Science.gov

Sample records for antimicrobial peptide genes

  1. Expression of ayu antimicrobial peptide genes after LPS stimulation

    PubMed Central

    NSRELDEN, Rehab Marray; HORIUCHI, Hiroyuki; FURUSAWA, Shuichi

    2017-01-01

    Plecoglossus altivelis (ayu) is one of the most important fish species in the Japanese islands and in internal fish hatcheries. Living in open aquatic environments exposes fish to many pathogens. Therefore, they require rapid and strong immune defenses. We investigated in vivo the direct association between the ayu innate immune response, represented by the relative transcription of genes encoding the cathelicidin and hepcidin antimicrobial peptides, and lipopolysaccharide (LPS), a conventional pathogen-associated molecular patterns (PAMPs) of Gram-negative bacteria. Different concentrations of LPS (1, 10 and 100 µg/fish) were injected intraperitoneally into young (sexually immature) and adult (fully sexually mature) ayu. The relative expression of the antimicrobial peptide genes was measured 6 hr, 24 hr and 1 week after stimulation with LPS. We found a direct association between the expression of the antimicrobial peptide genes investigated and LPS stimulation. This relationship was time-, dose- and age-dependent. Further research is required to determine the cell-specific transcriptional regulation and posttranscriptional regulation of these antimicrobial peptides. PMID:28484129

  2. Antimicrobial Peptides in Reptiles

    PubMed Central

    van Hoek, Monique L.

    2014-01-01

    Reptiles are among the oldest known amniotes and are highly diverse in their morphology and ecological niches. These animals have an evolutionarily ancient innate-immune system that is of great interest to scientists trying to identify new and useful antimicrobial peptides. Significant work in the last decade in the fields of biochemistry, proteomics and genomics has begun to reveal the complexity of reptilian antimicrobial peptides. Here, the current knowledge about antimicrobial peptides in reptiles is reviewed, with specific examples in each of the four orders: Testudines (turtles and tortosises), Sphenodontia (tuataras), Squamata (snakes and lizards), and Crocodilia (crocodilans). Examples are presented of the major classes of antimicrobial peptides expressed by reptiles including defensins, cathelicidins, liver-expressed peptides (hepcidin and LEAP-2), lysozyme, crotamine, and others. Some of these peptides have been identified and tested for their antibacterial or antiviral activity; others are only predicted as possible genes from genomic sequencing. Bioinformatic analysis of the reptile genomes is presented, revealing many predicted candidate antimicrobial peptides genes across this diverse class. The study of how these ancient creatures use antimicrobial peptides within their innate immune systems may reveal new understandings of our mammalian innate immune system and may also provide new and powerful antimicrobial peptides as scaffolds for potential therapeutic development. PMID:24918867

  3. Antimicrobial Peptides

    PubMed Central

    Bahar, Ali Adem; Ren, Dacheng

    2013-01-01

    The rapid increase in drug-resistant infections has presented a serious challenge to antimicrobial therapies. The failure of the most potent antibiotics to kill “superbugs” emphasizes the urgent need to develop other control agents. Here we review the history and new development of antimicrobial peptides (AMPs), a growing class of natural and synthetic peptides with a wide spectrum of targets including viruses, bacteria, fungi, and parasites. We summarize the major types of AMPs, their modes of action, and the common mechanisms of AMP resistance. In addition, we discuss the principles for designing effective AMPs and the potential of using AMPs to control biofilms (multicellular structures of bacteria embedded in extracellular matrixes) and persister cells (dormant phenotypic variants of bacterial cells that are highly tolerant to antibiotics). PMID:24287494

  4. Antimicrobial Peptides from Fish

    PubMed Central

    Masso-Silva, Jorge A.; Diamond, Gill

    2014-01-01

    Antimicrobial peptides (AMPs) are found widely distributed through Nature, and participate in the innate host defense of each species. Fish are a great source of these peptides, as they express all of the major classes of AMPs, including defensins, cathelicidins, hepcidins, histone-derived peptides, and a fish-specific class of the cecropin family, called piscidins. As with other species, the fish peptides exhibit broad-spectrum antimicrobial activity, killing both fish and human pathogens. They are also immunomodulatory, and their genes are highly responsive to microbes and innate immuno-stimulatory molecules. Recent research has demonstrated that some of the unique properties of fish peptides, including their ability to act even in very high salt concentrations, make them good potential targets for development as therapeutic antimicrobials. Further, the stimulation of their gene expression by exogenous factors could be useful in preventing pathogenic microbes in aquaculture. PMID:24594555

  5. Antimicrobial Peptides in 2014

    PubMed Central

    Wang, Guangshun; Mishra, Biswajit; Lau, Kyle; Lushnikova, Tamara; Golla, Radha; Wang, Xiuqing

    2015-01-01

    This article highlights new members, novel mechanisms of action, new functions, and interesting applications of antimicrobial peptides reported in 2014. As of December 2014, over 100 new peptides were registered into the Antimicrobial Peptide Database, increasing the total number of entries to 2493. Unique antimicrobial peptides have been identified from marine bacteria, fungi, and plants. Environmental conditions clearly influence peptide activity or function. Human α-defensin HD-6 is only antimicrobial under reduced conditions. The pH-dependent oligomerization of human cathelicidin LL-37 is linked to double-stranded RNA delivery to endosomes, where the acidic pH triggers the dissociation of the peptide aggregate to release its cargo. Proline-rich peptides, previously known to bind to heat shock proteins, are shown to inhibit protein synthesis. A model antimicrobial peptide is demonstrated to have multiple hits on bacteria, including surface protein delocalization. While cell surface modification to decrease cationic peptide binding is a recognized resistance mechanism for pathogenic bacteria, it is also used as a survival strategy for commensal bacteria. The year 2014 also witnessed continued efforts in exploiting potential applications of antimicrobial peptides. We highlight 3D structure-based design of peptide antimicrobials and vaccines, surface coating, delivery systems, and microbial detection devices involving antimicrobial peptides. The 2014 results also support that combination therapy is preferred over monotherapy in treating biofilms. PMID:25806720

  6. Anti-antimicrobial Peptides

    PubMed Central

    Ryan, Lloyd; Lamarre, Baptiste; Diu, Ting; Ravi, Jascindra; Judge, Peter J.; Temple, Adam; Carr, Matthew; Cerasoli, Eleonora; Su, Bo; Jenkinson, Howard F.; Martyna, Glenn; Crain, Jason; Watts, Anthony; Ryadnov, Maxim G.

    2013-01-01

    Antimicrobial or host defense peptides are innate immune regulators found in all multicellular organisms. Many of them fold into membrane-bound α-helices and function by causing cell wall disruption in microorganisms. Herein we probe the possibility and functional implications of antimicrobial antagonism mediated by complementary coiled-coil interactions between antimicrobial peptides and de novo designed antagonists: anti-antimicrobial peptides. Using sequences from native helical families such as cathelicidins, cecropins, and magainins we demonstrate that designed antagonists can co-fold with antimicrobial peptides into functionally inert helical oligomers. The properties and function of the resulting assemblies were studied in solution, membrane environments, and in bacterial culture by a combination of chiroptical and solid-state NMR spectroscopies, microscopy, bioassays, and molecular dynamics simulations. The findings offer a molecular rationale for anti-antimicrobial responses with potential implications for antimicrobial resistance. PMID:23737519

  7. Antimicrobial Peptides and Colitis

    PubMed Central

    Ho, Samantha; Pothoulakis, Charalabos; Koon, Hon Wai

    2013-01-01

    Antimicrobial peptides (AMPs) are important components of innate immunity. They are often expressed in response to colonic inflammation and infection. Over the last several years, the roles of several antimicrobial peptides have been explored. Gene expression of many AMPs (beta defensin HBD2-4 and cathelicidin) is induced in response to invasion of gut microbes into the mucosal barrier. Some AMPs are expressed in a constitutive manner (alpha defensin HD 5-6 and beta defensin HBD1), while others (defensin and bactericidal/permeability increasing protein BPI) are particularly associated with Inflammatory Bowel Disease (IBD) due to altered defensin expression or development of autoantibodies against Bactericidal/permeability increasing protein (BPI). Various AMPs have different spectrum and strength of antimicrobial effects. Some may play important roles in modulating the colitis (cathelicidin) while others (lactoferrin, hepcidin) may represent biomarkers of disease activity. The use of AMPs for therapeutic purposes is still at an early stage of development. A few natural AMPs were shown to be able to modulate colitis when delivered intravenously or intracolonically (cathelicidin, elafin and SLPI) in mouse colitis models. New AMPs (synthetic or artificial non-human peptides) are being developed and may represent new therapeutic approaches against colitis. This review discusses the latest research developments in the AMP field with emphasis in innate immunity and pathophysiology of colitis. PMID:22950497

  8. Peptide Antimicrobial Agents

    PubMed Central

    Jenssen, Håvard; Hamill, Pamela; Hancock, Robert E. W.

    2006-01-01

    Antimicrobial host defense peptides are produced by all complex organisms as well as some microbes and have diverse and complex antimicrobial activities. Collectively these peptides demonstrate a broad range of antiviral and antibacterial activities and modes of action, and it is important to distinguish between direct microbicidal and indirect activities against such pathogens. The structural requirements of peptides for antiviral and antibacterial activities are evaluated in light of the diverse set of primary and secondary structures described for host defense peptides. Peptides with antifungal and antiparasitic activities are discussed in less detail, although the broad-spectrum activities of such peptides indicate that they are important host defense molecules. Knowledge regarding the relationship between peptide structure and function as well as their mechanism of action is being applied in the design of antimicrobial peptide variants as potential novel therapeutic agents. PMID:16847082

  9. Identification of Mycobacterium avium genes associated with resistance to host antimicrobial peptides

    PubMed Central

    Motamedi, Nima; Danelishvili, Lia

    2014-01-01

    Antimicrobial peptides are an important component of the innate immune defence. Mycobacterium avium subsp. hominissuis (M. avium) is an organism that establishes contact with the respiratory and gastrointestinal mucosa as a necessary step for infection. M. avium is resistant to high concentrations of polymyxin B, a surrogate for antimicrobial peptides. To determine gene-encoding proteins that are associated with this resistance, we screened a transposon library of M. avium strain 104 for susceptibility to polymyxin B. Ten susceptible mutants were identified and the inactivated genes sequenced. The great majority of the genes were related to cell wall synthesis and permeability. The mutants were then examined for their ability to enter macrophages and to survive macrophage killing. Three clones among the mutants had impaired uptake by macrophages compared with the WT strain, and all ten clones were attenuated in macrophages. The mutants were also shown to be susceptible to cathelicidin (LL-37), in contrast to the WT bacterium. All but one of the mutants were significantly attenuated in mice. In conclusion, this study indicated that the M. avium envelope is the primary defence against host antimicrobial peptides. PMID:24836414

  10. Screening, Expression, Purification and Functional Characterization of Novel Antimicrobial Peptide Genes from Hermetia illucens (L.)

    PubMed Central

    Elhag, Osama; Zhou, Dingzhong; Song, Qi; Soomro, Abdul Aziz; Cai, Minmin; Zheng, Longyu; Yu, Ziniu; Zhang, Jibin

    2017-01-01

    Antimicrobial peptides from a wide spectrum of insects possess potent microbicidal properties against microbial-related diseases. In this study, seven new gene fragments of three types of antimicrobial peptides were obtained from Hermetia illucens (L), and were named cecropinZ1, sarcotoxin1, sarcotoxin (2a), sarcotoxin (2b), sarcotoxin3, stomoxynZH1, and stomoxynZH1(a). Among these genes, a 189-basepair gene (stomoxynZH1) was cloned into the pET32a expression vector and expressed in the Escherichia coli as a fusion protein with thioredoxin. Results show that Trx-stomoxynZH1 exhibits diverse inhibitory activity on various pathogens, including Gram-positive bacterium Staphylococcus aureus, Gram-negative bacterium Escherichia coli, fungus Rhizoctonia solani Khün (rice)-10, and fungus Sclerotinia sclerotiorum (Lib.) de Bary-14. The minimum inhibitory concentration of Trx-stomoxynZH1 is higher against Gram-positive bacteria than against Gram-negative bacteria but similar between the fungal strains. These results indicate that H. illucens (L.) could provide a rich source for the discovery of novel antimicrobial peptides. Importantly, stomoxynZH1 displays a potential benefit in controlling antibiotic-resistant pathogens. PMID:28056070

  11. Screening, Expression, Purification and Functional Characterization of Novel Antimicrobial Peptide Genes from Hermetia illucens (L.).

    PubMed

    Elhag, Osama; Zhou, Dingzhong; Song, Qi; Soomro, Abdul Aziz; Cai, Minmin; Zheng, Longyu; Yu, Ziniu; Zhang, Jibin

    2017-01-01

    Antimicrobial peptides from a wide spectrum of insects possess potent microbicidal properties against microbial-related diseases. In this study, seven new gene fragments of three types of antimicrobial peptides were obtained from Hermetia illucens (L), and were named cecropinZ1, sarcotoxin1, sarcotoxin (2a), sarcotoxin (2b), sarcotoxin3, stomoxynZH1, and stomoxynZH1(a). Among these genes, a 189-basepair gene (stomoxynZH1) was cloned into the pET32a expression vector and expressed in the Escherichia coli as a fusion protein with thioredoxin. Results show that Trx-stomoxynZH1 exhibits diverse inhibitory activity on various pathogens, including Gram-positive bacterium Staphylococcus aureus, Gram-negative bacterium Escherichia coli, fungus Rhizoctonia solani Khün (rice)-10, and fungus Sclerotinia sclerotiorum (Lib.) de Bary-14. The minimum inhibitory concentration of Trx-stomoxynZH1 is higher against Gram-positive bacteria than against Gram-negative bacteria but similar between the fungal strains. These results indicate that H. illucens (L.) could provide a rich source for the discovery of novel antimicrobial peptides. Importantly, stomoxynZH1 displays a potential benefit in controlling antibiotic-resistant pathogens.

  12. Characterization of a fish antimicrobial peptide: gene expression, subcellular localization, and spectrum of activity.

    PubMed

    Cole, A M; Darouiche, R O; Legarda, D; Connell, N; Diamond, G

    2000-08-01

    Antimicrobial peptides are proposed to act as the first line of mucosal host defense by exerting broad-spectrum microbicidal activity against pathogenic microbes. Pleurocidin, a new 25-residue linear antimicrobial peptide, was recently isolated from the skin secretions of winter flounder (Pleuronectes americanus). The present study identifies the cDNA and gene encoding pleurocidin. The pleurocidin gene comprises four exons. Its upstream region demonstrates consensus binding sequences for transcription factors found in host defense genes in mammals, including sequences identical to the NF-IL6 and alpha and gamma interferon response elements. Pleurocidin is predicted to exist as a 68-residue prepropeptide that undergoes proteolytic cleavage of its amino-terminal signal and carboxy-terminal anionic propiece to form the active, mature peptide. Transmission electron microscopy localized pleurocidin to the mucin granules of skin and intestinal goblet cells. Significant synergy was shown to occur between pleurocidin and D-cycloserine targeting Mycobacterium smegmatis. Pleurocidin was functionally active at physiologic concentrations of magnesium and calcium; however, high concentrations of these divalent cations ablated pleurocidin's activity against a standard test strain, Escherichia coli D31. Pleurocidin was tested against bacterial and fungal clinical isolates and showed broad-spectrum antimicrobial activity. Together, these data support the hypothesis that pleurocidin participates in innate mucosal immunity, and it may prove to be a beneficial therapeutic agent.

  13. Antimicrobial peptide-like genes in Nasonia vitripennis: a genomic perspective

    PubMed Central

    2010-01-01

    Background Antimicrobial peptides (AMPs) are an essential component of innate immunity which can rapidly respond to diverse microbial pathogens. Insects, as a rich source of AMPs, attract great attention of scientists in both understanding of the basic biology of the immune system and searching molecular templates for anti-infective drug design. Despite a large number of AMPs have been identified from different insect species, little information in terms of these peptides is available from parasitic insects. Results By using integrated computational approaches to systemically mining the Hymenopteran parasitic wasp Nasonia vitripennis genome, we establish the first AMP repertoire whose members exhibit extensive sequence and structural diversity and can be distinguished into multiple molecular types, including insect and fungal defensin-like peptides (DLPs) with the cysteine-stabilized α-helical and β-sheet (CSαβ) fold; Pro- or Gly-rich abaecins and hymenoptaecins; horseshoe crab tachystatin-type AMPs with the inhibitor cystine knot (ICK) fold; and a linear α-helical peptide. Inducible expression pattern of seven N. vitripennis AMP genes were verified, and two representative peptides were synthesized and functionally identified to be antibacterial. In comparison with Apis mellifera (Hymenoptera) and several non-Hymenopteran model insects, N. vitripennis has evolved a complex antimicrobial immune system with more genes and larger protein precursors. Three classical strategies that are likely responsible for the complexity increase have been recognized: 1) Gene duplication; 2) Exon duplication; and 3) Exon-shuffling. Conclusion The present study established the N. vitripennis peptidome associated with antimicrobial immunity by using a combined computational and experimental strategy. As the first AMP repertoire of a parasitic wasp, our results offer a basic platform for further studying the immunological and evolutionary significances of these newly discovered AMP

  14. Molecular cloning of novel antimicrobial peptide genes from the skin of the Chinese brown frog, Rana chensinensis.

    PubMed

    Zhao, Jie; Sun, Yan; Li, Zhi; Su, Qi

    2011-02-01

    One species of the Chinese brown frog, Rana chensinensis, is widely distributed in north-central China. In this study, a cDNA library was constructed to clone the antimicrobial peptides' genes from the skin of R. chensinensis. Twenty-three prepropeptide cDNA sequences encoding twelve novel mature antimicrobial peptides were isolated and characterized. Six peptides belonged to three known families previously identified from other Ranid frogs: temporin (4 peptides), brevinin-2 (1 peptide), and palustrin-2 (1 peptide). The other six peptides showed little similarity to known antimicrobial peptides. According to the amino acid sequences, with or without α-helix structure, and either hydrophilic or hydrophobic, these were organized into four new families: chensinin-1 (3 peptides), chensinin-2 (1 peptide), chensinin-3 (1 peptide), and chensinin-4 (1 peptide). Five peptides from different families were chemically synthesized, and their antimicrobial, cytolytic, and hemolytic activities were evaluated. Of these, brevinin-2CE showed strongest antimicrobial activities against both the Gram-positive and Gram-negative bacteria with a slight hemolysis. Temporin-1CEe and palustrin-2CE also displayed a slight hemolysis, but they had different activities to prokaryotic cells. Temporin-1CEe showed higher antimicrobial activity against Gram-positive bacteria than Gram-negative bacteria, whereas it was contrary to palustrin-2CE. Chensinin-1 CEb and chensinin-3CE only had moderate antimicrobial activity against microorganisms. In addition, the brevinin-2 peptides from different brown frogs were analyzed to reveal the taxonomy and phylogenetic relationships of R. chensinensis.

  15. Mytilin B and MGD2, two antimicrobial peptides of marine mussels: gene structure and expression analysis.

    PubMed

    Mitta, G; Hubert, F; Dyrynda, E A; Boudry, P; Roch, P

    2000-06-01

    Previous research has shown that mytilins and MGDs are two types of 4-kDa, cysteine-rich, cationic antimicrobial peptides, which are abundant in hemocytes of the mussels, Mytilus galloprovincialis and M. edulis. The expression of the genes encoding these peptides has been analyzed in the hemocytes of animals subjected to various stress factors, as well as during larval development. Variations in gene expression in adult mussels have been tested under conditions of physical stress, bacterial challenge and heat shock. The results suggest that in adult mussels, the MGD2 gene may be over-expressed with physical and temperature stress, but that reduced expression occurs with bacterial challenge. Gene expression during development has been analyzed using different larval and post-larval stages, ranging from 4-day-old veliger larvae to 32-day-old post-larvae. The results show that the expression of both mytilin B and MGD2 is developmentally regulated, but neither gene is expressed in mussels until after larval settlement and metamorphosis. Finally, the genes encoding two isoforms of these peptides have been cloned and sequenced, revealing that both genes contain four exons and three introns.

  16. Rapid evolution of antimicrobial peptide genes in an insect host-social parasite system.

    PubMed

    Erler, Silvio; Lhomme, Patrick; Rasmont, Pierre; Lattorff, H Michael G

    2014-04-01

    Selection, as a major driver for evolution in host-parasite interactions, may act on two levels; the virulence of the pathogen, and the hosts' defence system. Effectors of the host defence system might evolve faster than other genes e.g. those involved in adaptation to changes in life history or environmental fluctuations. Host-parasite interactions at the level of hosts and their specific social parasites, present a special setting for evolutionarily driven selection, as both share the same environmental conditions and pathogen pressures. Here, we study the evolution of antimicrobial peptide (AMP) genes, in six host bumblebee and their socially parasitic cuckoo bumblebee species. The selected AMP genes evolved much faster than non-immune genes, but only defensin-1 showed significant differences between host and social parasite. Nucleotide diversity and codon-by-codon analyses confirmed that purifying selection is the main selective force acting on bumblebee defence genes.

  17. A novel PCR-based method for high throughput prokaryotic expression of antimicrobial peptide genes

    PubMed Central

    2012-01-01

    Background To facilitate the screening of large quantities of new antimicrobial peptides (AMPs), we describe a cost-effective method for high throughput prokaryotic expression of AMPs. EDDIE, an autoproteolytic mutant of the N-terminal autoprotease, Npro, from classical swine fever virus, was selected as a fusion protein partner. The expression system was used for high-level expression of six antimicrobial peptides with different sizes: Bombinin-like peptide 7, Temporin G, hexapeptide, Combi-1, human Histatin 9, and human Histatin 6. These expressed AMPs were purified and evaluated for antimicrobial activity. Results Two or four primers were used to synthesize each AMP gene in a single step PCR. Each synthetic gene was then cloned into the pET30a/His-EDDIE-GFP vector via an in vivo recombination strategy. Each AMP was then expressed as an Npro fusion protein in Escherichia coli. The expressed fusion proteins existed as inclusion bodies in the cytoplasm and the expression levels of the six AMPs reached up to 40% of the total cell protein content. On in vitro refolding, the fusion AMPs was released from the C-terminal end of the autoprotease by self-cleavage, leaving AMPs with an authentic N terminus. The released fusion partner was easily purified by Ni-NTA chromatography. All recombinant AMPs displayed expected antimicrobial activity against E. coli, Micrococcus luteus and S. cerevisia. Conclusions The method described in this report allows the fast synthesis of genes that are optimized for over-expression in E. coli and for the production of sufficiently large amounts of peptides for functional and structural characterization. The Npro partner system, without the need for chemical or enzymatic removal of the fusion tag, is a low-cost, efficient way of producing AMPs for characterization. The cloning method, combined with bioinformatic analyses from genome and EST sequence data, will also be useful for screening new AMPs. Plasmid pET30a/His-EDDIE-GFP also provides

  18. Detection of polyketide synthase and nonribosomal peptide synthetase biosynthetic genes from antimicrobial coral-associated actinomycetes.

    PubMed

    Li, Jie; Dong, Jun-De; Yang, Jian; Luo, Xiong-Ming; Zhang, Si

    2014-10-01

    The diversity and properties of actinobacteria, predominant residents in coral holobionts, have been rarely documented. In this study, we aimed to explore the species diversity, antimicrobial activities and biosynthetic potential of culturable actinomycetes within the tissues of the scleractinian corals Porites lutea, Galaxea fascicularis and Acropora millepora from the South China Sea. A total of 70 strains representing 13 families and 15 genera of actinobacteria were isolated. The antimicrobial activity and biosynthetic potential of fifteen representative filamentous actinomycetes were estimated. Crude fermentation extracts of 6 strains exhibited comparable or greater activities against Vibrio alginolyticus than ciprofloxacin. Seven of the 15 actinomycetes strains possess type I polyketide synthases (PKS-I) and/or nonribosomal peptide synthetases (NRPS) genes. Nine tested strains possess type II polyketide synthases (PKS-II). Phylogenetic analysis based on 16S rRNA gene sequences indicated that these PKS and NRPS gene screening positive strains belong to genera Nocardiopsis, Pseudonocardia, Streptomyces, Micromonospora, Amycolatopsis and Prauserella. One PKS-I and four NRPS fragments showed <70% similarity to their closest relatives, which suggested the novelty of these genes. This study helps uncover the genetic capacity of stony coral-associated actinomycetes to produce bioactive molecules.

  19. Expression of essential genes for biosynthesis of antimicrobial peptides of Bacillus is modulated by inactivated cells of target microorganisms.

    PubMed

    Leães, Fernanda Leal; Velho, Renata Voltolini; Caldas, Danielle Gregório Gomes; Ritter, Ana Carolina; Tsai, Siu Mui; Brandelli, Adriano

    2016-01-01

    Certain Bacillus strains are important producers of antimicrobial peptides with great potential for biological control. Antimicrobial peptide production by Bacillus amyloliquefaciens P11 was investigated in the presence of heat-inactivated cells of bacteria and fungi. B. amyloliquefaciens P11 exhibited higher antimicrobial activity in the presence of inactivated cells of Staphylococcus aureus and Aspergillus parasiticus compared to other conditions tested. Expression of essential genes related to biosynthesis of the antimicrobial peptides surfactin (sfp), iturin A (lpa-14 and ituD), subtilosin A (sboA) and fengycin (fenA) was investigated by quantitative real-time PCR (qRT-PCR). The genes lpa-14 and ituD were highly expressed in the presence of S. aureus (inactivated cells), indicating induction of iturin A production by B. amyloliquefaciens P11. The other inducing condition (inactivated cells of A. parasiticus) suppressed expression of lpa-14, but increased expression of ituD. A twofold increase in fenA expression was observed for both conditions, while strong suppression of sboA expression was observed in the presence of inactivated cells of S. aureus. An increase in antimicrobial activity was observed, indicating that synthesis of antimicrobial peptides may be induced by target microorganisms.

  20. The flow of antimicrobial peptide genes through a genetic barrier between Mytilus edulis and M. galloprovincialis.

    PubMed

    Boon, Eva; Faure, Matthieu F; Bierne, Nicolas

    2009-05-01

    We studied the population genetics of two antimicrobial peptide (AMP) loci, called Mytilin B and Mytilus galloprovincialis defensin 2 (MGD2), in the secondary contact mosaic hybrid zone between Mytilus edulis and M. galloprovincialis. The isolation period between the two species was estimated to be approximately 1 million years (range, 0.5 million to 2 million years) long. During this period, coevolution between microbes and the immune system has likely occurred. The secondary contact, which would date back to approximately 25,000 (0-200,000) years, recently allowed these coadaptations to be rearranged through hybridization. Distinctive polymorphisms were uncovered in coding sequences of the two AMP loci such as insertion/deletion of codons or bisubstituted codons. Very low levels of differentiation were observed between populations of the two species at both loci, while other nuclear loci often showed marked structure among the same samples. The absence of population differentiation proved to be the consequence of secondary introgression of highly divergent alleles. While only a few recombinants were observed at the Mytilin B locus, the MGD2 locus showed a high intragenic recombination rate, which increased in the exon coding for the mature peptide. In addition, standard neutrality tests revealed significant deviations from the mutation-drift equilibrium at both loci. These results suggest that either balancing or directional selection is likely to play a role in the evolution of the two AMPs and introgression would be adaptive. However, evidence accumulated at the Mytilin B locus allows neither for identification of the direction of selection nor for any conclusions on whether selection acted directly on the antimicrobial peptide itself. At the MGD2 locus, a spatial variation of polymorphism patterns along the sequence suggests that selection was direct, although the precise nature of the selection (directional vs. balancing) remains unclear. This study concurs

  1. Multidimensional signatures in antimicrobial peptides

    PubMed Central

    Yount, Nannette Y.; Yeaman, Michael R.

    2004-01-01

    Conventional analyses distinguish between antimicrobial peptides by differences in amino acid sequence. Yet structural paradigms common to broader classes of these molecules have not been established. The current analyses examined the potential conservation of structural themes in antimicrobial peptides from evolutionarily diverse organisms. Using proteomics, an antimicrobial peptide signature was discovered to integrate stereospecific sequence patterns and a hallmark three-dimensional motif. This striking multidimensional signature is conserved among disulfide-containing antimicrobial peptides spanning biological kingdoms, and it transcends motifs previously limited to defined peptide subclasses. Experimental data validating this model enabled the identification of previously unrecognized antimicrobial activity in peptides of known identity. The multidimensional signature model provides a unifying structural theme in broad classes of antimicrobial peptides, will facilitate discovery of antimicrobial peptides as yet unknown, and offers insights into the evolution of molecular determinants in these and related host defense effector molecules. PMID:15118082

  2. Molecular Characterization of Antimicrobial Peptide Genes of the Carpenter Ant Camponotus floridanus

    PubMed Central

    Ratzka, Carolin; Förster, Frank; Liang, Chunguang; Kupper, Maria; Dandekar, Thomas; Feldhaar, Heike; Gross, Roy

    2012-01-01

    The production of antimicrobial peptides (AMPs) is a major defense mechanism against pathogen infestation and of particular importance for insects relying exclusively on an innate immune system. Here, we report on the characterization of three AMPs from the carpenter ant Camponotus floridanus. Due to sequence similarities and amino acid composition these peptides can be classified into the cysteine-rich (e.g. defensin) and glycine-rich (e.g. hymenoptaecin) AMP groups, respectively. The gene and cDNA sequences of these AMPs were established and their expression was shown to be induced by microbial challenge. We characterized two different defensin genes. The defensin-2 gene has a single intron, whereas the defensin-1 gene has two introns. The deduced amino acid sequence of the C. floridanus defensins is very similar to other known ant defensins with the exception of a short C-terminal extension of defensin-1. The hymenoptaecin gene has a single intron and a very peculiar domain structure. The corresponding precursor protein consists of a signal- and a pro-sequence followed by a hymenoptaecin-like domain and six directly repeated hymenoptaecin domains. Each of the hymenoptaecin domains is flanked by an EAEP-spacer sequence and a RR-site known to be a proteolytic processing site. Thus, proteolytic processing of the multipeptide precursor may generate several mature AMPs leading to an amplification of the immune response. Bioinformatical analyses revealed the presence of hymenoptaecin genes with similar multipeptide precursor structure in genomes of other ant species suggesting an evolutionary conserved important role of this gene in ant immunity. PMID:22912782

  3. Antimicrobial Peptides Under Clinical Trials.

    PubMed

    Greber, Katarzyna E; Dawgul, Małgorzata

    2017-01-01

    Today microbial drug resistance has become a serious problem not only within inpatient setting but also within outpatient setting. Repeated intake and unnecessary usage of antibiotics as well as the transfer of resistance genes are the most important factors that make the microorganisms resistant to conventional antibiotics. A large number of antimicrobials successfully used for prophylaxis and therapeutic purposes have now become ineffective [1, 2]. Therefore, new molecules are being studied to be used in the treatment of various diseases. Some of these molecules are structural compounds based on a combination of peptides, for example, naturally occurring endogenous peptide antibiotics and their synthetic analogues or molecules designed de novo using QSAR (quantitative structureproperty relationships)-based methods [3]. Trying to exploit numerous advantages of antimicrobial peptides such as high potency and selectivity, broad range of targets, potentially low toxicity and low accumulation in tissues, pharmaceutical industry aims to develop them as commercially available drugs and appropriate clinical trials are being conducted [4]. In this paper we define clinical trials steps and describe current status of several antimicrobial peptides under clinical development as well as briefly depict peptide drug formulation.

  4. Gene therapy based in antimicrobial peptides and proinflammatory cytokine prevents reactivation of experimental latent tuberculosis.

    PubMed

    Ramos-Espinosa, Octavio; Hernández-Bazán, Sujhey; Francisco-Cruz, Alejandro; Mata-Espinosa, Dulce; Barrios-Payán, Jorge; Marquina-Castillo, Brenda; López-Casillas, Fernando; Carretero, Marta; Del Río, Marcela; Hernández-Pando, Rogelio

    2016-10-01

    Mycobacterium tuberculosis (Mtb) latent infection can lead to reactivation. The design of new strategies to prevent it is an important subject. B6D2F1 mice were infected intratracheally with a low dose of Mtb H37Rv to induce chronic infection. After 7 months, mice were treated with one dose of recombinant adenoviruses encoding TNFα, β defensin-3 and LL37. Immunosupression was induced 1 month later with corticosterone. In comparison with the control group, mice treated with adenoviruses showed significantly less bacterial load and pneumonia, the adenoviruses encoding TNFα and LL37 being the most efficient. Gene therapy based in a proinflammatory cytokine or antimicrobial peptides is a potentially useful system to prevent reactivation of latent tuberculosis.

  5. Regulation of antimicrobial peptide gene expression by nutrients and by-products of microbial metabolism

    PubMed Central

    Campbell, Yan; Fantacone, Mary L.

    2013-01-01

    Background Antimicrobial peptides (AMPs) are synthesized and secreted by immune and epithelial cells that are constantly exposed to environmental microbes. AMPs are essential for barrier defense, and deficiencies lead to increased susceptibility to infection. In addition to their ability to disrupt the integrity of bacterial, viral and fungal membranes, AMPs bind lipopolysaccharides, act as chemoattractants for immune cells and bind to cellular receptors and modulate the expression of cytokines and chemokines. These additional biological activities may explain the role of AMPs in inflammatory diseases and cancer. Modulating the endogenous expression of AMPs offers potential therapeutic treatments for infection and disease. Methods The present review examines the published data from both in vitro and in vivo studies reporting the effects of nutrients and by-products of microbial metabolism on the expression of antimicrobial peptide genes in order to highlight an emerging appreciation for the role of dietary compounds in modulating the innate immune response. Results Vitamins A and D, dietary histone deacetylases and by-products of intestinal microbial metabolism (butyrate and secondary bile acids) have been found to regulate the expression of AMPs in humans. Vitamin D deficiency correlates with increased susceptibility to infection, and supplementation studies indicate an improvement in defense against infection. Animal and human clinical studies with butyrate indicate that increasing expression of AMPs in the colon protects against infection. Conclusion These findings suggest that diet and/or consumption of nutritional supplements may be used to improve and/or modulate immune function. In addition, by-products of gut microbe metabolism could be important for communicating with intestinal epithelial and immune cells, thus affecting the expression of AMPs. This interaction may help establish a mucosal barrier to prevent invasion of the intestinal epithelium by either

  6. Calcitriol stimulates gene expression of cathelicidin antimicrobial peptide in breast cancer cells with different phenotype.

    PubMed

    García-Quiroz, Janice; García-Becerra, Rocío; Santos-Martínez, Nancy; Avila, Euclides; Larrea, Fernando; Díaz, Lorenza

    2016-11-10

    In normal and neoplastic cells, growth-promoting, proangiogenic, cytotoxic and pro-apoptotic effects have all been attributed to cathelicidin antimicrobial peptide (CAMP). Nevertheless, little is known about the factors regulating this peptide expression in breast cancer. Herein we asked if the well-known antineoplastic hormone calcitriol could differentially modulate CAMP gene expression in human breast cancer cells depending on the cell phenotype in terms of efficacy and potency. The established breast cancer cell lines MCF7, BT-474, HCC1806, HCC1937, SUM-229PE and a primary cell culture generated from invasive ductal breast carcinoma were used in this study. Calcitriol regulation of cathelicidin gene expression in vitro and in human breast cancer xenografts was studied by real time PCR. Tumorigenicity was evaluated for each cell line in athymic mice. Estrogen receptor (ER)α + breast cancer cells showed the highest basal CAMP gene expression. When incubated with calcitriol, CAMP gene expression was stimulated in a dose-dependent and cell phenotype-independent manner. Efficacy of calcitriol was lower in ERα + cells when compared to ERα- cells (<10 vs. >70 folds over control, respectively). Conversely, calcitriol lowest potency upon CAMP gene expression was observed in the ERα-/EGFR+ SUM-229PE cell line (EC50 = 70.8 nM), while the highest was in the basal-type/triple-negative cells HCC1806 (EC50 = 2.13 nM) followed by ERα + cells MCF7 and BT-474 (EC50 = 4.42 nM and 14.6 nM, respectively). In vivo, lower basal CAMP gene expression was related to increased tumorigenicity and lack of ERα expression. Xenografted triple-negative breast tumors of calcitriol-treated mice showed increased CAMP gene expression compared to vehicle-treated animals. Independently of the cell phenotype, calcitriol provoked a concentration-dependent stimulation on CAMP gene expression, showing greater potency in the triple negative HCC1806 cell line. Efficacy of

  7. An alpha-helical cationic antimicrobial peptide selectively modulates macrophage responses to lipopolysaccharide and directly alters macrophage gene expression.

    PubMed

    Scott, M G; Rosenberger, C M; Gold, M R; Finlay, B B; Hancock, R E

    2000-09-15

    Certain cationic antimicrobial peptides block the binding of LPS to LPS-binding protein and reduce the ability of LPS to induce the production of inflammatory mediators by macrophages. To gain a more complete understanding of how LPS activates macrophages and how cationic peptides influence this process, we have used gene array technology to profile gene expression patterns in macrophages treated with LPS in the presence or the absence of the insect-derived cationic antimicrobial peptide CEMA (cecropin-melittin hybrid). We found that CEMA selectively blocked LPS-induced gene expression in the RAW 264.7 macrophage cell line. The ability of LPS to induce the expression of >40 genes was strongly inhibited by CEMA, while LPS-induced expression of another 16 genes was relatively unaffected. In addition, CEMA itself induced the expression of a distinct set of 35 genes, including genes involved in cell adhesion and apoptosis. Thus, CEMA, a synthetic alpha-helical peptide, selectively modulates the transcriptional response of macrophages to LPS and can alter gene expression in macrophages.

  8. Identification and analysis of the sap genes from Vibrio fischeri belonging to the ATP-binding cassette gene family required for peptide transport and resistance to antimicrobial peptides.

    PubMed

    Chen, H Y; Weng, S F; Lin, J W

    2000-03-24

    Partial nucleotide sequences of the sapD and sapF genes of the sap operon (GenBank Accession No. AF178651) from Vibrio fischeri ATCC 7744 have been determined, and the peptide transport system of ATP-binding proteins SapD and SapF encoded by the genes have been deduced. Alignment and comparison of the Sap proteins of V. fischeri, Escherichia coli, Salmonella typhimurium, and Haemophilus influenzae Rd show that these proteins are homologous. The sap operon residing in the genome enables V. fischeri to transport peptides and resist antimicrobial peptides. Nucleotide sequence and functional analyses confirm that the specific regulatory-region-like sequence R&R* that resides inside the sapD gene and before the sapF gene functions in gene expression and regulation; also, it is regulated by the LuxR-AI complex of the V. fischeri lux regulon. The putative upstream activator binding sequences SigmaUASI, SigmaUASII, SigmaUASIII TGTCGACTTGGGCCTCGCTGTCCGTATGCACA (72nd to 103rd bp), TGTCCGTATGCACA (90th to 103rd bp), and TGTTCAAGTACCAGAAAGACA (111st to 133rd bp) in the R&R* sequence, which are similar to the two-component regulator binding sequence TGT-N(8-12)-ACA and the LuxR-AI binding sequence ACCTGTAGGATCGTACAGGT in the regulatory region of the V. fischeri lux regulon, might be the specific sequences recognized by the LuxR-AI complex for enhancement.

  9. Antimicrobial Peptides from Plants

    PubMed Central

    Tam, James P.; Wang, Shujing; Wong, Ka H.; Tan, Wei Liang

    2015-01-01

    Plant antimicrobial peptides (AMPs) have evolved differently from AMPs from other life forms. They are generally rich in cysteine residues which form multiple disulfides. In turn, the disulfides cross-braced plant AMPs as cystine-rich peptides to confer them with extraordinary high chemical, thermal and proteolytic stability. The cystine-rich or commonly known as cysteine-rich peptides (CRPs) of plant AMPs are classified into families based on their sequence similarity, cysteine motifs that determine their distinctive disulfide bond patterns and tertiary structure fold. Cystine-rich plant AMP families include thionins, defensins, hevein-like peptides, knottin-type peptides (linear and cyclic), lipid transfer proteins, α-hairpinin and snakins family. In addition, there are AMPs which are rich in other amino acids. The ability of plant AMPs to organize into specific families with conserved structural folds that enable sequence variation of non-Cys residues encased in the same scaffold within a particular family to play multiple functions. Furthermore, the ability of plant AMPs to tolerate hypervariable sequences using a conserved scaffold provides diversity to recognize different targets by varying the sequence of the non-cysteine residues. These properties bode well for developing plant AMPs as potential therapeutics and for protection of crops through transgenic methods. This review provides an overview of the major families of plant AMPs, including their structures, functions, and putative mechanisms. PMID:26580629

  10. Butyrate enhances disease resistance of chickens by inducing antimicrobial host defense peptide gene expression

    USDA-ARS?s Scientific Manuscript database

    Host defense peptides (HDPs) constitute a large group of natural broad-spectrum antimicrobials and an important first line of immunity in virtually all forms of life. Specific augmentation of synthesis of endogenous HDPs may represent a promising antibiotic-alternative approach to disease control. I...

  11. Curcumin induces human cathelicidin antimicrobial peptide gene expression through a vitamin D receptor-independent pathway

    PubMed Central

    Guo, Chunxiao; Rosoha, Elena; Lowry, Malcolm B.; Borregaard, Niels; Gombart, Adrian F.

    2012-01-01

    The vitamin D receptor (VDR) mediates the pleiotropic biologic effects of 1α,25 dihydroxy-vitamin D3. Recent in vitro studies suggested that curcumin and poly-unsaturated fatty acids (PUFAs) also bind to VDR with low affinity. As potential ligands for the VDR, we hypothesized that curcumin and PUFAs would induce expression of known VDR target genes in cells. In this study, we tested whether these compounds regulated two important VDR target genes - human cathelicidin antimicrobial peptide (CAMP) and 1,25-dihydroxyvitamin D3 24-hydroxylase (CYP24A1)- in human monocytic cell line U937, colon cancer cell line HT-29 and keratinocyte cell line HaCaT. We demonstrated that PUFAs failed to induce CAMP or CYP24A1 mRNA expression in all three cell lines, but curcumin up-regulated CAMP mRNA and protein levels in U937 cells. Curcumin treatment induced CAMP promoter activity from a luciferase reporter construct lacking the VDR binding site and did not increase binding of the VDR to the CAMP promoter as determined by chromatin immunoprecipitation assays. These findings indicate that induction of CAMP by curcumin occurs through a vitamin D receptor-independent manner. We conclude that PUFAs and curcumin do not function as ligands for the VDR. PMID:22841393

  12. Plant antimicrobial peptides.

    PubMed

    Nawrot, Robert; Barylski, Jakub; Nowicki, Grzegorz; Broniarczyk, Justyna; Buchwald, Waldemar; Goździcka-Józefiak, Anna

    2014-05-01

    Plant antimicrobial peptides (AMPs) are a component of barrier defense system of plants. They have been isolated from roots, seeds, flowers, stems, and leaves of a wide variety of species and have activities towards phytopathogens, as well as against bacteria pathogenic to humans. Thus, plant AMPs are considered as promising antibiotic compounds with important biotechnological applications. Plant AMPs are grouped into several families and share general features such as positive charge, the presence of disulfide bonds (which stabilize the structure), and the mechanism of action targeting outer membrane structures.

  13. The screening of antimicrobial bacteria with diverse novel nonribosomal peptide synthetase (NRPS) genes from South China sea sponges.

    PubMed

    Zhang, Wei; Li, Zhiyong; Miao, Xiaoling; Zhang, Fengli

    2009-01-01

    Nonribosomal peptide synthetase (NRPS) adenylation (A) domain genes were investigated by polymerase chain reaction for 109 bacteria isolated from four South China Sea sponges, Stelletta tenuis, Halichondria rugosa, Dysidea avara, and Craniella australiensis. Meanwhile, the antimicrobial bioassay of bacteria with NRPS genes were carried out to confirm the screening of NRPS genes. Fifteen bacteria were found to contain NRPS genes and grouped into two phyla Firmicutes (13 of 15) and Proteobacteria (two of 15) according to 16S rDNA sequences. Based on the phylogenetic analysis of the conserved A domain amino acid sequences, most of the NRPS fragments (11 of 15) showed below 70% similarity to their closest relatives suggesting the novelty of these NRPS genes. All of the 15 bacteria with NRPS genes have antimicrobial activities, with most of them exhibiting activity against multiple indicators including fungi and gram-positive and gram-negative bacteria. The different antimicrobial spectra indicate the chemical diversity of biologically active metabolites of sponge-associated bacteria and the possible role of bacterial symbionts in the host's antimicrobial chemical defense. Phylogenetic analysis based on the representative NRPS genes shows high diversity of marine NRPS genes. The combined molecular technique and bioassay strategy will be useful to obtain sponge-associated bacteria with the potential to synthesize bioactive compounds.

  14. The effect of peptidoglycan enriched diets on antimicrobial peptide gene expression in rainbow trout (Oncorhynchus mykiss).

    PubMed

    Casadei, Elisa; Bird, Steve; Vecino, Jose L González; Wadsworth, Simon; Secombes, Christopher J

    2013-02-01

    The aim of this study was to investigate the effect of feeding rainbow trout (Oncorhynchus mykiss) peptidoglycan (PG) enriched diets on antimicrobial peptide (AMP) gene expression. Fish were divided into 5 groups and fed diets containing 0, 5, 10, 50 and 100 mg PG/Kg, and sampled 1, 7 and 14 days later. The expression of eight AMP genes (four defensins, two cathelicidins and two liver expressed AMPs) was determined in skin, gill, gut and liver, tissues important for first lines of defence or production of acute phase proteins. Up-regulation of many AMPs was found after feeding the PG enriched diets, with sequential expression seen over the time course studied, where defensins were typically expressed early and cathelicidins and LEAPs later on. A number of clear differences in AMP responsiveness between the tissues examined were also apparent. Of the four PG concentrations used, 5 mg PG/Kg did not always elicit AMP gene induction or to the same degree as seen with the other diets. The three higher dose groups generally showed similar trends although differences in fold change were more pronounced in the 50 and 100 mg PG/Kg groups. Curiously several AMPs were down-regulated after 14 days of feeding in gills, gut and liver. Nevertheless, overall the PG enriched diets had a positive effect on AMP expression. Further investigations now need to be undertaken to confirm whether this higher AMP gene expression correlates with protection against common bacterial diseases and if PG enriched diets have value as a means to temporarily boost the piscine immune system. Copyright © 2012 Elsevier Ltd. All rights reserved.

  15. Butyrate Enhances Disease Resistance of Chickens by Inducing Antimicrobial Host Defense Peptide Gene Expression

    PubMed Central

    Sunkara, Lakshmi T.; Achanta, Mallika; Schreiber, Nicole B.; Bommineni, Yugendar R.; Dai, Gan; Jiang, Weiyu; Lamont, Susan; Lillehoj, Hyun S.; Beker, Ali; Teeter, Robert G.; Zhang, Guolong

    2011-01-01

    Host defense peptides (HDPs) constitute a large group of natural broad-spectrum antimicrobials and an important first line of immunity in virtually all forms of life. Specific augmentation of synthesis of endogenous HDPs may represent a promising antibiotic-alternative approach to disease control. In this study, we tested the hypothesis that exogenous administration of butyrate, a major type of short-chain fatty acids derived from bacterial fermentation of undigested dietary fiber, is capable of inducing HDPs and enhancing disease resistance in chickens. We have found that butyrate is a potent inducer of several, but not all, chicken HDPs in HD11 macrophages as well as in primary monocytes, bone marrow cells, and jejuna and cecal explants. In addition, butyrate treatment enhanced the antibacterial activity of chicken monocytes against Salmonella enteritidis, with a minimum impact on inflammatory cytokine production, phagocytosis, and oxidative burst capacities of the cells. Furthermore, feed supplementation with 0.1% butyrate led to a significant increase in HDP gene expression in the intestinal tract of chickens. More importantly, such a feeding strategy resulted in a nearly 10-fold reduction in the bacterial titer in the cecum following experimental infections with S. enteritidis. Collectively, the results indicated that butyrate-induced synthesis of endogenous HDPs is a phylogenetically conserved mechanism of innate host defense shared by mammals and aves, and that dietary supplementation of butyrate has potential for further development as a convenient antibiotic-alternative strategy to enhance host innate immunity and disease resistance. PMID:22073293

  16. Computational promoter analysis of mouse, rat and human antimicrobial peptide-coding genes

    PubMed Central

    Brahmachary, Manisha; Schönbach, Christian; Yang, Liang; Huang, Enli; Tan, Sin Lam; Chowdhary, Rajesh; Krishnan, SPT; Lin, Chin-Yo; Hume, David A; Kai, Chikatoshi; Kawai, Jun; Carninci, Piero; Hayashizaki, Yoshihide; Bajic, Vladimir B

    2006-01-01

    Background Mammalian antimicrobial peptides (AMPs) are effectors of the innate immune response. A multitude of signals coming from pathways of mammalian pathogen/pattern recognition receptors and other proteins affect the expression of AMP-coding genes (AMPcgs). For many AMPcgs the promoter elements and transcription factors that control their tissue cell-specific expression have yet to be fully identified and characterized. Results Based upon the RIKEN full-length cDNA and public sequence data derived from human, mouse and rat, we identified 178 candidate AMP transcripts derived from 61 genes belonging to 29 AMP families. However, only for 31 mouse genes belonging to 22 AMP families we were able to determine true orthologous relationships with 30 human and 15 rat sequences. We screened the promoter regions of AMPcgs in the three species for motifs by an ab initio motif finding method and analyzed the derived promoter characteristics. Promoter models were developed for alpha-defensins, penk and zap AMP families. The results suggest a core set of transcription factors (TFs) that regulate the transcription of AMPcg families in mouse, rat and human. The three most frequent core TFs groups include liver-, nervous system-specific and nuclear hormone receptors (NHRs). Out of 440 motifs analyzed, we found that three represent potentially novel TF-binding motifs enriched in promoters of AMPcgs, while the other four motifs appear to be species-specific. Conclusion Our large-scale computational analysis of promoters of 22 families of AMPcgs across three mammalian species suggests that their key transcriptional regulators are likely to be TFs of the liver-, nervous system-specific and NHR groups. The computationally inferred promoter elements and potential TF binding motifs provide a rich resource for targeted experimental validation of TF binding and signaling studies that aim at the regulation of mouse, rat or human AMPcgs. PMID:17254313

  17. Immune genes and divergent antimicrobial peptides in flies of the subgenus Drosophila.

    PubMed

    Hanson, Mark A; Hamilton, Phineas T; Perlman, Steve J

    2016-10-24

    Drosophila is an important model for studying the evolution of animal immunity, due to the powerful genetic tools developed for D. melanogaster. However, Drosophila is an incredibly speciose lineage with a wide range of ecologies, natural histories, and diverse natural enemies. Surprisingly little functional work has been done on immune systems of species other than D. melanogaster. In this study, we examine the evolution of immune genes in the speciose subgenus Drosophila, which diverged from the subgenus Sophophora (that includes D. melanogaster) approximately 25-40 Mya. We focus on D. neotestacea, a woodland species used to study interactions between insects and parasitic nematodes, and combine recent transcriptomic data with infection experiments to elucidate aspects of host immunity. We found that the vast majority of genes involved in the D. melanogaster immune response are conserved in D. neotestacea, with a few interesting exceptions, particularly in antimicrobial peptides (AMPs); until recently, AMPs were not thought to evolve rapidly in Drosophila. Unexpectedly, we found a distinct diptericin in subgenus Drosophila flies that appears to have evolved under diversifying (positive) selection. We also describe the presence of the AMP drosocin, which was previously thought to be restricted to the subgenus Sophophora, in the subgenus Drosophila. We challenged two subgenus Drosophila species, D. neotestacea and D. virilis with bacterial and fungal pathogens and quantified AMP expression. While diptericin in D. virilis was induced by exposure to gram-negative bacteria, it was not induced in D. neotestacea, showing that conservation of immune genes does not necessarily imply conservation of the realized immune response. Our study lends support to the idea that invertebrate AMPs evolve rapidly, and that Drosophila harbor a diverse repertoire of AMPs with potentially important functional consequences.

  18. Antimicrobial peptides: therapeutic potentials.

    PubMed

    Kang, Su-Jin; Park, Sung Jean; Mishig-Ochir, Tsogbadrakh; Lee, Bong-Jin

    2014-12-01

    The increasing appearance of multidrug-resistant pathogens has created an urgent need for suitable alternatives to current antibiotics. Antimicrobial peptides (AMPs), which act as defensive weapons against microbes, have received great attention because of broad-spectrum activities, unique action mechanisms and rare antibiotic-resistant variants. Despite desirable characteristics, they have shown limitations in pharmaceutical development due to toxicity, stability and manufacturing costs. Because of these drawbacks, only a few AMPs have been tested in Phase III clinical trials and no AMPs have been approved by the US FDA yet. However, these obstacles could be overcome by well-known methods such as changing physicochemical characteristics and introducing nonnatural amino acids, acetylation or amidation, as well as modern techniques like molecular targeted AMPs, liposomal formulations and drug delivery systems. Thus, the current challenge in this field is to develop therapeutic AMPs at a reasonable cost as well as to overcome the limitations.

  19. Salmonella enterica Serovar Enteritidis Antimicrobial Peptide Resistance Genes Aid in Defense against Chicken Innate Immunity, Fecal Shedding, and Egg Deposition

    PubMed Central

    McKelvey, Jessica A.; Yang, Ming; Jiang, Yanhua

    2014-01-01

    Salmonella enterica serovar Enteritidis (S. Enteritidis) is a major etiologic agent of nontyphoid salmonellosis in the United States. S. Enteritidis persistently and silently colonizes the intestinal and reproductive tract of laying hens, resulting in contaminated poultry products. The consumption of contaminated poultry products has been identified as a significant risk factor for human salmonellosis. To understand the mechanisms S. Enteritidis utilizes to colonize and persist in laying hens, we used selective capture of transcribed sequences to identify genes overexpressed in the HD11 chicken macrophage cell line and in primary chicken oviduct epithelial cells. From the 15 genes found to be overexpressed in both cell types, we characterized the antimicrobial peptide resistance (AMPR) genes, virK and ybjX, in vitro and in vivo. In vitro, AMPR genes were required for natural morphology, motility, secretion, defense against detergents such as EDTA and bile salts, and resistance to antimicrobial peptides polymyxin B and avian β-defensins. From this, we inferred the AMPR genes play a role in outer membrane stability and/or modulation. In the intestinal tract, AMPR genes were involved in early intestinal colonization and fecal shedding. In the reproductive tract, virK was required in early colonization whereas a deletion of ybjX caused prolonged ovary colonization and egg deposition. Data from the present study indicate that AMPR genes are differentially utilized in various host environments, which may ultimately assist S. Enteritidis in persistent and silent colonization of chickens. PMID:25267840

  20. Expression of antimicrobial peptide genes in Bombyx mori gut modulated by oral bacterial infection and development.

    PubMed

    Wu, Shan; Zhang, Xiaofeng; He, Yongqiang; Shuai, Jiangbing; Chen, Xiaomei; Ling, Erjun

    2010-11-01

    Although Bombyx mori systematic immunity is extensively studied, little is known about the silkworm's intestine-specific responses to bacterial infection. Antimicrobial peptides (AMPs) gene expression analysis of B. mori intestinal tissue to oral infection with the Gram-positive (Staphylococcus aureus) and -negative (Escherichia coli) bacteria revealed that there is specificity in the interaction between host immune responses and parasite types. Neither Att1 nor Leb could be stimulated by S. aureus and E. coli. However, CecA1, Glo1, Glo2, Glo3, Glo4 and Lys, could only be trigged by S. aureus. On the contrary, E. coli stimulation caused the decrease in the expression of CecA1, Glo3 and Glo4 in some time points. Interestingly, there is regional specificity in the silkworm local gut immunity. During the immune response, the increase in Def, Hem and LLP3 was only detected in the foregut and midgut. For CecB1, CecD, LLP2 and Mor, after orally administered with E. coli, the up-regulation was only limited in the midgut and hindgut. CecE was the only AMP that positively responses to the both bacteria in all the testing situations. With development, the expression levels of the AMPs were also changed dramatically. That is, at spinning and prepupa stages, a large increase in the expression of CecA1, CecB1, CecD, CecE, Glo1, Glo2, Glo3, Glo4, Leb, Def, Hem, Mor and Lys was detected in the gut. Unexpectedly, in addition to the IMD pathway genes, the Toll and JAK/STAT pathway genes in the silkworm gut can also be activated by microbial oral infection. But in the developmental course, corresponding to the increase in expression of AMPs at spinning and prepupa stages, only the Toll pathway genes in the gut exhibit the similar increasing trend. Our results imply that the immune responses in the silkworm gut are synergistically regulated by the Toll, JAK/STAT and IMD pathways. However, as the time for approaching pupation, the Toll pathway may play a role in the AMPs expression.

  1. Antimicrobial peptides: properties and applicability.

    PubMed

    van 't Hof, W; Veerman, E C; Helmerhorst, E J; Amerongen, A V

    2001-04-01

    All organisms need protection against microorganisms, e. g. bacteria, viruses and fungi. For many years, attention has been focused on adaptive immunity as the main antimicrobial defense system. However, the adaptive immune system, with its network of humoral and cellular responses is only found in higher animals, while innate immunity is encountered in all living creatures. The turning point in the appreciation of the innate immunity was the discovery of antimicrobial peptides in the early eighties. In general these peptides act by disrupting the structural integrity of the microbial membranes. It has become clear that membrane-active peptides and proteins play a crucial role in both the innate and the adaptive immune system as antimicrobial agents. This review is focused on the functional and structural features of the naturally occurring antimicrobial peptides, and discusses their potential as therapeutics.

  2. Characterization, evolution and functional analysis of the liver-expressed antimicrobial peptide 2 (LEAP-2) gene in miiuy croaker.

    PubMed

    Liu, Tianxing; Gao, Yunhang; Wang, Rixin; Xu, Tianjun

    2014-12-01

    As an evolutionarily older defense strategy, the innate immune is the dominant immune system and provides a first line of antimicrobial host defense in teleost. Liver-expressed antimicrobial peptide-2 (LEAP-2) is a critical molecule of the innate immune system and plays a very important role in resistance against bacterial infections. We reported comprehensive analysis and characterization of LEAP-2 gene from miiuy croaker (Miichthys miiuy) in here. The complete cDNA of miiuy croaker LEAP-2 consists 2360 bp, including a 5' terminal untranslated region (UTR) of 170 bp, an open reading frame (ORF) of 312 bp, and a 3'-UTR of 1878 bp. Interestingly, two polyadenylation signals (AATTAAA) which may involve the stability, translation efficiency, or localization of an mRNA in a tissue were found in 3'-UTR. Genomic DNA of miiuy croaker LEAP-2 includes three exons and two introns, which is similar to LEAP-2 genes in other mammals and fish. The deduced 103 amino acids consist of signal peptide, prodomain and mature peptide. Four highly conserved cysteine residues involved two disulfide bridges in mature peptide. Real-time PCR results showed that LEAP-2 was ubiquitously expressed in all tissues and the expression level was highest in liver. Significantly, the expression levels were increased after infection with Vibrio anguillarum in liver and spleen. The antimicrobial activity analysis result of LEAP-2 in vitro indicated that LEAP-2 of miiuy croaker was effective in controlling Aeromonas hydrophila. In addition, we performed evolutionary analysis in order to estimate the selective constraints on the LEAP-2 gene. The result indicated that no positive selection exists in LEAP-2 gene sequences, which may be on account of irreplaceable function constrains. Meanwhile, we compared the structure of LEAP-2 with that of another Liver-expressed antimicrobial peptide (LEAP-1, also named HAMP), and found the LEAP-2 from miiuy croaker comprises of α-helix, β-sheet, and β-turn while the

  3. [Transgenic Belarussian-bred potato plants expressing genes for antimicrobial peptides of the cecropin-melittin type].

    PubMed

    Vutto, N L; Gapeeva, T A; Pundik, A N; Tret'iakova, T G; Volotovskiĭ, I D

    2010-12-01

    Binary vectors for Agrobacterium-mediated transformation were constructed to express the genes for antimicrobial peptides (APs) of the cectropin-melittin type under the control of the cauliflower mosaic virus 35S RNA promoter in plants. It was shown with Escherichia coli and Agrobacterium tumefaciens cells that the cassettes could be cloned in pB1121-based vectors with deletion of the 3-D-glycuronidase gene only in the orientation opposite to that of the original vector. Transgenic potato plants were obtained using the Belarussian varieties Odyssey, Vetraz, and Scarb. Their cells expressed the MsrA1 or CEMA peptides of the cecropin-melittin type. The expression was shown to confer higher resistance to bacterial (Erwinia carotovora) infection and extremely high resistance to fungal (Phytophtora infestans and Alternarla solani) infections.

  4. A reverse search for antimicrobial peptides in Ciona intestinalis: identification of a gene family expressed in hemocytes and evaluation of activity.

    PubMed

    Fedders, Henning; Leippe, Matthias

    2008-01-01

    In search of antimicrobial peptides in the tunicate Ciona intestinalis, we used the recently completed genome project and the substantial number of expressed sequence tag (EST) data available as a screening matrix. By this means, we identified a putative gene family that exhibits several structural features typical of antimicrobial peptides. We designed and synthesized a peptide corresponding to the core region of a member of this peptide family, which is predicted to adopt an amphipathic alpha-helical structure. The synthetic peptide exerted potent antimicrobial activity against a variety of bacteria and against the yeast Candida albicans but was not cytolytic for mammalian erythrocytes. Moreover, by employing a non-cell-permeable fluorescent dye it became evident that the peptide kills bacteria by permeabilizing their cytoplasmic membranes. Using the synthetic peptide as an antigen, we generated specific antibodies and localized the natural parent molecule to a compartment of a distinct hemocyte type, the univacuolar refractile granulocytes. As C. intestinalis apparently does not possess gene products that resemble well-known antimicrobial peptides of tunicates and of other animals, the aforementioned peptide family may represent a potent armamentarium of the hemocytes to combat microbial infection in sea squirts.

  5. Novel Formulations for Antimicrobial Peptides

    PubMed Central

    Carmona-Ribeiro, Ana Maria; Carrasco, Letícia Dias de Melo

    2014-01-01

    Peptides in general hold much promise as a major ingredient in novel supramolecular assemblies. They may become essential in vaccine design, antimicrobial chemotherapy, cancer immunotherapy, food preservation, organs transplants, design of novel materials for dentistry, formulations against diabetes and other important strategical applications. This review discusses how novel formulations may improve the therapeutic index of antimicrobial peptides by protecting their activity and improving their bioavailability. The diversity of novel formulations using lipids, liposomes, nanoparticles, polymers, micelles, etc., within the limits of nanotechnology may also provide novel applications going beyond antimicrobial chemotherapy. PMID:25302615

  6. Novel formulations for antimicrobial peptides.

    PubMed

    Carmona-Ribeiro, Ana Maria; de Melo Carrasco, Letícia Dias

    2014-10-09

    Peptides in general hold much promise as a major ingredient in novel supramolecular assemblies. They may become essential in vaccine design, antimicrobial chemotherapy, cancer immunotherapy, food preservation, organs transplants, design of novel materials for dentistry, formulations against diabetes and other important strategical applications. This review discusses how novel formulations may improve the therapeutic index of antimicrobial peptides by protecting their activity and improving their bioavailability. The diversity of novel formulations using lipids, liposomes, nanoparticles, polymers, micelles, etc., within the limits of nanotechnology may also provide novel applications going beyond antimicrobial chemotherapy.

  7. Pathogen-induced expression of a cecropin A-melittin antimicrobial peptide gene confers antifungal resistance in transgenic tobacco.

    PubMed

    Yevtushenko, Dmytro P; Romero, Rafael; Forward, Benjamin S; Hancock, Robert E; Kay, William W; Misra, Santosh

    2005-06-01

    Expression of defensive genes from a promoter that is specifically activated in response to pathogen invasion is highly desirable for engineering disease-resistant plants. A plant transformation vector was constructed with transcriptional fusion between the pathogen-responsive win3.12T promoter from poplar and the gene encoding the novel cecropin A-melittin hybrid peptide (CEMA) with strong antimicrobial activity. This promoter-transgene combination was evaluated in transgenic tobacco (Nicotiana tabacum L. cv. Xanthi) for enhanced plant resistance against a highly virulent pathogenic fungus Fusarium solani. Transgene expression in leaves was strongly increased after fungal infection or mechanical wounding, and the accumulation of CEMA transcripts was found to be systemic and positively correlated with the number of transgene insertions. A simple and efficient in vitro regeneration bioassay for preliminary screening of transgenic lines against pathogenic fungi was developed. CEMA had strong antifungal activity in vitro, inhibiting conidia germination at concentrations that were non-toxic to tobacco protoplasts. Most importantly, the expression level of the CEMA peptide in vivo, regulated by the win3.12T promoter, was sufficient to confer resistance against F. solani in transgenic tobacco. The antifungal resistance of plants with high CEMA expression was strong and reproducible. In addition, leaf tissue extracts from transgenic plants significantly reduced the number of fungal colonies arising from germinated conidia. Accumulation of CEMA peptide in transgenic tobacco had no deleterious effect on plant growth and development. This is the first report showing the application of a heterologous pathogen-inducible promoter to direct the expression of an antimicrobial peptide in plants, and the feasibility of this approach to provide disease resistance in tobacco and, possibly, other crops.

  8. Bacterial sensing of antimicrobial peptides.

    PubMed

    Otto, Michael

    2009-01-01

    Antimicrobial peptides (AMPs) form a crucial part of human innate host defense, especially in neutrophil phagosomes and on epithelial surfaces. Bacteria have a variety of efficient resistance mechanisms to human AMPs, such as efflux pumps, secreted proteases, and alterations of the bacterial cell surface that are aimed to minimize attraction of the typically cationic AMPs. In addition, bacteria have specific sensors that activate AMP resistance mechanisms when AMPs are present. The prototypical Gram-negative PhoP/PhoQ and the Gram-positive Aps AMP-sensing systems were first described and investigated in Salmonella typhimurium and Staphylococcus epidermidis, respectively. Both include a classical bacterial two-component sensor/regulator system, but show many structural, mechanistic, and functional differences. The PhoP/PhoQ regulon controls a variety of genes not necessarily limited to AMP resistance mechanisms, but apparently aimed to combat innate host defense on a broad scale. In contrast, the staphylococcal Aps system predominantly upregulates AMP resistance mechanisms, namely the D-alanylation of teichoic acids, inclusion of lysyl-phosphati-dylglycerol in the cytoplasmic membrane, and expression of the putative VraFG AMP efflux pump. Notably, both systems are crucial for virulence and represent possible targets for antimicrobial therapy. Copyright (c) 2009 S. Karger AG, Basel.

  9. Peptides and Peptidomimetics for Antimicrobial Drug Design

    PubMed Central

    Mojsoska, Biljana; Jenssen, Håvard

    2015-01-01

    The purpose of this paper is to introduce and highlight a few classes of traditional antimicrobial peptides with a focus on structure-activity relationship studies. After first dissecting the important physiochemical properties that influence the antimicrobial and toxic properties of antimicrobial peptides, the contributions of individual amino acids with respect to the peptides antibacterial properties are presented. A brief discussion of the mechanisms of action of different antimicrobials as well as the development of bacterial resistance towards antimicrobial peptides follows. Finally, current efforts on novel design strategies and peptidomimetics are introduced to illustrate the importance of antimicrobial peptide research in the development of future antibiotics. PMID:26184232

  10. Genomic Organization, Molecular Diversification, and Evolution of Antimicrobial Peptide Myticin-C Genes in the Mussel (Mytilus galloprovincialis)

    PubMed Central

    Vera, Manuel; Martínez, Paulino; Poisa-Beiro, Laura; Figueras, Antonio; Novoa, Beatriz

    2011-01-01

    Myticin-C is a highly variable antimicrobial peptide associated to immune response in Mediterranean mussel (Mytilus galloprovincialis). In this study, we tried to ascertain the genetic organization and the mechanisms underlying myticin-C variation and evolution of this gene family. We took advantage of the large intron size variation to find out the number of myticin-C genes. Using fragment analysis a maximum of four alleles was detected per individual at both introns in a large mussel sample suggesting a minimum of two myticin-C genes. The transmission pattern of size variants in two full-sib families was also used to ascertain the number of myticin-C genes underlying the variability observed. Results in both families were in accordance with two myticin-C genes organized in tandem. A more detailed analysis of myticin-C variation was carried out by sequencing a large sample of complementary (cDNA) and genomic DNA (gDNA) in 10 individuals. Two basic sequences were detected at most individuals and several sequences were constituted by combination of two different basic sequences, strongly suggesting somatic recombination or gene conversion. Slight within-basic sequence variation detected in all individuals was attributed to somatic mutation. Such mutations were more frequently at the C-terminal domain and mostly determined non-synonymous substitutions. The mature peptide domain showed the highest variation both in the whole cDNA and in the basic-sequence samples, which is in accordance with the pathogen recognition function associated to this domain. Although most tests suggested neutrality for myticin-C variation, evidence indicated positive selection in the mature peptide and C-terminal region. Three main highly supported clusters were observed when reconstructing phylogeny on basic sequences, meiotic recombination playing a relevant role on myticin-C evolution. This study demonstrates that mechanisms to generate molecular variation similar to that observed in

  11. Genomic organization, molecular diversification, and evolution of antimicrobial peptide myticin-C genes in the mussel (Mytilus galloprovincialis).

    PubMed

    Vera, Manuel; Martínez, Paulino; Poisa-Beiro, Laura; Figueras, Antonio; Novoa, Beatriz

    2011-01-01

    Myticin-C is a highly variable antimicrobial peptide associated to immune response in Mediterranean mussel (Mytilus galloprovincialis). In this study, we tried to ascertain the genetic organization and the mechanisms underlying myticin-C variation and evolution of this gene family. We took advantage of the large intron size variation to find out the number of myticin-C genes. Using fragment analysis a maximum of four alleles was detected per individual at both introns in a large mussel sample suggesting a minimum of two myticin-C genes. The transmission pattern of size variants in two full-sib families was also used to ascertain the number of myticin-C genes underlying the variability observed. Results in both families were in accordance with two myticin-C genes organized in tandem. A more detailed analysis of myticin-C variation was carried out by sequencing a large sample of complementary (cDNA) and genomic DNA (gDNA) in 10 individuals. Two basic sequences were detected at most individuals and several sequences were constituted by combination of two different basic sequences, strongly suggesting somatic recombination or gene conversion. Slight within-basic sequence variation detected in all individuals was attributed to somatic mutation. Such mutations were more frequently at the C-terminal domain and mostly determined non-synonymous substitutions. The mature peptide domain showed the highest variation both in the whole cDNA and in the basic-sequence samples, which is in accordance with the pathogen recognition function associated to this domain. Although most tests suggested neutrality for myticin-C variation, evidence indicated positive selection in the mature peptide and C-terminal region. Three main highly supported clusters were observed when reconstructing phylogeny on basic sequences, meiotic recombination playing a relevant role on myticin-C evolution. This study demonstrates that mechanisms to generate molecular variation similar to that observed in

  12. Effects of linear cationic x-helical antimicrobial peptides on immune-relevant genes in trout macrophages.

    USDA-ARS?s Scientific Manuscript database

    There is increasing evidence of the potential role of antimicrobial peptides in the regulation of immune responses in mammalian species. However, the effects of these peptides in fish have yet to be investigated. In this study, we examined the transcriptional expression profile of representative i...

  13. Chronic exposure to a neonicotinoid increases expression of antimicrobial peptide genes in the bumblebee Bombus impatiens

    PubMed Central

    Simmons, William R.; Angelini, David R.

    2017-01-01

    Bumblebees are important pollinators in wild and agricultural settings. In recent decades pollinator declines have been linked to the effects of increased pesticide use and the spread of disease. Synergy between these factors has been suggested, but no physiological mechanism has been identified. This study examines the connection between neonicotinoid exposure and innate immune function in the bumblebee Bombus impatiens, which is an important wild and commercial pollinator in eastern North America. Experimental colonies in the field were enclosed and provided pollen and sugar syrup containing an agriculturally relevant range of imidacloprid concentrations. Bumblebees were collected from colonies over four weeks, and the expression of antimicrobial peptides was measured using multiplex quantitative real time PCR. Significant increases in the expression of abaecin, apidaecin and hymenoptaecin were found over time in treatments receiving moderate to high concentrations of the pesticide. Responses were dependent on time of exposure and dose. These results indicate that immune function in bumblebees is affected by neonicotinoid exposure and suggest a physiological mechanism by which neonicotinoids may impact the innate immune function of bumblebee pollinators in wild and agricultural habitats. PMID:28322347

  14. Chronic exposure to a neonicotinoid increases expression of antimicrobial peptide genes in the bumblebee Bombus impatiens.

    PubMed

    Simmons, William R; Angelini, David R

    2017-03-21

    Bumblebees are important pollinators in wild and agricultural settings. In recent decades pollinator declines have been linked to the effects of increased pesticide use and the spread of disease. Synergy between these factors has been suggested, but no physiological mechanism has been identified. This study examines the connection between neonicotinoid exposure and innate immune function in the bumblebee Bombus impatiens, which is an important wild and commercial pollinator in eastern North America. Experimental colonies in the field were enclosed and provided pollen and sugar syrup containing an agriculturally relevant range of imidacloprid concentrations. Bumblebees were collected from colonies over four weeks, and the expression of antimicrobial peptides was measured using multiplex quantitative real time PCR. Significant increases in the expression of abaecin, apidaecin and hymenoptaecin were found over time in treatments receiving moderate to high concentrations of the pesticide. Responses were dependent on time of exposure and dose. These results indicate that immune function in bumblebees is affected by neonicotinoid exposure and suggest a physiological mechanism by which neonicotinoids may impact the innate immune function of bumblebee pollinators in wild and agricultural habitats.

