusion antigen of the two. Feed vaccination was done twice with a one-week interval. Fish were fed regular feed adsorbed with the vaccines. Feed vaccination was given over the course of one week to maximize the interaction between the feed vaccines and the fish intestine. Flounder fed the vaccine containing the fusion antigen had significantly elevated levels T cell genes (CD4-1, CD4-2, and CD8α), type 1 helper T cell (Th1) subset indicator genes (T-bet and IFN-γ), and antigen-specific antibodies compared to the groups fed the single antigen-expressing vaccines. Furthermore, the superiority of the fusion vaccine was also observed in survival rates when fish were challenged with E. tarda: OmpA-FlgD-expressing vaccine (82.5% survival); FlgD-vaccine (55.0%); OmpA-vaccine (50%); WT L. lactis BFE920 (37.5%); Ctrl (10%). In addition, vaccine-fed fish exhibited increased weight gain (∼20%) and a decreased feed conversion ratio (∼20%) during the four week vaccination period. Flounder fed the FlgD-expressing vaccine, either the single or the fusion form, had significantly increased expression of TLR5M, IL-1β, and IL-12p40, suggesting that the FlgD may be a ligand of olive flounder TLR5M receptor or closely related to the TLR5M pathway. In conclusion, the present study demonstrated that olive flounder fed L. lactis BFE920 expressing a fusion antigen composed of E. tarda OmpA and FlgD showed a strong protective effect against edwardsiellosis indicating this may be developed as an E. tarda feed vaccine. Copyright © 2017 Elsevier Ltd. All rights reserved.
Abou-Elhakam, H; Rabee, I; El Deeb, S; El Amir, A
2013-11-15
Yet no vaccine to protect ruminants against liver fluke infection has been commercialized. In an attempt to develop a suitable vaccine against Fasciola gigantica (F. gigantica) infection in rabbits, using 97 kDa Pmy antigen. It was found that, the mean worm burdens and bile egg count after challenge were reduced significantly by 58.40 and 61.40%, respectively. On the other hand, immunization of rabbits with Pmy induced a significant expression of humoral antibodies (IgM, total IgG, IgG1, IgG2 and IgG4) and different cytokines (IL-6, IL-10, L-12 and TNF-alpha). Among Ig isotypes, IgG2 and IgG4 were most dominant Post-infection (PI) while, recording a low IgG1 level. The dominance of IgG2 and IgG4 suggested late T helper1 (Th1) involvement in rabbit's cellular response. While, the low IgG1 level suggested Th2 response to adult F. gigantica worm Pmy. Among all cytokines, IL-10 was the highest in rabbits immunized with Pmy PI suggesting also the enhancement of Th2 response. It was clear that the native F. gigantica Pmy is considered as a relevant candidate for vaccination against fascioliasis. Also, these data suggested the immunoprophylactic effect of the native F. gigantica Pmy which is mediated by a mixed Th1/Th2 response.
The Doctrine of Original Antigenic Sin: Separating Good From Evil.
Monto, Arnold S; Malosh, Ryan E; Petrie, Joshua G; Martin, Emily T
2017-06-15
The term "original antigenic sin" was coined approximately 60 years ago to describe the imprinting by the initial first influenza A virus infection on the antibody response to subsequent vaccination. These studies did not suggest a reduction in the response to current antigens but instead suggested anamnestic recall of antibody to earlier influenza virus strains. Then, approximately 40 years ago, it was observed that sequential influenza vaccination might lead to reduced vaccine effectiveness (VE). This conclusion was largely dismissed after an experimental study involving sequential administration of then-standard influenza vaccines. Recent observations have provided convincing evidence that reduced VE after sequential influenza vaccination is a real phenomenon. We propose that such reduction in VE be termed "negative antigenic interaction," given that there is no age cohort effect. In contrast, the potentially positive protective effect of early influenza virus infection later in life continues to be observed. It is essential that we understand better the immunologic factors underlying both original antigenic sin and negative antigenic interaction, to support development of improved influenza vaccines and vaccination strategies. © The Author 2017. Published by Oxford University Press for the Infectious Diseases Society of America.
Felix Hoppe-Seyler Lecture 1997. Protective antibody responses against viruses.
Zinkernagel, R M
1997-08-01
Neutralizing antibody responses against the acute cytopathic vesicular stomatitis virus (VSV) have been studied in mice to evaluate their general characteristics including specificity, self-/non-self discrimination and memory. IgM responses are generated very early, by day 3 to 4, in a T helper cell-independent fashion and without VSV having polyclonal activating capacities. The order of the glycoprotein tips on the virus envelope (multiple, 8-10 nm distance, paracrystalline) exhibiting the neutralizing determinants are key to this prompt response. These paracrystalline identical multimeric antigens are characteristic of infectious agents and are always reacted against by B cells. Self-antigens that are accessible to B cells in the intact host are either monomeric in serum or mobile multimers on cell surfaces; these configurations need contact dependent or contact independent T help, respectively. Because T help is tolerant against self-antigens, no anti-self B cell responses are usually induced against monomeric self-antigens. If collagen or DNA (rigid multimeric self-antigens) become accessible, however, they may become targets of auto-antibody responses. The antibody repertoire against VSV is partially contained in the germline and partially is generated by somatic mutation; they seem not to undergo affinity-maturation. In any case protection against lethal infection is dependent upon strictly T helper cell dependent IgG generated by day 6 to 7 and reaches a protective level of about 1-10 micrograms/ml. Interesting affinity/avidity and onrate above a minimal threshold are of no apparent advantage for protection in vivo. Maintenance of these antibody levels by antigen depots, and not the presence of memory B cells alone, is key to providing protective immunological memory. Collectively these data suggest that studying biologically important protective antibody responses may modify some of the parameters that have been defined by studying hapten specific antibody
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rai, Devendra K.; Segundo, Fayna Diaz-San; Department of Pathobiology and Veterinary Science, CANR, University of Connecticut, Storrs, CT 06269
Here, we engineered two FMD viruses with histidine residues inserted into or fused to the FMDV capsid. Both 6xHis viruses exhibited growth kinetics, plaque morphologies and antigenic characteristics similar to wild-type virus. The 6xHis tag allowed one-step purification of the mutant virions by Co{sup 2+} affinity columns. Electron microscopy and biochemical assays showed that the 6xHis FMDVs readily assembled into antigen: adjuvant complexes in solution, by conjugating with Ni{sup 2+}-chelated nanolipoprotein and monophosphoryl lipid A adjuvant (MPLA:NiNLP). Animals Immunized with the inactivated 6xHis-FMDV:MPLA:NiNLP vaccine acquired enhanced protective immunity against FMDV challenge compared to virions alone. Induction of anti-6xHis and anti-FMDVmore » neutralizing antibodies in the immunized animals could be exploited in the differentiation of vaccinated from infected animals needed for the improvement of FMD control measures. The novel marker vaccine/nanolipid technology described here has broad applications for the development of distinctive and effective immune responses to other pathogens of importance. - Highlights: • 6xHis-tags in A{sub 24} FMDV enable purification and biding to adjuvants via metal ions. • 6xHis A{sub 24} FMDV:MPLA:NiNLP vaccine enhanced protective immunity against FMDV. • Surface exposed capsid tags allow distinction of infected from vaccinated animals.« less
Bhattacharya, M; Barlow, J J
1978-09-01
Evidence has been reported for at least two common tumor-associated antigens, or antigenic determinants, in human cystadenocarcinomas of the ovary that are apparently absent in tissues of normal reproductive organs. These antigenic determinants are immunologically distinct from carcinoembryonic antigen, alpha-fetoprotein, ferritins and histocompatibility antigens. One of these two ovarian cystadenocarcinoma-associated antigens (OCAA) is not detectable in any ovarian carcinomas except serous or mucinous types, other gynecologic or nongynecologic malignancies thus far tested, while the second antigen is present in about 90% of all gynecologic tumors and occasionally in breast and colon tumors. OCAA has been purified and partially characterized. It is a high molecular weight glycoprotein which carries the unique ovarian tumor-specific antigenic determinant along with some normal cross-reacting determinants. High levels of this glycoprotein antigen have been detected in the sera of ovarian cancer patients with advanced disease by the radioimmunoassay inhibition technique. The serial determination of circulating OCAA appeared to correlate with tumor volume as well as the clinical status of the patients.
Kintz, Erica; Heiss, Christian; Black, Ian; ...
2017-02-06
Salmonella enterica serovar Typhi is a human-restricted Gram-negative bacterial pathogen responsible for causing an estimated 27 million cases of typhoid fever annually, leading to 217,000 deaths, and current vaccines do not offer full protection. The O-antigen side chain of the lipopolysaccharide is an immunodominant antigen, can define host-pathogen interactions, and is under consideration as a vaccine target for some Gram-negative species. The composition of the O-antigen can be modified by the activity of glycosyltransferase (gtr) operons acquired by horizontal gene transfer. Here we investigate the role of two gtr operons that we identified in the S. Typhi genome. Strains weremore » engineered to express specific gtr operons. Full chemical analysis of the O-antigens of these strains identified gtr-dependent glucosylation and acetylation. The glucosylated form of the O-antigen mediated enhanced survival in human serum and decreased complement binding. A single nucleotide deviation from an epigenetic phase variation signature sequence rendered the expression of this glucosylating gtr operon uniform in the population. In contrast, the expression of the acetylating gtrC gene is controlled by epigenetic phase variation. Acetylation did not affect serum survival, but phase variation can be an immune evasion mechanism, and thus, this modification may contribute to persistence in a host. In murine immunization studies, both O-antigen modifications were generally immunodominant. Our results emphasize that natural O-antigen modifications should be taken into consideration when assessing responses to vaccines, especially O-antigen-based vaccines, and that the Salmonella gtr repertoire may confound the protective efficacy of broad-ranging Salmonella lipopolysaccharide conjugate vaccines.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kintz, Erica; Heiss, Christian; Black, Ian
Salmonella enterica serovar Typhi is a human-restricted Gram-negative bacterial pathogen responsible for causing an estimated 27 million cases of typhoid fever annually, leading to 217,000 deaths, and current vaccines do not offer full protection. The O-antigen side chain of the lipopolysaccharide is an immunodominant antigen, can define host-pathogen interactions, and is under consideration as a vaccine target for some Gram-negative species. The composition of the O-antigen can be modified by the activity of glycosyltransferase (gtr) operons acquired by horizontal gene transfer. Here we investigate the role of two gtr operons that we identified in the S. Typhi genome. Strains weremore » engineered to express specific gtr operons. Full chemical analysis of the O-antigens of these strains identified gtr-dependent glucosylation and acetylation. The glucosylated form of the O-antigen mediated enhanced survival in human serum and decreased complement binding. A single nucleotide deviation from an epigenetic phase variation signature sequence rendered the expression of this glucosylating gtr operon uniform in the population. In contrast, the expression of the acetylating gtrC gene is controlled by epigenetic phase variation. Acetylation did not affect serum survival, but phase variation can be an immune evasion mechanism, and thus, this modification may contribute to persistence in a host. In murine immunization studies, both O-antigen modifications were generally immunodominant. Our results emphasize that natural O-antigen modifications should be taken into consideration when assessing responses to vaccines, especially O-antigen-based vaccines, and that the Salmonella gtr repertoire may confound the protective efficacy of broad-ranging Salmonella lipopolysaccharide conjugate vaccines.« less
Colby, Jennifer M.; Krantz, Bryan A.
2015-01-01
Anthrax toxin is a tripartite virulence factor produced by Bacillus anthracis during infection. Under acidic endosomal pH conditions, the toxin's protective antigen (PA) component forms a transmembrane channel in host cells. The PA channel then translocates its two enzyme components, lethal factor (LF) and edema factor (EF), into the host cytosol under the proton motive force (PMF). Protein translocation under a PMF is catalyzed by a series of nonspecific polypeptide binding sites, called clamps. A 10-residue guest/host peptide model system, KKKKKXXSXX, was used to functionally probe polypeptide-clamp interactions within wild-type PA channels. The guest residues were Thr, Ala, Leu, Phe, Tyr, and Trp. In steady-state translocation experiments, the channel blocked most tightly with peptides that had increasing amounts of nonpolar surface area. Cooperative peptide binding was observed in the Trp-containing peptide sequence but not the other tested sequences. Trp substitutions into a flexible, uncharged linker between LF amino-terminal domain and diphtheria toxin A chain expedited translocation. Therefore, peptide clamp sites in translocase channels can sense large steric features (like tryptophan) in peptides; and while these steric interactions may make a peptide translocate poorly, in the context of folded domains they can make the protein translocate more rapidly presumably via a hydrophobic steric ratchet mechanism. PMID:26363343
Retamal, Miguel; Abed, Yacine; Rhéaume, Chantal; Baz, Mariana; Boivin, Guy
2017-06-01
Influenza A(H1N1)pdm09 virus continues to circulate worldwide without evidence of significant antigenic drift between 2009 and 2016. By using escape mutants, we previously identified six haemagglutinin (HA) changes (T80R, G143E, G158E, N159D, K166E and A198E) that were located within antigenic sites. Combinations of these mutations were introduced into the A(H1N1)pdm09 HA plasmid by mutagenesis. Reassortant 6 : 2 viruses containing both the HA and NA genes of the A(H1N1)pdm09 and the six internal gene segments of A/PR/8/34 were rescued by reverse genetics. In vitro, HA inhibition and microneutralization assays showed that the HA hexa-mutant reassortant virus (RG1) escaped A(H1N1)pdm09 hyper-immune ferret antiserum recognition. C57Black/6 mice that received the vaccine formulated with A/California/07/09 were challenged with 2×104 p.f.u. of either the 6 : 2 wild-type (WT) or RG1 viruses. Reductions in body weight loss, mortality rate and lung viral titre were observed in immunized animals challenged with the 6 : 2 WT virus compared to non-immunized mice. However, immunization did not protect mice challenged with RG1 virus. To further characterize the mutations causing this antigenic change, 11 additional RG viruses whose HA gene contained single or combinations of mutations were evaluated in vitro. Although the RG1 virus was still the least reactive against hyper-immune serum by HAI testing, mutations G158E and N159D within the Sa antigenic site appeared to play the major role in the altered antigenicity of the A(H1N1)pdm09 virus. These results show that the Sa antigenic site contains the most prominent epitopes susceptible to cause an antigenic drift, escaping actual vaccine protection.
Factor H-binding protein, a unique meningococcal vaccine antigen.
Pizza, Mariagrazia; Donnelly, John; Rappuoli, Rino
2008-12-30
GNA1870, also named factor H-binding protein (fHbp) or rLP-2086, is a genome-derived antigen and one of the components of a rationally designed vaccine against Neisseria meningitidis serogroup B, which has entered phase III clinical trials. It has been classified into three main non-cross-protective variant groups. GNA1870 has also been termed fHbp because of its ability to bind factor H, a key regulatory component of the alternative complement pathway. fHbp is important for survival in human blood, human sera, and in presence of antimicrobial peptides, independently of its expression level. All these properties make fHbp a unique vaccine antigen.
Szu, Shousun C; Klugman, Keith P; Hunt, Steven
2014-04-25
The capsular polysaccharide of Salmonella enterica serovar Typhi, Vi antigen, is an essential virulence factor and a protective antigen. Similar to other polysaccharide vaccines, the protective action of Vi, both to the polysaccharide alone or when presented as a conjugate, is mediated by serum IgG Vi antibodies. The evaluation of Vi capsular polysaccharide based vaccines to prevent typhoid fever would be significantly facilitated by the identification of a "protective level" of serum antibodies to Vi antigen. The protective level of anti-Vi IgG against typhoid fever was derived from the protective efficacy and immune response of a Vi-rEPA conjugate vaccine efficacy trial. The estimation was derived by two methods: correlation of the percent efficacy and the antibody distribution profile in the vaccine group at a given period of observation, and use of the relative ratio of anti-Vi IgG levels between the vaccine and placebo groups greater or equal to the Relative Risk of typhoid fever used in the efficacy determination. Both methods predicted a similar range of a minimum protective level of anti-Vi IgG between 1.4 and 2.0μg/ml (short term threshold). When applying a protective threshold of 10μg/ml at 6 months post immunization, an IgG level in excess of 1.4μg/ml was achieved by 90% of children at 46 months post immunization, consistent with an 89% level of protection over the duration of the study. We thus suggest that the proportion of children with Vi IgG>10μg/ml (long term threshold) 6 months after immunization may reflect the proportion protected over at least a 4 year period. The current assignment of an anti-Vi IgG protective level may be of value when evaluating vaccine performance of future Vi conjugate vaccines. Published by Elsevier Ltd.
Szu, Shousun C.; Klugman, Keith P.; Hunt, Steven
2014-01-01
Background The capsular polysaccharide of Salmonella enterica serovar Typhi, Vi antigen, is an essential virulence factor and a protective antigen. Similar to other polysaccharide vaccines, the protective action of Vi, both to the polysaccharide alone or when presented as a conjugate, is mediated by serum IgG Vi antibodies. The evaluation of Vi capsular polysaccharide based vaccines to prevent typhoid fever would be significantly facilitated by the identification of a “protective level” of serum antibodies to Vi antigen. Methods The protective level of anti-Vi IgG against typhoid fever was derived from the protective efficacy and immune response of a Vi-rEPA conjugate vaccine efficacy trial. The estimation was derived by two methods: correlation of the percent efficacy and the antibody distribution profile in the vaccine group at a given period of observation, and use of the relative ratio of anti-Vi IgG levels between the vaccine and placebo groups greater or equal to the Relative Risk of typhoid fever used in the efficacy determination. Results Both methods predicted a similar range of a minimum protective level of anti-Vi IgG between 1.4 and 2.0 μg/ml (short term threshold). When applying a protective threshold of 10 μg/ml at 6 months post immunization, an IgG level in excess of 1.4 μg/ml was achieved by 90% of children at 46 months post immunization, consistent with an 89% level of protection over the duration of the study. We thus suggest that the proportion of children with Vi IgG > 10 μg/ml (long term threshold) 6 months after immunization may reflect the proportion protected over at least a 4 year period. Conclusion The current assignment of an anti-Vi IgG protective level may be of value when evaluating vaccine performance of future Vi conjugate vaccines. PMID:24630869
Sloat, Brian R; Sandoval, Michael A; Cui, Zhengrong
2010-06-30
Nanoparticles are an attractive vaccine carrier with potent adjuvant activity. Data from our previous studies showed that immunization of mice with lecithin/glyceryl monostearate-based nanoparticles with protein antigens conjugated onto their surface induced a strong, quick, and long-lasting antigen-specific immune response. In the present study, we evaluated the feasibility of preserving the immunogenicity of protein antigens carried by nanoparticles without refrigeration using these antigen-conjugated nanoparticles as a model. The nanoparticles were lyophilized, and the immunogenicity of the antigens was evaluated in a mouse model using bovine serum albumin or the Bacillus anthracis protective antigen protein as model antigens. With proper excipients, the nanoparticles can be lyophilized while maintaining the immunogenicity of the antigens. Moreover, the immunogenicity of the model antigen conjugated onto the nanoparticles was undamaged after a relatively extended period of storage at room temperature or under accelerated conditions (37 degrees C) when the nanoparticles were lyophilized with 5% mannitol plus 1% polyvinylpyrrolidone. To our knowledge, the present study represents an early attempt to preserve the immunogenicity of the protein antigens carried by nanoparticles without refrigeration. 2010 Elsevier B.V. All rights reserved.
Structure-based non-canonical amino acid design to covalently crosslink an antibody–antigen complex
Xu, Jianqing; Tack, Drew; Hughes, Randall A.; Ellington, Andrew D.; Gray, Jeffrey J.
2014-01-01
Engineering antibodies to utilize non-canonical amino acids (NCAA) should greatly expand the utility of an already important biological reagent. In particular, introducing crosslinking reagents into antibody complementarity determining regions (CDRs) should provide a means to covalently crosslink residues at the antibody–antigen interface. Unfortunately, finding the optimum position for crosslinking two proteins is often a matter of iterative guessing, even when the interface is known in atomic detail. Computer-aided antibody design can potentially greatly restrict the number of variants that must be explored in order to identify successful crosslinking sites. We have therefore used Rosetta to guide the introduction of an oxidizable crosslinking NCAA, l-3,4-dihydroxyphenylalanine (l-DOPA), into the CDRs of the anti-protective antigen scFv antibody M18, and have measured crosslinking to its cognate antigen, domain 4 of the anthrax protective antigen. Computed crosslinking distance, solvent accessibility, and interface energetics were three factors considered that could impact the efficiency of l-DOPA-mediated crosslinking. In the end, 10 variants were synthesized, and crosslinking efficiencies were generally 10% or higher, with the best variant crosslinking to 52% of the available antigen. The results suggest that computational analysis can be used in a pipeline for engineering crosslinking antibodies. The rules learned from l-DOPA crosslinking of antibodies may also be generalizable to the formation of other crosslinked interfaces and complexes. PMID:23680795
Tsujimura, Kunio; Obata, Yuichi; Matsudaira, Yasue; Ozeki, Satoshi; Taguchi, Osamu; Nishida, Keiko; Okanami, Yuko; Akatsuka, Yoshiki; Kuzushima, Kiyotaka; Takahashi, Toshitada
2004-11-01
Mouse thymus-leukemia antigens (TL) are aberrantly expressed on T lymphomas in C57BL/6 (B6) and C3H/He (C3H) mice, while they are not expressed on normal T lymphocytes in these strains. When N-butyl-N-nitrosourea (NBU), a chemical carcinogen, was administered orally to B6 and C3H strains, lymphoma development was slower than in T3(b)-TL gene-transduced counterpart strains expressing TL ubiquitously as self-antigens, suggesting that anti-TL immunity may play a protective role. In addition, the development of lymphomas was slightly slower in C3H than in B6, which seems to be in accordance with the results of skin graft experiments indicating that both cellular and humoral immunities against TL were stronger in C3H than B6 mice. The interesting finding that B lymphomas derived from a T3(b)-TL transgenic strain (C3H background) expressing a very high level of TL were rejected in C3H, but not in H-2K(b) transgenic mice (C3H background), raises the possibility that TL-specific effector T cell populations are eliminated and/or energized to a certain extent by interacting with H-2K(b) molecules.
Margaroni, Maritsa; Agallou, Maria; Athanasiou, Evita; Kammona, Olga; Kiparissides, Costas; Gaitanaki, Catherine; Karagouni, Evdokia
2017-01-01
Visceral leishmaniasis (VL) persists as a major public health problem, and since the existing chemotherapy is far from satisfactory, development of an effective vaccine emerges as the most appropriate strategy for confronting VL. The development of an effective vaccine relies on the selection of the appropriate antigen and also the right adjuvant and/or delivery vehicle. In the present study, the protective efficacy of poly(D,L-lactide-co-glycolide) (PLGA) nanoparticles (NPs), which were surface-modified with a TNFα-mimicking eight-amino-acid peptide (p8) and further functionalized by encapsulating soluble Leishmania infantum antigens (sLiAg) and monophosphoryl lipid A (MPLA), a TLR4 ligand, was evaluated against challenge with L. infantum parasites in BALB/c mice. Vaccination with these multifunctionalized PLGA nanoformulations conferred significant protection against parasite infection in vaccinated mice. In particular, vaccination with PLGA-sLiAg-MPLA or p8-PLGA-sLiAg NPs resulted in almost complete elimination of the parasite in the spleen for up to 4 months post-challenge. Parasite burden reduction was accompanied by antigen-specific humoral and cellular immune responses. Specifically, injection with PLGA-sLiAg-MPLA raised exclusively anti-sLiAg IgG1 antibodies post-vaccination, while in p8-PLGA-sLiAg-vaccinated mice, no antibody production was detected. However, 4 months post-challenge, in mice vaccinated with all the multifunctionalized NPs, antibody class switching towards IgG2a subtype was observed. The study of cellular immune responses revealed the increased proliferation capacity of spleen cells against sLiAg, consisting of IFNγ-producing CD4 + and CD8 + T cells. Importantly, the activation of CD8 + T cells was exclusively attributed to vaccination with PLGA NPs surface-modified with the p8 peptide. Moreover, characterization of cytokine production in vaccinated-infected mice revealed that protection was accompanied by significant increase of IFN
Natural Killer T Cell Activation Protects Mice Against Experimental Autoimmune Encephalomyelitis
Singh, Avneesh K.; Wilson, Michael T.; Hong, Seokmann; Olivares-Villagómez, Danyvid; Du, Caigan; Stanic, Aleksandar K.; Joyce, Sebastian; Sriram, Subramaniam; Koezuka, Yasuhiko; Van Kaer, Luc
2001-01-01
Experimental autoimmune encephalomyelitis (EAE) serves as a prototypic model for T cell–mediated autoimmunity. Vα14 natural killer T (NKT) cells are a subset of T lymphocytes that recognize glycolipid antigens presented by the nonpolymorphic major histocompatibility complex (MHC) class I–like protein CD1d. Here, we show that activation of Vα14 NKT cells by the glycosphingolipid α-galactosylceramide (α-GalCer) protects susceptible mice against EAE. β-GalCer, which binds CD1d but is not recognized by NKT cells, failed to protect mice against EAE. Furthermore, α-GalCer was unable to protect CD1d knockout (KO) mice against EAE, indicating the requirement for an intact CD1d antigen presentation pathway. Protection of disease conferred by α-GalCer correlated with its ability to suppress myelin antigen-specific Th1 responses and/or to promote myelin antigen-specific Th2 cell responses. α-GalCer was unable to protect IL-4 KO and IL-10 KO mice against EAE, indicating a critical role for both of these cytokines. Because recognition of α-GalCer by NKT cells is phylogenetically conserved, our findings have identified NKT cells as novel target cells for treatment of inflammatory diseases of the central nervous system. PMID:11748281
Histocompatibility antigens in a population based silicosis series.
Kreiss, K; Danilovs, J A; Newman, L S
1989-01-01
Individual susceptibility to silicosis is suggested by the lack of a uniform dose response relation and by the presence of immunological epiphenomena, such as increased antibody levels and associated diseases that reflect altered immune regulation. Human leucocyte antigens (HLA) are linked with immune response capability and might indicate a possible genetic susceptibility to silicosis. Forty nine silicotic subjects were identified from chest radiographs in a population based study in Leadville, Colorado. They were interviewed for symptoms and occupational history and gave a blood specimen for HLA-A, -B, -DR, and -DQ typing and for antinuclear antibody, immune complexes, immunoglobulins, and rheumatoid factor. Silicotic subjects had twice the prevalence of B44 (45%) of the reference population and had triple the prevalence of A29 (20%), both of which were statistically significant when corrected for the number of comparisons made. No perturbations in D-region antigen frequencies were detected. B44-positive subjects were older at diagnosis and had less dyspnoea than other subjects. A29-positive subjects were more likely to have abnormal levels of IgA and had higher levels of immune complexes. This study is the first to find significant HLA antigen excesses among a series of silicotic cases and extends earlier reported hypotheses that were based on groups of antigens of which B44 and A29 are components. PMID:2818968
Zeelenberg, Ingrid S; Ostrowski, Matias; Krumeich, Sophie; Bobrie, Angélique; Jancic, Carolina; Boissonnas, Alexandre; Delcayre, Alain; Le Pecq, Jean-Bernard; Combadière, Béhazine; Amigorena, Sebastian; Théry, Clotilde
2008-02-15
Expression of non-self antigens by tumors can induce activation of T cells in vivo, although this activation can lead to either immunity or tolerance. CD8+ T-cell activation can be direct (if the tumor expresses MHC class I molecules) or indirect (after the capture and cross-presentation of tumor antigens by dendritic cells). The modes of tumor antigen capture by dendritic cells in vivo remain unclear. Here we examine the immunogenicity of the same model antigen secreted by live tumors either in association with membrane vesicles (exosomes) or as a soluble protein. We have artificially addressed the antigen to secreted vesicles by coupling it to the factor VIII-like C1C2 domain of milk fat globule epidermal growth factor-factor VIII (MFG-E8)/lactadherin. We show that murine fibrosarcoma tumor cells that secrete vesicle-bound antigen grow slower than tumors that secrete soluble antigen in immunocompetent, but not in immunodeficient, host mice. This growth difference is due to the induction of a more potent antigen-specific antitumor immune response in vivo by the vesicle-bound than by the soluble antigen. Finally, in vivo secretion of the vesicle-bound antigen either by tumors or by vaccination with naked DNA protects against soluble antigen-secreting tumors. We conclude that the mode of secretion can determine the immunogenicity of tumor antigens and that manipulation of the mode of antigen secretion may be used to optimize antitumor vaccination protocols.
Du, Luping; Yu, Zhengyu; Pang, Fengjiao; Xu, Xiangwei; Mao, Aihua; Yuan, Wanzhe; He, Kongwang; Li, Bin
2018-01-01
Efficient delivery of antigens through oral immunization is a first and critical step for successful induction of mucosal immunity, which can provide protection against pathogens invading the mucosa. Membranous/microfold cells (M cells) within the mucosa can transcytose internalized antigen without degradation and thus play an important role in initiating antigen-specific mucosal immune responses through inducing secretory IgA production. In this research, we modified poly (D, L-lactide-co-glycolide) (PLGA) nanoparticles (NPs) with Ulex europaeus agglutinin 1 (UEA-1) and successfully prepared an oral vaccine delivery system, UEA-1/PLGA NPs. PLGA NPs were prepared using a standard double emulsion solvent evaporation technique, which can protect the entrapped PRRSV DNA vaccine [pcDNA3.1-SynORF5 (synthetic ORF5)] or subunit vaccine ORF5-encoded glycoprotein (GP5) from exposure to the gastrointestinal (GI) tract and release the plasmids in a controlled manner. With UEA-1 modification, the UEA-1/PLGA NPs can be effectively transported by M-cells. We investigated immune response induced by UEA-1/PLGA-SynORF5 or UEA-1/PLGA-GP5 following inoculation in mice and piglets. Compared with PLGA-SynORF5 or PLGA-GP5 NPs, UEA-1/PLGA-SynORF5, or UEA-1/PLGA-GP5 NPs stimulated significantly increased serum IgG levels and augmented intestinal IgA levels in mice and piglets (P < 0.05). Our findings indicate UEA-1/PLGA NPs can be applied as a promising and universally robust oral vaccine delivery system. PMID:29423381
2013-01-01
Background Antibodies have an essential role in the acquired immune response against blood stage P. falciparum infection. Although several antigens have been identified as important antibody targets, it is still elusive which antigens have to be recognized for clinical protection. Herein, we analyzed antibodies from plasmas from symptomatic or asymptomatic individuals living in the same geographic area in the Western Amazon, measuring their recognition of multiple merozoite antigens. Methods Specific fragments of genes encoding merozoite proteins AMA1 and members of MSP and EBL families from circulating P. falciparum field isolates present in asymptomatic and symptomatic patients were amplified by PCR. After cloning and expression of different versions of the antigens as recombinant GST-fusion peptides, we tested the reactivity of patients’ plasmas by ELISA and the presence of IgG subclasses in the most reactive plasmas. Results 11 out of 24 recombinant antigens were recognized by plasmas from either symptomatic or asymptomatic infections. Antibodies to MSP9 (X2DF=1 = 9.26/p = 0.0047) and MSP5 (X2DF=1 = 8.29/p = 0.0069) were more prevalent in asymptomatic individuals whereas the opposite was observed for MSP1 block 2-MAD20 (X2DF=1 = 6.41/p = 0.0206, Fisher’s exact test). Plasmas from asymptomatic individuals reacted more intensely against MSP4 (U = 210.5, p < 0.03), MSP5 (U = 212, p < 0.004), MSP9 (U = 189.5, p < 0.002) and EBA175 (U = 197, p < 0.014, Mann-Whitney’s U test). IgG1 and IgG3 were predominant for all antigens, but some patients also presented with IgG2 and IgG4. The recognition of MSP5 (OR = 0.112, IC95% = 0.021-0.585) and MSP9 (OR = 0.125, IC95% = 0.030-0.529, cross tab analysis) predicted 8.9 and 8 times less chances, respectively, to present symptoms. Higher antibody levels against MSP5 and EBA175 were associated by odds ratios of 9.4 (IC95% = 1.29-69.25) and 5.7 (IC95
USDA-ARS?s Scientific Manuscript database
The antigenic diversity of avian influenza virus (AIV) within a subtype has been well established and is believed to be driven by the selection of immunologic escape mutants. In regions where vaccination against AIV has been implemented for prolonged periods (e.g. Vietnam and Egypt), vaccines which...
Chauchet, Xavier; Hannani, Dalil; Djebali, Sophia; Laurin, David; Polack, Benoit; Marvel, Jacqueline; Buffat, Laurent; Toussaint, Bertrand; Le Gouëllec, Audrey
2016-01-01
Live-attenuated bacterial vectors for antigens delivery have aroused growing interest in the field of cancer immunotherapy. Their potency to stimulate innate immunity and to promote intracellular antigen delivery into antigen-presenting cells could be exploited to elicit a strong and specific cellular immune response against tumor cells. We previously described genetically-modified and attenuated Pseudomonas aeruginosa vectors able to deliver in vivo protein antigens into antigen-presenting cells, through Type 3 secretion system of the bacteria. Using this approach, we managed to protect immunized mice against aggressive B16 melanoma development in both a prophylactic and therapeutic setting. In this study, we further investigated the antigen-specific CD8+ T cell response, in terms of phenotypic and functional aspects, obtained after immunizations with a killed but metabolically active P. aeruginosa attenuated vector. We demonstrated that P. aeruginosa vaccine induces a highly functional pool of antigen-specific CD8+ T cell able to infiltrate the tumor. Furthermore, multiple immunizations allowed the development of a long-lasting immune response, represented by a pool of predominantly effector memory cells which protected mice against late tumor challenge. Overall, killed but metabolically active P. aeruginosa vector is a safe and promising approach for active and specific antitumor immunotherapy. PMID:28035332
Li, Pei; Liu, Qing; Huang, Chun; Zhao, Xinxin; Roland, Kenneth L; Kong, Qingke
2017-05-15
Colanic Acid (CA) and lipopolysaccharide (LPS) are two major mannose-containing extracellular polysaccharides of Salmonella. Their presence on the bacterial surface can mask conserved protective outer membrane proteins (OMPs) from the host immune system. The mannose moiety in these molecules is derived from GDP-mannose, which is synthesized in several steps. The first two steps require the action of phosphomannose isomerase, encoded by pmi (manA), followed by phosphomannomutase, encoded by manB. There are two copies of manB present in the Salmonella chromosome, one located in the cps gene cluster (cpsG) responsible for CA synthesis, and the other in the rfb gene cluster (rfbK) involved in LPS O-antigen synthesis. In this study, it was demonstrated that the products of cpsG and rfbK are isozymes. To evaluate the impact of these genes on O-antigen synthesis, virulence and immunogenicity, single mutations (Δpmi, ΔrfbK or ΔcpsG) and a double mutation (ΔrfbK ΔcpsG) were introduced into both wild-type Salmonella enterica and an attenuated Δcya Δcrp vaccine strain. The Δpmi, ΔrfbK and ΔcpsG ΔrfbK mutants were defective in LPS synthesis and attenuated for virulence. In orally inoculated mice, strain S122 (Δcrp Δcya ΔcpsG ΔrfbK) and its parent S738 (Δcrp Δcya) were both avirulent and colonized internal tissues. Strain S122 elicited higher levels of anti-S. Typhimurium OMP serum IgG than its parent strain. Mice immunized with S122 were completely protected against challenge with wild-type virulent S. Typhimurium and partially protected against challenge with either wild-type virulent S. Choleraesuis or S. Enteritidis. These data indicate that deletions in rfbK and cpsG are useful mutations for inclusion in future attenuated Salmonella vaccine strains to induce cross-protective immunity. Copyright © 2017 Elsevier Ltd. All rights reserved.
Wagner, R; Shao, Y; Wolf, H
1999-03-26
Major obstacles in the development of HIV vaccines are the high variability of the virus and its complex interaction with the immune system. Recent studies demonstrated, that CTLs recognizing highly conserved epitopes in the group-specific antigen are capable of controlling HIV-replication in long-term nonprogressors. Necessary consequences for novel vaccine concepts are the presentation of a large repertoire of antigenic sites as well as the stimulation of different effectors of the immune system. Accordingly, different types of recombinant HIV-1 virus-like particles (VLPs) have been constructed stimulating the induction of neutralizing antibodies and HIV-specific CD8-positive CTL responses in preclinical studies. With respect to future vaccine trials, HIV vaccine formulations may need to be tailored to the local strains circulating within a geographical region. The expert group of the joint United Nations Programme on AIDS recently identified Yunnan, a southwestern province of China, as a region, in which the HIV epidemic is starting to gain speed, resembling to the situation in Thailand 10 years ago. A molecular clone of a representative virus strain is now available for the development of innovative antigen delivery systems aiming to be evaluated in future clinical vaccine trials throughout this area.
2008-10-28
highly immunogenic, which may prevent their use in vaccine regimens requiring multiple doses (4). Probiotics are defined as ‘‘live microorganisms that...Sterne lethal challenge (Fig. 3 B and C). Thus, results from these studies further highlight the efficacy of employing probiotic lactic acid bacteria in...delivery via probiotic lactic acid bacteria is in their ability to induce antigen-specific IgA responses in feces, saliva, bronchoalveolar, mesenteric
Osorio, Manuel; Takeda, Kazuyo; Stibitz, Scott; Kopecko, Dennis J.
2017-01-01
ABSTRACT We have been exploring the use of the live attenuated Salmonella enterica serovar Typhi Ty21a vaccine strain as a versatile oral vaccine vector for the expression and delivery of multiple foreign antigens, including Shigella O-antigens. In this study, we separately cloned genes necessary for the biosynthesis of the Shigella flexneri serotype 2a and 3a O-antigens, which have been shown to provide broad cross-protection to multiple disease-predominant S. flexneri serotypes. The cloned S. flexneri 2a rfb operon, along with bgt and gtrII, contained on the SfII bacteriophage, was sufficient in Ty21a to express the heterologous S. flexneri 2a O-antigen containing the 3,4 antigenic determinants. Further, this rfb operon, along with gtrA, gtrB, and gtrX contained on the Sfx bacteriophage and oac contained on the Sf6 bacteriophage, was sufficient to express S. flexneri 3a O-antigen containing the 6, 7, and 8 antigenic determinants. Ty21a, with these plasmid-carried or chromosomally inserted genes, demonstrated simultaneous and stable expression of homologous S. Typhi O-antigen plus the heterologous S. flexneri O-antigen. Candidate Ty21a vaccine strains expressing heterologous S. flexneri 2a or 3a lipopolysaccharide (LPS) elicited significant serum antibody responses against both homologous S. Typhi and heterologous Shigella LPS and protected mice against virulent S. flexneri 2a or 3a challenges. These new S. flexneri 2a and 3a O-antigen-expressing Ty21a vaccine strains, together with our previously constructed Ty21a strains expressing Shigella sonnei or Shigella dysenteriae 1 O-antigens, have the potential to be used together for simultaneous protection against the predominant causes of shigellosis worldwide as well as against typhoid fever. PMID:29046309
Zhang, Lei; Zeng, Zhanzhuang; Hu, Chaohua; Bellis, Susan L; Yang, Wendi; Su, Yintao; Zhang, Xinyan; Wu, Yunkun
2016-01-01
Conventional oral vaccines with simple architecture face barriers with regard to stimulating effective immunity. Here we describe oral vaccines with an intelligent phase-transitional shielding layer, poly[(methyl methacrylate)-co-(methyl acrylate)-co-(methacrylic acid)]-poly(D,L-lactide-co-glycolide) (PMMMA-PLGA), which can protect antigens in the gastro-intestinal tract and achieve targeted vaccination in the large intestine. With the surface immunogenic protein (SIP) from group B Streptococcus (GBS) entrapped as the antigen, oral administration with PMMMA-PLGA (PTRBL)/Trx-SIP nanoparticles stimulated robust immunity in tilapia, an animal with a relatively simple immune system. The vaccine succeeded in protecting against Streptococcus agalactiae, a pathogen of worldwide importance that threatens human health and is transmitted in water with infected fish. After oral vaccination with PTRBL/Trx-SIP, tilapia produced enhanced levels of SIP specific antibodies and displayed durability of immune protection. 100% of the vaccinated tilapia were protected from GBS infection, whereas the control groups without vaccines or vaccinated with Trx-SIP only exhibited respective infection rates of 100% or >60% within the initial 5 months after primary vaccination. Experiments in vivo demonstrated that the recombinant antigen Trx-SIP labeled with FITC was localized in colon, spleen and kidney, which are critical sites for mounting an immune response. Our results revealed that, rather than the size of the nanoparticles, it is more likely that the negative charge repulsion produced by ionization of the carboxyl groups in PMMMA shielded the nanoparticles from uptake by small intestinal epithelial cells. This system resolves challenges arising from gastrointestinal damage to antigens, and more importantly, offers a new approach applicable for oral vaccination. Copyright © 2015 Elsevier Ltd. All rights reserved.
Genome-Wide Identification of Chlamydia trachomatis Antigens Associated with Trachomatous Trichiasis
Lu, Chunxue; Holland, Martin J.; Gong, Siqi; Peng, Bo; Bailey, Robin L.; Mabey, David W.; Wu, Yimou; Zhong, Guangming
2012-01-01
antigens associated with both ocular pathology and protection, has provided important information for further understanding chlamydial pathogenesis and the development of subunit vaccines. PMID:22427578
USDA-ARS?s Scientific Manuscript database
Immunostimulating complexes (ISCOMs) are unique multimolecular structures formed by encapsulating antigens, lipids and triterpene saponins and are one of the most successful antigen delivery systems for microbial antigens. In the current study, both the route of administration and the antigen conce...
Development of Prototype Filovirus Recombinant Antigen Immunoassays
Boisen, Matt L.; Oottamasathien, Darin; Jones, Abigail B.; Millett, Molly M.; Nelson, Diana S.; Bornholdt, Zachary A.; Fusco, Marnie L.; Abelson, Dafna M.; Oda, Shun-ichiro; Hartnett, Jessica N.; Rowland, Megan M.; Heinrich, Megan L.; Akdag, Marjan; Goba, Augustine; Momoh, Mambu; Fullah, Mohammed; Baimba, Francis; Gbakie, Michael; Safa, Sadiki; Fonnie, Richard; Kanneh, Lansana; Cross, Robert W.; Geisbert, Joan B.; Geisbert, Thomas W.; Kulakosky, Peter C.; Grant, Donald S.; Shaffer, Jeffery G.; Schieffelin, John S.; Wilson, Russell B.; Saphire, Erica Ollmann; Branco, Luis M.; Garry, Robert F.; Khan, S. Humarr; Pitts, Kelly R.
