Sample records for antimicrobial peptide genes

  1. Antimicrobial Peptides in Reptiles

    PubMed Central

    van Hoek, Monique L.


    Reptiles are among the oldest known amniotes and are highly diverse in their morphology and ecological niches. These animals have an evolutionarily ancient innate-immune system that is of great interest to scientists trying to identify new and useful antimicrobial peptides. Significant work in the last decade in the fields of biochemistry, proteomics and genomics has begun to reveal the complexity of reptilian antimicrobial peptides. Here, the current knowledge about antimicrobial peptides in reptiles is reviewed, with specific examples in each of the four orders: Testudines (turtles and tortosises), Sphenodontia (tuataras), Squamata (snakes and lizards), and Crocodilia (crocodilans). Examples are presented of the major classes of antimicrobial peptides expressed by reptiles including defensins, cathelicidins, liver-expressed peptides (hepcidin and LEAP-2), lysozyme, crotamine, and others. Some of these peptides have been identified and tested for their antibacterial or antiviral activity; others are only predicted as possible genes from genomic sequencing. Bioinformatic analysis of the reptile genomes is presented, revealing many predicted candidate antimicrobial peptides genes across this diverse class. The study of how these ancient creatures use antimicrobial peptides within their innate immune systems may reveal new understandings of our mammalian innate immune system and may also provide new and powerful antimicrobial peptides as scaffolds for potential therapeutic development. PMID:24918867

  2. Antimicrobial Peptides

    PubMed Central

    Bahar, Ali Adem; Ren, Dacheng


    The rapid increase in drug-resistant infections has presented a serious challenge to antimicrobial therapies. The failure of the most potent antibiotics to kill “superbugs” emphasizes the urgent need to develop other control agents. Here we review the history and new development of antimicrobial peptides (AMPs), a growing class of natural and synthetic peptides with a wide spectrum of targets including viruses, bacteria, fungi, and parasites. We summarize the major types of AMPs, their modes of action, and the common mechanisms of AMP resistance. In addition, we discuss the principles for designing effective AMPs and the potential of using AMPs to control biofilms (multicellular structures of bacteria embedded in extracellular matrixes) and persister cells (dormant phenotypic variants of bacterial cells that are highly tolerant to antibiotics). PMID:24287494

  3. Antimicrobial Peptides from Fish

    PubMed Central

    Masso-Silva, Jorge A.; Diamond, Gill


    Antimicrobial peptides (AMPs) are found widely distributed through Nature, and participate in the innate host defense of each species. Fish are a great source of these peptides, as they express all of the major classes of AMPs, including defensins, cathelicidins, hepcidins, histone-derived peptides, and a fish-specific class of the cecropin family, called piscidins. As with other species, the fish peptides exhibit broad-spectrum antimicrobial activity, killing both fish and human pathogens. They are also immunomodulatory, and their genes are highly responsive to microbes and innate immuno-stimulatory molecules. Recent research has demonstrated that some of the unique properties of fish peptides, including their ability to act even in very high salt concentrations, make them good potential targets for development as therapeutic antimicrobials. Further, the stimulation of their gene expression by exogenous factors could be useful in preventing pathogenic microbes in aquaculture. PMID:24594555

  4. Antimicrobial Peptides in 2014

    PubMed Central

    Wang, Guangshun; Mishra, Biswajit; Lau, Kyle; Lushnikova, Tamara; Golla, Radha; Wang, Xiuqing


    This article highlights new members, novel mechanisms of action, new functions, and interesting applications of antimicrobial peptides reported in 2014. As of December 2014, over 100 new peptides were registered into the Antimicrobial Peptide Database, increasing the total number of entries to 2493. Unique antimicrobial peptides have been identified from marine bacteria, fungi, and plants. Environmental conditions clearly influence peptide activity or function. Human α-defensin HD-6 is only antimicrobial under reduced conditions. The pH-dependent oligomerization of human cathelicidin LL-37 is linked to double-stranded RNA delivery to endosomes, where the acidic pH triggers the dissociation of the peptide aggregate to release its cargo. Proline-rich peptides, previously known to bind to heat shock proteins, are shown to inhibit protein synthesis. A model antimicrobial peptide is demonstrated to have multiple hits on bacteria, including surface protein delocalization. While cell surface modification to decrease cationic peptide binding is a recognized resistance mechanism for pathogenic bacteria, it is also used as a survival strategy for commensal bacteria. The year 2014 also witnessed continued efforts in exploiting potential applications of antimicrobial peptides. We highlight 3D structure-based design of peptide antimicrobials and vaccines, surface coating, delivery systems, and microbial detection devices involving antimicrobial peptides. The 2014 results also support that combination therapy is preferred over monotherapy in treating biofilms. PMID:25806720

  5. Anti-antimicrobial Peptides

    PubMed Central

    Ryan, Lloyd; Lamarre, Baptiste; Diu, Ting; Ravi, Jascindra; Judge, Peter J.; Temple, Adam; Carr, Matthew; Cerasoli, Eleonora; Su, Bo; Jenkinson, Howard F.; Martyna, Glenn; Crain, Jason; Watts, Anthony; Ryadnov, Maxim G.


    Antimicrobial or host defense peptides are innate immune regulators found in all multicellular organisms. Many of them fold into membrane-bound α-helices and function by causing cell wall disruption in microorganisms. Herein we probe the possibility and functional implications of antimicrobial antagonism mediated by complementary coiled-coil interactions between antimicrobial peptides and de novo designed antagonists: anti-antimicrobial peptides. Using sequences from native helical families such as cathelicidins, cecropins, and magainins we demonstrate that designed antagonists can co-fold with antimicrobial peptides into functionally inert helical oligomers. The properties and function of the resulting assemblies were studied in solution, membrane environments, and in bacterial culture by a combination of chiroptical and solid-state NMR spectroscopies, microscopy, bioassays, and molecular dynamics simulations. The findings offer a molecular rationale for anti-antimicrobial responses with potential implications for antimicrobial resistance. PMID:23737519

  6. Antimicrobial Peptides and Colitis

    PubMed Central

    Ho, Samantha; Pothoulakis, Charalabos; Koon, Hon Wai


    Antimicrobial peptides (AMPs) are important components of innate immunity. They are often expressed in response to colonic inflammation and infection. Over the last several years, the roles of several antimicrobial peptides have been explored. Gene expression of many AMPs (beta defensin HBD2-4 and cathelicidin) is induced in response to invasion of gut microbes into the mucosal barrier. Some AMPs are expressed in a constitutive manner (alpha defensin HD 5-6 and beta defensin HBD1), while others (defensin and bactericidal/permeability increasing protein BPI) are particularly associated with Inflammatory Bowel Disease (IBD) due to altered defensin expression or development of autoantibodies against Bactericidal/permeability increasing protein (BPI). Various AMPs have different spectrum and strength of antimicrobial effects. Some may play important roles in modulating the colitis (cathelicidin) while others (lactoferrin, hepcidin) may represent biomarkers of disease activity. The use of AMPs for therapeutic purposes is still at an early stage of development. A few natural AMPs were shown to be able to modulate colitis when delivered intravenously or intracolonically (cathelicidin, elafin and SLPI) in mouse colitis models. New AMPs (synthetic or artificial non-human peptides) are being developed and may represent new therapeutic approaches against colitis. This review discusses the latest research developments in the AMP field with emphasis in innate immunity and pathophysiology of colitis. PMID:22950497

  7. Peptide Antimicrobial Agents

    PubMed Central

    Jenssen, Håvard; Hamill, Pamela; Hancock, Robert E. W.


    Antimicrobial host defense peptides are produced by all complex organisms as well as some microbes and have diverse and complex antimicrobial activities. Collectively these peptides demonstrate a broad range of antiviral and antibacterial activities and modes of action, and it is important to distinguish between direct microbicidal and indirect activities against such pathogens. The structural requirements of peptides for antiviral and antibacterial activities are evaluated in light of the diverse set of primary and secondary structures described for host defense peptides. Peptides with antifungal and antiparasitic activities are discussed in less detail, although the broad-spectrum activities of such peptides indicate that they are important host defense molecules. Knowledge regarding the relationship between peptide structure and function as well as their mechanism of action is being applied in the design of antimicrobial peptide variants as potential novel therapeutic agents. PMID:16847082

  8. Identification of Mycobacterium avium genes associated with resistance to host antimicrobial peptides

    PubMed Central

    Motamedi, Nima; Danelishvili, Lia


    Antimicrobial peptides are an important component of the innate immune defence. Mycobacterium avium subsp. hominissuis (M. avium) is an organism that establishes contact with the respiratory and gastrointestinal mucosa as a necessary step for infection. M. avium is resistant to high concentrations of polymyxin B, a surrogate for antimicrobial peptides. To determine gene-encoding proteins that are associated with this resistance, we screened a transposon library of M. avium strain 104 for susceptibility to polymyxin B. Ten susceptible mutants were identified and the inactivated genes sequenced. The great majority of the genes were related to cell wall synthesis and permeability. The mutants were then examined for their ability to enter macrophages and to survive macrophage killing. Three clones among the mutants had impaired uptake by macrophages compared with the WT strain, and all ten clones were attenuated in macrophages. The mutants were also shown to be susceptible to cathelicidin (LL-37), in contrast to the WT bacterium. All but one of the mutants were significantly attenuated in mice. In conclusion, this study indicated that the M. avium envelope is the primary defence against host antimicrobial peptides. PMID:24836414

  9. Screening, Expression, Purification and Functional Characterization of Novel Antimicrobial Peptide Genes from Hermetia illucens (L.)

    PubMed Central

    Elhag, Osama; Zhou, Dingzhong; Song, Qi; Soomro, Abdul Aziz; Cai, Minmin; Zheng, Longyu; Yu, Ziniu; Zhang, Jibin


    Antimicrobial peptides from a wide spectrum of insects possess potent microbicidal properties against microbial-related diseases. In this study, seven new gene fragments of three types of antimicrobial peptides were obtained from Hermetia illucens (L), and were named cecropinZ1, sarcotoxin1, sarcotoxin (2a), sarcotoxin (2b), sarcotoxin3, stomoxynZH1, and stomoxynZH1(a). Among these genes, a 189-basepair gene (stomoxynZH1) was cloned into the pET32a expression vector and expressed in the Escherichia coli as a fusion protein with thioredoxin. Results show that Trx-stomoxynZH1 exhibits diverse inhibitory activity on various pathogens, including Gram-positive bacterium Staphylococcus aureus, Gram-negative bacterium Escherichia coli, fungus Rhizoctonia solani Khün (rice)-10, and fungus Sclerotinia sclerotiorum (Lib.) de Bary-14. The minimum inhibitory concentration of Trx-stomoxynZH1 is higher against Gram-positive bacteria than against Gram-negative bacteria but similar between the fungal strains. These results indicate that H. illucens (L.) could provide a rich source for the discovery of novel antimicrobial peptides. Importantly, stomoxynZH1 displays a potential benefit in controlling antibiotic-resistant pathogens. PMID:28056070

  10. Screening, Expression, Purification and Functional Characterization of Novel Antimicrobial Peptide Genes from Hermetia illucens (L.).


    Elhag, Osama; Zhou, Dingzhong; Song, Qi; Soomro, Abdul Aziz; Cai, Minmin; Zheng, Longyu; Yu, Ziniu; Zhang, Jibin


    Antimicrobial peptides from a wide spectrum of insects possess potent microbicidal properties against microbial-related diseases. In this study, seven new gene fragments of three types of antimicrobial peptides were obtained from Hermetia illucens (L), and were named cecropinZ1, sarcotoxin1, sarcotoxin (2a), sarcotoxin (2b), sarcotoxin3, stomoxynZH1, and stomoxynZH1(a). Among these genes, a 189-basepair gene (stomoxynZH1) was cloned into the pET32a expression vector and expressed in the Escherichia coli as a fusion protein with thioredoxin. Results show that Trx-stomoxynZH1 exhibits diverse inhibitory activity on various pathogens, including Gram-positive bacterium Staphylococcus aureus, Gram-negative bacterium Escherichia coli, fungus Rhizoctonia solani Khün (rice)-10, and fungus Sclerotinia sclerotiorum (Lib.) de Bary-14. The minimum inhibitory concentration of Trx-stomoxynZH1 is higher against Gram-positive bacteria than against Gram-negative bacteria but similar between the fungal strains. These results indicate that H. illucens (L.) could provide a rich source for the discovery of novel antimicrobial peptides. Importantly, stomoxynZH1 displays a potential benefit in controlling antibiotic-resistant pathogens.

  11. Mytilin B and MGD2, two antimicrobial peptides of marine mussels: gene structure and expression analysis.


    Mitta, G; Hubert, F; Dyrynda, E A; Boudry, P; Roch, P


    Previous research has shown that mytilins and MGDs are two types of 4-kDa, cysteine-rich, cationic antimicrobial peptides, which are abundant in hemocytes of the mussels, Mytilus galloprovincialis and M. edulis. The expression of the genes encoding these peptides has been analyzed in the hemocytes of animals subjected to various stress factors, as well as during larval development. Variations in gene expression in adult mussels have been tested under conditions of physical stress, bacterial challenge and heat shock. The results suggest that in adult mussels, the MGD2 gene may be over-expressed with physical and temperature stress, but that reduced expression occurs with bacterial challenge. Gene expression during development has been analyzed using different larval and post-larval stages, ranging from 4-day-old veliger larvae to 32-day-old post-larvae. The results show that the expression of both mytilin B and MGD2 is developmentally regulated, but neither gene is expressed in mussels until after larval settlement and metamorphosis. Finally, the genes encoding two isoforms of these peptides have been cloned and sequenced, revealing that both genes contain four exons and three introns.

  12. Rapid evolution of antimicrobial peptide genes in an insect host-social parasite system.


    Erler, Silvio; Lhomme, Patrick; Rasmont, Pierre; Lattorff, H Michael G


    Selection, as a major driver for evolution in host-parasite interactions, may act on two levels; the virulence of the pathogen, and the hosts' defence system. Effectors of the host defence system might evolve faster than other genes e.g. those involved in adaptation to changes in life history or environmental fluctuations. Host-parasite interactions at the level of hosts and their specific social parasites, present a special setting for evolutionarily driven selection, as both share the same environmental conditions and pathogen pressures. Here, we study the evolution of antimicrobial peptide (AMP) genes, in six host bumblebee and their socially parasitic cuckoo bumblebee species. The selected AMP genes evolved much faster than non-immune genes, but only defensin-1 showed significant differences between host and social parasite. Nucleotide diversity and codon-by-codon analyses confirmed that purifying selection is the main selective force acting on bumblebee defence genes.

  13. Detection of polyketide synthase and nonribosomal peptide synthetase biosynthetic genes from antimicrobial coral-associated actinomycetes.


    Li, Jie; Dong, Jun-De; Yang, Jian; Luo, Xiong-Ming; Zhang, Si


    The diversity and properties of actinobacteria, predominant residents in coral holobionts, have been rarely documented. In this study, we aimed to explore the species diversity, antimicrobial activities and biosynthetic potential of culturable actinomycetes within the tissues of the scleractinian corals Porites lutea, Galaxea fascicularis and Acropora millepora from the South China Sea. A total of 70 strains representing 13 families and 15 genera of actinobacteria were isolated. The antimicrobial activity and biosynthetic potential of fifteen representative filamentous actinomycetes were estimated. Crude fermentation extracts of 6 strains exhibited comparable or greater activities against Vibrio alginolyticus than ciprofloxacin. Seven of the 15 actinomycetes strains possess type I polyketide synthases (PKS-I) and/or nonribosomal peptide synthetases (NRPS) genes. Nine tested strains possess type II polyketide synthases (PKS-II). Phylogenetic analysis based on 16S rRNA gene sequences indicated that these PKS and NRPS gene screening positive strains belong to genera Nocardiopsis, Pseudonocardia, Streptomyces, Micromonospora, Amycolatopsis and Prauserella. One PKS-I and four NRPS fragments showed <70% similarity to their closest relatives, which suggested the novelty of these genes. This study helps uncover the genetic capacity of stony coral-associated actinomycetes to produce bioactive molecules.

  14. Expression of essential genes for biosynthesis of antimicrobial peptides of Bacillus is modulated by inactivated cells of target microorganisms.


    Leães, Fernanda Leal; Velho, Renata Voltolini; Caldas, Danielle Gregório Gomes; Ritter, Ana Carolina; Tsai, Siu Mui; Brandelli, Adriano


    Certain Bacillus strains are important producers of antimicrobial peptides with great potential for biological control. Antimicrobial peptide production by Bacillus amyloliquefaciens P11 was investigated in the presence of heat-inactivated cells of bacteria and fungi. B. amyloliquefaciens P11 exhibited higher antimicrobial activity in the presence of inactivated cells of Staphylococcus aureus and Aspergillus parasiticus compared to other conditions tested. Expression of essential genes related to biosynthesis of the antimicrobial peptides surfactin (sfp), iturin A (lpa-14 and ituD), subtilosin A (sboA) and fengycin (fenA) was investigated by quantitative real-time PCR (qRT-PCR). The genes lpa-14 and ituD were highly expressed in the presence of S. aureus (inactivated cells), indicating induction of iturin A production by B. amyloliquefaciens P11. The other inducing condition (inactivated cells of A. parasiticus) suppressed expression of lpa-14, but increased expression of ituD. A twofold increase in fenA expression was observed for both conditions, while strong suppression of sboA expression was observed in the presence of inactivated cells of S. aureus. An increase in antimicrobial activity was observed, indicating that synthesis of antimicrobial peptides may be induced by target microorganisms.

  15. The flow of antimicrobial peptide genes through a genetic barrier between Mytilus edulis and M. galloprovincialis.


    Boon, Eva; Faure, Matthieu F; Bierne, Nicolas


    We studied the population genetics of two antimicrobial peptide (AMP) loci, called Mytilin B and Mytilus galloprovincialis defensin 2 (MGD2), in the secondary contact mosaic hybrid zone between Mytilus edulis and M. galloprovincialis. The isolation period between the two species was estimated to be approximately 1 million years (range, 0.5 million to 2 million years) long. During this period, coevolution between microbes and the immune system has likely occurred. The secondary contact, which would date back to approximately 25,000 (0-200,000) years, recently allowed these coadaptations to be rearranged through hybridization. Distinctive polymorphisms were uncovered in coding sequences of the two AMP loci such as insertion/deletion of codons or bisubstituted codons. Very low levels of differentiation were observed between populations of the two species at both loci, while other nuclear loci often showed marked structure among the same samples. The absence of population differentiation proved to be the consequence of secondary introgression of highly divergent alleles. While only a few recombinants were observed at the Mytilin B locus, the MGD2 locus showed a high intragenic recombination rate, which increased in the exon coding for the mature peptide. In addition, standard neutrality tests revealed significant deviations from the mutation-drift equilibrium at both loci. These results suggest that either balancing or directional selection is likely to play a role in the evolution of the two AMPs and introgression would be adaptive. However, evidence accumulated at the Mytilin B locus allows neither for identification of the direction of selection nor for any conclusions on whether selection acted directly on the antimicrobial peptide itself. At the MGD2 locus, a spatial variation of polymorphism patterns along the sequence suggests that selection was direct, although the precise nature of the selection (directional vs. balancing) remains unclear. This study concurs

  16. Molecular Characterization of Antimicrobial Peptide Genes of the Carpenter Ant Camponotus floridanus

    PubMed Central

    Ratzka, Carolin; Förster, Frank; Liang, Chunguang; Kupper, Maria; Dandekar, Thomas; Feldhaar, Heike; Gross, Roy


    The production of antimicrobial peptides (AMPs) is a major defense mechanism against pathogen infestation and of particular importance for insects relying exclusively on an innate immune system. Here, we report on the characterization of three AMPs from the carpenter ant Camponotus floridanus. Due to sequence similarities and amino acid composition these peptides can be classified into the cysteine-rich (e.g. defensin) and glycine-rich (e.g. hymenoptaecin) AMP groups, respectively. The gene and cDNA sequences of these AMPs were established and their expression was shown to be induced by microbial challenge. We characterized two different defensin genes. The defensin-2 gene has a single intron, whereas the defensin-1 gene has two introns. The deduced amino acid sequence of the C. floridanus defensins is very similar to other known ant defensins with the exception of a short C-terminal extension of defensin-1. The hymenoptaecin gene has a single intron and a very peculiar domain structure. The corresponding precursor protein consists of a signal- and a pro-sequence followed by a hymenoptaecin-like domain and six directly repeated hymenoptaecin domains. Each of the hymenoptaecin domains is flanked by an EAEP-spacer sequence and a RR-site known to be a proteolytic processing site. Thus, proteolytic processing of the multipeptide precursor may generate several mature AMPs leading to an amplification of the immune response. Bioinformatical analyses revealed the presence of hymenoptaecin genes with similar multipeptide precursor structure in genomes of other ant species suggesting an evolutionary conserved important role of this gene in ant immunity. PMID:22912782

  17. Antimicrobial Peptides Under Clinical Trials.


    Greber, Katarzyna E; Dawgul, Małgorzata


    Today microbial drug resistance has become a serious problem not only within inpatient setting but also within outpatient setting. Repeated intake and unnecessary usage of antibiotics as well as the transfer of resistance genes are the most important factors that make the microorganisms resistant to conventional antibiotics. A large number of antimicrobials successfully used for prophylaxis and therapeutic purposes have now become ineffective [1, 2]. Therefore, new molecules are being studied to be used in the treatment of various diseases. Some of these molecules are structural compounds based on a combination of peptides, for example, naturally occurring endogenous peptide antibiotics and their synthetic analogues or molecules designed de novo using QSAR (quantitative structureproperty relationships)-based methods [3]. Trying to exploit numerous advantages of antimicrobial peptides such as high potency and selectivity, broad range of targets, potentially low toxicity and low accumulation in tissues, pharmaceutical industry aims to develop them as commercially available drugs and appropriate clinical trials are being conducted [4]. In this paper we define clinical trials steps and describe current status of several antimicrobial peptides under clinical development as well as briefly depict peptide drug formulation.

  18. Gene therapy based in antimicrobial peptides and proinflammatory cytokine prevents reactivation of experimental latent tuberculosis.


    Ramos-Espinosa, Octavio; Hernández-Bazán, Sujhey; Francisco-Cruz, Alejandro; Mata-Espinosa, Dulce; Barrios-Payán, Jorge; Marquina-Castillo, Brenda; López-Casillas, Fernando; Carretero, Marta; Del Río, Marcela; Hernández-Pando, Rogelio


    Mycobacterium tuberculosis (Mtb) latent infection can lead to reactivation. The design of new strategies to prevent it is an important subject. B6D2F1 mice were infected intratracheally with a low dose of Mtb H37Rv to induce chronic infection. After 7 months, mice were treated with one dose of recombinant adenoviruses encoding TNFα, β defensin-3 and LL37. Immunosupression was induced 1 month later with corticosterone. In comparison with the control group, mice treated with adenoviruses showed significantly less bacterial load and pneumonia, the adenoviruses encoding TNFα and LL37 being the most efficient. Gene therapy based in a proinflammatory cytokine or antimicrobial peptides is a potentially useful system to prevent reactivation of latent tuberculosis.

  19. An alpha-helical cationic antimicrobial peptide selectively modulates macrophage responses to lipopolysaccharide and directly alters macrophage gene expression.


    Scott, M G; Rosenberger, C M; Gold, M R; Finlay, B B; Hancock, R E


    Certain cationic antimicrobial peptides block the binding of LPS to LPS-binding protein and reduce the ability of LPS to induce the production of inflammatory mediators by macrophages. To gain a more complete understanding of how LPS activates macrophages and how cationic peptides influence this process, we have used gene array technology to profile gene expression patterns in macrophages treated with LPS in the presence or the absence of the insect-derived cationic antimicrobial peptide CEMA (cecropin-melittin hybrid). We found that CEMA selectively blocked LPS-induced gene expression in the RAW 264.7 macrophage cell line. The ability of LPS to induce the expression of >40 genes was strongly inhibited by CEMA, while LPS-induced expression of another 16 genes was relatively unaffected. In addition, CEMA itself induced the expression of a distinct set of 35 genes, including genes involved in cell adhesion and apoptosis. Thus, CEMA, a synthetic alpha-helical peptide, selectively modulates the transcriptional response of macrophages to LPS and can alter gene expression in macrophages.

  20. Identification and analysis of the sap genes from Vibrio fischeri belonging to the ATP-binding cassette gene family required for peptide transport and resistance to antimicrobial peptides.


    Chen, H Y; Weng, S F; Lin, J W


    Partial nucleotide sequences of the sapD and sapF genes of the sap operon (GenBank Accession No. AF178651) from Vibrio fischeri ATCC 7744 have been determined, and the peptide transport system of ATP-binding proteins SapD and SapF encoded by the genes have been deduced. Alignment and comparison of the Sap proteins of V. fischeri, Escherichia coli, Salmonella typhimurium, and Haemophilus influenzae Rd show that these proteins are homologous. The sap operon residing in the genome enables V. fischeri to transport peptides and resist antimicrobial peptides. Nucleotide sequence and functional analyses confirm that the specific regulatory-region-like sequence R&R* that resides inside the sapD gene and before the sapF gene functions in gene expression and regulation; also, it is regulated by the LuxR-AI complex of the V. fischeri lux regulon. The putative upstream activator binding sequences SigmaUASI, SigmaUASII, SigmaUASIII TGTCGACTTGGGCCTCGCTGTCCGTATGCACA (72nd to 103rd bp), TGTCCGTATGCACA (90th to 103rd bp), and TGTTCAAGTACCAGAAAGACA (111st to 133rd bp) in the R&R* sequence, which are similar to the two-component regulator binding sequence TGT-N(8-12)-ACA and the LuxR-AI binding sequence ACCTGTAGGATCGTACAGGT in the regulatory region of the V. fischeri lux regulon, might be the specific sequences recognized by the LuxR-AI complex for enhancement.

  1. Antimicrobial Peptides from Plants

    PubMed Central

    Tam, James P.; Wang, Shujing; Wong, Ka H.; Tan, Wei Liang


    Plant antimicrobial peptides (AMPs) have evolved differently from AMPs from other life forms. They are generally rich in cysteine residues which form multiple disulfides. In turn, the disulfides cross-braced plant AMPs as cystine-rich peptides to confer them with extraordinary high chemical, thermal and proteolytic stability. The cystine-rich or commonly known as cysteine-rich peptides (CRPs) of plant AMPs are classified into families based on their sequence similarity, cysteine motifs that determine their distinctive disulfide bond patterns and tertiary structure fold. Cystine-rich plant AMP families include thionins, defensins, hevein-like peptides, knottin-type peptides (linear and cyclic), lipid transfer proteins, α-hairpinin and snakins family. In addition, there are AMPs which are rich in other amino acids. The ability of plant AMPs to organize into specific families with conserved structural folds that enable sequence variation of non-Cys residues encased in the same scaffold within a particular family to play multiple functions. Furthermore, the ability of plant AMPs to tolerate hypervariable sequences using a conserved scaffold provides diversity to recognize different targets by varying the sequence of the non-cysteine residues. These properties bode well for developing plant AMPs as potential therapeutics and for protection of crops through transgenic methods. This review provides an overview of the major families of plant AMPs, including their structures, functions, and putative mechanisms. PMID:26580629

  2. Butyrate enhances disease resistance of chickens by inducing antimicrobial host defense peptide gene expression

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Host defense peptides (HDPs) constitute a large group of natural broad-spectrum antimicrobials and an important first line of immunity in virtually all forms of life. Specific augmentation of synthesis of endogenous HDPs may represent a promising antibiotic-alternative approach to disease control. I...

  3. Plant antimicrobial peptides.


    Nawrot, Robert; Barylski, Jakub; Nowicki, Grzegorz; Broniarczyk, Justyna; Buchwald, Waldemar; Goździcka-Józefiak, Anna


    Plant antimicrobial peptides (AMPs) are a component of barrier defense system of plants. They have been isolated from roots, seeds, flowers, stems, and leaves of a wide variety of species and have activities towards phytopathogens, as well as against bacteria pathogenic to humans. Thus, plant AMPs are considered as promising antibiotic compounds with important biotechnological applications. Plant AMPs are grouped into several families and share general features such as positive charge, the presence of disulfide bonds (which stabilize the structure), and the mechanism of action targeting outer membrane structures.

  4. The effect of peptidoglycan enriched diets on antimicrobial peptide gene expression in rainbow trout (Oncorhynchus mykiss).


    Casadei, Elisa; Bird, Steve; Vecino, Jose L González; Wadsworth, Simon; Secombes, Christopher J


    The aim of this study was to investigate the effect of feeding rainbow trout (Oncorhynchus mykiss) peptidoglycan (PG) enriched diets on antimicrobial peptide (AMP) gene expression. Fish were divided into 5 groups and fed diets containing 0, 5, 10, 50 and 100 mg PG/Kg, and sampled 1, 7 and 14 days later. The expression of eight AMP genes (four defensins, two cathelicidins and two liver expressed AMPs) was determined in skin, gill, gut and liver, tissues important for first lines of defence or production of acute phase proteins. Up-regulation of many AMPs was found after feeding the PG enriched diets, with sequential expression seen over the time course studied, where defensins were typically expressed early and cathelicidins and LEAPs later on. A number of clear differences in AMP responsiveness between the tissues examined were also apparent. Of the four PG concentrations used, 5 mg PG/Kg did not always elicit AMP gene induction or to the same degree as seen with the other diets. The three higher dose groups generally showed similar trends although differences in fold change were more pronounced in the 50 and 100 mg PG/Kg groups. Curiously several AMPs were down-regulated after 14 days of feeding in gills, gut and liver. Nevertheless, overall the PG enriched diets had a positive effect on AMP expression. Further investigations now need to be undertaken to confirm whether this higher AMP gene expression correlates with protection against common bacterial diseases and if PG enriched diets have value as a means to temporarily boost the piscine immune system.

  5. Computational promoter analysis of mouse, rat and human antimicrobial peptide-coding genes

    PubMed Central

    Brahmachary, Manisha; Schönbach, Christian; Yang, Liang; Huang, Enli; Tan, Sin Lam; Chowdhary, Rajesh; Krishnan, SPT; Lin, Chin-Yo; Hume, David A; Kai, Chikatoshi; Kawai, Jun; Carninci, Piero; Hayashizaki, Yoshihide; Bajic, Vladimir B


    Background Mammalian antimicrobial peptides (AMPs) are effectors of the innate immune response. A multitude of signals coming from pathways of mammalian pathogen/pattern recognition receptors and other proteins affect the expression of AMP-coding genes (AMPcgs). For many AMPcgs the promoter elements and transcription factors that control their tissue cell-specific expression have yet to be fully identified and characterized. Results Based upon the RIKEN full-length cDNA and public sequence data derived from human, mouse and rat, we identified 178 candidate AMP transcripts derived from 61 genes belonging to 29 AMP families. However, only for 31 mouse genes belonging to 22 AMP families we were able to determine true orthologous relationships with 30 human and 15 rat sequences. We screened the promoter regions of AMPcgs in the three species for motifs by an ab initio motif finding method and analyzed the derived promoter characteristics. Promoter models were developed for alpha-defensins, penk and zap AMP families. The results suggest a core set of transcription factors (TFs) that regulate the transcription of AMPcg families in mouse, rat and human. The three most frequent core TFs groups include liver-, nervous system-specific and nuclear hormone receptors (NHRs). Out of 440 motifs analyzed, we found that three represent potentially novel TF-binding motifs enriched in promoters of AMPcgs, while the other four motifs appear to be species-specific. Conclusion Our large-scale computational analysis of promoters of 22 families of AMPcgs across three mammalian species suggests that their key transcriptional regulators are likely to be TFs of the liver-, nervous system-specific and NHR groups. The computationally inferred promoter elements and potential TF binding motifs provide a rich resource for targeted experimental validation of TF binding and signaling studies that aim at the regulation of mouse, rat or human AMPcgs. PMID:17254313

  6. Antimicrobial peptides: therapeutic potentials.


    Kang, Su-Jin; Park, Sung Jean; Mishig-Ochir, Tsogbadrakh; Lee, Bong-Jin


    The increasing appearance of multidrug-resistant pathogens has created an urgent need for suitable alternatives to current antibiotics. Antimicrobial peptides (AMPs), which act as defensive weapons against microbes, have received great attention because of broad-spectrum activities, unique action mechanisms and rare antibiotic-resistant variants. Despite desirable characteristics, they have shown limitations in pharmaceutical development due to toxicity, stability and manufacturing costs. Because of these drawbacks, only a few AMPs have been tested in Phase III clinical trials and no AMPs have been approved by the US FDA yet. However, these obstacles could be overcome by well-known methods such as changing physicochemical characteristics and introducing nonnatural amino acids, acetylation or amidation, as well as modern techniques like molecular targeted AMPs, liposomal formulations and drug delivery systems. Thus, the current challenge in this field is to develop therapeutic AMPs at a reasonable cost as well as to overcome the limitations.

  7. Salmonella enterica Serovar Enteritidis Antimicrobial Peptide Resistance Genes Aid in Defense against Chicken Innate Immunity, Fecal Shedding, and Egg Deposition

    PubMed Central

    McKelvey, Jessica A.; Yang, Ming; Jiang, Yanhua


    Salmonella enterica serovar Enteritidis (S. Enteritidis) is a major etiologic agent of nontyphoid salmonellosis in the United States. S. Enteritidis persistently and silently colonizes the intestinal and reproductive tract of laying hens, resulting in contaminated poultry products. The consumption of contaminated poultry products has been identified as a significant risk factor for human salmonellosis. To understand the mechanisms S. Enteritidis utilizes to colonize and persist in laying hens, we used selective capture of transcribed sequences to identify genes overexpressed in the HD11 chicken macrophage cell line and in primary chicken oviduct epithelial cells. From the 15 genes found to be overexpressed in both cell types, we characterized the antimicrobial peptide resistance (AMPR) genes, virK and ybjX, in vitro and in vivo. In vitro, AMPR genes were required for natural morphology, motility, secretion, defense against detergents such as EDTA and bile salts, and resistance to antimicrobial peptides polymyxin B and avian β-defensins. From this, we inferred the AMPR genes play a role in outer membrane stability and/or modulation. In the intestinal tract, AMPR genes were involved in early intestinal colonization and fecal shedding. In the reproductive tract, virK was required in early colonization whereas a deletion of ybjX caused prolonged ovary colonization and egg deposition. Data from the present study indicate that AMPR genes are differentially utilized in various host environments, which may ultimately assist S. Enteritidis in persistent and silent colonization of chickens. PMID:25267840

  8. Expression of antimicrobial peptide genes in Bombyx mori gut modulated by oral bacterial infection and development.


    Wu, Shan; Zhang, Xiaofeng; He, Yongqiang; Shuai, Jiangbing; Chen, Xiaomei; Ling, Erjun


    Although Bombyx mori systematic immunity is extensively studied, little is known about the silkworm's intestine-specific responses to bacterial infection. Antimicrobial peptides (AMPs) gene expression analysis of B. mori intestinal tissue to oral infection with the Gram-positive (Staphylococcus aureus) and -negative (Escherichia coli) bacteria revealed that there is specificity in the interaction between host immune responses and parasite types. Neither Att1 nor Leb could be stimulated by S. aureus and E. coli. However, CecA1, Glo1, Glo2, Glo3, Glo4 and Lys, could only be trigged by S. aureus. On the contrary, E. coli stimulation caused the decrease in the expression of CecA1, Glo3 and Glo4 in some time points. Interestingly, there is regional specificity in the silkworm local gut immunity. During the immune response, the increase in Def, Hem and LLP3 was only detected in the foregut and midgut. For CecB1, CecD, LLP2 and Mor, after orally administered with E. coli, the up-regulation was only limited in the midgut and hindgut. CecE was the only AMP that positively responses to the both bacteria in all the testing situations. With development, the expression levels of the AMPs were also changed dramatically. That is, at spinning and prepupa stages, a large increase in the expression of CecA1, CecB1, CecD, CecE, Glo1, Glo2, Glo3, Glo4, Leb, Def, Hem, Mor and Lys was detected in the gut. Unexpectedly, in addition to the IMD pathway genes, the Toll and JAK/STAT pathway genes in the silkworm gut can also be activated by microbial oral infection. But in the developmental course, corresponding to the increase in expression of AMPs at spinning and prepupa stages, only the Toll pathway genes in the gut exhibit the similar increasing trend. Our results imply that the immune responses in the silkworm gut are synergistically regulated by the Toll, JAK/STAT and IMD pathways. However, as the time for approaching pupation, the Toll pathway may play a role in the AMPs expression.

  9. Antimicrobial peptides: properties and applicability.


    van 't Hof, W; Veerman, E C; Helmerhorst, E J; Amerongen, A V


    All organisms need protection against microorganisms, e. g. bacteria, viruses and fungi. For many years, attention has been focused on adaptive immunity as the main antimicrobial defense system. However, the adaptive immune system, with its network of humoral and cellular responses is only found in higher animals, while innate immunity is encountered in all living creatures. The turning point in the appreciation of the innate immunity was the discovery of antimicrobial peptides in the early eighties. In general these peptides act by disrupting the structural integrity of the microbial membranes. It has become clear that membrane-active peptides and proteins play a crucial role in both the innate and the adaptive immune system as antimicrobial agents. This review is focused on the functional and structural features of the naturally occurring antimicrobial peptides, and discusses their potential as therapeutics.

  10. [Transgenic Belarussian-bred potato plants expressing genes for antimicrobial peptides of the cecropin-melittin type].


    Vutto, N L; Gapeeva, T A; Pundik, A N; Tret'iakova, T G; Volotovskiĭ, I D


    Binary vectors for Agrobacterium-mediated transformation were constructed to express the genes for antimicrobial peptides (APs) of the cectropin-melittin type under the control of the cauliflower mosaic virus 35S RNA promoter in plants. It was shown with Escherichia coli and Agrobacterium tumefaciens cells that the cassettes could be cloned in pB1121-based vectors with deletion of the 3-D-glycuronidase gene only in the orientation opposite to that of the original vector. Transgenic potato plants were obtained using the Belarussian varieties Odyssey, Vetraz, and Scarb. Their cells expressed the MsrA1 or CEMA peptides of the cecropin-melittin type. The expression was shown to confer higher resistance to bacterial (Erwinia carotovora) infection and extremely high resistance to fungal (Phytophtora infestans and Alternarla solani) infections.

  11. Novel Formulations for Antimicrobial Peptides

    PubMed Central

    Carmona-Ribeiro, Ana Maria; Carrasco, Letícia Dias de Melo


    Peptides in general hold much promise as a major ingredient in novel supramolecular assemblies. They may become essential in vaccine design, antimicrobial chemotherapy, cancer immunotherapy, food preservation, organs transplants, design of novel materials for dentistry, formulations against diabetes and other important strategical applications. This review discusses how novel formulations may improve the therapeutic index of antimicrobial peptides by protecting their activity and improving their bioavailability. The diversity of novel formulations using lipids, liposomes, nanoparticles, polymers, micelles, etc., within the limits of nanotechnology may also provide novel applications going beyond antimicrobial chemotherapy. PMID:25302615

  12. Novel formulations for antimicrobial peptides.


    Carmona-Ribeiro, Ana Maria; de Melo Carrasco, Letícia Dias


    Peptides in general hold much promise as a major ingredient in novel supramolecular assemblies. They may become essential in vaccine design, antimicrobial chemotherapy, cancer immunotherapy, food preservation, organs transplants, design of novel materials for dentistry, formulations against diabetes and other important strategical applications. This review discusses how novel formulations may improve the therapeutic index of antimicrobial peptides by protecting their activity and improving their bioavailability. The diversity of novel formulations using lipids, liposomes, nanoparticles, polymers, micelles, etc., within the limits of nanotechnology may also provide novel applications going beyond antimicrobial chemotherapy.

  13. Pathogen-induced expression of a cecropin A-melittin antimicrobial peptide gene confers antifungal resistance in transgenic tobacco.


    Yevtushenko, Dmytro P; Romero, Rafael; Forward, Benjamin S; Hancock, Robert E; Kay, William W; Misra, Santosh


    Expression of defensive genes from a promoter that is specifically activated in response to pathogen invasion is highly desirable for engineering disease-resistant plants. A plant transformation vector was constructed with transcriptional fusion between the pathogen-responsive win3.12T promoter from poplar and the gene encoding the novel cecropin A-melittin hybrid peptide (CEMA) with strong antimicrobial activity. This promoter-transgene combination was evaluated in transgenic tobacco (Nicotiana tabacum L. cv. Xanthi) for enhanced plant resistance against a highly virulent pathogenic fungus Fusarium solani. Transgene expression in leaves was strongly increased after fungal infection or mechanical wounding, and the accumulation of CEMA transcripts was found to be systemic and positively correlated with the number of transgene insertions. A simple and efficient in vitro regeneration bioassay for preliminary screening of transgenic lines against pathogenic fungi was developed. CEMA had strong antifungal activity in vitro, inhibiting conidia germination at concentrations that were non-toxic to tobacco protoplasts. Most importantly, the expression level of the CEMA peptide in vivo, regulated by the win3.12T promoter, was sufficient to confer resistance against F. solani in transgenic tobacco. The antifungal resistance of plants with high CEMA expression was strong and reproducible. In addition, leaf tissue extracts from transgenic plants significantly reduced the number of fungal colonies arising from germinated conidia. Accumulation of CEMA peptide in transgenic tobacco had no deleterious effect on plant growth and development. This is the first report showing the application of a heterologous pathogen-inducible promoter to direct the expression of an antimicrobial peptide in plants, and the feasibility of this approach to provide disease resistance in tobacco and, possibly, other crops.

  14. Peptides and Peptidomimetics for Antimicrobial Drug Design

    PubMed Central

    Mojsoska, Biljana; Jenssen, Håvard


    The purpose of this paper is to introduce and highlight a few classes of traditional antimicrobial peptides with a focus on structure-activity relationship studies. After first dissecting the important physiochemical properties that influence the antimicrobial and toxic properties of antimicrobial peptides, the contributions of individual amino acids with respect to the peptides antibacterial properties are presented. A brief discussion of the mechanisms of action of different antimicrobials as well as the development of bacterial resistance towards antimicrobial peptides follows. Finally, current efforts on novel design strategies and peptidomimetics are introduced to illustrate the importance of antimicrobial peptide research in the development of future antibiotics. PMID:26184232

  15. Genomic Organization, Molecular Diversification, and Evolution of Antimicrobial Peptide Myticin-C Genes in the Mussel (Mytilus galloprovincialis)

    PubMed Central

    Vera, Manuel; Martínez, Paulino; Poisa-Beiro, Laura; Figueras, Antonio; Novoa, Beatriz


    Myticin-C is a highly variable antimicrobial peptide associated to immune response in Mediterranean mussel (Mytilus galloprovincialis). In this study, we tried to ascertain the genetic organization and the mechanisms underlying myticin-C variation and evolution of this gene family. We took advantage of the large intron size variation to find out the number of myticin-C genes. Using fragment analysis a maximum of four alleles was detected per individual at both introns in a large mussel sample suggesting a minimum of two myticin-C genes. The transmission pattern of size variants in two full-sib families was also used to ascertain the number of myticin-C genes underlying the variability observed. Results in both families were in accordance with two myticin-C genes organized in tandem. A more detailed analysis of myticin-C variation was carried out by sequencing a large sample of complementary (cDNA) and genomic DNA (gDNA) in 10 individuals. Two basic sequences were detected at most individuals and several sequences were constituted by combination of two different basic sequences, strongly suggesting somatic recombination or gene conversion. Slight within-basic sequence variation detected in all individuals was attributed to somatic mutation. Such mutations were more frequently at the C-terminal domain and mostly determined non-synonymous substitutions. The mature peptide domain showed the highest variation both in the whole cDNA and in the basic-sequence samples, which is in accordance with the pathogen recognition function associated to this domain. Although most tests suggested neutrality for myticin-C variation, evidence indicated positive selection in the mature peptide and C-terminal region. Three main highly supported clusters were observed when reconstructing phylogeny on basic sequences, meiotic recombination playing a relevant role on myticin-C evolution. This study demonstrates that mechanisms to generate molecular variation similar to that observed in

  16. Genomic organization, molecular diversification, and evolution of antimicrobial peptide myticin-C genes in the mussel (Mytilus galloprovincialis).


    Vera, Manuel; Martínez, Paulino; Poisa-Beiro, Laura; Figueras, Antonio; Novoa, Beatriz


    Myticin-C is a highly variable antimicrobial peptide associated to immune response in Mediterranean mussel (Mytilus galloprovincialis). In this study, we tried to ascertain the genetic organization and the mechanisms underlying myticin-C variation and evolution of this gene family. We took advantage of the large intron size variation to find out the number of myticin-C genes. Using fragment analysis a maximum of four alleles was detected per individual at both introns in a large mussel sample suggesting a minimum of two myticin-C genes. The transmission pattern of size variants in two full-sib families was also used to ascertain the number of myticin-C genes underlying the variability observed. Results in both families were in accordance with two myticin-C genes organized in tandem. A more detailed analysis of myticin-C variation was carried out by sequencing a large sample of complementary (cDNA) and genomic DNA (gDNA) in 10 individuals. Two basic sequences were detected at most individuals and several sequences were constituted by combination of two different basic sequences, strongly suggesting somatic recombination or gene conversion. Slight within-basic sequence variation detected in all individuals was attributed to somatic mutation. Such mutations were more frequently at the C-terminal domain and mostly determined non-synonymous substitutions. The mature peptide domain showed the highest variation both in the whole cDNA and in the basic-sequence samples, which is in accordance with the pathogen recognition function associated to this domain. Although most tests suggested neutrality for myticin-C variation, evidence indicated positive selection in the mature peptide and C-terminal region. Three main highly supported clusters were observed when reconstructing phylogeny on basic sequences, meiotic recombination playing a relevant role on myticin-C evolution. This study demonstrates that mechanisms to generate molecular variation similar to that observed in

  17. Antimicrobial Peptides from Marine Proteobacteria

    PubMed Central

    Desriac, Florie; Jégou, Camille; Balnois, Eric; Brillet, Benjamin; Le Chevalier, Patrick; Fleury, Yannick


    After years of inadequate use and the emergence of multidrug resistant (MDR) strains, the efficiency of “classical” antibiotics has decreased significantly. New drugs to fight MDR strains are urgently needed. Bacteria hold much promise as a source of unusual bioactive metabolites. However, the potential of marine bacteria, except for Actinomycetes and Cyanobacteria, has been largely underexplored. In the past two decades, the structures of several antimicrobial compounds have been elucidated in marine Proteobacteria. Of these compounds, polyketides (PKs), synthesised by condensation of malonyl-coenzyme A and/or acetyl-coenzyme A, and non-ribosomal peptides (NRPs), obtained through the linkage of (unusual) amino acids, have recently generated particular interest. NRPs are good examples of naturally modified peptides. Here, we review and compile the data on the antimicrobial peptides isolated from marine Proteobacteria, especially NRPs. PMID:24084784

  18. Chronic exposure to a neonicotinoid increases expression of antimicrobial peptide genes in the bumblebee Bombus impatiens

    PubMed Central

    Simmons, William R.; Angelini, David R.


    Bumblebees are important pollinators in wild and agricultural settings. In recent decades pollinator declines have been linked to the effects of increased pesticide use and the spread of disease. Synergy between these factors has been suggested, but no physiological mechanism has been identified. This study examines the connection between neonicotinoid exposure and innate immune function in the bumblebee Bombus impatiens, which is an important wild and commercial pollinator in eastern North America. Experimental colonies in the field were enclosed and provided pollen and sugar syrup containing an agriculturally relevant range of imidacloprid concentrations. Bumblebees were collected from colonies over four weeks, and the expression of antimicrobial peptides was measured using multiplex quantitative real time PCR. Significant increases in the expression of abaecin, apidaecin and hymenoptaecin were found over time in treatments receiving moderate to high concentrations of the pesticide. Responses were dependent on time of exposure and dose. These results indicate that immune function in bumblebees is affected by neonicotinoid exposure and suggest a physiological mechanism by which neonicotinoids may impact the innate immune function of bumblebee pollinators in wild and agricultural habitats. PMID:28322347

  19. Chronic exposure to a neonicotinoid increases expression of antimicrobial peptide genes in the bumblebee Bombus impatiens.


    Simmons, William R; Angelini, David R


    Bumblebees are important pollinators in wild and agricultural settings. In recent decades pollinator declines have been linked to the effects of increased pesticide use and the spread of disease. Synergy between these factors has been suggested, but no physiological mechanism has been identified. This study examines the connection between neonicotinoid exposure and innate immune function in the bumblebee Bombus impatiens, which is an important wild and commercial pollinator in eastern North America. Experimental colonies in the field were enclosed and provided pollen and sugar syrup containing an agriculturally relevant range of imidacloprid concentrations. Bumblebees were collected from colonies over four weeks, and the expression of antimicrobial peptides was measured using multiplex quantitative real time PCR. Significant increases in the expression of abaecin, apidaecin and hymenoptaecin were found over time in treatments receiving moderate to high concentrations of the pesticide. Responses were dependent on time of exposure and dose. These results indicate that immune function in bumblebees is affected by neonicotinoid exposure and suggest a physiological mechanism by which neonicotinoids may impact the innate immune function of bumblebee pollinators in wild and agricultural habitats.

  20. Gene cloning and functional characterization of four novel antimicrobial-like peptides from scorpions of the family Vaejovidae.


    Ramírez-Carreto, Santos; Quintero-Hernández, Verónica; Jiménez-Vargas, Juana María; Corzo, Gerardo; Possani, Lourival D; Becerril, Baltazar; Ortiz, Ernesto


    From the cDNA libraries made from the venom glands of two scorpions belonging to the Vaejovidae family, four different putative non disulfide-bridged antimicrobial peptides were identified: VmCT1 and VmCT2 from Vaejovis mexicanus smithi plus VsCT1 and VsCT2 from Vaejovis subcristatus. These short peptides (with only 13 amino acid residues each) share important amino acid sequence similarities among themselves and with other reported antimicrobial peptides, but their biological activities vary dramatically. This communication reports the cloning, chemical synthesis and characterization of these peptides. Two peptides, VmCT1 and VmCT2 showed broad-spectrum antibacterial activity with minimum inhibitory concentrations MICs in the range of 5-25 μM and 10-20 μM respectively, whereas their hemolytic activity at these concentrations was low. Structure-function relationships that might determine the differences in activities are discussed.

  1. Tolerance to the antimicrobial peptide colistin in Pseudomonas aeruginosa biofilms is linked to metabolically active cells, and depends on the pmr and mexAB-oprM genes.


    Pamp, Sünje Johanna; Gjermansen, Morten; Johansen, Helle Krogh; Tolker-Nielsen, Tim


    Bacteria living as biofilm are frequently reported to exhibit inherent tolerance to antimicrobial compounds, and might therefore contribute to the persistence of infections. Antimicrobial peptides are attracting increasing interest as new potential antimicrobial therapeutics; however, little is known about potential mechanisms, which might contribute to resistance or tolerance development towards these compounds in biofilms. Here we provide evidence that a spatially distinct subpopulation of metabolically active cells in Pseudomonas aeruginosa biofilms is able to develop tolerance to the antimicrobial peptide colistin. On the contrary, biofilm cells exhibiting low metabolic activity were killed by colistin. We demonstrate that the subpopulation of metabolically active cells is able to adapt to colistin by inducing a specific adaptation mechanism mediated by the pmr operon, as well as an unspecific adaptation mechanism mediated by the mexAB-oprM genes. Mutants defective in either pmr-mediated lipopolysaccharide modification or in mexAB-oprM-mediated antimicrobial efflux were not able to develop a tolerant subpopulation in biofilms. In contrast to the observed pattern of colistin-mediated killing in biofilms, conventional antimicrobial compounds such as ciprofloxacin and tetracycline were found to specifically kill the subpopulation of metabolically active biofilm cells, whereas the subpopulation exhibiting low metabolic activity survived the treatment. Consequently, targeting the two physiologically distinct subpopulations by combined antimicrobial treatment with either ciprofloxacin and colistin or tetracycline and colistin almost completely eradicated all biofilm cells.

  2. Insect inducible antimicrobial peptides and their applications.


    Ezzati-Tabrizi, Reyhaneh; Farrokhi, Naser; Talaei-Hassanloui, Reza; Alavi, Seyed Mehdi; Hosseininaveh, Vahid


    Antimicrobial peptides (AMPs) are found as important components of the innate immune system (host defense) of all invertebrates. These peptides can be constitutively expressed or induced in response to microbial infections. Indeed, they vary in their amino acid sequences, potency and antimicrobial activity spectra. The smaller AMPs act greatly by disrupting the structure or function of microbial cell membranes. Here, the insect innate immune system with emphasis on inducible antimicrobial peptide properties against microbial invaders has been discussed.

  3. Antimicrobial peptides: clinical relevance and therapeutic implications.


    Pinheiro da Silva, Fabiano; Machado, Marcel Cerqueira César


    Antimicrobial peptides (AMPs) are molecules that provide protection against environmental pathogens, acting against a large number of microorganisms, including bacteria, fungi, yeast, virus and others. Two major groups of antimicrobial peptides are found in humans: cathelicidins and defensins. Recently, several studies have furnished information that besides their role in infection diseases, antimicrobial peptides play a role in diseases as diverse as inflammatory disorders, autoimmunity and cancer. Here, we discuss the role of antimicrobial peptides and vitamin D have in such complex diseases and propose their use should be more explored in the diagnosis and treatment of such conditions.

  4. Membrane disruption mechanism of antimicrobial peptides

    NASA Astrophysics Data System (ADS)

    Lee, Ka Yee


    Largely distributed among living organisms, antimicrobial peptides are a class of small (<100 residues) host defense peptides that induce selective membrane lytic activity against microbial pathogens. The permeabilizing behavior of these diverse peptides has been commonly attributed to the formation of pores, and such pore formation has been categorized as barrel-stave, toroidal, or carpet-like. With the continuing discovery of new peptide species, many are uncharacterized and the exact mechanism is unknown. Through the use of atomic force microscopy, the disruption of supported lipid bilayer patches by protegrin-1 is concentration-dependent. The intercalation of antimicrobial peptide into the bilayer results in structures beyond that of pore formation, but with the formation of worm-like micelles at high peptide concentration. Our results suggest that antimicrobial peptide acts to lower the interfacial energy of the bilayer in a way similar to detergents. Antimicrobial peptides with structural differences, magainin-1 and aurein 1.1, exhibit a mechanistic commonality.

  5. The First Salamander Defensin Antimicrobial Peptide

    PubMed Central

    Jiang, Ke; Rong, Mingqiang; Lai, Ren


    Antimicrobial peptides have been widely identified from amphibian skins except salamanders. A novel antimicrobial peptide (CFBD) was isolated and characterized from skin secretions of the salamander, Cynops fudingensis. The cDNA encoding CFBD precursor was cloned from the skin cDNA library of C. fudingensis. The precursor was composed of three domains: signal peptide of 17 residues, mature peptide of 41 residues and intervening propeptide of 3 residues. There are six cysteines in the sequence of mature CFBD peptide, which possibly form three disulfide-bridges. CFBD showed antimicrobial activities against Staphylococcus aureus, Bacillus subtilis, Candida albicans and Escherichia coli. This peptide could be classified into family of β-defensin based on its seqeuence similarity with β-defensins from other vertebrates. Evolution analysis indicated that CFBD was close to fish β-defensin. As far as we know, CFBD is the first β-defensin antimicrobial peptide from salamanders. PMID:24386139

  6. The first salamander defensin antimicrobial peptide.


    Meng, Ping; Yang, Shilong; Shen, Chuanbin; Jiang, Ke; Rong, Mingqiang; Lai, Ren


    Antimicrobial peptides have been widely identified from amphibian skins except salamanders. A novel antimicrobial peptide (CFBD) was isolated and characterized from skin secretions of the salamander, Cynops fudingensis. The cDNA encoding CFBD precursor was cloned from the skin cDNA library of C. fudingensis. The precursor was composed of three domains: signal peptide of 17 residues, mature peptide of 41 residues and intervening propeptide of 3 residues. There are six cysteines in the sequence of mature CFBD peptide, which possibly form three disulfide-bridges. CFBD showed antimicrobial activities against Staphylococcus aureus, Bacillus subtilis, Candida albicans and Escherichia coli. This peptide could be classified into family of β-defensin based on its sequence similarity with β-defensins from other vertebrates. Evolution analysis indicated that CFBD was close to fish β-defensin. As far as we know, CFBD is the first β-defensin antimicrobial peptide from salamanders.

  7. Human Antimicrobial Peptides and Proteins

    PubMed Central

    Wang, Guangshun


    As the key components of innate immunity, human host defense antimicrobial peptides and proteins (AMPs) play a critical role in warding off invading microbial pathogens. In addition, AMPs can possess other biological functions such as apoptosis, wound healing, and immune modulation. This article provides an overview on the identification, activity, 3D structure, and mechanism of action of human AMPs selected from the antimicrobial peptide database. Over 100 such peptides have been identified from a variety of tissues and epithelial surfaces, including skin, eyes, ears, mouths, gut, immune, nervous and urinary systems. These peptides vary from 10 to 150 amino acids with a net charge between −3 and +20 and a hydrophobic content below 60%. The sequence diversity enables human AMPs to adopt various 3D structures and to attack pathogens by different mechanisms. While α-defensin HD-6 can self-assemble on the bacterial surface into nanonets to entangle bacteria, both HNP-1 and β-defensin hBD-3 are able to block cell wall biosynthesis by binding to lipid II. Lysozyme is well-characterized to cleave bacterial cell wall polysaccharides but can also kill bacteria by a non-catalytic mechanism. The two hydrophobic domains in the long amphipathic α-helix of human cathelicidin LL-37 lays the basis for binding and disrupting the curved anionic bacterial membrane surfaces by forming pores or via the carpet model. Furthermore, dermcidin may serve as ion channel by forming a long helix-bundle structure. In addition, the C-type lectin RegIIIα can initially recognize bacterial peptidoglycans followed by pore formation in the membrane. Finally, histatin 5 and GAPDH(2-32) can enter microbial cells to exert their effects. It appears that granulysin enters cells and kills intracellular pathogens with the aid of pore-forming perforin. This arsenal of human defense proteins not only keeps us healthy but also inspires the development of a new generation of personalized medicine to

  8. Antimicrobial Peptides in Human Sepsis

    PubMed Central

    Martin, Lukas; van Meegern, Anne; Doemming, Sabine; Schuerholz, Tobias


    Nearly 100 years ago, antimicrobial peptides (AMPs) were identified as an important part of innate immunity. They exist in species from bacteria to mammals and can be isolated in body fluids and on surfaces constitutively or induced by inflammation. Defensins have anti-bacterial effects against Gram-positive and Gram-negative bacteria as well as anti-viral and anti-yeast effects. Human neutrophil peptides (HNP) 1–3 and human beta-defensins (HBDs) 1–3 are some of the most important defensins in humans. Recent studies have demonstrated higher levels of HNP 1–3 and HBD-2 in sepsis. The bactericidal/permeability-increasing protein (BPI) attenuates local inflammatory response and decreases systemic toxicity of endotoxins. Moreover, BPI might reflect the severity of organ dysfunction in sepsis. Elevated plasma lactoferrin is detected in patients with organ failure. HNP 1–3, lactoferrin, BPI, and heparin-binding protein are increased in sepsis. Human lactoferrin peptide 1–11 (hLF 1–11) possesses antimicrobial activity and modulates inflammation. The recombinant form of lactoferrin [talactoferrin alpha (TLF)] has been shown to decrease mortality in critically ill patients. A phase II/III study with TLF in sepsis did not confirm this result. The growing number of multiresistant bacteria is an ongoing problem in sepsis therapy. Furthermore, antibiotics are known to promote the liberation of pro-inflammatory cell components and thus augment the severity of sepsis. Compared to antibiotics, AMPs kill bacteria but also neutralize pathogenic factors such as lipopolysaccharide. The obstacle to applying naturally occurring AMPs is their high nephro- and neurotoxicity. Therefore, the challenge is to develop peptides to treat septic patients effectively without causing harm. This overview focuses on natural and synthetic AMPs in human and experimental sepsis and their potential to provide significant improvements in the treatment of critically ill with severe infections

  9. The Potential of Antimicrobial Peptides as Biocides

    PubMed Central

    Laverty, Garry; Gorman, Sean P.; Gilmore, Brendan F.


    Antimicrobial peptides constitute a diverse class of naturally occurring antimicrobial molecules which have activity against a wide range of pathogenic microorganisms. Antimicrobial peptides are exciting leads in the development of novel biocidal agents at a time when classical antibiotics are under intense pressure from emerging resistance, and the global industry in antibiotic research and development stagnates. This review will examine the potential of antimicrobial peptides, both natural and synthetic, as novel biocidal agents in the battle against multi-drug resistant pathogen infections. PMID:22072905

  10. Antimicrobial peptides: an alternative for innovative medicines?


    da Costa, João Pinto; Cova, Marta; Ferreira, Rita; Vitorino, Rui


    Antimicrobial peptides are small molecules with activity against bacteria, yeasts, fungi, viruses, bacteria, and even tumor cells that make these molecules attractive as therapeutic agents. Due to the alarming increase of antimicrobial resistance, interest in alternative antimicrobial agents has led to the exploitation of antimicrobial peptides, both synthetic and from natural sources. Thus, many peptide-based drugs are currently commercially available for the treatment of numerous ailments, such as hepatitis C, myeloma, skin infections, and diabetes. Initial barriers are being increasingly overcome with the development of cost-effective, more stable peptides. Herein, we review the available strategies for their synthesis, bioinformatics tools for the rational design of antimicrobial peptides with enhanced therapeutic indices, hurdles and shortcomings limiting the large-scale production of AMPs, as well as the challenges that the pharmaceutical industry faces on their use as therapeutic agents.

  11. Chemical genomic screening of a Saccharomyces cerevisiae genomewide mutant collection reveals genes required for defense against four antimicrobial peptides derived from proteins found in human saliva.


    Lis, Maciej; Bhatt, Sanjay; Schoenly, Nathan E; Lee, Anna Y; Nislow, Corey; Bobek, Libuse A


    To compare the effects of four antimicrobial peptides (MUC7 12-mer, histatin 12-mer, cathelicidin KR20, and a peptide containing lactoferricin amino acids 1 to 11) on the yeast Saccharomyces cerevisiae, we employed a genomewide fitness screen of combined collections of mutants with homozygous deletions of nonessential genes and heterozygous deletions of essential genes. When an arbitrary fitness score cutoffs of 1 (indicating a fitness defect, or hypersensitivity) and -1 (indicating a fitness gain, or resistance) was used, 425 of the 5,902 mutants tested exhibited altered fitness when treated with at least one peptide. Functional analysis of the 425 strains revealed enrichment among the identified deletions in gene groups associated with the Gene Ontology (GO) terms "ribosomal subunit," "ribosome biogenesis," "protein glycosylation," "vacuolar transport," "Golgi vesicle transport," "negative regulation of transcription," and others. Fitness profiles of all four tested peptides were highly similar, particularly among mutant strains exhibiting the greatest fitness defects. The latter group included deletions in several genes involved in induction of the RIM101 signaling pathway, including several components of the ESCRT sorting machinery. The RIM101 signaling regulates response of yeasts to alkaline and neutral pH and high salts, and our data indicate that this pathway also plays a prominent role in regulating protective measures against all four tested peptides. In summary, the results of the chemical genomic screens of S. cerevisiae mutant collection suggest that the four antimicrobial peptides, despite their differences in structure and physical properties, share many interactions with S. cerevisiae cells and consequently a high degree of similarity between their modes of action.