  15. Antimicrobial Peptides from Marine Proteobacteria

    PubMed Central

    Desriac, Florie; Jégou, Camille; Balnois, Eric; Brillet, Benjamin; Le Chevalier, Patrick; Fleury, Yannick

    2013-01-01

    After years of inadequate use and the emergence of multidrug resistant (MDR) strains, the efficiency of “classical” antibiotics has decreased significantly. New drugs to fight MDR strains are urgently needed. Bacteria hold much promise as a source of unusual bioactive metabolites. However, the potential of marine bacteria, except for Actinomycetes and Cyanobacteria, has been largely underexplored. In the past two decades, the structures of several antimicrobial compounds have been elucidated in marine Proteobacteria. Of these compounds, polyketides (PKs), synthesised by condensation of malonyl-coenzyme A and/or acetyl-coenzyme A, and non-ribosomal peptides (NRPs), obtained through the linkage of (unusual) amino acids, have recently generated particular interest. NRPs are good examples of naturally modified peptides. Here, we review and compile the data on the antimicrobial peptides isolated from marine Proteobacteria, especially NRPs. PMID:24084784

  16. Antimicrobial peptides from marine proteobacteria.

    PubMed

    Desriac, Florie; Jégou, Camille; Balnois, Eric; Brillet, Benjamin; Le Chevalier, Patrick; Fleury, Yannick

    2013-09-30

    After years of inadequate use and the emergence of multidrug resistant (MDR) strains, the efficiency of "classical" antibiotics has decreased significantly. New drugs to fight MDR strains are urgently needed. Bacteria hold much promise as a source of unusual bioactive metabolites. However, the potential of marine bacteria, except for Actinomycetes and Cyanobacteria, has been largely underexplored. In the past two decades, the structures of several antimicrobial compounds have been elucidated in marine Proteobacteria. Of these compounds, polyketides (PKs), synthesised by condensation of malonyl-coenzyme A and/or acetyl-coenzyme A, and non-ribosomal peptides (NRPs), obtained through the linkage of (unusual) amino acids, have recently generated particular interest. NRPs are good examples of naturally modified peptides. Here, we review and compile the data on the antimicrobial peptides isolated from marine Proteobacteria, especially NRPs.

  17. Tolerance to the antimicrobial peptide colistin in Pseudomonas aeruginosa biofilms is linked to metabolically active cells, and depends on the pmr and mexAB-oprM genes.

    PubMed

    Pamp, Sünje Johanna; Gjermansen, Morten; Johansen, Helle Krogh; Tolker-Nielsen, Tim

    2008-04-01

    Bacteria living as biofilm are frequently reported to exhibit inherent tolerance to antimicrobial compounds, and might therefore contribute to the persistence of infections. Antimicrobial peptides are attracting increasing interest as new potential antimicrobial therapeutics; however, little is known about potential mechanisms, which might contribute to resistance or tolerance development towards these compounds in biofilms. Here we provide evidence that a spatially distinct subpopulation of metabolically active cells in Pseudomonas aeruginosa biofilms is able to develop tolerance to the antimicrobial peptide colistin. On the contrary, biofilm cells exhibiting low metabolic activity were killed by colistin. We demonstrate that the subpopulation of metabolically active cells is able to adapt to colistin by inducing a specific adaptation mechanism mediated by the pmr operon, as well as an unspecific adaptation mechanism mediated by the mexAB-oprM genes. Mutants defective in either pmr-mediated lipopolysaccharide modification or in mexAB-oprM-mediated antimicrobial efflux were not able to develop a tolerant subpopulation in biofilms. In contrast to the observed pattern of colistin-mediated killing in biofilms, conventional antimicrobial compounds such as ciprofloxacin and tetracycline were found to specifically kill the subpopulation of metabolically active biofilm cells, whereas the subpopulation exhibiting low metabolic activity survived the treatment. Consequently, targeting the two physiologically distinct subpopulations by combined antimicrobial treatment with either ciprofloxacin and colistin or tetracycline and colistin almost completely eradicated all biofilm cells.

  18. Ceragenins: cholic acid-based mimics of antimicrobial peptides.

    PubMed

    Lai, Xin-Zhong; Feng, Yanshu; Pollard, Jacob; Chin, Judy N; Rybak, Michael J; Bucki, Robert; Epand, Raquel F; Epand, Richard M; Savage, Paul B

    2008-10-01

    The prevalence of drug-resistant bacteria drives the quest for new antimicrobials, including those that are not expected to readily engender resistance. One option is to mimic Nature's most ubiquitous means of controlling bacterial growth, antimicrobial peptides, which have evolved over eons. In general, bacteria remain susceptible to these peptides. Human antimicrobial peptides play a central role in innate immunity, and deficiencies in these peptides have been tied to increased rates of infection. However, clinical use of antimicrobial peptides is hampered by issues of cost and stability. The development of nonpeptide mimics of antimicrobial peptides may provide the best of both worlds: a means of using the same mechanism chosen by Nature to control bacterial growth without the problems associated with peptide therapeutics. The ceragenins were developed to mimic the cationic, facially amphiphilic structures of most antimicrobial peptides. These compounds reproduce the required morphology using a bile-acid scaffolding and appended amine groups. The resulting compounds are actively bactericidal against both gram-positive and gram-negative organisms, including drug-resistant bacteria. This antimicrobial activity originates from selective association of the ceragenins with negatively charged bacterial membrane components. Association has been studied with synthetic models of bacterial membrane components, with bacterial lipopolysaccharide, with vesicles derived from bacterial phospholipids, and with whole cells. Comparisons of the antimicrobial activities of ceragenins and representative antimicrobial peptides suggest that these classes of compounds share a mechanism of action. Rapid membrane depolarization is caused by both classes as well as blebbing of bacterial membranes. Bacteria express the same genes in response to both classes of compounds. On the basis of the antibacterial activities of ceragenins and preliminary in vivo studies, we expect these compounds to

  19. Novel cationic peptide TP359 down-regulates the expression of outer membrane biogenesis genes in Pseudomonas aeruginosa: a potential TP359 anti-microbial mechanism.

    PubMed

    Dosunmu, Ejovwoke F; Chaudhari, Atul A; Bawage, Swapnil; Bakeer, Mona K; Owen, Donald R; Singh, Shree R; Dennis, Vida A; Pillai, Shreekumar R

    2016-08-22

    Antimicrobial peptides (AMPs) are a class of antimicrobial agents with broad-spectrum activities. Several reports indicate that cationic AMPs bind to the negatively charged bacterial membrane causing membrane depolarization and damage. However, membrane depolarization and damage may be insufficient to elicit cell death, thereby suggesting that other mechanism(s) of action could be involved in this phenomenon. In this study, we investigated the antimicrobial activity of a novel antimicrobial peptide, TP359, against two strains of Pseudomonas aeruginosa, as well as its possible mechanisms of action. TP359 proved to be bactericidal against P. aeruginosa as confirmed by the reduced bacteria counts, membrane damage and cytoplasmic membrane depolarization. In addition, it was non-toxic to mouse J774 macrophages and human lung A549 epithelial cells. Electron microscopy analysis showed TP359 bactericidal effects by structural changes of the bacteria from viable rod-shaped cells to those with cell membrane damages, proceeding into the efflux of cytoplasmic contents and emergence of ghost cells. Gene expression analysis on the effects of TP359 on outer membrane biogenesis genes underscored marked down-regulation, particularly of oprF, which encodes a major structural and outer membrane porin (OprF) in both strains studied, indicating that the peptide may cause deregulation of outer membrane genes and reduced structural stability which could lead to cell death. Our data shows that TP359 has potent antimicrobial activity against P aeruginosa. The correlation between membrane damage, depolarization and reduced expression of outer membrane biogenesis genes, particularly oprF may suggest the bactericidal mechanism of action of the TP359 peptide.

  20. Antimicrobial Peptide Evolution in the Asiatic Honey Bee Apis cerana

    PubMed Central

    Xu, Peng; Shi, Min; Chen, Xue-xin

    2009-01-01

    The Asiatic honeybee, Apis cerana Fabricius, is an important honeybee species in Asian countries. It is still found in the wild, but is also one of the few bee species that can be domesticated. It has acquired some genetic advantages and significantly different biological characteristics compared with other Apis species. However, it has been less studied, and over the past two decades, has become a threatened species in China. We designed primers for the sequences of the four antimicrobial peptide cDNA gene families (abaecin, defensin, apidaecin, and hymenoptaecin) of the Western honeybee, Apis mellifera L. and identified all the antimicrobial peptide cDNA genes in the Asiatic honeybee for the first time. All the sequences were amplified by reverse transcriptase-polymerase chain reaction (RT-PCR). In all, 29 different defensin cDNA genes coding 7 different defensin peptides, 11 different abaecin cDNA genes coding 2 different abaecin peptides, 13 different apidaecin cDNA genes coding 4 apidaecin peptides and 34 different hymenoptaecin cDNA genes coding 13 different hymenoptaecin peptides were cloned and identified from the Asiatic honeybee adult workers. Detailed comparison of these four antimicrobial peptide gene families with those of the Western honeybee revealed that there are many similarities in the quantity and amino acid components of peptides in the abaecin, defensin and apidaecin families, while many more hymenoptaecin peptides are found in the Asiatic honeybee than those in the Western honeybee (13 versus 1). The results indicated that the Asiatic honeybee adult generated more variable antimicrobial peptides, especially hymenoptaecin peptides than the Western honeybee when stimulated by pathogens or injury. This suggests that, compared to the Western honeybee that has a longer history of domestication, selection on the Asiatic honeybee has favored the generation of more variable antimicrobial peptides as protection against pathogens. PMID:19156201

  1. Insect inducible antimicrobial peptides and their applications.

    PubMed

    Ezzati-Tabrizi, Reyhaneh; Farrokhi, Naser; Talaei-Hassanloui, Reza; Alavi, Seyed Mehdi; Hosseininaveh, Vahid

    2013-12-01

    Antimicrobial peptides (AMPs) are found as important components of the innate immune system (host defense) of all invertebrates. These peptides can be constitutively expressed or induced in response to microbial infections. Indeed, they vary in their amino acid sequences, potency and antimicrobial activity spectra. The smaller AMPs act greatly by disrupting the structure or function of microbial cell membranes. Here, the insect innate immune system with emphasis on inducible antimicrobial peptide properties against microbial invaders has been discussed.

  2. Antimicrobial peptides: clinical relevance and therapeutic implications.

    PubMed

    Pinheiro da Silva, Fabiano; Machado, Marcel Cerqueira César

    2012-08-01

    Antimicrobial peptides (AMPs) are molecules that provide protection against environmental pathogens, acting against a large number of microorganisms, including bacteria, fungi, yeast, virus and others. Two major groups of antimicrobial peptides are found in humans: cathelicidins and defensins. Recently, several studies have furnished information that besides their role in infection diseases, antimicrobial peptides play a role in diseases as diverse as inflammatory disorders, autoimmunity and cancer. Here, we discuss the role of antimicrobial peptides and vitamin D have in such complex diseases and propose their use should be more explored in the diagnosis and treatment of such conditions.

  3. Antimicrobial Properties of Amyloid Peptides

    PubMed Central

    Kagan, Bruce L.; Jang, Hyunbum; Capone, Ricardo; Arce, Fernando Teran; Ramachandran, Srinivasan; Lal, Ratnesh; Nussinov, Ruth

    2011-01-01

    More than two dozen clinical syndromes known as amyloid diseases are characterized by the buildup of extended insoluble fibrillar deposits in tissues. These amorphous Congo red staining deposits known as amyloids exhibit a characteristic green birefringence and cross-β structure. Substantial evidence implicates oligomeric intermediates of amyloids as toxic species in the pathogenesis of these chronic disease states. A growing body of data has suggested that these toxic species form ion channels in cellular membranes causing disruption of calcium homeostasis, membrane depolarization, energy drainage, and in some cases apoptosis. Amyloid peptide channels exhibit a number of common biological properties including the universal U-shape β-strand-turn-β-strand structure, irreversible and spontaneous insertion into membranes, production of large heterogeneous single-channel conductances, relatively poor ion selectivity, inhibition by Congo red, and channel blockade by zinc. Recent evidence has suggested that increased amounts of amyloids are not only toxic to its host target cells but also possess antimicrobial activity. Furthermore, at least one human antimicrobial peptide, protegrin-1, which kills microbes by a channel-forming mechanism, has been shown to possess the ability to form extended amyloid fibrils very similar to those of classic disease-forming amyloids. In this paper, we will review the reported antimicrobial properties of amyloids and the implications of these discoveries for our understanding of amyloid structure and function. PMID:22081976

  4. Membrane disruption mechanism of antimicrobial peptides

    NASA Astrophysics Data System (ADS)

    Lee, Ka Yee

    2012-04-01

    Largely distributed among living organisms, antimicrobial peptides are a class of small (<100 residues) host defense peptides that induce selective membrane lytic activity against microbial pathogens. The permeabilizing behavior of these diverse peptides has been commonly attributed to the formation of pores, and such pore formation has been categorized as barrel-stave, toroidal, or carpet-like. With the continuing discovery of new peptide species, many are uncharacterized and the exact mechanism is unknown. Through the use of atomic force microscopy, the disruption of supported lipid bilayer patches by protegrin-1 is concentration-dependent. The intercalation of antimicrobial peptide into the bilayer results in structures beyond that of pore formation, but with the formation of worm-like micelles at high peptide concentration. Our results suggest that antimicrobial peptide acts to lower the interfacial energy of the bilayer in a way similar to detergents. Antimicrobial peptides with structural differences, magainin-1 and aurein 1.1, exhibit a mechanistic commonality.

  5. Antimicrobial Peptides: Versatile Biological Properties

    PubMed Central

    Pushpanathan, Muthuirulan; Rajendhran, Jeyaprakash

    2013-01-01

    Antimicrobial peptides are diverse group of biologically active molecules with multidimensional properties. In recent past, a wide variety of AMPs with diverse structures have been reported from different sources such as plants, animals, mammals, and microorganisms. The presence of unusual amino acids and structural motifs in AMPs confers unique structural properties to the peptide that attribute for their specific mode of action. The ability of these active AMPs to act as multifunctional effector molecules such as signalling molecule, immune modulators, mitogen, antitumor, and contraceptive agent makes it an interesting candidate to study every aspect of their structural and biological properties for prophylactic and therapeutic applications. In addition, easy cloning and recombinant expression of AMPs in heterologous plant host systems provided a pipeline for production of disease resistant transgenic plants. Besides these properties, AMPs were also used as drug delivery vectors to deliver cell impermeable drugs to cell interior. The present review focuses on the diversity and broad spectrum antimicrobial activity of AMPs along with its multidimensional properties that could be exploited for the application of these bioactive peptides as a potential and promising drug candidate in pharmaceutical industries. PMID:23935642

  6. Cloning and functional characterization of a new antimicrobial peptide gene StCT1 from the venom of the scorpion Scorpiops tibetanus.

    PubMed

    Yuan, Wenying; Cao, Luyang; Ma, Yibao; Mao, Panyong; Wang, Weipeng; Zhao, Ruiming; Wu, Yingliang; Cao, Zhijian; Li, Wenxin

    2010-01-01

    Scorpion has an innovative venom gland, which is an important determinant in contributing to its successful survival for more than 400 million years. Scorpion venom contains a diversity of bioactive peptides, which represent a tremendous hitherto unexplored resource for use in drug design and development. Here, StCT1, a new antimicrobial peptide gene, was screened and isolated from the venomous gland cDNA library of the scorpion Scorpiops tibetanus. The full-length cDNA of StCT1 is 369 nucleotides encoding the precursor that contains a putative 24-residue signal peptide, a presumed 14-residue mature peptide, and an uncommon 37-residue acidic propeptide at the C-terminus. The minimal inhibitory concentrations (MICs) of the synthetic StCT1 peptide against Staphylococcus aureus and Micrococcus luteus were 12.5microg/ml and 100microg/ml, respectively. The MICs of StCT1 against clinical antibiotics-resistant bacterial strains, were 50-250microg/ml, 2-40 folds lower than those of penicillin. These results show that the antimicrobial peptide encoded by StCT1 gene from the venom of the scorpion S. tibetanus is a potential anti-infective polypeptide or lead compound, especially for treating antibiotics-resistant pathogens.

  7. Antimicrobial peptides interact with peptidoglycan

    NASA Astrophysics Data System (ADS)

    Neelay, Om P.; Peterson, Christian A.; Snavely, Mary E.; Brown, Taylor C.; TecleMariam, Ariam F.; Campbell, Jennifer A.; Blake, Allison M.; Schneider, Sydney C.; Cremeens, Matthew E.

    2017-10-01

    Traditional therapeutics are losing effectiveness as bacterial resistance increases, and antimicrobial peptides (AMPs) can serve as an alternative source for antimicrobial agents. Their mode of action is commonly hypothesized to involve pore formation in the lipid membrane, thereby leading to cell death. However, bacterial cell walls are much more complex than just the lipid membrane. A large portion of the wall is comprised of peptidoglycan, yet we did not find any report of AMP-peptidoglycan interactions. Consequently, this work evaluated AMP-peptidoglycan and AMP-phospholipid (multilamellar vesicles) interactions through tryptophan fluorescence. Given that peptidoglycan is insoluble and vesicles are large particles, we took advantage of the unique properties of Trp-fluorescence to use one technique for two very different systems. Interestingly, melittin and cecropin A interacted with peptidoglycan to a degree similar to vancomycin, a positive control. Whether these AMP-peptidoglycan interactions relate to a killing mode of action requires further study.

  8. Human Antimicrobial Peptides and Proteins

    PubMed Central

    Wang, Guangshun

    2014-01-01

    As the key components of innate immunity, human host defense antimicrobial peptides and proteins (AMPs) play a critical role in warding off invading microbial pathogens. In addition, AMPs can possess other biological functions such as apoptosis, wound healing, and immune modulation. This article provides an overview on the identification, activity, 3D structure, and mechanism of action of human AMPs selected from the antimicrobial peptide database. Over 100 such peptides have been identified from a variety of tissues and epithelial surfaces, including skin, eyes, ears, mouths, gut, immune, nervous and urinary systems. These peptides vary from 10 to 150 amino acids with a net charge between −3 and +20 and a hydrophobic content below 60%. The sequence diversity enables human AMPs to adopt various 3D structures and to attack pathogens by different mechanisms. While α-defensin HD-6 can self-assemble on the bacterial surface into nanonets to entangle bacteria, both HNP-1 and β-defensin hBD-3 are able to block cell wall biosynthesis by binding to lipid II. Lysozyme is well-characterized to cleave bacterial cell wall polysaccharides but can also kill bacteria by a non-catalytic mechanism. The two hydrophobic domains in the long amphipathic α-helix of human cathelicidin LL-37 lays the basis for binding and disrupting the curved anionic bacterial membrane surfaces by forming pores or via the carpet model. Furthermore, dermcidin may serve as ion channel by forming a long helix-bundle structure. In addition, the C-type lectin RegIIIα can initially recognize bacterial peptidoglycans followed by pore formation in the membrane. Finally, histatin 5 and GAPDH(2-32) can enter microbial cells to exert their effects. It appears that granulysin enters cells and kills intracellular pathogens with the aid of pore-forming perforin. This arsenal of human defense proteins not only keeps us healthy but also inspires the development of a new generation of personalized medicine to

  9. Antimicrobial Peptides in Human Sepsis

    PubMed Central

    Martin, Lukas; van Meegern, Anne; Doemming, Sabine; Schuerholz, Tobias

    2015-01-01

    Nearly 100 years ago, antimicrobial peptides (AMPs) were identified as an important part of innate immunity. They exist in species from bacteria to mammals and can be isolated in body fluids and on surfaces constitutively or induced by inflammation. Defensins have anti-bacterial effects against Gram-positive and Gram-negative bacteria as well as anti-viral and anti-yeast effects. Human neutrophil peptides (HNP) 1–3 and human beta-defensins (HBDs) 1–3 are some of the most important defensins in humans. Recent studies have demonstrated higher levels of HNP 1–3 and HBD-2 in sepsis. The bactericidal/permeability-increasing protein (BPI) attenuates local inflammatory response and decreases systemic toxicity of endotoxins. Moreover, BPI might reflect the severity of organ dysfunction in sepsis. Elevated plasma lactoferrin is detected in patients with organ failure. HNP 1–3, lactoferrin, BPI, and heparin-binding protein are increased in sepsis. Human lactoferrin peptide 1–11 (hLF 1–11) possesses antimicrobial activity and modulates inflammation. The recombinant form of lactoferrin [talactoferrin alpha (TLF)] has been shown to decrease mortality in critically ill patients. A phase II/III study with TLF in sepsis did not confirm this result. The growing number of multiresistant bacteria is an ongoing problem in sepsis therapy. Furthermore, antibiotics are known to promote the liberation of pro-inflammatory cell components and thus augment the severity of sepsis. Compared to antibiotics, AMPs kill bacteria but also neutralize pathogenic factors such as lipopolysaccharide. The obstacle to applying naturally occurring AMPs is their high nephro- and neurotoxicity. Therefore, the challenge is to develop peptides to treat septic patients effectively without causing harm. This overview focuses on natural and synthetic AMPs in human and experimental sepsis and their potential to provide significant improvements in the treatment of critically ill with severe infections

  10. The First Salamander Defensin Antimicrobial Peptide

    PubMed Central

    Jiang, Ke; Rong, Mingqiang; Lai, Ren

    2013-01-01

    Antimicrobial peptides have been widely identified from amphibian skins except salamanders. A novel antimicrobial peptide (CFBD) was isolated and characterized from skin secretions of the salamander, Cynops fudingensis. The cDNA encoding CFBD precursor was cloned from the skin cDNA library of C. fudingensis. The precursor was composed of three domains: signal peptide of 17 residues, mature peptide of 41 residues and intervening propeptide of 3 residues. There are six cysteines in the sequence of mature CFBD peptide, which possibly form three disulfide-bridges. CFBD showed antimicrobial activities against Staphylococcus aureus, Bacillus subtilis, Candida albicans and Escherichia coli. This peptide could be classified into family of β-defensin based on its seqeuence similarity with β-defensins from other vertebrates. Evolution analysis indicated that CFBD was close to fish β-defensin. As far as we know, CFBD is the first β-defensin antimicrobial peptide from salamanders. PMID:24386139

  11. The first salamander defensin antimicrobial peptide.

    PubMed

    Meng, Ping; Yang, Shilong; Shen, Chuanbin; Jiang, Ke; Rong, Mingqiang; Lai, Ren

    2013-01-01

    Antimicrobial peptides have been widely identified from amphibian skins except salamanders. A novel antimicrobial peptide (CFBD) was isolated and characterized from skin secretions of the salamander, Cynops fudingensis. The cDNA encoding CFBD precursor was cloned from the skin cDNA library of C. fudingensis. The precursor was composed of three domains: signal peptide of 17 residues, mature peptide of 41 residues and intervening propeptide of 3 residues. There are six cysteines in the sequence of mature CFBD peptide, which possibly form three disulfide-bridges. CFBD showed antimicrobial activities against Staphylococcus aureus, Bacillus subtilis, Candida albicans and Escherichia coli. This peptide could be classified into family of β-defensin based on its sequence similarity with β-defensins from other vertebrates. Evolution analysis indicated that CFBD was close to fish β-defensin. As far as we know, CFBD is the first β-defensin antimicrobial peptide from salamanders.

  12. The Potential of Antimicrobial Peptides as Biocides

    PubMed Central

    Laverty, Garry; Gorman, Sean P.; Gilmore, Brendan F.

    2011-01-01

    Antimicrobial peptides constitute a diverse class of naturally occurring antimicrobial molecules which have activity against a wide range of pathogenic microorganisms. Antimicrobial peptides are exciting leads in the development of novel biocidal agents at a time when classical antibiotics are under intense pressure from emerging resistance, and the global industry in antibiotic research and development stagnates. This review will examine the potential of antimicrobial peptides, both natural and synthetic, as novel biocidal agents in the battle against multi-drug resistant pathogen infections. PMID:22072905

  13. Antimicrobial peptides: an alternative for innovative medicines?

    PubMed

    da Costa, João Pinto; Cova, Marta; Ferreira, Rita; Vitorino, Rui

    2015-03-01

    Antimicrobial peptides are small molecules with activity against bacteria, yeasts, fungi, viruses, bacteria, and even tumor cells that make these molecules attractive as therapeutic agents. Due to the alarming increase of antimicrobial resistance, interest in alternative antimicrobial agents has led to the exploitation of antimicrobial peptides, both synthetic and from natural sources. Thus, many peptide-based drugs are currently commercially available for the treatment of numerous ailments, such as hepatitis C, myeloma, skin infections, and diabetes. Initial barriers are being increasingly overcome with the development of cost-effective, more stable peptides. Herein, we review the available strategies for their synthesis, bioinformatics tools for the rational design of antimicrobial peptides with enhanced therapeutic indices, hurdles and shortcomings limiting the large-scale production of AMPs, as well as the challenges that the pharmaceutical industry faces on their use as therapeutic agents.

  14. Gene cloning and functional characterization of four novel antimicrobial-like peptides from scorpions of the family Vaejovidae.

    PubMed

    Ramírez-Carreto, Santos; Quintero-Hernández, Verónica; Jiménez-Vargas, Juana María; Corzo, Gerardo; Possani, Lourival D; Becerril, Baltazar; Ortiz, Ernesto

    2012-04-01

    From the cDNA libraries made from the venom glands of two scorpions belonging to the Vaejovidae family, four different putative non disulfide-bridged antimicrobial peptides were identified: VmCT1 and VmCT2 from Vaejovis mexicanus smithi plus VsCT1 and VsCT2 from Vaejovis subcristatus. These short peptides (with only 13 amino acid residues each) share important amino acid sequence similarities among themselves and with other reported antimicrobial peptides, but their biological activities vary dramatically. This communication reports the cloning, chemical synthesis and characterization of these peptides. Two peptides, VmCT1 and VmCT2 showed broad-spectrum antibacterial activity with minimum inhibitory concentrations MICs in the range of 5-25 μM and 10-20 μM respectively, whereas their hemolytic activity at these concentrations was low. Structure-function relationships that might determine the differences in activities are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. Chemical genomic screening of a Saccharomyces cerevisiae genomewide mutant collection reveals genes required for defense against four antimicrobial peptides derived from proteins found in human saliva.

    PubMed

    Lis, Maciej; Bhatt, Sanjay; Schoenly, Nathan E; Lee, Anna Y; Nislow, Corey; Bobek, Libuse A

    2013-02-01

    To compare the effects of four antimicrobial peptides (MUC7 12-mer, histatin 12-mer, cathelicidin KR20, and a peptide containing lactoferricin amino acids 1 to 11) on the yeast Saccharomyces cerevisiae, we employed a genomewide fitness screen of combined collections of mutants with homozygous deletions of nonessential genes and heterozygous deletions of essential genes. When an arbitrary fitness score cutoffs of 1 (indicating a fitness defect, or hypersensitivity) and -1 (indicating a fitness gain, or resistance) was used, 425 of the 5,902 mutants tested exhibited altered fitness when treated with at least one peptide. Functional analysis of the 425 strains revealed enrichment among the identified deletions in gene groups associated with the Gene Ontology (GO) terms "ribosomal subunit," "ribosome biogenesis," "protein glycosylation," "vacuolar transport," "Golgi vesicle transport," "negative regulation of transcription," and others. Fitness profiles of all four tested peptides were highly similar, particularly among mutant strains exhibiting the greatest fitness defects. The latter group included deletions in several genes involved in induction of the RIM101 signaling pathway, including several components of the ESCRT sorting machinery. The RIM101 signaling regulates response of yeasts to alkaline and neutral pH and high salts, and our data indicate that this pathway also plays a prominent role in regulating protective measures against all four tested peptides. In summary, the results of the chemical genomic screens of S. cerevisiae mutant collection suggest that the four antimicrobial peptides, despite their differences in structure and physical properties, share many interactions with S. cerevisiae cells and consequently a high degree of similarity between their modes of action.

  16. Ileal antimicrobial peptide expression is dysregulated in old age.

    PubMed

    Tremblay, Sarah; Côté, Nathalie Marie Louise; Grenier, Guillaume; Duclos-Lasnier, Gabriella; Fortier, Louis-Charles; Ilangumaran, Subburaj; Menendez, Alfredo

    2017-01-01

    In an effort to understand the mechanisms underlying the high prevalence of gastrointestinal tract disorders in old age, we investigated the expression of intestinal antimicrobial peptides in the terminal small intestine of aged mice. Our results show that old mice have reduced transcript levels of ileal α-defensins and lysozyme, two important types of intestinal antimicrobial peptides produced by Paneth cells. In contrast, expression of the C-type lectins Reg3b and Reg3g, as well as β-defensin 1, angiogenin 4 and Relmb, which are made by several epithelial cell types, was significantly upregulated in aged animals suggesting an ongoing response to epithelial distress. Those changes in antimicrobial peptide gene expression associated with histological damage of the ileal epithelium and subtle modifications in the composition of the commensal microbiota. Our findings suggest that dysregulation of antimicrobial peptides expression is a feature of homeostasis disruption in the aged intestine and may contribute to geriatric gastrointestinal dysfunction.

  17. Antimicrobial peptides in insects; structure and function.

    PubMed

    Bulet, P; Hetru, C; Dimarcq, J L; Hoffmann, D

    1999-01-01

    Antimicrobial peptides appear to be ubiquitous and multipotent components of the innate immune defense arsenal used by both prokaryotic and eukaryotic organisms. During the past 15 years a multitude of these peptides have been isolated largely from insects. In spite of great differences in size, amino acid composition and structure, most of the antimicrobial peptides from insects can be grouped into one of three categories. The largest category in number contains peptides with intramolecular disulfide bonds forming hairpin-like beta-sheets or alpha-helical-beta-sheet mixed structures. The second most important group is composed of peptides forming amphipathic alpha-helices. The third group comprises peptides with an overrepresentation in proline and/or glycine residues. In general, the insect antimicrobial peptides have a broad range of activity and are not cytotoxic. Despite a wealth of information on structural requirements for their antimicrobial activity, the mode of action of these peptides is not yet fully understood. However, some data suggest the existence of two types of mode of action: 1. through peptide-lipid interaction or 2. through receptor-mediated recognition processes. This review presents the main results obtained during the last four years in the field of antimicrobial peptides from insects with a special focus on the proline-rich and cysteine-rich peptides.

  18. Structure-function relationships of antimicrobial peptides.

    PubMed

    Hwang, P M; Vogel, H J

    1998-01-01

    Antimicrobial peptides are ubiquitously produced throughout nature. Many of these relatively short peptides (6-50 residues) are lethal towards bacteria and fungi, yet they display minimal toxicity towards mammalian cells. All of the peptides are highly cationic and hydrophobic. It is widely believed that they act through nonspecific binding to biological membranes, even though the exact nature of these interactions is presently unclear. High-resolution nuclear magnetic resonance (NMR) has contributed greatly to knowledge in this field, providing insight about peptide structure in aqueous solution, in organic cosolvents, and in micellar systems. Solid-state NMR can provide additional information about peptide-membrane binding. Here we review our current knowledge about the structure of antimicrobial peptides. We also discuss studies pertaining to the mechanism of action. Despite the different three-dimensional structural motifs of the various classes, they all have similar amphiphilic surfaces that are well-suited for membrane binding. Many antimicrobial peptides bind in a membrane-parallel orientation, interacting only with one face of the bilayer. This may be sufficient for antimicrobial action. At higher concentrations, peptides and phospholipids translocate to form multimeric transmembrane channels that seem to contribute to the peptide's hemolytic activity. An understanding of the key features of the secondary and tertiary structures of the antimicrobial peptides and their effects on bactericidal and hemolytic activity can aid the rational design of improved analogs for clinical use.

  19. Antimicrobial peptides of multicellular organisms

    NASA Astrophysics Data System (ADS)

    Zasloff, Michael

    2002-01-01

    Multicellular organisms live, by and large, harmoniously with microbes. The cornea of the eye of an animal is almost always free of signs of infection. The insect flourishes without lymphocytes or antibodies. A plant seed germinates successfully in the midst of soil microbes. How is this accomplished? Both animals and plants possess potent, broad-spectrum antimicrobial peptides, which they use to fend off a wide range of microbes, including bacteria, fungi, viruses and protozoa. What sorts of molecules are they? How are they employed by animals in their defence? As our need for new antibiotics becomes more pressing, could we design anti-infective drugs based on the design principles these molecules teach us?

  20. Antimicrobial peptides keep insect endosymbionts under control.

    PubMed

    Login, Frédéric H; Balmand, Séverine; Vallier, Agnès; Vincent-Monégat, Carole; Vigneron, Aurélien; Weiss-Gayet, Michèle; Rochat, Didier; Heddi, Abdelaziz

    2011-10-21

    Vertically transmitted endosymbionts persist for millions of years in invertebrates and play an important role in animal evolution. However, the functional basis underlying the maintenance of these long-term resident bacteria is unknown. We report that the weevil coleoptericin-A (ColA) antimicrobial peptide selectively targets endosymbionts within the bacteriocytes and regulates their growth through the inhibition of cell division. Silencing the colA gene with RNA interference resulted in a decrease in size of the giant filamentous endosymbionts, which escaped from the bacteriocytes and spread into insect tissues. Although this family of peptides is commonly linked with microbe clearance, this work shows that endosymbiosis benefits from ColA, suggesting that long-term host-symbiont coevolution might have shaped immune effectors for symbiont maintenance.

  1. Antimicrobial peptide action on parasites.

    PubMed

    Torrent, Marc; Pulido, David; Rivas, Luis; Andreu, David

    2012-08-01

    Diseases caused by protozoan parasites can pose a severe thread to human health and are behind some serious neglected tropical diseases like malaria and leishmaniasis. Though several different drugs have been developed in order to eradicate these diseases, a successful candidate has not yet been discovered. Among the most active compounds tested, antimicrobial peptides (AMPs) are particularly appealing because of their wide spectrum of action. AMPs have been described to perturb protozoan homeostasis by disrupting the cellular membranes but also by interfering with key processes in the parasite metabolism. In this review we describe the diverse mechanisms of action of AMPs on protozoan targets and how they can be exploited to treat diseases. Moreover, we describe with detail the antimicrobial action of AMPs on two major parasitical infections: leishmaniasis and malaria. All the features reviewed here show that AMPs are promising drugs to target protozoan parasites and that further understanding of the mechanism of action of these compounds will lead to improved drugs that could be worth to test in a clinical phase.

  2. Expression of genes encoding antimicrobial and bradykinin-related peptides in skin of the stream brown frog Rana sakuraii.

    PubMed

    Suzuki, Hiroe; Iwamuro, Shawichi; Ohnuma, Aya; Coquet, Laurent; Leprince, Jérôme; Jouenne, Thierry; Vaudry, Hubert; Taylor, Christopher K; Abel, Peter W; Conlon, J Michael

    2007-03-01

    Peptidomic analysis of an extract of the skin of the stream brown frog Rana sakuraii Matsui and Matsui, 1990 led to the isolation of a C-terminally alpha-amidated peptide (VR-23; VIGSILGALASGLPTLISWIKNR x NH2) with broad-spectrum antimicrobial activity that shows structural similarity to the bee venom peptide, melittin together with two peptides belonging to the temporin family (temporin-1SKa; FLPVILPVIGKLLNGIL x NH2 and temporin-1SKb; FLPVILPVIGKLLSGIL x NH2), and peptides whose primary structures identified them as belonging to the brevinin-2 (2 peptides) and ranatuerin-2 (1 peptide) families. Using a forward primer that was designed from a conserved region of the 5'-untranslated regions of Rana temporaria preprotemporins in a 3'-RACE procedure, a cDNA clone encoding preprotemporin-1SKa was prepared from R. sakuraii skin total RNA. Further preprotemporin cDNAs encoding temporin-1SKc (AVDLAKIANIAN KVLSSL F x NH2) and temporin-1SKd (FLPMLAKLLSGFL x NH2) were obtained by RT-PCR. Unexpectedly, the 3'-RACE procedure using the same primer led to amplification of a cDNA encoding a preprobradykinin whose signal peptide region was identical to that of preprotemporin-1SKa except for the substitution Ser18-->Asn. R. sakuraii bradykinin ([Arg0,Leu1,Thr6,Trp8] BK) was 28-fold less potent than mammalian BK in effecting B2 receptor-mediated relaxation of mouse trachea and the des[Arg0] derivative was only a weak partial agonist. The evolutionary history of the Japanese brown frogs is incompletely understood but a comparison of the primary structures of the R. sakuraii dermal peptides with those of Tago's brown frog Rana tagoi provides evidence for a close phylogenetic relationship between these species.

  3. Novel Antimicrobial Peptides Derived from Flatfish Genes†

    PubMed Central

    Patrzykat, Aleksander; Gallant, Jeffrey W.; Seo, Jung-Kil; Pytyck, Jennifer; Douglas, Susan E.

    2003-01-01

    We report on the identification of active novel antimicrobials determined by screening both the genomic information and the mRNA transcripts from a number of different flatfish for sequences encoding antimicrobial peptides, predicting the sequences of active peptides from the genetic information, producing the predicted peptides chemically, and testing them for their activities. We amplified 35 sequences from various species of flatfish using primers whose sequences are based on conserved flanking regions of a known antimicrobial peptide from winter flounder, pleurocidin. We analyzed the sequences of the amplified products and predicted which sequences were likely to encode functional antimicrobial peptides on the basis of charge, hydrophobicity, relation to flanking sequences, and similarity to known active peptides. Twenty peptides were then produced synthetically and tested for their activities against gram-positive and gram-negative bacteria and the yeast Candida albicans. The most active peptide (with the carboxy-terminus amidated sequence GWRTLLKKAEVKTVGKLALKHYL, derived from American plaice) showed inhibitory activity over a concentration range of 1 to 8 μg/ml against a test panel of pathogens, including the intrinsically antibiotic-resistant organism Pseudomonas aeruginosa, methicillin-resistant Staphylococcus aureus, and C. albicans. The methods described here will be useful for the identification of novel peptides with good antimicrobial activities. PMID:12878506

  4. Short Antimicrobial Peptides and Peptide Scaffolds as Promising Antibacterial Agents.

    PubMed

    Domalaon, Ronald; Zhanel, George G; Schweizer, Frank

    2016-01-01

    Antimicrobial peptides have recently garnered significant attention as an emerging source of potential antibiotics, due to the swift emergence of multidrug-resistant bacteria and a dwindling antibiotic pipeline. The vast majority of antimicrobial peptides are long, comprised of more than 10 amino acids, resulting in significant production costs for their synthesis while simultaneously displaying metabolic instability and relatively poor pharmacological profiles. To counter these problems, efforts have been shifted to shorter molecules and the development of new peptidomimetic approaches. In this paper, we review promising short, naturally-isolated or synthetic, antimicrobial peptides, along with their mimics, and discuss their merits as potential antibacterial agents.

  5. De Novo Design of Potent Antimicrobial Peptides

    PubMed Central

    Frecer, V.; Ho, B.; Ding, J. L.

    2004-01-01

    Lipopolysaccharide (LPS), shed by gram-negative bacteria during infection and antimicrobial therapy, may lead to lethal endotoxic shock syndrome. A rational design strategy based on the presumed mechanism of antibacterial effect was adopted to design cationic antimicrobial peptides capable of binding to LPS through tandemly repeated sequences of alternating cationic and nonpolar residues. The peptides were designed to achieve enhanced antimicrobial potency due to initial bacterial membrane binding with a reduced risk of endotoxic shock. The peptides designed displayed binding affinities to LPS and lipid A (LA) in the low micromolar range and by molecular modeling were predicted to form amphipathic β-hairpin-like structures when they bind to LPS or LA. They also exhibited strong effects against gram-negative bacteria, with MICs in the nanomolar range, and low cytotoxic and hemolytic activities at concentrations significantly exceeding their MICs. Quantitative structure-activity relationship (QSAR) analysis of peptide sequences and their antimicrobial, cytotoxic, and hemolytic activities revealed that site-directed substitutions of residues in the hydrophobic face of the amphipathic peptides with less lipophilic residues selectively decrease the hemolytic effect without significantly affecting the antimicrobial or cytotoxic activity. On the other hand, the antimicrobial effect can be enhanced by substitutions in the polar face with more polar residues, which increase the amphipathicity of the peptide. On the basis of the QSARs, new analogs that have strong antimicrobial effects but that lack hemolytic activity can be proposed. The findings highlight the importance of peptide amphipathicity and allow a rational method that can be used to dissociate the antimicrobial and hemolytic effects of cationic peptides, which have potent antimicrobial properties, to be proposed. PMID:15328096

  6. (Lipo)polysaccharide interactions of antimicrobial peptides.

    PubMed

    Schmidtchen, Artur; Malmsten, Martin

    2015-07-01

    Due to rapidly increasing resistance development against conventional antibiotics, as well as problems associated with diseases either triggered or deteriorated by infection, antimicrobial and anti-inflammatory peptides have attracted considerable interest during the last few years. While there is an emerging understanding of the direct antimicrobial function of such peptides through bacterial membrane destabilization, the mechanisms of their anti-inflammatory function are less clear. We here summarize some recent results obtained from our own research on anti-inflammatory peptides, with focus on peptide-(lipo)polysaccharide interactions.

  7. Measuring antimicrobial peptide activity on epithelial surfaces in cell culture

    PubMed Central

    Diamond, Gill; Yim, Sunghan; Rigo, Isaura; McMahon, Laura

    2009-01-01

    To more accurately assess the activity and role of epithelial-cell derived antimicrobial peptides in their native settings, it is essential to perform assays at the surfaces under relevant conditions. In order to carry this out, we utilize 3-dimensional cultures of airway and gingival epithelium, which are grown at an air-liquid interface. Under these conditions, the cultures can be subjected to challenge with a variety of factors known to cause an increase in antimicrobial peptide gene expression. The functional relevance of this induction can then be assessed by quantifying antibacterial activity either directly on the surface of the cells or using the fluid secreted onto the apical surface of the cultures. The relative contribution of the peptides can also be measured by pre-incubation of the secreted fluid with specific inhibitory antibodies. Thus, a relatively inexpensive in vitro model can be used to evaluate the role of antimicrobial peptides in mucosal epithelium. PMID:20094876

  8. Novel histone-derived antimicrobial peptides use different antimicrobial mechanisms.

    PubMed

    Pavia, Kathryn E; Spinella, Sara A; Elmore, Donald E

    2012-03-01

    The increase in multidrug resistant bacteria has sparked an interest in the development of novel antibiotics. Antimicrobial peptides that operate by crossing the cell membrane may also have the potential to deliver drugs to intracellular targets. Buforin 2 (BF2) is an antimicrobial peptide that shares sequence identity with a fragment of histone subunit H2A and whose bactericidal mechanism depends on membrane translocation and DNA binding. Previously, novel histone-derived antimicrobial peptides (HDAPs) were designed based on properties of BF2, and DesHDAP1 and DesHDAP3 showed significant antibacterial activity. In this study, their DNA binding, permeabilization, and translocation abilities were assessed independently and compared to antibacterial activity to determine whether they share a mechanism with BF2. To investigate the importance of proline in determining the peptides' mechanisms of action, proline to alanine mutants of the novel peptides were generated. DesHDAP1, which shows significant similarities to BF2 in terms of secondary structure, translocates effectively across lipid vesicle and bacterial membranes, while the DesHDAP1 proline mutant shows reduced translocation abilities and antimicrobial potency. In contrast, both DesHDAP3 and its proline mutant translocate poorly, though the DesHDAP3 proline mutant is more potent. Our findings suggest that a proline hinge can promote membrane translocation in some peptides, but that the extent of its effect on permeabilization depends on the peptide's amphipathic properties. Our results also highlight the different antimicrobial mechanisms exhibited by histone-derived peptides and suggest that histones may serve as a source of novel antimicrobial peptides with varied properties.

  9. [Antimicrobial peptide in dentisty. Literature review].

    PubMed

    Sato, F Simain; Rompen, E; Heinen, E

    2009-12-01

    The use of antimicrobial substances has contributed to the development of multiple antimicrobial resistances (1), challenging the pharmaceutical industry to develop with new, innovative, and effective molecules. Discovered around 1980, molecules called natural antimicrobial peptides (AMPs) appear to hold great potential for the treatment of infections. These cationic peptides are able to stop the bacterial development and to control infections. The purpose of this review is to help improve the understanding of the way AMPs operate in the context of the development of new cures against viruses, bacteria, and mushrooms found in the human body in general and in the oral cavity in particular.

  10. The presence of sboA and spaS genes and antimicrobial peptides subtilosin A and subtilin among Bacillus strains of the Amazon basin

    PubMed Central

    Velho, Renata Voltolini; Basso, Ana Paula; Segalin, Jeferson; Costa-Medina, Luis Fernando; Brandelli, Adriano

    2013-01-01

    This report demonstrates the usefulness of PCR for the genes spaS and sboA as a means of identifying Bacillus strains with a potential to produce subtilin and subtilosin A. One collection strain and five Bacillus spp. isolated from aquatic environments in the Amazon basin were screened by PCR using primers for sboA and spaS designed specifically for this study. The sequences of the PCR products showed elevated homology with previously described spaS and sboA genes. Antimicrobial peptides were isolated from culture supernatants and analyzed by mass spectrometry. For all samples, the mass spectra revealed clusters with peaks at m/z 3300–3500 Da, corresponding to subtilosin A, subtilin and isoforms of these peptides. These results suggest that the antimicrobial activity of these strains may be associated with the production of subtilosin A and/or subtilin. The PCR used here was efficient in identifying novel Bacillus strains with the essential genes for producing subtilosin A and subtilin. PMID:23569414

  11. Antimicrobial preservative effectiveness of natural peptide antibiotics.

    PubMed

    Kamysz, Wojciech; Turecka, Katarzyna

    2005-01-01

    The constantly growing resistance of microbes to drugs and other substances which fight microbial infections leads to search for new antimicrobial substances. Among substances which attract the scientists attention are antimicrobial peptides. Such compounds are quite common in nature and belong to the most important elements of the innate immune system of all living organisms. Numerous antimicrobial peptides have been isolated from insects, amphibians, mammals, plants and bacterial species. In this study we investigated the in vitro activity of two animal peptides, citropin 1.1 and protegrin 1 alone and in combination against microbial strains proposed for the evaluation of preservatives: Escherichia coli ATCC 8739, Staphylococcus aureus ATCC 6538, Pseudomonas aeruginosa ATCC 9027, Candida albicans ATCC 10231, and Aspergillus niger ATCC 16404. The results of the antimicrobial preservative effectiveness were compared to the values received for benzalkonium chloride, popular preservative of medicines and cosmetics.

  12. Antimicrobial activity of human islet amyloid polypeptides: an insight into amyloid peptides' connection with antimicrobial peptides.

    PubMed

    Wang, Lan; Liu, Qian; Chen, Jin-Chun; Cui, Yi-Xian; Zhou, Bing; Chen, Yong-Xiang; Zhao, Yu-Fen; Li, Yan-Mei

    2012-07-01

    Human islet amyloid polypeptide (hIAPP) shows an antimicrobial activity towards two types of clinically relevant bacteria. The potency of hIAPP varies with its aggregation states. Circular dichroism was employed to determine the interaction between hIAPP and bacteria lipid membrane mimic. The antimicrobial activity of each aggregate species is associated with their ability to induce membrane disruption. Our findings provide new evidence revealing the antimicrobial activity of amyloid peptide, which suggest a possible connection between amyloid peptides and antimicrobial peptides.

  13. Antimicrobial Cyclic Peptides for Plant Disease Control

    PubMed Central

    Lee, Dong Wan; Kim, Beom Seok

    2015-01-01

    Antimicrobial cyclic peptides derived from microbes bind stably with target sites, have a tolerance to hydrolysis by proteases, and a favorable degradability under field conditions, which make them an attractive proposition for use as agricultural fungicides. Antimicrobial cyclic peptides are classified according to the types of bonds within the ring structure; homodetic, heterodetic, and complex cyclic peptides, which in turn reflect diverse physicochemical features. Most antimicrobial cyclic peptides affect the integrity of the cell envelope. This is achieved through direct interaction with the cell membrane or disturbance of the cell wall and membrane component biosynthesis such as chitin, glucan, and sphingolipid. These are specific and selective targets providing reliable activity and safety for non-target organisms. Synthetic cyclic peptides produced through combinatorial chemistry offer an alternative approach to develop antimicrobials for agricultural uses. Those synthesized so far have been studied for antibacterial activity, however, the recent advancements in powerful technologies now promise to provide novel antimicrobial cyclic peptides that are yet to be discovered from natural resources. PMID:25774105

  14. Antimicrobial peptides and bacteriocins: alternatives to traditional antibiotics.

    PubMed

    Sang, Yongming; Blecha, Frank

    2008-12-01

    Antimicrobial peptides (AMPs) are ubiquitous, gene-encoded natural antibiotics that have gained recent attention in the search for new antimicrobials to combat infectious disease. In multicellular organisms, AMPs, such as defensins and cathelicidins, provide a coordinated protective response against infection and are a principal component of innate immunity in vertebrates. In unicellular organisms, AMPs, such as bacteriocins, function to suppress competitor species. Because many AMPs kill bacteria by disruption of membrane integrity and are thus thought to be less likely to induce resistance, AMPs are being extensively evaluated as novel antimicrobial drugs. This review summarizes and discusses the antibiotic properties of AMPs highlighting their potential as alternatives to conventional antibiotics.

  15. Antimicrobial peptide gene cecropin-2 and defensin respond to peptidoglycan infection in the female adult of oriental fruit fly, Bactrocera dorsalis (Hendel).

    PubMed

    Liu, Shi-Huo; Wei, Dong; Yuan, Guo-Rui; Jiang, Hong-Bo; Dou, Wei; Wang, Jin-Jun

    2017-04-01

    Cecropins and defensins are important antimicrobial peptides in insects and are inducible after injection of immune triggers. In this study, we cloned the cDNAs of two antimicrobial peptides (AMPs), cecropin-2 (BdCec-2) and defensin (BdDef) from Bactrocera dorsalis (Hendel), a serious pest causing great economic losses to fruits and vegetables. The BdCec-2 sequence of 192bp encodes a protein of 63 amino acids residues with a predicted molecular weight of 6.78kD. The 282bp cDNA of BdDef encodes a protein of 93 residues with a predicted molecular weight of 9.81kD. Quantitative real-time PCR analyses showed that BdCec-2 and BdDef had similar expression profiles among development stages, the highest mRNA levels of these two AMP genes were observed in the adult stage. Among different adult body segments and tissues, both genes had similar transcriptional profiles, the highest mRNA levels appeared in abdomen and fat body, which was consistent with the reported fact that fat body was the main organ synthesizing AMPs in insects. The expression of BdCec-2 and BdDef were up-regulated after challenge with peptidoglycans from Escherichia coli (PGN-EB) and Staphylococcus aureus (PGN-SA), respectively, suggesting their antimicrobial activity against Gram-negative and Gram-positive microorganisms. These results describe for the first time the basic properties of the cecropin-2 and defensin genes from B. dorsalis that probably play an important role in the defense response against invading microbes. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Identification of Legionella pneumophila rcp, a pagP-like gene that confers resistance to cationic antimicrobial peptides and promotes intracellular infection.

    PubMed

    Robey, M; O'Connell, W; Cianciotto, N P

    2001-07-01

    In the course of characterizing a locus involved in heme utilization, we identified a Legionella pneumophila gene predicted to encode a protein with homology to the product of the Salmonella enterica serovar Typhimurium pagP gene. In Salmonella, pagP increases resistance to the bactericidal effects of cationic antimicrobial peptides (CAMPs). Mutants with insertions in the L. pneumophila pagP-like gene were generated and showed decreased resistance to different structural classes of CAMPs compared to the wild type; hence, this gene was designated rcp for resistance to cationic antimicrobial peptides. Furthermore, Legionella CAMP resistance was induced by growth in low-magnesium medium. To determine whether rcp had any role in intracellular survival, mutants were tested in the two most relevant host cells for Legionnaires' disease, i.e., amoebae and macrophages. These mutants exhibited a 1,000-fold-decreased recovery during a Hartmannella vermiformis coculture. Complementation of the infectivity defect could be achieved by introduction of a plasmid containing the intact rcp gene. Mutations in rcp consistently reduced both the numbers of bacteria recovered during intracellular infection and their cytopathic capacity for U937 macrophages. The rcp mutant was also more defective for lung colonization of A/J mice. Growth of rcp mutants in buffered yeast extract broth was identical to that of the wild type, indicating that the observed differences in numbers of bacteria recovered from host cells were not due to a generalized growth defect. However, in low-Mg(2+) medium, the rcp mutant was impaired in stationary-phase survival. This is the first demonstration of a pagP-like gene, involved in resistance to CAMPs, being required for intracellular infection and virulence.

  17. Insect Antimicrobial Peptides and Their Applications

    PubMed Central

    Yi, Hui-Yu; Chowdhury, Munmun; Huang, Ya-Dong; Yu, Xiao-Qiang

    2014-01-01

    Insects are one of the major sources of antimicrobial peptides/proteins (AMPs). Since observation of antimicrobial activity in the hemolymph of pupae from the giant silk moths Samia Cynthia and Hyalophora cecropia in 1974 and purification of first insect AMP (cecropin) from H. cecropia pupae in 1980, over 150 insect AMPs have been purified or identified. Most insect AMPs are small and cationic, and they show activities against bacteria and/or fungi, as well as some parasites and viruses. Insect AMPs can be classified into four families based on their structures or unique sequences: the α-helical peptides (cecropin and moricin), cysteine-rich peptides (insect defensin and drosomycin), proline-rich peptides (apidaecin, drosocin and lebocin), and glycine-rich peptides/proteins (attacin and gloverin). Among insect AMPs, defensins, cecropins, proline-rich peptides and attacins are common, while gloverins and moricins have been identified only in Lepidoptera. Most active AMPs are small peptides of 20–50 residues, which are generated from larger inactive precursor proteins or pro-proteins, but gloverins (~14 kDa) and attacins (~20 kDa) are large antimicrobial proteins. In this mini-review, we will discuss current knowledge and recent progress in several classes of insect AMPs, including insect defensins, cecropins, attacins, lebocins and other proline-rich peptides, gloverins, and moricins, with a focus on structural-functional relationships and their potential applications. PMID:24811407

  18. Two novel antimicrobial peptides from centipede venoms.

    PubMed

    Peng, Kanfu; Kong, Yi; Zhai, Lei; Wu, Xiongfei; Jia, Peng; Liu, Jingze; Yu, Haining

    2010-01-01

    Centipede venoms are complex mixtures of biochemically and pharmacologically active components such as peptides and proteins. Very few are known about their pharmacological actions. The present work reports the structural and functional characterization of two antimicrobial peptides (scolopin 1 and -2) identified from centipede venoms of Scolopendra subspinipes mutilans by Sephadex gel filtration and reverse-phase high-performance liquid chromatography (RP-HPLC). The amino acid sequences of scolopin 1 and -2 were FLPKMSTKLRVPYRRGTKDYH and GILKKFMLHRGTKVYKMRTLSKRSH determined by Edman degradation and matrix assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF MS). Both scolopin 1 and -2 showed strong antimicrobial activities against tested microorganisms including Gram-positive/negative bacteria and fungi. They also showed moderate hemolytic activity against both human and rabbit red cells. This is the first report of antimicrobial peptides from centipedes.

  19. Proteolytic activation of pro-spätzle is required for the induced transcription of antimicrobial peptide genes in lepidopteran insects

    PubMed Central

    Wang, Yang; Cheng, Tingcai; Rayaprolu, Subrahmanyam; Zou, Zhen; Xia, Qingyou; Xiang, Zhonghuai; Jiang, Haobo

    2007-01-01

    Microbial infection leads to proteolytic activation of Drosophila spätzle, which binds to the toll receptor and induces the synthesis of immune proteins. To test whether or not this mechanism exists in lepidopteran insects, we cloned the cDNA of Bombyx mori spätzle-1 and overexpressed the full-length and truncated BmSpz1 cDNA in Escherichia coli. The insoluble fusion proteins were affinity-purified under denaturing condition. After the silkworm larvae were injected with renatured BmSpz1, mRNA levels of antimicrobial peptide genes greatly increased. Similar transcriptional up-regulation was also found in Manduca sexta. Injection of pro-BmSpz1 had no such effect. When pro-BmSpz1 and Micrococcus luteus were incubated with the plasma from M. sexta larvae, we detected proteolytic processing of pro-BmSpz1. These results suggest that active spätzle is required for the induced production of antimicrobial peptides in B. mori and M. sexta. PMID:17337053

  20. Expression profiles of seven channel catfish antimicrobial peptides in response to Edwardsiella ictaluri infection

    USDA-ARS?s Scientific Manuscript database

    Using quantitative PCR technique, the relative transcriptional levels of seven channel catfish antimicrobial peptide (AMP) genes [NK-lysin type 1, NK-lysin type 2, NK-lysin type 3, bactericidal permeability-increasing protein (BPI), cathepsin D, hepcidin, and liver-expressed antimicrobial peptide 2 ...

  1. Toxins and antimicrobial peptides: interactions with membranes

    NASA Astrophysics Data System (ADS)

    Schlamadinger, Diana E.; Gable, Jonathan E.; Kim, Judy E.

    2009-08-01

    The innate immunity to pathogenic invasion of organisms in the plant and animal kingdoms relies upon cationic antimicrobial peptides (AMPs) as the first line of defense. In addition to these natural peptide antibiotics, similar cationic peptides, such as the bee venom toxin melittin, act as nonspecific toxins. Molecular details of AMP and peptide toxin action are not known, but the universal function of these peptides to disrupt cell membranes of pathogenic bacteria (AMPs) or a diverse set of eukaryotes and prokaryotes (melittin) is widely accepted. Here, we have utilized spectroscopic techniques to elucidate peptide-membrane interactions of alpha-helical human and mouse AMPs of the cathelicidin family as well as the peptide toxin melittin. The activity of these natural peptides and their engineered analogs was studied on eukaryotic and prokaryotic membrane mimics consisting of <200-nm bilayer vesicles composed of anionic and neutral lipids as well as cholesterol. Vesicle disruption, or peptide potency, was monitored with a sensitive fluorescence leakage assay. Detailed molecular information on peptidemembrane interactions and peptide structure was further gained through vibrational spectroscopy combined with circular dichroism. Finally, steady-state fluorescence experiments yielded insight into the local environment of native or engineered tryptophan residues in melittin and human cathelicidin embedded in bilayer vesicles. Collectively, our results provide clues to the functional structures of the engineered and toxic peptides and may impact the design of synthetic antibiotic peptides that can be used against the growing number of antibiotic-resistant pathogens.

  2. Original involvement of antimicrobial peptides in mussel innate immunity.

    PubMed

    Mitta, G; Vandenbulcke, F; Roch, P

    2000-12-15

    Recently, the existence and extended diversity of antimicrobial peptides has been revealed in two mussel species. These molecules are classified into four groups according to common features of their primary structure: defensins, mytilins, myticins and mytimycin. In Mytilus galloprovincialis, gene structure reveals synthesis as precursors in circulating hemocytes. Synthesised even in absence of challenge, the precursors mature and the peptides are stored in granules as active forms. The different peptides are engaged in the destruction of bacteria inside phagocytes, before being released into hemolymph to participate in systemic responses. Such involvement in anti-infectious responses is unique, and apparently more related to those of mammalian phagocytes than to those of insects.

  3. Antimicrobial peptide gene induction, involvement of Toll and IMD pathways and defense against bacteria in the red flour beetle, Tribolium castaneum

    PubMed Central

    Yokoi, Kakeru; Koyama, Hiroaki; Minakuchi, Chieka; Tanaka, Toshiharu; Miura, Ken

    2012-01-01

    Using Tribolium castaneum, we quantitatively investigated the induction of nine antimicrobial peptide (AMP) genes by live gram-negative bacteria (Escherichia coli and Enterobacter cloacae), gram-positive bacteria (Micrococcus luteus and Bacillus subtilis) and the budding yeast (Saccharomyces cerevisiae). Then, five representative AMP genes were selected, and the involvement of the Toll and IMD pathways in their induction by E. coli, M. luteus and S. cerevisiae was examined by utilizing RNA interference of either MyD88 or IMD. Results indicated: Robust and acute induction of three genes by the two bacterial species was mediated mainly by the IMD pathway; slow and sustained induction of one gene by the two bacteria was mediated mainly by the Toll pathway; induction of the remaining one gene by the two bacteria was mediated by both pathways; induction of the five genes by the yeast was mediated by the Toll and/or IMD pathways depending on respective genes. These results suggest that more promiscuous activation and usage of the two pathways may occur in T. castaneum than in Drosophila melanogaster. In addition, the IMD pathway was revealed to dominantly contribute to defense against two bacterial species, gram-negative E. cloacae and gram-positive B. subtilis that possesses DAP-type peptidoglycan. PMID:24371569

  4. Molecular characterization and functional analysis of two distinct liver-expressed antimicrobial peptide 2 (LEAP-2) genes in large yellow croaker (Larimichthys crocea).

    PubMed

    Li, He-Xiang; Lu, Xin-Jiang; Li, Chang-Hong; Chen, Jiong

    2014-06-01

    Liver-expressed antimicrobial peptide 2 (LEAP-2) plays a vital role in the host innate immune system. In the present study, two LEAP-2 genes (LcLEAP-2A and LcLEAP-2C) from large yellow croaker (Larimichthys crocea) were cloned, both of which consist of 3 exons and 2 introns. The LcLEAP-2A transcripts were expressed in a wide range of tissues, with the highest mRNA levels found in the liver and intestine, while LcLEAP-2C transcripts showed obvious lower mRNA levels in all tested tissues compared to LcLEAP-2A. Upon infection by Vibrio alginolyticus, LcLEAP-2A transcripts were significantly up-regulated in liver, trunk kidney, spleen, head kidney, and gill, but down-regulated in intestine. In addition, significant up-regulation of LcLEAP-2C transcripts were also detected in all tissues tested, including intestine. The LcLEAP-2A and LcLEAP-2C mature peptides were chemically synthesized and found to exhibit selective antimicrobial activity in vitro against various species of bacteria. LcLEAP-2C, but not LcLEAP-2A, had antimicrobial activity against V. alginolyticus. Moreover, LcLEAP-2C treatment at low concentrations was evaluated and found to improve survival rate in V. alginolyticus-infected large yellow croaker, resulting in a decrease in bacterial load and expression of inflammatory cytokines. These results suggest that LcLEAP-2 isoforms play an important role in innate immunity by killing bacteria and inhibiting early inflammatory response in large yellow croaker. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Antimicrobial Peptides for Use in Biosensing Applications

    DTIC Science & Technology

    2004-12-01

    S., Bevins, C. L., Brasseur, M. M., Tomassini, N., Turner, K., Eck, H. and Zasloff, M., 1991: Antimicrobial Peptides in the Stomach of Xenopus ... laevis , The Journal of Biological Chemistry, 266, 19851-19857. Steiner, H., Andreu, D. and Merrifield, R. B., 1988: Binding and action of cecropin

  6. RNAi knock-down of shrimp Litopenaeus vannamei Toll gene and immune deficiency gene reveals their difference in regulating antimicrobial peptides transcription.

    PubMed

    Hou, Fujun; He, Shulin; Liu, Yongjie; Zhu, Xiaowen; Sun, Chengbo; Liu, Xiaolin

    2014-06-01

    NF-κB dependent antimicrobial peptides (AMPs) are of critical importance in protecting insects or mammals from microorganisms infection. However, we still do not make clear signaling pathways in regulating AMPs expression in shrimps. In this study, RNAi approach was used to study differences between Toll signaling pathway and immune deficiency signaling pathway in regulating the transcription of NF-κB dependent AMPs post bacteria challenge. Results showed that the transcription level of anti-lipopolysaccharide factor was highly suppressed in Litopenaeus vannamei immune deficiency (LvIMD) silenced shrimps by gene specific dsRNA compared to Litopenaeus vannamei Toll (LvToll) silenced shrimps with or without Vibrio anguillarum and Micrococcus lysodeikticus challenge. Conversely the transcription level of penaeidin3a was significantly suppressed in LvToll silenced shrimps compared to LvIMD silenced shrimps. However, no obvious difference was found in regulating the transcription of CrustinP. Meanwhile, we found that silencing LvToll both down regulated the transcription of Dorsal and Relish while silencing LvIMD only down regulated the transcription of Relish. At last, shrimp survival experiment showed that post V. anguillarum challenge high mortality was found both in LvToll and LvIMD silenced groups while post M. lysodeikticus challenge we saw high mortality only in LvToll silenced group. Hence, we conclude that shrimp L. vannamei Toll pathway and IMD pathway might be different in regulating the transcription of NF-κB dependent AMPs and responding to bacteria challenge but not independent of each other.

  7. Bacterial strategies of resistance to antimicrobial peptides.

    PubMed

    Joo, Hwang-Soo; Fu, Chih-Iung; Otto, Michael

    2016-05-26

    Antimicrobial peptides (AMPs) are a key component of the host's innate immune system, targeting invasive and colonizing bacteria. For successful survival and colonization of the host, bacteria have a series of mechanisms to interfere with AMP activity, and AMP resistance is intimately connected with the virulence potential of bacterial pathogens. In particular, because AMPs are considered as potential novel antimicrobial drugs, it is vital to understand bacterial AMP resistance mechanisms. This review gives a comparative overview of Gram-positive and Gram-negative bacterial strategies of resistance to various AMPs, such as repulsion or sequestration by bacterial surface structures, alteration of membrane charge or fluidity, degradation and removal by efflux pumps.This article is part of the themed issue 'Evolutionary ecology of arthropod antimicrobial peptides'.

  8. Snakin-2, an antimicrobial peptide from potato whose gene is locally induced by wounding and responds to pathogen infection.

    PubMed

    Berrocal-Lobo, Marta; Segura, Ana; Moreno, Manuel; López, Gemma; García-Olmedo, Francisco; Molina, Antonio

    2002-03-01

    The peptide snakin-2 (StSN2) has been isolated from potato (Solanum tuberosum cv Jaerla) tubers and found to be active (EC(50) = 1-20 microM) against fungal and bacterial plant pathogens. It causes a rapid aggregation of both Gram-positive and Gram-negative bacteria. The corresponding StSN2 cDNA encodes a signal sequence followed by a 15-residue acidic sequence that precedes the mature StSN2 peptide, which is basic (isoelectric point = 9.16) and 66 amino acid residues long (molecular weight of 7,025). The StSN2 gene is developmentally expressed in tubers, stems, flowers, shoot apex, and leaves, but not in roots, or stolons, and is locally up-regulated by wounding and by abscisic acid treatment. Expression of this gene is also up-regulated after infection of potato tubers with the compatible fungus Botritys cinerea and down-regulated by the virulent bacteria Ralstonia solanacearum and Erwinia chrysanthemi. These observations are congruent with the hypothesis that the StSN2 is a component of both constitutive and inducible defense barriers.

  9. Snakin-2, an Antimicrobial Peptide from Potato Whose Gene Is Locally Induced by Wounding and Responds to Pathogen Infection1

    PubMed Central

    Berrocal-Lobo, Marta; Segura, Ana; Moreno, Manuel; López, Gemma; García-Olmedo, Francisco; Molina, Antonio

    2002-01-01

    The peptide snakin-2 (StSN2) has been isolated from potato (Solanum tuberosum cv Jaerla) tubers and found to be active (EC50 = 1–20 μm) against fungal and bacterial plant pathogens. It causes a rapid aggregation of both Gram-positive and Gram-negative bacteria. The corresponding StSN2 cDNA encodes a signal sequence followed by a 15-residue acidic sequence that precedes the mature StSN2 peptide, which is basic (isoelectric point = 9.16) and 66 amino acid residues long (molecular weight of 7,025). The StSN2 gene is developmentally expressed in tubers, stems, flowers, shoot apex, and leaves, but not in roots, or stolons, and is locally up-regulated by wounding and by abscisic acid treatment. Expression of this gene is also up-regulated after infection of potato tubers with the compatible fungus Botritys cinerea and down-regulated by the virulent bacteria Ralstonia solanacearum and Erwinia chrysanthemi. These observations are congruent with the hypothesis that the StSN2 is a component of both constitutive and inducible defense barriers. PMID:11891250

  10. A novel family of antimicrobial peptides from the skin of Amolops loloensis.

    PubMed

    Wang, Aili; Wang, Jiyuan; Hong, Jing; Feng, Hao; Yang, Hailong; Yu, Xiaodong; Ma, Yufang; Lai, Ren

    2008-06-01

    While conducting experiments to investigate antimicrobial peptides of amphibians living in the Yunnan-Sichuan region of southwest China, a new family of antimicrobial peptides was identified from skin secretions of the rufous-spotted torrent frog, Amolops loloensis. Members of the new peptide family named amolopins are composed of 18 amino acids with a unique sequence, for example, NILSSIVNGINRALSFFG. By BLAST search, amolopins did no show similarity to any known peptides. Among the tested microorganisms, native and synthetic peptides only showed antimicrobial activities against Staphylococcus aureus ATCC2592 and Bacillus pumilus, no effects on other microorganisms. The CD spectroscopy showed that it adopted a structure of random combined with beta-sheet in water, Tris-HCl or Tris-HCl-SDS. Several cDNAs encoding amolopins were cloned from the skin cDNA library of A. loloensis. The precursors of amolopin are composed of 62 amino acid residues including predicted signal peptides, acidic propieces, and mature antimicrobial peptides. The preproregion of amolopin precursor comprises a hydrophobic signal peptide of 22 residues followed by an 18 residue acidic propiece which terminates by a typical prohormone processing signal Lys-Arg. The preproregions of precursors are very similar to other amphibian antimicrobial peptide precursors but the mature amolopins are different from other antimicrobial peptide families. The remarkable similarity of preproregions of precursors that give rise to very different antimicrobial peptides in distantly related frog species suggests that the corresponding genes form a multigene family originating from a common ancestor.

  11. Design and Application of Antimicrobial Peptide Conjugates

    PubMed Central

    Reinhardt, Andre; Neundorf, Ines

    2016-01-01

    Antimicrobial peptides (AMPs) are an interesting class of antibiotics characterized by their unique antibiotic activity and lower propensity for developing resistance compared to common antibiotics. They belong to the class of membrane-active peptides and usually act selectively against bacteria, fungi and protozoans. AMPs, but also peptide conjugates containing AMPs, have come more and more into the focus of research during the last few years. Within this article, recent work on AMP conjugates is reviewed. Different aspects will be highlighted as a combination of AMPs with antibiotics or organometallic compounds aiming to increase antibacterial activity or target selectivity, conjugation with photosensitizers for improving photodynamic therapy (PDT) or the attachment to particles, to name only a few. Owing to the enormous resonance of antimicrobial conjugates in the literature so far, this research topic seems to be very attractive to different scientific fields, like medicine, biology, biochemistry or chemistry. PMID:27187357

  12. Peptide consensus sequence determination for the enhancement of the antimicrobial activity and selectivity of antimicrobial peptides

    PubMed Central

    Almaaytah, Ammar; Ajingi, Ya’u; Abualhaijaa, Ahmad; Tarazi, Shadi; Alshar’i, Nizar; Al-Balas, Qosay

    2017-01-01

    The rise of multidrug-resistant bacteria is causing a serious threat to the world’s human population. Recent reports have identified bacterial strains displaying pan drug resistance against antibiotics and generating fears among medical health specialists that humanity is on the dawn of entering a post-antibiotics era. Global research is currently focused on expanding the lifetime of current antibiotics and the development of new antimicrobial agents to tackle the problem of antimicrobial resistance. In the present study, we designed a novel consensus peptide named “Pepcon” through peptide consensus sequence determination among members of a highly homologous group of scorpion antimicrobial peptides. Members of this group were found to possess moderate antimicrobial activity with significant toxicity against mammalian cells. The aim of our design method was to generate a novel peptide with an enhanced antimicrobial potency and selectivity against microbial rather than mammalian cells. The results of our study revealed that the consensus peptide displayed potent antibacterial activities against a broad range of Gram-positive and Gram-negative bacteria. Our membrane permeation studies displayed that the peptide efficiently induced membrane damage and consequently led to cell death through the process of cell lysis. The microbial DNA binding assay of the peptide was found to be very weak suggesting that the peptide is not targeting the microbial DNA. Pepcon induced minimal cytotoxicity at the antimicrobial concentrations as the hemolytic activity was found to be zero at the minimal inhibitory concentrations (MICs). The results of our study demonstrate that the consensus peptide design strategy is efficient in generating peptides. PMID:28096686

  13. Peptide consensus sequence determination for the enhancement of the antimicrobial activity and selectivity of antimicrobial peptides.

    PubMed

    Almaaytah, Ammar; Ajingi, Ya'u; Abualhaijaa, Ahmad; Tarazi, Shadi; Alshar'i, Nizar; Al-Balas, Qosay

    2017-01-01

    The rise of multidrug-resistant bacteria is causing a serious threat to the world's human population. Recent reports have identified bacterial strains displaying pan drug resistance against antibiotics and generating fears among medical health specialists that humanity is on the dawn of entering a post-antibiotics era. Global research is currently focused on expanding the lifetime of current antibiotics and the development of new antimicrobial agents to tackle the problem of antimicrobial resistance. In the present study, we designed a novel consensus peptide named "Pepcon" through peptide consensus sequence determination among members of a highly homologous group of scorpion antimicrobial peptides. Members of this group were found to possess moderate antimicrobial activity with significant toxicity against mammalian cells. The aim of our design method was to generate a novel peptide with an enhanced antimicrobial potency and selectivity against microbial rather than mammalian cells. The results of our study revealed that the consensus peptide displayed potent antibacterial activities against a broad range of Gram-positive and Gram-negative bacteria. Our membrane permeation studies displayed that the peptide efficiently induced membrane damage and consequently led to cell death through the process of cell lysis. The microbial DNA binding assay of the peptide was found to be very weak suggesting that the peptide is not targeting the microbial DNA. Pepcon induced minimal cytotoxicity at the antimicrobial concentrations as the hemolytic activity was found to be zero at the minimal inhibitory concentrations (MICs). The results of our study demonstrate that the consensus peptide design strategy is efficient in generating peptides.

  14. The role of antimicrobial peptides in animal defenses

    NASA Astrophysics Data System (ADS)

    Hancock, Robert E. W.; Scott, Monisha G.

    2000-08-01

    It is becoming clear that the cationic antimicrobial peptides are an important component of the innate defenses of all species of life. Such peptides can be constitutively expressed or induced by bacteria or their products. The best peptides have good activities vs. a broad range of bacterial strains, including antibiotic-resistant isolates. They kill very rapidly, do not easily select resistant mutants, are synergistic with conventional antibiotics, other peptides, and lysozyme, and are able to kill bacteria in animal models. It is known that bacterial infections, especially when treated with antibiotics, can lead to the release of bacterial products such as lipopolysaccharide (LPS) and lipoteichoic acid, resulting in potentially lethal sepsis. In contrast to antibiotics, the peptides actually prevent cytokine induction by bacterial products in tissue culture and human blood, and they block the onset of sepsis in mouse models of endotoxemia. Consistent with this, transcriptional gene array experiments using a macrophage cell line demonstrated that a model peptide, CEMA, blocks the expression of many genes whose transcription was induced by LPS. The peptides do this in part by blocking LPS interaction with the serum protein LBP. In addition, CEMA itself has a direct effect on macrophage gene expression. Because cationic antimicrobial peptides are induced by LPS and are able to dampen the septic response of animal cells to LPS, we propose that, in addition to their role in direct and lysozyme-assisted killing of microbes, they have a role in feedback regulation of cytokine responses. We are currently developing variant peptides as therapeutics against antibiotic-resistant infections.