2015-01-01
Background. Throughout the 2014–2015 Ebola outbreak in West Africa, major gaps were exposed in the availability of validated rapid diagnostic platforms, protective vaccines, and effective therapeutic agents. These gaps potentiated the development of prototype rapid lateral flow immunodiagnostic (LFI) assays that are true point-of-contact platforms, for the detection of active Ebola infections in small blood samples. Methods. Recombinant Ebola and Marburg virus matrix VP40 and glycoprotein (GP) antigens were used to derive a panel of monoclonal and polyclonal antibodies. Antibodies were tested using a multivariate approach to identify antibody-antigen combinations suitable for enzyme-linked immunosorbent assay (ELISA) and LFI assay development. Results. Polyclonal antibodies generated in goats were superior reagents for capture and detection of recombinant VP40 in test sample matrices. These antibodies were optimized for use in antigen-capture ELISA and LFI assay platforms. Prototype immunoglobulin M (IgM)/immunoglobulin G (IgG) ELISAs were similarly developed that specifically detect Ebola virus–specific antibodies in the serum of experimentally infected nonhuman primates and in blood samples obtained from patients with Ebola from Sierra Leone. Conclusions. The prototype recombinant Ebola LFI assays developed in these studies have sensitivities that are useful for clinical diagnosis of acute ebolavirus infections. The antigen-capture and IgM/IgG ELISAs provide additional confirmatory assay platforms for detecting VP40 and other ebolavirus-specific immunoglobulins. PMID:26232440
Shigella Outer Membrane Protein PSSP-1 Is Broadly Protective against Shigella Infection
Rho, Semi; Kim, Su Hee; Kim, Heejoo; Song, Hyo Jin; Kim, Eun Jin; Kim, Ryang Yeo; Kim, Eun Hye; Sinha, Anuradha; Dey, Ayan; Yang, Jae Seung; Song, Man Ki; Nandy, Ranjan Kumar; Czerkinsky, Cecil
2015-01-01
In developing countries, Shigella is a primary cause of diarrhea in infants and young children. Although antibiotic therapy is an effective treatment for shigellosis, therapeutic options are narrowing due to the emergence of antibiotic resistance. Thus, preventive vaccination could become the most efficacious approach for controlling shigellosis. We have identified several conserved protein antigens that are shared by multiple Shigella serotypes and species. Among these, one antigen induced cross-protection against experimental shigellosis, and we have named it pan-Shigella surface protein 1 (PSSP-1). PSSP-1-induced protection requires a mucosal administration route and coadministration of an adjuvant. When PSSP-1 was administered intranasally, it induced cross-protection against Shigella flexneri serotypes 2a, 5a, and 6, Shigella boydii, Shigella sonnei, and Shigella dysenteriae serotype 1. Intradermally administered PSSP-1 induced strong serum antibody responses but failed to induce protection in the mouse lung pneumonia model. In contrast, intranasal administration elicited efficient local and systemic antibody responses and production of interleukin 17A and gamma interferon. Interestingly, blood samples from patients with recent-onset shigellosis showed variable but significant mucosal antibody responses to other conserved Shigella protein antigens but not to PSSP-1. We suggest that PSSP-1 is a promising antigen for a broadly protective vaccine against Shigella. PMID:25651919
Toda, Masahiro
2012-01-01
Because several antigenic peptides of human tumors that are recognized by T-lymphocytes have been identified, immune responses against cancer can now be artificially manipulated. Furthermore, since T-lymphocytes have been found to play an important role in the rejection of tumors by the host and also to have antigen-specific proliferative potentials and memory mechanisms, T-lymphocytes are thought to play a central role in cancer vaccination. Although multidisciplinary therapies have been attempted for the treatment of gliomas, the results remain unsatisfactory. For the development of new therapies against gliomas, it is required to identify tumor antigens as targets for specific immunotherapy. In this chapter, recent progress in research on glioma antigens is described.
Colby, Jennifer M; Krantz, Bryan A
2015-11-06
Anthrax toxin is a tripartite virulence factor produced by Bacillus anthracis during infection. Under acidic endosomal pH conditions, the toxin's protective antigen (PA) component forms a transmembrane channel in host cells. The PA channel then translocates its two enzyme components, lethal factor and edema factor, into the host cytosol under the proton motive force. Protein translocation under a proton motive force is catalyzed by a series of nonspecific polypeptide binding sites, called clamps. A 10-residue guest/host peptide model system, KKKKKXXSXX, was used to functionally probe polypeptide-clamp interactions within wild-type PA channels. The guest residues were Thr, Ala, Leu, Phe, Tyr, and Trp. In steady-state translocation experiments, the channel blocked most tightly with peptides that had increasing amounts of nonpolar surface area. Cooperative peptide binding was observed in the Trp-containing peptide sequence but not the other tested sequences. Trp substitutions into a flexible, uncharged linker between the lethal factor amino-terminal domain and diphtheria toxin A chain expedited translocation. Therefore, peptide-clamp sites in translocase channels can sense large steric features (like tryptophan) in peptides, and while these steric interactions may make a peptide translocate poorly, in the context of folded domains, they can make the protein translocate more rapidly presumably via a hydrophobic steric ratchet mechanism. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Sun, Jianjun; Lang, Alexander E; Aktories, Klaus; Collier, R John
2008-03-18
The protective antigen (PA) moiety of anthrax toxin forms a heptameric pore in endosomal membranes of mammalian cells and translocates the enzymatic moieties of the toxin to the cytosol of these cells. Phenylalanine-427 (F427), a solvent-exposed residue in the lumen of the pore, was identified earlier as being crucial for the transport function of PA. The seven F427 residues were shown in electrophysiological studies to form a clamp that catalyzes protein translocation through the pore. Here, we demonstrate by a variety of tests that certain F427 mutations also profoundly inhibit the conformational transition of the heptameric PA prepore to the pore and thereby block pore formation in membranes. Lysine, arginine, aspartic acid, or glycine at position 427 strongly inhibited this acidic pH-induced conformational transition, whereas histidine, serine, and threonine had virtually no effect on this step, but inhibited translocation instead. Thus, it is possible to inhibit pore formation or translocation selectively, depending on the choice of the side chain at position 427; and the net inhibition of the PA transport function by any given F427 mutation is the product of its effects on both steps. Mutations inhibiting either or both steps elicited a strong dominant-negative phenotype. These findings demonstrate the dual functions of F427 and underline its central role in transporting the enzymatic moieties of anthrax toxin across membranes.
Booster and higher antigen doses of inactivated influenza vaccine in HIV-infected patients.
Johnston, Jessica A; Tincher, Lindsey B; Lowe, Denise K
2013-12-01
To review the literature regarding booster or higher doses of influenza antigen for increasing immunogenicity of inactivated influenza vaccine (IIV) in HIV-infected patients. MEDLINE (1966 to September 2013) was searched using the terms immunize, influenza, vaccine, and HIV or AIDS in combination with two-dose, booster-dose, increased antigen, or high-dose. One trial of booster dosing with standard doses (SDs) of IIV, trivalent (IIV3); 2 trials of booster dosing with intermediate doses (ID) of H1N1 IIV or IIV3; and 1 trial of high-dose (HD) IIV3 were identified. Trials administering 2-dose, booster-dose, or increased antigen of influenza vaccine to patients with HIV were reviewed. Because adjuvanted IIV is not available and IIV, quadrivalent was recently approved in the United States, studies evaluating these vaccines were excluded. HIV-infected individuals are at high risk for influenza-related complications; however, vaccination with SD IIV may not confer optimal protection. It has been postulated that booster or higher doses of influenza antigen may lead to increased immunogenicity. When ID and SD or ID with boosters were evaluated in HIV-infected patients, significant increases in surrogate markers for influenza protection were not achieved. However, HD IIV3 did result in significant increases in seroprotective antibody levels, though 'clinical' influenza was not evaluated. Currently, evidence is insufficient to reach conclusions about the efficacy of booster dosing, ID, or HD influenza vaccine in HIV-infected patients. Trials evaluating booster or higher-antigen doses of IIV for 'clinical' influenza are necessary before routinely recommending for HIV-infected patients.
Uniform cell-autonomous tumorigenesis of the choroid plexus by papovavirus large T antigens.
Chen, J D; Van Dyke, T
1991-01-01
The simian virus 40 (SV40) large tumor antigen (T antigen) under its natural regulatory elements induces choroid plexus papillomas in transgenic mice. Because these tumors develop focally after several months, it has been suggested that secondary cellular alterations are required to induce a tumor in this tissue. In contrast to SV40, the related lymphotropic papovavirus early region induces rapid nonfocal choroid plexus neoplasia in transgenic mice. Here, using hybrid gene constructs, we showed that T antigen from either virus in in fact sufficient to induce these tumors. Their abilities to induce proliferative abnormalities in other tissues, such as kidney and thymus, were also indistinguishable. Differences in the rate of choroid plexus tumorigenesis reflected differences in the control regions of the two viruses, rather than differences in T antigen per se. Under SV40 regulation, expression was limited to a fraction of the choroid plexus cells prior to the formation of focal tumors. When SV40 T antigen was placed under lymphotropic papovavirus control, in contrast, expression was generally uniform in the choroid plexus and rapid expansion of the tissue ensued. We found a direct relationship between T-antigen expression, morphological transformation, and proliferation of the choroid plexus epithelial cells. Analysis of mosaic transgenic mice indicated further that T antigen exerts its mitogenic effect cell autonomously. These studies form the foundation for elucidating the role of various T-antigen subactivities in tumorigenesis. Images PMID:1658622
Sanapala, Shilpa; Rahav, Hannah; Patel, Hetal; Sun, Wei; Curtiss, Roy
2016-05-05
Based on our improved novel Salmonella vaccine delivery platform, we optimized the recombinant attenuated Salmonella typhimurium vaccine (RASV) χ12094 to deliver multiple Yersinia pestis antigens. These included LcrV196 (amino acids, 131-326), Psn encoded on pYA5383 and F1 encoded in the chromosome, their synthesis did not cause adverse effects on bacterial growth. Oral immunization with χ12094(pYA5383) simultaneously stimulated high antibody titers to LcrV, Psn and F1 in mice and presented complete protection against both subcutaneous (s.c.) and intranasal (i.n.) challenges with high lethal doses of Y. pestis CO92. Moreover, no deaths or other disease symptoms were observed in SCID mice orally immunized with χ12094(pYA5383) over a 60-day period. Therefore, the trivalent S. typhimurium-based live vaccine shows promise for a next-generation plague vaccine. Copyright © 2016 Elsevier Ltd. All rights reserved.
Biondi, Elisa; Lane, Joshua D.; Das, Debasis; Dasgupta, Saurja; Piccirilli, Joseph A.; Hoshika, Shuichi; Bradley, Kevin M.; Krantz, Bryan A.; Benner, Steven A.
2016-01-01
Reported here is a laboratory in vitro evolution (LIVE) experiment based on an artificially expanded genetic information system (AEGIS). This experiment delivers the first example of an AEGIS aptamer that binds to an isolated protein target, the first whose structural contact with its target has been outlined and the first to inhibit biologically important activities of its target, the protective antigen from Bacillus anthracis. We show how rational design based on secondary structure predictions can also direct the use of AEGIS to improve the stability and binding of the aptamer to its target. The final aptamer has a dissociation constant of ∼35 nM. These results illustrate the value of AEGIS-LIVE for those seeking to obtain receptors and ligands without the complexities of medicinal chemistry, and also challenge the biophysical community to develop new tools to analyze the spectroscopic signatures of new DNA folds that will emerge in synthetic genetic systems replacing standard DNA and RNA as platforms for LIVE. PMID:27701076
Jayashi, César M; Gonzalez, Armando E; Castillo Neyra, Ricardo; Kyngdon, Craig T; Gauci, Charles G; Lightowlers, Marshall W
2012-12-14
Recombinant antigens cloned from the oncosphere life cycle stage of the cestode parasite Taenia solium (T. solium) have been proven to be effective as vaccines for protecting pigs against infections with T. solium. Previous studies have defined three different host protective oncosphere antigens, TSOL18, TSOL16 and TSOL45. In this study, we evaluated the potential for combining the antigens TSOL16 and TSOL18 as a practical vaccine. Firstly, in a laboratory trial, we compared the immunogenicity of the combined antigens (TSOL16/18) versus the immunogenicity of the antigens separately. Secondly, in a field trial, we tested the ability of the TSOL16/18 vaccine to induce detectable antibody responses in animals living under environmental stress and traditionally reared in areas where T. solium cysticercosis is endemic; and finally, we characterised the immune response of the study population. Pigs of 8-16 weeks of age were vaccinated with 200 μg each of TSOL16 and TSOL18, plus 5mg of Quil-A. Specific total IgG, IgG(1) and IgG(2) antibody responses induced by TSOL16 and TSOL18 were determined with ELISA. The immunogenicity of both antigens was retained in the combined TSOL16/18 vaccine. The combined vaccine TSOL16/18 induced detectable specific anti-TSOL18 antibody responses in 100% (113/113) and specific anti-TSOL16 in 99% (112/113) of the vaccinated animals measured at 2 weeks following the booster vaccination. From the two IgG antibody subtypes analysed we found there was stronger response to IgG(2). Copyright © 2012 Elsevier Ltd. All rights reserved.
Gauthier, Charles; Chassagne, Pierre; Theillet, François-Xavier; Guerreiro, Catherine; Thouron, Françoise; Nato, Farida; Delepierre, Muriel; Sansonetti, Philippe J; Phalipon, Armelle; Mulard, Laurence A
2014-06-28
Synthetic functional mimics of the O-antigen from Shigella flexneri 2a are seen as promising vaccine components against endemic shigellosis. Herein, the influence of the polysaccharide non-stoichiometric di-O-acetylation on antigenicity is addressed for the first time. Three decasaccharides, representing relevant internal mono- and di-O-acetylation profiles of the O-antigen, were synthesized from a pivotal protected decasaccharide designed to tailor late stage site-selective O-acetylation. The latter was obtained via a convergent route involving the imidate glycosylation chemistry. Binding studies to five protective mIgGs showed that none of the acetates adds significantly to broad antibody recognition. Yet, one of the five antibodies had a unique pattern of binding. With IC50 in the micromolar to submicromolar range mIgG F22-4 exemplifies a remarkable tight binding antibody against diversely O-acetylated and non-O-acetylated fragments of a neutral polysaccharide of medical importance.
Li, Yu-An; Ji, Zhenying; Wang, Xiaobo; Wang, Shifeng; Shi, Huoying
2017-12-21
Streptococcus suis is one of the major pathogens that cause economic losses in the swine industry worldwide. However, current bacterins only provide limited prophylactic protection in the field. An ideal vaccine against S. suis should protect pigs against the clinical diseases caused by multiple serotypes, or at least protect against the dominant serotype in a given geographic region. A new recombinant Salmonella enterica serotype Choleraesuis vaccine vector, rSC0011, that is based on the regulated delayed attenuation system and regulated delayed antigen synthesis system, was developed recently. In this study, an improved recombinant attenuated Salmonella Choleraesuis vector, rSC0016, was developed by incorporating a sopB mutation to ensure adequate safety and maximal immunogenicity. In the spleens of mice, rSC0016 colonized less than rSC0011. rSC0016 and rSC0011 colonized similarly in Peyer's patches of mice. The recombinant vaccine rSC0016(pS-SaoA) induced stronger cellular, humoral, and mucosal immune responses in mice and swine against SaoA, a conserved surface protein that is present in many S. suis serotypes, than did rSC0011(pS-SaoA) without sopB or rSC0018(pS-SaoA), which is an avirulent, chemically attenuated vaccine strain. rSC0016(pS-SaoA) provided 100% protection against S. suis serotype 2 in mice and pigs, and full cross-protection against SS7 in pigs. This new vaccine vector provides a foundation for the development of a universal vaccine against multiple serotypes of S. suis in pigs.
Hemmink, Johanneke D; Weir, William; MacHugh, Niall D; Graham, Simon P; Patel, Ekta; Paxton, Edith; Shiels, Brian; Toye, Philip G; Morrison, W Ivan; Pelle, Roger
2016-07-01
An infection and treatment protocol is used to vaccinate cattle against Theileria parva infection. Due to incomplete cross-protection between different parasite isolates, a mixture of three isolates, termed the Muguga cocktail, is used for vaccination. While vaccination of cattle in some regions provides high levels of protection, some animals are not protected against challenge with buffalo-derived T. parva. Knowledge of the genetic composition of the Muguga cocktail vaccine is required to understand how vaccination is able to protect against field challenge and to identify the potential limitations of the vaccine. The aim of the current study was to determine the extent of genetic and antigenic diversity within the parasite isolates that constitute the Muguga cocktail. High throughput multi-locus sequencing of antigen-encoding loci was performed in parallel with typing using a panel of micro- and mini-satellite loci. The former focused on genes encoding CD8(+) T cell antigens, believed to be relevant to protective immunity. The results demonstrate that each of the three component stocks of the cocktail contains limited parasite genotypic diversity, with single alleles detected at many gene/satellite loci and, moreover, that two of the components show a very high level of similarity. Thus, the vaccine incorporates very little of the genetic and antigenic diversity observed in field populations of T. parva. The presence of alleles at low frequency (<10%) within vaccine component populations also points to the possibility of variability in the content of vaccine doses and the potential for loss of allelic diversity during tick passage. The results demonstrate that there is scope to modify the content of the vaccine in order to enhance its diversity and thus its potential for providing broad protection. The ability to accurately quantify genetic diversity in vaccine component stocks will facilitate improved quality control procedures designed to ensure the long
A Review of Intra- and Extracellular Antigen Delivery Systems for Virus Vaccines of Finfish
Munang'andu, Hetron Mweemba; Evensen, Øystein
2015-01-01
Vaccine efficacy in aquaculture has for a long time depended on evaluating relative percent survival and antibody responses after vaccination. However, current advances in vaccine immunology show that the route in which antigens are delivered into cells is deterministic of the type of adaptive immune response evoked by vaccination. Antigens delivered by the intracellular route induce MHC-I restricted CD8+ responses while antigens presented through the extracellular route activate MHC-II restricted CD4+ responses implying that the route of antigen delivery is a conduit to induction of B- or T-cell immune responses. In finfish, different antigen delivery systems have been explored that include live, DNA, inactivated whole virus, fusion protein, virus-like particles, and subunit vaccines although mechanisms linking these delivery systems to protective immunity have not been studied in detail. Hence, in this review we provide a synopsis of different strategies used to administer viral antigens via the intra- or extracellular compartments. Further, we highlight the differences in immune responses induced by antigens processed by the endogenous route compared to exogenously processed antigens. Overall, we anticipate that the synopsis put together in this review will shed insights into limitations and successes of the current vaccination strategies used in finfish vaccinology. PMID:26065009
Farchaus, J. W.; Ribot, W. J.; Jendrek, S.; Little, S. F.
1998-01-01
Bacillus anthracis, the etiologic agent for anthrax, produces two bipartite, AB-type exotoxins, edema toxin and lethal toxin. The B subunit of both exotoxins is an Mr 83,000 protein termed protective antigen (PA). The human anthrax vaccine currently licensed for use in the United States consists primarily of this protein adsorbed onto aluminum oxyhydroxide. This report describes the production of PA from a recombinant, asporogenic, nontoxigenic, and nonencapsulated host strain of B. anthracis and the subsequent purification and characterization of the protein product. Fermentation in a high-tryptone, high-yeast-extract medium under nonlimiting aeration produced 20 to 30 mg of secreted PA per liter. Secreted protease activity under these fermentation conditions was low and was inhibited more than 95% by the addition of EDTA. A purity of 88 to 93% was achieved for PA by diafiltration and anion-exchange chromatography, while greater than 95% final purity was achieved with an additional hydrophobic interaction chromatography step. The purity of the PA product was characterized by reversed-phase high-pressure liquid chromatography, sodium dodecyl sulfate (SDS)-capillary electrophoresis, capillary isoelectric focusing, native gel electrophoresis, and SDS-polyacrylamide gel electrophoresis. The biological activity of the PA, when combined with excess lethal factor in the macrophage cell lysis assay, was comparable to previously reported values. PMID:9501438
Walz, Lisa; Kays, Sarah-Katharina; Zimmer, Gert; von Messling, Veronika
2018-06-20
Immune responses induced by currently licensed inactivated influenza vaccines are mainly directed against the hemagglutinin (HA) glycoprotein, the immunodominant antigen of influenza viruses. The resulting antigenic drift of HA requires frequent updating of the vaccine composition and annual revaccination. On the other hand, the level of antibodies directed against the neuraminidase (NA) glycoprotein, the second major influenza virus antigen, vary greatly. To investigate the potential of the more conserved NA protein for the induction of a subtype-specific protection, vesicular stomatitis virus-based replicons expressing a panel of N1 proteins from prototypic seasonal and pandemic H1N1 strain and human H5N1 and H7N9 isolates were generated. Immunization of mice and ferrets with the replicon carrying the matched N1 protein resulted in robust humoral and cellular immune responses and protected against challenge with the homologous influenza virus with similar efficacy as the matched HA protein, illustrating the potential of the NA protein as vaccine antigen. The extent of protection after immunization with mismatched N1 proteins correlated with the level of cross-reactive sialidase-inhibiting antibody titers. Passive serum transfer experiments in mice confirmed that these functional antibodies determine subtype-specific cross-protection. Our findings illustrate the potential of NA-specific immunity for achieving broader protection against antigenic drift variants or newly emerging viruses carrying the same NA but a different HA subtype. IMPORTANCE Despite the availability of vaccines, annual influenza virus epidemics cause 250,000 to 500,000 deaths worldwide. Currently licensed inactivated vaccines, which are standardized for the amount of the hemagglutinin (HA) antigen, primarily induce strain-specific antibodies whereas the immune response to the neuraminidase (NA) antigen, which is also present on the viral surface, is usually low. Using NA-expressing single
Morgan, Marjorie S.; Rider, S. Dean; Arlian, Larry G.
2017-01-01
Background Scabies, caused by the mite, Sarcoptes scabiei, infects millions of humans, and many wild and domestic mammals. Scabies mites burrow in the lower stratum corneum of the epidermis of the skin and are the source of substances that are antigenic or modulate aspects of the protective response of the host. Ordinary scabies is a difficult disease to diagnose. Objective The goal of this project was to identify S. scabiei proteins that may be candidate antigens for use in a diagnostic test or may be used by the mite to modulate the host’s protective response. Methods An aqueous extract of S. scabiei was separated by 2-dimensional electrophoresis and proteins were identified by mass spectrometry. A parallel immunoblot was probed with serum from patients with ordinary scabies to identify IgM and/or IgG-binding antigens. The genes coding for 23 selected proteins were cloned into E. coli and the expressed recombinant proteins were screened with serum from patients with confirmed ordinary scabies. Results We identified 50 different proteins produced by S. scabiei, 34 of which were not previously identified, and determined that 66% were recognized by patient IgM and/or IgG. Fourteen proteins were screened for use in a diagnostic test but none possessed enough sensitivity and specificity to be useful. Six of the 9 proteins selected for the possibility that they may be immunomodulatory were not recognized by antibodies in patient serum. Conclusions Thirty-three proteins that bound IgM and/or IgG from the serum of patients with ordinary scabies were identified. None of the 14 tested were useful for inclusion in a diagnostic test. The identities of 16 proteins that are not recognized as antigens by infected patients were also determined. These could be among the molecules that are responsible for this mite’s ability to modulate its host’s innate and adaptive immune responses. PMID:28604804
Antigenic Determinants of Alpha-Like Proteins of Streptococcus agalactiae
Maeland, Johan A.; Bevanger, Lars; Lyng, Randi Valsoe
2004-01-01
The majority of group B streptococcus (GBS) isolates express one or more of a family of surface-anchored proteins that vary by strain and that form ladder-like patterns on Western blotting due to large repeat units. These proteins, which are important as GBS serotype markers and as inducers of protective antibodies, include the alpha C (Cα) and R4 proteins and the recently described alpha-like protein 2 (Alp2), encoded by alp2, and Alp3, encoded by alp3. In this study, we examined antigenic determinants possessed by Alp2 and Alp3 by testing of antibodies raised in rabbits, mainly by using enzyme-linked immunosorbent assays (ELISA) and an ELISA absorption test. The results showed that Alp2 and Alp3 shared an antigenic determinant, which may be a unique immunological marker of the Alp variants of GBS proteins. Alp2, in addition, possessed an antigenic determinant which showed specificity for Alp2 and a third determinant which showed serological cross-reactivity with Cα. Alp3, in addition to the determinant common to Alp2 and Alp3, harbored an antigenic site which also was present in the R4 protein, whereas no Alp3-specific antigenic site was detected. These ELISA-based results were confirmed by Western blotting and a fluorescent-antibody test. The results are consistent with highly complex antigenic structures of the alpha-like proteins in a fashion which is in agreement with the recently described structural mosaicism of the alp2 and alp3 genes. The results are expected to influence GBS serotyping, immunoprotection studies, and GBS vaccine developments. PMID:15539502
O-antigen and Core Carbohydrate of Vibrio fischeri Lipopolysaccharide
Post, Deborah M. B.; Yu, Liping; Krasity, Benjamin C.; Choudhury, Biswa; Mandel, Mark J.; Brennan, Caitlin A.; Ruby, Edward G.; McFall-Ngai, Margaret J.; Gibson, Bradford W.; Apicella, Michael A.
2012-01-01
Vibrio fischeri exists in a symbiotic relationship with the Hawaiian bobtail squid, Euprymna scolopes, where the squid provides a home for the bacteria, and the bacteria in turn provide camouflage that helps protect the squid from night-time predators. Like other Gram-negative organisms, V. fischeri expresses lipopolysaccharide (LPS) on its cell surface. The structure of the O-antigen and the core components of the LPS and their possible role in colonization of the squid have not previously been determined. In these studies, an O-antigen ligase mutant, waaL, was utilized to determine the structures of these LPS components and their roles in colonization of the squid. WaaL ligates the O-antigen to the core of the LPS; thus, LPS from waaL mutants lacks O-antigen. Our results show that the V. fischeri waaL mutant has a motility defect, is significantly delayed in colonization, and is unable to compete with the wild-type strain in co-colonization assays. Comparative analyses of the LPS from the wild-type and waaL strains showed that the V. fischeri LPS has a single O-antigen repeat composed of yersiniose, 8-epi-legionaminic acid, and N-acetylfucosamine. In addition, the LPS from the waaL strain showed that the core structure consists of l-glycero-d-manno-heptose, d-glycero-d-manno-heptose, glucose, 3-deoxy-d-manno-octulosonic acid, N-acetylgalactosamine, 8-epi-legionaminic acid, phosphate, and phosphoethanolamine. These studies indicate that the unusual V. fischeri O-antigen sugars play a role in the early phases of bacterial colonization of the squid. PMID:22247546
Rods and cones contain antigenically distinctive S-antigens.
Nork, T M; Mangini, N J; Millecchia, L L
1993-09-01
S-antigen (48 kDa protein or arrestin) is known to be present in rod photoreceptors. Its localization in cones is less clear with several conflicting reports among various species examined. This study employed three different anti-S-antigen antibodies (a48K, a polyclonal antiserum and two monoclonal antibodies, MAb A9-C6 and MAb 5c6.47) and examined their localization in rods and cones of human and cat retinas. To identify the respective cone types, an enzyme histochemical technique for carbonic anhydrase (CA) was employed to distinguish blue cones (CA-negative) from red or green cones (CA-positive). S-antigen localization was then examined by immunocytochemical staining of adjacent sections. In human retinas, a similar labeling pattern was seen with both a48K and MAb A9-C6, i.e., the rods and blue-sensitive cones were strongly positive, whereas the red- or green-sensitive cones showed little immunoreactivity. All human photoreceptors showed reactivity to MAb 5c6.47. In the cat retina, only CA-positive cones could be found. As in the human retina, both rods and cones of the cat were positive for MAb 5c6.47. A difference from the labeling pattern in human retina was noted for the other S-antigen antibodies; a48K labeled rods and all of the cones, whereas MAb A9-C6 reacted strongly with the rods but showed no cone staining. These results suggest that both rods and cones contain S-antigen but that they are antigenically distinctive.
Prostate-specific antigen and acute myocardial infarction: a possible new intriguing scenario.
Patanè, Salvatore; Marte, Filippo
2009-05-29
Prostate-specific antigen (PSA) has been identified as a member of the human kallikrein family of serine proteases and it is an established marker for detection of prostate cancer. Apparently spurious result has been reported in a work about mean serum PSA concentration during acute myocardial infarction with mean serum PSA concentration significantly lower on day 2 than either day 1 or day 3 and it has been reported that these preliminary results could reflect several factors, such as antiinfarctual treatment, reduced physical activity or an acute-phase response. Elevation of prostate-specific antigen has also been reported during acute myocardial infarction in three patients and in another one also after transurethral resection of the prostate (TURP) and without histological diagnosis of prostate cancer. In our report we present three cases of diminution of serum PSA concentration during acute myocardial infarction. Our report extends the evaluation of PSA during acute myocardial infarction. It seems that when elevation of prostate-specific antigen occurs during acute myocardial infarction, coronary lesions are frequent and often more severe than when diminution of prostate-specific antigen occurs during acute myocardial infarction. It opens a possible new intriguing scenario of the role of the prostate-specific antigen in acute myocardial infarction.
Li, Tao; Wang, Gaoling; Shi, Bingtian; Liu, Peixin; Si, Wei; Wang, Bin; Jiang, Li; Zhou, Lunjiang; Xiu, Jinsheng; Liu, Henggui
2015-01-01
Circulation of genotype VII Newcastle disease virus (NDV) has posed a great threat for the poultry industry worldwide. Antibodies against Hemagglutinin-neuraminidase (HN), a membrane protein of NDV with critical roles in NDV infection, have been reported to provide chickens protection from NDV infection. In this study, we comprehensively analyzed the in vivo antibody responses against the linear antigenic domains of the HN protein from genotype VII NDV using a yeast surface display system. The results revealed four distinct regions of HN, P1 (1-52aa), P2 (53-192aa), P3 (193-302aa) and P4 (303-571aa), respectively, according to their antigenic potency. Analysis by FACS and ELISA assay indicated P2 to be the dominant linear antigenic domain, with the immunogenic potency to protect the majority of chickens from NDV challenge. In contrast, the P1, P3 and P4 domains showed weak antigenicity in vivo and could not protect chickens from NDV challenge. These results provide important insight into the characteristic of humoral immune responses elicited by HN of NDV in vivo. PMID:26121247
Margaroni, Maritsa; Agallou, Maria; Athanasiou, Evita; Kammona, Olga; Kiparissides, Costas; Gaitanaki, Catherine; Karagouni, Evdokia
2017-01-01
Visceral leishmaniasis (VL) persists as a major public health problem, and since the existing chemotherapy is far from satisfactory, development of an effective vaccine emerges as the most appropriate strategy for confronting VL. The development of an effective vaccine relies on the selection of the appropriate antigen and also the right adjuvant and/or delivery vehicle. In the present study, the protective efficacy of poly(D,L-lactide-co-glycolide) (PLGA) nanoparticles (NPs), which were surface-modified with a TNFα-mimicking eight-amino-acid peptide (p8) and further functionalized by encapsulating soluble Leishmania infantum antigens (sLiAg) and monophosphoryl lipid A (MPLA), a TLR4 ligand, was evaluated against challenge with L. infantum parasites in BALB/c mice. Vaccination with these multifunctionalized PLGA nanoformulations conferred significant protection against parasite infection in vaccinated mice. In particular, vaccination with PLGA-sLiAg-MPLA or p8-PLGA-sLiAg NPs resulted in almost complete elimination of the parasite in the spleen for up to 4 months post-challenge. Parasite burden reduction was accompanied by antigen-specific humoral and cellular immune responses. Specifically, injection with PLGA-sLiAg-MPLA raised exclusively anti-sLiAg IgG1 antibodies post-vaccination, while in p8-PLGA-sLiAg-vaccinated mice, no antibody production was detected. However, 4 months post-challenge, in mice vaccinated with all the multifunctionalized NPs, antibody class switching towards IgG2a subtype was observed. The study of cellular immune responses revealed the increased proliferation capacity of spleen cells against sLiAg, consisting of IFNγ-producing CD4+ and CD8+ T cells. Importantly, the activation of CD8+ T cells was exclusively attributed to vaccination with PLGA NPs surface-modified with the p8 peptide. Moreover, characterization of cytokine production in vaccinated–infected mice revealed that protection was accompanied by significant increase of IFNγ and
'Minimalist' Nanovaccine Constituted from Near Whole Antigen for Cancer Immunotherapy.
Wang, Kun; Wen, Shuman; He, Lianghua; Li, Ang; Li, Yan; Dong, Haiqing; Li, Wei; Ren, Tianbin; Shi, Donglu; Li, Yongyong
2018-06-21
One of the major challenges in vaccine design has been the over dependence on incorporation of abundant adjuvants, that in fact is in violation of the 'minimalist' principle. In the present study, a compact nanovaccine derived from a near whole antigen (up to 97 wt%) was developed. The nanovaccine structure was stabilized by free cysteines within each antigen (ovalbumin, OVA) which were tempo-spatially exposed and heat-driven to form extensive intermolecular disulfide network. This process enables the engineering of a nanovaccine upon integration of the danger signal (CpG-SH) into the network during the synthetic process. The 50 nm-sized nanovaccine was developed comprising of approximately 500 antigen molecules per nanoparticle. The nanovaccine prophylactically protected 70% of mice from tumorigenesis (0% for the control group) in murine B16-OVA melanoma. Significant tumor inhibition was achieved by strongly nanovaccine-induced cytotoxic T lymphocytes. This strategy can be adapted for the future design of vaccine for a minimalist composition in clinical settings.
Joseph, SK; Ramaswamy, K
2013-01-01
The multivalent vaccine BmHAT, consisting of the Brugia malayi infective larval (L3) antigens heat shock protein12.6 (HSP12.6), abundant larval transcript-2 (ALT-2) and tetraspanin large extra cellular loop (TSP-LEL), was shown to be protective in rodent models from our laboratory. We hypothesize that since these antigens were identified using protective antibodies from immune endemic normal individuals, the multivalent vaccine can be augmented by natural L3 infections providing protection to the vaccinated host. This hypothesis was tested using single dose of DNA and Protein or Protein alone of the BmHAT vaccination in gerbils followed by live trickle L3 infection as booster dose. Vaccine-induced protection in gerbils was determined by worm establishment, micropore chamber assay and by antibody dependant cell cytotoxicity (ADCC) assay. Results were compared with the traditional prime-boost vaccination regimen. Gerbils vaccinated with BmHAT and boosted with L3 trickle infection were protected 51% (BmHAT DNA-Protein) and 48% (BmHAT Protein) respectively. BmHAT vaccination plus L3 trickle booster generated significant titer of antigen-specific IgG antibodies comparable to the traditional prime boost vaccination approach. BmHAT vaccination plus L3 trickle booster also generated antigen-specific cells in the spleen of vaccinated animals and these cells secreted predominantly IFN-γ and IL-4 in response to the vaccine antigens. These studies thus show that single dose of BmHAT multivalent vaccination followed by L3 trickle booster infection can confer significant protection against lymphatic filariasis. PMID:23735679
Shigella outer membrane protein PSSP-1 is broadly protective against Shigella infection.
Kim, Jae-Ouk; Rho, Semi; Kim, Su Hee; Kim, Heejoo; Song, Hyo Jin; Kim, Eun Jin; Kim, Ryang Yeo; Kim, Eun Hye; Sinha, Anuradha; Dey, Ayan; Yang, Jae Seung; Song, Man Ki; Nandy, Ranjan Kumar; Czerkinsky, Cecil; Kim, Dong Wook
2015-04-01
In developing countries, Shigella is a primary cause of diarrhea in infants and young children. Although antibiotic therapy is an effective treatment for shigellosis, therapeutic options are narrowing due to the emergence of antibiotic resistance. Thus, preventive vaccination could become the most efficacious approach for controlling shigellosis. We have identified several conserved protein antigens that are shared by multiple Shigella serotypes and species. Among these, one antigen induced cross-protection against experimental shigellosis, and we have named it pan-Shigella surface protein 1 (PSSP-1). PSSP-1-induced protection requires a mucosal administration route and coadministration of an adjuvant. When PSSP-1 was administered intranasally, it induced cross-protection against Shigella flexneri serotypes 2a, 5a, and 6, Shigella boydii, Shigella sonnei, and Shigella dysenteriae serotype 1. Intradermally administered PSSP-1 induced strong serum antibody responses but failed to induce protection in the mouse lung pneumonia model. In contrast, intranasal administration elicited efficient local and systemic antibody responses and production of interleukin 17A and gamma interferon. Interestingly, blood samples from patients with recent-onset shigellosis showed variable but significant mucosal antibody responses to other conserved Shigella protein antigens but not to PSSP-1. We suggest that PSSP-1 is a promising antigen for a broadly protective vaccine against Shigella. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Clark, Kimberly M; Johnson, John B; Kock, Nancy D; Mizel, Steven B; Parks, Griffith D
2011-10-25
To test the potential for parainfluenza virus 5 (PIV5)-based vectors to provide protection from vaccinia virus (VACV) infection, PIV5 was engineered to express secreted VACV L1R and B5R proteins, two important antigens for neutralization of intracellular mature (IMV) and extracellular enveloped (EEV) virions, respectively. Protection of mice from lethal intranasal VACV challenge required intranasal immunization with PIV5-L1R/B5R in a prime-boost protocol, and correlated with low VACV-induced pathology in the respiratory tract and anti-VACV neutralizing antibody. Mice immunized with PIV5-L1R/B5R showed some disease symptoms following VACV challenge such as loss of weight and hunching, but these symptoms were delayed and less severe than with unimmunized control mice. While immunization with PIV5 expressing B5R alone conferred at least some protection, the most effective immunization included the PIV5 vector expressing L1R alone or in combination with PIV5-B5R. PIV5-L1R/B5R vectors elicited protection from VACV challenge even when CD8+ cells were depleted, but not in the case of mice that were defective in B cell production. Mice were protected from VACV challenge out to at least 1.5 years after immunization with PIV5-L1R/B5R vectors, and showed significant levels of anti-VACV neutralizing antibodies. These results demonstrate the potential for PIV5-based vectors to provide long lasting protection against complex human respiratory pathogens such as VACV, but also highlight the need to understand mechanisms for the generation of strong immune responses against poorly immunogenic viral proteins. Copyright © 2011 Elsevier Inc. All rights reserved.
Cellular vaccines in listeriosis: role of the Listeria antigen GAPDH.
Calderón-González, Ricardo; Frande-Cabanes, Elisabet; Bronchalo-Vicente, Lucía; Lecea-Cuello, M Jesús; Pareja, Eduardo; Bosch-Martínez, Alexandre; Fanarraga, Mónica L; Yañez-Díaz, Sonsoles; Carrasco-Marín, Eugenio; Alvarez-Domínguez, Carmen
2014-01-01
The use of live Listeria-based vaccines carries serious difficulties when administrated to immunocompromised individuals. However, cellular carriers have the advantage of inducing multivalent innate immunity as well as cell-mediated immune responses, constituting novel and secure vaccine strategies in listeriosis. Here, we compare the protective efficacy of dendritic cells (DCs) and macrophages and their safety. We examined the immune response of these vaccine vectors using two Listeria antigens, listeriolysin O (LLO) and glyceraldehyde-3-phosphate-dehydrogenase (GAPDH), and several epitopes such as the LLO peptides, LLO189-201 and LLO91-99 and the GAPDH peptide, GAPDH1-22. We discarded macrophages as safe vaccine vectors because they show anti-Listeria protection but also high cytotoxicity. DCs loaded with GAPDH1-22 peptide conferred higher protection and security against listeriosis than the widely explored LLO91-99 peptide. Anti-Listeria protection was related to the changes in DC maturation caused by these epitopes, with high production of interleukin-12 as well as significant levels of other Th1 cytokines such as monocyte chemotactic protein-1, tumor necrosis factor-α, and interferon-γ, and with the induction of GAPDH1-22-specific CD4(+) and CD8(+) immune responses. This is believed to be the first study to explore the use of a novel GAPDH antigen as a potential DC-based vaccine candidate for listeriosis, whose efficiency appears to highlight the relevance of vaccine designs containing multiple CD4(+) and CD8(+) epitopes.
Killey, R; Mynors, C; Pearce, R; Nell, A; Prentis, A; Day, M J
2018-01-01
To determine the utility of an in-practice test kit to detect protective serum antibody against canine distemper virus, canine adenovirus and canine parvovirus type 2 in a sample of the UK dog population. Serum samples from 486 dogs, last vaccinated between less than 1 month and 124 months previously, were tested with the VacciCheck™ test kit for protective antibodies against distemper, adenovirus and parvovirus type 2. A high proportion of the dogs tested (93·6%) had protective antibody against all three of the core vaccine antigens: 95·7% of the dogs were seropositive against canine distemper virus, 97·3% against canine adenovirus and 98·5% against canine parvovirus type 2. The small number of dogs that were seronegative for one or more of the antigens (n = 31) may have had waning of previous serum antibody or may have been rare genetic non-responders to that specific antigen. UK veterinarians can be reassured that triennial revaccination of adult dogs with core vaccines provides long-lived protective immunity. In-practice serological test kits are a valuable tool for informing decision-making about canine core revaccination. © 2017 British Small Animal Veterinary Association.
Onchocerciasis modulates the immune response to mycobacterial antigens
Stewart, G R; Boussinesq, M; Coulson, T; Elson, L; Nutman, T; Bradley, J E
1999-01-01
Chronic helminth infection induces a type-2 cellular immune response. In contrast to this, mycobacterial infections commonly induce a type-1 immune response which is considered protective. Type-2 responses and diminished type-1 responses to mycobacteria have been previously correlated with active infection states such as pulmonary tuberculosis and lepromatous leprosy. The present study examines the immune responses of children exposed to both the helminth parasite Onchocerca volvulus and the mycobacterial infections, Mycobacterium tuberculosis and M. leprae. Proliferation of peripheral blood mononuclear cells (PBMC) and production of IL-4 in response to both helminth and mycobacterial antigen (PPD) decreased dramatically with increasing microfilarial (MF) density. Although interferon-gamma (IFN-γ) production strongly correlated with cellular proliferation, it was surprisingly not related to MF density for either antigen. IL-4 production in response to helminth antigen and PPD increased with ascending children's age. IFN-γ and cellular proliferation to PPD were not related to age, but in response to helminth antigen were significantly higher in children of age 9–12 years than children of either the younger age group (5–8 years) or the older group (13–16 years). Thus, there was a MF density-related down-regulation of cellular responsiveness and age-related skewing toward type 2 which was paralleled in response to both the helminth antigen and PPD. This parasite-induced immunomodulation of the response to mycobacteria correlates with a previous report of doubled incidence of lepromatous leprosy in onchocerciasis hyperendemic regions. Moreover, this demonstration that helminth infection in humans can modulate the immune response to a concurrent infection or immunological challenge is of critical importance to future vaccination strategies. PMID:10469056
Oral immunization with hepatitis B surface antigen expressed in transgenic plants
Kong, Qingxian; Richter, Liz; Yang, Yu Fang; Arntzen, Charles J.; Mason, Hugh S.; Thanavala, Yasmin
2001-01-01
Oral immunogenicity of recombinant hepatitis B surface antigen (HBsAg) derived from yeast (purified product) or in transgenic potatoes (uncooked unprocessed sample) was compared. An oral adjuvant, cholera toxin, was used to increase immune responses. Transgenic plant material containing HBsAg was the superior means of both inducing a primary immune response and priming the mice to respond to a subsequent parenteral injection of HBsAg. Electron microscopy of transgenic plant samples revealed evidence that the HBsAg accumulated intracellularly; we conclude that natural bioencapsulation of the antigen may provide protection from degradation in the digestive tract until plant cell degradation occurs near an immune effector site in the gut. The correlate of protection from hepatitis B virus infection is serum antibody titers induced by vaccination; the protective level in humans is 10 milliunits/ml or greater. Mice fed HBsAg-transgenic potatoes produced HBsAg-specific serum antibodies that exceeded the protective level and, on parenteral boosting, generated a strong long-lasting secondary antibody response. We have also shown the effectiveness of oral delivery by using a parenteral prime-oral boost immunization schedule. The demonstrated success of oral immunization for hepatitis B virus with an “edible vaccine” provides a strategy for contributing a means to achieve global immunization for hepatitis B prevention and eradication. PMID:11553782
Gurney, E G; Harrison, R O; Fenno, J
1980-01-01
We have isolated three clones of hybrid cells which synthesize antibodies specific for determinants on simian virus 40 (SV40) T antigens. Mouse myeloma NS1 cells were fused with spleen cells from mice that had been immunized with SV40-transformed mouse cells. Hybrid cells were selected in HAT medium and cloned in soft agar. We used an enzyme-linked immunosorbent assay for detection and quantification of mouse antibodies against SV40 T antigens. Monoclonal antibodies from 3 of the 24 clones that scored as positive in the enzyme-linked immunosorbent assay were verified by immunoprecipitation to be specific for SV40 T antigens. Two clones (7 and 412) produced antibodies that recognized denaturation-sensitive antigenic determinants unique to large T antigen. Antibodies from clone 7 appeared to have a low affinity for large T antigen. Antibodies from clone 412 had a higher affinity for large T antigen but did not recognize a subclass of large T antigen that was recognized by tumor serum. Antibodies of the third clone, clone 122, recognized a denaturation-stable antigenic determinant of the 53,000-dalton mouse nonviral T antigen in SV40-transformed cells. Antibodies from clone 122 also recognized similar (51,000- to 56,000-dalton) nonviral T antigens in SV40-transormed or lytically infected cells from five mammalian species and in four uninfected mouse lines. From these observations, we have concluded that (i) the 94,000-dalton SV40 large T antigen may exist as immunologically distinguishable subclasses, and (ii) the nonviral T antigens of five mammalian species share at least one antigenic determinant. Images PMID:6155477
Kano, Taiki; Kondo, Kazunao; Hamako, Jiharu; Matsushita, Fumio; Sakai, Kazuya; Matsui, Taei
2018-04-04
Von Willebrand factor (VWF) is one of the plasma protein carrying ABO(H) blood group antigens, but the combining process of these antigens is not clear. In the present study, we examined whether plasma glycosyltransferase affects the blood group antigens on VWF. VWF expressing H-antigen (H-VWF) from blood group O and bovine serum albumin conjugated with H-antigen (H-BSA) were incubated with recombinant α1-3-N-acetylgalactosaminyltransferase (rA-transferase) and A-plasma with or without an additional UDP-GalNAc. Transformed antigens were detected by western blotting and ELISA, using an anti-A antibody. Both H-VWF and H-BSA acquired the A-antigen after incubation with rA-transferase and UDP-GalNAc. Incubation with A-plasma very weakly converted the H-antigen on BSA and VWF to A-antigen only in the presence of supplemented UDP-GalNAc. This conversion was enhanced on desialylation of H-VWF. These results indicate that sugar chains of plasma VWF can be modified by the external glycosyltransferase, but that plasma glycosyltransferase has no effect on the blood group antigens of VWF due to its low activity and the lack of donor sugars. Further, sialic acid residues of VWF may exert a protective effect against post-translational glycosylation. Our results clearly exclude the possibility that blood group antigens of VWF are constructed extracellularly in plasma.