  12. Structure-function relationships of antimicrobial peptides.


    Hwang, P M; Vogel, H J


    Antimicrobial peptides are ubiquitously produced throughout nature. Many of these relatively short peptides (6-50 residues) are lethal towards bacteria and fungi, yet they display minimal toxicity towards mammalian cells. All of the peptides are highly cationic and hydrophobic. It is widely believed that they act through nonspecific binding to biological membranes, even though the exact nature of these interactions is presently unclear. High-resolution nuclear magnetic resonance (NMR) has contributed greatly to knowledge in this field, providing insight about peptide structure in aqueous solution, in organic cosolvents, and in micellar systems. Solid-state NMR can provide additional information about peptide-membrane binding. Here we review our current knowledge about the structure of antimicrobial peptides. We also discuss studies pertaining to the mechanism of action. Despite the different three-dimensional structural motifs of the various classes, they all have similar amphiphilic surfaces that are well-suited for membrane binding. Many antimicrobial peptides bind in a membrane-parallel orientation, interacting only with one face of the bilayer. This may be sufficient for antimicrobial action. At higher concentrations, peptides and phospholipids translocate to form multimeric transmembrane channels that seem to contribute to the peptide's hemolytic activity. An understanding of the key features of the secondary and tertiary structures of the antimicrobial peptides and their effects on bactericidal and hemolytic activity can aid the rational design of improved analogs for clinical use.

  13. Antimicrobial peptides of multicellular organisms

    NASA Astrophysics Data System (ADS)

    Zasloff, Michael


    Multicellular organisms live, by and large, harmoniously with microbes. The cornea of the eye of an animal is almost always free of signs of infection. The insect flourishes without lymphocytes or antibodies. A plant seed germinates successfully in the midst of soil microbes. How is this accomplished? Both animals and plants possess potent, broad-spectrum antimicrobial peptides, which they use to fend off a wide range of microbes, including bacteria, fungi, viruses and protozoa. What sorts of molecules are they? How are they employed by animals in their defence? As our need for new antibiotics becomes more pressing, could we design anti-infective drugs based on the design principles these molecules teach us?

  14. Antimicrobial peptide action on parasites.


    Torrent, Marc; Pulido, David; Rivas, Luis; Andreu, David


    Diseases caused by protozoan parasites can pose a severe thread to human health and are behind some serious neglected tropical diseases like malaria and leishmaniasis. Though several different drugs have been developed in order to eradicate these diseases, a successful candidate has not yet been discovered. Among the most active compounds tested, antimicrobial peptides (AMPs) are particularly appealing because of their wide spectrum of action. AMPs have been described to perturb protozoan homeostasis by disrupting the cellular membranes but also by interfering with key processes in the parasite metabolism. In this review we describe the diverse mechanisms of action of AMPs on protozoan targets and how they can be exploited to treat diseases. Moreover, we describe with detail the antimicrobial action of AMPs on two major parasitical infections: leishmaniasis and malaria. All the features reviewed here show that AMPs are promising drugs to target protozoan parasites and that further understanding of the mechanism of action of these compounds will lead to improved drugs that could be worth to test in a clinical phase.

  15. De Novo Design of Potent Antimicrobial Peptides

    PubMed Central

    Frecer, V.; Ho, B.; Ding, J. L.


    Lipopolysaccharide (LPS), shed by gram-negative bacteria during infection and antimicrobial therapy, may lead to lethal endotoxic shock syndrome. A rational design strategy based on the presumed mechanism of antibacterial effect was adopted to design cationic antimicrobial peptides capable of binding to LPS through tandemly repeated sequences of alternating cationic and nonpolar residues. The peptides were designed to achieve enhanced antimicrobial potency due to initial bacterial membrane binding with a reduced risk of endotoxic shock. The peptides designed displayed binding affinities to LPS and lipid A (LA) in the low micromolar range and by molecular modeling were predicted to form amphipathic β-hairpin-like structures when they bind to LPS or LA. They also exhibited strong effects against gram-negative bacteria, with MICs in the nanomolar range, and low cytotoxic and hemolytic activities at concentrations significantly exceeding their MICs. Quantitative structure-activity relationship (QSAR) analysis of peptide sequences and their antimicrobial, cytotoxic, and hemolytic activities revealed that site-directed substitutions of residues in the hydrophobic face of the amphipathic peptides with less lipophilic residues selectively decrease the hemolytic effect without significantly affecting the antimicrobial or cytotoxic activity. On the other hand, the antimicrobial effect can be enhanced by substitutions in the polar face with more polar residues, which increase the amphipathicity of the peptide. On the basis of the QSARs, new analogs that have strong antimicrobial effects but that lack hemolytic activity can be proposed. The findings highlight the importance of peptide amphipathicity and allow a rational method that can be used to dissociate the antimicrobial and hemolytic effects of cationic peptides, which have potent antimicrobial properties, to be proposed. PMID:15328096

  16. (Lipo)polysaccharide interactions of antimicrobial peptides.


    Schmidtchen, Artur; Malmsten, Martin


    Due to rapidly increasing resistance development against conventional antibiotics, as well as problems associated with diseases either triggered or deteriorated by infection, antimicrobial and anti-inflammatory peptides have attracted considerable interest during the last few years. While there is an emerging understanding of the direct antimicrobial function of such peptides through bacterial membrane destabilization, the mechanisms of their anti-inflammatory function are less clear. We here summarize some recent results obtained from our own research on anti-inflammatory peptides, with focus on peptide-(lipo)polysaccharide interactions.

  17. Novel histone-derived antimicrobial peptides use different antimicrobial mechanisms.


    Pavia, Kathryn E; Spinella, Sara A; Elmore, Donald E


    The increase in multidrug resistant bacteria has sparked an interest in the development of novel antibiotics. Antimicrobial peptides that operate by crossing the cell membrane may also have the potential to deliver drugs to intracellular targets. Buforin 2 (BF2) is an antimicrobial peptide that shares sequence identity with a fragment of histone subunit H2A and whose bactericidal mechanism depends on membrane translocation and DNA binding. Previously, novel histone-derived antimicrobial peptides (HDAPs) were designed based on properties of BF2, and DesHDAP1 and DesHDAP3 showed significant antibacterial activity. In this study, their DNA binding, permeabilization, and translocation abilities were assessed independently and compared to antibacterial activity to determine whether they share a mechanism with BF2. To investigate the importance of proline in determining the peptides' mechanisms of action, proline to alanine mutants of the novel peptides were generated. DesHDAP1, which shows significant similarities to BF2 in terms of secondary structure, translocates effectively across lipid vesicle and bacterial membranes, while the DesHDAP1 proline mutant shows reduced translocation abilities and antimicrobial potency. In contrast, both DesHDAP3 and its proline mutant translocate poorly, though the DesHDAP3 proline mutant is more potent. Our findings suggest that a proline hinge can promote membrane translocation in some peptides, but that the extent of its effect on permeabilization depends on the peptide's amphipathic properties. Our results also highlight the different antimicrobial mechanisms exhibited by histone-derived peptides and suggest that histones may serve as a source of novel antimicrobial peptides with varied properties.

  18. Cationic antimicrobial peptides in penaeid shrimp.


    Tassanakajon, Anchalee; Amparyup, Piti; Somboonwiwat, Kunlaya; Supungul, Premruethai


    Penaeid shrimp aquaculture has been consistently affected worldwide by devastating diseases that cause a severe loss in production. To fight a variety of harmful microbes in the surrounding environment, particularly at high densities (of which intensive farming represents an extreme example), shrimps have evolved and use a diverse array of antimicrobial peptides (AMPs) as part of an important first-line response of the host defense system. Cationic AMPs in penaeid shrimps composed of penaeidins, crustins, and anti-lipopolysaccharide factors are comprised of multiple classes or isoforms and possess antibacterial and antifungal activities against different strains of bacteria and fungi. Shrimp AMPs are primarily expressed in circulating hemocytes, which is the main site of the immune response, and hemocytes expressing AMPs probably migrate to infection sites to fight against pathogen invasion. Indeed, most AMPs are produced as early as the nauplii developmental stage to protect shrimp larvae from infections. In this review, we discuss the sequence diversity, expression, gene structure, and antimicrobial activities of cationic AMPs in penaeid shrimps. The information available on antimicrobial activities indicates that these shrimp AMPs have potential therapeutic applications in the control of disease problems in aquaculture.

  19. [Antimicrobial peptide in dentisty. Literature review].


    Sato, F Simain; Rompen, E; Heinen, E


    The use of antimicrobial substances has contributed to the development of multiple antimicrobial resistances (1), challenging the pharmaceutical industry to develop with new, innovative, and effective molecules. Discovered around 1980, molecules called natural antimicrobial peptides (AMPs) appear to hold great potential for the treatment of infections. These cationic peptides are able to stop the bacterial development and to control infections. The purpose of this review is to help improve the understanding of the way AMPs operate in the context of the development of new cures against viruses, bacteria, and mushrooms found in the human body in general and in the oral cavity in particular.

  20. The presence of sboA and spaS genes and antimicrobial peptides subtilosin A and subtilin among Bacillus strains of the Amazon basin

    PubMed Central

    Velho, Renata Voltolini; Basso, Ana Paula; Segalin, Jeferson; Costa-Medina, Luis Fernando; Brandelli, Adriano


    This report demonstrates the usefulness of PCR for the genes spaS and sboA as a means of identifying Bacillus strains with a potential to produce subtilin and subtilosin A. One collection strain and five Bacillus spp. isolated from aquatic environments in the Amazon basin were screened by PCR using primers for sboA and spaS designed specifically for this study. The sequences of the PCR products showed elevated homology with previously described spaS and sboA genes. Antimicrobial peptides were isolated from culture supernatants and analyzed by mass spectrometry. For all samples, the mass spectra revealed clusters with peaks at m/z 3300–3500 Da, corresponding to subtilosin A, subtilin and isoforms of these peptides. These results suggest that the antimicrobial activity of these strains may be associated with the production of subtilosin A and/or subtilin. The PCR used here was efficient in identifying novel Bacillus strains with the essential genes for producing subtilosin A and subtilin. PMID:23569414

  1. Antimicrobial preservative effectiveness of natural peptide antibiotics.


    Kamysz, Wojciech; Turecka, Katarzyna


    The constantly growing resistance of microbes to drugs and other substances which fight microbial infections leads to search for new antimicrobial substances. Among substances which attract the scientists attention are antimicrobial peptides. Such compounds are quite common in nature and belong to the most important elements of the innate immune system of all living organisms. Numerous antimicrobial peptides have been isolated from insects, amphibians, mammals, plants and bacterial species. In this study we investigated the in vitro activity of two animal peptides, citropin 1.1 and protegrin 1 alone and in combination against microbial strains proposed for the evaluation of preservatives: Escherichia coli ATCC 8739, Staphylococcus aureus ATCC 6538, Pseudomonas aeruginosa ATCC 9027, Candida albicans ATCC 10231, and Aspergillus niger ATCC 16404. The results of the antimicrobial preservative effectiveness were compared to the values received for benzalkonium chloride, popular preservative of medicines and cosmetics.

  2. Antimicrobial activity of human islet amyloid polypeptides: an insight into amyloid peptides' connection with antimicrobial peptides.


    Wang, Lan; Liu, Qian; Chen, Jin-Chun; Cui, Yi-Xian; Zhou, Bing; Chen, Yong-Xiang; Zhao, Yu-Fen; Li, Yan-Mei


    Human islet amyloid polypeptide (hIAPP) shows an antimicrobial activity towards two types of clinically relevant bacteria. The potency of hIAPP varies with its aggregation states. Circular dichroism was employed to determine the interaction between hIAPP and bacteria lipid membrane mimic. The antimicrobial activity of each aggregate species is associated with their ability to induce membrane disruption. Our findings provide new evidence revealing the antimicrobial activity of amyloid peptide, which suggest a possible connection between amyloid peptides and antimicrobial peptides.

  3. Antimicrobial Cyclic Peptides for Plant Disease Control

    PubMed Central

    Lee, Dong Wan; Kim, Beom Seok


    Antimicrobial cyclic peptides derived from microbes bind stably with target sites, have a tolerance to hydrolysis by proteases, and a favorable degradability under field conditions, which make them an attractive proposition for use as agricultural fungicides. Antimicrobial cyclic peptides are classified according to the types of bonds within the ring structure; homodetic, heterodetic, and complex cyclic peptides, which in turn reflect diverse physicochemical features. Most antimicrobial cyclic peptides affect the integrity of the cell envelope. This is achieved through direct interaction with the cell membrane or disturbance of the cell wall and membrane component biosynthesis such as chitin, glucan, and sphingolipid. These are specific and selective targets providing reliable activity and safety for non-target organisms. Synthetic cyclic peptides produced through combinatorial chemistry offer an alternative approach to develop antimicrobials for agricultural uses. Those synthesized so far have been studied for antibacterial activity, however, the recent advancements in powerful technologies now promise to provide novel antimicrobial cyclic peptides that are yet to be discovered from natural resources. PMID:25774105

  4. Antimicrobial peptides and bacteriocins: alternatives to traditional antibiotics.


    Sang, Yongming; Blecha, Frank


    Antimicrobial peptides (AMPs) are ubiquitous, gene-encoded natural antibiotics that have gained recent attention in the search for new antimicrobials to combat infectious disease. In multicellular organisms, AMPs, such as defensins and cathelicidins, provide a coordinated protective response against infection and are a principal component of innate immunity in vertebrates. In unicellular organisms, AMPs, such as bacteriocins, function to suppress competitor species. Because many AMPs kill bacteria by disruption of membrane integrity and are thus thought to be less likely to induce resistance, AMPs are being extensively evaluated as novel antimicrobial drugs. This review summarizes and discusses the antibiotic properties of AMPs highlighting their potential as alternatives to conventional antibiotics.

  5. Antimicrobial peptide gene cecropin-2 and defensin respond to peptidoglycan infection in the female adult of oriental fruit fly, Bactrocera dorsalis (Hendel).


    Liu, Shi-Huo; Wei, Dong; Yuan, Guo-Rui; Jiang, Hong-Bo; Dou, Wei; Wang, Jin-Jun


    Cecropins and defensins are important antimicrobial peptides in insects and are inducible after injection of immune triggers. In this study, we cloned the cDNAs of two antimicrobial peptides (AMPs), cecropin-2 (BdCec-2) and defensin (BdDef) from Bactrocera dorsalis (Hendel), a serious pest causing great economic losses to fruits and vegetables. The BdCec-2 sequence of 192bp encodes a protein of 63 amino acids residues with a predicted molecular weight of 6.78kD. The 282bp cDNA of BdDef encodes a protein of 93 residues with a predicted molecular weight of 9.81kD. Quantitative real-time PCR analyses showed that BdCec-2 and BdDef had similar expression profiles among development stages, the highest mRNA levels of these two AMP genes were observed in the adult stage. Among different adult body segments and tissues, both genes had similar transcriptional profiles, the highest mRNA levels appeared in abdomen and fat body, which was consistent with the reported fact that fat body was the main organ synthesizing AMPs in insects. The expression of BdCec-2 and BdDef were up-regulated after challenge with peptidoglycans from Escherichia coli (PGN-EB) and Staphylococcus aureus (PGN-SA), respectively, suggesting their antimicrobial activity against Gram-negative and Gram-positive microorganisms. These results describe for the first time the basic properties of the cecropin-2 and defensin genes from B. dorsalis that probably play an important role in the defense response against invading microbes.

  6. Identification of Legionella pneumophila rcp, a pagP-like gene that confers resistance to cationic antimicrobial peptides and promotes intracellular infection.


    Robey, M; O'Connell, W; Cianciotto, N P


    In the course of characterizing a locus involved in heme utilization, we identified a Legionella pneumophila gene predicted to encode a protein with homology to the product of the Salmonella enterica serovar Typhimurium pagP gene. In Salmonella, pagP increases resistance to the bactericidal effects of cationic antimicrobial peptides (CAMPs). Mutants with insertions in the L. pneumophila pagP-like gene were generated and showed decreased resistance to different structural classes of CAMPs compared to the wild type; hence, this gene was designated rcp for resistance to cationic antimicrobial peptides. Furthermore, Legionella CAMP resistance was induced by growth in low-magnesium medium. To determine whether rcp had any role in intracellular survival, mutants were tested in the two most relevant host cells for Legionnaires' disease, i.e., amoebae and macrophages. These mutants exhibited a 1,000-fold-decreased recovery during a Hartmannella vermiformis coculture. Complementation of the infectivity defect could be achieved by introduction of a plasmid containing the intact rcp gene. Mutations in rcp consistently reduced both the numbers of bacteria recovered during intracellular infection and their cytopathic capacity for U937 macrophages. The rcp mutant was also more defective for lung colonization of A/J mice. Growth of rcp mutants in buffered yeast extract broth was identical to that of the wild type, indicating that the observed differences in numbers of bacteria recovered from host cells were not due to a generalized growth defect. However, in low-Mg(2+) medium, the rcp mutant was impaired in stationary-phase survival. This is the first demonstration of a pagP-like gene, involved in resistance to CAMPs, being required for intracellular infection and virulence.

  7. Two novel antimicrobial peptides from centipede venoms.


    Peng, Kanfu; Kong, Yi; Zhai, Lei; Wu, Xiongfei; Jia, Peng; Liu, Jingze; Yu, Haining


    Centipede venoms are complex mixtures of biochemically and pharmacologically active components such as peptides and proteins. Very few are known about their pharmacological actions. The present work reports the structural and functional characterization of two antimicrobial peptides (scolopin 1 and -2) identified from centipede venoms of Scolopendra subspinipes mutilans by Sephadex gel filtration and reverse-phase high-performance liquid chromatography (RP-HPLC). The amino acid sequences of scolopin 1 and -2 were FLPKMSTKLRVPYRRGTKDYH and GILKKFMLHRGTKVYKMRTLSKRSH determined by Edman degradation and matrix assisted laser desorption ionization time of flight mass spectrometry (MALDI-TOF MS). Both scolopin 1 and -2 showed strong antimicrobial activities against tested microorganisms including Gram-positive/negative bacteria and fungi. They also showed moderate hemolytic activity against both human and rabbit red cells. This is the first report of antimicrobial peptides from centipedes.

  8. Expression profiles of seven channel catfish antimicrobial peptides in response to Edwardsiella ictaluri infection

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Using quantitative PCR technique, the relative transcriptional levels of seven channel catfish antimicrobial peptide (AMP) genes [NK-lysin type 1, NK-lysin type 2, NK-lysin type 3, bactericidal permeability-increasing protein (BPI), cathepsin D, hepcidin, and liver-expressed antimicrobial peptide 2 ...

  9. Proteolytic activation of pro-spätzle is required for the induced transcription of antimicrobial peptide genes in lepidopteran insects

    PubMed Central

    Wang, Yang; Cheng, Tingcai; Rayaprolu, Subrahmanyam; Zou, Zhen; Xia, Qingyou; Xiang, Zhonghuai; Jiang, Haobo


    Microbial infection leads to proteolytic activation of Drosophila spätzle, which binds to the toll receptor and induces the synthesis of immune proteins. To test whether or not this mechanism exists in lepidopteran insects, we cloned the cDNA of Bombyx mori spätzle-1 and overexpressed the full-length and truncated BmSpz1 cDNA in Escherichia coli. The insoluble fusion proteins were affinity-purified under denaturing condition. After the silkworm larvae were injected with renatured BmSpz1, mRNA levels of antimicrobial peptide genes greatly increased. Similar transcriptional up-regulation was also found in Manduca sexta. Injection of pro-BmSpz1 had no such effect. When pro-BmSpz1 and Micrococcus luteus were incubated with the plasma from M. sexta larvae, we detected proteolytic processing of pro-BmSpz1. These results suggest that active spätzle is required for the induced production of antimicrobial peptides in B. mori and M. sexta. PMID:17337053

  10. Toxins and antimicrobial peptides: interactions with membranes

    NASA Astrophysics Data System (ADS)

    Schlamadinger, Diana E.; Gable, Jonathan E.; Kim, Judy E.


    The innate immunity to pathogenic invasion of organisms in the plant and animal kingdoms relies upon cationic antimicrobial peptides (AMPs) as the first line of defense. In addition to these natural peptide antibiotics, similar cationic peptides, such as the bee venom toxin melittin, act as nonspecific toxins. Molecular details of AMP and peptide toxin action are not known, but the universal function of these peptides to disrupt cell membranes of pathogenic bacteria (AMPs) or a diverse set of eukaryotes and prokaryotes (melittin) is widely accepted. Here, we have utilized spectroscopic techniques to elucidate peptide-membrane interactions of alpha-helical human and mouse AMPs of the cathelicidin family as well as the peptide toxin melittin. The activity of these natural peptides and their engineered analogs was studied on eukaryotic and prokaryotic membrane mimics consisting of <200-nm bilayer vesicles composed of anionic and neutral lipids as well as cholesterol. Vesicle disruption, or peptide potency, was monitored with a sensitive fluorescence leakage assay. Detailed molecular information on peptidemembrane interactions and peptide structure was further gained through vibrational spectroscopy combined with circular dichroism. Finally, steady-state fluorescence experiments yielded insight into the local environment of native or engineered tryptophan residues in melittin and human cathelicidin embedded in bilayer vesicles. Collectively, our results provide clues to the functional structures of the engineered and toxic peptides and may impact the design of synthetic antibiotic peptides that can be used against the growing number of antibiotic-resistant pathogens.

  11. Original involvement of antimicrobial peptides in mussel innate immunity.


    Mitta, G; Vandenbulcke, F; Roch, P


    Recently, the existence and extended diversity of antimicrobial peptides has been revealed in two mussel species. These molecules are classified into four groups according to common features of their primary structure: defensins, mytilins, myticins and mytimycin. In Mytilus galloprovincialis, gene structure reveals synthesis as precursors in circulating hemocytes. Synthesised even in absence of challenge, the precursors mature and the peptides are stored in granules as active forms. The different peptides are engaged in the destruction of bacteria inside phagocytes, before being released into hemolymph to participate in systemic responses. Such involvement in anti-infectious responses is unique, and apparently more related to those of mammalian phagocytes than to those of insects.

  12. Antimicrobial peptide gene induction, involvement of Toll and IMD pathways and defense against bacteria in the red flour beetle, Tribolium castaneum

    PubMed Central

    Yokoi, Kakeru; Koyama, Hiroaki; Minakuchi, Chieka; Tanaka, Toshiharu; Miura, Ken


    Using Tribolium castaneum, we quantitatively investigated the induction of nine antimicrobial peptide (AMP) genes by live gram-negative bacteria (Escherichia coli and Enterobacter cloacae), gram-positive bacteria (Micrococcus luteus and Bacillus subtilis) and the budding yeast (Saccharomyces cerevisiae). Then, five representative AMP genes were selected, and the involvement of the Toll and IMD pathways in their induction by E. coli, M. luteus and S. cerevisiae was examined by utilizing RNA interference of either MyD88 or IMD. Results indicated: Robust and acute induction of three genes by the two bacterial species was mediated mainly by the IMD pathway; slow and sustained induction of one gene by the two bacteria was mediated mainly by the Toll pathway; induction of the remaining one gene by the two bacteria was mediated by both pathways; induction of the five genes by the yeast was mediated by the Toll and/or IMD pathways depending on respective genes. These results suggest that more promiscuous activation and usage of the two pathways may occur in T. castaneum than in Drosophila melanogaster. In addition, the IMD pathway was revealed to dominantly contribute to defense against two bacterial species, gram-negative E. cloacae and gram-positive B. subtilis that possesses DAP-type peptidoglycan. PMID:24371569

  13. Antimicrobial Peptides for Use in Biosensing Applications

    DTIC Science & Technology


    S., Bevins, C. L., Brasseur, M. M., Tomassini, N., Turner, K., Eck, H. and Zasloff, M., 1991: Antimicrobial Peptides in the Stomach of Xenopus ... laevis , The Journal of Biological Chemistry, 266, 19851-19857. Steiner, H., Andreu, D. and Merrifield, R. B., 1988: Binding and action of cecropin

  14. RNAi knock-down of shrimp Litopenaeus vannamei Toll gene and immune deficiency gene reveals their difference in regulating antimicrobial peptides transcription.


    Hou, Fujun; He, Shulin; Liu, Yongjie; Zhu, Xiaowen; Sun, Chengbo; Liu, Xiaolin


    NF-κB dependent antimicrobial peptides (AMPs) are of critical importance in protecting insects or mammals from microorganisms infection. However, we still do not make clear signaling pathways in regulating AMPs expression in shrimps. In this study, RNAi approach was used to study differences between Toll signaling pathway and immune deficiency signaling pathway in regulating the transcription of NF-κB dependent AMPs post bacteria challenge. Results showed that the transcription level of anti-lipopolysaccharide factor was highly suppressed in Litopenaeus vannamei immune deficiency (LvIMD) silenced shrimps by gene specific dsRNA compared to Litopenaeus vannamei Toll (LvToll) silenced shrimps with or without Vibrio anguillarum and Micrococcus lysodeikticus challenge. Conversely the transcription level of penaeidin3a was significantly suppressed in LvToll silenced shrimps compared to LvIMD silenced shrimps. However, no obvious difference was found in regulating the transcription of CrustinP. Meanwhile, we found that silencing LvToll both down regulated the transcription of Dorsal and Relish while silencing LvIMD only down regulated the transcription of Relish. At last, shrimp survival experiment showed that post V. anguillarum challenge high mortality was found both in LvToll and LvIMD silenced groups while post M. lysodeikticus challenge we saw high mortality only in LvToll silenced group. Hence, we conclude that shrimp L. vannamei Toll pathway and IMD pathway might be different in regulating the transcription of NF-κB dependent AMPs and responding to bacteria challenge but not independent of each other.

  15. Bacterial strategies of resistance to antimicrobial peptides.


    Joo, Hwang-Soo; Fu, Chih-Iung; Otto, Michael


    Antimicrobial peptides (AMPs) are a key component of the host's innate immune system, targeting invasive and colonizing bacteria. For successful survival and colonization of the host, bacteria have a series of mechanisms to interfere with AMP activity, and AMP resistance is intimately connected with the virulence potential of bacterial pathogens. In particular, because AMPs are considered as potential novel antimicrobial drugs, it is vital to understand bacterial AMP resistance mechanisms. This review gives a comparative overview of Gram-positive and Gram-negative bacterial strategies of resistance to various AMPs, such as repulsion or sequestration by bacterial surface structures, alteration of membrane charge or fluidity, degradation and removal by efflux pumps.This article is part of the themed issue 'Evolutionary ecology of arthropod antimicrobial peptides'.

  16. A novel family of antimicrobial peptides from the skin of Amolops loloensis.


    Wang, Aili; Wang, Jiyuan; Hong, Jing; Feng, Hao; Yang, Hailong; Yu, Xiaodong; Ma, Yufang; Lai, Ren


    While conducting experiments to investigate antimicrobial peptides of amphibians living in the Yunnan-Sichuan region of southwest China, a new family of antimicrobial peptides was identified from skin secretions of the rufous-spotted torrent frog, Amolops loloensis. Members of the new peptide family named amolopins are composed of 18 amino acids with a unique sequence, for example, NILSSIVNGINRALSFFG. By BLAST search, amolopins did no show similarity to any known peptides. Among the tested microorganisms, native and synthetic peptides only showed antimicrobial activities against Staphylococcus aureus ATCC2592 and Bacillus pumilus, no effects on other microorganisms. The CD spectroscopy showed that it adopted a structure of random combined with beta-sheet in water, Tris-HCl or Tris-HCl-SDS. Several cDNAs encoding amolopins were cloned from the skin cDNA library of A. loloensis. The precursors of amolopin are composed of 62 amino acid residues including predicted signal peptides, acidic propieces, and mature antimicrobial peptides. The preproregion of amolopin precursor comprises a hydrophobic signal peptide of 22 residues followed by an 18 residue acidic propiece which terminates by a typical prohormone processing signal Lys-Arg. The preproregions of precursors are very similar to other amphibian antimicrobial peptide precursors but the mature amolopins are different from other antimicrobial peptide families. The remarkable similarity of preproregions of precursors that give rise to very different antimicrobial peptides in distantly related frog species suggests that the corresponding genes form a multigene family originating from a common ancestor.

  17. Snakin-2, an Antimicrobial Peptide from Potato Whose Gene Is Locally Induced by Wounding and Responds to Pathogen Infection1

    PubMed Central

    Berrocal-Lobo, Marta; Segura, Ana; Moreno, Manuel; López, Gemma; García-Olmedo, Francisco; Molina, Antonio


    The peptide snakin-2 (StSN2) has been isolated from potato (Solanum tuberosum cv Jaerla) tubers and found to be active (EC50 = 1–20 μm) against fungal and bacterial plant pathogens. It causes a rapid aggregation of both Gram-positive and Gram-negative bacteria. The corresponding StSN2 cDNA encodes a signal sequence followed by a 15-residue acidic sequence that precedes the mature StSN2 peptide, which is basic (isoelectric point = 9.16) and 66 amino acid residues long (molecular weight of 7,025). The StSN2 gene is developmentally expressed in tubers, stems, flowers, shoot apex, and leaves, but not in roots, or stolons, and is locally up-regulated by wounding and by abscisic acid treatment. Expression of this gene is also up-regulated after infection of potato tubers with the compatible fungus Botritys cinerea and down-regulated by the virulent bacteria Ralstonia solanacearum and Erwinia chrysanthemi. These observations are congruent with the hypothesis that the StSN2 is a component of both constitutive and inducible defense barriers. PMID:11891250

  18. Snakin-2, an antimicrobial peptide from potato whose gene is locally induced by wounding and responds to pathogen infection.


    Berrocal-Lobo, Marta; Segura, Ana; Moreno, Manuel; López, Gemma; García-Olmedo, Francisco; Molina, Antonio


    The peptide snakin-2 (StSN2) has been isolated from potato (Solanum tuberosum cv Jaerla) tubers and found to be active (EC(50) = 1-20 microM) against fungal and bacterial plant pathogens. It causes a rapid aggregation of both Gram-positive and Gram-negative bacteria. The corresponding StSN2 cDNA encodes a signal sequence followed by a 15-residue acidic sequence that precedes the mature StSN2 peptide, which is basic (isoelectric point = 9.16) and 66 amino acid residues long (molecular weight of 7,025). The StSN2 gene is developmentally expressed in tubers, stems, flowers, shoot apex, and leaves, but not in roots, or stolons, and is locally up-regulated by wounding and by abscisic acid treatment. Expression of this gene is also up-regulated after infection of potato tubers with the compatible fungus Botritys cinerea and down-regulated by the virulent bacteria Ralstonia solanacearum and Erwinia chrysanthemi. These observations are congruent with the hypothesis that the StSN2 is a component of both constitutive and inducible defense barriers.

  19. Peptide consensus sequence determination for the enhancement of the antimicrobial activity and selectivity of antimicrobial peptides

    PubMed Central

    Almaaytah, Ammar; Ajingi, Ya’u; Abualhaijaa, Ahmad; Tarazi, Shadi; Alshar’i, Nizar; Al-Balas, Qosay


    The rise of multidrug-resistant bacteria is causing a serious threat to the world’s human population. Recent reports have identified bacterial strains displaying pan drug resistance against antibiotics and generating fears among medical health specialists that humanity is on the dawn of entering a post-antibiotics era. Global research is currently focused on expanding the lifetime of current antibiotics and the development of new antimicrobial agents to tackle the problem of antimicrobial resistance. In the present study, we designed a novel consensus peptide named “Pepcon” through peptide consensus sequence determination among members of a highly homologous group of scorpion antimicrobial peptides. Members of this group were found to possess moderate antimicrobial activity with significant toxicity against mammalian cells. The aim of our design method was to generate a novel peptide with an enhanced antimicrobial potency and selectivity against microbial rather than mammalian cells. The results of our study revealed that the consensus peptide displayed potent antibacterial activities against a broad range of Gram-positive and Gram-negative bacteria. Our membrane permeation studies displayed that the peptide efficiently induced membrane damage and consequently led to cell death through the process of cell lysis. The microbial DNA binding assay of the peptide was found to be very weak suggesting that the peptide is not targeting the microbial DNA. Pepcon induced minimal cytotoxicity at the antimicrobial concentrations as the hemolytic activity was found to be zero at the minimal inhibitory concentrations (MICs). The results of our study demonstrate that the consensus peptide design strategy is efficient in generating peptides. PMID:28096686

  20. Design and Application of Antimicrobial Peptide Conjugates

    PubMed Central

    Reinhardt, Andre; Neundorf, Ines


    Antimicrobial peptides (AMPs) are an interesting class of antibiotics characterized by their unique antibiotic activity and lower propensity for developing resistance compared to common antibiotics. They belong to the class of membrane-active peptides and usually act selectively against bacteria, fungi and protozoans. AMPs, but also peptide conjugates containing AMPs, have come more and more into the focus of research during the last few years. Within this article, recent work on AMP conjugates is reviewed. Different aspects will be highlighted as a combination of AMPs with antibiotics or organometallic compounds aiming to increase antibacterial activity or target selectivity, conjugation with photosensitizers for improving photodynamic therapy (PDT) or the attachment to particles, to name only a few. Owing to the enormous resonance of antimicrobial conjugates in the literature so far, this research topic seems to be very attractive to different scientific fields, like medicine, biology, biochemistry or chemistry. PMID:27187357

  1. The role of antimicrobial peptides in animal defenses.


    Hancock, R E; Scott, M G


    It is becoming clear that the cationic antimicrobial peptides are an important component of the innate defenses of all species of life. Such peptides can be constitutively expressed or induced by bacteria or their products. The best peptides have good activities vs. a broad range of bacterial strains, including antibiotic-resistant isolates. They kill very rapidly, do not easily select resistant mutants, are synergistic with conventional antibiotics, other peptides, and lysozyme, and are able to kill bacteria in animal models. It is known that bacterial infections, especially when treated with antibiotics, can lead to the release of bacterial products such as lipopolysaccharide (LPS) and lipoteichoic acid, resulting in potentially lethal sepsis. In contrast to antibiotics, the peptides actually prevent cytokine induction by bacterial products in tissue culture and human blood, and they block the onset of sepsis in mouse models of endotoxemia. Consistent with this, transcriptional gene array experiments using a macrophage cell line demonstrated that a model peptide, CEMA, blocks the expression of many genes whose transcription was induced by LPS. The peptides do this in part by blocking LPS interaction with the serum protein LBP. In addition, CEMA itself has a direct effect on macrophage gene expression. Because cationic antimicrobial peptides are induced by LPS and are able to dampen the septic response of animal cells to LPS, we propose that, in addition to their role in direct and lysozyme-assisted killing of microbes, they have a role in feedback regulation of cytokine responses. We are currently developing variant peptides as therapeutics against antibiotic-resistant infections.

  2. The role of antimicrobial peptides in animal defenses

    NASA Astrophysics Data System (ADS)

    Hancock, Robert E. W.; Scott, Monisha G.


    It is becoming clear that the cationic antimicrobial peptides are an important component of the innate defenses of all species of life. Such peptides can be constitutively expressed or induced by bacteria or their products. The best peptides have good activities vs. a broad range of bacterial strains, including antibiotic-resistant isolates. They kill very rapidly, do not easily select resistant mutants, are synergistic with conventional antibiotics, other peptides, and lysozyme, and are able to kill bacteria in animal models. It is known that bacterial infections, especially when treated with antibiotics, can lead to the release of bacterial products such as lipopolysaccharide (LPS) and lipoteichoic acid, resulting in potentially lethal sepsis. In contrast to antibiotics, the peptides actually prevent cytokine induction by bacterial products in tissue culture and human blood, and they block the onset of sepsis in mouse models of endotoxemia. Consistent with this, transcriptional gene array experiments using a macrophage cell line demonstrated that a model peptide, CEMA, blocks the expression of many genes whose transcription was induced by LPS. The peptides do this in part by blocking LPS interaction with the serum protein LBP. In addition, CEMA itself has a direct effect on macrophage gene expression. Because cationic antimicrobial peptides are induced by LPS and are able to dampen the septic response of animal cells to LPS, we propose that, in addition to their role in direct and lysozyme-assisted killing of microbes, they have a role in feedback regulation of cytokine responses. We are currently developing variant peptides as therapeutics against antibiotic-resistant infections.

  3. Evidence for adaptation from standing genetic variation on an antimicrobial peptide gene in the mussel Mytilus edulis.


    Gosset, Célia C; Do Nascimento, Joana; Augé, Marie-Thérèse; Bierne, Nicolas


    Genome scans of population differentiation identify candidate loci for adaptation but provide little information on how selection has influenced the genetic structure of these loci. Following a genome scan, we investigated the nature of the selection responsible for the outlying differentiation observed between populations of the marine mussel Mytilus edulis at a leucine/arginine polymorphism (L31R) in the antimicrobial peptide MGD2. We analysed DNA sequence polymorphisms, allele frequencies and population differentiation of polymorphisms closely linked to L31R, and pairwise and third-order linkage disequilibria. An outlying level of population differentiation was observed at L31R only, while no departure from panmixia was observed at linked loci surrounding L31R, as in most of the genome. Selection therefore seems to affect L31R directly. Three hypotheses can explain the lack of differentiation in the chromosomal region close to L31R: (i) hitchhiking has occurred but migration and recombination subsequently erased the signal, (ii) selection was weak enough and recombination strong enough to limit the hitchhiking effect to a very small chromosomal region or (iii) selection acted on a pre-existing polymorphism (i.e. standing variation) at linkage equilibrium with its background. Linkage equilibrium was observed between L31R and linked polymorphisms in every population analysed, as expected under the three hypotheses. However, linkage disequilibrium was observed in some populations between pairs of loci located upstream and downstream to L31R, generating a complex pattern of third-order linkage disequilibria which is best explained by the hypothesis of selection on a pre-existing polymorphism. We hypothesise that selection could be either balanced, maintaining alleles at different frequencies depending on the pathogen community encountered locally by mussels, or intermittent, resulting in sporadic fluctuations in allele frequency.

  4. Classification of antimicrobial peptides with imbalanced datasets

    NASA Astrophysics Data System (ADS)

    Camacho, Francy L.; Torres, Rodrigo; Ramos Pollán, Raúl


    In the last years, pattern recognition has been applied to several fields for solving multiple problems in science and technology as for example in protein prediction. This methodology can be useful for prediction of activity of biological molecules, e.g. for determination of antimicrobial activity of synthetic and natural peptides. In this work, we evaluate the performance of different physico-chemical properties of peptides (descriptors groups) in the presence of imbalanced data sets, when facing the task of detecting whether a peptide has antimicrobial activity. We evaluate undersampling and class weighting techniques to deal with the class imbalance with different classification methods and descriptor groups. Our classification model showed an estimated precision of 96% showing that descriptors used to codify the amino acid sequences contain enough information to correlate the peptides sequences with their antimicrobial activity by means of learning machines. Moreover, we show how certain descriptor groups (pseudoaminoacid composition type I) work better with imbalanced datasets while others (dipeptide composition) work better with balanced ones.

  5. Design of self-processing antimicrobial peptides for plant protection.


    Powell, W A; Catranis, C M; Maynard, C A


    Small antimicrobial peptides are excellent candidates for inclusion in self-processing proteins that could be used to confer pathogen resistance in transgenic plants. Antimicrobial peptides as small as 22 amino acids in length have been designed to incorporate the residual amino acids left from protein processing by the tobacco etch virus'(TEVs') NIa protease. Also, by minimizing the length of these peptides and the number of highly hydrophobic residues, haemolytic activity was reduced without affecting the peptide's antimicrobial activity.

  6. Cloning and expression of genes enocoding antimicrobial peptides and bradykinin from the skin and brain of Oki Tago's brown frog, Rana tagoi okiensis.


    Tazato, Shoro; Conlon, J Michael; Iwamuro, Shawichi


    Previous studies led to the isolation from skin extracts of Oki Tago's brown frog, Rana tagoi okiensis of five antimicrobial peptides belonging to the brevinin-1 (brevinin-1TOa), temporin (temporin-TOa and -TOb), and ranatuerin-2 (ranatuerin-2TOa and -2TOb) families, and bradykinin (BK) identical to mammalian BK. Using the reverse-transcription polymerase chain reaction (RT-PCR), we have now cloned from skin total RNA preparations cDNAs encoding biosynthetic precursors of brevinin-1TOa and brevinin-1TOb (containing the substitution Gly(1)-->Val), temporin-TOa and -TOb, and ranatuerin-2TOa and -2TOb. In addition, three cDNA clones encoding preprobradykinins were obtained that contained either one, two, or three tandem repeats of the sequence of BK followed by the sequence of [Thr(6)]-BK. In tissue expression analyses, preprobrevinin-1, preprotemporin, and preproranatuerin-2 gene transcripts were detected at higher levels in brain compared with peripheral tissues (heart, small intestine, kidney, liver lung, skeletal muscle, stomach, and testis). RT-PCR of brain RNA resulted in the amplification of cDNAs encoding ranatuerin-2TOc and ranatuerin-2TOd that contained the amino acid substitutions Lys(6)-->Arg and Ala(14)-->Thr, respectively compared with ranatuerin-2TOb. cDNAs encoding preprobrevinin-1TOa and preprotemporin-TOa were amplified from brain RNA as well as a second preprotemporin cDNA that contained a 10-nucleotide insertion that introduced a frame shift resulting in a premature stop codon. A cDNA encoding a novel peptide, DK25 (DVNDLKNLCAKTHNLLPMCAMFGKK) was amplified from brain RNA but neither DK25 nor its putative post-translationally modified form, DF22-amide (DVNDLKNLCAKTHNLLPMCAMF.NH(2)) displayed antimicrobial or hemolytic activities.

  7. Biologically Active and Antimicrobial Peptides from Plants

    PubMed Central

    Salas, Carlos E.; Badillo-Corona, Jesus A.; Ramírez-Sotelo, Guadalupe; Oliver-Salvador, Carmen


    Bioactive peptides are part of an innate response elicited by most living forms. In plants, they are produced ubiquitously in roots, seeds, flowers, stems, and leaves, highlighting their physiological importance. While most of the bioactive peptides produced in plants possess microbicide properties, there is evidence that they are also involved in cellular signaling. Structurally, there is an overall similarity when comparing them with those derived from animal or insect sources. The biological action of bioactive peptides initiates with the binding to the target membrane followed in most cases by membrane permeabilization and rupture. Here we present an overview of what is currently known about bioactive peptides from plants, focusing on their antimicrobial activity and their role in the plant signaling network and offering perspectives on their potential application. PMID:25815307

  8. Biologically active and antimicrobial peptides from plants.


    Salas, Carlos E; Badillo-Corona, Jesus A; Ramírez-Sotelo, Guadalupe; Oliver-Salvador, Carmen


    Bioactive peptides are part of an innate response elicited by most living forms. In plants, they are produced ubiquitously in roots, seeds, flowers, stems, and leaves, highlighting their physiological importance. While most of the bioactive peptides produced in plants possess microbicide properties, there is evidence that they are also involved in cellular signaling. Structurally, there is an overall similarity when comparing them with those derived from animal or insect sources. The biological action of bioactive peptides initiates with the binding to the target membrane followed in most cases by membrane permeabilization and rupture. Here we present an overview of what is currently known about bioactive peptides from plants, focusing on their antimicrobial activity and their role in the plant signaling network and offering perspectives on their potential application.

  9. Hepcidins in amphibians and fishes: Antimicrobial peptides or iron-regulatory hormones?


    Shi, Jishu; Camus, Alvin C


    Hepcidin, originally identified as a 25 amino acid peptide antibiotic produced in the liver, is a key regulator of iron balance and recycling in humans and mice. Closely related hepcidin genes and peptides also have been identified in other mammals, amphibians, and a number of fish species. We hypothesize that hepcidin, the iron-regulatory hormone in humans, may have evolved from an antimicrobial peptide in fishes. In this review we will highlight the evidence that indicates hepcidin evolved from an antimicrobial peptide to an iron-regulatory hormone in vertebrate evolution. This evidence includes the discovery of hepcidin as an antimicrobial peptide and iron-regulatory hormone, structural comparison of mammalian hepcidins and nonmammalian hepcidins, and the cellular and molecular evidence indicating that, while some fish hepcidins may serve only as antimicrobial peptides, other fish and amphibian hepcidins may function as iron regulators.

  10. Therapeutic antimicrobial peptides may compromise natural immunity

    PubMed Central

    Habets, Michelle G. J. L.; Brockhurst, Michael A.


    Antimicrobial peptides (AMPs) have been proposed as a promising new class of antimicrobials despite warnings that therapeutic use could drive the evolution of pathogens resistant to our own immunity peptides. Using experimental evolution, we demonstrate that Staphylococcus aureus rapidly evolved resistance to pexiganan, a drug-candidate for diabetic leg ulcer infections. Evolved resistance was costly in terms of impaired growth rate, but costs-of-resistance were completely ameliorated by compensatory adaptation. Crucially, we show that, in some populations, experimentally evolved resistance to pexiganan provided S. aureus with cross-resistance to human-neutrophil-defensin-1, a key component of the innate immune response to infection. This unintended consequence of therapeutic use could drastically undermine our innate immune system's ability to control and clear microbial infections. Our results therefore highlight grave potential risks of AMP therapies, with implications for their development. PMID:22279153

  11. Antimicrobial Peptides, Skin Infections and Atopic Dermatitis

    PubMed Central

    Hata, Tissa R.; Gallo, Richard L.


    The innate immune system evolved over 2 billion years ago to first recognize pathogens then eradicate them. Several distinct defects in this ancient but rapidly responsive element of human immune defense account for the increased incidence of skin infections in atopics. These defects include abnormalities in the physical barrier of the epidermis, alterations in microbial pattern recognition receptors such as toll receptors and NOD, and a diminished capacity to increase the expression of antimicrobial peptides during inflammation. Several antimicrobial peptides are affected including; cathelicidin, HBD-2, and HBD-3, which are lower in lesional skin of atopics compared to other inflammatory skin diseases, and dermcidin, which is decreased in sweat. Other defects in the immune defense barrier of atopics include a relative deficiency in plasmacytoid dendritic cells. In the future, understanding the cause of these defects may allow therapeutic intervention to reduce the incidence of infection in atopic individuals and potentially decrease the severity of this disorder. PMID:18620136

  12. Computational resources and tools for antimicrobial peptides.


    Liu, Shicai; Fan, Linlin; Sun, Jian; Lao, Xingzhen; Zheng, Heng


    Antimicrobial peptides (AMPs), as evolutionarily conserved components of innate immune system, protect against pathogens including bacteria, fungi, viruses, and parasites. In general, AMPs are relatively small peptides (<10 kDa) with cationic nature and amphipathic structure and have modes of action different from traditional antibiotics. Up to now, there are more than 19 000 AMPs that have been reported, including those isolated from nature sources or by synthesis. They have been considered to be promising substitutes of conventional antibiotics in the quest to address the increasing occurrence of antibiotic resistance. However, most AMPs have modest direct antimicrobial activity, and their mechanisms of action, as well as their structure-activity relationships, are still poorly understood. Computational strategies are invaluable assets to provide insight into the activity of AMPs and thus exploit their potential as a new generation of antimicrobials. This article reviews the advances of AMP databases and computational tools for the prediction and design of new active AMPs. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd.

  13. Antimicrobial peptides: a review of how peptide structure impacts antimicrobial activity

    NASA Astrophysics Data System (ADS)

    Soares, Jason W.; Mello, Charlene M.


    Antimicrobial peptides (AMPs) have been discovered in insects, mammals, reptiles, and plants to protect against microbial infection. Many of these peptides have been isolated and studied exhaustively to decipher the molecular mechanisms that impart protection against infectious bacteria, fungi, and viruses. Unfortunately, the molecular mechanisms are still being debated within the scientific community but valuable clues have been obtained through structure/function relationship studies1. Biophysical studies have revealed that cecropins, isolated from insects and pigs, exhibit random structure in solution but undergo a conformational change to an amphipathic α-helix upon interaction with a membrane surface2. The lack of secondary structure in solution results in an extremely durable peptide able to survive exposure to high temperatures, organic solvents and incorporation into fibers and films without compromising antibacterial activity. Studies to better understand the antimicrobial action of cecropins and other AMPs have provided insight into the importance of peptide sequence and structure in antimicrobial activities. Therefore, enhancing our knowledge of how peptide structure imparts function may result in customized peptide sequences tailored for specific applications such as targeted cell delivery systems, novel antibiotics and food preservation additives. This review will summarize the current state of knowledge with respect to cell binding and antimicrobial activity of AMPs focusing primarily upon cecropins.

  14. Haemophilus ducreyi is resistant to human antimicrobial peptides.


    Mount, Kristy L B; Townsend, Carisa A; Bauer, Margaret E


    We examined the susceptibility of Haemophilus ducreyi to antimicrobial peptides likely to be encountered in vivo during human infection. H. ducreyi was significantly more resistant than Escherichia coli to the bactericidal effects of all peptides tested. Class I and II H. ducreyi strains exhibited similar levels of resistance to antimicrobial peptides.

  15. Antimicrobial peptide precursor structures suggest effective production strategies.


    Vassilevski, Alexander A; Kozlov, Sergey A; Grishin, Eugene V


    Antimicrobial peptides (AMPs) constitute a diverse group of compounds that serve a common goal that is host organism defense from infection. Due to their antimicrobial properties, these molecules attract practical interest as potential antibiotics for medical and veterinary use as well as enhancers of plant disease resistance for agriculture. Broad AMP utilization is restricted by the expensiveness of their production using conventional chemical synthesis. For this reason, a number of chimeric genes have been developed for recombinant AMP production in prokaryotes. However, recombinant peptide instability and/or high toxicity to host cells dramatically reduce the yields. In this paper, we review patented strategies of fusion protein design for AMP production. In several cases, the proposed strategies clearly mimic the organization of natural AMP precursor proteins. We describe the main principals of natural AMP precursor organization and fusion constructs adopted and/or artificially designed by man.

  16. Cloning, phenotypic expression, and DNA sequence of the gene for lactacin F, an antimicrobial peptide produced by Lactobacillus spp.

    PubMed Central

    Muriana, P M; Klaenhammer, T R


    Lactacin F is a heat-stable bacteriocin produced by Lactobacillus acidophilus 11088. A 63-mer oligonucleotide probe deduced from the N-terminal lactacin F amino acid sequence was used to clone the putative laf structural gene from plasmid DNA of a lactacin F-producing transconjugant, L. acidophilus T143. One clone, NCK360, harbored a recombinant plasmid, pTRK160, which contained a 2.2-kb EcoRI fragment of the size expected from hybridization experiments. An Escherichia coli-L. acidophilus shuttle vector was constructed, and a subclone (pTRK162) containing the 2.2-kb EcoRI fragment was introduced by electroporation into two lactacin F-negative strains, L. acidophilus 89 and 88-C. Lactobacillus transformants containing pTRK162 expressed lactacin F activity and immunity. Bacteriocin produced by the transformants exhibited an inhibitory spectrum and heat stability identical to those of the wild-type bacteriocin. An 873-bp region of the 2.2-kb fragment was sequenced by using a 20-mer degenerate lactacin F-specific primer to initiate sequencing from within the lactacin F structural gene. Analysis of the resulting sequence identified an open reading frame which could encode a protein of 75 amino acids. The 25 N-terminal amino acids for lactacin F were identified within the open reading frame along with an N-terminal extension, possibly a signal sequence. The lactacin F N-terminal sequence, through the remainder of the open reading frame (57 amino acids; 6.3 kDa), correlated extremely well with composition analyses of purified lactacin F which also predicted a size of 51 to 56 amino acid residues. Molecular characterization of lactacin F identified a small hydrophobic peptide that may be representative of a common bacteriocin class in lactic acid bacteria. Images PMID:1900281

  17. Identification of antimicrobial peptides by using eigenvectors.


    Polanco, Carlos


    Antibacterial peptides are subject to broad research due to their potential application and the benefit they can provide for a wide range of diseases. In this work, a mathematical-computational method, called the Polarity Vector Method, is introduced that has a high discriminative level (>70%) to identify peptides associated with Gram (-) bacteria, Gram (+) bacteria, cancer cells, fungi, insects, mammalian cells, parasites, and viruses, taken from the Antimicrobial Peptides Database. This supervised method uses only eigenvectors from the incident polar matrix of the group studied. It was verified with a comparative study with another extensively verified method developed previously by our team, the Polarity Index Method. The number of positive hits of both methods was up to 98% in all the tests conducted.

  18. A novel class of antimicrobial peptides from the scorpion Heterometrus spinifer.


    Nie, Yao; Zeng, Xian-Chun; Yang, Ye; Luo, Feng; Luo, Xuesong; Wu, Shifen; Zhang, Lei; Zhou, Jianping


    The venom peptides from the scorpion Heterometrus spinifer have been poorly characterized so far. Here, we identified a novel class of antimicrobial peptides from the venom gland of H. spinifer, which were referred to as HsAp, HsAp2, HsAp3 and HsAp4, respectively. Each of the four peptides consists of 29 amino acid residues, and is cationic and weakly amphipathic. They display no significant homology to any other known peptides, and thus represent a new family of venom peptides from scorpions. Antimicrobial assay showed that HsAp is able to inhibit the growth of both Gram-negative and Gram-positive bacteria with the MIC values of 11.8-51.2 μM. HsAp is also able to inhibit the growth of the tested fungus. Genomic analysis indicated that the genes of all the four peptides are intronless. Our studies expand the families of antimicrobial peptides from scorpions.

  19. Peptides with Dual Antimicrobial and Anticancer Activities

    PubMed Central

    Felício, Mário R.; Silva, Osmar N.; Gonçalves, Sônia; Santos, Nuno C.; Franco, Octávio L.


    In recent years, the number of people suffering from cancer and multi-resistant infections has increased, such that both diseases are already seen as current and future major causes of death. Moreover, chronic infections are one of the main causes of cancer, due to the instability in the immune system that allows cancer cells to proliferate. Likewise, the physical debility associated with cancer or with anticancer therapy itself often paves the way for opportunistic infections. It is urgent to develop new therapeutic methods, with higher efficiency and lower side effects. Antimicrobial peptides (AMPs) are found in the innate immune system of a wide range of organisms. Identified as the most promising alternative to conventional molecules used nowadays against infections, some of them have been shown to have dual activity, both as antimicrobial and anticancer peptides (ACPs). Highly cationic and amphipathic, they have demonstrated efficacy against both conditions, with the number of nature-driven or synthetically designed peptides increasing year by year. With similar properties, AMPs that can also act as ACPs are viewed as future chemotherapeutic drugs, with the advantage of low propensity to resistance, which started this paradigm in the pharmaceutical market. These peptides have already been described as molecules presenting killing mechanisms at the membrane level, but also acting toward intracellular targets, which increases their success compartively to one-target specific drugs. This review will approach the desirable characteristics of small peptides that demonstrated dual activity against microbial infections and cancer, as well as the peptides engaged in clinical trials. PMID:28271058

  20. A novel Toll like receptor with two TIR domains (HcToll-2) is involved in regulation of antimicrobial peptide gene expression of Hyriopsis cumingii.


    Ren, Qian; Lan, Jiang-Feng; Zhong, Xue; Song, Xiao-Jun; Ma, Fei; Hui, Kai-Min; Wang, Wen; Yu, Xiao-Qiang; Wang, Jin-Xing


    Animal Toll-like receptors (TLRs) are involved in innate immunity. Toll proteins are generally transmembrane proteins. In this study, an atypical Toll-like receptor (HcToll-2) was identified from the triangle-shell pearl mussel Hyriopsis cumingii, which belongs to phylum Mollusca. Unlike the typical Toll like receptors with extracellular leucine-rich repeats (LRRs), transmembrane, and intracellular Toll/interleukin-1 receptor (TIR) domains, HcToll-2 has two homologous TIR domains located at the C-terminal (designated as HcTIR1 and HcTIR2) and lacks a transmembrane domain. Phylogenetic analysis showed that HcTIR1 was clustered with TIR of sea anemone Toll, and HcTIR2 was clustered with TIR of Drosophila Toll. HcToll-2 mRNA could be detected in the hepatopancreas and was upregulated after challenge with Escherichia coli and Staphylococcus aureus. Recombinant HcLRR protein with GST tag could bind to bacteria and also to LPS and PGN. Over-expression of both HcTIR1 and HcTIR2 induced drosomycin genes in Drosophila S2 cells. RNAi analysis showed that HcToll-2 was required for the expression of theromacin, which is a cysteine-rich antimicrobial peptide (AMP) gene. This research is the first report of an atypical Toll-like receptor HcToll-2 involved in antibacterial immunity through induction of AMP expression.

  1. The Erwinia amylovora PhoPQ system is involved in resistance to antimicrobial peptide and suppresses gene expression of two novel type III secretion systems.


    Nakka, Sridevi; Qi, Mingsheng; Zhao, Youfu


    The PhoPQ system is a pleiotropic two-component signal transduction system that controls many pathogenic properties in several mammalian and plant pathogens. Three different cues have been demonstrated to activate the PhoPQ system including a mild acidic pH, antimicrobial peptides, and low Mg(2+). In this study, our results showed that phoPQ mutants were more resistant to strong acidic conditions (pH 4.5 or 5) than that of the wild-type (WT) strain, suggesting that this system in Erwinia amylovora may negatively regulate acid resistance gene expression. Furthermore, the PhoPQ system negatively regulated gene expression of two novel type III secretion systems in E. amylovora. These results are in contrast to those reported for the PhoPQ system in Salmonella and Xanthomonas, where it positively regulates type III secretion system and acid resistance. In addition, survival of phoPQ mutants was about 10-fold lower than that of WT when treated with cecropin A at pH 5.5, suggesting that the PhoPQ system renders the pathogen more resistant to cecropin A.

  2. Specific expression of antimicrobial peptide and HSP70 genes in response to heat-shock and several bacterial challenges in mussels.


    Cellura, Cinzia; Toubiana, Mylène; Parrinello, Nicolò; Roch, Philippe


    Defensin, mytilin and myticin are antimicrobial peptides (AMP) involved in mussel innate immunity. Their in vitro antibacterial activity is different according to the targeted bacterial species. To determine if this specificity is correlated to different regulations of gene expressions, adult mussels were challenged in vivo with either Vibrio splendidus LGP32, Vibrio anguillarum, Micrococcus lysodeikticus or by heat shock. RNAs were isolated from circulating hemocytes and AMP mRNAs were quantified by Q-PCR using 28S rRNA as housekeeping gene. In addition, HSP70 gene expression was also quantified as representing non-specific response to stress. In naïve mussels, the three AMP mRNAs were present in dramatically different quantities. Compared to defensin, myticin was expressed 300-fold more and mytilin 30-fold more. HSP70 was found expressed 80-fold more than defensin. AMP genes were differentially regulated according to the challenging bacteria, M. lysodeikticus being the only one inducing down-regulation. Such variations in mRNA quantities were observed immediately after challenging, lasting less than 24h. Only V. anguillarum effect was observed later, between 12h and 3 days post-challenge. Compared to their background expression in naïve mussels, the major effect of V. splendidus was the decrease of mytilin and myticin mRNAs, V. anguillarum mainly increased both mytilin and HSP70 mRNAs, whereas M. lysodeikticus almost suppressed defensin mRNA. As expected, heat shock increased HSP70 mRNA, but also myticin mRNA. Consequently, AMP genes responded specifically to the challenges, confirming that at least some of the innate immune mechanisms are specifically orientated.

  3. Cationic Antimicrobial Peptide Resistance in Neisseria meningitidis

    PubMed Central

    Tzeng, Yih-Ling; Ambrose, Karita D.; Zughaier, Susu; Zhou, Xiaoliu; Miller, Yoon K.; Shafer, William M.; Stephens, David S.


    Cationic antimicrobial peptides (CAMPs) are important components of the innate host defense system against microbial infections and microbial products. However, the human pathogen Neisseria meningitidis is intrinsically highly resistant to CAMPs, such as polymyxin B (PxB) (MIC ≥ 512 μg/ml). To ascertain the mechanisms by which meningococci resist PxB, mutants that displayed increased sensitivity (≥4-fold) to PxB were identified from a library of mariner transposon mutants generated in a meningococcal strain, NMB. Surprisingly, more than half of the initial PxB-sensitive mutants had insertions within the mtrCDE operon, which encodes proteins forming a multidrug efflux pump. Additional PxB-sensitive mariner mutants were identified from a second round of transposon mutagenesis performed in an mtr efflux pump-deficient background. Further, a mutation in lptA, the phosphoethanolamine (PEA) transferase responsible for modification of the lipid A head groups, was identified to cause the highest sensitivity to PxB. Mutations within the mtrD or lptA genes also increased meningococcal susceptibility to two structurally unrelated CAMPs, human LL-37 and protegrin-1. Consistently, PxB neutralized inflammatory responses elicited by the lptA mutant lipooligosaccharide more efficiently than those induced by wild-type lipooligosaccharide. mariner mutants with increased resistance to PxB were also identified in NMB background and found to contain insertions within the pilMNOPQ operon involved in pilin biogenesis. Taken together, these data indicated that meningococci utilize multiple mechanisms including the action of the MtrC-MtrD-MtrE efflux pump and lipid A modification as well as the type IV pilin secretion system to modulate levels of CAMP resistance. The modification of meningococcal lipid A head groups with PEA also prevents neutralization of the biological effects of endotoxin by CAMP. PMID:16030233

  4. Resistance to Antimicrobial Peptides in Vibrios

    PubMed Central

    Destoumieux-Garzón, Delphine; Duperthuy, Marylise; Vanhove, Audrey Sophie; Schmitt, Paulina; Wai, Sun Nyunt


    Vibrios are associated with a broad diversity of hosts that produce antimicrobial peptides (AMPs) as part of their defense against microbial infections. In particular, vibrios colonize epithelia, which function as protective barriers and express AMPs as a first line of chemical defense against pathogens. Recent studies have shown they can also colonize phagocytes, key components of the animal immune system. Phagocytes infiltrate infected tissues and use AMPs to kill the phagocytosed microorganisms intracellularly, or deliver their antimicrobial content extracellularly to circumvent tissue infection. We review here the mechanisms by which vibrios have evolved the capacity to evade or resist the potent antimicrobial defenses of the immune cells or tissues they colonize. Among their strategies to resist killing by AMPs, primarily vibrios use membrane remodeling mechanisms. In particular, some highly resistant strains substitute hexaacylated Lipid A with a diglycine residue to reduce their negative surface charge, thereby lowering their electrostatic interactions with cationic AMPs. As a response to envelope stress, which can be induced by membrane-active agents including AMPs, vibrios also release outer membrane vesicles to create a protective membranous shield that traps extracellular AMPs and prevents interaction of the peptides with their own membranes. Finally, once AMPs have breached the bacterial membrane barriers, vibrios use RND efflux pumps, similar to those of other species, to transport AMPs out of their cytoplasmic space. PMID:27025756

  5. The shrimp IKK-NF-κB signaling pathway regulates antimicrobial peptide expression and may be subverted by white spot syndrome virus to facilitate viral gene expression.