  15. The role of antimicrobial peptides in animal defenses.

    PubMed

    Hancock, R E; Scott, M G

    2000-08-01

    It is becoming clear that the cationic antimicrobial peptides are an important component of the innate defenses of all species of life. Such peptides can be constitutively expressed or induced by bacteria or their products. The best peptides have good activities vs. a broad range of bacterial strains, including antibiotic-resistant isolates. They kill very rapidly, do not easily select resistant mutants, are synergistic with conventional antibiotics, other peptides, and lysozyme, and are able to kill bacteria in animal models. It is known that bacterial infections, especially when treated with antibiotics, can lead to the release of bacterial products such as lipopolysaccharide (LPS) and lipoteichoic acid, resulting in potentially lethal sepsis. In contrast to antibiotics, the peptides actually prevent cytokine induction by bacterial products in tissue culture and human blood, and they block the onset of sepsis in mouse models of endotoxemia. Consistent with this, transcriptional gene array experiments using a macrophage cell line demonstrated that a model peptide, CEMA, blocks the expression of many genes whose transcription was induced by LPS. The peptides do this in part by blocking LPS interaction with the serum protein LBP. In addition, CEMA itself has a direct effect on macrophage gene expression. Because cationic antimicrobial peptides are induced by LPS and are able to dampen the septic response of animal cells to LPS, we propose that, in addition to their role in direct and lysozyme-assisted killing of microbes, they have a role in feedback regulation of cytokine responses. We are currently developing variant peptides as therapeutics against antibiotic-resistant infections.

  16. The role of antimicrobial peptides in animal defenses

    PubMed Central

    Hancock, Robert E. W.; Scott, Monisha G.

    2000-01-01

    It is becoming clear that the cationic antimicrobial peptides are an important component of the innate defenses of all species of life. Such peptides can be constitutively expressed or induced by bacteria or their products. The best peptides have good activities vs. a broad range of bacterial strains, including antibiotic-resistant isolates. They kill very rapidly, do not easily select resistant mutants, are synergistic with conventional antibiotics, other peptides, and lysozyme, and are able to kill bacteria in animal models. It is known that bacterial infections, especially when treated with antibiotics, can lead to the release of bacterial products such as lipopolysaccharide (LPS) and lipoteichoic acid, resulting in potentially lethal sepsis. In contrast to antibiotics, the peptides actually prevent cytokine induction by bacterial products in tissue culture and human blood, and they block the onset of sepsis in mouse models of endotoxemia. Consistent with this, transcriptional gene array experiments using a macrophage cell line demonstrated that a model peptide, CEMA, blocks the expression of many genes whose transcription was induced by LPS. The peptides do this in part by blocking LPS interaction with the serum protein LBP. In addition, CEMA itself has a direct effect on macrophage gene expression. Because cationic antimicrobial peptides are induced by LPS and are able to dampen the septic response of animal cells to LPS, we propose that, in addition to their role in direct and lysozyme-assisted killing of microbes, they have a role in feedback regulation of cytokine responses. We are currently developing variant peptides as therapeutics against antibiotic-resistant infections. PMID:10922046

  17. Peptides with Dual Antimicrobial and Anticancer Activities

    NASA Astrophysics Data System (ADS)

    Felício, Mário R.; Silva, Osmar N.; Gonçalves, Sônia; Santos, Nuno C.; Franco, Octávio L.

    2017-02-01

    In recent years, the number of people suffering from cancer and multi-resistant infections has increased, such that both diseases are already seen as current and future major causes of death. Moreover, chronic infections are one of the main causes of cancer, due to the instability in the immune system that allows cancer cells to proliferate. Likewise, the physical debility associated with cancer or with anticancer therapy itself often paves the way for opportunistic infections. It is urgent to develop new therapeutic methods, with higher efficiency and lower side effects. Antimicrobial peptides (AMPs) are found in the innate immune system of a wide range of organisms. Identified as the most promising alternative to conventional molecules used nowadays against infections, some of them have been shown to have dual activity, both as antimicrobial and anticancer peptides (ACPs). Highly cationic and amphipathic, they have demonstrated efficacy against both conditions, with the number of nature-driven or synthetically designed peptides increasing year by year. With similar properties, AMPs that can also act as ACPs are viewed as future chemotherapeutic drugs, with the advantage of low propensity to resistance, which started this paradigm in the pharmaceutical market. These peptides have already been described as molecules presenting killing mechanisms at the membrane level, but also acting towards intracellular targets, which increases their success comparatively to specific one-target drugs. This review will approach the desirable characteristics of small peptides that demonstrated dual activity against microbial infections and cancer, as well as the peptides engaged in clinical trials.

  18. Evidence for adaptation from standing genetic variation on an antimicrobial peptide gene in the mussel Mytilus edulis.

    PubMed

    Gosset, Célia C; Do Nascimento, Joana; Augé, Marie-Thérèse; Bierne, Nicolas

    2014-06-01

    Genome scans of population differentiation identify candidate loci for adaptation but provide little information on how selection has influenced the genetic structure of these loci. Following a genome scan, we investigated the nature of the selection responsible for the outlying differentiation observed between populations of the marine mussel Mytilus edulis at a leucine/arginine polymorphism (L31R) in the antimicrobial peptide MGD2. We analysed DNA sequence polymorphisms, allele frequencies and population differentiation of polymorphisms closely linked to L31R, and pairwise and third-order linkage disequilibria. An outlying level of population differentiation was observed at L31R only, while no departure from panmixia was observed at linked loci surrounding L31R, as in most of the genome. Selection therefore seems to affect L31R directly. Three hypotheses can explain the lack of differentiation in the chromosomal region close to L31R: (i) hitchhiking has occurred but migration and recombination subsequently erased the signal, (ii) selection was weak enough and recombination strong enough to limit the hitchhiking effect to a very small chromosomal region or (iii) selection acted on a pre-existing polymorphism (i.e. standing variation) at linkage equilibrium with its background. Linkage equilibrium was observed between L31R and linked polymorphisms in every population analysed, as expected under the three hypotheses. However, linkage disequilibrium was observed in some populations between pairs of loci located upstream and downstream to L31R, generating a complex pattern of third-order linkage disequilibria which is best explained by the hypothesis of selection on a pre-existing polymorphism. We hypothesise that selection could be either balanced, maintaining alleles at different frequencies depending on the pathogen community encountered locally by mussels, or intermittent, resulting in sporadic fluctuations in allele frequency.

  19. Differential Change Patterns of Main Antimicrobial Peptide Genes During Infection of Entomopathogenic Nematodes and Their Symbiotic Bacteria.

    PubMed

    Darsouei, Reyhaneh; Karimi, Javad; Ghadamyari, Mohammad; Hosseini, Mojtaba

    2017-08-01

    The expression of antimicrobial peptides (AMPs) as the main humoral defense reactions of insects during infection by entomopathogenic nematodes (EPNs) and their symbiont is addressed herein. Three AMPs, attacin, cecropin, and spodoptericin, were evaluated in the fifth instar larvae of Spodoptera exigua Hübner (beet armyworm) when challenged with Steinernema carpocapsae or Heterorhabditis bacteriophora. The results indicated that attacin was expressed to a greater extent than either cecropin or spodoptericin. While spodoptericin was expressed to a much lesser extent, this AMP was induced against Gram-positive bacteria, and thus not expressed after penetration of Xenorhabdus nematophila and Photorhabdus luminescens. Attacin and cecropin in the larvae treated with S. carpocapsae at 8 hr post-injection (PI) attained the maximum expression levels and were 138.42-fold and 65.84-fold greater than those of larvae infected with H. bacteriophora, respectively. Generally, the ability of H. bacteriophora to suppress attacin, cecropin, and spodoptericin was greater than that of S. carpocapsae. According to the results, the expression of AMPs by Sp. exigua larvae against S. carpocapsae was determined in the 4 statuses of monoxenic nematode, axenic nematode, live symbiotic bacterium, and dead symbiotic bacterium. The expression of attacin in larvae treated with a monoxenic nematode and live bacterium at 8 and 2 hr PI, respectively, were increased to the maximum amount. Live X. nematophila was the strongest agent for the suppression of attacin. The expression of cecropin against monoxenic nematodes and live symbiotic bacteria at 8 and 4 hr PI, respectively, reached the maximum amount while the expression levels of attacin and cecropin for axenic nematodes were lesser and stable. The results highlighted that the ability of P. luminescens in AMPs suppression was much more than X. nematophila. The results also showed that the effect of symbiotic bacterium in suppressing attacin and

  20. Classification of antimicrobial peptides with imbalanced datasets

    NASA Astrophysics Data System (ADS)

    Camacho, Francy L.; Torres, Rodrigo; Ramos Pollán, Raúl

    2015-12-01

    In the last years, pattern recognition has been applied to several fields for solving multiple problems in science and technology as for example in protein prediction. This methodology can be useful for prediction of activity of biological molecules, e.g. for determination of antimicrobial activity of synthetic and natural peptides. In this work, we evaluate the performance of different physico-chemical properties of peptides (descriptors groups) in the presence of imbalanced data sets, when facing the task of detecting whether a peptide has antimicrobial activity. We evaluate undersampling and class weighting techniques to deal with the class imbalance with different classification methods and descriptor groups. Our classification model showed an estimated precision of 96% showing that descriptors used to codify the amino acid sequences contain enough information to correlate the peptides sequences with their antimicrobial activity by means of learning machines. Moreover, we show how certain descriptor groups (pseudoaminoacid composition type I) work better with imbalanced datasets while others (dipeptide composition) work better with balanced ones.

  1. Design of self-processing antimicrobial peptides for plant protection.

    PubMed

    Powell, W A; Catranis, C M; Maynard, C A

    2000-08-01

    Small antimicrobial peptides are excellent candidates for inclusion in self-processing proteins that could be used to confer pathogen resistance in transgenic plants. Antimicrobial peptides as small as 22 amino acids in length have been designed to incorporate the residual amino acids left from protein processing by the tobacco etch virus'(TEVs') NIa protease. Also, by minimizing the length of these peptides and the number of highly hydrophobic residues, haemolytic activity was reduced without affecting the peptide's antimicrobial activity.

  2. Biologically active and antimicrobial peptides from plants.

    PubMed

    Salas, Carlos E; Badillo-Corona, Jesus A; Ramírez-Sotelo, Guadalupe; Oliver-Salvador, Carmen

    2015-01-01

    Bioactive peptides are part of an innate response elicited by most living forms. In plants, they are produced ubiquitously in roots, seeds, flowers, stems, and leaves, highlighting their physiological importance. While most of the bioactive peptides produced in plants possess microbicide properties, there is evidence that they are also involved in cellular signaling. Structurally, there is an overall similarity when comparing them with those derived from animal or insect sources. The biological action of bioactive peptides initiates with the binding to the target membrane followed in most cases by membrane permeabilization and rupture. Here we present an overview of what is currently known about bioactive peptides from plants, focusing on their antimicrobial activity and their role in the plant signaling network and offering perspectives on their potential application.

  3. Biologically Active and Antimicrobial Peptides from Plants

    PubMed Central

    Salas, Carlos E.; Badillo-Corona, Jesus A.; Ramírez-Sotelo, Guadalupe; Oliver-Salvador, Carmen

    2015-01-01

    Bioactive peptides are part of an innate response elicited by most living forms. In plants, they are produced ubiquitously in roots, seeds, flowers, stems, and leaves, highlighting their physiological importance. While most of the bioactive peptides produced in plants possess microbicide properties, there is evidence that they are also involved in cellular signaling. Structurally, there is an overall similarity when comparing them with those derived from animal or insect sources. The biological action of bioactive peptides initiates with the binding to the target membrane followed in most cases by membrane permeabilization and rupture. Here we present an overview of what is currently known about bioactive peptides from plants, focusing on their antimicrobial activity and their role in the plant signaling network and offering perspectives on their potential application. PMID:25815307

  4. Cloning and expression of genes enocoding antimicrobial peptides and bradykinin from the skin and brain of Oki Tago's brown frog, Rana tagoi okiensis.

    PubMed

    Tazato, Shoro; Conlon, J Michael; Iwamuro, Shawichi

    2010-08-01

    Previous studies led to the isolation from skin extracts of Oki Tago's brown frog, Rana tagoi okiensis of five antimicrobial peptides belonging to the brevinin-1 (brevinin-1TOa), temporin (temporin-TOa and -TOb), and ranatuerin-2 (ranatuerin-2TOa and -2TOb) families, and bradykinin (BK) identical to mammalian BK. Using the reverse-transcription polymerase chain reaction (RT-PCR), we have now cloned from skin total RNA preparations cDNAs encoding biosynthetic precursors of brevinin-1TOa and brevinin-1TOb (containing the substitution Gly(1)-->Val), temporin-TOa and -TOb, and ranatuerin-2TOa and -2TOb. In addition, three cDNA clones encoding preprobradykinins were obtained that contained either one, two, or three tandem repeats of the sequence of BK followed by the sequence of [Thr(6)]-BK. In tissue expression analyses, preprobrevinin-1, preprotemporin, and preproranatuerin-2 gene transcripts were detected at higher levels in brain compared with peripheral tissues (heart, small intestine, kidney, liver lung, skeletal muscle, stomach, and testis). RT-PCR of brain RNA resulted in the amplification of cDNAs encoding ranatuerin-2TOc and ranatuerin-2TOd that contained the amino acid substitutions Lys(6)-->Arg and Ala(14)-->Thr, respectively compared with ranatuerin-2TOb. cDNAs encoding preprobrevinin-1TOa and preprotemporin-TOa were amplified from brain RNA as well as a second preprotemporin cDNA that contained a 10-nucleotide insertion that introduced a frame shift resulting in a premature stop codon. A cDNA encoding a novel peptide, DK25 (DVNDLKNLCAKTHNLLPMCAMFGKK) was amplified from brain RNA but neither DK25 nor its putative post-translationally modified form, DF22-amide (DVNDLKNLCAKTHNLLPMCAMF.NH(2)) displayed antimicrobial or hemolytic activities. Copyright 2010 Elsevier Inc. All rights reserved.

  5. Antimicrobial Peptides, Skin Infections and Atopic Dermatitis

    PubMed Central

    Hata, Tissa R.; Gallo, Richard L.

    2008-01-01

    The innate immune system evolved over 2 billion years ago to first recognize pathogens then eradicate them. Several distinct defects in this ancient but rapidly responsive element of human immune defense account for the increased incidence of skin infections in atopics. These defects include abnormalities in the physical barrier of the epidermis, alterations in microbial pattern recognition receptors such as toll receptors and NOD, and a diminished capacity to increase the expression of antimicrobial peptides during inflammation. Several antimicrobial peptides are affected including; cathelicidin, HBD-2, and HBD-3, which are lower in lesional skin of atopics compared to other inflammatory skin diseases, and dermcidin, which is decreased in sweat. Other defects in the immune defense barrier of atopics include a relative deficiency in plasmacytoid dendritic cells. In the future, understanding the cause of these defects may allow therapeutic intervention to reduce the incidence of infection in atopic individuals and potentially decrease the severity of this disorder. PMID:18620136

  6. Therapeutic antimicrobial peptides may compromise natural immunity

    PubMed Central

    Habets, Michelle G. J. L.; Brockhurst, Michael A.

    2012-01-01

    Antimicrobial peptides (AMPs) have been proposed as a promising new class of antimicrobials despite warnings that therapeutic use could drive the evolution of pathogens resistant to our own immunity peptides. Using experimental evolution, we demonstrate that Staphylococcus aureus rapidly evolved resistance to pexiganan, a drug-candidate for diabetic leg ulcer infections. Evolved resistance was costly in terms of impaired growth rate, but costs-of-resistance were completely ameliorated by compensatory adaptation. Crucially, we show that, in some populations, experimentally evolved resistance to pexiganan provided S. aureus with cross-resistance to human-neutrophil-defensin-1, a key component of the innate immune response to infection. This unintended consequence of therapeutic use could drastically undermine our innate immune system's ability to control and clear microbial infections. Our results therefore highlight grave potential risks of AMP therapies, with implications for their development. PMID:22279153

  7. Bacterial strategies of resistance to antimicrobial peptides

    PubMed Central

    Joo, Hwang-Soo; Fu, Chih-Iung

    2016-01-01

    Antimicrobial peptides (AMPs) are a key component of the host's innate immune system, targeting invasive and colonizing bacteria. For successful survival and colonization of the host, bacteria have a series of mechanisms to interfere with AMP activity, and AMP resistance is intimately connected with the virulence potential of bacterial pathogens. In particular, because AMPs are considered as potential novel antimicrobial drugs, it is vital to understand bacterial AMP resistance mechanisms. This review gives a comparative overview of Gram-positive and Gram-negative bacterial strategies of resistance to various AMPs, such as repulsion or sequestration by bacterial surface structures, alteration of membrane charge or fluidity, degradation and removal by efflux pumps. This article is part of the themed issue ‘Evolutionary ecology of arthropod antimicrobial peptides’. PMID:27160595

  8. Hepcidins in amphibians and fishes: Antimicrobial peptides or iron-regulatory hormones?

    PubMed

    Shi, Jishu; Camus, Alvin C

    2006-01-01

    Hepcidin, originally identified as a 25 amino acid peptide antibiotic produced in the liver, is a key regulator of iron balance and recycling in humans and mice. Closely related hepcidin genes and peptides also have been identified in other mammals, amphibians, and a number of fish species. We hypothesize that hepcidin, the iron-regulatory hormone in humans, may have evolved from an antimicrobial peptide in fishes. In this review we will highlight the evidence that indicates hepcidin evolved from an antimicrobial peptide to an iron-regulatory hormone in vertebrate evolution. This evidence includes the discovery of hepcidin as an antimicrobial peptide and iron-regulatory hormone, structural comparison of mammalian hepcidins and nonmammalian hepcidins, and the cellular and molecular evidence indicating that, while some fish hepcidins may serve only as antimicrobial peptides, other fish and amphibian hepcidins may function as iron regulators.

  9. Bcr1 Functions Downstream of Ssd1 To Mediate Antimicrobial Peptide Resistance in Candida albicans

    PubMed Central

    Jung, Sook-In; Finkel, Jonathan S.; Solis, Norma V.; Chaili, Siyang; Mitchell, Aaron P.; Yeaman, Michael R.

    2013-01-01

    In order to colonize the host and cause disease, Candida albicans must avoid being killed by host defense peptides. Previously, we determined that the regulatory protein Ssd1 governs antimicrobial peptide resistance in C. albicans. Here, we sought to identify additional genes whose products govern susceptibility to antimicrobial peptides. We discovered that a bcr1Δ/Δ mutant, like the ssd1Δ/Δ mutant, had increased susceptibility to the antimicrobial peptides, protamine, RP-1, and human β defensin-2. Homozygous deletion of BCR1 in the ssd1Δ/Δ mutant did not result in a further increase in antimicrobial peptide susceptibility. Exposure of the bcr1Δ/Δ and ssd1Δ/Δ mutants to RP-1 induced greater loss of mitochondrial membrane potential and increased plasma membrane permeability than with the control strains. Therefore, Bcr1 and Ssd1 govern antimicrobial peptide susceptibility and likely function in the same pathway. Furthermore, BCR1 mRNA expression was downregulated in the ssd1Δ/Δ mutant, and the forced expression of BCR1 in the ssd1Δ/Δ mutant partially restored antimicrobial peptide resistance. These results suggest that Bcr1 functions downstream of Ssd1. Interestingly, overexpression of 11 known Bcr1 target genes in the bcr1Δ/Δ mutant failed to restore antimicrobial peptide resistance, suggesting that other Bcr1 target genes are likely responsible for antimicrobial peptide resistance. Collectively, these results demonstrate that Bcr1 functions downstream of Ssd1 to govern antimicrobial peptide resistance by maintaining mitochondrial energetics and reducing membrane permeabilization. PMID:23314964

  10. Computational resources and tools for antimicrobial peptides.

    PubMed

    Liu, Shicai; Fan, Linlin; Sun, Jian; Lao, Xingzhen; Zheng, Heng

    2017-01-01

    Antimicrobial peptides (AMPs), as evolutionarily conserved components of innate immune system, protect against pathogens including bacteria, fungi, viruses, and parasites. In general, AMPs are relatively small peptides (<10 kDa) with cationic nature and amphipathic structure and have modes of action different from traditional antibiotics. Up to now, there are more than 19 000 AMPs that have been reported, including those isolated from nature sources or by synthesis. They have been considered to be promising substitutes of conventional antibiotics in the quest to address the increasing occurrence of antibiotic resistance. However, most AMPs have modest direct antimicrobial activity, and their mechanisms of action, as well as their structure-activity relationships, are still poorly understood. Computational strategies are invaluable assets to provide insight into the activity of AMPs and thus exploit their potential as a new generation of antimicrobials. This article reviews the advances of AMP databases and computational tools for the prediction and design of new active AMPs. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd.

  11. Antimicrobial peptides: a review of how peptide structure impacts antimicrobial activity

    NASA Astrophysics Data System (ADS)

    Soares, Jason W.; Mello, Charlene M.

    2004-03-01

    Antimicrobial peptides (AMPs) have been discovered in insects, mammals, reptiles, and plants to protect against microbial infection. Many of these peptides have been isolated and studied exhaustively to decipher the molecular mechanisms that impart protection against infectious bacteria, fungi, and viruses. Unfortunately, the molecular mechanisms are still being debated within the scientific community but valuable clues have been obtained through structure/function relationship studies1. Biophysical studies have revealed that cecropins, isolated from insects and pigs, exhibit random structure in solution but undergo a conformational change to an amphipathic α-helix upon interaction with a membrane surface2. The lack of secondary structure in solution results in an extremely durable peptide able to survive exposure to high temperatures, organic solvents and incorporation into fibers and films without compromising antibacterial activity. Studies to better understand the antimicrobial action of cecropins and other AMPs have provided insight into the importance of peptide sequence and structure in antimicrobial activities. Therefore, enhancing our knowledge of how peptide structure imparts function may result in customized peptide sequences tailored for specific applications such as targeted cell delivery systems, novel antibiotics and food preservation additives. This review will summarize the current state of knowledge with respect to cell binding and antimicrobial activity of AMPs focusing primarily upon cecropins.

  12. Haemophilus ducreyi is resistant to human antimicrobial peptides.

    PubMed

    Mount, Kristy L B; Townsend, Carisa A; Bauer, Margaret E

    2007-09-01

    We examined the susceptibility of Haemophilus ducreyi to antimicrobial peptides likely to be encountered in vivo during human infection. H. ducreyi was significantly more resistant than Escherichia coli to the bactericidal effects of all peptides tested. Class I and II H. ducreyi strains exhibited similar levels of resistance to antimicrobial peptides.

  13. Two families of antimicrobial peptides from wasp (Vespa magnifica) venom.

    PubMed

    Xu, Xueqing; Li, Jianxu; Lu, Qiuming; Yang, Hailong; Zhang, Yungong; Lai, Ren

    2006-02-01

    The hornet possesses highly toxic venom, which is rich in toxin, enzymes and biologically active peptides. Many bioactive substances were identified from wasp venom. Two families of antimicrobial peptides were purified and characterized from the venom of the wasp, Vespamagnifica (Smith). The primary structures of these peptides are homologous to those of chemotactic peptides and mastoparans isolated from other vespid venoms. They also share similarity to temporins which are amphibian antimicrobial peptides identified from the skin of the frog, Ranaboylii. These peptides show antimicrobial activities against bacteria and fungi. However, they show little hemolytic activity against human blood red cells.

  14. Cloning, phenotypic expression, and DNA sequence of the gene for lactacin F, an antimicrobial peptide produced by Lactobacillus spp.

    PubMed Central

    Muriana, P M; Klaenhammer, T R

    1991-01-01

    Lactacin F is a heat-stable bacteriocin produced by Lactobacillus acidophilus 11088. A 63-mer oligonucleotide probe deduced from the N-terminal lactacin F amino acid sequence was used to clone the putative laf structural gene from plasmid DNA of a lactacin F-producing transconjugant, L. acidophilus T143. One clone, NCK360, harbored a recombinant plasmid, pTRK160, which contained a 2.2-kb EcoRI fragment of the size expected from hybridization experiments. An Escherichia coli-L. acidophilus shuttle vector was constructed, and a subclone (pTRK162) containing the 2.2-kb EcoRI fragment was introduced by electroporation into two lactacin F-negative strains, L. acidophilus 89 and 88-C. Lactobacillus transformants containing pTRK162 expressed lactacin F activity and immunity. Bacteriocin produced by the transformants exhibited an inhibitory spectrum and heat stability identical to those of the wild-type bacteriocin. An 873-bp region of the 2.2-kb fragment was sequenced by using a 20-mer degenerate lactacin F-specific primer to initiate sequencing from within the lactacin F structural gene. Analysis of the resulting sequence identified an open reading frame which could encode a protein of 75 amino acids. The 25 N-terminal amino acids for lactacin F were identified within the open reading frame along with an N-terminal extension, possibly a signal sequence. The lactacin F N-terminal sequence, through the remainder of the open reading frame (57 amino acids; 6.3 kDa), correlated extremely well with composition analyses of purified lactacin F which also predicted a size of 51 to 56 amino acid residues. Molecular characterization of lactacin F identified a small hydrophobic peptide that may be representative of a common bacteriocin class in lactic acid bacteria. Images PMID:1900281

  15. Avian Antimicrobial Host Defense Peptides: From Biology to Therapeutic Applications

    PubMed Central

    Zhang, Guolong; Sunkara, Lakshmi T.

    2014-01-01

    Host defense peptides (HDPs) are an important first line of defense with antimicrobial and immunomoduatory properties. Because they act on the microbial membranes or host immune cells, HDPs pose a low risk of triggering microbial resistance and therefore, are being actively investigated as a novel class of antimicrobials and vaccine adjuvants. Cathelicidins and β-defensins are two major families of HDPs in avian species. More than a dozen HDPs exist in birds, with the genes in each HDP family clustered in a single chromosomal segment, apparently as a result of gene duplication and diversification. In contrast to their mammalian counterparts that adopt various spatial conformations, mature avian cathelicidins are mostly α-helical. Avian β-defensins, on the other hand, adopt triple-stranded β-sheet structures similar to their mammalian relatives. Besides classical β-defensins, a group of avian-specific β-defensin-related peptides, namely ovodefensins, exist with a different six-cysteine motif. Like their mammalian counterparts, avian cathelicidins and defensins are derived from either myeloid or epithelial origin expressed in a majority of tissues with broad-spectrum antibacterial and immune regulatory activities. Structure-function relationship studies with several avian HDPs have led to identification of the peptide analogs with potential for use as antimicrobials and vaccine adjuvants. Dietary modulation of endogenous HDP synthesis has also emerged as a promising alternative approach to disease control and prevention in chickens. PMID:24583933

  16. Antimicrobial peptide precursor structures suggest effective production strategies.

    PubMed

    Vassilevski, Alexander A; Kozlov, Sergey A; Grishin, Eugene V

    2008-01-01

    Antimicrobial peptides (AMPs) constitute a diverse group of compounds that serve a common goal that is host organism defense from infection. Due to their antimicrobial properties, these molecules attract practical interest as potential antibiotics for medical and veterinary use as well as enhancers of plant disease resistance for agriculture. Broad AMP utilization is restricted by the expensiveness of their production using conventional chemical synthesis. For this reason, a number of chimeric genes have been developed for recombinant AMP production in prokaryotes. However, recombinant peptide instability and/or high toxicity to host cells dramatically reduce the yields. In this paper, we review patented strategies of fusion protein design for AMP production. In several cases, the proposed strategies clearly mimic the organization of natural AMP precursor proteins. We describe the main principals of natural AMP precursor organization and fusion constructs adopted and/or artificially designed by man.

  17. Identification of antimicrobial peptides by using eigenvectors.

    PubMed

    Polanco, Carlos

    2016-01-01

    Antibacterial peptides are subject to broad research due to their potential application and the benefit they can provide for a wide range of diseases. In this work, a mathematical-computational method, called the Polarity Vector Method, is introduced that has a high discriminative level (>70%) to identify peptides associated with Gram (-) bacteria, Gram (+) bacteria, cancer cells, fungi, insects, mammalian cells, parasites, and viruses, taken from the Antimicrobial Peptides Database. This supervised method uses only eigenvectors from the incident polar matrix of the group studied. It was verified with a comparative study with another extensively verified method developed previously by our team, the Polarity Index Method. The number of positive hits of both methods was up to 98% in all the tests conducted.

  18. Peptides with Dual Antimicrobial and Anticancer Activities

    PubMed Central

    Felício, Mário R.; Silva, Osmar N.; Gonçalves, Sônia; Santos, Nuno C.; Franco, Octávio L.

    2017-01-01

    In recent years, the number of people suffering from cancer and multi-resistant infections has increased, such that both diseases are already seen as current and future major causes of death. Moreover, chronic infections are one of the main causes of cancer, due to the instability in the immune system that allows cancer cells to proliferate. Likewise, the physical debility associated with cancer or with anticancer therapy itself often paves the way for opportunistic infections. It is urgent to develop new therapeutic methods, with higher efficiency and lower side effects. Antimicrobial peptides (AMPs) are found in the innate immune system of a wide range of organisms. Identified as the most promising alternative to conventional molecules used nowadays against infections, some of them have been shown to have dual activity, both as antimicrobial and anticancer peptides (ACPs). Highly cationic and amphipathic, they have demonstrated efficacy against both conditions, with the number of nature-driven or synthetically designed peptides increasing year by year. With similar properties, AMPs that can also act as ACPs are viewed as future chemotherapeutic drugs, with the advantage of low propensity to resistance, which started this paradigm in the pharmaceutical market. These peptides have already been described as molecules presenting killing mechanisms at the membrane level, but also acting toward intracellular targets, which increases their success compartively to one-target specific drugs. This review will approach the desirable characteristics of small peptides that demonstrated dual activity against microbial infections and cancer, as well as the peptides engaged in clinical trials. PMID:28271058

  19. A novel class of antimicrobial peptides from the scorpion Heterometrus spinifer.

    PubMed

    Nie, Yao; Zeng, Xian-Chun; Yang, Ye; Luo, Feng; Luo, Xuesong; Wu, Shifen; Zhang, Lei; Zhou, Jianping

    2012-12-01

    The venom peptides from the scorpion Heterometrus spinifer have been poorly characterized so far. Here, we identified a novel class of antimicrobial peptides from the venom gland of H. spinifer, which were referred to as HsAp, HsAp2, HsAp3 and HsAp4, respectively. Each of the four peptides consists of 29 amino acid residues, and is cationic and weakly amphipathic. They display no significant homology to any other known peptides, and thus represent a new family of venom peptides from scorpions. Antimicrobial assay showed that HsAp is able to inhibit the growth of both Gram-negative and Gram-positive bacteria with the MIC values of 11.8-51.2 μM. HsAp is also able to inhibit the growth of the tested fungus. Genomic analysis indicated that the genes of all the four peptides are intronless. Our studies expand the families of antimicrobial peptides from scorpions.

  20. A novel Toll like receptor with two TIR domains (HcToll-2) is involved in regulation of antimicrobial peptide gene expression of Hyriopsis cumingii.

    PubMed

    Ren, Qian; Lan, Jiang-Feng; Zhong, Xue; Song, Xiao-Jun; Ma, Fei; Hui, Kai-Min; Wang, Wen; Yu, Xiao-Qiang; Wang, Jin-Xing

    2014-07-01

    Animal Toll-like receptors (TLRs) are involved in innate immunity. Toll proteins are generally transmembrane proteins. In this study, an atypical Toll-like receptor (HcToll-2) was identified from the triangle-shell pearl mussel Hyriopsis cumingii, which belongs to phylum Mollusca. Unlike the typical Toll like receptors with extracellular leucine-rich repeats (LRRs), transmembrane, and intracellular Toll/interleukin-1 receptor (TIR) domains, HcToll-2 has two homologous TIR domains located at the C-terminal (designated as HcTIR1 and HcTIR2) and lacks a transmembrane domain. Phylogenetic analysis showed that HcTIR1 was clustered with TIR of sea anemone Toll, and HcTIR2 was clustered with TIR of Drosophila Toll. HcToll-2 mRNA could be detected in the hepatopancreas and was upregulated after challenge with Escherichia coli and Staphylococcus aureus. Recombinant HcLRR protein with GST tag could bind to bacteria and also to LPS and PGN. Over-expression of both HcTIR1 and HcTIR2 induced drosomycin genes in Drosophila S2 cells. RNAi analysis showed that HcToll-2 was required for the expression of theromacin, which is a cysteine-rich antimicrobial peptide (AMP) gene. This research is the first report of an atypical Toll-like receptor HcToll-2 involved in antibacterial immunity through induction of AMP expression. Copyright © 2014 Elsevier Ltd. All rights reserved.

  1. The Erwinia amylovora PhoPQ system is involved in resistance to antimicrobial peptide and suppresses gene expression of two novel type III secretion systems.

    PubMed

    Nakka, Sridevi; Qi, Mingsheng; Zhao, Youfu

    2010-10-20

    The PhoPQ system is a pleiotropic two-component signal transduction system that controls many pathogenic properties in several mammalian and plant pathogens. Three different cues have been demonstrated to activate the PhoPQ system including a mild acidic pH, antimicrobial peptides, and low Mg(2+). In this study, our results showed that phoPQ mutants were more resistant to strong acidic conditions (pH 4.5 or 5) than that of the wild-type (WT) strain, suggesting that this system in Erwinia amylovora may negatively regulate acid resistance gene expression. Furthermore, the PhoPQ system negatively regulated gene expression of two novel type III secretion systems in E. amylovora. These results are in contrast to those reported for the PhoPQ system in Salmonella and Xanthomonas, where it positively regulates type III secretion system and acid resistance. In addition, survival of phoPQ mutants was about 10-fold lower than that of WT when treated with cecropin A at pH 5.5, suggesting that the PhoPQ system renders the pathogen more resistant to cecropin A.

  2. Specific expression of antimicrobial peptide and HSP70 genes in response to heat-shock and several bacterial challenges in mussels.

    PubMed

    Cellura, Cinzia; Toubiana, Mylène; Parrinello, Nicolò; Roch, Philippe

    2007-04-01

    Defensin, mytilin and myticin are antimicrobial peptides (AMP) involved in mussel innate immunity. Their in vitro antibacterial activity is different according to the targeted bacterial species. To determine if this specificity is correlated to different regulations of gene expressions, adult mussels were challenged in vivo with either Vibrio splendidus LGP32, Vibrio anguillarum, Micrococcus lysodeikticus or by heat shock. RNAs were isolated from circulating hemocytes and AMP mRNAs were quantified by Q-PCR using 28S rRNA as housekeeping gene. In addition, HSP70 gene expression was also quantified as representing non-specific response to stress. In naïve mussels, the three AMP mRNAs were present in dramatically different quantities. Compared to defensin, myticin was expressed 300-fold more and mytilin 30-fold more. HSP70 was found expressed 80-fold more than defensin. AMP genes were differentially regulated according to the challenging bacteria, M. lysodeikticus being the only one inducing down-regulation. Such variations in mRNA quantities were observed immediately after challenging, lasting less than 24h. Only V. anguillarum effect was observed later, between 12h and 3 days post-challenge. Compared to their background expression in naïve mussels, the major effect of V. splendidus was the decrease of mytilin and myticin mRNAs, V. anguillarum mainly increased both mytilin and HSP70 mRNAs, whereas M. lysodeikticus almost suppressed defensin mRNA. As expected, heat shock increased HSP70 mRNA, but also myticin mRNA. Consequently, AMP genes responded specifically to the challenges, confirming that at least some of the innate immune mechanisms are specifically orientated.

  3. Cationic Antimicrobial Peptide Resistance in Neisseria meningitidis

    PubMed Central

    Tzeng, Yih-Ling; Ambrose, Karita D.; Zughaier, Susu; Zhou, Xiaoliu; Miller, Yoon K.; Shafer, William M.; Stephens, David S.

    2005-01-01

    Cationic antimicrobial peptides (CAMPs) are important components of the innate host defense system against microbial infections and microbial products. However, the human pathogen Neisseria meningitidis is intrinsically highly resistant to CAMPs, such as polymyxin B (PxB) (MIC ≥ 512 μg/ml). To ascertain the mechanisms by which meningococci resist PxB, mutants that displayed increased sensitivity (≥4-fold) to PxB were identified from a library of mariner transposon mutants generated in a meningococcal strain, NMB. Surprisingly, more than half of the initial PxB-sensitive mutants had insertions within the mtrCDE operon, which encodes proteins forming a multidrug efflux pump. Additional PxB-sensitive mariner mutants were identified from a second round of transposon mutagenesis performed in an mtr efflux pump-deficient background. Further, a mutation in lptA, the phosphoethanolamine (PEA) transferase responsible for modification of the lipid A head groups, was identified to cause the highest sensitivity to PxB. Mutations within the mtrD or lptA genes also increased meningococcal susceptibility to two structurally unrelated CAMPs, human LL-37 and protegrin-1. Consistently, PxB neutralized inflammatory responses elicited by the lptA mutant lipooligosaccharide more efficiently than those induced by wild-type lipooligosaccharide. mariner mutants with increased resistance to PxB were also identified in NMB background and found to contain insertions within the pilMNOPQ operon involved in pilin biogenesis. Taken together, these data indicated that meningococci utilize multiple mechanisms including the action of the MtrC-MtrD-MtrE efflux pump and lipid A modification as well as the type IV pilin secretion system to modulate levels of CAMP resistance. The modification of meningococcal lipid A head groups with PEA also prevents neutralization of the biological effects of endotoxin by CAMP. PMID:16030233

  4. Resistance to Antimicrobial Peptides in Vibrios

    PubMed Central

    Destoumieux-Garzón, Delphine; Duperthuy, Marylise; Vanhove, Audrey Sophie; Schmitt, Paulina; Wai, Sun Nyunt

    2014-01-01

    Vibrios are associated with a broad diversity of hosts that produce antimicrobial peptides (AMPs) as part of their defense against microbial infections. In particular, vibrios colonize epithelia, which function as protective barriers and express AMPs as a first line of chemical defense against pathogens. Recent studies have shown they can also colonize phagocytes, key components of the animal immune system. Phagocytes infiltrate infected tissues and use AMPs to kill the phagocytosed microorganisms intracellularly, or deliver their antimicrobial content extracellularly to circumvent tissue infection. We review here the mechanisms by which vibrios have evolved the capacity to evade or resist the potent antimicrobial defenses of the immune cells or tissues they colonize. Among their strategies to resist killing by AMPs, primarily vibrios use membrane remodeling mechanisms. In particular, some highly resistant strains substitute hexaacylated Lipid A with a diglycine residue to reduce their negative surface charge, thereby lowering their electrostatic interactions with cationic AMPs. As a response to envelope stress, which can be induced by membrane-active agents including AMPs, vibrios also release outer membrane vesicles to create a protective membranous shield that traps extracellular AMPs and prevents interaction of the peptides with their own membranes. Finally, once AMPs have breached the bacterial membrane barriers, vibrios use RND efflux pumps, similar to those of other species, to transport AMPs out of their cytoplasmic space. PMID:27025756

  5. The shrimp IKK-NF-κB signaling pathway regulates antimicrobial peptide expression and may be subverted by white spot syndrome virus to facilitate viral gene expression.

    PubMed

    Wang, Pei-Hui; Gu, Zhi-Hua; Wan, Ding-Hui; Liu, Bo-Du; Huang, Xian-De; Weng, Shao-Ping; Yu, Xiao-Qiang; He, Jian-Guo

    2013-09-01

    The IκB kinases IKKα and IKKβ and the IKK-related kinases TANK-binding kinase 1 (TBK1) and IKKε are the master regulators of the NF-κB signaling pathway. Although this pathway has been extensively studied in mammals, less attention has been paid in crustaceans, which have significant economic value. Here, we report the cloning and functional studies of two IKK homologs, LvIKKβ and LvIKKε, from Pacific white shrimp, Litopenaeus vannamei. LvIKKβ and LvIKKε mRNAs are widely expressed in different tissues and are responsive to white spot syndrome virus (WSSV) infection. When overexpressed in Drosophila S2 cells, LvIKKβ but not LvIKKε activates the promoters of NF-κB pathway-controlled antimicrobial peptide genes (AMPs), such as the Penaeidins (PENs). In HEK 293T cells, both LvIKKβ and LvIKKε activate an NF-κB reporter. The silencing of LvIKKβ or LvIKKε using double-stranded RNA (dsRNA)-mediated RNA interference (RNAi) decreases the expression of L. vannamei AMPs, including PENs, lysozyme and crustins. Intriguingly, LvIKKβ- or LvIKKε-silenced L. vannamei are resistant to WSSV infection. We hypothesized that successful infection with WSSV requires the activation of the IKK-NF-κB signaling pathway to modulate viral gene expression. We constructed luciferase reporters for 147 WSSV genes. By screening, we found that the WSV051, WSV059, WSV069, WSV083, WSV090, WSV107, WSV244, WSV303, WSV371 and WSV445 promoters can be activated by LvIKKβ or LvIKKε in Drosophila S2 cells. Taken together, our results reveal that LvIKKβ and LvIKKε may participate in the regulation of shrimp AMPs and that WSSV may subvert the L. vannamei IKK-NF-κB signaling pathway to facilitate viral gene expression.

  6. Antiendotoxin activity of cationic peptide antimicrobial agents.

    PubMed Central

    Gough, M; Hancock, R E; Kelly, N M

    1996-01-01

    The endotoxin from gram-negative bacteria consists of a molecule lipopolysaccharide (LPS) which can be shed by bacteria during antimicrobial therapy. A resulting syndrome, endotoxic shock, is a leading cause of death in the developed world. Thus, there is great interest in the development of antimicrobial agents which can reverse rather than promote sepsis, especially given the recent disappointing clinical performance of antiendotoxin therapies. We describe here two small cationic peptides, MBI-27 and MBI-28, which have both antiendotoxic and antibacterial activities in vitro and in vivo in animal models. We had previously demonstrated that these peptides bind to LPS with an affinity equivalent to that of polymyxin B. Consistent with this, the peptides blocked the ability of LPS and intact cells to induce the endotoxic shock mediator, tumor necrosis factor (TNF), upon incubation with the RAW 264.7 murine macrophage cell line. MBI-28 was equivalent to polymyxin B in its ability to block LPS induction of TNF by this cell line, even when added 60 min after the TNF stimulus. Furthermore, MBI-28 offered significant protection in a galactosamine-sensitized mouse model of lethal endotoxic shock. This protection correlated with the ability of MBI-28 to reduce LPS-induced circulating TNF by nearly 90% in this mouse model. Both MBI-27 and MBI-28 demonstrated antibacterial activity against gram-negative bacteria in vitro and in vivo against Pseudomonas aeruginosa infections in neutropenic mice. PMID:8945527

  7. Antiendotoxin activity of cationic peptide antimicrobial agents.

    PubMed

    Gough, M; Hancock, R E; Kelly, N M

    1996-12-01

    The endotoxin from gram-negative bacteria consists of a molecule lipopolysaccharide (LPS) which can be shed by bacteria during antimicrobial therapy. A resulting syndrome, endotoxic shock, is a leading cause of death in the developed world. Thus, there is great interest in the development of antimicrobial agents which can reverse rather than promote sepsis, especially given the recent disappointing clinical performance of antiendotoxin therapies. We describe here two small cationic peptides, MBI-27 and MBI-28, which have both antiendotoxic and antibacterial activities in vitro and in vivo in animal models. We had previously demonstrated that these peptides bind to LPS with an affinity equivalent to that of polymyxin B. Consistent with this, the peptides blocked the ability of LPS and intact cells to induce the endotoxic shock mediator, tumor necrosis factor (TNF), upon incubation with the RAW 264.7 murine macrophage cell line. MBI-28 was equivalent to polymyxin B in its ability to block LPS induction of TNF by this cell line, even when added 60 min after the TNF stimulus. Furthermore, MBI-28 offered significant protection in a galactosamine-sensitized mouse model of lethal endotoxic shock. This protection correlated with the ability of MBI-28 to reduce LPS-induced circulating TNF by nearly 90% in this mouse model. Both MBI-27 and MBI-28 demonstrated antibacterial activity against gram-negative bacteria in vitro and in vivo against Pseudomonas aeruginosa infections in neutropenic mice.

  8. Antimicrobial peptides as potential new antifungals.

    PubMed

    Müller, F M; Lyman, C A; Walsh, T J

    1999-01-01

    Ribosomally synthesized natural antimicrobial peptides (AP) and their synthetic derivatives are small, cationic, amphipathic molecules of 12-50 amino acids with unusually broad activity spectra. These peptides kill microorganisms by a common mechanism, which involves binding to the lipid bilayer of biological membranes, forming pores, and ultimately followed by cell lysis. Several AP from mammals, amphibians, insects, plants and their synthetic derivatives demonstrate promising in vitro activity against various pathogenic fungi including azole-resistant Candida albicans strains. In addition to their antimicrobial activity, some AP such as lactoferrin, interact with a variety of host cells and can increase the activity of natural killer and lymphokine activated killer cells. Pretreatment of polymorphonuclear neutrophil leukocytes (PMN) or monocytes with these AP also may upregulate superoxide release. AP as potential new antifungal agents offer some advantages, such as rapid killing of pathogenic fungi and the difficulty to raise mutants resistant to these peptides. AP are limited by their nonselective toxicity, stability, immunogenicity and their costs of production. Potential clinical applications of AP in the future have to be further explored in preclinical and clinical studies to assess their impact as a new class of antifungals.

  9. Cationic Hydrophobic Peptides with Antimicrobial Activity

    PubMed Central

    Stark, Margareta; Liu, Li-Ping; Deber, Charles M.

    2002-01-01

    The MICs of cationic, hydrophobic peptides of the prototypic sequence KKAAAXAAAAAXAAWAAXAAAKKKK-amide (where X is one of the 20 commonly occurring amino acids) are in a low micromolar range for a panel of gram-negative and gram-positive bacteria, with no or low hemolytic activity against human and rabbit erythrocytes. The peptides are active only when the average segmental hydrophobicity of the 19-residue core is above an experimentally determined threshold value (where X is Phe, Trp, Leu, Ile, Met, Val, Cys, or Ala). Antimicrobial activity could be increased by using peptides that were truncated from the prototype length to 11 core residues, with X being Phe and with 6 Lys residues grouped at the N terminus. We propose a mechanism for the interaction between these peptides and bacterial membranes similar to the “carpet model,” wherein the Lys residues interact with the anionic phospholipid head groups in the bacterial membrane surface and the hydrophobic core portion of the peptide is then able to interact with the lipid bilayer, causing disruption of the bacterial membrane. PMID:12384369

  10. The Antimicrobial and Antiviral Applications of Cell-Penetrating Peptides.

    PubMed

    Pärn, Kalle; Eriste, Elo; Langel, Ülo

    2015-01-01

    Over the past two decades, cell-penetrating peptides (CPPs) have become increasingly popular both in research and in application. There have been numerous studies on the physiochemical characteristics and behavior of CPPs in various environments; likewise, the mechanisms of entry and delivery capabilities of these peptides have also been extensively researched. Besides the fundamental issues, there is an enormous interest in the delivery capabilities of the peptides as the family of CPPs is a promising and mostly non-toxic delivery vector candidate for numerous medical applications such as gene silencing, transgene delivery, and splice correction. Lately, however, there has been an emerging field of study besides the high-profile gene therapy applications-the use of peptides and CPPs to combat various infections caused by harmful bacteria, fungi, and viruses.In this chapter, we aim to provide a short overview of the history and properties of CPPs which is followed by more thorough descriptions of antimicrobial and antiviral peptides. To achieve this, we analyze the origin of such peptides, give an overview of the mechanisms of action and discuss the various practical applications which are ongoing or have been suggested based on research.

  11. Anti-antimicrobial peptides: folding-mediated host defense antagonists.

    PubMed

    Ryan, Lloyd; Lamarre, Baptiste; Diu, Ting; Ravi, Jascindra; Judge, Peter J; Temple, Adam; Carr, Matthew; Cerasoli, Eleonora; Su, Bo; Jenkinson, Howard F; Martyna, Glenn; Crain, Jason; Watts, Anthony; Ryadnov, Maxim G

    2013-07-12

    Antimicrobial or host defense peptides are innate immune regulators found in all multicellular organisms. Many of them fold into membrane-bound α-helices and function by causing cell wall disruption in microorganisms. Herein we probe the possibility and functional implications of antimicrobial antagonism mediated by complementary coiled-coil interactions between antimicrobial peptides and de novo designed antagonists: anti-antimicrobial peptides. Using sequences from native helical families such as cathelicidins, cecropins, and magainins we demonstrate that designed antagonists can co-fold with antimicrobial peptides into functionally inert helical oligomers. The properties and function of the resulting assemblies were studied in solution, membrane environments, and in bacterial culture by a combination of chiroptical and solid-state NMR spectroscopies, microscopy, bioassays, and molecular dynamics simulations. The findings offer a molecular rationale for anti-antimicrobial responses with potential implications for antimicrobial resistance.

  12. Antimicrobial peptides in the centipede Scolopendra subspinipes mutilans.

    PubMed

    Yoo, Won Gi; Lee, Joon Ha; Shin, Younhee; Shim, Jae-Young; Jung, Myunghee; Kang, Byeong-Chul; Oh, Jaedon; Seong, Jiyeon; Lee, Hak Kyo; Kong, Hong Sik; Song, Ki-Duk; Yun, Eun-Young; Kim, In-Woo; Kwon, Young-Nam; Lee, Dong Gun; Hwang, Ui-Wook; Park, Junhyung; Hwang, Jae Sam

    2014-06-01

    The centipede Scolopendra subspinipes mutilans is an environmentally beneficial and medically important arthropod species. Although this species is increasingly applied as a reliable source of new antimicrobial peptides, the transcriptome of this species is a prerequisite for more rational selection of antimicrobial peptides. In this report, we isolated total RNA from the whole body of adult centipedes, S. subspinipes mutilans, that were nonimmunized and immunized against Escherichia coli, and we generated a total of 77,063 pooled contigs and singletons using high-throughput sequencing. To screen putative antimicrobial peptides, in silico analyses of the S. subspinipes mutilans transcriptome were performed based on the physicochemical evidence of length, charge, isoelectric point, and in vitro and in vivo aggregation scores together with the existence of continuous antimicrobial peptide stretches. Moreover, we excluded some transcripts that showed similarity with both previously known antimicrobial peptides and the human proteome, had a proteolytic cleavage site, and had downregulated expression compared with the nonimmunized sample. As a result, we selected 17 transcripts and tested their antimicrobial activity with a radial diffusion assay. Among them, ten synthetic peptides experimentally showed antimicrobial activity against microbes and no toxicity to mouse erythrocytes. Our results provide not only a useful set of antimicrobial peptide candidates and an efficient strategy for novel antimicrobial peptide development but also the transcriptome data of a big centipede as a valuable resource.

  13. Fatty acid conjugation enhances the activities of antimicrobial peptides.

    PubMed

    Li, Zhining; Yuan, Penghui; Xing, Meng; He, Zhumei; Dong, Chuanfu; Cao, Yongchang; Liu, Qiuyun

    2013-04-01

    Antimicrobial peptides are small molecules that play a crucial role in innate immunity in multi-cellular organisms, and usually expressed and secreted constantly at basal levels to prevent infection, but local production can be augmented upon an infection. The clock is ticking as rising antibiotic abuse has led to the emergence of many drug resistance bacteria. Due to their broad spectrum antibiotic and antifungal activities as well as anti-viral and anti-tumor activities, efforts are being made to develop antimicrobial peptides into future microbial agents. This article describes some of the recent patents on antimicrobial peptides with fatty acid conjugation. Potency and selectivity of antimicrobial peptide can be modulated with fatty acid tails of variable length. Interaction between membranes and antimicrobial peptides was affected by fatty acid conjugation. At concentrations above the critical miscelle concentration (CMC), propensity of solution selfassembly hampered binding of the peptide to cell membranes. Overall, fatty acid conjugation has enhanced the activities of antimicrobial peptides, and occasionally it rendered inactive antimicrobial peptides to be bioactive. Antimicrobial peptides can not only be used as medicine but also as food additives.

  14. Plant Antimicrobial Peptides as Potential Anticancer Agents

    PubMed Central

    Guzmán-Rodríguez, Jaquelina Julia; López-Gómez, Rodolfo

    2015-01-01

    Antimicrobial peptides (AMPs) are part of the innate immune defense mechanism of many organisms and are promising candidates to treat infections caused by pathogenic bacteria to animals and humans. AMPs also display anticancer activities because of their ability to inactivate a wide range of cancer cells. Cancer remains a cause of high morbidity and mortality worldwide. Therefore, the development of methods for its control is desirable. Attractive alternatives include plant AMP thionins, defensins, and cyclotides, which have anticancer activities. Here, we provide an overview of plant AMPs anticancer activities, with an emphasis on their mode of action, their selectivity, and their efficacy. PMID:25815333

  15. Membrane Disruption Mechanism by Antimicrobial Peptides

    NASA Astrophysics Data System (ADS)

    Lee, Ka Yee C.

    2011-03-01

    Antimicrobial peptides (AMPs) are a class of small (less than100 residues) host defense peptides that induce selective membrane lytic activity against microbes. To understand the mechanism of membrane disruption by AMPs, we investigated, via atomic force microscopy, topological changes in supported phospholipid bilayers induced by protegrin-1 (PG-1). We have observed that PG-1 induces structural transformations, progressing from fingerlike instabilities at bilayer edges, to the formation of sievelike nanoporous structures and finally to a network of stripelike structures in a zwitterionic dimyristoylphosphatidylcholine (DMPC) model membrane in buffer, with increasing PG-1 concentration. Our results suggest that AMPs act to lower the interfacial energy of the bilayer in a way similar to detergents. By varying the lipid composition, temperature and using AMPs with different secondary structures, we are able to identify factors other than electrostatics that are important for the efficacy of AMPs.

  16. Co-regulation of Salmonella enterica genes required for virulence and resistance to antimicrobial peptides by SlyA and PhoP/PhoQ.

    PubMed

    Navarre, William Wiley; Halsey, Thomas A; Walthers, Don; Frye, Jonathan; McClelland, Michael; Potter, Jennifer L; Kenney, Linda J; Gunn, John S; Fang, Ferric C; Libby, Stephen J

    2005-04-01

    Analysis of the transcriptome of slyA mutant Salmonella enterica serovar Typhimurium revealed that many SlyA-dependent genes, including pagC, pagD, ugtL, mig-14, virK, phoN, pgtE, pipB2, sopD2, pagJ and pagK, are also controlled by the PhoP/PhoQ regulatory system. Many SlyA- and PhoP/PhoQ-co-regulated genes have functions associated with the bacterial envelope, and some have been directly implicated in virulence and resistance to antimicrobial peptides. Purified His-tagged SlyA binds to the pagC and mig-14 promoters in regions homologous to a previously proposed 'SlyA-box'. The pagC promoter lacks a consensus PhoP binding site and does not bind PhoP in vitro, suggesting that the effect of PhoP on pagC transcription is indirect. Stimulation of pagC expression by PhoP requires SlyA. Levels of SlyA protein and mRNA are not significantly changed under low-magnesium PhoP-inducing conditions in which pagC expression is profoundly elevated, however, indicating that the PhoP/PhoQ system does not activate pagC expression by altering SlyA protein concentration. Models are proposed in which PhoP may control SlyA activity via a soluble ligand or SlyA may function as an anti-repressor to allow PhoP activation. The absence of almost all SlyA-activated genes from the Escherichia coli K12 genome suggests that the functional linkage between the SlyA and PhoP/PhoQ regulatory systems arose as Salmonella evolved its distinctive pathogenic lifestyle.

  17. Peptidomics and genomics analysis of novel antimicrobial peptides from the frog, Rana nigrovittata.

    PubMed

    Ma, Yufang; Liu, Cunbao; Liu, Xiuhong; Wu, Jing; Yang, Hailong; Wang, Yipeng; Li, Jianxu; Yu, Haining; Lai, Ren

    2010-01-01

    Much attention has been paid on amphibian peptides for their wide-ranging pharmacological properties, clinical potential, and gene-encoded origin. More than 300 antimicrobial peptides (AMPs) from amphibians have been studied. Peptidomics and genomics analysis combined with functional test including microorganism killing, histamine-releasing, and mast cell degranulation was used to investigate antimicrobial peptide diversity. Thirty-four novel AMPs from skin secretions of Rana nigrovittata were identified in current work, and they belong to 9 families, including 6 novel families. Other three families are classified into rugosin, gaegurin, and temporin family of amphibian AMP, respectively. These AMPs share highly conserved preproregions including signal peptides and spacer acidic peptides, while greatly diversified on mature peptides structures. In this work, peptidomics combined with genomics analysis was confirmed to be an effective way to identify amphibian AMPs, especially novel families. Some AMPs reported here will provide leading molecules for designing novel antimicrobial agents.

  18. DBAASP: database of antimicrobial activity and structure of peptides.

    PubMed

    Gogoladze, Giorgi; Grigolava, Maia; Vishnepolsky, Boris; Chubinidze, Mindia; Duroux, Patrice; Lefranc, Marie-Paule; Pirtskhalava, Malak

    2014-08-01

    The Database of Antimicrobial Activity and Structure of Peptides (DBAASP) is a manually curated database for those peptides for which antimicrobial activity against particular targets has been evaluated experimentally. The database is a depository of complete information on: the chemical structure of peptides; target species; target object of cell; peptide antimicrobial/haemolytic/cytotoxic activities; and experimental conditions at which activities were estimated. The DBAASP search page allows the user to search peptides according to their structural characteristics, complexity type (monomer, dimer and two-peptide), source, synthesis type (ribosomal, nonribosomal and synthetic) and target species. The database prediction algorithm provides a tool for rational design of new antimicrobial peptides. DBAASP is accessible at http://www.biomedicine.org.ge/dbaasp/.

  19. De Novo Transcriptome Analysis and Detection of Antimicrobial Peptides of the American Cockroach Periplaneta americana (Linnaeus)

    PubMed Central

    Subramaniyam, Sathiyamoorthy; Yun, Eun-Young; Kim, Iksoo; Park, Junhyung; Hwang, Jae Sam

    2016-01-01

    Cockroaches are surrogate hosts for microbes that cause many human diseases. In spite of their generally destructive nature, cockroaches have recently been found to harbor potentially beneficial and medically useful substances such as drugs and allergens. However, genomic information for the American cockroach (Periplaneta americana) is currently unavailable; therefore, transcriptome and gene expression profiling is needed as an important resource to better understand the fundamental biological mechanisms of this species, which would be particularly useful for the selection of novel antimicrobial peptides. Thus, we performed de novo transcriptome analysis of P. americana that were or were not immunized with Escherichia coli. Using an Illumina HiSeq sequencer, we generated a total of 9.5 Gb of sequences, which were assembled into 85,984 contigs and functionally annotated using Basic Local Alignment Search Tool (BLAST), Gene Ontology (GO), and Kyoto Encyclopedia of Genes and Genomes (KEGG) database terms. Finally, using an in silico antimicrobial peptide prediction method, 86 antimicrobial peptide candidates were predicted from the transcriptome, and 21 of these peptides were experimentally validated for their antimicrobial activity against yeast and gram positive and -negative bacteria by a radial diffusion assay. Notably, 11 peptides showed strong antimicrobial activities against these organisms and displayed little or no cytotoxic effects in the hemolysis and cell viability assay. This work provides prerequisite baseline data for the identification and development of novel antimicrobial peptides, which is expected to provide a better understanding of the phenomenon of innate immunity in similar species. PMID:27167617

  20. De Novo Transcriptome Analysis and Detection of Antimicrobial Peptides of the American Cockroach Periplaneta americana (Linnaeus).

    PubMed

    Kim, In-Woo; Lee, Joon Ha; Subramaniyam, Sathiyamoorthy; Yun, Eun-Young; Kim, Iksoo; Park, Junhyung; Hwang, Jae Sam

    2016-01-01

    Cockroaches are surrogate hosts for microbes that cause many human diseases. In spite of their generally destructive nature, cockroaches have recently been found to harbor potentially beneficial and medically useful substances such as drugs and allergens. However, genomic information for the American cockroach (Periplaneta americana) is currently unavailable; therefore, transcriptome and gene expression profiling is needed as an important resource to better understand the fundamental biological mechanisms of this species, which would be particularly useful for the selection of novel antimicrobial peptides. Thus, we performed de novo transcriptome analysis of P. americana that were or were not immunized with Escherichia coli. Using an Illumina HiSeq sequencer, we generated a total of 9.5 Gb of sequences, which were assembled into 85,984 contigs and functionally annotated using Basic Local Alignment Search Tool (BLAST), Gene Ontology (GO), and Kyoto Encyclopedia of Genes and Genomes (KEGG) database terms. Finally, using an in silico antimicrobial peptide prediction method, 86 antimicrobial peptide candidates were predicted from the transcriptome, and 21 of these peptides were experimentally validated for their antimicrobial activity against yeast and gram positive and -negative bacteria by a radial diffusion assay. Notably, 11 peptides showed strong antimicrobial activities against these organisms and displayed little or no cytotoxic effects in the hemolysis and cell viability assay. This work provides prerequisite baseline data for the identification and development of novel antimicrobial peptides, which is expected to provide a better understanding of the phenomenon of innate immunity in similar species.

  1. Safety and Efficacy of Antimicrobial Peptides against Naturally Acquired Leishmaniasis

    PubMed Central

    Alberola, J.; Rodríguez, A.; Francino, O.; Roura, X.; Rivas, L.; Andreu, D.

    2004-01-01

    Leishmaniases, which are important causes of morbidity and mortality in humans and dogs, are extremely difficult to treat. Antimicrobial peptides are rarely used as alternative treatments for naturally acquired parasitic diseases. Here we report that the acylated synthetic antimicrobial peptide Oct-CA(1-7)M(2-9) is safe and effective for treating naturally acquired canine leishmaniasis. PMID:14742227

  2. Antimicrobial Peptides in Biomedical Device Manufacturing.

    PubMed

    Riool, Martijn; de Breij, Anna; Drijfhout, Jan W; Nibbering, Peter H; Zaat, Sebastian A J

    2017-01-01

    Over the past decades the use of medical devices, such as catheters, artificial heart valves, prosthetic joints, and other implants, has grown significantly. Despite continuous improvements in device design, surgical procedures, and wound care, biomaterial-associated infections (BAI) are still a major problem in modern medicine. Conventional antibiotic treatment often fails due to the low levels of antibiotic at the site of infection. The presence of biofilms on the biomaterial and/or the multidrug-resistant phenotype of the bacteria further impair the efficacy of antibiotic treatment. Removal of the biomaterial is then the last option to control the infection. Clearly, there is a pressing need for alternative strategies to prevent and treat BAI. Synthetic antimicrobial peptides (AMPs) are considered promising candidates as they are active against a broad spectrum of (antibiotic-resistant) planktonic bacteria and biofilms. Moreover, bacteria are less likely to develop resistance to these rapidly-acting peptides. In this review we highlight the four main strategies, three of which applying AMPs, in biomedical device manufacturing to prevent BAI. The first involves modification of the physicochemical characteristics of the surface of implants. Immobilization of AMPs on surfaces of medical devices with a variety of chemical techniques is essential in the second strategy. The main disadvantage of these two strategies relates to the limited antibacterial effect in the tissue surrounding the implant. This limitation is addressed by the third strategy that releases AMPs from a coating in a controlled fashion. Lastly, AMPs can be integrated in the design and manufacturing of additively manufactured/3D-printed implants, owing to the physicochemical characteristics of the implant material and the versatile manufacturing technologies compatible with antimicrobials incorporation. These novel technologies utilizing AMPs will contribute to development of novel and safe

  3. Immunomodulatory effects of anti-microbial peptides.

    PubMed

    Otvos, Laszlo

    2016-09-01

    Anti-microbial peptides (AMPs) were originally thought to exert protecting actions against bacterial infection by disintegrating bacterial membranes. Upon identification of internal bacterial targets, the view changed and moved toward inhibition of prokaryote-specific biochemical processes. However, the level of none of these activities can explain the robust efficacy of some of these peptides in animal models of systemic and cutaneous infections. A rapidly growing panel of reports suggests that AMPs, now called host-defense peptides (HDPs), act through activating the immune system of the host. This includes recruitment and activation of macrophages and mast cells, inducing chemokine production and altering NF-κB signaling processes. As a result, both pro- and anti-inflammatory responses are elevated together with activation of innate and adaptive immunity mechanisms, wound healing, and apoptosis. HDPs sterilize the systemic circulation and local injury sites significantly more efficiently than pure single-endpoint in vitro microbiological or biochemical data would suggest and actively aid recovering from tissue damage after or even without bacterial infections. However, the multiple and, often opposing, immunomodulatory functions of HDPs require exceptional care in therapeutic considerations.

  4. Antimicrobial Peptides Targeting Gram-Positive Bacteria

    PubMed Central

    Malanovic, Nermina; Lohner, Karl

    2016-01-01

    Antimicrobial peptides (AMPs) have remarkably different structures as well as biological activity profiles, whereupon most of these peptides are supposed to kill bacteria via membrane damage. In order to understand their molecular mechanism and target cell specificity for Gram-positive bacteria, it is essential to consider the architecture of their cell envelopes. Before AMPs can interact with the cytoplasmic membrane of Gram-positive bacteria, they have to traverse the cell wall composed of wall- and lipoteichoic acids and peptidoglycan. While interaction of AMPs with peptidoglycan might rather facilitate penetration, interaction with anionic teichoic acids may act as either a trap for AMPs or a ladder for a route to the cytoplasmic membrane. Interaction with the cytoplasmic membrane frequently leads to lipid segregation affecting membrane domain organization, which affects membrane permeability, inhibits cell division processes or leads to delocalization of essential peripheral membrane proteins. Further, precursors of cell wall components, especially the highly conserved lipid II, are directly targeted by AMPs. Thereby, the peptides do not inhibit peptidoglycan synthesis via binding to proteins like common antibiotics, but form a complex with the precursor molecule, which in addition can promote pore formation and membrane disruption. Thus, the multifaceted mode of actions will make AMPs superior to antibiotics that act only on one specific target. PMID:27657092

  5. Research in practice: Antimicrobial peptides of the skin.

    PubMed

    Gläser, Regine

    2011-09-01

    Antimicrobial peptides represent evolutionary ancient molecules whose importance became evident within the last years. These highly effective peptides protect the skin and other epithelia against infection and form a fast acting "chemical barrier" also regulating the normal flora of the skin and mucosa. In the Department of Dermatology, University Hospital Kiel, various antimicrobial peptides have been discovered, characterized and investigated in healthy persons as well as in different skin diseases. Everyday clinical observations formed the background for several interesting hypotheses and findings.

  6. Genes encoding 4-Cys antimicrobial peptides in wheat Triticum kiharae Dorof. et Migush.: multimodular structural organization, instraspecific variability, distribution and role in defence.

    PubMed

    Utkina, Lyubov L; Andreev, Yaroslav A; Rogozhin, Eugene A; Korostyleva, Tatyana V; Slavokhotova, Anna A; Oparin, Peter B; Vassilevski, Alexander A; Grishin, Eugene V; Egorov, Tsezi A; Odintsova, Tatyana I

    2013-08-01

    A novel family of antifungal peptides was discovered in the wheat Triticum kiharae Dorof. et Migusch. Two members of the family, designated Tk-AMP-X1 and Tk-AMP-X2, were completely sequenced and shown to belong to the α-hairpinin structural family of plant peptides with a characteristic C1XXXC2-X(n)-C3XXXC4 motif. The peptides inhibit the spore germination of several fungal pathogens in vitro. cDNA and gene cloning disclosed unique structure of genes encoding Tk-AMP-X peptides. They code for precursor proteins of unusual multimodular structure, consisting of a signal peptide, several α-hairpinin (4-Cys) peptide domains with a characteristic cysteine pattern separated by linkers and a C-terminal prodomain. Three types of precursor proteins, with five, six or seven 4-Cys peptide modules, were found in wheat. Among the predicted family members, several peptides previously isolated from T. kiharae seeds were identified. Genes encoding Tk-AMP-X precursors have no introns in the protein-coding regions and are upregulated by fungal pathogens and abiotic stress, providing conclusive evidence for their role in stress response. A combined PCR-based and bioinformatics approach was used to search for related genes in the plant kingdom. Homologous genes differing in the number of peptide modules were discovered in phylogenetically-related Triticum and Aegilops species, including polyploid wheat genome donors. Association of the Tk-AMP-X genes with A, B/G or D genomes of hexaploid wheat was demonstrated. Furthermore, Tk-AMP-X-related sequences were shown to be widespread in the Poaceae family among economically important crops, such as barley, rice and maize. © 2013 FEBS.

  7. Effect of Fatty Acid Conjugation on Antimicrobial Peptide Activity

    DTIC Science & Technology

    2004-12-01

    killing mechanism of antimicrobial peptides makes them an interesting alternative to traditional antibiotics, as target bacteria may be less able...C14-AKK and C16-AKK to within a 7% error are 220 and 16mM respectively. Since amphipathicity is requisite for antimicrobial action KAK is not...Schnaare, 2000: Antimicrobial evaluation of N-alkyl betaines and N-alkyl-N,N-dimethylamine oxides with variations in chain length. Antimicrobial Agents

  8. From antimicrobial to anticancer peptides. A review

    PubMed Central

    Gaspar, Diana; Veiga, A. Salomé; Castanho, Miguel A. R. B.

    2013-01-01

    Antimicrobial peptides (AMPs) are part of the innate immune defense mechanism of many organisms. Although AMPs have been essentially studied and developed as potential alternatives for fighting infectious diseases, their use as anticancer peptides (ACPs) in cancer therapy either alone or in combination with other conventional drugs has been regarded as a therapeutic strategy to explore. As human cancer remains a cause of high morbidity and mortality worldwide, an urgent need of new, selective, and more efficient drugs is evident. Even though ACPs are expected to be selective toward tumor cells without impairing the normal body physiological functions, the development of a selective ACP has been a challenge. It is not yet possible to predict antitumor activity based on ACPs structures. ACPs are unique molecules when compared to the actual chemotherapeutic arsenal available for cancer treatment and display a variety of modes of action which in some types of cancer seem to co-exist. Regardless the debate surrounding the definition of structure-activity relationships for ACPs, great effort has been invested in ACP design and the challenge of improving effective killing of tumor cells remains. As detailed studies on ACPs mechanisms of action are crucial for optimizing drug development, in this review we provide an overview of the literature concerning peptides' structure, modes of action, selectivity, and efficacy and also summarize some of the many ACPs studied and/or developed for targeting different solid and hematologic malignancies with special emphasis on the first group. Strategies described for drug development and for increasing peptide selectivity toward specific cells while reducing toxicity are also discussed. PMID:24101917

  9. Antimicrobial peptide LL-37 participates in the transcriptional regulation of melanoma cells

    PubMed Central

    Muñoz, Mindy; Craske, Madeleine; Severino, Patricia; de Lima, Thais Martins; Labhart, Paul; Chammas, Roger; Velasco, Irineu Tadeu; Machado, Marcel Cerqueira César; Egan, Brian; Nakaya, Helder I; Pinheiro da Silva, Fabiano

    2016-01-01

    Antimicrobial peptides are an ancient family of molecules that emerged millions of years ago and have been strongly conserved during the evolutionary process of living organisms. Recently, our group described that the human antimicrobial peptide LL-37 migrates to the nucleus, raising the possibility that LL-37 could directly modulate transcription under certain conditions. Here, we showed evidence that LL-37 binds to gene promoter regions, and LL-37 gene silencing changed the transcriptional program of melanoma A375 cells genes associated with histone, metabolism, cellular stress, ubiquitination and mitochondria. PMID:27994673

  10. Nanostructures as promising tools for delivery of antimicrobial peptides.

    PubMed

    Brandelli, A

    2012-07-01

    Antimicrobial peptides have been extensively investigated for their potential applications as therapeutics and food biopreservatives. The antimicrobial activity may be impaired by the susceptibility for proteolytic degradation and undesirable interactions of the antimicrobial peptide in the biological environment. Development of nanostructures for entrapment and delivery of antimicrobial peptides may represent an alternative to the direct application of these substances. Lipid nanovesicles have been developed for encapsulation of antimicrobial peptides. Phosphatidylcholine is often employed in liposome manufacture, which is mostly achieved by the thin-film hydration method. Nanofibers may allow different physical modes of drug loading, including direct adsorption on the nanofiber surface or the assembly of drug-loaded nanoparticles. Self-assembled peptides reveal attractive features as nanostructures for applications in drug delivery and promising as antimicrobial agent for treatment of brain infections. Magnetic nanoparticles and nanotubules are also potential structures for entrapment of antimicrobial peptides. Nanoparticles can be also chemically modified with specific cell surface ligands to enhance cell adhesion and site specific delivery. This article reviews the most important nanostructures as promising tools for peptide delivery systems.

  11. Sequence diversity and evolution of antimicrobial peptides in invertebrates.

    PubMed

    Tassanakajon, Anchalee; Somboonwiwat, Kunlaya; Amparyup, Piti

    2015-02-01

    Antimicrobial peptides (AMPs) are evolutionarily ancient molecules that act as the key components in the invertebrate innate immunity against invading pathogens. Several AMPs have been identified and characterized in invertebrates, and found to display considerable diversity in their amino acid sequence, structure and biological activity. AMP genes appear to have rapidly evolved, which might have arisen from the co-evolutionary arms race between host and pathogens, and enabled organisms to survive in different microbial environments. Here, the sequence diversity of invertebrate AMPs (defensins, cecropins, crustins and anti-lipopolysaccharide factors) are presented to provide a better understanding of the evolution pattern of these peptides that play a major role in host defense mechanisms. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Differential distribution and defence involvement of antimicrobial peptides in mussel.