Kirchenbaum, Greg A.; Carter, Donald M.
2015-01-01
ABSTRACT Broadly reactive antibodies targeting the conserved hemagglutinin (HA) stalk region are elicited following sequential infection or vaccination with influenza viruses belonging to divergent subtypes and/or expressing antigenically distinct HA globular head domains. Here, we demonstrate, through the use of novel chimeric HA proteins and competitive binding assays, that sequential infection of ferrets with antigenically distinct seasonal H1N1 (sH1N1) influenza virus isolates induced an HA stalk-specific antibody response. Additionally, stalk-specific antibody titers were boosted following sequential infection with antigenically distinct sH1N1 isolates in spite of preexisting, cross-reactive, HA-specific antibody titers. Despite a decline in stalk-specific serum antibody titers, sequential sH1N1 influenza virus-infected ferrets were protected from challenge with a novel H1N1 influenza virus (A/California/07/2009), and these ferrets poorly transmitted the virus to naive contacts. Collectively, these findings indicate that HA stalk-specific antibodies are commonly elicited in ferrets following sequential infection with antigenically distinct sH1N1 influenza virus isolates lacking HA receptor-binding site cross-reactivity and can protect ferrets against a pathogenic novel H1N1 virus. IMPORTANCE The influenza virus hemagglutinin (HA) is a major target of the humoral immune response following infection and/or seasonal vaccination. While antibodies targeting the receptor-binding pocket of HA possess strong neutralization capacities, these antibodies are largely strain specific and do not confer protection against antigenic drift variant or novel HA subtype-expressing viruses. In contrast, antibodies targeting the conserved stalk region of HA exhibit broader reactivity among viruses within and among influenza virus subtypes. Here, we show that sequential infection of ferrets with antigenically distinct seasonal H1N1 influenza viruses boosts the antibody responses
Elvin, Stephen J; Eyles, James E; Howard, Kenneth A; Ravichandran, Easwaran; Somavarappu, Satyanarayan; Alpar, H Oya; Williamson, E Diane
2006-05-15
Protection against virulent plague challenge by the parenteral and aerosol routes was afforded by a single administration of microencapsulated Caf1 and LcrV antigens from Yersinia pestis in BALB/c mice. Recombinant Caf1 and LcrV were individually encapsulated in polymeric microspheres, to the surface of which additional antigen was adsorbed. The microspheres containing either Caf1 or LcrV were blended and used to immunise mice on a single occasion, by either the intra-nasal or intra-muscular route. Both routes of immunisation induced systemic and local immune responses, with high levels of serum IgG being developed in response to both vaccine antigens. In Elispot assays, secretion of cytokines by spleen and draining lymph node cells was demonstrated, revealing activation of both Th1 and Th2 associated cytokines; and spleen cells from animals immunised by either route were found to proliferate in vitro in response to both vaccine antigens. Virulent challenge experiments demonstrated that non-invasive immunisation by intra-nasal instillation can provide strong systemic and local immune responses and protect against high level challenge. Microencapsulation of these vaccine antigens has the added advantage that controlled release of the antigens occurs in vivo, so that protective immunity can be induced after only a single immunising dose.
Suarez, David L.; Spackman, Erica; Jadhao, Samadhan; Dauphin, Gwenaelle; Kim-Torchetti, Mia; McGrane, James; Weaver, John; Daniels, Peter; Wong, Frank; Selleck, Paul; Wiyono, Agus; Indriani, Risa; Yupiana, Yuni; Sawitri Siregar, Elly; Prajitno, Teguh; Smith, Derek; Fouchier, Ron
2015-01-01
ABSTRACT Vaccines are used in integrated control strategies to protect poultry against H5N1 high-pathogenicity avian influenza (HPAI). H5N1 HPAI was first reported in Indonesia in 2003, and vaccination was initiated in 2004, but reports of vaccine failures began to emerge in mid-2005. This study investigated the role of Indonesian licensed vaccines, specific vaccine seed strains, and emerging variant field viruses as causes of vaccine failures. Eleven of 14 licensed vaccines contained the manufacturer's listed vaccine seed strains, but 3 vaccines contained a seed strain different from that listed on the label. Vaccines containing A/turkey/Wisconsin/1968 (WI/68), A/chicken/Mexico/28159-232/1994 (Mex/94), and A/turkey/England/N28/1973 seed strains had high serological potency in chickens (geometric mean hemagglutination inhibition [HI] titers, ≥1:169), but vaccines containing strain A/chicken/Guangdong/1/1996 generated by reverse genetics (rg; rgGD/96), A/chicken/Legok/2003 (Legok/03), A/chicken/Vietnam/C57/2004 generated by rg (rgVN/04), or A/chicken/Legok/2003 generated by rg (rgLegok/03) had lower serological potency (geometric mean HI titers, ≤1:95). In challenge studies, chickens immunized with any of the H5 avian influenza vaccines were protected against A/chicken/West Java/SMI-HAMD/2006 (SMI-HAMD/06) and were partially protected against A/chicken/Papua/TA5/2006 (Papua/06) but were not protected against A/chicken/West Java/PWT-WIJ/2006 (PWT/06). Experimental inactivated vaccines made with PWT/06 HPAI virus or rg-generated PWT/06 low-pathogenicity avian influenza (LPAI) virus seed strains protected chickens from lethal challenge, as did a combination of a commercially available live fowl poxvirus vaccine expressing the H5 influenza virus gene and inactivated Legok/03 vaccine. These studies indicate that antigenic variants did emerge in Indonesia following widespread H5 avian influenza vaccine usage, and efficacious inactivated vaccines can be developed using
Hoving, Jennifer C.; Nieuwenhuizen, Natalie; McSorley, Henry J.; Ndlovu, Hlumani; Bobat, Saeeda; Kimberg, Matti; Kirstein, Frank; Cutler, Anthony J.; DeWals, Benjamin; Cunningham, Adam F.; Brombacher, Frank
2013-01-01
In this study, B cell function in protective TH2 immunity against N. brasiliensis infection was investigated. Protection against secondary infection depended on IL-4Rα and IL-13; but not IL-4. Protection did not associate with parasite specific antibody responses. Re-infection of B cell-specific IL-4Rα−/− mice resulted in increased worm burdens compared to control mice, despite their equivalent capacity to control primary infection. Impaired protection correlated with reduced lymphocyte IL-13 production and B cell MHC class II and CD86 surface expression. Adoptive transfer of in vivo N. brasiliensis primed IL-4Rα expressing B cells into naïve BALB/c mice, but not IL-4Rα or IL-13 deficient B cells, conferred protection against primary N. brasiliensis infection. This protection required MHC class II compatibility on B cells suggesting cognate interactions by B cells with CD4+ T cells were important to co-ordinate immunity. Furthermore, the rapid nature of these protective effects by B cells suggested non-BCR mediated mechanisms, such as via Toll Like Receptors, was involved, and this was supported by transfer experiments using antigen pulsed Myd88−/− B cells. These data suggest TLR dependent antigen processing by IL-4Rα-responsive B cells producing IL-13 contribute significantly to CD4+ T cell-mediated protective immunity against N. brasiliensis infection. PMID:24204255
Davoodi-Semiromi, Abdoreza; Schreiber, Melissa; Nallapali, Samson; Verma, Dheeraj; Singh, Nameirakpam D.; Banks, Robert K.; Chakrabarti, Debopam; Daniell, Henry
2009-01-01
Summary Cholera and malaria are major diseases causing high mortality. The only licensed cholera vaccine is expensive; immunity is lost in children within 3 years and adults are not fully protected. No vaccine is yet available for malaria. Therefore, in this study, the cholera toxin-B subunit (CTB) of Vibrio cholerae fused to malarial vaccine antigens apical membrane antigen-1 (AMA1) and merozoite surface protein-1 (MSP1) was expressed in lettuce and tobacco chloroplasts. Southern blot analysis confirmed homoplasmy and stable integration of transgenes. CTB-AMA1 and CTB-MSP1 fusion proteins accumulated up to 13.17% and 10.11% (total soluble protein, TSP) in tobacco and up to 7.3% and 6.1% (TSP) in lettuce respectively. Nine groups of mice (n = 10/group) were immunized subcutaneously (SQV) or orally (ORV) with purified antigens or transplastomic tobacco leaves. Significant levels of antigen-specific antibody titres of immunized mice completely inhibited proliferation of the malarial parasite and cross-reacted with the native parasite proteins in immunoblots and immunofluorescence studies. Protection against cholera toxin challenge in both ORV (100%) and SQV (89%) mice correlated with CTB-specific titres of intestinal, serum IgA and IgG1 in ORV and only IgG1 in SQV mice, but no other immunoglobulin. Increasing numbers of interleukin-10+ T cell but not Foxp3+ regulatory T cells, suppression of interferon-γ and absence of interleukin-17 were observed in protected mice, suggesting that immunity is conferred via the Tr1/Th2 immune response. Dual immunity against two major infectious diseases provided by chloroplast-derived vaccine antigens for long-term (>300 days, 50% of mouse life span) offers a realistic platform for low cost vaccines and insight into mucosal and systemic immunity. PMID:20051036
Specht, Charles A; Lee, Chrono K; Huang, Haibin; Hester, Maureen M; Liu, Jianhua; Luckie, Bridget A; Torres Santana, Melanie A; Mirza, Zeynep; Khoshkenar, Payam; Abraham, Ambily; Shen, Zu T; Lodge, Jennifer K; Akalin, Ali; Homan, Jane; Ostroff, Gary R; Levitz, Stuart M
2017-11-28
Development of a vaccine to protect against cryptococcosis is a priority given the enormous global burden of disease in at-risk individuals. Using glucan particles (GPs) as a delivery system, we previously demonstrated that mice vaccinated with crude Cryptococcus -derived alkaline extracts were protected against lethal challenge with Cryptococcus neoformans and Cryptococcus gattii The goal of the present study was to identify protective protein antigens that could be used in a subunit vaccine. Using biased and unbiased approaches, six candidate antigens (Cda1, Cda2, Cda3, Fpd1, MP88, and Sod1) were selected, recombinantly expressed in Escherichia coli , purified, and loaded into GPs. Three mouse strains (C57BL/6, BALB/c, and DR4) were then vaccinated with the antigen-laden GPs, following which they received a pulmonary challenge with virulent C. neoformans and C. gattii strains. Four candidate vaccines (GP-Cda1, GP-Cda2, GP-Cda3, and GP-Sod1) afforded a significant survival advantage in at least one mouse model; some vaccine combinations provided added protection over that seen with either antigen alone. Vaccine-mediated protection against C. neoformans did not necessarily predict protection against C. gattii Vaccinated mice developed pulmonary inflammatory responses that effectively contained the infection; many surviving mice developed sterilizing immunity. Predicted T helper cell epitopes differed between mouse strains and in the degree to which they matched epitopes predicted in humans. Thus, we have discovered cryptococcal proteins that make promising candidate vaccine antigens. Protection varied depending on the mouse strain and cryptococcal species, suggesting that a successful human subunit vaccine will need to contain multiple antigens, including ones that are species specific. IMPORTANCE The encapsulated fungi Cryptococcus neoformans and Cryptococcus gattii are responsible for nearly 200,000 deaths annually, mostly in immunocompromised individuals. An
Waghela, Suryakant D.; Bray, Jocelyn; Martin, Cameron L.; Sangewar, Neha; Charendoff, Chloe; Shetti, Rashmi; Ashley, Clay; Chen, Chang-Hsin; Berghman, Luc R.; Mwangi, Duncan; Dominowski, Paul J.; Foss, Dennis L.; Rai, Sharath; Vora, Shaunak; Gabbert, Lindsay; Burrage, Thomas G.; Brake, David; Neilan, John
2016-01-01
The African swine fever virus (ASFV) causes a fatal hemorrhagic disease in domestic swine, and at present no treatment or vaccine is available. Natural and gene-deleted, live attenuated strains protect against closely related virulent strains; however, they are yet to be deployed and evaluated in the field to rule out chronic persistence and a potential for reversion to virulence. Previous studies suggest that antibodies play a role in protection, but induction of cytotoxic T lymphocytes (CTLs) could be the key to complete protection. Hence, generation of an efficacious subunit vaccine depends on identification of CTL targets along with a suitable delivery method that will elicit effector CTLs capable of eliminating ASFV-infected host cells and confer long-term protection. To this end, we evaluated the safety and immunogenicity of an adenovirus-vectored ASFV (Ad-ASFV) multiantigen cocktail formulated in two different adjuvants and at two immunizing doses in swine. Immunization with the cocktail rapidly induced unprecedented ASFV antigen-specific antibody and cellular immune responses against all of the antigens. The robust antibody responses underwent rapid isotype switching within 1 week postpriming, steadily increased over a 2-month period, and underwent rapid recall upon boost. Importantly, the primed antibodies strongly recognized the parental ASFV (Georgia 2007/1) by indirect fluorescence antibody (IFA) assay and Western blotting. Significant antigen-specific gamma interferon-positive (IFN-γ+) responses were detected postpriming and postboosting. Furthermore, this study is the first to demonstrate induction of ASFV antigen-specific CTL responses in commercial swine using Ad-ASFV multiantigens. The relevance of the induced immune responses in regard to protection needs to be evaluated in a challenge study. PMID:27628166
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shivachandra, Sathish B.; Rao, Mangala; Janosi, Laszlo
2006-02-05
An in vitro binding system is described to display large full-length proteins on bacteriophage T4 capsid surface at high density. The phage T4 icosahedral capsid features 155 copies of a nonessential highly antigenic outer capsid protein, Hoc, at the center of each major capsid protein hexon. Gene fusions were engineered to express the 83-kDa protective antigen (PA) from Bacillus anthracis fused to the N-terminus of Hoc and the 130-kDa PA-Hoc protein was expressed in Escherichia coli and purified. The purified PA-Hoc was assembled in vitro on hoc {sup -} phage particles. Binding was specific, stable, and of high affinity. Thismore » defined in vitro system allowed manipulation of the copy number of displayed PA and imposed no significant limitation on the size of the displayed antigen. In contrast to in vivo display systems, the in vitro approach allows all the capsid binding sites to be occupied by the 130-kDa PA-Hoc fusion protein. The PA-T4 particles were immunogenic in mice in the absence of an adjuvant, eliciting strong PA-specific antibodies and anthrax lethal toxin neutralizing antibodies. The in vitro display on phage T4 offers a novel platform for potential construction of customized vaccines against anthrax and other infectious diseases.« less
Andries, K; Rombaut, B; Dewindt, B; Boeyé, A
1994-01-01
Two hundred forty pyridazinamine derivatives were tested for the ability to stabilize the antigenicity and infectivity of oral poliovirus vaccine subjected to 45 degrees C for 2 h. Seven compounds stabilized the antigenicity of all three vaccine strains and neutralized the viral particles in a way that is reversible by dilution. Of these, R 77975 (pirodavir) was selected for vaccine potency tests. Sabin type 2 and type 3 strains were subjected to 4, 25, 42, and 45 degrees C for 1 week in the presence and absence of R 77975. Although R 77975 particularly stabilized the infectivity of the most thermolabile vaccine strain (Sabin type 3), the protection did not exceed that of 1 M MgCl2. When virus was inactivated in the absence of R 77975, the native or N antigenicity changed in H antigenicity. However, in the presence of the capsid-binding compound, N antigenicity was preserved in particles that had lost infectivity. PMID:8151800
Detection and Persistence of Vi Antigen in Tissues of Actively Immunized Mice1
Gaines, Sidney; Currie, Julius A.; Tully, Joseph G.
1965-01-01
Gaines, Sidney (Walter Reed Army Institute of Research, Washington, D.C.), Julius A. Currie, and Joseph G. Tully. Detection and persistence of Vi antigen in tissues of actively immunized mice. J. Bacteriol. 89:776–781. 1965.—The presence, distribution, and persistence of Vi antigen in mouse tissue was determined by means of active immunization tests with tissue extracts. Mice were injected intraperitoneally with purified Vi antigen or Vi-containing bacilli. At appropriate intervals, animals were killed, and saline extracts of their tissues were prepared. Mice were immunized with these extracts and challenged 6 days later with 10 ld50 of Salmonella typhosa Ty2. Protection was afforded by tissue extracts from Vi-injected mice, but not by normal tissue extracts. That the immunizing capacity of tissue extracts from Vi-injected mice was attributable to Vi antigen was affirmed by the demonstration that these extracts stimulated the production of Vi antibody in mice, coated erythrocytes for agglutination by Vi antiserum, and inhibited agglutination of Vi-sensitized red blood cells by known Vi antisera. Vi antigen could be detected in the liver and spleen of mice injected with as little as 1 μg. In mice given 150 μg, the antigen was still present in liver tissue 231 days later. PMID:14273660
Sensory nerves within the airways can initiate a variety of protective reflexes. We hypothesized that insults such as exposure to antigen and particulate matter (PM) might dysregulate airway sensory nerve function, thereby contributing to enhanced airway inflammation and hyperre...
Sayes, Fadel; Pawlik, Alexandre; Frigui, Wafa; Gröschel, Matthias I.; Crommelynck, Samuel; Fayolle, Catherine; Cia, Felipe; Bancroft, Gregory J.; Bottai, Daria; Leclerc, Claude; Brosch, Roland; Majlessi, Laleh
2016-01-01
Mycobacterium tuberculosis (Mtb), possesses at least three type VII secretion systems, ESX-1, -3 and -5 that are actively involved in pathogenesis and host-pathogen interaction. We recently showed that an attenuated Mtb vaccine candidate (Mtb Δppe25-pe19), which lacks the characteristic ESX-5-associated pe/ppe genes, but harbors all other components of the ESX-5 system, induces CD4+ T-cell immune responses against non-esx-5-associated PE/PPE protein homologs. These T cells strongly cross-recognize the missing esx-5-associated PE/PPE proteins. Here, we characterized the fine composition of the functional cross-reactive Th1 effector subsets specific to the shared PE/PPE epitopes in mice immunized with the Mtb Δppe25-pe19 vaccine candidate. We provide evidence that the Mtb Δppe25-pe19 strain, despite its significant attenuation, is comparable to the WT Mtb strain with regard to: (i) its antigenic repertoire related to the different ESX systems, (ii) the induced Th1 effector subset composition, (iii) the differentiation status of the Th1 cells induced, and (iv) its particular features at stimulating the innate immune response. Indeed, we found significant contribution of PE/PPE-specific Th1 effector cells in the protective immunity against pulmonary Mtb infection. These results offer detailed insights into the immune mechanisms underlying the remarkable protective efficacy of the live attenuated Mtb Δppe25-pe19 vaccine candidate, as well as the specific potential of PE/PPE proteins as protective immunogens. PMID:27467705
Sutherland, Jayne S.; Lalor, Maeve K.; Black, Gillian F.; Ambrose, Lyn R.; Loxton, Andre G.; Chegou, Novel N.; Kassa, Desta; Mihret, Adane; Howe, Rawleigh; Mayanja-Kizza, Harriet; Gomez, Marie P.; Donkor, Simon; Franken, Kees; Hanekom, Willem; Klein, Michel R.; Parida, Shreemanta K.; Boom, W. Henry; Thiel, Bonnie A.; Crampin, Amelia C.; Ota, Martin; Walzl, Gerhard; Ottenhoff, Tom H. M.; Dockrell, Hazel M.; Kaufmann, Stefan H. E.
2013-01-01
Background Tuberculosis (TB) remains a global health threat with 9 million new cases and 1.4 million deaths per year. In order to develop a protective vaccine, we need to define the antigens expressed by Mycobacterium tuberculosis (Mtb), which are relevant to protective immunity in high-endemic areas. Methods We analysed responses to 23 Mtb antigens in a total of 1247 subjects with different HIV and TB status across 5 geographically diverse sites in Africa (South Africa, The Gambia, Ethiopia, Malawi and Uganda). We used a 7-day whole blood assay followed by IFN-γ ELISA on the supernatants. Antigens included PPD, ESAT-6 and Ag85B (dominant antigens) together with novel resuscitation-promoting factors (rpf), reactivation proteins, latency (Mtb DosR regulon-encoded) antigens, starvation-induced antigens and secreted antigens. Results There was variation between sites in responses to the antigens, presumably due to underlying genetic and environmental differences. When results from all sites were combined, HIV- subjects with active TB showed significantly lower responses compared to both TST- and TST+ contacts to latency antigens (Rv0569, Rv1733, Rv1735, Rv1737) and the rpf Rv0867; whilst responses to ESAT-6/CFP-10 fusion protein (EC), PPD, Rv2029, TB10.3, and TB10.4 were significantly higher in TST+ contacts (LTBI) compared to TB and TST- contacts fewer differences were seen in subjects with HIV co-infection, with responses to the mitogen PHA significantly lower in subjects with active TB compared to those with LTBI and no difference with any antigen. Conclusions Our multi-site study design for testing novel Mtb antigens revealed promising antigens for future vaccine development. The IFN-γ ELISA is a cheap and useful tool for screening potential antigenicity in subjects with different ethnic backgrounds and across a spectrum of TB and HIV infection states. Analysis of cytokines other than IFN-γ is currently on-going to determine correlates of protection, which may
Sutherland, Jayne S; Lalor, Maeve K; Black, Gillian F; Ambrose, Lyn R; Loxton, Andre G; Chegou, Novel N; Kassa, Desta; Mihret, Adane; Howe, Rawleigh; Mayanja-Kizza, Harriet; Gomez, Marie P; Donkor, Simon; Franken, Kees; Hanekom, Willem; Klein, Michel R; Parida, Shreemanta K; Boom, W Henry; Thiel, Bonnie A; Crampin, Amelia C; Ota, Martin; Walzl, Gerhard; Ottenhoff, Tom H M; Dockrell, Hazel M; Kaufmann, Stefan H E
2013-01-01
Tuberculosis (TB) remains a global health threat with 9 million new cases and 1.4 million deaths per year. In order to develop a protective vaccine, we need to define the antigens expressed by Mycobacterium tuberculosis (Mtb), which are relevant to protective immunity in high-endemic areas. We analysed responses to 23 Mtb antigens in a total of 1247 subjects with different HIV and TB status across 5 geographically diverse sites in Africa (South Africa, The Gambia, Ethiopia, Malawi and Uganda). We used a 7-day whole blood assay followed by IFN-γ ELISA on the supernatants. Antigens included PPD, ESAT-6 and Ag85B (dominant antigens) together with novel resuscitation-promoting factors (rpf), reactivation proteins, latency (Mtb DosR regulon-encoded) antigens, starvation-induced antigens and secreted antigens. There was variation between sites in responses to the antigens, presumably due to underlying genetic and environmental differences. When results from all sites were combined, HIV- subjects with active TB showed significantly lower responses compared to both TST(-) and TST(+) contacts to latency antigens (Rv0569, Rv1733, Rv1735, Rv1737) and the rpf Rv0867; whilst responses to ESAT-6/CFP-10 fusion protein (EC), PPD, Rv2029, TB10.3, and TB10.4 were significantly higher in TST(+) contacts (LTBI) compared to TB and TST(-) contacts fewer differences were seen in subjects with HIV co-infection, with responses to the mitogen PHA significantly lower in subjects with active TB compared to those with LTBI and no difference with any antigen. Our multi-site study design for testing novel Mtb antigens revealed promising antigens for future vaccine development. The IFN-γ ELISA is a cheap and useful tool for screening potential antigenicity in subjects with different ethnic backgrounds and across a spectrum of TB and HIV infection states. Analysis of cytokines other than IFN-γ is currently on-going to determine correlates of protection, which may be useful for vaccine efficacy
Kaur, H; Thakur, A; Kaur, S
2015-04-01
A substantial number of antigens of Leishmania donovani have been described in the past. However, identifying candidate antigens is not enough. Appropriate antigen delivery to induce the right type of immune response against leishmaniasis (i.e. induction of a strong antigen-specific Th1 type of immune response) is another crucial component of an effective vaccine. Therefore, 'cocktail' vaccines are proposed based on the assumption that such cocktails will show enhanced efficacy. Studies have been carried out on LD31 and LD51 polypeptides from L. donovani promastigotes, which have proven to be potential vaccine candidates. This study was designed to check the protective efficacy of various cocktails of low molecular weight antigens alone and along with saponin as adjuvant. Mice were sacrificed on different post-challenge days for evaluation of parasite load and other immunological parameters. Protective efficacy of different vaccine formulations was revealed by significant decline in parasite burden and increased DTH Delayed Type Hypersenstivity responses. The antibody response was of IgG type with elevated IgG2a and decreased production of IgG1, whereas cytokine levels pointed towards the generation of protective Th1 type of immune response. Among all vaccine formulations, cocktail of 31+51+saponin was found to be highly immunogenic and imparted maximum protection. © 2015 John Wiley & Sons Ltd.
Advances in alfalfa mosaic virus-mediated expression of anthrax antigen in planta
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brodzik, R.; Bandurska, K.; Deka, D.
2005-12-16
Plant viruses show great potential for production of pharmaceuticals in plants. Such viruses can harbor a small antigenic peptide(s) as a part of their coat proteins (CP) and elicit an antigen-specific immune response. Here, we report the high yield and consistency in production of recombinant alfalfa mosaic virus (AlMV) particles for specific presentation of the small loop 15 amino acid epitope from domain-4 of the Bacillus anthracis protective antigen (PA-D4s). The epitope was inserted immediately after the first 25 N-terminal amino acids of AlMV CP to retain genome activation and binding of CP to viral RNAs. Recombinant AlMV particles weremore » efficiently produced in tobacco, easily purified for immunological analysis, and exhibited extended stability and systemic proliferation in planta. Intraperitional injections of mice with recombinant plant virus particles harboring the PA-D4s epitope elicited a distinct immune response. Western blotting and ELISA analysis showed that sera from immunized mice recognized both native PA antigen and the AlMV CP.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Afrin, Samia; Dagdelen, John; Ma, Zhiwen
Highly-specular reflective surfaces that can withstand elevated-temperatures are desirable for many applications including reflective heat shielding in solar receivers and secondary reflectors, which can be used between primary concentrators and heat collectors. A high-efficiency, high-temperature solar receiver design based on arrays of cavities needs a highly-specular reflective surface on its front section to help sunlight penetrate into the absorber tubes for effective flux spreading. Since this application is for high-temperature solar receivers, this surface needs to be durable and to maintain its optical properties through the usable life. Degradation mechanisms associated with elevated temperatures and thermal cycling, which include cracking,more » delamination, corrosion/oxidation, and environmental effects, could cause the optical properties of surfaces to degrade rapidly in these conditions. Protected mirror surfaces for these applications have been tested by depositing a thin layer of SiO2 on top of electrodeposited silver by means of the sol-gel method. To obtain an effective thin film structure, this sol-gel procedure has been investigated extensively by varying process parameters that affect film porosity and thickness. Endurance tests have been performed in a furnace at 150 degrees C for thousands of hours. This paper presents the sol-gel process for intermediate-temperature specular reflective coatings and provides the long-term reliability test results of sol-gel protected silver-coated surfaces.« less
Designing malaria vaccines to circumvent antigen variability.
Ouattara, Amed; Barry, Alyssa E; Dutta, Sheetij; Remarque, Edmond J; Beeson, James G; Plowe, Christopher V
2015-12-22
Prospects for malaria eradication will be greatly enhanced by an effective vaccine, but parasite genetic diversity poses a major impediment to malaria vaccine efficacy. In recent pre-clinical and field trials, vaccines based on polymorphic Plasmodium falciparum antigens have shown efficacy only against homologous strains, raising the specter of allele-specific immunity such as that which plagues vaccines against influenza and HIV. The most advanced malaria vaccine, RTS,S, targets relatively conserved epitopes on the P. falciparum circumsporozoite protein. After more than 40 years of development and testing, RTS,S, has shown significant but modest efficacy against clinical malaria in phase 2 and 3 trials. Ongoing phase 2 studies of an irradiated sporozoite vaccine will ascertain whether the full protection against homologous experimental malaria challenge conferred by high doses of a whole organism vaccine can provide protection against diverse strains in the field. Here we review and evaluate approaches being taken to design broadly cross-protective malaria vaccines. Copyright © 2015. Published by Elsevier Ltd.
Designing malaria vaccines to circumvent antigen variability✩
Ouattara, Amed; Barry, Alyssa E.; Dutta, Sheetij; Remarque, Edmond J.; Beeson, James G.; Plowe, Christopher V.
2016-01-01
Prospects for malaria eradication will be greatly enhanced by an effective vaccine, but parasite genetic diversity poses a major impediment to malaria vaccine efficacy. In recent pre-clinical and field trials, vaccines based on polymorphic Plasmodium falciparum antigens have shown efficacy only against homologous strains, raising the specter of allele-specific immunity such as that which plagues vaccines against influenza and HIV. The most advanced malaria vaccine, RTS,S, targets relatively conserved epitopes on the P. falciparum circumsporozoite protein. After more than 40 years of development and testing, RTS,S, has shown significant but modest efficacy against clinical malaria in phase 2 and 3 trials. Ongoing phase 2 studies of an irradiated sporozoite vaccine will ascertain whether the full protection against homologous experimental malaria challenge conferred by high doses of a whole organism vaccine can provide protection against diverse strains in the field. Here we review and evaluate approaches being taken to design broadly cross-protective malaria vaccines. PMID:26475447
Structural and Computational Biology in the Design of Immunogenic Vaccine Antigens
Liljeroos, Lassi; Malito, Enrico; Ferlenghi, Ilaria; Bottomley, Matthew James
2015-01-01
Vaccination is historically one of the most important medical interventions for the prevention of infectious disease. Previously, vaccines were typically made of rather crude mixtures of inactivated or attenuated causative agents. However, over the last 10–20 years, several important technological and computational advances have enabled major progress in the discovery and design of potently immunogenic recombinant protein vaccine antigens. Here we discuss three key breakthrough approaches that have potentiated structural and computational vaccine design. Firstly, genomic sciences gave birth to the field of reverse vaccinology, which has enabled the rapid computational identification of potential vaccine antigens. Secondly, major advances in structural biology, experimental epitope mapping, and computational epitope prediction have yielded molecular insights into the immunogenic determinants defining protective antigens, enabling their rational optimization. Thirdly, and most recently, computational approaches have been used to convert this wealth of structural and immunological information into the design of improved vaccine antigens. This review aims to illustrate the growing power of combining sequencing, structural and computational approaches, and we discuss how this may drive the design of novel immunogens suitable for future vaccines urgently needed to increase the global prevention of infectious disease. PMID:26526043
Structural and Computational Biology in the Design of Immunogenic Vaccine Antigens.
Liljeroos, Lassi; Malito, Enrico; Ferlenghi, Ilaria; Bottomley, Matthew James
2015-01-01
Vaccination is historically one of the most important medical interventions for the prevention of infectious disease. Previously, vaccines were typically made of rather crude mixtures of inactivated or attenuated causative agents. However, over the last 10-20 years, several important technological and computational advances have enabled major progress in the discovery and design of potently immunogenic recombinant protein vaccine antigens. Here we discuss three key breakthrough approaches that have potentiated structural and computational vaccine design. Firstly, genomic sciences gave birth to the field of reverse vaccinology, which has enabled the rapid computational identification of potential vaccine antigens. Secondly, major advances in structural biology, experimental epitope mapping, and computational epitope prediction have yielded molecular insights into the immunogenic determinants defining protective antigens, enabling their rational optimization. Thirdly, and most recently, computational approaches have been used to convert this wealth of structural and immunological information into the design of improved vaccine antigens. This review aims to illustrate the growing power of combining sequencing, structural and computational approaches, and we discuss how this may drive the design of novel immunogens suitable for future vaccines urgently needed to increase the global prevention of infectious disease.
Lakhrif, Zineb; Moreau, Alexis; Hérault, Bruno; Di-Tommaso, Anne; Juste, Matthieu; Moiré, Nathalie; Dimier-Poisson, Isabelle; Mévélec, Marie-Noëlle; Aubrey, Nicolas
2018-01-01
Toxoplasmosis is a major public health problem and the development of a human vaccine is of high priority. Efficient vaccination against Toxoplasma gondii requires both a mucosal and systemic Th1 immune response. Moreover, dendritic cells play a critical role in orchestrating the innate immune functions and driving specific adaptive immunity to T. gondii. In this study, we explore an original vaccination strategy that combines administration via mucosal and systemic routes of fusion proteins able to target the major T. gondii surface antigen SAG1 to DCs using an antibody fragment single-chain fragment variable (scFv) directed against DEC205 endocytic receptor. Our results show that SAG1 targeting to DCs by scFv via intranasal and subcutaneous administration improved protection against chronic T. gondii infection. A marked reduction in brain parasite burden is observed when compared with the intranasal or the subcutaneous route alone. DC targeting improved both local and systemic humoral and cellular immune responses and potentiated more specifically the Th1 response profile by more efficient production of IFN-γ, interleukin-2, IgG2a, and nasal IgA. This study provides evidence of the potential of DC targeting for the development of new vaccines against a range of Apicomplexa parasites. PMID:29515595
Thermostable Cross-Protective Subunit Vaccine against Brucella Species
Barabé, Nicole D.; Grigat, Michelle L.; Lee, William E.; Poirier, Robert T.; Jager, Scott J.; Berger, Bradley J.
2014-01-01
A subunit vaccine candidate was produced from Brucella suis 145 (biovar 4; expressing both the A antigen of Brucella abortus and the M antigen of Brucella melitensis). The preparation consisted mostly of polysaccharide (PS; >90% [wt/wt]; both cell-associated PS and exo-PS were combined) and a small amount of protein (1 to 3%) with no apparent nucleic acids. Vaccinated mice were protected (these had a statistically significant reduction in bacterial colonization compared to that of unvaccinated controls) when challenged with representative strains of three Brucella species most pathogenic for humans, i.e., B. abortus, B. melitensis, and B. suis. As little as 1 ng of the vaccine, without added adjuvant, protected mice against B. suis 145 infection (5 × 105 CFU), and a single injection of 1 μg of this subunit vaccine protected mice from B. suis 145 challenge for at least 14 months. A single immunization induced a serum IgG response to Brucella antigens that remained elevated for up to 9 weeks. The use of heat (i.e., boiling-water bath, autoclaving) in the vaccine preparation showed that it was thermostable. This method also ensured safety and security. The vaccine produced was immunogenic and highly protective against multiple strains of Brucella and represents a promising candidate for further evaluation. PMID:25320267
Thermostable cross-protective subunit vaccine against Brucella species.
Cherwonogrodzky, John W; Barabé, Nicole D; Grigat, Michelle L; Lee, William E; Poirier, Robert T; Jager, Scott J; Berger, Bradley J
2014-12-01
A subunit vaccine candidate was produced from Brucella suis 145 (biovar 4; expressing both the A antigen of Brucella abortus and the M antigen of Brucella melitensis). The preparation consisted mostly of polysaccharide (PS; >90% [wt/wt]; both cell-associated PS and exo-PS were combined) and a small amount of protein (1 to 3%) with no apparent nucleic acids. Vaccinated mice were protected (these had a statistically significant reduction in bacterial colonization compared to that of unvaccinated controls) when challenged with representative strains of three Brucella species most pathogenic for humans, i.e., B. abortus, B. melitensis, and B. suis. As little as 1 ng of the vaccine, without added adjuvant, protected mice against B. suis 145 infection (5 × 10(5) CFU), and a single injection of 1 μg of this subunit vaccine protected mice from B. suis 145 challenge for at least 14 months. A single immunization induced a serum IgG response to Brucella antigens that remained elevated for up to 9 weeks. The use of heat (i.e., boiling-water bath, autoclaving) in the vaccine preparation showed that it was thermostable. This method also ensured safety and security. The vaccine produced was immunogenic and highly protective against multiple strains of Brucella and represents a promising candidate for further evaluation. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Compeer, Ewoud Bernardus; Flinsenberg, Thijs Willem Hendrik; van der Grein, Susanna Geertje; Boes, Marianne
2012-01-01
Cross-presentation of endocytosed antigen as peptide/class I major histocompatibility complex complexes plays a central role in the elicitation of CD8(+) T cell clones that mediate anti-viral and anti-tumor immune responses. While it has been clear that there are specific subsets of professional antigen presenting cells capable of antigen cross-presentation, identification of mechanisms involved is still ongoing. Especially amongst dendritic cells (DC), there are specialized subsets that are highly proficient at antigen cross-presentation. We here present a focused survey on the cell biological processes in the endosomal pathway that support antigen cross-presentation. This review highlights DC-intrinsic mechanisms that facilitate the cross-presentation of endocytosed antigen, including receptor-mediated uptake, maturation-induced endosomal sorting of membrane proteins, dynamic remodeling of endosomal structures and cell surface-directed endosomal trafficking. We will conclude with the description of pathogen-induced deviation of endosomal processing, and discuss how immune evasion strategies pertaining endosomal trafficking may preclude antigen cross-presentation.
Active suppression induced by repetitive self-epitopes protects against EAE development.
Puentes, Fabiola; Dickhaut, Katharina; Hofstätter, Maria; Falk, Kirsten; Rötzschke, Olaf
2013-01-01
Autoimmune diseases result from a breakdown in self-tolerance to autoantigens. Self-tolerance is induced and sustained by central and peripheral mechanisms intended to deviate harmful immune responses and to maintain homeostasis, where regulatory T cells play a crucial role. The use of self-antigens in the study and treatment of a range of autoimmune diseases has been widely described; however, the mechanisms underlying the induced protection by these means are unclear. This study shows that protection of experimental autoimmune disease induced by T cell self-epitopes in a multimerized form (oligomers) is mediated by the induction of active suppression. The experimental autoimmune encephalomyelitis (EAE) animal model for multiple sclerosis was used to study the mechanisms of protection induced by the treatment of oligomerized T cell epitope of myelin proteolipid protein (PLP139-151). Disease protection attained by the administration of oligomers was shown to be antigen specific and effective in both prevention and treatment of ongoing EAE. Oligomer mediated tolerance was actively transferred by cells from treated mice into adoptive hosts. The induction of active suppression was correlated with the recruitment of cells in the periphery associated with increased production of IL-10 and reduction of the pro-inflammatory cytokine TNF-α. The role of suppressive cytokines was demonstrated by the reversion of oligomer-induced protection after in vivo blocking of either IL-10 or TGF-β cytokines. This study strongly supports an immunosuppressive role of repeat auto-antigens to control the development of EAE with potential applications in vaccination and antigen specific treatment of autoimmune diseases.
Nanoparticles decorated with viral antigens are more immunogenic at low surface density.
Brewer, Matthew G; DiPiazza, Anthony; Acklin, Joshua; Feng, Changyong; Sant, Andrea J; Dewhurst, Stephen
2017-02-01
There is an urgent need to develop protective vaccines for high priority viral pathogens. One approach known to enhance immune responses to viral proteins is to display them on a nanoparticle (NP) scaffold. However, little is known about the effect of protein density on the B cell response to antigens displayed on NPs. To address this question HIV-1 Envelope (Env) and influenza hemagglutinin (HA) were displayed on a polystyrene-based NP scaffold at various densities - corresponding to mean antigen distances that span the range encountered on naturally occurring virions. Our studies revealed that NPs displaying lower densities of Env or HA more efficiently stimulated antigen-specific B cells in vitro, as measured by calcium flux, than did NPs displaying higher antigen densities. Similarly, NPs displaying a low density of Env or HA also elicited higher titers of antigen-specific serum IgG in immunized BALB/c mice (including elevated titers of hemagglutination-inhibiting antibodies), as well as an increased frequency of antigen-specific antibody secreting cells in the lymph node, spleen and bone marrow. Importantly, our studies showed that the enhanced B cell response elicited by the lower density NPs is likely secondary to more efficient development of follicular helper CD4 T cells and germinal center B cells. These findings demonstrate that the density of antigen on a NP scaffold is a critical determinant of the humoral immune response elicited, and that high density display does not always result in an optimal response. Copyright © 2017 Elsevier Ltd. All rights reserved.