    Wang, Pei-Hui; Gu, Zhi-Hua; Wan, Ding-Hui; Liu, Bo-Du; Huang, Xian-De; Weng, Shao-Ping; Yu, Xiao-Qiang; He, Jian-Guo


    The IκB kinases IKKα and IKKβ and the IKK-related kinases TANK-binding kinase 1 (TBK1) and IKKε are the master regulators of the NF-κB signaling pathway. Although this pathway has been extensively studied in mammals, less attention has been paid in crustaceans, which have significant economic value. Here, we report the cloning and functional studies of two IKK homologs, LvIKKβ and LvIKKε, from Pacific white shrimp, Litopenaeus vannamei. LvIKKβ and LvIKKε mRNAs are widely expressed in different tissues and are responsive to white spot syndrome virus (WSSV) infection. When overexpressed in Drosophila S2 cells, LvIKKβ but not LvIKKε activates the promoters of NF-κB pathway-controlled antimicrobial peptide genes (AMPs), such as the Penaeidins (PENs). In HEK 293T cells, both LvIKKβ and LvIKKε activate an NF-κB reporter. The silencing of LvIKKβ or LvIKKε using double-stranded RNA (dsRNA)-mediated RNA interference (RNAi) decreases the expression of L. vannamei AMPs, including PENs, lysozyme and crustins. Intriguingly, LvIKKβ- or LvIKKε-silenced L. vannamei are resistant to WSSV infection. We hypothesized that successful infection with WSSV requires the activation of the IKK-NF-κB signaling pathway to modulate viral gene expression. We constructed luciferase reporters for 147 WSSV genes. By screening, we found that the WSV051, WSV059, WSV069, WSV083, WSV090, WSV107, WSV244, WSV303, WSV371 and WSV445 promoters can be activated by LvIKKβ or LvIKKε in Drosophila S2 cells. Taken together, our results reveal that LvIKKβ and LvIKKε may participate in the regulation of shrimp AMPs and that WSSV may subvert the L. vannamei IKK-NF-κB signaling pathway to facilitate viral gene expression.

  6. The Antimicrobial and Antiviral Applications of Cell-Penetrating Peptides.


    Pärn, Kalle; Eriste, Elo; Langel, Ülo


    Over the past two decades, cell-penetrating peptides (CPPs) have become increasingly popular both in research and in application. There have been numerous studies on the physiochemical characteristics and behavior of CPPs in various environments; likewise, the mechanisms of entry and delivery capabilities of these peptides have also been extensively researched. Besides the fundamental issues, there is an enormous interest in the delivery capabilities of the peptides as the family of CPPs is a promising and mostly non-toxic delivery vector candidate for numerous medical applications such as gene silencing, transgene delivery, and splice correction. Lately, however, there has been an emerging field of study besides the high-profile gene therapy applications-the use of peptides and CPPs to combat various infections caused by harmful bacteria, fungi, and viruses.In this chapter, we aim to provide a short overview of the history and properties of CPPs which is followed by more thorough descriptions of antimicrobial and antiviral peptides. To achieve this, we analyze the origin of such peptides, give an overview of the mechanisms of action and discuss the various practical applications which are ongoing or have been suggested based on research.

  7. Antiendotoxin activity of cationic peptide antimicrobial agents.


    Gough, M; Hancock, R E; Kelly, N M


    The endotoxin from gram-negative bacteria consists of a molecule lipopolysaccharide (LPS) which can be shed by bacteria during antimicrobial therapy. A resulting syndrome, endotoxic shock, is a leading cause of death in the developed world. Thus, there is great interest in the development of antimicrobial agents which can reverse rather than promote sepsis, especially given the recent disappointing clinical performance of antiendotoxin therapies. We describe here two small cationic peptides, MBI-27 and MBI-28, which have both antiendotoxic and antibacterial activities in vitro and in vivo in animal models. We had previously demonstrated that these peptides bind to LPS with an affinity equivalent to that of polymyxin B. Consistent with this, the peptides blocked the ability of LPS and intact cells to induce the endotoxic shock mediator, tumor necrosis factor (TNF), upon incubation with the RAW 264.7 murine macrophage cell line. MBI-28 was equivalent to polymyxin B in its ability to block LPS induction of TNF by this cell line, even when added 60 min after the TNF stimulus. Furthermore, MBI-28 offered significant protection in a galactosamine-sensitized mouse model of lethal endotoxic shock. This protection correlated with the ability of MBI-28 to reduce LPS-induced circulating TNF by nearly 90% in this mouse model. Both MBI-27 and MBI-28 demonstrated antibacterial activity against gram-negative bacteria in vitro and in vivo against Pseudomonas aeruginosa infections in neutropenic mice.

  8. Antiendotoxin activity of cationic peptide antimicrobial agents.

    PubMed Central

    Gough, M; Hancock, R E; Kelly, N M


    The endotoxin from gram-negative bacteria consists of a molecule lipopolysaccharide (LPS) which can be shed by bacteria during antimicrobial therapy. A resulting syndrome, endotoxic shock, is a leading cause of death in the developed world. Thus, there is great interest in the development of antimicrobial agents which can reverse rather than promote sepsis, especially given the recent disappointing clinical performance of antiendotoxin therapies. We describe here two small cationic peptides, MBI-27 and MBI-28, which have both antiendotoxic and antibacterial activities in vitro and in vivo in animal models. We had previously demonstrated that these peptides bind to LPS with an affinity equivalent to that of polymyxin B. Consistent with this, the peptides blocked the ability of LPS and intact cells to induce the endotoxic shock mediator, tumor necrosis factor (TNF), upon incubation with the RAW 264.7 murine macrophage cell line. MBI-28 was equivalent to polymyxin B in its ability to block LPS induction of TNF by this cell line, even when added 60 min after the TNF stimulus. Furthermore, MBI-28 offered significant protection in a galactosamine-sensitized mouse model of lethal endotoxic shock. This protection correlated with the ability of MBI-28 to reduce LPS-induced circulating TNF by nearly 90% in this mouse model. Both MBI-27 and MBI-28 demonstrated antibacterial activity against gram-negative bacteria in vitro and in vivo against Pseudomonas aeruginosa infections in neutropenic mice. PMID:8945527

  9. Antimicrobial peptides as potential new antifungals.


    Müller, F M; Lyman, C A; Walsh, T J


    Ribosomally synthesized natural antimicrobial peptides (AP) and their synthetic derivatives are small, cationic, amphipathic molecules of 12-50 amino acids with unusually broad activity spectra. These peptides kill microorganisms by a common mechanism, which involves binding to the lipid bilayer of biological membranes, forming pores, and ultimately followed by cell lysis. Several AP from mammals, amphibians, insects, plants and their synthetic derivatives demonstrate promising in vitro activity against various pathogenic fungi including azole-resistant Candida albicans strains. In addition to their antimicrobial activity, some AP such as lactoferrin, interact with a variety of host cells and can increase the activity of natural killer and lymphokine activated killer cells. Pretreatment of polymorphonuclear neutrophil leukocytes (PMN) or monocytes with these AP also may upregulate superoxide release. AP as potential new antifungal agents offer some advantages, such as rapid killing of pathogenic fungi and the difficulty to raise mutants resistant to these peptides. AP are limited by their nonselective toxicity, stability, immunogenicity and their costs of production. Potential clinical applications of AP in the future have to be further explored in preclinical and clinical studies to assess their impact as a new class of antifungals.

  10. Cationic Hydrophobic Peptides with Antimicrobial Activity

    PubMed Central

    Stark, Margareta; Liu, Li-Ping; Deber, Charles M.


    The MICs of cationic, hydrophobic peptides of the prototypic sequence KKAAAXAAAAAXAAWAAXAAAKKKK-amide (where X is one of the 20 commonly occurring amino acids) are in a low micromolar range for a panel of gram-negative and gram-positive bacteria, with no or low hemolytic activity against human and rabbit erythrocytes. The peptides are active only when the average segmental hydrophobicity of the 19-residue core is above an experimentally determined threshold value (where X is Phe, Trp, Leu, Ile, Met, Val, Cys, or Ala). Antimicrobial activity could be increased by using peptides that were truncated from the prototype length to 11 core residues, with X being Phe and with 6 Lys residues grouped at the N terminus. We propose a mechanism for the interaction between these peptides and bacterial membranes similar to the “carpet model,” wherein the Lys residues interact with the anionic phospholipid head groups in the bacterial membrane surface and the hydrophobic core portion of the peptide is then able to interact with the lipid bilayer, causing disruption of the bacterial membrane. PMID:12384369

  11. Antimicrobial peptides in the centipede Scolopendra subspinipes mutilans.


    Yoo, Won Gi; Lee, Joon Ha; Shin, Younhee; Shim, Jae-Young; Jung, Myunghee; Kang, Byeong-Chul; Oh, Jaedon; Seong, Jiyeon; Lee, Hak Kyo; Kong, Hong Sik; Song, Ki-Duk; Yun, Eun-Young; Kim, In-Woo; Kwon, Young-Nam; Lee, Dong Gun; Hwang, Ui-Wook; Park, Junhyung; Hwang, Jae Sam


    The centipede Scolopendra subspinipes mutilans is an environmentally beneficial and medically important arthropod species. Although this species is increasingly applied as a reliable source of new antimicrobial peptides, the transcriptome of this species is a prerequisite for more rational selection of antimicrobial peptides. In this report, we isolated total RNA from the whole body of adult centipedes, S. subspinipes mutilans, that were nonimmunized and immunized against Escherichia coli, and we generated a total of 77,063 pooled contigs and singletons using high-throughput sequencing. To screen putative antimicrobial peptides, in silico analyses of the S. subspinipes mutilans transcriptome were performed based on the physicochemical evidence of length, charge, isoelectric point, and in vitro and in vivo aggregation scores together with the existence of continuous antimicrobial peptide stretches. Moreover, we excluded some transcripts that showed similarity with both previously known antimicrobial peptides and the human proteome, had a proteolytic cleavage site, and had downregulated expression compared with the nonimmunized sample. As a result, we selected 17 transcripts and tested their antimicrobial activity with a radial diffusion assay. Among them, ten synthetic peptides experimentally showed antimicrobial activity against microbes and no toxicity to mouse erythrocytes. Our results provide not only a useful set of antimicrobial peptide candidates and an efficient strategy for novel antimicrobial peptide development but also the transcriptome data of a big centipede as a valuable resource.

  12. Fatty acid conjugation enhances the activities of antimicrobial peptides.


    Li, Zhining; Yuan, Penghui; Xing, Meng; He, Zhumei; Dong, Chuanfu; Cao, Yongchang; Liu, Qiuyun


    Antimicrobial peptides are small molecules that play a crucial role in innate immunity in multi-cellular organisms, and usually expressed and secreted constantly at basal levels to prevent infection, but local production can be augmented upon an infection. The clock is ticking as rising antibiotic abuse has led to the emergence of many drug resistance bacteria. Due to their broad spectrum antibiotic and antifungal activities as well as anti-viral and anti-tumor activities, efforts are being made to develop antimicrobial peptides into future microbial agents. This article describes some of the recent patents on antimicrobial peptides with fatty acid conjugation. Potency and selectivity of antimicrobial peptide can be modulated with fatty acid tails of variable length. Interaction between membranes and antimicrobial peptides was affected by fatty acid conjugation. At concentrations above the critical miscelle concentration (CMC), propensity of solution selfassembly hampered binding of the peptide to cell membranes. Overall, fatty acid conjugation has enhanced the activities of antimicrobial peptides, and occasionally it rendered inactive antimicrobial peptides to be bioactive. Antimicrobial peptides can not only be used as medicine but also as food additives.

  13. Plant Antimicrobial Peptides as Potential Anticancer Agents

    PubMed Central

    Guzmán-Rodríguez, Jaquelina Julia; López-Gómez, Rodolfo


    Antimicrobial peptides (AMPs) are part of the innate immune defense mechanism of many organisms and are promising candidates to treat infections caused by pathogenic bacteria to animals and humans. AMPs also display anticancer activities because of their ability to inactivate a wide range of cancer cells. Cancer remains a cause of high morbidity and mortality worldwide. Therefore, the development of methods for its control is desirable. Attractive alternatives include plant AMP thionins, defensins, and cyclotides, which have anticancer activities. Here, we provide an overview of plant AMPs anticancer activities, with an emphasis on their mode of action, their selectivity, and their efficacy. PMID:25815333

  14. Peptidomics and genomics analysis of novel antimicrobial peptides from the frog, Rana nigrovittata.


    Ma, Yufang; Liu, Cunbao; Liu, Xiuhong; Wu, Jing; Yang, Hailong; Wang, Yipeng; Li, Jianxu; Yu, Haining; Lai, Ren


    Much attention has been paid on amphibian peptides for their wide-ranging pharmacological properties, clinical potential, and gene-encoded origin. More than 300 antimicrobial peptides (AMPs) from amphibians have been studied. Peptidomics and genomics analysis combined with functional test including microorganism killing, histamine-releasing, and mast cell degranulation was used to investigate antimicrobial peptide diversity. Thirty-four novel AMPs from skin secretions of Rana nigrovittata were identified in current work, and they belong to 9 families, including 6 novel families. Other three families are classified into rugosin, gaegurin, and temporin family of amphibian AMP, respectively. These AMPs share highly conserved preproregions including signal peptides and spacer acidic peptides, while greatly diversified on mature peptides structures. In this work, peptidomics combined with genomics analysis was confirmed to be an effective way to identify amphibian AMPs, especially novel families. Some AMPs reported here will provide leading molecules for designing novel antimicrobial agents.

  15. De Novo Transcriptome Analysis and Detection of Antimicrobial Peptides of the American Cockroach Periplaneta americana (Linnaeus)

    PubMed Central

    Subramaniyam, Sathiyamoorthy; Yun, Eun-Young; Kim, Iksoo; Park, Junhyung; Hwang, Jae Sam


    Cockroaches are surrogate hosts for microbes that cause many human diseases. In spite of their generally destructive nature, cockroaches have recently been found to harbor potentially beneficial and medically useful substances such as drugs and allergens. However, genomic information for the American cockroach (Periplaneta americana) is currently unavailable; therefore, transcriptome and gene expression profiling is needed as an important resource to better understand the fundamental biological mechanisms of this species, which would be particularly useful for the selection of novel antimicrobial peptides. Thus, we performed de novo transcriptome analysis of P. americana that were or were not immunized with Escherichia coli. Using an Illumina HiSeq sequencer, we generated a total of 9.5 Gb of sequences, which were assembled into 85,984 contigs and functionally annotated using Basic Local Alignment Search Tool (BLAST), Gene Ontology (GO), and Kyoto Encyclopedia of Genes and Genomes (KEGG) database terms. Finally, using an in silico antimicrobial peptide prediction method, 86 antimicrobial peptide candidates were predicted from the transcriptome, and 21 of these peptides were experimentally validated for their antimicrobial activity against yeast and gram positive and -negative bacteria by a radial diffusion assay. Notably, 11 peptides showed strong antimicrobial activities against these organisms and displayed little or no cytotoxic effects in the hemolysis and cell viability assay. This work provides prerequisite baseline data for the identification and development of novel antimicrobial peptides, which is expected to provide a better understanding of the phenomenon of innate immunity in similar species. PMID:27167617

  16. De Novo Transcriptome Analysis and Detection of Antimicrobial Peptides of the American Cockroach Periplaneta americana (Linnaeus).


    Kim, In-Woo; Lee, Joon Ha; Subramaniyam, Sathiyamoorthy; Yun, Eun-Young; Kim, Iksoo; Park, Junhyung; Hwang, Jae Sam


    Cockroaches are surrogate hosts for microbes that cause many human diseases. In spite of their generally destructive nature, cockroaches have recently been found to harbor potentially beneficial and medically useful substances such as drugs and allergens. However, genomic information for the American cockroach (Periplaneta americana) is currently unavailable; therefore, transcriptome and gene expression profiling is needed as an important resource to better understand the fundamental biological mechanisms of this species, which would be particularly useful for the selection of novel antimicrobial peptides. Thus, we performed de novo transcriptome analysis of P. americana that were or were not immunized with Escherichia coli. Using an Illumina HiSeq sequencer, we generated a total of 9.5 Gb of sequences, which were assembled into 85,984 contigs and functionally annotated using Basic Local Alignment Search Tool (BLAST), Gene Ontology (GO), and Kyoto Encyclopedia of Genes and Genomes (KEGG) database terms. Finally, using an in silico antimicrobial peptide prediction method, 86 antimicrobial peptide candidates were predicted from the transcriptome, and 21 of these peptides were experimentally validated for their antimicrobial activity against yeast and gram positive and -negative bacteria by a radial diffusion assay. Notably, 11 peptides showed strong antimicrobial activities against these organisms and displayed little or no cytotoxic effects in the hemolysis and cell viability assay. This work provides prerequisite baseline data for the identification and development of novel antimicrobial peptides, which is expected to provide a better understanding of the phenomenon of innate immunity in similar species.

  17. DBAASP: database of antimicrobial activity and structure of peptides.


    Gogoladze, Giorgi; Grigolava, Maia; Vishnepolsky, Boris; Chubinidze, Mindia; Duroux, Patrice; Lefranc, Marie-Paule; Pirtskhalava, Malak


    The Database of Antimicrobial Activity and Structure of Peptides (DBAASP) is a manually curated database for those peptides for which antimicrobial activity against particular targets has been evaluated experimentally. The database is a depository of complete information on: the chemical structure of peptides; target species; target object of cell; peptide antimicrobial/haemolytic/cytotoxic activities; and experimental conditions at which activities were estimated. The DBAASP search page allows the user to search peptides according to their structural characteristics, complexity type (monomer, dimer and two-peptide), source, synthesis type (ribosomal, nonribosomal and synthetic) and target species. The database prediction algorithm provides a tool for rational design of new antimicrobial peptides. DBAASP is accessible at

  18. Safety and Efficacy of Antimicrobial Peptides against Naturally Acquired Leishmaniasis

    PubMed Central

    Alberola, J.; Rodríguez, A.; Francino, O.; Roura, X.; Rivas, L.; Andreu, D.


    Leishmaniases, which are important causes of morbidity and mortality in humans and dogs, are extremely difficult to treat. Antimicrobial peptides are rarely used as alternative treatments for naturally acquired parasitic diseases. Here we report that the acylated synthetic antimicrobial peptide Oct-CA(1-7)M(2-9) is safe and effective for treating naturally acquired canine leishmaniasis. PMID:14742227

  19. Research in practice: Antimicrobial peptides of the skin.


    Gläser, Regine


    Antimicrobial peptides represent evolutionary ancient molecules whose importance became evident within the last years. These highly effective peptides protect the skin and other epithelia against infection and form a fast acting "chemical barrier" also regulating the normal flora of the skin and mucosa. In the Department of Dermatology, University Hospital Kiel, various antimicrobial peptides have been discovered, characterized and investigated in healthy persons as well as in different skin diseases. Everyday clinical observations formed the background for several interesting hypotheses and findings.

  20. Immunomodulatory effects of anti-microbial peptides.


    Otvos, Laszlo


    Anti-microbial peptides (AMPs) were originally thought to exert protecting actions against bacterial infection by disintegrating bacterial membranes. Upon identification of internal bacterial targets, the view changed and moved toward inhibition of prokaryote-specific biochemical processes. However, the level of none of these activities can explain the robust efficacy of some of these peptides in animal models of systemic and cutaneous infections. A rapidly growing panel of reports suggests that AMPs, now called host-defense peptides (HDPs), act through activating the immune system of the host. This includes recruitment and activation of macrophages and mast cells, inducing chemokine production and altering NF-κB signaling processes. As a result, both pro- and anti-inflammatory responses are elevated together with activation of innate and adaptive immunity mechanisms, wound healing, and apoptosis. HDPs sterilize the systemic circulation and local injury sites significantly more efficiently than pure single-endpoint in vitro microbiological or biochemical data would suggest and actively aid recovering from tissue damage after or even without bacterial infections. However, the multiple and, often opposing, immunomodulatory functions of HDPs require exceptional care in therapeutic considerations.

  1. Antimicrobial Peptides Targeting Gram-Positive Bacteria

    PubMed Central

    Malanovic, Nermina; Lohner, Karl


    Antimicrobial peptides (AMPs) have remarkably different structures as well as biological activity profiles, whereupon most of these peptides are supposed to kill bacteria via membrane damage. In order to understand their molecular mechanism and target cell specificity for Gram-positive bacteria, it is essential to consider the architecture of their cell envelopes. Before AMPs can interact with the cytoplasmic membrane of Gram-positive bacteria, they have to traverse the cell wall composed of wall- and lipoteichoic acids and peptidoglycan. While interaction of AMPs with peptidoglycan might rather facilitate penetration, interaction with anionic teichoic acids may act as either a trap for AMPs or a ladder for a route to the cytoplasmic membrane. Interaction with the cytoplasmic membrane frequently leads to lipid segregation affecting membrane domain organization, which affects membrane permeability, inhibits cell division processes or leads to delocalization of essential peripheral membrane proteins. Further, precursors of cell wall components, especially the highly conserved lipid II, are directly targeted by AMPs. Thereby, the peptides do not inhibit peptidoglycan synthesis via binding to proteins like common antibiotics, but form a complex with the precursor molecule, which in addition can promote pore formation and membrane disruption. Thus, the multifaceted mode of actions will make AMPs superior to antibiotics that act only on one specific target. PMID:27657092

  2. Effect of Fatty Acid Conjugation on Antimicrobial Peptide Activity

    DTIC Science & Technology


    killing mechanism of antimicrobial peptides makes them an interesting alternative to traditional antibiotics, as target bacteria may be less able...C14-AKK and C16-AKK to within a 7% error are 220 and 16mM respectively. Since amphipathicity is requisite for antimicrobial action KAK is not...Schnaare, 2000: Antimicrobial evaluation of N-alkyl betaines and N-alkyl-N,N-dimethylamine oxides with variations in chain length. Antimicrobial Agents

  3. Antimicrobial peptide LL-37 participates in the transcriptional regulation of melanoma cells

    PubMed Central

    Muñoz, Mindy; Craske, Madeleine; Severino, Patricia; de Lima, Thais Martins; Labhart, Paul; Chammas, Roger; Velasco, Irineu Tadeu; Machado, Marcel Cerqueira César; Egan, Brian; Nakaya, Helder I; Pinheiro da Silva, Fabiano


    Antimicrobial peptides are an ancient family of molecules that emerged millions of years ago and have been strongly conserved during the evolutionary process of living organisms. Recently, our group described that the human antimicrobial peptide LL-37 migrates to the nucleus, raising the possibility that LL-37 could directly modulate transcription under certain conditions. Here, we showed evidence that LL-37 binds to gene promoter regions, and LL-37 gene silencing changed the transcriptional program of melanoma A375 cells genes associated with histone, metabolism, cellular stress, ubiquitination and mitochondria. PMID:27994673

  4. Differential distribution and defence involvement of antimicrobial peptides in mussel.


    Mitta, G; Vandenbulcke, F; Noël, T; Romestand, B; Beauvillain, J C; Salzet, M; Roch, P


    In previous papers, we characterised 3 types of 4-kDa, cysteine-rich, cationic antimicrobial peptides: MGDs (for Mytilus galloprovincialis defensins), mytilins and myticins, which are abundant in the mussel hemocytes. In the present work, we revealed a differential distribution of the cells expressing the different genes. In addition, using confocal and electron microscopy, we confirmed that defensins and mytilins were partially located in different sub-types of circulating hemocytes although the peptides can be located in the same cell, and even in the same granule. We also demonstrated that mytilins exert their microbicidal effect within the cells through the process of phagosome-mytilin granule fusion leading to the co-location of ingested bacteria and mytilins.

  5. Sequence diversity and evolution of antimicrobial peptides in invertebrates.


    Tassanakajon, Anchalee; Somboonwiwat, Kunlaya; Amparyup, Piti


    Antimicrobial peptides (AMPs) are evolutionarily ancient molecules that act as the key components in the invertebrate innate immunity against invading pathogens. Several AMPs have been identified and characterized in invertebrates, and found to display considerable diversity in their amino acid sequence, structure and biological activity. AMP genes appear to have rapidly evolved, which might have arisen from the co-evolutionary arms race between host and pathogens, and enabled organisms to survive in different microbial environments. Here, the sequence diversity of invertebrate AMPs (defensins, cecropins, crustins and anti-lipopolysaccharide factors) are presented to provide a better understanding of the evolution pattern of these peptides that play a major role in host defense mechanisms.

  6. A lesson from Bombinins H, mildly cationic diastereomeric antimicrobial peptides from Bombina skin.


    Mangoni, Maria Luisa


    Gene-encoded peptide antibiotics represent fascinating molecules for the development of new antimicrobials with a new mode of action: and one of the richest sources is amphibian skin. In particular, the skin of the fire-bellied toad Bombina genus contains mildly cationic antimicrobial peptides (AMPs), named bombinins H, with attractive properties. Indeed, some members of this peptide family coexist in skin secretions as isomers in which a single D-amino acid (alloisoleucine or leucine) is incorporated as a result of a post-translational modification of the respective gene-encoded Lamino acid. Here, a brief overview of the genes coding for these peptides, their spectrum of antimicrobial activities, mechanism of action and interactions with biological or model membranes is reported. Remarkably, a single D-amino acid substitution represents a unique approach developed by Nature not only to modulate the peptide stability in vivo, but also to confer the all-L peptide and its diastereomer distinctive biological features. Overall, such findings should assist in the generation of new peptide-based anti-infective agents, which are urgently needed because of the growing emergence of microbial strains resistant to conventional antimicrobials.

  7. Mechanical properties that influence antimicrobial peptide activity in lipid membranes.


    Marín-Medina, Nathaly; Ramírez, Diego Alejandro; Trier, Steve; Leidy, Chad


    Antimicrobial peptides are small amphiphilic proteins found in animals and plants as essential components of the innate immune system and whose function is to control bacterial infectious activity. In order to accomplish their function, antimicrobial peptides use different mechanisms of action which have been deeply studied in view of their potential exploitation to treat antibiotic-resistant bacterial infections. One of the main mechanisms of action of these peptides is the disruption of the bacterial membrane through pore formation, which, in some cases, takes place via a monomer to oligomer cooperative transition. Previous studies have shown that lipid composition, and the presence of exogenous components, such as cholesterol in model membranes or carotenoids in bacteria, can affect the potency of distinct antimicrobial peptides. At the same time, considering the membrane as a two-dimensional material, it has been shown that membrane composition defines its mechanical properties which might be relevant in many membrane-related processes. Nevertheless, the correlation between the mechanical properties of the membrane and antimicrobial peptide potency has not been considered according to the importance it deserves. The relevance of these mechanical properties in membrane deformation due to peptide insertion is reviewed here for different types of pores in order to elucidate if indeed membrane composition affects antimicrobial peptide activity by modulation of the mechanical properties of the membrane. This would also provide a better understanding of the mechanisms used by bacteria to overcome antimicrobial peptide activity.

  8. Three new antimicrobial peptides from the scorpion Pandinus imperator.


    Zeng, Xian-Chun; Zhou, Lingli; Shi, Wanxia; Luo, Xuesong; Zhang, Lei; Nie, Yao; Wang, Jinwei; Wu, Shifen; Cao, Bin; Cao, Hanjun


    Three novel cysteine-free venom peptides, which were referred to as Pantinin-1, Pantinin-2 and Pantinin-3, respectively, have been identified from the scorpion Pandinus imperator by cDNA cloning strategy. The precursor of each peptide consists of a signal peptide, a mature peptide with no disulfide bridges, and an acidic propeptide with a typical processing signal. Each of the three peptides is an α-helical, cationic and amphipathic molecule with 13 or 14 amino acid residues. Their amino acid sequences are homologous to those of some 13-mer antimicrobial peptides isolated from scorpions. Antimicrobial assay showed that all the three peptides possess relatively strong activities against Gram-positive bacteria and a fungus, but have very weak antimicrobial activities against Gram-negative bacteria. Toxicity assay showed that the three peptides exhibit very low or mild hemolytic activities against human red blood cells. It is interesting to see that Pantinin-3 is able to potently inhibit the growth of vancomycin-resistant Enterococcus (VRE) S13, a pathogen that can cause a number of human infections; this suggests that Pantinin-3 has great potential to be applied in the treatment of VRE infections. Our findings gain new insights into the structure/function relationships of the small linear cationic antimicrobial peptides from scorpions, and provide new templates for designing of antimicrobial agents targeting antibiotic-resistant pathogenic bacteria.

  9. Bacterial Evasion of Host Antimicrobial Peptide Defenses

    PubMed Central

    Cole, Jason N.; Nizet, Victor


    SUMMARY Antimicrobial peptides (AMPs), also known as host defense peptides, are small naturally occurring microbicidal molecules produced by the host innate immune response that function as a first line of defense to kill pathogenic microorganisms by inducing deleterious cell membrane damage. AMPs also possess signaling and chemoattractant activities and can modulate the innate immune response to enhance protective immunity or suppress inflammation. Human pathogens have evolved defense molecules and strategies to counter and survive the AMPs released by host immune cells such as neutrophils and macrophages. Here, we review the various mechanisms used by human bacterial pathogens to resist AMP-mediated killing, including surface charge modification, active efflux, alteration of membrane fluidity, inactivation by proteolytic digestion, and entrapment by surface proteins and polysaccharides. Enhanced understanding of AMP resistance at the molecular level may offer insight into the mechanisms of bacterial pathogenesis and augment the discovery of novel therapeutic targets and drug design for the treatment of recalcitrant multidrug-resistant bacterial infections. PMID:26999396

  10. The role of antimicrobial peptides in chronic inflammatory skin diseases

    PubMed Central

    Majewski, Sławomir


    Antimicrobial peptides (AMPs) are effector molecules of the innate immune system of the skin. They present an activity against a broad spectrum of Gram-positive and Gram-negative bacteria as well as some fungi, parasites and enveloped viruses. Several inflammatory skin diseases including psoriasis, atopic dermatitis, acne vulgaris and rosacea are characterized by a dysregulated expression of AMPs. Antimicrobial peptides are excessively produced in lesional psoriatic scales or rosacea in contrast to the atopic skin that shows lower AMP levels when compared with psoriasis. The importance of the AMPs contribution to host immunity is indisputable as alterations in the antimicrobial peptide expression have been associated with various pathologic processes. This review discusses the biology and clinical relevance of antimicrobial peptides expressed in the skin and their role in the pathogenesis of inflammatory skin diseases. PMID:26985172

  11. De-novo design of antimicrobial peptides for plant protection.


    Zeitler, Benjamin; Herrera Diaz, Areli; Dangel, Alexandra; Thellmann, Martha; Meyer, Helge; Sattler, Michael; Lindermayr, Christian


    This work describes the de-novo design of peptides that inhibit a broad range of plant pathogens. Four structurally different groups of peptides were developed that differ in size and position of their charged and hydrophobic clusters and were assayed for their ability to inhibit bacterial growth and fungal spore germination. Several peptides are highly active at concentrations between 0,1 and 1 µg/ml against plant pathogenic bacteria, such as Pseudomonas syringae, Pectobacterium carotovorum, and Xanthomonas vesicatoria. Importantly, no hemolytic activity could be detected for these peptides at concentrations up to 200 µg/ml. Moreover, the peptides are also active after spraying on the plant surface demonstrating a possible way of application. In sum, our designed peptides represent new antimicrobial agents and with the increasing demand for antimicrobial compounds for production of "healthy" food, these peptides might serve as templates for novel antibacterial and antifungal agents.

  12. De-Novo Design of Antimicrobial Peptides for Plant Protection

    PubMed Central

    Zeitler, Benjamin; Herrera Diaz, Areli; Dangel, Alexandra; Thellmann, Martha; Meyer, Helge; Sattler, Michael; Lindermayr, Christian


    This work describes the de-novo design of peptides that inhibit a broad range of plant pathogens. Four structurally different groups of peptides were developed that differ in size and position of their charged and hydrophobic clusters and were assayed for their ability to inhibit bacterial growth and fungal spore germination. Several peptides are highly active at concentrations between 0,1 and 1 µg/ml against plant pathogenic bacteria, such as Pseudomonas syringae, Pectobacterium carotovorum, and Xanthomonas vesicatoria. Importantly, no hemolytic activity could be detected for these peptides at concentrations up to 200 µg/ml. Moreover, the peptides are also active after spraying on the plant surface demonstrating a possible way of application. In sum, our designed peptides represent new antimicrobial agents and with the increasing demand for antimicrobial compounds for production of “healthy” food, these peptides might serve as templates for novel antibacterial and antifungal agents. PMID:23951222

  13. Differential expression of antimicrobial peptides in active and latent tuberculosis and its relationship with diabetes mellitus.


    Gonzalez-Curiel, Irma; Castañeda-Delgado, Julio; Lopez-Lopez, Nallely; Araujo, Zaida; Hernandez-Pando, Rogelio; Gandara-Jasso, Benjamin; Macias-Segura, Noe; Enciso-Moreno, Antonio; Rivas-Santiago, Bruno


    Tuberculosis (TB) is one of the most important infectious diseases, causing 1.8 million deaths annually worldwide. This problem has increased because of the association with human immmunodeficiency virus and diabetes mellitus type 2, mainly in developing countries. In the past few years it has been highlighted the significance of antimicrobial peptides in the immunopathogenesis of TB ex vivo and in experimental models studies. In this study we analyzed the expression of CAMP, DEFA1, DEFB4, and DEFB103A in patients with latent TB and progressive TB with and without comorbidity with diabetes mellitus type 2. Antimicrobial peptide gene expression increased during progressive TB, which could be used as a biomarker for reactivation. By contrast, patients with diabetes mellitus type 2 have lower antimicrobial peptides gene expression, suggesting that the lack of its proper production in these patients contribute to enhance the risk for TB reactivation.

  14. Uses of antimicrobial genes from microbial genome


    Sorek, Rotem; Rubin, Edward M.


    We describe a method for mining microbial genomes to discover antimicrobial genes and proteins having broad spectrum of activity. Also described are antimicrobial genes and their expression products from various microbial genomes that were found using this method. The products of such genes can be used as antimicrobial agents or as tools for molecular biology.

  15. Alternative mechanisms of action of cationic antimicrobial peptides on bacteria.


    Hale, John D F; Hancock, Robert E W


    Cationic antimicrobial peptides are a novel type of antibiotic offering much potential in the treatment of microbial-related diseases. They offer many advantages for commercial development, including a broad spectrum of action and modest size. However, despite the identification or synthetic production of thousands of such peptides, the mode of action remains elusive, except for a few examples. While the dogma for the mechanism of action of antimicrobial peptides against bacteria is believed to be through pore formation or membrane barrier disruption, some peptides clearly act differently and other intracellular target sites have been identified. This article presents an updated review of how cationic antimicrobial peptides are able to affect bacterial killing, with a focus on internal targets.

  16. Biofilm induced tolerance towards antimicrobial peptides.


    Folkesson, Anders; Haagensen, Janus A J; Zampaloni, Claudia; Sternberg, Claus; Molin, Søren


    Increased tolerance to antimicrobial agents is thought to be an important feature of microbes growing in biofilms. We address the question of how biofilm organization affects antibiotic susceptibility. We established Escherichia coli biofilms with differential structural organization due to the presence of IncF plasmids expressing altered forms of the transfer pili in two different biofilm model systems. The mature biofilms were subsequently treated with two antibiotics with different molecular targets, the peptide antibiotic colistin and the fluoroquinolone ciprofloxacin. The dynamics of microbial killing were monitored by viable count determination, and confocal laser microscopy. Strains forming structurally organized biofilms show an increased bacterial survival when challenged with colistin, compared to strains forming unstructured biofilms. The increased survival is due to genetically regulated tolerant subpopulation formation and not caused by a general biofilm property. No significant difference in survival was detected when the strains were challenged with ciprofloxacin. Our data show that biofilm formation confers increased colistin tolerance to cells within the biofilm structure, but the protection is conditional being dependent on the structural organization of the biofilm, and the induction of specific tolerance mechanisms.

  17. Biofilm Induced Tolerance towards Antimicrobial Peptides

    PubMed Central

    Folkesson, Anders; Haagensen, Janus A. J.; Zampaloni, Claudia; Sternberg, Claus; Molin, Søren


    Increased tolerance to antimicrobial agents is thought to be an important feature of microbes growing in biofilms. We address the question of how biofilm organization affects antibiotic susceptibility. We established Escherichia coli biofilms with differential structural organization due to the presence of IncF plasmids expressing altered forms of the transfer pili in two different biofilm model systems. The mature biofilms were subsequently treated with two antibiotics with different molecular targets, the peptide antibiotic colistin and the fluoroquinolone ciprofloxacin. The dynamics of microbial killing were monitored by viable count determination, and confocal laser microscopy. Strains forming structurally organized biofilms show an increased bacterial survival when challenged with colistin, compared to strains forming unstructured biofilms. The increased survival is due to genetically regulated tolerant subpopulation formation and not caused by a general biofilm property. No significant difference in survival was detected when the strains were challenged with ciprofloxacin. Our data show that biofilm formation confers increased colistin tolerance to cells within the biofilm structure, but the protection is conditional being dependent on the structural organization of the biofilm, and the induction of specific tolerance mechanisms. PMID:18382672

  18. Antimicrobial peptides: Possible anti-infective agents.


    Lakshmaiah Narayana, Jayaram; Chen, Jyh-Yih


    Multidrug-resistant bacterial, fungal, viral, and parasitic infections are major health threats. The Infectious Diseases Society of America has expressed concern on the decrease of pharmaceutical companies working on antibiotic research and development. However, small companies, along with academic research institutes, are stepping forward to develop novel therapeutic methods to overcome the present healthcare situation. Among the leading alternatives to current drugs are antimicrobial peptides (AMPs), which are abundantly distributed in nature. AMPs exhibit broad-spectrum activity against a wide variety of bacteria, fungi, viruses, and parasites, and even cancerous cells. They also show potential immunomodulatory properties, and are highly responsive to infectious agents and innate immuno-stimulatory molecules. In recent years, many AMPs have undergone or are undergoing clinical development, and a few are commercially available for topical and other applications. In this review, we outline selected anion and cationic AMPs which are at various stages of development, from preliminary analysis to clinical drug development. Moreover, we also consider current production methods and delivery tools for AMPs, which must be improved for the effective use of these agents.

  19. Use of Peptide Libraries for Identification and Optimization of Novel Antimicrobial Peptides.


    Ashby, Martin; Petkova, Asya; Gani, Jurnorain; Mikut, Ralf; Hilpert, Kai


    The increasing rates of resistance among bacteria and to a lesser extent fungi have resulted in an urgent need to find new molecules that hold therapeutic promise against multidrug-resistant strains. Antimicrobial peptides have proven very effective against a variety of multidrug-resistant bacteria. Additionally, the low levels of resistance reported towards these molecules are an attractive feature for antimicrobial drug development. Here we summarise information on diverse peptide libraries used to discover or to optimize antimicrobial peptides. Chemical synthesized peptide libraries, for example split and mix method, tea bag method, multi-pin method and cellulose spot method are discussed. In addition biological peptide library screening methods are summarized, like phage display, bacterial display, mRNA-display and ribosomal display. A few examples are given for small peptide libraries, which almost exclusively follow a rational design of peptides of interest rather than a combinatorial approach.

  20. Strategies and molecular tools to fight antimicrobial resistance: resistome, transcriptome, and antimicrobial peptides

    PubMed Central

    Tavares, Letícia S.; Silva, Carolina S. F.; de Souza, Vinicius C.; da Silva, Vânia L.; Diniz, Cláudio G.; Santos, Marcelo O.


    The increasing number of antibiotic resistant bacteria motivates prospective research toward discovery of new antimicrobial active substances. There are, however, controversies concerning the cost-effectiveness of such research with regards to the description of new substances with novel cellular interactions, or description of new uses of existing substances to overcome resistance. Although examination of bacteria isolated from remote locations with limited exposure to humans has revealed an absence of antibiotic resistance genes, it is accepted that these genes were both abundant and diverse in ancient living organisms, as detected in DNA recovered from Pleistocene deposits (30,000 years ago). Indeed, even before the first clinical use of antibiotics more than 60 years ago, resistant organisms had been isolated. Bacteria can exhibit different strategies for resistance against antibiotics. New genetic information may lead to the modification of protein structure affecting the antibiotic carriage into the cell, enzymatic inactivation of drugs, or even modification of cellular structure interfering in the drug-bacteria interaction. There are still plenty of new genes out there in the environment that can be appropriated by putative pathogenic bacteria to resist antimicrobial agents. On the other hand, there are several natural compounds with antibiotic activity that may be used to oppose them. Antimicrobial peptides (AMPs) are molecules which are wide-spread in all forms of life, from multi-cellular organisms to bacterial cells used to interfere with microbial growth. Several AMPs have been shown to be effective against multi-drug resistant bacteria and have low propensity to resistance development, probably due to their unique mode of action, different from well-known antimicrobial drugs. These substances may interact in different ways with bacterial cell membrane, protein synthesis, protein modulation, and protein folding. The analysis of bacterial transcriptome

  1. The role of amphibian antimicrobial peptides in protection of amphibians from pathogens linked to global amphibian declines.


    Rollins-Smith, Louise A


    Amphibian species have experienced population declines and extinctions worldwide that are unprecedented in recent history. Many of these recent declines have been linked to a pathogenic skin fungus, Batrachochytrium dendrobatidis, or to iridoviruses of the genus Ranavirus. One of the first lines of defense against pathogens that enter by way of the skin are antimicrobial peptides synthesized and stored in dermal granular glands and secreted into the mucus following alarm or injury. Here, I review what is known about the capacity of amphibian antimicrobial peptides from diverse amphibians to inhibit B. dendrobatidis or ranavirus infections. When multiple species were compared for the effectiveness of their in vitro antimicrobial peptides defenses against B. dendrobatidis, non-declining species of rainforest amphibians had more effective antimicrobial peptides than species in the same habitat that had recently experienced population declines. Further, there was a significant correlation between the effectiveness of the antimicrobial peptides and resistance of the species to experimental infection. These studies support the hypothesis that antimicrobial peptides are an important component of innate defenses against B. dendrobatidis. Some amphibian antimicrobial peptides inhibit ranavirus infections and infection of human T lymphocytes by the human immunodeficiency virus (HIV). An effective antimicrobial peptide defense against skin pathogens appears to depend on a diverse array of genes expressing antimicrobial peptides. The production of antimicrobial peptides may be regulated by signals from the pathogens. However, this defense must also accommodate potentially beneficial microbes on the skin that compete or inhibit growth of the pathogens. How this delicate balancing act is accomplished is an important area of future research.

  2. DRAMP: a comprehensive data repository of antimicrobial peptides

    PubMed Central

    Fan, Linlin; Sun, Jian; Zhou, Meifeng; Zhou, Jie; Lao, Xingzhen; Zheng, Heng; Xu, Hanmei


    The growing problem of antibiotic-resistant microorganisms results in an urgent need for substitutes to conventional antibiotics with novel modes of action and effective activities. Antimicrobial peptides (AMPs), produced by a wide variety of living organisms acting as a defense mechanism against invading pathogenic microbes, are considered to be such promising alternatives. AMPs display a broad spectrum of antimicrobial activity and a low propensity for developing resistance. Therefore, a thorough understanding of AMPs is essential to exploit them as antimicrobial drugs. Considering this, we developed a comprehensive user-friendly data repository of antimicrobial peptides (DRAMP), which holds 17349 antimicrobial sequences, including 4571 general AMPs, 12704 patented sequences and 74 peptides in drug development. Entries in the database have detailed annotations, especially detailed antimicrobial activity data (shown as target organism with MIC value) and structure information. Annotations also include accession numbers crosslinking to Pubmed, Swiss-prot and Protein Data Bank (PDB). The website of the database comes with easy-to-operate browsing as well as searching with sorting and filtering functionalities. Several useful sequence analysis tools are provided, including similarity search, sequence alignment and conserved domain search (CD-Search). DRAMP should be a useful resource for the development of novel antimicrobial peptide drugs. PMID:27075512

  3. DRAMP: a comprehensive data repository of antimicrobial peptides.


    Fan, Linlin; Sun, Jian; Zhou, Meifeng; Zhou, Jie; Lao, Xingzhen; Zheng, Heng; Xu, Hanmei


    The growing problem of antibiotic-resistant microorganisms results in an urgent need for substitutes to conventional antibiotics with novel modes of action and effective activities. Antimicrobial peptides (AMPs), produced by a wide variety of living organisms acting as a defense mechanism against invading pathogenic microbes, are considered to be such promising alternatives. AMPs display a broad spectrum of antimicrobial activity and a low propensity for developing resistance. Therefore, a thorough understanding of AMPs is essential to exploit them as antimicrobial drugs. Considering this, we developed a comprehensive user-friendly data repository of antimicrobial peptides (DRAMP), which holds 17349 antimicrobial sequences, including 4571 general AMPs, 12704 patented sequences and 74 peptides in drug development. Entries in the database have detailed annotations, especially detailed antimicrobial activity data (shown as target organism with MIC value) and structure information. Annotations also include accession numbers crosslinking to Pubmed, Swiss-prot and Protein Data Bank (PDB). The website of the database comes with easy-to-operate browsing as well as searching with sorting and filtering functionalities. Several useful sequence analysis tools are provided, including similarity search, sequence alignment and conserved domain search (CD-Search). DRAMP should be a useful resource for the development of novel antimicrobial peptide drugs.

  4. Production of cecropin A antimicrobial peptide in rice seed endosperm

    PubMed Central


    Background Cecropin A is a natural antimicrobial peptide that exhibits rapid, potent and long-lasting lytic activity against a broad spectrum of pathogens, thus having great biotechnological potential. Here, we report a system for producing bioactive cecropin A in rice seeds. Results Transgenic rice plants expressing a codon-optimized synthetic cecropin A gene drived by an endosperm-specific promoter, either the glutelin B1 or glutelin B4 promoter, were generated. The signal peptide sequence from either the glutelin B1 or the glutelin B4 were N-terminally fused to the coding sequence of the cecropin A. We also studied whether the presence of the KDEL endoplasmic reticulum retention signal at the C-terminal has an effect on cecropin A subcellular localization and accumulation. The transgenic rice plants showed stable transgene integration and inheritance. We show that cecropin A accumulates in protein storage bodies in the rice endosperm, particularly in type II protein bodies, supporting that the glutelin N-terminal signal peptides play a crucial role in directing the cecropin A to this organelle, independently of being tagged with the KDEL endoplasmic reticulum retention signal. The production of cecropin A in transgenic rice seeds did not affect seed viability or seedling growth. Furthermore, transgenic cecropin A seeds exhibited resistance to infection by fungal and bacterial pathogens (Fusarium verticillioides and Dickeya dadantii, respectively) indicating that the in planta-produced cecropin A is biologically active. Conclusions Rice seeds can sustain bioactive cecropin A production and accumulation in protein bodies. The system might benefit the production of this antimicrobial agent for subsequent applications in crop protection and food preservation. PMID:24755305

  5. Archetypal tryptophan-rich antimicrobial peptides: properties and applications.


    Shagaghi, Nadin; Palombo, Enzo A; Clayton, Andrew H A; Bhave, Mrinal


    Drug-resistant microorganisms ('superbugs') present a serious challenge to the success of antimicrobial treatments. Subsequently, there is a crucial need for novel bio-control agents. Many antimicrobial peptides (AMPs) show a broad-spectrum activity against bacteria, fungi or viruses and are strong candidates to complement or substitute current antimicrobial agents. Some AMPs are also effective against protozoa or cancer cells. The tryptophan (Trp)-rich peptides (TRPs) are a subset of AMPs that display potent antimicrobial activity, credited to the unique biochemical properties of tryptophan that allow it to insert into biological membranes. Further, many Trp-rich AMPs cross bacterial membranes without compromising their integrity and act intracellularly, suggesting interactions with nucleic acids and enzymes. In this work, we overview some archetypal TRPs derived from natural sources, i.e., indolicidin, tritrpticin and lactoferricin, summarising their biochemical properties, structures, antimicrobial activities, mechanistic studies and potential applications.

  6. A maritime pine antimicrobial peptide involved in ammonium nutrition.


    Canales, Javier; Avila, Concepción; Cánovas, Francisco M


    A large family of small cysteine-rich antimicrobial peptides (AMPs) is involved in the innate defence of plants against pathogens. Recently, it has been shown that AMPs may also play important roles in plant growth and development. In previous work, we have identified a gene of the AMP β-barrelin family that was differentially regulated in the roots of maritime pine (Pinus pinaster Ait.) in response to changes in ammonium nutrition. Here, we present the molecular characterization of two AMP genes, PpAMP1 and PpAMP2, showing different molecular structure and physicochemical properties. PpAMP1 and PpAMP2 displayed different expression patterns in maritime pine seedlings and adult trees. Furthermore, our expression analyses indicate that PpAMP1 is the major form of AMP in the tree, and its relative abundance is regulated by ammonium availability. In contrast, PpAMP2 is expressed at much lower levels and it is not regulated by ammonium. To gain new insights into the function of PpAMP1, we over-expressed the recombinant protein in Escherichia coli and demonstrated that PpAMP1 strongly inhibited yeast growth, indicating that it exhibits antimicrobial activity. We have also found that PpAMP1 alters ammonium uptake, suggesting that it is involved in the regulation of ammonium ion flux into pine roots.

  7. Bombyx mori E26 transformation-specific 2 (BmEts2), an Ets family protein, represses Bombyx mori Rels (BmRels)-mediated promoter activation of antimicrobial peptide genes in the silkworm Bombyx mori.


    Tanaka, H; Sagisaka, A; Suzuki, N; Yamakawa, M


    E26 transformation-specific (Ets) family transcription factors are known to play roles in various biological phenomena, including immunity, in vertebrates. However, the mechanisms by which Ets proteins contribute to immunity in invertebrates remain poorly understood. In this study, we identified a cDNA encoding BmEts2, which is a putative orthologue of Drosophila Yan and human translocation-ets-leukemia/Ets-variant gene 6, from the silkworm Bombyx mori. Expression of the BmEts2 gene was significantly increased in the fat bodies of silkworm larvae in response to injection with Escherichia coli and Staphylococcus aureus. BmEts2 overexpression dramatically repressed B. mori Rels (BmRels)-mediated promoter activation of antimicrobial peptide genes in silkworm cells. Conversely, gene knockdown of BmEts2 significantly enhanced BmRels activity. In addition, two κB sites located on the 5' upstream region of cecropin B1 were found to be involved in the repression of BmRels-mediated promoter activation. Protein-competition analysis further demonstrated that BmEts2 competitively inhibited binding of BmRels to κB sites. Overall, BmEts2 acts as a repressor of BmRels-mediated transactivation of antimicrobial protein genes by inhibiting the binding of BmRels to κB sites.

  8. Nanomechanical Response of Bacterial Cells to Cationic Antimicrobial Peptides

    NASA Astrophysics Data System (ADS)

    Lu, Shun; Walters, Grant; Parg, Richard; Dutcher, John


    The effectiveness of antimicrobial compounds can be easily screened, however their mechanism of action is much more difficult to determine. Many compounds act by compromising the mechanical integrity of the bacterial cell envelope, and our study introduces an atomic force microscopy (AFM)-based creep deformation technique to evaluate changes in the time-dependent mechanical properties of Pseudomonas aeruginosa PAO1 bacterial cells upon exposure to two different but structurally related antimicrobial peptides: polymyxin B and polymyxin B nonapeptide. We observed a distinctive signature for the loss of integrity of the bacterial cell envelope following exposure to the peptides. Measurements performed before and after exposure, as well as time-resolved measurements and those performed at different concentrations, revealed large changes to the viscoelastic parameters that are consistent with differences in the membrane permeabilizing effects of the peptides. The AFM creep deformation measurement provides new, unique insight into the kinetics and mechanism of action of antimicrobial peptides on bacteria.

  9. Antimicrobial peptides from skin secretions of Hypsiboas pulchellus (Anura: Hylidae).


    Siano, Alvaro; Húmpola, María Verónica; de Oliveira, Eliandre; Albericio, Fernando; Simonetta, Arturo C; Lajmanovich, Rafael; Tonarelli, Georgina G


    The skin of many amphibians produces a large repertoire of antimicrobial peptides that are crucial in the first line of defense against microbial invasion. Despite the immense richness of wild amphibians in Argentina, knowledge about peptides with antimicrobial properties is limited to a few species. Here we used LC-MS-MS to analyze samples of Hypsiboas pulchellus skin with the aim to identify antimicrobial peptides in the mass range of 1000 to 2000 Da. Twenty-three novel sequences were identified by MS, three of which were selected for chemical synthesis and further studies. The three synthetic peptides, named P1-Hp-1971, P2-Hp-1935, and P3-Hp-1891, inhibited the growth of two ATCC strains: Escherichia coli (MIC: 16, 33, and 17 μM, respectively) and Staphylococcus aureus (MIC: 8, 66, and 17 μM, respectively). P1-Hp-1971 and P3-Hp-1891 were the most active peptides. P1-Hp-1971, which showed the highest therapeutic indices (40 for E. coli and 80 for S. aureus), is a proline-glycine-rich peptide with a highly unordered structure, while P3-Hp-1891 adopts an amphipathic α-helical structure in the presence of 2,2,2-trifluoroethanol and anionic liposomes. This is the first peptidomic study of Hypsiboas pulchellus skin secretions to allow the identification of antimicrobial peptides.

  10. Evolution of Antimicrobial Peptides to Self-Assembled Peptides for Biomaterial Applications

    PubMed Central

    McCloskey, Alice P.; Gilmore, Brendan F.; Laverty, Garry


    Biomaterial-related infections are a persistent burden on patient health, recovery, mortality and healthcare budgets. Self-assembled antimicrobial peptides have evolved from the area of antimicrobial peptides. Peptides serve as important weapons in nature, and increasingly medicine, for combating microbial infection and biofilms. Self-assembled peptides harness a “bottom-up” approach, whereby the primary peptide sequence may be modified with natural and unnatural amino acids to produce an inherently antimicrobial hydrogel. Gelation may be tailored to occur in the presence of physiological and infective indicators (e.g. pH, enzymes) and therefore allow local, targeted antimicrobial therapy at the site of infection. Peptides demonstrate inherent biocompatibility, antimicrobial activity, biodegradability and numerous functional groups. They are therefore prime candidates for the production of polymeric molecules that have the potential to be conjugated to biomaterials with precision. Non-native chemistries and functional groups are easily incorporated into the peptide backbone allowing peptide hydrogels to be tailored to specific functional requirements. This article reviews an area of increasing interest, namely self-assembled peptides and their potential therapeutic applications as innovative hydrogels and biomaterials in the prevention of biofilm-related infection. PMID:25436505

  11. [Role of antimicrobial peptides (AMP) and pattern recognition receptors (PRR) in the intestinal mucosa homeostasis].


    Lapis, Károly


    Homeostasis and integrity of bowel mucosa is assured by well controlled mechanical, biochemical and immunological mechanisms. First line of defense is presented by the antimicrobial peptides (AMP), which form a continuous layer on the bowel surface, produced by intestinal specific (Paneth) and non-specific epithelial cells. AMPs have a significant antimicrobial, antifungal and antiviral, as well as immunomodulatory effects. Next line of defense is the pattern recognition receptors (PRR), which allows identifying conservative molecular patterns of different pathogens, and starts antimicrobial and inflammatory mechanisms through gene-expression induction. We review the most recent knowledge and studies concerning these mechanisms.

  12. Role of Arginine and Lysine in the Antimicrobial Mechanism of Histone-derived Antimicrobial Peptides

    PubMed Central

    Cutrona, Kara J.; Kaufman, Bethany A.; Figueroa, Dania M.; Elmore, Donald E.


    Translocation of cell-penetrating peptides is often promoted by increased content of arginine or other guanidinum groups. However, relatively little research has considered the role of these functional groups on antimicrobial peptide activity. This study compared the activity of three histone-derived antimicrobial peptides—buforin II, DesHDAP1, and parasin— with variants that contain only lysine or arginine cationic residues. These peptides operate via different mechanisms as parasin causes membrane permeabilization while buforin II and DesHDAP1 translocate into bacteria. For all peptides, antibacterial activity increased with increased arginine content. Higher arginine content increased permeabilization for parasin while it improved translocation for buforin II and DesHDAP1. These observations provide insight into the relative importance of arginine and lysine in these antimicrobial peptides. PMID:26555191

  13. Chlamydia-secreted protease CPAF degrades host antimicrobial peptides.


    Tang, Lingli; Chen, Jianlin; Zhou, Zhiguang; Yu, Ping; Yang, Zhangsheng; Zhong, Guangming


    Chlamydia trachomatis infection in the lower genital tract, if untreated, can ascend to the upper genital tract, potentially leading to complications such as tubal factor infertility. The ascension involves cell-to-cell spreading, which may require C. trachomatis organisms to overcome mucosal extracellular effectors such as antimicrobial peptides. We found that among the 8 antimicrobial peptides tested, the cathelicidin LL-37 that is produced by both urogenital epithelial cells and the recruited neutrophils possessed a most potent antichlamydial activity. Interestingly, this antichlamydial activity was completely inhibited by CPAF, a C. trachomatis-secreted serine protease. The inhibition was dependent on CPAF's proteolytic activity. CPAF selectively degraded LL-37 and other antimicrobial peptides with an antichlamydial activity. CPAF is known to secrete into and accumulate in the infected host cell cytoplasm at the late stage of chlamydial intracellular growth and may be released to confront the extracellular antimicrobial peptides before the intra-inclusion organisms are exposed to extracellular environments during host cell lysis and chlamydial spreading. Thus, the finding that CPAF selectively targets host antimicrobial peptides that possess antichlamydial activities for proteolysis suggests that CPAF may contribute to C. trachomatis pathogenicity by aiding in ascending infection.

  14. Sparse Neural Network Models of Antimicrobial Peptide-Activity Relationships.


    Müller, Alex T; Kaymaz, Aral C; Gabernet, Gisela; Posselt, Gernot; Wessler, Silja; Hiss, Jan A; Schneider, Gisbert


    We present an adaptive neural network model for chemical data classification. The method uses an evolutionary algorithm for optimizing the network structure by seeking sparsely connected architectures. The number of hidden layers, the number of neurons in each layer and their connectivity are free variables of the system. We used the method for predicting antimicrobial peptide activity from the amino acid sequence. Visualization of the evolved sparse network structures suggested a high charge density and a low aggregation potential in solution as beneficial for antimicrobial activity. However, different training data sets and peptide representations resulted in greatly varying network structures. Overall, the sparse network models turned out to be less accurate than fully-connected networks. In a prospective application, we synthesized and tested 10 de novo generated peptides that were predicted to either possess antimicrobial activity, or to be inactive. Two of the predicted antibacterial peptides showed cosiderable bacteriostatic effects against both Staphylococcus aureus and Escherichia coli. None of the predicted inactive peptides possessed antibacterial properties. Molecular dynamics simulations of selected peptide structures in water and TFE suggest a pronounced peptide helicity in a hydrophobic environment. The results of this study underscore the applicability of neural networks for guiding the computer-assisted design of new peptides with desired properties.

  15. Host Antimicrobial Peptides in Bacterial Homeostasis and Pathogenesis of Disease

    PubMed Central

    Heimlich, Derek R.; Harrison, Alistair; Mason, Kevin M.


    Innate immune responses function as a first line of host defense against the development of bacterial infection, and in some cases to preserve the sterility of privileged sites in the human host. Bacteria that enter these sites must counter host responses for colonization. From the host’s perspective, the innate immune system works expeditiously to minimize the bacterial threat before colonization and subsequent dysbiosis. The multifactorial nature of disease further challenges predictions of how each independent variable influences bacterial pathogenesis. From bacterial colonization to infection and through disease, the microenvironments of the host are in constant flux as bacterial and host factors contribute to changes at the host-pathogen interface, with the host attempting to eradicate bacteria and the bacteria fighting to maintain residency. A key component of this innate host response towards bacterial infection is the production of antimicrobial peptides (AMPs). As an early component of the host response, AMPs modulate bacterial load and prevent establishment of infection. Under quiescent conditions, some AMPs are constitutively expressed by the epithelium. Bacterial infection can subsequently induce production of other AMPs in an effort to maintain sterility, or to restrict colonization. As demonstrated in various studies, the absence of a single AMP can influence pathogenesis, highlighting the importance of AMP concentration in maintaining homeostasis. Yet, AMPs can increase bacterial virulence through the co-opting of the peptides or alteration of bacterial virulence gene expression. Further, bacterial factors used to subvert AMPs can modify host microenvironments and alter colonization of the residential flora that principally maintain homeostasis. Thus, the dynamic interplay between host defense peptides and bacterial factors produced to quell peptide activity play a critical role in the progression and outcome of disease. PMID:26029470

  16. Host Antimicrobial Peptides in Bacterial Homeostasis and Pathogenesis of Disease.


    Heimlich, Derek R; Harrison, Alistair; Mason, Kevin M


    Innate immune responses function as a first line of host defense against the development of bacterial infection, and in some cases to preserve the sterility of privileged sites in the human host. Bacteria that enter these sites must counter host responses for colonization. From the host's perspective, the innate immune system works expeditiously to minimize the bacterial threat before colonization and subsequent dysbiosis. The multifactorial nature of disease further challenges predictions of how each independent variable influences bacterial pathogenesis. From bacterial colonization to infection and through disease, the microenvironments of the host are in constant flux as bacterial and host factors contribute to changes at the host-pathogen interface, with the host attempting to eradicate bacteria and the bacteria fighting to maintain residency. A key component of this innate host response towards bacterial infection is the production of antimicrobial peptides (AMPs). As an early component of the host response, AMPs modulate bacterial load and prevent establishment of infection. Under quiescent conditions, some AMPs are constitutively expressed by the epithelium. Bacterial infection can subsequently induce production of other AMPs in an effort to maintain sterility, or to restrict colonization. As demonstrated in various studies, the absence of a single AMP can influence pathogenesis, highlighting the importance of AMP concentration in maintaining homeostasis. Yet, AMPs can increase bacterial virulence through the co-opting of the peptides or alteration of bacterial virulence gene expression. Further, bacterial factors used to subvert AMPs can modify host microenvironments and alter colonization of the residential flora that principally maintain homeostasis. Thus, the dynamic interplay between host defense peptides and bacterial factors produced to quell peptide activity play a critical role in the progression and outcome of disease.

  17. De Novo Designed Synthetic Mimics of Antimicrobial Peptides

    PubMed Central

    Scott, Richard W.; DeGrado, William F.; Tew, Gregory N.