    PubMed

    Mitta, G; Vandenbulcke, F; Noël, T; Romestand, B; Beauvillain, J C; Salzet, M; Roch, P

    2000-08-01

    In previous papers, we characterised 3 types of 4-kDa, cysteine-rich, cationic antimicrobial peptides: MGDs (for Mytilus galloprovincialis defensins), mytilins and myticins, which are abundant in the mussel hemocytes. In the present work, we revealed a differential distribution of the cells expressing the different genes. In addition, using confocal and electron microscopy, we confirmed that defensins and mytilins were partially located in different sub-types of circulating hemocytes although the peptides can be located in the same cell, and even in the same granule. We also demonstrated that mytilins exert their microbicidal effect within the cells through the process of phagosome-mytilin granule fusion leading to the co-location of ingested bacteria and mytilins.

  13. Mechanical properties that influence antimicrobial peptide activity in lipid membranes.

    PubMed

    Marín-Medina, Nathaly; Ramírez, Diego Alejandro; Trier, Steve; Leidy, Chad

    2016-12-01

    Antimicrobial peptides are small amphiphilic proteins found in animals and plants as essential components of the innate immune system and whose function is to control bacterial infectious activity. In order to accomplish their function, antimicrobial peptides use different mechanisms of action which have been deeply studied in view of their potential exploitation to treat antibiotic-resistant bacterial infections. One of the main mechanisms of action of these peptides is the disruption of the bacterial membrane through pore formation, which, in some cases, takes place via a monomer to oligomer cooperative transition. Previous studies have shown that lipid composition, and the presence of exogenous components, such as cholesterol in model membranes or carotenoids in bacteria, can affect the potency of distinct antimicrobial peptides. At the same time, considering the membrane as a two-dimensional material, it has been shown that membrane composition defines its mechanical properties which might be relevant in many membrane-related processes. Nevertheless, the correlation between the mechanical properties of the membrane and antimicrobial peptide potency has not been considered according to the importance it deserves. The relevance of these mechanical properties in membrane deformation due to peptide insertion is reviewed here for different types of pores in order to elucidate if indeed membrane composition affects antimicrobial peptide activity by modulation of the mechanical properties of the membrane. This would also provide a better understanding of the mechanisms used by bacteria to overcome antimicrobial peptide activity.

  14. A lesson from Bombinins H, mildly cationic diastereomeric antimicrobial peptides from Bombina skin.

    PubMed

    Mangoni, Maria Luisa

    2013-12-01

    Gene-encoded peptide antibiotics represent fascinating molecules for the development of new antimicrobials with a new mode of action: and one of the richest sources is amphibian skin. In particular, the skin of the fire-bellied toad Bombina genus contains mildly cationic antimicrobial peptides (AMPs), named bombinins H, with attractive properties. Indeed, some members of this peptide family coexist in skin secretions as isomers in which a single D-amino acid (alloisoleucine or leucine) is incorporated as a result of a post-translational modification of the respective gene-encoded Lamino acid. Here, a brief overview of the genes coding for these peptides, their spectrum of antimicrobial activities, mechanism of action and interactions with biological or model membranes is reported. Remarkably, a single D-amino acid substitution represents a unique approach developed by Nature not only to modulate the peptide stability in vivo, but also to confer the all-L peptide and its diastereomer distinctive biological features. Overall, such findings should assist in the generation of new peptide-based anti-infective agents, which are urgently needed because of the growing emergence of microbial strains resistant to conventional antimicrobials.

  15. Bacterial Evasion of Host Antimicrobial Peptide Defenses

    PubMed Central

    Cole, Jason N.; Nizet, Victor

    2015-01-01

    SUMMARY Antimicrobial peptides (AMPs), also known as host defense peptides, are small naturally occurring microbicidal molecules produced by the host innate immune response that function as a first line of defense to kill pathogenic microorganisms by inducing deleterious cell membrane damage. AMPs also possess signaling and chemoattractant activities and can modulate the innate immune response to enhance protective immunity or suppress inflammation. Human pathogens have evolved defense molecules and strategies to counter and survive the AMPs released by host immune cells such as neutrophils and macrophages. Here, we review the various mechanisms used by human bacterial pathogens to resist AMP-mediated killing, including surface charge modification, active efflux, alteration of membrane fluidity, inactivation by proteolytic digestion, and entrapment by surface proteins and polysaccharides. Enhanced understanding of AMP resistance at the molecular level may offer insight into the mechanisms of bacterial pathogenesis and augment the discovery of novel therapeutic targets and drug design for the treatment of recalcitrant multidrug-resistant bacterial infections. PMID:26999396

  16. Three new antimicrobial peptides from the scorpion Pandinus imperator.

    PubMed

    Zeng, Xian-Chun; Zhou, Lingli; Shi, Wanxia; Luo, Xuesong; Zhang, Lei; Nie, Yao; Wang, Jinwei; Wu, Shifen; Cao, Bin; Cao, Hanjun

    2013-07-01

    Three novel cysteine-free venom peptides, which were referred to as Pantinin-1, Pantinin-2 and Pantinin-3, respectively, have been identified from the scorpion Pandinus imperator by cDNA cloning strategy. The precursor of each peptide consists of a signal peptide, a mature peptide with no disulfide bridges, and an acidic propeptide with a typical processing signal. Each of the three peptides is an α-helical, cationic and amphipathic molecule with 13 or 14 amino acid residues. Their amino acid sequences are homologous to those of some 13-mer antimicrobial peptides isolated from scorpions. Antimicrobial assay showed that all the three peptides possess relatively strong activities against Gram-positive bacteria and a fungus, but have very weak antimicrobial activities against Gram-negative bacteria. Toxicity assay showed that the three peptides exhibit very low or mild hemolytic activities against human red blood cells. It is interesting to see that Pantinin-3 is able to potently inhibit the growth of vancomycin-resistant Enterococcus (VRE) S13, a pathogen that can cause a number of human infections; this suggests that Pantinin-3 has great potential to be applied in the treatment of VRE infections. Our findings gain new insights into the structure/function relationships of the small linear cationic antimicrobial peptides from scorpions, and provide new templates for designing of antimicrobial agents targeting antibiotic-resistant pathogenic bacteria.

  17. Probing Protein Sequences as Sources for Encrypted Antimicrobial Peptides

    PubMed Central

    Brand, Guilherme D.; Magalhães, Mariana T. Q.; Tinoco, Maria L. P.; Aragão, Francisco J. L.; Nicoli, Jacques; Kelly, Sharon M.; Cooper, Alan; Bloch, Carlos

    2012-01-01

    Starting from the premise that a wealth of potentially biologically active peptides may lurk within proteins, we describe here a methodology to identify putative antimicrobial peptides encrypted in protein sequences. Candidate peptides were identified using a new screening procedure based on physicochemical criteria to reveal matching peptides within protein databases. Fifteen such peptides, along with a range of natural antimicrobial peptides, were examined using DSC and CD to characterize their interaction with phospholipid membranes. Principal component analysis of DSC data shows that the investigated peptides group according to their effects on the main phase transition of phospholipid vesicles, and that these effects correlate both to antimicrobial activity and to the changes in peptide secondary structure. Consequently, we have been able to identify novel antimicrobial peptides from larger proteins not hitherto associated with such activity, mimicking endogenous and/or exogenous microorganism enzymatic processing of parent proteins to smaller bioactive molecules. A biotechnological application for this methodology is explored. Soybean (Glycine max) plants, transformed to include a putative antimicrobial protein fragment encoded in its own genome were tested for tolerance against Phakopsora pachyrhizi, the causative agent of the Asian soybean rust. This procedure may represent an inventive alternative to the transgenic technology, since the genetic material to be used belongs to the host organism and not to exogenous sources. PMID:23029273

  18. Probing protein sequences as sources for encrypted antimicrobial peptides.

    PubMed

    Brand, Guilherme D; Magalhães, Mariana T Q; Tinoco, Maria L P; Aragão, Francisco J L; Nicoli, Jacques; Kelly, Sharon M; Cooper, Alan; Bloch, Carlos

    2012-01-01

    Starting from the premise that a wealth of potentially biologically active peptides may lurk within proteins, we describe here a methodology to identify putative antimicrobial peptides encrypted in protein sequences. Candidate peptides were identified using a new screening procedure based on physicochemical criteria to reveal matching peptides within protein databases. Fifteen such peptides, along with a range of natural antimicrobial peptides, were examined using DSC and CD to characterize their interaction with phospholipid membranes. Principal component analysis of DSC data shows that the investigated peptides group according to their effects on the main phase transition of phospholipid vesicles, and that these effects correlate both to antimicrobial activity and to the changes in peptide secondary structure. Consequently, we have been able to identify novel antimicrobial peptides from larger proteins not hitherto associated with such activity, mimicking endogenous and/or exogenous microorganism enzymatic processing of parent proteins to smaller bioactive molecules. A biotechnological application for this methodology is explored. Soybean (Glycine max) plants, transformed to include a putative antimicrobial protein fragment encoded in its own genome were tested for tolerance against Phakopsora pachyrhizi, the causative agent of the Asian soybean rust. This procedure may represent an inventive alternative to the transgenic technology, since the genetic material to be used belongs to the host organism and not to exogenous sources.

  19. Screening And Optimizing Antimicrobial Peptides By Using SPOT-Synthesis

    NASA Astrophysics Data System (ADS)

    López-Pérez, Paula M.; Grimsey, Elizabeth; Bourne, Luc; Mikut, Ralf; Hilpert, Kai

    2017-04-01

    Peptide arrays on cellulose are a powerful tool to investigate peptide interactions with a number of different molecules, for examples antibodies, receptors or enzymes. Such peptide arrays can also be used to study interactions with whole cells. In this review, we focus on the interaction of small antimicrobial peptides with bacteria. Antimicrobial peptides (AMPs) can kill multidrug-resistant (MDR) human pathogenic bacteria and therefore could be next generation antibiotics targeting MDR bacteria. We describe the screen and the result of different optimization strategies of peptides cleaved from the membrane. In addition, screening of antibacterial activity of peptides that are tethered to the surface is discussed. Surface-active peptides can be used to protect surfaces from bacterial infections, for example implants.

  20. Screening and Optimizing Antimicrobial Peptides by Using SPOT-Synthesis

    PubMed Central

    López-Pérez, Paula M.; Grimsey, Elizabeth; Bourne, Luc; Mikut, Ralf; Hilpert, Kai

    2017-01-01

    Peptide arrays on cellulose are a powerful tool to investigate peptide interactions with a number of different molecules, for examples antibodies, receptors or enzymes. Such peptide arrays can also be used to study interactions with whole cells. In this review, we focus on the interaction of small antimicrobial peptides with bacteria. Antimicrobial peptides (AMPs) can kill multidrug-resistant (MDR) human pathogenic bacteria and therefore could be next generation antibiotics targeting MDR bacteria. We describe the screen and the result of different optimization strategies of peptides cleaved from the membrane. In addition, screening of antibacterial activity of peptides that are tethered to the surface is discussed. Surface-active peptides can be used to protect surfaces from bacterial infections, for example implants. PMID:28447030

  1. Antimicrobial and Immunomodulatory Activities of PR-39 Derived Peptides

    PubMed Central

    Veldhuizen, Edwin J. A.; Schneider, Viktoria A. F.; Agustiandari, Herfita; van Dijk, Albert; Tjeerdsma-van Bokhoven, Johanna L. M.; Bikker, Floris J.; Haagsman, Henk P.

    2014-01-01

    The porcine cathelicidin PR-39 is a host defence peptide that plays a pivotal role in the innate immune defence of the pig against infections. Besides direct antimicrobial activity, it is involved in immunomodulation, wound healing and several other biological processes. In this study, the antimicrobial- and immunomodulatory activity of PR-39, and N- and C-terminal derivatives of PR-39 were tested. PR-39 exhibited an unexpected broad antimicrobial spectrum including several Gram positive strains such as Bacillus globigii and Enterococcus faecalis. Of organisms tested, only Staphylococcus aureus was insensitive to PR-39. Truncation of PR-39 down to 15 (N-terminal) amino acids did not lead to major loss of activity, while peptides corresponding to the C-terminal part of PR-39 were hampered in their antimicrobial activity. However, shorter peptides were all much more sensitive to inhibition by salt. Active peptides induced ATP leakage and loss of membrane potential in Bacillus globigii and Escherichia coli, indicating a lytic mechanism of action for these peptides. Finally, only the mature peptide was able to induce IL-8 production in porcine macrophages, but some shorter peptides also had an effect on TNF-α production showing differential regulation of cytokine induction by PR-39 derived peptides. None of the active peptides showed high cytotoxicity highlighting the potential of these peptides for use as an alternative to antibiotics. PMID:24755622

  2. The role of antimicrobial peptides in chronic inflammatory skin diseases

    PubMed Central

    Majewski, Sławomir

    2016-01-01

    Antimicrobial peptides (AMPs) are effector molecules of the innate immune system of the skin. They present an activity against a broad spectrum of Gram-positive and Gram-negative bacteria as well as some fungi, parasites and enveloped viruses. Several inflammatory skin diseases including psoriasis, atopic dermatitis, acne vulgaris and rosacea are characterized by a dysregulated expression of AMPs. Antimicrobial peptides are excessively produced in lesional psoriatic scales or rosacea in contrast to the atopic skin that shows lower AMP levels when compared with psoriasis. The importance of the AMPs contribution to host immunity is indisputable as alterations in the antimicrobial peptide expression have been associated with various pathologic processes. This review discusses the biology and clinical relevance of antimicrobial peptides expressed in the skin and their role in the pathogenesis of inflammatory skin diseases. PMID:26985172

  3. De-Novo Design of Antimicrobial Peptides for Plant Protection

    PubMed Central

    Zeitler, Benjamin; Herrera Diaz, Areli; Dangel, Alexandra; Thellmann, Martha; Meyer, Helge; Sattler, Michael; Lindermayr, Christian

    2013-01-01

    This work describes the de-novo design of peptides that inhibit a broad range of plant pathogens. Four structurally different groups of peptides were developed that differ in size and position of their charged and hydrophobic clusters and were assayed for their ability to inhibit bacterial growth and fungal spore germination. Several peptides are highly active at concentrations between 0,1 and 1 µg/ml against plant pathogenic bacteria, such as Pseudomonas syringae, Pectobacterium carotovorum, and Xanthomonas vesicatoria. Importantly, no hemolytic activity could be detected for these peptides at concentrations up to 200 µg/ml. Moreover, the peptides are also active after spraying on the plant surface demonstrating a possible way of application. In sum, our designed peptides represent new antimicrobial agents and with the increasing demand for antimicrobial compounds for production of “healthy” food, these peptides might serve as templates for novel antibacterial and antifungal agents. PMID:23951222

  4. De-novo design of antimicrobial peptides for plant protection.

    PubMed

    Zeitler, Benjamin; Herrera Diaz, Areli; Dangel, Alexandra; Thellmann, Martha; Meyer, Helge; Sattler, Michael; Lindermayr, Christian

    2013-01-01

    This work describes the de-novo design of peptides that inhibit a broad range of plant pathogens. Four structurally different groups of peptides were developed that differ in size and position of their charged and hydrophobic clusters and were assayed for their ability to inhibit bacterial growth and fungal spore germination. Several peptides are highly active at concentrations between 0,1 and 1 µg/ml against plant pathogenic bacteria, such as Pseudomonas syringae, Pectobacterium carotovorum, and Xanthomonas vesicatoria. Importantly, no hemolytic activity could be detected for these peptides at concentrations up to 200 µg/ml. Moreover, the peptides are also active after spraying on the plant surface demonstrating a possible way of application. In sum, our designed peptides represent new antimicrobial agents and with the increasing demand for antimicrobial compounds for production of "healthy" food, these peptides might serve as templates for novel antibacterial and antifungal agents.

  5. Alternative mechanisms of action of cationic antimicrobial peptides on bacteria.

    PubMed

    Hale, John D F; Hancock, Robert E W

    2007-12-01

    Cationic antimicrobial peptides are a novel type of antibiotic offering much potential in the treatment of microbial-related diseases. They offer many advantages for commercial development, including a broad spectrum of action and modest size. However, despite the identification or synthetic production of thousands of such peptides, the mode of action remains elusive, except for a few examples. While the dogma for the mechanism of action of antimicrobial peptides against bacteria is believed to be through pore formation or membrane barrier disruption, some peptides clearly act differently and other intracellular target sites have been identified. This article presents an updated review of how cationic antimicrobial peptides are able to affect bacterial killing, with a focus on internal targets.

  6. Uses of antimicrobial genes from microbial genome

    DOEpatents

    Sorek, Rotem; Rubin, Edward M.

    2013-08-20

    We describe a method for mining microbial genomes to discover antimicrobial genes and proteins having broad spectrum of activity. Also described are antimicrobial genes and their expression products from various microbial genomes that were found using this method. The products of such genes can be used as antimicrobial agents or as tools for molecular biology.

  7. Biofilm Induced Tolerance towards Antimicrobial Peptides

    PubMed Central

    Folkesson, Anders; Haagensen, Janus A. J.; Zampaloni, Claudia; Sternberg, Claus; Molin, Søren

    2008-01-01

    Increased tolerance to antimicrobial agents is thought to be an important feature of microbes growing in biofilms. We address the question of how biofilm organization affects antibiotic susceptibility. We established Escherichia coli biofilms with differential structural organization due to the presence of IncF plasmids expressing altered forms of the transfer pili in two different biofilm model systems. The mature biofilms were subsequently treated with two antibiotics with different molecular targets, the peptide antibiotic colistin and the fluoroquinolone ciprofloxacin. The dynamics of microbial killing were monitored by viable count determination, and confocal laser microscopy. Strains forming structurally organized biofilms show an increased bacterial survival when challenged with colistin, compared to strains forming unstructured biofilms. The increased survival is due to genetically regulated tolerant subpopulation formation and not caused by a general biofilm property. No significant difference in survival was detected when the strains were challenged with ciprofloxacin. Our data show that biofilm formation confers increased colistin tolerance to cells within the biofilm structure, but the protection is conditional being dependent on the structural organization of the biofilm, and the induction of specific tolerance mechanisms. PMID:18382672

  8. Antimicrobial peptides: Possible anti-infective agents.

    PubMed

    Lakshmaiah Narayana, Jayaram; Chen, Jyh-Yih

    2015-10-01

    Multidrug-resistant bacterial, fungal, viral, and parasitic infections are major health threats. The Infectious Diseases Society of America has expressed concern on the decrease of pharmaceutical companies working on antibiotic research and development. However, small companies, along with academic research institutes, are stepping forward to develop novel therapeutic methods to overcome the present healthcare situation. Among the leading alternatives to current drugs are antimicrobial peptides (AMPs), which are abundantly distributed in nature. AMPs exhibit broad-spectrum activity against a wide variety of bacteria, fungi, viruses, and parasites, and even cancerous cells. They also show potential immunomodulatory properties, and are highly responsive to infectious agents and innate immuno-stimulatory molecules. In recent years, many AMPs have undergone or are undergoing clinical development, and a few are commercially available for topical and other applications. In this review, we outline selected anion and cationic AMPs which are at various stages of development, from preliminary analysis to clinical drug development. Moreover, we also consider current production methods and delivery tools for AMPs, which must be improved for the effective use of these agents.

  9. Biofilm induced tolerance towards antimicrobial peptides.

    PubMed

    Folkesson, Anders; Haagensen, Janus A J; Zampaloni, Claudia; Sternberg, Claus; Molin, Søren

    2008-04-02

    Increased tolerance to antimicrobial agents is thought to be an important feature of microbes growing in biofilms. We address the question of how biofilm organization affects antibiotic susceptibility. We established Escherichia coli biofilms with differential structural organization due to the presence of IncF plasmids expressing altered forms of the transfer pili in two different biofilm model systems. The mature biofilms were subsequently treated with two antibiotics with different molecular targets, the peptide antibiotic colistin and the fluoroquinolone ciprofloxacin. The dynamics of microbial killing were monitored by viable count determination, and confocal laser microscopy. Strains forming structurally organized biofilms show an increased bacterial survival when challenged with colistin, compared to strains forming unstructured biofilms. The increased survival is due to genetically regulated tolerant subpopulation formation and not caused by a general biofilm property. No significant difference in survival was detected when the strains were challenged with ciprofloxacin. Our data show that biofilm formation confers increased colistin tolerance to cells within the biofilm structure, but the protection is conditional being dependent on the structural organization of the biofilm, and the induction of specific tolerance mechanisms.

  10. Use of Peptide Libraries for Identification and Optimization of Novel Antimicrobial Peptides.

    PubMed

    Ashby, Martin; Petkova, Asya; Gani, Jurnorain; Mikut, Ralf; Hilpert, Kai

    2017-01-01

    The increasing rates of resistance among bacteria and to a lesser extent fungi have resulted in an urgent need to find new molecules that hold therapeutic promise against multidrug-resistant strains. Antimicrobial peptides have proven very effective against a variety of multidrug-resistant bacteria. Additionally, the low levels of resistance reported towards these molecules are an attractive feature for antimicrobial drug development. Here we summarise information on diverse peptide libraries used to discover or to optimize antimicrobial peptides. Chemical synthesized peptide libraries, for example split and mix method, tea bag method, multi-pin method and cellulose spot method are discussed. In addition biological peptide library screening methods are summarized, like phage display, bacterial display, mRNA-display and ribosomal display. A few examples are given for small peptide libraries, which almost exclusively follow a rational design of peptides of interest rather than a combinatorial approach.

  11. Antimicrobial action of synthetic peptides towards wine spoilage yeasts.

    PubMed

    Enrique, María; Marcos, Jose F; Yuste, María; Martínez, Mireia; Vallés, Salvador; Manzanares, Paloma

    2007-09-30

    The antimicrobial action of selected short synthetic peptides against wine spoilage yeasts such as Cryptococcus albidus, Dekkera bruxellensis, Pichia membranifaciens, Saccharomyces cerevisiae, Zygosaccharomyces bailii and Zygosaccharomyces bisporus has been examined. Peptides analyzed include nine sequence-related antifungal hexapeptides (PAFs) previously developed by a combinatorial approach, and two representative lactoferricin B (LfcinB)-derived peptides. Different peptides had distinct activity profiles. In vitro assays identified the peptides PAF26, PAF36, and LfcinB(17-31), as having growth inhibitory properties towards several of the yeasts at low micromolar concentrations. Z. bailii and Z. bisporus were the most sensitive yeasts. In addition to their fungistatic activity, the three peptides showed fungicidal properties towards Z. bailii, Z. bisporus, and S. cerevisiae in laboratory growth medium. Remarkably, only LfcinB(17-31) against Z. bisporus had inhibitory and fungicidal properties in wine at the concentrations assayed, showing that the antimicrobial action of each peptide is dependent on both the food matrix and the target micro-organism. Lack of fungicidal activity of peptides against Z. bailii in wine is related to the presence of salt ions other than divalent cations. On the contrary, fungicidal activity of LfcinB(17-31) towards Z. bisporus was not significantly affected by wine salts. Our data identify a bioactive peptide from natural origin with potential use against the food spoilage yeast Z. bisporus, and indicate that the application of antimicrobial peptides in wine preservation deserves further investigation.

  12. Strategies and molecular tools to fight antimicrobial resistance: resistome, transcriptome, and antimicrobial peptides

    PubMed Central

    Tavares, Letícia S.; Silva, Carolina S. F.; de Souza, Vinicius C.; da Silva, Vânia L.; Diniz, Cláudio G.; Santos, Marcelo O.

    2013-01-01

    The increasing number of antibiotic resistant bacteria motivates prospective research toward discovery of new antimicrobial active substances. There are, however, controversies concerning the cost-effectiveness of such research with regards to the description of new substances with novel cellular interactions, or description of new uses of existing substances to overcome resistance. Although examination of bacteria isolated from remote locations with limited exposure to humans has revealed an absence of antibiotic resistance genes, it is accepted that these genes were both abundant and diverse in ancient living organisms, as detected in DNA recovered from Pleistocene deposits (30,000 years ago). Indeed, even before the first clinical use of antibiotics more than 60 years ago, resistant organisms had been isolated. Bacteria can exhibit different strategies for resistance against antibiotics. New genetic information may lead to the modification of protein structure affecting the antibiotic carriage into the cell, enzymatic inactivation of drugs, or even modification of cellular structure interfering in the drug-bacteria interaction. There are still plenty of new genes out there in the environment that can be appropriated by putative pathogenic bacteria to resist antimicrobial agents. On the other hand, there are several natural compounds with antibiotic activity that may be used to oppose them. Antimicrobial peptides (AMPs) are molecules which are wide-spread in all forms of life, from multi-cellular organisms to bacterial cells used to interfere with microbial growth. Several AMPs have been shown to be effective against multi-drug resistant bacteria and have low propensity to resistance development, probably due to their unique mode of action, different from well-known antimicrobial drugs. These substances may interact in different ways with bacterial cell membrane, protein synthesis, protein modulation, and protein folding. The analysis of bacterial transcriptome

  13. DRAMP: a comprehensive data repository of antimicrobial peptides.

    PubMed

    Fan, Linlin; Sun, Jian; Zhou, Meifeng; Zhou, Jie; Lao, Xingzhen; Zheng, Heng; Xu, Hanmei

    2016-04-14

    The growing problem of antibiotic-resistant microorganisms results in an urgent need for substitutes to conventional antibiotics with novel modes of action and effective activities. Antimicrobial peptides (AMPs), produced by a wide variety of living organisms acting as a defense mechanism against invading pathogenic microbes, are considered to be such promising alternatives. AMPs display a broad spectrum of antimicrobial activity and a low propensity for developing resistance. Therefore, a thorough understanding of AMPs is essential to exploit them as antimicrobial drugs. Considering this, we developed a comprehensive user-friendly data repository of antimicrobial peptides (DRAMP), which holds 17349 antimicrobial sequences, including 4571 general AMPs, 12704 patented sequences and 74 peptides in drug development. Entries in the database have detailed annotations, especially detailed antimicrobial activity data (shown as target organism with MIC value) and structure information. Annotations also include accession numbers crosslinking to Pubmed, Swiss-prot and Protein Data Bank (PDB). The website of the database comes with easy-to-operate browsing as well as searching with sorting and filtering functionalities. Several useful sequence analysis tools are provided, including similarity search, sequence alignment and conserved domain search (CD-Search). DRAMP should be a useful resource for the development of novel antimicrobial peptide drugs.

  14. DRAMP: a comprehensive data repository of antimicrobial peptides

    PubMed Central

    Fan, Linlin; Sun, Jian; Zhou, Meifeng; Zhou, Jie; Lao, Xingzhen; Zheng, Heng; Xu, Hanmei

    2016-01-01

    The growing problem of antibiotic-resistant microorganisms results in an urgent need for substitutes to conventional antibiotics with novel modes of action and effective activities. Antimicrobial peptides (AMPs), produced by a wide variety of living organisms acting as a defense mechanism against invading pathogenic microbes, are considered to be such promising alternatives. AMPs display a broad spectrum of antimicrobial activity and a low propensity for developing resistance. Therefore, a thorough understanding of AMPs is essential to exploit them as antimicrobial drugs. Considering this, we developed a comprehensive user-friendly data repository of antimicrobial peptides (DRAMP), which holds 17349 antimicrobial sequences, including 4571 general AMPs, 12704 patented sequences and 74 peptides in drug development. Entries in the database have detailed annotations, especially detailed antimicrobial activity data (shown as target organism with MIC value) and structure information. Annotations also include accession numbers crosslinking to Pubmed, Swiss-prot and Protein Data Bank (PDB). The website of the database comes with easy-to-operate browsing as well as searching with sorting and filtering functionalities. Several useful sequence analysis tools are provided, including similarity search, sequence alignment and conserved domain search (CD-Search). DRAMP should be a useful resource for the development of novel antimicrobial peptide drugs. PMID:27075512

  15. The role of amphibian antimicrobial peptides in protection of amphibians from pathogens linked to global amphibian declines.

    PubMed

    Rollins-Smith, Louise A

    2009-08-01

    Amphibian species have experienced population declines and extinctions worldwide that are unprecedented in recent history. Many of these recent declines have been linked to a pathogenic skin fungus, Batrachochytrium dendrobatidis, or to iridoviruses of the genus Ranavirus. One of the first lines of defense against pathogens that enter by way of the skin are antimicrobial peptides synthesized and stored in dermal granular glands and secreted into the mucus following alarm or injury. Here, I review what is known about the capacity of amphibian antimicrobial peptides from diverse amphibians to inhibit B. dendrobatidis or ranavirus infections. When multiple species were compared for the effectiveness of their in vitro antimicrobial peptides defenses against B. dendrobatidis, non-declining species of rainforest amphibians had more effective antimicrobial peptides than species in the same habitat that had recently experienced population declines. Further, there was a significant correlation between the effectiveness of the antimicrobial peptides and resistance of the species to experimental infection. These studies support the hypothesis that antimicrobial peptides are an important component of innate defenses against B. dendrobatidis. Some amphibian antimicrobial peptides inhibit ranavirus infections and infection of human T lymphocytes by the human immunodeficiency virus (HIV). An effective antimicrobial peptide defense against skin pathogens appears to depend on a diverse array of genes expressing antimicrobial peptides. The production of antimicrobial peptides may be regulated by signals from the pathogens. However, this defense must also accommodate potentially beneficial microbes on the skin that compete or inhibit growth of the pathogens. How this delicate balancing act is accomplished is an important area of future research.

  16. Production of cecropin A antimicrobial peptide in rice seed endosperm

    PubMed Central

    2014-01-01

    Background Cecropin A is a natural antimicrobial peptide that exhibits rapid, potent and long-lasting lytic activity against a broad spectrum of pathogens, thus having great biotechnological potential. Here, we report a system for producing bioactive cecropin A in rice seeds. Results Transgenic rice plants expressing a codon-optimized synthetic cecropin A gene drived by an endosperm-specific promoter, either the glutelin B1 or glutelin B4 promoter, were generated. The signal peptide sequence from either the glutelin B1 or the glutelin B4 were N-terminally fused to the coding sequence of the cecropin A. We also studied whether the presence of the KDEL endoplasmic reticulum retention signal at the C-terminal has an effect on cecropin A subcellular localization and accumulation. The transgenic rice plants showed stable transgene integration and inheritance. We show that cecropin A accumulates in protein storage bodies in the rice endosperm, particularly in type II protein bodies, supporting that the glutelin N-terminal signal peptides play a crucial role in directing the cecropin A to this organelle, independently of being tagged with the KDEL endoplasmic reticulum retention signal. The production of cecropin A in transgenic rice seeds did not affect seed viability or seedling growth. Furthermore, transgenic cecropin A seeds exhibited resistance to infection by fungal and bacterial pathogens (Fusarium verticillioides and Dickeya dadantii, respectively) indicating that the in planta-produced cecropin A is biologically active. Conclusions Rice seeds can sustain bioactive cecropin A production and accumulation in protein bodies. The system might benefit the production of this antimicrobial agent for subsequent applications in crop protection and food preservation. PMID:24755305

  17. Production of cecropin A antimicrobial peptide in rice seed endosperm.

    PubMed

    Bundó, Mireia; Montesinos, Laura; Izquierdo, Esther; Campo, Sonia; Mieulet, Delphine; Guiderdoni, Emmanuel; Rossignol, Michel; Badosa, Esther; Montesinos, Emilio; San Segundo, Blanca; Coca, María

    2014-04-22

    Cecropin A is a natural antimicrobial peptide that exhibits rapid, potent and long-lasting lytic activity against a broad spectrum of pathogens, thus having great biotechnological potential. Here, we report a system for producing bioactive cecropin A in rice seeds. Transgenic rice plants expressing a codon-optimized synthetic cecropin A gene drived by an endosperm-specific promoter, either the glutelin B1 or glutelin B4 promoter, were generated. The signal peptide sequence from either the glutelin B1 or the glutelin B4 were N-terminally fused to the coding sequence of the cecropin A. We also studied whether the presence of the KDEL endoplasmic reticulum retention signal at the C-terminal has an effect on cecropin A subcellular localization and accumulation. The transgenic rice plants showed stable transgene integration and inheritance. We show that cecropin A accumulates in protein storage bodies in the rice endosperm, particularly in type II protein bodies, supporting that the glutelin N-terminal signal peptides play a crucial role in directing the cecropin A to this organelle, independently of being tagged with the KDEL endoplasmic reticulum retention signal. The production of cecropin A in transgenic rice seeds did not affect seed viability or seedling growth. Furthermore, transgenic cecropin A seeds exhibited resistance to infection by fungal and bacterial pathogens (Fusarium verticillioides and Dickeya dadantii, respectively) indicating that the in planta-produced cecropin A is biologically active. Rice seeds can sustain bioactive cecropin A production and accumulation in protein bodies. The system might benefit the production of this antimicrobial agent for subsequent applications in crop protection and food preservation.

  18. Archetypal tryptophan-rich antimicrobial peptides: properties and applications.

    PubMed

    Shagaghi, Nadin; Palombo, Enzo A; Clayton, Andrew H A; Bhave, Mrinal

    2016-02-01

    Drug-resistant microorganisms ('superbugs') present a serious challenge to the success of antimicrobial treatments. Subsequently, there is a crucial need for novel bio-control agents. Many antimicrobial peptides (AMPs) show a broad-spectrum activity against bacteria, fungi or viruses and are strong candidates to complement or substitute current antimicrobial agents. Some AMPs are also effective against protozoa or cancer cells. The tryptophan (Trp)-rich peptides (TRPs) are a subset of AMPs that display potent antimicrobial activity, credited to the unique biochemical properties of tryptophan that allow it to insert into biological membranes. Further, many Trp-rich AMPs cross bacterial membranes without compromising their integrity and act intracellularly, suggesting interactions with nucleic acids and enzymes. In this work, we overview some archetypal TRPs derived from natural sources, i.e., indolicidin, tritrpticin and lactoferricin, summarising their biochemical properties, structures, antimicrobial activities, mechanistic studies and potential applications.

  19. A maritime pine antimicrobial peptide involved in ammonium nutrition.

    PubMed

    Canales, Javier; Avila, Concepción; Cánovas, Francisco M

    2011-09-01

    A large family of small cysteine-rich antimicrobial peptides (AMPs) is involved in the innate defence of plants against pathogens. Recently, it has been shown that AMPs may also play important roles in plant growth and development. In previous work, we have identified a gene of the AMP β-barrelin family that was differentially regulated in the roots of maritime pine (Pinus pinaster Ait.) in response to changes in ammonium nutrition. Here, we present the molecular characterization of two AMP genes, PpAMP1 and PpAMP2, showing different molecular structure and physicochemical properties. PpAMP1 and PpAMP2 displayed different expression patterns in maritime pine seedlings and adult trees. Furthermore, our expression analyses indicate that PpAMP1 is the major form of AMP in the tree, and its relative abundance is regulated by ammonium availability. In contrast, PpAMP2 is expressed at much lower levels and it is not regulated by ammonium. To gain new insights into the function of PpAMP1, we over-expressed the recombinant protein in Escherichia coli and demonstrated that PpAMP1 strongly inhibited yeast growth, indicating that it exhibits antimicrobial activity. We have also found that PpAMP1 alters ammonium uptake, suggesting that it is involved in the regulation of ammonium ion flux into pine roots. © 2011 Blackwell Publishing Ltd.

  20. Nanomechanical Response of Bacterial Cells to Cationic Antimicrobial Peptides

    NASA Astrophysics Data System (ADS)

    Lu, Shun; Walters, Grant; Parg, Richard; Dutcher, John

    2014-03-01

    The effectiveness of antimicrobial compounds can be easily screened, however their mechanism of action is much more difficult to determine. Many compounds act by compromising the mechanical integrity of the bacterial cell envelope, and our study introduces an atomic force microscopy (AFM)-based creep deformation technique to evaluate changes in the time-dependent mechanical properties of Pseudomonas aeruginosa PAO1 bacterial cells upon exposure to two different but structurally related antimicrobial peptides: polymyxin B and polymyxin B nonapeptide. We observed a distinctive signature for the loss of integrity of the bacterial cell envelope following exposure to the peptides. Measurements performed before and after exposure, as well as time-resolved measurements and those performed at different concentrations, revealed large changes to the viscoelastic parameters that are consistent with differences in the membrane permeabilizing effects of the peptides. The AFM creep deformation measurement provides new, unique insight into the kinetics and mechanism of action of antimicrobial peptides on bacteria.

  1. Bombyx mori E26 transformation-specific 2 (BmEts2), an Ets family protein, represses Bombyx mori Rels (BmRels)-mediated promoter activation of antimicrobial peptide genes in the silkworm Bombyx mori.

    PubMed

    Tanaka, H; Sagisaka, A; Suzuki, N; Yamakawa, M

    2016-10-01

    E26 transformation-specific (Ets) family transcription factors are known to play roles in various biological phenomena, including immunity, in vertebrates. However, the mechanisms by which Ets proteins contribute to immunity in invertebrates remain poorly understood. In this study, we identified a cDNA encoding BmEts2, which is a putative orthologue of Drosophila Yan and human translocation-ets-leukemia/Ets-variant gene 6, from the silkworm Bombyx mori. Expression of the BmEts2 gene was significantly increased in the fat bodies of silkworm larvae in response to injection with Escherichia coli and Staphylococcus aureus. BmEts2 overexpression dramatically repressed B. mori Rels (BmRels)-mediated promoter activation of antimicrobial peptide genes in silkworm cells. Conversely, gene knockdown of BmEts2 significantly enhanced BmRels activity. In addition, two κB sites located on the 5' upstream region of cecropin B1 were found to be involved in the repression of BmRels-mediated promoter activation. Protein-competition analysis further demonstrated that BmEts2 competitively inhibited binding of BmRels to κB sites. Overall, BmEts2 acts as a repressor of BmRels-mediated transactivation of antimicrobial protein genes by inhibiting the binding of BmRels to κB sites. © 2016 The Royal Entomological Society.

  2. Perspectives on the evolutionary ecology of arthropod antimicrobial peptides.

    PubMed

    Rolff, Jens; Schmid-Hempel, Paul

    2016-05-26

    Antimicrobial peptides (AMPs) are important elements of the innate immune defence in multicellular organisms that target and kill microbes. Here, we reflect on the various points that are raised by the authors of the 11 contributions to a special issue of Philosophical Transactions on the 'evolutionary ecology of arthropod antimicrobial peptides'. We see five interesting topics emerging. (i) AMP genes in insects, and perhaps in arthropods more generally, evolve much slower than most other immune genes. One explanation refers to the constraints set by AMPs being part of a finely tuned defence system. A new view argues that AMPs are under strong stabilizing selection. Regardless, this striking observation still invites many more questions than have been answered so far. (ii) AMPs almost always are expressed in combinations and sometimes show expression patterns that are dependent on the infectious agent. While it is often assumed that this can be explained by synergistic interactions, such interactions have rarely been demonstrated and need to be studied further. Moreover, how to define synergy in the first place remains difficult and needs to be addressed. (iii) AMPs play a very important role in mediating the interaction between a host and its mutualistic or commensal microbes. This has only been studied in a very small number of (insect) species. It has become clear that the very same AMPs play different roles in different situations and hence are under concurrent selection. (iv) Different environments shape the physiology of organisms; especially the host-associated microbial communities should impact on the evolution host AMPs. Studies in social insects and some organisms from extreme environments seem to support this notion, but, overall, the evidence for adaptation of AMPs to a given environment is scant. (v) AMPs are considered or already developed as new drugs in medicine. However, bacteria can evolve resistance to AMPs. Therefore, in the light of our

  3. Antimicrobial peptides from skin secretions of Hypsiboas pulchellus (Anura: Hylidae).

    PubMed

    Siano, Alvaro; Húmpola, María Verónica; de Oliveira, Eliandre; Albericio, Fernando; Simonetta, Arturo C; Lajmanovich, Rafael; Tonarelli, Georgina G

    2014-04-25

    The skin of many amphibians produces a large repertoire of antimicrobial peptides that are crucial in the first line of defense against microbial invasion. Despite the immense richness of wild amphibians in Argentina, knowledge about peptides with antimicrobial properties is limited to a few species. Here we used LC-MS-MS to analyze samples of Hypsiboas pulchellus skin with the aim to identify antimicrobial peptides in the mass range of 1000 to 2000 Da. Twenty-three novel sequences were identified by MS, three of which were selected for chemical synthesis and further studies. The three synthetic peptides, named P1-Hp-1971, P2-Hp-1935, and P3-Hp-1891, inhibited the growth of two ATCC strains: Escherichia coli (MIC: 16, 33, and 17 μM, respectively) and Staphylococcus aureus (MIC: 8, 66, and 17 μM, respectively). P1-Hp-1971 and P3-Hp-1891 were the most active peptides. P1-Hp-1971, which showed the highest therapeutic indices (40 for E. coli and 80 for S. aureus), is a proline-glycine-rich peptide with a highly unordered structure, while P3-Hp-1891 adopts an amphipathic α-helical structure in the presence of 2,2,2-trifluoroethanol and anionic liposomes. This is the first peptidomic study of Hypsiboas pulchellus skin secretions to allow the identification of antimicrobial peptides.

  4. The role of oct-1 in the regulation of tracheal antimicrobial peptide (TAP) and lingual antimicrobial peptide (LAP) expression in bovine mammary epithelial cells.

    PubMed

    Yang, Jun; Sang, Yongming; Meade, Kieran G; Ross, Chris

    2011-11-01

    Lingual antimicrobial peptide (LAP) and tracheal antimicrobial peptide (TAP) are two important β-defensins of antimicrobial peptide family, which are evolutionarily conserved effector molecules of the innate immune response. Although known to be sensitive to pathogenic challenge, the control of their expression remains unclear. Both LAP and TAP genes showed constitutive and inducible expression in bovine mammary epithelial tissues, and the aim of this study was to investigate the mechanisms underlying their expression and regulation. Reporter plasmids fused with 5' regions of the two gene promoter regions were constructed and transiently transfected into a bovine mammary epithelial (BME) cell line. Initial serial deletion of the promoter regions from both genes identified two positive regulatory elements within the 1 kb regions upstream the transcription start sites, which co-operatively contribute to LAP and TAP gene expression. Further luciferase reporter assays revealed that an enhancer and a 61-bp region proximal to both genes are important for basal expression and regulation of transcription. Electrophoretic mobility shift assays (EMSA) indicated the involvement of the Oct-1 protein-DNA complex in regulating the promoter activity, which was confirmed by super shift EMSA with Oct-1 antibody and by knockdown of Oct-1 with small interfering RNA. The Oct-1 binding motif was also shown to be responsive to phorbol 12-myristate 13-acetate but not LPS stimulation. The results from this study clearly demonstrate the involvement of the Oct-1 transcription factor in the regulation of LAP and TAP expression.

  5. Evolution of Antimicrobial Peptides to Self-Assembled Peptides for Biomaterial Applications

    PubMed Central

    McCloskey, Alice P.; Gilmore, Brendan F.; Laverty, Garry

    2014-01-01

    Biomaterial-related infections are a persistent burden on patient health, recovery, mortality and healthcare budgets. Self-assembled antimicrobial peptides have evolved from the area of antimicrobial peptides. Peptides serve as important weapons in nature, and increasingly medicine, for combating microbial infection and biofilms. Self-assembled peptides harness a “bottom-up” approach, whereby the primary peptide sequence may be modified with natural and unnatural amino acids to produce an inherently antimicrobial hydrogel. Gelation may be tailored to occur in the presence of physiological and infective indicators (e.g. pH, enzymes) and therefore allow local, targeted antimicrobial therapy at the site of infection. Peptides demonstrate inherent biocompatibility, antimicrobial activity, biodegradability and numerous functional groups. They are therefore prime candidates for the production of polymeric molecules that have the potential to be conjugated to biomaterials with precision. Non-native chemistries and functional groups are easily incorporated into the peptide backbone allowing peptide hydrogels to be tailored to specific functional requirements. This article reviews an area of increasing interest, namely self-assembled peptides and their potential therapeutic applications as innovative hydrogels and biomaterials in the prevention of biofilm-related infection. PMID:25436505

  6. Role of Arginine and Lysine in the Antimicrobial Mechanism of Histone-derived Antimicrobial Peptides

    PubMed Central

    Cutrona, Kara J.; Kaufman, Bethany A.; Figueroa, Dania M.; Elmore, Donald E.

    2015-01-01

    Translocation of cell-penetrating peptides is often promoted by increased content of arginine or other guanidinum groups. However, relatively little research has considered the role of these functional groups on antimicrobial peptide activity. This study compared the activity of three histone-derived antimicrobial peptides—buforin II, DesHDAP1, and parasin— with variants that contain only lysine or arginine cationic residues. These peptides operate via different mechanisms as parasin causes membrane permeabilization while buforin II and DesHDAP1 translocate into bacteria. For all peptides, antibacterial activity increased with increased arginine content. Higher arginine content increased permeabilization for parasin while it improved translocation for buforin II and DesHDAP1. These observations provide insight into the relative importance of arginine and lysine in these antimicrobial peptides. PMID:26555191

  7. [Role of antimicrobial peptides (AMP) and pattern recognition receptors (PRR) in the intestinal mucosa homeostasis].

    PubMed

    Lapis, Károly

    2009-11-22

    Homeostasis and integrity of bowel mucosa is assured by well controlled mechanical, biochemical and immunological mechanisms. First line of defense is presented by the antimicrobial peptides (AMP), which form a continuous layer on the bowel surface, produced by intestinal specific (Paneth) and non-specific epithelial cells. AMPs have a significant antimicrobial, antifungal and antiviral, as well as immunomodulatory effects. Next line of defense is the pattern recognition receptors (PRR), which allows identifying conservative molecular patterns of different pathogens, and starts antimicrobial and inflammatory mechanisms through gene-expression induction. We review the most recent knowledge and studies concerning these mechanisms.

  8. Chlamydia-secreted protease CPAF degrades host antimicrobial peptides.

    PubMed

    Tang, Lingli; Chen, Jianlin; Zhou, Zhiguang; Yu, Ping; Yang, Zhangsheng; Zhong, Guangming

    2015-06-01

    Chlamydia trachomatis infection in the lower genital tract, if untreated, can ascend to the upper genital tract, potentially leading to complications such as tubal factor infertility. The ascension involves cell-to-cell spreading, which may require C. trachomatis organisms to overcome mucosal extracellular effectors such as antimicrobial peptides. We found that among the 8 antimicrobial peptides tested, the cathelicidin LL-37 that is produced by both urogenital epithelial cells and the recruited neutrophils possessed a most potent antichlamydial activity. Interestingly, this antichlamydial activity was completely inhibited by CPAF, a C. trachomatis-secreted serine protease. The inhibition was dependent on CPAF's proteolytic activity. CPAF selectively degraded LL-37 and other antimicrobial peptides with an antichlamydial activity. CPAF is known to secrete into and accumulate in the infected host cell cytoplasm at the late stage of chlamydial intracellular growth and may be released to confront the extracellular antimicrobial peptides before the intra-inclusion organisms are exposed to extracellular environments during host cell lysis and chlamydial spreading. Thus, the finding that CPAF selectively targets host antimicrobial peptides that possess antichlamydial activities for proteolysis suggests that CPAF may contribute to C. trachomatis pathogenicity by aiding in ascending infection.

  9. Antimicrobial polymers as synthetic mimics of host-defense peptides.

    PubMed

    Kuroda, Kenichi; Caputo, Gregory A

    2013-01-01

    Antibiotic-resistant bacteria 'superbugs' are an emerging threat to public health due to the decrease in effective antibiotics as well as the slowed pace of development of new antibiotics to replace those that become ineffective. The need for new antimicrobial agents is a well-documented issue relating to world health. Tremendous efforts have been given to developing compounds that not only show high efficacy, but also those that are less susceptible to resistance development in the bacteria. However, the development of newer, stronger antibiotics which can overcome these acquired resistances is still a scientific challenge because a new mode of antimicrobial action is likely required. To that end, amphiphilic, cationic polymers have emerged as a promising candidate for further development as an antimicrobial agent with decreased potential for resistance development. These polymers are designed to mimic naturally occurring host-defense antimicrobial peptides which act on bacterial cell walls or membranes. Antimicrobial-peptide mimetic polymers display antibacterial activity against a broad spectrum of bacteria including drug-resistant strains and are less susceptible to resistance development in bacteria. These polymers also showed selective activity to bacteria over mammalian cells. Antimicrobial polymers provide a new molecular framework for chemical modification and adaptation to tune their biological functions. The peptide-mimetic design of antimicrobial polymers will be versatile, generating a new generation of antibiotics toward implementation of polymers in biomedical applications. Copyright © 2012 Wiley Periodicals, Inc.

  10. Antimicrobial peptides from the venoms of Vespa bicolor Fabricius.

    PubMed

    Chen, Wenhu; Yang, Xinbo; Yang, Xiaolong; Zhai, Lei; Lu, Zekuan; Liu, Jingze; Yu, Haining

    2008-11-01

    Hornets possess highly toxic venoms, which are rich in toxins, enzymes and biologically active peptides. Many bioactive substances have been identified from wasp venoms. Vespa mastoparan (MP-VBs) and Vespa chemotatic peptide presenting antimicrobial action (VESP-VBs) were purified and characterized from the venom of the wasp, Vespa bicolor Fabricius. The precursors encoding VESP-VBs and MP-VBs were cloned from the cDNA library of the venomous glands. Analyzed by FAB-MS, the amino acid sequence and molecular mass for VESP-VB1 were FMPIIGRLMSGSL and 1420.6, for MP-VB1 were INMKASAAVAKKLL and 1456.5, respectively. The primary structures of these peptides are homologous to those of chemotactic peptides and mastoparans isolated from other vespid venoms. These peptides showed strong antimicrobial activities against bacteria and fungi and induced mast cell degranulation, but displayed almost no hemolytic activity towards human blood red cells.

  11. Leukocyte antimicrobial peptides: multifunctional effector molecules of innate immunity.

    PubMed

    Risso, A

    2000-12-01

    Antimicrobial peptides are effector molecules of innate immunity that provide a first line of defense against pathogens. In mammals, they are stored in granules of leukocytes and are present in those sites that are exposed to microbial invasion, such as mucosal surfaces and skin. In the last decade, biochemical investigations and recombinant DNA technology have allowed the identification and characterization of several antimicrobial peptides from various animal and vegetal species. Most of the mammalian peptides have been grouped in two broad families: defensins and cathelicidin-derived peptides. Functional studies have shown that the toxicity mechanisms for many peptides consist of a rapid permeabilization of the target cell membrane. In addition to their microbicidal activity, some members of both families are multifunctional molecules, playing a modulating role in the inflammation and the antigen-driven immune response.

  12. Improved Methods for Classification, Prediction and Design of Antimicrobial Peptides

    PubMed Central

    Wang, Guangshun

    2015-01-01

    Peptides with diverse amino acid sequences, structures and functions are essential players in biological systems. The construction of well-annotated databases not only facilitates effective information management, search and mining, but also lays the foundation for developing and testing new peptide algorithms and machines. The antimicrobial peptide database (APD) is an original construction in terms of both database design and peptide entries. The host defense antimicrobial peptides (AMPs) registered in the APD cover the five kingdoms (bacteria, protists, fungi, plants, and animals) or three domains of life (bacteria, archaea, and eukaryota). This comprehensive database (http://aps.unmc.edu/AP) provides useful information on peptide discovery timeline, nomenclature, classification, glossary, calculation tools, and statistics. The APD enables effective search, prediction, and design of peptides with antibacterial, antiviral, antifungal, antiparasitic, insecticidal, spermicidal, anticancer activities, chemotactic, immune modulation, or anti-oxidative properties. A universal classification scheme is proposed herein to unify innate immunity peptides from a variety of biological sources. As an improvement, the upgraded APD makes predictions based on the database-defined parameter space and provides a list of the sequences most similar to natural AMPs. In addition, the powerful pipeline design of the database search engine laid a solid basis for designing novel antimicrobials to combat resistant superbugs, viruses, fungi or parasites. This comprehensive AMP database is a useful tool for both research and education. PMID:25555720

  13. Sparse Neural Network Models of Antimicrobial Peptide-Activity Relationships.

    PubMed

    Müller, Alex T; Kaymaz, Aral C; Gabernet, Gisela; Posselt, Gernot; Wessler, Silja; Hiss, Jan A; Schneider, Gisbert

    2016-12-01

    We present an adaptive neural network model for chemical data classification. The method uses an evolutionary algorithm for optimizing the network structure by seeking sparsely connected architectures. The number of hidden layers, the number of neurons in each layer and their connectivity are free variables of the system. We used the method for predicting antimicrobial peptide activity from the amino acid sequence. Visualization of the evolved sparse network structures suggested a high charge density and a low aggregation potential in solution as beneficial for antimicrobial activity. However, different training data sets and peptide representations resulted in greatly varying network structures. Overall, the sparse network models turned out to be less accurate than fully-connected networks. In a prospective application, we synthesized and tested 10 de novo generated peptides that were predicted to either possess antimicrobial activity, or to be inactive. Two of the predicted antibacterial peptides showed cosiderable bacteriostatic effects against both Staphylococcus aureus and Escherichia coli. None of the predicted inactive peptides possessed antibacterial properties. Molecular dynamics simulations of selected peptide structures in water and TFE suggest a pronounced peptide helicity in a hydrophobic environment. The results of this study underscore the applicability of neural networks for guiding the computer-assisted design of new peptides with desired properties.

  14. Host Antimicrobial Peptides in Bacterial Homeostasis and Pathogenesis of Disease

    PubMed Central

    Heimlich, Derek R.; Harrison, Alistair; Mason, Kevin M.

    2014-01-01

    Innate immune responses function as a first line of host defense against the development of bacterial infection, and in some cases to preserve the sterility of privileged sites in the human host. Bacteria that enter these sites must counter host responses for colonization. From the host’s perspective, the innate immune system works expeditiously to minimize the bacterial threat before colonization and subsequent dysbiosis. The multifactorial nature of disease further challenges predictions of how each independent variable influences bacterial pathogenesis. From bacterial colonization to infection and through disease, the microenvironments of the host are in constant flux as bacterial and host factors contribute to changes at the host-pathogen interface, with the host attempting to eradicate bacteria and the bacteria fighting to maintain residency. A key component of this innate host response towards bacterial infection is the production of antimicrobial peptides (AMPs). As an early component of the host response, AMPs modulate bacterial load and prevent establishment of infection. Under quiescent conditions, some AMPs are constitutively expressed by the epithelium. Bacterial infection can subsequently induce production of other AMPs in an effort to maintain sterility, or to restrict colonization. As demonstrated in various studies, the absence of a single AMP can influence pathogenesis, highlighting the importance of AMP concentration in maintaining homeostasis. Yet, AMPs can increase bacterial virulence through the co-opting of the peptides or alteration of bacterial virulence gene expression. Further, bacterial factors used to subvert AMPs can modify host microenvironments and alter colonization of the residential flora that principally maintain homeostasis. Thus, the dynamic interplay between host defense peptides and bacterial factors produced to quell peptide activity play a critical role in the progression and outcome of disease. PMID:26029470

  15. Host Antimicrobial Peptides in Bacterial Homeostasis and Pathogenesis of Disease.

    PubMed

    Heimlich, Derek R; Harrison, Alistair; Mason, Kevin M

    2014-12-01

    Innate immune responses function as a first line of host defense against the development of bacterial infection, and in some cases to preserve the sterility of privileged sites in the human host. Bacteria that enter these sites must counter host responses for colonization. From the host's perspective, the innate immune system works expeditiously to minimize the bacterial threat before colonization and subsequent dysbiosis. The multifactorial nature of disease further challenges predictions of how each independent variable influences bacterial pathogenesis. From bacterial colonization to infection and through disease, the microenvironments of the host are in constant flux as bacterial and host factors contribute to changes at the host-pathogen interface, with the host attempting to eradicate bacteria and the bacteria fighting to maintain residency. A key component of this innate host response towards bacterial infection is the production of antimicrobial peptides (AMPs). As an early component of the host response, AMPs modulate bacterial load and prevent establishment of infection. Under quiescent conditions, some AMPs are constitutively expressed by the epithelium. Bacterial infection can subsequently induce production of other AMPs in an effort to maintain sterility, or to restrict colonization. As demonstrated in various studies, the absence of a single AMP can influence pathogenesis, highlighting the importance of AMP concentration in maintaining homeostasis. Yet, AMPs can increase bacterial virulence through the co-opting of the peptides or alteration of bacterial virulence gene expression. Further, bacterial factors used to subvert AMPs can modify host microenvironments and alter colonization of the residential flora that principally maintain homeostasis. Thus, the dynamic interplay between host defense peptides and bacterial factors produced to quell peptide activity play a critical role in the progression and outcome of disease.

  16. Antimicrobial peptide coatings for hydroxyapatite: electrostatic and covalent attachment of antimicrobial peptides to surfaces.

    PubMed

    Townsend, Leigh; Williams, Richard L; Anuforom, Olachi; Berwick, Matthew R; Halstead, Fenella; Hughes, Erik; Stamboulis, Artemis; Oppenheim, Beryl; Gough, Julie; Grover, Liam; Scott, Robert A H; Webber, Mark; Peacock, Anna F A; Belli, Antonio; Logan, Ann; de Cogan, Felicity

    2017-01-01

    The interface between implanted devices and their host tissue is complex and is often optimized for maximal integration and cell adhesion. However, this also gives a surface suitable for bacterial colonization. We have developed a novel method of modifying the surface at the material-tissue interface with an antimicrobial peptide (AMP) coating to allow cell attachment while inhibiting bacterial colonization. The technology reported here is a dual AMP coating. The dual coating consists of AMPs covalently bonded to the hydroxyapatite surface, followed by deposition of electrostatically bound AMPs. The dual approach gives an efficacious coating which is stable for over 12 months and can prevent colonization of the surface by both Gram-positive and Gram-negative bacteria.

  17. De Novo Designed Synthetic Mimics of Antimicrobial Peptides

    PubMed Central

    Scott, Richard W.; DeGrado, William F.; Tew, Gregory N.

    2008-01-01

    Summary Antimicrobial peptides are small cationic amphiphiles that play an important role in the innate immune system. Given their broad specificity, they appear to be ideal therapeutic agents. As a result, over the last decade, there has been considerable interest in developing them as intravenously administered antibiotics. However, it has proven difficult to accomplish this goal with peptide-based structures. While it has been possible to solve some relatively simple problems such as susceptibility to proteolysis, more severe problems have included the expense of the materials, toxicity, limited efficacy, and limited tissue distribution. As a result, we developed small synthetic oligomers designed to adopt amphiphilic conformations and exhibit potent antimicrobial activity while being non-toxic to host cells. One class of these synthetic mimics of antimicrobial peptides (SMAMPs) is being developed as intravenous antibiotics PMID:18996193

  18. Insights into Antimicrobial Peptides from Spiders and Scorpions.

    PubMed

    Wang, Xiuqing; Wang, Guangshun

    2016-01-01

    The venoms of spiders and scorpions contain a variety of chemical compounds. Antimicrobial peptides (AMPs) from these organisms were first discovered in the 1990s. As of May 2015, there were 42 spider's and 63 scorpion's AMPs in the Antimicrobial Peptide Database (http://aps.unmc.edu/AP). These peptides have demonstrated broad or narrow-spectrum activities against bacteria, fungi, viruses, and parasites. In addition, they can be toxic to cancer cells, insects and erythrocytes. To provide insight into such an activity spectrum, this article discusses the discovery, classification, structure and activity relationships, bioinformatics analysis, and potential applications of spider and scorpion AMPs. Our analysis reveals that, in the case of linear peptides, spiders use both glycine-rich and helical peptide models for defense, whereas scorpions use two distinct helical peptide models with different amino acid compositions to exert the observed antimicrobial activities and hemolytic toxicity. Our structural bioinformatics study improves the knowledge in the field and can be used to design more selective peptides to combat tumors, parasites, and viruses.

  19. Insights into Antimicrobial Peptides from Spiders and Scorpions

    PubMed Central

    Wang, Xiuqing; Wang, Guangshun

    2015-01-01

    The venoms of spiders and scorpions contain a variety of chemical compounds. Antimicrobial peptides (AMPs) from these organisms were first discovered in the 1990s. As of May 2015, there were 42 spider’s and 63 scorpion’s AMPs in the Antimicrobial Peptide Database (http://aps.unmc.edu/AP). These peptides have demonstrated broad or narrow-spectrum activities against bacteria, fungi, viruses, and parasites. In addition, they can be toxic to cancer cells, insects and erythrocytes. To provide insight into such an activity spectrum, this article discusses the discovery, classification, structure and activity relationships, bioinformatics analysis, and potential applications of spider and scorpion AMPs. Our analysis reveals that, in the case of linear peptides, spiders use both glycine-rich and helical peptide models for defense, whereas scorpions use two distinct helical peptide models with different amino acid compositions to exert the observed antimicrobial activities and hemolytic toxicity. Our structural bioinformatics study improves the knowledge in the field and can be used to design more selective peptides to combat tumors, parasites, and viruses. PMID:27165405

  20. Antimicrobial peptide defenses against pathogens associated with global amphibian declines.

    PubMed

    Rollins-Smith, Louise A; Doersam, Jennifer K; Longcore, Joyce E; Taylor, Sharon K; Shamblin, Jessica C; Carey, Cynthia; Zasloff, Michael A

    2002-01-01

    Global declines of amphibian populations are a source of great concern. Several pathogens that can infect the skin have been implicated in the declines. The pathogen most frequently associated with recent die-offs is a chytrid fungus, Batrachochytrium dendrobatidis. A second fungus, Basidiobolus ranarum, was isolated from declining populations of Wyoming toads. A third pathogen, Aeromonas hydrophila, is an opportunistic bacterium found in healthy frogs, but capable of inducing disease. Among the immune defense mechanisms used by amphibians is the production of antimicrobial peptides in granular glands in the skin. These packets of natural antibiotics can be emptied onto the skin when the amphibian is injured. To determine whether antimicrobial skin peptides defend against these amphibian pathogens, six peptides (magainin I, magainin II, PGLa, CPF, ranalexin, and dermaseptin), from three species, and representing three structurally different families of peptides, were tested in growth inhibition assays. We show here that the peptides can kill or inhibit growth of both fungi but not Aeromonas. Although each peptide varied in its effectiveness, at least one from each species was effective against both fungi at a concentration of about 10-20 microM. This is the first direct evidence that antimicrobial peptides in the skin can operate as a first line of defense against the organisms associated with global amphibian declines. It suggests that this innate defense mechanism may play a role in preventing or limiting infection by these organisms.

  1. IQ-motif peptides as novel anti-microbial agents.

    PubMed

    McLean, Denise T F; Lundy, Fionnuala T; Timson, David J

    2013-04-01

    The IQ-motif is an amphipathic, often positively charged, α-helical, calmodulin binding sequence found in a number of eukaryote signalling, transport and cytoskeletal proteins. They share common biophysical characteristics with established, cationic α-helical antimicrobial peptides, such as the human cathelicidin LL-37. Therefore, we tested eight peptides encoding the sequences of IQ-motifs derived from the human cytoskeletal scaffolding proteins IQGAP2 and IQGAP3. Some of these peptides were able to inhibit the growth of Escherichia coli and Staphylococcus aureus with minimal inhibitory concentrations (MIC) comparable to LL-37. In addition some IQ-motifs had activity against the fungus Candida albicans. This antimicrobial activity is combined with low haemolytic activity (comparable to, or lower than, that of LL-37). Those IQ-motifs with anti-microbial activity tended to be able to bind to lipopolysaccharide. Some of these were also able to permeabilise the cell membranes of both Gram positive and Gram negative bacteria. These results demonstrate that IQ-motifs are viable lead sequences for the identification and optimisation of novel anti-microbial peptides. Thus, further investigation of the anti-microbial properties of this diverse group of sequences is merited.

  2. The dynamic action mechanism of small cationic antimicrobial peptides.

    PubMed

    Lopez Cascales, J J; Garro, A; Porasso, R D; Enriz, R D

    2014-10-21

    Antimicrobial peptides form part of the immune system as protection against the action of external pathogens. The differences that exist between mammalian and microbial cell membrane architectures are key aspects of the ability of these peptides to discriminate between pathogens and host cells. Given that the pathogen membrane is the non-specific target of these cationic peptides, different molecular mechanisms have been suggested to describe the rules that permit them to distinguish between pathogens and mammalian cells. In this context, and setting aside the old fashion idea that cationic peptides act through one mechanism alone, this work will provide insight into the molecular action mechanism of small antimicrobial peptides, based on molecular dynamics simulations of phospholipid bilayers that mimic different cell membrane architectures. After measuring different properties of these lipid bilayers, in the absence and presence of peptides, a four-step action mechanism was suggested on the basis of the formation of phospholipid rafts induced by the presence of these cationic peptides. Thus, this work shows how differences in the bending modulus (k(b)) of these lipid rafts and differences in the free energy profiles (ΔG(z)) associated with the insertion of these peptides into these lipid rafts are key aspects for explaining the action mechanism of these cationic peptides at the molecular level.

  3. Discovering new in silico tools for antimicrobial peptide prediction.

    PubMed

    Torrent, Marc; Nogués, M Victòria; Boix, Ester

    2012-08-01

    Antimicrobial peptides (AMPs) are important effectors of the innate immune system and play a vital role in the prevention of infections. Due to the increased emergence of new antibiotic-resistant bacteria, new drugs are constantly under investigation. AMPs in particular are recognized as promising candidates because of their modularity and wide antimicrobial spectrum. However, the mechanisms of action of AMPs, as well as their structure-activity relationships, are not completely understood. AMPs display no conserved three-dimensional structure and poor sequence conservation, which hinders rational design. Several bioinformatics tools have been developed to generate new templates with appealing antimicrobial properties with the aim of finding highly active peptide compounds with low cytotoxicity. The current tools reviewed here allow for the prediction and design of new active peptides with reasonable accuracy. However, a reliable method to assess the antimicrobial activity of AMPs has not yet been developed. The standardization of procedures to experimentally evaluate the antimicrobial activity of AMPs, together with the constant growth of current well-established databases, may allow for the future development of new bioinformatics tools to accurately predict antimicrobial activity.

  4. Analysis of expressed sequence tags (ESTs) from avocado seed (Persea americana var. drymifolia) reveals abundant expression of the gene encoding the antimicrobial peptide snakin.

    PubMed

    Guzmán-Rodríguez, Jaquelina J; Ibarra-Laclette, Enrique; Herrera-Estrella, Luis; Ochoa-Zarzosa, Alejandra; Suárez-Rodríguez, Luis María; Rodríguez-Zapata, Luis C; Salgado-Garciglia, Rafael; Jimenez-Moraila, Beatriz; López-Meza, Joel E; López-Gómez, Rodolfo

    2013-09-01

    Avocado is one of the most important fruits in the world. Avocado "native mexicano" (Persea americana var. drymifolia) seeds are widely used in the propagation of this plant and are the primary source of rootstocks globally for a variety of avocado cultivars, such as the Hass avocado. Here, we report the isolation of 5005 ESTs from the 5' ends of P. americana var. drymifolia seed cDNA clones representing 1584 possible unigenes. These avocado seed ESTs were compared with the avocado flower EST library, and we detected several genes that are expressed either in both tissues or only in the seed. The snakin gene, which encodes an element of the innate immune response in plants, was one of those most frequently found among the seed ESTs, and this suggests that it is abundantly expressed in the avocado seed. We expressed the snakin gene in a heterologous system, namely the bovine endothelial cell line BVE-E6E7. Conditioned media from transfected BVE-E6E7 cells showed antimicrobial activity against strains of Escherichia coli and Staphylococcus aureus. This is the first study of the function of the snakin gene in plant seed tissue, and our observations suggest that this gene might play a protective role in the avocado seed.

  5. Convergent evolution-guided design of antimicrobial peptides derived from influenza A virus hemagglutinin.

    PubMed

    Zhu, Shunyi; Aumelas, André; Gao, Bin

    2011-02-24

    Antimicrobial activity and solution structures of four 13-amino acid peptides derived from the fusion domain of viral hemagglutinin proteins are presented. The results show that carboxyl-terminal amidation is a key factor to switch a viral fusion domain-derived sequence into an antimicrobial peptide. Optimization of amphiphilic balance on the amidated analogue largely improves efficacy and enlarges antimicrobial spectra of these peptides. Our work indicates that viral fusion domains have potential to be engineered into potent antimicrobial peptides.

  6. Imaging the action of antimicrobial peptides on living bacterial cells

    PubMed Central

    Gee, Michelle L.; Burton, Matthew; Grevis-James, Alistair; Hossain, Mohammed Akhter; McArthur, Sally; Palombo, Enzo A.; Wade, John D.; Clayton, Andrew H. A.

    2013-01-01

    Antimicrobial peptides hold promise as broad-spectrum alternatives to conventional antibiotics. The mechanism of action of this class of peptide is a topical area of research focused predominantly on their interaction with artificial membranes. Here we compare the interaction mechanism of a model antimicrobial peptide with single artificial membranes and live bacterial cells. The interaction kinetics was imaged using time-lapse fluorescence lifetime imaging of a fluorescently-tagged melittin derivative. Interaction with the synthetic membranes resulted in membrane pore formation. In contrast, the interaction with bacteria led to transient membrane disruption and corresponding leakage of the cytoplasm, but surprisingly with a much reduced level of pore formation. The discovery that pore formation is a less significant part of lipid-peptide interaction in live bacteria highlights the mechanistic complexity of these interactions in living cells compared to simple artificial systems. PMID:23532056

  7. Novel antimicrobial peptides identified from an endoparasitic wasp cDNA library.

    PubMed

    Shen, Xiaojing; Ye, Gongyin; Cheng, Xiongying; Yu, Chunyan; Yao, Hongwei; Hu, Cui

    2010-01-01

    We screened an endoparasitic wasp (Pteromalus puparum) cDNA library for DNA sequences having antimicrobial activity using a vital dye exclusion assay. Two dozens of clones were isolated that inhibited the growth of host Escherichia coli cells due to expression of the cloned genes. Three peptides (PP13, PP102 and PP113) were synthesized chemically based on the amino acid sequences deduced from these clones and assayed for their antimicrobial activity. These peptides have net positive charges and are active against both Gram-negative and -positive bacteria, but are not active against fungi tested. Their hemolytic activity on human red blood cells was measured, and no hemolytic activity was observed after 1-h incubation at a concentration of 62.5 microM or below. A Blast search indicated that the three peptides have not been previously characterized as antimicrobial peptides (AMPs). Salt-dependency studies revealed that the biocidal activity of these peptides against E. coli decreased with increasing concentration of NaCl. Transmission electron microscopic (TEM) examination of PP13-treated E. coli cells showed extensive damage of cell membranes. The CD spectroscopy studies noted that the enhanced alpha-helical characteristics of PP13 strongly contribute to its higher antimicrobial properties. These results demonstrate the feasibility to identify novel AMPs by screening the expressional cDNA library.

  8. Chemical and genetic characterization of bacteriocins: antimicrobial peptides for food safety.

    PubMed

    Snyder, Abigail B; Worobo, Randy W

    2014-01-15

    Antimicrobial peptides are produced across all domains of life. Among these diverse compounds, those produced by bacteria have been most successfully applied as agents of biocontrol in food and agriculture. Bacteriocins are ribosomally synthesized, proteinaceous compounds that inhibit the growth of closely related bacteria. Even within the subcategory of bacteriocins, the peptides vary significantly in terms of the gene cluster responsible for expression, and chemical and structural composition. The polycistronic gene cluster generally includes a structural gene and various combinations of immunity, secretion, and regulatory genes and modifying enzymes. Chemical variation can exist in amino acid identity, chain length, secondary and tertiary structural features, as well as specificity of active sites. This diversity posits bacteriocins as potential antimicrobial agents with a range of functions and applications. Those produced by food-grade bacteria and applied in normally occurring concentrations can be used as GRAS-status food additives. However, successful application requires thorough characterization. © 2013 Society of Chemical Industry.

  9. Antimicrobial peptides: a new class of antimalarial drugs?

    PubMed Central

    Vale, Nuno; Aguiar, Luísa; Gomes, Paula

    2014-01-01

    A range of antimicrobial peptides (AMP) exhibit activity on malaria parasites, Plasmodium spp., in their blood or mosquito stages, or both. These peptides include a diverse array of both natural and synthetic molecules varying greatly in size, charge, hydrophobicity, and secondary structure features. Along with an overview of relevant literature reports regarding AMP that display antiplasmodial activity, this review makes a few considerations about those molecules as a potential new class of antimalarial drugs. PMID:25566072

  10. A novel C-type lectin with four CRDs is involved in the regulation of antimicrobial peptide gene expression in Hyriopsis cumingii.

    PubMed

    Zhao, Ling-Ling; Wang, Yu-Qing; Dai, Yun-Jia; Zhao, Li-Juan; Qin, Qiwei; Lin, Li; Ren, Qian; Lan, Jiang-Feng

    2016-08-01

    C-type lectins (CTLs) are found in a wide number of invertebrates, and have been reported to participate in immune responses, such as the activation of prophenoloxidase, cell adhesion, bacterial clearance and phagocytosis. Previous studies on CTLs focused on the function of their carbohydrate recognition domains (CRDs). Currently, studies on lectins with multi-CRDs are limited. In this study, a lectin with four CRDs was cloned from Hyriopsis cumingii, and called HcLec4. HcLec4 was widely distributed in several tissues and was significantly down-regulated at the early stage (2 h) of bacterial infection. We further analyzed the bacteria and carbohydrate binding activities of HcLec4. The results showed that HcLec4 could bind to several bacteria, lipopolysaccharide (LPS) and peptidoglycan (PGN). In HcLec4 knockdown mussels, the bacterial clearance rate was increased, and the expression level of antimicrobial peptides (AMPs) was up-regulated. This study reveals that HcLec4 exerts its antibacterial effect by regulating the expression of AMPs at the early stage of bacterial infection. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Identification of candidate antimicrobial peptides derived from abalone hemocyanin.

    PubMed

    Zhuang, Jun; Coates, Christopher J; Zhu, Hongtao; Zhu, Ping; Wu, Zujian; Xie, Lianhui

    2015-03-01

    Hemocyanins present in invertebrate hemolymph are multifunctional proteins, responsible for oxygen transport and contributing to innate immunity through phenoloxidase-like activity. In arthropods, hemocyanin has been identified as a source of broad-spectrum antimicrobial peptides during infection. Conversely, no hemocyanin-derived antimicrobial peptides have been reported for molluscs. The present study describes a putative antimicrobial region, termed haliotisin, located within the linking sequence between the α-helical domain and β-sheet domain of abalone (Haliotis tuberculata) hemocyanin functional unit E. A series of synthetic peptides based on overlapping fragments of the haliotisin region were tested for their bactericidal potential. Incubating Gram-positive and Gram-negative bacteria in the presence of certain haliotisin peptides, notably peptides 3-4-5 (DTFDYKKFGYRYDSLELEGRSISRIDELIQQRQEKDRTFAGFLLKGFGTSAS) led to reductions in microbial growth. Furthermore, transmission electron micrographs of haliotisin-treated bacteria revealed damages to the microbial cell wall. Data discussed here provides the first evidence to suggest that molluscan hemocyanin may act as a source of anti-infective peptides.