Cellular vaccines in listeriosis: role of the Listeria antigen GAPDH
Calderón-González, Ricardo; Frande-Cabanes, Elisabet; Bronchalo-Vicente, Lucía; Lecea-Cuello, M. Jesús; Pareja, Eduardo; Bosch-Martínez, Alexandre; Fanarraga, Mónica L.; Yañez-Díaz, Sonsoles; Carrasco-Marín, Eugenio; Álvarez-Domínguez, Carmen
2014-01-01
The use of live Listeria-based vaccines carries serious difficulties when administrated to immunocompromised individuals. However, cellular carriers have the advantage of inducing multivalent innate immunity as well as cell-mediated immune responses, constituting novel and secure vaccine strategies in listeriosis. Here, we compare the protective efficacy of dendritic cells (DCs) and macrophages and their safety. We examined the immune response of these vaccine vectors using two Listeria antigens, listeriolysin O (LLO) and glyceraldehyde-3-phosphate-dehydrogenase (GAPDH), and several epitopes such as the LLO peptides, LLO189−201 and LLO91−99 and the GAPDH peptide, GAPDH1−22. We discarded macrophages as safe vaccine vectors because they show anti-Listeria protection but also high cytotoxicity. DCs loaded with GAPDH1−22 peptide conferred higher protection and security against listeriosis than the widely explored LLO91−99 peptide. Anti-Listeria protection was related to the changes in DC maturation caused by these epitopes, with high production of interleukin-12 as well as significant levels of other Th1 cytokines such as monocyte chemotactic protein-1, tumor necrosis factor-α, and interferon-γ, and with the induction of GAPDH1−22-specific CD4+ and CD8+ immune responses. This is believed to be the first study to explore the use of a novel GAPDH antigen as a potential DC-based vaccine candidate for listeriosis, whose efficiency appears to highlight the relevance of vaccine designs containing multiple CD4+ and CD8+ epitopes. PMID:24600592
Schwenk, Robert; Nikki, Jennifer; Rein, Lisa; Spaccapelo, Roberta; Crisanti, Andrea; Wightman, Paul D.; Ockenhouse, Christian F.; Dutta, Sheetij
2014-01-01
The availability of a highly purified and well characterized circumsporozoite protein (CSP) is essential to improve upon the partial success of recombinant CSP-based malaria vaccine candidates. Soluble, near full-length, Plasmodium falciparum CSP vaccine antigen (CS/D) was produced in E. coli under bio-production conditions that comply with current Good Manufacturing Practices (cGMP). A mouse immunogenicity study was conducted using a stable oil-in-water emulsion (SE) of CS/D in combination with the Toll-Like Receptor 4 (TLR4) agonist Glucopyranosyl Lipid A (GLA/SE), or one of two TLR7/8 agonists: R848 (un-conjugated) or 3M-051 (covalently conjugated). Compared to Alum and SE, GLA/SE induced higher CS/D specific antibody response in Balb/c mice. Subclass analysis showed higher IgG2:IgG1 ratio of GLA/SE induced antibodies as compared to Alum and SE. TLR synergy was not observed when soluble R848 was mixed with GLA/SE. Antibody response of 3M051 formulations in Balb/c was similar to GLA/SE, except for the higher IgG2:IgG1 ratio and a trend towards higher T cell responses in 3M051 containing groups. However, no synergistic enhancement of antibody and T cell response was evident when 3M051 conjugate was mixed with GLA/SE. In C57Bl/6 mice, CS/D adjuvanted with 3M051/SE or GLA/SE induced higher CSP repeat specific titers compared to SE. While, 3M051 induced antibodies had high IgG2c:IgG1 ratio, GLA/SE promoted high levels of both IgG1 and IgG2c. GLA/SE also induced more potent T-cell responses compared to SE in two independent C57/BL6 vaccination studies, suggesting a balanced and productive TH1/TH2 response. GLA and 3M-051 similarly enhanced the protective efficacy of CS/D against challenge with a transgenic P. berghei parasite and most importantly, high levels of cytophilic IgG2 antibodies were associated with protection in this model. Our data indicated that the cGMP-grade, soluble CS/D antigen combined with the TLR4-containing adjuvant GLA/SE warrants further
Healthy human T-Cell Responses to Aspergillus fumigatus antigens.
Chaudhary, Neelkamal; Staab, Janet F; Marr, Kieren A
2010-02-17
Aspergillus fumigatus is associated with both invasive and allergic pulmonary diseases, in different hosts. The organism is inhaled as a spore, which, if not cleared from the airway, germinates into hyphal morphotypes that are responsible for tissue invasion and resultant inflammation. Hyphae secrete multiple products that function as antigens, evoking both a protective (T(H)1-T(H)17) and destructive allergic (T(H)2) immunity. How Aspergillus allergens (Asp f proteins) participate in the development of allergic sensitization is unknown. To determine whether Asp f proteins are strictly associated with T(H)2 responses, or represent soluble hyphal products recognized by healthy hosts, human T cell responses to crude and recombinant products were characterized by ELISPOT. While responses (number of spots producing IFN-gamma, IL-4 or IL-17) to crude hyphal antigen preparations were weak, responses to recombinant Asp f proteins were higher. Recombinant allergens stimulated cells to produce IFN-gamma more so than IL-4 or IL-17. Volunteers exhibited a diverse CD4+ and CD8+ T cell antigen recognition profile, with prominent CD4 T(H)1-responses to Asp f3 (a putative peroxismal membrane protein), Asp f9/16 (cell wall glucanase), Asp f11 (cyclophilin type peptidyl-prolyl isomerase) and Asp f22 (enolase). Strong IFN-gamma responses were reproduced in most subjects tested over 6 month intervals. Products secreted after conidial germination into hyphae are differentially recognized by protective T cells in healthy, non-atopic individuals. Defining the specificity of the human T cell repertoire, and identifying factors that govern early responses may allow for development of novel diagnostics and therapeutics for both invasive and allergic Aspergillus diseases.
Lokhandwala, Shehnaz; Waghela, Suryakant D; Bray, Jocelyn; Martin, Cameron L; Sangewar, Neha; Charendoff, Chloe; Shetti, Rashmi; Ashley, Clay; Chen, Chang-Hsin; Berghman, Luc R; Mwangi, Duncan; Dominowski, Paul J; Foss, Dennis L; Rai, Sharath; Vora, Shaunak; Gabbert, Lindsay; Burrage, Thomas G; Brake, David; Neilan, John; Mwangi, Waithaka
2016-11-01
The African swine fever virus (ASFV) causes a fatal hemorrhagic disease in domestic swine, and at present no treatment or vaccine is available. Natural and gene-deleted, live attenuated strains protect against closely related virulent strains; however, they are yet to be deployed and evaluated in the field to rule out chronic persistence and a potential for reversion to virulence. Previous studies suggest that antibodies play a role in protection, but induction of cytotoxic T lymphocytes (CTLs) could be the key to complete protection. Hence, generation of an efficacious subunit vaccine depends on identification of CTL targets along with a suitable delivery method that will elicit effector CTLs capable of eliminating ASFV-infected host cells and confer long-term protection. To this end, we evaluated the safety and immunogenicity of an adenovirus-vectored ASFV (Ad-ASFV) multiantigen cocktail formulated in two different adjuvants and at two immunizing doses in swine. Immunization with the cocktail rapidly induced unprecedented ASFV antigen-specific antibody and cellular immune responses against all of the antigens. The robust antibody responses underwent rapid isotype switching within 1 week postpriming, steadily increased over a 2-month period, and underwent rapid recall upon boost. Importantly, the primed antibodies strongly recognized the parental ASFV (Georgia 2007/1) by indirect fluorescence antibody (IFA) assay and Western blotting. Significant antigen-specific gamma interferon-positive (IFN-γ + ) responses were detected postpriming and postboosting. Furthermore, this study is the first to demonstrate induction of ASFV antigen-specific CTL responses in commercial swine using Ad-ASFV multiantigens. The relevance of the induced immune responses in regard to protection needs to be evaluated in a challenge study. Copyright © 2016, American Society for Microbiology. All Rights Reserved.
Oscherwitz, Jon; Yu, Fen; Cease, Kemp B
2010-09-15
The current vaccines for anthrax in the United States and United Kingdom are efficacious in the two most accepted animal models of inhalation anthrax, nonhuman primates and rabbits, but require extensive immunization protocols. We previously demonstrated that a linear determinant in domain 2 of Bacillus anthracis protective Ag (PA) is a potentially important target for an epitope-specific vaccine for anthrax, as Abs specific for this site, referred to as the loop-neutralizing determinant (LND), neutralize lethal toxin in vitro, yet are virtually absent in PA-immunized rabbits. In this study, we evaluated the immunogenicity and protective efficacy in rabbits of multiple antigenic peptides (MAPs) consisting of aa 304-319 from the LND of PA colinearly synthesized at the C terminus (T-B MAP) or N terminus (B-T MAP) with a heterologous T cell epitope from Plasmodium falciparum. Immunogenicity studies demonstrated that both MAPs elicited toxin-neutralizing Ab in rabbits. To evaluate the MAPs as potential anthrax vaccines, we immunized groups of rabbits (n = 7) with each MAP in Freund's adjuvant and then exposed all rabbits to a 200-LD(50) challenge with aerosolized spores of B. anthracis Ames strain. All seven rabbits immunized with the B-T MAP and 89% (six of seven) of rabbits immunized with the T-B MAP survived the spore challenge. Corollary studies with reference sera from human vaccinees immunized with rPA or anthrax vaccine absorbed and nonhuman primates immunized with PA revealed no detectable Ab with specificity for the LND. We conclude that a synthetic peptide vaccine targeting the LND would be a potentially efficacious vaccine for anthrax.
Granoff, Dan M.; Giuntini, Serena; Gowans, Flor A.; Lujan, Eduardo; Sharkey, Kelsey; Beernink, Peter T.
2016-01-01
Meningococcal factor H-binding protein (FHbp) is an antigen in 2 serogroup B meningococcal vaccines. FHbp specifically binds human and some nonhuman primate complement FH. To investigate the effect of binding of FH to FHbp on protective antibody responses, we immunized infant rhesus macaques with either a control recombinant FHbp antigen that bound macaque FH or a mutant antigen with 2 amino acid substitutions and >250-fold lower affinity for FH. The mutant antigen elicited 3-fold higher serum IgG anti-FHbp titers and up to 15-fold higher serum bactericidal titers than the control FHbp vaccine. When comparing sera with similar IgG anti-FHbp titers, the antibodies elicited by the mutant antigen gave greater deposition of complement component C4b on live meningococci (classical complement pathway) and inhibited binding of FH, while the anti-FHbp antibodies elicited by the control vaccine enhanced FH binding. Thus, the mutant FHbp vaccine elicited an anti-FHbp antibody repertoire directed at FHbp epitopes within the FH binding site, which resulted in greater protective activity than the antibodies elicited by the control vaccine, which targeted FHbp epitopes outside of the FH combining site. Binding of a host protein to a vaccine antigen impairs protective antibody responses, which can be overcome with low-binding mutant antigens. PMID:27668287
Bratthall, D; Köhler, B
1976-04-01
For an immunologic point of view, several facts are worth consideration. S mutans can be separated into at least seven serotypes. Five of the types are based on antigens that may be specific for S mutans. One type, e, is related to the Lancefield group E streptocci, and one type, f, may lack an antigen that shows serological specificity. Analyses of plaque samples from individuals with a high caries activity have, in most instances, shown the presence of c, d, and possibly the g types. This does not necessarily mean that they are per se more cariogenic than the other types, but if all the serotypes cannot be combatted simultaneously, the c, d, and g types are an obvious first choice. S mutans strains do have antigens other than those used for serological identification, and it is not known which antigens can evoke antibodies with the highest protective capacity in humans. The phenomenon of antigenic shifts may make it possible for the bacteria to elude antibodies. However, the number of possible changes may be restricted. If certain antigens are of importance for the cariogenicity of S mutans, a change in their structure might result in a less cariogenic flora.
Mora, Marirosa; Bensi, Giuliano; Capo, Sabrina; Falugi, Fabiana; Zingaretti, Chiara; Manetti, Andrea G O; Maggi, Tiziana; Taddei, Anna Rita; Grandi, Guido; Telford, John L
2005-10-25
Although pili have long been recognized in Gram-negative pathogens as important virulence factors involved in adhesion and invasion, very little is known about extended surface organelles in Gram-positive pathogens. Here we report that Group A Streptococcus (GAS), a Gram-positive human-specific pathogen that causes pharyngitis, impetigo, invasive disease, necrotizing fasciitis, and autoimmune sequelae has long, surface-exposed, pilus-like structures composed of members of a family of extracellular matrix-binding proteins. We describe four variant pili and show that each is recognized by a specific serum of the Lancefield T-typing system, which has been used for over five decades to characterize GAS isolates. Furthermore, we show that immunization of mice with a combination of recombinant pilus proteins confers protection against mucosal challenge with virulent GAS bacteria. The data indicate that induction of a protective immune response against these structures may be a useful strategy for development of a vaccine against disease caused by GAS infection.
Preclinical evaluation of a chemically detoxified pneumolysin as pneumococcal vaccine antigen.
Hermand, Philippe; Vandercammen, Annick; Mertens, Emmanuel; Di Paolo, Emmanuel; Verlant, Vincent; Denoël, Philippe; Godfroid, Fabrice
2017-01-02
The use of protein antigens able to protect against the majority of Streptococcus pneumoniae serotypes is envisaged as stand-alone and/or complement to the current capsular polysaccharide-based pneumococcal vaccines. Pneumolysin (Ply) is a key virulence factor that is highly conserved in amino acid sequence across pneumococcal serotypes, and therefore may be considered as a vaccine target. However, native Ply cannot be used in vaccines due to its intrinsic cytolytic activity. In the present work a completely, irreversibly detoxified pneumolysin (dPly) has been generated using an optimized formaldehyde treatment. Detoxi-fication was confirmed by dPly challenge in mice and histological analysis of the injection site in rats. Immunization with dPly elicited Ply-specific functional antibodies that were able to inhibit Ply activity in a hemolysis assay. In addition, immunization with dPly protected mice against lethal intranasal challenge with Ply, and intranasal immunization inhibited nasopharyngeal colonization after intranasal challenge with homologous or heterologous pneumococcal strain. Our findings supported dPly as a valid candidate antigen for further pneumococcal vaccine development.
Preclinical evaluation of a chemically detoxified pneumolysin as pneumococcal vaccine antigen
Hermand, Philippe; Vandercammen, Annick; Mertens, Emmanuel; Di Paolo, Emmanuel; Verlant, Vincent; Denoël, Philippe; Godfroid, Fabrice
2017-01-01
ABSTRACT The use of protein antigens able to protect against the majority of Streptococcus pneumoniae serotypes is envisaged as stand-alone and/or complement to the current capsular polysaccharide-based pneumococcal vaccines. Pneumolysin (Ply) is a key virulence factor that is highly conserved in amino acid sesec-typsecquence across pneumococcal serotypes, and therefore may be considered as a vaccine target. However, native Ply cannot be used in vaccines due to its intrinsic cytolytic activity. In the present work a completely, irreversibly detoxified pneumolysin (dPly) has been generated using an optimized formaldehyde treatment. Detoxi-fication was confirmed by dPly challenge in mice and histological analysis of the injection site in rats. Immunization with dPly elicited Ply-specific functional antibodies that were able to inhibit Ply activity in a hemolysis assay. In addition, immunization with dPly protected mice against lethal intranasal challenge with Ply, and intranasal immunization inhibited nasopharyngeal colonization after intranasal challenge with homologous or heterologous pneumococcal strain. Our findings supported dPly as a valid candidate antigen for further pneumococcal vaccine development. PMID:27768518
2002-01-01
Antigenics is developing a therapeutic cancer vaccine based on heat-shock proteins (HSPs). The vaccine [HSPPC-96, Oncophage] is in a pivotal phase III clinical trial for renal cancer at 80 clinical sites worldwide. The trial is enrolling at least 500 patients who are randomised to receive surgical removal of the primary tumour followed by out-patient treatment with Oncophage((R)) or surgery only. This study was initiated on the basis of results from a pilot phase I/II study and preliminary results from a phase II study in patients with renal cell cancer. In October 2001, Oncophage was designated as a fast-track product by the Food and Drug Administration in the US for the treatment of renal cell carcinoma. Oncophage is in phase I/II trials in Italy for colorectal cancer (30 patients) and melanoma. The trials in Italy are being conducted at the Istituto dei Tumouri, Milan (in association with Sigma-Tau). Preliminary data from the phase II trial for melanoma was presented at the AACR-NCI-EORTC International Conference in Florida, USA, in October 2001. Oncophage is also in a phase I/II (42 patients) and a phase II trial (84 patients) in the US for renal cell cancer, a phase II trial in the US for non-Hodgkin's lymphoma (35 patients), a phase II trial in the US for sarcoma (20-35 patients), a phase I/II trial in the US for melanoma (36 patients), and phase I/II trials in Germany for gastric (30 patients) and pancreatic cancers. A pilot phase I trial in patients with pancreatic cancer began in the US in 1997 with 5 patients enrolled. In November 2000, Antigenics announced that this trial had been expanded to a phase I/II study which would now include survival as an endpoint and would enroll 5 additional patients. The US trials are being performed at Memorial Sloan-Kettering Cancer Center and the M.D. Anderson Cancer Center. The trials in Germany are being carried out at Johannes Gutenberg-University Hospital, Mainz. Oncophage is an autologous vaccine consisting of
McCallum, Fiona J; Persson, Kristina E M; Fowkes, Freya J I; Reiling, Linda; Mugyenyi, Cleopatra K; Richards, Jack S; Simpson, Julie A; Williams, Thomas N; Gilson, Paul R; Hodder, Anthony N; Sanders, Paul R; Anders, Robin F; Narum, David L; Chitnis, Chetan; Crabb, Brendan S; Marsh, Kevin; Beeson, James G
2017-04-01
Antibodies play a key role in acquired human immunity to Plasmodium falciparum (Pf) malaria and target merozoites to reduce or prevent blood-stage replication and the development of disease. Merozoites present a complex array of antigens to the immune system, and currently, there is only a partial understanding of the targets of protective antibodies and how responses to different antigens are acquired and boosted. We hypothesized that there would be differences in the rate of acquisition of antibodies to different antigens and how well they are boosted by infection, which impacts the acquisition of immunity. We examined responses to a range of merozoite antigens in 2 different cohorts of children and adults with different age structures and levels of malaria exposure. Overall, antibodies were associated with age, exposure, and active infection, and the repertoire of responses increased with age and active infection. However, rates of antibody acquisition varied between antigens and different regions within an antigen following exposure to malaria, supporting our hypothesis. Antigen-specific responses could be broadly classified into early response types in which antibodies were acquired early in childhood exposure and late response types that appear to require substantially more exposure for the development of substantial levels. We identified antigen-specific responses that were effectively boosted after recent infection, whereas other responses were not. These findings advance our understanding of the acquisition of human immunity to malaria and are relevant to the development of malaria vaccines targeting merozoite antigens and the selection of antigens for use in malaria surveillance. © Society for Leukocyte Biology.
Zimic, Mirko; Pajuelo, Mónica; Gilman, Robert H.; Gutiérrez, Andrés H.; Rueda, Luis D.; Flores, Myra; Chile, Nancy; Verástegui, Manuela; Gonzalez, Armando; García, Héctor H.; Sheen, Patricia
2011-01-01
Cathepsin L-like proteases are secreted by several parasites including Taenia solium. The mechanism used by T. solium oncospheres to degrade and penetrate the intestine and infect the host is incompletely understood. It is assumed that intestinal degradation is driven by the proteolytic activity of enzymes secreted by the oncosphere. Blocking the proteolytic activity by an antibody response would prevent the oncosphere penetration and further infection. Serine and cysteine proteases including chymotrypsin, trypsin, elastase, and cathepsin L, are secreted by T. solium and Taenia saginata oncospheres when cultured in vitro, being potential vaccine candidates. However, the purification of a sufficient quantity of proteases secreted by oncospheres to conduct a vaccine trial is costly and lengthy. A 53/25 kDa cathepsin L-like fraction partially purified from T. solium cyst fluid was described previously as an important antigen for immunodiagnostics. In this study we found that this antigen is present in the T. solium oncosphere and is also secreted by the cysticercus. This protein fraction was tested for its ability to protect pigs against an oral challenge with T. solium oncospheres in a vaccine trial. IgG antibodies against the 53/25 kDa cathepsin L-like protein fraction were elicited in the vaccinated animals but did not confer protection. PMID:22119017
Hattori, Takamitsu; Lai, Darson; Dementieva, Irina S.; ...
2016-02-09
Antibodies have a well-established modular architecture wherein the antigen-binding site residing in the antigen-binding fragment (Fab or Fv) is an autonomous and complete unit for antigen recognition. Here, we describe antibodies departing from this paradigm. We developed recombinant antibodies to trimethylated lysine residues on histone H3, important epigenetic marks and challenging targets for molecular recognition. Quantitative characterization demonstrated their exquisite specificity and high affinity, and they performed well in common epigenetics applications. Surprisingly, crystal structures and biophysical analyses revealed that two antigen-binding sites of these antibodies form a head-to-head dimer and cooperatively recognize the antigen in the dimer interface. Thismore » “antigen clasping” produced an expansive interface where trimethylated Lys bound to an unusually extensive aromatic cage in one Fab and the histone N terminus to a pocket in the other, thereby rationalizing the high specificity. A long-neck antibody format with a long linker between the antigen-binding module and the Fc region facilitated antigen clasping and achieved both high specificity and high potency. Antigen clasping substantially expands the paradigm of antibody–antigen recognition and suggests a strategy for developing extremely specific antibodies.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hattori, Takamitsu; Lai, Darson; Dementieva, Irina S.
Antibodies have a well-established modular architecture wherein the antigen-binding site residing in the antigen-binding fragment (Fab or Fv) is an autonomous and complete unit for antigen recognition. Here, we describe antibodies departing from this paradigm. We developed recombinant antibodies to trimethylated lysine residues on histone H3, important epigenetic marks and challenging targets for molecular recognition. Quantitative characterization demonstrated their exquisite specificity and high affinity, and they performed well in common epigenetics applications. Surprisingly, crystal structures and biophysical analyses revealed that two antigen-binding sites of these antibodies form a head-to-head dimer and cooperatively recognize the antigen in the dimer interface. Thismore » “antigen clasping” produced an expansive interface where trimethylated Lys bound to an unusually extensive aromatic cage in one Fab and the histone N terminus to a pocket in the other, thereby rationalizing the high specificity. A long-neck antibody format with a long linker between the antigen-binding module and the Fc region facilitated antigen clasping and achieved both high specificity and high potency. Antigen clasping substantially expands the paradigm of antibody–antigen recognition and suggests a strategy for developing extremely specific antibodies.« less
Heine, Shannon J.; Diaz-McNair, Jovita; Andar, Abhay U.; Drachenberg, Cinthia B.; van de Verg, Lillian; Walker, Richard; Picking, Wendy L.; Pasetti, Marcela F.
2014-01-01
Shigella is one of the leading pathogens contributing to the vast pediatric diarrheal disease burden in low-income countries. No licensed vaccine is available and the existing candidates are only partially effective and serotype-specific. Shigella type III secretion system proteins IpaB and IpaD, which are conserved across Shigella spp., are candidates for a broadly protective, subunit-based vaccine. Herein, we investigated the immunogenicity and protective efficacy of IpaB and IpaD administered intradermally (i.d.) with a double-mutant of the E. coli heat-labile enterotoxin (dmLT) adjuvant using microneedles. Different dosage levels of IpaB and IpaD with or without dmLT were tested in mice. Vaccine delivery into the dermis, recruitment of neutrophils, macrophages, dendritic cells (DC) and Langerhans cells (LC), and colocalization of vaccine antigens within skin-activated antigen presenting cells (APC) was demonstrated through histology and immunofluorescence microscopy. Ag-loaded neutrophils, macrophages, DC and LC remained in the tissue at least one week. IpaB, IpaD and dmLT-specific serum IgG and IgG secreting cells were produced following i.d. immunization. The protective efficacy was 70% against S. flexneri and 50% against S. sonnei. Similar results were obtained when the vaccine was administered intranasally, with the i.d. route requiring 25-40 times lower doses. Distinctively, IgG was detected in mucosal secretions; sIgA as well as mucosal and systemic IgA antibody secreting cells (ASC) were seemingly absent. Vaccine-induced T cells produced IFN-γ, IL-2, TNF-α, IL-17, IL-4, IL-5 and IL-10. These results demonstrate the potential of i.d. vaccination with IpaB and IpaD to prevent Shigella infection and support further studies in humans. PMID:24453241
Ebrahimi, Firouz; Rasaee, Mohammad Javad; Mousavi, Seyed Latif; Babaeipour, Valiollah
2010-02-01
Botulinum neurotoxins (BoNTs) are potent toxicant proteins composed of a heavy chain (100 kDa) and a light chain (50 kDa) of seven (A-G) serotypes that is responsible for botulism syndrome. In this study, polypeptides from C-terminal heavy chain of BoNTs serotypes A, B and E to the length of 54, 45 and 48 amino acid respectively were selected, linked together using a hydrophobic linker and expressed in E. coli. The expression efficiency of the chimeric protein was found to be 51%. The chimeric protein was produced in the form of inclusion body (IB) both at two studied temperatures, 30 degrees C and 37 degrees C. This IB was extracted by ultracentrifugation and followed for chimeric protein solubilization and purification using of ultrafiltration and preparative electrophoresis. The purified chimeric protein was characterized using blotting and ELISA. To evaluate the protection ability of this chimeric antigen against their active toxins, it was injected to mice and the antibody titer as well as the extent of protectivity were determined. Mice given three injections (10 microg/mice) of the antigen were protected against an intra-peritoneal administration of 10 LD(50 )of serotypes A and E, but 100 LD(50) of serotype B. We conclude that a significant correlation exists between the antigenic characteristics and protection capability of the chimeric protein prepared in this study.
Antigen delivery by α2-macroglobulin enhances the cytotoxic T lymphocyte response
Bowers, Edith V.; Horvath, Jeffrey J.; Bond, Jennifer E.; Cianciolo, George J.; Pizzo, Salvatore V.
2009-01-01
α2M* targets antigens to APCs for rapid internalization, processing, and presentation. When used as an antigen-delivery vehicle, α2M* amplifies MHC class II presentation, as demonstrated by increased antibody titers. Recent evidence, however, suggests that α2M* encapsulation may also enhance antigen-specific CTL immunity. In this study, we demonstrate that α2M*-delivered antigen (OVA) enhances the production of specific in vitro and in vivo CTL responses. Murine splenocytes expressing a transgenic TCR specific for CTL peptide OVA257–264 (SIINFEKL) demonstrated up to 25-fold greater IFN-γ and IL-2 secretion when treated in vitro with α2M*-OVA compared with soluble OVA. The frequency of IFN-γ-producing cells was increased ∼15-fold, as measured by ELISPOT. Expansion of the OVA-specific CD8+ T cell population, as assayed by tetramer binding and [3H]thymidine incorporation, and OVA-specific cell-mediated cytotoxicity, as determined by a flow cytometric assay, were also enhanced significantly by α2M*-OVA. Furthermore, significant CTL responses were observed at antigen doses tenfold lower than those required with OVA alone. Finally, we also observed enhanced humoral and CTL responses by naïve mice following intradermal immunization with α2M*-OVA. These α2M*-OVA-immunized mice demonstrated increased protection against a s.c.-implanted, OVA-expressing tumor, as demonstrated by delayed tumor growth and prolonged animal survival. The observation that α2M*-mediated antigen delivery elicits specific CTL responses suggests the cross-presentation of antigen onto MHC class I. These results support α2M* as an effective antigen-delivery system that may be particularly useful for vaccines based on weakly immunogenic subunits or requiring dose sparing. PMID:19652028
Sickle cell protection from malaria.
Eridani, Sandro
2011-10-19
A linkage between presence of Sickle Haemoglobin (HbS) and protection from malaria infection and clinical manifestations in certain areas was suspected from early observations and progressively elucidated by more recent studies. Research has confirmed the abovementioned connection, but also clarified how such protection may be abolished by coexistence of sickle cell trait (HbS trait) and alpha thalassemia, which may explain the relatively low incidence of HbS trait in the Mediterranean. The mechanisms of such protective effect are now being investigated: factors of genetic, molecular and immunological nature are prominent. As for genetic factors attention is given to the role of the red blood cell (RBC) membrane complement regulatory proteins as polymorphisms of these components seem to be associated with resistance to severe malaria; genetic ligands like the Duffy group blood antigen, necessary for erythrocytic invasion, and human protein CD36, a major receptor for P. falciparum-infected RBC's, are also under scrutiny: attention is focused also on plasmodium erythrocyte-binding antigens, which bind to RBC surface components. Genome-wide linkage and association studies are now carried out too, in order to identify genes associated with malaria resistance. Only a minor role is attributed to intravascular sickling, phagocytosis and haemolysis, while specific molecular mechanisms are the object of intensive research: among these a decisive role is played by a biochemical sequence, involving activation of haeme oxygenase (HMO-1), whose effect appears mediated by carbon monoxide (CO). A central role in protection from malaria is also played by immunological factors, which may stimulate antibody production to plasmodium antigens in the early years of life; the role of agents like pathogenic CD8 T-cells has been suggested while the effects of molecular actions on the immunity mechanism are presently investigated. It thus appears that protection from malaria can be
Hironiwa, N; Ishii, S; Kadono, S; Iwayanagi, Y; Mimoto, F; Habu, K; Igawa, T; Hattori, K
2016-01-01
The pH-dependent antigen binding antibody, termed a recycling antibody, has recently been reported as an attractive type of second-generation engineered therapeutic antibody. A recycling antibody can dissociate antigen in the acidic endosome, and thus bind to its antigen multiple times. As a consequence, a recycling antibody can neutralize large amounts of antigen in plasma. Because this approach relies on histidine residues to achieve pH-dependent antigen binding, which could limit the epitopes that can be targeted and affect the rate of antigen dissociation in the endosome, we explored an alternative approach for generating recycling antibodies. Since calcium ion concentration is known to be lower in endosome than in plasma, we hypothesized that an antibody with antigen-binding properties that are calcium-dependent could be used as recycling antibody. Here, we report a novel anti-interleukin-6 receptor (IL-6R) antibody, identified from a phage library that binds to IL-6R only in the presence of a calcium ion. Thermal dynamics and a crystal structure study revealed that the calcium ion binds to the heavy chain CDR3 region (HCDR3), which changes and possibly stabilizes the structure of HCDR3 to make it bind to antigen calcium dependently (PDB 5AZE). In vitro and in vivo studies confirmed that this calcium-dependent antigen-binding antibody can dissociate its antigen in the endosome and accelerate antigen clearance from plasma, making it a novel approach for generating recycling antibody. PMID:26496237
Kwon, Kwang-Chul; Verma, Dheeraj; Singh, Nameirakpam D.; Herzog, Roland; Daniell, Henry
2012-01-01
Among 12 billion injections administered annually, unsafe delivery leads to >20 million infections and >100 million reactions. In an emerging new concept, freeze-dried plant cells (lettuce) expressing vaccine antigens/biopharmaceuticals are protected in the stomach from acids/enzymes but are released to the immune or blood circulatory system when plant cell walls are digested by microbes that colonize the gut. Vaccine antigens bioencapsulated in plant cells upon oral delivery after priming, conferred both mucosal and systemic immunity and protection against bacterial, viral or protozoan pathogens or toxin challenge. Oral delivery of autoantigens was effective against complications of type 1diabetes and hemophilia, by developing tolerance. Oral delivery of proinsulin or exendin-4 expressed in plant cells regulated blood glucose levels similar to injections. Therefore, this new platform offers a low cost alternative to deliver different therapeutic proteins to combat infectious or inherited diseases by eliminating inactivated pathogens, expensive purification, cold storage/transportation and sterile injections. PMID:23099275
Chlorphenesin: an Antigen-Associated Immunosuppressant
Whang, H. Y.; Neter, E.
1970-01-01
Chlorphenesin (3-p-chlorophenoxy-1,2-propanediol), when injected intravenously together with either of two common bacterial antigens, inhibits the antibody response of the rabbit. The antigens studied are those common to Enterobacteriaceae and to gram-positive bacteria. The immunosuppression is contingent upon incubation of chlorphenesin and antigen in vitro prior to administration, since separate injection of antigen and inhibitor or of mixtures without prior incubation yields undiminished antibody response. Chlorphenesin, as shown by hemagglutination-inhibition tests, does not alter the antigenic determinants, because antibody neutralization occurs in the presence or absence of the drug. The immunosuppressive effect is reversible, since precipitation of chlorphenesin at 4 C substantially restores immunogenicity. Animals immunized with antigen-drug mixtures, which fail to respond with significant antibody production, nonetheless are immunologically primed. It is concluded that chlorphenesin represents another example of antigen-associated immunosuppressants. PMID:16557800
Chlorphenesin: an antigen-associated immunosuppressant.
Whang, H Y; Neter, E
1970-07-01
Chlorphenesin (3-p-chlorophenoxy-1,2-propanediol), when injected intravenously together with either of two common bacterial antigens, inhibits the antibody response of the rabbit. The antigens studied are those common to Enterobacteriaceae and to gram-positive bacteria. The immunosuppression is contingent upon incubation of chlorphenesin and antigen in vitro prior to administration, since separate injection of antigen and inhibitor or of mixtures without prior incubation yields undiminished antibody response. Chlorphenesin, as shown by hemagglutination-inhibition tests, does not alter the antigenic determinants, because antibody neutralization occurs in the presence or absence of the drug. The immunosuppressive effect is reversible, since precipitation of chlorphenesin at 4 C substantially restores immunogenicity. Animals immunized with antigen-drug mixtures, which fail to respond with significant antibody production, nonetheless are immunologically primed. It is concluded that chlorphenesin represents another example of antigen-associated immunosuppressants.
2015-01-01
1 Introduction The Pegasus White Ice Runway at McMurdo Station, Antarctica , has expe- rienced significant melting during the past two austral...Laboratory Trials of White Ice Paint to Improve the Energy Reflectance Properties of the Glacial- Ice Runway Surface Co ld R eg io ns R es ea rc h...ERDC/CRREL TN-15-1 January 2015 Pegasus Airfield Repair and Protection Laboratory Trials of White Ice Paint to Improve the Energy Reflectance
Yang, XinChao; Li, MengHui; Liu, JianHua; Ji, YiHong; Li, XiangRui; Xu, LiXin; Yan, RuoFeng; Song, XiaoKai
2017-02-16
Eimeria maxima is one of the most prevalent Eimeria species causing avian coccidiosis, and results in huge economic loss to the global poultry industry. Current control strategies, such as anti-coccidial medication and live vaccines have been limited because of their drawbacks. The third generation anticoccidial vaccines including the recombinant vaccines as well as DNA vaccines have been suggested as a promising alternative strategy. To date, only a few protective antigens of E. maxima have been reported. Hence, there is an urgent need to identify novel protective antigens of E. maxima for the development of neotype anticoccidial vaccines. With the aim of identifying novel protective genes of E. maxima, a cDNA expression library of E. maxima sporozoites was constructed using Gateway technology. Subsequently, the cDNA expression library was divided into 15 sub-libraries for cDNA expression library immunization (cDELI) using parasite challenged model in chickens. Protective sub-libraries were selected for the next round of screening until individual protective clones were obtained, which were further sequenced and analyzed. Adopting the Gateway technology, a high-quality entry library was constructed, containing 9.2 × 10 6 clones with an average inserted fragments length of 1.63 kb. The expression library capacity was 2.32 × 10 7 colony-forming units (cfu) with an average inserted fragments length of 1.64 Kb. The expression library was screened using parasite challenged model in chickens. The screening yielded 6 immune protective genes including four novel protective genes of EmJS-1, EmRP, EmHP-1 and EmHP-2, and two known protective genes of EmSAG and EmCKRS. EmJS-1 is the selR domain-containing protein of E. maxima whose function is unknown. EmHP-1 and EmHP-2 are the hypothetical proteins of E. maxima. EmRP and EmSAG are rhomboid-like protein and surface antigen glycoproteins of E. maxima respectively, and involved in invasion of the parasite. Our
Pittman, Phillip R; Fisher, Diana; Quinn, Xiaofei; Schmader, Trevor; Barrera-Oro, Julio G
2013-10-17
We describe the Bacillus anthracis protective antigen IgG antibody response and the B. anthracis lethal toxin neutralization activity to a delayed dose of anthrax vaccine adsorbed (AVA, BioThrax(®)) using validated assays. 373 individuals received 1, 2, or 3 priming doses, 18-24 months afterward, they received a delayed dose of AVA. Overall, 23.6% of subjects showed detectable anti-PA IgG before the boost, compared to 99.2% (P<0.0001) 28 days after the boost. Geometric mean anti-PA IgG concentration (GMC) was 1.66 μg/mL before and 887.82 μg/mL after the boost (P<0.0001). The proportion of individuals with four-fold increase in GMC following the boost ranged from 93.8% to 100%. Robust anti-PA IgG levels and B. anthracis lethal toxin neutralization activity are induced when an AVA dose is delayed as long as two years. These data support continuing with the vaccination schedule when a dose is delayed as long as two years rather than restarting the series. Published by Elsevier Ltd.
Lynch, Michelle M; Cernetich-Ott, Amy; Weidanz, William P; Burns, James M
2009-03-01
For the development of blood-stage malaria vaccines, there is a clear need to establish in vitro measures of the antibody-mediated and the cell-mediated immune responses that correlate with protection. In this study, we focused on establishing correlates of antibody-mediated immunity induced by immunization with apical membrane antigen 1 (AMA1) and merozoite surface protein 1(42) (MSP1(42)) subunit vaccines. To do so, we exploited the Plasmodium chabaudi rodent model, with which we can immunize animals with both protective and nonprotective vaccine formulations and allow the parasitemia in the challenged animals to peak. Vaccine formulations were varied with regard to the antigen dose, the antigen conformation, and the adjuvant used. Prechallenge antibody responses were evaluated by enzyme-linked immunosorbent assay and were tested for a correlation with protection against nonlethal P. chabaudi malaria, as measured by a reduction in the peak level of parasitemia. The analysis showed that neither the isotype profile nor the avidity of vaccine-induced antibodies correlated with protective efficacy. However, high titers of antibodies directed against conformation-independent epitopes were associated with poor vaccine performance and may limit the effectiveness of protective antibodies that recognize conformation-dependent epitopes. We were able to predict the efficacies of the P. chabaudi AMA1 (PcAMA1) and P. chabaudi MSP1(42) (PcMSP1(42)) vaccines only when the prechallenge antibody titers to both refolded and reduced/alkylated antigens were considered in combination. The relative importance of these two measures of vaccine-induced responses as predictors of protection differed somewhat for the PcAMA1 and the PcMSP1(42) vaccines, a finding confirmed in our final immunization and challenge study. A similar approach to the evaluation of vaccine-induced antibody responses may be useful during clinical trials of Plasmodium falciparum AMA1 and MSP1(42) vaccines.
Lynch, Michelle M.; Cernetich-Ott, Amy; Weidanz, William P.; Burns, James M.
2009-01-01
For the development of blood-stage malaria vaccines, there is a clear need to establish in vitro measures of the antibody-mediated and the cell-mediated immune responses that correlate with protection. In this study, we focused on establishing correlates of antibody-mediated immunity induced by immunization with apical membrane antigen 1 (AMA1) and merozoite surface protein 142 (MSP142) subunit vaccines. To do so, we exploited the Plasmodium chabaudi rodent model, with which we can immunize animals with both protective and nonprotective vaccine formulations and allow the parasitemia in the challenged animals to peak. Vaccine formulations were varied with regard to the antigen dose, the antigen conformation, and the adjuvant used. Prechallenge antibody responses were evaluated by enzyme-linked immunosorbent assay and were tested for a correlation with protection against nonlethal P. chabaudi malaria, as measured by a reduction in the peak level of parasitemia. The analysis showed that neither the isotype profile nor the avidity of vaccine-induced antibodies correlated with protective efficacy. However, high titers of antibodies directed against conformation-independent epitopes were associated with poor vaccine performance and may limit the effectiveness of protective antibodies that recognize conformation-dependent epitopes. We were able to predict the efficacies of the P. chabaudi AMA1 (PcAMA1) and P. chabaudi MSP142 (PcMSP142) vaccines only when the prechallenge antibody titers to both refolded and reduced/alkylated antigens were considered in combination. The relative importance of these two measures of vaccine-induced responses as predictors of protection differed somewhat for the PcAMA1 and the PcMSP142 vaccines, a finding confirmed in our final immunization and challenge study. A similar approach to the evaluation of vaccine-induced antibody responses may be useful during clinical trials of Plasmodium falciparum AMA1 and MSP142 vaccines. PMID:19116303
Brune, Karl D; Buldun, Can M; Li, Yuanyuan; Taylor, Iona J; Brod, Florian; Biswas, Sumi; Howarth, Mark
2017-05-17
Engineering modular platforms to control biomolecular architecture can advance both the understanding and the manipulation of biological systems. Icosahedral particles uniformly displaying single antigens stimulate potent immune activation and have been successful in various licensed vaccines. However, it remains challenging to display multiple antigens on a single particle and to induce broader immunity protective across strains or even against distinct diseases. Here, we design a dually addressable synthetic nanoparticle by engineering the multimerizing coiled-coil IMX313 and two orthogonally reactive split proteins. SpyCatcher protein forms an isopeptide bond with SpyTag peptide through spontaneous amidation. SnoopCatcher forms an isopeptide bond with SnoopTag peptide through transamidation. SpyCatcher-IMX-SnoopCatcher provides a modular platform, whereby SpyTag-antigen and SnoopTag-antigen can be multimerized on opposite faces of the particle simply upon mixing. We demonstrate efficient derivatization of the platform with model proteins and complex pathogen-derived antigens. SpyCatcher-IMX-SnoopCatcher was expressed in Escherichia coli and was resilient to lyophilization or extreme temperatures. For the next generation of malaria vaccines, blocking the transmission of the parasite from human to mosquito is an important goal. SpyCatcher-IMX-SnoopCatcher multimerization of the leading transmission-blocking antigens Pfs25 and Pfs28 greatly enhanced the antibody response to both antigens in comparison to the monomeric proteins. This dual plug-and-display architecture should help to accelerate vaccine development for malaria and other diseases.
Antigenic variability: Obstacles on the road to vaccines against traditionally difficult targets.
Servín-Blanco, R; Zamora-Alvarado, R; Gevorkian, G; Manoutcharian, K
2016-10-02
Despite the impressive impact of vaccines on public health, the success of vaccines targeting many important pathogens and cancers has to date been limited. The burden of infectious diseases today is mainly caused by antigenically variable pathogens (AVPs), which escape immune responses induced by prior infection or vaccination through changes in molecular structures recognized by antibodies or T cells. Extensive genetic and antigenic variability is the major obstacle for the development of new or improved vaccines against "difficult" targets. Alternative, qualitatively new approaches leading to the generation of disease- and patient-specific vaccine immunogens that incorporate complex permanently changing epitope landscapes of intended targets accompanied by appropriate immunomodulators are urgently needed. In this review, we highlight some of the most critical common issues related to the development of vaccines against many pathogens and cancers that escape protective immune responses owing to antigenic variation, and discuss recent efforts to overcome the obstacles by applying alternative approaches for the rational design of new types of immunogens.
1988-10-31
00 0 Cloning and Expression of Genes for Dengue Virus (Type-2 Encoded-Antigens for Rapid ODiagnosis and Vaccine DevelopmentN| ANNUAL PROGRESS REPORT...11. TITLE (include Security Classification) Cloning and Expression of Genes f or Dengue Virus Type 2 Fncoded Antigens for Rapid Diagnosis and Vaccine ...epidemics in Central and South Americas and the Caribbean is a cause of major concern. An effective vaccine is not available to protect individuals
Janowiak, Blythe E; Fischer, Audrey; Collier, R John
2010-03-12
Multimeric pores formed in the endosomal membrane by the Protective Antigen moiety of anthrax toxin translocate the enzymatic moieties of the toxin to the cytosolic compartment of mammalian cells. There is evidence that the side chains of the Phe(427) residues come into close proximity with one another in the lumen of the pore and form a structure, termed the Phe clamp, that catalyzes the translocation process. In this report we describe the effects of replacing Phe(427) in a single subunit of the predominantly heptameric pore with a basic or an acidic amino acid. Incorporating any charged residue at this position inhibited cytotoxicity >or=1,000-fold in our standard assay and caused strong inhibition of translocation in a planar phospholipid bilayer system. His and Glu were the most strongly inhibitory residues, ablating both cytotoxicity and translocation. Basic residues at position 427 prevented the Phe clamp from interacting with a translocation substrate to form a seal against the passage of ions and accelerated dissociation of the substrate from the pore. Acidic residues, in contrast, allowed the seal to form and the substrate to remain firmly bound, but blocked its passage, perhaps via electrostatic interactions with the positively charged N-terminal segment. Our findings are discussed in relation to the role of the Phe clamp in a Brownian ratchet model of translocation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fischer, N. O.
The goal of this proposal is to demonstrate that co-localization of protein subunit antigens and adjuvants on nanolipoprotein particles (NLPs) can increase the protective efficacy of recombinant subunit antigens from Burkholderia spp. and Francisella tularensis against an aerosol challenge. NLPs are are biocompatible, high-density lipoprotein mimetics that are amenable to the incorporation of multiple, chemically-disparate adjuvant and antigen molecules. We hypothesize that the ability to co-localize optimized adjuvant formulations with subunit antigens within a single particle will enhance the stimulation and activation of key immune effector cells, increasing the protective efficacy of subunit antigen-based vaccines. While Burkholderia spp. and F.more » tularensis subunit antigens are the focus of this proposal, we anticipate that this approach is applicable to a wide range of DOD-relevant biothreat agents. The F344 rat aerosol challenge model for F. tularensis has been successfully established at Battelle under this contract, and Year 3 efficacy studies performed at Battelle demonstrated that an NLP vaccine formulation was able to enhance survival of female F344 rats relative to naïve animals. In addition, Year 3 focused on the incorporation of multiple Burkholderia antigens (both polysaccharides and proteins) onto adjuvanted NLPs, with immunological analysis poised to begin in the next quarter.« less
Siragam, Vinayakumar; Brinc, Davor; Crow, Andrew R.; Song, Seng; Freedman, John; Lazarus, Alan H.