    Summary Antimicrobial peptides are small cationic amphiphiles that play an important role in the innate immune system. Given their broad specificity, they appear to be ideal therapeutic agents. As a result, over the last decade, there has been considerable interest in developing them as intravenously administered antibiotics. However, it has proven difficult to accomplish this goal with peptide-based structures. While it has been possible to solve some relatively simple problems such as susceptibility to proteolysis, more severe problems have included the expense of the materials, toxicity, limited efficacy, and limited tissue distribution. As a result, we developed small synthetic oligomers designed to adopt amphiphilic conformations and exhibit potent antimicrobial activity while being non-toxic to host cells. One class of these synthetic mimics of antimicrobial peptides (SMAMPs) is being developed as intravenous antibiotics PMID:18996193

  18. Antimicrobial peptide coatings for hydroxyapatite: electrostatic and covalent attachment of antimicrobial peptides to surfaces.


    Townsend, Leigh; Williams, Richard L; Anuforom, Olachi; Berwick, Matthew R; Halstead, Fenella; Hughes, Erik; Stamboulis, Artemis; Oppenheim, Beryl; Gough, Julie; Grover, Liam; Scott, Robert A H; Webber, Mark; Peacock, Anna F A; Belli, Antonio; Logan, Ann; de Cogan, Felicity


    The interface between implanted devices and their host tissue is complex and is often optimized for maximal integration and cell adhesion. However, this also gives a surface suitable for bacterial colonization. We have developed a novel method of modifying the surface at the material-tissue interface with an antimicrobial peptide (AMP) coating to allow cell attachment while inhibiting bacterial colonization. The technology reported here is a dual AMP coating. The dual coating consists of AMPs covalently bonded to the hydroxyapatite surface, followed by deposition of electrostatically bound AMPs. The dual approach gives an efficacious coating which is stable for over 12 months and can prevent colonization of the surface by both Gram-positive and Gram-negative bacteria.

  19. Insights into Antimicrobial Peptides from Spiders and Scorpions.


    Wang, Xiuqing; Wang, Guangshun


    The venoms of spiders and scorpions contain a variety of chemical compounds. Antimicrobial peptides (AMPs) from these organisms were first discovered in the 1990s. As of May 2015, there were 42 spider's and 63 scorpion's AMPs in the Antimicrobial Peptide Database ( These peptides have demonstrated broad or narrow-spectrum activities against bacteria, fungi, viruses, and parasites. In addition, they can be toxic to cancer cells, insects and erythrocytes. To provide insight into such an activity spectrum, this article discusses the discovery, classification, structure and activity relationships, bioinformatics analysis, and potential applications of spider and scorpion AMPs. Our analysis reveals that, in the case of linear peptides, spiders use both glycine-rich and helical peptide models for defense, whereas scorpions use two distinct helical peptide models with different amino acid compositions to exert the observed antimicrobial activities and hemolytic toxicity. Our structural bioinformatics study improves the knowledge in the field and can be used to design more selective peptides to combat tumors, parasites, and viruses.

  20. Insights into Antimicrobial Peptides from Spiders and Scorpions

    PubMed Central

    Wang, Xiuqing; Wang, Guangshun


    The venoms of spiders and scorpions contain a variety of chemical compounds. Antimicrobial peptides (AMPs) from these organisms were first discovered in the 1990s. As of May 2015, there were 42 spider’s and 63 scorpion’s AMPs in the Antimicrobial Peptide Database ( These peptides have demonstrated broad or narrow-spectrum activities against bacteria, fungi, viruses, and parasites. In addition, they can be toxic to cancer cells, insects and erythrocytes. To provide insight into such an activity spectrum, this article discusses the discovery, classification, structure and activity relationships, bioinformatics analysis, and potential applications of spider and scorpion AMPs. Our analysis reveals that, in the case of linear peptides, spiders use both glycine-rich and helical peptide models for defense, whereas scorpions use two distinct helical peptide models with different amino acid compositions to exert the observed antimicrobial activities and hemolytic toxicity. Our structural bioinformatics study improves the knowledge in the field and can be used to design more selective peptides to combat tumors, parasites, and viruses. PMID:27165405

  1. IQ-motif peptides as novel anti-microbial agents.


    McLean, Denise T F; Lundy, Fionnuala T; Timson, David J


    The IQ-motif is an amphipathic, often positively charged, α-helical, calmodulin binding sequence found in a number of eukaryote signalling, transport and cytoskeletal proteins. They share common biophysical characteristics with established, cationic α-helical antimicrobial peptides, such as the human cathelicidin LL-37. Therefore, we tested eight peptides encoding the sequences of IQ-motifs derived from the human cytoskeletal scaffolding proteins IQGAP2 and IQGAP3. Some of these peptides were able to inhibit the growth of Escherichia coli and Staphylococcus aureus with minimal inhibitory concentrations (MIC) comparable to LL-37. In addition some IQ-motifs had activity against the fungus Candida albicans. This antimicrobial activity is combined with low haemolytic activity (comparable to, or lower than, that of LL-37). Those IQ-motifs with anti-microbial activity tended to be able to bind to lipopolysaccharide. Some of these were also able to permeabilise the cell membranes of both Gram positive and Gram negative bacteria. These results demonstrate that IQ-motifs are viable lead sequences for the identification and optimisation of novel anti-microbial peptides. Thus, further investigation of the anti-microbial properties of this diverse group of sequences is merited.

  2. The dynamic action mechanism of small cationic antimicrobial peptides.


    Lopez Cascales, J J; Garro, A; Porasso, R D; Enriz, R D


    Antimicrobial peptides form part of the immune system as protection against the action of external pathogens. The differences that exist between mammalian and microbial cell membrane architectures are key aspects of the ability of these peptides to discriminate between pathogens and host cells. Given that the pathogen membrane is the non-specific target of these cationic peptides, different molecular mechanisms have been suggested to describe the rules that permit them to distinguish between pathogens and mammalian cells. In this context, and setting aside the old fashion idea that cationic peptides act through one mechanism alone, this work will provide insight into the molecular action mechanism of small antimicrobial peptides, based on molecular dynamics simulations of phospholipid bilayers that mimic different cell membrane architectures. After measuring different properties of these lipid bilayers, in the absence and presence of peptides, a four-step action mechanism was suggested on the basis of the formation of phospholipid rafts induced by the presence of these cationic peptides. Thus, this work shows how differences in the bending modulus (k(b)) of these lipid rafts and differences in the free energy profiles (ΔG(z)) associated with the insertion of these peptides into these lipid rafts are key aspects for explaining the action mechanism of these cationic peptides at the molecular level.

  3. Discovering new in silico tools for antimicrobial peptide prediction.


    Torrent, Marc; Nogués, M Victòria; Boix, Ester


    Antimicrobial peptides (AMPs) are important effectors of the innate immune system and play a vital role in the prevention of infections. Due to the increased emergence of new antibiotic-resistant bacteria, new drugs are constantly under investigation. AMPs in particular are recognized as promising candidates because of their modularity and wide antimicrobial spectrum. However, the mechanisms of action of AMPs, as well as their structure-activity relationships, are not completely understood. AMPs display no conserved three-dimensional structure and poor sequence conservation, which hinders rational design. Several bioinformatics tools have been developed to generate new templates with appealing antimicrobial properties with the aim of finding highly active peptide compounds with low cytotoxicity. The current tools reviewed here allow for the prediction and design of new active peptides with reasonable accuracy. However, a reliable method to assess the antimicrobial activity of AMPs has not yet been developed. The standardization of procedures to experimentally evaluate the antimicrobial activity of AMPs, together with the constant growth of current well-established databases, may allow for the future development of new bioinformatics tools to accurately predict antimicrobial activity.

  4. Analysis of expressed sequence tags (ESTs) from avocado seed (Persea americana var. drymifolia) reveals abundant expression of the gene encoding the antimicrobial peptide snakin.


    Guzmán-Rodríguez, Jaquelina J; Ibarra-Laclette, Enrique; Herrera-Estrella, Luis; Ochoa-Zarzosa, Alejandra; Suárez-Rodríguez, Luis María; Rodríguez-Zapata, Luis C; Salgado-Garciglia, Rafael; Jimenez-Moraila, Beatriz; López-Meza, Joel E; López-Gómez, Rodolfo


    Avocado is one of the most important fruits in the world. Avocado "native mexicano" (Persea americana var. drymifolia) seeds are widely used in the propagation of this plant and are the primary source of rootstocks globally for a variety of avocado cultivars, such as the Hass avocado. Here, we report the isolation of 5005 ESTs from the 5' ends of P. americana var. drymifolia seed cDNA clones representing 1584 possible unigenes. These avocado seed ESTs were compared with the avocado flower EST library, and we detected several genes that are expressed either in both tissues or only in the seed. The snakin gene, which encodes an element of the innate immune response in plants, was one of those most frequently found among the seed ESTs, and this suggests that it is abundantly expressed in the avocado seed. We expressed the snakin gene in a heterologous system, namely the bovine endothelial cell line BVE-E6E7. Conditioned media from transfected BVE-E6E7 cells showed antimicrobial activity against strains of Escherichia coli and Staphylococcus aureus. This is the first study of the function of the snakin gene in plant seed tissue, and our observations suggest that this gene might play a protective role in the avocado seed.

  5. Chemical and genetic characterization of bacteriocins: antimicrobial peptides for food safety.


    Snyder, Abigail B; Worobo, Randy W


    Antimicrobial peptides are produced across all domains of life. Among these diverse compounds, those produced by bacteria have been most successfully applied as agents of biocontrol in food and agriculture. Bacteriocins are ribosomally synthesized, proteinaceous compounds that inhibit the growth of closely related bacteria. Even within the subcategory of bacteriocins, the peptides vary significantly in terms of the gene cluster responsible for expression, and chemical and structural composition. The polycistronic gene cluster generally includes a structural gene and various combinations of immunity, secretion, and regulatory genes and modifying enzymes. Chemical variation can exist in amino acid identity, chain length, secondary and tertiary structural features, as well as specificity of active sites. This diversity posits bacteriocins as potential antimicrobial agents with a range of functions and applications. Those produced by food-grade bacteria and applied in normally occurring concentrations can be used as GRAS-status food additives. However, successful application requires thorough characterization.

  6. Imaging the action of antimicrobial peptides on living bacterial cells

    PubMed Central

    Gee, Michelle L.; Burton, Matthew; Grevis-James, Alistair; Hossain, Mohammed Akhter; McArthur, Sally; Palombo, Enzo A.; Wade, John D.; Clayton, Andrew H. A.


    Antimicrobial peptides hold promise as broad-spectrum alternatives to conventional antibiotics. The mechanism of action of this class of peptide is a topical area of research focused predominantly on their interaction with artificial membranes. Here we compare the interaction mechanism of a model antimicrobial peptide with single artificial membranes and live bacterial cells. The interaction kinetics was imaged using time-lapse fluorescence lifetime imaging of a fluorescently-tagged melittin derivative. Interaction with the synthetic membranes resulted in membrane pore formation. In contrast, the interaction with bacteria led to transient membrane disruption and corresponding leakage of the cytoplasm, but surprisingly with a much reduced level of pore formation. The discovery that pore formation is a less significant part of lipid-peptide interaction in live bacteria highlights the mechanistic complexity of these interactions in living cells compared to simple artificial systems. PMID:23532056

  7. Antimicrobial peptides: a new class of antimalarial drugs?

    PubMed Central

    Vale, Nuno; Aguiar, Luísa; Gomes, Paula


    A range of antimicrobial peptides (AMP) exhibit activity on malaria parasites, Plasmodium spp., in their blood or mosquito stages, or both. These peptides include a diverse array of both natural and synthetic molecules varying greatly in size, charge, hydrophobicity, and secondary structure features. Along with an overview of relevant literature reports regarding AMP that display antiplasmodial activity, this review makes a few considerations about those molecules as a potential new class of antimalarial drugs. PMID:25566072

  8. cDNA cloning, characterization and expression analysis of a novel antimicrobial peptide gene penaeidin-3 (Fi-Pen3) from the haemocytes of Indian white shrimp Fenneropenaeus indicus.


    Shanthi, S; Vaseeharan, B


    A new member of antimicrobial peptide genes of the penaeidin family, penaeidin 3, was cloned from the haemocytes of Indian white shrimp Fenneropeneaus indicus (F. indicus), by reverse transcription PCR (RT-PCR) and rapid amplification of cDNA end (RACE-PCR) methods. The complete nucleotide sequence of cDNA clone of Indian white shrimp F. indicus Penaeidin 3 (Fi-Pen3) was 243bp long and has an open reading frame which encodes 80 amino acid peptide. The homology analysis of Fi-Pen3 sequence with other Penaeidins 3 shows higher similarity with Penaeus monodon (92%). The theoretical 3D structure generated through ab initio modelling indicated the presence of two-disulphide bridges in the alpha-helix. The signal peptide sequence of Fi-Pen3 is almost entirely homologous to that of other Penaeidin 3 of crustaceans, while differing relatively in the N-terminal domain of the mature peptide. The mature peptide has a predicted molecular weight of 84.9kDa, and a theoretical pI of 9.38. Phylogenetic analysis of Fi-Pen3 shows high resemblance with other Pen-3 from P. monodon, Litopenaeus stylirostris, Litopenaeus vannamei and Litopenaeus setiferus. Fi-Pen3 found to be expressed in haemocytes, heart, hepatopancreas, muscles, gills, intestine, and eyestalk with higher expression in haemocytes. Microbial challenge resulted in mRNA up-regulation, up to 6h post injection of Vibrio parahemolyticus. The Fi-Pen3 mRNA expression of F. indicus in the premolt stage (D(01) and D(02)) was significantly up-regulated than the postmolt (A and B) and intermolt stages (C). The findings of the present paper underline the involvement of Fi-Pen3 in innate immune system of F. indicus.

  9. Characterization of the Antimicrobial Peptide Penisin, a Class Ia Novel Lantibiotic from Paenibacillus sp. Strain A3

    PubMed Central

    Baindara, Piyush; Chaudhry, Vasvi; Mittal, Garima; Liao, Luciano M.; Matos, Carolina O.; Khatri, Neeraj; Franco, Octavio L.; Patil, Prabhu B.


    Attempts to isolate novel antimicrobial peptides from microbial sources have been on the rise recently, despite their low efficacy in therapeutic applications. Here, we report identification and characterization of a new efficient antimicrobial peptide from a bacterial strain designated A3 that exhibited highest identity with Paenibacillus ehimensis. Upon purification and subsequent molecular characterization of the antimicrobial peptide, referred to as penisin, we found the peptide to be a bacteriocin-like peptide. Consistent with these results, RAST analysis of the entire genome sequence revealed the presence of a lantibiotic gene cluster containing genes necessary for synthesis and maturation of a lantibiotic. While circular dichroism and one-dimension nuclear magnetic resonance experiments confirmed a random coil structure of the peptide, similar to other known lantibiotics, additional biochemical evidence suggests posttranslational modifications of the core peptide yield six thioether cross-links. The deduced amino acid sequence of the putative biosynthetic gene penA showed approximately 74% similarity with elgicin A and 50% similarity with the lantibiotic paenicidin A. Penisin effectively killed methicillin-resistant Staphylococcus aureus (MRSA) and did not exhibit hemolysis activity. Unlike other lantibiotics, it effectively inhibited the growth of Gram-negative bacteria. Furthermore, 80 mg/kg of body weight of penisin significantly reduced bacterial burden in a mouse thigh infection model and protected BALB/c mice in a bacteremia model entailing infection with Staphylococcus aureus MTCC 96, suggesting that it could be a promising new antimicrobial peptide. PMID:26574006

  10. A novel C-type lectin with four CRDs is involved in the regulation of antimicrobial peptide gene expression in Hyriopsis cumingii.


    Zhao, Ling-Ling; Wang, Yu-Qing; Dai, Yun-Jia; Zhao, Li-Juan; Qin, Qiwei; Lin, Li; Ren, Qian; Lan, Jiang-Feng


    C-type lectins (CTLs) are found in a wide number of invertebrates, and have been reported to participate in immune responses, such as the activation of prophenoloxidase, cell adhesion, bacterial clearance and phagocytosis. Previous studies on CTLs focused on the function of their carbohydrate recognition domains (CRDs). Currently, studies on lectins with multi-CRDs are limited. In this study, a lectin with four CRDs was cloned from Hyriopsis cumingii, and called HcLec4. HcLec4 was widely distributed in several tissues and was significantly down-regulated at the early stage (2 h) of bacterial infection. We further analyzed the bacteria and carbohydrate binding activities of HcLec4. The results showed that HcLec4 could bind to several bacteria, lipopolysaccharide (LPS) and peptidoglycan (PGN). In HcLec4 knockdown mussels, the bacterial clearance rate was increased, and the expression level of antimicrobial peptides (AMPs) was up-regulated. This study reveals that HcLec4 exerts its antibacterial effect by regulating the expression of AMPs at the early stage of bacterial infection.

  11. Identification of candidate antimicrobial peptides derived from abalone hemocyanin.


    Zhuang, Jun; Coates, Christopher J; Zhu, Hongtao; Zhu, Ping; Wu, Zujian; Xie, Lianhui


    Hemocyanins present in invertebrate hemolymph are multifunctional proteins, responsible for oxygen transport and contributing to innate immunity through phenoloxidase-like activity. In arthropods, hemocyanin has been identified as a source of broad-spectrum antimicrobial peptides during infection. Conversely, no hemocyanin-derived antimicrobial peptides have been reported for molluscs. The present study describes a putative antimicrobial region, termed haliotisin, located within the linking sequence between the α-helical domain and β-sheet domain of abalone (Haliotis tuberculata) hemocyanin functional unit E. A series of synthetic peptides based on overlapping fragments of the haliotisin region were tested for their bactericidal potential. Incubating Gram-positive and Gram-negative bacteria in the presence of certain haliotisin peptides, notably peptides 3-4-5 (DTFDYKKFGYRYDSLELEGRSISRIDELIQQRQEKDRTFAGFLLKGFGTSAS) led to reductions in microbial growth. Furthermore, transmission electron micrographs of haliotisin-treated bacteria revealed damages to the microbial cell wall. Data discussed here provides the first evidence to suggest that molluscan hemocyanin may act as a source of anti-infective peptides.

  12. Linear antimicrobial peptides from Ectatomma quadridens ant venom.


    Pluzhnikov, Kirill A; Kozlov, Sergey A; Vassilevski, Alexander A; Vorontsova, Olga V; Feofanov, Alexei V; Grishin, Eugene V


    Venoms from three poneromorph ant species (Paraponera clavata, Ectatomma quadridens and Ectatomma tuberculatum) were investigated for the growth inhibition of Gram-positive and Gram-negative bacteria. It was shown that the venom of E. quadridens and its peptide fraction in particular possess marked antibacterial action. Three linear antimicrobial peptides sharing low similarity to the well-known ponericin peptides were isolated from this ant venom by means of size-exclusion and reversed-phase chromatography. The peptides showed antimicrobial activity at low micromolar concentrations. Their primary structure was established by direct Edman sequencing in combination with mass spectrometry. The most active peptide designated ponericin-Q42 was chemically synthesized. Its secondary structure was investigated in aqueous and membrane-mimicking environment, and the peptide was shown to be partially helical already in water, which is unusual for short linear peptides. Analysis of its activity on different bacterial strains, human erythrocytes and chronic myelogenous leukemia K562 cells revealed that the peptide shows broad spectrum cytolytic activity at micromolar and submicromolar concentrations. Ponericin-Q42 also possesses weak toxic activity on flesh fly larvae with LD50 of ∼105 μg/g.

  13. Antimicrobial potency and selectivity of simplified symmetric-end peptides.


    Dong, Na; Zhu, Xin; Chou, Shuli; Shan, Anshan; Li, Weizhong; Jiang, Junguang


    Because antimicrobial peptides (AMPs) are potentially useful for the treatment of multidrug-resistant infections, more attention is being paid to the structural modification and structure-function relationship of both naturally occurring and synthetic AMPs. Previous studies indicated that Protegrin-1 (PG-1), isolated from porcine leukocytes, exhibited considerable antimicrobial activity and cytotoxicity. The β-turn of PG-1 floated on the surface of bacterial membrane, while its β-strand inserted into the bacterial membrane and formed pores that were dedicated to producing cytotoxicity. For reducing cytotoxicity and improving cells selectivity, we designed a series of simplified symmetric-end peptides by combining the β-turn of PG-1 with simple amino acid repeat sequences. The sequence of designed symmetric-end peptides is (XR)nH(RX)n, (n = 1,2; X represents I, F, W and P; H represents CRRRFC). The symmetric-end peptides displayed antimicrobial activity against both gram-positive and gram-negative bacteria. In particular, (XR)2H(RX)2 (X here is I, F and W) showed greater antimicrobial potency than PG-1. Hemolysis activity and cytotoxicity, detected by using human red blood cells (RBCs) and human embryonic lung fibroblasts MRC-5 cells, were observably lower than the native peptide PG-1. (IR)2H(RI)2 (IR2), folded into β-sheet structures, displayed the highest therapeutic index, suggesting its great cell selectivity. The fluorescence spectroscopy, flow cytometry, and electron microscopy observation indicated that IR2 exhibited great membrane penetration potential by inducing membrane blebbing, disruption and lysis. Collectively, generating symmetric-end β-sheet peptides is a promising strategy for designing effective AMPs with great antimicrobial activities and cell selectivity.

  14. Lipid-Based Liquid Crystals As Carriers for Antimicrobial Peptides: Phase Behavior and Antimicrobial Effect.


    Boge, Lukas; Bysell, Helena; Ringstad, Lovisa; Wennman, David; Umerska, Anita; Cassisa, Viviane; Eriksson, Jonny; Joly-Guillou, Marie-Laure; Edwards, Katarina; Andersson, Martin


    The number of antibiotic-resistant bacteria is increasing worldwide, and the demand for novel antimicrobials is constantly growing. Antimicrobial peptides (AMPs) could be an important part of future treatment strategies of various bacterial infection diseases. However, AMPs have relatively low stability, because of proteolytic and chemical degradation. As a consequence, carrier systems protecting the AMPs are greatly needed, to achieve efficient treatments. In addition, the carrier system also must administrate the peptide in a controlled manner to match the therapeutic dose window. In this work, lyotropic liquid crystalline (LC) structures consisting of cubic glycerol monooleate/water and hexagonal glycerol monooleate/oleic acid/water have been examined as carriers for AMPs. These LC structures have the capability of solubilizing both hydrophilic and hydrophobic substances, as well as being biocompatible and biodegradable. Both bulk gels and discrete dispersed structures (i.e., cubosomes and hexosomes) have been studied. Three AMPs have been investigated with respect to phase stability of the LC structures and antimicrobial effect: AP114, DPK-060, and LL-37. Characterization of the LC structures was performed using small-angle X-ray scattering (SAXS), dynamic light scattering, ζ-potential, and cryogenic transmission electron microscopy (Cryo-TEM) and peptide loading efficacy by ultra performance liquid chromatography. The antimicrobial effect of the LCNPs was investigated in vitro using minimum inhibitory concentration (MIC) and time-kill assay. The most hydrophobic peptide (AP114) was shown to induce an increase in negative curvature of the cubic LC system. The most polar peptide (DPK-060) induced a decrease in negative curvature while LL-37 did not change the LC phase at all. The hexagonal LC phase was not affected by any of the AMPs. Moreover, cubosomes loaded with peptides AP114 and DPK-060 showed preserved antimicrobial activity, whereas particles loaded

  15. Selected antimicrobial peptides inhibit in vitro growth of Campylobacter spp.

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Novel alternatives to traditional antibiotics are urgently needed for food-animal production. A goal of our laboratory is to develop and evaluate antimicrobial peptides (AMP) to control and reduce foodborne pathogens in poultry. AMP have been found in most every class of living organism where they h...

  16. Design of novel analogues of short antimicrobial peptide anoplin with improved antimicrobial activity.


    Wang, Yang; Chen, Jianbo; Zheng, Xin; Yang, Xiaoli; Ma, Panpan; Cai, Ying; Zhang, Bangzhi; Chen, Yuan


    Currently, novel antibiotics are urgently required to combat the emergence of drug-resistant bacteria. Antimicrobial peptides with membrane-lytic mechanism of action have attracted considerable interest. Anoplin, a natural α-helical amphiphilic antimicrobial peptide, is an ideal research template because of its short sequence. In this study, we designed and synthesized a group of analogues of anoplin. Among these analogues, anoplin-4 composed of D-amino acids displayed the highest antimicrobial activity due to increased charge, hydrophobicity and amphiphilicity. Gratifyingly, anoplin-4 showed low toxicity to host cells, indicating high bacterial selectivity. Furthermore, the mortality rate of mice infected with Escherichia coli was significantly reduced by anoplin-4 treatment relative to anoplin. In conclusion, anoplin-4 is a novel anoplin analogue with high antimicrobial activity and enzymatic stability, which may represent a potent agent for the treatment of infection.

  17. Lipid selectivity in novel antimicrobial peptides: Implication on antimicrobial and hemolytic activity.


    Maturana, P; Martinez, M; Noguera, M E; Santos, N C; Disalvo, E A; Semorile, L; Maffia, P C; Hollmann, A


    Antimicrobial peptides (AMPs) are small cationic molecules that display antimicrobial activity against a wide range of bacteria, fungi and viruses. For an AMP to be considered as a therapeutic option, it must have not only potent antibacterial properties but also low hemolytic and cytotoxic activities [1]. Even though many studies have been conducted in order to correlate the antimicrobial activity with affinity toward model lipid membranes, the use of these membranes to explain cytotoxic effects (especially hemolysis) has been less explored. In this context, we studied lipid selectivity in two related novel AMPs, peptide 6 (P6) and peptide 6.2 (P6.2). Each peptide was designed from a previously reported AMP, and specific amino acid replacements were performed in an attempt to shift their hydrophobic moment or net charge. P6 showed no antimicrobial activity and high hemolytic activity, and P6.2 exhibited good antibacterial and low hemolytic activity. Using both peptides as a model we correlated the affinity toward membranes of different lipid composition and the antimicrobial and hemolytic activities. Our results from surface pressure and zeta potential assays showed that P6.2 exhibited a higher affinity and faster binding kinetic toward PG-containing membranes, while P6 showed this behavior for pure PC membranes. The final position and structure of P6.2 into the membrane showed an alpha-helix conversion, resulting in a parallel alignment with the Trps inserted into the membrane. On the other hand, the inability of P6 to adopt an amphipathic structure, plus its lower affinity toward PG-containing membranes seem to explain its poor antimicrobial activity. Regarding erythrocyte interactions, P6 showed the highest affinity toward erythrocyte membranes, resulting in an increased hemolytic activity. Overall, our data led us to conclude that affinity toward negatively charged lipids instead of zwitterionic ones seems to be a key factor that drives from hemolytic to

  18. A potent antimicrobial peptide derived from the protein LsGRP1 of Lilium.


    Lin, Chia-Hua; Chang, Min-Wei; Chen, Chao-Ying


    LsGRP1 is a defense-related gene differentially expressed in lily leaves in response to pathogen attack. The difficulty in the expression of LsGRP1 in Escherichia coli suggested the presence of antimicrobial activity in LsGRP1. To evaluate the antimicrobial trait of LsGRP1, three LsGRP1-derived peptides were chemically synthesized; namely LsGRP1(N) (N-terminal region without the signal peptide), LsGRP1(G) (glycine-rich region), and LsGRP1(C) (C-terminal cysteine-rich region). LsGRP1(C) was proposed to be a potential antimicrobial agent according to its broad-spectrum and effective antimicrobial activity. LsGRP1(C) displayed inhibition effects on bacterial and fungal growth, possibly by altering the integrity of the cell membrane, as indicated by scanning electron microscopy and SYTOX Green staining assays. Additionally, LsGRP1(C) induced programmed cell death-like phenomenon in the tested fungal species as indicated by 2',7'-dichlorodihydrofluorescein diacetate and 4',6'-diamidino-2-phenylindole assays. Further immunofluorescence staining showed that LsGRP1(C) was located at the fungal cell surface. According to these observations, we concluded that LsGRP1(C) originated from the plant defense-related protein LsGRP1 would play a role as an antimicrobial peptide and have a potential for practical use.

  19. Sequence requirements and an optimization strategy for short antimicrobial peptides.


    Hilpert, Kai; Elliott, Melissa R; Volkmer-Engert, Rudolf; Henklein, Peter; Donini, Oreola; Zhou, Qun; Winkler, Dirk F H; Hancock, Robert E W


    Short antimicrobial host-defense peptides represent a possible alternative as lead structures to fight antibiotic resistant bacterial infections. Bac2A is a 12-mer linear variant of the naturally occurring bovine host defense peptide, bactenecin, and demonstrates moderate, broad-spectrum antimicrobial activity against Gram-positive and Gram-negative bacteria as well as against the yeast Candida albicans. With the assistance of a method involving peptide synthesis on a cellulose support, the primary sequence requirements for antimicrobial activity against the human pathogen Pseudomonas aeruginosa of 277 Bac2A variants were investigated by using a luciferase-based assay. Sequence scrambling of Bac2A led to activities ranging from superior or equivalent to Bac2A to inactive, indicating that good activity was not solely dependent on the composition of amino acids or the overall charge or hydrophobicity, but rather required particular linear sequence patterns. A QSAR computational analysis was applied to analyze the data resulting in a model that supported this sequence pattern hypothesis. The activity of selected peptides was confirmed by conventional minimal inhibitory concentration (MIC) analyses with a panel of human pathogen bacteria and fungi. Circular-dichroism (CD) spectroscopy with selected peptides in liposomes and membrane depolarization assays were consistent with a relationship between structure and activity. An additional optimization process was performed involving systematic amino acid substitutions of one of the optimal scrambled peptide variants, resulting in superior active peptide variants. This process provides a cost and time effective enrichment of new candidates for drug development, increasing the chances of finding pharmacologically relevant peptides.

  20. S. Typhimurium strategies to resist killing by cationic antimicrobial peptides.


    Matamouros, Susana; Miller, Samuel I


    S. Typhimurium is a broad host range Gram-negative pathogen that must evade killing by host innate immune systems to colonize, replicate, cause disease, and be transmitted to other hosts. A major pathogenic strategy of Salmonellae is entrance, survival, and replication within eukaryotic cell phagocytic vacuoles. These phagocytic vacuoles and gastrointestinal mucosal surfaces contain multiple cationic antimicrobial peptides (CAMPs) which control invading bacteria. S. Typhimurium possesses several key mechanisms to resist killing by CAMPs which involve sensing CAMPs and membrane damage to activate signaling cascades that result in remodeling of the bacterial envelope to reduce its overall negative charge with an increase in hydrophobicity to decrease binding and effectiveness of CAMPs. Moreover Salmonellae have additional mechanisms to resist killing by CAMPs including an outer membrane protease which targets cationic peptides at the surface, and specific efflux pumps which protect the inner membrane from damage. This article is part of a Special Issue entitled: Bacterial Resistance to Antimicrobial Peptides.

  1. Chemical immobilization of antimicrobial peptides on biomaterial surfaces.


    Silva, Rafael R; Avelino, Karen Y P S; Ribeiro, Kalline L; Franco, Octavio L; Oliveira, Maria D L; Andrade, Cesar A S


    The hospital infections associated with surgical procedures and implants still represents a severe problem to modern society. Therefore, new strategies to combat bacterial infections mainly caused by microorganisms resistant to conventional antibiotics are extremely necessary. In this context, antimicrobial peptides have gained prominence due their biocompatibility, low toxicity and effectiveness. The immobilization of antimicrobial peptides (AMPs) onto a biomaterial surface is an excellent alternative to the development of new biodevices with microbicide properties. Herein, we describe reports related to physical-chemical characterization, in vitro/in vivo studies and clinical applicability. In this review, we focused on the AMPs mechanisms of action, different peptide immobilization strategies on solid surface and their microbicide effectiveness.

  2. Synthetic cationic amphiphilic α-helical peptides as antimicrobial agents.


    Wiradharma, Nikken; Khoe, Ulung; Hauser, Charlotte A E; Seow, See Voon; Zhang, Shuguang; Yang, Yi-Yan


    Antimicrobial peptides (AMPs) secreted by the innate immune system are prevalent as the effective first-line of defense to overcome recurring microbial invasions. They have been widely accepted as the blueprints for the development of new antimicrobial agents for the treatment of drug resistant infections. However, there is also a growing concern that AMPs with a sequence that is too close to the host organism's AMP may inevitably compromise its own natural defense. In this study, we design a series of synthetic (non-natural) short α-helical AMPs to expand the arsenal of the AMP families and to gain further insights on their antimicrobial activities. These cationic and amphiphilic peptides have a general sequence of (XXYY)(n) (X: hydrophobic residue, Y: cationic residue, and n: the number of repeat units), and are designed to mimic the folding behavior of the naturally-occurring α-helical AMPs. The synthetic α-helical AMPs with 3 repeat units, (FFRR)(3), (LLRR)(3), and (LLKK)(3), are found to be more selective towards microbial cells than rat red blood cells, with minimum inhibitory concentration (MIC) values that are more than 10 times lower than their 50% hemolytic concentrations (HC(50)). They are effective against Gram-positive B. subtilis and yeast C. albicans; and the studies using scanning electron microscopy (SEM) have elucidated that these peptides possess membrane-lytic activities against microbial cells. Furthermore, non-specific immune stimulation assays of a typical peptide shows negligible IFN-α, IFN-γ, and TNF-α inductions in human peripheral blood mononuclear cells, which implies additional safety aspects of the peptide for both systemic and topical use. Therefore, the peptides designed in this study can be promising antimicrobial agents against the frequently-encountered Gram-positive bacteria- or yeast-induced infections.

  3. Purification, characterisation and cDNA cloning of an antimicrobial peptide from Macadamia integrifolia.


    Marcus, J P; Goulter, K C; Green, J L; Harrison, S J; Manners, J M


    An antimicrobial peptide with no significant amino acid sequence similarity to previously described peptides has been isolated from the nut kernels of Macadcamia integrifolia. The peptide, termed MiAMP1, is highly basic with an estimated pI of 10.1, a mass of 8.1 kDa and contains 76 amino acids including 6 cysteine residues. A cDNA clone containing the entire coding region corresponding to the peptide was obtained. The deduced amino acid sequence of the cDNA indicated a 26-amino-acid signal peptide at the N-terminus of the preprotein. Purified MiAMP1 inhibited the growth of a variety of fungal, oomycete and gram-positive bacterial phytopathogens in vitro. Some pathogens exhibited close to 100% inhibition in less than 1 microM peptide (5 microg/ml). Antimicrobial activity was diminished against most, but not all, microbes in the presence of calcium and potassium chloride salts (1 mM and 50 mM, respectively). MiAMP1 was active against bakers yeast, was inactive against Escherichia coli and was non-toxic to plant and mammalian cells. Analysis of genomic DNA indicated that MiAMP1 was encoded on a single copy gene containing no introns. The MiAMP1 gene may prove useful in genetic manipulations to increase disease resistance in transgenic plants.

  4. Purification and characterization of an antimicrobial peptide, insect defensin, from immunized house fly (Diptera: Muscidae).


    Dang, X L; Wang, Y S; Huang, Y D; Yu, X Q; Zhang, W Q


    The house fly, Musca domestica L. (Diptera: Muscidae), is involved in phoretic movement of pathogenic agents, but it has a very efficient defense mechanism against infection. It is believed that antimicrobial peptides play a significant role in the defense system of the house fly. Here, we isolated a peptide from the immunized house fly pupae, measured its molecular mass (3987.6 Da) by matrix-assisted laser desorption ionization/time of flight-mass spectrometry, and determined its amino acid sequence by using the Procise Protein Sequencing System (Applied Biosystems, Foster City, CA). The peptide was confirmed as a member of the insect defensin family. It displayed high activity against gram-positive bacteria but lower activity against gram-negative bacteria and fungi. Reverse transcription-polymerase chain reaction showed that the house fly defensin gene was constitutively expressed in naive pupae and strongly up-regulated after immunization. House fly defensin is an amphiphilic peptide with a structure similar to that of the CSalphabeta scaffold of insect defensin A from the flesh fly, Phormia terraenovae Robineau-Desvoidy. To our knowledge, this is the first isolated and characterized house fly antimicrobial peptide, and our work may provide useful information for developing pharmacologically active antimicrobial agents.

  5. The Medical Potential of Antimicrobial Peptides from Insects.


    Tonk, Miray; Vilcinskas, Andreas


    Antimicrobial peptides (AMPs) are peptide-based effector molecules produced by the innate immune system to combat microbes. Insects produce the broadest repertoire of AMPs, and their potent antimicrobial activity in vitro and in vivo has promoted their development as alternatives to conventional antibiotics, in an attempt to address the threat of multidrug-resistant pathogens. Here we discuss current obstacles that hinder the therapeutic development of novel insect-derived AMPs, including potential cytotoxic, immunogenic and allergenic side effects, and the high costs of large-scale production. These challenges may be overcome by the falling costs of synthetic peptide analogs and the heterologous production of recombinant peptides in insect cells or plants (molecular pharming). Insect AMPs offer a promising alternative for the treatment of skin, eye and lung infections, and could also restore the susceptibility of multidrug-resistant pathogens to conventional antibiotics when used as combinatorial treatments. Insect AMPs can also be used as templates for the rational design of peptide mimetics to overcome the drawbacks of natural therapeutic peptides.

  6. Design and Engineering Strategies for Synthetic Antimicrobial Peptides

    NASA Astrophysics Data System (ADS)

    Tossi, Alessandro

    Thousands of antimicrobial peptides (AMPs) of prokaryotic, fungal, plant, or animal origin have been identified, and their potential as lead compounds for the design of novel therapeutic agents in the treatment of infection, for stimulating the immune system, or in countering septic shock has been widely recognized. Added to this is their possible use in prophylaxis of infectious diseases for animal or plant protection, for disinfection of surgical instruments or industrial surfaces, and for food preservation among other commercially important applications. Since the early eighties, AMPs have been subject to a vast number of studies aimed at understanding what determines their potency and spectrum of activities against bacterial or fungal pathogens, and at maximizing these while limiting cytotoxic activities toward host cells. Much research has also been directed toward understanding specific mechanisms of action underlying the antimicrobial activity and selectivity, to be able to redesign the peptides for optimal performance. A central theme in the mode of action of many AMPs is their dynamic interaction with biological membranes, which involves various properties of these peptides such as, among others, surface hydrophobicity and polarity, charge, structure, and induced conformational variations. These features are often intimately interconnected so that engineering peptides to independently adjust any one property in particular is not an easy task. However, solid-phase peptide synthesis allows the use of a large repertoire of nonproteinogenic amino acids that can be used in the rational design of peptides to finely tune structural and physicochemical properties and precisely probe structure-function relationships.

  7. Antimicrobial peptides from the skins of North American frogs.


    Conlon, J Michael; Kolodziejek, Jolanta; Nowotny, Norbert


    North America is home to anuran species belonging to the families Bufonidae, Eleutherodactylidae, Hylidae, Leiopelmatidae, Ranidae, and Scaphiopodidae but antimicrobial peptides have been identified only in skin secretions and/or skin extracts of frogs belonging to the Leiopelmatidae ("tailed frogs") and Ranidae ("true frogs"). Eight structurally-related cationic alpha-helical peptides with broad-spectrum antibacterial activity, termed ascaphins, have been isolated from specimens of Ascaphus truei (Leiopelmatidae) occupying a coastal range. Characterization of orthologous antimicrobial peptides from Ascaphus specimens occupying an inland range supports the proposal that this population should be regarded as a separate species A. montanus. Ascaphin-8 shows potential for development into a therapeutically valuable anti-infective agent. Peptides belonging to the brevinin-1, esculentin-1, esculentin-2, palustrin-1, palustrin-2, ranacyclin, ranatuerin-1, ranatuerin-2, and temporin families have been isolated from North American ranids. It is proposed that "ranalexins" represent brevinin-1 peptides that have undergone a four amino acid residue internal deletion. Current taxonomic recommendations divide North American frogs from the family Ranidae into two genera: Lithobates and Rana. Cladistic analysis based upon the amino acid sequences of the brevinin-1 peptides provides strong support for this assignment.

  8. Defensins and Other Antimicrobial Peptides at the Ocular Surface

    PubMed Central

    McDermott, Alison M.


    Although constantly exposed to the environment and “foreign bodies” such as contact lenses and unwashed fingertips, the ocular surface succumbs to infection relatively infrequently. This is, in large part, due to a very active and robust innate immune response mounted at the ocular surface. Studies over the past 20 years have revealed that small peptides with antimicrobial activity are a major component of the human innate immune response system. The ocular surface is no exception, with peptides of the defensin and cathelicidin families being detected in the tear film and secreted by corneal and conjunctival epithelial cells. There is also much evidence to suggest that the role of some antimicrobial peptides is not restricted to direct killing of pathogens, but, rather, that they function in various aspects of the immune response, including recruitment of immune cells, and through actions on dendritic cells provide a link to adaptive immunity. A role in wound healing is also supported. In this article, the properties, mechanisms of actions and functional roles of antimicrobial peptides are reviewed, with particular emphasis on the potential multifunctional roles of defensins and LL-37 (the only known human cathelicidin) at the ocular surface. PMID:17216098

  9. The therapeutic applications of antimicrobial peptides (AMPs): a patent review.


    Kang, Hee-Kyoung; Kim, Cheolmin; Seo, Chang Ho; Park, Yoonkyung


    Antimicrobial peptides (AMPs) are small molecules with a broad spectrum of antibiotic activities against bacteria, yeasts, fungi, and viruses and cytotoxic activity on cancer cells, in addition to anti-inflammatory and immunomodulatory activities. Therefore, AMPs have garnered interest as novel therapeutic agents. Because of the rapid increase in drug-resistant pathogenic microorganisms, AMPs from synthetic and natural sources have been developed using alternative antimicrobial strategies. This article presents a broad analysis of patents referring to the therapeutic applications of AMPs since 2009. The review focuses on the universal trends in the effective design, mechanism, and biological evolution of AMPs.

  10. Mechanisms of Antimicrobial Peptide Resistance in Gram-Negative Bacteria

    PubMed Central

    Band, Victor I.; Weiss, David S.


    Cationic antimicrobial peptides (CAMPs) are important innate immune defenses that inhibit colonization by pathogens and contribute to clearance of infections. Gram-negative bacterial pathogens are a major target, yet many of them have evolved mechanisms to resist these antimicrobials. These resistance mechanisms can be critical contributors to bacterial virulence and are often crucial for survival within the host. Here, we summarize methods used by Gram-negative bacteria to resist CAMPs. Understanding these mechanisms may lead to new therapeutic strategies against pathogens with extensive CAMP resistance. PMID:25927010

  11. Mechanisms of Antimicrobial Peptide Resistance in Gram-Negative Bacteria.


    Band, Victor I; Weiss, David S


    Cationic antimicrobial peptides (CAMPs) are important innate immune defenses that inhibit colonization by pathogens and contribute to clearance of infections. Gram-negative bacterial pathogens are a major target, yet many of them have evolved mechanisms to resist these antimicrobials. These resistance mechanisms can be critical contributors to bacterial virulence and are often crucial for survival within the host. Here, we summarize methods used by Gram-negative bacteria to resist CAMPs. Understanding these mechanisms may lead to new therapeutic strategies against pathogens with extensive CAMP resistance.

  12. Regulation of Antimicrobial Peptides in Aedes aegypti Aag2 Cells.


    Zhang, Rudian; Zhu, Yibin; Pang, Xiaojing; Xiao, Xiaoping; Zhang, Renli; Cheng, Gong


    Antimicrobial peptides (AMPs) are an important group of immune effectors that play a role in combating microbial infections in invertebrates. Most of the current information on the regulation of insect AMPs in microbial infection have been gained from Drosophila, and their regulation in other insects are still not completely understood. Here, we generated an AMP induction profile in response to infections with some Gram-negative, -positive bacteria, and fungi in Aedes aegypti embryonic Aag2 cells. Most of the AMP inductions caused by the gram-negative bacteria was controlled by the Immune deficiency (Imd) pathway; nonetheless, Gambicin, an AMP gene discovered only in mosquitoes, was combinatorially regulated by the Imd, Toll and JAK-STAT pathways in the Aag2 cells. Gambicin promoter analyses including specific sequence motif deletions implicated these three pathways in Gambicin activity, as shown by a luciferase assay. Moreover, the recognition between Rel1 (refer to Dif/Dorsal in Drosophila) and STAT and their regulatory sites at the Gambicin promoter site was validated by a super-shift electrophoretic mobility shift assay (EMSA). Our study provides information that increases our understanding of the regulation of AMPs in response to microbial infections in mosquitoes. And it is a new finding that the A. aegypti AMPs are mainly regulated Imd pathway only, which is quite different from the previous understanding obtained from Drosophila.

  13. Regulation of Antimicrobial Peptides in Aedes aegypti Aag2 Cells

    PubMed Central

    Zhang, Rudian; Zhu, Yibin; Pang, Xiaojing; Xiao, Xiaoping; Zhang, Renli; Cheng, Gong


    Antimicrobial peptides (AMPs) are an important group of immune effectors that play a role in combating microbial infections in invertebrates. Most of the current information on the regulation of insect AMPs in microbial infection have been gained from Drosophila, and their regulation in other insects are still not completely understood. Here, we generated an AMP induction profile in response to infections with some Gram-negative, -positive bacteria, and fungi in Aedes aegypti embryonic Aag2 cells. Most of the AMP inductions caused by the gram-negative bacteria was controlled by the Immune deficiency (Imd) pathway; nonetheless, Gambicin, an AMP gene discovered only in mosquitoes, was combinatorially regulated by the Imd, Toll and JAK-STAT pathways in the Aag2 cells. Gambicin promoter analyses including specific sequence motif deletions implicated these three pathways in Gambicin activity, as shown by a luciferase assay. Moreover, the recognition between Rel1 (refer to Dif/Dorsal in Drosophila) and STAT and their regulatory sites at the Gambicin promoter site was validated by a super-shift electrophoretic mobility shift assay (EMSA). Our study provides information that increases our understanding of the regulation of AMPs in response to microbial infections in mosquitoes. And it is a new finding that the A. aegypti AMPs are mainly regulated Imd pathway only, which is quite different from the previous understanding obtained from Drosophila. PMID:28217557

  14. Small cationic antimicrobial peptides delocalize peripheral membrane proteins

    PubMed Central

    Wenzel, Michaela; Chiriac, Alina Iulia; Otto, Andreas; Zweytick, Dagmar; May, Caroline; Schumacher, Catherine; Gust, Ronald; Albada, H. Bauke; Penkova, Maya; Krämer, Ute; Erdmann, Ralf; Metzler-Nolte, Nils; Straus, Suzana K.; Bremer, Erhard; Becher, Dörte; Brötz-Oesterhelt, Heike; Sahl, Hans-Georg; Bandow, Julia Elisabeth


    Short antimicrobial peptides rich in arginine (R) and tryptophan (W) interact with membranes. To learn how this interaction leads to bacterial death, we characterized the effects of the minimal pharmacophore RWRWRW-NH2. A ruthenium-substituted derivative of this peptide localized to the membrane in vivo, and the peptide also integrated readily into mixed phospholipid bilayers that resemble Gram-positive membranes. Proteome and Western blot analyses showed that integration of the peptide caused delocalization of peripheral membrane proteins essential for respiration and cell-wall biosynthesis, limiting cellular energy and undermining cell-wall integrity. This delocalization phenomenon also was observed with the cyclic peptide gramicidin S, indicating the generality of the mechanism. Exogenous glutamate increases tolerance to the peptide, indicating that osmotic destabilization also contributes to antibacterial efficacy. Bacillus subtilis responds to peptide stress by releasing osmoprotective amino acids, in part via mechanosensitive channels. This response is triggered by membrane-targeting bacteriolytic peptides of different structural classes as well as by hypoosmotic conditions. PMID:24706874

  15. Antimicrobial Peptides: An Emerging Category of Therapeutic Agents

    PubMed Central

    Mahlapuu, Margit; Håkansson, Joakim; Ringstad, Lovisa; Björn, Camilla


    Antimicrobial peptides (AMPs), also known as host defense peptides, are short and generally positively charged peptides found in a wide variety of life forms from microorganisms to humans. Most AMPs have the ability to kill microbial pathogens directly, whereas others act indirectly by modulating the host defense systems. Against a background of rapidly increasing resistance development to conventional antibiotics all over the world, efforts to bring AMPs into clinical use are accelerating. Several AMPs are currently being evaluated in clinical trials as novel anti-infectives, but also as new pharmacological agents to modulate the immune response, promote wound healing, and prevent post-surgical adhesions. In this review, we provide an overview of the biological role, classification, and mode of action of AMPs, discuss the opportunities and challenges to develop these peptides for clinical applications, and review the innovative formulation strategies for application of AMPs. PMID:28083516

  16. Antimicrobial Peptides with Differential Bacterial Binding Characteristics

    DTIC Science & Technology


    screened also displayed discriminatory binding to pathogenic E. coli O157:H7 relative to non -pathogenic E. coli ML35. The three fragments that were...screened for binding to pathogenic and non -pathogenic Escherichia coli (a Gram- negative bacterium) as well as Staphylococcus aureus (a Gram-positive...strain-specific (pathogenic vs. non -pathogenic E. coli). Several of the peptide fragments demonstrated the ability to discriminate between

  17. Peptides from the scorpion Vaejovis punctatus with broad antimicrobial activity.


    Ramírez-Carreto, Santos; Jiménez-Vargas, Juana María; Rivas-Santiago, Bruno; Corzo, Gerardo; Possani, Lourival D; Becerril, Baltazar; Ortiz, Ernesto


    The antimicrobial potential of two new non-disulfide bound peptides, named VpAmp1.0 (LPFFLLSLIPSAISAIKKI, amidated) and VpAmp2.0 (FWGFLGKLAMKAVPSLIGGNKSSSK) is here reported. These are 19- and 25-aminoacid-long peptides with +2 and +4 net charges, respectively. Their sequences correspond to the predicted mature regions from longer precursors, putatively encoded by cDNAs derived from the venom glands of the Mexican scorpion Vaejovis punctatus. Both peptides were chemically synthesized and assayed against a variety of microorganisms, including pathogenic strains from clinical isolates and strains resistant to conventional antibiotics. Two shorter variants, named VpAmp1.1 (FFLLSLIPSAISAIKKI, amidated) and VpAmp2.1 (FWGFLGKLAMKAVPSLIGGNKK), were also synthesized and tested. The antimicrobial assays revealed that the four synthetic peptides effectively inhibit the growth of both Gram-positive (Staphylococcus aureus and Streptococcus agalactiaea) and Gram-negative (Escherichia coli and Pseudomonas aeruginosa) bacteria, with MICs in the range of 2.5-24.0 μM; yeasts (Candida albicans and Candida glabrata) with MICs of 3.1-50.0 μM; and two clinically isolated strains of Mycobacterium tuberculosis-including a multi-drug resistant one- with MICs in the range of 4.8-30.5 μM. A comparison between the activities of the original peptides and their derivatives gives insight into the structural/functional role of their distinctive residues.

  18. Boosting Antimicrobial Peptides by Hydrophobic Oligopeptide End Tags*

    PubMed Central

    Schmidtchen, Artur; Pasupuleti, Mukesh; Mörgelin, Matthias; Davoudi, Mina; Alenfall, Jan; Chalupka, Anna; Malmsten, Martin


    A novel approach for boosting antimicrobial peptides through end tagging with hydrophobic oligopeptide stretches is demonstrated. Focusing on two peptides derived from kininogen, GKHKNKGKKNGKHNGWK (GKH17) and HKHGHGHGKHKNKGKKN (HKH17), tagging resulted in enhanced killing of Gram-positive Staphylococcus aureus, Gram-negative Escherichia coli, and fungal Candida albicans. Microbicidal potency increased with tag length, also in plasma, and was larger for Trp and Phe stretches than for aliphatic ones. The enhanced microbicidal effects correlated to a higher degree of bacterial wall rupture. Analogously, tagging promoted peptide binding to model phospholipid membranes and liposome rupture, particularly for anionic and cholesterol-void membranes. Tagged peptides displayed low toxicity, particularly in the presence of serum, and resisted degradation by human leukocyte elastase and by staphylococcal aureolysin and V8 proteinase. The biological relevance of these findings was demonstrated ex vivo and in vivo in porcine S. aureus skin infection models. The generality of end tagging for facile boosting of antimicrobial peptides without the need for post-synthesis modification was also demonstrated. PMID:19398550

  19. Antimicrobial Peptides Derived from Fusion Peptides of Influenza A Viruses, a Promising Approach to Designing Potent Antimicrobial Agents.


    Wang, Jingyu; Zhong, Wenjing; Lin, Dongguo; Xia, Fan; Wu, Wenjiao; Zhang, Heyuan; Lv, Lin; Liu, Shuwen; He, Jian


    The emergence and dissemination of antibiotic-resistant bacterial pathogens have spurred the urgent need to develop novel antimicrobial agents with different mode of action. In this respect, we turned several fusogenic peptides (FPs) derived from the hemagglutinin glycoproteins (HAs) of IAV into potent antibacterials by replacing the negatively or neutrally charged residues of FPs with positively charged lysines. Their antibacterial activities were evaluated by testing the MICs against a panel of bacterial strains including S. aureus, S. mutans, P. aeruginosa, and E. coli. The results showed that peptides HA-FP-1, HA-FP-2-1, and HA-FP-3-1 were effective against both Gram-positive and Gram-negative bacteria with MICs ranging from 1.9 to 16.0 μm, while the toxicities toward mammalian cells were low. In addition, the mode of action and the secondary structure of these peptides were also discussed. These data not only provide several potent peptides displaying promising potential in development as broad antimicrobial agents, but also present a useful strategy in designing new antimicrobial agents.

  20. Antimicrobial peptides and proteins of the horse - insights into a well-armed organism

    PubMed Central


    Antimicrobial peptides play a pivotal role as key effectors of the innate immune system in plants and animals and act as endogenous antibiotics. The molecules exhibit an antimicrobial activity against bacteria, viruses, and eukaryotic pathogens with different specificities and potencies depending on the structure and amino-acid composition of the peptides. Several antimicrobial peptides were comprehensively investigated in the last three decades and some molecules with remarkable antimicrobial properties have reached the third phase of clinical studies. Next to the peptides themselves, numerous organisms were examined and analyzed regarding their repertoire of antimicrobial peptides revealing a huge number of candidates with potencies and properties for future medical applications. One of these organisms is the horse, which possesses numerous peptides that are interesting candidates for therapeutical applications in veterinary medicine. Here we summarize investigations and knowledge on equine antimicrobial peptides, point to interesting candidates, and discuss prospects for therapeutical applications. PMID:21888650

  1. Identification of multiple antimicrobial peptides from the skin of fine-spined frog, Hylarana spinulosa (Ranidae).


    Yang, Xiaolong; Hu, Yuhong; Xu, Shiqi; Hu, Yonghong; Meng, Hao; Guo, Chao; Liu, Yuliang; Liu, Jingze; Yu, Zhijun; Wang, Hui


    In this study, peptidomics and genomics analyses were used to study antimicrobial peptides from the skin of Hylarana spinulosa. Twenty-nine different antimicrobial peptide precursors were characterized from the skin of H. spinulosa, which produce 23 mature antimicrobial peptides belonging to 12 different families. To confirm the actual presence and characteristics of these antimicrobial peptides in the skin tissue extractions from H. spinulosa, we used two distinct methods, one was peptide purification method that combined gel filtration chromatography and reversed-phase high performance liquid chromatography (RP-HPLC), and the other was peptidomics approach based on liquid chromatography in conjunction with tandem mass spectrometry (LC-MS/MS). In the peptidomics approach, incomplete tryptic digestion and gas-phase fractionation (GPF) analysis were used to increase peptidome coverage and reproducibility of peptide ion selection. Multiple species of microorganisms were chosen to test and analyze the antimicrobial activities and spectrum of these antimicrobial peptides.

  2. Nanomechanical Response of Bacterial Cells to Antimicrobial Peptides

    NASA Astrophysics Data System (ADS)

    Parg, Richard; Dutcher, John


    The effectiveness of antimicrobial compounds can be easily screened, however their mechanism of action is much more difficult to determine. Many compounds act by compromising the mechanical integrity of the bacterial cell envelope, and we have developed an atomic force microscopy (AFM)-based creep deformation technique to evaluate changes in the time-dependent mechanical properties of bacterial cells upon exposure to antimicrobial peptides. Measurements performed before and after exposure, as well as time-resolved measurements and those performed at different antimicrobial concentrations, revealed large changes to the viscoelastic parameters including a distinctive signature for the loss of integrity of the bacterial cell envelope. Our previous experiments have focused on Pseudomonas aeruginosaPAO1 bacterial cells in Milli-Q water, for which the cells can withstand the large osmotic pressure. In the present study we have focused on performing the measurements in buffer to obtain more biologically relevant results. The AFM creep deformation measurement provides new, unique insight into the kinetics and mechanism of action of antimicrobial peptides on bacteria.

  3. Role of the Escherichia coli SbmA in the antimicrobial activity of proline-rich peptides.


    Mattiuzzo, Maura; Bandiera, Antonella; Gennaro, Renato; Benincasa, Monica; Pacor, Sabrina; Antcheva, Nikolinka; Scocchi, Marco


    In contrast to many antimicrobial peptides, members of the proline-rich group of antimicrobial peptides inactivate Gram-negative bacteria by a non-lytic mechanism. Several lines of evidence indicate that they are internalized into bacteria and their activity mediated by interaction with unknown cellular components. With the aim of identifying such interactors, we selected mutagenized Escherichia coli clones resistant to the proline-rich Bac7(1-35) peptide and analysed genes responsible for conferring resistance, whose products may thus be involved in the peptide's mode of action. We isolated a number of genomic regions bearing such genes, and one in particular coding for SbmA, an inner membrane protein predicted to be part of an ABC transporter. An E. coli strain carrying a point mutation in sbmA, as well as other sbmA-null mutants, in fact showed resistance to several proline-rich peptides but not to representative membranolytic peptides. Use of fluorescently labelled Bac7(1-35) confirmed that resistance correlated with a decreased ability to internalize the peptide, suggesting that a bacterial protein, SbmA, is necessary for the transport of, and for susceptibility to, proline-rich antimicrobial peptides of eukaryotic origin.

  4. iTRAQ-Based Quantitative Proteomic Analysis of the Antimicrobial Mechanism of Peptide F1 against Escherichia coli.


    Miao, Jianyin; Chen, Feilong; Duan, Shan; Gao, Xiangyang; Liu, Guo; Chen, Yunjiao; Dixon, William; Xiao, Hang; Cao, Yong


    Antimicrobial peptides have received increasing attention in the agricultural and food industries due to their potential to control pathogens. However, to facilitate the development of novel peptide-based antimicrobial agents, details regarding the molecular mechanisms of these peptides need to be elucidated. The aim of this study was to investigate the antimicrobial mechanism of peptide F1, a bacteriocin found in Tibetan kefir, against Escherichia coli at protein levels using iTRAQ-based quantitative proteomic analysis. In response to treatment with peptide F1, 31 of the 280 identified proteins in E. coli showed alterations in their expression, including 10 down-regulated proteins and 21 up-regulated proteins. These 31 proteins all possess different molecular functions and are involved in different molecular pathways, as is evident in referencing the Kyoto Encyclopedia of Genes and Genomes pathways. Specifically, pathways that were significantly altered in E. coli in response to peptide F1 treatment include the tricarboxylic acid cycle, oxidative phosphorylation, glycerophospholipid metabolism, and the cell cycle-caulobacter pathways, which was also associated with inhibition of the cell growth, induction of morphological changes, and cell death. The results provide novel insights into the molecular mechanisms of antimicrobial peptides.

  5. Bacterial Labionin-Containing Peptides and Sactibiotics: Unusual Types of Antimicrobial Peptides with Potential Use in Clinical Settings (A Review).


    Coelho, Marcus Lívio Varella; de Souza Duarte, Andreza Freitas; do Carmo de Freire Bastos, Maria


    One of the biggest challenges faced presently by clinicians is the emergence of multi drug--resistant pathogens that can infect humans and animals.To control the infections caused by such pathogens the development of new drugs is required. Bacteria are a rich source of ribosomally-synthesized antimicrobial peptides known as bacteriocins, which are characterized by the presence of a self-defense immunity system. Labionin-containing lantibiotics and sactibiotics are post-translationally modified bacteriocins with peculiar features. Labionin-containing peptides belong tosubclass Iclantibiotics in which the carbacyclic triamino triacid labionin, a structural variant of lanthionine,and a methyl-substitute labionin derivative are found, giving the molecule a labyrinthine structure. Sactibiotics are circular or linear peptides belonging to a distinct bacteriocin class (class V) which is characterized by the presence of cross-linkages formed by the thiol group of cysteine residues and the α-carbon of acceptor amino acids. A few examples of these bacteriocins have been described in the literature to date, although putative gene clusters with the potential to encode such peptides can be found in the genome of many bacterial species. Some peptides already under study exhibit potential biotechnological applications because of their remarkable antibacterial or antiviral activities, as well as their analgesic activity. Therefore, in this review, the main findings concerning these peptides will be addressed and discussed, with anemphasis on their potential use in clinical settings.

  6. Insect Antimicrobial Peptide Complexes Prevent Resistance Development in Bacteria

    PubMed Central

    Chernysh, Sergey; Gordya, Natalia; Suborova, Tatyana


    In recent decades much attention has been paid to antimicrobial peptides (AMPs) as natural antibiotics, which are presumably protected from resistance development in bacteria. However, experimental evolution studies have revealed prompt resistance increase in bacteria to any individual AMP tested. Here we demonstrate that naturally occurring compounds containing insect AMP complexes have clear advantage over individual peptide and small molecule antibiotics in respect of drug resistance development. As a model we have used the compounds isolated from bacteria challenged maggots of Calliphoridae flies. The compound isolated from blow fly Calliphora vicina was found to contain three distinct families of cell membrane disrupting/permeabilizing peptides (defensins, cecropins and diptericins), one family of proline rich peptides and several unknown antimicrobial substances. Resistance changes under long term selective pressure of the compound and reference antibiotics cefotaxime, meropenem and polymyxin B were tested using Escherichia coli, Klebsiella pneumonia and Acinetobacter baumannii clinical strains. All the strains readily developed resistance to the reference antibiotics, while no signs of resistance growth to the compound were registered. Similar results were obtained with the compounds isolated from 3 other fly species. The experiments revealed that natural compounds containing insect AMP complexes, in contrast to individual AMP and small molecule antibiotics, are well protected from resistance development in bacteria. Further progress in the research of natural AMP complexes may provide novel solutions to the drug resistance problem. PMID:26177023

  7. A novel cysteine-rich antimicrobial peptide from the mucus of the snail of Achatina fulica.


    Zhong, Jian; Wang, Wenhong; Yang, Xiaomei; Yan, Xiuwen; Liu, Rui


    Antimicrobial peptides (AMPs) are important components of the innate immunity. Many antimicrobial peptides have been found from marine mollusks. Little information about AMPs of mollusks living on land is available. A novel cysteine-rich antimicrobial peptide (mytimacin-AF) belonging to the peptide family of mytimacins was purified and characterized from the mucus of the snail of Achatina fulica. Its cDNA was also cloned from the cDNA library. Mytimacin-AF is composed of 80 amino acid residues including 10 cysteines. Mytimacin-AF showed potent antimicrobial activity against Gram-negative and Gram-positive bacteria and the fungus Candida albicans. Among tested microorganisms, it exerted strongest antimicrobial activity against Staphylococcus aureus with a minimal peptide concentration (MIC) of 1.9 μg/ml. Mytimacin-AF had little hemolytic activity against human blood red cells. The current work confirmed the presence of mytimacin-like antimicrobial peptide in land-living mollusks.