  12. cDNA cloning, characterization and expression analysis of a novel antimicrobial peptide gene penaeidin-3 (Fi-Pen3) from the haemocytes of Indian white shrimp Fenneropenaeus indicus.

    PubMed

    Shanthi, S; Vaseeharan, B

    2012-03-20

    A new member of antimicrobial peptide genes of the penaeidin family, penaeidin 3, was cloned from the haemocytes of Indian white shrimp Fenneropeneaus indicus (F. indicus), by reverse transcription PCR (RT-PCR) and rapid amplification of cDNA end (RACE-PCR) methods. The complete nucleotide sequence of cDNA clone of Indian white shrimp F. indicus Penaeidin 3 (Fi-Pen3) was 243bp long and has an open reading frame which encodes 80 amino acid peptide. The homology analysis of Fi-Pen3 sequence with other Penaeidins 3 shows higher similarity with Penaeus monodon (92%). The theoretical 3D structure generated through ab initio modelling indicated the presence of two-disulphide bridges in the alpha-helix. The signal peptide sequence of Fi-Pen3 is almost entirely homologous to that of other Penaeidin 3 of crustaceans, while differing relatively in the N-terminal domain of the mature peptide. The mature peptide has a predicted molecular weight of 84.9kDa, and a theoretical pI of 9.38. Phylogenetic analysis of Fi-Pen3 shows high resemblance with other Pen-3 from P. monodon, Litopenaeus stylirostris, Litopenaeus vannamei and Litopenaeus setiferus. Fi-Pen3 found to be expressed in haemocytes, heart, hepatopancreas, muscles, gills, intestine, and eyestalk with higher expression in haemocytes. Microbial challenge resulted in mRNA up-regulation, up to 6h post injection of Vibrio parahemolyticus. The Fi-Pen3 mRNA expression of F. indicus in the premolt stage (D(01) and D(02)) was significantly up-regulated than the postmolt (A and B) and intermolt stages (C). The findings of the present paper underline the involvement of Fi-Pen3 in innate immune system of F. indicus.

  13. Linear antimicrobial peptides from Ectatomma quadridens ant venom.

    PubMed

    Pluzhnikov, Kirill A; Kozlov, Sergey A; Vassilevski, Alexander A; Vorontsova, Olga V; Feofanov, Alexei V; Grishin, Eugene V

    2014-12-01

    Venoms from three poneromorph ant species (Paraponera clavata, Ectatomma quadridens and Ectatomma tuberculatum) were investigated for the growth inhibition of Gram-positive and Gram-negative bacteria. It was shown that the venom of E. quadridens and its peptide fraction in particular possess marked antibacterial action. Three linear antimicrobial peptides sharing low similarity to the well-known ponericin peptides were isolated from this ant venom by means of size-exclusion and reversed-phase chromatography. The peptides showed antimicrobial activity at low micromolar concentrations. Their primary structure was established by direct Edman sequencing in combination with mass spectrometry. The most active peptide designated ponericin-Q42 was chemically synthesized. Its secondary structure was investigated in aqueous and membrane-mimicking environment, and the peptide was shown to be partially helical already in water, which is unusual for short linear peptides. Analysis of its activity on different bacterial strains, human erythrocytes and chronic myelogenous leukemia K562 cells revealed that the peptide shows broad spectrum cytolytic activity at micromolar and submicromolar concentrations. Ponericin-Q42 also possesses weak toxic activity on flesh fly larvae with LD50 of ∼105 μg/g.

  14. Antimicrobial potency and selectivity of simplified symmetric-end peptides.

    PubMed

    Dong, Na; Zhu, Xin; Chou, Shuli; Shan, Anshan; Li, Weizhong; Jiang, Junguang

    2014-09-01

    Because antimicrobial peptides (AMPs) are potentially useful for the treatment of multidrug-resistant infections, more attention is being paid to the structural modification and structure-function relationship of both naturally occurring and synthetic AMPs. Previous studies indicated that Protegrin-1 (PG-1), isolated from porcine leukocytes, exhibited considerable antimicrobial activity and cytotoxicity. The β-turn of PG-1 floated on the surface of bacterial membrane, while its β-strand inserted into the bacterial membrane and formed pores that were dedicated to producing cytotoxicity. For reducing cytotoxicity and improving cells selectivity, we designed a series of simplified symmetric-end peptides by combining the β-turn of PG-1 with simple amino acid repeat sequences. The sequence of designed symmetric-end peptides is (XR)nH(RX)n, (n = 1,2; X represents I, F, W and P; H represents CRRRFC). The symmetric-end peptides displayed antimicrobial activity against both gram-positive and gram-negative bacteria. In particular, (XR)2H(RX)2 (X here is I, F and W) showed greater antimicrobial potency than PG-1. Hemolysis activity and cytotoxicity, detected by using human red blood cells (RBCs) and human embryonic lung fibroblasts MRC-5 cells, were observably lower than the native peptide PG-1. (IR)2H(RI)2 (IR2), folded into β-sheet structures, displayed the highest therapeutic index, suggesting its great cell selectivity. The fluorescence spectroscopy, flow cytometry, and electron microscopy observation indicated that IR2 exhibited great membrane penetration potential by inducing membrane blebbing, disruption and lysis. Collectively, generating symmetric-end β-sheet peptides is a promising strategy for designing effective AMPs with great antimicrobial activities and cell selectivity.

  15. Lipid-Based Liquid Crystals As Carriers for Antimicrobial Peptides: Phase Behavior and Antimicrobial Effect.

    PubMed

    Boge, Lukas; Bysell, Helena; Ringstad, Lovisa; Wennman, David; Umerska, Anita; Cassisa, Viviane; Eriksson, Jonny; Joly-Guillou, Marie-Laure; Edwards, Katarina; Andersson, Martin

    2016-05-03

    The number of antibiotic-resistant bacteria is increasing worldwide, and the demand for novel antimicrobials is constantly growing. Antimicrobial peptides (AMPs) could be an important part of future treatment strategies of various bacterial infection diseases. However, AMPs have relatively low stability, because of proteolytic and chemical degradation. As a consequence, carrier systems protecting the AMPs are greatly needed, to achieve efficient treatments. In addition, the carrier system also must administrate the peptide in a controlled manner to match the therapeutic dose window. In this work, lyotropic liquid crystalline (LC) structures consisting of cubic glycerol monooleate/water and hexagonal glycerol monooleate/oleic acid/water have been examined as carriers for AMPs. These LC structures have the capability of solubilizing both hydrophilic and hydrophobic substances, as well as being biocompatible and biodegradable. Both bulk gels and discrete dispersed structures (i.e., cubosomes and hexosomes) have been studied. Three AMPs have been investigated with respect to phase stability of the LC structures and antimicrobial effect: AP114, DPK-060, and LL-37. Characterization of the LC structures was performed using small-angle X-ray scattering (SAXS), dynamic light scattering, ζ-potential, and cryogenic transmission electron microscopy (Cryo-TEM) and peptide loading efficacy by ultra performance liquid chromatography. The antimicrobial effect of the LCNPs was investigated in vitro using minimum inhibitory concentration (MIC) and time-kill assay. The most hydrophobic peptide (AP114) was shown to induce an increase in negative curvature of the cubic LC system. The most polar peptide (DPK-060) induced a decrease in negative curvature while LL-37 did not change the LC phase at all. The hexagonal LC phase was not affected by any of the AMPs. Moreover, cubosomes loaded with peptides AP114 and DPK-060 showed preserved antimicrobial activity, whereas particles loaded

  16. Characterization of the Antimicrobial Peptide Penisin, a Class Ia Novel Lantibiotic from Paenibacillus sp. Strain A3

    PubMed Central

    Baindara, Piyush; Chaudhry, Vasvi; Mittal, Garima; Liao, Luciano M.; Matos, Carolina O.; Khatri, Neeraj; Franco, Octavio L.; Patil, Prabhu B.

    2015-01-01

    Attempts to isolate novel antimicrobial peptides from microbial sources have been on the rise recently, despite their low efficacy in therapeutic applications. Here, we report identification and characterization of a new efficient antimicrobial peptide from a bacterial strain designated A3 that exhibited highest identity with Paenibacillus ehimensis. Upon purification and subsequent molecular characterization of the antimicrobial peptide, referred to as penisin, we found the peptide to be a bacteriocin-like peptide. Consistent with these results, RAST analysis of the entire genome sequence revealed the presence of a lantibiotic gene cluster containing genes necessary for synthesis and maturation of a lantibiotic. While circular dichroism and one-dimension nuclear magnetic resonance experiments confirmed a random coil structure of the peptide, similar to other known lantibiotics, additional biochemical evidence suggests posttranslational modifications of the core peptide yield six thioether cross-links. The deduced amino acid sequence of the putative biosynthetic gene penA showed approximately 74% similarity with elgicin A and 50% similarity with the lantibiotic paenicidin A. Penisin effectively killed methicillin-resistant Staphylococcus aureus (MRSA) and did not exhibit hemolysis activity. Unlike other lantibiotics, it effectively inhibited the growth of Gram-negative bacteria. Furthermore, 80 mg/kg of body weight of penisin significantly reduced bacterial burden in a mouse thigh infection model and protected BALB/c mice in a bacteremia model entailing infection with Staphylococcus aureus MTCC 96, suggesting that it could be a promising new antimicrobial peptide. PMID:26574006

  17. Selected antimicrobial peptides inhibit in vitro growth of Campylobacter spp.

    USDA-ARS?s Scientific Manuscript database

    Novel alternatives to traditional antibiotics are urgently needed for food-animal production. A goal of our laboratory is to develop and evaluate antimicrobial peptides (AMP) to control and reduce foodborne pathogens in poultry. AMP have been found in most every class of living organism where they h...

  18. Design of novel analogues of short antimicrobial peptide anoplin with improved antimicrobial activity.

    PubMed

    Wang, Yang; Chen, Jianbo; Zheng, Xin; Yang, Xiaoli; Ma, Panpan; Cai, Ying; Zhang, Bangzhi; Chen, Yuan

    2014-12-01

    Currently, novel antibiotics are urgently required to combat the emergence of drug-resistant bacteria. Antimicrobial peptides with membrane-lytic mechanism of action have attracted considerable interest. Anoplin, a natural α-helical amphiphilic antimicrobial peptide, is an ideal research template because of its short sequence. In this study, we designed and synthesized a group of analogues of anoplin. Among these analogues, anoplin-4 composed of D-amino acids displayed the highest antimicrobial activity due to increased charge, hydrophobicity and amphiphilicity. Gratifyingly, anoplin-4 showed low toxicity to host cells, indicating high bacterial selectivity. Furthermore, the mortality rate of mice infected with Escherichia coli was significantly reduced by anoplin-4 treatment relative to anoplin. In conclusion, anoplin-4 is a novel anoplin analogue with high antimicrobial activity and enzymatic stability, which may represent a potent agent for the treatment of infection.

  19. [Cationic antimicrobial peptides as molecular immunity factors: multi-functionality].

    PubMed

    Kokriakov, V N; Koval'chuk, L V; Aleshina, G M; Shamova, O V

    2006-01-01

    Cationic antimicrobial peptides (AMP) of mammals (defensins, cathelicidins, protegrins and many others) are regarded as important components of congenital immunity. AMP are multifunctional molecules, capable of killing microorganisms directly by acting as endogenic, natural antibiotics ("immediate immunity"); in addition, they may take part in congenital and adaptive immune reactions (immunoregulation) and function as signal molecules, involved into tissue reparation, inflammation (including sepsis), blood coagulation and other important processes in the body. The molecular mechanisms of the direct antimicrobial action of AMP are considered. In addition to antimicrobial and immunoregulating action, AMP have influence on immunoneuroendocrine interactions, taking part in the pathogenesis of stress reactions (corticostatic action), as well as play the role of regulatory peptides of adaptogenic action. The many-sided character of the action of AMP opens prospects to the creation of new medicinal remedies on their basis. Such requirements are met by the Russian preparation "Superlymph" (a complex of natural cytokines), containing protegrin-like AMP.

  20. De novo antimicrobial peptides with low mammalian cell toxicity.

    PubMed

    Javadpour, M M; Juban, M M; Lo, W C; Bishop, S M; Alberty, J B; Cowell, S M; Becker, C L; McLaughlin, M L

    1996-08-02

    De novo antimicrobial peptides with the sequences: (KLAKKLA)n, (KLAKLAK)n (where n = 1,2,3), (KALKALK)3, (KLGKKLG)n, and (KAAKKAA)n (where n = 2,3), were prepared as the C-terminus amides. These peptides were designed to be perfectly amphipathic in helical conformations. Peptide antibacterial activity was tested against Escherichia coli, Pseudomonas aeruginosa, and Staphylococcus aureus. Peptide cytotoxicity was tested against human erythrocytes and 3T3 mouse fibroblasts. The 3T3 cell testing was a much more sensitive test of cytotoxicity. The peptides were much less lytic toward human erythrocytes than 3T3 cells. Peptide secondary structure in aqueous solution, sodium dodecylsulfate micelles, and phospholipid vesicles was estimated using circular dichroism spectroscopy. The leucine/alanine-containing 21-mers were bacteriostatic at 3-8 microM and cytotoxic to 3T3 cells at about 10 microM concentrations. The leucine/alanine- or leucine/glycine-containing 14-mers and the leucine/glycine 21-mer were bacteriostatic at 6-22 microM but had much lower cytotoxicity toward 3T3 cells and higher selectivities than the natural antimicrobial peptides magainin 2 amide and cecropin B amide. The 7-mer peptides are devoid of biological activity and of secondary structure in membrane mimetic environments. The 14-mer peptides and the glycine-containing 21-mer show modest levels of helicity in model membranes. The leucine/alanine-containing 21-mer peptides have substantial helicity in model membranes. The propensity to alpha-helical conformation of the peptides in amphipathic media is proportional to their 3T3 cell cytotoxicity.

  1. Animal Venom Peptides: Potential for New Antimicrobial Agents.

    PubMed

    Primon-Barros, Muriel; José Macedo, Alexandre

    2017-01-01

    Microbial infections affect people worldwide, causing diseases with significant impact on public health, indicating the need for research and development of new antimicrobial agents. Animal venoms represent a vast and largely unexploited source of biologically active molecules with attractive candidates for the development of novel therapeutics. Venoms consist of complex mixtures of molecules, including antimicrobial peptides (AMPs). Since the discovery of AMPs, they have been studied as promising new antimicrobial drugs. Amongst the remarkable sources of AMPs with known antimicrobial activities are ants, bees, centipedes, cone snails, scorpions, snakes, spiders, and wasps. The antimicrobial tests against bacteria, protozoans, fungi and viruses using 170 different peptides isolated directly from crude venoms or cDNA libraries of venom glands are listed and discussed in this review, as well as hemolytic ativity. The potential of venoms as source of new compounds, including AMPs, is extensively discussed. Currently, there are six FDA-approved drugs and many others are undergoing preclinical and clinical trials. The search for antimicrobial "weapons" makes the AMPs from venoms promising candidates. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  2. Identification of novel human immunodeficiency virus type 1-inhibitory peptides based on the antimicrobial peptide database.

    PubMed

    Wang, Guangshun; Watson, Karen M; Peterkofsky, Alan; Buckheit, Robert W

    2010-03-01

    To identify novel anti-HIV-1 peptides based on the antimicrobial peptide database (APD; http://aps.unmc.edu/AP/main.php), we have screened 30 candidates and found 11 peptides with 50% effective concentrations (EC(50)) of <10 microM and therapeutic indices (TI) of up to 17. Furthermore, among the eight peptides (with identical amino acid compositions but different sequences) generated by shuffling the sequence of an aurein 1.2 analog, two had a TI twice that of the original sequence. Because antiviral peptides in the database have an arginine/lysine (R/K) ratio of >1, increases in the Arg contents of amphibian maximin H5 and dermaseptin S9 peptides and the database-derived GLK-19 peptide improved the TIs. These examples demonstrate that the APD is a rich resource and a useful tool for developing novel HIV-1-inhibitory peptides.

  3. Lipid selectivity in novel antimicrobial peptides: Implication on antimicrobial and hemolytic activity.

    PubMed

    Maturana, P; Martinez, M; Noguera, M E; Santos, N C; Disalvo, E A; Semorile, L; Maffia, P C; Hollmann, A

    2017-05-01

    Antimicrobial peptides (AMPs) are small cationic molecules that display antimicrobial activity against a wide range of bacteria, fungi and viruses. For an AMP to be considered as a therapeutic option, it must have not only potent antibacterial properties but also low hemolytic and cytotoxic activities [1]. Even though many studies have been conducted in order to correlate the antimicrobial activity with affinity toward model lipid membranes, the use of these membranes to explain cytotoxic effects (especially hemolysis) has been less explored. In this context, we studied lipid selectivity in two related novel AMPs, peptide 6 (P6) and peptide 6.2 (P6.2). Each peptide was designed from a previously reported AMP, and specific amino acid replacements were performed in an attempt to shift their hydrophobic moment or net charge. P6 showed no antimicrobial activity and high hemolytic activity, and P6.2 exhibited good antibacterial and low hemolytic activity. Using both peptides as a model we correlated the affinity toward membranes of different lipid composition and the antimicrobial and hemolytic activities. Our results from surface pressure and zeta potential assays showed that P6.2 exhibited a higher affinity and faster binding kinetic toward PG-containing membranes, while P6 showed this behavior for pure PC membranes. The final position and structure of P6.2 into the membrane showed an alpha-helix conversion, resulting in a parallel alignment with the Trps inserted into the membrane. On the other hand, the inability of P6 to adopt an amphipathic structure, plus its lower affinity toward PG-containing membranes seem to explain its poor antimicrobial activity. Regarding erythrocyte interactions, P6 showed the highest affinity toward erythrocyte membranes, resulting in an increased hemolytic activity. Overall, our data led us to conclude that affinity toward negatively charged lipids instead of zwitterionic ones seems to be a key factor that drives from hemolytic to

  4. Natural antimicrobial peptides as promising anti-HIV candidates

    PubMed Central

    Wang, Guangshun

    2015-01-01

    Human immunodeficiency virus type 1 (HIV-1) infection remains to be one of the major global health problems. It is thus necessary to identify novel therapeutic molecules to combat HIV-1. Natural antimicrobial peptides (AMPs) have been recognized as promising templates for developing topical microbicides. This review systematically discusses over 80 anti-HIV peptides annotated in the antimicrobial peptide database (http://aps.unmc.edu/AP). Such peptides have been discovered from bacteria, plants, and animals. Examples include gramicidin and bacteriocins from bacteria, cyclotides from plants, melittins and cecropins from insects, piscidins from fish, ascaphins, caerins, dermaseptins, esculentins, and maximins from amphibians, and cathelicidins and defensins from vertebrates. These peptides appear to work by different mechanisms and could block viral entry in multiple ways. As additional advantages, such anti-HIV peptides may possess other desired features such as antibacterial, antiparasital, spermicidal, and anticancer activity. With continued optimization of peptide stability, production, formulation and delivery methods, it is anticipated that some of these compounds may eventually become new anti-HIV drugs. PMID:26834391

  5. A potent antimicrobial peptide derived from the protein LsGRP1 of Lilium.

    PubMed

    Lin, Chia-Hua; Chang, Min-Wei; Chen, Chao-Ying

    2014-04-01

    LsGRP1 is a defense-related gene differentially expressed in lily leaves in response to pathogen attack. The difficulty in the expression of LsGRP1 in Escherichia coli suggested the presence of antimicrobial activity in LsGRP1. To evaluate the antimicrobial trait of LsGRP1, three LsGRP1-derived peptides were chemically synthesized; namely LsGRP1(N) (N-terminal region without the signal peptide), LsGRP1(G) (glycine-rich region), and LsGRP1(C) (C-terminal cysteine-rich region). LsGRP1(C) was proposed to be a potential antimicrobial agent according to its broad-spectrum and effective antimicrobial activity. LsGRP1(C) displayed inhibition effects on bacterial and fungal growth, possibly by altering the integrity of the cell membrane, as indicated by scanning electron microscopy and SYTOX Green staining assays. Additionally, LsGRP1(C) induced programmed cell death-like phenomenon in the tested fungal species as indicated by 2',7'-dichlorodihydrofluorescein diacetate and 4',6'-diamidino-2-phenylindole assays. Further immunofluorescence staining showed that LsGRP1(C) was located at the fungal cell surface. According to these observations, we concluded that LsGRP1(C) originated from the plant defense-related protein LsGRP1 would play a role as an antimicrobial peptide and have a potential for practical use.

  6. Sequence requirements and an optimization strategy for short antimicrobial peptides.

    PubMed

    Hilpert, Kai; Elliott, Melissa R; Volkmer-Engert, Rudolf; Henklein, Peter; Donini, Oreola; Zhou, Qun; Winkler, Dirk F H; Hancock, Robert E W

    2006-10-01

    Short antimicrobial host-defense peptides represent a possible alternative as lead structures to fight antibiotic resistant bacterial infections. Bac2A is a 12-mer linear variant of the naturally occurring bovine host defense peptide, bactenecin, and demonstrates moderate, broad-spectrum antimicrobial activity against Gram-positive and Gram-negative bacteria as well as against the yeast Candida albicans. With the assistance of a method involving peptide synthesis on a cellulose support, the primary sequence requirements for antimicrobial activity against the human pathogen Pseudomonas aeruginosa of 277 Bac2A variants were investigated by using a luciferase-based assay. Sequence scrambling of Bac2A led to activities ranging from superior or equivalent to Bac2A to inactive, indicating that good activity was not solely dependent on the composition of amino acids or the overall charge or hydrophobicity, but rather required particular linear sequence patterns. A QSAR computational analysis was applied to analyze the data resulting in a model that supported this sequence pattern hypothesis. The activity of selected peptides was confirmed by conventional minimal inhibitory concentration (MIC) analyses with a panel of human pathogen bacteria and fungi. Circular-dichroism (CD) spectroscopy with selected peptides in liposomes and membrane depolarization assays were consistent with a relationship between structure and activity. An additional optimization process was performed involving systematic amino acid substitutions of one of the optimal scrambled peptide variants, resulting in superior active peptide variants. This process provides a cost and time effective enrichment of new candidates for drug development, increasing the chances of finding pharmacologically relevant peptides.

  7. Antimicrobial peptides and the skin immune defense system

    PubMed Central

    Schauber, Jürgen; Gallo, Richard L.

    2009-01-01

    Our skin is constantly challenged by microbes but is rarely infected. Cutaneous production of antimicrobial peptides (AMPs) is a primary system for protection, and expression of some AMPs further increases in response to microbial invasion. Cathelicidins are unique AMPs that protect the skin through 2 distinct pathways: (1) direct antimicrobial activity and (2) initiation of a host response resulting in cytokine release, inflammation, angiogenesis, and reepithelialization. Cathelicidin dysfunction emerges as a central factor in the pathogenesis of several cutaneous diseases, including atopic dermatitis, in which cathelicidin is suppressed; rosacea, in which cathelicidin peptides are abnormally processed to forms that induce inflammation; and psoriasis, in which cathelicidin peptide converts self-DNA to a potent stimulus in an autoinflammatory cascade. Recent work identified vitamin D3 as a major factor involved in the regulation of cathelicidin. Therapies targeting control of cathelicidin and other AMPs might provide new approaches in the management of infectious and inflammatory skin diseases. PMID:18439663

  8. Chemical immobilization of antimicrobial peptides on biomaterial surfaces.

    PubMed

    Silva, Rafael R; Avelino, Karen Y P S; Ribeiro, Kalline L; Franco, Octavio L; Oliveira, Maria D L; Andrade, Cesar A S

    2016-01-01

    The hospital infections associated with surgical procedures and implants still represents a severe problem to modern society. Therefore, new strategies to combat bacterial infections mainly caused by microorganisms resistant to conventional antibiotics are extremely necessary. In this context, antimicrobial peptides have gained prominence due their biocompatibility, low toxicity and effectiveness. The immobilization of antimicrobial peptides (AMPs) onto a biomaterial surface is an excellent alternative to the development of new biodevices with microbicide properties. Herein, we describe reports related to physical-chemical characterization, in vitro/in vivo studies and clinical applicability. In this review, we focused on the AMPs mechanisms of action, different peptide immobilization strategies on solid surface and their microbicide effectiveness.

  9. Antimicrobial peptide diversity in the skin of the torrent frog, Amolops jingdongensis.

    PubMed

    He, Xiaoqin; Yang, Shilong; Wei, Lin; Liu, Rui; Lai, Ren; Rong, Mingqiang

    2013-02-01

    Antimicrobial peptide diversity has been found in some amphibians. The diversity of antimicrobial peptides may have resulted from the diversity of microorganisms encountered by amphibians. Peptidomics and genomics analyses were used to study antimicrobial peptide diversity in the skin secretions of the torrent frog, Amolops jingdongensis. Thirty-one antimicrobial peptides belonging to nine groups were identified in the skin secretions of this frog. Among them, there are two novel antimicrobial groups (jingdongin-1 and -2) with unique structural motifs. The other seven groups belong to known antimicrobial peptide families, namely brevinin-1, brevinin-2, odorranain-F, esculentin-2, temporin, amolopin-3, and ranacyclin. Combined with previous reports, more than 13 antimicrobial peptide groups have been identified from the genus Amolops. Most of these antimicrobial peptide groups are also found in amphibians belonging to the genus Rana or Odorrana which suggests a possible evolutionary connection among Amolops, Rana, and Odorrana. Two novel antimicrobial groups (jingdongin-1 and -2) were synthesized and their antimicrobial activities were assayed. Some of them showed strong antimicrobial abilities against microorganisms including Gram-negative and -positive bacteria, and fungi. The extreme diversity of antimicrobial peptides in the Amolops amphibians was demonstrated. In addition, several novel peptide templates were provided for antimicrobial agent design.

  10. Synthetic cationic amphiphilic α-helical peptides as antimicrobial agents.

    PubMed

    Wiradharma, Nikken; Khoe, Ulung; Hauser, Charlotte A E; Seow, See Voon; Zhang, Shuguang; Yang, Yi-Yan

    2011-03-01

    Antimicrobial peptides (AMPs) secreted by the innate immune system are prevalent as the effective first-line of defense to overcome recurring microbial invasions. They have been widely accepted as the blueprints for the development of new antimicrobial agents for the treatment of drug resistant infections. However, there is also a growing concern that AMPs with a sequence that is too close to the host organism's AMP may inevitably compromise its own natural defense. In this study, we design a series of synthetic (non-natural) short α-helical AMPs to expand the arsenal of the AMP families and to gain further insights on their antimicrobial activities. These cationic and amphiphilic peptides have a general sequence of (XXYY)(n) (X: hydrophobic residue, Y: cationic residue, and n: the number of repeat units), and are designed to mimic the folding behavior of the naturally-occurring α-helical AMPs. The synthetic α-helical AMPs with 3 repeat units, (FFRR)(3), (LLRR)(3), and (LLKK)(3), are found to be more selective towards microbial cells than rat red blood cells, with minimum inhibitory concentration (MIC) values that are more than 10 times lower than their 50% hemolytic concentrations (HC(50)). They are effective against Gram-positive B. subtilis and yeast C. albicans; and the studies using scanning electron microscopy (SEM) have elucidated that these peptides possess membrane-lytic activities against microbial cells. Furthermore, non-specific immune stimulation assays of a typical peptide shows negligible IFN-α, IFN-γ, and TNF-α inductions in human peripheral blood mononuclear cells, which implies additional safety aspects of the peptide for both systemic and topical use. Therefore, the peptides designed in this study can be promising antimicrobial agents against the frequently-encountered Gram-positive bacteria- or yeast-induced infections.

  11. Ancient antimicrobial peptides kill antibiotic-resistant pathogens: Australian mammals provide new options.

    PubMed

    Wang, Jianghui; Wong, Emily S W; Whitley, Jane C; Li, Jian; Stringer, Jessica M; Short, Kirsty R; Renfree, Marilyn B; Belov, Katherine; Cocks, Benjamin G

    2011-01-01

    To overcome the increasing resistance of pathogens to existing antibiotics the 10×'20 Initiative declared the urgent need for a global commitment to develop 10 new antimicrobial drugs by the year 2020. Naturally occurring animal antibiotics are an obvious place to start. The recently sequenced genomes of mammals that are divergent from human and mouse, including the tammar wallaby and the platypus, provide an opportunity to discover novel antimicrobials. Marsupials and monotremes are ideal potential sources of new antimicrobials because they give birth to underdeveloped immunologically naïve young that develop outside the sterile confines of a uterus in harsh pathogen-laden environments. While their adaptive immune system develops innate immune factors produced either by the mother or by the young must play a key role in protecting the immune-compromised young. In this study we focus on the cathelicidins, a key family of antimicrobial peptide genes. We identified 14 cathelicidin genes in the tammar wallaby genome and 8 in the platypus genome. The tammar genes were expressed in the mammary gland during early lactation before the adaptive immune system of the young develops, as well as in the skin of the pouch young. Both platypus and tammar peptides were effective in killing a broad range of bacterial pathogens. One potent peptide, expressed in the early stages of tammar lactation, effectively killed multidrug-resistant clinical isolates of Pseudomonas aeruginosa, Klebsiella pneumoniae and Acinetobacter baumannii. Marsupial and monotreme young are protected by antimicrobial peptides that are potent, broad spectrum and salt resistant. The genomes of our distant relatives may hold the key for the development of novel drugs to combat multidrug-resistant pathogens.

  12. Purification, characterisation and cDNA cloning of an antimicrobial peptide from Macadamia integrifolia.

    PubMed

    Marcus, J P; Goulter, K C; Green, J L; Harrison, S J; Manners, J M

    1997-03-15

    An antimicrobial peptide with no significant amino acid sequence similarity to previously described peptides has been isolated from the nut kernels of Macadcamia integrifolia. The peptide, termed MiAMP1, is highly basic with an estimated pI of 10.1, a mass of 8.1 kDa and contains 76 amino acids including 6 cysteine residues. A cDNA clone containing the entire coding region corresponding to the peptide was obtained. The deduced amino acid sequence of the cDNA indicated a 26-amino-acid signal peptide at the N-terminus of the preprotein. Purified MiAMP1 inhibited the growth of a variety of fungal, oomycete and gram-positive bacterial phytopathogens in vitro. Some pathogens exhibited close to 100% inhibition in less than 1 microM peptide (5 microg/ml). Antimicrobial activity was diminished against most, but not all, microbes in the presence of calcium and potassium chloride salts (1 mM and 50 mM, respectively). MiAMP1 was active against bakers yeast, was inactive against Escherichia coli and was non-toxic to plant and mammalian cells. Analysis of genomic DNA indicated that MiAMP1 was encoded on a single copy gene containing no introns. The MiAMP1 gene may prove useful in genetic manipulations to increase disease resistance in transgenic plants.

  13. Antimicrobial peptides from the skins of North American frogs.

    PubMed

    Conlon, J Michael; Kolodziejek, Jolanta; Nowotny, Norbert

    2009-08-01

    North America is home to anuran species belonging to the families Bufonidae, Eleutherodactylidae, Hylidae, Leiopelmatidae, Ranidae, and Scaphiopodidae but antimicrobial peptides have been identified only in skin secretions and/or skin extracts of frogs belonging to the Leiopelmatidae ("tailed frogs") and Ranidae ("true frogs"). Eight structurally-related cationic alpha-helical peptides with broad-spectrum antibacterial activity, termed ascaphins, have been isolated from specimens of Ascaphus truei (Leiopelmatidae) occupying a coastal range. Characterization of orthologous antimicrobial peptides from Ascaphus specimens occupying an inland range supports the proposal that this population should be regarded as a separate species A. montanus. Ascaphin-8 shows potential for development into a therapeutically valuable anti-infective agent. Peptides belonging to the brevinin-1, esculentin-1, esculentin-2, palustrin-1, palustrin-2, ranacyclin, ranatuerin-1, ranatuerin-2, and temporin families have been isolated from North American ranids. It is proposed that "ranalexins" represent brevinin-1 peptides that have undergone a four amino acid residue internal deletion. Current taxonomic recommendations divide North American frogs from the family Ranidae into two genera: Lithobates and Rana. Cladistic analysis based upon the amino acid sequences of the brevinin-1 peptides provides strong support for this assignment.

  14. Design and Engineering Strategies for Synthetic Antimicrobial Peptides

    NASA Astrophysics Data System (ADS)

    Tossi, Alessandro

    Thousands of antimicrobial peptides (AMPs) of prokaryotic, fungal, plant, or animal origin have been identified, and their potential as lead compounds for the design of novel therapeutic agents in the treatment of infection, for stimulating the immune system, or in countering septic shock has been widely recognized. Added to this is their possible use in prophylaxis of infectious diseases for animal or plant protection, for disinfection of surgical instruments or industrial surfaces, and for food preservation among other commercially important applications. Since the early eighties, AMPs have been subject to a vast number of studies aimed at understanding what determines their potency and spectrum of activities against bacterial or fungal pathogens, and at maximizing these while limiting cytotoxic activities toward host cells. Much research has also been directed toward understanding specific mechanisms of action underlying the antimicrobial activity and selectivity, to be able to redesign the peptides for optimal performance. A central theme in the mode of action of many AMPs is their dynamic interaction with biological membranes, which involves various properties of these peptides such as, among others, surface hydrophobicity and polarity, charge, structure, and induced conformational variations. These features are often intimately interconnected so that engineering peptides to independently adjust any one property in particular is not an easy task. However, solid-phase peptide synthesis allows the use of a large repertoire of nonproteinogenic amino acids that can be used in the rational design of peptides to finely tune structural and physicochemical properties and precisely probe structure-function relationships.

  15. The Medical Potential of Antimicrobial Peptides from Insects.

    PubMed

    Tonk, Miray; Vilcinskas, Andreas

    2017-01-01

    Antimicrobial peptides (AMPs) are peptide-based effector molecules produced by the innate immune system to combat microbes. Insects produce the broadest repertoire of AMPs, and their potent antimicrobial activity in vitro and in vivo has promoted their development as alternatives to conventional antibiotics, in an attempt to address the threat of multidrug-resistant pathogens. Here we discuss current obstacles that hinder the therapeutic development of novel insect-derived AMPs, including potential cytotoxic, immunogenic and allergenic side effects, and the high costs of large-scale production. These challenges may be overcome by the falling costs of synthetic peptide analogs and the heterologous production of recombinant peptides in insect cells or plants (molecular pharming). Insect AMPs offer a promising alternative for the treatment of skin, eye and lung infections, and could also restore the susceptibility of multidrug-resistant pathogens to conventional antibiotics when used as combinatorial treatments. Insect AMPs can also be used as templates for the rational design of peptide mimetics to overcome the drawbacks of natural therapeutic peptides.

  16. Epithelial Antimicrobial Peptides: Guardian of the Oral Cavity

    PubMed Central

    Hans, Mayank; Madaan Hans, Veenu

    2014-01-01

    Gingival epithelium provides first line of defence from the microorganisms present in dental plaque. It not only provides a mechanical barrier but also has an active immune function too. Gingival epithelial cells participate in innate immunity by producing a range of antimicrobial peptides to protect the host against oral pathogens. These epithelial antimicrobial peptides (EAPs) include the β-defensin family, cathelicidin (LL-37), calprotectin, and adrenomedullin. While some are constitutively expressed in gingival epithelial cells, others are induced upon exposure to microbial insults. It is likely that these EAPs have a role in determining the initiation and progression of oral diseases. EAPs are broad spectrum antimicrobials with a different but overlapping range of activity. Apart from antimicrobial activity, they participate in several other crucial roles in host tissues. Some of these, for instance, β-defensins, are chemotactic to immune cells. Others, such as calprotectin are important for wound healing and cell proliferation. Adrenomedullin, a multifunctional peptide, has its biological action in a wide range of tissues. Not only is it a potent vasodilator but also it has several endocrine effects. Knowing in detail the various bioactions of these EAPs may provide us with useful information regarding their utility as therapeutic agents. PMID:25435884

  17. Purification and characterization of an antimicrobial peptide, insect defensin, from immunized house fly (Diptera: Muscidae).

    PubMed

    Dang, X L; Wang, Y S; Huang, Y D; Yu, X Q; Zhang, W Q

    2010-11-01

    The house fly, Musca domestica L. (Diptera: Muscidae), is involved in phoretic movement of pathogenic agents, but it has a very efficient defense mechanism against infection. It is believed that antimicrobial peptides play a significant role in the defense system of the house fly. Here, we isolated a peptide from the immunized house fly pupae, measured its molecular mass (3987.6 Da) by matrix-assisted laser desorption ionization/time of flight-mass spectrometry, and determined its amino acid sequence by using the Procise Protein Sequencing System (Applied Biosystems, Foster City, CA). The peptide was confirmed as a member of the insect defensin family. It displayed high activity against gram-positive bacteria but lower activity against gram-negative bacteria and fungi. Reverse transcription-polymerase chain reaction showed that the house fly defensin gene was constitutively expressed in naive pupae and strongly up-regulated after immunization. House fly defensin is an amphiphilic peptide with a structure similar to that of the CSalphabeta scaffold of insect defensin A from the flesh fly, Phormia terraenovae Robineau-Desvoidy. To our knowledge, this is the first isolated and characterized house fly antimicrobial peptide, and our work may provide useful information for developing pharmacologically active antimicrobial agents.

  18. A Fourier transformation based method to mine peptide space for antimicrobial activity.

    PubMed

    Nagarajan, Vijayaraj; Kaushik, Navodit; Murali, Beddhu; Zhang, Chaoyang; Lakhera, Sanyogita; Elasri, Mohamed O; Deng, Youping

    2006-09-26

    Naturally occurring antimicrobial peptides are currently being explored as potential candidate peptide drugs. Since antimicrobial peptides are part of the innate immune system of every living organism, it is possible to discover new candidate peptides using the available genomic and proteomic data. High throughput computational techniques could also be used to virtually scan the entire peptide space for discovering out new candidate antimicrobial peptides. We have identified a unique indexing method based on biologically distinct characteristic features of known antimicrobial peptides. Analysis of the entries in the antimicrobial peptide databases, based on our indexing method, using Fourier transformation technique revealed a distinct peak in their power spectrum. We have developed a method to mine the genomic and proteomic data, for the presence of peptides with potential antimicrobial activity, by looking for this distinct peak. We also used the Euclidean metric to rank the potential antimicrobial peptides activity. We have parallelized our method so that virtually any given protein space could be data mined, in search of antimicrobial peptides. The results show that the Fourier transform based method with the property based coding strategy could be used to scan the peptide space for discovering new potential antimicrobial peptides.

  19. The SapA Protein Is Involved in Resistance to Antimicrobial Peptide PR-39 and Virulence of Actinobacillus pleuropneumoniae

    PubMed Central

    Xie, Fang; Wang, Yalei; Li, Gang; Liu, Shuanghong; Cui, Ning; Liu, Siguo; Langford, Paul R.; Wang, Chunlai

    2017-01-01

    Antimicrobial peptides are essential to the innate immune defense of the mammal against bacterial infection. However, pathogenic bacteria have evolved multiple strategies to resist and evade antimicrobial peptides, which is vital to bacterial survival and colonization in hosts. PR-39 is a linear porcine antimicrobial peptide containing 39 amino acid residues with a high proline content. Resistance to antimicrobial peptide PR-39 has been observed in Actinobacillus pleuropneumoniae. However, little is known about the factors required for this resistance. In the present study, PR-39 exposure increased the expression of the sapA gene in A. pleuropneumoniae. The sapA gene, which encodes a putative peptide transport periplasmic protein, was deleted from this bacterium. The ΔsapA mutant showed increased sensitivity to PR-39 compared to the wild-type MD12 and complemented PΔsapA strains. However, the ΔsapA mutant did not exhibit any alterations in outer membrane integrity. Scanning electron microscopy showed that the ΔsapA mutant displayed morphological defects, as indicated by a deformed and sunken shape after PR-39 treatment. In addition, disruption of the SapA protein led to reduced colonization and attenuated virulence of A. pleuropneumoniae in the BALB/c mouse model. Collectively, these data suggest that SapA acts as one mechanism for A. pleuropneumoniae to counteract PR-39-mediated killing. To the best of our knowledge, this is the first study to show a mechanism underlying antimicrobial peptide resistance in A. pleuropneumoniae. PMID:28539918

  20. The SapA Protein Is Involved in Resistance to Antimicrobial Peptide PR-39 and Virulence of Actinobacillus pleuropneumoniae.

    PubMed

    Xie, Fang; Wang, Yalei; Li, Gang; Liu, Shuanghong; Cui, Ning; Liu, Siguo; Langford, Paul R; Wang, Chunlai

    2017-01-01

    Antimicrobial peptides are essential to the innate immune defense of the mammal against bacterial infection. However, pathogenic bacteria have evolved multiple strategies to resist and evade antimicrobial peptides, which is vital to bacterial survival and colonization in hosts. PR-39 is a linear porcine antimicrobial peptide containing 39 amino acid residues with a high proline content. Resistance to antimicrobial peptide PR-39 has been observed in Actinobacillus pleuropneumoniae. However, little is known about the factors required for this resistance. In the present study, PR-39 exposure increased the expression of the sapA gene in A. pleuropneumoniae. The sapA gene, which encodes a putative peptide transport periplasmic protein, was deleted from this bacterium. The ΔsapA mutant showed increased sensitivity to PR-39 compared to the wild-type MD12 and complemented PΔsapA strains. However, the ΔsapA mutant did not exhibit any alterations in outer membrane integrity. Scanning electron microscopy showed that the ΔsapA mutant displayed morphological defects, as indicated by a deformed and sunken shape after PR-39 treatment. In addition, disruption of the SapA protein led to reduced colonization and attenuated virulence of A. pleuropneumoniae in the BALB/c mouse model. Collectively, these data suggest that SapA acts as one mechanism for A. pleuropneumoniae to counteract PR-39-mediated killing. To the best of our knowledge, this is the first study to show a mechanism underlying antimicrobial peptide resistance in A. pleuropneumoniae.

  1. Defensins and Other Antimicrobial Peptides at the Ocular Surface

    PubMed Central

    McDermott, Alison M.

    2006-01-01

    Although constantly exposed to the environment and “foreign bodies” such as contact lenses and unwashed fingertips, the ocular surface succumbs to infection relatively infrequently. This is, in large part, due to a very active and robust innate immune response mounted at the ocular surface. Studies over the past 20 years have revealed that small peptides with antimicrobial activity are a major component of the human innate immune response system. The ocular surface is no exception, with peptides of the defensin and cathelicidin families being detected in the tear film and secreted by corneal and conjunctival epithelial cells. There is also much evidence to suggest that the role of some antimicrobial peptides is not restricted to direct killing of pathogens, but, rather, that they function in various aspects of the immune response, including recruitment of immune cells, and through actions on dendritic cells provide a link to adaptive immunity. A role in wound healing is also supported. In this article, the properties, mechanisms of actions and functional roles of antimicrobial peptides are reviewed, with particular emphasis on the potential multifunctional roles of defensins and LL-37 (the only known human cathelicidin) at the ocular surface. PMID:17216098

  2. High-yield recombinant expression of the chicken antimicrobial peptide fowlicidin-2 in Escherichia coli.

    PubMed

    Feng, Xingjun; Xu, Wenshan; Qu, Pei; Li, Xiaochong; Xing, Liwei; Liu, Di; Jiao, Jian; Wang, Jue; Li, Zhongqiu; Liu, Chunlong

    2015-01-01

    The antimicrobial peptide fowlicidin-2 identified in chicken is a member of the cathelicidins family. The mature fowlicidin-2 possesses high antibacterial efficacy and lipopolysaccharide (LPS) neutralizing activity, and also represents an excellent candidate as an antimicrobial agent. In the present study, the recombinant fowlicidin-2 was successfully produced by Escherichia coli (E. coli) recombinant expression system. The gene encoding fowlicidin-2 with the codon preference of E. coli was designed through codon optimization and synthesized in vitro. The gene was then ligated into the plasmid pET-32a(+), which features fusion protein thioredoxin at the N-terminal. The recombinant plasmid was transformed into E. coli BL21(DE3) and cultured in Luria-Bertani (LB) medium. After isopropyl-β-D-thiogalactopyranoside (IPTG) induction, the fowlicidin-2 fusion protein was successfully expressed as inclusion bodies. The inclusion bodies were dissolved and successfully released the peptide in 70% formic acid solution containing cyanogen bromide (CNBr) in a single step. After purification by reverse-phase high-performance liquid chromatography (RP-HPLC), ∼6.0 mg of fowlicidin-2 with purity more than 97% was obtained from 1 litre of bacteria culture. The recombinant peptide exhibited high antibacterial activity against the Gram-positive and Gram-negative bacteria, and even drug-resistant strains. This system could be used to rapidly and efficiently produce milligram quantities of a battery of recombinant antimicrobial peptides as well as for large-scale production. © 2015 American Institute of Chemical Engineers.

  3. Shrimp humoral responses against pathogens: antimicrobial peptides and melanization.

    PubMed

    Tassanakajon, Anchalee; Rimphanitchayakit, Vichien; Visetnan, Suwattana; Amparyup, Piti; Somboonwiwat, Kunlaya; Charoensapsri, Walaiporn; Tang, Sureerat

    2017-05-10

    Diseases have caused tremendous economic losses and become the major problem threatening the sustainable development of shrimp aquaculture. The knowledge of host defense mechanisms against invading pathogens is essential for the implementation of efficient strategies to prevent disease outbreaks. Like other invertebrates, shrimp rely on the innate immune system to defend themselves against a range of microbes by recognizing and destroying them through cellular and humoral immune responses. Detection of microbial pathogens triggers the signal transduction pathways including the NF-κB signaling, Toll and Imd pathways, resulting in the activation of genes involved in host defense responses. In this review, we update the discovery of components of the Toll and Imd pathways in shrimp and their participation in the regulation of shrimp antimicrobial peptide (AMP) synthesis. We also focus on a recent progress on the two most powerful and the best-studied shrimp humoral responses: AMPs and melanization. Shrimp AMPs are mainly cationic peptides with sequence diversity which endues them the broad range of activities against microorganisms. Melanization, regulated by the prophenoloxidase activating cascade, also plays a crucial role in killing and sequestration of invading pathogens. The progress and emerging research on mechanisms and functional characterization of components of these two indispensable humoral responses in shrimp immunity are summarized and discussed. Interestingly, the pattern recognition protein (PRP) crosstalk is evidenced between the proPO activating cascade and the AMP synthesis pathways in shrimp, which enables the innate immune system to build up efficient immune responses. Copyright © 2017 Elsevier Ltd. All rights reserved.

  4. Mechanisms of Antimicrobial Peptide Resistance in Gram-Negative Bacteria

    PubMed Central

    Band, Victor I.; Weiss, David S.

    2014-01-01

    Cationic antimicrobial peptides (CAMPs) are important innate immune defenses that inhibit colonization by pathogens and contribute to clearance of infections. Gram-negative bacterial pathogens are a major target, yet many of them have evolved mechanisms to resist these antimicrobials. These resistance mechanisms can be critical contributors to bacterial virulence and are often crucial for survival within the host. Here, we summarize methods used by Gram-negative bacteria to resist CAMPs. Understanding these mechanisms may lead to new therapeutic strategies against pathogens with extensive CAMP resistance. PMID:25927010

  5. Mechanisms of Antimicrobial Peptide Resistance in Gram-Negative Bacteria.

    PubMed

    Band, Victor I; Weiss, David S

    2015-03-01

    Cationic antimicrobial peptides (CAMPs) are important innate immune defenses that inhibit colonization by pathogens and contribute to clearance of infections. Gram-negative bacterial pathogens are a major target, yet many of them have evolved mechanisms to resist these antimicrobials. These resistance mechanisms can be critical contributors to bacterial virulence and are often crucial for survival within the host. Here, we summarize methods used by Gram-negative bacteria to resist CAMPs. Understanding these mechanisms may lead to new therapeutic strategies against pathogens with extensive CAMP resistance.

  6. The therapeutic applications of antimicrobial peptides (AMPs): a patent review.

    PubMed

    Kang, Hee-Kyoung; Kim, Cheolmin; Seo, Chang Ho; Park, Yoonkyung

    2017-01-01

    Antimicrobial peptides (AMPs) are small molecules with a broad spectrum of antibiotic activities against bacteria, yeasts, fungi, and viruses and cytotoxic activity on cancer cells, in addition to anti-inflammatory and immunomodulatory activities. Therefore, AMPs have garnered interest as novel therapeutic agents. Because of the rapid increase in drug-resistant pathogenic microorganisms, AMPs from synthetic and natural sources have been developed using alternative antimicrobial strategies. This article presents a broad analysis of patents referring to the therapeutic applications of AMPs since 2009. The review focuses on the universal trends in the effective design, mechanism, and biological evolution of AMPs.

  7. Regulation of Antimicrobial Peptides in Aedes aegypti Aag2 Cells

    PubMed Central

    Zhang, Rudian; Zhu, Yibin; Pang, Xiaojing; Xiao, Xiaoping; Zhang, Renli; Cheng, Gong

    2017-01-01

    Antimicrobial peptides (AMPs) are an important group of immune effectors that play a role in combating microbial infections in invertebrates. Most of the current information on the regulation of insect AMPs in microbial infection have been gained from Drosophila, and their regulation in other insects are still not completely understood. Here, we generated an AMP induction profile in response to infections with some Gram-negative, -positive bacteria, and fungi in Aedes aegypti embryonic Aag2 cells. Most of the AMP inductions caused by the gram-negative bacteria was controlled by the Immune deficiency (Imd) pathway; nonetheless, Gambicin, an AMP gene discovered only in mosquitoes, was combinatorially regulated by the Imd, Toll and JAK-STAT pathways in the Aag2 cells. Gambicin promoter analyses including specific sequence motif deletions implicated these three pathways in Gambicin activity, as shown by a luciferase assay. Moreover, the recognition between Rel1 (refer to Dif/Dorsal in Drosophila) and STAT and their regulatory sites at the Gambicin promoter site was validated by a super-shift electrophoretic mobility shift assay (EMSA). Our study provides information that increases our understanding of the regulation of AMPs in response to microbial infections in mosquitoes. And it is a new finding that the A. aegypti AMPs are mainly regulated Imd pathway only, which is quite different from the previous understanding obtained from Drosophila. PMID:28217557

  8. Regulation of Antimicrobial Peptides in Aedes aegypti Aag2 Cells.

    PubMed

    Zhang, Rudian; Zhu, Yibin; Pang, Xiaojing; Xiao, Xiaoping; Zhang, Renli; Cheng, Gong

    2017-01-01

    Antimicrobial peptides (AMPs) are an important group of immune effectors that play a role in combating microbial infections in invertebrates. Most of the current information on the regulation of insect AMPs in microbial infection have been gained from Drosophila, and their regulation in other insects are still not completely understood. Here, we generated an AMP induction profile in response to infections with some Gram-negative, -positive bacteria, and fungi in Aedes aegypti embryonic Aag2 cells. Most of the AMP inductions caused by the gram-negative bacteria was controlled by the Immune deficiency (Imd) pathway; nonetheless, Gambicin, an AMP gene discovered only in mosquitoes, was combinatorially regulated by the Imd, Toll and JAK-STAT pathways in the Aag2 cells. Gambicin promoter analyses including specific sequence motif deletions implicated these three pathways in Gambicin activity, as shown by a luciferase assay. Moreover, the recognition between Rel1 (refer to Dif/Dorsal in Drosophila) and STAT and their regulatory sites at the Gambicin promoter site was validated by a super-shift electrophoretic mobility shift assay (EMSA). Our study provides information that increases our understanding of the regulation of AMPs in response to microbial infections in mosquitoes. And it is a new finding that the A. aegypti AMPs are mainly regulated Imd pathway only, which is quite different from the previous understanding obtained from Drosophila.

  9. Small cationic antimicrobial peptides delocalize peripheral membrane proteins

    PubMed Central

    Wenzel, Michaela; Chiriac, Alina Iulia; Otto, Andreas; Zweytick, Dagmar; May, Caroline; Schumacher, Catherine; Gust, Ronald; Albada, H. Bauke; Penkova, Maya; Krämer, Ute; Erdmann, Ralf; Metzler-Nolte, Nils; Straus, Suzana K.; Bremer, Erhard; Becher, Dörte; Brötz-Oesterhelt, Heike; Sahl, Hans-Georg; Bandow, Julia Elisabeth

    2014-01-01

    Short antimicrobial peptides rich in arginine (R) and tryptophan (W) interact with membranes. To learn how this interaction leads to bacterial death, we characterized the effects of the minimal pharmacophore RWRWRW-NH2. A ruthenium-substituted derivative of this peptide localized to the membrane in vivo, and the peptide also integrated readily into mixed phospholipid bilayers that resemble Gram-positive membranes. Proteome and Western blot analyses showed that integration of the peptide caused delocalization of peripheral membrane proteins essential for respiration and cell-wall biosynthesis, limiting cellular energy and undermining cell-wall integrity. This delocalization phenomenon also was observed with the cyclic peptide gramicidin S, indicating the generality of the mechanism. Exogenous glutamate increases tolerance to the peptide, indicating that osmotic destabilization also contributes to antibacterial efficacy. Bacillus subtilis responds to peptide stress by releasing osmoprotective amino acids, in part via mechanosensitive channels. This response is triggered by membrane-targeting bacteriolytic peptides of different structural classes as well as by hypoosmotic conditions. PMID:24706874

  10. Antimicrobial Peptides: An Emerging Category of Therapeutic Agents

    PubMed Central

    Mahlapuu, Margit; Håkansson, Joakim; Ringstad, Lovisa; Björn, Camilla

    2016-01-01

    Antimicrobial peptides (AMPs), also known as host defense peptides, are short and generally positively charged peptides found in a wide variety of life forms from microorganisms to humans. Most AMPs have the ability to kill microbial pathogens directly, whereas others act indirectly by modulating the host defense systems. Against a background of rapidly increasing resistance development to conventional antibiotics all over the world, efforts to bring AMPs into clinical use are accelerating. Several AMPs are currently being evaluated in clinical trials as novel anti-infectives, but also as new pharmacological agents to modulate the immune response, promote wound healing, and prevent post-surgical adhesions. In this review, we provide an overview of the biological role, classification, and mode of action of AMPs, discuss the opportunities and challenges to develop these peptides for clinical applications, and review the innovative formulation strategies for application of AMPs. PMID:28083516

  11. Novel mode of action of plant defense peptides - hevein-like antimicrobial peptides from wheat inhibit fungal metalloproteases.

    PubMed

    Slavokhotova, Anna A; Naumann, Todd A; Price, Neil P J; Rogozhin, Eugene A; Andreev, Yaroslav A; Vassilevski, Alexander A; Odintsova, Tatyana I

    2014-10-01

    The multilayered plant immune system relies on rapid recognition of pathogen-associated molecular patterns followed by activation of defense-related genes, resulting in the reinforcement of plant cell walls and the production of antimicrobial compounds. To suppress plant defense, fungi secrete effectors, including a recently discovered Zn-metalloproteinase from Fusarium verticillioides, named fungalysin Fv-cmp. This proteinase cleaves class IV chitinases, which are plant defense proteins that bind and degrade chitin of fungal cell walls. In this study, we investigated plant responses to such pathogen invasion, and discovered novel inhibitors of fungalysin. We produced several recombinant hevein-like antimicrobial peptides named wheat antimicrobial peptides (WAMPs) containing different amino acids (Ala, Lys, Glu, and Asn) at the nonconserved position 34. An additional Ser at the site of fungalysin proteolysis makes the peptides resistant to the protease. Moreover, an equal molar concentration of WAMP-1b or WAMP-2 to chitinase was sufficient to block the fungalysin activity, keeping the chitinase intact. Thus, WAMPs represent novel protease inhibitors that are active against fungal metalloproteases. According to in vitro antifungal assays WAMPs directly inhibited hyphal elongation, suggesting that fungalysin plays an important role in fungal development. A novel molecular mechanism of dynamic interplay between host defense molecules and fungal virulence factors is suggested. © 2014 FEBS.

  12. Peptides from the scorpion Vaejovis punctatus with broad antimicrobial activity.

    PubMed

    Ramírez-Carreto, Santos; Jiménez-Vargas, Juana María; Rivas-Santiago, Bruno; Corzo, Gerardo; Possani, Lourival D; Becerril, Baltazar; Ortiz, Ernesto

    2015-11-01

    The antimicrobial potential of two new non-disulfide bound peptides, named VpAmp1.0 (LPFFLLSLIPSAISAIKKI, amidated) and VpAmp2.0 (FWGFLGKLAMKAVPSLIGGNKSSSK) is here reported. These are 19- and 25-aminoacid-long peptides with +2 and +4 net charges, respectively. Their sequences correspond to the predicted mature regions from longer precursors, putatively encoded by cDNAs derived from the venom glands of the Mexican scorpion Vaejovis punctatus. Both peptides were chemically synthesized and assayed against a variety of microorganisms, including pathogenic strains from clinical isolates and strains resistant to conventional antibiotics. Two shorter variants, named VpAmp1.1 (FFLLSLIPSAISAIKKI, amidated) and VpAmp2.1 (FWGFLGKLAMKAVPSLIGGNKK), were also synthesized and tested. The antimicrobial assays revealed that the four synthetic peptides effectively inhibit the growth of both Gram-positive (Staphylococcus aureus and Streptococcus agalactiaea) and Gram-negative (Escherichia coli and Pseudomonas aeruginosa) bacteria, with MICs in the range of 2.5-24.0 μM; yeasts (Candida albicans and Candida glabrata) with MICs of 3.1-50.0 μM; and two clinically isolated strains of Mycobacterium tuberculosis-including a multi-drug resistant one- with MICs in the range of 4.8-30.5 μM. A comparison between the activities of the original peptides and their derivatives gives insight into the structural/functional role of their distinctive residues.

  13. Boosting Antimicrobial Peptides by Hydrophobic Oligopeptide End Tags*

    PubMed Central

    Schmidtchen, Artur; Pasupuleti, Mukesh; Mörgelin, Matthias; Davoudi, Mina; Alenfall, Jan; Chalupka, Anna; Malmsten, Martin

    2009-01-01

    A novel approach for boosting antimicrobial peptides through end tagging with hydrophobic oligopeptide stretches is demonstrated. Focusing on two peptides derived from kininogen, GKHKNKGKKNGKHNGWK (GKH17) and HKHGHGHGKHKNKGKKN (HKH17), tagging resulted in enhanced killing of Gram-positive Staphylococcus aureus, Gram-negative Escherichia coli, and fungal Candida albicans. Microbicidal potency increased with tag length, also in plasma, and was larger for Trp and Phe stretches than for aliphatic ones. The enhanced microbicidal effects correlated to a higher degree of bacterial wall rupture. Analogously, tagging promoted peptide binding to model phospholipid membranes and liposome rupture, particularly for anionic and cholesterol-void membranes. Tagged peptides displayed low toxicity, particularly in the presence of serum, and resisted degradation by human leukocyte elastase and by staphylococcal aureolysin and V8 proteinase. The biological relevance of these findings was demonstrated ex vivo and in vivo in porcine S. aureus skin infection models. The generality of end tagging for facile boosting of antimicrobial peptides without the need for post-synthesis modification was also demonstrated. PMID:19398550

  14. Antimicrobial Peptides Derived from Fusion Peptides of Influenza A Viruses, a Promising Approach to Designing Potent Antimicrobial Agents.

    PubMed

    Wang, Jingyu; Zhong, Wenjing; Lin, Dongguo; Xia, Fan; Wu, Wenjiao; Zhang, Heyuan; Lv, Lin; Liu, Shuwen; He, Jian

    2015-10-01

    The emergence and dissemination of antibiotic-resistant bacterial pathogens have spurred the urgent need to develop novel antimicrobial agents with different mode of action. In this respect, we turned several fusogenic peptides (FPs) derived from the hemagglutinin glycoproteins (HAs) of IAV into potent antibacterials by replacing the negatively or neutrally charged residues of FPs with positively charged lysines. Their antibacterial activities were evaluated by testing the MICs against a panel of bacterial strains including S. aureus, S. mutans, P. aeruginosa, and E. coli. The results showed that peptides HA-FP-1, HA-FP-2-1, and HA-FP-3-1 were effective against both Gram-positive and Gram-negative bacteria with MICs ranging from 1.9 to 16.0 μm, while the toxicities toward mammalian cells were low. In addition, the mode of action and the secondary structure of these peptides were also discussed. These data not only provide several potent peptides displaying promising potential in development as broad antimicrobial agents, but also present a useful strategy in designing new antimicrobial agents.

  15. Antimicrobial peptides and proteins of the horse - insights into a well-armed organism

    PubMed Central

    2011-01-01

    Antimicrobial peptides play a pivotal role as key effectors of the innate immune system in plants and animals and act as endogenous antibiotics. The molecules exhibit an antimicrobial activity against bacteria, viruses, and eukaryotic pathogens with different specificities and potencies depending on the structure and amino-acid composition of the peptides. Several antimicrobial peptides were comprehensively investigated in the last three decades and some molecules with remarkable antimicrobial properties have reached the third phase of clinical studies. Next to the peptides themselves, numerous organisms were examined and analyzed regarding their repertoire of antimicrobial peptides revealing a huge number of candidates with potencies and properties for future medical applications. One of these organisms is the horse, which possesses numerous peptides that are interesting candidates for therapeutical applications in veterinary medicine. Here we summarize investigations and knowledge on equine antimicrobial peptides, point to interesting candidates, and discuss prospects for therapeutical applications. PMID:21888650

  16. Antimicrobial peptides as natural bio-preservative to enhance the shelf-life of food.

    PubMed

    Rai, Mahendra; Pandit, Raksha; Gaikwad, Swapnil; Kövics, György

    2016-09-01

    Antimicrobial peptides (AMPs) are diverse group of natural proteins present in animals, plants, insects and bacteria. These peptides are responsible for defense of host from pathogenic organisms. Chemical, enzymatic and recombinant techniques are used for the synthesis of antimicrobial peptides. These peptides have been found to be an alternative to the chemical preservatives. Currently, nisin is the only antimicrobial peptide, which is widely utilized in the preservation of food. Antimicrobial peptides can be used alone or in combination with other antimicrobial, essential oils and polymeric nanoparticles to enhance the shelf-life of food. This review presents an overview on different types of antimicrobial peptides, purification techniques, mode of action and application in food preservation.

  17. Salivary Antimicrobial Peptides in Early Detection of Periodontitis

    PubMed Central

    Güncü, Güliz N.; Yilmaz, Dogukan; Könönen, Eija; Gürsoy, Ulvi K.

    2015-01-01

    In the pathogenesis of periodontitis, an infection-induced inflammatory disease of the tooth-supporting tissues, there is a complex interaction between the subgingival microbiota and host tissues. A periodontal diagnostic tool for detecting the initiation and progression of the disease, monitoring the response to therapy, or measuring the degree of susceptibility to future disease progression has been of interest for a long time. The value of various enzymes, proteins, and immunoglobulins, which are abundant constituents of saliva, as potential biomarkers has been recognized and extensively investigated for periodontal diseases. Gingival defensins and cathelicidins are small cationic antimicrobial peptides that play an important role in innate immune response. However, their applicability as salivary biomarkers is still under debate. The present review focuses on proteomic biomarkers and antimicrobial peptides, in particular, to be used at early phases of periodontitis. PMID:26734583

  18. Five novel antimicrobial peptides from the Kuhl's wart frog skin secretions, Limnonectes kuhlii.

    PubMed

    Wang, Guoxiang; Wang, Ying; Ma, Dongying; Liu, Huan; Li, Jianxu; Zhang, Keyun; Yang, Xiaolong; Lai, Ren; Liu, Jingze

    2013-02-01

    Five novel antimicrobial peptides (temporin-LK1, rugosin-LK1, rugosin-LK2, gaegurin-LK1, and gaegurin-LK2) are purified and characterized from Kuhl's wart frog skin secretions, Limnonectes kuhlii. They share obvious similarity to temporin, rugosin, and gaegurin antimicrobial peptide family, respectively. Their amino acid sequences were determined by Edman degradation and mass spectrometry, and further confirmed by cDNA cloning. Nine cDNA sequences encoding precursors of these five purified antimicrobial peptides and other four hypothetical antimicrobial peptides were cloned from the skin cDNA library of L. kuhlii. The deduced precursors are composed of a predicted signal peptide, an acidic spacer peptide, and a mature antimicrobial peptide. Most of them showed strong antimicrobial activities against Gram-positive and Gram-negative bacteria and fungi. The current work identified and characterized three families of antimicrobial peptides from L. kuhlii skins and confirmed that the genus of Limnonectes amphibians share similar antimicrobial peptide families with the genus of Rana amphibians. In addition, a unique antimicrobial peptide (temporin-LK1) with 17 residues including four phenylalanines, which is significantly different from other temporins (16 residues, one or two phenylalanines), was identified in this work. Such unique structure might provide novel template or leading structure to design antimicrobial agents.

  19. Context mediates antimicrobial efficacy of kinocidin congener peptide RP-1.

    PubMed

    Yount, Nannette Y; Cohen, Samuel E; Kupferwasser, Deborah; Waring, Alan J; Ruchala, Piotr; Sharma, Shantanu; Wasserman, Karlman; Jung, Chun-Ling; Yeaman, Michael R

    2011-01-01

    Structure-mechanism relationships are key determinants of host defense peptide efficacy. These relationships are influenced by anatomic, physiologic and microbiologic contexts. Structure-mechanism correlates were assessed for the synthetic peptide RP-1, modeled on microbicidal domains of platelet kinocidins. Antimicrobial efficacies and mechanisms of action against susceptible ((S)) or resistant ((R)) Salmonella typhimurium (ST), Staphylococcus aureus (SA), and Candida albicans (CA) strain pairs were studied at pH 7.5 and 5.5. Although RP-1 was active against all study organisms, it exhibited greater efficacy against bacteria at pH 7.5, but greater efficacy against CA at pH 5.5. RP-1 de-energized SA and CA, but caused hyperpolarization of ST in both pH conditions. However, RP-1 permeabilized ST(S) and CA strains at both pH, whereas permeabilization was modest for ST(R) or SA strain at either pH. Biochemical analysis, molecular modeling, and FTIR spectroscopy data revealed that RP-1 has indistinguishable net charge and backbone trajectories at pH 5.5 and 7.5. Yet, concordant with organism-specific efficacy, surface plasmon resonance, and FTIR, molecular dynamics revealed modest helical order increases but greater RP-1 avidity and penetration of bacterial than eukaryotic lipid systems, particularly at pH 7.5. The present findings suggest that pH- and target-cell lipid contexts influence selective antimicrobial efficacy and mechanisms of RP-1 action. These findings offer new insights into selective antimicrobial efficacy and context-specificity of antimicrobial peptides in host defense, and support design strategies for potent anti-infective peptides with minimal concomitant cytotoxicity.

  20. Context Mediates Antimicrobial Efficacy of Kinocidin Congener Peptide RP-1

    PubMed Central

    Yount, Nannette Y.; Cohen, Samuel E.; Kupferwasser, Deborah; Waring, Alan J.; Ruchala, Piotr; Sharma, Shantanu; Wasserman, Karlman; Jung, Chun-Ling; Yeaman, Michael R.

    2011-01-01

    Structure-mechanism relationships are key determinants of host defense peptide efficacy. These relationships are influenced by anatomic, physiologic and microbiologic contexts. Structure-mechanism correlates were assessed for the synthetic peptide RP-1, modeled on microbicidal domains of platelet kinocidins. Antimicrobial efficacies and mechanisms of action against susceptible (S) or resistant (R) Salmonella typhimurium (ST), Staphylococcus aureus (SA), and Candida albicans (CA) strain pairs were studied at pH 7.5 and 5.5. Although RP-1 was active against all study organisms, it exhibited greater efficacy against bacteria at pH 7.5, but greater efficacy against CA at pH 5.5. RP-1 de-energized SA and CA, but caused hyperpolarization of ST in both pH conditions. However, RP-1 permeabilized STS and CA strains at both pH, whereas permeabilization was modest for STR or SA strain at either pH. Biochemical analysis, molecular modeling, and FTIR spectroscopy data revealed that RP-1 has indistinguishable net charge and backbone trajectories at pH 5.5 and 7.5. Yet, concordant with organism-specific efficacy, surface plasmon resonance, and FTIR, molecular dynamics revealed modest helical order increases but greater RP-1 avidity and penetration of bacterial than eukaryotic lipid systems, particularly at pH 7.5. The present findings suggest that pH– and target–cell lipid contexts influence selective antimicrobial efficacy and mechanisms of RP-1 action. These findings offer new insights into selective antimicrobial efficacy and context–specificity of antimicrobial peptides in host defense, and support design strategies for potent anti-infective peptides with minimal concomitant cytotoxicity. PMID:22073187

  1. Synthesis and solution structure of the antimicrobial peptide protegrin-1.

    PubMed

    Aumelas, A; Mangoni, M; Roumestand, C; Chiche, L; Despaux, E; Grassy, G; Calas, B; Chavanieu, A

    1996-05-01

    Protegrins are members of a family of five Cys-rich, cationic antimicrobial peptides recently isolated from porcine cells. We have synthesised an 18-amino-acid peptide that corresponds to protegrin-1. After Cys oxidation, the peptide has bactericidal activity against gram-positive and gram-negative bacteria, similar to that described for the natural peptide. The solution structure of protegrin-1 was investigated by means of 1H-NMR spectroscopy in water and in (CD3)2SO, with distance-geometry and simulated-annealing calculations. The C6-C15 and C8-C13 disulfide pattern was determined on the basis of NMR-derived constraints. These two parallel disulfide bridges stabilised a beta-sheet structure which comprised two antiparallel strands (residues 5-9 and 12-16) linked by a distorted beta-turn (residues 9-12). The N-terminus and C-terminus were essentially disordered. The distribution of hydrophobic and hydrophilic residues at the peptide surface was found to be a structural feature shared with tachyplesin-1, a related peptide which displays cytolytic activity, and, to a lesser extent, with mammalian defensins. These findings led us to assume that the distribution pattern could be required for the cytolytic activity of these peptides.

  2. Nanomechanical Response of Bacterial Cells to Antimicrobial Peptides

    NASA Astrophysics Data System (ADS)

    Parg, Richard; Dutcher, John

    2015-03-01

    The effectiveness of antimicrobial compounds can be easily screened, however their mechanism of action is much more difficult to determine. Many compounds act by compromising the mechanical integrity of the bacterial cell envelope, and we have developed an atomic force microscopy (AFM)-based creep deformation technique to evaluate changes in the time-dependent mechanical properties of bacterial cells upon exposure to antimicrobial peptides. Measurements performed before and after exposure, as well as time-resolved measurements and those performed at different antimicrobial concentrations, revealed large changes to the viscoelastic parameters including a distinctive signature for the loss of integrity of the bacterial cell envelope. Our previous experiments have focused on Pseudomonas aeruginosaPAO1 bacterial cells in Milli-Q water, for which the cells can withstand the large osmotic pressure. In the present study we have focused on performing the measurements in buffer to obtain more biologically relevant results. The AFM creep deformation measurement provides new, unique insight into the kinetics and mechanism of action of antimicrobial peptides on bacteria.

  3. Diversity, evolution and medical applications of insect antimicrobial peptides.

    PubMed

    Mylonakis, Eleftherios; Podsiadlowski, Lars; Muhammed, Maged; Vilcinskas, Andreas

    2016-05-26

    Antimicrobial peptides (AMPs) are short proteins with antimicrobial activity. A large portion of known AMPs originate from insects, and the number and diversity of these molecules in different species varies considerably. Insect AMPs represent a potential source of alternative antibiotics to address the limitation of current antibiotics, which has been caused by the emergence and spread of multidrug-resistant pathogens. To get more insight into AMPs, we investigated the diversity and evolution of insect AMPs by mapping their phylogenetic distribution, allowing us to predict the evolutionary origins of selected AMP families and to identify evolutionarily conserved and taxon-specific families. Furthermore, we highlight the use of the nematode Caenorhabditis elegans as a whole-animal model in high-throughput screening methods to identify AMPs with efficacy against human pathogens, including Acinetobacter baumanii and methicillin-resistant Staphylococcus aureus We also discuss the potential medical applications of AMPs, including their use as alternatives for conventional antibiotics in ectopic therapies, their combined use with antibiotics to restore the susceptibility of multidrug-resistant pathogens, and their use as templates for the rational design of peptidomimetic drugs that overcome the disadvantages of therapeutic peptides.The article is part of the themed issue 'Evolutionary ecology of arthropod antimicrobial peptides'. © 2016 The Authors.

  4. Staphylococcus aureus Infection of Epidermal Keratinocytes Promotes Expression of Innate Antimicrobial Peptides

    PubMed Central

    Menzies, Barbara E.; Kenoyer, Aimee

    2005-01-01

    Keratinocytes upregulate expression of endogenous antimicrobial peptides in response to inflammatory stimuli. We show that both viable and heat-inactivated Staphylococcus aureus and lipoteichoic acid differentially alter expression of these peptides upon contact with human keratinocytes. The findings indicate a diversity of staphylococcal factors involved in upregulation of antimicrobial peptide expression in cutaneous epithelia. PMID:16041048

  5. Role of the Escherichia coli SbmA in the antimicrobial activity of proline-rich peptides.

    PubMed

    Mattiuzzo, Maura; Bandiera, Antonella; Gennaro, Renato; Benincasa, Monica; Pacor, Sabrina; Antcheva, Nikolinka; Scocchi, Marco

    2007-10-01

    In contrast to many antimicrobial peptides, members of the proline-rich group of antimicrobial peptides inactivate Gram-negative bacteria by a non-lytic mechanism. Several lines of evidence indicate that they are internalized into bacteria and their activity mediated by interaction with unknown cellular components. With the aim of identifying such interactors, we selected mutagenized Escherichia coli clones resistant to the proline-rich Bac7(1-35) peptide and analysed genes responsible for conferring resistance, whose products may thus be involved in the peptide's mode of action. We isolated a number of genomic regions bearing such genes, and one in particular coding for SbmA, an inner membrane protein predicted to be part of an ABC transporter. An E. coli strain carrying a point mutation in sbmA, as well as other sbmA-null mutants, in fact showed resistance to several proline-rich peptides but not to representative membranolytic peptides. Use of fluorescently labelled Bac7(1-35) confirmed that resistance correlated with a decreased ability to internalize the peptide, suggesting that a bacterial protein, SbmA, is necessary for the transport of, and for susceptibility to, proline-rich antimicrobial peptides of eukaryotic origin.