2005-01-01
Intravenous Ig (IVIg) mediates protection from the effects of immune thrombocytopenic purpura (ITP) as well as numerous other autoimmune states; however, the active antibodies within IVIg are unknown. There is some evidence that antibodies specific for a cell-associated antigen on erythrocytes are responsible, at least in part, for the therapeutic effect of IVIg in ITP. Yet whether an IVIg directed to a soluble antigen can likewise be beneficial in ITP or other autoimmune diseases is also unknown. A murine model of ITP was used to determine the effectiveness of IgG specific to soluble antigens in treating immune thrombocytopenic purpura. Mice experimentally treated with soluble OVA + anti-OVA versus mice treated with OVA conjugated to rbcs (OVA-rbcs) + anti-OVA were compared. In both situations, mice were protected from ITP. Both these experimental therapeutic regimes acted in a complement-independent fashion and both also blocked reticuloendothelial function. In contrast to OVA-rbcs + anti-OVA, soluble OVA + anti-OVA (as well as IVIg) did not have any effect on thrombocytopenia in mice lacking the inhibitory receptor FcγRIIB (FcγRIIB–/– mice). Similarly, antibodies reactive with the endogenous soluble antigens albumin and transferrin also ameliorated ITP in an FcγRIIB-dependent manner. Finally, broadening the significance of these experiments was the finding that anti-albumin was protective in a K/BxN serum–induced arthritis model. We conclude that IgG antibodies directed to soluble antigens ameliorated 2 disparate IVIg-treatable autoimmune diseases. PMID:15630455
Biomimetic Antigenic Nanoparticles Elicit Controlled Protective Immune Response to Influenza
Patterson, Dustin P.; Rynda-Apple, Agnieszka; Harmsen, Ann L.; Harmsen, Allen G.; Douglas, Trevor
2013-01-01
Here we present a biomimetic strategy towards nanoparticle design for controlled immune response through encapsulation of conserved internal influenza proteins on the interior of virus like particles (VLPs) to direct CD8+ cytotoxic T cell protection. Programmed encapsulation and sequestration of the conserved nucleoprotein (NP) from influenza on the interior of a VLP, derived from the bacteriophage P22, results in a vaccine that provides multi-strain protection against 100 times lethal doses of influenza in an NP specific CD8+ T cell-dependent manner. VLP assembly and encapsulation of the immunogenic NP cargo protein is the result of a genetically programmed self-assembly making this strategy amendable to the quick production of vaccines to rapidly emerging pathogens. Addition of adjuvants or targeting molecules were not required for eliciting the protective response. PMID:23540530
Novel Antigens for enterotoxigenic Escherichia coli (ETEC) Vaccines
Fleckenstein, James M.; Sheikh, Alaullah; Qadri, Firdausi
2014-01-01
Enterotoxigenic Escherichia coli (ETEC) are the most common bacterial pathogens-causing diarrhea in developing countries where they cause hundreds of thousands of deaths, mostly in children. These organisms are leading cause of diarrheal illness in travelers to endemic countries. ETEC pathogenesis, and consequently vaccine approaches, have largely focused on plasmid-encoded enterotoxins or fimbrial colonization factors. To date these approaches have not yielded a broadly protective vaccine. However, recent studies suggest that ETEC pathogenesis is more complex than previously appreciated and involves additional plasmid and chromosomally-encoded virulence molecules that can be targeted in vaccines. Here, we review recent novel antigen discovery efforts, potential contribution of these proteins to the molecular pathogenesis of ETEC and protective immunity, and the potential implications for development of next generation vaccines for important pathogens. These proteins may help to improve the effectiveness of future vaccines by making simpler and possibly broadly protective because of their conserved nature. PMID:24702311
Zhang, Jianfeng; Jex, Edward; Feng, Tsungwei; Sivko, Gloria S; Baillie, Leslie W; Goldman, Stanley; Van Kampen, Kent R; Tang, De-chu C
2013-01-01
Bacillus anthracis is the causative agent of anthrax, and its spores have been developed into lethal bioweapons. To mitigate an onslaught from airborne anthrax spores that are maliciously disseminated, it is of paramount importance to develop a rapid-response anthrax vaccine that can be mass administered by nonmedical personnel during a crisis. We report here that intranasal instillation of a nonreplicating adenovirus vector encoding B. anthracis protective antigen could confer rapid and sustained protection against inhalation anthrax in mice in a single-dose regimen in the presence of preexisting adenovirus immunity. The potency of the vaccine was greatly enhanced when codons of the antigen gene were optimized to match the tRNA pool found in human cells. In addition, an adenovirus vector encoding lethal factor can confer partial protection against inhalation anthrax and might be coadministered with a protective antigen-based vaccine.
Oscherwitz, Jon; Feldman, Daniel; Yu, Fen; Cease, Kemp B
2015-01-09
Anthrax represents a formidable bioterrorism threat for which new, optimized vaccines are required. We previously demonstrated that epitope-focused multiple antigenic peptides or a recombinant protein in Freund's adjuvant can elicit Ab against the loop neutralizing determinant (LND), a cryptic linear neutralizing epitope in the 2ß2-2ß3 loop of protective antigen from Bacillus anthracis, which mediated protection of rabbits from inhalation challenge with B. anthracis Ames strain. However, demonstration of efficacy using human-use adjuvants is required before proceeding with further development of an LND vaccine for testing in non-human primates and humans. To optimize the LND immunogen, we first evaluated the protective efficacy and immune correlates associated with immunization of rabbits with mixtures containing two molecular variants of multiple antigenic peptides in Freunds adjuvant, termed BT-LND(2) and TB-LND(2). TB-LND(2) was then further evaluated for protective efficacy in rabbits employing human-use adjuvants. Immunization of rabbits with TB-LND(2) in human-use adjuvants elicited protection from Ames strain spore challenge which was statistically indistinguishable from that elicited through immunization with protective antigen. All TB-LND(2) rabbits with any detectable serum neutralization prior to challenge were protected from aerosolized spore exposure. Remarkably, rabbits immunized with TB-LND(2) in Alhydrogel/CpG had significant anamnestic increases in post-challenge LND-specific Ab and neutralization titers despite little evidence of spore germination in these rabbits. An LND-specific epitope-focused vaccine may complement PA-based vaccines and may represent a complementary stand-alone vaccine for anthrax. Copyright © 2014 Elsevier Ltd. All rights reserved.
Memory T cells maintain protracted protection against malaria.
Krzych, Urszula; Zarling, Stasya; Pichugin, Alexander
2014-10-01
Immunologic memory is one of the cardinal features of antigen-specific immune responses, and the persistence of memory cells contributes to prophylactic immunizations against infectious agents. Adequately maintained memory T and B cell pools assure a fast, effective and specific response against re-infections. However, many aspects of immunologic memory are still poorly understood, particularly immunologic memory inducible by parasites, for example, Plasmodium spp., the causative agents of malaria. For example, memory responses to Plasmodium antigens amongst residents of malaria endemic areas appear to be either inadequately developed or maintained, because persons who survive episodes of childhood malaria remain vulnerable to intermittent malaria infections. By contrast, multiple exposures of humans and laboratory rodents to radiation-attenuated Plasmodium sporozoites (γ-spz) induce sterile and long-lasting protection against experimental sporozoite challenge. Multifactorial immune mechanisms maintain this protracted and sterile protection. While the presence of memory CD4 T cell subsets has been associated with lasting protection in humans exposed to multiple bites from Anopheles mosquitoes infected with attenuated Plasmodium falciparum, memory CD8 T cells maintain protection induced with Plasmodium yoelii and Plasmodium berghei γ-spz in murine models. In this review, we discuss our observations that show memory CD8 T cells specific for antigens expressed by P. berghei liver stage parasites as an indispensable component for the maintenance of protracted protective immunity against experimental malaria infection; moreover, the provision of an Ag-depot assures a quick recall of memory T cells as IFN-γ-producing effector CD8 T cells and IL-4- producing CD4 T cells that collaborate with B cells for an effective antibody response. Published by Elsevier B.V.
Wagner, Leslie; Verma, Anita; Meade, Bruce D.; Reiter, Karine; Narum, David L.; Brady, Rebecca A.; Little, Stephen F.
2012-01-01
New anthrax vaccines currently under development are based on recombinant protective antigen (rPA) and formulated with aluminum adjuvant. Because long-term stability is a desired characteristic of these vaccines, an understanding of the effects of adsorption to aluminum adjuvants on the structure of rPA is important. Using both biophysical and immunological techniques, we compared the structure and immunogenicity of freshly prepared rPA-Alhydrogel formulations to that of formulations stored for 3 weeks at either room temperature or 37°C in order to assess the changes in rPA structure that might occur upon long-term storage on aluminum adjuvant. Intrinsic fluorescence emission spectra of tryptophan residues indicated that some tertiary structure alterations of rPA occurred during storage on Alhydrogel. Using anti-PA monoclonal antibodies to probe specific regions of the adsorbed rPA molecule, we found that two monoclonal antibodies that recognize epitopes located in domain 1 of PA exhibited greater reactivity to the stored formulations than to freshly prepared formulations. Immunogenicity of rPA-Alhydrogel formulations in mice was assessed by measuring the induction of toxin-neutralizing antibodies, as well as antibodies reactive to 12-mer peptides spanning the length of PA. Mice immunized with freshly prepared formulations developed significantly higher toxin-neutralizing antibody titers than mice immunized with the stored preparations. In contrast, sera from mice immunized with stored preparations exhibited increased reactivity to nine 12-mer peptides corresponding to sequences located throughout the rPA molecule. These results demonstrate that storage of rPA-Alhydrogel formulations can lead to structural alteration of the protein and loss of the ability to elicit toxin-neutralizing antibodies. PMID:22815152
Magini, Diletta; Giovani, Cinzia; Mangiavacchi, Simona; Maccari, Silvia; Cecchi, Raffaella; Ulmer, Jeffrey B.; De Gregorio, Ennio; Geall, Andrew J.; Brazzoli, Michela; Bertholet, Sylvie
2016-01-01
Current hemagglutinin (HA)-based seasonal influenza vaccines induce vaccine strain-specific neutralizing antibodies that usually fail to provide protection against mismatched circulating viruses. Inclusion in the vaccine of highly conserved internal proteins such as the nucleoprotein (NP) and the matrix protein 1 (M1) was shown previously to increase vaccine efficacy by eliciting cross-reactive T-cells. However, appropriate delivery systems are required for efficient priming of T-cell responses. In this study, we demonstrated that administration of novel self-amplifying mRNA (SAM®) vectors expressing influenza NP (SAM(NP)), M1 (SAM(M1)), and NP and M1 (SAM(M1-NP)) delivered with lipid nanoparticles (LNP) induced robust polyfunctional CD4 T helper 1 cells, while NP-containing SAM also induced cytotoxic CD8 T cells. Robust expansions of central memory (TCM) and effector memory (TEM) CD4 and CD8 T cells were also measured. An enhanced recruitment of NP-specific cytotoxic CD8 T cells was observed in the lungs of SAM(NP)-immunized mice after influenza infection that paralleled with reduced lung viral titers and pathology, and increased survival after homologous and heterosubtypic influenza challenge. Finally, we demonstrated for the first time that the co-administration of RNA (SAM(M1-NP)) and protein (monovalent inactivated influenza vaccine (MIIV)) was feasible, induced simultaneously NP-, M1- and HA-specific T cells and HA-specific neutralizing antibodies, and enhanced MIIV efficacy against a heterologous challenge. In conclusion, systemic administration of SAM vectors expressing conserved internal influenza antigens induced protective immune responses in mice, supporting the SAM® platform as another promising strategy for the development of broad-spectrum universal influenza vaccines. PMID:27525409
Hance, Kenneth W.; Zeytin, Hasan E.; Greiner, John W.
2010-01-01
In recent years, investigators have carried out several studies designed to evaluate whether human tumor-associated antigens might be exploited as targets for active specific immunotherapy, specifically human cancer vaccines. Not too long ago such an approach would have been met with considerable skepticism because the immune system was believed to be a rigid discriminator between self and non-self which, in turn, protected the host from a variety of pathogens. That viewpoint has been challenged in recent years by a series of studies indicating that antigenic determinants of self have not induced absolute host immune tolerance. Moreover, under specific conditions that evoke danger signals, peptides from self-antigen can be processed by the antigen-presenting cellular machinery, loaded onto the major histocompatibility antigen groove to serve as targets for immune intervention. Those findings provide the rationale to investigate a wide range of tumor-associated antigens, including differentiation antigens, oncogenes, and tumor suppressor genes as possible immune-based targets. One of those tumor-associated antigens is the carcinoembryonic antigen (CEA). Described almost 40 years ago, CEA is a Mr 180–200,000 oncofetal antigen that is one of the more widely studied human tumor-associated antigens. This review will provide: (i) a brief overview of the CEA gene family, (ii) a summary of early preclinical findings on overcoming immune tolerance to CEA, and (iii) the rationale to develop mouse models which spontaneously develop gastrointestinal tumors and express the CEA transgene. Those models have been used extensively in the study of overcoming host immune tolerance to CEA, a self, tumor-associated antigen, and the experimental findings have served as the rationale for the design of early clinical trials to evaluate CEA-based cancer vaccines. PMID:15888344
USDA-ARS?s Scientific Manuscript database
Anaplasma marginale is a tick-borne rickettsial pathogen of cattle with a worldwide distribution. Currently a safe and efficacious vaccine is unavailable. Outer membrane protein (OMP) extracts or a well- defined surface protein complex reproducibly induce protective immunity. However, there are seve...
Moyle, Peter Michael
Traditional vaccination approaches (e.g. live attenuated or killed microorganisms) are among the most effective means to prevent the spread of infectious diseases. These approaches, nevertheless, have failed to yield successful vaccines against many important pathogens. To overcome this problem, methods have been developed to identify microbial components, against which protective immune responses can be elicited. Subunit antigens identified by these approaches enable the production of defined vaccines, with improved safety profiles. However, they are generally poorly immunogenic, necessitating their administration with potent immunostimulatory adjuvants. Since few safe and effective adjuvants are currently used in vaccines approved for human use, with those available displaying poor potency, or an inability to stimulate the types of immune responses required for vaccines against specific diseases (e.g. cytotoxic lymphocytes (CTLs) to treat cancers), the development of new vaccines will be aided by the availability of characterized platforms of new adjuvants, improving our capacity to rationally select adjuvants for different applications. One such approach, involves the addition of microbial components (pathogen-associated molecular patterns; PAMPs), that can stimulate strong immune responses, into subunit vaccine formulations. The conjugation of PAMPs to subunit antigens provides a means to greatly increase vaccine potency, by targeting immunostimulation and antigen to the same antigen presenting cell. Thus, methods that enable the efficient, and inexpensive production of antigen-adjuvant fusions represent an exciting mean to improve immunity towards subunit antigens. Herein we review four protein-based adjuvants (flagellin, bacterial lipoproteins, the extra domain A of fibronectin (EDA), and heat shock proteins (Hsps)), which can be genetically fused to antigens to enable recombinant production of antigen-adjuvant fusion proteins, with a focus on their
[Difference in target antigens between central tolerance and peripheral tolerance deficiencies].
Chida, Natsuko; Kobayashi, Ichiro
2015-01-01
Failure of the immunotolerance mechanisms causes multiple organ-specific autoimmune disorders. Mutations of autoimmune regulator (AIRE) gene result in central immunotolerance deficiency named autoimmune polyendocrinopathy, candidiasis, ectodermal dystrophy (APECED). Mutations of FOXP3 genes cause regulatory T cell (Treg) deficiency named immune dysregulation, polyendocrinopathy, enteropathy, X-linked (IPEX) syndrome. Because T cell tolerance influences B cell tolerance, autoantibodies seem to reflect the presence of autoreactive T cells with the same antigen specificity. To date many differences in both clinical features and autoantibody profiles have been described between APECED and IPEX syndrome. In addition to the differences in target organs, we have found differences in the target antigens in the same organ, small intestine, between both disorders; anti-autoimmune enteropathy-related 75 kDa antigen (AIE-75) antibodies are specific to IPEX syndrome, whereas anti-tryptophan hydroxylase-1 (TPH-1) antibodies are specific to APECED. These facts suggest that immunotolerance to AIE-75 depends on the Treg, whereas the tolerance to TPH-1 depends on the central mechanisms. Furthermore, given the earlier onset and more serious clinical features of IPEX syndrome than APECED, physiological roles of Aire on the selection of Treg may be, if present, limited.
Memory Th1 Cells Are Protective in Invasive Staphylococcus aureus Infection
Lalor, Stephen J.; Leech, John M.; O’Keeffe, Kate M.; Mac Aogáin, Micheál; O’Halloran, Dara P.; Lacey, Keenan A.; Tavakol, Mehri; Hearnden, Claire H.; Fitzgerald-Hughes, Deirdre; Humphreys, Hilary; Fennell, Jérôme P.; van Wamel, Willem J.; Foster, Timothy J.; Geoghegan, Joan A.; Lavelle, Ed C.; Rogers, Thomas R.; McLoughlin, Rachel M.
2015-01-01
Mechanisms of protective immunity to Staphylococcus aureus infection in humans remain elusive. While the importance of cellular immunity has been shown in mice, T cell responses in humans have not been characterised. Using a murine model of recurrent S. aureus peritonitis, we demonstrated that prior exposure to S. aureus enhanced IFNγ responses upon subsequent infection, while adoptive transfer of S. aureus antigen-specific Th1 cells was protective in naïve mice. Translating these findings, we found that S. aureus antigen-specific Th1 cells were also significantly expanded during human S. aureus bloodstream infection (BSI). These Th1 cells were CD45RO+, indicative of a memory phenotype. Thus, exposure to S. aureus induces memory Th1 cells in mice and humans, identifying Th1 cells as potential S. aureus vaccine targets. Consequently, we developed a model vaccine comprising staphylococcal clumping factor A, which we demonstrate to be an effective human T cell antigen, combined with the Th1-driving adjuvant CpG. This novel Th1-inducing vaccine conferred significant protection during S. aureus infection in mice. This study notably advances our understanding of S. aureus cellular immunity, and demonstrates for the first time that a correlate of S. aureus protective immunity identified in mice may be relevant in humans. PMID:26539822
Cruz-Adalia, Aránzazu; Ramirez-Santiago, Guillermo; Osuna-Pérez, Jesús; Torres-Torresano, Mónica; Zorita, Virgina; Martínez-Riaño, Ana; Boccasavia, Viola; Borroto, Aldo; Martínez Del Hoyo, Gloria; González-Granado, José María; Alarcón, Balbino; Sánchez-Madrid, Francisco; Veiga, Esteban
2017-11-17
Bacterial phagocytosis and antigen cross-presentation to activate CD8 + T cells are principal functions of professional antigen presenting cells. However, conventional CD4 + T cells also capture and kill bacteria from infected dendritic cells in a process termed transphagocytosis (also known as transinfection). Here, we show that transphagocytic T cells present bacterial antigens to naive CD8 + T cells, which proliferate and become cytotoxic in response. CD4 + T-cell-mediated antigen presentation also occurs in vivo in the course of infection, and induces the generation of central memory CD8 + T cells with low PD-1 expression. Moreover, transphagocytic CD4 + T cells induce protective anti-tumour immune responses by priming CD8 + T cells, highlighting the potential of CD4 + T cells as a tool for cancer immunotherapy.
Linzer, R; Mukasa, H; Slade, H D
1975-10-01
The polysaccharide antigen preparations from serotype a and serotype d strains of Streptococcus mutans contained both a serotype-specific antigenic determinant and a common a-d antigenic determinant, as demonstrated by agar gel diffusion studies and a quantitative cross-precipitin assay. The chromatographically purified antigens were isolated by a method which depended on their serological specificity to determine if these two antigenic determinants were located on the same molecule. The a and d polysaccharides were recovered from specific antigen-antibody complexes and characterized with respect to their immunological specificity and chemical composition. Agar gel diffusion tests demonstrated that, in both the a and d preparations, the serotype-specific antigenic determinant and the common a-d antigenic determinant were present in one molecule.
Hess, Jessica A; Zhan, Bin; Torigian, April R; Patton, John B; Petrovsky, Nikolai; Zhan, Tingting; Bottazzi, Maria Elena; Hotez, Peter J; Klei, Thomas R; Lustigman, Sara; Abraham, David
2016-07-01
In some regions in Africa, elimination of onchocerciasis may be possible with mass drug administration, although there is concern based on several factors that onchocerciasis cannot be eliminated solely through this approach. A vaccine against Onchocerca volvulus would provide a critical tool for the ultimate elimination of this infection. Previous studies have demonstrated that immunization of mice with Ov-103 and Ov-RAL-2, when formulated with alum, induced protective immunity. It was hypothesized that the levels of protective immunity induced with the two recombinant antigens formulated with alum would be improved by formulation with other adjuvants known to enhance different types of antigen-specific immune responses. Immunizing mice with Ov-103 and Ov-RAL-2 in conjunction with alum, Advax 2 and MF59 induced significant levels of larval killing and host protection. The immune response was biased towards Th2 with all three of the adjuvants, with IgG1 the dominant antibody. Improved larval killing and host protection was observed in mice immunized with co-administered Ov-103 and Ov-RAL-2 in conjunction with each of the three adjuvants as compared to single immunizations. Antigen-specific antibody titers were significantly increased in mice immunized concurrently with the two antigens. Based on chemokine levels, it appears that neutrophils and eosinophils participate in the protective immune response induced by Ov-103, and macrophages and neutrophils participate in immunity induced by Ov-RAL-2. The mechanism of protective immunity induced by Ov-103 and Ov-RAL-2, with the adjuvants alum, Advax 2 and MF59, appears to be multifactorial with roles for cytokines, chemokines, antibody and specific effector cells. The vaccines developed in this study have the potential of reducing the morbidity associated with onchocerciasis in humans.
Shang, Shaobin; Siddiqui, Sarah; Bian, Yao; Zhao, Jie; Wang, Chyung-Ru
2016-01-01
MHC Ib-restricted CD8+ T cells have been implicated in host defense against Mycobacterium tuberculosis (Mtb) infection. However, the relative contribution of various MHC Ib-restricted T cell populations to anti-mycobacterial immunity remains elusive. In this study, we used mice that lack MHC Ia (Kb-/-Db-/-), MHC Ia/H2-M3 (Kb-/-Db-/-M3-/-), or β2m (β2m-/-) to study the role of M3-restricted and other MHC Ib-restricted T cells in immunity against Mtb. Unlike their dominant role in Listeria infection, we found that M3-restricted CD8+ T cells only represented a small proportion of the CD8+ T cells responding to Mtb infection. Non-M3, MHC Ib-restricted CD8+ T cells expanded preferentially in the lungs of Mtb-infected Kb-/-Db-/-M3-/- mice, exhibited polyfunctional capacities and conferred protection against Mtb. These MHC Ib-restricted CD8+ T cells recognized several Mtb-derived protein antigens at a higher frequency than MHC Ia-restricted CD8+ T cells. The presentation of Mtb antigens to MHC Ib-restricted CD8+ T cells was mostly β2m-dependent but TAP-independent. Interestingly, a large proportion of Mtb-specific MHC Ib-restricted CD8+ T cells in Kb-/-Db-/-M3-/- mice were Qa-2-restricted while no considerable numbers of MR1 or CD1-restricted Mtb-specific CD8+ T cells were detected. Our findings indicate that nonclassical CD8+ T cells other than the known M3, CD1, and MR1-restricted CD8+ T cells contribute to host immune responses against Mtb infection. Targeting these MHC Ib-restricted CD8+ T cells would facilitate the design of better Mtb vaccines with broader coverage across MHC haplotypes due to the limited polymorphism of MHC class Ib molecules. PMID:27272249
Jex, Edward; Feng, Tsungwei; Sivko, Gloria S.; Baillie, Leslie W.; Goldman, Stanley; Van Kampen, Kent R.; Tang, De-chu C.
2013-01-01
Bacillus anthracis is the causative agent of anthrax, and its spores have been developed into lethal bioweapons. To mitigate an onslaught from airborne anthrax spores that are maliciously disseminated, it is of paramount importance to develop a rapid-response anthrax vaccine that can be mass administered by nonmedical personnel during a crisis. We report here that intranasal instillation of a nonreplicating adenovirus vector encoding B. anthracis protective antigen could confer rapid and sustained protection against inhalation anthrax in mice in a single-dose regimen in the presence of preexisting adenovirus immunity. The potency of the vaccine was greatly enhanced when codons of the antigen gene were optimized to match the tRNA pool found in human cells. In addition, an adenovirus vector encoding lethal factor can confer partial protection against inhalation anthrax and might be coadministered with a protective antigen-based vaccine. PMID:23100479
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ford, Nicole R.; Hecht, Karen A.; Hu, Dehong
2016-01-08
The diatom Thalassiosira pseudonana was genetically modified to express biosilica-targeted fusion proteins incorporating a tetracysteine tag for site-directed labeling with biarsenical affinity probes and either EGFP or single chain antibody to test colocalization of probes with the EGFP-tagged recombinant protein or binding of biosilica-immobilized antibodies to large and small molecule antigens, respectively. Site-directed labeling with the biarsenical probes demonstrated colocalization with EGFP-encoded proteins in nascent and mature biosilica, supporting their use in studying biosilica maturation. Isolated biosilica transformed with a single chain antibody against either the Bacillus anthracis surface layer protein EA1 or small molecule explosive trinitrotoluene (TNT) effectively boundmore » the respective antigens. A marked increase in fluorescence lifetime of the TNT surrogate Alexa Fluor 555-trinitrobenzene reflected the high binding specificity of the transformed isolated biosilica. These results demonstrated the potential use of biosilica-immobilized single chain antibodies as binders for large and small molecule antigens in sensing and therapeutics.« less
Chabot, Donald J; Ribot, Wilson J; Joyce, Joseph; Cook, James; Hepler, Robert; Nahas, Debbie; Chua, Jennifer; Friedlander, Arthur M
2016-07-25
The efficacy of currently licensed anthrax vaccines is largely attributable to a single Bacillus anthracis immunogen, protective antigen. To broaden protection against possible strains resistant to protective antigen-based vaccines, we previously developed a vaccine in which the anthrax polyglutamic acid capsule was covalently conjugated to the outer membrane protein complex of Neisseria meningitidis serotype B and demonstrated that two doses of 2.5μg of this vaccine conferred partial protection of rhesus macaques against inhalational anthrax . Here, we demonstrate complete protection of rhesus macaques against inhalational anthrax with a higher 50μg dose of the same capsule conjugate vaccine. These results indicate that B. anthracis capsule is a highly effective vaccine component that should be considered for incorporation in future generation anthrax vaccines. Published by Elsevier Ltd.
Bassi, Maria R; Larsen, Mads A B; Kongsgaard, Michael; Rasmussen, Michael; Buus, Søren; Stryhn, Anette; Thomsen, Allan R; Christensen, Jan P
2016-02-01
The live attenuated yellow fever vaccine (YF-17D) has been successfully used for more than 70 years. It is generally considered a safe vaccine, however, recent reports of serious adverse events following vaccination have raised concerns and led to suggestions that even safer YF vaccines should be developed. Replication deficient adenoviruses (Ad) have been widely evaluated as recombinant vectors, particularly in the context of prophylactic vaccination against viral infections in which induction of CD8+ T-cell mediated immunity is crucial, but potent antibody responses may also be elicited using these vectors. In this study, we present two adenobased vectors targeting non-structural and structural YF antigens and characterize their immunological properties. We report that a single immunization with an Ad-vector encoding the non-structural protein 3 from YF-17D could elicit a strong CD8+ T-cell response, which afforded a high degree of protection from subsequent intracranial challenge of vaccinated mice. However, full protection was only observed using a vector encoding the structural proteins from YF-17D. This vector elicited virus-specific CD8+ T cells as well as neutralizing antibodies, and both components were shown to be important for protection thus mimicking the situation recently uncovered in YF-17D vaccinated mice. Considering that Ad-vectors are very safe, easy to produce and highly immunogenic in humans, our data indicate that a replication deficient adenovector-based YF vaccine may represent a safe and efficient alternative to the classical live attenuated YF vaccine and should be further tested.
EFFECT OF X-IRRADIATION ON THE CELLULAR AND HUMORAL RESPONSES TO ANTIGEN
DOE Office of Scientific and Technical Information (OSTI.GOV)
Speirs, R.S.
1962-01-01
Mice were immunized by 6 subcutaneous injections of tetanus toxoid before exposure to 500 r x radiation. At various times after irradiation the animals were challenged with intraperitoneal injections of tetanus toxoid and serum antibody titers were determined. Results indicate that the time of irradiation in relation to antigen injection greatly influences the cellular response as well as antibody production. High radiation doses prior to antigen injection reduce the number of cells capable of responding and also inhibit the production of antibody. As the animals recovered from the effects of irradiation the production of antibody appeared to reflect the capacitymore » of the eosinophils to respond. It was concluded that eosinophils play an intermediate role in the cellular everts that lead to the production of antibody. (C.H.)« less
Kong, Wei; Wanda, Soo-Young; Zhang, Xin; Bollen, Wendy; Tinge, Steven A; Roland, Kenneth L; Curtiss, Roy
2008-07-08
We have devised and constructed a biological containment system designed to cause programmed bacterial cell lysis with no survivors. We have validated this system, using Salmonella enterica serovar Typhimurium vaccines for antigen delivery after colonization of host lymphoid tissues. The system is composed of two parts. The first component is Salmonella typhimurium strain chi8937, with deletions of asdA and arabinose-regulated expression of murA, two genes required for peptidoglycan synthesis and additional mutations to enhance complete lysis and antigen delivery. The second component is plasmid pYA3681, which encodes arabinose-regulated murA and asdA expression and C2-regulated synthesis of antisense asdA and murA mRNA transcribed from the P22 P(R) promoter. An arabinose-regulated c2 gene is present in the chromosome. chi8937(pYA3681) exhibits arabinose-dependent growth. Upon invasion of host tissues, an arabinose-free environment, transcription of asdA, murA, and c2 ceases, and concentrations of their gene products decrease because of cell division. The drop in C2 concentration results in activation of P(R), driving synthesis of antisense mRNA to block translation of any residual asdA and murA mRNA. A highly antigenic alpha-helical domain of Streptococcus pneumoniae Rx1 PspA was cloned into pYA3681, resulting in pYA3685 to test antigen delivery. Mice orally immunized with chi8937(pYA3685) developed antibody responses to PspA and Salmonella outer membrane proteins. No viable vaccine strain cells were detected in host tissues after 21 days. This system has potential applications with other Gram-negative bacteria in which biological containment would be desirable.
Kong, Wei; Wanda, Soo-Young; Zhang, Xin; Bollen, Wendy; Tinge, Steven A.; Roland, Kenneth L.; Curtiss, Roy
2008-01-01
We have devised and constructed a biological containment system designed to cause programmed bacterial cell lysis with no survivors. We have validated this system, using Salmonella enterica serovar Typhimurium vaccines for antigen delivery after colonization of host lymphoid tissues. The system is composed of two parts. The first component is Salmonella typhimurium strain χ8937, with deletions of asdA and arabinose-regulated expression of murA, two genes required for peptidoglycan synthesis and additional mutations to enhance complete lysis and antigen delivery. The second component is plasmid pYA3681, which encodes arabinose-regulated murA and asdA expression and C2-regulated synthesis of antisense asdA and murA mRNA transcribed from the P22 PR promoter. An arabinose-regulated c2 gene is present in the chromosome. χ8937(pYA3681) exhibits arabinose-dependent growth. Upon invasion of host tissues, an arabinose-free environment, transcription of asdA, murA, and c2 ceases, and concentrations of their gene products decrease because of cell division. The drop in C2 concentration results in activation of PR, driving synthesis of antisense mRNA to block translation of any residual asdA and murA mRNA. A highly antigenic α-helical domain of Streptococcus pneumoniae Rx1 PspA was cloned into pYA3681, resulting in pYA3685 to test antigen delivery. Mice orally immunized with χ8937(pYA3685) developed antibody responses to PspA and Salmonella outer membrane proteins. No viable vaccine strain cells were detected in host tissues after 21 days. This system has potential applications with other Gram-negative bacteria in which biological containment would be desirable. PMID:18607005
Clapp, Tanya; Munks, Michael W; Trivedi, Ruchit; Kompella, Uday B; Braun, LaToya Jones
2014-06-24
Preventing losses in vaccine potency due to accidental freezing has recently become a topic of interest for improving vaccines. All vaccines with aluminum-containing adjuvants are susceptible to such potency losses. Recent studies have described excipients that protect the antigen from freeze-induced inactivation, prevent adjuvant agglomeration and retain potency. Although these strategies have demonstrated success, they do not provide a mechanistic understanding of freeze-thaw (FT) induced potency losses. In the current study, we investigated how adjuvant frozen in the absence of antigen affects vaccine immunogenicity and whether preventing damage to the freeze-sensitive recombinant hepatitis B surface antigen (rHBsAg) was sufficient for maintaining vaccine potency. The final vaccine formulation or Alhydrogel(®) alone was subjected to three FT-cycles. The vaccines were characterized for antigen adsorption, rHBsAg tertiary structure, particle size and charge, adjuvant elemental content and in-vivo potency. Particle agglomeration of either vaccine particles or adjuvant was observed following FT-stress. In vivo studies demonstrated no statistical differences in IgG responses between vaccines with FT-stressed adjuvant and no adjuvant. Adsorption of rHBsAg was achieved; regardless of adjuvant treatment, suggesting that the similar responses were not due to soluble antigen in the frozen adjuvant-containing formulations. All vaccines with adjuvant, including the non-frozen controls, yielded similar, blue-shifted fluorescence emission spectra. Immune response differences could not be traced to differences in the tertiary structure of the antigen in the formulations. Zeta potential measurements and elemental content analyses suggest that FT-stress resulted in a significant chemical alteration of the adjuvant surface. This data provides evidence that protecting a freeze-labile antigen from subzero exposure is insufficient to maintain vaccine potency. Future studies should
Antigenic evaluation of a recombinant baculovirus-expressed Sarcocystis neurona SAG1 antigen.
Gupta, G D; Lakritz, J; Saville, W J; Livingston, R S; Dubey, J P; Middleton, J R; Marsh, A E
2004-10-01
Sarcocystis neurona is the primary parasite associated with equine protozoal myeloencephalitis (EPM). This is a commonly diagnosed neurological disorder in the Americas that infects the central nervous system of horses. Current serologic assays utilize culture-derived parasites as antigen. This method requires large numbers of parasites to be grown in culture, which is labor intensive and time consuming. Also, a culture-derived whole-parasite preparation contains conserved antigens that could cross-react with antibodies against other Sarcocystis species and members of Sarcocystidae such as Neospora spp., Hammondia spp., and Toxoplasma gondii. Therefore, there is a need to develop an improved method for the detection of S. neurona-specific antibodies. The sera of infected horses react strongly to surface antigen 1 (SnSAG1), an approximately 29-kDa protein, in immunoblot analysis, suggesting that it is an immunodominant antigen. The SnSAG1 gene of S. neurona was cloned, and recombinant S. neurona SAG1 protein (rSnSAG1-Bac) was expressed with the use of a baculovirus system. By immunoblot analysis, the rSnSAG1-Bac antigen detected antibodies to S. neurona from naturally infected and experimentally inoculated equids, cats, rabbit, mice, and skunk. This is the first report of a baculovirus-expressed recombinant S. neurona antigen being used to detect anti-S. neurona antibodies in a variety of host species.
Teutschbein, Janka; Simon, Svenja; Lother, Jasmin; Springer, Jan; Hortschansky, Peter; Morton, C Oliver; Löffler, Jürgen; Einsele, Hermann; Conneally, Eibhlin; Rogers, Thomas R; Guthke, Reinhard; Brakhage, Axel A; Kniemeyer, Olaf
2016-05-06
Aspergillus fumigatus is the species that most commonly causes the opportunistic infection invasive aspergillosis (IA) in patients being treated for hematological malignancies. Little is known about the A. fumigatus proteins that trigger the production of Aspergillus-specific IgG antibodies during the course of IA. To characterize the serological response to A. fumigatus protein antigens, mycelial proteins were separated by 2-D gel electrophoresis. The gels were immunoblotted with sera from patients with probable and proven IA and control patients without IA. We identified 49 different fungal proteins, which gave a positive IgG antibody signal. Most of these antigens play a role in primary metabolism and stress responses. Overall, our analysis identified 18 novel protein antigens from A. fumigatus. To determine whether these antigens can be used as diagnostic or prognostic markers or exhibit a protective activity, we employed supervised machine learning with decision trees. We identified two candidates for further analysis, the protein antigens CpcB and Shm2. Heterologously produced Shm2 induced a strongly proinflammatory response in human peripheral blood mononuclear cells after in vitro stimulation. In contrast, CpcB did not activate the immune response of PBMCs. These findings could serve as the basis for the development of an immunotherapy of IA.
Kaever, Thomas; Matho, Michael H; Meng, Xiangzhi; Crickard, Lindsay; Schlossman, Andrew; Xiang, Yan; Crotty, Shane; Peters, Bjoern; Zajonc, Dirk M
2016-05-01
Vaccinia virus (VACV) A27 is a target for viral neutralization and part of the Dryvax smallpox vaccine. A27 is one of the three glycosaminoglycan (GAG) adhesion molecules and binds to heparan sulfate. To understand the function of anti-A27 antibodies, especially their protective capacity and their interaction with A27, we generated and subsequently characterized 7 murine monoclonal antibodies (MAbs), which fell into 4 distinct epitope groups (groups I to IV). The MAbs in three groups (groups I, III, and IV) bound to linear peptides, while the MAbs in group II bound only to VACV lysate and recombinant A27, suggesting that they recognized a conformational and discontinuous epitope. Only group I antibodies neutralized the mature virion in a complement-dependent manner and protected against VACV challenge, while a group II MAb partially protected against VACV challenge but did not neutralize the mature virion. The epitope for group I MAbs was mapped to a region adjacent to the GAG binding site, a finding which suggests that group I MAbs could potentially interfere with the cellular adhesion of A27. We further determined the crystal structure of the neutralizing group I MAb 1G6, as well as the nonneutralizing group IV MAb 8E3, bound to the corresponding linear epitope-containing peptides. Both the light and the heavy chains of the antibodies are important in binding to their antigens. For both antibodies, the L1 loop seems to dominate the overall polar interactions with the antigen, while for MAb 8E3, the light chain generally appears to make more contacts with the antigen. Vaccinia virus is a powerful model to study antibody responses upon vaccination, since its use as the smallpox vaccine led to the eradication of one of the world's greatest killers. The immunodominant antigens that elicit the protective antibodies are known, yet for many of these antigens, little information about their precise interaction with antibodies is available. In an attempt to better
Expression of Histophilus somni IbpA DR2 protective antigen in the diatom Thalassiosira pseudonana.
Davis, Aubrey; Crum, Lauren T; Corbeil, Lynette B; Hildebrand, Mark
2017-07-01
Increasing demand for the low-cost production of valuable proteins has stimulated development of novel expression systems. Many challenges faced by existing technology may be overcome by using unicellular microalgae as an expression platform due to their ability to be cultivated rapidly, inexpensively, and in large scale. Diatoms are a particularly productive type of unicellular algae showing promise as production organisms. Here, we report the development of an expression system in the diatom Thalassiosira pseudonana by expressing the protective IbpA DR2 antigen from Histophilus somni for the production of a vaccine against bovine respiratory disease. The utilization of diatoms with their typically silicified cell walls permitted development of silicon-responsive transcription elements to induce protein expression. Specifically, we demonstrate that transcription elements from the silicon transporter gene SIT1 are sufficient to drive high levels of IbpA DR2 expression during silicon limitation and growth arrest. These culture conditions eliminate the flux of cellular resources into cell division processes, yet do not limit protein expression. In addition to improving protein expression levels by molecular manipulations, yield was dramatically increased through cultivation enhancement including elevated light and CO 2 supplementation. We substantially increased recombinant protein production over starting levels to 1.2% of the total sodium dodecyl sulfate-extractable protein in T. pseudonana, which was sufficient to conduct preliminary immunization trials in mice. Mice exposed to 5 μg of diatom-expressed DR2 in whole or sonicated cells (without protein purification) exhibited a modest immune response without the addition of adjuvant.
A dual purpose universal influenza vaccine candidate confers protective immunity against anthrax.
Arévalo, Maria T; Li, Junwei; Diaz-Arévalo, Diana; Chen, Yanping; Navarro, Ashley; Wu, Lihong; Yan, Yongyong; Zeng, Mingtao
2017-03-01
Preventive influenza vaccines must be reformulated annually because of antigen shift and drift of circulating influenza viral strains. However, seasonal vaccines do not always match the circulating strains, and there is the ever-present threat that avian influenza viruses may adapt to humans. Hence, a universal influenza vaccine is needed to provide protective immunity against a broad range of influenza viruses. We designed an influenza antigen consisting of three tandem M2e repeats plus HA2, in combination with a detoxified anthrax oedema toxin delivery system (EFn plus PA) to enhance immune responses. The EFn-3×M2e-HA2 plus PA vaccine formulation elicited robust, antigen-specific, IgG responses; and was protective against heterologous influenza viral challenge when intranasally delivered to mice three times. Moreover, use of the detoxified anthrax toxin system as an adjuvant had the additional benefit of generating protective immunity against anthrax. Hence, this novel vaccine strategy could potentially address two major emerging public health and biodefence threats. © 2016 John Wiley & Sons Ltd.
1981-01-01
A highly specific and reproducible antigen-induced, antigen-specific culture and assay system for antibody production by human peripheral blood B lymphocytes has been developed. The system is clearly T cell and monocyte dependent and is independent of exogenous mitogens. The major factors in our ability to trigger specific antibody production with antigen alone have been the use of extremely low concentrations of antigen in vitro (doses several orders of magnitude below those inducing a peak blastogenic response), careful attention to in vitro cell density and culture vessel geometry, and appreciation of the kinetics of the circulating antigen-inducible B cell repertoire. A dichotomy and overlap between antigen-induced, antigen-specific and antigen-induced, polyclonal responses was observed in the study of doubly immunized individuals. Whereas antibody responses highly specific for the antigen in culture were observed under one set of culture conditions (flat-bottomed vessels, 1.5 x 10(6) cells), switching to another culture system (round-bottomed vessels, 5 x 10(5) cells) resulted in polyclonal responses to antigen. Despite these culture condition-related differences in the induction of antibody synthesis, the suppression of specific antibody production that occurred at high concentrations of antigen was specific only for the antigen in culture. The capability to easily and reproducibly look at truly antigen-induced, antigen specific antibody production should be a major tool in furthering the understanding of human B cell activation and immunoregulation. PMID:6169778
Wei, Yandi; Xu, Guanlong; Zhang, Guozhong; Wen, Chu; Anwar, Furkat; Wang, Shuoguo; Lemmon, Gordon; Wang, Jinliang; Carter, Robert; Wang, Min; Sun, Honglei; Sun, Yipeng; Zhao, Jixun; Wu, Gang; Webster, Robert G.; Liu, Jinhua; Pu, Juan
2016-01-01
We previously demonstrated that H9N2 subtype avian influenza viruses (AIVs) isolated from 1994 to 2008 evolved into distinct antigenic groups (C, D, and E) and then underwent antigenic drift from commercial vaccines, causing a country-wide outbreak during 2010–2013. In this study, H9N2 AIVs isolated from chickens during 2009–2013 were antigenically analyzed by performing hemagglutination inhibition and neutralization assays using a panel of polyclonal antibodies. Our findings confirmed the antigenic drift of recent H9N2 viruses from the commercial vaccine and showed that most of these antigenic variants form a novel HI antigenic group, F, with a few belonging to groups D and E. Slight antigenic variation was observed in group F viruses. Genetic analysis of amino acid sequences deduced from hemagglutinin (HA) gene sequences indicated that 9 of 15 mutations predominant in the 2009–2013 viruses can be mapped to known antigenic sites, which might be responsible for the novel antigenicity of group F. These antigenic changes make it necessary to modify the influenza vaccine to ensure efficient protection. A vaccine candidate, Ck/HeB/YT/10, was selected and provided significant protection against viruses from different antigenic groups in terms of reduction in virus shedding, suggesting broad cross-reactivity. Taken together, our results indicate that the H9N2 chicken influenza viruses in China have evolved from distinct antigenic groups into a novel group F that became dominant during the country-wide outbreak and now seems to be undergoing new antigenic divergence. Systematic surveillance and timely updating of vaccine strains are important for viral prevention and control in the future. PMID:26711021
PD-1 suppresses development of humoral responses that protect against Tn-bearing tumors
Haro, Marcela A.; Littrell, Chad A.; Yin, Zhaojun; Huang, Xuefei; Haas, Karen M.