  8. Novel imidazolium salt--peptide conjugates and their antimicrobial activity.


    Reinhardt, A; Horn, M; Schmauck, J Pieper Gen; Bröhl, A; Giernoth, R; Oelkrug, C; Schubert, A; Neundorf, I


    Our study presents innovative research dealing with the synthesis and biological evaluation of conjugates out of antimicrobial peptides (AMPs) and imidazolium cations that are derived from ionic liquids. AMPs are considered as promising alternatives to common antibiotics due to their different activity mechanisms. Antibacterial effects have also been described for ionic liquids bearing imidazolium cations . Besides single coupling of carboxy-functionalized imidazolium cations to the peptide N-terminal we also developed conjugates bearing multiple copies of imidazolium cations. The combination of both compounds resulted in synergistic effects that were most pronounced when more imidazolium cations were attached to the peptides. In addition, antibacterial activity even in drug-resistant bacterial strains could be observed. Moreover, the novel compounds showed good selectivity only against bacterial cells, an observation that was further proven by lipid interaction studies using giant unilamellar vesicles.

  9. Expression systems for heterologous production of antimicrobial peptides.


    Parachin, Nádia Skorupa; Mulder, Kelly Cristina; Viana, Antônio Américo Barbosa; Dias, Simoni Campos; Franco, Octávio Luiz


    Antimicrobial peptides (AMPs) consist of molecules that act on the defense systems of numerous organisms toward multiple pathogens such as bacteria, fungi, parasites and viruses. These compounds have become extremely significant due to the increasing resistance of microorganisms to common antibiotics. However, the low quantity of peptides obtained from direct purification is, to date, still a remarkable bottleneck for scientific and industrial research development. Therefore, this review describes the main heterologous systems currently used for AMP production, including bacteria, fungi and plants, and also the related strategies for reaching greater functional peptide production. The main difficulties of each system are also described in order to provide some directions for AMP production. In summary, data revised here indicate that large-scale production of AMPs can be obtained using biotechnological tools, and the products may be applied in the pharmaceutical industry as well as in agribusiness.

  10. Transmembrane Pores Formed by Human Antimicrobial Peptide LL-37

    SciTech Connect

    Qian, Shuo


    Human LL-37 is a multifunctional cathelicidin peptide that has shown a wide spectrum of antimicrobial activity by permeabilizing microbial membranes similar to other antimicrobial peptides; however, its molecular mechanism has not been clarified. Two independent experiments revealed LL-37 bound to membranes in the {alpha}-helical form with the axis lying in the plane of membrane. This led to the conclusion that membrane permeabilization by LL-37 is a nonpore carpet-like mechanism of action. Here we report the detection of transmembrane pores induced by LL-37. The pore formation coincided with LL-37 helices aligning approximately normal to the plane of the membrane. We observed an unusual phenomenon of LL-37 embedded in stacked membranes, which are commonly used in peptide orientation studies. The membrane-bound LL-37 was found in the normal orientation only when the membrane spacing in the multilayers exceeded its fully hydrated value. This was achieved by swelling the stacked membranes with excessive water to a swollen state. The transmembrane pores were detected and investigated in swollen states by means of oriented circular dichroism, neutron in-plane scattering, and x-ray lamellar diffraction. The results are consistent with the effect of LL-37 on giant unilamellar vesicles. The detected pores had a water channel of radius 2333 {angstrom}. The molecular mechanism of pore formation by LL-37 is consistent with the two-state model exhibited by magainin and other small pore-forming peptides. The discovery that peptide-membrane interactions in swollen states are different from those in less hydrated states may have implications for other large membrane-active peptides and proteins studied in stacked membranes.

  11. Characterization of diverse antimicrobial peptides in skin secretions of Chungan torrent frog Amolops chunganensis.


    Yang, Xiaohong; Xia, Jiangnan; Yu, Zhijun; Hu, Yuhong; Li, Fengjiao; Meng, Hao; Yang, Shujie; Liu, Jingze; Wang, Hui


    We have cloned, synthesized, and characterized 11 novel antimicrobial peptides from a skin derived cDNA library of the Chungan torrent frog, Amolops chunganensis. Seven of the 11 antimicrobial peptides were present in authentic A. chunganensis skin secretions. Sequence analysis indicated that the 11 peptides belonged to the temporin, esculentin-2, palustrin-2, brevinin-1, and brevinin-2 families. The peptides displayed potent antimicrobial activities against several strains of microorganisms. One peptide, brevinin-1CG5, demonstrated antimicrobial activity against all tested Gram-positive and Gram-negative bacteria and fungi, and showed high antimicrobial potency (MIC=0.6 μM) against Gram-positive bacterium Rhodococcus rhodochrous. Some peptides also demonstrated weak hemolytic activity against human erythrocytes in vitro. Phylogenetic analysis based on the amino acid sequences of brevinin-1, brevinin-2, and esculentin-2 peptides from family Ranidae confirmed that the current taxonomic status of A. chunganensis is correct.

  12. A liaR deletion restores susceptibility to daptomycin and antimicrobial peptides in multidrug-resistant Enterococcus faecalis.


    Reyes, Jinnethe; Panesso, Diana; Tran, Truc T; Mishra, Nagendra N; Cruz, Melissa R; Munita, Jose M; Singh, Kavindra V; Yeaman, Michael R; Murray, Barbara E; Shamoo, Yousif; Garsin, Danielle; Bayer, Arnold S; Arias, Cesar A


    Daptomycin is a lipopeptide antibiotic that is used clinically against many gram-positive bacterial pathogens and is considered a key frontline bactericidal antibiotic to treat multidrug-resistant enterococci. Emergence of daptomycin resistance during therapy of serious enterococcal infections is a major clinical issue. In this work, we show that deletion of the gene encoding the response regulator, LiaR (a member of the LiaFSR system that controls cell envelope homeostasis), from daptomycin-resistant Enterococcus faecalis not only reversed resistance to 2 clinically available cell membrane-targeting antimicrobials (daptomycin and telavancin), but also resulted in hypersusceptibility to these antibiotics and to a variety of antimicrobial peptides of diverse origin and with different mechanisms of action. The changes in susceptibility to these antibiotics and antimicrobial peptides correlated with in vivo attenuation in a Caenorhabditis elegans model. Mechanistically, deletion of liaR altered the localization of cardiolipin microdomains in the cell membrane. Our findings suggest that LiaR is a master regulator of the enterococcal cell membrane response to diverse antimicrobial agents and peptides; as such, LiaR represents a novel target to restore the activity of clinically useful antimicrobials against these organisms and, potentially, increase susceptibility to endogenous antimicrobial peptides.

  13. Gram-positive bacterial cell envelopes: The impact on the activity of antimicrobial peptides.


    Malanovic, Nermina; Lohner, Karl


    A number of cationic antimicrobial peptides, effectors of innate immunity, are supposed to act at the cytoplasmic membrane leading to permeabilization and eventually membrane disruption. Thereby, interaction of antimicrobial peptides with anionic membrane phospholipids is considered to be a key factor in killing of bacteria. Recently, evidence was provided that killing takes place only when bacterial cell membranes are completely saturated with peptides. This adds to an ongoing debate, which role cell wall components such as peptidoglycan, lipoteichoic acid and lipopolysaccharide may play in the killing event, i.e. if they rather entrap or facilitate antimicrobial peptides access to the cytoplasmic membrane. Therefore, in this review we focused on the impact of Gram-positive cell wall components for the mode of action and activity of antimicrobial peptides as well as in innate immunity. This led us to conclude that interaction of antimicrobial peptides with peptidoglycan may not contribute to a reduction of their antimicrobial activity, whereas interaction with anionic lipoteichoic acids may reduce the local concentration of antimicrobial peptides on the cytoplasmic membrane necessary for sufficient destabilization of the membranes and bacterial killing. Further affinity studies of antimicrobial peptides toward the different cell wall as well as membrane components will be needed to address this problem on a quantitative level. This article is part of a Special Issue entitled: Antimicrobial peptides edited by Karl Lohner and Kai Hilpert.

  14. A simple and low-cost platform technology for producing pexiganan antimicrobial peptide in E. coli.


    Zhao, Chun-Xia; Dwyer, Mirjana Dimitrijev; Yu, Alice Lei; Wu, Yang; Fang, Sheng; Middelberg, Anton P J


    Antimicrobial peptides, as a new class of antibiotics, have generated tremendous interest as potential alternatives to classical antibiotics. However, the large-scale production of antimicrobial peptides remains a significant challenge. This paper reports a simple and low-cost chromatography-free platform technology for producing antimicrobial peptides in Escherichia coli (E. coli). A fusion protein comprising a variant of the helical biosurfactant protein DAMP4 and the known antimicrobial peptide pexiganan is designed by joining the two polypeptides, at the DNA level, via an acid-sensitive cleavage site. The resulting DAMP4(var)-pexiganan fusion protein expresses at high level and solubility in recombinant E. coli, and a simple heat-purification method was applied to disrupt cells and deliver high-purity DAMP4(var)-pexiganan protein. Simple acid cleavage successfully separated the DAMP4 variant protein and the antimicrobial peptide. Antimicrobial activity tests confirmed that the bio-produced antimicrobial peptide has the same antimicrobial activity as the equivalent product made by conventional chemical peptide synthesis. This simple and low-cost platform technology can be easily adapted to produce other valuable peptide products, and opens a new manufacturing approach for producing antimicrobial peptides at large scale using the tools and approaches of biochemical engineering.

  15. The New Antimicrobial Peptide SpHyastatin from the Mud Crab Scylla paramamosain with Multiple Antimicrobial Mechanisms and High Effect on Bacterial Infection

    PubMed Central

    Shan, Zhongguo; Zhu, Kexin; Peng, Hui; Chen, Bei; Liu, Jie; Chen, Fangyi; Ma, Xiaowan; Wang, Shuping; Qiao, Kun; Wang, Kejian


    SpHyastatin was first identified as a new cationic antimicrobial peptide in hemocytes of the mud crab Scylla paramamosain. Based on the amino acid sequences deduced, it was predicted that this peptide was composed of two different functional domains, a proline-rich domain (PRD) and a cysteine-rich domain (CRD). The recombinant product of SpHyastatin displayed potent antimicrobial activities against the human pathogen Staphylococcus aureus and the aquatic animal pathogens Aeromonas hydrophila and Pseudomonas fluorescens. Compared with the CRD of SpHyastatin, the PRD presented better antimicrobial and chitin binding activities, but both regions were essential for allowing SpHyastatin complete antimicrobial activity. The binding properties of SpHyastatin to different microbial surface molecules suggested that this might be an initial and crucial step for performing its antimicrobial activities. Evaluated using propidium iodide uptake assays and scanning electron microscopy images, the antimicrobial mechanism of SpHyastatin was found to be prone to disrupt cell membrane integrity. Interestingly, SpHyastatin exerted its role specifically on the surface of S. aureus and Pichia pastoris whereas it directly killed P. fluorescens through simultaneous targeting the membrane and the cytoplasm, indicating that SpHyastatin could use different antimicrobial mechanisms to kill different species of microbes. As expected, the recombinant SpHyastatin increased the survival rate of crabs challenged with Vibrio parahaemolyticus. In addition, SpHyastatin could modulate some V. parahaemolyticus-responsive genes in S. paramamosain. PMID:27493644

  16. Diversity, evolution and medical applications of insect antimicrobial peptides

    PubMed Central

    Mylonakis, Eleftherios; Podsiadlowski, Lars; Muhammed, Maged


    Antimicrobial peptides (AMPs) are short proteins with antimicrobial activity. A large portion of known AMPs originate from insects, and the number and diversity of these molecules in different species varies considerably. Insect AMPs represent a potential source of alternative antibiotics to address the limitation of current antibiotics, which has been caused by the emergence and spread of multidrug-resistant pathogens. To get more insight into AMPs, we investigated the diversity and evolution of insect AMPs by mapping their phylogenetic distribution, allowing us to predict the evolutionary origins of selected AMP families and to identify evolutionarily conserved and taxon-specific families. Furthermore, we highlight the use of the nematode Caenorhabditis elegans as a whole-animal model in high-throughput screening methods to identify AMPs with efficacy against human pathogens, including Acinetobacter baumanii and methicillin-resistant Staphylococcus aureus. We also discuss the potential medical applications of AMPs, including their use as alternatives for conventional antibiotics in ectopic therapies, their combined use with antibiotics to restore the susceptibility of multidrug-resistant pathogens, and their use as templates for the rational design of peptidomimetic drugs that overcome the disadvantages of therapeutic peptides. The article is part of the themed issue ‘Evolutionary ecology of arthropod antimicrobial peptides’. PMID:27160593

  17. Molecular characterization of a novel antimicrobial peptide from Mytilus coruscus.


    Liao, Zhi; Wang, Xin-chao; Liu, Hui-hui; Fan, Mei-hua; Sun, Jing-jing; Shen, Wang


    Antimicrobial peptides (AMPs) are components of the innate immune responses that form the first line of host defense against pathogens. Marine mussels can produce a surprising abundance of cysteine-rich AMPs pertaining to the defensin, myticin, mytilin and mytimycin families, particularly in the circulating hemocytes. In the current study, we purified and characterized a novel cysteine-rich peptide with remarkable antibacterial activity from Mytilus coruscus and designated with myticusin-1, a 104-amino acid long polypeptide including 10 cysteine residues forming an unusual cysteine pattern. Antimicrobial assays demonstrated that myticusin-1 exhibited stronger anti-microbial properties against Gram-positive bacteria more than Gram-negative bacteria and fungus. Furthermore, myticusin-1 caused significant morphological alterations in both Sarcina luteus and Escherichia coli as shown by transmission electron microscopy (TEM). The cDNA of myticusin-1 was cloned and sequenced from the hemocytes cDNA library of M. coruscus. The mRNA transcripts of myticusin-1 are mainly detected in hemocyte, which indicates that myticusin-1 are specifically synthesized and stored in circulating hemocytes. The expression level of myticusin-1 in hemocytes was up-regulated and reached the highest level at 36 h after S. luteus challenge, which was 20-fold increase compared to that of the control group. These results indicated that myticusin-1 was involved in the host immune response against bacterial infection and might contribute to the clearance of invading bacteria.

  18. Recombinant expression of the antimicrobial peptide polyphemusin and its activity against the protozoan oyster pathogen Perkinsus marinus.


    Pierce, J C; Maloy, W L; Salvador, L; Dungan, C F


    Polyphemusin is a broad-spectrum antimicrobial peptide isolated from hemocytes of the North American horseshoe crab Limulus polyphemus. To date the polyphemusin used for scientific analyses has been purified from the natural materials or obtained by chemical synthesis. We report here the recombinant expression in Escherichia coli, and subsequent purification, of a polyphemusin analogue (rLim1). To prevent toxicity of the antimicrobial peptide in the highly susceptible E. coli host, we used a carboxy-terminal fusion protein cloning strategy provided by a maltose-binding protein (MBP) gene fusion system (New England Biolabs). Antimicrobial activity of recombinant polyphemusin was similar to that seen with amidated native polyphemusin peptide. When rLim1 was tested for antibiotic activity against the apicomplexan protozoan oyster pathogen Perkinsus marinus, complete inhibition was observed at 12 micrograms/ml, and partial inhibition at 8 micrograms/ml.

  19. Identification and characterization of antimicrobial peptides from the skin of the endangered frog Odorrana ishikawae.


    Iwakoshi-Ukena, Eiko; Ukena, Kazuyoshi; Okimoto, Aiko; Soga, Miyuki; Okada, Genya; Sano, Naomi; Fujii, Tamotsu; Sugawara, Yoshiaki; Sumida, Masayuki


    The endangered anuran species, Odorrana ishikawae, is endemic to only two small Japanese Islands, Amami and Okinawa. To assess the innate immune system in this frog, we investigated antimicrobial peptides in the skin using artificially bred animals. Nine novel antimicrobial peptides containing the C-terminal cyclic heptapeptide domain were isolated on the basis of antimicrobial activity against Escherichia coli. The peptides were members of the esculentin-1 (two peptides), esculentin-2 (one peptide), palustrin-2 (one peptide), brevinin-2 (three peptides) and nigrocin-2 (two peptides) antimicrobial peptide families. They were named esculentin-1ISa, esculentin-1ISb, esculentin-2ISa, palustrin-2ISa, brevinin-2ISa, brevinin-2ISb, brevinin-2ISc, nigrocin-2ISa and nigrocin-2ISb. Peptide primary structures suggest a close relationship with the Asian odorous frogs, Odorrana grahami and Odorrana hosii. These antimicrobial peptides possessed a broad-spectrum of growth inhibition against five microorganisms (E. coli, Staphylococcus aureus, methicillin-resistant S. aureus, Bacillus subtilis and Candida albicans). Nine different cDNAs encoding the precursor proteins were also cloned and showed that the precursor proteins exhibited a signal peptide, an N-terminal acidic spacer domain, a Lys-Arg processing site and an antimicrobial peptide at the C-terminus.

  20. Roles of Hydrophobicity and Charge Distribution of Cationic Antimicrobial Peptides in Peptide-Membrane Interactions*

    PubMed Central

    Yin, Lois M.; Edwards, Michelle A.; Li, Jessica; Yip, Christopher M.; Deber, Charles M.


    Cationic antimicrobial peptides (CAPs) occur as important innate immunity agents in many organisms, including humans, and offer a viable alternative to conventional antibiotics, as they physically disrupt the bacterial membranes, leading to membrane lysis and eventually cell death. In this work, we studied the biophysical and microbiological characteristics of designed CAPs varying in hydrophobicity levels and charge distributions by a variety of biophysical and biochemical approaches, including in-tandem atomic force microscopy, attenuated total reflection-FTIR, CD spectroscopy, and SDS-PAGE. Peptide structural properties were correlated with their membrane-disruptive abilities and antimicrobial activities. In bacterial lipid model membranes, a time-dependent increase in aggregated β-strand-type structure in CAPs with relatively high hydrophobicity (such as KKKKKKALFALWLAFLA-NH2) was essentially absent in CAPs with lower hydrophobicity (such as KKKKKKAAFAAWAAFAA-NH2). Redistribution of positive charges by placing three Lys residues at both termini while maintaining identical sequences minimized self-aggregation above the dimer level. Peptides containing four Leu residues were destructive to mammalian model membranes, whereas those with corresponding Ala residues were not. This finding was mirrored in hemolysis studies in human erythrocytes, where Ala-only peptides displayed virtually no hemolysis up to 320 μm, but the four-Leu peptides induced 40–80% hemolysis at the same concentration range. All peptides studied displayed strong antimicrobial activity against Pseudomonas aeruginosa (minimum inhibitory concentrations of 4–32 μm). The overall findings suggest optimum routes to balancing peptide hydrophobicity and charge distribution that allow efficient penetration and disruption of the bacterial membranes without damage to mammalian (host) membranes. PMID:22253439

  1. Comparative Evaluation of the Antimicrobial Activity of Different Antimicrobial Peptides against a Range of Pathogenic Bacteria

    PubMed Central

    Ebbensgaard, Anna; Mordhorst, Hanne; Overgaard, Michael Toft; Nielsen, Claus Gyrup; Aarestrup, Frank Møller; Hansen, Egon Bech


    Analysis of a Selected Set of Antimicrobial Peptides The rapid emergence of resistance to classical antibiotics has increased the interest in novel antimicrobial compounds. Antimicrobial peptides (AMPs) represent an attractive alternative to classical antibiotics and a number of different studies have reported antimicrobial activity data of various AMPs, but there is only limited comparative data available. The mode of action for many AMPs is largely unknown even though several models have suggested that the lipopolysaccharides (LPS) play a crucial role in the attraction and attachment of the AMP to the bacterial membrane in Gram-negative bacteria. We compared the potency of Cap18, Cap11, Cap11-1-18m2, Cecropin P1, Cecropin B, Bac2A, Bac2A-NH2, Sub5-NH2, Indolicidin, Melittin, Myxinidin, Myxinidin-NH2, Pyrrhocoricin, Apidaecin and Metalnikowin I towards Staphylococcus aureus, Enterococcus faecalis, Pseudomonas aeruginosa, Escherichia coli, Aeromonas salmonicida, Listeria monocytogenes, Campylobacter jejuni, Flavobacterium psychrophilum, Salmonella typhimurium and Yersinia ruckeri by minimal inhibitory concentration (MIC) determinations. Additional characteristics such as cytotoxicity, thermo and protease stability were measured and compared among the different peptides. Further, the antimicrobial activity of a selection of cationic AMPs was investigated in various E. coli LPS mutants. Cap18 Shows a High Broad Spectrum Antimicrobial Activity Of all the tested AMPs, Cap18 showed the most efficient antimicrobial activity, in particular against Gram-negative bacteria. In addition, Cap18 is highly thermostable and showed no cytotoxic effect in a hemolytic assay, measured at the concentration used. However, Cap18 is, as most of the tested AMPs, sensitive to proteolytic digestion in vitro. Thus, Cap18 is an excellent candidate for further development into practical use; however, modifications that should reduce the protease sensitivity would be needed. In addition, our

  2. Identification of a Novel Proline-Rich Antimicrobial Peptide from Brassica napus.


    Cao, Huihui; Ke, Tao; Liu, Renhu; Yu, Jingyin; Dong, Caihua; Cheng, Mingxing; Huang, Junyan; Liu, Shengyi


    Proline-rich antimicrobial peptides (PR-AMPs) are a group of cationic host defense peptides that are characterized by a high content of proline residues. Up to now, they have been reported in some insects, vertebrate and invertebrate animals, but are not found in plants. In this study, we performed an in silico screening of antimicrobial peptides, which led to discovery of a Brassica napus gene encoding a novel PR-AMP. This gene encodes a 35-amino acid peptide with 13 proline residues, designated BnPRP1. BnPRP1 has 40.5% identity with a known proline-rich antimicrobial peptide SP-B from the pig. BnPRP1 was artificially synthetized and cloned into the prokaryotic expression vector pET30a/His-EDDIE-GFP. Recombinant BnPRP1 was produced in Escherichia coli and has a predicted molecular mass of 3.8 kDa. Analysis of its activity demonstrated that BnPRP1 exhibited strong antimicrobial activity against Gram-positive bacterium, Gram-negative bacterium, yeast and also had strong antifungal activity against several pathogenic fungi, such as Sclerotinia sclerotiorum, Mucor sp., Magnaporthe oryzae and Botrytis cinerea. Circular dichroism (CD) revealed the main secondary structure of BnPRP1 was the random coil. BnPRP1 gene expression detected by qRT-PCR is responsive to pathogen inoculation. At 48 hours after S. sclerotiorum inoculation, the expression of BnPRP1 increased significantly in the susceptible lines while slight decrease occurred in resistant lines. These suggested that BnPRP1 might play a role in the plant defense response against S. sclerotiorum. BnPRP1 isolated from B. napus was the first PR-AMP member that was characterized in plants, and its homology sequences were found in some other Brassicaceae plants by the genome sequences analysis. Compared with the known PR-AMPs, BnPRP1 has the different primary sequences and antimicrobial activity. Above all, this study gives a chance to cast a new light on further understanding about the AMPs' mechanism and application.

  3. Mammalian antimicrobial peptide influences control of cutaneous Leishmania infection

    PubMed Central

    Kulkarni, Manjusha M.; Barbi, Joseph; McMaster, W. Robert; Gallo, Richard L.; Satoskar, Abhay R.; McGwire, Bradford S.


    Summary Cathelicidin-type antimicrobial peptides (CAMP) are important mediators of innate immunity against microbial pathogens acting through direct interaction with and disruption of microbial membranes and indirectly through modulation of host cell migration and activation. Using a mouse knock-out model in CAMP we studied the role of this host peptide in control of dissemination of cutaneous infection by the parasitic protozoan Leishmania. The presence of pronounced host inflammatory infiltration in lesions and lymph nodes of infected animals was CAMP-dependent. Lack of CAMP expression was associated with higher levels of IL-10 receptor expression in bone marrow, splenic and lymph node macrophages as well as higher anti-inflammatory IL-10 production by bone marrow macrophages and spleen cells but reduced production of the pro-inflammatory cytokines IL-12 and IFN-γ by lymph nodes. Unlike wild-type mice, local lesions were exacerbated and parasites were found largely disseminated in CAMP knockouts. Infection of CAMP knockouts with parasite mutants lacking the surface metalloprotease virulence determinant resulted in more robust disseminated infection than in control animals suggesting that CAMP activity is negatively regulated by parasite surface proteolytic activity. This correlated with the ability of the pro-tease to degrade CAMP in vitro and co-localization of CAMP with parasites within macrophages. Our results highlight the interplay of antimicrobial peptides and Leishmania that influence the host immune response and the outcome of infection. PMID:21501359

  4. Antimicrobial Peptides as Mediators of Innate Immunity in Teleosts

    PubMed Central

    Katzenback, Barbara A.


    Antimicrobial peptides (AMPs) have been identified throughout the metazoa suggesting their evolutionarily conserved nature and their presence in teleosts is no exception. AMPs are short (18–46 amino acids), usually cationic, amphipathic peptides. While AMPs are diverse in amino acid sequence, with no two AMPs being identical, they collectively appear to have conserved functions in the innate immunity of animals towards the pathogens they encounter in their environment. Fish AMPs are upregulated in response to pathogens and appear to have direct broad-spectrum antimicrobial activity towards both human and fish pathogens. However, an emerging role for AMPs as immunomodulatory molecules has become apparent—the ability of AMPs to activate the innate immune system sheds light onto the multifaceted capacity of these small peptides to combat pathogens through direct and indirect means. Herein, this review focuses on the role of teleost AMPs as modulators of the innate immune system and their regulation in response to pathogens or other exogenous molecules. The capacity to regulate AMP expression by exogenous factors may prove useful in modulating AMP expression in fish to prevent disease, particularly in aquaculture settings where crowded conditions and environmental stress pre-dispose these fish to infection. PMID:26426065

  5. Unveiling antimicrobial peptide-generating human proteases using PROTEASIX.


    Bastos, Paulo; Trindade, Fábio; Ferreira, Rita; Casteleiro, Mercedes Arguello; Stevens, Robert; Klein, Julie; Vitorino, Rui


    Extracting information from peptidomics data is a major current challenge, as endogenous peptides can result from the activity of multiple enzymes. Proteolytic enzymes can display overlapping or complementary specificity. The activity spectrum of human endogenous peptide-generating proteases is not fully known. Hence, the indirect study of proteolytic enzymes through the analysis of its substrates is largely hampered. Antimicrobial peptides (AMPs) represent a primordial set of immune defense molecules generated by proteolytic cleavage of precursor proteins. These peptides can be modulated by host and microorganismal stimuli, which both dictate proteolytic enzymes' expression and activity. Peptidomics is an attractive approach to identify peptides with a biological role and to assess proteolytic activity. However, bioinformatics tools to deal with peptidomics data are lacking. PROTEASIX is an excellent choice for the prediction of AMPs-generating proteases based on the reconstitution of a substrate's cleavage sites and the crossing of such information with known proteases' specificity retrieved by several publicly available databases. Therefore, the focus of the present tutorial is to explore the potential of PROTEASIX when gather information concerning proteases involved in the generation of human AMPs and to teach the user how to make the most out of peptidomics results using PROTEASIX.

  6. Importance of Tryptophan in Transforming an Amphipathic Peptide into a Pseudomonas aeruginosa-Targeted Antimicrobial Peptide

    PubMed Central

    Zhu, Xin; Ma, Zhi; Wang, Jiajun; Chou, Shuli; Shan, Anshan


    Here, we found that simple substitution of amino acids in the middle position of the hydrophobic face of an amphipathic peptide RI16 with tryptophan (T9W) considerably transformed into an antimicrobial peptide specifically targeting Pseudomonas aeruginosa. Minimal inhibitory concentration (MIC) results demonstrated that T9W had a strong and specifically antimicrobial activity against P. aeruginosa, including antibiotic-resistant strains, but was not active against Escherichia coli, Salmonella typhimurium, Staphylococcus aureus and Staphyfococcus epidermidis. Fluorescent spectroscopic assays indicated that T9W interacted with the membrane of P. aeruginosa, depolarizing the outer and the inner membrane of bacterial cells. Salt susceptibility assay showed that T9W still maintained its strong anti-pseudomonas activity in the presence of salts at physiological concentrations, and in hemolytic and MTT assays T9W also showed no toxicity against human blood cells and macrophages. In vivo assay demonstrated that T9W also displayed no toxicity to Chinese Kun Ming (KM) mice. Furthermore, the strong antibiofilm activity was also observed with the peptide T9W, which decreased the percentage of biomass formation in a dose-dependent manner. Overall, these findings indicated that design of single-pathogen antimicrobial agents can be achieved by simple amino acid mutation in naturally occurring peptide sequences and this study suggested a model of optimization/design of anti-pseudomonas drugs in which the tryptophan residue was a conserved element. PMID:25494332

  7. Importance of Tryptophan in Transforming an Amphipathic Peptide into a Pseudomonas aeruginosa-Targeted Antimicrobial Peptide.


    Zhu, Xin; Ma, Zhi; Wang, Jiajun; Chou, Shuli; Shan, Anshan


    Here, we found that simple substitution of amino acids in the middle position of the hydrophobic face of an amphipathic peptide RI16 with tryptophan (T9W) considerably transformed into an antimicrobial peptide specifically targeting Pseudomonas aeruginosa. Minimal inhibitory concentration (MIC) results demonstrated that T9W had a strong and specifically antimicrobial activity against P. aeruginosa, including antibiotic-resistant strains, but was not active against Escherichia coli, Salmonella typhimurium, Staphylococcus aureus and Staphyfococcus epidermidis. Fluorescent spectroscopic assays indicated that T9W interacted with the membrane of P. aeruginosa, depolarizing the outer and the inner membrane of bacterial cells. Salt susceptibility assay showed that T9W still maintained its strong anti-pseudomonas activity in the presence of salts at physiological concentrations, and in hemolytic and MTT assays T9W also showed no toxicity against human blood cells and macrophages. In vivo assay demonstrated that T9W also displayed no toxicity to Chinese Kun Ming (KM) mice. Furthermore, the strong antibiofilm activity was also observed with the peptide T9W, which decreased the percentage of biomass formation in a dose-dependent manner. Overall, these findings indicated that design of single-pathogen antimicrobial agents can be achieved by simple amino acid mutation in naturally occurring peptide sequences and this study suggested a model of optimization/design of anti-pseudomonas drugs in which the tryptophan residue was a conserved element.

  8. Characterization of Antimicrobial Peptides toward the Development of Novel Antibiotics

    PubMed Central

    Aoki, Wataru; Ueda, Mitsuyoshi


    Antimicrobial agents have eradicated many infectious diseases and significantly improved our living environment. However, abuse of antimicrobial agents has accelerated the emergence of multidrug-resistant microorganisms, and there is an urgent need for novel antibiotics. Antimicrobial peptides (AMPs) have attracted attention as a novel class of antimicrobial agents because AMPs efficiently kill a wide range of species, including bacteria, fungi, and viruses, via a novel mechanism of action. In addition, they are effective against pathogens that are resistant to almost all conventional antibiotics. AMPs have promising properties; they directly disrupt the functions of cellular membranes and nucleic acids, and the rate of appearance of AMP-resistant strains is very low. However, as pharmaceuticals, AMPs exhibit unfavorable properties, such as instability, hemolytic activity, high cost of production, salt sensitivity, and a broad spectrum of activity. Therefore, it is vital to improve these properties to develop novel AMP treatments. Here, we have reviewed the basic biochemical properties of AMPs and the recent strategies used to modulate these properties of AMPs to enhance their safety. PMID:24276381

  9. Circular Dichroism studies on the interactions of antimicrobial peptides with bacterial cells

    NASA Astrophysics Data System (ADS)

    Avitabile, Concetta; D'Andrea, Luca Domenico; Romanelli, Alessandra


    Studying how antimicrobial peptides interact with bacterial cells is pivotal to understand their mechanism of action. In this paper we explored the use of Circular Dichroism to detect the secondary structure of two antimicrobial peptides, magainin 2 and cecropin A, with E. coli bacterial cells. The results of our studies allow us to gain two important information in the context of antimicrobial peptides- bacterial cells interactions: peptides fold mainly due to interaction with LPS, which is the main component of the Gram negative bacteria outer membrane and the time required for the folding on the bacterial cells depends on the peptide analyzed.

  10. A novel antimicrobial peptide derived from fish goose type lysozyme disrupts the membrane of Salmonella enterica.


    Kumaresan, Venkatesh; Bhatt, Prasanth; Ganesh, Munuswamy-Ramanujam; Harikrishnan, Ramasamy; Arasu, MariadhasValan; Al-Dhabi, Naif Abdullah; Pasupuleti, Mukesh; Marimuthu, Kasi; Arockiaraj, Jesu


    In aquaculture, accumulation of antibiotics resulted in development of resistance among bacterial pathogens. Consequently, it became mandatory to find alternative to synthetic antibiotics. Antimicrobial peptides (AMPs) which are described as evolutionary ancient weapons have been considered as promising alternates in recent years. In this study, a novel antimicrobial peptide had been derived from goose type lysozyme (LyzG) which was identified from the cDNA library of freshwater fish Channa striatus (Cs). The identified lysozyme cDNA contains 585 nucleotides which encodes a protein of 194 amino acids. CsLyzG was closely related to Siniperca chuatsi with 92.8% homology. The depicted protein sequence contained a GEWL domain with conserved GLMQ motif, 7 active residues and 2 catalytic residues. Gene expression analysis revealed that CsLyzG was distributed in major immune organs with highest expression in head kidney. Results of temporal expression analysis after bacterial (Aeromonas hydrophila) and fungal (Aphanomyces invadans) challenges indicated a stimulant-dependent expression pattern of CsLyzG. Two antimicrobial peptides IK12 and TS10 were identified from CsLyzG and synthesized. Antibiogram showed that IK12 was active against Salmonella enterica, a major multi-drug resistant (MDR) bacterial pathogen which produces beta lactamase. The IK12 induced loss of cell viability in the bacterial pathogen. Flow cytometry assay revealed that IK12 disrupt the membrane of S. enterica which is confirmed by scanning electron microscope (SEM) analysis that reveals blebs around the bacterial cell membrane. Conclusively, CsLyzG is a potential innate immune component and the identified antimicrobial peptide has great caliber to be used as an ecofriendly antibacterial substance in aquaculture.

  11. Antimicrobial activity of antihypertensive food-derived peptides and selected alanine analogues.


    McClean, Stephen; Beggs, Louise B; Welch, Robert W


    This study evaluated four food-derived peptides with known antihypertensive activities for antimicrobial activity against pathogenic microorganisms, and assessed structure-function relationships using alanine analogues. The peptides (EVSLNSGYY, barley; PGTAVFK, soybean; TTMPLW, α-casein; VHLPP, α-zein) and the six alanine substitution peptides of PGTAVFK were synthesised, characterised and evaluated for antimicrobial activity using the bacteria, Escherichia coli, Staphylococcus aureus, and Micrococcus luteus and the yeast, Candida albicans. The peptides TTMPLW and PGTAVFK inhibited growth of all four microorganisms tested, with activities of a similar order of magnitude to ampicillin and ethanol controls. EVSLNSGYY inhibited the growth of the bacteria, but VHLPP showed no antimicrobial activity. The alanine analogue, PGAAVFK showed the highest overall antimicrobial activity and PGTAVFA showed no activity; overall, the activities of the analogues were consistent with their structures. Some peptides with antihypertensive activity also show antimicrobial activity, suggesting that food-derived peptides may exert beneficial effects via a number of mechanisms.

  12. Dynamical and phase behavior of a phospholipid membrane altered by an antimicrobial peptide at low concentration

    SciTech Connect

    Mamontov, Eugene; Tyagi, M.; Qian, Shuo; Rai, Durgesh K.; Urban, Volker S.; Sharma, V. K.


    Here we discuss that the mechanism of action of antimicrobial peptides is traditionally attributed to the formation of pores in the lipid cell membranes of pathogens, which requires a substantial peptide to lipid ratio. However, using incoherent neutron scattering, we show that even at a concentration too low for pore formation, an archetypal antimicrobial peptide, melittin, disrupts the regular phase behavior of the microscopic dynamics in a phospholipid membrane, dimyristoylphosphatidylcholine (DMPC). At the same time, another antimicrobial peptide, alamethicin, does not exert a similar effect on the DMPC microscopic dynamics. The melittin-altered lateral motion of DMPC at physiological temperature no longer resembles the fluid-phase behavior characteristic of functional membranes of the living cells. The disruptive effect demonstrated by melittin even at low concentrations reveals a new mechanism of antimicrobial action relevant in more realistic scenarios, when peptide concentration is not as high as would be required for pore formation, which may facilitate treatment with antimicrobial peptides.

  13. Machine learning in the rational design of antimicrobial peptides.


    Rondón-Villarreal, Paola; Sierra, Daniel A; Torres, Rodrigo


    One of the most important public health issues is the microbial and bacterial resistance to conventional antibiotics by pathogen microorganisms. In recent years, many researches have been focused on the development of new antibiotics. Among these, antimicrobial peptides (AMPs) have raised as a promising alternative to combat antibioticresistant microorganisms. For this reason, many theoretical efforts have been done in the development of new computational tools for the rational design of both better and effective AMPs. In this review, we present an overview of the rational design of AMPs using machine learning techniques and new research fields.

  14. Assays for Identifying Inducers of the Antimicrobial Peptide LL-37.


    Nylén, Frank; Bergman, Peter; Gudmundsson, Gudmundur H; Agerberth, Birgitta


    One promising approach to meet the growing problem of antibiotic resistance is to modulate host defense mechanisms, i.e., host-directed therapy (HDT), in the fight against infections. Induction of endogenous antimicrobial peptides (AMPs) via small molecular compounds, such as 1,25-dihydroxyvitamin D3 or phenylbutyrate, could provide one such HDT-based approach.We have developed a cell-based screening assay for the identification of novel compounds with the capacity to induce AMP expression and here follows the detailed protocol.

  15. Antimicrobial Peptides and Wound Healing: Biological and Therapeutic Considerations

    PubMed Central

    Mangoni, Maria Luisa; McDermott, Alison M.; Zasloff, Michael


    Repair of tissue wounds is a fundamental process to re-establish tissue integrity and regular function. Importantly, infection is a major factor that hinders wound healing. Multicellular organisms have evolved an arsenal of host-defence molecules, including antimicrobial peptides (AMPs), aimed at controlling microbial proliferation and at modulating the host's immune response to a variety of biological or physical insults. In this brief review we provide the evidence for a role of AMPs as endogenous mediators of wound healing and their promising therapeutic potential for treatment of non-life threatening skin and other epithelial injuries. PMID:26738772

  16. Mining antimicrobial peptides from small open reading frames in Ciona intestinalis.


    Lu, Yongzhong; Zhuang, Yu; Liu, Jie


    Though being able to encode various kinds of bioactive peptides, small open reading frames (sORFs) are poorly annotated in many genomic data. The present study was conducted to evaluate the potential of sORFs in encoding antimicrobial peptides (AMPs) in the basal chordate model Ciona intestinalis. About 4.8 m genomic sequence was first retrieved for sORFs mining by the program sORF finder, then the sORFs were translated into amino acid sequences for AMP prediction via CAMP server, and thereafter, ten putative AMPs were selected for expression and antimicrobial activity validation. In total, over 180 peptides deduced from the sORFs were predicted to be AMPs. Among the ten tested peptides, six were found to have significant expressed sequence tag matches, providing strong evidence for gene expression; five were proved to be active against the bacterial strains. These results indicate that many sORFs in C. intestinalis genome contain AMP information. This work can serve as an important initial step to investigate the role of sORFs in the innate defense of C. intestinalis.

  17. Influence of the yjiL-mdtM Gene Cluster on the Antibacterial Activity of Proline-Rich Antimicrobial Peptides Overcoming Escherichia coli Resistance Induced by the Missing SbmA Transporter System

    PubMed Central

    Krizsan, Andor; Knappe, Daniel


    In view of increasing health threats from multiresistant pathogens, antimicrobial peptides (AMPs) and, specifically, proline-rich AMPs (PrAMPs) have been investigated in animal models. PrAMPs enter bacteria via the ABC transporter SbmA and inhibit intracellular targets. We used phage transduction (Tn10 insertion) to screen by random mutagenesis for alternative uptake mechanisms for analogs of apidaecin 1b, a honeybee-derived PrAMP. All 24 apidaecin-resistant mutants had the Tn10 insertion in the sbmA gene. These sbmA::Tn10 insertion mutants and the Escherichia coli BW25113 ΔsbmA (JW0368) strain were still susceptible to the bactenecin PrAMP Bac7(1-35) and oncocin PrAMPs Onc18 and Onc112, as well as to Chex1-Arg20, despite significantly reduced internalizations. In a second round of random mutagenesis, the remaining susceptibility was linked to the yjiL-mdtM gene cluster. E. coli BW25113 and its ΔyjiL null mutant (JW5785) were equally susceptible to all PrAMPs tested, whereas the BW25113 ΔmdtM mutant was less susceptible to oncocins. The JW0368 yjiL::Tn10 transposon mutant (BS2) was resistant to all short PrAMPs and susceptible only to full-length Bac7 and A3-APO. Interestingly, PrAMPs appear to enter bacteria via MdtM, a multidrug resistance transporter (drug/H+ antiporter) of the major facilitator superfamily (MFS) that can efflux antibiotics, biocides, and bile salts. In conclusion, PrAMPs enter bacteria via ABC and MFS transporters that efflux antibiotics and cytotoxic compounds from the cytoplasm to the periplasm. PMID:26169420

  18. Influence of the yjiL-mdtM Gene Cluster on the Antibacterial Activity of Proline-Rich Antimicrobial Peptides Overcoming Escherichia coli Resistance Induced by the Missing SbmA Transporter System.


    Krizsan, Andor; Knappe, Daniel; Hoffmann, Ralf


    In view of increasing health threats from multiresistant pathogens, antimicrobial peptides (AMPs) and, specifically, proline-rich AMPs (PrAMPs) have been investigated in animal models. PrAMPs enter bacteria via the ABC transporter SbmA and inhibit intracellular targets. We used phage transduction (Tn10 insertion) to screen by random mutagenesis for alternative uptake mechanisms for analogs of apidaecin 1b, a honeybee-derived PrAMP. All 24 apidaecin-resistant mutants had the Tn10 insertion in the sbmA gene. These sbmA::Tn10 insertion mutants and the Escherichia coli BW25113 ΔsbmA (JW0368) strain were still susceptible to the bactenecin PrAMP Bac7(1-35) and oncocin PrAMPs Onc18 and Onc112, as well as to Chex1-Arg20, despite significantly reduced internalizations. In a second round of random mutagenesis, the remaining susceptibility was linked to the yjiL-mdtM gene cluster. E. coli BW25113 and its ΔyjiL null mutant (JW5785) were equally susceptible to all PrAMPs tested, whereas the BW25113 ΔmdtM mutant was less susceptible to oncocins. The JW0368 yjiL::Tn10 transposon mutant (BS2) was resistant to all short PrAMPs and susceptible only to full-length Bac7 and A3-APO. Interestingly, PrAMPs appear to enter bacteria via MdtM, a multidrug resistance transporter (drug/H(+) antiporter) of the major facilitator superfamily (MFS) that can efflux antibiotics, biocides, and bile salts. In conclusion, PrAMPs enter bacteria via ABC and MFS transporters that efflux antibiotics and cytotoxic compounds from the cytoplasm to the periplasm.

  19. Resurrecting inactive antimicrobial peptides from the lipopolysaccharide trap.


    Mohanram, Harini; Bhattacharjya, Surajit


    Host defense antimicrobial peptides (AMPs) are a promising source of antibiotics for the treatment of multiple-drug-resistant pathogens. Lipopolysaccharide (LPS), the major component of the outer leaflet of the outer membrane of Gram-negative bacteria, functions as a permeability barrier against a variety of molecules, including AMPs. Further, LPS or endotoxin is the causative agent of sepsis killing 100,000 people per year in the United States alone. LPS can restrict the activity of AMPs inducing aggregations at the outer membrane, as observed for frog AMPs, temporins, and also in model AMPs. Aggregated AMPs, "trapped" by the outer membrane, are unable to traverse the cell wall, causing their inactivation. In this work, we show that these inactive AMPs can overcome LPS-induced aggregations while conjugated with a short LPS binding β-boomerang peptide motif and become highly bactericidal. The generated hybrid peptides exhibit activity against Gram-negative and Gram-positive bacteria in high-salt conditions and detoxify endotoxin. Structural and biophysical studies establish the mechanism of action of these peptides in LPS outer membrane. Most importantly, this study provides a new concept for the development of a potent broad-spectrum antibiotic with efficient outer membrane disruption as the mode of action.

  20. Effects of dimerization on the structure and biological activity of antimicrobial peptide Ctx-Ha.


    Lorenzón, E N; Cespedes, G F; Vicente, E F; Nogueira, L G; Bauab, T M; Castro, M S; Cilli, E M


    It is well known that cationic antimicrobial peptides (cAMPs) are potential microbicidal agents for the increasing problem of antimicrobial resistance. However, the physicochemical properties of each peptide need to be optimized for clinical use. To evaluate the effects of dimerization on the structure and biological activity of the antimicrobial peptide Ctx-Ha, we have synthesized the monomeric and three dimeric (Lys-branched) forms of the Ctx-Ha peptide by solid-phase peptide synthesis using a combination of 9-fluorenylmethyloxycarbonyl (Fmoc) and t-butoxycarbonyl (Boc) chemical approaches. The antimicrobial activity assay showed that dimerization decreases the ability of the peptide to inhibit growth of bacteria or fungi; however, the dimeric analogs displayed a higher level of bactericidal activity. In addition, a dramatic increase (50 times) in hemolytic activity was achieved with these analogs. Permeabilization studies showed that the rate of carboxyfluorescein release was higher for the dimeric peptides than for the monomeric peptide, especially in vesicles that contained sphingomyelin. Despite different biological activities, the secondary structure and pore diameter were not significantly altered by dimerization. In contrast to the case for other dimeric cAMPs, we have shown that dimerization selectively decreases the antimicrobial activity of this peptide and increases the hemolytic activity. The results also show that the interaction between dimeric peptides and the cell wall could be responsible for the decrease of the antimicrobial activity of these peptides.

  1. Searching for Synthetic Antimicrobial Peptides: An Experiment for Organic Chemistry Students

    ERIC Educational Resources Information Center

    Vasquez, Thomas E., Jr.; Saldan~a, Cristina; Muzikar, Katy A.; Mashek, Debra; Liu, Jane M.


    This laboratory experiment provides undergraduate students enrolled in organic chemistry the opportunity to design and synthesize their own peptide, which is then tested for antimicrobial activity. After reading a primary scientific paper on antimicrobial peptides, students design and synthesize their own hexapeptide that they hypothesize will…

  2. Antimicrobial activity of de novo designed cationic peptides against multi-resistant clinical isolates.


    Faccone, Diego; Veliz, Omar; Corso, Alejandra; Noguera, Martin; Martínez, Melina; Payes, Cristian; Semorile, Liliana; Maffía, Paulo Cesar


    Antibiotic resistance is one of the main problems concerning public health or clinical practice. Antimicrobial peptides appear as good candidates for the development of new therapeutic drugs. In this study we de novo designed a group of cationic antimicrobial peptides, analyzed its physicochemical properties, including its structure by circular dichroism and studied its antimicrobial properties against a panel of clinical isolates expressing different mechanisms of resistance. Three cationic alpha helical peptides exhibited antimicrobial activity comparable to, or even better than the comparator omiganan (MBI-226).

  3. Streptomyces as Overexpression System for Heterologous Production of an Antimicrobial Peptide.


    Roldán-Tapia, Marisol; Anné, Jozef; Reyes, Ana Gisela; Carrasco, Ulises; Millán-Pacheco, Cesar; Barrios-González, Javier; Mejía, Armando


    Defense mechanisms of plants against phytopathogens include cationic antimicrobial peptides (CAPs). The broad-spectrum activity of these peptides has been evaluated previously against different phytopathogens. Their lack of toxicity for plants and animals is a promising feature for pest control. Although, some attempts have been made previously in order to increase their heterologous expressions, the employed strategies have so far proven to be ineffective. Low production yield and elevated costs are the obstacles to overcome. In this study, a strategy for CAP overexpression is presented based on the construction of an expression cassette for Streptomyces lividans TK24. This system contains elements that allow the increase of the efficiency of the peptide's expression. The main elements included in this cassette are the sequences of the promoter and signal peptide from a subtilisin inhibitor gene of Streptomyces venezuelae. This allows the efficient secretion of the peptide to the growth medium, thereby simplifying its recovery and avoiding its toxic effect on the producing organism. The results obtained demonstrate the system's efficiency by achieving a peptide concentration of 11.61 mg/ml. This represents at least a 10-fold increase compared to previously established strategies.

  4. Antimicrobial peptides in marine invertebrate health and disease.


    Destoumieux-Garzón, Delphine; Rosa, Rafael Diego; Schmitt, Paulina; Barreto, Cairé; Vidal-Dupiol, Jeremie; Mitta, Guillaume; Gueguen, Yannick; Bachère, Evelyne


    Aquaculture contributes more than one-third of the animal protein from marine sources worldwide. A significant proportion of aquaculture products are derived from marine protostomes that are commonly referred to as 'marine invertebrates'. Among them, penaeid shrimp (Ecdysozosoa, Arthropoda) and bivalve molluscs (Lophotrochozoa, Mollusca) are economically important. Mass rearing of arthropods and molluscs causes problems with pathogens in aquatic ecosystems that are exploited by humans. Remarkably, species of corals (Cnidaria) living in non-exploited ecosystems also suffer from devastating infectious diseases that display intriguing similarities with those affecting farmed animals. Infectious diseases affecting wild and farmed animals that are present in marine environments are predicted to increase in the future. This paper summarizes the role of the main pathogens and their interaction with host immunity, with a specific focus on antimicrobial peptides (AMPs) and pathogen resistance against AMPs. We provide a detailed review of penaeid shrimp AMPs and their role at the interface between the host and its resident/pathogenic microbiota. We also briefly describe the relevance of marine invertebrate AMPs in an applied context.This article is part of the themed issue 'Evolutionary ecology of arthropod antimicrobial peptides'.

  5. Cationic antimicrobial peptides disrupt the Streptococcus pyogenes ExPortal.


    Vega, Luis Alberto; Caparon, Michael G


    Although they possess a well-characterized ability to porate the bacterial membrane, emerging research suggests that cationic antimicrobial peptides (CAPs) can influence pathogen behaviour at levels that are sublethal. In this study, we investigated the interaction of polymyxin B and human neutrophil peptide (HNP-1) with the human pathogen Streptococcus pyogenes. At sublethal concentrations, these CAPs preferentially targeted the ExPortal, a unique microdomain of the S. pyogenes membrane, specialized for protein secretion and processing. A consequence of this interaction was the disruption of ExPortal organization and a redistribution of ExPortal components into the peripheral membrane. Redistribution was associated with inhibition of secretion of certain toxins, including the SpeB cysteine protease and the streptolysin O (SLO) cytolysin, but not SIC, a protein that protects S. pyogenes from CAPs. These data suggest a novel function for CAPs in targeting the ExPortal and interfering with secretion of factors required for infection and survival. This mechanism may prove valuable for the design of new types of antimicrobial agents to combat the emergence of antibiotic-resistant pathogens.

  6. Analysis of the antimicrobial activities of a chemokine-derived peptide (CDAP-4) on Pseudomonas aeruginosa

    SciTech Connect

    Martinez-Becerra, Francisco; Dominguez-Ramirez, Lenin; Mendoza-Hernandez, Guillermo; Lopez-Vidal, Yolanda; Soldevila, Gloria . E-mail:


    Chemokines are key molecules involved in the control of leukocyte trafficking. Recently, a novel function as antimicrobial proteins has been described. CCL13 is the only member of the MCP chemokine subfamily displaying antimicrobial activity. To determine Key residues involved in its antimicrobial activity, CCL13 derived peptides were synthesized and tested against several bacterial strains, including Pseudomonas aeruginosa. One of these peptides, corresponding to the C-terminal region of CCL13 (CDAP-4) displayed good antimicrobial activity. Electron microscopy studies revealed remarkable morphological changes after CDAP-4 treatment. By computer modeling, CDAP-4 in {alpha} helical configuration generated a positive electrostatic potential that extended beyond the surface of the molecule. This feature is similar to other antimicrobial peptides. Altogether, these findings indicate that the antimicrobial activity was displayed by CCL13 resides to some extent at the C-terminal region. Furthermore, CDAP-4 could be considered a good antimicrobial candidate with a potential use against pathogens including P. aeruginosa.

  7. Antimicrobial peptides in oyster hemolymph: the bacterial connection.


    Defer, Diane; Desriac, Florie; Henry, Joël; Bourgougnon, Nathalie; Baudy-Floc'h, Michèle; Brillet, Benjamin; Le Chevalier, Patrick; Fleury, Yannick


    We have explored antimicrobial compounds in oyster hemolymph and purified four active peptides with molecular masses of 4464, 3158, 655 and 636 Da. While no exploitable structural elements were obtained for the former three, a partial amino acid sequence (X-P-P-X-X-I-V) was obtained for the latter, named Cg-636. Due to both its low MM and the presence of exotic amino acid residue (X), we suspected a bacterial origin and tracked cultivable hemolymph-resident bacteria of oyster for their antimicrobial abilities. Supernatants of 224 hemolymph resident bacteria coming from 60 oysters were screened against 10 target bacteria including aquaculture pathogens. Around 2% (5 strains) revealed antimicrobial activities. They belong to Pseudoalteromonas and Vibrio genera. Two closely related strains named hCg-6 and hCg-42 have been shown to produce Bacteriocin-Like Inhibitory Substances (BLIS) even in oyster hemolymph. We report herein first BLIS-producing bacteria isolated from bivalve hemolymph. These results strongly suggest that hemolymph resident bacteria may prevent pathogen establishment and pave the way for considering a role of resident bacteria into bivalve defense.

  8. Determinants of recombinant production of antimicrobial cationic peptides and creation of peptide variants in bacteria.


    Zhang, L; Falla, T; Wu, M; Fidai, S; Burian, J; Kay, W; Hancock, R E


    Cationic peptides possessing antibacterial activity are virtually ubiquitous in nature, and offer exciting prospects as new therapeutic agents. We had previously demonstrated that such peptides could be produced by fusion protein technology in bacteria and several carrier proteins had been tested as fusion partners including glutathione-S-transferase, S. aureus protein A, IgG binding protein and P. aeruginosa outer membrane protein OprF. However these fusion partners, while successfully employed in peptide expression, were not optimized for high level production of cationic peptides (Piers, K., Brow, M. L., and Hancock, R. E. W. 1993, Gene 137, 7-13). In this paper we took advantage of a small replication protein RepA from E. coli and used its truncated version to construct fusion partners. The minimal elements required for high level expression of cationic peptide were defined as a DNA sequence encoding a fusion protein comprising, from the N-terminus, a 68 amino acid carrier region, an anionic prepro domain, a single methionine and the peptide of interest. The 68 amino acid carrier region was a block of three polypeptides consisting of a truncated RepA, a synthetic cellulose binding domain and a hexa histidine domain. The improved system showed high level expression and simplified downstream purification. The active peptide could be yielded by CNBr cleavage of the fusion protein. This novel vector was used to express three classes of cationic peptides including the alpha-helical peptide CEMA, the looped peptide bactenecin and the extended peptide indolicidin. In addition, mutagenesis of the peptide gene to produce peptide variants of CEMA and indolicidin using the improved vector system was shown to be successful.

  9. A molecular dynamics and circular dichroism study of a novel synthetic antimicrobial peptide

    NASA Astrophysics Data System (ADS)

    Rodina, N. P.; Yudenko, A. N.; Terterov, I. N.; Eliseev, I. E.


    Antimicrobial peptides are a class of small, usually positively charged amphiphilic peptides that are used by the innate immune system to combat bacterial infection in multicellular eukaryotes. Antimicrobial peptides are known for their broad-spectrum antimicrobial activity and thus can be used as a basis for a development of new antibiotics against multidrug-resistant bacteria. The most challengeous task on the way to a therapeutic use of antimicrobial peptides is a rational design of new peptides with enhanced activity and reduced toxicity. Here we report a molecular dynamics and circular dichroism study of a novel synthetic antimicrobial peptide D51. This peptide was earlier designed by Loose et al. using a linguistic model of natural antimicrobial peptides. Molecular dynamics simulation of the peptide folding in explicit solvent shows fast formation of two antiparallel beta strands connected by a beta-turn that is confirmed by circular dichroism measurements. Obtained from simulation amphipatic conformation of the peptide is analysed and possible mechanism of it's interaction with bacterial membranes together with ways to enhance it's antibacterial activity are suggested.

  10. Comparative surface antimicrobial properties of synthetic biocides and novel human apolipoprotein E derived antimicrobial peptides.


    Forbes, Sarah; McBain, Andrew J; Felton-Smith, Susan; Jowitt, Thomas A; Birchenough, Holly L; Dobson, Curtis B


    Medical device infection remains a major clinical concern. Biocidal compounds have been incorporated into medical device materials ideally to inhibit bacterial colonisation whilst exhibiting relatively low cytotoxicity. We compared the antibacterial activity, anti-biofilm efficacy and cytotoxicity of a novel peptide derivative of human apolipoprotein E (apoEdpL-W) to that of commonly used biocides, before and after coating onto a range of standard polymers. Since the antimicrobial function of most biocides frequently involves associations with cellular membranes, we have also studied the detailed interactions of the test antimicrobials with phospholipid bilayers, using the quartz crystal microbalance device combined with dual-polarisation interferometry. ApoEdpL-W displayed broad-spectrum antibacterial activity and marked efficacy against nascent Staphylococcus aureus biofilms. Compounds showed better antimicrobial activity when combined with hydrogel materials than with non-porous materials. The membrane interactions of apoEdpL-W were most similar to that of PHMB, with both agents appearing to readily bind and insert into lipid bilayers, possibly forming pores. However apoEdpL-W showed lower cytotoxicity than PHMB, its efficacy was less affected by the presence of serum, and it demonstrated the highest level of biocompatibility of all the biocides, as indicated by our measurement of its antimicrobial biocompatibility index. This work shows the potential of apoEdpL-W as an effective antiseptic coating agent.

  11. Additivity and synergy between an antimicrobial peptide and inhibitory ions.


    Walkenhorst, William F; Sundrud, Justine N; Laviolette, Joshua M


    Recently we described the pH dependence of activity for a family of cationic antimicrobial peptides (CAMPs) selected from a combinatorial library. In the current work we report on the effects of toxic ions (Cu(2+), Zn(2+), and F(-)) and the chelator EDTA on the activity profiles of one member of this family, the 12-residue cationic antimicrobial peptide *ARVA, against a panel of microorganisms. All four ions exhibited either synergy or additivity with *ARVA for all organisms tested with the exception of *ARVA combined with NaF against Candida albicans which exhibited indifference. CuCl2 and ZnCl2 exhibited synergy with *ARVA against both the Gram negative Pseudomonas aeruginosa and the Gram positive Staphylococcus aureus as well as strong additivity against Escherichia coli at submillimolar concentrations. The chelator EDTA was synergistic with *ARVA against the two Gram negative organisms but showed only simple additivity with S. aureus and C. albicans despite their much lower MICs with EDTA. This effect may be related to the known differences in the divalent ion binding properties of the Gram negative LPS layer as compared to the peptidoglycan layer of the Gram positive organism. Unlike the other ions, NaF showed only additivity or indifference when combined with *ARVA and required much higher concentrations for activity. The yeast C. albicans did not show synergy or strong additivity with any of the inhibitory compounds tested. The effects of toxic ions and chelators observed here have important implications for applications using CAMPs and for the design of novel formulations involving CAMPs. This article is part of a Special Issue entitled: Interfacially Active Peptides and Proteins. Guest Editors: William C. Wimley and Kalina Hristova.

  12. Discovery of novel antimicrobial peptides with unusual cysteine motifs in dandelion Taraxacum officinale Wigg. flowers.


    Astafieva, A A; Rogozhin, E A; Odintsova, T I; Khadeeva, N V; Grishin, E V; Egorov, Ts A


    Three novel antimicrobial peptides designated ToAMP1, ToAMP2 and ToAMP3 were purified from Taraxacum officinale flowers. Their amino acid sequences were determined. The peptides are cationic and cysteine-rich and consist of 38, 44 and 42 amino acid residues for ToAMP1, ToAMP2 and ToAMP3, respectively. Importantly, according to cysteine motifs, the peptides are representatives of two novel previously unknown families of plant antimicrobial peptides. ToAMP1 and ToAMP2 share high sequence identity and belong to 6-Cys-containing antimicrobial peptides, while ToAMP3 is a member of a distinct 8-Cys family. The peptides were shown to display high antimicrobial activity both against fungal and bacterial pathogens, and therefore represent new promising molecules for biotechnological and medicinal applications.

  13. Rational design of artificial β-strand-forming antimicrobial peptides with biocompatible properties.


    Rapsch, Karsten; Bier, Frank F; von Nickisch-Rosenegk, Markus


    Because the intensive use of antibiotics has led to a large variety of resistant bacterial strains, therapeutic measures have become increasingly challenging. In order to ensure reliable treatment of diseases, alternative antimicrobial agents need to be explored. In this context, antimicrobial peptides have been discussed as novel bioactive molecules, which, however, may be limited in their applicability due to their high manufacturing costs and poor pharmacokinetic properties. Consequently, the design of artificial antimicrobial peptides featuring two flanking cationic regions and a hydrophobic center is presented. These sequences led to distinct antimicrobial activity on the same order of magnitude as that of naturally occurring reference peptides but with less cytotoxic or cytostatic drawbacks. Furthermore, a deletion and substitution library revealed the minimal sequence requirements. By analysis of the computed 3D structures of these peptides, a single characteristic β-strand was identified. This structural motif was pivotal for antimicrobial activity. Consequently, an optimized peptide sequence with antimicrobial and biocompatible properties was derived, and its application was demonstrated in a mixed culture experiment. Thus, it was shown that the optimized artificial antimicrobial peptide is suitable as a therapeutic agent and may be used as template for the development of new antimicrobial peptides with unique secondary structures.

  14. AMPed Up immunity: how antimicrobial peptides have multiple roles in immune defense

    PubMed Central

    Lai, Yuping; Gallo, Richard L.