  6. Temporin-SHf, a New Type of Phe-rich and Hydrophobic Ultrashort Antimicrobial Peptide*

    PubMed Central

    Abbassi, Feten; Lequin, Olivier; Piesse, Christophe; Goasdoué, Nicole; Foulon, Thierry; Nicolas, Pierre; Ladram, Ali

    2010-01-01

    Because issues of cost and bioavailability have hampered the development of gene-encoded antimicrobial peptides to combat infectious diseases, short linear peptides with high microbial cell selectivity have been recently considered as antibiotic substitutes. A new type of short antimicrobial peptide, designated temporin-SHf, was isolated and cloned from the skin of the frog Pelophylax saharica. Temporin-SHf has a highly hydrophobic sequence (FFFLSRIFa) and possesses the highest percentage of Phe residues of any known peptide or protein. Moreover, it is the smallest natural linear antimicrobial peptide found to date, with only eight residues. Despite its small size and hydrophobicity, temporin-SHf has broad-spectrum microbicidal activity against Gram-positive and Gram-negative bacteria and yeasts, with no hemolytic activity. CD and NMR spectroscopy combined with restrained molecular dynamics calculations showed that the peptide adopts a well defined non-amphipathic α-helical structure from residue 3 to 8, when bound to zwitterionic dodecyl phosphocholine or anionic SDS micelles. Relaxation enhancement caused by paramagnetic probes showed that the peptide adopts nearly parallel orientations to the micelle surface and that the helical structure is stabilized by a compact hydrophobic core on one face that penetrates into the micelle interior. Differential scanning calorimetry on multilamellar vesicles combined with membrane permeabilization assays on bacterial cells indicated that temporin-SHf disrupts the acyl chain packing of anionic lipid bilayers, thereby triggering local cracks and microbial membrane disintegration through a detergent-like effect probably via the carpet mechanism. The short length, compositional simplicity, and broad-spectrum activity of temporin-SHf make it an attractive candidate to develop new antibiotic agents. PMID:20308076

  7. modlAMP: Python for antimicrobial peptides.

    PubMed

    Müller, Alex T; Gabernet, Gisela; Hiss, Jan A; Schneider, Gisbert

    2017-09-01

    We have implemented the lecular esign aboratory's nti icrobial eptides package ( ), a Python-based software package for the design, classification and visual representation of peptide data. modlAMP offers functions for molecular descriptor calculation and the retrieval of amino acid sequences from public or local sequence databases, and provides instant access to precompiled datasets for machine learning. The package also contains methods for the analysis and representation of circular dichroism spectra. The modlAMP Python package is available under the BSD license from URL http://doi.org/10.5905/ethz-1007-72 or via pip from the Python Package Index (PyPI). gisbert.schneider@pharma.ethz.ch. Supplementary data are available at Bioinformatics online.

  8. Insect Antimicrobial Peptide Complexes Prevent Resistance Development in Bacteria

    PubMed Central

    Chernysh, Sergey; Gordya, Natalia; Suborova, Tatyana

    2015-01-01

    In recent decades much attention has been paid to antimicrobial peptides (AMPs) as natural antibiotics, which are presumably protected from resistance development in bacteria. However, experimental evolution studies have revealed prompt resistance increase in bacteria to any individual AMP tested. Here we demonstrate that naturally occurring compounds containing insect AMP complexes have clear advantage over individual peptide and small molecule antibiotics in respect of drug resistance development. As a model we have used the compounds isolated from bacteria challenged maggots of Calliphoridae flies. The compound isolated from blow fly Calliphora vicina was found to contain three distinct families of cell membrane disrupting/permeabilizing peptides (defensins, cecropins and diptericins), one family of proline rich peptides and several unknown antimicrobial substances. Resistance changes under long term selective pressure of the compound and reference antibiotics cefotaxime, meropenem and polymyxin B were tested using Escherichia coli, Klebsiella pneumonia and Acinetobacter baumannii clinical strains. All the strains readily developed resistance to the reference antibiotics, while no signs of resistance growth to the compound were registered. Similar results were obtained with the compounds isolated from 3 other fly species. The experiments revealed that natural compounds containing insect AMP complexes, in contrast to individual AMP and small molecule antibiotics, are well protected from resistance development in bacteria. Further progress in the research of natural AMP complexes may provide novel solutions to the drug resistance problem. PMID:26177023

  9. Differential expression of antimicrobial peptides in active and latent tuberculosis and its relationship with diabetes mellitus.

    PubMed

    Gonzalez-Curiel, Irma; Castañeda-Delgado, Julio; Lopez-Lopez, Nallely; Araujo, Zaida; Hernandez-Pando, Rogelio; Gandara-Jasso, Benjamin; Macias-Segura, Noe; Enciso-Moreno, Antonio; Rivas-Santiago, Bruno

    2011-08-01

    Tuberculosis (TB) is one of the most important infectious diseases, causing 1.8 million deaths annually worldwide. This problem has increased because of the association with human immmunodeficiency virus and diabetes mellitus type 2, mainly in developing countries. In the past few years it has been highlighted the significance of antimicrobial peptides in the immunopathogenesis of TB ex vivo and in experimental models studies. In this study we analyzed the expression of CAMP, DEFA1, DEFB4, and DEFB103A in patients with latent TB and progressive TB with and without comorbidity with diabetes mellitus type 2. Antimicrobial peptide gene expression increased during progressive TB, which could be used as a biomarker for reactivation. By contrast, patients with diabetes mellitus type 2 have lower antimicrobial peptides gene expression, suggesting that the lack of its proper production in these patients contribute to enhance the risk for TB reactivation. Copyright © 2011 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

  10. Expression and purification the antimicrobial peptide CM4 in Escherichia coli.

    PubMed

    Zhou, Liangfan; Lin, Qingping; Li, Baocun; Li, Nannan; Zhang, Shuangquan

    2009-03-01

    The antimicrobial peptide CM4 is a 35-residue cationic peptide. To explore a new approach for the expression and purification of CM4 in Escherichia coli, the CM4 gene was cloned into the vector pET32a to construct an expression vector pET32a-CM4. The fusion protein Trx-CM4, purified by Ni(2+)-chelating chromatography, was cleaved by hydroxylamine hydrochloride to release recombinant CM4. Purification of recombinant CM4 was achieved by reverse HPLC chromatography, and about 1.4 mg/l active recombinant CM4 with the purity more than 98% was obtained. The recombinant CM4 showed antimicrobial activities that were similar to synthetic one.

  11. iTRAQ-Based Quantitative Proteomic Analysis of the Antimicrobial Mechanism of Peptide F1 against Escherichia coli.

    PubMed

    Miao, Jianyin; Chen, Feilong; Duan, Shan; Gao, Xiangyang; Liu, Guo; Chen, Yunjiao; Dixon, William; Xiao, Hang; Cao, Yong

    2015-08-19

    Antimicrobial peptides have received increasing attention in the agricultural and food industries due to their potential to control pathogens. However, to facilitate the development of novel peptide-based antimicrobial agents, details regarding the molecular mechanisms of these peptides need to be elucidated. The aim of this study was to investigate the antimicrobial mechanism of peptide F1, a bacteriocin found in Tibetan kefir, against Escherichia coli at protein levels using iTRAQ-based quantitative proteomic analysis. In response to treatment with peptide F1, 31 of the 280 identified proteins in E. coli showed alterations in their expression, including 10 down-regulated proteins and 21 up-regulated proteins. These 31 proteins all possess different molecular functions and are involved in different molecular pathways, as is evident in referencing the Kyoto Encyclopedia of Genes and Genomes pathways. Specifically, pathways that were significantly altered in E. coli in response to peptide F1 treatment include the tricarboxylic acid cycle, oxidative phosphorylation, glycerophospholipid metabolism, and the cell cycle-caulobacter pathways, which was also associated with inhibition of the cell growth, induction of morphological changes, and cell death. The results provide novel insights into the molecular mechanisms of antimicrobial peptides.

  12. Expression systems for heterologous production of antimicrobial peptides.

    PubMed

    Parachin, Nádia Skorupa; Mulder, Kelly Cristina; Viana, Antônio Américo Barbosa; Dias, Simoni Campos; Franco, Octávio Luiz

    2012-12-01

    Antimicrobial peptides (AMPs) consist of molecules that act on the defense systems of numerous organisms toward multiple pathogens such as bacteria, fungi, parasites and viruses. These compounds have become extremely significant due to the increasing resistance of microorganisms to common antibiotics. However, the low quantity of peptides obtained from direct purification is, to date, still a remarkable bottleneck for scientific and industrial research development. Therefore, this review describes the main heterologous systems currently used for AMP production, including bacteria, fungi and plants, and also the related strategies for reaching greater functional peptide production. The main difficulties of each system are also described in order to provide some directions for AMP production. In summary, data revised here indicate that large-scale production of AMPs can be obtained using biotechnological tools, and the products may be applied in the pharmaceutical industry as well as in agribusiness.

  13. Novel imidazolium salt--peptide conjugates and their antimicrobial activity.

    PubMed

    Reinhardt, A; Horn, M; Schmauck, J Pieper Gen; Bröhl, A; Giernoth, R; Oelkrug, C; Schubert, A; Neundorf, I

    2014-12-17

    Our study presents innovative research dealing with the synthesis and biological evaluation of conjugates out of antimicrobial peptides (AMPs) and imidazolium cations that are derived from ionic liquids. AMPs are considered as promising alternatives to common antibiotics due to their different activity mechanisms. Antibacterial effects have also been described for ionic liquids bearing imidazolium cations . Besides single coupling of carboxy-functionalized imidazolium cations to the peptide N-terminal we also developed conjugates bearing multiple copies of imidazolium cations. The combination of both compounds resulted in synergistic effects that were most pronounced when more imidazolium cations were attached to the peptides. In addition, antibacterial activity even in drug-resistant bacterial strains could be observed. Moreover, the novel compounds showed good selectivity only against bacterial cells, an observation that was further proven by lipid interaction studies using giant unilamellar vesicles.

  14. A novel cysteine-rich antimicrobial peptide from the mucus of the snail of Achatina fulica.

    PubMed

    Zhong, Jian; Wang, Wenhong; Yang, Xiaomei; Yan, Xiuwen; Liu, Rui

    2013-01-01

    Antimicrobial peptides (AMPs) are important components of the innate immunity. Many antimicrobial peptides have been found from marine mollusks. Little information about AMPs of mollusks living on land is available. A novel cysteine-rich antimicrobial peptide (mytimacin-AF) belonging to the peptide family of mytimacins was purified and characterized from the mucus of the snail of Achatina fulica. Its cDNA was also cloned from the cDNA library. Mytimacin-AF is composed of 80 amino acid residues including 10 cysteines. Mytimacin-AF showed potent antimicrobial activity against Gram-negative and Gram-positive bacteria and the fungus Candida albicans. Among tested microorganisms, it exerted strongest antimicrobial activity against Staphylococcus aureus with a minimal peptide concentration (MIC) of 1.9 μg/ml. Mytimacin-AF had little hemolytic activity against human blood red cells. The current work confirmed the presence of mytimacin-like antimicrobial peptide in land-living mollusks.

  15. Transmembrane Pores Formed by Human Antimicrobial Peptide LL-37

    SciTech Connect

    Qian, Shuo

    2011-01-01

    Human LL-37 is a multifunctional cathelicidin peptide that has shown a wide spectrum of antimicrobial activity by permeabilizing microbial membranes similar to other antimicrobial peptides; however, its molecular mechanism has not been clarified. Two independent experiments revealed LL-37 bound to membranes in the {alpha}-helical form with the axis lying in the plane of membrane. This led to the conclusion that membrane permeabilization by LL-37 is a nonpore carpet-like mechanism of action. Here we report the detection of transmembrane pores induced by LL-37. The pore formation coincided with LL-37 helices aligning approximately normal to the plane of the membrane. We observed an unusual phenomenon of LL-37 embedded in stacked membranes, which are commonly used in peptide orientation studies. The membrane-bound LL-37 was found in the normal orientation only when the membrane spacing in the multilayers exceeded its fully hydrated value. This was achieved by swelling the stacked membranes with excessive water to a swollen state. The transmembrane pores were detected and investigated in swollen states by means of oriented circular dichroism, neutron in-plane scattering, and x-ray lamellar diffraction. The results are consistent with the effect of LL-37 on giant unilamellar vesicles. The detected pores had a water channel of radius 2333 {angstrom}. The molecular mechanism of pore formation by LL-37 is consistent with the two-state model exhibited by magainin and other small pore-forming peptides. The discovery that peptide-membrane interactions in swollen states are different from those in less hydrated states may have implications for other large membrane-active peptides and proteins studied in stacked membranes.

  16. Characterization of diverse antimicrobial peptides in skin secretions of Chungan torrent frog Amolops chunganensis.

    PubMed

    Yang, Xiaohong; Xia, Jiangnan; Yu, Zhijun; Hu, Yuhong; Li, Fengjiao; Meng, Hao; Yang, Shujie; Liu, Jingze; Wang, Hui

    2012-11-01

    We have cloned, synthesized, and characterized 11 novel antimicrobial peptides from a skin derived cDNA library of the Chungan torrent frog, Amolops chunganensis. Seven of the 11 antimicrobial peptides were present in authentic A. chunganensis skin secretions. Sequence analysis indicated that the 11 peptides belonged to the temporin, esculentin-2, palustrin-2, brevinin-1, and brevinin-2 families. The peptides displayed potent antimicrobial activities against several strains of microorganisms. One peptide, brevinin-1CG5, demonstrated antimicrobial activity against all tested Gram-positive and Gram-negative bacteria and fungi, and showed high antimicrobial potency (MIC=0.6 μM) against Gram-positive bacterium Rhodococcus rhodochrous. Some peptides also demonstrated weak hemolytic activity against human erythrocytes in vitro. Phylogenetic analysis based on the amino acid sequences of brevinin-1, brevinin-2, and esculentin-2 peptides from family Ranidae confirmed that the current taxonomic status of A. chunganensis is correct. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. A liaR deletion restores susceptibility to daptomycin and antimicrobial peptides in multidrug-resistant Enterococcus faecalis.

    PubMed

    Reyes, Jinnethe; Panesso, Diana; Tran, Truc T; Mishra, Nagendra N; Cruz, Melissa R; Munita, Jose M; Singh, Kavindra V; Yeaman, Michael R; Murray, Barbara E; Shamoo, Yousif; Garsin, Danielle; Bayer, Arnold S; Arias, Cesar A

    2015-04-15

    Daptomycin is a lipopeptide antibiotic that is used clinically against many gram-positive bacterial pathogens and is considered a key frontline bactericidal antibiotic to treat multidrug-resistant enterococci. Emergence of daptomycin resistance during therapy of serious enterococcal infections is a major clinical issue. In this work, we show that deletion of the gene encoding the response regulator, LiaR (a member of the LiaFSR system that controls cell envelope homeostasis), from daptomycin-resistant Enterococcus faecalis not only reversed resistance to 2 clinically available cell membrane-targeting antimicrobials (daptomycin and telavancin), but also resulted in hypersusceptibility to these antibiotics and to a variety of antimicrobial peptides of diverse origin and with different mechanisms of action. The changes in susceptibility to these antibiotics and antimicrobial peptides correlated with in vivo attenuation in a Caenorhabditis elegans model. Mechanistically, deletion of liaR altered the localization of cardiolipin microdomains in the cell membrane. Our findings suggest that LiaR is a master regulator of the enterococcal cell membrane response to diverse antimicrobial agents and peptides; as such, LiaR represents a novel target to restore the activity of clinically useful antimicrobials against these organisms and, potentially, increase susceptibility to endogenous antimicrobial peptides.

  18. Gram-positive bacterial cell envelopes: The impact on the activity of antimicrobial peptides.

    PubMed

    Malanovic, Nermina; Lohner, Karl

    2016-05-01

    A number of cationic antimicrobial peptides, effectors of innate immunity, are supposed to act at the cytoplasmic membrane leading to permeabilization and eventually membrane disruption. Thereby, interaction of antimicrobial peptides with anionic membrane phospholipids is considered to be a key factor in killing of bacteria. Recently, evidence was provided that killing takes place only when bacterial cell membranes are completely saturated with peptides. This adds to an ongoing debate, which role cell wall components such as peptidoglycan, lipoteichoic acid and lipopolysaccharide may play in the killing event, i.e. if they rather entrap or facilitate antimicrobial peptides access to the cytoplasmic membrane. Therefore, in this review we focused on the impact of Gram-positive cell wall components for the mode of action and activity of antimicrobial peptides as well as in innate immunity. This led us to conclude that interaction of antimicrobial peptides with peptidoglycan may not contribute to a reduction of their antimicrobial activity, whereas interaction with anionic lipoteichoic acids may reduce the local concentration of antimicrobial peptides on the cytoplasmic membrane necessary for sufficient destabilization of the membranes and bacterial killing. Further affinity studies of antimicrobial peptides toward the different cell wall as well as membrane components will be needed to address this problem on a quantitative level. This article is part of a Special Issue entitled: Antimicrobial peptides edited by Karl Lohner and Kai Hilpert.

  19. A simple and low-cost platform technology for producing pexiganan antimicrobial peptide in E. coli.

    PubMed

    Zhao, Chun-Xia; Dwyer, Mirjana Dimitrijev; Yu, Alice Lei; Wu, Yang; Fang, Sheng; Middelberg, Anton P J

    2015-05-01

    Antimicrobial peptides, as a new class of antibiotics, have generated tremendous interest as potential alternatives to classical antibiotics. However, the large-scale production of antimicrobial peptides remains a significant challenge. This paper reports a simple and low-cost chromatography-free platform technology for producing antimicrobial peptides in Escherichia coli (E. coli). A fusion protein comprising a variant of the helical biosurfactant protein DAMP4 and the known antimicrobial peptide pexiganan is designed by joining the two polypeptides, at the DNA level, via an acid-sensitive cleavage site. The resulting DAMP4(var)-pexiganan fusion protein expresses at high level and solubility in recombinant E. coli, and a simple heat-purification method was applied to disrupt cells and deliver high-purity DAMP4(var)-pexiganan protein. Simple acid cleavage successfully separated the DAMP4 variant protein and the antimicrobial peptide. Antimicrobial activity tests confirmed that the bio-produced antimicrobial peptide has the same antimicrobial activity as the equivalent product made by conventional chemical peptide synthesis. This simple and low-cost platform technology can be easily adapted to produce other valuable peptide products, and opens a new manufacturing approach for producing antimicrobial peptides at large scale using the tools and approaches of biochemical engineering.

  20. Diversity, evolution and medical applications of insect antimicrobial peptides

    PubMed Central

    Mylonakis, Eleftherios; Podsiadlowski, Lars; Muhammed, Maged

    2016-01-01

    Antimicrobial peptides (AMPs) are short proteins with antimicrobial activity. A large portion of known AMPs originate from insects, and the number and diversity of these molecules in different species varies considerably. Insect AMPs represent a potential source of alternative antibiotics to address the limitation of current antibiotics, which has been caused by the emergence and spread of multidrug-resistant pathogens. To get more insight into AMPs, we investigated the diversity and evolution of insect AMPs by mapping their phylogenetic distribution, allowing us to predict the evolutionary origins of selected AMP families and to identify evolutionarily conserved and taxon-specific families. Furthermore, we highlight the use of the nematode Caenorhabditis elegans as a whole-animal model in high-throughput screening methods to identify AMPs with efficacy against human pathogens, including Acinetobacter baumanii and methicillin-resistant Staphylococcus aureus. We also discuss the potential medical applications of AMPs, including their use as alternatives for conventional antibiotics in ectopic therapies, their combined use with antibiotics to restore the susceptibility of multidrug-resistant pathogens, and their use as templates for the rational design of peptidomimetic drugs that overcome the disadvantages of therapeutic peptides. The article is part of the themed issue ‘Evolutionary ecology of arthropod antimicrobial peptides’. PMID:27160593

  1. Molecular characterization of a novel antimicrobial peptide from Mytilus coruscus.

    PubMed

    Liao, Zhi; Wang, Xin-chao; Liu, Hui-hui; Fan, Mei-hua; Sun, Jing-jing; Shen, Wang

    2013-02-01

    Antimicrobial peptides (AMPs) are components of the innate immune responses that form the first line of host defense against pathogens. Marine mussels can produce a surprising abundance of cysteine-rich AMPs pertaining to the defensin, myticin, mytilin and mytimycin families, particularly in the circulating hemocytes. In the current study, we purified and characterized a novel cysteine-rich peptide with remarkable antibacterial activity from Mytilus coruscus and designated with myticusin-1, a 104-amino acid long polypeptide including 10 cysteine residues forming an unusual cysteine pattern. Antimicrobial assays demonstrated that myticusin-1 exhibited stronger anti-microbial properties against Gram-positive bacteria more than Gram-negative bacteria and fungus. Furthermore, myticusin-1 caused significant morphological alterations in both Sarcina luteus and Escherichia coli as shown by transmission electron microscopy (TEM). The cDNA of myticusin-1 was cloned and sequenced from the hemocytes cDNA library of M. coruscus. The mRNA transcripts of myticusin-1 are mainly detected in hemocyte, which indicates that myticusin-1 are specifically synthesized and stored in circulating hemocytes. The expression level of myticusin-1 in hemocytes was up-regulated and reached the highest level at 36 h after S. luteus challenge, which was 20-fold increase compared to that of the control group. These results indicated that myticusin-1 was involved in the host immune response against bacterial infection and might contribute to the clearance of invading bacteria.

  2. The New Antimicrobial Peptide SpHyastatin from the Mud Crab Scylla paramamosain with Multiple Antimicrobial Mechanisms and High Effect on Bacterial Infection

    PubMed Central

    Shan, Zhongguo; Zhu, Kexin; Peng, Hui; Chen, Bei; Liu, Jie; Chen, Fangyi; Ma, Xiaowan; Wang, Shuping; Qiao, Kun; Wang, Kejian

    2016-01-01

    SpHyastatin was first identified as a new cationic antimicrobial peptide in hemocytes of the mud crab Scylla paramamosain. Based on the amino acid sequences deduced, it was predicted that this peptide was composed of two different functional domains, a proline-rich domain (PRD) and a cysteine-rich domain (CRD). The recombinant product of SpHyastatin displayed potent antimicrobial activities against the human pathogen Staphylococcus aureus and the aquatic animal pathogens Aeromonas hydrophila and Pseudomonas fluorescens. Compared with the CRD of SpHyastatin, the PRD presented better antimicrobial and chitin binding activities, but both regions were essential for allowing SpHyastatin complete antimicrobial activity. The binding properties of SpHyastatin to different microbial surface molecules suggested that this might be an initial and crucial step for performing its antimicrobial activities. Evaluated using propidium iodide uptake assays and scanning electron microscopy images, the antimicrobial mechanism of SpHyastatin was found to be prone to disrupt cell membrane integrity. Interestingly, SpHyastatin exerted its role specifically on the surface of S. aureus and Pichia pastoris whereas it directly killed P. fluorescens through simultaneous targeting the membrane and the cytoplasm, indicating that SpHyastatin could use different antimicrobial mechanisms to kill different species of microbes. As expected, the recombinant SpHyastatin increased the survival rate of crabs challenged with Vibrio parahaemolyticus. In addition, SpHyastatin could modulate some V. parahaemolyticus-responsive genes in S. paramamosain. PMID:27493644

  3. Roles of Hydrophobicity and Charge Distribution of Cationic Antimicrobial Peptides in Peptide-Membrane Interactions*

    PubMed Central

    Yin, Lois M.; Edwards, Michelle A.; Li, Jessica; Yip, Christopher M.; Deber, Charles M.

    2012-01-01

    Cationic antimicrobial peptides (CAPs) occur as important innate immunity agents in many organisms, including humans, and offer a viable alternative to conventional antibiotics, as they physically disrupt the bacterial membranes, leading to membrane lysis and eventually cell death. In this work, we studied the biophysical and microbiological characteristics of designed CAPs varying in hydrophobicity levels and charge distributions by a variety of biophysical and biochemical approaches, including in-tandem atomic force microscopy, attenuated total reflection-FTIR, CD spectroscopy, and SDS-PAGE. Peptide structural properties were correlated with their membrane-disruptive abilities and antimicrobial activities. In bacterial lipid model membranes, a time-dependent increase in aggregated β-strand-type structure in CAPs with relatively high hydrophobicity (such as KKKKKKALFALWLAFLA-NH2) was essentially absent in CAPs with lower hydrophobicity (such as KKKKKKAAFAAWAAFAA-NH2). Redistribution of positive charges by placing three Lys residues at both termini while maintaining identical sequences minimized self-aggregation above the dimer level. Peptides containing four Leu residues were destructive to mammalian model membranes, whereas those with corresponding Ala residues were not. This finding was mirrored in hemolysis studies in human erythrocytes, where Ala-only peptides displayed virtually no hemolysis up to 320 μm, but the four-Leu peptides induced 40–80% hemolysis at the same concentration range. All peptides studied displayed strong antimicrobial activity against Pseudomonas aeruginosa (minimum inhibitory concentrations of 4–32 μm). The overall findings suggest optimum routes to balancing peptide hydrophobicity and charge distribution that allow efficient penetration and disruption of the bacterial membranes without damage to mammalian (host) membranes. PMID:22253439

  4. Comparative Evaluation of the Antimicrobial Activity of Different Antimicrobial Peptides against a Range of Pathogenic Bacteria

    PubMed Central

    Ebbensgaard, Anna; Mordhorst, Hanne; Overgaard, Michael Toft; Nielsen, Claus Gyrup; Aarestrup, Frank Møller; Hansen, Egon Bech

    2015-01-01

    Analysis of a Selected Set of Antimicrobial Peptides The rapid emergence of resistance to classical antibiotics has increased the interest in novel antimicrobial compounds. Antimicrobial peptides (AMPs) represent an attractive alternative to classical antibiotics and a number of different studies have reported antimicrobial activity data of various AMPs, but there is only limited comparative data available. The mode of action for many AMPs is largely unknown even though several models have suggested that the lipopolysaccharides (LPS) play a crucial role in the attraction and attachment of the AMP to the bacterial membrane in Gram-negative bacteria. We compared the potency of Cap18, Cap11, Cap11-1-18m2, Cecropin P1, Cecropin B, Bac2A, Bac2A-NH2, Sub5-NH2, Indolicidin, Melittin, Myxinidin, Myxinidin-NH2, Pyrrhocoricin, Apidaecin and Metalnikowin I towards Staphylococcus aureus, Enterococcus faecalis, Pseudomonas aeruginosa, Escherichia coli, Aeromonas salmonicida, Listeria monocytogenes, Campylobacter jejuni, Flavobacterium psychrophilum, Salmonella typhimurium and Yersinia ruckeri by minimal inhibitory concentration (MIC) determinations. Additional characteristics such as cytotoxicity, thermo and protease stability were measured and compared among the different peptides. Further, the antimicrobial activity of a selection of cationic AMPs was investigated in various E. coli LPS mutants. Cap18 Shows a High Broad Spectrum Antimicrobial Activity Of all the tested AMPs, Cap18 showed the most efficient antimicrobial activity, in particular against Gram-negative bacteria. In addition, Cap18 is highly thermostable and showed no cytotoxic effect in a hemolytic assay, measured at the concentration used. However, Cap18 is, as most of the tested AMPs, sensitive to proteolytic digestion in vitro. Thus, Cap18 is an excellent candidate for further development into practical use; however, modifications that should reduce the protease sensitivity would be needed. In addition, our

  5. Identification and characterization of antimicrobial peptides from the skin of the endangered frog Odorrana ishikawae.

    PubMed

    Iwakoshi-Ukena, Eiko; Ukena, Kazuyoshi; Okimoto, Aiko; Soga, Miyuki; Okada, Genya; Sano, Naomi; Fujii, Tamotsu; Sugawara, Yoshiaki; Sumida, Masayuki

    2011-04-01

    The endangered anuran species, Odorrana ishikawae, is endemic to only two small Japanese Islands, Amami and Okinawa. To assess the innate immune system in this frog, we investigated antimicrobial peptides in the skin using artificially bred animals. Nine novel antimicrobial peptides containing the C-terminal cyclic heptapeptide domain were isolated on the basis of antimicrobial activity against Escherichia coli. The peptides were members of the esculentin-1 (two peptides), esculentin-2 (one peptide), palustrin-2 (one peptide), brevinin-2 (three peptides) and nigrocin-2 (two peptides) antimicrobial peptide families. They were named esculentin-1ISa, esculentin-1ISb, esculentin-2ISa, palustrin-2ISa, brevinin-2ISa, brevinin-2ISb, brevinin-2ISc, nigrocin-2ISa and nigrocin-2ISb. Peptide primary structures suggest a close relationship with the Asian odorous frogs, Odorrana grahami and Odorrana hosii. These antimicrobial peptides possessed a broad-spectrum of growth inhibition against five microorganisms (E. coli, Staphylococcus aureus, methicillin-resistant S. aureus, Bacillus subtilis and Candida albicans). Nine different cDNAs encoding the precursor proteins were also cloned and showed that the precursor proteins exhibited a signal peptide, an N-terminal acidic spacer domain, a Lys-Arg processing site and an antimicrobial peptide at the C-terminus. Copyright © 2010 Elsevier Inc. All rights reserved.

  6. Recombinant expression of the antimicrobial peptide polyphemusin and its activity against the protozoan oyster pathogen Perkinsus marinus.

    PubMed

    Pierce, J C; Maloy, W L; Salvador, L; Dungan, C F

    1997-09-01

    Polyphemusin is a broad-spectrum antimicrobial peptide isolated from hemocytes of the North American horseshoe crab Limulus polyphemus. To date the polyphemusin used for scientific analyses has been purified from the natural materials or obtained by chemical synthesis. We report here the recombinant expression in Escherichia coli, and subsequent purification, of a polyphemusin analogue (rLim1). To prevent toxicity of the antimicrobial peptide in the highly susceptible E. coli host, we used a carboxy-terminal fusion protein cloning strategy provided by a maltose-binding protein (MBP) gene fusion system (New England Biolabs). Antimicrobial activity of recombinant polyphemusin was similar to that seen with amidated native polyphemusin peptide. When rLim1 was tested for antibiotic activity against the apicomplexan protozoan oyster pathogen Perkinsus marinus, complete inhibition was observed at 12 micrograms/ml, and partial inhibition at 8 micrograms/ml.

  7. Interactions Between Peptide and Preservatives: Effects on Peptide Self-Interactions and Antimicrobial Efficiency In Aqueous Multi-Dose Formulations.

    PubMed

    Heljo, P; Ross, A; Zarraga, I E; Pappenberger, A; Mahler, H-C

    2015-10-01

    Antimicrobial preservatives are known to interact with proteins and potentially affect their stability in aqueous solutions. In this systematic study, the interactions of a model peptide with three commonly used preservatives, benzyl alcohol, phenol and m-cresol, were evaluated. The impact on peptide oligomerization was studied using GC-MALS, SEC-MALS and DLS, antimicrobial efficiency of different formulations were studied using the Ph. Eur. antimicrobial efficacy test, and the molecular adsorption of preservative molecules on reversible peptide oligomers was monitored using NMR. The hydrodynamic radius and molar mass of the peptide oligomers was shown to clearly increase in the presence of m-cresol but less significantly with phenol and benzyl alcohol. The increase in size was most likely caused by peptide self-interactions becoming more attractive, leading to reversible oligomerization. On the other hand, increasing the concentration of peptide in multi-dose formulations led to reduced molecular mobility and decreased antimicrobial efficacy of all preservatives. Peptide-preservative interactions not only affect peptide self-interactions, but also antimicrobial efficiency of the preservatives and are thus of significant relevance. Adsorption of preservatives on oligomeric states of peptides is proposed as a mechanism to explain this reduced antimicrobial efficacy.

  8. Antimicrobial Peptides as Mediators of Innate Immunity in Teleosts

    PubMed Central

    Katzenback, Barbara A.

    2015-01-01

    Antimicrobial peptides (AMPs) have been identified throughout the metazoa suggesting their evolutionarily conserved nature and their presence in teleosts is no exception. AMPs are short (18–46 amino acids), usually cationic, amphipathic peptides. While AMPs are diverse in amino acid sequence, with no two AMPs being identical, they collectively appear to have conserved functions in the innate immunity of animals towards the pathogens they encounter in their environment. Fish AMPs are upregulated in response to pathogens and appear to have direct broad-spectrum antimicrobial activity towards both human and fish pathogens. However, an emerging role for AMPs as immunomodulatory molecules has become apparent—the ability of AMPs to activate the innate immune system sheds light onto the multifaceted capacity of these small peptides to combat pathogens through direct and indirect means. Herein, this review focuses on the role of teleost AMPs as modulators of the innate immune system and their regulation in response to pathogens or other exogenous molecules. The capacity to regulate AMP expression by exogenous factors may prove useful in modulating AMP expression in fish to prevent disease, particularly in aquaculture settings where crowded conditions and environmental stress pre-dispose these fish to infection. PMID:26426065

  9. S. Typhimurium strategies to resist killing by cationic antimicrobial peptides.

    PubMed

    Matamouros, Susana; Miller, Samuel I

    2015-11-01

    S. Typhimurium is a broad host range Gram-negative pathogen that must evade killing by host innate immune systems to colonize, replicate, cause disease, and be transmitted to other hosts. A major pathogenic strategy of Salmonellae is entrance, survival, and replication within eukaryotic cell phagocytic vacuoles. These phagocytic vacuoles and gastrointestinal mucosal surfaces contain multiple cationic antimicrobial peptides (CAMPs) which control invading bacteria. S. Typhimurium possesses several key mechanisms to resist killing by CAMPs which involve sensing CAMPs and membrane damage to activate signaling cascades that result in remodeling of the bacterial envelope to reduce its overall negative charge with an increase in hydrophobicity to decrease binding and effectiveness of CAMPs. Moreover Salmonellae have additional mechanisms to resist killing by CAMPs including an outer membrane protease which targets cationic peptides at the surface, and specific efflux pumps which protect the inner membrane from damage. This article is part of a Special Issue entitled: Bacterial Resistance to Antimicrobial Peptides. Copyright © 2015 Elsevier B.V. All rights reserved.

  10. Mammalian antimicrobial peptide influences control of cutaneous Leishmania infection

    PubMed Central

    Kulkarni, Manjusha M.; Barbi, Joseph; McMaster, W. Robert; Gallo, Richard L.; Satoskar, Abhay R.; McGwire, Bradford S.

    2011-01-01

    Summary Cathelicidin-type antimicrobial peptides (CAMP) are important mediators of innate immunity against microbial pathogens acting through direct interaction with and disruption of microbial membranes and indirectly through modulation of host cell migration and activation. Using a mouse knock-out model in CAMP we studied the role of this host peptide in control of dissemination of cutaneous infection by the parasitic protozoan Leishmania. The presence of pronounced host inflammatory infiltration in lesions and lymph nodes of infected animals was CAMP-dependent. Lack of CAMP expression was associated with higher levels of IL-10 receptor expression in bone marrow, splenic and lymph node macrophages as well as higher anti-inflammatory IL-10 production by bone marrow macrophages and spleen cells but reduced production of the pro-inflammatory cytokines IL-12 and IFN-γ by lymph nodes. Unlike wild-type mice, local lesions were exacerbated and parasites were found largely disseminated in CAMP knockouts. Infection of CAMP knockouts with parasite mutants lacking the surface metalloprotease virulence determinant resulted in more robust disseminated infection than in control animals suggesting that CAMP activity is negatively regulated by parasite surface proteolytic activity. This correlated with the ability of the pro-tease to degrade CAMP in vitro and co-localization of CAMP with parasites within macrophages. Our results highlight the interplay of antimicrobial peptides and Leishmania that influence the host immune response and the outcome of infection. PMID:21501359

  11. Structure and mechanism of action of the antimicrobial peptide piscidin.

    PubMed

    Campagna, Sylvie; Saint, Nathalie; Molle, Gérard; Aumelas, André

    2007-02-20

    Piscidin, an antibacterial peptide isolated from the mast cells of striped bass, has potent antimicrobial activity against a broad spectrum of pathogens in vitro. We investigated the mechanism of action of this 22-residue cationic peptide by carrying out structural studies and electrophysiological experiments in lipid bilayers. Circular dichroism experiments showed that piscidin was unstructured in water but had a high alpha-helix content in dodecylphosphocholine (DPC) micelles. 1H NMR data in water and TFE confirmed these results and demonstrated that the segment of residues 8-17 adopted an alpha-helical structure in a micellar environment. This molecule has a marked amphipathic character, due to well-defined hydrophobic and hydrophilic sectors. This structure is similar to those determined for other cationic peptides involved in permeabilization of the bacterial membrane. Multichannel experiments with piscidin incorporated into azolectin planar bilayers gave reproducible I-V curves at various peptide concentrations and unambiguously showed that this peptide permeabilized the membrane. This pore forming activity was confirmed by single-channel experiments, with well-defined ion channels obtained at different voltages. The characteristics of the ion channels (voltage dependence, only one or two states of conductance) clearly suggest that piscidin is more likely to permeabilize the membrane by toroidal pore formation rather than via the "barrel-stave" mechanism.

  12. Protocols for Studying Antimicrobial Peptides (AMPs) as Anticancer Agents.

    PubMed

    Madera, Laurence; Hoskin, David W

    2017-01-01

    Antimicrobial peptides (AMPs) are a class of small cationic peptides that are important for host defense. In a manner that is similar to AMP-mediated destruction of microbial pathogens, certain AMPs can physically associate with the anionic lipid membrane components of cancer cells, resulting in destabilization of the lipid membrane and subsequent peptide binding to intracellular targets, which ultimately leads to the death of the cancer cell. In comparison, normal healthy cells possess a neutral membrane charge and are therefore less affected by AMPs. Based on the selective cytotoxicity of certain AMPs for cancer cells, these peptides represent a potential reservoir of novel anticancer therapeutic agents. The development and improvement of AMPs as anticancer agents requires appropriate methods for determining the effects of these peptides on the viability and function of cancer cells. In this chapter, we describe methods to assess the ability of AMPs to cause cell membrane damage (measured by propidium iodide uptake), apoptosis and/or necrosis (measured by annexin V-FLUOS/propidium iodide staining), and mitochondrial membrane destabilization (measured by 3,3'-dihexyloxacarbocyanine iodide staining), as well as reduced motility (measured by a migration and invasion assay) of cancer cells growing in suspension or as monolayers. We also describe a tubule-forming assay that can be used to assess the effect of AMPs on angiogenesis.

  13. Unveiling antimicrobial peptide-generating human proteases using PROTEASIX.

    PubMed

    Bastos, Paulo; Trindade, Fábio; Ferreira, Rita; Casteleiro, Mercedes Arguello; Stevens, Robert; Klein, Julie; Vitorino, Rui

    2017-02-27

    Extracting information from peptidomics data is a major current challenge, as endogenous peptides can result from the activity of multiple enzymes. Proteolytic enzymes can display overlapping or complementary specificity. The activity spectrum of human endogenous peptide-generating proteases is not fully known. Hence, the indirect study of proteolytic enzymes through the analysis of its substrates is largely hampered. Antimicrobial peptides (AMPs) represent a primordial set of immune defense molecules generated by proteolytic cleavage of precursor proteins. These peptides can be modulated by host and microorganismal stimuli, which both dictate proteolytic enzymes' expression and activity. Peptidomics is an attractive approach to identify peptides with a biological role and to assess proteolytic activity. However, bioinformatics tools to deal with peptidomics data are lacking. PROTEASIX is an excellent choice for the prediction of AMPs-generating proteases based on the reconstitution of a substrate's cleavage sites and the crossing of such information with known proteases' specificity retrieved by several publicly available databases. Therefore, the focus of the present tutorial is to explore the potential of PROTEASIX when gather information concerning proteases involved in the generation of human AMPs and to teach the user how to make the most out of peptidomics results using PROTEASIX.

  14. Importance of Tryptophan in Transforming an Amphipathic Peptide into a Pseudomonas aeruginosa-Targeted Antimicrobial Peptide.

    PubMed

    Zhu, Xin; Ma, Zhi; Wang, Jiajun; Chou, Shuli; Shan, Anshan

    2014-01-01

    Here, we found that simple substitution of amino acids in the middle position of the hydrophobic face of an amphipathic peptide RI16 with tryptophan (T9W) considerably transformed into an antimicrobial peptide specifically targeting Pseudomonas aeruginosa. Minimal inhibitory concentration (MIC) results demonstrated that T9W had a strong and specifically antimicrobial activity against P. aeruginosa, including antibiotic-resistant strains, but was not active against Escherichia coli, Salmonella typhimurium, Staphylococcus aureus and Staphyfococcus epidermidis. Fluorescent spectroscopic assays indicated that T9W interacted with the membrane of P. aeruginosa, depolarizing the outer and the inner membrane of bacterial cells. Salt susceptibility assay showed that T9W still maintained its strong anti-pseudomonas activity in the presence of salts at physiological concentrations, and in hemolytic and MTT assays T9W also showed no toxicity against human blood cells and macrophages. In vivo assay demonstrated that T9W also displayed no toxicity to Chinese Kun Ming (KM) mice. Furthermore, the strong antibiofilm activity was also observed with the peptide T9W, which decreased the percentage of biomass formation in a dose-dependent manner. Overall, these findings indicated that design of single-pathogen antimicrobial agents can be achieved by simple amino acid mutation in naturally occurring peptide sequences and this study suggested a model of optimization/design of anti-pseudomonas drugs in which the tryptophan residue was a conserved element.

  15. Importance of Tryptophan in Transforming an Amphipathic Peptide into a Pseudomonas aeruginosa-Targeted Antimicrobial Peptide

    PubMed Central

    Zhu, Xin; Ma, Zhi; Wang, Jiajun; Chou, Shuli; Shan, Anshan

    2014-01-01

    Here, we found that simple substitution of amino acids in the middle position of the hydrophobic face of an amphipathic peptide RI16 with tryptophan (T9W) considerably transformed into an antimicrobial peptide specifically targeting Pseudomonas aeruginosa. Minimal inhibitory concentration (MIC) results demonstrated that T9W had a strong and specifically antimicrobial activity against P. aeruginosa, including antibiotic-resistant strains, but was not active against Escherichia coli, Salmonella typhimurium, Staphylococcus aureus and Staphyfococcus epidermidis. Fluorescent spectroscopic assays indicated that T9W interacted with the membrane of P. aeruginosa, depolarizing the outer and the inner membrane of bacterial cells. Salt susceptibility assay showed that T9W still maintained its strong anti-pseudomonas activity in the presence of salts at physiological concentrations, and in hemolytic and MTT assays T9W also showed no toxicity against human blood cells and macrophages. In vivo assay demonstrated that T9W also displayed no toxicity to Chinese Kun Ming (KM) mice. Furthermore, the strong antibiofilm activity was also observed with the peptide T9W, which decreased the percentage of biomass formation in a dose-dependent manner. Overall, these findings indicated that design of single-pathogen antimicrobial agents can be achieved by simple amino acid mutation in naturally occurring peptide sequences and this study suggested a model of optimization/design of anti-pseudomonas drugs in which the tryptophan residue was a conserved element. PMID:25494332

  16. Characterization of Antimicrobial Peptides toward the Development of Novel Antibiotics

    PubMed Central

    Aoki, Wataru; Ueda, Mitsuyoshi

    2013-01-01

    Antimicrobial agents have eradicated many infectious diseases and significantly improved our living environment. However, abuse of antimicrobial agents has accelerated the emergence of multidrug-resistant microorganisms, and there is an urgent need for novel antibiotics. Antimicrobial peptides (AMPs) have attracted attention as a novel class of antimicrobial agents because AMPs efficiently kill a wide range of species, including bacteria, fungi, and viruses, via a novel mechanism of action. In addition, they are effective against pathogens that are resistant to almost all conventional antibiotics. AMPs have promising properties; they directly disrupt the functions of cellular membranes and nucleic acids, and the rate of appearance of AMP-resistant strains is very low. However, as pharmaceuticals, AMPs exhibit unfavorable properties, such as instability, hemolytic activity, high cost of production, salt sensitivity, and a broad spectrum of activity. Therefore, it is vital to improve these properties to develop novel AMP treatments. Here, we have reviewed the basic biochemical properties of AMPs and the recent strategies used to modulate these properties of AMPs to enhance their safety. PMID:24276381

  17. Characterization of Antimicrobial Peptides toward the Development of Novel Antibiotics.

    PubMed

    Aoki, Wataru; Ueda, Mitsuyoshi

    2013-08-21

    Antimicrobial agents have eradicated many infectious diseases and significantly improved our living environment. However, abuse of antimicrobial agents has accelerated the emergence of multidrug-resistant microorganisms, and there is an urgent need for novel antibiotics. Antimicrobial peptides (AMPs) have attracted attention as a novel class of antimicrobial agents because AMPs efficiently kill a wide range of species, including bacteria, fungi, and viruses, via a novel mechanism of action. In addition, they are effective against pathogens that are resistant to almost all conventional antibiotics. AMPs have promising properties; they directly disrupt the functions of cellular membranes and nucleic acids, and the rate of appearance of AMP-resistant strains is very low. However, as pharmaceuticals, AMPs exhibit unfavorable properties, such as instability, hemolytic activity, high cost of production, salt sensitivity, and a broad spectrum of activity. Therefore, it is vital to improve these properties to develop novel AMP treatments. Here, we have reviewed the basic biochemical properties of AMPs and the recent strategies used to modulate these properties of AMPs to enhance their safety.

  18. Identification of a Novel Proline-Rich Antimicrobial Peptide from Brassica napus.

    PubMed

    Cao, Huihui; Ke, Tao; Liu, Renhu; Yu, Jingyin; Dong, Caihua; Cheng, Mingxing; Huang, Junyan; Liu, Shengyi

    2015-01-01

    Proline-rich antimicrobial peptides (PR-AMPs) are a group of cationic host defense peptides that are characterized by a high content of proline residues. Up to now, they have been reported in some insects, vertebrate and invertebrate animals, but are not found in plants. In this study, we performed an in silico screening of antimicrobial peptides, which led to discovery of a Brassica napus gene encoding a novel PR-AMP. This gene encodes a 35-amino acid peptide with 13 proline residues, designated BnPRP1. BnPRP1 has 40.5% identity with a known proline-rich antimicrobial peptide SP-B from the pig. BnPRP1 was artificially synthetized and cloned into the prokaryotic expression vector pET30a/His-EDDIE-GFP. Recombinant BnPRP1 was produced in Escherichia coli and has a predicted molecular mass of 3.8 kDa. Analysis of its activity demonstrated that BnPRP1 exhibited strong antimicrobial activity against Gram-positive bacterium, Gram-negative bacterium, yeast and also had strong antifungal activity against several pathogenic fungi, such as Sclerotinia sclerotiorum, Mucor sp., Magnaporthe oryzae and Botrytis cinerea. Circular dichroism (CD) revealed the main secondary structure of BnPRP1 was the random coil. BnPRP1 gene expression detected by qRT-PCR is responsive to pathogen inoculation. At 48 hours after S. sclerotiorum inoculation, the expression of BnPRP1 increased significantly in the susceptible lines while slight decrease occurred in resistant lines. These suggested that BnPRP1 might play a role in the plant defense response against S. sclerotiorum. BnPRP1 isolated from B. napus was the first PR-AMP member that was characterized in plants, and its homology sequences were found in some other Brassicaceae plants by the genome sequences analysis. Compared with the known PR-AMPs, BnPRP1 has the different primary sequences and antimicrobial activity. Above all, this study gives a chance to cast a new light on further understanding about the AMPs' mechanism and application.

  19. Circular Dichroism studies on the interactions of antimicrobial peptides with bacterial cells

    NASA Astrophysics Data System (ADS)

    Avitabile, Concetta; D'Andrea, Luca Domenico; Romanelli, Alessandra

    2014-03-01

    Studying how antimicrobial peptides interact with bacterial cells is pivotal to understand their mechanism of action. In this paper we explored the use of Circular Dichroism to detect the secondary structure of two antimicrobial peptides, magainin 2 and cecropin A, with E. coli bacterial cells. The results of our studies allow us to gain two important information in the context of antimicrobial peptides- bacterial cells interactions: peptides fold mainly due to interaction with LPS, which is the main component of the Gram negative bacteria outer membrane and the time required for the folding on the bacterial cells depends on the peptide analyzed.

  20. Spermicidal Activity of the Safe Natural Antimicrobial Peptide Subtilosin

    PubMed Central

    Sutyak, Katia E.; Anderson, Robert A.; Dover, Sara E.; Feathergill, Kenneth A.; Aroutcheva, Alla A.; Faro, Sebastian; Chikindas, Michael L.

    2008-01-01

    Bacterial vaginosis (BV), a condition affecting millions of women each year, is primarily caused by the gram-variable organism Gardnerella vaginalis. A number of organisms associated with BV cases have been reported to develop multidrug resistance, leading to the need for alternative therapies. Previously, we reported the antimicrobial peptide subtilosin has proven antimicrobial activity against G. vaginalis, but not against the tested healthy vaginal microbiota of lactobacilli. After conducting tissue sensitivity assays using an ectocervical tissue model, we determined that human cells remained viable after prolonged exposures to partially-purified subtilosin, indicating the compound is safe for human use. Subtilosin was shown to eliminate the motility and forward progression of human spermatozoa in a dose-dependent manner, and can therefore be considered a general spermicidal agent. These results suggest subtilosin would be a valuable component in topical personal care products aimed at contraception and BV prophylaxis and treatment. PMID:18923673

  1. Distinct antimicrobial peptide expression determines host species-specific bacterial associations

    PubMed Central

    Franzenburg, Sören; Walter, Jonas; Künzel, Sven; Wang, Jun; Baines, John F.; Bosch, Thomas C. G.; Fraune, Sebastian

    2013-01-01

    Animals are colonized by coevolved bacterial communities, which contribute to the host’s health. This commensal microbiota is often highly specific to its host-species, inferring strong selective pressures on the associated microbes. Several factors, including diet, mucus composition, and the immune system have been proposed as putative determinants of host-associated bacterial communities. Here we report that species-specific antimicrobial peptides account for different bacterial communities associated with closely related species of the cnidarian Hydra. Gene family extensions for potent antimicrobial peptides, the arminins, were detected in four Hydra species, with each species possessing a unique composition and expression profile of arminins. For functional analysis, we inoculated arminin-deficient and control polyps with bacterial consortia characteristic for different Hydra species and compared their selective preferences by 454 pyrosequencing of the bacterial microbiota. In contrast to control polyps, arminin-deficient polyps displayed decreased potential to select for bacterial communities resembling their native microbiota. This finding indicates that species-specific antimicrobial peptides shape species-specific bacterial associations. PMID:24003149

  2. A novel antimicrobial peptide derived from fish goose type lysozyme disrupts the membrane of Salmonella enterica.

    PubMed

    Kumaresan, Venkatesh; Bhatt, Prasanth; Ganesh, Munuswamy-Ramanujam; Harikrishnan, Ramasamy; Arasu, MariadhasValan; Al-Dhabi, Naif Abdullah; Pasupuleti, Mukesh; Marimuthu, Kasi; Arockiaraj, Jesu

    2015-12-01

    In aquaculture, accumulation of antibiotics resulted in development of resistance among bacterial pathogens. Consequently, it became mandatory to find alternative to synthetic antibiotics. Antimicrobial peptides (AMPs) which are described as evolutionary ancient weapons have been considered as promising alternates in recent years. In this study, a novel antimicrobial peptide had been derived from goose type lysozyme (LyzG) which was identified from the cDNA library of freshwater fish Channa striatus (Cs). The identified lysozyme cDNA contains 585 nucleotides which encodes a protein of 194 amino acids. CsLyzG was closely related to Siniperca chuatsi with 92.8% homology. The depicted protein sequence contained a GEWL domain with conserved GLMQ motif, 7 active residues and 2 catalytic residues. Gene expression analysis revealed that CsLyzG was distributed in major immune organs with highest expression in head kidney. Results of temporal expression analysis after bacterial (Aeromonas hydrophila) and fungal (Aphanomyces invadans) challenges indicated a stimulant-dependent expression pattern of CsLyzG. Two antimicrobial peptides IK12 and TS10 were identified from CsLyzG and synthesized. Antibiogram showed that IK12 was active against Salmonella enterica, a major multi-drug resistant (MDR) bacterial pathogen which produces beta lactamase. The IK12 induced loss of cell viability in the bacterial pathogen. Flow cytometry assay revealed that IK12 disrupt the membrane of S. enterica which is confirmed by scanning electron microscope (SEM) analysis that reveals blebs around the bacterial cell membrane. Conclusively, CsLyzG is a potential innate immune component and the identified antimicrobial peptide has great caliber to be used as an ecofriendly antibacterial substance in aquaculture.

  3. Dynamical and phase behavior of a phospholipid membrane altered by an antimicrobial peptide at low concentration

    SciTech Connect

    Mamontov, Eugene; Tyagi, M.; Qian, Shuo; Rai, Durgesh K.; Urban, Volker S.; Sharma, V. K.

    2016-05-27

    Here we discuss that the mechanism of action of antimicrobial peptides is traditionally attributed to the formation of pores in the lipid cell membranes of pathogens, which requires a substantial peptide to lipid ratio. However, using incoherent neutron scattering, we show that even at a concentration too low for pore formation, an archetypal antimicrobial peptide, melittin, disrupts the regular phase behavior of the microscopic dynamics in a phospholipid membrane, dimyristoylphosphatidylcholine (DMPC). At the same time, another antimicrobial peptide, alamethicin, does not exert a similar effect on the DMPC microscopic dynamics. The melittin-altered lateral motion of DMPC at physiological temperature no longer resembles the fluid-phase behavior characteristic of functional membranes of the living cells. The disruptive effect demonstrated by melittin even at low concentrations reveals a new mechanism of antimicrobial action relevant in more realistic scenarios, when peptide concentration is not as high as would be required for pore formation, which may facilitate treatment with antimicrobial peptides.

  4. Antimicrobial activity of antihypertensive food-derived peptides and selected alanine analogues.

    PubMed

    McClean, Stephen; Beggs, Louise B; Welch, Robert W

    2014-03-01

    This study evaluated four food-derived peptides with known antihypertensive activities for antimicrobial activity against pathogenic microorganisms, and assessed structure-function relationships using alanine analogues. The peptides (EVSLNSGYY, barley; PGTAVFK, soybean; TTMPLW, α-casein; VHLPP, α-zein) and the six alanine substitution peptides of PGTAVFK were synthesised, characterised and evaluated for antimicrobial activity using the bacteria, Escherichia coli, Staphylococcus aureus, and Micrococcus luteus and the yeast, Candida albicans. The peptides TTMPLW and PGTAVFK inhibited growth of all four microorganisms tested, with activities of a similar order of magnitude to ampicillin and ethanol controls. EVSLNSGYY inhibited the growth of the bacteria, but VHLPP showed no antimicrobial activity. The alanine analogue, PGAAVFK showed the highest overall antimicrobial activity and PGTAVFA showed no activity; overall, the activities of the analogues were consistent with their structures. Some peptides with antihypertensive activity also show antimicrobial activity, suggesting that food-derived peptides may exert beneficial effects via a number of mechanisms.

  5. Dynamical and phase behavior of a phospholipid membrane altered by an antimicrobial peptide at low concentration

    SciTech Connect

    Mamontov, Eugene; Tyagi, M.; Qian, Shuo; Rai, Durgesh K.; Urban, Volker S.; Sharma, V. K.

    2016-05-27

    Here we discuss that the mechanism of action of antimicrobial peptides is traditionally attributed to the formation of pores in the lipid cell membranes of pathogens, which requires a substantial peptide to lipid ratio. However, using incoherent neutron scattering, we show that even at a concentration too low for pore formation, an archetypal antimicrobial peptide, melittin, disrupts the regular phase behavior of the microscopic dynamics in a phospholipid membrane, dimyristoylphosphatidylcholine (DMPC). At the same time, another antimicrobial peptide, alamethicin, does not exert a similar effect on the DMPC microscopic dynamics. The melittin-altered lateral motion of DMPC at physiological temperature no longer resembles the fluid-phase behavior characteristic of functional membranes of the living cells. The disruptive effect demonstrated by melittin even at low concentrations reveals a new mechanism of antimicrobial action relevant in more realistic scenarios, when peptide concentration is not as high as would be required for pore formation, which may facilitate treatment with antimicrobial peptides.

  6. Antimicrobial Peptides and Wound Healing: Biological and Therapeutic Considerations

    PubMed Central

    Mangoni, Maria Luisa; McDermott, Alison M.; Zasloff, Michael

    2016-01-01

    Repair of tissue wounds is a fundamental process to re-establish tissue integrity and regular function. Importantly, infection is a major factor that hinders wound healing. Multicellular organisms have evolved an arsenal of host-defence molecules, including antimicrobial peptides (AMPs), aimed at controlling microbial proliferation and at modulating the host's immune response to a variety of biological or physical insults. In this brief review we provide the evidence for a role of AMPs as endogenous mediators of wound healing and their promising therapeutic potential for treatment of non-life threatening skin and other epithelial injuries. PMID:26738772

  7. Antimicrobial Peptides: New Recognition Molecules for Detecting Botulinum Toxins

    PubMed Central

    Kulagina, Nadezhda V.; Anderson, George P.; Ligler, Frances S.; Shaffer, Kara M.; Taitt, Chris Rowe

    2007-01-01

    Many organisms secrete antimicrobial peptides (AMPs) for protection against harmful microbes. The present study describes detection of botulinum neurotoxoids A, B and E using AMPs as recognition elements in an array biosensor. While AMP affinities were similar to those for anti-botulinum antibodies, differences in binding patterns were observed and can potentially be used for identification of toxoid serotype. Furthermore, some AMPs also demonstrated superior detection sensitivity compared to antibodies: toxoid A could be detected at 3.5 LD50 of the active toxin in a 75-min assay, whereas toxoids B and E were detected at 14 and 80 LD50 for their respective toxins.

  8. Assays for Identifying Inducers of the Antimicrobial Peptide LL-37.

    PubMed

    Nylén, Frank; Bergman, Peter; Gudmundsson, Gudmundur H; Agerberth, Birgitta

    2017-01-01

    One promising approach to meet the growing problem of antibiotic resistance is to modulate host defense mechanisms, i.e., host-directed therapy (HDT), in the fight against infections. Induction of endogenous antimicrobial peptides (AMPs) via small molecular compounds, such as 1,25-dihydroxyvitamin D3 or phenylbutyrate, could provide one such HDT-based approach.We have developed a cell-based screening assay for the identification of novel compounds with the capacity to induce AMP expression and here follows the detailed protocol.

  9. Machine learning in the rational design of antimicrobial peptides.

    PubMed

    Rondón-Villarreal, Paola; Sierra, Daniel A; Torres, Rodrigo

    2014-01-01

    One of the most important public health issues is the microbial and bacterial resistance to conventional antibiotics by pathogen microorganisms. In recent years, many researches have been focused on the development of new antibiotics. Among these, antimicrobial peptides (AMPs) have raised as a promising alternative to combat antibioticresistant microorganisms. For this reason, many theoretical efforts have been done in the development of new computational tools for the rational design of both better and effective AMPs. In this review, we present an overview of the rational design of AMPs using machine learning techniques and new research fields.

  10. Antimicrobial peptides and wound healing: biological and therapeutic considerations.

    PubMed

    Mangoni, Maria Luisa; McDermott, Alison M; Zasloff, Michael

    2016-03-01

    Repair of tissue wounds is a fundamental process to re-establish tissue integrity and regular function. Importantly, infection is a major factor that hinders wound healing. Multicellular organisms have evolved an arsenal of host-defense molecules, including antimicrobial peptides (AMPs), aimed at controlling microbial proliferation and at modulating the host's immune response to a variety of biological or physical insults. In this brief review, we provide the evidence for a role of AMPs as endogenous mediators of wound healing and their promising therapeutic potential for the treatment of non-life-threatening skin and other epithelial injuries. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  11. Susceptibilities of Bordetella pertussis strains to antimicrobial peptides.

    PubMed Central

    Fernandez, R C; Weiss, A A

    1996-01-01

    We examined the susceptibilities of Bordetella pertussis strains to several antimicrobial peptides by determining the concentration required to inhibit or kill 50% of the bacterial population. The peptides are ranked in decreasing potency as follows: cecropin B > cecropin A >> melittin > cecropin P1 > (ala8,13,18)-magainin II amide > mastoparan = defensin HNP1 > protamine > or = magainin II = magainin I. By using a radial diffusion assay to compare susceptibilities between strains, wild-type B. pertussis BP338 was more resistant than the avirulent bvg mutant strain BP347 and the brk mutant strain BPM2041 to killing by cecropin P1. In contrast, compared with the wild type, the avirulent BP347 strain was highly resistant to killing by protamine and defensin HNP1. PMID:8849226

  12. Mining antimicrobial peptides from small open reading frames in Ciona intestinalis.

    PubMed

    Lu, Yongzhong; Zhuang, Yu; Liu, Jie

    2014-01-01

    Though being able to encode various kinds of bioactive peptides, small open reading frames (sORFs) are poorly annotated in many genomic data. The present study was conducted to evaluate the potential of sORFs in encoding antimicrobial peptides (AMPs) in the basal chordate model Ciona intestinalis. About 4.8 m genomic sequence was first retrieved for sORFs mining by the program sORF finder, then the sORFs were translated into amino acid sequences for AMP prediction via CAMP server, and thereafter, ten putative AMPs were selected for expression and antimicrobial activity validation. In total, over 180 peptides deduced from the sORFs were predicted to be AMPs. Among the ten tested peptides, six were found to have significant expressed sequence tag matches, providing strong evidence for gene expression; five were proved to be active against the bacterial strains. These results indicate that many sORFs in C. intestinalis genome contain AMP information. This work can serve as an important initial step to investigate the role of sORFs in the innate defense of C. intestinalis.

  13. Resurrecting inactive antimicrobial peptides from the lipopolysaccharide trap.

    PubMed

    Mohanram, Harini; Bhattacharjya, Surajit

    2014-01-01

    Host defense antimicrobial peptides (AMPs) are a promising source of antibiotics for the treatment of multiple-drug-resistant pathogens. Lipopolysaccharide (LPS), the major component of the outer leaflet of the outer membrane of Gram-negative bacteria, functions as a permeability barrier against a variety of molecules, including AMPs. Further, LPS or endotoxin is the causative agent of sepsis killing 100,000 people per year in the United States alone. LPS can restrict the activity of AMPs inducing aggregations at the outer membrane, as observed for frog AMPs, temporins, and also in model AMPs. Aggregated AMPs, "trapped" by the outer membrane, are unable to traverse the cell wall, causing their inactivation. In this work, we show that these inactive AMPs can overcome LPS-induced aggregations while conjugated with a short LPS binding β-boomerang peptide motif and become highly bactericidal. The generated hybrid peptides exhibit activity against Gram-negative and Gram-positive bacteria in high-salt conditions and detoxify endotoxin. Structural and biophysical studies establish the mechanism of action of these peptides in LPS outer membrane. Most importantly, this study provides a new concept for the development of a potent broad-spectrum antibiotic with efficient outer membrane disruption as the mode of action.

  14. InverPep: A database of invertebrate antimicrobial peptides.

    PubMed

    Gómez, Esteban A; Giraldo, Paula; Orduz, Sergio

    2017-03-01

    The aim of this work was to construct InverPep, a database specialised in experimentally validated antimicrobial peptides (AMPs) from invertebrates. AMP data contained in InverPep were manually curated from other databases and the scientific literature. MySQL was integrated with the development platform Laravel; this framework allows to integrate programming in PHP with HTML and was used to design the InverPep web page's interface. InverPep contains 18 separated fields, including InverPep code, phylum and species source, peptide name, sequence, peptide length, secondary structure, molar mass, charge, isoelectric point, hydrophobicity, Boman index, aliphatic index and percentage of hydrophobic amino acids. CALCAMPI, an algorithm to calculate the physicochemical properties of multiple peptides simultaneously, was programmed in PERL language. To date, InverPep contains 702 experimentally validated AMPs from invertebrate species. All of the peptides contain information associated with their source, physicochemical properties, secondary structure, biological activity and links to external literature. Most AMPs in InverPep have a length between 10 and 50 amino acids, a positive charge, a Boman index between 0 and 2 kcal/mol, and 30-50% hydrophobic amino acids. InverPep includes 33 AMPs not reported in other databases. Besides, CALCAMPI and statistical analysis of InverPep data is presented. The InverPep database is available in English and Spanish. InverPep is a useful database to study invertebrate AMPs and its information could be used for the design of new peptides. The user-friendly interface of InverPep and its information can be freely accessed via a web-based browser at http://ciencias.medellin.unal.edu.co/gruposdeinvestigacion/prospeccionydisenobiomoleculas/InverPep/public/home_en. Copyright © 2016 International Society for Chemotherapy of Infection and Cancer. Published by Elsevier Ltd. All rights reserved.

  15. Influence of the yjiL-mdtM Gene Cluster on the Antibacterial Activity of Proline-Rich Antimicrobial Peptides Overcoming Escherichia coli Resistance Induced by the Missing SbmA Transporter System.

    PubMed

    Krizsan, Andor; Knappe, Daniel; Hoffmann, Ralf

    2015-10-01

    In view of increasing health threats from multiresistant pathogens, antimicrobial peptides (AMPs) and, specifically, proline-rich AMPs (PrAMPs) have been investigated in animal models. PrAMPs enter bacteria via the ABC transporter SbmA and inhibit intracellular targets. We used phage transduction (Tn10 insertion) to screen by random mutagenesis for alternative uptake mechanisms for analogs of apidaecin 1b, a honeybee-derived PrAMP. All 24 apidaecin-resistant mutants had the Tn10 insertion in the sbmA gene. These sbmA::Tn10 insertion mutants and the Escherichia coli BW25113 ΔsbmA (JW0368) strain were still susceptible to the bactenecin PrAMP Bac7(1-35) and oncocin PrAMPs Onc18 and Onc112, as well as to Chex1-Arg20, despite significantly reduced internalizations. In a second round of random mutagenesis, the remaining susceptibility was linked to the yjiL-mdtM gene cluster. E. coli BW25113 and its ΔyjiL null mutant (JW5785) were equally susceptible to all PrAMPs tested, whereas the BW25113 ΔmdtM mutant was less susceptible to oncocins. The JW0368 yjiL::Tn10 transposon mutant (BS2) was resistant to all short PrAMPs and susceptible only to full-length Bac7 and A3-APO. Interestingly, PrAMPs appear to enter bacteria via MdtM, a multidrug resistance transporter (drug/H(+) antiporter) of the major facilitator superfamily (MFS) that can efflux antibiotics, biocides, and bile salts. In conclusion, PrAMPs enter bacteria via ABC and MFS transporters that efflux antibiotics and cytotoxic compounds from the cytoplasm to the periplasm.

  16. Influence of the yjiL-mdtM Gene Cluster on the Antibacterial Activity of Proline-Rich Antimicrobial Peptides Overcoming Escherichia coli Resistance Induced by the Missing SbmA Transporter System

    PubMed Central

    Krizsan, Andor; Knappe, Daniel

    2015-01-01

    In view of increasing health threats from multiresistant pathogens, antimicrobial peptides (AMPs) and, specifically, proline-rich AMPs (PrAMPs) have been investigated in animal models. PrAMPs enter bacteria via the ABC transporter SbmA and inhibit intracellular targets. We used phage transduction (Tn10 insertion) to screen by random mutagenesis for alternative uptake mechanisms for analogs of apidaecin 1b, a honeybee-derived PrAMP. All 24 apidaecin-resistant mutants had the Tn10 insertion in the sbmA gene. These sbmA::Tn10 insertion mutants and the Escherichia coli BW25113 ΔsbmA (JW0368) strain were still susceptible to the bactenecin PrAMP Bac7(1-35) and oncocin PrAMPs Onc18 and Onc112, as well as to Chex1-Arg20, despite significantly reduced internalizations. In a second round of random mutagenesis, the remaining susceptibility was linked to the yjiL-mdtM gene cluster. E. coli BW25113 and its ΔyjiL null mutant (JW5785) were equally susceptible to all PrAMPs tested, whereas the BW25113 ΔmdtM mutant was less susceptible to oncocins. The JW0368 yjiL::Tn10 transposon mutant (BS2) was resistant to all short PrAMPs and susceptible only to full-length Bac7 and A3-APO. Interestingly, PrAMPs appear to enter bacteria via MdtM, a multidrug resistance transporter (drug/H+ antiporter) of the major facilitator superfamily (MFS) that can efflux antibiotics, biocides, and bile salts. In conclusion, PrAMPs enter bacteria via ABC and MFS transporters that efflux antibiotics and cytotoxic compounds from the cytoplasm to the periplasm. PMID:26169420

  17. Effects of dimerization on the structure and biological activity of antimicrobial peptide Ctx-Ha.

    PubMed

    Lorenzón, E N; Cespedes, G F; Vicente, E F; Nogueira, L G; Bauab, T M; Castro, M S; Cilli, E M

    2012-06-01

    It is well known that cationic antimicrobial peptides (cAMPs) are potential microbicidal agents for the increasing problem of antimicrobial resistance. However, the physicochemical properties of each peptide need to be optimized for clinical use. To evaluate the effects of dimerization on the structure and biological activity of the antimicrobial peptide Ctx-Ha, we have synthesized the monomeric and three dimeric (Lys-branched) forms of the Ctx-Ha peptide by solid-phase peptide synthesis using a combination of 9-fluorenylmethyloxycarbonyl (Fmoc) and t-butoxycarbonyl (Boc) chemical approaches. The antimicrobial activity assay showed that dimerization decreases the ability of the peptide to inhibit growth of bacteria or fungi; however, the dimeric analogs displayed a higher level of bactericidal activity. In addition, a dramatic increase (50 times) in hemolytic activity was achieved with these analogs. Permeabilization studies showed that the rate of carboxyfluorescein release was higher for the dimeric peptides than for the monomeric peptide, especially in vesicles that contained sphingomyelin. Despite different biological activities, the secondary structure and pore diameter were not significantly altered by dimerization. In contrast to the case for other dimeric cAMPs, we have shown that dimerization selectively decreases the antimicrobial activity of this peptide and increases the hemolytic activity. The results also show that the interaction between dimeric peptides and the cell wall could be responsible for the decrease of the antimicrobial activity of these peptides.

  18. Searching for Synthetic Antimicrobial Peptides: An Experiment for Organic Chemistry Students

    ERIC Educational Resources Information Center

    Vasquez, Thomas E., Jr.; Saldan~a, Cristina; Muzikar, Katy A.; Mashek, Debra; Liu, Jane M.

    2016-01-01

    This laboratory experiment provides undergraduate students enrolled in organic chemistry the opportunity to design and synthesize their own peptide, which is then tested for antimicrobial activity. After reading a primary scientific paper on antimicrobial peptides, students design and synthesize their own hexapeptide that they hypothesize will…

  19. Searching for Synthetic Antimicrobial Peptides: An Experiment for Organic Chemistry Students

    ERIC Educational Resources Information Center

    Vasquez, Thomas E., Jr.; Saldan~a, Cristina; Muzikar, Katy A.; Mashek, Debra; Liu, Jane M.

    2016-01-01

    This laboratory experiment provides undergraduate students enrolled in organic chemistry the opportunity to design and synthesize their own peptide, which is then tested for antimicrobial activity. After reading a primary scientific paper on antimicrobial peptides, students design and synthesize their own hexapeptide that they hypothesize will…

  20. Antimicrobial activity of de novo designed cationic peptides against multi-resistant clinical isolates.

    PubMed

    Faccone, Diego; Veliz, Omar; Corso, Alejandra; Noguera, Martin; Martínez, Melina; Payes, Cristian; Semorile, Liliana; Maffía, Paulo Cesar

    2014-01-01

    Antibiotic resistance is one of the main problems concerning public health or clinical practice. Antimicrobial peptides appear as good candidates for the development of new therapeutic drugs. In this study we de novo designed a group of cationic antimicrobial peptides, analyzed its physicochemical properties, including its structure by circular dichroism and studied its antimicrobial properties against a panel of clinical isolates expressing different mechanisms of resistance. Three cationic alpha helical peptides exhibited antimicrobial activity comparable to, or even better than the comparator omiganan (MBI-226).

  1. Cationic antimicrobial peptides disrupt the Streptococcus pyogenes ExPortal.

    PubMed

    Vega, Luis Alberto; Caparon, Michael G

    2012-09-01

    Although they possess a well-characterized ability to porate the bacterial membrane, emerging research suggests that cationic antimicrobial peptides (CAPs) can influence pathogen behaviour at levels that are sublethal. In this study, we investigated the interaction of polymyxin B and human neutrophil peptide (HNP-1) with the human pathogen Streptococcus pyogenes. At sublethal concentrations, these CAPs preferentially targeted the ExPortal, a unique microdomain of the S. pyogenes membrane, specialized for protein secretion and processing. A consequence of this interaction was the disruption of ExPortal organization and a redistribution of ExPortal components into the peripheral membrane. Redistribution was associated with inhibition of secretion of certain toxins, including the SpeB cysteine protease and the streptolysin O (SLO) cytolysin, but not SIC, a protein that protects S. pyogenes from CAPs. These data suggest a novel function for CAPs in targeting the ExPortal and interfering with secretion of factors required for infection and survival. This mechanism may prove valuable for the design of new types of antimicrobial agents to combat the emergence of antibiotic-resistant pathogens.