2017-01-01
Tn is a carbohydrate antigen uniquely exposed on tumor mucins and thus, an ideal target for immunotherapy. However, it has been difficult to elicit protective antibody responses against Tn antigen and other tumor associated carbohydrate antigens. Our study demonstrates this can be attributed to PD-1 immuno-inhibition. Our data show a major role for PD-1 in suppressing mucin- and Tn-specific B-cell activation, expansion, and antibody production important for protection against Tn-bearing tumor cells. These Tn/mucin-specific B cells belong to the innate-like B-1b cell subset typically responsible for T cell–independent antibody responses. Interestingly, PD-1–mediated regulation is B cell–intrinsic and CD4+ cells play a key role in supporting Tn/mucin-specific B cell antibody production in the context of PD-1 deficiency. Mucin-reactive antibodies produced in the absence of PD-1 inhibition largely belong to the IgM subclass and elicit potent antitumor effects via a complement-dependent mechanism. The identification of this role for PD-1 in regulating B cell–dependent antitumor immunity to Tn antigen highlights an opportunity to develop new therapeutic strategies targeting tumor associated carbohydrate antigens. PMID:27856425
Alvarez Hayes, Jimena; Oviedo, Juan Marcos; Valdez, Hugo; Laborde, Juan Martín; Maschi, Fabricio; Ayala, Miguel; Shah, Rohan; Fernandez Lahore, Marcelo; Rodriguez, Maria Eugenia
2017-10-01
Whooping cough, which is caused by Bordetella pertussis and B. parapertussis, is a reemerging disease. New protective antigens are needed to improve the efficacy of current vaccines against both species. Using proteomic tools, it was here found that B. parapertussis expresses a homolog of AfuA, a previously reported new vaccine candidate against B. pertussis. It was found that this homolog, named AfuA Bpp , is expressed during B. parapertussis infection, exposed on the surface of the bacteria and recognized by specific antibodies induced by the recombinant AfuA cloned from B. pertussis (rAfuA). Importantly, the presence of the O-antigen, a molecule that has been found to shield surface antigens on B. parapertussis, showed no influence on antibody recognition of AfuA Bpp on the bacterial surface. The present study further showed that antibodies induced by immunization with the recombinant protein were able to opsonize B. parapertussis and promote bacterial uptake by neutrophils. Finally, it was shown that this antigen confers protection against B. parapertussis infection in a mouse model. Altogether, these results indicate that AfuA is a good vaccine candidate for acellular vaccines protective against both causative agents of whooping cough. © 2017 The Societies and John Wiley & Sons Australia, Ltd.
Endogenous antigen processing drives the primary CD4+ T cell response to influenza
Miller, Michael A.; Ganesan, Asha Purnima V.; Luckashenak, Nancy; Mendonca, Mark; Eisenlohr, Laurence C.
2015-01-01
By convention, CD4+ T lymphocytes recognize foreign and self peptides derived from internalized antigens in combination with MHC class II molecules. Alternative pathways of epitope production have been identified but their contributions to host defense have not been established. We show here in a mouse infection model that the CD4+ T cell response to influenza, critical for durable protection from the virus, is driven principally by unconventional processing of antigen synthesized within the infected antigen-presenting cell, not by classical processing of endocytosed virions or material from infected cells. Investigation of the cellular components involved, including the H2-M molecular chaperone, the proteasome, and gamma-interferon inducible lysosomal thiol reductase revealed considerable heterogeneity in the generation of individual epitopes, an arrangement that ensures peptide diversity and broad CD4+ T cell engagement. These results could fundamentally revise strategies for rational vaccine design and may lead to key insights into the induction of autoimmune and anti-tumor responses. PMID:26413780
Cheng, Wing Ki; Wee, Kathleen; Kollmann, Tobias R.
2014-01-01
Robust CD8+ T cell responses are essential for immune protection against intracellular pathogens. Using parenteral administration of ovalbumin (OVA) protein as a model antigen, the effect of the Toll-like receptor 9 (TLR9) agonist, CpG oligodeoxynucleotide (ODN) 1826, as an adjuvant delivered either topically, subcutaneously, or intramuscularly on antigen-specific CD8+ T cell responses in a mouse model was evaluated. Topical CpG adjuvant increased the frequency of OVA-specific CD8+ T cells in the peripheral blood and in the spleen. The more effective strategy to administer topical CpG adjuvant to enhance CD8+ T cell responses was single-dose administration at the time of antigen injection with a prime-boost regimen. Topical CpG adjuvant conferred both rapid and long-lasting protection against systemic challenge with recombinant Listeria monocytogenes expressing the cytotoxic T lymphocyte (CTL) epitope of OVA257–264 (strain Lm-OVA) in a TLR9-dependent manner. Topical CpG adjuvant induced a higher proportion of CD8+ effector memory T cells than parenteral administration of the adjuvant. Although traditional vaccination strategies involve coformulation of antigen and adjuvant, split administration using topical adjuvant is effective and has advantages of safety and flexibility. Split administration of topical CpG ODN 1826 with parenteral protein antigen is superior to other administration strategies in enhancing both acute and memory protective CD8+ T cell immune responses to subcutaneous protein vaccines. This vaccination strategy induces rapid and persistent protective immune responses against the intracellular organism L. monocytogenes. PMID:24391136
Old, Lloyd J.; Stockert, Elisabeth; Boyse, Edward A.; Kim, Jae Ho
1968-01-01
Antigenic modulation (the loss of TL antigens from TL+ cells exposed to TL antibody in the absence of lytic complement) has been demonstrated in vitro. An ascites leukemia, phenotype TL.1,2,3, which modulates rapidly and completely when incubated with TL antiserum in vitro, was selected for further study of the phenomenon. Over a wide range of TL antibody concentrations modulation at 37°C was detectable within 10 min and was complete within approximately 1 hr. The cells were initially sensitized to C' by their contact with antibody, thereafter losing this sensitivity to C' lysis together with their sensitivity to TL antibody and C' in the cytotoxic test. The capacity of the cells to undergo modulation was abolished by actinomycin D and by iodoacetamide, and by reducing the temperature of incubation to 0°C. Thus modulation apparently is an active cellular process. Antigens TL. 1,2, and 3 are all modulated by anti-TL.1,3 serum and by anti-TL.3 serum. This modulation affects all three TL components together, even when antibody to one or two of them is lacking. aAnti-TL.2 serum does not induce modulation and in fact impairs modulation by the other TL antibodies. The influence of the TL phenotype of cells upon the demonstrable content of H-2 (D region) isoantigen, first shown in cells modulated in vivo, has been observed with cells modulated in vitro. Cells undergoing modulation show a progressive increase in H-2 (D region) antigen over a period of 4 hr, with no change in H-2 antigens of the K region. Restoration of the TL+ phenotype of modulated cells after removal of antibody is less rapid than TL+ → TL- modulation and may require several cell divisions. PMID:5636556
The genetic origin of minor histocompatibility antigens.
Roopenian, D C; Christianson, G J; Davis, A P; Zuberi, A R; Mobraaten, L E
1993-01-01
The purpose of this study was to elucidate the genetic origin of minor histocompatibility (H) antigens. Toward this end common inbred mouse strains, distinct subspecies, and species of the subgenus Mus were examined for expression of various minor H antigens. These antigens were encoded by the classical minor H loci H-3 and H-4 or by newly identified minor H antigens detected as a consequence of mutation. Both minor H antigens that stimulate MHC class I-restricted cytotoxic T cells (Tc) and antigens that stimulate MHC class II-restricted helper T cells (Th) were monitored. The results suggested that strains of distinct ancestry commonly express identical or cross-reactive antigens. Moreover, a correlation between the lack of expression of minor H antigens and ancestral heritage was observed. To address whether the antigens found on unrelated strains were allelic with the sensitizing minor H antigens or a consequence of antigen cross-reactivity, classical genetic segregation analysis was carried out. Even in distinct subspecies and species, the minor H antigens always mapped to the site of the appropriate minor H locus. Together the results suggest: 1) minor H antigen sequences are evolutionarily stable in that their pace of antigenic change is slow enough to predate subspeciation and speciation; 2) the minor H antigens originated in the inbred strains as a consequence of a rare polymorphism or loss mutation carried in a founder mouse stock that caused the mouse to perceive the wild-type protein as foreign; 3) there is a remarkable lack of antigenic cross-reactivity between the defined minor H antigens and other gene products.
Wei, Yandi; Xu, Guanlong; Zhang, Guozhong; Wen, Chu; Anwar, Furkat; Wang, Shuoguo; Lemmon, Gordon; Wang, Jinliang; Carter, Robert; Wang, Min; Sun, Honglei; Sun, Yipeng; Zhao, Jixun; Wu, Gang; Webster, Robert G; Liu, Jinhua; Pu, Juan
2016-01-01
We previously demonstrated that H9N2 subtype avian influenza viruses (AIVs) isolated from 1994 to 2008 evolved into distinct antigenic groups (C, D, and E) and then underwent antigenic drift from commercial vaccines, causing a country-wide outbreak during 2010-2013. In this study, H9N2 AIVs isolated from chickens during 2009-2013 were antigenically analyzed by performing hemagglutination inhibition and neutralization assays using a panel of polyclonal antibodies. Our findings confirmed the antigenic drift of recent H9N2 viruses from the commercial vaccine and showed that most of these antigenic variants form a novel HI antigenic group, F, with a few belonging to groups D and E. Slight antigenic variation was observed in group F viruses. Genetic analysis of amino acid sequences deduced from hemagglutinin (HA) gene sequences indicated that 9 of 15 mutations predominant in the 2009-2013 viruses can be mapped to known antigenic sites, which might be responsible for the novel antigenicity of group F. These antigenic changes make it necessary to modify the influenza vaccine to ensure efficient protection. A vaccine candidate, Ck/HeB/YT/10, was selected and provided significant protection against viruses from different antigenic groups in terms of reduction in virus shedding, suggesting broad cross-reactivity. Taken together, our results indicate that the H9N2 chicken influenza viruses in China have evolved from distinct antigenic groups into a novel group F that became dominant during the country-wide outbreak and now seems to be undergoing new antigenic divergence. Systematic surveillance and timely updating of vaccine strains are important for viral prevention and control in the future. Copyright © 2015 Elsevier B.V. All rights reserved.
Presenting Influenza A M2e Antigen on Recombinant Spores of Bacillus subtilis
Obuchowski, Michał; Nidzworski, Dawid
2016-01-01
Effective vaccination against influenza virus infection is a serious problem mainly due to antigenic variability of the virus. Among many of investigated antigens, the extracellular domain of the M2 protein (M2e) features high homology in all strains of influenza A viruses and antibodies against M2e and is protective in animal models; this makes it a potential candidate for generation of a universal influenza vaccine. However, due to the low immunogenicity of the M2e, formulation of a vaccine based on this antigen requires some modification to induce effective immune responses. In this work we evaluated the possible use of Bacillus subtilis spores as a carrier of the Influenza A M2e antigen in mucosal vaccination. A tandem repeat of 4 consensus sequences coding for human—avian—swine—human M2e (M2eH-A-S-H) peptide was fused to spore coat proteins and stably exposed on the spore surface, as demonstrated by the immunostaining of intact, recombinant spores. Oral immunization of mice with recombinant endospores carrying M2eH-A-S-H elicited specific antibody production without the addition of adjuvants. Bacillus subtilis endospores can serve as influenza antigen carriers. Recombinant spores constructed in this work showed low immunogenicity although were able to induce antibody production. The System of influenza antigen administration presented in this work is attractive mainly due to the omitting time-consuming and cost-intensive immunogen production and purification. Therefore modification should be made to increase the immunogenicity of the presented system. PMID:27902762
The Klebsiella pneumoniae O Antigen Contributes to Bacteremia and Lethality during Murine Pneumonia
Shankar-Sinha, Sunita; Valencia, Gabriel A.; Janes, Brian K.; Rosenberg, Jessica K.; Whitfield, Chris; Bender, Robert A.; Standiford, Ted J.; Younger, John G.
2004-01-01
Bacterial surface carbohydrates are important pathogenic factors in gram-negative pneumonia infections. Among these factors, O antigen has been reported to protect pathogens against complement-mediated killing. To examine further the role of O antigen, we insertionally inactivated the gene encoding a galactosyltransferase necessary for serotype O1 O-antigen synthesis (wbbO) from Klebsiella pneumoniae 43816. Analysis of the mutant lipopolysaccharide by sodium dodecyl sulfate-polyacrylamide gel electrophoresis confirmed the absence of O antigen. In vitro, there were no detectable differences between wild-type K. pneumoniae and the O-antigen-deficient mutant in regard to avid binding by murine complement C3 or resistance to serum- or whole-blood-mediated killing. Nevertheless, the 72-h 50% lethal dose of the wild-type strain was 30-fold greater than that of the mutant (2 × 103 versus 6 × 104 CFU) after intratracheal injection in ICR strain mice. Despite being less lethal, the mutant organism exhibited comparable intrapulmonary proliferation at 24 h compared to the level of the wild type. Whole-lung chemokine expression (CCL3 and CXCL2) and bronchoalveolar inflammatory cell content were also similar between the two infections. However, whereas the wild-type organism produced bacteremia within 24 h of infection in every instance, bacteremia was not seen in mutant-infected mice. These results suggest that during murine pneumonia caused by K. pneumoniae, O antigen contributes to lethality by increasing the propensity for bacteremia and not by significantly changing the early course of intrapulmonary infection. PMID:14977947
Goodin, Jeremy L.; Nellis, David F.; Powell, Bradford S.; Vyas, Vinay V.; Enama, Jeffrey T.; Wang, Lena C.; Clark, Patrick K.; Giardina, Steven L.; Adamovicz, Jeffery. J.; Michiel, Dennis F.
2009-01-01
The F1-V vaccine antigen, protective against Yersinia pestis, exhibits a strong tendency to multimerize that affects larger-scale manufacture and characterization. In this work, the sole F1-V cysteine was replaced with serine by site-directed mutagenesis for characterization of F1-V non-covalent multimer interactions and protective potency without participation by disulfide-linkages. F1-V and F1-VC424S proteins were over-expressed in Escherichia coli, recovered using mechanical lysis/pH-modulation and purified from urea-solubilized soft inclusion bodies, using successive ion-exchange, ceramic hydroxyapatite, and size-exclusion chromatography. This purification method resulted in up to 2 mg per gram of cell paste of 95% pure, mono-disperse protein having ≤ 0.5 endotoxin units per mg by a kinetic chromogenic limulus amoebocyte lysate reactivity assay. Both F1-V and F1-VC424S were monomeric at pH 10.0 and progressively self-associated as pH conditions decreased to pH 6.0. Solution additives were screened for their ability to inhibit F1-V self-association at pH 6.5. An L-arginine buffer provided the greatest stabilizing effect. Conversion to >500-kDa multimers occurred between pH 6.0 and 5.0. Conditions for efficient F1-V adsorption to the cGMP-compatible Alhydrogel® adjuvant were optimized. Side-by-side evaluation for protective potency against subcutaneous plague infection in mice was conducted for F1-VC424S monomer; cysteine-capped F1-V monomer; cysteine-capped F1-V multimer; and a F1-V standard reported previously. After a two-dose vaccination with 2 × 20 µg of F1-V, respectively, 100, 80, 80, and 70% of injected mice survived a subcutaneous lethal plague challenge with 108 LD50 Y. pestis CO92. Thus, vaccination with F1-V monomer and multimeric forms resulted in significant, and essentially equivalent, protection. PMID:17293124
Iheagwara, Uzoma K.; Beatty, Pamela L.; Van, Phu T.; Ross, Ted M.; Minden, Jonathan S.; Finn, Olivera J.
2014-01-01
Most tumor-associated antigens (TAA) are self-molecules that are abnormally expressed in cancer cells and become targets of antitumor immune responses. Antibodies and T cells specific for some TAA have been found in healthy individuals and are associated with lowered lifetime risk for developing cancer. Lower risk for cancer has also been associated with a history of febrile viral diseases. We hypothesized that virus infections could lead to transient expression of abnormal forms of self-molecules, some of which are TAA; facilitated by the adjuvant effects of infection and inflammation, these molecules could elicit specific antibodies, T cells and lasting immune memory simultaneously with immunity against viral antigens. Such infection-induced immune memory for TAA would be expected to provide life-long immune surveillance of cancer. Using influenza virus infection in mice as a model system, we tested this hypothesis and demonstrated that influenza-experienced mice control 3LL mouse lung tumor challenge better than infection-naive control mice. Using 2D-Difference Gel Electrophoresis (2D-DIGE) and mass spectrometry, we identified numerous molecules, some of which are known TAA, on the 3LL tumor cells recognized by antibodies elicited by two successive influenza infections. We studied in detail immune responses against GAPDH, Histone H4, HSP90, Malate Dehydrogenase 2 and Annexin A2, all of which were overexpressed in influenza-infected lungs and in tumor cells. Lastly, we show that immune responses generated through vaccination against peptides derived from these antigens correlated with improved tumor control. PMID:24778322
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fischer, N. O.
The goal of this proposal is to demonstrate that colocalization of protein subunit antigens and adjuvants on nanolipoprotein particles (NLPs) can increase the protective efficacy of subunit antigens from Burkholderia spp. and Francisella tularensis against an aerosol challenge. In the second quarter of the third year, LLNL finalized all immunological assessments of NLP vaccine formulations in the F344 model. Battelle has immunized rats with three unique NLP formulations by either intramuscular or intranasal administration. All inoculations have been completed, and protective efficacy against an aerosolized challenge will begin at the end of October, 2014.
Central Tolerance to Tissue-specific Antigens Mediated by Direct and Indirect Antigen Presentation
Gallegos, Alena M.; Bevan, Michael J.
2004-01-01
Intrathymic expression of tissue-specific antigens (TSAs) by medullary thymic epithelial cells (Mtecs) leads to deletion of autoreactive T cells. However, because Mtecs are known to be poor antigen-presenting cells (APCs) for tolerance to ubiquitous antigens, and very few Mtecs express a given TSA, it was unclear if central tolerance to TSA was induced directly by Mtec antigen presentation or indirectly by thymic bone marrow (BM)-derived cells via cross-presentation. We show that professional BM-derived APCs acquire TSAs from Mtecs and delete autoreactive CD8 and CD4 T cells. Although direct antigen presentation by Mtecs did not delete the CD4 T cell population tested in this study, Mtec presentation efficiently deleted both monoclonal and polyclonal populations of CD8 T cells. For developing CD8 T cells, deletion by BM-derived APC and by Mtec presentation occurred abruptly at the transitional, CD4high CD8low TCRintermediate stage, presumably as the cells transit from the cortex to the medulla. These studies reveal a cooperative relationship between Mtecs and BM-derived cells in thymic elimination of autoreactive T cells. Although Mtecs synthesize TSAs and delete a subset of autoreactive T cells, BM-derived cells extend the range of clonal deletion by cross-presenting antigen captured from Mtecs. PMID:15492126
Vallejo, Abbe N.; Miller, Norman W.; Harvey, Nancy E.; Cuchens, Marvin A.; Warr, Gregory W.
1992-01-01
Studies were conducted to address further the role(s) of antigen processing and presentation in the induction of immune responses in a phylogenetically lower vertebrate, specifically a teleost, the channel catfish. In particular, studies were aimed at determining the subcellular compartments involved in antigen degradation by channel catfish antigen-presenting cells (APC) as well as ascertaining the reexpression of immunogenic peptides on the surfaces of APC. The results showed that exogenous protein antigens were actively endocytosed by APC as detected by flow cytometry. Use of radiolabeled antigen and subcellular fractionation protocols also showed that antigen localized in endosomes/lysosomes. Furthermore, there was an apparent redistribution of antigen between these organelles and the plasma membrane during the course of antigen pulsing. Functional assays for the induction of in vitro antigen-specific proliferation of immune catfish peripheral blood leukocytes (PBL) showed that membrane preparations from antigen-pulsed autologous APC were highly stimulatory. The magnitude of responses elicited with such membrane preparations was very similar to that of PBL cultures stimulated with native antigen-pulsed and fixed intact APC or prefixed intact APC incubated with a peptide fragment of the nominal antigen. Current data further corroborate our previous findings that steps akin to antigen processing and presentation are clearly important in the induction of immune responses in lower vertebrates like fish, in a manner similar to that seen in mammalian systems. Consequently, it would appear that many immune functions among the diverse taxa of vertebrates are remarkably conserved. PMID:1343103
Mapping Antigenic Motifs in the Trypomastigote Small Surface Antigen from Trypanosoma cruzi
Balouz, Virginia; Cámara, María de los Milagros; Cánepa, Gaspar E.; Carmona, Santiago J.; Volcovich, Romina; Gonzalez, Nicolás; Altcheh, Jaime; Agüero, Fernán
2015-01-01
The trypomastigote small surface antigen (TSSA) is a mucin-like molecule from Trypanosoma cruzi, the etiological agent of Chagas disease, which displays amino acid polymorphisms in parasite isolates. TSSA expression is restricted to the surface of infective cell-derived trypomastigotes, where it functions as an adhesin and engages surface receptors on the host cell as a prerequisite for parasite internalization. Previous results have established TSSA-CL, the isoform encoded by the CL Brener clone, as an appealing candidate for use in serology-based diagnostics for Chagas disease. Here, we used a combination of peptide- and recombinant protein-based tools to map the antigenic structure of TSSA-CL at maximal resolution. Our results indicate the presence of different partially overlapping B-cell epitopes clustering in the central portion of TSSA-CL, which contains most of the polymorphisms found in parasite isolates. Based on these results, we assessed the serodiagnostic performance of a 21-amino-acid-long peptide that spans TSSA-CL major antigenic determinants, which was similar to the performance of the previously validated glutathione S-transferase (GST)-TSSA-CL fusion molecule. Furthermore, the tools developed for the antigenic characterization of the TSSA antigen were also used to explore other potential diagnostic applications of the anti-TSSA humoral response in Chagasic patients. Overall, our present results provide additional insights into the antigenic structure of TSSA-CL and support this molecule as an excellent target for molecular intervention in Chagas disease. PMID:25589551
Vallochi, Adriana Lima; da Silva Rios, Lília; Nakamura, Marceli Vicente; Silveira, Cláudio; Muccioli, Cristina; Martins, Maria Cristina; Belfort, Rubens; Rizzo, Luiz Vicente
2005-02-01
Ocular lesions are frequent in various individuals infected with Toxoplasma gondii. Disease intensity in ocular toxoplasmosis varies greatly between patients. Autoimmunity has been suggested as a possible component to retinal destruction. Immunologic parameters in the response to retina antigens were evaluated in infected persons with and without ocular lesions and in non-infected controls. Subjects were divided into groups on the basis of titers of serum antibodies to T. gondii, presence and severity of ocular lesions, and clinical history. Peripheral blood mononuclear cells from patients with mild disease responded to one or more retinal antigens with a significantly higher frequency than patients without disease or with severe disease. Interestingly, the cytokines produced by the proliferating mononuclear cells did not follow any specific patterns, except for the fact that IL-4 and IL-5 were seldom detected. Our results suggest that although the presence of an immune response towards autoantigens is not protective against the development of ocular lesions by the T. gondii, it may protect against the development of severe disease.
Impact of genetic changes, pathogenicity and antigenicity on Enterovirus- A71 vaccine development.
Yee, Pinn Tsin Isabel; Laa Poh, Chit
2017-06-01
Enterovirus-A71 (EV-A71) is an etiological agent of the hand, foot and mouth disease (HFMD). EV-A71 infection produces high fever and ulcers in children. Some EV-A71 strains produce severe infections leading to pulmonary edema and death. Although the protective efficacy of the inactivated vaccine (IV) was ≥90% against mild HFMD, there was approximately 80% protection against severe HFMD. The monovalent EV-A71 IV elicits humoral immunity but lacks long-term immunogenicity. Spontaneous mutations of the EV-A71 genome could lead to antigenicity changes and the virus may not be neutralized by antibodies elicited by the IV. A better alternative would be the live attenuated vaccine (LAV) that elicits cellular and humoral immunity. The LAV induces excellent antigenicity and chances of reversion is reduced by presence of multiple mutations which could reduce pathogenicity. Besides CV-A16, outbreaks have been caused by CV-A6 and CV-A10, hence the development of bivalent and trivalent vaccines is required. Copyright © 2017 Elsevier Inc. All rights reserved.
Lee, Chrono K.; Huang, Haibin; Hester, Maureen M.; Liu, Jianhua; Luckie, Bridget A.; Torres Santana, Melanie A.; Mirza, Zeynep; Khoshkenar, Payam; Abraham, Ambily; Shen, Zu T.; Lodge, Jennifer K.; Akalin, Ali; Homan, Jane; Ostroff, Gary R.
2017-01-01
ABSTRACT Development of a vaccine to protect against cryptococcosis is a priority given the enormous global burden of disease in at-risk individuals. Using glucan particles (GPs) as a delivery system, we previously demonstrated that mice vaccinated with crude Cryptococcus-derived alkaline extracts were protected against lethal challenge with Cryptococcus neoformans and Cryptococcus gattii. The goal of the present study was to identify protective protein antigens that could be used in a subunit vaccine. Using biased and unbiased approaches, six candidate antigens (Cda1, Cda2, Cda3, Fpd1, MP88, and Sod1) were selected, recombinantly expressed in Escherichia coli, purified, and loaded into GPs. Three mouse strains (C57BL/6, BALB/c, and DR4) were then vaccinated with the antigen-laden GPs, following which they received a pulmonary challenge with virulent C. neoformans and C. gattii strains. Four candidate vaccines (GP-Cda1, GP-Cda2, GP-Cda3, and GP-Sod1) afforded a significant survival advantage in at least one mouse model; some vaccine combinations provided added protection over that seen with either antigen alone. Vaccine-mediated protection against C. neoformans did not necessarily predict protection against C. gattii. Vaccinated mice developed pulmonary inflammatory responses that effectively contained the infection; many surviving mice developed sterilizing immunity. Predicted T helper cell epitopes differed between mouse strains and in the degree to which they matched epitopes predicted in humans. Thus, we have discovered cryptococcal proteins that make promising candidate vaccine antigens. Protection varied depending on the mouse strain and cryptococcal species, suggesting that a successful human subunit vaccine will need to contain multiple antigens, including ones that are species specific. PMID:29184017
Munang'andu, Hetron Mweemba; Paul, Joydeb; Evensen, Øystein
2016-12-13
Streptococcus agalactiae is an emerging infectious disease adversely affecting Nile tilapia ( Niloticus oreochromis ) production in aquaculture. Research carried out in the last decade has focused on developing protective vaccines using different strategies, although no review has been carried out to evaluate the efficacy of these strategies. The purpose of this review is to provide a synopsis of vaccination strategies and antigen delivery systems currently used for S. agalactiae vaccines in tilapia. Furthermore, as shown herein, current vaccine designs include the use of replicative antigen delivery systems, such as attenuated virulent strains, heterologous vectors and DNA vaccines, while non-replicative vaccines include the inactivated whole cell (IWC) and subunit vaccines encoding different S. agalactiae immunogenic proteins. Intraperitoneal vaccination is the most widely used immunization strategy, although immersion, spray and oral vaccines have also been tried with variable success. Vaccine efficacy is mostly evaluated by use of the intraperitoneal challenge model aimed at evaluating the relative percent survival (RPS) of vaccinated fish. The major limitation with this approach is that it lacks the ability to elucidate the mechanism of vaccine protection at portals of bacterial entry in mucosal organs and prevention of pathology in target organs. Despite this, indications are that the correlates of vaccine protection can be established based on antibody responses and antigen dose, although these parameters require optimization before they can become an integral part of routine vaccine production. Nevertheless, this review shows that different approaches can be used to produce protective vaccines against S. agalactiae in tilapia although there is a need to optimize the measures of vaccine efficacy.
Munang’andu, Hetron Mweemba; Paul, Joydeb; Evensen, Øystein
2016-01-01
Streptococcus agalactiae is an emerging infectious disease adversely affecting Nile tilapia (Niloticus oreochromis) production in aquaculture. Research carried out in the last decade has focused on developing protective vaccines using different strategies, although no review has been carried out to evaluate the efficacy of these strategies. The purpose of this review is to provide a synopsis of vaccination strategies and antigen delivery systems currently used for S. agalactiae vaccines in tilapia. Furthermore, as shown herein, current vaccine designs include the use of replicative antigen delivery systems, such as attenuated virulent strains, heterologous vectors and DNA vaccines, while non-replicative vaccines include the inactivated whole cell (IWC) and subunit vaccines encoding different S. agalactiae immunogenic proteins. Intraperitoneal vaccination is the most widely used immunization strategy, although immersion, spray and oral vaccines have also been tried with variable success. Vaccine efficacy is mostly evaluated by use of the intraperitoneal challenge model aimed at evaluating the relative percent survival (RPS) of vaccinated fish. The major limitation with this approach is that it lacks the ability to elucidate the mechanism of vaccine protection at portals of bacterial entry in mucosal organs and prevention of pathology in target organs. Despite this, indications are that the correlates of vaccine protection can be established based on antibody responses and antigen dose, although these parameters require optimization before they can become an integral part of routine vaccine production. Nevertheless, this review shows that different approaches can be used to produce protective vaccines against S. agalactiae in tilapia although there is a need to optimize the measures of vaccine efficacy. PMID:27983591
Rigano, M M; Alvarez, M L; Pinkhasov, J; Jin, Y; Sala, F; Arntzen, C J; Walmsley, A M
2004-02-01
Transgenic plants are potentially safe and inexpensive vehicles to produce and mucosally deliver protective antigens. However, the application of this technology is limited by the poor response of the immune system to non-particulate, subunit vaccines. Co-delivery of therapeutic proteins with carrier proteins could increase the effectiveness of the antigen. This paper reports the ability of transgenic Arabidopsis thaliana plants to produce a fusion protein consisting of the B subunit of the Escherichia coli heat-labile enterotoxin and a 6 kDa tuberculosis antigen, the early secretory antigenic target ESAT-6. Both components of the fusion protein were detected using GM1-ganglioside-dependent enzyme-linked immunosorbant assay. This suggested the fusion protein retained both its native antigenicity and the ability to form pentamers.
Radioimmunoassays of hidden viral antigens
DOE Office of Scientific and Technical Information (OSTI.GOV)
Neurath, A.R.; Strick, N.; Baker, L.
1982-07-01
Antigens corresponding to infectious agents may be present in biological specimens only in a cryptic form bound to antibodies and, thus, may elude detection. We describe a solid-phase technique for separation of antigens from antibodies. Immune complexes are precipitated from serum by polyethylene glycol, dissociated with NaSCN, and adsorbed onto nitrocellulose or polystyrene supports. Antigens remain topographically separated from antibodies after removal of NaSCN and can be detected with radiolabeled antibodies. Genomes from viruses immobilized on nitrocellulose can be identified by nucleic acid hybridization. Nanogram quantities of sequestered hepatitis B surface and core antigens and picogram amounts of hepatitis Bmore » virus DNA were detected. Antibody-bound adenovirus, herpesvirus, and measles virus antigens were discerned by the procedure.« less
Jancovich, James K; Chapman, Dave; Hansen, Debra T; Robida, Mark D; Loskutov, Andrey; Craciunescu, Felicia; Borovkov, Alex; Kibler, Karen; Goatley, Lynnette; King, Katherine; Netherton, Christopher L; Taylor, Geraldine; Jacobs, Bertram; Sykes, Kathryn; Dixon, Linda K
2018-04-15
African swine fever virus (ASFV) causes an acute hemorrhagic fever in domestic pigs, with high socioeconomic impact. No vaccine is available, limiting options for control. Although live attenuated ASFV can induce up to 100% protection against lethal challenge, little is known of the antigens which induce this protective response. To identify additional ASFV immunogenic and potentially protective antigens, we cloned 47 viral genes in individual plasmids for gene vaccination and in recombinant vaccinia viruses. These antigens were selected to include proteins with different functions and timing of expression. Pools of up to 22 antigens were delivered by DNA prime and recombinant vaccinia virus boost to groups of pigs. Responses of immune lymphocytes from pigs to individual recombinant proteins and to ASFV were measured by interferon gamma enzyme-linked immunosorbent spot (ELISpot) assays to identify a subset of the antigens that consistently induced the highest responses. All 47 antigens were then delivered to pigs by DNA prime and recombinant vaccinia virus boost, and pigs were challenged with a lethal dose of ASFV isolate Georgia 2007/1. Although pigs developed clinical and pathological signs consistent with acute ASFV, viral genome levels were significantly reduced in blood and several lymph tissues in those pigs immunized with vectors expressing ASFV antigens compared with the levels in control pigs. IMPORTANCE The lack of a vaccine limits the options to control African swine fever. Advances have been made in the development of genetically modified live attenuated ASFV that can induce protection against challenge. However, there may be safety issues relating to the use of these in the field. There is little information about ASFV antigens that can induce a protective immune response against challenge. We carried out a large screen of 30% of ASFV antigens by delivering individual genes in different pools to pigs by DNA immunization prime and recombinant vaccinia
2018-01-01
ABSTRACT African swine fever virus (ASFV) causes an acute hemorrhagic fever in domestic pigs, with high socioeconomic impact. No vaccine is available, limiting options for control. Although live attenuated ASFV can induce up to 100% protection against lethal challenge, little is known of the antigens which induce this protective response. To identify additional ASFV immunogenic and potentially protective antigens, we cloned 47 viral genes in individual plasmids for gene vaccination and in recombinant vaccinia viruses. These antigens were selected to include proteins with different functions and timing of expression. Pools of up to 22 antigens were delivered by DNA prime and recombinant vaccinia virus boost to groups of pigs. Responses of immune lymphocytes from pigs to individual recombinant proteins and to ASFV were measured by interferon gamma enzyme-linked immunosorbent spot (ELISpot) assays to identify a subset of the antigens that consistently induced the highest responses. All 47 antigens were then delivered to pigs by DNA prime and recombinant vaccinia virus boost, and pigs were challenged with a lethal dose of ASFV isolate Georgia 2007/1. Although pigs developed clinical and pathological signs consistent with acute ASFV, viral genome levels were significantly reduced in blood and several lymph tissues in those pigs immunized with vectors expressing ASFV antigens compared with the levels in control pigs. IMPORTANCE The lack of a vaccine limits the options to control African swine fever. Advances have been made in the development of genetically modified live attenuated ASFV that can induce protection against challenge. However, there may be safety issues relating to the use of these in the field. There is little information about ASFV antigens that can induce a protective immune response against challenge. We carried out a large screen of 30% of ASFV antigens by delivering individual genes in different pools to pigs by DNA immunization prime and recombinant
[Protective immunity against Mycobacterium tuberculosis].
Kawamura, Ikuo
2006-11-01
Mycobacterium tuberculosis (MTB) is a facultative intracellular pathogen with which over a billion people have been infected and 3 million people die annually. The bacterium induces vigorous immune responses, yet evades host immunity, persisting within phagosomes of the infected macrophages. Thus, it is necessary to delineate that the virulence-related intracellular survival mechanism and the host immune responses to eradicate M. tuberculosis on the molecular basis. In this regard, recent findings clearly indicated that Toll-like receptors (TLRs) play an essential role in the recognition of MTB components by macrophages and dendritic cells, resulting in not only activation of innate immunity but also development of antigen-specific adaptive immunity. It has been also reported that induction of early death of the infected cells may be one of the strategy of host defense against MTB because macrophages go into apoptosis upon infection with MTB, resulting in suppression of the intracellular replication. Furthermore, recent report has shown that autophagy is induced by IFN-gamma and suppress intracellular survival of mycobacteria, suggesting that activation of autophagy pathway is required to overcome phagosome maturation arrest induced by MTB. In addition, it is known that IFN-gamma plays an important role in protection. The cytokine that is produced from NK cells and dendritic cells at the early period of infection strongly induces not only macrophage activation but also development of antigen-specific IFN-gamma-producing CD4+T cells. Since antigen-specific CD8+ T cells and CD1-restricted T cells are also reported to contribute to the protective immunity, cooperation of these T cells is essential for the host resistance. In this paper, I am going to summarize the recent progress of the understanding of protective immunity against MTB.
Hasegawa, T; Isobe, K; Nakashima, I; Shimokata, K
1992-01-01
In order to analyse the amounts of antigen in the thymus for the induction of tolerance, several carcinoembryonic antigen (CEA) transgenic lines were established which expressed human CEA antigen with different amounts. The chimeric KSN nude mice transplanted with the thymus of the B601 line (in which CEA mRNA and CEA protein could be detected in various tissues) to kidney capsule showed tolerance to human CEA. On the other hand, the chimeric KSN nude mice transplanted with the thymus of the B602 or BC60 line (in which neither CEA mRNA nor CEA protein could be detected by Northern blot analysis and flow cytometry analysis) or normal C57BL/6 (B6) did not develop the tolerance to human CEA. However, the chimeric KSN nude mice transplanted simultaneously with thymus of the B6 and spleen of the B601 line became tolerant to human CEA antigen. In the case of systemic immunization with cells which had CEA antigen, the B601 line was tolerant to human CEA. Surprisingly, the B602 and BC60 lines were also tolerant to CEA molecule. These results indicate that not only the antigen present in the thymus but also the antigen which flows from the peripheral organs to the thymus may be necessary for the induction of CEA tolerance. Images Figure 1 PMID:1493931
Picchio, Mariano S; Sánchez, Vanesa R; Arcon, Nadia; Soto, Ariadna S; Perrone Sibilia, Matías; Aldirico, María de Los Angeles; Urrutia, Mariela; Moretta, Rosalía; Fenoy, Ignacio M; Goldman, Alejandra; Martin, Valentina
2018-02-01
The development of an effective and safe vaccine to prevent Toxoplasma gondii infection is an important aim due to the great clinical and economic impact of this parasitosis. We have previously demonstrated that immunization with the serine protease inhibitor-1 (TgPI-1) confers partial protection to C3H/HeN and C57BL/6 mice. In order to improve the level of protection, in this work, we combined this novel antigen with ROP2 and/or GRA4 recombinant proteins (rTgPI-1+rROP2, rTgPI-1+rGRA4, rTgPI-1+rROP2+rGRA4) to explore the best combination against chronic toxoplasmosis in C3H/HeN mice. All tested vaccine formulations, administered following a homologous prime-boost protocol that combines intradermal and intranasal routes, conferred partial protection as measured by the reduction of brain cyst burden following oral challenge with tissue cysts of Me49 T. gondii strain. The highest level of protection was achieved by the mixture of rTgPI-1 and rROP2 proteins with an average parasite burden reduction of 50% compared to the unvaccinated control group. The vaccine-induced protective effect was related to the elicitation of systemic cellular and humoral immune responses that included antigen-specific spleen cell proliferation, the release of Th1/Th2 cytokines, and the generation of antigen-specific antibodies in serum. Additionally, mucosal immune responses were also induced, characterized by secretion of antigen-specific IgA antibodies in intestinal lavages and specific mesenteric lymph node cell proliferation. Our results demonstrate that rTgPI-1+rROP2 antigens seem a promising mixture to be combined with other immunogenic proteins in a multiantigenic vaccine formulation against toxoplasmosis. Copyright © 2018 Elsevier Inc. All rights reserved.
Kintzer, Alexander F.; Sterling, Harry J.; Tang, Iok I.; Abdul-Gader, Ali; Miles, Andrew J.; Wallace, B. A.; Williams, Evan R.; Krantz, Bryan A.
2010-01-01
Anthrax is caused by strains of Bacillus anthracis that produce two key virulence factors, anthrax toxin (Atx) and a poly-γ-D-glutamic acid capsule. Atx is comprised of three-proteins: protective antigen (PA) and two enzymes, lethal factor (LF) and edema factor (EF). To disrupt cell function, these components must assemble into holotoxin complexes, which contain either a ring-shaped homooctameric or homoheptameric PA oligomer bound to multiple copies of either LF and/or EF, producing lethal toxin (LT), edema toxin, or mixtures thereof. Once a host cell endocytoses these complexes, PA converts into a membrane-inserted channel that translocates LF and EF into the cytosol. LT may assemble on host cell surfaces or extracellularly in plasma. We show that under physiological conditions in bovine plasma that LT complexes containing heptameric PA aggregate and inactivate more readily than LT complexes containing octameric PA. LT complexes containing octameric PA possess enhanced stability, channel forming activity, and macrophage cytotoxicity relative to those containing heptameric PA. Under physiological conditions, multiple biophysical probes reveal that heptameric PA can prematurely adopt the channel conformation, but octameric PA complexes remain in their soluble prechannel configuration allowing them to resist aggregation and inactivation. We conclude that PA may form an octameric oligomeric state as a means to produce a more stable and active LT complex that may circulate freely in the blood. PMID:20433851
Leukemia-associated antigens in man.
Brown, G; Capellaro, D; Greaves, M
1975-12-01
Rabbit antisera raised against acute lymphoblastic leukemia (ALL) cells were used to distinguish ALL from other leukemias, to identify rare leukemia cells in the bone marrow of patients in remission, and to define human leukemia-associated antigens. Antibody binding was studied with the use of immunofluorescence reagents and the analytic capacity of the Fluorescence Activated Cell Sorter-1 (FACS-1). The results indicated that most non-T-cell ALL have three leukemia-associated antigens on their surface which are absent from normal lymphoid cells: 1) an antigen shared with myelocytes, myeloblastic leukemia cells, and fetal liver (hematopoietic) cells; 2) an antigen shared with a subset of intermediate normoblasts in normal bone marrow and fetal liver; and 3) an antigen found thus far only on non-T-cell ALL and in some acute undifferentiated leukemias, which we therefore regard as a strong candidate for a leukemia-specific antigen. These antigens are absent from a subgroup of ALL patients in which the lymphoblasta express T-cell surface markers. Preliminary studies on the bone marrow samples of patients in remission indicated that rare leukemia cells were present in some samples. The implications of these findings with respect to the heterogeneity and cell origin(s) of ALL, its diagnosis, and its potential monitoring during treatment were discussed.
Reflective Coatings Protect People and Animals
NASA Technical Reports Server (NTRS)
2010-01-01
Led by Marshall Space Flight Center, NASA engineers called upon National Metalizing of Cranbury, New Jersey, to help create a reflective sunshield to deploy on Skylab in place of a shield that was lost during launch in 1973. Years later, a former employee for National Metalizing founded Advanced Flexible Materials (AFM) Inc., of Petaluma, California, and utilized the radiant barrier technology in the public domain to produce a variety of products such as wraps to keep marathon finishers safe from hypothermia as well as a lining for mittens and vests. Recently, the material helped to keep manatees warm as they were lifted from the water as part of a tag-and-release program.
Peptide vaccines prevent tumor growth by activating T cells that respond to native tumor antigens.