    Antimicrobial peptides (AMPs) are widely expressed and rapidly induced at epithelial surfaces to repel assault from diverse infectious agents including bacteria, viruses, fungi and parasites. Much information suggests that AMPs act by mechanisms that extend beyond their capacity to serve as gene-encoded antibiotics. For example, some AMPs alter the properties of the mammalian membrane or interact with its receptors to influence diverse cellular processes including cytokine release, chemotaxis, antigen presentation, angiogenesis and wound healing. These functions complement their antimicrobial action and favor resolution of infection and repair of damaged epithelia. Opposing this, some microbes have evolved mechanisms to inactivate or avoid AMPs and subsequently become pathogens. Thus, AMPs are multifunctional molecules that have a central role in infection and Inflammation. PMID:19217824

  15. Effects of Antimicrobial Peptide Revealed by Simulations: Translocation, Pore Formation, Membrane Corrugation and Euler Buckling

    PubMed Central

    Chen, Licui; Jia, Nana; Gao, Lianghui; Fang, Weihai; Golubovic, Leonardo


    We explore the effects of the peripheral and transmembrane antimicrobial peptides on the lipid bilayer membrane by using the coarse grained Dissipative Particle Dynamics simulations. We study peptide/lipid membrane complexes by considering peptides with various structure, hydrophobicity and peptide/lipid interaction strength. The role of lipid/water interaction is also discussed. We discuss a rich variety of membrane morphological changes induced by peptides, such as pore formation, membrane corrugation and Euler buckling. PMID:23579956

  16. New perspectives for natural antimicrobial peptides: application as antinflammatory drugs in a murine model

    PubMed Central


    Background Antimicrobial peptides (AMPs) are an ancient group of defense molecules. AMPs are widely distributed in nature (being present in mammals, birds, amphibians, insects, plants, and microorganisms). They display bactericidal as well as immunomodulatory properties. The aim of this study was to investigate the antimicrobial and anti-inflammatory activities of a combination of two AMPs (temporin B and the royal jellein I) against Staphylococcus epidermidis. Results The temporin B (TB-KK) and the royal jelleins I, II, III chemically modified at the C terminal (RJI-C, RJII-C, RJIII-C), were tested for their activity against 10 different Staphylococcus epidermidis strains, alone and in combination. Of the three royal jelleins, RJI-C showed the highest activity. Moreover, the combination of RJI-C and TB-KK (MIX) displayed synergistic activity. In vitro, the MIX displayed low hemolytic activity, no NO2- production and the ability to curb the synthesis of the pro-inflammatory cytokines TNF-α and IFN-γ to the same extent as acetylsalicylic acid. In vivo, the MIX sterilized mice infected with Staphylococcus epidermidis in eleven days and inhibited the expression of genes encoding the prostaglandin-endoperoxide synthase 2 (COX-2) and CD64, two important parameters of inflammation. Conclusion The study shows that the MIX – a combination of two naturally occurring peptides - displays both antimicrobial and anti-inflammatory activities. PMID:23157568

  17. Antimicrobial peptides as novel anti-tuberculosis therapeutics.


    Silva, João P; Appelberg, Rui; Gama, Francisco Miguel


    Tuberculosis (TB), a disease caused by the human pathogen Mycobacterium tuberculosis, has recently joined HIV/AIDS as the world's deadliest infectious disease, affecting around 9.6 million people worldwide in 2014. Of those, about 1.2 million died from the disease. Resistance acquisition to existing antibiotics, with the subsequent emergence of Multi-Drug Resistant mycobacteria strains, together with an increasing economic burden, has urged the development of new anti-TB drugs. In this scope, antimicrobial peptides (AMPs), which are small, cationic and amphipathic peptides that make part of the innate immune system, now arise as promising candidates for TB treatment. In this review, we analyze the potential of AMPs for this application. We address the mechanisms of action, advantages and disadvantages over conventional antibiotics and how problems associated with its use may be overcome to boost their therapeutic potential. Additionally, we address the challenges of translational development from benchside to bedside, evaluate the current development pipeline and analyze the expected global impact from a socio-economic standpoint. The quest for more efficient and more compliant anti-TB drugs, associated with the great therapeutic potential of emerging AMPs and the rising peptide market, provide an optimal environment for the emergence of AMPs as promising therapies. Still, their pharmacological properties need to be enhanced and manufacturing-associated issues need to be addressed.

  18. Designing carbohydrate nanoparticles for prolonged efficacy of antimicrobial peptide.


    Bi, Lin; Yang, Lei; Narsimhan, Ganesan; Bhunia, Arun K; Yao, Yuan


    In this work, carbohydrate nanoparticles were created to prolong the efficacy of antimicrobial peptide against pathogens. Nisin and Listeria monocytogenes were used as the peptide and pathogen models, respectively, and phytoglycogen (PG)-based nanoparticles were developed as carriers of nisin. PG from su1 mutant maize was subjected to β-amylolysis as well as subsequent succinate or octenyl succinate substitutions. The goal was to minimize the loss of peptide during storage and meanwhile realize an effective release in the presence of bacteria. The capabilities of PG derivatives as carriers of nisin were evaluated using centrifugal ultrafiltration, zeta-potential, and the initial availability of nisin against L. monocytogenes. All methods indicated that nisin loading was favored by a high degree of substitution (DS), presence of hydrophobic octenyl moiety, and β-amylolysis of PG nanoparticles. To evaluate the prolonged nisin efficacy, preparations containing nisin and PG derivatives were loaded into a BHI-agar deep-well model (mimicking nisin depletion at the nutrient-containing surface). The residual inhibitory activities of preparations against L. monocytogenes were monitored during 21 days of storage at 4 °C. The results showed that all PG derivatives led to the prolonged retention of nisin activity and the longest retention was associated with high DS, β-amylolysis, and octenyl succinate. Evidently, both electrostatic and hydrophobic interactions are the driving forces of nisin adsorption, and the glucan structure at the nanoparticle surface also affects nisin loading and retention during storage.

  19. Multiple Functions of the New Cytokine-Based Antimicrobial Peptide Thymic Stromal Lymphopoietin (TSLP)

    PubMed Central

    Bjerkan, Louise; Sonesson, Andreas; Schenck, Karl


    Thymic stromal lymphopoietin (TSLP) is a pleiotropic cytokine, hitherto mostly known to be involved in inflammatory responses and immunoregulation. The human tslp gene gives rise to two transcription and translation variants: a long form (lfTSLP) that is induced by inflammation, and a short, constitutively-expressed form (sfTSLP), that appears to be downregulated by inflammation. The TSLP forms can be produced by a number of cell types, including epithelial and dendritic cells (DCs). lfTSLP can activate mast cells, DCs, and T cells through binding to the lfTSLP receptor (TSLPR) and has a pro-inflammatory function. In contrast, sfTSLP inhibits cytokine secretion of DCs, but the receptor mediating this effect is unknown. Our recent studies have demonstrated that both forms of TSLP display potent antimicrobial activity, exceeding that of many other known antimicrobial peptides (AMPs), with sfTSLP having the strongest effect. The AMP activity is primarily mediated by the C-terminal region of the protein and is localized within a 34-mer peptide (MKK34) that spans the C-terminal α-helical region in TSLP. Fluorescent studies of peptide-treated bacteria, electron microscopy, and liposome leakage models showed that MKK34 exerted membrane-disrupting effects comparable to those of LL-37. Expression of TSLP in skin, oral mucosa, salivary glands, and intestine is part of the defense barrier that aids in the control of both commensal and pathogenic microbes. PMID:27399723

  20. Comparative Analysis of the Bacterial Membrane Disruption Effect of Two Natural Plant Antimicrobial Peptides

    PubMed Central

    Farkas, Attila; Maróti, Gergely; Kereszt, Attila; Kondorosi, Éva


    In the Medicago truncatula genome about 700 genes code for nodule-specific cysteine-rich (NCR) small peptides that are expressed in the symbiotic organ, the root nodule, where they control terminal differentiation of the endosymbiotic rhizobium bacteria to nitrogen-fixing bacteroids. Cationic NCR peptides were predicted to have antimicrobial activities. Here antibacterial activities of NCR247, NCR335, polymyxin B (PMB), and streptomycin were investigated and compared on two foodborne pathogens Salmonella enterica and Listeria monocytogenes as representatives of Gram-negative and Gram-positive bacteria. The integrity of the bacterial membrane was seriously compromised by these NCR peptides. Different localization was observed for NCR247 and NCR335 in the treated bacteria, the peptides mostly accumulated in the cytosol in S. enterica while they remained in the bacterial membrane in L. monocytogenes. Scanning electron microscopy revealed distinct membrane morphology of the peptide-treated bacteria. Complete cell disruption was induced by PMB and NCR335 in S. enterica while NCR247 treatment resulted in extensive budding observed on the cell surface of Salmonella. PMB had no effect on L. monocytogenes while NCR335 and NCR247 provoked morphological changes on this bacterium, the whole Listeria cell content was released in response to NCR335 treatment. PMID:28167938

  1. Design and characterization of short antimicrobial peptides using leucine zipper templates with selectivity towards microorganisms.


    Ahmad, Aqeel; Azmi, Sarfuddin; Srivastava, Saurabh; Kumar, Amit; Tripathi, Jitendra Kumar; Mishra, Nripendra N; Shukla, Praveen K; Ghosh, Jimut Kanti


    Design of antimicrobial peptides with selective activity towards microorganisms is an important step towards the development of new antimicrobial agents. Leucine zipper sequence has been implicated in cytotoxic activity of naturally occurring antimicrobial peptides; moreover, this motif has been utilized for the design of novel antimicrobial peptides with modulated cytotoxicity. To understand further the impact of substitution of amino acids at 'a' and/or 'd' position of a leucine zipper sequence of an antimicrobial peptides on its antimicrobial and cytotoxic properties four short peptides (14-residue) were designed on the basis of a leucine zipper sequence without or with replacement of leucine residues in its 'a' and 'd' positions with D-leucine or alanine or proline residue. The original short leucine zipper peptide (SLZP) and its D-leucine substituted analog, DLSA showed comparable activity against the tested Gram-positive and negative bacteria and the fungal strains. The alanine substituted analog (ASA) though showed appreciable activity against the tested bacteria, it showed to some extent lower activity against the tested fungi. However, the proline substituted analog (PSA) showed lower activity against the tested bacterial or fungal strains. Interestingly, DLSA, ASA and PSA showed significantly lower cytotoxicity than SLZP against both human red blood cells (hRBCs) and murine 3T3 cells. Cytotoxic and bactericidal properties of these peptides matched with peptide-induced damage/permeabilization of mammalian cells and bacteria or their mimetic lipid vesicles suggesting cell membrane could be the target of these peptides. As evidenced by tryptophan fluorescence and acrylamide quenching studies the peptides showed similarities either in interaction or in their localization within the bacterial membrane mimetic negatively charged lipid vesicles. Only SLZP showed localization inside the mammalian membrane mimetic zwitterionic lipid vesicles. The results show

  2. Snake Cathelicidin NA-CATH and Smaller Helical Antimicrobial Peptides Are Effective against Burkholderia thailandensis

    PubMed Central

    Blower, Ryan J.; Barksdale, Stephanie M.; van Hoek, Monique L.


    Burkholderia thailandensis is a Gram-negative soil bacterium used as a model organism for B. pseudomallei, the causative agent of melioidosis and an organism classified category B priority pathogen and a Tier 1 select agent for its potential use as a biological weapon. Burkholderia species are reportedly “highly resistant” to antimicrobial agents, including cyclic peptide antibiotics, due to multiple resistance systems, a hypothesis we decided to test using antimicrobial (host defense) peptides. In this study, a number of cationic antimicrobial peptides (CAMPs) were tested in vitro against B. thailandensis for both antimicrobial activity and inhibition of biofilm formation. Here, we report that the Chinese cobra (Naja atra) cathelicidin NA-CATH was significantly antimicrobial against B. thailandensis. Additional cathelicidins, including the human cathelicidin LL-37, a sheep cathelicidin SMAP-29, and some smaller ATRA peptide derivatives of NA-CATH were also effective. The D-enantiomer of one small peptide (ATRA-1A) was found to be antimicrobial as well, with EC50 in the range of the L-enantiomer. Our results also demonstrate that human alpha-defensins (HNP-1 & -2) and a short beta-defensin-derived peptide (Peptide 4 of hBD-3) were not bactericidal against B. thailandensis. We also found that the cathelicidin peptides, including LL-37, NA-CATH, and SMAP-29, possessed significant ability to prevent biofilm formation of B. thailandensis. Additionally, we show that LL-37 and its D-enantiomer D-LL-37 can disperse pre-formed biofilms. These results demonstrate that although B. thailandensis is highly resistant to many antibiotics, cyclic peptide antibiotics such as polymyxin B, and defensing peptides, some antimicrobial peptides including the elapid snake cathelicidin NA-CATH exert significant antimicrobial and antibiofilm activity towards B. thailandensis. PMID:26196513

  3. Recent advances in the research and development of marine antimicrobial peptides.


    El-Gamal, Mohammed I; Abdel-Maksoud, Mohammed S; Oh, Chang-Hyun


    Antimicrobial peptides are a group of natural or semi-synthetic molecules possessing antimicrobial activities against bacteria, fungi, viruses, parasites, etc. They are considered as promising candidates for treatment of microbial infections and suppression of microbial resistance. The increasing emergence of bacterial resistance has required development of new efficient antibiotics that can be added to the antibacterial armamentarium. The marine world provides a rich source of antimicrobial peptides. That world has not been highly explored yet, and much more effort is required in order to discover new efficient antimicrobial peptides. In the present article, we have reviewed the recent progress in the field of marine antimicrobial peptides from 2009 until the mid of 2012.

  4. Engineered killer mimotopes: new synthetic peptides for antimicrobial therapy.


    Magliani, W; Conti, S; Salati, A; Arseni, S; Ravanetti, L; Frazzi, R; Polonelli, L


    This review deals with a novel approach to produce synthetic antibiotic peptides (killer mimotopes), similar to those described for the conversion of epitopes into peptide mimotopes, allowing their use as surrogate vaccines. Synthetic peptides pertaining to the complementary determining regions (CDRs) of a recombinant antiidiotypic antibody (PaKTscFv), which mimic the wide spectrum of microbicidal activity of a killer toxin produced by the yeast Pichia anomala (PaKT), have proven to act as structural or functional mimotopes of PaKT. This activity appeared to be mediated by interaction with specific cell wall killer toxin receptors (KTRs), mainly constituted by beta glucans. Killer mimotopes have shown in vitro an impressive microbicidal activity against Candida albicans. They were adopted as a model of PaKT- and PaKTscFv-susceptible microorganisms. Optimization through alanine scanning led to the generation of an engineered decapeptide (KP) of a CDR-L1 pertaining antibody fragment with an enhanced in vitro microbicidal activity. It had a potent therapeutic effect against experimental vaginal and systemic candidiasis in normal and immunodeficient mice caused by flucanozole susceptible and resistant yeast isolates. KP exerted a microbicidal activity in vitro against multidrug-resistant eukaryotic and prokaryotic pathogenic microorganisms, which was neutralized by interaction with laminarin (beta 1,3-glucan). To our knowledge, KP represents the prototype of an engineered peptide fragment derived from a microbicidal recombinant antiidiotypic antibody. It is capable of exerting antimicrobial activity in vitro and a therapeutic effect in vivo presumably acting through interaction with the beta glucan KTR component in the cell walls of pathogenic microorganisms.

  5. Improvement of in vivo antimicrobial activity of HBcARD peptides by D-arginine replacement.


    Chen, Heng-Li; Su, Pei-Yi; Shih, Chiaho


    We previously identified a novel antimicrobial peptide with a broad spectrum bactericidal activity from human hepatitis B virus (HBV) core protein (HBc) arginine-rich domain (ARD). We compared the antimicrobial activities of HBcARD peptides from different hepadnaviruses which share similar amino acid sequences. In general, mammalian HBcARD peptides exhibited stronger antimicrobial activity than avian peptides. Using the strategy of D-amino acid substitutions, we improved the antimicrobial efficacy of human HBcARD peptide. This D-HBcARD peptide was much more resistant than L-HBcARD peptide to proteolytic degradation in vitro. Moreover, this D-HBcARD peptide maintained similar minimal bactericidal concentrations (MBC) against tested bacteria, and showed very low hemolytic activity. In the Staphylococcus aureus-infected mouse model, this D-HBcARD peptide was more protective than the L-HBcARD peptide. Repeated treatments with either L- or D-HBcARD peptides induced no significant immunogenicity. New derivatives of HBcARD peptides could serve as alternatives to the conventional antibiotics in clinical medicine in the future.

  6. Membrane-active peptides from marine organisms--antimicrobials, cell-penetrating peptides and peptide toxins: applications and prospects.


    Ponnappan, Nisha; Budagavi, Deepthi Poornima; Yadav, Bhoopesh Kumar; Chugh, Archana


    Marine organisms are known to be a rich and unique source of bioactive compounds as they are exposed to extreme conditions in the oceans. The present study is an attempt to briefly describe some of the important membrane-active peptides (MAPs) such as antimicrobial peptides (AMPs), cell-penetrating peptides (CPPs) and peptide toxins from marine organisms. Since both AMPs and CPPs play a role in membrane perturbation and exhibit interchangeable role, they can speculatively fall under the broad umbrella of MAPs. The study focuses on the structural and functional characteristics of different classes of marine MAPs. Further, AMPs are considered as a potential remedy to antibiotic resistance acquired by several pathogens. Peptides from marine organisms show novel post-translational modifications such as cysteine knots, halogenation and histidino-alanine bridge that enable these peptides to withstand harsh marine environmental conditions. These unusual modifications of AMPs from marine organisms are expected to increase their half-life in living systems, contributing to their increased bioavailability and stability when administered as drug in in vivo systems. Apart from AMPs, marine toxins with membrane-perturbing properties could be essentially investigated for their cytotoxic effect on various pathogens and their cell-penetrating activity across various mammalian cells. The current review will help in identifying the MAPs from marine organisms with crucial post-translational modifications that can be used as template for designing novel therapeutic agents and drug-delivery vehicles for treatment of human diseases.

  7. Analysis of differentially expressed genes in response to bacterial stimulation in hemocytes of the carpet-shell clam Ruditapes decussatus: identification of new antimicrobial peptides.


    Gestal, Camino; Costa, Marímar; Figueras, Antonio; Novoa, Beatriz


    Suppression subtractive hybridization was used to identify differentially expressed genes in hemocytes from carpet-shell clam Ruditapes decussatus stimulated with a mixture of dead bacterial strains. Putative function could be assigned to 100 of the 253 sequenced cDNAs. Based on sequence homologies, 3.16% of the total identified genes were possibly related to immune functions. Clam myticin isoforms 1, 2 and 3, and clam mytilin, with similarity with myticins and mytilins previously reported on Mytilus galloprovincialis were identified and characterized for the first time in clams. The analysis of their expression levels by quantitative PCR showed that they were induced by bacterial challenge. The results obtained in this work could be the first step leading to the understanding of molecular mechanisms by which these economically important marine bivalves respond to pathogens.

  8. Combined systems approaches reveal highly plastic responses to antimicrobial peptide challenge in Escherichia coli.


    Kozlowska, Justyna; Vermeer, Louic S; Rogers, Geraint B; Rehnnuma, Nabila; Amos, Sarah-Beth T A; Koller, Garrit; McArthur, Michael; Bruce, Kenneth D; Mason, A James


    Obtaining an in-depth understanding of the arms races between peptides comprising the innate immune response and bacterial pathogens is of fundamental interest and will inform the development of new antibacterial therapeutics. We investigated whether a whole organism view of antimicrobial peptide (AMP) challenge on Escherichia coli would provide a suitably sophisticated bacterial perspective on AMP mechanism of action. Selecting structurally and physically related AMPs but with expected differences in bactericidal strategy, we monitored changes in bacterial metabolomes, morphological features and gene expression following AMP challenge at sub-lethal concentrations. For each technique, the vast majority of changes were specific to each AMP, with such a plastic response indicating E. coli is highly capable of discriminating between specific antibiotic challenges. Analysis of the ontological profiles generated from the transcriptomic analyses suggests this approach can accurately predict the antibacterial mode of action, providing a fresh, novel perspective for previous functional and biophysical studies.

  9. Combined Systems Approaches Reveal Highly Plastic Responses to Antimicrobial Peptide Challenge in Escherichia coli

    PubMed Central

    Kozlowska, Justyna; Vermeer, Louic S.; Rogers, Geraint B.; Rehnnuma, Nabila; Amos, Sarah-Beth T. A.; Koller, Garrit; McArthur, Michael; Bruce, Kenneth D.; Mason, A. James


    Obtaining an in-depth understanding of the arms races between peptides comprising the innate immune response and bacterial pathogens is of fundamental interest and will inform the development of new antibacterial therapeutics. We investigated whether a whole organism view of antimicrobial peptide (AMP) challenge on Escherichia coli would provide a suitably sophisticated bacterial perspective on AMP mechanism of action. Selecting structurally and physically related AMPs but with expected differences in bactericidal strategy, we monitored changes in bacterial metabolomes, morphological features and gene expression following AMP challenge at sub-lethal concentrations. For each technique, the vast majority of changes were specific to each AMP, with such a plastic response indicating E. coli is highly capable of discriminating between specific antibiotic challenges. Analysis of the ontological profiles generated from the transcriptomic analyses suggests this approach can accurately predict the antibacterial mode of action, providing a fresh, novel perspective for previous functional and biophysical studies. PMID:24789011

  10. Cationic Antimicrobial Peptide Resistance Mechanisms of Streptococcal Pathogens

    PubMed Central

    LaRock, Christopher N.; Nizet, Victor


    Cationic antimicrobial peptides (CAMPs) are critical front line contributors to host defense against invasive bacterial infection. These immune factors have direct killing activity toward microbes, but many pathogens are able to resist their effects. Group A Streptococcus, group B Streptococcus and Streptococcus pneumoniae are among the most common pathogens of humans and display a variety of phenotypic adaptations to resist CAMPs. Common themes of CAMP resistance mechanisms among the pathogenic streptococci are repulsion, sequestration, export, and destruction. Each pathogen has a different array of CAMP-resistant mechanisms, with invasive disease potential reflecting the utilization of several mechanisms that may act in synergy. Here we discuss recent progress in identifying the sources of CAMP resistance in the medically important Streptococcus genus. Further study of these mechanisms can contribute to our understanding of streptococcal pathogenesis, and may provide new therapeutic targets for therapy and disease prevention. PMID:25701232

  11. Antimicrobial peptides: modes of mechanism, modulation of defense responses.


    Rahnamaeian, Mohammad


    Complicated schemes of classical breeding and their drawbacks, environmental risks imposed by agrochemicals, decrease of arable land, and coincident escalating damages of pests and pathogens have accentuated the necessity for highly efficient measures to improve crop protection. During co-evolution of host-microbe interactions, antimicrobial peptides (AMPs) have exhibited a brilliant history in protecting host organisms against devastation by invading pathogens. Since the 1980s, a plethora of AMPs has been isolated from and characterized in different organisms. Nevertheless the AMPs expressed in plants render them more resistant to diverse pathogens, a more orchestrated approach based on knowledge of their mechanisms of action and cellular targets, structural toxic principle, and possible impact on immune system of corresponding transgenic plants will considerably improve crop protection strategies against harmful plant diseases. This review outlines the current knowledge on different modes of action of AMPs and then argues the waves of AMPs’ ectopic expression on transgenic plants’ immune system.

  12. Interaction of antimicrobial peptide with mycolyl transferase in Mycobacterium tuberculosis.


    Banerjee, Devjani I; Gohil, Tejas P


    It is estimated that about 40% of the Indian population are infected with tuberculosis (TB) and that ∼3,000,000 people die as a result of TB annually. TB is caused by Mycobacterium tuberculosis. In 2011, the World Health Organization declared India as having the highest TB burden worldwide. An important criteria for pathogenicity is the presence of mycolic acid linked to the protective outer membrane of bacteria. Mycolyl transferase catalyzes the transfer of mycolic acid and promotes cell wall synthesis. This is also considered as a novel target for drug-mediated intervention strategies. Here, we have attempted to understand the interaction between the antimicrobial peptide (AMP), dermcidin, and mycolyl transferase in M. tuberculosis using a computational approach. The present study was undertaken in order to elucidate the capability of AMPs to treat this bacteria, which is less sensitive to available antibiotics, and to design a novel method for new therapies.

  13. Antimicrobial Peptides as a Strategy to Combat Fungal Biofilms.


    Delattin, Nicolas; Brucker, Katrijn De; Cremer, Kaat De; Cammue, Bruno P A; Thevissen, Karin


    Invasive fungal infections caused by opportunistic fungal pathogens are associated with high mortality rates, mainly due to the occurrence of genotypic and/or phenotypic resistance. One of the causes of phenotypic resistance is the preferred growth of various fungal pathogens as biofilms, which are tolerant or resistant to most classes of antifungal agents. Moreover, increasing evidence points to biofilm formation as a general prerequisite for the development of systemic infections. Therefore, new antibiofilm agents are urgently needed to reduce the incidence of biofilm-associated infections. Nowadays, antimicrobial peptides (AMPs) are considered as valuable alternatives for or complements to the classical antifungal agents to combat fungal infections. Many review reports describe activity of AMPs against free-living planktonic fungal pathogens. In contrast, this review summarizes the antibiofilm properties of natural or synthetic AMPs against fungal biofilms and their potential to enhance the antibiofilm activity of existing antifungal agents.

  14. Membrane selectivity and disordering mechanism of antimicrobial peptide protegrin-1

    NASA Astrophysics Data System (ADS)

    Ishitsuka, Yuji

    Protegrin-1 (PG-1) is a beta-sheet antimicrobial peptide (AMP), a class of peptides innate to various organisms and functions as a defense agent against harmful microorganisms by means of membrane disordering. Characteristic chemical and structural properties of AMPs allow selective interaction against invaders' cell membranes. Despite their enormous biomedical potential, progress towards developing them into therapeutic agents has been hampered by a lack of insight into their mechanism of action. AMP insertion assays using Langmuir monolayers reveal that both electrostatic properties of the lipid head group as well as the packing density of the lipid tail group play important roles in determining the membrane selectivity of AMPs. These results help elucidate how the AMP selectively targets the cell membrane of microorganisms over the cell membrane of the host. In addition, these results also explain the higher hemolytic ability of PG-1 against human red blood cells (RBCs) compared to the hemolytic ability of PG-1 against sheep and pig RBCs. Synchrotron X-ray reflectivity shows that PG-1 penetrates into the lipid layer. Grazing incidence X-ray diffraction and fluorescence microscopy indicate that the insertion of PG-1 disorders tail group packing. Membrane selectivity and insertion location information of AMPs with different primary sequence and secondary structure have been obtained by using a truncated version of PG-1: PC-17, and an alpha-helical AMP, LL-37, respectively. The similarity of the membrane disordering process across these various peptides motivated us to test the membrane disordering effect of molecules designed to mimic these peptides. Peptide-mimics based on meta-phenylene ethynylenes demonstrate similar membrane disordering effects, showing that the potency of AMPs is derived from their overall chemical and structural properties, rather than exact peptide sequence. Atomic force microscopy (AFM) was used to directly image first, the PG-1

  15. Antimicrobial peptides for the control of biofilm formation.


    Moreno, Mercedes González; Lombardi, Lisa; Di Luca, Mariagrazia


    Antimicrobial peptides (AMPs) are an abundant and varied group of molecules recognized as the most ancient components of the innate immune system. They are found in a wide group of organisms including bacteria, plants and animals as a defense mechanism against different kinds of infectious pathogens. Over the past two decades, a fast-growing number of AMPs have been identified/designed and their wide-spectrum antimicrobial activity has been deeply investigated. In recent years, there has been an increasing interest in the use of AMPs as alternative anti-biofilm molecules for the control of biofilm-related infections. Biofilms are sessile communities of microbial cells embedded in a self-produced matrix and characterized by a low metabolic activity. Due to their peculiar physiological properties, bacteria/fungi in biofilms result more resistant to conventional antibiotic therapies compared with their planktonic counterparts. AMPs may be a promising strategy to combat biofilm-related infections, as many of them target the microbial membrane, thus being potentially effective also on metabolically inactive cells. Investigations conducted so far evidenced that these peptides may be active in either eradicating established biofilms or preventing their formation, depending on the specific molecule. Here we present a detailed review of the literature describing the latest results of both in vitro and in vivo experiments aimed at evaluating AMP potential usage in biofilm control. In addition, we provide the reader with an overview on AMP local delivery systems, and we discuss their potential application in the coating of medical indwelling devices.

  16. NMR Structural Studies of Antimicrobial Peptides: LPcin Analogs

    PubMed Central

    Jeong, Ji-Ho; Kim, Ji-Sun; Choi, Sung-Sub; Kim, Yongae


    Lactophoricin (LPcin), a component of proteose peptone (113–135) isolated from bovine milk, is a cationic amphipathic antimicrobial peptide consisting of 23 amino acids. We designed a series of N- or C-terminal truncated variants, mutated analogs, and truncated mutated analogs using peptide-engineering techniques. Then, we selected three LPcin analogs of LPcin-C8 (LPcin-YK1), LPcin-T2WT6W (LPcin-YK2), and LPcin-T2WT6W-C8 (LPcin-YK3), which may have better antimicrobial activities than LPcin, and successfully expressed them in E. coli with high yield. We elucidated the 3D structures and topologies of the three LPcin analogs in membrane environments by conducting NMR structural studies. We investigated the purity of the LPcin analogs and the α-helical secondary structures by performing 1H-15N 2D HSQC and HMQC-NOESY liquid-state NMR spectroscopy using protein-containing micelle samples. We measured the 3D structures and tilt angles in membranes by conducting 15N 1D and 2D 1H-15N SAMMY type solid-state NMR spectroscopy with an 800 MHz in-house-built 1H-15N double-resonance solid-state NMR probe with a strip-shield coil, using protein-containing large bicelle samples aligned and confirmed by molecular-dynamics simulations. The three LPcin analogs were found to be curved α-helical structures, with tilt angles of 55–75° for normal membrane bilayers, and their enhanced activities may be correlated with these topologies. PMID:26789765

  17. Fungicidal mechanisms of the antimicrobial peptide Bac8c.


    Lee, Wonyoung; Lee, Dong Gun


    Bac8c (RIWVIWRR-NH2) is an analogue peptide derived through complete substitution analysis of the linear bovine host defense peptide variant Bac2A. In the present study, the antifungal mechanism of Bac8c against pathogenic fungi was investigated, with a particular focus on the effects of Bac8c on the cytoplasmic membrane. We used bis-(1,3-dibutylbarbituric acid) trimethine oxonol [DiBAC4(3)] staining and 3,3'-dipropylthiacarbocyanine iodide [DiSC3(5)] assays to show that Bac8c induced disturbances in the membrane potential of Candida albicans. An increase in membrane permeability and suppression of cell wall regeneration were also observed in Bac8c-treated C. albicans. We studied the effects of Bac8c treatment on model membranes to elucidate its antifungal mechanism. Using calcein and FITC-labeled dextran leakage assays from Bac8c-treated large unilamellar vesicles (LUVs) and giant unilamellar vesicles (GUVs), we found that Bac8c has a pore-forming action on fungal membranes, with an estimated pore radius of between 2.3 and 3.3 nm. A membrane-targeted mechanism of action was also supported by the observation of potassium release from the cytosol of Bac8c-treated C. albicans. These results indicate that Bac8c is considered as a potential candidate to develop a novel antimicrobial agent because of its low-cost production characteristics and high antimicrobial activity via its ability to induce membrane perturbations in fungi.

  18. Recombinant expression of antimicrobial peptides using a novel self-cleaving aggregation tag in Escherichia coli.


    Luan, Chao; Xie, Yong Gang; Pu, Yu Tian; Zhang, Hai Wen; Han, Fei Fei; Feng, Jie; Wang, Yi Zhen


    Antimicrobial peptides (AMPs) are part of the innate immune system of complex multicellular organisms. Despite the fact that AMPs show great potential as a novel class of antibiotics, the lack of a cost-effective means for their mass production limits both basic research and clinical use. In this work, we describe a novel expression system for the production of antimicrobial peptides in Escherichia coli by combining ΔI-CM mini-intein with the self-assembling amphipathic peptide 18A to drive the formation of active aggregates. Two AMPs, human β-defensin 2 and LL-37, were fused to the self-cleaving tag and expressed as active protein aggregates. The active aggregates were recovered by centrifugation and the intact antimicrobial peptides were released into solution by an intein-mediated cleavage reaction in cleaving buffer (phosphate-buffered saline supplemented with 40 mmol/L Bis-Tris, 2 mmol/L EDTA, pH 6.2). The peptides were further purified by cation-exchange chromatography. Peptides yields of 0.82 ± 0.24 and 0.59 ± 0.11 mg/L were achieved for human β-defensin 2 and LL-37, respectively, with demonstrated antimicrobial activity. Using our expression system, intact antimicrobial peptides were recovered by simple centrifugation from active protein aggregates after the intein-mediated cleavage reaction. Thus, we provide an economical and efficient way to produce intact antimicrobial peptides in E. coli.

  19. Mechanism of bacterial membrane poration by Antimicrobial Peptides

    NASA Astrophysics Data System (ADS)

    Arora, Ankita; Mishra, Abhijit


    Bacterial resistance to conventional antibiotics is a major health concern. Antimicrobial peptides (AMPs), an important component of mammalian immune system, are thought to utilize non-specific interactions to target common features on the outer membranes of pathogens; hence development of resistance to such AMPs may be less pronounced. Most AMPs are amphiphilic and cationic in nature. Most AMPs form pores in the bacterial membranes causing them to lyse, however, the exact mechanism is unknown. Here, we study the AMP CHRG01 (KSSTRGRKSSRRKK), derived from human β defensin 3 (hBD3) with all Cysteine residues substituted with Serine. Circular Dichorism studies indicate that CHRG01 shows helicity and there is change in helicity as it interacts with the lipid membrane. The AMP was effective against different species of bacteria. Leakage of cellular components from bacterial cells observed by SEM and AFM indicates AMP action by pore formation. Confocal microscopy studies on giant vesicles incubated with AMP confirm poration. The effect of this AMP on model bacterial membranes is characterized using Small Angle X-ray scattering and Fluorescence spectroscopy to elucidate the mechanism behind antimicrobial activity.

  20. Use of antimicrobial peptides against microbial biofilms: advantages and limits.


    Batoni, Giovanna; Maisetta, Giuseppantonio; Brancatisano, Franca Lisa; Esin, Semih; Campa, Mario


    The formation of surface-attached cellular agglomerates, the so-called biofilms, contributes significantly to bacterial resistance to antibiotics and innate host defenses. Bacterial biofilms are associated to various pathological conditions in humans such as cystic fibrosis, colonization of indwelling medical devices and dental plaque formation involved in caries and periodontitis. Over the last years, natural antimicrobial peptides (AMPs) have attracted considerable interest as a new class of antimicrobial drugs for a number of reasons. Among these, there are the broad activity spectrum, the relative selectivity towards their targets (microbial membranes), the rapid mechanism of action and, above all, the low frequency in selecting resistant strains. Since biofilm resistance to antibiotics is mainly due to the slow growth rate and low metabolic activity of bacteria in such community, the use of AMPs to inhibit biofilm formation could be potentially an attractive therapeutic approach. In fact, due to the prevalent mechanism of action of AMPs, which relies on their ability to permeabilize and/or to form pores within the cytoplasmic membranes, they have a high potential to act also on slow growing or even non-growing bacteria. This review will highlight the most important findings obtained testing AMPs in in vitro and in vivo models of bacterial biofilms, pointing out the possible advantages and limits of their use against microbial biofilm-related infections.

  1. Molecular design, structures, and activity of antimicrobial peptide-mimetic polymers.


    Takahashi, Haruko; Palermo, Edmund F; Yasuhara, Kazuma; Caputo, Gregory A; Kuroda, Kenichi


    There is an urgent need for new antibiotics which are effective against drug-resistant bacteria without contributing to resistance development. We have designed and developed antimicrobial copolymers with cationic amphiphilic structures based on the mimicry of naturally occurring antimicrobial peptides. These copolymers exhibit potent antimicrobial activity against a broad spectrum of bacteria including methicillin-resistant Staphylococcus aureus with no adverse hemolytic activity. Notably, these polymers also did not result in any measurable resistance development in E. coli. The peptide-mimetic design principle offers significant flexibility and diversity in the creation of new antimicrobial materials and their potential biomedical applications.

  2. Antimicrobial activity and interactions of cationic peptides derived from Galleria mellonella cecropin D-like peptide with model membranes.


    Oñate-Garzón, José; Manrique-Moreno, Marcela; Trier, Steven; Leidy, Chad; Torres, Rodrigo; Patiño, Edwin


    Antimicrobial peptides are effector molecules of the innate immune system against invading pathogens. The cationic charge in their structures has a strong correlation with antimicrobial activity, being responsible for the initial electrostatic interaction between peptides and the anionic microbial surface. This paper contains evidence that charge modification in the neutral peptide Gm cecropin D-like (WT) improved the antimicrobial activity of the modified peptides. Two cationic peptides derived from WT sequence named as ΔM1 and ΔM2, with net charge of +5 and +9, respectively, showed at least an eightfold increase in their antimicrobial activity in comparison to WT. The mechanism of action of these peptides was investigated using small unilamellar vesicles (SUVs) as model membranes. To study permeabilization effects of the peptides on cell membranes, entrapped calcein liposomes were used and the results showed that all peptides induced calcein release from 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoglycerol (POPG) SUVs, whereas in 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), POPC/POPG and 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE)/POPG SUVs, only ΔM1 and ΔM2 induced a notable permeabilization. In addition, interactions of these peptides with phospholipids at the level of the glycerol backbone and hydrophobic domain were studied through observed changes in generalized polarization and fluorescence anisotropy using probes such as Laurdan and DPH, respectively. The results suggest that peptides slightly ordered the bilayer structure at the level of glycerol backbone and on the hydrophobic core in 1,2-dimyristoyl-sn-glycero-3-phosphoglycerol (DMPG) SUVs, whereas in 1,2-dimyristoyl-sn-glycero-3-phosphocholine (DMPC)/DMPG SUVs, only ΔM1 and ΔM2 peptides increased the order of bilayers. Thus, peptides would be inducing clustering of phospholipids creating phospholipid domains with a higher phase transition temperature.

  3. Membrane Active Antimicrobial Peptides: Translating Mechanistic Insights to Design

    PubMed Central

    Li, Jianguo; Koh, Jun-Jie; Liu, Shouping; Lakshminarayanan, Rajamani; Verma, Chandra S.; Beuerman, Roger W.


    Antimicrobial peptides (AMPs) are promising next generation antibiotics that hold great potential for combating bacterial resistance. AMPs can be both bacteriostatic and bactericidal, induce rapid killing and display a lower propensity to develop resistance than do conventional antibiotics. Despite significant progress in the past 30 years, no peptide antibiotic has reached the clinic yet. Poor understanding of the action mechanisms and lack of rational design principles have been the two major obstacles that have slowed progress. Technological developments are now enabling multidisciplinary approaches including molecular dynamics simulations combined with biophysics and microbiology toward providing valuable insights into the interactions of AMPs with membranes at atomic level. This has led to increasingly robust models of the mechanisms of action of AMPs and has begun to contribute meaningfully toward the discovery of new AMPs. This review discusses the detailed action mechanisms that have been put forward, with detailed atomistic insights into how the AMPs interact with bacterial membranes. The review further discusses how this knowledge is exploited toward developing design principles for novel AMPs. Finally, the current status, associated challenges, and future directions for the development of AMP therapeutics are discussed. PMID:28261050

  4. Antimicrobial Peptide Resistance Mechanisms of Gram-Positive Bacteria.


    Nawrocki, Kathryn L; Crispell, Emily K; McBride, Shonna M


    Antimicrobial peptides, or AMPs, play a significant role in many environments as a tool to remove competing organisms. In response, many bacteria have evolved mechanisms to resist these peptides and prevent AMP-mediated killing. The development of AMP resistance mechanisms is driven by direct competition between bacterial species, as well as host and pathogen interactions. Akin to the number of different AMPs found in nature, resistance mechanisms that have evolved are just as varied and may confer broad-range resistance or specific resistance to AMPs. Specific mechanisms of AMP resistance prevent AMP-mediated killing against a single type of AMP, while broad resistance mechanisms often lead to a global change in the bacterial cell surface and protect the bacterium from a large group of AMPs that have similar characteristics. AMP resistance mechanisms can be found in many species of bacteria and can provide a competitive edge against other bacterial species or a host immune response. Gram-positive bacteria are one of the largest AMP producing groups, but characterization of Gram-positive AMP resistance mechanisms lags behind that of Gram-negative species. In this review we present a summary of the AMP resistance mechanisms that have been identified and characterized in Gram-positive bacteria. Understanding the mechanisms of AMP resistance in Gram-positive species can provide guidelines in developing and applying AMPs as therapeutics, and offer insight into the role of resistance in bacterial pathogenesis.

  5. Antimicrobial peptides as new recognition molecules for screening challenging species

    PubMed Central

    Kulagina, Nadezhda V.; Shaffer, Kara M.; Ligler, Frances S.; Taitt, Chris R.


    The goal of this study was to evaluate binding of four targets of biodefense interest to immobilized antimicrobial peptides (AMPs) in biosensor assays. Polymyxins B and E, melittin, cecropins A, B, and P, parasin, bactenecin and magainin-1, as well as control antibodies, were used as capture molecules for detection of Cy3-labeled Venezuelan equine encephalitis virus (VEE), vaccinia virus, C. burnetti and B. melitensis. Although VEE, vaccinia virus and C. burnetti did not show any binding activity to their corresponding capture antibodies, B. melitensis bound to immobilized anti-Brucella monoclonal antibodies. The majority of the immobilized AMPs included in this study bound labeled VEE, vaccinia virus and C. burnetti in a concentration-dependent manner, and B. melitensis bound to polymyxin B, polymyxin E, and bactenecin. No binding was observed on immobilized magainin-1. In contrast to all bacterial targets tested to date, VEE and vaccinia virus demonstrated similar patterns of binding to all peptides. While the direct assay is generally replaced by a sandwich assay for analysis of real-world samples, direct binding experiments are commonly used to characterize specificity and sensitivity of binding molecules. In this case, they clearly demonstrate the capability of AMPs as recognition molecules for four biothreat agents. PMID:18231571

  6. Immune Signaling and Antimicrobial Peptide Expression in Lepidoptera

    PubMed Central

    Casanova-Torres, Ángel M.; Goodrich-Blair, Heidi


    Many lepidopteran insects are agricultural pests that affect stored grains, food and fiber crops. These insects have negative ecological and economic impacts since they lower crop yield, and pesticides are expensive and can have off-target effects on beneficial arthropods. A better understanding of lepidopteran immunity will aid in identifying new targets for the development of specific insect pest management compounds. A fundamental aspect of immunity, and therefore a logical target for control, is the induction of antimicrobial peptide (AMP) expression. These peptides insert into and disrupt microbial membranes, thereby promoting pathogen clearance and insect survival. Pathways leading to AMP expression have been extensively studied in the dipteran Drosophila melanogaster. However, Diptera are an important group of pollinators and pest management strategies that target their immune systems is not recommended. Recent advances have facilitated investigation of lepidopteran immunity, revealing both conserved and derived characteristics. Although the general pathways leading to AMP expression are conserved, specific components of these pathways, such as recognition proteins have diverged. In this review we highlight how such comparative immunology could aid in developing pest management strategies that are specific to agricultural insect pests. PMID:25861461

  7. Focal Targeting of the Bacterial Envelope by Antimicrobial Peptides

    PubMed Central

    Rashid, Rafi; Veleba, Mark; Kline, Kimberly A.


    Antimicrobial peptides (AMPs) are utilized by both eukaryotic and prokaryotic organisms. AMPs such as the human beta defensins, human neutrophil peptides, human cathelicidin, and many bacterial bacteriocins are cationic and capable of binding to anionic regions of the bacterial surface. Cationic AMPs (CAMPs) target anionic lipids [e.g., phosphatidylglycerol (PG) and cardiolipins (CL)] in the cell membrane and anionic components [e.g., lipopolysaccharide (LPS) and lipoteichoic acid (LTA)] of the cell envelope. Bacteria have evolved mechanisms to modify these same targets in order to resist CAMP killing, e.g., lysinylation of PG to yield cationic lysyl-PG and alanylation of LTA. Since CAMPs offer a promising therapeutic alternative to conventional antibiotics, which are becoming less effective due to rapidly emerging antibiotic resistance, there is a strong need to improve our understanding about the AMP mechanism of action. Recent literature suggests that AMPs often interact with the bacterial cell envelope at discrete foci. Here we review recent AMP literature, with an emphasis on focal interactions with bacteria, including (1) CAMP disruption mechanisms, (2) delocalization of membrane proteins and lipids by CAMPs, and (3) CAMP sensing systems and resistance mechanisms. We conclude with new approaches for studying the bacterial membrane, e.g., lipidomics, high resolution imaging, and non-detergent-based membrane domain extraction. PMID:27376064

  8. Membrane Active Antimicrobial Peptides: Translating Mechanistic Insights to Design.


    Li, Jianguo; Koh, Jun-Jie; Liu, Shouping; Lakshminarayanan, Rajamani; Verma, Chandra S; Beuerman, Roger W


    Antimicrobial peptides (AMPs) are promising next generation antibiotics that hold great potential for combating bacterial resistance. AMPs can be both bacteriostatic and bactericidal, induce rapid killing and display a lower propensity to develop resistance than do conventional antibiotics. Despite significant progress in the past 30 years, no peptide antibiotic has reached the clinic yet. Poor understanding of the action mechanisms and lack of rational design principles have been the two major obstacles that have slowed progress. Technological developments are now enabling multidisciplinary approaches including molecular dynamics simulations combined with biophysics and microbiology toward providing valuable insights into the interactions of AMPs with membranes at atomic level. This has led to increasingly robust models of the mechanisms of action of AMPs and has begun to contribute meaningfully toward the discovery of new AMPs. This review discusses the detailed action mechanisms that have been put forward, with detailed atomistic insights into how the AMPs interact with bacterial membranes. The review further discusses how this knowledge is exploited toward developing design principles for novel AMPs. Finally, the current status, associated challenges, and future directions for the development of AMP therapeutics are discussed.

  9. Synthesis and secretory expression of hybrid antimicrobial peptide CecA-mag and its mutants in Pichia pastoris.


    Wang, Xiuqing; Zhu, Mingxing; Zhang, Aijun; Yang, Fengqin; Chen, Puyan


    The hybrid peptide CA(1-7)-M(2-12) gene was designed according to the N-terminal 1-7 amino acid sequence of the antimicrobial peptide cecropin A (CA) and the N-terminal 2-12 amino acid sequence of maganin (M) and synthesized using Pichia pastoris preferred codons. The gene was cloned into pPICZαA and transformed into the P. pastoris recipient bacterium SMD1168, regulated by the alcohol oxidase (AOX). Expression of the cecA-mag hybrid antimicrobial peptide (MW, 1.9 kDa) revealed broad-spectrum antibiotic activity and to the ability to inhibit growth of most G(-) and G(+) bacteria. Three mutants of cecA-mag were designed and synthesized by recombination polymerase chain reaction site-directed mutagenesis to investigate the relationship between the structure and function of this antimicrobial peptide. The inhibition titers of these mutants against Staphylococcus aureus were evaluated using the agar diffusion method. Under the conditions of the same concentration and volume, the bacteriostatic diameters of three cecA-mag mutants were 1.2, 1.2 and 1.5 times, respectively, compared with the diameters of wild-type cecA-mag.

  10. [Solution structure and antibacterial mechanism of two synthetic antimicrobial peptides].


    Yang, Lin; Fan, Meihua; Liu, Xuezhu; Wu, Mei; Shi, Ge; Liao, Zhi


    Mytilin-derived-peptide-1 (MDP-1) and mytilin-derived-peptide-2 (MDP-2) are two truncated decapeptides with reversed sequence synthesized corresponding to the residues 20-29 of mytilin-1 (GenBank Accession No. FJ973154) from M. coruscus. The objective of this study is to characterize the structural basis of these two peptides for their antimicrobial activities and functional differences, and to investigate the inhibitory mechanism of MDPs on Escherichia coli and Sarcina lutea. The structures of MDP-1 and MDP-2 in solution were determined by 1H 2D NMR methods; the antibactericidal effects of MDPs on E. coli and S. lutea were observed by transmitted electron microscopy (TEM). Both MDP-1 and MDP-2 have a well-defined loop structure stabilized by two additional disulfide bridges, which resemble the-hairpin structure of mytilin-1 model. The surface profile of MDPs' structures was characterized by protruding charged residues surrounded by hydrophobic residues. TEM analysis showed that MDPs destroyed cytoplasmic membrane and cell wall of bacteria and the interface between the cell wall and membrane was blurred. Furthermore, some holes were observed in treated bacteria, which resulted in cell death. Structural comparison between MDP-1 and MDP-2 shows that the distribution of positively charged amino acids on the loop of MDPs is topologically different significantly, which might be the reason why MDP-2 has higher activity than MDP-1. Furthermore, TEM results suggested that the bactericidal mechanisms of MDPs against E. coli and S. lutea were similar. Both MDP-1 and MDP-2 could attach to the negatively charged bacterial wall by positively charged amino acid residues and destroy the bacteria membrane in a pore-forming manner, thus cause the contents of the cells to release and eventually cell death.

  11. Antimicrobial Peptides and Innate Lung Defenses: Role in Infectious and Noninfectious Lung Diseases and Therapeutic Applications.


    Hiemstra, Pieter S; Amatngalim, Gimano D; van der Does, Anne M; Taube, Christian


    Respiratory infections are a major clinical problem, and treatment is increasingly complicated by the emergence of microbial antibiotic resistance. Development of new antibiotics is notoriously costly and slow; therefore, alternative strategies are needed. Antimicrobial peptides, central effector molecules of the immune system, are being considered as alternatives to conventional antibiotics. These peptides display a range of activities, including not only direct antimicrobial activity, but also immunomodulation and wound repair. In the lung, airway epithelial cells and neutrophils in particular contribute to their synthesis. The relevance of antimicrobial peptides for host defense against infection has been demonstrated in animal models and is supported by observations in patient studies, showing altered expression and/or unfavorable circumstances for their action in a variety of lung diseases. Importantly, antimicrobial peptides are active against microorganisms that are resistant against conventional antibiotics, including multidrug-resistant bacteria. Several strategies have been proposed to use these peptides in the treatment of infections, including direct administration of antimicrobial peptides, enhancement of their local production, and creation of more favorable circumstances for their action. In this review, recent developments in antimicrobial peptides research in the lung and clinical applications for novel therapies of lung diseases are discussed.

  12. The Cooperative Behaviour of α-Helical Antimicrobial Peptides in Different Environments

    NASA Astrophysics Data System (ADS)

    Pinna, Marco; Wang, Janping; Mura, Manuela; Zhou, Yuhua; Zvelindovsky, Andrei; Dennison, Sarah; Phoenix, David


    A systematic analysis of the antimicrobial peptides (AMPs) cooperative action is performed by means of a full atomistic molecular dynamics simulation. The following peptide analogues: Aurein 2.5-COOH, Aurein 2.6-COOH and Aurein 3.1-COOH are investigated in different environments including aqueous solution, trifluoroethanol (TFE), palmitoyloleoylphosphatidylethanolamine (POPE), and palmitoyloleoylphosphatidylglycerol (POPG) lipid bilayers. Simulations conducted for monomer and trimer peptide highlight the importance of the cooperative behaviour and reveal the different mechanisms of antimicrobial peptides action in different lipid bilayers.

  13. Understanding bacterial resistance to antimicrobial peptides: From the surface to deep inside.


    Maria-Neto, Simone; de Almeida, Keyla Caroline; Macedo, Maria Ligia Rodrigues; Franco, Octávio Luiz


    Resistant bacterial infections are a major health problem in many parts of the world. The major commercial antibiotic classes often fail to combat common bacteria. Although antimicrobial peptides are able to control bacterial infections by interfering with microbial metabolism and physiological processes in several ways, a large number of cases of resistance to antibiotic peptide classes have also been reported. To gain a better understanding of the resistance process various technologies have been applied. Here we discuss multiple strategies by which bacteria could develop enhanced antimicrobial peptide resistance, focusing on sub-cellular regions from the surface to deep inside, evaluating bacterial membranes, cell walls and cytoplasmic metabolism. Moreover, some high-throughput methods for antimicrobial resistance detection and discrimination are also examined. This article is part of a Special Issue entitled: Bacterial Resistance to Antimicrobial Peptides.

  14. Centrocins: isolation and characterization of novel dimeric antimicrobial peptides from the green sea urchin, Strongylocentrotus droebachiensis.


    Li, Chun; Haug, Tor; Moe, Morten K; Styrvold, Olaf B; Stensvåg, Klara


    As immune effector molecules, antimicrobial peptides (AMPs) play an important role in the invertebrate immune system. Here, we present two novel AMPs, named centrocins 1 (4.5kDa) and 2 (4.4kDa), purified from coelomocyte extracts of the green sea urchin, Strongylocentrotus droebachiensis. The native peptides are cationic and show potent activities against Gram-positive and Gram-negative bacteria. The centrocins have an intramolecular heterodimeric structure, containing a heavy chain (30 amino acids) and a light chain (12 amino acids). The cDNA encoding the peptides and genomic sequences were cloned and sequenced. One putative isoform (centrocin 1b) was identified and one intron was found in the genes coding for the centrocins. The full length protein sequence of centrocin 1 consists of 119 amino acids, whereas centrocin 2 consists of 118 amino acids which both include a preprosequence of 51 or 50 amino acids for centrocins 1 and 2, respectively, and an interchain of 24 amino acids between the heavy and light chain. The difference of molecular mass between the native centrocins and the deduced sequences from cDNA indicates that the native centrocins contain a post-translational brominated tryptophan. In addition, two amino acids at the C-terminal, Gly-Arg, were removed from the light chains during the post-translational processing. The separate peptide chains of centrocin 1 were synthesized and the heavy chain alone was shown to be sufficient for antimicrobial activity. The genome of the closely related species, the purple sea urchin (S. purpuratus), was shown to contain two putative proteins with high similarity to the centrocins.

  15. A cumulative experience examining the effect of natural and synthetic antimicrobial peptides vs. Chlamydia trachomatis.


    Yasin, B; Pang, M; Wagar, E A


    We tested the activity of 48 structurally diverse antimicrobial peptides against Chlamydia trachomatis, serovar L2. The peptides' activity against C. trachomatis, serovar L2 was measured in 48-h McCoy cell shell vial assays. Peptides of 16-20 amino acids were more active than larger peptides, such as defensins. Beta-sheet protegrins, as well as alpha-helical peptides such as novispirin (G-10) were equally active. Enantiomers were as active as native structures. Moderate-sized circular mini-defensins were less effective against C. trachomatis. Moderate-sized cationic peptides may be useful in microbicide preparations designed to prevent chlamydial infection.

  16. Potent Inducers of Endogenous Antimicrobial Peptides for Host Directed Therapy of Infections

    NASA Astrophysics Data System (ADS)

    Ottosson, H.; Nylén, F.; Sarker, P.; Miraglia, E.; Bergman, P.; Gudmundsson, G. H.; Raqib, R.; Agerberth, B.; Strömberg, R.


    A new concept for treatment of infections is induction of our own antimicrobial peptides and the presented novel class of inducer, aroylated phenylenediamines (APDs), gives up to 20 to 30-fold induction of the human antimicrobial peptide LL-37, in vitro. In addition, oral administration of an APD in a rabbit model of Shigellosis resulted in recovery from the infection in a few days implying that APD’s are promising candidates for treatment of infections.

  17. Potent Inducers of Endogenous Antimicrobial Peptides for Host Directed Therapy of Infections

    PubMed Central

    Ottosson, H.; Nylén, F.; Sarker, P.; Miraglia, E.; Bergman, P.; Gudmundsson, G. H.; Raqib, R.; Agerberth, B.; Strömberg, R.


    A new concept for treatment of infections is induction of our own antimicrobial peptides and the presented novel class of inducer, aroylated phenylenediamines (APDs), gives up to 20 to 30-fold induction of the human antimicrobial peptide LL-37, in vitro. In addition, oral administration of an APD in a rabbit model of Shigellosis resulted in recovery from the infection in a few days implying that APD’s are promising candidates for treatment of infections. PMID:27827460

  18. Antimicrobial Peptides Containing Unnatural Amino Acid Exhibit Potent Bactericidal Activity against ESKAPE Pathogens

    DTIC Science & Technology


    Antimicrobial peptides containing unnatural amino acid exhibit potent bactericidal activity against ESKAPE pathogens R. P. Hicks a, J. J. Abercrombie...tic classes, membrane-disruptors and non -membrane-disrup- tors.30,31 Five different mechanisms have been proposed at one time or another to explain...DATES COVERED - 4. TITLE AND SUBTITLE Antimicrobial Peptides Containing Unnatural Amino Acid Exhibit Potent Bactericidal Activity Against

  19. Euler buckling, membrane corrugation and pore formation induced by antimicrobial peptide

    NASA Astrophysics Data System (ADS)

    Golubovic, Leonardo; Gao, Lianghui; Chen, Licui; Jia, Nana; Fang, Weihai


    Antimicrobial peptides serve as defense weapons against bacteria. They are secreted by organisms of plants and animals and have a wide variety in composition and structure. In this study, we theoretically explore the effects of the antimicrobial peptides on the lipid bilayer membrane by using analytic arguments and the coarse grained dissipative particle dynamics simulations. We study peptide/lipid membrane complexes by considering peptides with various structure, hydrophobicity and peptide/lipid interaction strength. The role of lipid/water interaction is also discussed. We discuss a rich variety of membrane morphological changes induced by peptides, such as pore formation, membrane corrugation and Euler buckling. Such buckled membrane states have been indeed seen in a number of experiments with bacteria affected by peptide, yet this is the first theoretical study addressing these phenomena more deeply.

  20. Cathelicidin-related antimicrobial peptide modulates the severity of acute pancreatitis in mice

    PubMed Central



    The present study aimed to investigate the immunomodulatory effects of mouse cathelicidin-related antimicrobial peptide (CRAMP) on experimental acute pancreatitis (AP). AP is a common clinical condition characterized by acute abdominal inflammation. Innate immune cells and mediators are intrinsically linked to the pathogenesis of AP. Cathelicidins are innate immunity-derived antimicrobial peptides that exert immunomodulatory effects on various host cells. However, how cathelicidins are involved and modulate the severity and inflammatory responses of AP remains unclear. In the present study, the mouse CRAMP gene-deficient cnlp−/− mice and their wild-type C57BL/6J littermates were induced with AP by multiple hourly injections of supramaximal doses of caerulein. Serum amylase levels, pancreatic myeloperoxidase activity and histological examination were performed in order to determine the disease severity and the levels of inflammatory cytokines. Disease severity and inflammatory markers were subsequently evaluated in the control mice, cnlp−/− C57BL/6J mice with AP, and wild-type C57BL/6J mice with AP. The results demonstrated that cnlp−/− mice exhibited a more severe phenotype and inflammatory response following AP induction compared with the wild-type mice, as evidenced by increased serum amylase levels, pancreatic myeloperoxidase release, and early inflammatory mediator tumor necrosis factor-α production. Histological examination confirmed that CRAMP deficiency worsened the pancreatic inflammatory condition. These results indicate that CRAMP may be considered a novel modulatory mediator in mouse experimental AP. PMID:27035328

  1. Inducible Resistance of Fish Bacterial Pathogens to the Antimicrobial Peptide Cecropin B

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cecropin B is a cationic antimicrobial peptide originally isolated from the diapausing pupae of the giant silk moth, Hylphora cecropia. Cecropin B elicits its antimicrobial effects through disruption of the anionic cell membranes of gram-negative bacteria. Previous work by our laboratory demonstra...

  2. Amyloidogenic amyloid-β-peptide variants induce microbial agglutination and exert antimicrobial activity

    PubMed Central

    Spitzer, Philipp; Condic, Mateja; Herrmann, Martin; Oberstein, Timo Jan; Scharin-Mehlmann, Marina; Gilbert, Daniel F.; Friedrich, Oliver; Grömer, Teja; Kornhuber, Johannes; Lang, Roland; Maler, Juan Manuel


    Amyloid-β (Aβ) peptides are the main components of the plaques found in the brains of patients with Alzheimer’s disease. However, Aβ peptides are also detectable in secretory compartments and peripheral blood contains a complex mixture of more than 40 different modified and/or N- and C-terminally truncated Aβ peptides. Recently, anti-infective properties of Aβ peptides have been reported. Here, we investigated the interaction of Aβ peptides of different lengths with various bacterial strains and the yeast Candida albicans. The amyloidogenic peptides Aβ1-42, Aβ2-42, and Aβ3p-42 but not the non-amyloidogenic peptides Aβ1-40 and Aβ2-40 bound to microbial surfaces. As observed by immunocytochemistry, scanning electron microscopy and Gram staining, treatment of several bacterial strains and Candida albicans with Aβ peptide variants ending at position 42 (Aβx-42) caused the formation of large agglutinates. These aggregates were not detected after incubation with Aβx-40. Furthermore, Aβx-42 exerted an antimicrobial activity on all tested pathogens, killing up to 80% of microorganisms within 6 h. Aβ1-40 only had a moderate antimicrobial activity against C. albicans. Agglutination of Aβ1-42 was accelerated in the presence of microorganisms. These data demonstrate that the amyloidogenic Aβx-42 variants have antimicrobial activity and may therefore act as antimicrobial peptides in the immune system. PMID:27624303

  3. Antimicrobial proline-rich peptides from the hemolymph of marine snail Rapana venosa.


    Dolashka, Pavlina; Moshtanska, Vesela; Borisova, Valika; Dolashki, Aleksander; Stevanovic, Stefan; Dimanov, Tzvetan; Voelter, Wolfgang


    Hemolymph of Rapana venosa snails is a complex mixture of biochemically and pharmacologically active components such as peptides and proteins. Antimicrobial peptides are gaining attention as antimicrobial alternatives to chemical food preservatives and commonly used antibiotics. Therefore, for the first time we have explored the isolation, identification and characterisation of 11 novel antimicrobial peptides produced by the hemolymph of molluscs. The isolated peptides from the hemolymph applying ultrafiltration and reverse-phase high-performance liquid chromatography (RP-HPLC) have molecular weights between 3000 and 9500 Da, determined by mass spectrometric analysis. The N-terminal sequences of the peptides identified by Edman degradation matched no peptides in the MASCOT search database, indicating novel proline-rich peptides. UV spectra revealed that these substances possessed the characteristics of protein peptides with acidic isoelectric points. However, no Cotton effects were observed between 190 and 280 nm by circular dichroism spectroscopy. Four of the pro-rich peptides also showed strong antimicrobial activities against tested microorganisms including Gram-positive and Gram-negative bacteria.

  4. Self-assembly of cationic multidomain peptide hydrogels: supramolecular nanostructure and rheological properties dictate antimicrobial activity.