  2. Bioactive Antimicrobial Peptides as Therapeutics for Corneal Wounds and Infections

    PubMed Central

    Griffith, Gina L.; Kasus-Jacobi, Anne; Pereira, H. Anne

    2017-01-01

    Significance: More than 2 million eye injuries and infections occur each year in the United States that leave civilians and military members with reduced or complete vision loss due to the lack of effective therapeutics. Severe ocular injuries and infections occur in varied settings including the home, workplace, and battlefields. In this review, we discuss the potential of developing antimicrobial peptides (AMPs) as therapeutics for the treatment of corneal wounds and infections for which the current treatment options are inadequate. Recent Advances: Standard-of-care employs the use of fluorescein dye for the diagnosis of ocular defects and is followed by the use of antibiotics and/or steroids to treat the infection and reduce inflammation. Recent advances for treating corneal wounds include the development of amniotic membrane therapies, wound chambers, and drug-loaded hydrogels. In this review, we will discuss an innovative approach using AMPs with the dual effect of promoting corneal wound healing and clearing infections. Critical Issues: An important aspect of treating ocular injuries is that treatments need to be effective and administered expeditiously. This is especially important for injuries that occur during combat and in individuals who demonstrate delayed wound healing. To overcome gaps in current treatment modalities, bioactive peptides based on naturally occurring cationic antimicrobial proteins are being investigated as new therapeutics. Future Directions: The development of new therapeutics that can treat ocular infections and promote corneal wound healing, including the healing of persistent corneal epithelial defects, would be of great clinical benefit. PMID:28616359

  3. Macrocyclic Antimicrobial Peptides Engineered from ω-Conotoxin.

    PubMed

    Hemu, Xinya; Tam, James P

    2017-01-01

    The potent calcium channel blocker ω-conotoxin MVIIA is a linear cystine-knot peptide with multiple basic amino acids at both termini. This work shows that macrocyclization of MVIIA linking two positive-charge terminal clusters as a contiguous segment converts a conotoxin into an antimicrobial peptide. In addition, conversion of disulfide bonds to amino butyric acids improved the antimicrobial activity of the cyclic analogs. Ten macrocyclic analogs, with or without disulfide bonds, were prepared by both Boc and Fmoc chemistry using native chemical ligation. All cyclic analogs were active against selected Gram-positive and Gram-negative bacteria with minimal inhibitory concentrations in a low μM range. In contrast, MVIIA and its linear analog were inactive at concentrations up to 0.5 mM. The cyclic analogs also showed 2 to 3-fold improved chemotactic activity against human monocytes THP-1 compared with MVIIA. Reduction of molecular stability against thermal and acid treatment due to the reduced number of disulfide crosslinks can be partly restored by backbone cyclization. Together, these results show that macrocyclization and side chain modification of a linear conopeptide lead to a gain-of-function, which brings a new perspective in designing and engineering of peptidyl therapeutics. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  4. Antimicrobial peptides in marine invertebrate health and disease.

    PubMed

    Destoumieux-Garzón, Delphine; Rosa, Rafael Diego; Schmitt, Paulina; Barreto, Cairé; Vidal-Dupiol, Jeremie; Mitta, Guillaume; Gueguen, Yannick; Bachère, Evelyne

    2016-05-26

    Aquaculture contributes more than one-third of the animal protein from marine sources worldwide. A significant proportion of aquaculture products are derived from marine protostomes that are commonly referred to as 'marine invertebrates'. Among them, penaeid shrimp (Ecdysozosoa, Arthropoda) and bivalve molluscs (Lophotrochozoa, Mollusca) are economically important. Mass rearing of arthropods and molluscs causes problems with pathogens in aquatic ecosystems that are exploited by humans. Remarkably, species of corals (Cnidaria) living in non-exploited ecosystems also suffer from devastating infectious diseases that display intriguing similarities with those affecting farmed animals. Infectious diseases affecting wild and farmed animals that are present in marine environments are predicted to increase in the future. This paper summarizes the role of the main pathogens and their interaction with host immunity, with a specific focus on antimicrobial peptides (AMPs) and pathogen resistance against AMPs. We provide a detailed review of penaeid shrimp AMPs and their role at the interface between the host and its resident/pathogenic microbiota. We also briefly describe the relevance of marine invertebrate AMPs in an applied context.This article is part of the themed issue 'Evolutionary ecology of arthropod antimicrobial peptides'.

  5. Streptomyces as Overexpression System for Heterologous Production of an Antimicrobial Peptide.

    PubMed

    Roldán-Tapia, Marisol; Anné, Jozef; Reyes, Ana Gisela; Carrasco, Ulises; Millán-Pacheco, Cesar; Barrios-González, Javier; Mejía, Armando

    2017-02-08

    Defense mechanisms of plants against phytopathogens include cationic antimicrobial peptides (CAPs). The broad-spectrum activity of these peptides has been evaluated previously against different phytopathogens. Their lack of toxicity for plants and animals is a promising feature for pest control. Although, some attempts have been made previously in order to increase their heterologous expressions, the employed strategies have so far proven to be ineffective. Low production yield and elevated costs are the obstacles to overcome. In this study, a strategy for CAP overexpression is presented based on the construction of an expression cassette for Streptomyces lividans TK24. This system contains elements that allow the increase of the efficiency of the peptide's expression. The main elements included in this cassette are the sequences of the promoter and signal peptide from a subtilisin inhibitor gene of Streptomyces venezuelae. This allows the efficient secretion of the peptide to the growth medium, thereby simplifying its recovery and avoiding its toxic effect on the producing organism. The results obtained demonstrate the system's efficiency by achieving a peptide concentration of 11.61 mg/ml. This represents at least a 10-fold increase compared to previously established strategies.

  6. Antimicrobial peptide-modified liposomes for bacteria targeted delivery of temoporfin in photodynamic antimicrobial chemotherapy.

    PubMed

    Yang, Kewei; Gitter, Burkhard; Rüger, Ronny; Wieland, Gerhard D; Chen, Ming; Liu, Xiangli; Albrecht, Volker; Fahr, Alfred

    2011-10-01

    Photodynamic antimicrobial chemotherapy (PACT) and antimicrobial peptides (AMPs) are two promising strategies to combat the increasing prevalence of antibiotic-resistant bacteria. To take advantage of these two strategies, we integrated a novel antimicrobial peptide (WLBU2) and a potent generation II photosensitizer (temoporfin) into liposomes by preparing WLBU2-modified liposomes, aiming at bacteria targeted delivery of temoporfin for PACT. WLBU2 was successfully coupled to temoporfin-loaded liposomes using a functional phospholipid. The delivery of temoporfin to bacteria was confirmed by fluorescence microscopy and flow cytometry, thus demonstrating that more temoporfin was delivered to bacteria by WLBU2-modified liposomes than by unmodified liposomes. Consequently, the WLBU2-modified liposomes eradicated all methicillin-resistant Staphylococcus aureus (MRSA) and induced a 3.3 log(10) reduction of Pseudomonas aeruginosa in the in vitro photodynamic inactivation test. These findings demonstrate that the use of AMP-modified liposomes is promising for bacteria-targeted delivery of photosensitizers and for improving the PACT efficiency against both gram-positive and gram-negative bacteria in the local infections. This journal is © The Royal Society of Chemistry and Owner Societies 2011

  7. Antimicrobial peptides and peptidomimetics - potent therapeutic allies for staphylococcal infections.

    PubMed

    Mohammad, Haroon; Thangamani, Shankar; Seleem, Mohamed N

    2015-01-01

    The pervasiveness of bacterial resistance to conventional antibiotics, particularly those associated with staphylococcal infections, has become a global epidemic. However, research involving antimicrobial peptides (AMPs) and their synthetic analogues has unearthed a potentially novel class of antibacterials for the treatment of an array of diseases caused by pathogenic bacteria, such as staphylococci. AMPs have several unique advantages over traditional antibiotics such as the projected slow emergence of bacterial resistance to these agents and their capability to modulate the host immune response to infection. Unfortunately, their susceptibility to proteolytic degradation, loss of antimicrobial activity due to serum binding or physiological concentration of salts, and toxicity to host tissues has limited their use as systemic agents thus far. Additionally, the presence of economic and regulatory obstacles has hindered the translation of AMPs, as antimicrobials, from the bench to the clinic. The present review delves further into the benefits and challenges of utilizing AMPs as antibacterial agents (particularly for staphylococcal infections), the methods which have been utilized to overcome their limitations, their successes and failures in clinical trials, and future avenues for researchers to pursue to develop AMPs as novel therapeutic allies in the treatment of bacterial infections.

  8. Antimicrobial peptides in oyster hemolymph: the bacterial connection.

    PubMed

    Defer, Diane; Desriac, Florie; Henry, Joël; Bourgougnon, Nathalie; Baudy-Floc'h, Michèle; Brillet, Benjamin; Le Chevalier, Patrick; Fleury, Yannick

    2013-06-01

    We have explored antimicrobial compounds in oyster hemolymph and purified four active peptides with molecular masses of 4464, 3158, 655 and 636 Da. While no exploitable structural elements were obtained for the former three, a partial amino acid sequence (X-P-P-X-X-I-V) was obtained for the latter, named Cg-636. Due to both its low MM and the presence of exotic amino acid residue (X), we suspected a bacterial origin and tracked cultivable hemolymph-resident bacteria of oyster for their antimicrobial abilities. Supernatants of 224 hemolymph resident bacteria coming from 60 oysters were screened against 10 target bacteria including aquaculture pathogens. Around 2% (5 strains) revealed antimicrobial activities. They belong to Pseudoalteromonas and Vibrio genera. Two closely related strains named hCg-6 and hCg-42 have been shown to produce Bacteriocin-Like Inhibitory Substances (BLIS) even in oyster hemolymph. We report herein first BLIS-producing bacteria isolated from bivalve hemolymph. These results strongly suggest that hemolymph resident bacteria may prevent pathogen establishment and pave the way for considering a role of resident bacteria into bivalve defense.

  9. In vitro determination of the short-chain synthetic peptide RP13 antimicrobial activity.

    PubMed

    Sánchez, Adrián; Calderón, Ernesto; Castañón-Alonso, Sandra L; Santos, Araceli; Hernández, Beatriz; Vázquez, Alfredo

    2014-01-01

    The proliferation of antibiotic-resistant microorganisms, along with the lack of new drugs against them, has elicited the interest of the scientific community on the study and development of endogenous synthetic compounds with bacteriostatic or bactericidal activity. In recent years, several short-chain, low molecular weight peptides isolated from natural sources such as plants and animals have demonstrated an array of antimicrobial activities. Despite having structural characteristics similar to microbicidal peptides isolated from human platelets, peptide RP11 does not exhibit antimicrobial activity. In vitro determination of the antimicrobial activity of the synthetic peptide RP13. Peptide RP13 was prepared modifying the original amino acids sequence of peptide RP11, reversing the position of the amino acids lysine and tyrosine in order to modify the conformation of the original peptide. These amino acids are localized close to the N-terminus of the peptidic chain. Peptide RP13 was prepared in solution using conventional methods for peptide synthesis. The antimicrobial activity of RP13 was assessed against the microorganisms S. aureus, E. faecalis and E. coli in a test solution and later evaluated by cultivation of plates during the first 2 h after inoculation of bacteria. RP13 activity antimicrobial was compared against tetracycline, a broad-spectrum antibiotic. The new peptide RP13, resulting form the structural modification of the amino acid sequence of peptide RP11, displayed antimicrobial activity. RP13 demonstrated to be more efficient inhibiting the growth of gram-positive than gramnegative bacteria. The structural modification of peptide RP11, obtained from human platelets, resulted in a new peptide with improved antimicrobial activity. These results clearly demonstrate that peptides of natural origin, as well as their synthetic analogs, represent an attractive alternative against pathogenic agents.

  10. Determinants of recombinant production of antimicrobial cationic peptides and creation of peptide variants in bacteria.

    PubMed

    Zhang, L; Falla, T; Wu, M; Fidai, S; Burian, J; Kay, W; Hancock, R E

    1998-06-29

    Cationic peptides possessing antibacterial activity are virtually ubiquitous in nature, and offer exciting prospects as new therapeutic agents. We had previously demonstrated that such peptides could be produced by fusion protein technology in bacteria and several carrier proteins had been tested as fusion partners including glutathione-S-transferase, S. aureus protein A, IgG binding protein and P. aeruginosa outer membrane protein OprF. However these fusion partners, while successfully employed in peptide expression, were not optimized for high level production of cationic peptides (Piers, K., Brow, M. L., and Hancock, R. E. W. 1993, Gene 137, 7-13). In this paper we took advantage of a small replication protein RepA from E. coli and used its truncated version to construct fusion partners. The minimal elements required for high level expression of cationic peptide were defined as a DNA sequence encoding a fusion protein comprising, from the N-terminus, a 68 amino acid carrier region, an anionic prepro domain, a single methionine and the peptide of interest. The 68 amino acid carrier region was a block of three polypeptides consisting of a truncated RepA, a synthetic cellulose binding domain and a hexa histidine domain. The improved system showed high level expression and simplified downstream purification. The active peptide could be yielded by CNBr cleavage of the fusion protein. This novel vector was used to express three classes of cationic peptides including the alpha-helical peptide CEMA, the looped peptide bactenecin and the extended peptide indolicidin. In addition, mutagenesis of the peptide gene to produce peptide variants of CEMA and indolicidin using the improved vector system was shown to be successful.

  11. Analysis of the antimicrobial activities of a chemokine-derived peptide (CDAP-4) on Pseudomonas aeruginosa

    SciTech Connect

    Martinez-Becerra, Francisco; Dominguez-Ramirez, Lenin; Mendoza-Hernandez, Guillermo; Lopez-Vidal, Yolanda; Soldevila, Gloria . E-mail: garciaze@servidor.unam.mx

    2007-04-06

    Chemokines are key molecules involved in the control of leukocyte trafficking. Recently, a novel function as antimicrobial proteins has been described. CCL13 is the only member of the MCP chemokine subfamily displaying antimicrobial activity. To determine Key residues involved in its antimicrobial activity, CCL13 derived peptides were synthesized and tested against several bacterial strains, including Pseudomonas aeruginosa. One of these peptides, corresponding to the C-terminal region of CCL13 (CDAP-4) displayed good antimicrobial activity. Electron microscopy studies revealed remarkable morphological changes after CDAP-4 treatment. By computer modeling, CDAP-4 in {alpha} helical configuration generated a positive electrostatic potential that extended beyond the surface of the molecule. This feature is similar to other antimicrobial peptides. Altogether, these findings indicate that the antimicrobial activity was displayed by CCL13 resides to some extent at the C-terminal region. Furthermore, CDAP-4 could be considered a good antimicrobial candidate with a potential use against pathogens including P. aeruginosa.

  12. Antimicrobial activities of amphiphilic peptides covalently bonded to a water-insoluble resin.

    PubMed Central

    Haynie, S L; Crum, G A; Doele, B A

    1995-01-01

    A series of polymer-bound antimicrobial peptides was prepared, and the peptides were tested for their antimicrobial activities. The immobilized peptides were prepared by a strategy that used solid-phase peptide synthesis that linked the carboxy-terminal amino acid with an ethylenediamine-modified polyamide resin (PepsynK). The acid-stable, permanent amide bond between the support and the nascent peptide renders the peptide resistant to cleavage from the support during the final acid-catalyzed deprotection step in the synthesis. Select immobilized peptides containing amino acid sequences that ranged from the naturally occurring magainin to simpler synthetic sequences with idealized secondary structures were excellent antimicrobial agents against several organisms. The immobilized peptides typically reduced the number of viable cells by > or = 5 log units. We show that the reduction in cell numbers cannot be explained by the action of a soluble component. We observed no leached or hydrolyzed peptide from the resin, nor did we observe any antimicrobial activity in soluble extracts from the immobilized peptide. The immobilized peptides were washed and reused for repeated microbial contact and killing. These results suggest that the surface actions by magainins and structurally related antimicrobial peptides are sufficient for their lethal activities. PMID:7726486

  13. Comparative surface antimicrobial properties of synthetic biocides and novel human apolipoprotein E derived antimicrobial peptides.

    PubMed

    Forbes, Sarah; McBain, Andrew J; Felton-Smith, Susan; Jowitt, Thomas A; Birchenough, Holly L; Dobson, Curtis B

    2013-07-01

    Medical device infection remains a major clinical concern. Biocidal compounds have been incorporated into medical device materials ideally to inhibit bacterial colonisation whilst exhibiting relatively low cytotoxicity. We compared the antibacterial activity, anti-biofilm efficacy and cytotoxicity of a novel peptide derivative of human apolipoprotein E (apoEdpL-W) to that of commonly used biocides, before and after coating onto a range of standard polymers. Since the antimicrobial function of most biocides frequently involves associations with cellular membranes, we have also studied the detailed interactions of the test antimicrobials with phospholipid bilayers, using the quartz crystal microbalance device combined with dual-polarisation interferometry. ApoEdpL-W displayed broad-spectrum antibacterial activity and marked efficacy against nascent Staphylococcus aureus biofilms. Compounds showed better antimicrobial activity when combined with hydrogel materials than with non-porous materials. The membrane interactions of apoEdpL-W were most similar to that of PHMB, with both agents appearing to readily bind and insert into lipid bilayers, possibly forming pores. However apoEdpL-W showed lower cytotoxicity than PHMB, its efficacy was less affected by the presence of serum, and it demonstrated the highest level of biocompatibility of all the biocides, as indicated by our measurement of its antimicrobial biocompatibility index. This work shows the potential of apoEdpL-W as an effective antiseptic coating agent.

  14. A molecular dynamics and circular dichroism study of a novel synthetic antimicrobial peptide

    NASA Astrophysics Data System (ADS)

    Rodina, N. P.; Yudenko, A. N.; Terterov, I. N.; Eliseev, I. E.

    2013-08-01

    Antimicrobial peptides are a class of small, usually positively charged amphiphilic peptides that are used by the innate immune system to combat bacterial infection in multicellular eukaryotes. Antimicrobial peptides are known for their broad-spectrum antimicrobial activity and thus can be used as a basis for a development of new antibiotics against multidrug-resistant bacteria. The most challengeous task on the way to a therapeutic use of antimicrobial peptides is a rational design of new peptides with enhanced activity and reduced toxicity. Here we report a molecular dynamics and circular dichroism study of a novel synthetic antimicrobial peptide D51. This peptide was earlier designed by Loose et al. using a linguistic model of natural antimicrobial peptides. Molecular dynamics simulation of the peptide folding in explicit solvent shows fast formation of two antiparallel beta strands connected by a beta-turn that is confirmed by circular dichroism measurements. Obtained from simulation amphipatic conformation of the peptide is analysed and possible mechanism of it's interaction with bacterial membranes together with ways to enhance it's antibacterial activity are suggested.

  15. Additivity and synergy between an antimicrobial peptide and inhibitory ions.

    PubMed

    Walkenhorst, William F; Sundrud, Justine N; Laviolette, Joshua M

    2014-09-01

    Recently we described the pH dependence of activity for a family of cationic antimicrobial peptides (CAMPs) selected from a combinatorial library. In the current work we report on the effects of toxic ions (Cu(2+), Zn(2+), and F(-)) and the chelator EDTA on the activity profiles of one member of this family, the 12-residue cationic antimicrobial peptide *ARVA, against a panel of microorganisms. All four ions exhibited either synergy or additivity with *ARVA for all organisms tested with the exception of *ARVA combined with NaF against Candida albicans which exhibited indifference. CuCl2 and ZnCl2 exhibited synergy with *ARVA against both the Gram negative Pseudomonas aeruginosa and the Gram positive Staphylococcus aureus as well as strong additivity against Escherichia coli at submillimolar concentrations. The chelator EDTA was synergistic with *ARVA against the two Gram negative organisms but showed only simple additivity with S. aureus and C. albicans despite their much lower MICs with EDTA. This effect may be related to the known differences in the divalent ion binding properties of the Gram negative LPS layer as compared to the peptidoglycan layer of the Gram positive organism. Unlike the other ions, NaF showed only additivity or indifference when combined with *ARVA and required much higher concentrations for activity. The yeast C. albicans did not show synergy or strong additivity with any of the inhibitory compounds tested. The effects of toxic ions and chelators observed here have important implications for applications using CAMPs and for the design of novel formulations involving CAMPs. This article is part of a Special Issue entitled: Interfacially Active Peptides and Proteins. Guest Editors: William C. Wimley and Kalina Hristova. Copyright © 2014 Elsevier B.V. All rights reserved.

  16. Design, Characterization, and Antimicrobial Activity of a Novel Antimicrobial Peptide Derived from Bovine Lactophoricin.

    PubMed

    Kim, Ji-Sun; Joeng, Ji-Ho; Kim, Yongae

    2017-04-28

    Lactophoricin (LPcin), which is a part of proteose peptone isolated from bovine milk, is a cationic amphipathic α-helical antimicrobial peptide. Its truncated variants and mutated analogs were designed and their antimicrobial activities were evaluated by using various assays, like broth dilution methods and disk diffusion methods as well as hemolysis assay. Three analogs, LPcin-C8 (LPcin-YK1), LPcin-T2&6W (LPcin-YK2), and LPcin-T2&6W-C8 (LPcin-YK3), which showed better antibiotic activities than LPcin, were selected. Their secondary structures were also characterized by using CD spectropolarimetry. These three analogs of LPcin could be used as an alternative source of powerful antibacterial agents.

  17. Discovery of novel antimicrobial peptides with unusual cysteine motifs in dandelion Taraxacum officinale Wigg. flowers.

    PubMed

    Astafieva, A A; Rogozhin, E A; Odintsova, T I; Khadeeva, N V; Grishin, E V; Egorov, Ts A

    2012-08-01

    Three novel antimicrobial peptides designated ToAMP1, ToAMP2 and ToAMP3 were purified from Taraxacum officinale flowers. Their amino acid sequences were determined. The peptides are cationic and cysteine-rich and consist of 38, 44 and 42 amino acid residues for ToAMP1, ToAMP2 and ToAMP3, respectively. Importantly, according to cysteine motifs, the peptides are representatives of two novel previously unknown families of plant antimicrobial peptides. ToAMP1 and ToAMP2 share high sequence identity and belong to 6-Cys-containing antimicrobial peptides, while ToAMP3 is a member of a distinct 8-Cys family. The peptides were shown to display high antimicrobial activity both against fungal and bacterial pathogens, and therefore represent new promising molecules for biotechnological and medicinal applications. Crown Copyright © 2012. Published by Elsevier Inc. All rights reserved.

  18. Rational design of artificial β-strand-forming antimicrobial peptides with biocompatible properties.

    PubMed

    Rapsch, Karsten; Bier, Frank F; von Nickisch-Rosenegk, Markus

    2014-10-06

    Because the intensive use of antibiotics has led to a large variety of resistant bacterial strains, therapeutic measures have become increasingly challenging. In order to ensure reliable treatment of diseases, alternative antimicrobial agents need to be explored. In this context, antimicrobial peptides have been discussed as novel bioactive molecules, which, however, may be limited in their applicability due to their high manufacturing costs and poor pharmacokinetic properties. Consequently, the design of artificial antimicrobial peptides featuring two flanking cationic regions and a hydrophobic center is presented. These sequences led to distinct antimicrobial activity on the same order of magnitude as that of naturally occurring reference peptides but with less cytotoxic or cytostatic drawbacks. Furthermore, a deletion and substitution library revealed the minimal sequence requirements. By analysis of the computed 3D structures of these peptides, a single characteristic β-strand was identified. This structural motif was pivotal for antimicrobial activity. Consequently, an optimized peptide sequence with antimicrobial and biocompatible properties was derived, and its application was demonstrated in a mixed culture experiment. Thus, it was shown that the optimized artificial antimicrobial peptide is suitable as a therapeutic agent and may be used as template for the development of new antimicrobial peptides with unique secondary structures.

  19. Antimicrobial peptides as novel anti-tuberculosis therapeutics.

    PubMed

    Silva, João P; Appelberg, Rui; Gama, Francisco Miguel

    2016-01-01

    Tuberculosis (TB), a disease caused by the human pathogen Mycobacterium tuberculosis, has recently joined HIV/AIDS as the world's deadliest infectious disease, affecting around 9.6 million people worldwide in 2014. Of those, about 1.2 million died from the disease. Resistance acquisition to existing antibiotics, with the subsequent emergence of Multi-Drug Resistant mycobacteria strains, together with an increasing economic burden, has urged the development of new anti-TB drugs. In this scope, antimicrobial peptides (AMPs), which are small, cationic and amphipathic peptides that make part of the innate immune system, now arise as promising candidates for TB treatment. In this review, we analyze the potential of AMPs for this application. We address the mechanisms of action, advantages and disadvantages over conventional antibiotics and how problems associated with its use may be overcome to boost their therapeutic potential. Additionally, we address the challenges of translational development from benchside to bedside, evaluate the current development pipeline and analyze the expected global impact from a socio-economic standpoint. The quest for more efficient and more compliant anti-TB drugs, associated with the great therapeutic potential of emerging AMPs and the rising peptide market, provide an optimal environment for the emergence of AMPs as promising therapies. Still, their pharmacological properties need to be enhanced and manufacturing-associated issues need to be addressed.

  20. Designing carbohydrate nanoparticles for prolonged efficacy of antimicrobial peptide.

    PubMed

    Bi, Lin; Yang, Lei; Narsimhan, Ganesan; Bhunia, Arun K; Yao, Yuan

    2011-03-10

    In this work, carbohydrate nanoparticles were created to prolong the efficacy of antimicrobial peptide against pathogens. Nisin and Listeria monocytogenes were used as the peptide and pathogen models, respectively, and phytoglycogen (PG)-based nanoparticles were developed as carriers of nisin. PG from su1 mutant maize was subjected to β-amylolysis as well as subsequent succinate or octenyl succinate substitutions. The goal was to minimize the loss of peptide during storage and meanwhile realize an effective release in the presence of bacteria. The capabilities of PG derivatives as carriers of nisin were evaluated using centrifugal ultrafiltration, zeta-potential, and the initial availability of nisin against L. monocytogenes. All methods indicated that nisin loading was favored by a high degree of substitution (DS), presence of hydrophobic octenyl moiety, and β-amylolysis of PG nanoparticles. To evaluate the prolonged nisin efficacy, preparations containing nisin and PG derivatives were loaded into a BHI-agar deep-well model (mimicking nisin depletion at the nutrient-containing surface). The residual inhibitory activities of preparations against L. monocytogenes were monitored during 21 days of storage at 4 °C. The results showed that all PG derivatives led to the prolonged retention of nisin activity and the longest retention was associated with high DS, β-amylolysis, and octenyl succinate. Evidently, both electrostatic and hydrophobic interactions are the driving forces of nisin adsorption, and the glucan structure at the nanoparticle surface also affects nisin loading and retention during storage.

  1. Effects of Antimicrobial Peptide Revealed by Simulations: Translocation, Pore Formation, Membrane Corrugation and Euler Buckling

    PubMed Central

    Chen, Licui; Jia, Nana; Gao, Lianghui; Fang, Weihai; Golubovic, Leonardo

    2013-01-01

    We explore the effects of the peripheral and transmembrane antimicrobial peptides on the lipid bilayer membrane by using the coarse grained Dissipative Particle Dynamics simulations. We study peptide/lipid membrane complexes by considering peptides with various structure, hydrophobicity and peptide/lipid interaction strength. The role of lipid/water interaction is also discussed. We discuss a rich variety of membrane morphological changes induced by peptides, such as pore formation, membrane corrugation and Euler buckling. PMID:23579956

  2. AMPed Up immunity: how antimicrobial peptides have multiple roles in immune defense

    PubMed Central

    Lai, Yuping; Gallo, Richard L.

    2009-01-01

    Antimicrobial peptides (AMPs) are widely expressed and rapidly induced at epithelial surfaces to repel assault from diverse infectious agents including bacteria, viruses, fungi and parasites. Much information suggests that AMPs act by mechanisms that extend beyond their capacity to serve as gene-encoded antibiotics. For example, some AMPs alter the properties of the mammalian membrane or interact with its receptors to influence diverse cellular processes including cytokine release, chemotaxis, antigen presentation, angiogenesis and wound healing. These functions complement their antimicrobial action and favor resolution of infection and repair of damaged epithelia. Opposing this, some microbes have evolved mechanisms to inactivate or avoid AMPs and subsequently become pathogens. Thus, AMPs are multifunctional molecules that have a central role in infection and Inflammation. PMID:19217824

  3. New perspectives for natural antimicrobial peptides: application as antinflammatory drugs in a murine model

    PubMed Central

    2012-01-01

    Background Antimicrobial peptides (AMPs) are an ancient group of defense molecules. AMPs are widely distributed in nature (being present in mammals, birds, amphibians, insects, plants, and microorganisms). They display bactericidal as well as immunomodulatory properties. The aim of this study was to investigate the antimicrobial and anti-inflammatory activities of a combination of two AMPs (temporin B and the royal jellein I) against Staphylococcus epidermidis. Results The temporin B (TB-KK) and the royal jelleins I, II, III chemically modified at the C terminal (RJI-C, RJII-C, RJIII-C), were tested for their activity against 10 different Staphylococcus epidermidis strains, alone and in combination. Of the three royal jelleins, RJI-C showed the highest activity. Moreover, the combination of RJI-C and TB-KK (MIX) displayed synergistic activity. In vitro, the MIX displayed low hemolytic activity, no NO2- production and the ability to curb the synthesis of the pro-inflammatory cytokines TNF-α and IFN-γ to the same extent as acetylsalicylic acid. In vivo, the MIX sterilized mice infected with Staphylococcus epidermidis in eleven days and inhibited the expression of genes encoding the prostaglandin-endoperoxide synthase 2 (COX-2) and CD64, two important parameters of inflammation. Conclusion The study shows that the MIX – a combination of two naturally occurring peptides - displays both antimicrobial and anti-inflammatory activities. PMID:23157568

  4. Antisense peptide nucleic acid–peptide conjugates for functional analyses of genes in Pseudomonas aeruginosa.

    PubMed

    Maekawa, Kazuhiko; Azuma, Motoki; Okuno, Yousuke; Tsukamoto, Tasuku; Nishiguchi, Kenzo; Setsukinai, Ken-ichi; Maki, Hideki; Numata, Yoshito; Takemoto, Hiroshi; Rokushima, Masatomo

    2015-11-15

    Pseudomonas aeruginosa is one of the most common and clinically important pathogens because of its resistance to a wide variety of antibiotics. A number of treatments of P. aeruginosa have been developed, but there is still no definitive one. Antisense drugs have a great potential to treat multidrug-resistant P. aeruginosa because this technology, in principle, can inhibit the expression of any essential genes. Nucleic Acid Ther.2012, 22, 323 reported that peptide nucleic acid (PNA) antisenses conjugated to the carrier peptide (RXR)4 and targeted to ftsZ and acpP (essential genes) had antibacterial activity in P. aeruginosa. However, growth inhibition was also found with peptide-PNA antisense conjugates of mismatched sequences (negative controls), and hence there remains a possibility for considerable enhancement of basal level activity due to the general toxicity. To assess the true potential of peptide-PNA conjugates, we measured sequence-dependent knockdown of the (RXR)4-PNA conjugates by using a scrambled sequence as a negative control. In addition, we evaluated (RXR)4-PNA antisenses against three other essential genes (lepB, lptD and mraY) and a non-essential gene (PA1303), and confirmed that multiple sequences targeting only the essential genes showed antimicrobial activity in P. aeruginosa PAO1 cells. We also conducted a rescue experiment and confirmed that the antimicrobial activity of anti-mraY antisenses was an on-target effect, not due to general toxicity. These findings indicate that the (RXR)4–PNA antisense should be a useful tool for target validation of a specific gene and could be a therapeutic platform capable of targeting a variety of genes in P. aeruginosa.

  5. Multiple Functions of the New Cytokine-Based Antimicrobial Peptide Thymic Stromal Lymphopoietin (TSLP)

    PubMed Central

    Bjerkan, Louise; Sonesson, Andreas; Schenck, Karl

    2016-01-01

    Thymic stromal lymphopoietin (TSLP) is a pleiotropic cytokine, hitherto mostly known to be involved in inflammatory responses and immunoregulation. The human tslp gene gives rise to two transcription and translation variants: a long form (lfTSLP) that is induced by inflammation, and a short, constitutively-expressed form (sfTSLP), that appears to be downregulated by inflammation. The TSLP forms can be produced by a number of cell types, including epithelial and dendritic cells (DCs). lfTSLP can activate mast cells, DCs, and T cells through binding to the lfTSLP receptor (TSLPR) and has a pro-inflammatory function. In contrast, sfTSLP inhibits cytokine secretion of DCs, but the receptor mediating this effect is unknown. Our recent studies have demonstrated that both forms of TSLP display potent antimicrobial activity, exceeding that of many other known antimicrobial peptides (AMPs), with sfTSLP having the strongest effect. The AMP activity is primarily mediated by the C-terminal region of the protein and is localized within a 34-mer peptide (MKK34) that spans the C-terminal α-helical region in TSLP. Fluorescent studies of peptide-treated bacteria, electron microscopy, and liposome leakage models showed that MKK34 exerted membrane-disrupting effects comparable to those of LL-37. Expression of TSLP in skin, oral mucosa, salivary glands, and intestine is part of the defense barrier that aids in the control of both commensal and pathogenic microbes. PMID:27399723

  6. Engineered killer mimotopes: new synthetic peptides for antimicrobial therapy.

    PubMed

    Magliani, W; Conti, S; Salati, A; Arseni, S; Ravanetti, L; Frazzi, R; Polonelli, L

    2004-07-01

    This review deals with a novel approach to produce synthetic antibiotic peptides (killer mimotopes), similar to those described for the conversion of epitopes into peptide mimotopes, allowing their use as surrogate vaccines. Synthetic peptides pertaining to the complementary determining regions (CDRs) of a recombinant antiidiotypic antibody (PaKTscFv), which mimic the wide spectrum of microbicidal activity of a killer toxin produced by the yeast Pichia anomala (PaKT), have proven to act as structural or functional mimotopes of PaKT. This activity appeared to be mediated by interaction with specific cell wall killer toxin receptors (KTRs), mainly constituted by beta glucans. Killer mimotopes have shown in vitro an impressive microbicidal activity against Candida albicans. They were adopted as a model of PaKT- and PaKTscFv-susceptible microorganisms. Optimization through alanine scanning led to the generation of an engineered decapeptide (KP) of a CDR-L1 pertaining antibody fragment with an enhanced in vitro microbicidal activity. It had a potent therapeutic effect against experimental vaginal and systemic candidiasis in normal and immunodeficient mice caused by flucanozole susceptible and resistant yeast isolates. KP exerted a microbicidal activity in vitro against multidrug-resistant eukaryotic and prokaryotic pathogenic microorganisms, which was neutralized by interaction with laminarin (beta 1,3-glucan). To our knowledge, KP represents the prototype of an engineered peptide fragment derived from a microbicidal recombinant antiidiotypic antibody. It is capable of exerting antimicrobial activity in vitro and a therapeutic effect in vivo presumably acting through interaction with the beta glucan KTR component in the cell walls of pathogenic microorganisms.

  7. Comparative Analysis of the Bacterial Membrane Disruption Effect of Two Natural Plant Antimicrobial Peptides

    PubMed Central

    Farkas, Attila; Maróti, Gergely; Kereszt, Attila; Kondorosi, Éva

    2017-01-01

    In the Medicago truncatula genome about 700 genes code for nodule-specific cysteine-rich (NCR) small peptides that are expressed in the symbiotic organ, the root nodule, where they control terminal differentiation of the endosymbiotic rhizobium bacteria to nitrogen-fixing bacteroids. Cationic NCR peptides were predicted to have antimicrobial activities. Here antibacterial activities of NCR247, NCR335, polymyxin B (PMB), and streptomycin were investigated and compared on two foodborne pathogens Salmonella enterica and Listeria monocytogenes as representatives of Gram-negative and Gram-positive bacteria. The integrity of the bacterial membrane was seriously compromised by these NCR peptides. Different localization was observed for NCR247 and NCR335 in the treated bacteria, the peptides mostly accumulated in the cytosol in S. enterica while they remained in the bacterial membrane in L. monocytogenes. Scanning electron microscopy revealed distinct membrane morphology of the peptide-treated bacteria. Complete cell disruption was induced by PMB and NCR335 in S. enterica while NCR247 treatment resulted in extensive budding observed on the cell surface of Salmonella. PMB had no effect on L. monocytogenes while NCR335 and NCR247 provoked morphological changes on this bacterium, the whole Listeria cell content was released in response to NCR335 treatment. PMID:28167938

  8. Design and characterization of short antimicrobial peptides using leucine zipper templates with selectivity towards microorganisms.

    PubMed

    Ahmad, Aqeel; Azmi, Sarfuddin; Srivastava, Saurabh; Kumar, Amit; Tripathi, Jitendra Kumar; Mishra, Nripendra N; Shukla, Praveen K; Ghosh, Jimut Kanti

    2014-11-01

    Design of antimicrobial peptides with selective activity towards microorganisms is an important step towards the development of new antimicrobial agents. Leucine zipper sequence has been implicated in cytotoxic activity of naturally occurring antimicrobial peptides; moreover, this motif has been utilized for the design of novel antimicrobial peptides with modulated cytotoxicity. To understand further the impact of substitution of amino acids at 'a' and/or 'd' position of a leucine zipper sequence of an antimicrobial peptides on its antimicrobial and cytotoxic properties four short peptides (14-residue) were designed on the basis of a leucine zipper sequence without or with replacement of leucine residues in its 'a' and 'd' positions with D-leucine or alanine or proline residue. The original short leucine zipper peptide (SLZP) and its D-leucine substituted analog, DLSA showed comparable activity against the tested Gram-positive and negative bacteria and the fungal strains. The alanine substituted analog (ASA) though showed appreciable activity against the tested bacteria, it showed to some extent lower activity against the tested fungi. However, the proline substituted analog (PSA) showed lower activity against the tested bacterial or fungal strains. Interestingly, DLSA, ASA and PSA showed significantly lower cytotoxicity than SLZP against both human red blood cells (hRBCs) and murine 3T3 cells. Cytotoxic and bactericidal properties of these peptides matched with peptide-induced damage/permeabilization of mammalian cells and bacteria or their mimetic lipid vesicles suggesting cell membrane could be the target of these peptides. As evidenced by tryptophan fluorescence and acrylamide quenching studies the peptides showed similarities either in interaction or in their localization within the bacterial membrane mimetic negatively charged lipid vesicles. Only SLZP showed localization inside the mammalian membrane mimetic zwitterionic lipid vesicles. The results show

  9. Snake Cathelicidin NA-CATH and Smaller Helical Antimicrobial Peptides Are Effective against Burkholderia thailandensis

    PubMed Central

    Blower, Ryan J.; Barksdale, Stephanie M.; van Hoek, Monique L.

    2015-01-01

    Burkholderia thailandensis is a Gram-negative soil bacterium used as a model organism for B. pseudomallei, the causative agent of melioidosis and an organism classified category B priority pathogen and a Tier 1 select agent for its potential use as a biological weapon. Burkholderia species are reportedly “highly resistant” to antimicrobial agents, including cyclic peptide antibiotics, due to multiple resistance systems, a hypothesis we decided to test using antimicrobial (host defense) peptides. In this study, a number of cationic antimicrobial peptides (CAMPs) were tested in vitro against B. thailandensis for both antimicrobial activity and inhibition of biofilm formation. Here, we report that the Chinese cobra (Naja atra) cathelicidin NA-CATH was significantly antimicrobial against B. thailandensis. Additional cathelicidins, including the human cathelicidin LL-37, a sheep cathelicidin SMAP-29, and some smaller ATRA peptide derivatives of NA-CATH were also effective. The D-enantiomer of one small peptide (ATRA-1A) was found to be antimicrobial as well, with EC50 in the range of the L-enantiomer. Our results also demonstrate that human alpha-defensins (HNP-1 & -2) and a short beta-defensin-derived peptide (Peptide 4 of hBD-3) were not bactericidal against B. thailandensis. We also found that the cathelicidin peptides, including LL-37, NA-CATH, and SMAP-29, possessed significant ability to prevent biofilm formation of B. thailandensis. Additionally, we show that LL-37 and its D-enantiomer D-LL-37 can disperse pre-formed biofilms. These results demonstrate that although B. thailandensis is highly resistant to many antibiotics, cyclic peptide antibiotics such as polymyxin B, and defensing peptides, some antimicrobial peptides including the elapid snake cathelicidin NA-CATH exert significant antimicrobial and antibiofilm activity towards B. thailandensis. PMID:26196513

  10. Genome Analysis of Staphylococcus capitis TE8 Reveals Repertoire of Antimicrobial Peptides and Adaptation Strategies for Growth on Human Skin.

    PubMed

    Kumar, Rohit; Jangir, Pramod Kumar; Das, Jhumki; Taneja, Bhupesh; Sharma, Rakesh

    2017-09-05

    Staphylococcus capitis TE8 was isolated from skin surface of a healthy human foot, and exhibited a strong antibacterial activity against Gram-positive bacteria, including Staphylococcus aureus. Whole genome sequence of S. capitis TE8 was obtained by shotgun and paired-end pyrosequencing with a coverage of 109-fold. The draft genome contains 2,516,639 bp in 8 scaffolds with 209 total contigs. The genome contains 2319 protein coding sequences, 58 tRNA and 3 rRNA. Genome sequence analysis revealed 4 distinct gene loci with the ability to encode antimicrobial peptides: (i) an epidermicin gene cluster; (ii) a gallidermin gene cluster; (iii) a gene cluster encoding six phenol soluble modulin (PSM) β-type peptides (PSMβ1-β6) and (iv) an additional gene that belonged to PSMβ family and encoded a 44 residues long peptide, HTP2388. Synthetic peptides with sequence identical to seven PSMβ-like peptides i.e. PSMβ1-β6 and peptide HTP2388 showed antibacterial activity. Genome sequence also revealed genes for adhesins, intracellular adhesins, osmoadaptation, oxidative and acid stress tolerance possibly responsible for initial attachment, colonization and survival of S. capitis TE8 on human skin. Comparative genome analysis revealed presence of a gamut of genes in S. capitis strains in comparison to Staphylococcus epidermidis and Staphylococcus caprae indicating towards their possible role in better adaptation and survival on human skin.

  11. Recent advances in the research and development of marine antimicrobial peptides.

    PubMed

    El-Gamal, Mohammed I; Abdel-Maksoud, Mohammed S; Oh, Chang-Hyun

    2013-08-01

    Antimicrobial peptides are a group of natural or semi-synthetic molecules possessing antimicrobial activities against bacteria, fungi, viruses, parasites, etc. They are considered as promising candidates for treatment of microbial infections and suppression of microbial resistance. The increasing emergence of bacterial resistance has required development of new efficient antibiotics that can be added to the antibacterial armamentarium. The marine world provides a rich source of antimicrobial peptides. That world has not been highly explored yet, and much more effort is required in order to discover new efficient antimicrobial peptides. In the present article, we have reviewed the recent progress in the field of marine antimicrobial peptides from 2009 until the mid of 2012.

  12. A novel antimicrobial peptide from skin secretions of the tree frog Theloderma kwangsiensis.

    PubMed

    Yan, Hongli; Liu, Yingying; Tang, Jing; Mo, Guoxiang; Song, Yuzhu; Yan, Xiuwen; Wei, Lin; Lai, Ren

    2013-09-01

    Most of amphibians belonging to family Rhacophoridae live in arboreal habitats. A large number of antimicrobial peptides (AMPs) have been identified from amphibian skins. No antimicrobial peptide from Rhacophoridae amphibians has been reported. In this study, we purified and characterized a novel antimicrobial peptide, pleurain-a1-thel from skin secretions of the tree frog, Theloderma kwangsiensis. Its amino acid sequence was determined as RILTMTKRVKMPQLYKQIVCRLFKTC by Edman degradation, mass spectrometry analysis and cDNA cloning. There are two cysteines, which form an intra-molecular disulfide bridge, in the sequence of pleurain-a1-thel. Pleurain-a1-thel exerted potential antimicrobial activities against wide spectrum of microorganisms, including Gram-negative and -positive bacteria and fungi. It exerted little hemolytic activity in human or rabbit red cells. To the best of our knowledge, this is the first report of antimicrobial peptide from Rhacophoridae amphibians.

  13. Analysis of differentially expressed genes in response to bacterial stimulation in hemocytes of the carpet-shell clam Ruditapes decussatus: identification of new antimicrobial peptides.

    PubMed

    Gestal, Camino; Costa, Marímar; Figueras, Antonio; Novoa, Beatriz

    2007-12-30

    Suppression subtractive hybridization was used to identify differentially expressed genes in hemocytes from carpet-shell clam Ruditapes decussatus stimulated with a mixture of dead bacterial strains. Putative function could be assigned to 100 of the 253 sequenced cDNAs. Based on sequence homologies, 3.16% of the total identified genes were possibly related to immune functions. Clam myticin isoforms 1, 2 and 3, and clam mytilin, with similarity with myticins and mytilins previously reported on Mytilus galloprovincialis were identified and characterized for the first time in clams. The analysis of their expression levels by quantitative PCR showed that they were induced by bacterial challenge. The results obtained in this work could be the first step leading to the understanding of molecular mechanisms by which these economically important marine bivalves respond to pathogens.

  14. Improvement of in vivo antimicrobial activity of HBcARD peptides by D-arginine replacement.

    PubMed

    Chen, Heng-Li; Su, Pei-Yi; Shih, Chiaho

    2016-11-01

    We previously identified a novel antimicrobial peptide with a broad spectrum bactericidal activity from human hepatitis B virus (HBV) core protein (HBc) arginine-rich domain (ARD). We compared the antimicrobial activities of HBcARD peptides from different hepadnaviruses which share similar amino acid sequences. In general, mammalian HBcARD peptides exhibited stronger antimicrobial activity than avian peptides. Using the strategy of D-amino acid substitutions, we improved the antimicrobial efficacy of human HBcARD peptide. This D-HBcARD peptide was much more resistant than L-HBcARD peptide to proteolytic degradation in vitro. Moreover, this D-HBcARD peptide maintained similar minimal bactericidal concentrations (MBC) against tested bacteria, and showed very low hemolytic activity. In the Staphylococcus aureus-infected mouse model, this D-HBcARD peptide was more protective than the L-HBcARD peptide. Repeated treatments with either L- or D-HBcARD peptides induced no significant immunogenicity. New derivatives of HBcARD peptides could serve as alternatives to the conventional antibiotics in clinical medicine in the future.

  15. Membrane-active peptides from marine organisms--antimicrobials, cell-penetrating peptides and peptide toxins: applications and prospects.

    PubMed

    Ponnappan, Nisha; Budagavi, Deepthi Poornima; Yadav, Bhoopesh Kumar; Chugh, Archana

    2015-03-01

    Marine organisms are known to be a rich and unique source of bioactive compounds as they are exposed to extreme conditions in the oceans. The present study is an attempt to briefly describe some of the important membrane-active peptides (MAPs) such as antimicrobial peptides (AMPs), cell-penetrating peptides (CPPs) and peptide toxins from marine organisms. Since both AMPs and CPPs play a role in membrane perturbation and exhibit interchangeable role, they can speculatively fall under the broad umbrella of MAPs. The study focuses on the structural and functional characteristics of different classes of marine MAPs. Further, AMPs are considered as a potential remedy to antibiotic resistance acquired by several pathogens. Peptides from marine organisms show novel post-translational modifications such as cysteine knots, halogenation and histidino-alanine bridge that enable these peptides to withstand harsh marine environmental conditions. These unusual modifications of AMPs from marine organisms are expected to increase their half-life in living systems, contributing to their increased bioavailability and stability when administered as drug in in vivo systems. Apart from AMPs, marine toxins with membrane-perturbing properties could be essentially investigated for their cytotoxic effect on various pathogens and their cell-penetrating activity across various mammalian cells. The current review will help in identifying the MAPs from marine organisms with crucial post-translational modifications that can be used as template for designing novel therapeutic agents and drug-delivery vehicles for treatment of human diseases.

  16. Antimicrobial peptides: modes of mechanism, modulation of defense responses.

    PubMed

    Rahnamaeian, Mohammad

    2011-09-01

    Complicated schemes of classical breeding and their drawbacks, environmental risks imposed by agrochemicals, decrease of arable land, and coincident escalating damages of pests and pathogens have accentuated the necessity for highly efficient measures to improve crop protection. During co-evolution of host-microbe interactions, antimicrobial peptides (AMPs) have exhibited a brilliant history in protecting host organisms against devastation by invading pathogens. Since the 1980s, a plethora of AMPs has been isolated from and characterized in different organisms. Nevertheless the AMPs expressed in plants render them more resistant to diverse pathogens, a more orchestrated approach based on knowledge of their mechanisms of action and cellular targets, structural toxic principle, and possible impact on immune system of corresponding transgenic plants will considerably improve crop protection strategies against harmful plant diseases. This review outlines the current knowledge on different modes of action of AMPs and then argues the waves of AMPs’ ectopic expression on transgenic plants’ immune system.

  17. Cationic Antimicrobial Peptide Resistance Mechanisms of Streptococcal Pathogens

    PubMed Central

    LaRock, Christopher N.; Nizet, Victor

    2015-01-01

    Cationic antimicrobial peptides (CAMPs) are critical front line contributors to host defense against invasive bacterial infection. These immune factors have direct killing activity toward microbes, but many pathogens are able to resist their effects. Group A Streptococcus, group B Streptococcus and Streptococcus pneumoniae are among the most common pathogens of humans and display a variety of phenotypic adaptations to resist CAMPs. Common themes of CAMP resistance mechanisms among the pathogenic streptococci are repulsion, sequestration, export, and destruction. Each pathogen has a different array of CAMP-resistant mechanisms, with invasive disease potential reflecting the utilization of several mechanisms that may act in synergy. Here we discuss recent progress in identifying the sources of CAMP resistance in the medically important Streptococcus genus. Further study of these mechanisms can contribute to our understanding of streptococcal pathogenesis, and may provide new therapeutic targets for therapy and disease prevention. PMID:25701232

  18. Antimicrobial Peptides as a Strategy to Combat Fungal Biofilms.

    PubMed

    Delattin, Nicolas; Brucker, Katrijn De; Cremer, Kaat De; Cammue, Bruno P A; Thevissen, Karin

    2017-01-01

    Invasive fungal infections caused by opportunistic fungal pathogens are associated with high mortality rates, mainly due to the occurrence of genotypic and/or phenotypic resistance. One of the causes of phenotypic resistance is the preferred growth of various fungal pathogens as biofilms, which are tolerant or resistant to most classes of antifungal agents. Moreover, increasing evidence points to biofilm formation as a general prerequisite for the development of systemic infections. Therefore, new antibiofilm agents are urgently needed to reduce the incidence of biofilm-associated infections. Nowadays, antimicrobial peptides (AMPs) are considered as valuable alternatives for or complements to the classical antifungal agents to combat fungal infections. Many review reports describe activity of AMPs against free-living planktonic fungal pathogens. In contrast, this review summarizes the antibiofilm properties of natural or synthetic AMPs against fungal biofilms and their potential to enhance the antibiofilm activity of existing antifungal agents.

  19. Combined Systems Approaches Reveal Highly Plastic Responses to Antimicrobial Peptide Challenge in Escherichia coli

    PubMed Central

    Kozlowska, Justyna; Vermeer, Louic S.; Rogers, Geraint B.; Rehnnuma, Nabila; Amos, Sarah-Beth T. A.; Koller, Garrit; McArthur, Michael; Bruce, Kenneth D.; Mason, A. James

    2014-01-01

    Obtaining an in-depth understanding of the arms races between peptides comprising the innate immune response and bacterial pathogens is of fundamental interest and will inform the development of new antibacterial therapeutics. We investigated whether a whole organism view of antimicrobial peptide (AMP) challenge on Escherichia coli would provide a suitably sophisticated bacterial perspective on AMP mechanism of action. Selecting structurally and physically related AMPs but with expected differences in bactericidal strategy, we monitored changes in bacterial metabolomes, morphological features and gene expression following AMP challenge at sub-lethal concentrations. For each technique, the vast majority of changes were specific to each AMP, with such a plastic response indicating E. coli is highly capable of discriminating between specific antibiotic challenges. Analysis of the ontological profiles generated from the transcriptomic analyses suggests this approach can accurately predict the antibacterial mode of action, providing a fresh, novel perspective for previous functional and biophysical studies. PMID:24789011

  20. Combined systems approaches reveal highly plastic responses to antimicrobial peptide challenge in Escherichia coli.

    PubMed

    Kozlowska, Justyna; Vermeer, Louic S; Rogers, Geraint B; Rehnnuma, Nabila; Amos, Sarah-Beth T A; Koller, Garrit; McArthur, Michael; Bruce, Kenneth D; Mason, A James

    2014-05-01

    Obtaining an in-depth understanding of the arms races between peptides comprising the innate immune response and bacterial pathogens is of fundamental interest and will inform the development of new antibacterial therapeutics. We investigated whether a whole organism view of antimicrobial peptide (AMP) challenge on Escherichia coli would provide a suitably sophisticated bacterial perspective on AMP mechanism of action. Selecting structurally and physically related AMPs but with expected differences in bactericidal strategy, we monitored changes in bacterial metabolomes, morphological features and gene expression following AMP challenge at sub-lethal concentrations. For each technique, the vast majority of changes were specific to each AMP, with such a plastic response indicating E. coli is highly capable of discriminating between specific antibiotic challenges. Analysis of the ontological profiles generated from the transcriptomic analyses suggests this approach can accurately predict the antibacterial mode of action, providing a fresh, novel perspective for previous functional and biophysical studies.

  1. Membrane selectivity and disordering mechanism of antimicrobial peptide protegrin-1

    NASA Astrophysics Data System (ADS)

    Ishitsuka, Yuji

    Protegrin-1 (PG-1) is a beta-sheet antimicrobial peptide (AMP), a class of peptides innate to various organisms and functions as a defense agent against harmful microorganisms by means of membrane disordering. Characteristic chemical and structural properties of AMPs allow selective interaction against invaders' cell membranes. Despite their enormous biomedical potential, progress towards developing them into therapeutic agents has been hampered by a lack of insight into their mechanism of action. AMP insertion assays using Langmuir monolayers reveal that both electrostatic properties of the lipid head group as well as the packing density of the lipid tail group play important roles in determining the membrane selectivity of AMPs. These results help elucidate how the AMP selectively targets the cell membrane of microorganisms over the cell membrane of the host. In addition, these results also explain the higher hemolytic ability of PG-1 against human red blood cells (RBCs) compared to the hemolytic ability of PG-1 against sheep and pig RBCs. Synchrotron X-ray reflectivity shows that PG-1 penetrates into the lipid layer. Grazing incidence X-ray diffraction and fluorescence microscopy indicate that the insertion of PG-1 disorders tail group packing. Membrane selectivity and insertion location information of AMPs with different primary sequence and secondary structure have been obtained by using a truncated version of PG-1: PC-17, and an alpha-helical AMP, LL-37, respectively. The similarity of the membrane disordering process across these various peptides motivated us to test the membrane disordering effect of molecules designed to mimic these peptides. Peptide-mimics based on meta-phenylene ethynylenes demonstrate similar membrane disordering effects, showing that the potency of AMPs is derived from their overall chemical and structural properties, rather than exact peptide sequence. Atomic force microscopy (AFM) was used to directly image first, the PG-1

  2. NMR Structural Studies of Antimicrobial Peptides: LPcin Analogs

    PubMed Central

    Jeong, Ji-Ho; Kim, Ji-Sun; Choi, Sung-Sub; Kim, Yongae

    2016-01-01

    Lactophoricin (LPcin), a component of proteose peptone (113–135) isolated from bovine milk, is a cationic amphipathic antimicrobial peptide consisting of 23 amino acids. We designed a series of N- or C-terminal truncated variants, mutated analogs, and truncated mutated analogs using peptide-engineering techniques. Then, we selected three LPcin analogs of LPcin-C8 (LPcin-YK1), LPcin-T2WT6W (LPcin-YK2), and LPcin-T2WT6W-C8 (LPcin-YK3), which may have better antimicrobial activities than LPcin, and successfully expressed them in E. coli with high yield. We elucidated the 3D structures and topologies of the three LPcin analogs in membrane environments by conducting NMR structural studies. We investigated the purity of the LPcin analogs and the α-helical secondary structures by performing 1H-15N 2D HSQC and HMQC-NOESY liquid-state NMR spectroscopy using protein-containing micelle samples. We measured the 3D structures and tilt angles in membranes by conducting 15N 1D and 2D 1H-15N SAMMY type solid-state NMR spectroscopy with an 800 MHz in-house-built 1H-15N double-resonance solid-state NMR probe with a strip-shield coil, using protein-containing large bicelle samples aligned and confirmed by molecular-dynamics simulations. The three LPcin analogs were found to be curved α-helical structures, with tilt angles of 55–75° for normal membrane bilayers, and their enhanced activities may be correlated with these topologies. PMID:26789765

  3. Antimicrobial peptides for the control of biofilm formation.

    PubMed

    Moreno, Mercedes González; Lombardi, Lisa; Di Luca, Mariagrazia

    2017-01-05

    Antimicrobial peptides (AMPs) are an abundant and varied group of molecules recognized as the most ancient components of the innate immune system. They are found in a wide group of organisms including bacteria, plants and animals as a defense mechanism against different kinds of infectious pathogens. Over the past two decades, a fast-growing number of AMPs have been identified/designed and their wide-spectrum antimicrobial activity has been deeply investigated. In recent years, there has been an increasing interest in the use of AMPs as alternative anti-biofilm molecules for the control of biofilm-related infections. Biofilms are sessile communities of microbial cells embedded in a self-produced matrix and characterized by a low metabolic activity. Due to their peculiar physiological properties, bacteria/fungi in biofilms result more resistant to conventional antibiotic therapies compared with their planktonic counterparts. AMPs may be a promising strategy to combat biofilm-related infections, as many of them target the microbial membrane, thus being potentially effective also on metabolically inactive cells. Investigations conducted so far evidenced that these peptides may be active in either eradicating established biofilms or preventing their formation, depending on the specific molecule. Here we present a detailed review of the literature describing the latest results of both in vitro and in vivo experiments aimed at evaluating AMP potential usage in biofilm control. In addition, we provide the reader with an overview on AMP local delivery systems, and we discuss their potential application in the coating of medical indwelling devices.

  4. Fungicidal mechanisms of the antimicrobial peptide Bac8c.

    PubMed

    Lee, Wonyoung; Lee, Dong Gun

    2015-02-01

    Bac8c (RIWVIWRR-NH2) is an analogue peptide derived through complete substitution analysis of the linear bovine host defense peptide variant Bac2A. In the present study, the antifungal mechanism of Bac8c against pathogenic fungi was investigated, with a particular focus on the effects of Bac8c on the cytoplasmic membrane. We used bis-(1,3-dibutylbarbituric acid) trimethine oxonol [DiBAC4(3)] staining and 3,3'-dipropylthiacarbocyanine iodide [DiSC3(5)] assays to show that Bac8c induced disturbances in the membrane potential of Candida albicans. An increase in membrane permeability and suppression of cell wall regeneration were also observed in Bac8c-treated C. albicans. We studied the effects of Bac8c treatment on model membranes to elucidate its antifungal mechanism. Using calcein and FITC-labeled dextran leakage assays from Bac8c-treated large unilamellar vesicles (LUVs) and giant unilamellar vesicles (GUVs), we found that Bac8c has a pore-forming action on fungal membranes, with an estimated pore radius of between 2.3 and 3.3 nm. A membrane-targeted mechanism of action was also supported by the observation of potassium release from the cytosol of Bac8c-treated C. albicans. These results indicate that Bac8c is considered as a potential candidate to develop a novel antimicrobial agent because of its low-cost production characteristics and high antimicrobial activity via its ability to induce membrane perturbations in fungi.

  5. Beyond NMR Spectra of Antimicrobial Peptides: Dynamical Images at Atomic Resolution and Functional Insights

    PubMed Central

    Ramamoorthy, Ayyalusamy

    2009-01-01

    There is a considerable current interest in understanding the function of antimicrobial peptides for the development of potent novel antibiotic compounds with a very high selectivity. Since their interaction with the cell membrane is the major driving force for their function, solid-state NMR spectroscopy is the unique method of choice to study these insoluble, noncrystalline, membrane-peptide complexes. Here I discuss solid-state NMR studies of antimicrobial peptides that have reported high-resolution structure, dynamics, orientation, and oligomeric states of antimicrobial peptides in a membrane environment, and also address important questions about the mechanism of action at atomic-level resolution. Increasing number of solid-state NMR applications to antimicrobial peptides are expected in the near future, as these compounds are promising candidates to overcome ever-increasing antibiotic resistance problem and are well-suited for the development and applications of solid-state NMR techniques. PMID:19386477

  6. Use of antimicrobial peptides against microbial biofilms: advantages and limits.

    PubMed

    Batoni, Giovanna; Maisetta, Giuseppantonio; Brancatisano, Franca Lisa; Esin, Semih; Campa, Mario

    2011-01-01

    The formation of surface-attached cellular agglomerates, the so-called biofilms, contributes significantly to bacterial resistance to antibiotics and innate host defenses. Bacterial biofilms are associated to various pathological conditions in humans such as cystic fibrosis, colonization of indwelling medical devices and dental plaque formation involved in caries and periodontitis. Over the last years, natural antimicrobial peptides (AMPs) have attracted considerable interest as a new class of antimicrobial drugs for a number of reasons. Among these, there are the broad activity spectrum, the relative selectivity towards their targets (microbial membranes), the rapid mechanism of action and, above all, the low frequency in selecting resistant strains. Since biofilm resistance to antibiotics is mainly due to the slow growth rate and low metabolic activity of bacteria in such community, the use of AMPs to inhibit biofilm formation could be potentially an attractive therapeutic approach. In fact, due to the prevalent mechanism of action of AMPs, which relies on their ability to permeabilize and/or to form pores within the cytoplasmic membranes, they have a high potential to act also on slow growing or even non-growing bacteria. This review will highlight the most important findings obtained testing AMPs in in vitro and in vivo models of bacterial biofilms, pointing out the possible advantages and limits of their use against microbial biofilm-related infections.

  7. Next generation of antimicrobial peptides as molecular targeted medicines.

    PubMed

    Aoki, Wataru; Kuroda, Kouichi; Ueda, Mitsuyoshi

    2012-10-01

    Antibiotics have significantly improved our living environments. However, overuse of antibiotics has led to the emergence of multi-drug resistant microorganisms, and the subsequent constant demand for the exploration of novel antibiotics. To this end, antimicrobial peptides (AMPs) have attracted much attention as a novel class of antibiotics. AMPs have strong antimicrobial activity against a wide-range of species, including gram-positive and gram-negative bacteria, fungi, and viruses. In addition, they are also effective against pathogenic organisms that are resistant to conventional drugs. Despite their great potential, the hemolytic activity and a highly broad spectrum of activity of AMPs dictate the need for amendments to develop safe pharmaceuticals. The human body contains commensal microflora as an integral part of complex mucosal surfaces that offers protection against pathogenic organisms. Administration of antibiotics with broad spectra of activity disrupts the indigenous microflora and increases the risks of diarrhea and other fatal infections. Therefore, it is difficult, but vital, to develop treatments capable of rapidly eliminating pathogenic organisms while maintaining the commensal microbiota. As such, novel pharmaceuticals, safe designer AMPs have been heavily researched. In this article, we review recent attempts to spatially and temporally regulate AMPs to enhance the quality-of-life of patients. Copyright © 2012 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  8. Mechanism of bacterial membrane poration by Antimicrobial Peptides

    NASA Astrophysics Data System (ADS)

    Arora, Ankita; Mishra, Abhijit

    2015-03-01

    Bacterial resistance to conventional antibiotics is a major health concern. Antimicrobial peptides (AMPs), an important component of mammalian immune system, are thought to utilize non-specific interactions to target common features on the outer membranes of pathogens; hence development of resistance to such AMPs may be less pronounced. Most AMPs are amphiphilic and cationic in nature. Most AMPs form pores in the bacterial membranes causing them to lyse, however, the exact mechanism is unknown. Here, we study the AMP CHRG01 (KSSTRGRKSSRRKK), derived from human β defensin 3 (hBD3) with all Cysteine residues substituted with Serine. Circular Dichorism studies indicate that CHRG01 shows helicity and there is change in helicity as it interacts with the lipid membrane. The AMP was effective against different species of bacteria. Leakage of cellular components from bacterial cells observed by SEM and AFM indicates AMP action by pore formation. Confocal microscopy studies on giant vesicles incubated with AMP confirm poration. The effect of this AMP on model bacterial membranes is characterized using Small Angle X-ray scattering and Fluorescence spectroscopy to elucidate the mechanism behind antimicrobial activity.

  9. Recombinant expression of antimicrobial peptides using a novel self-cleaving aggregation tag in Escherichia coli.

    PubMed

    Luan, Chao; Xie, Yong Gang; Pu, Yu Tian; Zhang, Hai Wen; Han, Fei Fei; Feng, Jie; Wang, Yi Zhen

    2014-03-01

    Antimicrobial peptides (AMPs) are part of the innate immune system of complex multicellular organisms. Despite the fact that AMPs show great potential as a novel class of antibiotics, the lack of a cost-effective means for their mass production limits both basic research and clinical use. In this work, we describe a novel expression system for the production of antimicrobial peptides in Escherichia coli by combining ΔI-CM mini-intein with the self-assembling amphipathic peptide 18A to drive the formation of active aggregates. Two AMPs, human β-defensin 2 and LL-37, were fused to the self-cleaving tag and expressed as active protein aggregates. The active aggregates were recovered by centrifugation and the intact antimicrobial peptides were released into solution by an intein-mediated cleavage reaction in cleaving buffer (phosphate-buffered saline supplemented with 40 mmol/L Bis-Tris, 2 mmol/L EDTA, pH 6.2). The peptides were further purified by cation-exchange chromatography. Peptides yields of 0.82 ± 0.24 and 0.59 ± 0.11 mg/L were achieved for human β-defensin 2 and LL-37, respectively, with demonstrated antimicrobial activity. Using our expression system, intact antimicrobial peptides were recovered by simple centrifugation from active protein aggregates after the intein-mediated cleavage reaction. Thus, we provide an economical and efficient way to produce intact antimicrobial peptides in E. coli.

  10. Molecular Design, Structures, and Activity of Antimicrobial Peptide-Mimetic Polymers

    PubMed Central

    Takahashi, Haruko; Palermo, Edmund F.; Yasuhara, Kazuma; Caputo, Gregory A.

    2014-01-01

    There is an urgent need for new antibiotics which are effective against drug-resistant bacteria without contributing to resistance development. We have designed and developed antimicrobial copolymers with cationic amphiphilic structures based on the mimicry of naturally occurring antimicrobial peptides. These copolymers exhibit potent antimicrobial activity against a broad spectrum of bacteria including methicillin-resistant Staphylococcus aureus with no adverse hemolytic activity. Notably, these polymers also did not result in any measurable resistance development in E. coli. The peptide-mimetic design principle offers significant flexibility and diversity in the creation of new antimicrobial materials and their potential biomedical applications. PMID:23832766

  11. Antimicrobial activity and interactions of cationic peptides derived from Galleria mellonella cecropin D-like peptide with model membranes.

    PubMed

    Oñate-Garzón, José; Manrique-Moreno, Marcela; Trier, Steven; Leidy, Chad; Torres, Rodrigo; Patiño, Edwin

    2017-03-01

    Antimicrobial peptides are effector molecules of the innate immune system against invading pathogens. The cationic charge in their structures has a strong correlation with antimicrobial activity, being responsible for the initial electrostatic interaction between peptides and the anionic microbial surface. This paper contains evidence that charge modification in the neutral peptide Gm cecropin D-like (WT) improved the antimicrobial activity of the modified peptides. Two cationic peptides derived from WT sequence named as ΔM1 and ΔM2, with net charge of +5 and +9, respectively, showed at least an eightfold increase in their antimicrobial activity in comparison to WT. The mechanism of action of these peptides was investigated using small unilamellar vesicles (SUVs) as model membranes. To study permeabilization effects of the peptides on cell membranes, entrapped calcein liposomes were used and the results showed that all peptides induced calcein release from 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoglycerol (POPG) SUVs, whereas in 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), POPC/POPG and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE)/POPG SUVs, only ΔM1 and ΔM2 induced a notable permeabilization. In addition, interactions of these peptides with phospholipids at the level of the glycerol backbone and hydrophobic domain were studied through observed changes in generalized polarization and fluorescence anisotropy using probes such as Laurdan and DPH, respectively. The results suggest that peptides slightly ordered the bilayer structure at the level of glycerol backbone and on the hydrophobic core in 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) SUVs, whereas in 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC)/DMPG SUVs, only ΔM1 and ΔM2 peptides increased the order of bilayers. Thus, peptides would be inducing clustering of phospholipids creating phospholipid domains with a higher phase transition temperature.

  12. Focal Targeting of the Bacterial Envelope by Antimicrobial Peptides

    PubMed Central

    Rashid, Rafi; Veleba, Mark; Kline, Kimberly A.

    2016-01-01

    Antimicrobial peptides (AMPs) are utilized by both eukaryotic and prokaryotic organisms. AMPs such as the human beta defensins, human neutrophil peptides, human cathelicidin, and many bacterial bacteriocins are cationic and capable of binding to anionic regions of the bacterial surface. Cationic AMPs (CAMPs) target anionic lipids [e.g., phosphatidylglycerol (PG) and cardiolipins (CL)] in the cell membrane and anionic components [e.g., lipopolysaccharide (LPS) and lipoteichoic acid (LTA)] of the cell envelope. Bacteria have evolved mechanisms to modify these same targets in order to resist CAMP killing, e.g., lysinylation of PG to yield cationic lysyl-PG and alanylation of LTA. Since CAMPs offer a promising therapeutic alternative to conventional antibiotics, which are becoming less effective due to rapidly emerging antibiotic resistance, there is a strong need to improve our understanding about the AMP mechanism of action. Recent literature suggests that AMPs often interact with the bacterial cell envelope at discrete foci. Here we review recent AMP literature, with an emphasis on focal interactions with bacteria, including (1) CAMP disruption mechanisms, (2) delocalization of membrane proteins and lipids by CAMPs, and (3) CAMP sensing systems and resistance mechanisms. We conclude with new approaches for studying the bacterial membrane, e.g., lipidomics, high resolution imaging, and non-detergent-based membrane domain extraction. PMID:27376064

  13. Antimicrobial peptides as new recognition molecules for screening challenging species

    PubMed Central

    Kulagina, Nadezhda V.; Shaffer, Kara M.; Ligler, Frances S.; Taitt, Chris R.

    2007-01-01

    The goal of this study was to evaluate binding of four targets of biodefense interest to immobilized antimicrobial peptides (AMPs) in biosensor assays. Polymyxins B and E, melittin, cecropins A, B, and P, parasin, bactenecin and magainin-1, as well as control antibodies, were used as capture molecules for detection of Cy3-labeled Venezuelan equine encephalitis virus (VEE), vaccinia virus, C. burnetti and B. melitensis. Although VEE, vaccinia virus and C. burnetti did not show any binding activity to their corresponding capture antibodies, B. melitensis bound to immobilized anti-Brucella monoclonal antibodies. The majority of the immobilized AMPs included in this study bound labeled VEE, vaccinia virus and C. burnetti in a concentration-dependent manner, and B. melitensis bound to polymyxin B, polymyxin E, and bactenecin. No binding was observed on immobilized magainin-1. In contrast to all bacterial targets tested to date, VEE and vaccinia virus demonstrated similar patterns of binding to all peptides. While the direct assay is generally replaced by a sandwich assay for analysis of real-world samples, direct binding experiments are commonly used to characterize specificity and sensitivity of binding molecules. In this case, they clearly demonstrate the capability of AMPs as recognition molecules for four biothreat agents. PMID:18231571

  14. Immune Signaling and Antimicrobial Peptide Expression in Lepidoptera

    PubMed Central

    Casanova-Torres, Ángel M.; Goodrich-Blair, Heidi

    2013-01-01

    Many lepidopteran insects are agricultural pests that affect stored grains, food and fiber crops. These insects have negative ecological and economic impacts since they lower crop yield, and pesticides are expensive and can have off-target effects on beneficial arthropods. A better understanding of lepidopteran immunity will aid in identifying new targets for the development of specific insect pest management compounds. A fundamental aspect of immunity, and therefore a logical target for control, is the induction of antimicrobial peptide (AMP) expression. These peptides insert into and disrupt microbial membranes, thereby promoting pathogen clearance and insect survival. Pathways leading to AMP expression have been extensively studied in the dipteran Drosophila melanogaster. However, Diptera are an important group of pollinators and pest management strategies that target their immune systems is not recommended. Recent advances have facilitated investigation of lepidopteran immunity, revealing both conserved and derived characteristics. Although the general pathways leading to AMP expression are conserved, specific components of these pathways, such as recognition proteins have diverged. In this review we highlight how such comparative immunology could aid in developing pest management strategies that are specific to agricultural insect pests. PMID:25861461

  15. Antimicrobial Peptide Resistance Mechanisms of Gram-Positive Bacteria.

    PubMed

    Nawrocki, Kathryn L; Crispell, Emily K; McBride, Shonna M

    2014-10-13

    Antimicrobial peptides, or AMPs, play a significant role in many environments as a tool to remove competing organisms. In response, many bacteria have evolved mechanisms to resist these peptides and prevent AMP-mediated killing. The development of AMP resistance mechanisms is driven by direct competition between bacterial species, as well as host and pathogen interactions. Akin to the number of different AMPs found in nature, resistance mechanisms that have evolved are just as varied and may confer broad-range resistance or specific resistance to AMPs. Specific mechanisms of AMP resistance prevent AMP-mediated killing against a single type of AMP, while broad resistance mechanisms often lead to a global change in the bacterial cell surface and protect the bacterium from a large group of AMPs that have similar characteristics. AMP resistance mechanisms can be found in many species of bacteria and can provide a competitive edge against other bacterial species or a host immune response. Gram-positive bacteria are one of the largest AMP producing groups, but characterization of Gram-positive AMP resistance mechanisms lags behind that of Gram-negative species. In this review we present a summary of the AMP resistance mechanisms that have been identified and characterized in Gram-positive bacteria. Understanding the mechanisms of AMP resistance in Gram-positive species can provide guidelines in developing and applying AMPs as therapeutics, and offer insight into the role of resistance in bacterial pathogenesis.

  16. Antimicrobial Peptide Resistance Mechanisms of Gram-Positive Bacteria

    PubMed Central

    Nawrocki, Kathryn L.; Crispell, Emily K.; McBride, Shonna M.