Jordan, Kimberly R; McMahan, Rachel H; Kemmler, Charles B; Kappler, John W; Slansky, Jill E
2010-03-09
Peptide vaccines enhance the response of T cells toward tumor antigens and represent a strategy to augment antigen-independent immunotherapies of cancer. However, peptide vaccines that include native tumor antigens rarely prevent tumor growth. We have assembled a set of peptide variants for a mouse-colon tumor model to determine how to improve T-cell responses. These peptides have similar affinity for MHC molecules, but differ in the affinity of the peptide-MHC/T-cell receptor interaction with a tumor-specific T-cell clone. We systematically demonstrated that effective antitumor responses are generated after vaccination with variant peptides that stimulate the largest proportion of endogenous T cells specific for the native tumor antigen. Importantly, we found some variant peptides that strongly stimulated a specific T-cell clone in vitro, but elicited fewer tumor-specific T cells in vivo, and were not protective. The T cells expanded by the effective vaccines responded to the wild-type antigen by making cytokines and killing target cells, whereas most of the T cells expanded by the ineffective vaccines only responded to the peptide variants. We conclude that peptide-variant vaccines are most effective when the peptides react with a large responsive part of the tumor-specific T-cell repertoire.
Mapping antigenic motifs in the trypomastigote small surface antigen from Trypanosoma cruzi.
Balouz, Virginia; Cámara, María de Los Milagros; Cánepa, Gaspar E; Carmona, Santiago J; Volcovich, Romina; Gonzalez, Nicolás; Altcheh, Jaime; Agüero, Fernán; Buscaglia, Carlos A
2015-03-01
The trypomastigote small surface antigen (TSSA) is a mucin-like molecule from Trypanosoma cruzi, the etiological agent of Chagas disease, which displays amino acid polymorphisms in parasite isolates. TSSA expression is restricted to the surface of infective cell-derived trypomastigotes, where it functions as an adhesin and engages surface receptors on the host cell as a prerequisite for parasite internalization. Previous results have established TSSA-CL, the isoform encoded by the CL Brener clone, as an appealing candidate for use in serology-based diagnostics for Chagas disease. Here, we used a combination of peptide- and recombinant protein-based tools to map the antigenic structure of TSSA-CL at maximal resolution. Our results indicate the presence of different partially overlapping B-cell epitopes clustering in the central portion of TSSA-CL, which contains most of the polymorphisms found in parasite isolates. Based on these results, we assessed the serodiagnostic performance of a 21-amino-acid-long peptide that spans TSSA-CL major antigenic determinants, which was similar to the performance of the previously validated glutathione S-transferase (GST)-TSSA-CL fusion molecule. Furthermore, the tools developed for the antigenic characterization of the TSSA antigen were also used to explore other potential diagnostic applications of the anti-TSSA humoral response in Chagasic patients. Overall, our present results provide additional insights into the antigenic structure of TSSA-CL and support this molecule as an excellent target for molecular intervention in Chagas disease. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Nandre, Rahul; Ruan, Xiaosai; Lu, Ti; Duan, Qiangde; Sack, David; Zhang, Weiping
2018-03-01
Enterotoxigenic Escherichia coli (ETEC) strains are a leading cause of children's diarrhea and travelers' diarrhea. Vaccines inducing antibodies to broadly inhibit bacterial adherence and to neutralize toxin enterotoxicity are expected to be effective against ETEC-associated diarrhea. 6×His-tagged adhesin-toxoid fusion proteins were shown to induce neutralizing antibodies to several adhesins and LT and STa toxins (X. Ruan, D. A. Sack, W. Zhang, PLoS One 10:e0121623, 2015, https://doi.org/10.1371/journal.pone.0121623). However, antibodies derived from His-tagged CFA/I/II/IV-2xSTa A14Q -dmLT or CFA/I/II/IV-2xSTa N12S -dmLT protein were less effective in neutralizing STa enterotoxicity and were not evaluated in vivo for efficacy against ETEC diarrhea. Additionally, His-tagged proteins are considered less desirable for human vaccines. In this study, we produced a tagless adhesin-toxoid MEFA (multiepitope fusion antigen) protein, enhanced anti-STa immunogenicity by including a third copy of STa toxoid STa N12S , and examined antigen immunogenicity in a murine model. Moreover, we immunized pregnant pigs with the tagless adhesin-toxoid MEFA protein and evaluated passive antibody protection against STa + or LT + ETEC infection in a pig challenge model. Results showed that tagless adhesin-toxoid MEFA CFA/I/II/IV-3xSTa N12S -mnLT R192G/L211A induced broad antiadhesin and antitoxin antibody responses in the intraperitoneally immunized mice and the intramuscularly immunized pigs. Mouse and pig serum antibodies significantly inhibited adherence of seven colonization factor antigen (CFA) adhesins (CFA/I and CS1 to CS6) and effectively neutralized both toxins. More importantly, suckling piglets born to the immunized mothers acquired antibodies and were protected against STa + ETEC and LT + ETEC diarrhea. These results indicated that tagless CFA/I/II/IV-3xSTa N12S -mnLT R192G/L211A induced broadly protective antiadhesin and antitoxin antibodies and demonstrate that this adhesin
Fusion Protein Vaccines Targeting Two Tumor Antigens Generate Synergistic Anti-Tumor Effects
Cheng, Wen-Fang; Chang, Ming-Cheng; Sun, Wei-Zen; Jen, Yu-Wei; Liao, Chao-Wei; Chen, Yun-Yuan; Chen, Chi-An
2013-01-01
Introduction Human papillomavirus (HPV) has been consistently implicated in causing several kinds of malignancies, and two HPV oncogenes, E6 and E7, represent two potential target antigens for cancer vaccines. We developed two fusion protein vaccines, PE(ΔIII)/E6 and PE(ΔIII)/E7 by targeting these two tumor antigens to test whether a combination of two fusion proteins can generate more potent anti-tumor effects than a single fusion protein. Materials and Methods In vivo antitumor effects including preventive, therapeutic, and antibody depletion experiments were performed. In vitro assays including intracellular cytokine staining and ELISA for Ab responses were also performed. Results PE(ΔIII)/E6+PE(ΔIII)/E7 generated both stronger E6 and E7-specific immunity. Only 60% of the tumor protective effect was observed in the PE(ΔIII)/E6 group compared to 100% in the PE(ΔIII)/E7 and PE(ΔIII)/E6+PE(ΔIII)/E7 groups. Mice vaccinated with the PE(ΔIII)/E6+PE(ΔIII)/E7 fusion proteins had a smaller subcutaneous tumor size than those vaccinated with PE(ΔIII)/E6 or PE(ΔIII)/E7 fusion proteins alone. Conclusion Fusion protein vaccines targeting both E6 and E7 tumor antigens generated more potent immunotherapeutic effects than E6 or E7 tumor antigens alone. This novel strategy of targeting two tumor antigens together can promote the development of cancer vaccines and immunotherapy in HPV-related malignancies. PMID:24058440
Linderman, Susanne L; Hensley, Scott E
2016-08-01
Human antibodies (Abs) elicited by influenza viruses often bind with a high affinity to past influenza virus strains, but paradoxically, do not bind to the viral strain actually eliciting the response. This phenomena is called 'original antigenic sin' (OAS) since this can occur at the expense of generating new de novo Abs. Here, we characterized the specificity and functionality of Abs elicited in mice that were sequentially exposed to two antigenically distinct H1N1 influenza virus strains. Many Abs elicited under these conditions had an OAS phenotype, in that they bound strongly to the viral strain used for the first exposure and very weakly to the viral strain used for the second exposure. We found that OAS and non-OAS Abs target the same general region of the influenza hemagglutinin protein and that B cells expressing these two types of Abs can be clonally-related. Surprisingly, although OAS Abs bound with very low affinities, some were able to effectively protect against an antigenically drifted viral strain following passive transfer in vivo. Taken together, our data indicate that OAS Abs share some level of cross-reactivity between priming and recall viral strains and that B cells producing these Abs can be protective when recalled into secondary immune responses.
USDA-ARS?s Scientific Manuscript database
Influenza A virus (IAV) vaccines that provide broad cross-protection against antigenic variants are necessary to prevent infection and shedding of the wide array of IAV cocirculating in swine. Whole inactivated virus (WIV) vaccines provide only partial protection against IAV with substantial antigen...
Limited antigenic variation in the Trypanosoma cruzi candidate vaccine antigen TSA-1.
Knight, J M; Zingales, B; Bottazzi, M E; Hotez, P; Zhan, B
2014-12-01
Chagas disease (American trypanosomiasis caused by Trypanosoma cruzi) is one of the most important neglected tropical diseases in the Western Hemisphere. The toxicities and limited efficacies of current antitrypanosomal drugs have prompted a search for alternative technologies such as a therapeutic vaccine comprised of T. cruzi antigens, including a recombinant antigen encoding the N-terminal 65 kDa portion of Trypomastigote surface antigen-1 (TSA-1). With at least six known genetically distinct T. cruzi lineages, variability between the different lineages poses a unique challenge for the development of broadly effective therapeutic vaccine. The variability across the major lineages in the current vaccine candidate antigen TSA-1 has not previously been addressed. To assess the variation in TSA-1, we cloned and sequenced TSA-1 from several different T. cruzi strains representing three of the most clinically relevant lineages. Analysis of the different alleles showed limited variation in TSA-1 across the different strains and fit with the current theory for the evolution of the different lineages. Additionally, minimal variation in known antigenic epitopes for the HLA-A 02 allele suggests that interlineage variation in TSA-1 would not impair the range and efficacy of a vaccine containing TSA-1. © 2014 John Wiley & Sons Ltd.
Thyroid peroxidase (TPO) expressed in thyroid and breast tissues shows similar antigenic properties.
Godlewska, Marlena; Arczewska, Katarzyna D; Rudzińska, Magdalena; Łyczkowska, Anna; Krasuska, Wanda; Hanusek, Karolina; Ruf, Jean; Kiedrowski, Mirosław; Czarnocka, Barbara
2017-01-01
Thyroid peroxidase (TPO) is essential for physiological function of the thyroid gland. The high prevalence of thyroid peroxidase antibodies (TPOAbs) in patients with breast cancer and their protective role had previously been demonstrated, indicating a link between breast cancer and thyroid autoimmunity. Recently, TPO was shown to be present in breast cancer tissue samples but its antigenicity has not been analyzed. In this study, we investigated TPO expression levels in a series of fifty-six breast cancer samples paired with normal (peri-tumoral) tissue and its antigenic activity using a panel of well-characterized murine anti-human TPOAbs. We have shown that TPO transcripts were present in both normal and cancer tissue samples, although the amounts in the latter were reduced. Additionally, we observed that TPO levels are lower in more advanced cancers. TPO protein expression was confirmed in all tissue samples, both normal and cancerous. We also found that the antigenicity of the immunodominant regions (IDRs) in breast TPO resembles that of thyroid TPO, which is crucial for effective interactions with human TPOAbs. Expression of TPO in breast cancer together with its antigenic activity may have beneficial effects in TPOAb-positive breast cancer patients. However, further studies are needed to confirm the beneficial role of TPOAbs and to better understand the underlying mechanism.
Sellami, Mohamed Hichem; Chaabane, Manel; Kaabi, Houda; Torjemane, Lamia; Ladeb, Saloua; Ben Othmane, Tarek; Hmida, Slama
2012-03-01
FY antigens are candidate minor histocompatibility antigens relevant to renal allograft rejection, but no data have been reported about their role in graft-versus-host disease (GVHD) incidence after human leukocyte antigen (HLA)-identical siblings hematopoietic stem cell transplantation (HSCT). The aim of this study was to examine the effect of donor/recipient disparity at FY antigens on the incidence of GVHD in Tunisian patients receiving an HLA-identical HSCT. This work enrolled 105 Tunisian pairs of recipients and their HLA-identical sibling donors of HSCs. FY genotyping was performed with the polymerase chain reaction-sequence-specific primer method and donor/recipient disparity for these antigens was analyzed at two levels: incompatibility and nonidentity. The case-control analyses showed no significant correlation between FY disparity and the incidence of either acute or chronic GVHD. Sample size calculation showed that 572 cases and 1716 controls would be necessary to be able to detect a significant association with 80% power and two-sided type I error level of 5% (α=0.05). The lack of association in the studied cohort may be explained by the low immunogenicity of FY antigens in HSCT context, compared with other antigens such as HA-1 and CD31.
Reiman, Jennifer M; Kumar, Sanjai; Rodriguez, Ingrid B; Gnidehou, Sedami; Ito, Koichi; Stanisic, Danielle I; Lee, Moses; McPhun, Virginia; Majam, Victoria; Willemsen, Nicole M; Batzloff, Michael R; Raja, Amber I; Dooley, Brad; Hoffman, Stephen L; Yanow, Stephanie K; Good, Michael F
2018-01-01
Blood stage malaria parasites attenuated with seco-cyclopropyl pyrrolo indole (CPI) analogues induce robust immunity in mice to homologous and heterologous malaria parasites and are being considered for the development of a human vaccine. However, it is not understood how attenuated parasites induce immunity. We showed that following vaccination, parasite DNA persisted in blood for several months, raising the possibility that ongoing immune stimulation may be critical. However, parasites were not seen microscopically beyond 24 h postvaccination. We aimed to provide a mechanistic understanding of immune induction. Mice were vaccinated with chemically attenuated Plasmodium chabaudi parasites. PCR and adoptive transfer studies were used to determine the presence of parasites and antigen in vivo . In other experiments, Plasmodium falciparum parasitised red blood cells were attenuated in vitro and RNA and antigen expression studied. We show that blood transferred from vaccinated mice into naïve mice activates T cells and induces complete protective immunity in the recipient mice strongly suggesting that there is persistence of parasite antigen postvaccination. This is supported by the presence of parasite RNA in vaccinated mice and both RNA and antigen expression in P. falciparum cultures treated with CPI drugs in vitro . In addition, drugs that block parasite growth also prevent the induction of immunity in vaccinated mice, indicating that some growth of attenuated parasites is required for immune induction. Attenuated parasites persist at submicroscopic levels in the blood of mice postvaccination with the ability to activate T cells and induce ongoing protective immune responses.
Identification of immune signatures predictive of clinical protection from malaria.
Valletta, John Joseph; Recker, Mario
2017-10-01
Antibodies are thought to play an essential role in naturally acquired immunity to malaria. Prospective cohort studies have frequently shown how continuous exposure to the malaria parasite Plasmodium falciparum cause an accumulation of specific responses against various antigens that correlate with a decreased risk of clinical malaria episodes. However, small effect sizes and the often polymorphic nature of immunogenic parasite proteins make the robust identification of the true targets of protective immunity ambiguous. Furthermore, the degree of individual-level protection conferred by elevated responses to these antigens has not yet been explored. Here we applied a machine learning approach to identify immune signatures predictive of individual-level protection against clinical disease. We find that commonly assumed immune correlates are poor predictors of clinical protection in children. On the other hand, antibody profiles predictive of an individual's malaria protective status can be found in data comprising responses to a large set of diverse parasite proteins. We show that this pattern emerges only after years of continuous exposure to the malaria parasite, whereas susceptibility to clinical episodes in young hosts (< 10 years) cannot be ascertained by measured antibody responses alone.
Identification of immune signatures predictive of clinical protection from malaria
2017-01-01
Antibodies are thought to play an essential role in naturally acquired immunity to malaria. Prospective cohort studies have frequently shown how continuous exposure to the malaria parasite Plasmodium falciparum cause an accumulation of specific responses against various antigens that correlate with a decreased risk of clinical malaria episodes. However, small effect sizes and the often polymorphic nature of immunogenic parasite proteins make the robust identification of the true targets of protective immunity ambiguous. Furthermore, the degree of individual-level protection conferred by elevated responses to these antigens has not yet been explored. Here we applied a machine learning approach to identify immune signatures predictive of individual-level protection against clinical disease. We find that commonly assumed immune correlates are poor predictors of clinical protection in children. On the other hand, antibody profiles predictive of an individual’s malaria protective status can be found in data comprising responses to a large set of diverse parasite proteins. We show that this pattern emerges only after years of continuous exposure to the malaria parasite, whereas susceptibility to clinical episodes in young hosts (< 10 years) cannot be ascertained by measured antibody responses alone. PMID:29065113
Sarmiento, Rosa E; Tirado, Rocio G; Valverde, Laura E; Gómez-Garcia, Beatriz
2007-01-01
Background The binding of viral-specific antibodies to cell-surface antigens usually results in down modulation of the antigen through redistribution of antigens into patches that subsequently may be internalized by endocytosis or may form caps that can be expelled to the extracellular space. Here, by use of confocal-laser-scanning microscopy we investigated the kinetics of the modulation of respiratory syncytial virus (RSV) antigen by RSV-specific IgG. RSV-infected human epithelial cells (HEp-2) were incubated with anti-RSV polyclonal IgG and, at various incubation times, the RSV-cell-surface-antigen-antibody complexes (RSV Ag-Abs) and intracellular viral proteins were detected by indirect immunoflourescence. Results Interaction of anti-RSV polyclonal IgG with RSV HEp-2 infected cells induced relocalization and aggregation of viral glycoproteins in the plasma membrane formed patches that subsequently produced caps or were internalized through clathrin-mediated endocytosis participation. Moreover, the concentration of cell surface RSV Ag-Abs and intracellular viral proteins showed a time dependent cyclic variation and that anti-RSV IgG protected HEp-2 cells from viral-induced death. Conclusion The results from this study indicate that interaction between RSV cell surface proteins and specific viral antibodies alter the expression of viral antigens expressed on the cells surface and intracellular viral proteins; furthermore, interfere with viral induced destruction of the cell. PMID:17608950
Byrd, Wyatt; Boedeker, Edgar C
2013-03-15
Although enterotoxigenic Escherichia coli (ETEC) infections are important causes of infantile and traveler's diarrhea there is no licensed vaccine available for those at-risk. Our goal is to develop a safe, live attenuated ETEC vaccine. We used an attenuated E. coli strain (O157:H7, Δ-intimin, Stx1-neg, Stx2-neg) as a vector (ZCR533) to prepare two vaccine strains, one strain expressing colonization factor antigen I (ZCR533-CFA/I) and one strain expressing CFA/I and a detoxified heat-labile enterotoxin (ZCR533-CFA/I+LThK63) to deliver ETEC antigens to mucosal sites in BALB/c mice. Following intranasal and intragastric immunization with the vaccine strains, serum IgG and IgA antibodies were measured to the CFA/I antigen, however, only serum IgG antibodies were detected to the heat-labile enterotoxin. Intranasal administration of the vaccine strains induced respiratory and intestinal antibody responses to the CFA/I and LT antigens, while intragastric administration induced only intestinal antibody responses with no respiratory antibodies detected to the CFA/I and LT antigens. Mice immunized intranasally with the vaccine strains showed enhanced clearance of wild-type (wt) ETEC bacteria from the lungs. Mice immunized intranasally and intragastrically with the vaccine strains were protected from intestinal colonization following oral challenge with ETEC wt bacteria. Mice immunized intragastrically with the ZCR533-CFA/I+LThK63 vaccine strain had less fluid accumulate in their intestine following challenge with ETEC wt bacteria or with purified LT as compared to the sham mice indicating that the immunized mice were protected from LT-induced intestinal fluid accumulation. Thus, mice intragastrically immunized with the ZCR533-CFA/I+LThK63 vaccine strain were able to effectively neutralize the activity of the LT enterotoxin. However, no difference in intestinal fluid accumulation was detected in the mice immunized intranasally with the vaccine strain as compared to the sham
USDA-ARS?s Scientific Manuscript database
Delivery of various forms of recombinant Theileria parva sporozoite antigen (p67) has been shown to elicit antibody responses in cattle capable of providing protection against East Coast fever, the clinical disease caused by T. parva. Previous formulations of full-length and shorter recombinant vers...
Influenza Virus-Like Particles Containing M2 Induce Broadly Cross Protective Immunity
Song, Jae-Min; Wang, Bao-Zhong; Park, Kyoung-Mi; Van Rooijen, Nico; Quan, Fu-Shi; Kim, Min-Chul; Jin, Hyun-Tak; Pekosz, Andrew; Compans, Richard W.; Kang, Sang-Moo
2011-01-01
Background Current influenza vaccines based on the hemagglutinin protein are strain specific and do not provide good protection against drifted viruses or emergence of new pandemic strains. An influenza vaccine that can confer cross-protection against antigenically different influenza A strains is highly desirable for improving public health. Methodology/Principal Findings To develop a cross protective vaccine, we generated influenza virus-like particles containing the highly conserved M2 protein in a membrane-anchored form (M2 VLPs), and investigated their immunogenicity and breadth of cross protection. Immunization of mice with M2 VLPs induced anti-M2 antibodies binding to virions of various strains, M2 specific T cell responses, and conferred long-lasting cross protection against heterologous and heterosubtypic influenza viruses. M2 immune sera were found to play an important role in providing cross protection against heterosubtypic virus and an antigenically distinct 2009 pandemic H1N1 virus, and depletion of dendritic and macrophage cells abolished this cross protection, providing new insight into cross-protective immune mechanisms. Conclusions/Significance These results suggest that presenting M2 on VLPs in a membrane-anchored form is a promising approach for developing broadly cross protective influenza vaccines. PMID:21267073
Lokhandwala, Shehnaz; Waghela, Suryakant D; Bray, Jocelyn; Sangewar, Neha; Charendoff, Chloe; Martin, Cameron L; Hassan, Wisam S; Koynarski, Tsvetoslav; Gabbert, Lindsay; Burrage, Thomas G; Brake, David; Neilan, John; Mwangi, Waithaka
2017-01-01
African Swine Fever Virus (ASFV) is a high-consequence transboundary animal pathogen that often causes hemorrhagic disease in swine with a case fatality rate close to 100%. Lack of treatment or vaccine for the disease makes it imperative that safe and efficacious vaccines are developed to safeguard the swine industry. In this study, we evaluated the immunogenicity of seven adenovirus-vectored novel ASFV antigens, namely A151R, B119L, B602L, EP402RΔPRR, B438L, K205R and A104R. Immunization of commercial swine with a cocktail of the recombinant adenoviruses formulated in adjuvant primed strong ASFV antigen-specific IgG responses that underwent rapid recall upon boost. Notably, most vaccinees mounted robust IgG responses against all the antigens in the cocktail. Most importantly and relevant to vaccine development, the induced antibodies recognized viral proteins from Georgia 2007/1 ASFV-infected cells by IFA and by western blot analysis. The recombinant adenovirus cocktail also induced ASFV-specific IFN-γ-secreting cells that were recalled upon boosting. Evaluation of local and systemic effects of the recombinant adenovirus cocktail post-priming and post-boosting in the immunized animals showed that the immunogen was well tolerated and no serious negative effects were observed. Taken together, these outcomes showed that the adenovirus-vectored novel ASFV antigen cocktail was capable of safely inducing strong antibody and IFN-γ+ cell responses in commercial swine. The data will be used for selection of antigens for inclusion in a multi-antigen prototype vaccine to be evaluated for protective efficacy.
Adenovirus-vectored novel African Swine Fever Virus antigens elicit robust immune responses in swine
Waghela, Suryakant D.; Bray, Jocelyn; Sangewar, Neha; Charendoff, Chloe; Martin, Cameron L.; Hassan, Wisam S.; Koynarski, Tsvetoslav; Gabbert, Lindsay; Burrage, Thomas G.; Brake, David; Neilan, John; Mwangi, Waithaka
2017-01-01
African Swine Fever Virus (ASFV) is a high-consequence transboundary animal pathogen that often causes hemorrhagic disease in swine with a case fatality rate close to 100%. Lack of treatment or vaccine for the disease makes it imperative that safe and efficacious vaccines are developed to safeguard the swine industry. In this study, we evaluated the immunogenicity of seven adenovirus-vectored novel ASFV antigens, namely A151R, B119L, B602L, EP402RΔPRR, B438L, K205R and A104R. Immunization of commercial swine with a cocktail of the recombinant adenoviruses formulated in adjuvant primed strong ASFV antigen-specific IgG responses that underwent rapid recall upon boost. Notably, most vaccinees mounted robust IgG responses against all the antigens in the cocktail. Most importantly and relevant to vaccine development, the induced antibodies recognized viral proteins from Georgia 2007/1 ASFV-infected cells by IFA and by western blot analysis. The recombinant adenovirus cocktail also induced ASFV-specific IFN-γ-secreting cells that were recalled upon boosting. Evaluation of local and systemic effects of the recombinant adenovirus cocktail post-priming and post-boosting in the immunized animals showed that the immunogen was well tolerated and no serious negative effects were observed. Taken together, these outcomes showed that the adenovirus-vectored novel ASFV antigen cocktail was capable of safely inducing strong antibody and IFN-γ+ cell responses in commercial swine. The data will be used for selection of antigens for inclusion in a multi-antigen prototype vaccine to be evaluated for protective efficacy. PMID:28481911
Reglinski, Mark; Lynskey, Nicola N; Choi, Yoon Jung; Edwards, Robert J; Sriskandan, Shiranee
2016-04-01
Despite over a century of research and the careful scrutiny of many promising targets, there is currently no vaccine available for the prevention of Streptococcus pyogenes infection. Through analysis of the protective, anti-streptococcal components of pooled human immunoglobulin, we previously identified ten highly conserved and invariant S. pyogenes antigens that contribute to anti-streptococcal immunity in the adult population. We sought to emulate population immunity to S. pyogenes through a process of active vaccination, using the antigens targeted by pooled human immunoglobulin. Seven targets were produced recombinantly and mixed to form a multicomponent vaccine (Spy7). Vaccinated mice were challenged with S. pyogenes isolates representing four globally relevant serotypes (M1, M3, M12 and M89) using an established model of invasive disease. Vaccination with Spy7 stimulated the production of anti-streptococcal antibodies, and limited systemic dissemination of M1 and M3 S. pyogenes from an intramuscular infection focus. Vaccination additionally attenuated disease severity due to M1 S. pyogenes as evidenced by reduction in weight loss, and modulated cytokine release. Spy7 vaccination successfully stimulated the generation of protective anti-streptococcal immunity in vivo. Identification of reactive antigens using pooled human immunoglobulin may represent a novel route to vaccine discovery for extracellular bacteria. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
Reglinski, Mark; Lynskey, Nicola N.; Choi, Yoon Jung; Edwards, Robert J.; Sriskandan, Shiranee
2016-01-01
Summary Objectives Despite over a century of research and the careful scrutiny of many promising targets, there is currently no vaccine available for the prevention of Streptococcus pyogenes infection. Through analysis of the protective, anti-streptococcal components of pooled human immunoglobulin, we previously identified ten highly conserved and invariant S. pyogenes antigens that contribute to anti-streptococcal immunity in the adult population. We sought to emulate population immunity to S. pyogenes through a process of active vaccination, using the antigens targeted by pooled human immunoglobulin. Methods Seven targets were produced recombinantly and mixed to form a multicomponent vaccine (Spy7). Vaccinated mice were challenged with S. pyogenes isolates representing four globally relevant serotypes (M1, M3, M12 and M89) using an established model of invasive disease. Results Vaccination with Spy7 stimulated the production of anti-streptococcal antibodies, and limited systemic dissemination of M1 and M3 S. pyogenes from an intramuscular infection focus. Vaccination additionally attenuated disease severity due to M1 S. pyogenes as evidenced by reduction in weight loss, and modulated cytokine release. Conclusion Spy7 vaccination successfully stimulated the generation of protective anti-streptococcal immunity in vivo. Identification of reactive antigens using pooled human immunoglobulin may represent a novel route to vaccine discovery for extracellular bacteria. PMID:26880087
NASA Astrophysics Data System (ADS)
Lu, Yichen; Friedman, Rachel; Kushner, Nicholas; Doling, Amy; Thomas, Lawrence; Touzjian, Neal; Starnbach, Michael; Lieberman, Judy
2000-07-01
Bacillus anthrax lethal toxin can be engineered to deliver foreign proteins to the cytosol for antigen presentation to CD8 T cells. Vaccination with modified toxins carrying 8-9 amino acid peptide epitopes induces protective immunity in mice. To evaluate whether large protein antigens can be used with this system, recombinant constructs encoding several HIV antigens up to 500 amino acids were produced. These candidate HIV vaccines are safe in animals and induce CD8 T cells in mice. Constructs encoding gag p24 and nef stimulate gag-specific CD4 proliferation and a secondary cytotoxic T lymphocyte response in HIV-infected donor peripheral blood mononuclear cells in vitro. These results lay the foundation for future clinical vaccine studies.
Potter, A A; Babiuk, L A
2001-11-01
Vaccination of individuals has been practiced for many years and has been one of the most effective methods of controlling infectious diseases. Unfortunately, even with this success, society continues to suffer multi-billion dollar economic losses annually due to infectious diseases. These losses occur in all animal species as well as in humans. In order to further reduce these losses, academicians and companies are employing the multidisciplinary approach to develop better and safer vaccines. These include capitalizing on advances in molecular biology, chemistry, pharmacy, immunology, genomics, proteomics, and fermentation. Thus, we are moving from a more empirical approach to vaccine production to a more focused, and, hopefully, more logical approach to identification and production of protective antigens. Furthermore, formulation and delivery of these antigens in playing a major role in revolutionizing how we deliver vaccines to induce the most appropriate immune response and ensure protection. The current review summarizes some of these advances and speculates as to how future vaccines will be produced and delivered for the benefit of society.
Medina, Rafael A.; Stertz, Silke; Manicassamy, Balaji; Zimmermann, Petra; Sun, Xiangjie; Albrecht, Randy A.; Uusi-Kerttula, Hanni; Zagordi, Osvaldo; Belshe, Robert B.; Frey, Sharon E.; Eggink, Dirk; Tumpey, Terrence M.; García-Sastre, Adolfo
2014-01-01
The global spread of the 2009 pandemic H1N1 (pH1N1) virus in humans increases the likelihood that this influenza virus strain could undergo antigenic drift in the coming years. Previous seasonal H1N1 and H3N2 influenza strains acquired additional glycosylations in the globular head of their hemagglutinin (HA) proteins as they evolved over time; these are believed to shield antigenically relevant regions. We used influenza A/Netherlands/602/2009 recombinant (rpH1N1) viruses to which we added additional HA glycosylation sites reflecting their temporal appearance in previous seasonal H1N1 viruses. Additional glycosylations resulted in substantial attenuation in mice and ferrets, while deleting HA glycosylation sites from a pre-pandemic 1991 seasonal H1N1 influenza virus resulted in increased pathogenicity in mice. Sera from mice infected with wild type (WT) rpH1N1 virus showed a considerable loss of HA inhibitory (HI) activity against rpH1N1 viruses glycosylated at sites 144 or 144-172, indicating that the polyclonal antibody response elicited by WT rpH1N1 HA seems to be directed against an immunodominant region, likely site Sa, shielded by glycosylation at 144. Sera from humans vaccinated with the pH1N1 inactivated vaccine also showed reduced activity against the 144 and 144-172 mutant viruses. Remarkably, the HI activity of sera from virus-infected mice demonstrated that glycosylation at position 144 resulted in the induction of a broader polyclonal response able to cross-neutralize all WT and glycosylation mutant pH1N1 viruses. Mice infected with a recent seasonal virus in which glycosylation sites 71, 142 and 177 were removed, elicited antibodies that protected against challenge with the antigenically distant pH1N1 virus. Thus, acquisition of glycosylation sites in the HA of H1N1 human influenza viruses not only affects their pathogenicity and ability to escape from polyclonal antibodies elicited by previous influenza virus strains, but also their ability to
Investigation on Sugar-Protein Connectivity in Salmonella O-Antigen Glycoconjugate Vaccines.
De Benedetto, Gianluigi; Salvini, Laura; Gotta, Stefano; Cescutti, Paola; Micoli, Francesca
2018-05-16
Invasive nontyphoidal Salmonella disease, for which licensed vaccines are not available, is a leading cause of bloodstream infections in Africa. The O-antigen portion of lipopolysaccharide is a good target for protective immunity. Covalent conjugation of the O-antigen to a carrier protein increases its immunogenicity and O-antigen based glycoconjugate vaccines are currently under investigation at the preclinical stage. We developed a conjugation chemistry for linking O-antigen to CRM 197 carrier protein, through sequential insertion of adipic acid dihydrazide (ADH) and adipic acid bis( N-hydroxysuccinimide) ester (SIDEA) as linkers, without impacting O-antigen chain epitopes. Here the resulting sugar-protein connectivity has been investigated in detail. The core portion of the lipopolysaccharide was used as a model molecule to prepare CRM 197 conjugates, making structural investigations easier. The first step of reductive amination with ADH involves the terminal 3-deoxy-d- manno-oct-2-ulosonic acid (KDO) residue of the core region. The second reaction step resulted not to be selective, as SIDEA reacted with both ADH and pyrophosphorylethanolamine (PPEtN) of the core region, independently from the pH at which the reaction was performed. Peptide mapping analysis of the deglycosylated core-CRM 197 conjugates confirmed that lysine residues of CRM 197 were linked to SIDEA not only through KDO-ADH but also through PPEtN. This analysis also confirmed that the conjugation chemistry is random on the protein, involving a large number of lysine residues, particularly the surface exposed ones. The method for core-CRM 197 characterization was successfully extended to O-antigen-CRM 197 conjugate, confirming the results obtained with the core. This study not only allowed full characterization of OAg-CRM 197 conjugates, but can be applied to optimize synthesis and characterization of other OAg-based glycoconjugate vaccines. Analytical methods to investigate saccharide
2013-01-01
The efficacious delivery of antigens to antigen-presenting cells (APCs), in particular, to dendritic cells (DCs), and their subsequent activation remains a significant challenge in the development of effective vaccines. This study highlights the potential of dissolving microneedle (MN) arrays laden with nanoencapsulated antigen to increase vaccine immunogenicity by targeting antigen specifically to contiguous DC networks within the skin. Following in situ uptake, skin-resident DCs were able to deliver antigen-encapsulated poly-d,l-lactide-co-glycolide (PGLA) nanoparticles to cutaneous draining lymph nodes where they subsequently induced significant expansion of antigen-specific T cells. Moreover, we show that antigen-encapsulated nanoparticle vaccination via microneedles generated robust antigen-specific cellular immune responses in mice. This approach provided complete protection in vivo against both the development of antigen-expressing B16 melanoma tumors and a murine model of para-influenza, through the activation of antigen-specific cytotoxic CD8+ T cells that resulted in efficient clearance of tumors and virus, respectively. In addition, we show promising findings that nanoencapsulation facilitates antigen retention into skin layers and provides antigen stability in microneedles. Therefore, the use of biodegradable polymeric nanoparticles for selective targeting of antigen to skin DC subsets through dissolvable MNs provides a promising technology for improved vaccination efficacy, compliance, and coverage. PMID:23373658
Monaris, D.; Sbrogio-Almeida, M. E.; Dib, C. C.; Canhamero, T. A.; Souza, G. O.; Vasconcellos, S. A.; Ferreira, L. C. S.
2015-01-01
Leptospirosis is a global zoonotic disease caused by different Leptospira species, such as Leptospira interrogans, that colonize the renal tubules of wild and domestic animals. Thus far, attempts to develop effective leptospirosis vaccines, both for humans and animals, have failed to induce immune responses capable of conferring protection and simultaneously preventing renal colonization. In this study, we evaluated the protective immunity induced by subunit vaccines containing seven different recombinant Leptospira interrogans outer membrane proteins, including the carboxy-terminal portion of the immunoglobulinlike protein A (LigAC) and six novel antigens, combined with aluminum hydroxide (alum) or Salmonella flagellin (FliC) as adjuvants. Hamsters vaccinated with the different formulations elicited high antigen-specific antibody titers. Immunization with LigAC, either with alum or flagellin, conferred protective immunity but did not prevent renal colonization. Similarly, animals immunized with LigAC or LigAC coadministered with six leptospiral proteins with alum adjuvant conferred protection but did not reduce renal colonization. In contrast, immunizing animals with the pool of seven antigens in combination with flagellin conferred protection and significantly reduced renal colonization by the pathogen. The present study emphasizes the relevance of antigen composition and added adjuvant in the efficacy of antileptospirosis subunit vaccines and shows the complex relationship between immune responses and renal colonization by the pathogen. PMID:26108285
Integrating influenza antigenic dynamics with molecular evolution
Bedford, Trevor; Suchard, Marc A; Lemey, Philippe; Dudas, Gytis; Gregory, Victoria; Hay, Alan J; McCauley, John W; Russell, Colin A; Smith, Derek J; Rambaut, Andrew
2014-01-01
Influenza viruses undergo continual antigenic evolution allowing mutant viruses to evade host immunity acquired to previous virus strains. Antigenic phenotype is often assessed through pairwise measurement of cross-reactivity between influenza strains using the hemagglutination inhibition (HI) assay. Here, we extend previous approaches to antigenic cartography, and simultaneously characterize antigenic and genetic evolution by modeling the diffusion of antigenic phenotype over a shared virus phylogeny. Using HI data from influenza lineages A/H3N2, A/H1N1, B/Victoria and B/Yamagata, we determine patterns of antigenic drift across viral lineages, showing that A/H3N2 evolves faster and in a more punctuated fashion than other influenza lineages. We also show that year-to-year antigenic drift appears to drive incidence patterns within each influenza lineage. This work makes possible substantial future advances in investigating the dynamics of influenza and other antigenically-variable pathogens by providing a model that intimately combines molecular and antigenic evolution. DOI: http://dx.doi.org/10.7554/eLife.01914.001 PMID:24497547
Bayoumi, R A
1987-03-01
It is proposed that the in vivo mechanism of protection against falciparum malaria in individuals of the Hb AS genotype is not due solely to the adverse influence of Hb AS erythrocytes on the intraerythrocytic growth and development of P. falciparum. Instead, the simple physiological effect of Hb S on parasite growth appears to trigger an in vivo process of enhancement of the intensity and/or specificity of the host immune response, leading to acquired protective immunity, in a process simulating vaccination. Testing the hypothesis may lead to the identification of plasmodial antigens that induce protective responses in the human host and distinguish them from non-protective, immunosuppressive or decoy antigens that promote parasite survival. This may ultimately help in the selection of candidate antigens for a malaria blood-stage vaccine.
Zhang, Congcong; Oberoi, Pranav; Oelsner, Sarah; Waldmann, Anja; Lindner, Aline; Tonn, Torsten; Wels, Winfried S
2017-01-01
Significant progress has been made in recent years toward realizing the potential of natural killer (NK) cells for cancer immunotherapy. NK cells can respond rapidly to transformed and stressed cells and have the intrinsic potential to extravasate and reach their targets in almost all body tissues. In addition to donor-derived primary NK cells, also the established NK cell line NK-92 is being developed for adoptive immunotherapy, and general safety of infusion of irradiated NK-92 cells has been established in phase I clinical trials with clinical responses observed in some of the cancer patients treated. To enhance their therapeutic utility, NK-92 cells have been modified to express chimeric antigen receptors (CARs) composed of a tumor-specific single chain fragment variable antibody fragment fused via hinge and transmembrane regions to intracellular signaling moieties such as CD3ζ or composite signaling domains containing a costimulatory protein together with CD3ζ. CAR-mediated activation of NK cells then bypasses inhibitory signals and overcomes NK resistance of tumor cells. In contrast to primary NK cells, CAR-engineered NK-92 cell lines suitable for clinical development can be established from molecularly and functionally well-characterized single cell clones following good manufacturing practice-compliant procedures. In preclinical in vitro and in vivo models, potent antitumor activity of NK-92 variants targeted to differentiation antigens expressed by hematologic malignancies, and overexpressed or mutated self-antigens associated with solid tumors has been found, encouraging further development of CAR-engineered NK-92 cells. Importantly, in syngeneic mouse tumor models, induction of endogenous antitumor immunity after treatment with CAR-expressing NK-92 cells has been demonstrated, resulting in cures and long-lasting immunological memory protecting against tumor rechallenge at distant sites. Here, we summarize the current status and future prospects of CAR
Zhang, Congcong; Oberoi, Pranav; Oelsner, Sarah; Waldmann, Anja; Lindner, Aline; Tonn, Torsten; Wels, Winfried S.
2017-01-01
Significant progress has been made in recent years toward realizing the potential of natural killer (NK) cells for cancer immunotherapy. NK cells can respond rapidly to transformed and stressed cells and have the intrinsic potential to extravasate and reach their targets in almost all body tissues. In addition to donor-derived primary NK cells, also the established NK cell line NK-92 is being developed for adoptive immunotherapy, and general safety of infusion of irradiated NK-92 cells has been established in phase I clinical trials with clinical responses observed in some of the cancer patients treated. To enhance their therapeutic utility, NK-92 cells have been modified to express chimeric antigen receptors (CARs) composed of a tumor-specific single chain fragment variable antibody fragment fused via hinge and transmembrane regions to intracellular signaling moieties such as CD3ζ or composite signaling domains containing a costimulatory protein together with CD3ζ. CAR-mediated activation of NK cells then bypasses inhibitory signals and overcomes NK resistance of tumor cells. In contrast to primary NK cells, CAR-engineered NK-92 cell lines suitable for clinical development can be established from molecularly and functionally well-characterized single cell clones following good manufacturing practice-compliant procedures. In preclinical in vitro and in vivo models, potent antitumor activity of NK-92 variants targeted to differentiation antigens expressed by hematologic malignancies, and overexpressed or mutated self-antigens associated with solid tumors has been found, encouraging further development of CAR-engineered NK-92 cells. Importantly, in syngeneic mouse tumor models, induction of endogenous antitumor immunity after treatment with CAR-expressing NK-92 cells has been demonstrated, resulting in cures and long-lasting immunological memory protecting against tumor rechallenge at distant sites. Here, we summarize the current status and future prospects of CAR
Antigen vehiculization particles based on the Z protein of Junin virus.
Borio, Cristina S; Bilen, Marcos F; Argüelles, Marcelo H; Goñi, Sandra E; Iserte, Javier A; Glikmann, Graciela; Lozano, Mario E
2012-11-02
Arenavirus matrix protein Z plays an important role in virus budding and is able to generate enveloped virus-like-particles (VLPs) in absence of any other viral proteins. In these VLPs, Z protein is associated to the plasma membrane inner surface by its myristoyl residue. Budding induction and vesicle formation properties can be exploited to generate enveloped VLPs platform. These structures can be designed to carry specific antigen in the inner side or on the surface of VLPs.Vaccines based on VLPs are a highly effective type of subunit vaccines that mimic the overall structure of virus particles in absence of viral nucleic acid, being noninfectious.In this work we assayed the capacity of Junin Z protein to produce VLPs carrying the green fluorescent protein (eGFP), as a model antigen. In this report the Junin Z protein ability to produce VLPs from 293T cells and its capacity to deliver a specific antigen (eGFP) fused to Z was evaluated. Confocal microscopy showed a particular membrane bending in cells expressing Z and a spot welded distribution in the cytoplasm. VLPs were detected by TEM (transmission electron microscopy) and were purified from cell supernatant. The proteinase protection assay demonstrated the VLPs integrity and the absence of degradation of the fused antigen, thus indicating its internal localization. Finally, immunization of mice with purified VLPs produced high titres of anti-eGFP antibodies compared to the controls. It was proved that VLPs can be generated from cells transfected with a fusion Junin virus Z-eGFP protein in absence of any other viral protein, and the capacity of Z protein to support fusions at the C-terminal, without impairing its budding activity, allowing vehiculization of specific antigens into VLPs.
Chemotherapy Enhances Cross-Presentation of Nuclear Tumor Antigens
Anyaegbu, Chidozie C.; Lake, Richard A.; Heel, Kathy; Robinson, Bruce W.; Fisher, Scott A.