    Jiang, Linhai; Xu, Dawei; Sellati, Timothy J; Dong, He


    Hydrogels are an important class of biomaterials that have been widely utilized for a variety of biomedical/medical applications. The biological performance of hydrogels, particularly those used as wound dressing could be greatly advanced if imbued with inherent antimicrobial activity capable of staving off colonization of the wound site by opportunistic bacterial pathogens. Possessing such antimicrobial properties would also protect the hydrogel itself from being adversely affected by microbial attachment to its surface. We have previously demonstrated the broad-spectrum antimicrobial activity of supramolecular assemblies of cationic multi-domain peptides (MDPs) in solution. Here, we extend the 1-D soluble supramolecular assembly to 3-D hydrogels to investigate the effect of the supramolecular nanostructure and its rheological properties on the antimicrobial activity of self-assembled hydrogels. Among designed MDPs, the bactericidal activity of peptide hydrogels was found to follow an opposite trend to that in solution. Improved antimicrobial activity of self-assembled peptide hydrogels is dictated by the combined effect of supramolecular surface chemistry and storage modulus of the bulk materials, rather than the ability of individual peptides/peptide assemblies to penetrate bacterial cell membrane as observed in solution. The structure-property-activity relationship developed through this study will provide important guidelines for designing biocompatible peptide hydrogels with built-in antimicrobial activity for various biomedical applications.

  5. LEAP-1, a novel highly disulfide-bonded human peptide, exhibits antimicrobial activity.


    Krause, A; Neitz, S; Mägert, H J; Schulz, A; Forssmann, W G; Schulz-Knappe, P; Adermann, K


    We report the isolation and characterization of a novel human peptide with antimicrobial activity, termed LEAP-1 (liver-expressed antimicrobial peptide). Using a mass spectrometric assay detecting cysteine-rich peptides, a 25-residue peptide containing four disulfide bonds was identified in human blood ultrafiltrate. LEAP-1 expression was predominantly detected in the liver, and, to a much lower extent, in the heart. In radial diffusion assays, Gram-positive Bacillus megaterium, Bacillus subtilis, Micrococcus luteus, Staphylococcus carnosus, and Gram-negative Neisseria cinerea as well as the yeast Saccharomyces cerevisiae dose-dependently exhibited sensitivity upon treatment with synthetic LEAP-1. The discovery of LEAP-1 extends the known families of mammalian peptides with antimicrobial activity by its novel disulfide motif and distinct expression pattern.

  6. Relative free energy of binding between antimicrobial peptides and SDS or DPC micelles

    PubMed Central

    Sayyed-Ahmad, Abdallah; Khandelia, Himanshu; Kaznessis, Yiannis N.


    We present relative binding free energy calculations for six antimicrobial peptide–micelle systems, three peptides interacting with two types of micelles. The peptides are the scorpion derived antimicrobial peptide (AMP), IsCT and two of its analogues. The micelles are dodecylphosphatidylcholine (DPC) and sodium dodecylsulphate (SDS) micelles. The interfacial electrostatic properties of DPC and SDS micelles are assumed to be similar to those of zwitterionic mammalian and anionic bacterial membrane interfaces, respectively. We test the hypothesis that the binding strength between peptides and the anionic micelle SDS can provide information on peptide antimicrobial activity, since it is widely accepted that AMPs function by binding to and disrupting the predominantly anionic lipid bilayer of the bacterial cytoplasmic membrane. We also test the hypothesis that the binding strength between peptides and the zwitterionic micelle DPC can provide information on peptide haemolytic activities, since it is accepted that they also bind to and disrupt the zwitterionic membrane of mammalian cells. Equilibrium structures of the peptides, micelles and peptide–micelle complexes are obtained from more than 300 ns of molecular dynamics simulations. A thermodynamic cycle is introduced to compute the binding free energy from electrostatic, non-electrostatic and entropic contributions. We find relative binding free energy strengths between peptides and SDS to correlate with the experimentally measured rankings for peptide antimicrobial activities, and relative free energy binding strengths between peptides and DPC to correlate with the observed rankings for peptide haemolytic toxicities. These findings point to the importance of peptide–membrane binding strength for antimicrobial activity and haemolytic activity. PMID:21113423

  7. Synergistic effects of antimicrobial peptide DP7 combined with antibiotics against multidrug-resistant bacteria

    PubMed Central

    Wu, Xiaozhe; Li, Zhan; Li, Xiaolu; Tian, Yaomei; Fan, Yingzi; Yu, Chaoheng; Zhou, Bailing; Liu, Yi; Xiang, Rong; Yang, Li


    Antibiotic-resistant bacteria present a great threat to public health. In this study, the synergistic effects of antimicrobial peptides (AMPs) and antibiotics on several multidrug-resistant bacterial strains were studied, and their synergistic effects on azithromycin (AZT)-resistance genes were analyzed to determine the relationships between antimicrobial resistance and these synergistic effects. A checkerboard method was used to evaluate the synergistic effects of AMPs (DP7 and CLS001) and several antibiotics (gentamicin, vancomycin [VAN], AZT, and amoxicillin) on clinical bacterial strains (Staphylococcus aureus, Pseudomonas aeruginosa, Acinetobacter baumannii, and Escherichia coli). The AZT-resistance genes (ermA, ermB, ermC, mefA, and msrA) were identified in the resistant strains using quantitative polymerase chain reaction. For all the clinical isolates tested that were resistant to different antibiotics, DP7 had high antimicrobial activity (≤32 mg/L). When DP7 was combined with VAN or AZT, the effect was most frequently synergistic. When we studied the resistance genes of the AZT-resistant isolates, the synergistic effect of DP7–AZT occurred most frequently in highly resistant strains or strains carrying more than two AZT-resistance genes. A transmission electron microscopic analysis of the S. aureus strain synergistically affected by DP7–AZT showed no noteworthy morphological changes, suggesting that a molecular-level mechanism plays an important role in the synergistic action of DP7–AZT. AMP DP7 plus the antibiotic AZT or VAN is more effective, especially against highly antibiotic-resistant strains. PMID:28356719

  8. Histone deacetylase inhibition enhances antimicrobial peptide but not inflammatory cytokine expression upon bacterial challenge

    PubMed Central

    Fischer, Natalie; Sechet, Emmanuel; Friedman, Robin; Amiot, Aurélien; Sobhani, Iradj; Nigro, Giulia; Sansonetti, Philippe J.; Sperandio, Brice


    Antimicrobial peptides (AMP) are defense effectors of the innate immunity playing a crucial role in the intestinal homeostasis with commensals and protection against pathogens. Herein we aimed to investigate AMP gene regulation by deciphering specific characteristics allowing their enhanced expression among innate immune genes, particularly those encoding proinflammatory mediators. Our emphasis was on epigenetic regulation of the gene encoding the AMP β-defensin 2 (HBD2), taken as a model of possibly specific induction, upon challenge with a commensal bacterium, compared with the proinflammatory cytokine IL-8. Using an in vitro model of colonic epithelial cells challenged with Escherichia coli K12, we showed that inhibition of histone deacetylases (HDAC) by trichostatin A dramatically enhanced induction of HBD2 expression, without affecting expression of IL-8. This mechanism was supported by an increased phosphorylation of histone H3 on serine S10, preferentially at the HBD2 promoter. This process occurred through activation of the IκB kinase complex, which also led to activation of NF-κB. Moreover, we demonstrated that NF-κB was modified by acetylation upon HDAC inhibition, partly by the histone acetyltransferase p300, and that both NF-κB and p300 supported enhanced induction of HBD2 expression. Furthermore, we identified additional genes belonging to antimicrobial defense and epithelial restitution pathways that showed a similar pattern of epigenetic control. Finally, we confirmed our finding in human colonic primary cells using an ex vivo organoid model. This work opens the way to use epigenetic pharmacology to achieve induction of epithelial antimicrobial defenses, while limiting the deleterious risk of an inflammatory response. PMID:27162363

  9. Mechanisms and consequences of bacterial resistance to antimicrobial peptides.


    Andersson, D I; Hughes, D; Kubicek-Sutherland, J Z


    Cationic antimicrobial peptides (AMPs) are an intrinsic part of the human innate immune system. Over 100 different human AMPs are known to exhibit broad-spectrum antibacterial activity. Because of the increased frequency of resistance to conventional antibiotics there is an interest in developing AMPs as an alternative antibacterial therapy. Several cationic peptides that are derivatives of AMPs from the human innate immune system are currently in clinical development. There are also ongoing clinical studies aimed at modulating the expression of AMPs to boost the human innate immune response. In this review we discuss the potential problems associated with these therapeutic approaches. There is considerable experimental data describing mechanisms by which bacteria can develop resistance to AMPs. As for any type of drug resistance, the rate by which AMP resistance would emerge and spread in a population of bacteria in a natural setting will be determined by a complex interplay of several different factors, including the mutation supply rate, the fitness of the resistant mutant at different AMP concentrations, and the strength of the selective pressure. Several studies have already shown that AMP-resistant bacterial mutants display broad cross-resistance to a variety of AMPs with different structures and modes of action. Therefore, routine clinical administration of AMPs to treat bacterial infections may select for resistant bacterial pathogens capable of better evading the innate immune system. The ramifications of therapeutic levels of exposure on the development of AMP resistance and bacterial pathogenesis are not yet understood. This is something that needs to be carefully studied and monitored if AMPs are used in clinical settings.

  10. Simultaneous Antibiofilm and Antiviral Activities of an Engineered Antimicrobial Peptide during Virus-Bacterium Coinfection

    PubMed Central

    Melvin, Jeffrey A.; Lashua, Lauren P.; Kiedrowski, Megan R.; Yang, Guanyi; Deslouches, Berthony; Montelaro, Ronald C.


    ABSTRACT Antimicrobial-resistant infections are an urgent public health threat, and development of novel antimicrobial therapies has been painstakingly slow. Polymicrobial infections are increasingly recognized as a significant source of severe disease and also contribute to reduced susceptibility to antimicrobials. Chronic infections also are characterized by their ability to resist clearance, which is commonly linked to the development of biofilms that are notorious for antimicrobial resistance. The use of engineered cationic antimicrobial peptides (eCAPs) is attractive due to the slow development of resistance to these fast-acting antimicrobials and their ability to kill multidrug-resistant clinical isolates, key elements for the success of novel antimicrobial agents. Here, we tested the ability of an eCAP, WLBU2, to disrupt recalcitrant Pseudomonas aeruginosa biofilms. WLBU2 was capable of significantly reducing biomass and viability of P. aeruginosa biofilms formed on airway epithelium and maintained activity during viral coinfection, a condition that confers extraordinary levels of antibiotic resistance. Biofilm disruption was achieved in short treatment times by permeabilization of bacterial membranes. Additionally, we observed simultaneous reduction of infectivity of the viral pathogen respiratory syncytial virus (RSV). WLBU2 is notable for its ability to maintain activity across a broad range of physiological conditions and showed negligible toxicity toward the airway epithelium, expanding its potential applications as an antimicrobial therapeutic. IMPORTANCE Antimicrobial-resistant infections are an urgent public health threat, making development of novel antimicrobials able to effectively treat these infections extremely important. Chronic and polymicrobial infections further complicate antimicrobial therapy, often through the development of microbial biofilms. Here, we describe the ability of an engineered antimicrobial peptide to disrupt biofilms

  11. Role of amphipathicity and hydrophobicity in the balance between hemolysis and peptide-membrane interactions of three related antimicrobial peptides.


    Hollmann, Axel; Martínez, Melina; Noguera, Martín E; Augusto, Marcelo T; Disalvo, Anibal; Santos, Nuno C; Semorile, Liliana; Maffía, Paulo C


    Cationic antimicrobial peptides (CAMPs) represent important self defense molecules in many organisms, including humans. These peptides have a broad spectrum of activities, killing or neutralizing many Gram-negative and Gram-positive bacteria. The emergence of multidrug resistant microbes has stimulated research on the development of alternative antibiotics. In the search for new antibiotics, cationic antimicrobial peptides (CAMPs) offer a viable alternative to conventional antibiotics, as they physically disrupt the bacterial membranes, leading to lysis of microbial membranes and eventually cell death. In particular, the group of linear α-helical cationic peptides has attracted increasing interest from clinical as well as basic research during the last decade. In this work, we studied the biophysical and microbiological characteristics of three new designed CAMPs. We modified a previously studied CAMP sequence, in order to increase or diminish the hydrophobic face, changing the position of two lysines or replacing three leucines, respectively. These mutations modified the hydrophobic moment of the resulting peptides and allowed us to study the importance of this parameter in the membrane interactions of the peptides. The structural properties of the peptides were also correlated with their membrane-disruptive abilities, antimicrobial activities and hemolysis of human red blood cells.

  12. Novel antimicrobial peptides isolated from the skin secretions of Hainan odorous frog, Odorrana hainanensis.


    Wang, Hui; Yu, Zhijun; Hu, Yuhong; Li, Fengjiao; Liu, Limeng; Zheng, Hongyuan; Meng, Hao; Yang, Shujie; Yang, Xiaolong; Liu, Jingze


    Long time geographical isolation of Hainan Island from the China continent has resulted in appearance of many novel frog species. As one of them, Hainan odorous frog, Odorrana hainanensis possesses some special antimicrobial peptides distinct from those found in other Odorrana. In this study, three antimicrobial peptides have been purified and characterized from the skin secretion of O. hainanensis. With the similarity to the temporin family, two peptides are characterized by amidated C-terminals, so they are named as temporin-HN1 (AILTTLANWARKFL-NH(2)) and temporin-HN2 (NILNTIINLAKKIL-NH(2)). The third antimicrobial peptide belongs to the brevinin-1 family which is widely distributed in Eurasian ranids, and thus, it is named as brevinin-1HN1 (FLPLIASLAANFVPKIFCKITKKC). Furthermore, after sequencing 68 clones, eight cDNAs encoding antimicrobial peptide precursors were cloned from the skin-derived cDNA library of O. hainanensis. These eight cDNAs can encode seven mature antimicrobial peptides including the above three, as well as brevinin-1V, brevinin-2HS2, odorranain-A6, and odorranain-B1. Twelve different species of microorganisms were chosen, including Gram-positive, Gram-negative and fungi, to test the antimicrobial activities of temporin-HN1, temporin-HN2, brevinin-1HN1, brevinin-1V, and brevinin-2HS2. The result shows that, in addition to their activities against Gram-positive bacteria, temporin-HN1 and temporin-HN2 also possess activities against some Gram-negative bacteria and fungi. However, the two antimicrobial peptides, brevinin-1HN1 and brevinin-1V of the brevinin-1 family have stronger antimicrobial activities than temporin-HN1 and temporin-HN2 of the temporin family. Brevinin-1HN1 possesses activity against Staphylococcus aureus (ATCC25923), Rhodococcus rhodochrous X15, and Slime mould 090223 at the concentration of 1.2 μM.

  13. A novel antifungal peptide designed from the primary structure of a natural antimicrobial peptide purified from Argopecten purpuratus hemocytes.


    Arenas, Gloria; Guzmán, Fanny; Cárdenas, Constanza; Mercado, Luis; Marshall, Sergio H


    We have isolated and purified a natural antimicrobial peptide from Argopecten purpuratus hemocytes. 47 residues were determined from its primary structure representing the N-terminal of the complete sequence. This peptide of 5100.78Da was chemically synthesized and named Ap. The peptide has 25% of hydrophobic amino acids with a net charge of +1, and partial homology with known active antimicrobial peptides. Based on that sequence, a new peptide was designed and modeled to increase hydrophobicity and cationicity. The designed 30-residue peptide was chemically synthesized resulting in a novel 38% hydrophobic molecule named peptide Ap-S, with a net charge of +5 and 3028Da. A secondary structure was shown by circular dichroism, thus exposing a hydrophobic epitope toward the N-terminus and a hydrophilic one toward the C-terminus, improving amphipathicity. Ap-S was much more active than the parental Ap. Ap-S up to 100microM has no cytotoxic effect against fish cell line CHSE-214. We demonstrated that the chemical modification of a natural peptide and the chemical synthesis of derived molecules may be a powerful tool for obtaining substitutes to conventional antibiotics, displaying the many advantages of antimicrobial peptides and overcoming the limitations of natural peptides for large-scale production and application, such as the low specific activity and the minute amounts recovered in vivo. This peptide may have a relevant application in aquaculture by controlling Saprolegna sp., a parasitic pathogen fungus that attacks the culture of fish in different stages of their growth, from egg to adult.

  14. High Specific Selectivity and Membrane-Active Mechanism of Synthetic Cationic Hybrid Antimicrobial Peptides Based on the Peptide FV7.


    Tan, Tingting; Wu, Di; Li, Weizhong; Zheng, Xin; Li, Weifen; Shan, Anshan


    Hybrid peptides integrating different functional domains of peptides have many advantages, such as remarkable antimicrobial activity, lower hemolysis and ideal cell selectivity, compared with natural antimicrobial peptides. FV7 (FRIRVRV-NH₂), a consensus amphiphilic sequence was identified as being analogous to host defense peptides. In this study, we designed a series of hybrid peptides FV7-LL-37 (17-29) (FV-LL), FV7-magainin 2 (9-21) (FV-MA) and FV7-cecropin A (1-8) (FV-CE) by combining the FV7 sequence with the small functional sequences LL-37 (17-29) (LL), magainin 2 (9-21) (MA) and cecropin A (1-8) (CE) which all come from well-described natural peptides. The results demonstrated that the synthetic hybrid peptides, in particular FV-LL, had potent antibacterial activities over a wide range of Gram-negative and Gram-positive bacteria with lower hemolytic activity than other peptides. Furthermore, fluorescent spectroscopy indicated that the hybrid peptide FV-LL exhibited marked membrane destruction by inducing outer and inner bacterial membrane permeabilization, while scanning electron microscopy (SEM) and transmission electron microscopy (TEM) demonstrated that FV-LL damaged membrane integrity by disrupting the bacterial membrane. Inhibiting biofilm formation assays also showed that FV-LL had similar anti-biofilm activity compared with the functional peptide sequence FV7. Synthetic cationic hybrid peptides based on FV7 could provide new models for combining different functional domains and demonstrate effective avenues to screen for novel antimicrobial agents.

  15. High Specific Selectivity and Membrane-Active Mechanism of Synthetic Cationic Hybrid Antimicrobial Peptides Based on the Peptide FV7

    PubMed Central

    Tan, Tingting; Wu, Di; Li, Weizhong; Zheng, Xin; Li, Weifen; Shan, Anshan


    Hybrid peptides integrating different functional domains of peptides have many advantages, such as remarkable antimicrobial activity, lower hemolysis and ideal cell selectivity, compared with natural antimicrobial peptides. FV7 (FRIRVRV-NH2), a consensus amphiphilic sequence was identified as being analogous to host defense peptides. In this study, we designed a series of hybrid peptides FV7-LL-37 (17–29) (FV-LL), FV7-magainin 2 (9–21) (FV-MA) and FV7-cecropin A (1–8) (FV-CE) by combining the FV7 sequence with the small functional sequences LL-37 (17–29) (LL), magainin 2 (9–21) (MA) and cecropin A (1–8) (CE) which all come from well-described natural peptides. The results demonstrated that the synthetic hybrid peptides, in particular FV-LL, had potent antibacterial activities over a wide range of Gram-negative and Gram-positive bacteria with lower hemolytic activity than other peptides. Furthermore, fluorescent spectroscopy indicated that the hybrid peptide FV-LL exhibited marked membrane destruction by inducing outer and inner bacterial membrane permeabilization, while scanning electron microscopy (SEM) and transmission electron microscopy (TEM) demonstrated that FV-LL damaged membrane integrity by disrupting the bacterial membrane. Inhibiting biofilm formation assays also showed that FV-LL had similar anti-biofilm activity compared with the functional peptide sequence FV7. Synthetic cationic hybrid peptides based on FV7 could provide new models for combining different functional domains and demonstrate effective avenues to screen for novel antimicrobial agents. PMID:28178190

  16. Influence of the Length and Charge on the Activity of α-Helical Amphipathic Antimicrobial Peptides.


    Gagnon, Marie-Claude; Strandberg, Erik; Grau-Campistany, Ariadna; Wadhwani, Parvesh; Reichert, Johannes; Bürck, Jochen; Rabanal, Francesc; Auger, Michèle; Paquin, Jean-François; Ulrich, Anne S


    Hydrophobic mismatch is important for pore-forming amphipathic antimicrobial peptides, as demonstrated recently [Grau-Campistany, A., et al. (2015) Sci. Rep. 5, 9388]. A series of different length peptides have been generated with the heptameric repeat sequence KIAGKIA, called KIA peptides, and it was found that only those helices sufficiently long to span the hydrophobic thickness of the membrane could induce leakage in lipid vesicles; there was also a clear length dependence of the antimicrobial and hemolytic activities. For the original KIA sequences, the cationic charge increased with peptide length. The goal of this work is to examine whether the charge also has an effect on activity; hence, we constructed two further series of peptides with a sequence similar to those of the KIA peptides, but with a constant charge of +7 for all lengths from 14 to 28 amino acids. For both of these new series, a clear length dependence similar to that of KIA peptides was observed, indicating that charge has only a minor influence. Both series also showed a distinct threshold length for peptides to be active, which correlates directly with the thickness of the membrane. Among the longer peptides, the new series showed activities only slightly lower than those of the original KIA peptides of the same length that had a higher charge. Shorter peptides, in which Gly was replaced with Lys, showed activities similar to those of KIA peptides of the same length, but peptides in which Ile was replaced with Lys lost their helicity and were less active.

  17. Toward Infection-Resistant Surfaces: Achieving High Antimicrobial Peptide Potency by Modulating the Functionality of Polymer Brush and Peptide.


    Yu, Kai; Lo, Joey C Y; Mei, Yan; Haney, Evan F; Siren, Erika; Kalathottukaren, Manu Thomas; Hancock, Robert E W; Lange, Dirk; Kizhakkedathu, Jayachandran N


    Bacterial infection associated with indwelling medical devices and implants is a major clinical issue, and the prevention or treatment of such infections is challenging. Antimicrobial coatings offer a significant step toward addressing this important clinical problem. Antimicrobial coatings based on tethered antimicrobial peptides (AMPs) on hydrophilic polymer brushes have been shown to be one of the most promising strategies to avoid bacterial colonization and have demonstrated broad spectrum activity. Optimal combinations of the functionality of the polymer-brush-tethered AMPs are essential to maintaining long-term AMP activity on the surface. However, there is limited knowledge currently available on this topic. Here we report the development of potent antimicrobial coatings on implant surfaces by elucidating the roles of polymer brush chemistry and peptide structure on the overall antimicrobial activity of the coatings. We screened several combinations of polymer brush coatings and AMPs constructed on nanoparticles, titanium surfaces, and quartz slides on their antimicrobial activity and bacterial adhesion against Gram-positive and Gram-negative bacteria. Highly efficient killing of planktonic bacteria by the antimicrobial coatings on nanoparticle surfaces, as well as potent killing of adhered bacteria in the case of coatings on titanium surfaces, was observed. Remarkably, the antimicrobial activity of AMP-conjugated brush coatings demonstrated a clear dependence on the polymer brush chemistry and peptide structure, and optimization of these parameters is critical to achieving infection-resistant surfaces. By analyzing the interaction of polymer-brush-tethered AMPs with model lipid membranes using circular dichroism spectroscopy, we determined that the polymer brush chemistry has an influence on the extent of secondary structure change of tethered peptides before and after interaction with biomembranes. The peptide structure also has an influence on the density

  18. Potential Use of Antimicrobial Peptides as Vaginal Spermicides/Microbicides.


    Tanphaichitr, Nongnuj; Srakaew, Nopparat; Alonzi, Rhea; Kiattiburut, Wongsakorn; Kongmanas, Kessiri; Zhi, Ruina; Li, Weihua; Baker, Mark; Wang, Guanshun; Hickling, Duane


    The concurrent increases in global population and sexually transmitted infection (STI) demand a search for agents with dual spermicidal and microbicidal properties for topical vaginal application. Previous attempts to develop the surfactant spermicide, nonoxynol-9 (N-9), into a vaginal microbicide were unsuccessful largely due to its inefficiency to kill microbes. Furthermore, N-9 causes damage to the vaginal epithelium, thus accelerating microbes to enter the women's body. For this reason, antimicrobial peptides (AMPs), naturally secreted by all forms of life as part of innate immunity, deserve evaluation for their potential spermicidal effects. To date, twelve spermicidal AMPs have been described including LL-37, magainin 2 and nisin A. Human cathelicidin LL-37 is the most promising spermicidal AMP to be further developed for vaginal use for the following reasons. First, it is a human AMP naturally produced in the vagina after intercourse. Second, LL-37 exerts microbicidal effects to numerous microbes including those that cause STI. Third, its cytotoxicity is selective to sperm and not to the female reproductive tract. Furthermore, the spermicidal effects of LL-37 have been demonstrated in vivo in mice. Therefore, the availability of LL-37 as a vaginal spermicide/microbicide will empower women for self-protection against unwanted pregnancies and STI.

  19. Differential expression of antimicrobial peptides in margins of chronic wounds.


    Dressel, Stefanie; Harder, Jürgen; Cordes, Jesko; Wittersheim, Maike; Meyer-Hoffert, Ulf; Sunderkötter, Cord; Gläser, Regine


    Skin wounds usually heal without major infections, although the loss of the mechanical epithelial barrier exposes the tissue to various bacteria. One reason may be the expression of antimicrobial peptides (AMP) of which some [human beta-defensins (hBD) and LL-37] were recently shown to support additionally certain steps of wound healing. There are no studies which have compared expression patterns of different classes of AMP in chronic wounds. The aim of our study was therefore to analyse the expression profile of hBD-2, hBD-3, LL-37, psoriasin and RNase 7 by immunohistochemistry from defined wound margins of chronic venous ulcers. We detected a strong induction of psoriasin and hBD-2 in chronic wounds in comparison with healthy skin. Except for stratum corneum, no expression of RNase 7 and LL-37 was detected in the epidermis while expression of hBD-3 was heterogeneous. Bacterial swabs identified Staphylococcus aureus and additional bacterial populations, but no association between colonization and AMP expression was found. The differential expression of AMP is noteworthy considering the high bacterial load of chronic ulcers. Clinically, supplementation of AMP with the capability to enhance wound healing besides restricting bacterial overgrowth could present a physiological support for treatment of disturbed wound healing.

  20. Role of Antimicrobial Peptides in Amphibian Defense Against Trematode Infection

    PubMed Central

    Calhoun, Dana M.; Woodhams, Doug; Howard, Cierra; LaFonte, Bryan E.; Gregory, Jacklyn R.; Johnson, Pieter T. J.


    Antimicrobial peptides (AMPs) contribute to the immune defenses of many vertebrates, including amphibians. As larvae, amphibians are often exposed to the infectious stages of trematode parasites, many of which must penetrate the host’s skin, potentially interacting with host AMPs. We tested the effects of the natural AMPs repertoires on both the survival of trematode infectious stages as well as their ability to infect larval amphibians. All five trematode species exhibited decreased survival of cercariae in response to higher concentrations of adult bullfrog AMPs, but no effect when exposed to AMPs from larval bullfrogs. Similarly, the use of norepinephrine to remove AMPs from larval bullfrogs, Pacific chorus frogs, and gray treefrogs had only weak (gray treefrogs) or non-significant (other tested species) effects on infection success by Ribeiroia ondatrae. We nonetheless observed strong differences in parasite infection as a function of both host stage (first- versus second-year bullfrogs) and host species (Pacific chorus frogs versus gray treefrogs) that were apparently unrelated to AMPs. Taken together, our results suggest that AMPs do not play a significant role in defending larval amphibians against trematode cercariae, but that they could be one mechanism helping to prevent infection of post-metamorphic amphibians, particularly for highly aquatic species. PMID:26911920

  1. Biotic stress resistance in agriculture through antimicrobial peptides.


    Sarika; Iquebal, M A; Rai, Anil


    Antimicrobial peptides (AMPs) are the hosts' defense molecules against microbial pathogens and gaining extensive research attention worldwide. These have been reported to play vital role of host innate immunity in response to microbial challenges. AMPs can be used as a natural antibiotic as an alternative of their chemical counterpart for protection of plants/animals against diseases. There are a number of sources of AMPs including prokaryotic and eukaryotic organisms and are present, both in vertebrates and invertebrates. AMPs can be classified as cationic or anionic, based on net charges. Large number of databases and tools are available in the public domain which can be used for development of new genetically modified disease resistant varieties/breeds for agricultural production. The results of the biotechnological research as well as genetic engineering related to AMPs have shown high potential for reduction of economic losses of agricultural produce due to pathogens. In this article, an attempt has been made to introduce the role of AMPs in relation to plants and animals. Their functional and structural characteristics have been described in terms of its role in agriculture. Different sources of AMPs and importance of these sources has been reviewed in terms of its availability. This article also reviews the bioinformatics resources including different database tools and algorithms available in public domain. References of promising biotechnology research in relation to AMPs, prospects of AMPs for further development of genetically modified varieties/breeds are highlighted. AMPs are valuable resource for students, researchers, educators and medical and industrial personnel.

  2. Antimicrobial peptides and gut microbiota in homeostasis and pathology

    PubMed Central

    Ostaff, Maureen J; Stange, Eduard Friedrich; Wehkamp, Jan


    We survive because we adapted to a world of microorganisms. All our epithelial surfaces participate in keeping up an effective barrier against microbes while not initiating ongoing inflammatory processes and risking collateral damage to the host. Major players in this scenario are antimicrobial peptides (AMPs). Such broad-spectrum innate antibiotics are in part produced by specialized cells but also widely sourced from all epithelia as well as circulating inflammatory cells. AMPs belong to an ancient defense system found in all organisms and participated in a preservative co-evolution with a complex microbiome. Particularly interesting interactions between host barrier and microbiota can be found in the gut. The intestinal cell lining not only has to maintain a tightly regulated homeostasis during its high-throughput regeneration, but also a balanced relationship towards an extreme number of mutualistic or commensal inhabitants. Recent research suggests that advancing our understanding of the circumstances of such balanced and sometimes imbalanced interactions between gut microbiota and host AMPs should have therapeutic implications for different intestinal disorders. PMID:24039130

  3. Potential Use of Antimicrobial Peptides as Vaginal Spermicides/Microbicides

    PubMed Central

    Tanphaichitr, Nongnuj; Srakaew, Nopparat; Alonzi, Rhea; Kiattiburut, Wongsakorn; Kongmanas, Kessiri; Zhi, Ruina; Li, Weihua; Baker, Mark; Wang, Guanshun; Hickling, Duane


    The concurrent increases in global population and sexually transmitted infection (STI) demand a search for agents with dual spermicidal and microbicidal properties for topical vaginal application. Previous attempts to develop the surfactant spermicide, nonoxynol-9 (N-9), into a vaginal microbicide were unsuccessful largely due to its inefficiency to kill microbes. Furthermore, N-9 causes damage to the vaginal epithelium, thus accelerating microbes to enter the women’s body. For this reason, antimicrobial peptides (AMPs), naturally secreted by all forms of life as part of innate immunity, deserve evaluation for their potential spermicidal effects. To date, twelve spermicidal AMPs have been described including LL-37, magainin 2 and nisin A. Human cathelicidin LL-37 is the most promising spermicidal AMP to be further developed for vaginal use for the following reasons. First, it is a human AMP naturally produced in the vagina after intercourse. Second, LL-37 exerts microbicidal effects to numerous microbes including those that cause STI. Third, its cytotoxicity is selective to sperm and not to the female reproductive tract. Furthermore, the spermicidal effects of LL-37 have been demonstrated in vivo in mice. Therefore, the availability of LL-37 as a vaginal spermicide/microbicide will empower women for self-protection against unwanted pregnancies and STI. PMID:26978373

  4. Msb2 Shedding Protects Candida albicans against Antimicrobial Peptides

    PubMed Central

    Szafranski-Schneider, Eva; Swidergall, Marc; Cottier, Fabien; Tielker, Denis; Román, Elvira; Pla, Jesus; Ernst, Joachim F.


    Msb2 is a sensor protein in the plasma membrane of fungi. In the human fungal pathogen C. albicans Msb2 signals via the Cek1 MAP kinase pathway to maintain cell wall integrity and allow filamentous growth. Msb2 doubly epitope-tagged in its large extracellular and small cytoplasmic domain was efficiently cleaved during liquid and surface growth and the extracellular domain was almost quantitatively released into the growth medium. Msb2 cleavage was independent of proteases Sap9, Sap10 and Kex2. Secreted Msb2 was highly O-glycosylated by protein mannosyltransferases including Pmt1 resulting in an apparent molecular mass of >400 kDa. Deletion analyses revealed that the transmembrane region is required for Msb2 function, while the large N-terminal and the small cytoplasmic region function to downregulate Msb2 signaling or, respectively, allow its induction by tunicamycin. Purified extracellular Msb2 domain protected fungal and bacterial cells effectively from antimicrobial peptides (AMPs) histatin-5 and LL-37. AMP inactivation was not due to degradation but depended on the quantity and length of the Msb2 glycofragment. C. albicans msb2 mutants were supersensitive to LL-37 but not histatin-5, suggesting that secreted rather than cell-associated Msb2 determines AMP protection. Thus, in addition to its sensor function Msb2 has a second activity because shedding of its glycofragment generates AMP quorum resistance. PMID:22319443

  5. Reactive Oxygen Species, Apoptosis, Antimicrobial Peptides and Human Inflammatory Diseases

    PubMed Central

    Oyinloye, Babatunji Emmanuel; Adenowo, Abiola Fatimah; Kappo, Abidemi Paul


    Excessive free radical generation, especially reactive oxygen species (ROS) leading to oxidative stress in the biological system, has been implicated in the pathogenesis and pathological conditions associated with diverse human inflammatory diseases (HIDs). Although inflammation which is considered advantageous is a defensive mechanism in response to xenobiotics and foreign pathogen; as a result of cellular damage arising from oxidative stress, if uncontrolled, it may degenerate to chronic inflammation when the ROS levels exceed the antioxidant capacity. Therefore, in the normal resolution of inflammatory reactions, apoptosis is acknowledged to play a crucial role, while on the other hand, dysregulation in the induction of apoptosis by enhanced ROS production could also result in excessive apoptosis identified in the pathogenesis of HIDs. Apparently, a careful balance must be maintained in this complex environment. Antimicrobial peptides (AMPs) have been proposed in this review as an excellent candidate capable of playing prominent roles in maintaining this balance. Consequently, in novel drug design for the treatment and management of HIDs, AMPs are promising candidates owing to their size and multidimensional properties as well as their wide spectrum of activities and indications of reduced rate of resistance. PMID:25850012

  6. A consistent nomenclature of antimicrobial peptides isolated from frogs of the subfamily Phyllomedusinae.


    Amiche, Mohamed; Ladram, Ali; Nicolas, Pierre


    A growing number of cationic antimicrobial peptides have been isolated from the skin of hylid frogs belonging to the Phyllomedusinae subfamily. The amino acid sequences of these peptides are currently located in several databases under identifiers with no consistent system of nomenclature to describe them. In order to provide a workable terminology for antimicrobial peptides from Phyllomedusid frogs, we have made a systematic effort to collect, analyze, and classify all the Phyllomedusid peptide sequences available in databases. We propose that frogs belonging to the Phyllomedusinae subfamily should be described by the species names set out in Amphibian Species of the World:, American Museum of Natural History, New York, USA. Multiple alignments analysis of at least 80 antimicrobial peptides isolated from 12 Phyllomedusinae species were distributed in seven distinct peptide families including dermaseptin, phylloseptin, plasticin, dermatoxin, phylloxin, hyposin and orphan peptides, and will be considered as the name of the headgroup of each family. The parent peptide's name should be followed by the first upper letter of the species for orthologous peptides and publication date determines priority. For example, the abbreviation B for bicolor and H for hypochondrialis. When two species begin with the same letter, two letters in upper case should be used (the first letter followed by the second or the third letter and so on). For example, the abbreviation DI for distincta, DU for duellmani, VA for vaillanti and VN for vanzolinii. Paralogous peptides should bear letter(s) in upper case followed by numbers.

  7. Biosynthesis of the Polycyclic Antimicrobial Peptides Lacticin 481, Haloduracin, and Cinnamycin

    ERIC Educational Resources Information Center

    Cooper, Lisa E.


    Lantibiotics are bacterial-derived polycyclic antimicrobial peptides. They are genetically encoded and ribosomally synthesized as precursor peptides containing a structural region that undergoes post-translational modification and a leader sequence that is not modified. Specific serine and threonine residues in the pre-lantibiotic structural…

  8. Membrane-active Antimicrobial Peptides as Template Structures for Novel Antibiotic Agents.


    Lohner, Karl


    The increase of pathogens being resistant to antibiotics represents a global health problem and therefore it is a pressing need to develop antibiotics with novel mechanisms of action. Host defense peptides, which have direct antimicrobial activity (also termed antimicrobial peptides) or immune modulating activity, are valuable template structures for the development of such compounds. Antimicrobial peptides exhibit remarkably different structures as well as biological activity profiles with multiple targets. A large fraction of these peptides interfere physically with the cell membrane of bacteria (focus of this review), but can also translocate into the cytosol, where they interact with nucleic acids, ribosomes and proteins. Several potential interaction sites have to be considered on the route of the peptides from the environment to the cytoplasmic membrane. Translocation of peptides through the cell wall may not be impaired by the thick but relatively porous peptidoglycan layer. However, interaction with lipopolysaccharides of the outer membrane of Gram-negative bacteria and (lipo)teichoic acids of Gram-positive bacteria may reduce the effective concentration at the cytoplasmic membrane, where supposedly the killing event takes place. On a molecular level several mechanisms are discussed, which are important for the rational design of improved antimicrobial compounds: toroidal pore formation, carpet model (coverage of membrane surface by peptides), interfacial activity, void formation, clustering of lipids and effects of membrane curvature. In summary, many of these models just represent special cases that can be interrelated to each other and depend on both the nature of lipids and peptides.

  9. Secretory production of antimicrobial peptides in Escherichia coli using the catalytic domain of a cellulase as fusion partner.


    Yu, Huili; Li, Haoran; Gao, Dongfang; Gao, Cuijuan; Qi, Qingsheng


    Antimicrobial peptides (AMPs) are small molecules which serve as essential components of the innate immune system in various organisms. AMPs possess a broad spectrum of antimicrobial activities. However, the scaled production of such peptides in Escherichia coli faces many difficulties because of their small size and toxicity to the host. Here, we described a new fusion strategy to extracellularly produce significant amounts of these antimicrobial peptides in recombinant E. coli at significant amount. Employing the catalytic domain of a cellulase (Cel-CD) from Bacillus subtilis KSM-64 as the fusion partner, five recombinant antimicrobial peptides were confirmed to accumulate in the culture medium at concentrations ranging from 184 mg/L to 297 mg/L. The radical diffusion experiment demonstrated that the released model antimicrobial peptide, bombinin, had antibacterial activities against both E. coli and Staphylococcus aureus. This strategy will be suitable for the production of antimicrobial peptides and other toxicity proteins.

  10. Antimicrobial peptide scolopendrasin VII, derived from the centipede Scolopendra subspinipes mutilans, stimulates macrophage chemotaxis via formyl peptide receptor 1.


    Park, Yoo Jung; Lee, Ha Young; Jung, Young Su; Park, Joon Seong; Hwang, Jae Sam; Bae, Yoe-Sik


    In this study, we report that one of the antimicrobial peptides scolopendrasin VII, derived from Scolopendra subspinipes mutilans, stimulates actin polymerization and the subsequent chemotactic migration of macrophages through the activation of ERK and protein kinase B (Akt) activity. The scolopendrasin VII-induced chemotactic migration of macrophages is inhibited by the formyl peptide receptor 1 (FPR1) antagonist cyclosporine H. We also found that scolopendrasin VII stimulate the chemotactic migration of FPR1-transfected RBL-2H3 cells, but not that of vector-transfected cells; moreover, scolopendrasin VII directly binds to FPR1. Our findings therefore suggest that the antimicrobial peptide scolopendrasin VII, derived from Scolopendra subspinipes mutilans, stimulates macrophages, resulting in chemotactic migration via FPR1 signaling, and the peptide can be useful in the study of FPR1-related biological responses.

  11. Synthesis and biological activity of lipophilic analogs of the cationic antimicrobial active peptide anoplin.


    Chionis, Kostas; Krikorian, Dimitrios; Koukkou, Anna-Irini; Sakarellos-Daitsiotis, Maria; Panou-Pomonis, Eugenia


    Anoplin is a short natural cationic antimicrobial peptide which is derived from the venom sac of the solitary wasp, Anoplius samariensis. Due to its short sequence G(1) LLKR(5) IKT(8) LL-NH2 , it is ideal for research tests. In this study, novel analogs of anoplin were prepared and examined for their antimicrobial, hemolytic activity, and proteolytic stability. Specific substitutions were introduced in amino acids Gly(1) , Arg(5) , and Thr(8) and lipophilic groups with different lengths in the N-terminus in order to investigate how these modifications affect their antimicrobial activity. These cationic analogs exhibited higher antimicrobial activity than the native peptide; they are also nontoxic at their minimum inhibitory concentration (MIC) values and resistant to enzymatic degradation. The substituted peptide GLLKF(5) IKK(8) LL-NH2 exhibited high activity against Gram-negative bacterium Zymomonas mobilis (MIC = 7 µg/ml), and the insertion of octanoic, decanoic, and dodecanoic acid residues in its N-terminus increased the antimicrobial activity against Gram-positive and Gram-negative bacteria (MIC = 5 µg/ml). The conformational characteristics of the peptide analogs were studied by circular dichroism. Structure activity studies revealed that the substitution of specific amino acids and the incorporation of lipophilic groups enhanced the amphipathic α-helical conformation inducing better antimicrobial effects. Copyright © 2016 European Peptide Society and John Wiley & Sons, Ltd.

  12. Comparative Analysis of the Antimicrobial Activities of Plant Defensin-Like and Ultrashort Peptides against Food-Spoiling Bacteria

    PubMed Central

    Kraszewska, Joanna; Beckett, Michael C.; James, Tharappel C.


    ABSTRACT Antimicrobial peptides offer potential as novel therapeutics to combat food spoilage and poisoning caused by pathogenic and nonpathogenic bacteria. Our previous studies identified the peptide human beta-defensin 3 (HBD3) as a potent antimicrobial agent against a wide range of beer-spoiling bacteria. Thus, HBD3 is an excellent candidate for development as an additive to prevent food and beverage spoilage. To expand the repertoire of peptides with antimicrobial activity against bacteria associated with food spoilage and/or food poisoning, we carried out an in silico discovery pipeline to identify peptides with structure and activity similar to those of HBD3, focusing on peptides of plant origin. Using a standardized assay, we compared the antimicrobial activities of nine defensin-like plant peptides to the activity of HBD3. Only two of the peptides, fabatin-2 and Cp-thionin-2, displayed antimicrobial activity; however, the peptides differed from HBD3 in being sensitive to salt and were thermostable. We also compared the activities of several ultrashort peptides to that of HBD3. One of the peptides, the synthetic tetrapeptide O3TR, displayed biphasic antimicrobial activity but had a narrower host range than HBD3. Finally, to determine if the peptides might act in concert to improve antimicrobial activity, we compared the activities of the peptides in pairwise combinations. The plant defensin-like peptides fabatin-2 and Cp-thionin-2 displayed a synergistic effect with HBD3, while O3TR was antagonistic. Thus, some plant defensin-like peptides are effective antimicrobials and may act in concert with HBD3 to control bacteria associated with food spoilage and food poisoning. IMPORTANCE Food spoilage and food poisoning caused by bacteria can have major health and economic implications for human society. With the rise in resistance to conventional antibiotics, there is a need to identify new antimicrobials to combat these outbreaks in our food supply. Here we

  13. Antibiotic gold: tethering of antimicrobial peptides to gold nanoparticles maintains conformational flexibility of peptides and improves trypsin susceptibility.


    Wadhwani, Parvesh; Heidenreich, Nico; Podeyn, Benjamin; Bürck, Jochen; Ulrich, Anne S


    Peptide-coated nanoparticles are valuable tools for diverse biological applications, such as drug delivery, molecular recognition, and antimicrobial action. The functionalization of pre-fabricated nanoparticles with free peptides in solution is inefficient either due to aggregation of the particles or due to the poor ligand exchange reaction. Here, we present a one-pot synthesis for preparing gold nanoparticles with a homogeneous distribution that are covered in situ with cationic peptides in a site-selective manner via Cys-residue at the N-terminus. Five representative peptides were selected, which are known to perturb cellular membranes and exert their antimicrobial and/or cell penetrating activity by folding into amphiphilic α-helical structures. When tethered to the nanoparticles at a single site, all peptides were found to switch their conformation from unordered state (in aqueous buffers) to their functionally relevant α-helical conformation in the presence of model membranes, as shown by circular dichroism spectroscopy. The conjugated peptides also maintained the same antibacterial activity as in the free form. Most importantly, when tethered to the gold nanoparticles the peptides showed an enormous increase in stability against trypsin digestion compared to the free forms, leading to a dramatic improvement of their lifetimes and activities. These findings suggest that site-selective surface tethering of peptides to gold nanoparticles has several advantages: (i) it does not prevent the peptides from folding into their biologically active conformation, (ii) such conjugation protects the peptides against protease digestion, and (iii) this way it is possible to prepare stable, water soluble antimicrobial nanoparticles as promising antibacterial agents.

  14. Halocyntin and papillosin, two new antimicrobial peptides isolated from hemocytes of the solitary tunicate, Halocynthia papillosa.


    Galinier, Richard; Roger, Emmanuel; Sautiere, Pierre-Eric; Aumelas, Andre; Banaigs, Bernard; Mitta, Guillaume


    We report here the screening of five marine invertebrate species from two taxa (tunicates and echinoderms) for the presence of cationic antimicrobial peptides (AMP) in defence cells (hemocytes). Antimicrobial activities were detected only in the two tunicates Microcosmus sabatieri and Halocynthia papillosa. In addition, we report the isolation and characterization of two novel peptides from H. papillosa hemocytes. These molecules display antibacterial activity against Gram-positive and Gram-negative bacteria. Complete peptide characterization was obtained by a combination of Edman degradation and mass spectrometry. The mature molecules, named halocyntin and papillosin, comprise 26 and 34 amino acid residues, respectively. Their primary structure display no significant similarities with previously described AMP.

  15. Structure-activity relationships and action mechanisms of collagen-like antimicrobial peptides.


    Masuda, Ryo; Dazai, Yui; Mima, Takehiko; Koide, Takaki


    An antimicrobial triple-helical peptide, R3, was previously obtained from a collagen-like combinatorial peptide library. In this research, based on structure-activity relationship studies of R3, a more potent peptide, RR4, with increased positive net charge and charge density relative to R3, was developed. RR4 exhibited antimicrobial activity against both Gram-negative and Gram-positive bacterial strains, including multidrug-resistant strains. Its action could be attributed to entry into cells and interactions with intercellular molecules such as DNA/RNA that inhibited cell division rather than increasing bacterial membrane permeability. Furthermore, RR4 exhibited remarkable stability in serum and low cytotoxicity.

  16. Contribution of Amphipathicity and Hydrophobicity to the Antimicrobial Activity and Cytotoxicity of β-Hairpin Peptides

    PubMed Central


    Bacteria have acquired extensive resistance mechanisms to protect themselves against antibiotic action. Today the bacterial membrane has become one of the “final frontiers” in the search for new compounds acting on novel targets to address the threat of multi-drug resistant (MDR) and XDR bacterial pathogens. β-Hairpin antimicrobial peptides are amphipathic, membrane-binding antibiotics that exhibit a broad range of activities against Gram-positive, Gram-negative, and fungal pathogens. However, most members of the class also possess adverse cytotoxicity and hemolytic activity that preclude their development as candidate antimicrobials. We examined peptide hydrophobicity, amphipathicity, and structure to better dissect and understand the correlation between antimicrobial activity and toxicity, membrane binding, and membrane permeability. The hydrophobicity, pI, net charge at physiological pH, and amphipathic moment for the β-hairpin antimicrobial peptides tachyplesin-1, polyphemusin-1, protegrin-1, gomesin, arenicin-3, and thanatin were determined and correlated with key antimicrobial activity and toxicity data. These included antimicrobial activity against five key bacterial pathogens and two fungi, cytotoxicity against human cell lines, and hemolytic activity in human erythrocytes. Observed antimicrobial activity trends correlated with compound amphipathicity and, to a lesser extent, with overall hydrophobicity. Antimicrobial activity increased with amphipathicity, but unfortunately so did toxicity. Of note, tachyplesin-1 was found to be 8-fold more amphipathic than gomesin. These analyses identify tachyplesin-1 as a promising scaffold for rational design and synthetic optimization toward an antibiotic candidate. PMID:27331141

  17. Engineered Chimeric Peptides as Antimicrobial Surface Coating Agents toward Infection-Free Implants

    PubMed Central

    Yazici, Hilal; O'Neill, Mary B.; Kacar, Turgay; Wilson, Brandon R.; Oren, E. Emre; Sarikaya, Mehmet; Tamerler, Candan


    Prevention of bacterial colonization and consequent biofilm formation remains a major challenge in implantable medical devices. Implant-associated infections are not only a major cause of implant failures but also their conventional treatment with antibiotics brings further complications due to the escalation in multidrug resistance to a variety of bacterial species. Owing to their unique properties, antimicrobial peptides (AMPs) have gained significant attention as effective agents to combat colonization of microorganisms. These peptides have been shown to exhibit a wide spectrum of activities with specificity to a target cell while having a low tendency for developing bacterial resistance. Engineering biomaterial surfaces that feature AMP properties, therefore, offer a promising approach to prevent implant infections. Here, we engineered a chimeric peptide with bifunctionality that both forms a robust solid-surface coating while presenting antimicrobial property. The individual domains of the chimeric peptides were evaluated for their solid-binding kinetics to titanium substrate as well as for their antimicrobial properties in solution. The antimicrobial efficacy of the chimeric peptide on the implant material was evaluated in vitro against infection by a variety of bacteria, including Streptococcus mutans, Staphylococcus. epidermidis, and Escherichia coli, which are commonly found in oral and orthopedic implant related surgeries. Our results demonstrate significant improvement in reducing bacterial colonization onto titanium surfaces below the detectable limit. Engineered chimeric peptides with freely displayed antimicrobial domains could be a potential solution for developing infection-free surfaces by engineering implant interfaces with highly reduced bacterial colonization property. PMID:26795060

  18. Engineered Chimeric Peptides as Antimicrobial Surface Coating Agents toward Infection-Free Implants.


    Yazici, Hilal; O'Neill, Mary B; Kacar, Turgay; Wilson, Brandon R; Oren, E Emre; Sarikaya, Mehmet; Tamerler, Candan


    Prevention of bacterial colonization and consequent biofilm formation remains a major challenge in implantable medical devices. Implant-associated infections are not only a major cause of implant failures but also their conventional treatment with antibiotics brings further complications due to the escalation in multidrug resistance to a variety of bacterial species. Owing to their unique properties, antimicrobial peptides (AMPs) have gained significant attention as effective agents to combat colonization of microorganisms. These peptides have been shown to exhibit a wide spectrum of activities with specificity to a target cell while having a low tendency for developing bacterial resistance. Engineering biomaterial surfaces that feature AMP properties, therefore, offer a promising approach to prevent implant infections. Here, we engineered a chimeric peptide with bifunctionality that both forms a robust solid-surface coating while presenting antimicrobial property. The individual domains of the chimeric peptides were evaluated for their solid-binding kinetics to titanium substrate as well as for their antimicrobial properties in solution. The antimicrobial efficacy of the chimeric peptide on the implant material was evaluated in vitro against infection by a variety of bacteria, including Streptococcus mutans, Staphylococcus. epidermidis, and Escherichia coli, which are commonly found in oral and orthopedic implant related surgeries. Our results demonstrate significant improvement in reducing bacterial colonization onto titanium surfaces below the detectable limit. Engineered chimeric peptides with freely displayed antimicrobial domains could be a potential solution for developing infection-free surfaces by engineering implant interfaces with highly reduced bacterial colonization property.

  19. Characterization of a novel antimicrobial peptide with chitin-biding domain from Mytilus coruscus.


    Qin, Chuan-li; Huang, Wei; Zhou, Shi-quan; Wang, Xin-chao; Liu, Hui-hui; Fan, Mei-hua; Wang, Ri-xin; Gao, Peng; Liao, Zhi


    Using reverse phase high performance liquid chromatography (RP-HPLC), a novel antimicrobial peptide with 55 amino acid residues was isolated from the hemolymph of Mytilus coruscus. This new antimicrobial peptide displays predominant antimicrobial activity against fungi and Gram-positive bacteria. The molecular mass and the N-terminal sequence of this peptide were analyzed by Mass Spectrometry and Edman degradation, respectively. This antimicrobial peptide, with molecular mass of 6621.55 Da, is characterized by a chitin-biding domain and by 6 Cysteine residues engaged in three intra-molecular disulfide bridges. The full-length of cDNA sequence of this new peptide was obtained by rapid amplification of cDNA ends (RACE) and the encoded precursor was turn out to be a chitotriosidase-like protein. Therefore, we named the precursor with mytichitin-1 and the new antimicrobial peptide (designated as mytichitin-CB) is the carboxyl-terminal part of mytichitin-1. The mRNA transcripts of mytichitin-1 are mainly detected in gonad and the expression level of mytichitin-1 in gonad was up-regulated and reached the highest level at 12 h after bacterial challenge, which was 9-fold increase compared to that of the control group. These results indicated that mytichitin-1 was involved in the host immune response against bacterial infection and might contribute to the clearance of invading bacteria.

  20. Dynamical and phase behavior of a phospholipid membrane altered by an antimicrobial peptide at low concentration


    Mamontov, Eugene; Tyagi, M.; Qian, Shuo; ...


    Here we discuss that the mechanism of action of antimicrobial peptides is traditionally attributed to the formation of pores in the lipid cell membranes of pathogens, which requires a substantial peptide to lipid ratio. However, using incoherent neutron scattering, we show that even at a concentration too low for pore formation, an archetypal antimicrobial peptide, melittin, disrupts the regular phase behavior of the microscopic dynamics in a phospholipid membrane, dimyristoylphosphatidylcholine (DMPC). At the same time, another antimicrobial peptide, alamethicin, does not exert a similar effect on the DMPC microscopic dynamics. The melittin-altered lateral motion of DMPC at physiological temperature nomore » longer resembles the fluid-phase behavior characteristic of functional membranes of the living cells. The disruptive effect demonstrated by melittin even at low concentrations reveals a new mechanism of antimicrobial action relevant in more realistic scenarios, when peptide concentration is not as high as would be required for pore formation, which may facilitate treatment with antimicrobial peptides.« less

  1. Antimicrobial Peptides Targeting Gram-negative Pathogens, Produced and Delivered by Lactic Acid Bacteria

    PubMed Central

    Volzing, Katherine; Borrero, Juan; Sadowsky, Michael J.; Kaznessis, Yiannis N.


    We present results of tests with recombinant Lactococcus lactis that produce and secrete heterologous antimicrobial peptides with activity against Gram-negative pathogenic Escherichia coli and Salmonella. In an initial screening, the activities of numerous candidate antimicrobial peptides, made by solid state synthesis, were assessed against several indicator pathogenic E. coli and Salmonella strains. Peptides A3APO and Alyteserin were selected as top performers based on high antimicrobial activity against the pathogens tested and on significantly lower antimicrobial activity against L. lactis. Expression cassettes containing the signal peptide of the protein Usp45 fused to the codon optimized sequence of mature A3APO and Alyteserin were cloned under the control of a nisin-inducible promoter nisA and transformed into L. lactis IL1403. The resulting recombinant strains were induced to express and secrete both peptides. A3APO- and Alyteserin-containing supernatants from these recombinant L. lactis inhibited the growth of pathogenic E. coli and Salmonella by up to 20-fold, while maintaining the host’s viability. This system may serve as a model for the production and delivery of antimicrobial peptides by lactic acid bacteria to target Gram-negative pathogenic bacteria populations. PMID:23808914

  2. Production of phytotoxic cationic α-helical antimicrobial peptides in plant cells using inducible promoters.


    Company, Nuri; Nadal, Anna; Ruiz, Cristina; Pla, Maria


    Synthetic linear antimicrobial peptides with cationic α-helical structures, such as BP100, have potent and specific activities against economically important plant pathogenic bacteria. They are also recognized as valuable therapeutics and preservatives. However, highly active BP100 derivatives are often phytotoxic when expressed at high levels as recombinant peptides in plants. Here we demonstrate that production of recombinant phytotoxic peptides in transgenic plants is possible by strictly limiting transgene expression to certain tissues and conditions, and specifically that minimization of this expression during transformation and regeneration of transgenic plants is essential to obtain viable plant biofactories. On the basis of whole-genome transcriptomic data available online, we identified the Os.hsp82 promoter that fulfilled this requirement and was highly induced in response to heat shock. Using this strategy, we generated transgenic rice lines producing moderate yields of severely phytotoxic BP100 derivatives on exposure to high temperature. In addition, a threshold for gene expression in selected tissues and stages was experimentally established, below which the corresponding promoters should be suitable for driving the expression of recombinant phytotoxic proteins in genetically modified plants. In view of the growing transcriptomics data available, this approach is of interest to assist promoter selection for specific purposes.

  3. Towards the Development of Synthetic Antibiotics: Designs Inspired by Natural Antimicrobial Peptides.


    Azmi, Fazren; Skwarczynski, Mariusz; Toth, Istvan


    Virtually every living organism produces gene-encoded antimicrobial peptides (AMPs) that provide an immediate defence against pathogen invasion. Many AMPs have been isolated and used as antibiotics that are effective against multidrug-resistant bacteria. Although encouraging, AMPs have such poor drug-like properties that their application for clinical use is restricted. In turn, this has diverted research to the development of synthetic molecules that retain the therapeutic efficacy of AMPs but are endowed with greater biological stability and safety profiles. Most of the synthetic molecules, either based on a peptidic or non-peptidic scaffold, have been designed to mimic the amphiphilic properties of native AMPs, which are widely believed to be the key determinant of their antibacterial activity. In this review, the structural, chemical and biophysical features that govern the biological activities of various synthetic designs are discussed extensively. Recent innovative approaches from the literature that exhibit novel concepts towards the development of new synthetic antibacterial agents, including the engineered delivery platform incorporated with AMP mimetics, are also emphasised.

  4. Production of Phytotoxic Cationic α-Helical Antimicrobial Peptides in Plant Cells Using Inducible Promoters

    PubMed Central

    Company, Nuri; Nadal, Anna; Ruiz, Cristina; Pla, Maria


    Synthetic linear antimicrobial peptides with cationic α-helical structures, such as BP100, have potent and specific activities against economically important plant pathogenic bacteria. They are also recognized as valuable therapeutics and preservatives. However, highly active BP100 derivatives are often phytotoxic when expressed at high levels as recombinant peptides in plants. Here we demonstrate that production of recombinant phytotoxic peptides in transgenic plants is possible by strictly limiting transgene expression to certain tissues and conditions, and specifically that minimization of this expression during transformation and regeneration of transgenic plants is essential to obtain viable plant biofactories. On the basis of whole-genome transcriptomic data available online, we identified the Os.hsp82 promoter that fulfilled this requirement and was highly induced in response to heat shock. Using this strategy, we generated transgenic rice lines producing moderate yields of severely phytotoxic BP100 derivatives on exposure to high temperature. In addition, a threshold for gene expression in selected tissues and stages was experimentally established, below which the corresponding promoters should be suitable for driving the expression of recombinant phytotoxic proteins in genetically modified plants. In view of the growing transcriptomics data available, this approach is of interest to assist promoter selection for specific purposes. PMID:25387106

  5. Cellular membrane composition requirement by antimicrobial and anticancer peptide GA-K4.


    Mishig-Ochir, Tsogbadrakh; Gombosuren, Davaadulam; Jigjid, Altanchimeg; Tuguldur, Badamkhatan; Chuluunbaatar, Galbadrakh; Urnukhsaikhan, Enerelt; Pathak, Chinar; Lee, Bong-Jin


    Naturally occurring antimicrobial peptides important for innate immunity are widely studied for their antimicrobial and anticancer activity. The primary target of these AMPs is believed to be the bacterial cytoplasmic membrane. However, the interaction between cytoplasmic membrane and the antimicrobial peptides remains poorly understood. Therefore to focus on the target membrane composition that is required by AMPs to interact with membranes, we have examined the interaction of the antimicrobial and anticancer active 11-residue GA-K4 (FLKWLFKWAKK) peptide with model and intact cell membranes. Effect on the structural conformational properties of GA-K4 peptide was investigated by means of far-UV CD and fluorescence spectroscopic methods. The different conformation of GA-K4 peptide in large unilamellar vesicles (LUV) bilayer and micelle environment suggest that the curvature has an influence on the secondary structure acquired by the peptide. Furthermore, the leakage experiment result confirmed that GA-K4 induced the leakage of cytoplasmic membrane in Staphylococcus аureus bacterial cells. Fluorescence data revealed the interfacial location of GA-K4 peptide in the model membranes. The blue-shift in emission wavelength by tryptophan residues in fluorescence data indicated the penetration of GA-K4 peptide in micelles and phospholipid bilayers. These results showed that the GA-K4 peptide is a membrane-active peptide and its activity depends on membrane curvature and lipid composition. Although further studies are required to confirm the mechanism of action, the data suggest mechanism of toroidal pore formation for the interaction of GA-K4 peptide with membranes. Our studies will be helpful in better understanding of the membrane requirment of peptides to express their therapeutic effects.

  6. Bionano Interaction Study on Antimicrobial Star-Shaped Peptide Polymer Nanoparticles.


    Lam, Shu J; Wong, Edgar H H; O'Brien-Simpson, Neil M; Pantarat, Namfon; Blencowe, Anton; Reynolds, Eric C; Qiao, Greg G


    'Structurally nanoengineered antimicrobial peptide polymers' (SNAPPs), in the form of star-shaped peptide polymer nanoparticles, have been recently demonstrated as a new class of antimicrobial agents with superior in vitro and in vivo efficacy against Gram-negative pathogens, including multidrug-resistant species. Herein, we present a detailed bionano interaction study on SNAPPs by assessing their antimicrobial activities against several Gram-negative bacteria in complex biological matrices. Simulated body fluid and animal serum were used as test media to reveal factors that influence the antimicrobial efficacy of SNAPPs. With the exception of Acinetobacter baumannii, the presence of divalent cations at physiological concentrations reduced the antimicrobial efficacy of SNAPPs from minimum inhibitory concentrations (MICs) within the nanomolar range (40-300 nM) against Escherichia coli, Pseudomanas aeruginosa, and Klebsiella pneumoniae to 0.6-4.7 μM. By using E. coli as a representative bacterial species, we demonstrated that the reduction in activity was due to a decrease in the ability of SNAPPs to cause outer and inner membrane disruption. This effect could be reversed through coadministration with a chelating agent. Interestingly, the potency of SNAPPs against A. baumannii was retained even under high salt concentrations. The presence of serum proteins was also found to affect the interaction of SNAPPs with bacterial membranes, possibly through intermolecular binding. Collectively, this study highlights the need to consider the possible interactions of (bio)molecules present in vivo with any new antimicrobial agent under development. We also demonstrate that outer membrane disruption/destabilization is an important but hitherto under-recognized target for the antimicrobial action of peptide-based agents, such as antimicrobial peptides (AMPs). Overall, the findings presented herein could aid in the design of more efficient peptide-based antimicrobial agents with

  7. Expression of Caenorhabditis elegans antimicrobial peptide NLP-31 in Escherichia coli

    NASA Astrophysics Data System (ADS)

    Lim, Mei-Perng; Nathan, Sheila


    Burkholderia pseudomallei is the causative agent of melioidosis, a fulminant disease endemic in Southeast Asia and Northern Australia. The standardized form of therapy is antibiotics treatment; however, the bacterium has become increasingly resistant to these antibiotics. This has spurred the need to search for alternative therapeutic agents. Antimicrobial peptides (AMPs) are small proteins that possess broad-spectrum antimicrobial activity. In a previous study, the nematode Caenorhabditis elegans was infected by B. pseudomallei and a whole animal transcriptome analysis identified a number of AMP-encoded genes which were induced significantly in the infected worms. One of the AMPs identified is NLP-31 and to date, there are no reports of anti-B. pseudomallei activity demonstrated by NLP-31. To produce NLP-31 protein for future studies, the gene encoding for NLP-31 was cloned into the pET32b expression vector and transformed into Escherichia coli BL21(DE3). Protein expression was induced with 1 mM IPTG for 20 hours at 20°C and recombinant NLP-31 was detected in the soluble fraction. Taken together, a simple optimized heterologous production of AMPs in an E. coli expression system has been successfully developed.