    2014-01-01

    Antimicrobial peptides, or AMPs, play a significant role in many environments as a tool to remove competing organisms. In response, many bacteria have evolved mechanisms to resist these peptides and prevent AMP-mediated killing. The development of AMP resistance mechanisms is driven by direct competition between bacterial species, as well as host and pathogen interactions. Akin to the number of different AMPs found in nature, resistance mechanisms that have evolved are just as varied and may confer broad-range resistance or specific resistance to AMPs. Specific mechanisms of AMP resistance prevent AMP-mediated killing against a single type of AMP, while broad resistance mechanisms often lead to a global change in the bacterial cell surface and protect the bacterium from a large group of AMPs that have similar characteristics. AMP resistance mechanisms can be found in many species of bacteria and can provide a competitive edge against other bacterial species or a host immune response. Gram-positive bacteria are one of the largest AMP producing groups, but characterization of Gram-positive AMP resistance mechanisms lags behind that of Gram-negative species. In this review we present a summary of the AMP resistance mechanisms that have been identified and characterized in Gram-positive bacteria. Understanding the mechanisms of AMP resistance in Gram-positive species can provide guidelines in developing and applying AMPs as therapeutics, and offer insight into the role of resistance in bacterial pathogenesis. PMID:25419466

  17. Membrane Active Antimicrobial Peptides: Translating Mechanistic Insights to Design

    PubMed Central

    Li, Jianguo; Koh, Jun-Jie; Liu, Shouping; Lakshminarayanan, Rajamani; Verma, Chandra S.; Beuerman, Roger W.

    2017-01-01

    Antimicrobial peptides (AMPs) are promising next generation antibiotics that hold great potential for combating bacterial resistance. AMPs can be both bacteriostatic and bactericidal, induce rapid killing and display a lower propensity to develop resistance than do conventional antibiotics. Despite significant progress in the past 30 years, no peptide antibiotic has reached the clinic yet. Poor understanding of the action mechanisms and lack of rational design principles have been the two major obstacles that have slowed progress. Technological developments are now enabling multidisciplinary approaches including molecular dynamics simulations combined with biophysics and microbiology toward providing valuable insights into the interactions of AMPs with membranes at atomic level. This has led to increasingly robust models of the mechanisms of action of AMPs and has begun to contribute meaningfully toward the discovery of new AMPs. This review discusses the detailed action mechanisms that have been put forward, with detailed atomistic insights into how the AMPs interact with bacterial membranes. The review further discusses how this knowledge is exploited toward developing design principles for novel AMPs. Finally, the current status, associated challenges, and future directions for the development of AMP therapeutics are discussed. PMID:28261050

  18. Membrane Active Antimicrobial Peptides: Translating Mechanistic Insights to Design.

    PubMed

    Li, Jianguo; Koh, Jun-Jie; Liu, Shouping; Lakshminarayanan, Rajamani; Verma, Chandra S; Beuerman, Roger W

    2017-01-01

    Antimicrobial peptides (AMPs) are promising next generation antibiotics that hold great potential for combating bacterial resistance. AMPs can be both bacteriostatic and bactericidal, induce rapid killing and display a lower propensity to develop resistance than do conventional antibiotics. Despite significant progress in the past 30 years, no peptide antibiotic has reached the clinic yet. Poor understanding of the action mechanisms and lack of rational design principles have been the two major obstacles that have slowed progress. Technological developments are now enabling multidisciplinary approaches including molecular dynamics simulations combined with biophysics and microbiology toward providing valuable insights into the interactions of AMPs with membranes at atomic level. This has led to increasingly robust models of the mechanisms of action of AMPs and has begun to contribute meaningfully toward the discovery of new AMPs. This review discusses the detailed action mechanisms that have been put forward, with detailed atomistic insights into how the AMPs interact with bacterial membranes. The review further discusses how this knowledge is exploited toward developing design principles for novel AMPs. Finally, the current status, associated challenges, and future directions for the development of AMP therapeutics are discussed.

  19. [Solution structure and antibacterial mechanism of two synthetic antimicrobial peptides].

    PubMed

    Yang, Lin; Fan, Meihua; Liu, Xuezhu; Wu, Mei; Shi, Ge; Liao, Zhi

    2011-11-01

    Mytilin-derived-peptide-1 (MDP-1) and mytilin-derived-peptide-2 (MDP-2) are two truncated decapeptides with reversed sequence synthesized corresponding to the residues 20-29 of mytilin-1 (GenBank Accession No. FJ973154) from M. coruscus. The objective of this study is to characterize the structural basis of these two peptides for their antimicrobial activities and functional differences, and to investigate the inhibitory mechanism of MDPs on Escherichia coli and Sarcina lutea. The structures of MDP-1 and MDP-2 in solution were determined by 1H 2D NMR methods; the antibactericidal effects of MDPs on E. coli and S. lutea were observed by transmitted electron microscopy (TEM). Both MDP-1 and MDP-2 have a well-defined loop structure stabilized by two additional disulfide bridges, which resemble the-hairpin structure of mytilin-1 model. The surface profile of MDPs' structures was characterized by protruding charged residues surrounded by hydrophobic residues. TEM analysis showed that MDPs destroyed cytoplasmic membrane and cell wall of bacteria and the interface between the cell wall and membrane was blurred. Furthermore, some holes were observed in treated bacteria, which resulted in cell death. Structural comparison between MDP-1 and MDP-2 shows that the distribution of positively charged amino acids on the loop of MDPs is topologically different significantly, which might be the reason why MDP-2 has higher activity than MDP-1. Furthermore, TEM results suggested that the bactericidal mechanisms of MDPs against E. coli and S. lutea were similar. Both MDP-1 and MDP-2 could attach to the negatively charged bacterial wall by positively charged amino acid residues and destroy the bacteria membrane in a pore-forming manner, thus cause the contents of the cells to release and eventually cell death.

  20. Synthesis and secretory expression of hybrid antimicrobial peptide CecA-mag and its mutants in Pichia pastoris.

    PubMed

    Wang, Xiuqing; Zhu, Mingxing; Zhang, Aijun; Yang, Fengqin; Chen, Puyan

    2012-03-01

    The hybrid peptide CA(1-7)-M(2-12) gene was designed according to the N-terminal 1-7 amino acid sequence of the antimicrobial peptide cecropin A (CA) and the N-terminal 2-12 amino acid sequence of maganin (M) and synthesized using Pichia pastoris preferred codons. The gene was cloned into pPICZαA and transformed into the P. pastoris recipient bacterium SMD1168, regulated by the alcohol oxidase (AOX). Expression of the cecA-mag hybrid antimicrobial peptide (MW, 1.9 kDa) revealed broad-spectrum antibiotic activity and to the ability to inhibit growth of most G(-) and G(+) bacteria. Three mutants of cecA-mag were designed and synthesized by recombination polymerase chain reaction site-directed mutagenesis to investigate the relationship between the structure and function of this antimicrobial peptide. The inhibition titers of these mutants against Staphylococcus aureus were evaluated using the agar diffusion method. Under the conditions of the same concentration and volume, the bacteriostatic diameters of three cecA-mag mutants were 1.2, 1.2 and 1.5 times, respectively, compared with the diameters of wild-type cecA-mag.

  1. Ribosomally synthesized peptides with antimicrobial properties: biosynthesis, structure, function, and applications.

    PubMed

    Papagianni, Maria

    2003-09-01

    Ribosomally synthesized peptides with antimicrobial properties (antimicrobial peptides-AMPs) are produced by eukaryotes and prokaryotes and represent crucial components of their defense systems against microorganisms. Although they differ in structure, they are nearly all cationic and very often amphiphilic, which reflects the fact that many of them attack their target cells by permeabilizing the cell membrane. They can be roughly categorized into those that have a high content of a certain amino acid, most often proline, those that contain intramolecular disulfide bridges, and those with an amphiphilic region in their molecule if they assume an alpha-helical structure. Most of the known ribosomally synthesized peptides with antimicrobial functions have been identified and studied during the last 20 years. As a result of these studies, new knowledge has been acquired into biology and biochemistry. It has become evident that these peptides may be developed into useful antimicrobial additives and drugs. The use of two-peptide antimicrobial peptides as replacement for clinical antibiotics is promising, though their applications in preservation of foods (safe and effective for use in meat, vegetables, and dairy products), in veterinary medicine, and in dentistry are more immediate. This review focuses on the current status of some of the main types of ribosomally synthesized AMPs produced by eucaryotes and procaryotes and discusses the novel antimicrobial functions, new developments, e.g. heterologous production of bacteriocins by lactic acid bacteria, or construction of multibacteriocinogenic strains, novel applications related to these peptides, and future research paradigms.

  2. Identification of multiple antimicrobial peptides from the skin of fine-spined frog, Hylarana spinulosa (Ranidae).

    PubMed

    Yang, Xiaolong; Hu, Yuhong; Xu, Shiqi; Hu, Yonghong; Meng, Hao; Guo, Chao; Liu, Yuliang; Liu, Jingze; Yu, Zhijun; Wang, Hui

    2013-12-01

    In this study, peptidomics and genomics analyses were used to study antimicrobial peptides from the skin of Hylarana spinulosa. Twenty-nine different antimicrobial peptide precursors were characterized from the skin of H. spinulosa, which produce 23 mature antimicrobial peptides belonging to 12 different families. To confirm the actual presence and characteristics of these antimicrobial peptides in the skin tissue extractions from H. spinulosa, we used two distinct methods, one was peptide purification method that combined gel filtration chromatography and reversed-phase high performance liquid chromatography (RP-HPLC), and the other was peptidomics approach based on liquid chromatography in conjunction with tandem mass spectrometry (LC-MS/MS). In the peptidomics approach, incomplete tryptic digestion and gas-phase fractionation (GPF) analysis were used to increase peptidome coverage and reproducibility of peptide ion selection. Multiple species of microorganisms were chosen to test and analyze the antimicrobial activities and spectrum of these antimicrobial peptides. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  3. Antimicrobial Peptides and Innate Lung Defenses: Role in Infectious and Noninfectious Lung Diseases and Therapeutic Applications.

    PubMed

    Hiemstra, Pieter S; Amatngalim, Gimano D; van der Does, Anne M; Taube, Christian

    2016-02-01

    Respiratory infections are a major clinical problem, and treatment is increasingly complicated by the emergence of microbial antibiotic resistance. Development of new antibiotics is notoriously costly and slow; therefore, alternative strategies are needed. Antimicrobial peptides, central effector molecules of the immune system, are being considered as alternatives to conventional antibiotics. These peptides display a range of activities, including not only direct antimicrobial activity, but also immunomodulation and wound repair. In the lung, airway epithelial cells and neutrophils in particular contribute to their synthesis. The relevance of antimicrobial peptides for host defense against infection has been demonstrated in animal models and is supported by observations in patient studies, showing altered expression and/or unfavorable circumstances for their action in a variety of lung diseases. Importantly, antimicrobial peptides are active against microorganisms that are resistant against conventional antibiotics, including multidrug-resistant bacteria. Several strategies have been proposed to use these peptides in the treatment of infections, including direct administration of antimicrobial peptides, enhancement of their local production, and creation of more favorable circumstances for their action. In this review, recent developments in antimicrobial peptides research in the lung and clinical applications for novel therapies of lung diseases are discussed.

  4. The Cooperative Behaviour of α-Helical Antimicrobial Peptides in Different Environments

    NASA Astrophysics Data System (ADS)

    Pinna, Marco; Wang, Janping; Mura, Manuela; Zhou, Yuhua; Zvelindovsky, Andrei; Dennison, Sarah; Phoenix, David

    2014-03-01

    A systematic analysis of the antimicrobial peptides (AMPs) cooperative action is performed by means of a full atomistic molecular dynamics simulation. The following peptide analogues: Aurein 2.5-COOH, Aurein 2.6-COOH and Aurein 3.1-COOH are investigated in different environments including aqueous solution, trifluoroethanol (TFE), palmitoyloleoylphosphatidylethanolamine (POPE), and palmitoyloleoylphosphatidylglycerol (POPG) lipid bilayers. Simulations conducted for monomer and trimer peptide highlight the importance of the cooperative behaviour and reveal the different mechanisms of antimicrobial peptides action in different lipid bilayers.

  5. Understanding bacterial resistance to antimicrobial peptides: From the surface to deep inside.

    PubMed

    Maria-Neto, Simone; de Almeida, Keyla Caroline; Macedo, Maria Ligia Rodrigues; Franco, Octávio Luiz

    2015-11-01

    Resistant bacterial infections are a major health problem in many parts of the world. The major commercial antibiotic classes often fail to combat common bacteria. Although antimicrobial peptides are able to control bacterial infections by interfering with microbial metabolism and physiological processes in several ways, a large number of cases of resistance to antibiotic peptide classes have also been reported. To gain a better understanding of the resistance process various technologies have been applied. Here we discuss multiple strategies by which bacteria could develop enhanced antimicrobial peptide resistance, focusing on sub-cellular regions from the surface to deep inside, evaluating bacterial membranes, cell walls and cytoplasmic metabolism. Moreover, some high-throughput methods for antimicrobial resistance detection and discrimination are also examined. This article is part of a Special Issue entitled: Bacterial Resistance to Antimicrobial Peptides.

  6. Centrocins: isolation and characterization of novel dimeric antimicrobial peptides from the green sea urchin, Strongylocentrotus droebachiensis.

    PubMed

    Li, Chun; Haug, Tor; Moe, Morten K; Styrvold, Olaf B; Stensvåg, Klara

    2010-09-01

    As immune effector molecules, antimicrobial peptides (AMPs) play an important role in the invertebrate immune system. Here, we present two novel AMPs, named centrocins 1 (4.5kDa) and 2 (4.4kDa), purified from coelomocyte extracts of the green sea urchin, Strongylocentrotus droebachiensis. The native peptides are cationic and show potent activities against Gram-positive and Gram-negative bacteria. The centrocins have an intramolecular heterodimeric structure, containing a heavy chain (30 amino acids) and a light chain (12 amino acids). The cDNA encoding the peptides and genomic sequences were cloned and sequenced. One putative isoform (centrocin 1b) was identified and one intron was found in the genes coding for the centrocins. The full length protein sequence of centrocin 1 consists of 119 amino acids, whereas centrocin 2 consists of 118 amino acids which both include a preprosequence of 51 or 50 amino acids for centrocins 1 and 2, respectively, and an interchain of 24 amino acids between the heavy and light chain. The difference of molecular mass between the native centrocins and the deduced sequences from cDNA indicates that the native centrocins contain a post-translational brominated tryptophan. In addition, two amino acids at the C-terminal, Gly-Arg, were removed from the light chains during the post-translational processing. The separate peptide chains of centrocin 1 were synthesized and the heavy chain alone was shown to be sufficient for antimicrobial activity. The genome of the closely related species, the purple sea urchin (S. purpuratus), was shown to contain two putative proteins with high similarity to the centrocins.

  7. A Novel Beta-Defensin Antimicrobial Peptide in Atlantic Cod with Stimulatory Effect on Phagocytic Activity

    PubMed Central

    Ruangsri, Jareeporn; Kitani, Yoichiro; Kiron, Viswanath; Lokesh, Jep; Brinchmann, Monica F.; Karlsen, Bård Ove; Fernandes, Jorge M. O.

    2013-01-01

    A novel defensin antimicrobial peptide gene was identified in Atlantic cod, Gadus morhua. This three exon/two intron defensin gene codes for a peptide precursor consisting of two domains: a signal peptide of 26 amino acids and a mature peptide of 40 residues. The mature cod defensin has six conserved cysteine residues that form 1–5, 2–4 and 3–6 disulphide bridges. This pattern is typical of beta-defensins and this gene was therefore named cod beta-defensin (defb). The tertiary structure of Defb exhibits an α/β fold with one α helix and β1β2β3 sheets. RT-PCR analysis indicated that defb transcripts were present mainly in the swim bladder and peritoneum wall but could also be detected at moderate to low levels in skin, head- and excretory kidneys. In situ hybridisation revealed that defb was specifically expressed by cells located in the swim bladder submucosa and the oocytes. During embryonic development, defb gene transcripts were detectable from the golden eye stage onwards and their expression was restricted to the swim bladder and retina. Defb was differentially expressed in several tissues following antigenic challenge with Vibrio anguillarum, being up-regulated up to 25-fold in head kidney. Recombinant Defb displayed antibacterial activity, with a minimal inhibitory concentration of 0.4–0.8 µM and 25–50 µM against the Gram-(+) bacteria Planococcus citreus and Micrococcus luteus, respectively. In addition, Defb stimulated phagocytic activity of cod head kidney leucocytes in vitro. These findings imply that beta-defensins may play an important role in the innate immune response of Atlantic cod. PMID:23638029

  8. A cumulative experience examining the effect of natural and synthetic antimicrobial peptides vs. Chlamydia trachomatis.

    PubMed

    Yasin, B; Pang, M; Wagar, E A

    2004-08-01

    We tested the activity of 48 structurally diverse antimicrobial peptides against Chlamydia trachomatis, serovar L2. The peptides' activity against C. trachomatis, serovar L2 was measured in 48-h McCoy cell shell vial assays. Peptides of 16-20 amino acids were more active than larger peptides, such as defensins. Beta-sheet protegrins, as well as alpha-helical peptides such as novispirin (G-10) were equally active. Enantiomers were as active as native structures. Moderate-sized circular mini-defensins were less effective against C. trachomatis. Moderate-sized cationic peptides may be useful in microbicide preparations designed to prevent chlamydial infection.

  9. Potent Inducers of Endogenous Antimicrobial Peptides for Host Directed Therapy of Infections

    NASA Astrophysics Data System (ADS)

    Ottosson, H.; Nylén, F.; Sarker, P.; Miraglia, E.; Bergman, P.; Gudmundsson, G. H.; Raqib, R.; Agerberth, B.; Strömberg, R.

    2016-11-01

    A new concept for treatment of infections is induction of our own antimicrobial peptides and the presented novel class of inducer, aroylated phenylenediamines (APDs), gives up to 20 to 30-fold induction of the human antimicrobial peptide LL-37, in vitro. In addition, oral administration of an APD in a rabbit model of Shigellosis resulted in recovery from the infection in a few days implying that APD’s are promising candidates for treatment of infections.

  10. Potent Inducers of Endogenous Antimicrobial Peptides for Host Directed Therapy of Infections

    PubMed Central

    Ottosson, H.; Nylén, F.; Sarker, P.; Miraglia, E.; Bergman, P.; Gudmundsson, G. H.; Raqib, R.; Agerberth, B.; Strömberg, R.

    2016-01-01

    A new concept for treatment of infections is induction of our own antimicrobial peptides and the presented novel class of inducer, aroylated phenylenediamines (APDs), gives up to 20 to 30-fold induction of the human antimicrobial peptide LL-37, in vitro. In addition, oral administration of an APD in a rabbit model of Shigellosis resulted in recovery from the infection in a few days implying that APD’s are promising candidates for treatment of infections. PMID:27827460

  11. Antimicrobial peptides from skin secretions of Chinese red belly toad Bombina maxima.

    PubMed

    Lai, Ren; Zheng, Yong Tang; Shen, Ji Hong; Liu, Guan Jie; Liu, Hen; Lee, Wen Hui; Tang, Shao Zhong; Zhang, Yun

    2002-03-01

    Two groups of antimicrobial peptides have been isolated from skin secretions of Bombina maxima. Peptides in the first group, named maximins 1, 2, 3, 4 and 5, are structurally related to bombinin-like peptides (BLPs). Unlike BLPs, sequence variations in maximins occurred all through the molecules. In addition to the potent antimicrobial activity, cytotoxicity against tumor cells and spermicidal action of maximins, maximin 3 possessed a significant anti-HIV activity. Maximins 1 and 3 were toxic to mice with LD(50) values of 8.2 and 4.3 mg/kg, respectively. Peptides in the second group, termed maximins H1, H2, H3 and H4, are homologous with bombinin H peptides. cDNA sequences revealed that one maximin peptide plus one maximin H peptide derived from a common larger protein.

  12. Euler buckling, membrane corrugation and pore formation induced by antimicrobial peptide

    NASA Astrophysics Data System (ADS)

    Golubovic, Leonardo; Gao, Lianghui; Chen, Licui; Jia, Nana; Fang, Weihai

    2014-03-01

    Antimicrobial peptides serve as defense weapons against bacteria. They are secreted by organisms of plants and animals and have a wide variety in composition and structure. In this study, we theoretically explore the effects of the antimicrobial peptides on the lipid bilayer membrane by using analytic arguments and the coarse grained dissipative particle dynamics simulations. We study peptide/lipid membrane complexes by considering peptides with various structure, hydrophobicity and peptide/lipid interaction strength. The role of lipid/water interaction is also discussed. We discuss a rich variety of membrane morphological changes induced by peptides, such as pore formation, membrane corrugation and Euler buckling. Such buckled membrane states have been indeed seen in a number of experiments with bacteria affected by peptide, yet this is the first theoretical study addressing these phenomena more deeply.

  13. Cathelicidin-related antimicrobial peptide modulates the severity of acute pancreatitis in mice

    PubMed Central

    DENG, YUAN-YUAN; SHAMOON, MUHAMMAD; HE, YUE; BHATIA, MADHAV; SUN, JIA

    2016-01-01

    The present study aimed to investigate the immunomodulatory effects of mouse cathelicidin-related antimicrobial peptide (CRAMP) on experimental acute pancreatitis (AP). AP is a common clinical condition characterized by acute abdominal inflammation. Innate immune cells and mediators are intrinsically linked to the pathogenesis of AP. Cathelicidins are innate immunity-derived antimicrobial peptides that exert immunomodulatory effects on various host cells. However, how cathelicidins are involved and modulate the severity and inflammatory responses of AP remains unclear. In the present study, the mouse CRAMP gene-deficient cnlp−/− mice and their wild-type C57BL/6J littermates were induced with AP by multiple hourly injections of supramaximal doses of caerulein. Serum amylase levels, pancreatic myeloperoxidase activity and histological examination were performed in order to determine the disease severity and the levels of inflammatory cytokines. Disease severity and inflammatory markers were subsequently evaluated in the control mice, cnlp−/− C57BL/6J mice with AP, and wild-type C57BL/6J mice with AP. The results demonstrated that cnlp−/− mice exhibited a more severe phenotype and inflammatory response following AP induction compared with the wild-type mice, as evidenced by increased serum amylase levels, pancreatic myeloperoxidase release, and early inflammatory mediator tumor necrosis factor-α production. Histological examination confirmed that CRAMP deficiency worsened the pancreatic inflammatory condition. These results indicate that CRAMP may be considered a novel modulatory mediator in mouse experimental AP. PMID:27035328

  14. Inducible Resistance of Fish Bacterial Pathogens to the Antimicrobial Peptide Cecropin B

    USDA-ARS?s Scientific Manuscript database

    Cecropin B is a cationic antimicrobial peptide originally isolated from the diapausing pupae of the giant silk moth, Hylphora cecropia. Cecropin B elicits its antimicrobial effects through disruption of the anionic cell membranes of gram-negative bacteria. Previous work by our laboratory demonstra...

  15. Antimicrobial proline-rich peptides from the hemolymph of marine snail Rapana venosa.

    PubMed

    Dolashka, Pavlina; Moshtanska, Vesela; Borisova, Valika; Dolashki, Aleksander; Stevanovic, Stefan; Dimanov, Tzvetan; Voelter, Wolfgang

    2011-07-01

    Hemolymph of Rapana venosa snails is a complex mixture of biochemically and pharmacologically active components such as peptides and proteins. Antimicrobial peptides are gaining attention as antimicrobial alternatives to chemical food preservatives and commonly used antibiotics. Therefore, for the first time we have explored the isolation, identification and characterisation of 11 novel antimicrobial peptides produced by the hemolymph of molluscs. The isolated peptides from the hemolymph applying ultrafiltration and reverse-phase high-performance liquid chromatography (RP-HPLC) have molecular weights between 3000 and 9500 Da, determined by mass spectrometric analysis. The N-terminal sequences of the peptides identified by Edman degradation matched no peptides in the MASCOT search database, indicating novel proline-rich peptides. UV spectra revealed that these substances possessed the characteristics of protein peptides with acidic isoelectric points. However, no Cotton effects were observed between 190 and 280 nm by circular dichroism spectroscopy. Four of the pro-rich peptides also showed strong antimicrobial activities against tested microorganisms including Gram-positive and Gram-negative bacteria.

  16. Amyloidogenic amyloid-β-peptide variants induce microbial agglutination and exert antimicrobial activity

    PubMed Central

    Spitzer, Philipp; Condic, Mateja; Herrmann, Martin; Oberstein, Timo Jan; Scharin-Mehlmann, Marina; Gilbert, Daniel F.; Friedrich, Oliver; Grömer, Teja; Kornhuber, Johannes; Lang, Roland; Maler, Juan Manuel

    2016-01-01

    Amyloid-β (Aβ) peptides are the main components of the plaques found in the brains of patients with Alzheimer’s disease. However, Aβ peptides are also detectable in secretory compartments and peripheral blood contains a complex mixture of more than 40 different modified and/or N- and C-terminally truncated Aβ peptides. Recently, anti-infective properties of Aβ peptides have been reported. Here, we investigated the interaction of Aβ peptides of different lengths with various bacterial strains and the yeast Candida albicans. The amyloidogenic peptides Aβ1-42, Aβ2-42, and Aβ3p-42 but not the non-amyloidogenic peptides Aβ1-40 and Aβ2-40 bound to microbial surfaces. As observed by immunocytochemistry, scanning electron microscopy and Gram staining, treatment of several bacterial strains and Candida albicans with Aβ peptide variants ending at position 42 (Aβx-42) caused the formation of large agglutinates. These aggregates were not detected after incubation with Aβx-40. Furthermore, Aβx-42 exerted an antimicrobial activity on all tested pathogens, killing up to 80% of microorganisms within 6 h. Aβ1-40 only had a moderate antimicrobial activity against C. albicans. Agglutination of Aβ1-42 was accelerated in the presence of microorganisms. These data demonstrate that the amyloidogenic Aβx-42 variants have antimicrobial activity and may therefore act as antimicrobial peptides in the immune system. PMID:27624303

  17. Synthesis and biological activity of lipophilic analogs of the cationic antimicrobial active peptide anoplin.

    PubMed

    Chionis, Kostas; Krikorian, Dimitrios; Koukkou, Anna-Irini; Sakarellos-Daitsiotis, Maria; Panou-Pomonis, Eugenia

    2016-11-01

    Anoplin is a short natural cationic antimicrobial peptide which is derived from the venom sac of the solitary wasp, Anoplius samariensis. Due to its short sequence G(1) LLKR(5) IKT(8) LL-NH2 , it is ideal for research tests. In this study, novel analogs of anoplin were prepared and examined for their antimicrobial, hemolytic activity, and proteolytic stability. Specific substitutions were introduced in amino acids Gly(1) , Arg(5) , and Thr(8) and lipophilic groups with different lengths in the N-terminus in order to investigate how these modifications affect their antimicrobial activity. These cationic analogs exhibited higher antimicrobial activity than the native peptide; they are also nontoxic at their minimum inhibitory concentration (MIC) values and resistant to enzymatic degradation. The substituted peptide GLLKF(5) IKK(8) LL-NH2 exhibited high activity against Gram-negative bacterium Zymomonas mobilis (MIC = 7 µg/ml), and the insertion of octanoic, decanoic, and dodecanoic acid residues in its N-terminus increased the antimicrobial activity against Gram-positive and Gram-negative bacteria (MIC = 5 µg/ml). The conformational characteristics of the peptide analogs were studied by circular dichroism. Structure activity studies revealed that the substitution of specific amino acids and the incorporation of lipophilic groups enhanced the amphipathic α-helical conformation inducing better antimicrobial effects. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd.

  18. Five novel antimicrobial peptides from skin secretions of the frog, Amolops loloensis.

    PubMed

    Wang, Meijuan; Wang, Ying; Wang, Aili; Song, Yuzhu; Ma, Dongying; Yang, Hailong; Ma, Yufang; Lai, Ren

    2010-01-01

    While investigating antimicrobial peptide diversity of Amolops loloensis, five novel antimicrobial peptides belonging to two families were identified from skin secretions of this frog. The first family including two members is esculentin-2-AL (esculentin-2-ALa and -ALb); the second family including three members is temporin-AL (temporin-ALd to -ALf). The family of esculentin-2-AL is composed of 37 amino acid residues (aa); the family of temporin-AL is composed of 16, 13 and 10 aa, respectively. All of these antimicrobial peptides showed antimicrobial activities against tested microorganisms. cDNAs encoding precursors of esculentin-2-ALs and temporin-ALs were cloned from the skin cDNA library of A. loloensis. All the precursors share similar overall structures. There is a typical prohormone processing signal (Lys-Arg) located between the acidic propiece and the mature peptide. The antimicrobial peptide family of esculentin-2 is firstly reported in the genus of Amolops. Combined with previous reports, a total of four antimicrobial peptide families have been identified from the genus of Amolops; three of them are also found in the genus of Rana. These results suggest the possible evolutionary connection between the genera Amolops and Rana.

  19. Self-assembly of cationic multidomain peptide hydrogels: supramolecular nanostructure and rheological properties dictate antimicrobial activity.

    PubMed

    Jiang, Linhai; Xu, Dawei; Sellati, Timothy J; Dong, He

    2015-12-07

    Hydrogels are an important class of biomaterials that have been widely utilized for a variety of biomedical/medical applications. The biological performance of hydrogels, particularly those used as wound dressing could be greatly advanced if imbued with inherent antimicrobial activity capable of staving off colonization of the wound site by opportunistic bacterial pathogens. Possessing such antimicrobial properties would also protect the hydrogel itself from being adversely affected by microbial attachment to its surface. We have previously demonstrated the broad-spectrum antimicrobial activity of supramolecular assemblies of cationic multi-domain peptides (MDPs) in solution. Here, we extend the 1-D soluble supramolecular assembly to 3-D hydrogels to investigate the effect of the supramolecular nanostructure and its rheological properties on the antimicrobial activity of self-assembled hydrogels. Among designed MDPs, the bactericidal activity of peptide hydrogels was found to follow an opposite trend to that in solution. Improved antimicrobial activity of self-assembled peptide hydrogels is dictated by the combined effect of supramolecular surface chemistry and storage modulus of the bulk materials, rather than the ability of individual peptides/peptide assemblies to penetrate bacterial cell membrane as observed in solution. The structure-property-activity relationship developed through this study will provide important guidelines for designing biocompatible peptide hydrogels with built-in antimicrobial activity for various biomedical applications.

  20. LEAP-1, a novel highly disulfide-bonded human peptide, exhibits antimicrobial activity.

    PubMed

    Krause, A; Neitz, S; Mägert, H J; Schulz, A; Forssmann, W G; Schulz-Knappe, P; Adermann, K

    2000-09-01

    We report the isolation and characterization of a novel human peptide with antimicrobial activity, termed LEAP-1 (liver-expressed antimicrobial peptide). Using a mass spectrometric assay detecting cysteine-rich peptides, a 25-residue peptide containing four disulfide bonds was identified in human blood ultrafiltrate. LEAP-1 expression was predominantly detected in the liver, and, to a much lower extent, in the heart. In radial diffusion assays, Gram-positive Bacillus megaterium, Bacillus subtilis, Micrococcus luteus, Staphylococcus carnosus, and Gram-negative Neisseria cinerea as well as the yeast Saccharomyces cerevisiae dose-dependently exhibited sensitivity upon treatment with synthetic LEAP-1. The discovery of LEAP-1 extends the known families of mammalian peptides with antimicrobial activity by its novel disulfide motif and distinct expression pattern.

  1. Mechanisms and consequences of bacterial resistance to antimicrobial peptides.

    PubMed

    Andersson, D I; Hughes, D; Kubicek-Sutherland, J Z

    2016-05-01

    Cationic antimicrobial peptides (AMPs) are an intrinsic part of the human innate immune system. Over 100 different human AMPs are known to exhibit broad-spectrum antibacterial activity. Because of the increased frequency of resistance to conventional antibiotics there is an interest in developing AMPs as an alternative antibacterial therapy. Several cationic peptides that are derivatives of AMPs from the human innate immune system are currently in clinical development. There are also ongoing clinical studies aimed at modulating the expression of AMPs to boost the human innate immune response. In this review we discuss the potential problems associated with these therapeutic approaches. There is considerable experimental data describing mechanisms by which bacteria can develop resistance to AMPs. As for any type of drug resistance, the rate by which AMP resistance would emerge and spread in a population of bacteria in a natural setting will be determined by a complex interplay of several different factors, including the mutation supply rate, the fitness of the resistant mutant at different AMP concentrations, and the strength of the selective pressure. Several studies have already shown that AMP-resistant bacterial mutants display broad cross-resistance to a variety of AMPs with different structures and modes of action. Therefore, routine clinical administration of AMPs to treat bacterial infections may select for resistant bacterial pathogens capable of better evading the innate immune system. The ramifications of therapeutic levels of exposure on the development of AMP resistance and bacterial pathogenesis are not yet understood. This is something that needs to be carefully studied and monitored if AMPs are used in clinical settings.

  2. Relative free energy of binding between antimicrobial peptides and SDS or DPC micelles

    PubMed Central

    Sayyed-Ahmad, Abdallah; Khandelia, Himanshu; Kaznessis, Yiannis N.

    2010-01-01

    We present relative binding free energy calculations for six antimicrobial peptide–micelle systems, three peptides interacting with two types of micelles. The peptides are the scorpion derived antimicrobial peptide (AMP), IsCT and two of its analogues. The micelles are dodecylphosphatidylcholine (DPC) and sodium dodecylsulphate (SDS) micelles. The interfacial electrostatic properties of DPC and SDS micelles are assumed to be similar to those of zwitterionic mammalian and anionic bacterial membrane interfaces, respectively. We test the hypothesis that the binding strength between peptides and the anionic micelle SDS can provide information on peptide antimicrobial activity, since it is widely accepted that AMPs function by binding to and disrupting the predominantly anionic lipid bilayer of the bacterial cytoplasmic membrane. We also test the hypothesis that the binding strength between peptides and the zwitterionic micelle DPC can provide information on peptide haemolytic activities, since it is accepted that they also bind to and disrupt the zwitterionic membrane of mammalian cells. Equilibrium structures of the peptides, micelles and peptide–micelle complexes are obtained from more than 300 ns of molecular dynamics simulations. A thermodynamic cycle is introduced to compute the binding free energy from electrostatic, non-electrostatic and entropic contributions. We find relative binding free energy strengths between peptides and SDS to correlate with the experimentally measured rankings for peptide antimicrobial activities, and relative free energy binding strengths between peptides and DPC to correlate with the observed rankings for peptide haemolytic toxicities. These findings point to the importance of peptide–membrane binding strength for antimicrobial activity and haemolytic activity. PMID:21113423

  3. Synergistic effects of antimicrobial peptide DP7 combined with antibiotics against multidrug-resistant bacteria.

    PubMed

    Wu, Xiaozhe; Li, Zhan; Li, Xiaolu; Tian, Yaomei; Fan, Yingzi; Yu, Chaoheng; Zhou, Bailing; Liu, Yi; Xiang, Rong; Yang, Li

    2017-01-01

    Antibiotic-resistant bacteria present a great threat to public health. In this study, the synergistic effects of antimicrobial peptides (AMPs) and antibiotics on several multidrug-resistant bacterial strains were studied, and their synergistic effects on azithromycin (AZT)-resistance genes were analyzed to determine the relationships between antimicrobial resistance and these synergistic effects. A checkerboard method was used to evaluate the synergistic effects of AMPs (DP7 and CLS001) and several antibiotics (gentamicin, vancomycin [VAN], AZT, and amoxicillin) on clinical bacterial strains (Staphylococcus aureus, Pseudomonas aeruginosa, Acinetobacter baumannii, and Escherichia coli). The AZT-resistance genes (ermA, ermB, ermC, mefA, and msrA) were identified in the resistant strains using quantitative polymerase chain reaction. For all the clinical isolates tested that were resistant to different antibiotics, DP7 had high antimicrobial activity (≤32 mg/L). When DP7 was combined with VAN or AZT, the effect was most frequently synergistic. When we studied the resistance genes of the AZT-resistant isolates, the synergistic effect of DP7-AZT occurred most frequently in highly resistant strains or strains carrying more than two AZT-resistance genes. A transmission electron microscopic analysis of the S. aureus strain synergistically affected by DP7-AZT showed no noteworthy morphological changes, suggesting that a molecular-level mechanism plays an important role in the synergistic action of DP7-AZT. AMP DP7 plus the antibiotic AZT or VAN is more effective, especially against highly antibiotic-resistant strains.

  4. Histone deacetylase inhibition enhances antimicrobial peptide but not inflammatory cytokine expression upon bacterial challenge

    PubMed Central

    Fischer, Natalie; Sechet, Emmanuel; Friedman, Robin; Amiot, Aurélien; Sobhani, Iradj; Nigro, Giulia; Sansonetti, Philippe J.; Sperandio, Brice

    2016-01-01

    Antimicrobial peptides (AMP) are defense effectors of the innate immunity playing a crucial role in the intestinal homeostasis with commensals and protection against pathogens. Herein we aimed to investigate AMP gene regulation by deciphering specific characteristics allowing their enhanced expression among innate immune genes, particularly those encoding proinflammatory mediators. Our emphasis was on epigenetic regulation of the gene encoding the AMP β-defensin 2 (HBD2), taken as a model of possibly specific induction, upon challenge with a commensal bacterium, compared with the proinflammatory cytokine IL-8. Using an in vitro model of colonic epithelial cells challenged with Escherichia coli K12, we showed that inhibition of histone deacetylases (HDAC) by trichostatin A dramatically enhanced induction of HBD2 expression, without affecting expression of IL-8. This mechanism was supported by an increased phosphorylation of histone H3 on serine S10, preferentially at the HBD2 promoter. This process occurred through activation of the IκB kinase complex, which also led to activation of NF-κB. Moreover, we demonstrated that NF-κB was modified by acetylation upon HDAC inhibition, partly by the histone acetyltransferase p300, and that both NF-κB and p300 supported enhanced induction of HBD2 expression. Furthermore, we identified additional genes belonging to antimicrobial defense and epithelial restitution pathways that showed a similar pattern of epigenetic control. Finally, we confirmed our finding in human colonic primary cells using an ex vivo organoid model. This work opens the way to use epigenetic pharmacology to achieve induction of epithelial antimicrobial defenses, while limiting the deleterious risk of an inflammatory response. PMID:27162363

  5. Synergistic effects of antimicrobial peptide DP7 combined with antibiotics against multidrug-resistant bacteria

    PubMed Central

    Wu, Xiaozhe; Li, Zhan; Li, Xiaolu; Tian, Yaomei; Fan, Yingzi; Yu, Chaoheng; Zhou, Bailing; Liu, Yi; Xiang, Rong; Yang, Li

    2017-01-01

    Antibiotic-resistant bacteria present a great threat to public health. In this study, the synergistic effects of antimicrobial peptides (AMPs) and antibiotics on several multidrug-resistant bacterial strains were studied, and their synergistic effects on azithromycin (AZT)-resistance genes were analyzed to determine the relationships between antimicrobial resistance and these synergistic effects. A checkerboard method was used to evaluate the synergistic effects of AMPs (DP7 and CLS001) and several antibiotics (gentamicin, vancomycin [VAN], AZT, and amoxicillin) on clinical bacterial strains (Staphylococcus aureus, Pseudomonas aeruginosa, Acinetobacter baumannii, and Escherichia coli). The AZT-resistance genes (ermA, ermB, ermC, mefA, and msrA) were identified in the resistant strains using quantitative polymerase chain reaction. For all the clinical isolates tested that were resistant to different antibiotics, DP7 had high antimicrobial activity (≤32 mg/L). When DP7 was combined with VAN or AZT, the effect was most frequently synergistic. When we studied the resistance genes of the AZT-resistant isolates, the synergistic effect of DP7–AZT occurred most frequently in highly resistant strains or strains carrying more than two AZT-resistance genes. A transmission electron microscopic analysis of the S. aureus strain synergistically affected by DP7–AZT showed no noteworthy morphological changes, suggesting that a molecular-level mechanism plays an important role in the synergistic action of DP7–AZT. AMP DP7 plus the antibiotic AZT or VAN is more effective, especially against highly antibiotic-resistant strains. PMID:28356719

  6. Proline-rich antimicrobial peptides: potential therapeutics against antibiotic-resistant bacteria.

    PubMed

    Li, Wenyi; Tailhades, Julien; O'Brien-Simpson, Neil M; Separovic, Frances; Otvos, Laszlo; Hossain, M Akhter; Wade, John D

    2014-10-01

    The increasing resistance of pathogens to antibiotics causes a huge clinical burden that places great demands on academic researchers and the pharmaceutical industry for resolution. Antimicrobial peptides, part of native host defense, have emerged as novel potential antibiotic alternatives. Among the different classes of antimicrobial peptides, proline-rich antimicrobial peptides, predominantly sourced from insects, have been extensively investigated to study their specific modes of action. In this review, we focus on recent developments in these peptides. They show a variety of modes of actions, including mechanism shift at high concentration, non-lytic mechanisms, as well as possessing different intracellular targets and lipopolysaccharide binding activity. Furthermore, proline-rich antimicrobial peptides display the ability to not only modulate the immune system via cytokine activity or angiogenesis but also possess properties of penetrating cell membranes and crossing the blood brain barrier suggesting a role as potential novel carriers. Ongoing studies of these peptides will likely lead to the development of more potent antimicrobial peptides that may serve as important additions to the armoury of agents against bacterial infection and drug delivery.

  7. Simultaneous Antibiofilm and Antiviral Activities of an Engineered Antimicrobial Peptide during Virus-Bacterium Coinfection

    PubMed Central

    Melvin, Jeffrey A.; Lashua, Lauren P.; Kiedrowski, Megan R.; Yang, Guanyi; Deslouches, Berthony; Montelaro, Ronald C.

    2016-01-01

    ABSTRACT Antimicrobial-resistant infections are an urgent public health threat, and development of novel antimicrobial therapies has been painstakingly slow. Polymicrobial infections are increasingly recognized as a significant source of severe disease and also contribute to reduced susceptibility to antimicrobials. Chronic infections also are characterized by their ability to resist clearance, which is commonly linked to the development of biofilms that are notorious for antimicrobial resistance. The use of engineered cationic antimicrobial peptides (eCAPs) is attractive due to the slow development of resistance to these fast-acting antimicrobials and their ability to kill multidrug-resistant clinical isolates, key elements for the success of novel antimicrobial agents. Here, we tested the ability of an eCAP, WLBU2, to disrupt recalcitrant Pseudomonas aeruginosa biofilms. WLBU2 was capable of significantly reducing biomass and viability of P. aeruginosa biofilms formed on airway epithelium and maintained activity during viral coinfection, a condition that confers extraordinary levels of antibiotic resistance. Biofilm disruption was achieved in short treatment times by permeabilization of bacterial membranes. Additionally, we observed simultaneous reduction of infectivity of the viral pathogen respiratory syncytial virus (RSV). WLBU2 is notable for its ability to maintain activity across a broad range of physiological conditions and showed negligible toxicity toward the airway epithelium, expanding its potential applications as an antimicrobial therapeutic. IMPORTANCE Antimicrobial-resistant infections are an urgent public health threat, making development of novel antimicrobials able to effectively treat these infections extremely important. Chronic and polymicrobial infections further complicate antimicrobial therapy, often through the development of microbial biofilms. Here, we describe the ability of an engineered antimicrobial peptide to disrupt biofilms

  8. Role of amphipathicity and hydrophobicity in the balance between hemolysis and peptide-membrane interactions of three related antimicrobial peptides.

    PubMed

    Hollmann, Axel; Martínez, Melina; Noguera, Martín E; Augusto, Marcelo T; Disalvo, Anibal; Santos, Nuno C; Semorile, Liliana; Maffía, Paulo C

    2016-05-01

    Cationic antimicrobial peptides (CAMPs) represent important self defense molecules in many organisms, including humans. These peptides have a broad spectrum of activities, killing or neutralizing many Gram-negative and Gram-positive bacteria. The emergence of multidrug resistant microbes has stimulated research on the development of alternative antibiotics. In the search for new antibiotics, cationic antimicrobial peptides (CAMPs) offer a viable alternative to conventional antibiotics, as they physically disrupt the bacterial membranes, leading to lysis of microbial membranes and eventually cell death. In particular, the group of linear α-helical cationic peptides has attracted increasing interest from clinical as well as basic research during the last decade. In this work, we studied the biophysical and microbiological characteristics of three new designed CAMPs. We modified a previously studied CAMP sequence, in order to increase or diminish the hydrophobic face, changing the position of two lysines or replacing three leucines, respectively. These mutations modified the hydrophobic moment of the resulting peptides and allowed us to study the importance of this parameter in the membrane interactions of the peptides. The structural properties of the peptides were also correlated with their membrane-disruptive abilities, antimicrobial activities and hemolysis of human red blood cells.

  9. Differential expression of antimicrobial peptides in margins of chronic wounds.

    PubMed

    Dressel, Stefanie; Harder, Jürgen; Cordes, Jesko; Wittersheim, Maike; Meyer-Hoffert, Ulf; Sunderkötter, Cord; Gläser, Regine

    2010-07-01

    Skin wounds usually heal without major infections, although the loss of the mechanical epithelial barrier exposes the tissue to various bacteria. One reason may be the expression of antimicrobial peptides (AMP) of which some [human beta-defensins (hBD) and LL-37] were recently shown to support additionally certain steps of wound healing. There are no studies which have compared expression patterns of different classes of AMP in chronic wounds. The aim of our study was therefore to analyse the expression profile of hBD-2, hBD-3, LL-37, psoriasin and RNase 7 by immunohistochemistry from defined wound margins of chronic venous ulcers. We detected a strong induction of psoriasin and hBD-2 in chronic wounds in comparison with healthy skin. Except for stratum corneum, no expression of RNase 7 and LL-37 was detected in the epidermis while expression of hBD-3 was heterogeneous. Bacterial swabs identified Staphylococcus aureus and additional bacterial populations, but no association between colonization and AMP expression was found. The differential expression of AMP is noteworthy considering the high bacterial load of chronic ulcers. Clinically, supplementation of AMP with the capability to enhance wound healing besides restricting bacterial overgrowth could present a physiological support for treatment of disturbed wound healing.

  10. Reactive Oxygen Species, Apoptosis, Antimicrobial Peptides and Human Inflammatory Diseases

    PubMed Central

    Oyinloye, Babatunji Emmanuel; Adenowo, Abiola Fatimah; Kappo, Abidemi Paul

    2015-01-01

    Excessive free radical generation, especially reactive oxygen species (ROS) leading to oxidative stress in the biological system, has been implicated in the pathogenesis and pathological conditions associated with diverse human inflammatory diseases (HIDs). Although inflammation which is considered advantageous is a defensive mechanism in response to xenobiotics and foreign pathogen; as a result of cellular damage arising from oxidative stress, if uncontrolled, it may degenerate to chronic inflammation when the ROS levels exceed the antioxidant capacity. Therefore, in the normal resolution of inflammatory reactions, apoptosis is acknowledged to play a crucial role, while on the other hand, dysregulation in the induction of apoptosis by enhanced ROS production could also result in excessive apoptosis identified in the pathogenesis of HIDs. Apparently, a careful balance must be maintained in this complex environment. Antimicrobial peptides (AMPs) have been proposed in this review as an excellent candidate capable of playing prominent roles in maintaining this balance. Consequently, in novel drug design for the treatment and management of HIDs, AMPs are promising candidates owing to their size and multidimensional properties as well as their wide spectrum of activities and indications of reduced rate of resistance. PMID:25850012

  11. Antimicrobial peptides and gut microbiota in homeostasis and pathology

    PubMed Central

    Ostaff, Maureen J; Stange, Eduard Friedrich; Wehkamp, Jan

    2013-01-01

    We survive because we adapted to a world of microorganisms. All our epithelial surfaces participate in keeping up an effective barrier against microbes while not initiating ongoing inflammatory processes and risking collateral damage to the host. Major players in this scenario are antimicrobial peptides (AMPs). Such broad-spectrum innate antibiotics are in part produced by specialized cells but also widely sourced from all epithelia as well as circulating inflammatory cells. AMPs belong to an ancient defense system found in all organisms and participated in a preservative co-evolution with a complex microbiome. Particularly interesting interactions between host barrier and microbiota can be found in the gut. The intestinal cell lining not only has to maintain a tightly regulated homeostasis during its high-throughput regeneration, but also a balanced relationship towards an extreme number of mutualistic or commensal inhabitants. Recent research suggests that advancing our understanding of the circumstances of such balanced and sometimes imbalanced interactions between gut microbiota and host AMPs should have therapeutic implications for different intestinal disorders. PMID:24039130

  12. Potential Use of Antimicrobial Peptides as Vaginal Spermicides/Microbicides

    PubMed Central

    Tanphaichitr, Nongnuj; Srakaew, Nopparat; Alonzi, Rhea; Kiattiburut, Wongsakorn; Kongmanas, Kessiri; Zhi, Ruina; Li, Weihua; Baker, Mark; Wang, Guanshun; Hickling, Duane

    2016-01-01

    The concurrent increases in global population and sexually transmitted infection (STI) demand a search for agents with dual spermicidal and microbicidal properties for topical vaginal application. Previous attempts to develop the surfactant spermicide, nonoxynol-9 (N-9), into a vaginal microbicide were unsuccessful largely due to its inefficiency to kill microbes. Furthermore, N-9 causes damage to the vaginal epithelium, thus accelerating microbes to enter the women’s body. For this reason, antimicrobial peptides (AMPs), naturally secreted by all forms of life as part of innate immunity, deserve evaluation for their potential spermicidal effects. To date, twelve spermicidal AMPs have been described including LL-37, magainin 2 and nisin A. Human cathelicidin LL-37 is the most promising spermicidal AMP to be further developed for vaginal use for the following reasons. First, it is a human AMP naturally produced in the vagina after intercourse. Second, LL-37 exerts microbicidal effects to numerous microbes including those that cause STI. Third, its cytotoxicity is selective to sperm and not to the female reproductive tract. Furthermore, the spermicidal effects of LL-37 have been demonstrated in vivo in mice. Therefore, the availability of LL-37 as a vaginal spermicide/microbicide will empower women for self-protection against unwanted pregnancies and STI. PMID:26978373

  13. Potential Use of Antimicrobial Peptides as Vaginal Spermicides/Microbicides.

    PubMed

    Tanphaichitr, Nongnuj; Srakaew, Nopparat; Alonzi, Rhea; Kiattiburut, Wongsakorn; Kongmanas, Kessiri; Zhi, Ruina; Li, Weihua; Baker, Mark; Wang, Guanshun; Hickling, Duane

    2016-03-11

    The concurrent increases in global population and sexually transmitted infection (STI) demand a search for agents with dual spermicidal and microbicidal properties for topical vaginal application. Previous attempts to develop the surfactant spermicide, nonoxynol-9 (N-9), into a vaginal microbicide were unsuccessful largely due to its inefficiency to kill microbes. Furthermore, N-9 causes damage to the vaginal epithelium, thus accelerating microbes to enter the women's body. For this reason, antimicrobial peptides (AMPs), naturally secreted by all forms of life as part of innate immunity, deserve evaluation for their potential spermicidal effects. To date, twelve spermicidal AMPs have been described including LL-37, magainin 2 and nisin A. Human cathelicidin LL-37 is the most promising spermicidal AMP to be further developed for vaginal use for the following reasons. First, it is a human AMP naturally produced in the vagina after intercourse. Second, LL-37 exerts microbicidal effects to numerous microbes including those that cause STI. Third, its cytotoxicity is selective to sperm and not to the female reproductive tract. Furthermore, the spermicidal effects of LL-37 have been demonstrated in vivo in mice. Therefore, the availability of LL-37 as a vaginal spermicide/microbicide will empower women for self-protection against unwanted pregnancies and STI.

  14. Msb2 Shedding Protects Candida albicans against Antimicrobial Peptides

    PubMed Central

    Szafranski-Schneider, Eva; Swidergall, Marc; Cottier, Fabien; Tielker, Denis; Román, Elvira; Pla, Jesus; Ernst, Joachim F.

    2012-01-01

    Msb2 is a sensor protein in the plasma membrane of fungi. In the human fungal pathogen C. albicans Msb2 signals via the Cek1 MAP kinase pathway to maintain cell wall integrity and allow filamentous growth. Msb2 doubly epitope-tagged in its large extracellular and small cytoplasmic domain was efficiently cleaved during liquid and surface growth and the extracellular domain was almost quantitatively released into the growth medium. Msb2 cleavage was independent of proteases Sap9, Sap10 and Kex2. Secreted Msb2 was highly O-glycosylated by protein mannosyltransferases including Pmt1 resulting in an apparent molecular mass of >400 kDa. Deletion analyses revealed that the transmembrane region is required for Msb2 function, while the large N-terminal and the small cytoplasmic region function to downregulate Msb2 signaling or, respectively, allow its induction by tunicamycin. Purified extracellular Msb2 domain protected fungal and bacterial cells effectively from antimicrobial peptides (AMPs) histatin-5 and LL-37. AMP inactivation was not due to degradation but depended on the quantity and length of the Msb2 glycofragment. C. albicans msb2 mutants were supersensitive to LL-37 but not histatin-5, suggesting that secreted rather than cell-associated Msb2 determines AMP protection. Thus, in addition to its sensor function Msb2 has a second activity because shedding of its glycofragment generates AMP quorum resistance. PMID:22319443

  15. Role of Antimicrobial Peptides in Amphibian Defense Against Trematode Infection

    PubMed Central

    Calhoun, Dana M.; Woodhams, Doug; Howard, Cierra; LaFonte, Bryan E.; Gregory, Jacklyn R.; Johnson, Pieter T. J.

    2016-01-01

    Antimicrobial peptides (AMPs) contribute to the immune defenses of many vertebrates, including amphibians. As larvae, amphibians are often exposed to the infectious stages of trematode parasites, many of which must penetrate the host’s skin, potentially interacting with host AMPs. We tested the effects of the natural AMPs repertoires on both the survival of trematode infectious stages as well as their ability to infect larval amphibians. All five trematode species exhibited decreased survival of cercariae in response to higher concentrations of adult bullfrog AMPs, but no effect when exposed to AMPs from larval bullfrogs. Similarly, the use of norepinephrine to remove AMPs from larval bullfrogs, Pacific chorus frogs, and gray treefrogs had only weak (gray treefrogs) or non-significant (other tested species) effects on infection success by Ribeiroia ondatrae. We nonetheless observed strong differences in parasite infection as a function of both host stage (first- versus second-year bullfrogs) and host species (Pacific chorus frogs versus gray treefrogs) that were apparently unrelated to AMPs. Taken together, our results suggest that AMPs do not play a significant role in defending larval amphibians against trematode cercariae, but that they could be one mechanism helping to prevent infection of post-metamorphic amphibians, particularly for highly aquatic species. PMID:26911920

  16. High Specific Selectivity and Membrane-Active Mechanism of Synthetic Cationic Hybrid Antimicrobial Peptides Based on the Peptide FV7

    PubMed Central

    Tan, Tingting; Wu, Di; Li, Weizhong; Zheng, Xin; Li, Weifen; Shan, Anshan

    2017-01-01

    Hybrid peptides integrating different functional domains of peptides have many advantages, such as remarkable antimicrobial activity, lower hemolysis and ideal cell selectivity, compared with natural antimicrobial peptides. FV7 (FRIRVRV-NH2), a consensus amphiphilic sequence was identified as being analogous to host defense peptides. In this study, we designed a series of hybrid peptides FV7-LL-37 (17–29) (FV-LL), FV7-magainin 2 (9–21) (FV-MA) and FV7-cecropin A (1–8) (FV-CE) by combining the FV7 sequence with the small functional sequences LL-37 (17–29) (LL), magainin 2 (9–21) (MA) and cecropin A (1–8) (CE) which all come from well-described natural peptides. The results demonstrated that the synthetic hybrid peptides, in particular FV-LL, had potent antibacterial activities over a wide range of Gram-negative and Gram-positive bacteria with lower hemolytic activity than other peptides. Furthermore, fluorescent spectroscopy indicated that the hybrid peptide FV-LL exhibited marked membrane destruction by inducing outer and inner bacterial membrane permeabilization, while scanning electron microscopy (SEM) and transmission electron microscopy (TEM) demonstrated that FV-LL damaged membrane integrity by disrupting the bacterial membrane. Inhibiting biofilm formation assays also showed that FV-LL had similar anti-biofilm activity compared with the functional peptide sequence FV7. Synthetic cationic hybrid peptides based on FV7 could provide new models for combining different functional domains and demonstrate effective avenues to screen for novel antimicrobial agents. PMID:28178190

  17. High Specific Selectivity and Membrane-Active Mechanism of Synthetic Cationic Hybrid Antimicrobial Peptides Based on the Peptide FV7.

    PubMed

    Tan, Tingting; Wu, Di; Li, Weizhong; Zheng, Xin; Li, Weifen; Shan, Anshan

    2017-02-06

    Hybrid peptides integrating different functional domains of peptides have many advantages, such as remarkable antimicrobial activity, lower hemolysis and ideal cell selectivity, compared with natural antimicrobial peptides. FV7 (FRIRVRV-NH₂), a consensus amphiphilic sequence was identified as being analogous to host defense peptides. In this study, we designed a series of hybrid peptides FV7-LL-37 (17-29) (FV-LL), FV7-magainin 2 (9-21) (FV-MA) and FV7-cecropin A (1-8) (FV-CE) by combining the FV7 sequence with the small functional sequences LL-37 (17-29) (LL), magainin 2 (9-21) (MA) and cecropin A (1-8) (CE) which all come from well-described natural peptides. The results demonstrated that the synthetic hybrid peptides, in particular FV-LL, had potent antibacterial activities over a wide range of Gram-negative and Gram-positive bacteria with lower hemolytic activity than other peptides. Furthermore, fluorescent spectroscopy indicated that the hybrid peptide FV-LL exhibited marked membrane destruction by inducing outer and inner bacterial membrane permeabilization, while scanning electron microscopy (SEM) and transmission electron microscopy (TEM) demonstrated that FV-LL damaged membrane integrity by disrupting the bacterial membrane. Inhibiting biofilm formation assays also showed that FV-LL had similar anti-biofilm activity compared with the functional peptide sequence FV7. Synthetic cationic hybrid peptides based on FV7 could provide new models for combining different functional domains and demonstrate effective avenues to screen for novel antimicrobial agents.

  18. A novel antifungal peptide designed from the primary structure of a natural antimicrobial peptide purified from Argopecten purpuratus hemocytes.

    PubMed

    Arenas, Gloria; Guzmán, Fanny; Cárdenas, Constanza; Mercado, Luis; Marshall, Sergio H

    2009-08-01

    We have isolated and purified a natural antimicrobial peptide from Argopecten purpuratus hemocytes. 47 residues were determined from its primary structure representing the N-terminal of the complete sequence. This peptide of 5100.78Da was chemically synthesized and named Ap. The peptide has 25% of hydrophobic amino acids with a net charge of +1, and partial homology with known active antimicrobial peptides. Based on that sequence, a new peptide was designed and modeled to increase hydrophobicity and cationicity. The designed 30-residue peptide was chemically synthesized resulting in a novel 38% hydrophobic molecule named peptide Ap-S, with a net charge of +5 and 3028Da. A secondary structure was shown by circular dichroism, thus exposing a hydrophobic epitope toward the N-terminus and a hydrophilic one toward the C-terminus, improving amphipathicity. Ap-S was much more active than the parental Ap. Ap-S up to 100microM has no cytotoxic effect against fish cell line CHSE-214. We demonstrated that the chemical modification of a natural peptide and the chemical synthesis of derived molecules may be a powerful tool for obtaining substitutes to conventional antibiotics, displaying the many advantages of antimicrobial peptides and overcoming the limitations of natural peptides for large-scale production and application, such as the low specific activity and the minute amounts recovered in vivo. This peptide may have a relevant application in aquaculture by controlling Saprolegna sp., a parasitic pathogen fungus that attacks the culture of fish in different stages of their growth, from egg to adult.

  19. Influence of the Length and Charge on the Activity of α-Helical Amphipathic Antimicrobial Peptides.

    PubMed

    Gagnon, Marie-Claude; Strandberg, Erik; Grau-Campistany, Ariadna; Wadhwani, Parvesh; Reichert, Johannes; Bürck, Jochen; Rabanal, Francesc; Auger, Michèle; Paquin, Jean-François; Ulrich, Anne S

    2017-03-21

    Hydrophobic mismatch is important for pore-forming amphipathic antimicrobial peptides, as demonstrated recently [Grau-Campistany, A., et al. (2015) Sci. Rep. 5, 9388]. A series of different length peptides have been generated with the heptameric repeat sequence KIAGKIA, called KIA peptides, and it was found that only those helices sufficiently long to span the hydrophobic thickness of the membrane could induce leakage in lipid vesicles; there was also a clear length dependence of the antimicrobial and hemolytic activities. For the original KIA sequences, the cationic charge increased with peptide length. The goal of this work is to examine whether the charge also has an effect on activity; hence, we constructed two further series of peptides with a sequence similar to those of the KIA peptides, but with a constant charge of +7 for all lengths from 14 to 28 amino acids. For both of these new series, a clear length dependence similar to that of KIA peptides was observed, indicating that charge has only a minor influence. Both series also showed a distinct threshold length for peptides to be active, which correlates directly with the thickness of the membrane. Among the longer peptides, the new series showed activities only slightly lower than those of the original KIA peptides of the same length that had a higher charge. Shorter peptides, in which Gly was replaced with Lys, showed activities similar to those of KIA peptides of the same length, but peptides in which Ile was replaced with Lys lost their helicity and were less active.

  20. Toward Infection-Resistant Surfaces: Achieving High Antimicrobial Peptide Potency by Modulating the Functionality of Polymer Brush and Peptide.

    PubMed

    Yu, Kai; Lo, Joey C Y; Mei, Yan; Haney, Evan F; Siren, Erika; Kalathottukaren, Manu Thomas; Hancock, Robert E W; Lange, Dirk; Kizhakkedathu, Jayachandran N

    2015-12-30

    Bacterial infection associated with indwelling medical devices and implants is a major clinical issue, and the prevention or treatment of such infections is challenging. Antimicrobial coatings offer a significant step toward addressing this important clinical problem. Antimicrobial coatings based on tethered antimicrobial peptides (AMPs) on hydrophilic polymer brushes have been shown to be one of the most promising strategies to avoid bacterial colonization and have demonstrated broad spectrum activity. Optimal combinations of the functionality of the polymer-brush-tethered AMPs are essential to maintaining long-term AMP activity on the surface. However, there is limited knowledge currently available on this topic. Here we report the development of potent antimicrobial coatings on implant surfaces by elucidating the roles of polymer brush chemistry and peptide structure on the overall antimicrobial activity of the coatings. We screened several combinations of polymer brush coatings and AMPs constructed on nanoparticles, titanium surfaces, and quartz slides on their antimicrobial activity and bacterial adhesion against Gram-positive and Gram-negative bacteria. Highly efficient killing of planktonic bacteria by the antimicrobial coatings on nanoparticle surfaces, as well as potent killing of adhered bacteria in the case of coatings on titanium surfaces, was observed. Remarkably, the antimicrobial activity of AMP-conjugated brush coatings demonstrated a clear dependence on the polymer brush chemistry and peptide structure, and optimization of these parameters is critical to achieving infection-resistant surfaces. By analyzing the interaction of polymer-brush-tethered AMPs with model lipid membranes using circular dichroism spectroscopy, we determined that the polymer brush chemistry has an influence on the extent of secondary structure change of tethered peptides before and after interaction with biomembranes. The peptide structure also has an influence on the density

  1. A consistent nomenclature of antimicrobial peptides isolated from frogs of the subfamily Phyllomedusinae.

    PubMed

    Amiche, Mohamed; Ladram, Ali; Nicolas, Pierre

    2008-11-01

    A growing number of cationic antimicrobial peptides have been isolated from the skin of hylid frogs belonging to the Phyllomedusinae subfamily. The amino acid sequences of these peptides are currently located in several databases under identifiers with no consistent system of nomenclature to describe them. In order to provide a workable terminology for antimicrobial peptides from Phyllomedusid frogs, we have made a systematic effort to collect, analyze, and classify all the Phyllomedusid peptide sequences available in databases. We propose that frogs belonging to the Phyllomedusinae subfamily should be described by the species names set out in Amphibian Species of the World: http://research.amnh.org/herpetology/amphibia/index.php, American Museum of Natural History, New York, USA. Multiple alignments analysis of at least 80 antimicrobial peptides isolated from 12 Phyllomedusinae species were distributed in seven distinct peptide families including dermaseptin, phylloseptin, plasticin, dermatoxin, phylloxin, hyposin and orphan peptides, and will be considered as the name of the headgroup of each family. The parent peptide's name should be followed by the first upper letter of the species for orthologous peptides and publication date determines priority. For example, the abbreviation B for bicolor and H for hypochondrialis. When two species begin with the same letter, two letters in upper case should be used (the first letter followed by the second or the third letter and so on). For example, the abbreviation DI for distincta, DU for duellmani, VA for vaillanti and VN for vanzolinii. Paralogous peptides should bear letter(s) in upper case followed by numbers.

  2. Biosynthesis of the Polycyclic Antimicrobial Peptides Lacticin 481, Haloduracin, and Cinnamycin

    ERIC Educational Resources Information Center

    Cooper, Lisa E.

    2009-01-01

    Lantibiotics are bacterial-derived polycyclic antimicrobial peptides. They are genetically encoded and ribosomally synthesized as precursor peptides containing a structural region that undergoes post-translational modification and a leader sequence that is not modified. Specific serine and threonine residues in the pre-lantibiotic structural…

  3. Biosynthesis of the Polycyclic Antimicrobial Peptides Lacticin 481, Haloduracin, and Cinnamycin

    ERIC Educational Resources Information Center

    Cooper, Lisa E.

    2009-01-01

    Lantibiotics are bacterial-derived polycyclic antimicrobial peptides. They are genetically encoded and ribosomally synthesized as precursor peptides containing a structural region that undergoes post-translational modification and a leader sequence that is not modified. Specific serine and threonine residues in the pre-lantibiotic structural…

  4. Membrane-active Antimicrobial Peptides as Template Structures for Novel Antibiotic Agents.

    PubMed

    Lohner, Karl

    2017-01-01

    The increase of pathogens being resistant to antibiotics represents a global health problem and therefore it is a pressing need to develop antibiotics with novel mechanisms of action. Host defense peptides, which have direct antimicrobial activity (also termed antimicrobial peptides) or immune modulating activity, are valuable template structures for the development of such compounds. Antimicrobial peptides exhibit remarkably different structures as well as biological activity profiles with multiple targets. A large fraction of these peptides interfere physically with the cell membrane of bacteria (focus of this review), but can also translocate into the cytosol, where they interact with nucleic acids, ribosomes and proteins. Several potential interaction sites have to be considered on the route of the peptides from the environment to the cytoplasmic membrane. Translocation of peptides through the cell wall may not be impaired by the thick but relatively porous peptidoglycan layer. However, interaction with lipopolysaccharides of the outer membrane of Gram-negative bacteria and (lipo)teichoic acids of Gram-positive bacteria may reduce the effective concentration at the cytoplasmic membrane, where supposedly the killing event takes place. On a molecular level several mechanisms are discussed, which are important for the rational design of improved antimicrobial compounds: toroidal pore formation, carpet model (coverage of membrane surface by peptides), interfacial activity, void formation, clustering of lipids and effects of membrane curvature. In summary, many of these models just represent special cases that can be interrelated to each other and depend on both the nature of lipids and peptides.

  5. Rational Evolution of Antimicrobial Peptides Containing Unnatural Amino Acids to Combat Burn Wound Infections.

    PubMed

    Xiong, Meng; Chen, Ming; Zhang, Jue

    2016-09-01

    Antimicrobial peptides have long been raised as a promising strategy to combat bacterial infection in burn wounds. Here, we attempted to rationally design small antimicrobial peptides containing unnatural amino acids by integrating in silico analysis and in vitro assay. Predictive quantitative sequence-activity models were established and validated rigorously based on a large panel of nonamer antimicrobial peptides with known antibacterial activity. The best quantitative sequence-activity model predictor was employed to guide genetic evolution of a peptide population. In the evolution procedure, a number of unnatural amino acids with desired physicochemical properties were introduced, resulting in a genetic evolution-improved population, from which seven peptide candidates with top scores, containing 1-3 unnatural amino acids, and having diverse structures were successfully identified, and their antibacterial potencies against two antibiotic-resistant bacterial strains isolated from infected burn wounds were measured using in vitro susceptibility test. Consequently, four (WL-Orn-LARKIV-NH2 , ARKRWF-Dab-FL-NH2 , KFI-Hag-IWR-Orn-R-NH2 and YW-Hag-R-Cit-RF-Orn-N-NH2 ) of the seven tested peptides were found to be more potent than reference Bac2A, the smallest naturally occurring broad spectrum antimicrobial peptide. Molecular dynamics simulations revealed that the designed peptides can fold into amphipathic helical structure that allows them to interact directly with microbial membranes. © 2016 John Wiley & Sons A/S.

  6. Prokaryotic selectivity and LPS-neutralizing activity of short antimicrobial peptides designed from the human antimicrobial peptide LL-37.

    PubMed

    Nan, Yong Hai; Bang, Jeong-Kyu; Jacob, Binu; Park, Il-Seon; Shin, Song Yub

    2012-06-01

    To develop novel antimicrobial peptides (AMPs) with shorter lengths, improved prokaryotic selectivity and retained lipolysaccharide (LPS)-neutralizing activity compared to human cathelicidin AMP, LL-37, a series of amino acid-substituted analogs based on IG-19 (residues 13-31 of LL-37) were synthesized. Among the IG-19 analogs, the analog a4 showed the highest prokaryotic selectivity, but much lower LPS-neutralizing activity compared to parental LL-37. The analogs, a5, a6, a7 and a8 with higher hydrophobicity displayed LPS-neutralizing activity comparable to that of LL-37, but much lesser prokaryotic selectivity. These results indicate that the proper hydrophobicity of the peptides is crucial to exert the amalgamated property of LPS-neutralizing activity and prokaryotic selectivity. Furthermore, to increase LPS-neutralizing activity of the analog a4 without a remarkable decrease in prokaryotic selectivity, we synthesized Trp-substituted analogs (a4-W1 and a4-W2), in which Phe(5) or Phe(15) of a4 is replaced by Trp. Despite their same prokaryotic selectivity, a4-W2 displayed much higher LPS-neutralizing activity compared to a4-W1. When compared with parental LL-37, a4-W2 showed retained LPS-neutralizing activity and 2.8-fold enhanced prokaryotic selectivity. These results suggest that the effective site for Trp-substitution when designing novel AMPs with higher LPS-neutralizing activity, without a remarkable reduction in prokaryotic selectivity, is the amphipathic interface between the end of the hydrophilic side and the start of the hydrophobic side rather than the central position of the hydrophobic side in their α-helical wheel projection. Taken together, the analog a4-W2 can serve as a promising template for the development of therapeutic agents for the treatment of endotoxic shock and bacterial infection. Copyright © 2012. Published by Elsevier Inc.

  7. Modulation of host antimicrobial peptide (beta-defensins 1 and 2) expression during gastritis.

    PubMed

    Bajaj-Elliott, M; Fedeli, P; Smith, G V; Domizio, P; Maher, L; Ali, R S; Quinn, A G; Farthing, M J G

    2002-09-01

    beta-Defensins are a newly identified family of antimicrobial peptides that are expressed by epithelia on mucosal surfaces where their production is augmented by infection or inflammation. Helicobacter pylori colonises the gastric epithelium causing persistent gastric inflammation leading to antral and corpus gastritis, and peptic ulcer disease. To evaluate the role of beta-defensins in the innate immune response of the gastric epithelium to infection and inflammation, we have assessed mRNA expression and regulation of human beta-defensins 1 and 2 (hBD1, hBD2) by H pylori and proinflammatory stimuli. We have also compared gene and peptide expression of these bactericidal agents in H pylori induced gastritis with that in normal gastric mucosa. Modulation of expression of hBD1 and hBD2 by various stimuli was studied in three (AGS, MKN7, MKN45) gastric epithelial cell lines by quantitative competitive reverse transcription-polymerase chain reaction (RT-PCR). Defensin mRNA expression was measured by semiquantitative RT-PCR in gastritis tissue and compared with controls. Peptide localisation was assessed by immunohistochemistry. Cytotoxic H pylori and interleukin 1 beta (IL-1 beta) markedly upregulated expression of hBD2 in a dose and time dependent manner in both AGS and MKN7 cell lines. A modest increase in hBD1 expression was also noted during infection. Interestingly, induction of hBD1 gene expression by IL-1 beta was only observed in MKN7 cells. The magnitude of this response was delayed and reduced compared with hBD2 expression. In gastric biopsies, hBD2 was undetectable in normal gastric antrum but a marked increase was observed in H pylori positive gastritis compared with control tissue (p<0.001). Constitutive expression of hBD1 was observed in normal gastric mucosa and there was a significant increase in gastritis (p<0.05). Immunohistochemistry revealed a parallel increase in hBD1 and hBD2 peptide expression in gastritis tissue with positive staining confined

  8. Comparison of Cytotoxic Activity in Leukemic Lineages Reveals Important Features of β-Hairpin Antimicrobial Peptides.

    PubMed

    Buri, Marcus V; Torquato, Heron F Vieira; Barros, Carlos Castilho; Ide, Jaime S; Miranda, Antonio; Paredes-Gamero, Edgar J

    2017-07-01

    Several reports described different modes of cell death triggered by antimicrobial peptides (AMPs) due to direct effects on membrane disruption, and more recently by apoptosis and necrosis-like patterns. Cytotoxic curves of four β-hairpin AMPs (gomesin, protegrin, tachyplesin, and polyphemusin) were obtained from several human leukemic lineages and normal monocytes and Two cell lines were then selected based on their cytotoxic sensitivity. One was sensitive to AMPs (K562) and the other resistant (KG-1) and their effect compared between these lineages. Thus, these lineages were chosen to further investigate biological features related with their cytotoxicities to AMPs. Stimulation with AMPs produced cell death, with activation of caspase-3, in K562 lineage. Increase on the fluidity of plasmatic membrane by reducing cholesterol potentiated cytotoxicity of AMPs in both lineages. Quantification of internal and external gomesin binding to the cellular membrane of both K562 and KG-1 cells showed that more peptide is accumulated inside of K562 cells. Additionally, evaluation of multi-drug resistant pumps activity showed that KG-1 has more activity than K562 lineage. A comparison of intrinsic gene patterns showed great differences between K562 and KG-1, but stimulation with gomesin promoted few changes in gene expression patterns. Differences in internalization process through the plasma membrane, multidrug resistance pumps activity, and gene expression pattern are important features to AMPs regulated cell death. J. Cell. Biochem. 118: 1764-1773, 2017. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  9. Antim