2014-01-01
Cross-presentation of tumor antigen is essential for efficient priming of naïve CD8+ T lymphocytes and induction of effective anti-tumor immunity. We hypothesized that the subcellular location of a tumor antigen could affect the efficiency of cross-presentation, and hence the outcome of anti-tumor responses to that antigen. We compared cross-presentation of a nominal antigen expressed in the nuclear, secretory, or cytoplasmic compartments of B16 melanoma tumors. All tumors expressed similar levels of the antigen. The antigen was cross-presented from all compartments but when the concentration was low, nuclear antigen was less efficiently cross-presented than antigen from other cellular locations. The efficiency of cross-presentation of the nuclear antigen was improved following chemotherapy-induced tumor cell apoptosis and this correlated with an increase in the proportion of effector CTL. These data demonstrate that chemotherapy improves nuclear tumor antigen cross-presentation and could be important for anti-cancer immunotherapies that target nuclear antigens. PMID:25243472
Antigenic Drift Defines a New D4 Subgenotype of Measles Virus.
Muñoz-Alía, Miguel Ángel; Muller, Claude P; Russell, Stephen J
2017-06-01
The measles virus hemagglutinin (MeV-H) protein is the main target of protective neutralizing antibodies. Using a panel of monoclonal antibodies (MAbs) that recognize known major antigenic sites in MeV-H, we identified a D4 genotype variant that escapes neutralization by MAbs targeting the neutralizing epitope (NE) antigenic site. By site-directed mutagenesis, L249P was identified as the critical mutation disrupting the NE in this genotype D4 variant. Forty-two available D4 genotype gene sequences were subsequently analyzed and divided into 2 groups according to the presence or absence of the L249P MeV-H mutation. Further analysis of the MeV-N gene sequences of these 2 groups confirmed that they represent clearly definable, sequence-divergent D4 subgenotypes, which we named subgenotypes D4.1 and D4.2. The subgenotype D4.1 MeVs were isolated predominantly in Kenya and Ethiopia, whereas the MAb-resistant subgenotype D4.2 MeVs were isolated predominantly in France and Great Britain, countries with higher vaccine coverage rates. Interestingly, D4.2 subgenotype viruses showed a trend toward diminished susceptibility to neutralization by human sera pooled from approximately 60 to 80 North American donors. Escape from MAb neutralization may be a powerful epidemiological surveillance tool to monitor the evolution of new MeV subgenotypes. IMPORTANCE Measles virus is a paradigmatic RNA virus, as the antigenic composition of the vaccination has not needed to be updated since its discovery. The vaccine confers protection by inducing neutralizing antibodies that interfere with the function of the hemagglutinin protein. Viral strains are indistinguishable serologically, although characteristic nucleotide sequences differentiate 24 genotypes. In this work, we describe a distant evolutionary branch within genotype D4. Designated subgenotype D4.2, this virus is distinguishable by neutralization with vaccine-induced monoclonal antibodies that target the neutralizing epitope (NE
Antigenic Drift Defines a New D4 Subgenotype of Measles Virus
Muller, Claude P.
2017-01-01
ABSTRACT The measles virus hemagglutinin (MeV-H) protein is the main target of protective neutralizing antibodies. Using a panel of monoclonal antibodies (MAbs) that recognize known major antigenic sites in MeV-H, we identified a D4 genotype variant that escapes neutralization by MAbs targeting the neutralizing epitope (NE) antigenic site. By site-directed mutagenesis, L249P was identified as the critical mutation disrupting the NE in this genotype D4 variant. Forty-two available D4 genotype gene sequences were subsequently analyzed and divided into 2 groups according to the presence or absence of the L249P MeV-H mutation. Further analysis of the MeV-N gene sequences of these 2 groups confirmed that they represent clearly definable, sequence-divergent D4 subgenotypes, which we named subgenotypes D4.1 and D4.2. The subgenotype D4.1 MeVs were isolated predominantly in Kenya and Ethiopia, whereas the MAb-resistant subgenotype D4.2 MeVs were isolated predominantly in France and Great Britain, countries with higher vaccine coverage rates. Interestingly, D4.2 subgenotype viruses showed a trend toward diminished susceptibility to neutralization by human sera pooled from approximately 60 to 80 North American donors. Escape from MAb neutralization may be a powerful epidemiological surveillance tool to monitor the evolution of new MeV subgenotypes. IMPORTANCE Measles virus is a paradigmatic RNA virus, as the antigenic composition of the vaccination has not needed to be updated since its discovery. The vaccine confers protection by inducing neutralizing antibodies that interfere with the function of the hemagglutinin protein. Viral strains are indistinguishable serologically, although characteristic nucleotide sequences differentiate 24 genotypes. In this work, we describe a distant evolutionary branch within genotype D4. Designated subgenotype D4.2, this virus is distinguishable by neutralization with vaccine-induced monoclonal antibodies that target the neutralizing epitope
Tao, Pan; Mahalingam, Marthandan; Zhu, Jingen; Moayeri, Mahtab; Kirtley, Michelle L.; Fitts, Eric C.; Andersson, Jourdan A.; Lawrence, William S.; Leppla, Stephen H.; Chopra, Ashok K.; Rao, Venigalla B.
2017-01-01
Bioterrorism remains as one of the biggest challenges to global security and public health. Since the deadly anthrax attacks of 2001 in the United States, Bacillus anthracis and Yersinia pestis, the causative agents of anthrax and plague, respectively, gained notoriety and were listed by the CDC as Tier-1 biothreat agents. Currently, there is no Food and Drug Administration-approved vaccine against either of these threats for mass vaccination to protect general public, let alone a bivalent vaccine. Here, we report the development of a single recombinant vaccine, a triple antigen consisting of all three target antigens, F1 and V from Y. pestis and PA from B. anthracis, in a structurally stable context. Properly folded and soluble, the triple antigen retained the functional and immunogenicity properties of all three antigens. Remarkably, two doses of this immunogen adjuvanted with Alhydrogel® elicited robust antibody responses in mice, rats, and rabbits and conferred complete protection against inhalational anthrax and pneumonic plague. No significant antigenic interference was observed. Furthermore, we report, for the first time, complete protection of animals against simultaneous challenge with Y. pestis and the lethal toxin of B. anthracis, demonstrating that a single biodefense vaccine can protect against a bioterror attack with weaponized B. anthracis and/or Y. pestis. This bivalent anthrax–plague vaccine is, therefore, a strong candidate for stockpiling, after demonstration of its safety and immunogenicity in human clinical trials, as part of national preparedness against two of the deadliest bioterror threats. PMID:28694806
Tao, Pan; Mahalingam, Marthandan; Zhu, Jingen; Moayeri, Mahtab; Kirtley, Michelle L; Fitts, Eric C; Andersson, Jourdan A; Lawrence, William S; Leppla, Stephen H; Chopra, Ashok K; Rao, Venigalla B
2017-01-01
Bioterrorism remains as one of the biggest challenges to global security and public health. Since the deadly anthrax attacks of 2001 in the United States, Bacillus anthracis and Yersinia pestis , the causative agents of anthrax and plague, respectively, gained notoriety and were listed by the CDC as Tier-1 biothreat agents. Currently, there is no Food and Drug Administration-approved vaccine against either of these threats for mass vaccination to protect general public, let alone a bivalent vaccine. Here, we report the development of a single recombinant vaccine, a triple antigen consisting of all three target antigens, F1 and V from Y. pestis and PA from B. anthracis , in a structurally stable context. Properly folded and soluble, the triple antigen retained the functional and immunogenicity properties of all three antigens. Remarkably, two doses of this immunogen adjuvanted with Alhydrogel ® elicited robust antibody responses in mice, rats, and rabbits and conferred complete protection against inhalational anthrax and pneumonic plague. No significant antigenic interference was observed. Furthermore, we report, for the first time, complete protection of animals against simultaneous challenge with Y. pestis and the lethal toxin of B. anthracis , demonstrating that a single biodefense vaccine can protect against a bioterror attack with weaponized B. anthracis and/or Y. pestis . This bivalent anthrax-plague vaccine is, therefore, a strong candidate for stockpiling, after demonstration of its safety and immunogenicity in human clinical trials, as part of national preparedness against two of the deadliest bioterror threats.
Vaccine approaches conferring cross-protection against influenza viruses
Vemula, Sai V.; Sayedahmed, Ekramy E; Sambhara, Suryaprakash; Mittal, Suresh K.
2018-01-01
Introduction Annual vaccination is one of the most efficient and cost-effective strategies to prevent and control influenza epidemics. Most of currently available influenza vaccines are strong inducer of antibody responses against viral surface proteins, hemagglutinin (HA) and neuraminidase (NA), but are poor inducers of cell-mediated immune responses against conserved internal proteins. Moreover, due to the high variability of viral surface proteins because of antigenic drift or antigenic shift, many of the currently licensed vaccines confer little or no protection against drift or shift variants. Areas covered Next generation influenza vaccines that can induce humoral immune responses to receptor-binding epitopes as well as broadly neutralizing conserved epitopes, and cell-mediated immune responses against highly conserved internal proteins would be effective against variant viruses as well as a novel pandemic influenza until circulating strain-specific vaccines become available. Here we discuss vaccine approaches that have potential to provide broad spectrum protection against influenza viruses. Expert opinion Based on current progress in defining cross-protective influenza immunity, it seems that the development of a universal influenza vaccine is feasible. It would revolutionize the strategy for influenza pandemic preparedness, and significantly impact the shelf-life and protection efficacy of seasonal influenza vaccines. PMID:28925296
Moise, Leonard; Gutierrez, Andres; Kibria, Farzana; Martin, Rebecca; Tassone, Ryan; Liu, Rui; Terry, Frances; Martin, Bill; De Groot, Anne S
2015-01-01
Computational vaccine design, also known as computational vaccinology, encompasses epitope mapping, antigen selection and immunogen design using computational tools. The iVAX toolkit is an integrated set of tools that has been in development since 1998 by De Groot and Martin. It comprises a suite of immunoinformatics algorithms for triaging candidate antigens, selecting immunogenic and conserved T cell epitopes, eliminating regulatory T cell epitopes, and optimizing antigens for immunogenicity and protection against disease. iVAX has been applied to vaccine development programs for emerging infectious diseases, cancer antigens and biodefense targets. Several iVAX vaccine design projects have had success in pre-clinical studies in animal models and are progressing toward clinical studies. The toolkit now incorporates a range of immunoinformatics tools for infectious disease and cancer immunotherapy vaccine design. This article will provide a guide to the iVAX approach to computational vaccinology.
Tao, Pan; Li, Qin; Shivachandra, Sathish B; Rao, Venigalla B
2017-01-01
Protein-based subunit vaccines represent a safer alternative to the whole pathogen in vaccine development. However, limitations of physiological instability and low immunogenicity of such vaccines demand an efficient delivery system to stimulate robust immune responses. The bacteriophage T4 capsid-based antigen delivery system can robustly elicit both humoral and cellular immune responses without any adjuvant. Therefore, it offers a strong promise as a novel antigen delivery system. Currently Bacillus anthracis, the causative agent of anthrax, is a serious biothreat agent and no FDA-approved anthrax vaccine is available for mass vaccination. Here, we describe a potential anthrax vaccine using a T4 capsid platform to display and deliver the 83 kDa protective antigen, PA, a key component of the anthrax toxin. This T4 vaccine platform might serve as a universal antigen delivery system that can be adapted to develop vaccines against any infectious disease.
Chan, Jo-Anne; Stanisic, Danielle I; Duffy, Michael F; Robinson, Leanne J; Lin, Enmoore; Kazura, James W; King, Christopher L; Siba, Peter M; Fowkes, Freya Ji; Mueller, Ivo; Beeson, James G
2017-12-01
Acquired antibodies play an important role in immunity to P. falciparum malaria and are typically directed towards surface antigens expressed by merozoites and infected erythrocytes (IEs). The importance of specific IE surface antigens as immune targets remains unclear. We evaluated antibodies and protective associations in two cohorts of children in Papua New Guinea. We used genetically-modified P. falciparum to evaluate the importance of PfEMP1 and a P. falciparum isolate with a virulent phenotype. Our findings suggested that PfEMP1 was the dominant target of antibodies to the IE surface, including functional antibodies that promoted opsonic phagocytosis by monocytes. Antibodies were associated with increasing age and concurrent parasitemia, and were higher among children exposed to a higher force-of-infection as determined using molecular detection. Antibodies to IE surface antigens were consistently associated with reduced risk of malaria in both younger and older children. However, protective associations for antibodies to merozoite surface antigens were only observed in older children. This suggests that antibodies to IE surface antigens, particularly PfEMP1, play an earlier role in acquired immunity to malaria, whereas greater exposure is required for protective antibodies to merozoite antigens. These findings have implications for vaccine design and serosurveillance of malaria transmission and immunity. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Natural selection promotes antigenic evolvability.
Graves, Christopher J; Ros, Vera I D; Stevenson, Brian; Sniegowski, Paul D; Brisson, Dustin
2013-01-01
The hypothesis that evolvability - the capacity to evolve by natural selection - is itself the object of natural selection is highly intriguing but remains controversial due in large part to a paucity of direct experimental evidence. The antigenic variation mechanisms of microbial pathogens provide an experimentally tractable system to test whether natural selection has favored mechanisms that increase evolvability. Many antigenic variation systems consist of paralogous unexpressed 'cassettes' that recombine into an expression site to rapidly alter the expressed protein. Importantly, the magnitude of antigenic change is a function of the genetic diversity among the unexpressed cassettes. Thus, evidence that selection favors among-cassette diversity is direct evidence that natural selection promotes antigenic evolvability. We used the Lyme disease bacterium, Borrelia burgdorferi, as a model to test the prediction that natural selection favors amino acid diversity among unexpressed vls cassettes and thereby promotes evolvability in a primary surface antigen, VlsE. The hypothesis that diversity among vls cassettes is favored by natural selection was supported in each B. burgdorferi strain analyzed using both classical (dN/dS ratios) and Bayesian population genetic analyses of genetic sequence data. This hypothesis was also supported by the conservation of highly mutable tandem-repeat structures across B. burgdorferi strains despite a near complete absence of sequence conservation. Diversification among vls cassettes due to natural selection and mutable repeat structures promotes long-term antigenic evolvability of VlsE. These findings provide a direct demonstration that molecular mechanisms that enhance evolvability of surface antigens are an evolutionary adaptation. The molecular evolutionary processes identified here can serve as a model for the evolution of antigenic evolvability in many pathogens which utilize similar strategies to establish chronic infections.
Natural Selection Promotes Antigenic Evolvability
Graves, Christopher J.; Ros, Vera I. D.; Stevenson, Brian; Sniegowski, Paul D.; Brisson, Dustin
2013-01-01
The hypothesis that evolvability - the capacity to evolve by natural selection - is itself the object of natural selection is highly intriguing but remains controversial due in large part to a paucity of direct experimental evidence. The antigenic variation mechanisms of microbial pathogens provide an experimentally tractable system to test whether natural selection has favored mechanisms that increase evolvability. Many antigenic variation systems consist of paralogous unexpressed ‘cassettes’ that recombine into an expression site to rapidly alter the expressed protein. Importantly, the magnitude of antigenic change is a function of the genetic diversity among the unexpressed cassettes. Thus, evidence that selection favors among-cassette diversity is direct evidence that natural selection promotes antigenic evolvability. We used the Lyme disease bacterium, Borrelia burgdorferi, as a model to test the prediction that natural selection favors amino acid diversity among unexpressed vls cassettes and thereby promotes evolvability in a primary surface antigen, VlsE. The hypothesis that diversity among vls cassettes is favored by natural selection was supported in each B. burgdorferi strain analyzed using both classical (dN/dS ratios) and Bayesian population genetic analyses of genetic sequence data. This hypothesis was also supported by the conservation of highly mutable tandem-repeat structures across B. burgdorferi strains despite a near complete absence of sequence conservation. Diversification among vls cassettes due to natural selection and mutable repeat structures promotes long-term antigenic evolvability of VlsE. These findings provide a direct demonstration that molecular mechanisms that enhance evolvability of surface antigens are an evolutionary adaptation. The molecular evolutionary processes identified here can serve as a model for the evolution of antigenic evolvability in many pathogens which utilize similar strategies to establish chronic infections
Concepts and applications for influenza antigenic cartography
Cai, Zhipeng; Zhang, Tong; Wan, Xiu-Feng
2011-01-01
Influenza antigenic cartography projects influenza antigens into a two or three dimensional map based on immunological datasets, such as hemagglutination inhibition and microneutralization assays. A robust antigenic cartography can facilitate influenza vaccine strain selection since the antigenic map can simplify data interpretation through intuitive antigenic map. However, antigenic cartography construction is not trivial due to the challenging features embedded in the immunological data, such as data incompleteness, high noises, and low reactors. To overcome these challenges, we developed a computational method, temporal Matrix Completion-Multidimensional Scaling (MC-MDS), by adapting the low rank MC concept from the movie recommendation system in Netflix and the MDS method from geographic cartography construction. The application on H3N2 and 2009 pandemic H1N1 influenza A viruses demonstrates that temporal MC-MDS is effective and efficient in constructing influenza antigenic cartography. The web sever is available at http://sysbio.cvm.msstate.edu/AntigenMap. PMID:21761589
Prediction of the limit of detection of an optical resonant reflection biosensor.
Hong, Jongcheol; Kim, Kyung-Hyun; Shin, Jae-Heon; Huh, Chul; Sung, Gun Yong
2007-07-09
A prediction of the limit of detection of an optical resonant reflection biosensor is presented. An optical resonant reflection biosensor using a guided-mode resonance filter is one of the most promising label-free optical immunosensors due to a sharp reflectance peak and a high sensitivity to the changes of optical path length. We have simulated this type of biosensor using rigorous coupled wave theory to calculate the limit of detection of the thickness of the target protein layer. Theoretically, our biosensor has an estimated ability to detect thickness change approximately the size of typical antigen proteins. We have also investigated the effects of the absorption and divergence of the incident light on the detection ability of the biosensor.
Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.
2008-01-01
The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410
Gomase, Virendra S; Chitlange, Nikhilkumar R; Changbhale, Smruti S; Kale, Karbhari V
2013-08-01
Brugia malayi is a threadlike nematode cause's swelling of lymphatic organs, condition well known as lymphatic filariasis; till date no invention made to effectively address lymphatic filariasis. In this analysis we a have predicted suitable antigenic peptides from Brugia malayi antigen protein for peptide vaccine design against lymphatic filariasis based on cross protection phenomenon as, an ample immune response can be generated with a single protein subunit. We found MHC class II binding peptides of Brugia malayi antigen protein are important determinant against the diseased condition. The analysis shows Brugia malayi antigen protein having 505 amino acids, which shows 497 nonamers. In this assay, we have predicted MHC-I binding peptides for 8mer_H2_Db (optimal score- 15.966), 9mer_H2_Db (optimal score- 15.595), 10mer_H2_Db (optimal score- 19.405), 11mer_H2_Dballeles (optimal score- 23.801). We also predicted the SVM based MHCII-IAb nonamers, 51-FQQIDPLDA, 442-FAAIACLVH, 206-YLNPFGHQF, 167-WYVIMAACY, 367-YAMIVIRLL, 434- LVITTAANF, 176-LDSYCLWKP, 435-VITTAANFA, 364-WPGYAMIVI (optimal score- 13.963); MHCII-IAd nonamers, 52-QQIDPLDAE, 171-MAACYLDSY, 239-QWRSVILCN, 168-YVIMAACYL, 3-QYLSVHSLS, 322-EILLHAKVV, 417- LGIIASFVS, 396-KAIFLAHFG, 167-WYVIMAACY, 269-LALHCINVI, 93-FINKAAPKQ, 259-NCIIVLKAF, 79- QGVLLIIPR, 22-TILQRSQAI, 63-RGFVYGNVS, 109-NISSLAFET,(optimal score- 16.748); and MHCII-IAg7 nonamers 171-MAACYLDSY, 73-KIVNGAQGV, 259-NCIIVLKAF, 209-PFGHQFSFE, 102-SCDTLLKNI, 25-QRSQAIRIV, 444- AIACLVHLF, 88-SLVNGFINK, 252-FPRHQLLNC, 471-RFVLANDNE, 52-QQIDPLDAE, 469-HRRFVLAND, 457- SNRHYFLAD, 362-KSWPGYAMI, 476-NDNEGEDFE, 370-IVIRLLQAL (optimal score- 19.847) which represents potential binders from Brugia malayi antigen protein. The method integrates prediction of MHC class I binding proteasomal C-terminal cleavage peptides and Eighteen potential antigenic peptides at average propensity 1.063 having highest local hydrophilicity. Thus a small antigen fragment can induce
Jas, Ruma; Ghosh, Joydeb; DAS, Kinsuk
2016-01-01
Cross antigenicity is the major problem in developing a reliable tool for immunodiagnosis and immunoprophylaxis of parasitic diseases. Mixed infection due to different types of gastrointestinal parasites is more common than single species infection under field condition. The present study was undertaken to detect antigenic cross-reactivity among Haemonchus contortus, Oesophagostomum columbianum and Trichuris ovis of goats by SDS-PAGE and western blot analysis using hyperimmune sera (HIS) rose in rabbit separately against the antigens of the three nematode species. Thirteen, 16 and 14 polypeptides in crude somatic antigen (CSAg) of H. contortus (CSAg-Hc), O. columbianum (CSAg-Oc) and T. ovis (CSAg-To), respectively, were resolved in SDS PAGE analyses. It was revealed that 54 kDa peptide was shared by H.contortus and O. columbianum , whereas 47 kDa peptide was shared by O. columbianum and T. ovis . Western blot analyses revealed that three immunogenic polypeptides (MW 54, 49 and 42 kDa) in CSAg-Hc, five in CSAg-Oc (54, 47, 44, 38 and 35.5 kDa) and CSAg-To and five polypeptides (90, 51, 47, 39.5 and 31 kDa) in CSAg-To cross-reacted with the heterologous HIS. Four species-specific immunoreactive polypeptides (92, 85, 65 and 39 kDa) of H. contortus and two (72 & 26 kDa) in O. columbianum were also identified in the study. The shared polypeptides and species-specific polypeptides might be evaluated as protective antigen and subsequently exploitation for developing immunodiagnostic and for immunoprophylactic tools of for these common nematode species.
JAS, Ruma; GHOSH, Joydeb; DAS, Kinsuk
2016-01-01
Background: Cross antigenicity is the major problem in developing a reliable tool for immunodiagnosis and immunoprophylaxis of parasitic diseases. Mixed infection due to different types of gastrointestinal parasites is more common than single species infection under field condition. Methods: The present study was undertaken to detect antigenic cross-reactivity among Haemonchus contortus, Oesophagostomum columbianum and Trichuris ovis of goats by SDS-PAGE and western blot analysis using hyperimmune sera (HIS) rose in rabbit separately against the antigens of the three nematode species. Results: Thirteen, 16 and 14 polypeptides in crude somatic antigen (CSAg) of H. contortus (CSAg-Hc), O. columbianum (CSAg-Oc) and T. ovis (CSAg-To), respectively, were resolved in SDS PAGE analyses. It was revealed that 54 kDa peptide was shared by H.contortus and O. columbianum, whereas 47 kDa peptide was shared by O. columbianum and T. ovis. Western blot analyses revealed that three immunogenic polypeptides (MW 54, 49 and 42 kDa) in CSAg-Hc, five in CSAg-Oc (54, 47, 44, 38 and 35.5 kDa) and CSAg-To and five polypeptides (90, 51, 47, 39.5 and 31 kDa) in CSAg-To cross-reacted with the heterologous HIS. Four species-specific immunoreactive polypeptides (92, 85, 65 and 39 kDa) of H. contortus and two (72 & 26 kDa) in O. columbianum were also identified in the study. Conclusion: The shared polypeptides and species-specific polypeptides might be evaluated as protective antigen and subsequently exploitation for developing immunodiagnostic and for immunoprophylactic tools of for these common nematode species. PMID:28127366
Salo, Päivi M.; Yin, Ming; Arbes, Samuel J.; Cohn, Richard D.; Sever, Michelle; Muilenberg, Michael; Burge, Harriet A.; London, Stephanie J.; Zeldin, Darryl C.
2005-01-01
Background: Alternaria alternata is one of the most common fungi associated with allergic disease. However, Alternaria exposure in indoor environments is not well characterized. Objective: The primary goals of this study were to examine the prevalence of Alternaria exposure and identify independent predictors of Alternaria antigen concentrations in U.S. homes. Methods: Data for this cross-sectional study were obtained from the National Survey of Lead and Allergens in Housing. A nationally representative sample of 831 housing units in 75 different locations throughout the U.S. completed the survey. Information on housing and household characteristics was obtained by questionnaire and environmental assessments. Concentrations of Alternaria antigens in dust collected from various indoor sites were assessed with a polyclonal anti-Alternaria antibody assay. Results: Alternaria antigens were detected in most (95-99%) of the dust samples. The geometric mean concentration, reflecting the average Alternaria concentration in homes, was 4.88 μg/g (SE=0.13 μg/g). In the multivariable linear regression analysis, the age of the housing unit, geographic region, urbanization, poverty, family race, observed mold and moisture problems, use of dehumidifier, and presence of cats and dogs were independent predictors of Alternaria antigen concentrations. Less frequent cleaning and smoking indoors also contributed to higher Alternaria antigen levels in homes. Conclusion: Exposure to Alternaria alternata antigens in U.S. homes is common. Antigen levels in homes are not only influenced by regional factors but also by residential characteristics. Preventing mold and moisture problems, avoiding smoking indoors, and regular household cleaning may help reduce exposure to Alternaria antigens indoors. PMID:16159634
Macdonald, Isabel K.; Allen, Jared; Murray, Andrea; Parsy-Kowalska, Celine B.; Healey, Graham F.; Chapman, Caroline J.; Sewell, Herbert F.; Robertson, John F. R.
2012-01-01
An assay employing a panel of tumor-associated antigens has been validated and is available commercially (EarlyCDT®-Lung) to aid the early detection of lung cancer by measurement of serum autoantibodies. The high throughput (HTP) strategy described herein was pursued to identify new antigens to add to the EarlyCDT-Lung panel and to assist in the development of new panels for other cancers. Two ligation-independent cloning vectors were designed and synthesized, producing fusion proteins suitable for the autoantibody ELISA. We developed an abridged HTP version of the validated autoantibody ELISA, determining that results reflected the performance of the EarlyCDT assay, by comparing results on both formats. Once validated this HTP ELISA was utilized to screen multiple fusion proteins prepared on small-scale, by a HTP expression screen. We determined whether the assay performance for these HTP protein batches was an accurate reflection of the performance of R&D or commercial batches. A HTP discovery platform for the identification and optimal production of tumor- associated antigens which detects autoantibodies has been developed and validated. The most favorable conditions for the exposure of immunogenic epitopes were assessed to produce discriminatory proteins for use in a commercial ELISA. This process is rapid and cost-effective compared to standard cloning and screening technologies and enables rapid advancement in the field of autoantibody assay discovery. This approach will significantly reduce timescale and costs for developing similar panels of autoantibody assays for the detection of other cancer types with the ultimate aim of improved overall survival due to early diagnosis and treatment. PMID:22815807
Kogot, Joshua M.; Zhang, Yanting; Moore, Stephen J.; Pagano, Paul; Stratis-Cullum, Dimitra N.; Chang-Yen, David; Turewicz, Marek; Pellegrino, Paul M.; de Fusco, Andre; Soh, H. Tom; Stagliano, Nancy E.
2011-01-01
Bacterial surface peptide display has gained popularity as a method of affinity reagent generation for a wide variety of applications ranging from drug discovery to pathogen detection. In order to isolate the bacterial clones that express peptides with high affinities to the target molecule, multiple rounds of manual magnetic activated cell sorting (MACS) followed by multiple rounds of fluorescence activated cell sorting (FACS) are conventionally used. Although such manual methods are effective, alternative means of library screening which improve the reproducibility, reduce the cost, reduce cross contamination, and minimize exposure to hazardous target materials are highly desired for practical application. Toward this end, we report the first semi-automated system demonstrating the potential for screening bacterially displayed peptides using disposable microfluidic cartridges. The Micro-Magnetic Separation platform (MMS) is capable of screening a bacterial library containing 3×1010 members in 15 minutes and requires minimal operator training. Using this system, we report the isolation of twenty-four distinct peptide ligands that bind to the protective antigen (PA) of Bacilus anthracis in three rounds of selection. A consensus motif WXCFTC was found using the MMS and was also found in one of the PA binders isolated by the conventional MACS/FACS approach. We compared MMS and MACS rare cell recovery over cell populations ranging from 0.1% to 0.0000001% and found that both magnetic sorting methods could recover cells down to 0.0000001% initial cell population, with the MMS having overall lower standard deviation of cell recovery. We believe the MMS system offers a compelling approach towards highly efficient, semi-automated screening of molecular libraries that is at least equal to manual magnetic sorting methods and produced, for the first time, 15-mer peptide binders to PA protein that exhibit better affinity and specificity than peptides isolated using
Devlin, Rebecca; Marques, Catarina A; Paape, Daniel; Prorocic, Marko; Zurita-Leal, Andrea C; Campbell, Samantha J; Lapsley, Craig; Dickens, Nicholas; McCulloch, Richard
2016-01-01
Survival of Trypanosoma brucei depends upon switches in its protective Variant Surface Glycoprotein (VSG) coat by antigenic variation. VSG switching occurs by frequent homologous recombination, which is thought to require locus-specific initiation. Here, we show that a RecQ helicase, RECQ2, acts to repair DNA breaks, including in the telomeric site of VSG expression. Despite this, RECQ2 loss does not impair antigenic variation, but causes increased VSG switching by recombination, arguing against models for VSG switch initiation through direct generation of a DNA double strand break (DSB). Indeed, we show DSBs inefficiently direct recombination in the VSG expression site. By mapping genome replication dynamics, we reveal that the transcribed VSG expression site is the only telomeric site that is early replicating – a differential timing only seen in mammal-infective parasites. Specific association between VSG transcription and replication timing reveals a model for antigenic variation based on replication-derived DNA fragility. DOI: http://dx.doi.org/10.7554/eLife.12765.001 PMID:27228154
Park, Sung-Hyun; Chen, Wen-Chi; Esmaeil, Nafiseh; Lucas, Benjamin; Marsh, Leigh M.; Reibman, Joan
2014-01-01
Abstract Pulmonary hypertension has a marked detrimental effect on quality of life and life expectancy. In a mouse model of antigen-induced pulmonary arterial remodeling, we have recently shown that coexposure to urban ambient particulate matter (PM) significantly increased the thickening of the pulmonary arteries and also resulted in significantly increased right ventricular systolic pressures. Here we interrogate the mechanism and show that combined neutralization of interleukin 13 (IL-13) and IL-17A significantly ameliorated the increase in right ventricular systolic pressure, the circumferential muscularization of pulmonary arteries, and the molecular change in the right ventricle. Surprisingly, our data revealed a protective role of IL-17A for the antigen- and PM-induced severe thickening of pulmonary arteries. This protection was due to the inhibition of the effects of IL-13, which drove this response, and the expression of metalloelastase and resistin-like molecule α. However, the latter was redundant for the arterial thickening response. Anti-IL-13 exacerbated airway neutrophilia, which was due to a resulting excess effect of IL-17A, confirming concurrent cross inhibition of IL-13- and IL-17A-dependent responses in the lungs of animals exposed to antigen and PM. Our experiments also identified IL-13/IL-17A-independent molecular reprogramming in the lungs induced by exposure to antigen and PM, which indicates a risk for arterial remodeling and protection from arterial constriction. Our study points to IL-13- and IL-17A-coinduced inflammation as a new template for biomarkers and therapeutic targeting for the management of immune response–induced pulmonary hypertension. PMID:25610601
Salmonella DNA Adenine Methylase Mutants Confer Cross-Protective Immunity
Heithoff, Douglas M.; Enioutina, Elena Y.; Daynes, Raymond A.; Sinsheimer, Robert L.; Low, David A.; Mahan, Michael J.
2001-01-01
Salmonella isolates that lack or overproduce DNA adenine methylase (Dam) elicited a cross-protective immune response to different Salmonella serovars. The protection afforded by the Salmonella enterica serovar Typhimurium Dam vaccine was greater than that elicited in mice that survived a virulent infection. S. enterica serovar Typhimurium Dam mutant strains exhibited enhanced sensitivity to mediators of innate immunity such as antimicrobial peptides, bile salts, and hydrogen peroxide. Also, S. enterica serovar Typhimurium Dam− vaccines were not immunosuppressive; unlike wild-type vaccines, they failed to induce increased nitric oxide levels and permitted a subsequent robust humoral response to diptheria toxoid antigen in infected mice. Dam mutant strains exhibited a low-grade persistence which, coupled with the nonimmunosuppression and the ectopic protein expression caused by altered levels of Dam, may provide an expanded source of potential antigens in vaccinated hosts. PMID:11598044
Thiel, U; Pirson, S; Müller-Spahn, C; Conrad, H; Busch, D H; Bernhard, H; Burdach, S; Richter, G H S
2011-01-01
Background: The development of a successful immunotherapy is hampered by an ineffective T-cell repertoire against tumour antigens and the inability of the patient's immune system to overcome tolerance-inducing mechanisms. Here, we test the specific recognition and lytical potential of allo-restricted CD8+ T cells against Ewing tumour (ET) associated antigens Enhancer of Zeste, Drosophila Homolog 2 (EZH2), and Chondromodulin-I (CHM1) identified through previous microarray analysis. Methods: Following repetitive CHM1319 (VIMPCSWWV) and EZH2666 (YMCSFLFNL) peptide-driven stimulations with HLA-A*0201+ dendritic cells (DC), allo-restricted HLA-A*0201− CD8+ T cells were stained with HLA-A*0201/peptide multimers, sorted and expanded by limiting dilution. Results: Expanded T cells specifically recognised peptide-pulsed target cells or antigen-transfected cells in the context of HLA-A*0201 and killed HLA-A*0201+ ET lines expressing the antigen while HLA-A*0201– ET lines were not affected. Furthermore, adoptively transferred T cells caused significant ET growth delay in Rag2−/−γC−/− mice. Within this context, we identified the CHM1319 peptide as a new candidate target antigen for ET immunotherapy. Conclusion: These results clearly identify the ET-derived antigens, EZH2666 and CHM1319, as suitable targets for protective allo-restricted human CD8+ T-cell responses against non-immunogenic ET and may benefit new therapeutic strategies in ET patients treated with allogeneic stem cell transplantation. PMID:21407224
Zhang, S; Zhang, H S; Cordon-Cardo, C; Ragupathi, G; Livingston, P O
1998-11-01
The relative expression of mucin antigens MUC1, MUC2, MUC3, MUC4, MUC5AC, MUC5B, and MUC7 and glycoprotein antigens KSA, carcinoembryonic antigen, prostate-specific membrane antigen (PSMA), HER-2/neu, and human chorionic gonadotropin-beta on different cancers and normal tissues is difficult to determine from available reports. We have compared the distribution of these antigens by immunohistology on a broad range of malignant and normal tissues. MUC1 expression was most intense in cancers of breast, lung, ovarian, and endometrial origin; MUC2 was most intense in cancers of colon and prostate origin; and MUC5AC was most intense in cancers of breast and gastric origin. MUC4 was intensely expressed in 50% of cancers of colon and pancreas origin, and MUC3, MUC5B, and MUC7 were expressed in a variety of epithelial cancers, but not so intensely. KSA was intensely and uniformly expressed on all epithelial cancers; carcinoembryonic antigen was expressed in most cancers of breast, lung, colon, pancreas, and gastric origin; and PSMA was expressed only in cancers of prostate origin. Human chorionic gonadotropin-beta was expressed on the majority of sarcomas and cancers of breast, lung, and pancreas origin, although intense staining was not seen. Staining on normal tissues was restricted to one or many normal epithelial tissues ranging from MUC3, MUC4, and PSMA, which were expressed only on epithelia of pancreas, stomach, and prostate origin, respectively, to MUC1 and KSA, which were expressed on most normal epithelia. Expression was restricted to the secretory borders of these epithelia while stroma and other normal tissues were completely negative. These results plus the results of the two previous papers (S. Zhang et al, Int. J. Cancer, 73: 42-49, 1997; S. Zhang et al., Int. J. Cancer, 73: 50-56, 1997) in this series provide the basis for selection of multiple cell surface antigens as targets for antibody-mediated attack against these cancers.
Gupta, G; Khan, A A; Rao, D N
2010-03-01
Yersinia pestis, a Gram-negative bacterium, is the etiological agent of pneumonic and bubonic plague and still active in various regions of the world. Because plague is highly infectious and can readily spread by aerosolization, it poses a bioterrorism threat. The effective induction of mucosal as well as systemic immunity is an important attribute of an improved vaccine for plague. An alternative approach described here is the use of protective epitopes derived from immunodominant antigens (F1 and V) of Yersinia pestis. As T-cell immunity is also a major contributor of protection, microencapsulated B-T constructs of F1 and V antigen were used to immunize outbred and inbred mice through intranasal route, and lympho-proliferative response and cytokine profile of both Th(1) and Th(2) arms were measured in spleen, lamina propria and Peyer's patches. Three B-T constructs of F1 antigen and seven of V antigen showed significantly high T-cell response in terms of inducing systemic as well as mucosal response when compared to constituent peptides. These ten conjugates showed Th(1) cytokine profile whereas rest of the conjugates showed mixed Th(1)/Th(2) response. Four conjugates of V antigen showed high level of IL-10 production. In present study, microencapsulated B-T constructs after intranasal immunization generated systemic as well as mucosal immune response in all three sites, which offers an alternative approach for plague vaccine.
Immunogenicity and safety of a tetravalent E. coli O-antigen bioconjugate vaccine in animal models.
van den Dobbelsteen, Germie P J M; Faé, Kellen C; Serroyen, Jan; van den Nieuwenhof, Ingrid M; Braun, Martin; Haeuptle, Micha A; Sirena, Dominique; Schneider, Joerg; Alaimo, Cristina; Lipowsky, Gerd; Gambillara-Fonck, Veronica; Wacker, Michael; Poolman, Jan T
2016-07-29
Extra-intestinal pathogenic Escherichia coli (ExPEC) are major human pathogens; however, no protective vaccine is currently available. We assessed in animal models the immunogenicity and safety of a 4-valent E. coli conjugate vaccine (ExPEC-4V, serotypes O1, O2, O6 and O25 conjugated to Exotoxin A from Pseudomonas aeruginosa (EPA)) produced using a novel in vivo bioconjugation method. Three doses of ExPEC-4V (with or without aluminum hydroxide) were administered to rabbits (2μg or 20μg per O-antigen, subcutaneously), mice (0.2μg or 2μg per O-antigen, subcutaneously) and rats (0.4μg or 4μg per O-antigen, intramuscularly). Antibody persistence and boostability were evaluated in rats using O6-EPA monovalent conjugate (0.4μg O-antigen/dose, intramuscularly). Toxicity was assessed in rats (16μg total polysaccharide, intramuscularly). Serum IgG and IgM antibodies were measured by ELISA. Robust antigen-specific IgG responses were observed in all animal models, with increased responses in rabbits when administered with adjuvant. O antigen-specific antibody responses persisted up to 168days post-priming. Booster immunization induced a rapid recall response. Toxicity of ExPEC-4V when administered to rats was considered to be at the no observed adverse effect level. ExPEC-4V conjugate vaccine showed good immunogenicity and tolerability in animal models supporting progression to clinical evaluation. Copyright © 2016 Elsevier Ltd. All rights reserved.
Thyroid peroxidase (TPO) expressed in thyroid and breast tissues shows similar antigenic properties
Godlewska, Marlena; Arczewska, Katarzyna D.; Rudzińska, Magdalena; Łyczkowska, Anna; Krasuska, Wanda; Hanusek, Karolina; Ruf, Jean; Kiedrowski, Mirosław
2017-01-01
Background Thyroid peroxidase (TPO) is essential for physiological function of the thyroid gland. The high prevalence of thyroid peroxidase antibodies (TPOAbs) in patients with breast cancer and their protective role had previously been demonstrated, indicating a link between breast cancer and thyroid autoimmunity. Recently, TPO was shown to be present in breast cancer tissue samples but its antigenicity has not been analyzed. Methods In this study, we investigated TPO expression levels in a series of fifty-six breast cancer samples paired with normal (peri-tumoral) tissue and its antigenic activity using a panel of well-characterized murine anti-human TPOAbs. Results We have shown that TPO transcripts were present in both normal and cancer tissue samples, although the amounts in the latter were reduced. Additionally, we observed that TPO levels are lower in more advanced cancers. TPO protein expression was confirmed in all tissue samples, both normal and cancerous. We also found that the antigenicity of the immunodominant regions (IDRs) in breast TPO resembles that of thyroid TPO, which is crucial for effective interactions with human TPOAbs. Conclusions Expression of TPO in breast cancer together with its antigenic activity may have beneficial effects in TPOAb-positive breast cancer patients. However, further studies are needed to confirm the beneficial role of TPOAbs and to better understand the underlying mechanism. PMID:28575127
Pawlak, Aleksandra; Rybka, Jacek; Dudek, Bartłomiej; Krzyżewska, Eva; Rybka, Wojciech; Kędziora, Anna; Klausa, Elżbieta; Bugla-Płoskońska, Gabriela
2017-01-01
Complement is one of the most important parts of the innate immune system. Some bacteria can gain resistance against the bactericidal action of complement by decorating their outer cell surface with lipopolysaccharides (LPSs) containing a very long O-antigen or with specific outer membrane proteins. Additionally, the presence of sialic acid in the LPS molecules can provide a level of protection for bacteria, likening them to human cells, a phenomenon known as molecular mimicry. Salmonella O48, which contains sialic acid in the O-antigen, is the major cause of reptile-associated salmonellosis, a worldwide public health problem. In this study, we tested the effect of prolonged exposure to human serum on strains from Salmonella serogroup O48, specifically on the O-antigen length. After multiple passages in serum, three out of four tested strains became resistant to serum action. The gas-liquid chromatography/tandem mass spectrometry analysis showed that, for most of the strains, the average length of the LPS O-antigen increased. Thus, we have discovered a link between the resistance of bacterial cells to serum and the elongation of the LPS O-antigen. PMID:28934165
Pawlak, Aleksandra; Rybka, Jacek; Dudek, Bartłomiej; Krzyżewska, Eva; Rybka, Wojciech; Kędziora, Anna; Klausa, Elżbieta; Bugla-Płoskońska, Gabriela
2017-09-21
Complement is one of the most important parts of the innate immune system. Some bacteria can gain resistance against the bactericidal action of complement by decorating their outer cell surface with lipopolysaccharides (LPSs) containing a very long O-antigen or with specific outer membrane proteins. Additionally, the presence of sialic acid in the LPS molecules can provide a level of protection for bacteria, likening them to human cells, a phenomenon known as molecular mimicry. Salmonella O48, which contains sialic acid in the O-antigen, is the major cause of reptile-associated salmonellosis, a worldwide public health problem. In this study, we tested the effect of prolonged exposure to human serum on strains from Salmonella serogroup O48, specifically on the O-antigen length. After multiple passages in serum, three out of four tested strains became resistant to serum action. The gas-liquid chromatography/tandem mass spectrometry analysis showed that, for most of the strains, the average length of the LPS O-antigen increased. Thus, we have discovered a link between the resistance of bacterial cells to serum and the elongation of the LPS O-antigen.
Joubert, Pierre-Emmanuel; Albert, Matthew L.
2012-01-01
Phagocytosis of dying cells constitutes an important mechanism of antigen capture for the cross-priming of CD8+ T cells. This process has been shown to be critical for achieving tumor and viral immunity. While most studies have focused on the mechanisms inherent in the dendritic cell that account for exogenous antigen accessing MHC I, several recent reports have highlighted the important contribution made by the antigen donor cell. Specifically, the cell stress and cell death pathways that precede antigen transfer are now known to impact cross-presentation and cross-priming. Herein, we review the current literature regarding a role for macroautophagy within the antigen donor cell. Further examination of this point of immune regulation is warranted and may contribute to a better understanding of how to optimize immunotherapy for treatment of cancer and chronic infectious disease. PMID:22566942