  8. Bi-functional peptides with both trypsin-inhibitory and antimicrobial activities are frequent defensive molecules in Ranidae amphibian skins.


    Yan, Xiuwen; Liu, Huan; Yang, Xuening; Che, Qiaolin; Liu, Rui; Yang, Hailong; Liu, Xiuhong; You, Dewen; Wang, Aili; Li, Jianxu; Lai, Ren


    Amphibian skins act as the first line against noxious aggression by microorganisms, parasites, and predators. Anti-microorganism activity is an important task of amphibian skins. A large amount of gene-encoded antimicrobial peptides (AMPs) has been identified from amphibian skins. Only a few of small protease inhibitors have been found in amphibian skins. From skin secretions of 5 species (Odorrana livida, Hylarana nigrovittata, Limnonectes kuhlii, Odorrana grahami, and Amolops loloensis) of Ranidae frogs, 16 small serine protease inhibitor peptides have been purified and characterized. They have lengths of 17-20 amino acid residues (aa). All of them are encoded by precursors with length of 65-70 aa. These small peptides show strong trypsin-inhibitory abilities. Some of them can exert antimicrobial activities. They share the conserved GCWTKSXXPKPC fragment in their primary structures, suggesting they belong to the same families of peptide. Signal peptides of precursors encoding these serine protease inhibitors share obvious sequence similarity with those of precursors encoding AMPs from Ranidae frogs. The current results suggest that these small serine protease inhibitors are the common defensive compounds in frog skin of Ranidae as amphibian skin AMPs.

  9. High CO2 concentration as an inductor agent to drive production of recombinant phytotoxic antimicrobial peptides in plant biofactories.


    Ruiz, Cristina; Pla, Maria; Company, Nuri; Riudavets, Jordi; Nadal, Anna


    Cationic α-helical antimicrobial peptides such as BP100 are of increasing interest for developing novel phytosanitary or therapeutic agents and products with industrial applications. Biotechnological production of these peptides in plants can be severely impaired due to the toxicity exerted on the host by high-level expression. This can be overcome by using inducible promoters with extremely low activity throughout plant development, although the yields are limited. We examined the use of modified atmospheres using the increased levels of [CO2], commonly used in the food industry, as the inductor agent to biotechnologically produce phytotoxic compounds with higher yields. Here we show that 30% [CO2] triggered a profound transcriptional response in rice leaves, including a change in the energy provision from photosynthesis to glycolysis, and the activation of stress defense mechanisms. Five genes with central roles in up-regulated pathways were initially selected and their promoters successfully used to drive the expression of phytotoxic BP100 in genetically modified (GM) rice. GM plants had a normal phenotype on development and seed production in non-induction conditions. Treatment with 30 % [CO2] led to recombinant peptide accumulation of up to 1 % total soluble protein when the Os.hb2 promoter was used. This is within the range of biotechnological production of other peptides in plants. Using BP100 as a proof-of-concept we demonstrate that very high [CO2] can be considered an economically viable strategy to drive production of recombinant phytotoxic antimicrobial peptides in plant biofactories.

  10. Self-assembled cationic peptide nanoparticles as an efficient antimicrobial agent

    NASA Astrophysics Data System (ADS)

    Liu, Lihong; Xu, Kaijin; Wang, Huaying; Jeremy Tan, P. K.; Fan, Weimin; Venkatraman, Subbu S.; Li, Lanjuan; Yang, Yi-Yan


    Antimicrobial cationic peptides are of interest because they can combat multi-drug-resistant microbes. Most peptides form α-helices or β-sheet-like structures that can insert into and subsequently disintegrate negatively charged bacterial cell surfaces. Here, we show that a novel class of core-shell nanoparticles formed by self-assembly of an amphiphilic peptide have strong antimicrobial properties against a range of bacteria, yeasts and fungi. The nanoparticles show a high therapeutic index against Staphylococcus aureus infection in mice and are more potent than their unassembled peptide counterparts. Using Staphylococcus aureus-infected meningitis rabbits, we show that the nanoparticles can cross the blood-brain barrier and suppress bacterial growth in infected brains. Taken together, these nanoparticles are promising antimicrobial agents that can be used to treat brain infections and other infectious diseases.

  11. Antimicrobial activity of the scolopendrasin V peptide identified from the centipede, Scolopendra subspinipes mutilans.


    Lee, Joon Ha; Kim, In-Woo; Kim, Mi-Ae; Ahn, Mi-Young; Yun, Eun-Young; Hwang, Jae Sam


    In a previous study, we analyzed the transcriptome of Scolopendra subspinipes mutilans using next generation sequencing technology and identified several antimicrobial peptide candidates. One of peptides, scolopendrasin V, was selected based on the physicochemical properties of antimicrobial peptides using a bioinformatics strategy. In this study, we assessed the antimicrobial activities of scolopendrasin V by using radial diffusion assay and colony count assay. We also investigated the mode of action of scolopendrasin V using flow cytometry. We found that scolopendrasin V's mechanism of action involved binding to the surface of microorganisms via a specific interaction with lipopolysaccharides, lipoteichoic acid, and peptidoglycans, which are components of the bacterial membrane. These results provide a basis for developing peptide antibiotics.

  12. Proteolytic Degradation of Human Antimicrobial Peptide LL-37 by Bacillus anthracis May Contribute to Virulence

    PubMed Central

    Thwaite, Joanne E.; Hibbs, Stephen; Titball, Richard W.; Atkins, Timothy P.


    In this paper we report on the susceptibilities of a range of Bacillus species to the human antimicrobial peptide LL-37. B. subtilis showed a low level of resistance to killing by LL-37 (50% growth-inhibitory concentration [GI50], 1 μg/ml). B. cereus and B. thuringiensis showed intermediate levels of resistance to killing (GI50s, 33 μg/ml and 37 μg/ml, respectively). B. anthracis showed the highest level of resistance (GI50s, 40 to 66 μg/ml). The degradation of LL-37 by B. anthracis culture supernatant was blocked by the metalloprotease inhibitors EDTA and 1,10-phenanthroline, and the gene encoding the protease responsible for LL-37 degradation was not plasmid borne. Our findings suggest that alongside the classical plasmid-based virulence determinants, extracellular metalloproteases of B. anthracis may play a role in survival in the host. PMID:16801407

  13. In Silico Template Selection of Short Antimicrobial Peptide Viscotoxin for Improving Its Antimicrobial Efficiency in Development of Potential Therapeutic Drugs.


    Senthilkumar, B; Rajasekaran, R


    Rapid increase in antibiotic resistance has posed a worldwide threat, due to increased mortality, morbidity, and expenditure caused by antibiotic-resistant microbes. Recent development of the antimicrobial peptides like viscotoxin (Vt) has been successfully comprehended as a substitute for classical antibiotics. A structurally stable peptide, Vt can enhance antimicrobial property and can be used for various developmental purposes. Thus, structural stability among the antimicrobial peptides, Vt A1 (3C8P), A2 (1JMN), A3 (1ED0), B (1JMP), and C (1ORL) of Viscus album was computationally analyzed. In specific, the static confirmation of VtA3 showed high number of intramolecular interactions, along with an increase in hydrophobicity than others comparatively. Further, conformational sampling was used to analyze various geometrical parameters such as root mean square deviation, root mean square fluctuation, radius of gyration, and ovality which also revealed the structural stability of VtA3. Moreover, the statistically validated contours of surface area, lipophilicity, and distance constraints of disulfide bonds also supported the priority of VtA3 with respect to stability. Finally, the functional activity of peptides was accessed by computing their free energy of membrane association and membrane interactions, which defined VtA3 as functionally stable. Currently, peptide-based antibiotics and nanoparticles have attracted the pharmaceutical industries for their potential therapeutic applications. Thereby, it is proposed that viscotoxin A3 (1ED0) could be used as a preeminent template for scaffolding potentially efficient antimicrobial peptide-based drugs and nanomaterials in future.

  14. An anti-infective synthetic peptide with dual antimicrobial and immunomodulatory activities

    PubMed Central

    Silva, O. N.; de la Fuente-Núñez, C.; Haney, E. F.; Fensterseifer, I. C. M.; Ribeiro, S. M.; Porto, W. F.; Brown, P.; Faria-Junior, C.; Rezende, T. M. B.; Moreno, S. E.; Lu, T. K.; Hancock, R. E. W.; Franco, O. L.


    Antibiotic-resistant infections are predicted to kill 10 million people per year by 2050, costing the global economy $100 trillion. Therefore, there is an urgent need to develop alternative technologies. We have engineered a synthetic peptide called clavanin-MO, derived from a marine tunicate antimicrobial peptide, which exhibits potent antimicrobial and immunomodulatory properties both in vitro and in vivo. The peptide effectively killed a panel of representative bacterial strains, including multidrug-resistant hospital isolates. Antimicrobial activity of the peptide was demonstrated in animal models, reducing bacterial counts by six orders of magnitude, and contributing to infection clearance. In addition, clavanin-MO was capable of modulating innate immunity by stimulating leukocyte recruitment to the site of infection, and production of immune mediators GM-CSF, IFN-γ and MCP-1, while suppressing an excessive and potentially harmful inflammatory response by increasing synthesis of anti-inflammatory cytokines such as IL-10 and repressing the levels of pro-inflammatory cytokines IL-12 and TNF-α. Finally, treatment with the peptide protected mice against otherwise lethal infections caused by both Gram-negative and -positive drug-resistant strains. The peptide presented here directly kills bacteria and further helps resolve infections through its immune modulatory properties. Peptide anti-infective therapeutics with combined antimicrobial and immunomodulatory properties represent a new approach to treat antibiotic-resistant infections. PMID:27804992

  15. Antimicrobial peptide control of pathogenic microorganisms of the oral cavity: a review of the literature.


    da Silva, Bruno Rocha; de Freitas, Victor Aragão Abreu; Nascimento-Neto, Luiz Gonzaga; Carneiro, Victor Alves; Arruda, Francisco Vassiliepe Sousa; de Aguiar, Andréa Silvia Walter; Cavada, Benildo Sousa; Teixeira, Edson Holanda


    Antimicrobial peptides, molecules produced in many different organisms, have high biocidal activity against several microorganisms. However, several questions about these molecules remain unclear. Therefore, this report details a systematic survey of the literature on the use of antimicrobial peptides against oral pathogens and indicates which peptides and microorganisms are most extensively studied. Articles were located using the PubMed and Science Direct databases with the following inclusion criteria: publication date between 2002 and 2011; keywords "biofilm OR biological film OR biological layer OR bacterial growth" AND "peptide" AND "oral cavity OR mouth OR buccal mucosa OR oral mucosa OR mouth mucosa"; and abstract in English. A total of 73 articles were selected after refinement of the data. An increase in publications focusing on the use of antimicrobial peptides against oral microorganisms was observed. In addition, the peptides produced by cells of the oral mucosa (defensins, LL-37 and histatins) as well as Streptococcus mutans (among cariogenic bacteria) and Porphyromonas gingivalis (among periodontal bacteria) were the most studied subjects. It was concluded that the use of antimicrobial peptides as a tool for microbial control is of increasing importance, likely due to its widespread use, mechanism of action, and low rates of bacterial resistance.

  16. Localization of antimicrobial peptides in the tunic of Ciona intestinalis (Ascidiacea, Tunicata) and their involvement in local inflammatory-like reactions

    PubMed Central

    Di Bella, M.A.; Fedders, H.; De Leo, G.; Leippe, M.


    Tunicates comprising a wide variety of different species synthesize antimicrobial peptides as important effector molecules of the innate immune system. Recently, two putative gene families coding for antimicrobial peptides were identified in the expressed sequence tag database of the tunicate Ciona intestinalis. Two synthetic peptides representing the cationic core region of one member of each of the families displayed potent antibacterial and antifungal activities. Moreover, the natural peptides were demonstrated to be synthesized and stored in distinct hemocyte types. Here, we investigated the presence of these natural peptides, namely Ci-MAM-A and Ci-PAP-A, in the tunic of C. intestinalis considering that the ascidian tunic is a body surface barrier exposed to constant microbial assault. Furthermore, as the tunic may represent a major route of entry for pathogen invasion after its damage we monitored the location of these peptides upon a local inflammatory-like reaction induced by injection of foreign cells. Using immunocytochemistry and electron microscopy both peptides were localized to the tunic and were massively present in granulocytes of inflamed tissue. Conclusively, antimicrobial peptides may constitute a chemical barrier within the tunic of urochordates. PMID:24371555

  17. Antimicrobial peptide exposure selects for Staphylococcus aureus resistance to human defence peptides

    PubMed Central

    Kubicek-Sutherland, Jessica Z.; Lofton, Hava; Vestergaard, Martin; Hjort, Karin; Ingmer, Hanne; Andersson, Dan I.


    Background The clinical development of antimicrobial peptides (AMPs) is currently under evaluation to combat the rapid increase in MDR bacterial pathogens. However, many AMPs closely resemble components of the human innate immune system and the ramifications of prolonged bacterial exposure to AMPs are not fully understood. Objectives We show that in vitro serial passage of a clinical USA300 MRSA strain in a host-mimicking environment containing host-derived AMPs results in the selection of stable AMP resistance. Methods Serial passage experiments were conducted using steadily increasing concentrations of LL-37, PR-39 or wheat germ histones. WGS and proteomic analysis by MS were used to identify the molecular mechanism associated with increased tolerance of AMPs. AMP-resistant mutants were characterized by measuring in vitro fitness, AMP and antibiotic susceptibility, and virulence in a mouse model of sepsis. Results AMP-resistant Staphylococcus aureus mutants often displayed little to no fitness cost and caused invasive disease in mice. Further, this phenotype coincided with diminished susceptibility to both clinically prescribed antibiotics and human defence peptides. Conclusions These findings suggest that therapeutic use of AMPs could select for virulent mutants with cross-resistance to human innate immunity as well as antibiotic therapy. Thus, therapeutic use of AMPs and the implications of cross-resistance need to be carefully monitored and evaluated. PMID:27650186

  18. Antimicrobial Peptides as Anti-biofilm Agents in Medical Implants.


    Sánchez-Gómez, Susana; Martínez-de-Tejada, Guillermo


    Biofilm-associated infections constitute a daunting threat to human health, since these pathologies increase patient mortality and morbidity, resulting in prolonged hospitalization periods and heavy economic losses. Moreover, these infections contribute to the increasing emergence and dissemination of antibiotic resistance in hospitals and in the community. Although biofilm-associated microorganisms can proliferate in healthy tissue, abiotic surfaces like those of medical implants greatly increase the likelihood of biofilm formation in the host. Due to their broad spectrum of bactericidal activity against multi-drug resistant microorganisms including metabolically inactive cells, antimicrobial peptides (AMPs) have great potential as anti-biofilm agents. In fact, a clinically available AMP, polymyxin E (colistin), frequently constitutes the drug of last recourse in biofilm-associated infections (e.g. cystic fibrosis) when resistance to all the other drugs arises. In this article, we outline the main strategies under development to combat biofilm-associated infections with an emphasis in the prevention of microbial colonization of medical implants. These approaches include the use of AMPs both for the development of anti-adhesive surface coatings and to kill biofilm-forming cells either on contact or via controlled release (leaching surfaces). Although in vitro results for all these applications are very encouraging, further research is needed to improve the anti-biofilm activity of these coatings in vivo. The possibility of exploiting the antibiotic potentiating activity of some AMPs and to combine several anti-biofilm mechanisms in tandem targeting the biofilm formation process at different stages is also discussed.

  19. Development of Antimicrobial Peptide Prediction Tool for Aquaculture Industries.


    Gautam, Aditi; Sharma, Asuda; Jaiswal, Sarika; Fatma, Samar; Arora, Vasu; Iquebal, M A; Nandi, S; Sundaray, J K; Jayasankar, P; Rai, Anil; Kumar, Dinesh


    Microbial diseases in fish, plant, animal and human are rising constantly; thus, discovery of their antidote is imperative. The use of antibiotic in aquaculture further compounds the problem by development of resistance and consequent consumer health risk by bio-magnification. Antimicrobial peptides (AMPs) have been highly promising as natural alternative to chemical antibiotics. Though AMPs are molecules of innate immune defense of all advance eukaryotic organisms, fish being heavily dependent on their innate immune defense has been a good source of AMPs with much wider applicability. Machine learning-based prediction method using wet laboratory-validated fish AMP can accelerate the AMP discovery using available fish genomic and proteomic data. Earlier AMP prediction servers are based on multi-phyla/species data, and we report here the world's first AMP prediction server in fishes. It is freely accessible at . A total of 151 AMPs related to fish collected from various databases and published literature were taken for this study. For model development and prediction, N-terminus residues, C-terminus residues and full sequences were considered. Best models were with kernels polynomial-2, linear and radial basis function with accuracy of 97, 99 and 97 %, respectively. We found that performance of support vector machine-based models is superior to artificial neural network. This in silico approach can drastically reduce the time and cost of AMP discovery. This accelerated discovery of lead AMP molecules having potential wider applications in diverse area like fish and human health as substitute of antibiotics, immunomodulator, antitumor, vaccine adjuvant and inactivator, and also for packaged food can be of much importance for industries.

  20. Multitasking antimicrobial peptides in plant development and host defense against biotic/abiotic stress.


    Goyal, Ravinder K; Mattoo, Autar K


    Crop losses due to pathogens are a major threat to global food security. Plants employ a multilayer defense against a pathogen including the use of physical barriers (cell wall), induction of hypersensitive defense response (HR), resistance (R) proteins, and synthesis of antimicrobial peptides (AMPs). Unlike a complex R gene-mediated immunity, AMPs directly target diverse microbial pathogens. Many a times, R-mediated immunity breaks down and plant defense is compromised. Although R-gene dependent pathogen resistance has been well studied, comparatively little is known about the interactions of AMPs with host defense and physiology. AMPs are ubiquitous, low molecular weight peptides that display broad spectrum resistance against bacteria, fungi and viruses. In plants, AMPs are mainly classified into cyclotides, defensins, thionins, lipid transfer proteins, snakins, and hevein-like vicilin-like and knottins. Genetic distance lineages suggest their conservation with minimal effect of speciation events during evolution. AMPs provide durable resistance in plants through a combination of membrane lysis and cellular toxicity of the pathogen. Plant hormones - gibberellins, ethylene, jasmonates, and salicylic acid, are among the physiological regulators that regulate the expression of AMPs. Transgenically produced AMP-plants have become a means showing that AMPs are able to mitigate host defense responses while providing durable resistance against pathogens.

  1. Antimicrobial Evaluation of Nocathiacins, a Thiazole Peptide Class of Antibiotics

    PubMed Central

    Pucci, Michael J.; Bronson, Joanne J.; Barrett, John F.; DenBleyker, Kenneth L.; Discotto, Linda F.; Fung-Tomc, Joan C.; Ueda, Yasutsugu


    Nocathiacins are cyclic thiazolyl peptides with inhibitory activity against gram-positive bacteria. BMS-249524 (nocathiacin I), identified from screening a library of compounds against a multiply antibiotic-resistant Enterococcus faecium strain, was used as a lead chemotype to obtain additional structurally related compounds. The MIC assay results of BMS-249524 and two more water-soluble derivatives, BMS-411886 and BMS-461996, revealed potent in vitro activities against a variety of gram-positive pathogens including methicillin-resistant Staphylococcus aureus, penicillin-resistant Streptococcus pneumoniae, vancomycin intermediate-resistant S. aureus, vancomycin-resistant enterococci, Mycobacterium tuberculosis and Mycobacterium avium. Analysis of killing kinetics revealed that these compounds are bactericidal for S. aureus with at least a 3-log10 reduction of bacterial growth within 6 h of exposure to four times the MICs. Nocathiacin-resistant mutants were characterized by DNA sequence analyses. The mutations mapped to the rplK gene encoding the L11 ribosomal protein in the 50S subunit in a region previously shown to be involved in the binding of related thiazolyl peptide antibiotics. These compounds demonstrated potential for further development as a new class of antibacterial agents with activity against key antibiotic-resistant gram-positive bacterial pathogens. PMID:15388422

  2. Sonorensin: an Antimicrobial Peptide, Belonging to the Heterocycloanthracin Subfamily of Bacteriocins, from a New Marine Isolate, Bacillus sonorensis MT93

    PubMed Central

    Chopra, Lipsy; Singh, Gurdeep; Choudhary, Vikas


    Marine environments are the greatest fronts of biodiversity, representing a resource of unexploited or unknown microorganisms and new substances having potential applications. Among microbial products, antimicrobial peptides (AMPs) have received great attention recently due to their applications as food preservatives and therapeutic agents. A new marine soil isolate producing an AMP was identified as Bacillus sonorensis based on 16S rRNA gene sequence analysis. It produced an AMP that showed a broad spectrum of activity against both Gram-positive and Gram-negative bacteria. The peptide, named sonorensin, was purified to homogeneity using a combination of chromatographic techniques. The intact molecular mass of the purified peptide, 6,274 Da, as revealed by matrix-assisted laser desorption ionization–time of flight (MALDI-TOF), was in agreement with Tricine-SDS-PAGE analysis. A PCR array of primers was used to identify AMP structural genes, which allowed the successful amplification of the related genes from strain MT93. The putative open reading frame of sonorensin was amplified, cloned into the pET-32a(+) vector, expressed as a thioredoxin (Trx) fusion protein in Escherichia coli, and then purified. Sequence alignment analysis revealed that the bacteriocin being reported could belong to new subfamily of bacteriocins, heterocycloanthracin. The peptide indicated its potential as a biocontrol agent or food antimicrobial agent, due to its antimicrobial activity against bacteria such as Listeria monocytogenes and Staphylococcus aureus. This is the first report of the production, purification, and characterization of wild-type and recombinant bacteriocin by B. sonorensis and the first bacteriocin of the heterocycloanthracin subfamily to be characterized. PMID:24610839

  3. Sonorensin: an antimicrobial peptide, belonging to the heterocycloanthracin subfamily of bacteriocins, from a new marine isolate, Bacillus sonorensis MT93.


    Chopra, Lipsy; Singh, Gurdeep; Choudhary, Vikas; Sahoo, Debendra K


    Marine environments are the greatest fronts of biodiversity, representing a resource of unexploited or unknown microorganisms and new substances having potential applications. Among microbial products, antimicrobial peptides (AMPs) have received great attention recently due to their applications as food preservatives and therapeutic agents. A new marine soil isolate producing an AMP was identified as Bacillus sonorensis based on 16S rRNA gene sequence analysis. It produced an AMP that showed a broad spectrum of activity against both Gram-positive and Gram-negative bacteria. The peptide, named sonorensin, was purified to homogeneity using a combination of chromatographic techniques. The intact molecular mass of the purified peptide, 6,274 Da, as revealed by matrix-assisted laser desorption ionization-time of flight (MALDI-TOF), was in agreement with Tricine-SDS-PAGE analysis. A PCR array of primers was used to identify AMP structural genes, which allowed the successful amplification of the related genes from strain MT93. The putative open reading frame of sonorensin was amplified, cloned into the pET-32a(+) vector, expressed as a thioredoxin (Trx) fusion protein in Escherichia coli, and then purified. Sequence alignment analysis revealed that the bacteriocin being reported could belong to new subfamily of bacteriocins, heterocycloanthracin. The peptide indicated its potential as a biocontrol agent or food antimicrobial agent, due to its antimicrobial activity against bacteria such as Listeria monocytogenes and Staphylococcus aureus. This is the first report of the production, purification, and characterization of wild-type and recombinant bacteriocin by B. sonorensis and the first bacteriocin of the heterocycloanthracin subfamily to be characterized.

  4. On the Functional Overlap between Complement and Anti-Microbial Peptides

    PubMed Central

    Zimmer, Jana; Hobkirk, James; Mohamed, Fatima; Browning, Michael J.; Stover, Cordula M.


    Intriguingly, activated complement and anti-microbial peptides share certain functionalities; lytic, phagocytic, and chemo-attractant activities and each may, in addition, exert cell instructive roles. Each has been shown to have distinct LPS detoxifying activity and may play a role in the development of endotoxin tolerance. In search of the origin of complement, a functional homolog of complement C3 involved in opsonization has been identified in horseshoe crabs. Horseshoe crabs possess anti-microbial peptides able to bind to acyl chains or phosphate groups/saccharides of endotoxin, LPS. Complement activity as a whole is detectable in marine invertebrates. These are also a source of anti-microbial peptides with potential pharmaceutical applicability. Investigating the locality for the production of complement pathway proteins and their role in modulating cellular immune responses are emerging fields. The significance of local synthesis of complement components is becoming clearer from in vivo studies of parenchymatous disease involving specifically generated, complement-deficient mouse lines. Complement C3 is a central component of complement activation. Its provision by cells of the myeloid lineage varies. Their effector functions in turn are increased in the presence of anti-microbial peptides. This may point to a potentiating range of activities, which should serve the maintenance of health but may also cause disease. Because of the therapeutic implications, this review will consider closely studies dealing with complement activation and anti-microbial peptide activity in acute inflammation (e.g., dialysis-related peritonitis, appendicitis, and ischemia). PMID:25646095

  5. Mechanism of action and specificity of antimicrobial peptides designed based on buforin IIb.


    Jang, Su A; Kim, Hyun; Lee, Ju Young; Shin, Ju Ri; Kim, Da Jung; Cho, Ju Hyun; Kim, Sun Chang


    Buforin IIb-a synthetic analog of buforin II that contains a proline hinge between the two α-helices and a model α-helical sequence at the C-terminus (3× RLLR)-is a potent cell-penetrating antimicrobial peptide. To develop novel antimicrobial peptides with enhanced activities and specificity/therapeutic index, we designed several analogs (Buf III analogs) by substitutions of amino acids in the proline hinge region and two α-helices of buforin IIb, and examined their antimicrobial activity and mechanism of action. The substitution of hydrophobic residues ([F(6)] and [V(8)]) in the proline hinge region with other hydrophobic residues ([W(6)] and [I(8)]) did not affect antimicrobial activity, while the substitution of the first four amino acids RAGL with a model α-helical sequence increased the antimicrobial activity up to 2-fold. Like buforin IIb, Buf III analogs penetrated the bacterial cell membranes without significantly permeabilizing them and were accumulated inside Escherichia coli. Buf III analogs were shown to bind DNA in vitro and the DNA binding affinity of the peptides correlated linearly with their antimicrobial potency. Among the Buf III analogs, the therapeutic index of Buf IIIb and IIIc (RVVRQWPIG[RVVR](3) and KLLKQWPIG[KLLK](3), respectively) were improved 7-fold compared to that of buforin IIb. These results indicate that Buf III analogs appear to be promising candidates for future development as novel antimicrobial agents.

  6. Characterization of unique amphipathic antimicrobial peptides from venom of the scorpion Pandinus imperator.

    PubMed Central

    Corzo, G; Escoubas, P; Villegas, E; Barnham, K J; He, W; Norton, R S; Nakajima, T


    Two novel antimicrobial peptides have been identified and characterized from venom of the African scorpion Pandinus imperator. The peptides, designated pandinin 1 and 2, are alpha-helical polycationic peptides, with pandinin 1 belonging to the group of antibacterial peptides previously described from scorpions, frogs and insects, and pandinin 2 to the group of short magainin-type helical peptides from frogs. Both peptides demonstrated high antimicrobial activity against a range of Gram-positive bacteria (2.4-5.2 microM), but were less active against Gram-negative bacteria (2.4-38.2 microM), and only pandinin 2 affected the yeast Candida albicans. Pandinin 2 also demonstrated strong haemolytic activity (11.1-44.5 microM) against sheep erythrocytes, in contrast with pandinin 1, which was not haemolytic. CD studies and a high-resolution structure of pandinin 2 determined by NMR, showed that the two peptides are both essentially helical, but differ in their overall structure. Pandinin 2 is composed of a single alpha-helix with a predominantly hydrophobic N-terminal sequence, whereas pandinin 1 consists of two distinct alpha-helices separated by a coil region of higher flexibility. This is the first report of magainin-type polycationic antimicrobial peptides in scorpion venom. Their presence brings new insights into the mode of action of scorpion venom and also opens new avenues for the discovery of novel antibiotic molecules from arthropod venoms. PMID:11563967

  7. Identification and rational design of novel antimicrobial peptides for plant protection.


    Marcos, Jose F; Muñoz, Alberto; Pérez-Payá, Enrique; Misra, Santosh; López-García, Belén


    Peptides and small proteins exhibiting antimicrobial activity have been isolated from many organisms ranging from insects to humans, including plants. Their role in defense is established, and their use in agriculture was already being proposed shortly after their discovery. However, some natural peptides have undesirable properties that complicate their application. Advances in peptide synthesis and high-throughput activity screening have made possible the de novo and rational design of novel peptides with improved properties. This review summarizes findings in the identification and design of short antimicrobial peptides with activity against plant pathogens, and will discuss alternatives for their heterologous production suited to plant disease control. Recent studies suggest that peptide antimicrobial action is not due solely to microbe permeation as previously described, but that more subtle factors might account for the specificity and absence of toxicity of some peptides. The elucidation of the mode of action and interaction with microbes will assist the improvement of peptide design with a view to targeting specific problems in agriculture and providing new tools for plant protection.

  8. Expression analysis and identification of antimicrobial peptide transcripts from six North American frog species

    USGS Publications Warehouse

    Robertson, Laura S.; Fellers, Gary M.; Marranca, Jamie Marie; Kleeman, Patrick M.


    Frogs secrete antimicrobial peptides onto their skin. We describe an assay to preserve and analyze antimicrobial peptide transcripts from field-collected skin secretions that will complement existing methods for peptide analysis. We collected skin secretions from 4 North American species in the field in California and 2 species in the laboratory. Most frogs appeared healthy after release; however, Rana boylii in the Sierra Nevada foothills, but not the Coast Range, showed signs of morbidity and 2 died after handling. The amount of total RNA extracted from skin secretions was higher in R. boylii and R. sierrae compared to R. draytonii, and much higher compared to Pseudacris regilla. Interspecies variation in amount of RNA extracted was not explained by size, but for P. regilla it depended upon collection site and date. RNA extracted from skin secretions from frogs handled with bare hands had poor quality compared to frogs handled with gloves or plastic bags. Thirty-four putative antimicrobial peptide precursor transcripts were identified. This study demonstrates that RNA extracted from skin secretions collected in the field is of high quality suitable for use in sequencing or quantitative PCR (qPCR). However, some species do not secrete profusely, resulting in very little extracted RNA. The ability to measure transcript abundance of antimicrobial peptides in field-collected skin secretions complements proteomic analyses and may provide insight into transcriptional mechanisms that could affect peptide abundance.

  9. Antimicrobial Peptides of Meat Origin - An In silico and In vitro Analysis.


    Keska, Paulina; Stadnik, Joanna


    The aim of this study was to evaluate the antimicrobial activity of meat protein-derived peptides against selected Gram-positive and Gram-negative bacteria. The in silico and in vitro approach was combined to determine the potency of antimicrobial peptides derived from pig (Sus scrofa) and cow (Bos taurus) proteins. The in silico studies consisted of an analysis of the amino acid composition of peptides obtained from the CAMPR database, their molecular weight and other physicochemical properties (isoelectric point, molar extinction coefficient, instability index, aliphatic index, hydropathy index and net charge). The degree of similarity was estimated between the antimicrobial peptide sequences derived from the slaughtered animals and the main meat proteins. Antimicrobial activity of peptides isolated from dry-cured meat products was analysed (in vitro) against two strains of pathogenic bacteria using the disc diffusion method. There was no evidence of growthinhibitory properties of peptides isolated from dry-cured meat products against Escherichia coli K12 ATCC 10798 and Staphylococcus aureus ATCC 25923.

  10. Purification and characterization of a plant antimicrobial peptide expressed in Escherichia coli.


    Harrison, S J; McManus, A M; Marcus, J P; Goulter, K C; Green, J L; Nielsen, K J; Craik, D J; Maclean, D J; Manners, J M


    MiAMP1 is a low-molecular-weight, cysteine-rich, antimicrobial peptide isolated from the nut kernel of Macadamia integrifolia. A DNA sequence encoding MiAMP1 with an additional ATG start codon was cloned into a modified pET vector under the control of the T7 RNA polymerase promoter. The pET vector was cotransformed together with the vector pSB161, which expresses a rare arginine tRNA. The peptide was readily isolated in high yield from the insoluble fraction of the Escherichia coli extract. The purified peptide was shown to have an identical molecular weight to the native peptide by mass spectroscopy indicating that the N-terminal methionine had been cleaved. Analysis by NMR spectroscopy indicated that the refolded recombinant peptide had a similar overall three-dimensional structure to that of the native peptide. The peptide inhibited the growth of phytopathogenic fungi in vitro in a similar manner to the native peptide. To our knowledge, MiAMP1 is the first antimicrobial peptide from plants to be functionally expressed in E. coli. This will permit a detailed structure-function analysis of the peptide and studies of its mode of action on phytopathogens.

  11. Antimicrobial Activity of Novel Synthetic Peptides Derived from Indolicidin and Ranalexin against Streptococcus pneumoniae

    PubMed Central

    Jindal, Hassan Mahmood; Le, Cheng Foh; Mohd Yusof, Mohd Yasim; Velayuthan, Rukumani Devi; Lee, Vannajan Sanghiran; Zain, Sharifuddin Md; Isa, Diyana Mohd; Sekaran, Shamala Devi


    Antimicrobial peptides (AMPs) represent promising alternatives to conventional antibiotics in order to defeat multidrug-resistant bacteria such as Streptococcus pneumoniae. In this study, thirteen antimicrobial peptides were designed based on two natural peptides indolicidin and ranalexin. Our results revealed that four hybrid peptides RN7-IN10, RN7-IN9, RN7-IN8, and RN7-IN6 possess potent antibacterial activity against 30 pneumococcal clinical isolates (MIC 7.81-15.62µg/ml). These four hybrid peptides also showed broad spectrum antibacterial activity (7.81µg/ml) against S. aureus, methicillin resistant S. aureus (MRSA), and E. coli. Furthermore, the time killing assay results showed that the hybrid peptides were able to eliminate S. pneumoniae within less than one hour which is faster than the standard drugs erythromycin and ceftriaxone. The cytotoxic effects of peptides were tested against human erythrocytes, WRL-68 normal liver cell line, and NL-20 normal lung cell line. The results revealed that none of the thirteen peptides have cytotoxic or hemolytic effects at their MIC values. The in silico molecular docking study was carried out to investigate the binding properties of peptides with three pneumococcal virulent targets by Autodock Vina. RN7IN6 showed a strong affinity to target proteins; autolysin, pneumolysin, and pneumococcal surface protein A (PspA) based on rigid docking studies. Our results suggest that the hybrid peptides could be suitable candidates for antibacterial drug development. PMID:26046345

  12. Antimicrobial Activity of Novel Synthetic Peptides Derived from Indolicidin and Ranalexin against Streptococcus pneumoniae.


    Jindal, Hassan Mahmood; Le, Cheng Foh; Mohd Yusof, Mohd Yasim; Velayuthan, Rukumani Devi; Lee, Vannajan Sanghiran; Zain, Sharifuddin Md; Isa, Diyana Mohd; Sekaran, Shamala Devi


    Antimicrobial peptides (AMPs) represent promising alternatives to conventional antibiotics in order to defeat multidrug-resistant bacteria such as Streptococcus pneumoniae. In this study, thirteen antimicrobial peptides were designed based on two natural peptides indolicidin and ranalexin. Our results revealed that four hybrid peptides RN7-IN10, RN7-IN9, RN7-IN8, and RN7-IN6 possess potent antibacterial activity against 30 pneumococcal clinical isolates (MIC 7.81-15.62µg/ml). These four hybrid peptides also showed broad spectrum antibacterial activity (7.81µg/ml) against S. aureus, methicillin resistant S. aureus (MRSA), and E. coli. Furthermore, the time killing assay results showed that the hybrid peptides were able to eliminate S. pneumoniae within less than one hour which is faster than the standard drugs erythromycin and ceftriaxone. The cytotoxic effects of peptides were tested against human erythrocytes, WRL-68 normal liver cell line, and NL-20 normal lung cell line. The results revealed that none of the thirteen peptides have cytotoxic or hemolytic effects at their MIC values. The in silico molecular docking study was carried out to investigate the binding properties of peptides with three pneumococcal virulent targets by Autodock Vina. RN7IN6 showed a strong affinity to target proteins; autolysin, pneumolysin, and pneumococcal surface protein A (PspA) based on rigid docking studies. Our results suggest that the hybrid peptides could be suitable candidates for antibacterial drug development.

  13. Membrane interactions and biological activity of antimicrobial peptides from Australian scorpion.


    Luna-Ramírez, Karen; Sani, Marc-Antoine; Silva-Sanchez, Jesus; Jiménez-Vargas, Juana María; Reyna-Flores, Fernando; Winkel, Kenneth D; Wright, Christine E; Possani, Lourival D; Separovic, Frances


    UyCT peptides are antimicrobial peptides isolated from the venom of the Australian scorpion. The activity of the UyCT peptides against Gram positive and Gram negative bacteria and red blood cells was determined. The membrane interactions of these peptides were evaluated by dye release (DR) of the fluorophore calcein from liposomes and isothermal titration calorimetry (ITC); and their secondary structure was determined by circular dichroism (CD). Three different lipid systems were used to mimic red blood cells, Escherichia coli and Staphylococcus aureus membranes. UyCT peptides exhibited broad spectrum antimicrobial activity with low MIC for S. aureus and multi-drug resistant Gram negative strains. Peptide combinations showed some synergy enhancing their potency but not hemolytic activity. The UyCT peptides adopted a helical structure in lipid environments and DR results confirmed that the mechanism of action is by disrupting the membrane. ITC data indicated that UyCT peptides preferred prokaryotic rather than eukaryotic membranes. The overall results suggest that UyCT peptides could be pharmaceutical leads for the treatment of Gram negative multiresistant bacterial infections, especially against Acinetobacter baumanni, and candidates for peptidomimetics to enhance their potency and minimize hemolysis. This article is part of a Special Issue entitled: Interfacially Active Peptides and Proteins. Guest Editors: William C. Wimley and Kalina Hristova.

  14. Use of Galerina marginata genes and proteins for peptide production


    Hallen-Adams, Heather E.; Scott-Craig, John S.; Walton, Jonathan D.; Luo, Hong


    The present invention relates to compositions and methods comprising genes and peptides associated with cyclic peptides and cyclic peptide production in mushrooms. In particular, the present invention relates to using genes and proteins from Galerina species encoding peptides specifically relating to amatoxins in addition to proteins involved with processing cyclic peptide toxins. In a preferred embodiment, the present invention also relates to methods for making small peptides and small cyclic peptides including peptides similar to amanitin. Further, the present inventions relate to providing kits for making small peptides.

  15. Use of Galerina marginata genes and proteins for peptide production


    Hallen-Adams, Heather E.; Scott-Craig, John S.; Walton, Jonathan D.; Luo, Hong


    The present invention relates to compositions and methods comprising genes and peptides associated with cyclic peptides and cyclic peptide production in mushrooms. In particular, the present invention relates to using genes and proteins from Galerina species encoding peptides specifically relating to amatoxins in addition to proteins involved with processing cyclic peptide toxins. In a preferred embodiment, the present invention also relates to methods for making small peptides and small cyclic peptides including peptides similar to amanitin. Further, the present inventions relate to providing kits for making small peptides.

  16. Sex, offspring and carcass determine antimicrobial peptide expression in the burying beetle

    PubMed Central

    Jacobs, Chris G. C.; Steiger, Sandra; Heckel, David G.; Wielsch, Natalie; Vilcinskas, Andreas; Vogel, Heiko


    The burying beetle Nicrophorus vespilloides has emerged as a model system for the investigation of adaptations that allow the utilization of carrion as a diet and as a resource for reproduction. The survival of beetles and their offspring given their exposure to soil-dwelling and cadaver-borne microbes requires mechanisms that reduce bacterial contamination in the diet and that achieve sanitation of the microhabitat. To explore the role of antimicrobial peptides (AMPs) in this context, we analyzed burying beetle males and females at different stages of their breeding cycle using the RNA-Seq and proteomics approaches. To address variation in immune functions, we investigated the impact of adult sex, the presence or absence of offspring (social context), and the presence of carrion (environmental context) on the expression of the identified immune effector genes. We found that particular AMPs are sex-specific and tightly regulated by the presence of a carcass or offspring and identified the two most context-dependent antimicrobial proteins in anal secretions. The context-specific expression dynamics of particular AMPs and lysozymes reveals a complex regulatory system, reflecting adaptations to specific ecological niches. This study highlights how burying beetles cope with microorganisms found on carrion and identifies candidates for both internal and external immunity. PMID:27139635

  17. Antimicrobial Peptides as Potential Alternatives to Antibiotics in Food Animal Industry.


    Wang, Shuai; Zeng, Xiangfang; Yang, Qing; Qiao, Shiyan


    Over the last decade, the rapid emergence of multidrug-resistant pathogens has become a global concern, which has prompted the search for alternative antibacterial agents for use in food animals. Antimicrobial peptides (AMPs), produced by bacteria, insects, amphibians and mammals, as well as by chemical synthesis, are possible candidates for the design of new antimicrobial agents because of their natural antimicrobial properties and a low propensity for development of resistance by microorganisms. This manuscript reviews the current knowledge of the basic biology of AMPs and their applications in non-ruminant nutrition. Antimicrobial peptides not only have broad-spectrum activity against bacteria, fungi, and viruses but also have the ability to bypass the common resistance mechanisms that are placing standard antibiotics in jeopardy. In addition, AMPs have beneficial effects on growth performance, nutrient digestibility, intestinal morphology and gut microbiota in pigs and broilers. Therefore, AMPs have good potential as suitable alternatives to conventional antibiotics used in swine and poultry industries.

  18. Oral inflammation, a role for antimicrobial peptide modulation of cytokine and chemokine responses.


    Brogden, Kim A; Johnson, Georgia K; Vincent, Steven D; Abbasi, Taher; Vali, Shireen


    Acute and chronic inflammation commonly occurs throughout the oral cavity. The most common causes are physical damage and microbial infections, and less frequently immune reactions and malignant changes. All of these processes result in the induction of antimicrobial peptides, chemokines and cytokines that lead to cellular infiltrates, a vascular response, tissue destruction and cellular proliferation. A fascinating concept developing in the current literature suggests that antimicrobial peptides modulate the production of chemokines, cytokines and other cellular mediators and that this may have a larger ramification as an underlying mechanism mediating inflammation. Here, we propose that the ability of antimicrobial peptides to induce chemokines and anti-inflammatory or proinflammatory cytokines plays an important role in the early events of oral inflammation and may be a target for the prevention or treatment of oral inflammatory conditions.

  19. Self-assembly of cationic multidomain peptide hydrogels: supramolecular nanostructure and rheological properties dictate antimicrobial activity

    NASA Astrophysics Data System (ADS)

    Jiang, Linhai; Xu, Dawei; Sellati, Timothy J.; Dong, He


    Hydrogels are an important class of biomaterials that have been widely utilized for a variety of biomedical/medical applications. The biological performance of hydrogels, particularly those used as wound dressing could be greatly advanced if imbued with inherent antimicrobial activity capable of staving off colonization of the wound site by opportunistic bacterial pathogens. Possessing such antimicrobial properties would also protect the hydrogel itself from being adversely affected by microbial attachment to its surface. We have previously demonstrated the broad-spectrum antimicrobial activity of supramolecular assemblies of cationic multi-domain peptides (MDPs) in solution. Here, we extend the 1-D soluble supramolecular assembly to 3-D hydrogels to investigate the effect of the supramolecular nanostructure and its rheological properties on the antimicrobial activity of self-assembled hydrogels. Among designed MDPs, the bactericidal activity of peptide hydrogels was found to follow an opposite trend to that in solution. Improved antimicrobial activity of self-assembled peptide hydrogels is dictated by the combined effect of supramolecular surface chemistry and storage modulus of the bulk materials, rather than the ability of individual peptides/peptide assemblies to penetrate bacterial cell membrane as observed in solution. The structure-property-activity relationship developed through this study will provide important guidelines for designing biocompatible peptide hydrogels with built-in antimicrobial activity for various biomedical applications.Hydrogels are an important class of biomaterials that have been widely utilized for a variety of biomedical/medical applications. The biological performance of hydrogels, particularly those used as wound dressing could be greatly advanced if imbued with inherent antimicrobial activity capable of staving off colonization of the wound site by opportunistic bacterial pathogens. Possessing such antimicrobial properties would

  20. The sulfolobicin genes of Sulfolobus acidocaldarius encode novel antimicrobial proteins.


    Ellen, Albert F; Rohulya, Olha V; Fusetti, Fabrizia; Wagner, Michaela; Albers, Sonja-Verena; Driessen, Arnold J M


    Crenarchaea, such as Sulfolobus acidocaldarius and Sulfolobus tokodaii, produce antimicrobial proteins called sulfolobicins. These antimicrobial proteins inhibit the growth of closely related species. Here we report the identification of the sulfolobicin-encoding genes in S. acidocaldarius. The active sulfolobicin comprises two proteins that are equipped with a classical signal sequence. These proteins are secreted by the cells and found to be membrane vesicle associated. Gene inactivation studies demonstrate that both proteins are required for the bacteriostatic antimicrobial activity. Sulfolobicins constitute a novel class of antimicrobial proteins without detectable homology to any other protein.

  1. Characterization of two antimicrobial peptides produced by a halotolerant Bacillus subtilis strain SK.DU.4 isolated from a rhizosphere soil sample

    PubMed Central


    A bacterial strain producing two antimicrobial peptides was isolated from a rhizosphere soil sample and identified as Bacillus subtilis based on both phenotypic and 16S rRNA gene sequence phylogenetic analysis. It grew optimally up to 14% NaCl and produced antimicrobial peptide within 24 h of growth. The peptides were purified using a combination of chemical extraction and chromatographic techniques. The MALDI-TOF analysis of HPLC purified fractions revealed that the strain SK.DU.4 secreted a bacteriocin-like peptide with molecular mass of 5323.9 Da and a surface-active lipopeptide (m/z 1056 Da). The peptide mass fingerprinting of low-molecular-weight bacteriocin exhibited significant similarity with stretches of secreted lipoprotein of Methylomicrobium album BG8 and displayed 70% sequence coverage. MALDI MS/MS analysis elucidated the lipopeptide as a cyclic lipopeptide with a β-hydroxy fatty acid linked to Ser of a peptide with seven α-amino acids (Asp-Tyr-Asn-Gln-Pro-Asn-Ser) and assigned it to iturin-like group of antimicrobial biosurfactants. However, it differed in amino acid composition with other members of the iturin family. Both peptides were active against Gram-positive bacteria, suggesting that they had an additive effect. PMID:23289832

  2. The coordinated Response of the Physical and Antimicrobial Peptide Barriers of the Skin

    PubMed Central

    Borkowski, Andrew W.; Gallo, Richard L.


    Antimicrobial peptides (AMPs) are an essential and multifunctional element for immune defense of the skin during infection and injury. In this issue, Ahrens et al. characterize the response of β-defensins, a class of AMPs, following acute and chronic challenges to the permeability barrier of the skin. Their findings suggest that the antimicrobial and permeability barriers of the skin are closely linked. PMID:21228809

  3. Antimicrobial functionalization of silicone surfaces with engineered short peptides having broad spectrum antimicrobial and salt-resistant properties.


    Li, Xiang; Li, Peng; Saravanan, Rathi; Basu, Anindya; Mishra, Biswajit; Lim, Suo Hon; Su, Xiaodi; Tambyah, Paul Anantharajah; Leong, Susanna Su Jan


    Catheter-associated urinary tract infections (CAUTIs) are often preceded by pathogen colonization on catheter surfaces and are a major health threat facing hospitals worldwide. Antimicrobial peptides (AMPs) are a class of new antibiotics that hold promise in curbing CAUTIs caused by antibiotic-resistant pathogens. This study aims to systematically evaluate the feasibility of immobilizing two newly engineered arginine/lysine/tryptophan-rich AMPs with broad antimicrobial spectra and salt-tolerant properties on silicone surfaces to address CAUTIs. The peptides were successfully immobilized on polydimethylsiloxane and urinary catheter surfaces via an allyl glycidyl ether (AGE) polymer brush interlayer, as confirmed by X-ray photoelectron spectroscopy and water contact angle analyses. The peptide-coated silicone surfaces exhibited excellent microbial killing activity towards bacteria and fungi in urine and in phosphate-buffered saline. Although both the soluble and immobilized peptides demonstrated membrane disruption capabilities, the latter showed a slower rate of kill, presumably due to reduced diffusivity and flexibility resulting from conjugation to the polymer brush. The synergistic effects of the AGE polymer brush and AMPs prevented biofilm formation by repelling cell adhesion. The peptide-coated surface showed no toxicity towards smooth muscle cells. The findings of this study clearly indicate the potential for the development of AMP-based coating platforms to prevent CAUTIs.

  4. Antimicrobial Peptide Structure and Mechanism of Action: A Focus on the Role of Membrane Structure.


    Lee, Tzong-Hsien; Hall, Kristopher N; Aguilar, Marie-Isabel


    Antimicrobial peptides (AMPs) are showing increasing promise as potential candidate antibacterial drugs in the face of the rapidly emerging bacterial resistance to conventional antibiotics in recent years. The target of these peptides is the microbial membrane and there are numerous models to explain their mechanism of action ranging from pore formation to general membrane disruption. The interaction between the AMP and the target membrane is critical to the specificity and activity of these peptides. However, a precise understanding of the relationship between antimicrobial peptide structure and their cytolytic function in a range of organisms is still lacking. This is a result of the complex nature of the interactions of AMPs with the cell membrane, the mechanism of which can vary considerably between different classes of antimicrobia peptides. A wide range of biophysical techniques have been used to study the influence of a number of peptide and membrane properties on the cytolytic activity of these peptides in model membrane systems. Central to characterisation of this interaction is a quantitative analysis of the binding of peptide to the membrane and the coherent dynamic changes in membrane structure. Recently, dual polarization interferometry has been used to perform an in depth analysis of antimicrobial peptide induced membrane perturbation and with new mass-structure co-fitting kinetic analysis have allowed a real-time label free analysis of binding affinity and kinetics. We review these studies which describe multi-step mechanisms which are adopted by various AMPs in nature and may advance our approach to the development of a new generation of effective antimicrobial therapeutics.

  5. Antimicrobial properties of analgesic kyotorphin peptides unraveled through atomic force microscopy

    SciTech Connect

    Ribeiro, Marta M.B.; Franquelim, Henri G.; Torcato, Ines M.; Ramu, Vasanthakumar G.; Heras, Montserrat; Bardaji, Eduard R.; Castanho, Miguel A.R.B.


    Highlights: Black-Right-Pointing-Pointer New kyotorphin derivatives have antimicrobial properties against S. aureus. Black-Right-Pointing-Pointer Atomic force microscopy show membrane disturbing effects of KTP-NH{sub 2} and IbKTP-NH{sub 2}. Black-Right-Pointing-Pointer None of the KTP derivatives are hemolytic. Black-Right-Pointing-Pointer The minimal peptidic sequence with antimicrobial activity is Tyr-Arg, if amidated. -- Abstract: Antimicrobial peptides (AMPs) are promising candidates as alternatives to conventional antibiotics for the treatment of resistant pathogens. In the last decades, new AMPs have been found from the cleavage of intact proteins with no antibacterial activity themselves. Bovine hemoglobin hydrolysis, for instance, results in AMPs and the minimal antimicrobial peptide sequence was defined as Tyr-Arg plus a positively charged amino acid residue. The Tyr-Arg dipeptide alone, known as kyotorphin (KTP), is an endogenous analgesic neuropeptide but has no antimicrobial activity itself. In previous studies new KTP derivatives combining C-terminal amidation and Ibuprofen (Ib) - KTP-NH{sub 2}, IbKTP, IbKTP-NH{sub 2} - were designed in order to improve KTP brain targeting. Those modifications succeeded in enhancing peptide-cell membrane affinity towards fluid anionic lipids and higher analgesic activity after systemic injection resulted therefrom. Here, we investigated if this affinity for anionic lipid membranes also translates into antimicrobial activity because bacteria have anionic membranes. Atomic force microscopy revealed that KTP derivatives perturbed Staphylococcus aureus membrane structure by inducing membrane blebbing, disruption and lysis. In addition, these peptides bind to red blood cells but are non-hemolytic. From the KTP derivatives tested, amidated KTP proves to be the most active antibacterial agent. The combination of analgesia and antibacterial activities with absence of toxicity is highly appealing from the clinical point of view

  6. Biofilms from Klebsiella pneumoniae: Matrix Polysaccharide Structure and Interactions with Antimicrobial Peptides

    PubMed Central

    Benincasa, Monica; Lagatolla, Cristina; Dolzani, Lucilla; Milan, Annalisa; Pacor, Sabrina; Liut, Gianfranco; Tossi, Alessandro; Cescutti, Paola; Rizzo, Roberto


    Biofilm matrices of two Klebsiella pneumoniae clinical isolates, KpTs101 and KpTs113, were investigated for their polysaccharide composition and protective effects against antimicrobial peptides. Both strains were good biofilm producers, with KpTs113 forming flocs with very low adhesive properties to supports. Matrix exopolysaccharides were isolated and their monosaccharide composition and glycosidic linkage types were defined. KpTs101 polysaccharide is neutral and composed only of galactose, in both pyranose and furanose ring configurations. Conversely, KpTs113 polysaccharide is anionic due to glucuronic acid units, and also contains glucose and mannose residues. The susceptibility of the two strains to two bovine cathelicidin antimicrobial peptides, BMAP-27 and Bac7(1–35), was assessed using both planktonic cultures and biofilms. Biofilm matrices exerted a relevant protection against both antimicrobials, which act with quite different mechanisms. Similar protection was also detected when antimicrobial peptides were tested against planktonic bacteria in the presence of the polysaccharides extracted from KpTs101 and KpTs113 biofilms, suggesting sequestering adduct formation with antimicrobials. Circular dichroism experiments on BMAP-27 in the presence of increasing amounts of either polysaccharide confirmed their ability to interact with the peptide and induce an α-helical conformation. PMID:27681920

  7. Biofilms from Klebsiella pneumoniae: Matrix Polysaccharide Structure and Interactions with Antimicrobial Peptides.


    Benincasa, Monica; Lagatolla, Cristina; Dolzani, Lucilla; Milan, Annalisa; Pacor, Sabrina; Liut, Gianfranco; Tossi, Alessandro; Cescutti, Paola; Rizzo, Roberto


    Biofilm matrices of two Klebsiella pneumoniae clinical isolates, KpTs101 and KpTs113, were investigated for their polysaccharide composition and protective effects against antimicrobial peptides. Both strains were good biofilm producers, with KpTs113 forming flocs with very low adhesive properties to supports. Matrix exopolysaccharides were isolated and their monosaccharide composition and glycosidic linkage types were defined. KpTs101 polysaccharide is neutral and composed only of galactose, in both pyranose and furanose ring configurations. Conversely, KpTs113 polysaccharide is anionic due to glucuronic acid units, and also contains glucose and mannose residues. The susceptibility of the two strains to two bovine cathelicidin antimicrobial peptides, BMAP-27 and Bac7(1-35), was assessed using both planktonic cultures and biofilms. Biofilm matrices exerted a relevant protection against both antimicrobials, which act with quite different mechanisms. Similar protection was also detected when antimicrobial peptides were tested against planktonic bacteria in the presence of the polysaccharides extracted from KpTs101 and KpTs113 biofilms, suggesting sequestering adduct formation with antimicrobials. Circular dichroism experiments on BMAP-27 in the presence of increasing amounts of either polysaccharide confirmed their ability to interact with the peptide and induce an α-helical conformation.

  8. Caseins from bovine colostrum and milk strongly bind piscidin-1, an antimicrobial peptide from fish.


    Kütt, Mary-Liis; Stagsted, Jan


    A model system of bovine colostrum and piscidin, a fish-derived antimicrobial peptide, was developed to study potential interactions of antimicrobial peptides in colostrum. We did not detect any antimicrobial activity of colostrum using the radial plate diffusion assay; in fact colostrum completely abrogated activity of added piscidin. This could not be explained by degradation of piscidin by colostrum, which was less than ten percent. We found that colostrum even protected piscidin against degradation by added proteases. We further observed that colostrum and milk rapidly quenched the fluorescence of fluorescein-piscidin but not that of fluorescein. This effect was not seen with BSA and the specific quenching of fluorescein-piscidin by colostrum was saturably inhibited with unlabeled piscidin. Size exclusion chromatography indicated that fluorescein-piscidin bound to casein micelles with no apparent binding to IgG or whey proteins. Further, addition of pure caseins was able to quench fluorescence of fluorescein-piscidin and to inhibit the antimicrobial activity of piscidin. The interaction between caseins and piscidin could be dissociated by guanidine hydrochloride and recovered piscidin had antimicrobial activity against bacteria. Based on our results we propose that caseins could be carriers for antimicrobial peptides in colostrum and milk.

  9. Recombinant probiotics with antimicrobial peptides: a dual strategy to improve immune response in immunocompromised patients.


    Mandal, Santi M; Silva, Osmar N; Franco, Octavio L


    Bacterial infectious diseases are currently a serious health problem, especially in patients compromised by illness or those receiving immune-suppressant drugs. In this context, it is not only essential to improve the understanding of infectious mechanisms and host response but also to discover novel therapies with extreme urgency. Probiotics and antimicrobial peptides are also favorably viewed as novel strategies in the control of resistant bacteria. The present review will shed some light on the use of probiotic microorganisms expressing antimicrobial peptides as a dual therapy to control bacterial infectious diseases.

  10. Synthetic mimic of antimicrobial peptide with nonmembrane-disrupting antibacterial properties.


    Gabriel, Gregory J; Madkour, Ahmad E; Dabkowski, Jeffrey M; Nelson, Christopher F; Nüsslein, Klaus; Tew, Gregory N


    Polyguanidinium oxanorbornene ( PGON) was synthesized from norbornene monomers via ring-opening metathesis polymerization. This polymer was observed to be strongly antibacterial against Gram-negative and Gram-positive bacteria as well as nonhemolytic against human red blood cells. Time-kill studies indicated that this polymer is lethal and not just bacteriostatic. In sharp contrast to previously reported SMAMPs (synthetic mimics of antimicrobial peptides), PGON did not disrupt membranes in vesicle-dye leakage assays and microscopy experiments. The unique biological properties of PGON, in same ways similar to cell-penetrating peptides, strongly encourage the examination of other novel guanidino containing macromolecules as powerful and selective antimicrobial agents.

  11. Synthetic Mimic of Antimicrobial Peptide with Nonmembrane-Disrupting Antibacterial Properties

    PubMed Central


    Polyguanidinium oxanorbornene (PGON) was synthesized from norbornene monomers via ring-opening metathesis polymerization. This polymer was observed to be strongly antibacterial against Gram-negative and Gram-positive bacteria as well as nonhemolytic against human red blood cells. Time-kill studies indicated that this polymer is lethal and not just bacteriostatic. In sharp contrast to previously reported SMAMPs (synthetic mimics of antimicrobial peptides), PGON did not disrupt membranes in vesicle-dye leakage assays and microscopy experiments. The unique biological properties of PGON, in same ways similar to cell-penetrating peptides, strongly encourage the examination of other novel guanidino containing macromolecules as powerful and selective antimicrobial agents. PMID:18850741

  12. Reflections on a systematic nomenclature for antimicrobial peptides from the skins of frogs of the family Ranidae.


    Conlon, J Michael


    Frogs belonging to the extensive family Ranidae represent a valuable source of antimicrobial peptides with therapeutic potential but there is currently no consistent system of nomenclature to describe these peptides. Terminology based solely on species name does not reflect the evolutionary relationships existing between peptides encoded by orthologous and paralogous genes. On the basis of limited structural similarity, at least 14 well-established peptide families have been identified (brevinin-1, brevinin-2, esculentin-1, esculentin-2, japonicin-1, japonicin-2, nigrocin-2, palustrin-1, palustrin-2, ranacyclin, ranalexin, ranatuerin-1, ranatuerin-2, temporin). It is proposed that terms that are synonymous with these names should no longer be used. Orthologous peptides from different species may be characterized by the initial letter of that species, set in upper case, with paralogs belonging to the same peptide family being assigned letters set in lower case, e.g. brevinin-1Pa, brevinin-1Pb, etc. When two species begin with the same initial letter, two letters may be used, e.g. P for pipiens and PL for palustris. Species names and assignments to genera may be obtained from Amphibian Species of the World Electronic Database, accessible at American Museum of Natural History, New York, USA.

  13. Surveying the potential of secreted antimicrobial peptides to enhance plant disease resistance.


    Breen, Susan; Solomon, Peter S; Bedon, Frank; Vincent, Delphine


    Antimicrobial peptides (AMPs) are natural products found across diverse taxa as part of the innate immune system against pathogen attacks. Some AMPs are synthesized through the canonical gene expression machinery and are called ribosomal AMPs. Other AMPs are assembled by modular enzymes generating nonribosomal AMPs and harbor unusual structural diversity. Plants synthesize an array of AMPs, yet are still subject to many pathogen invasions. Crop breeding programs struggle to release new cultivars in which complete disease resistance is achieved, and usually such resistance becomes quickly overcome by the targeted pathogens which have a shorter generation time. AMPs could offer a solution by exploring not only plant-derived AMPs, related or unrelated to the crop of interest, but also non-plant AMPs produced by bacteria, fungi, oomycetes or animals. This review highlights some promising candidates within the plant kingdom and elsewhere, and offers some perspectives on how to identify and validate their bioactivities. Technological advances, particularly in mass spectrometry (MS) and nuclear magnetic resonance (NMR), have been instrumental in identifying and elucidating the structure of novel AMPs, especially nonribosomal peptides which cannot be identified through genomics approaches. The majority of non-plant AMPs showing potential for plant disease immunity are often tested using in vitro assays. The greatest challenge remains the functional validation of candidate AMPs in plants through transgenic experiments, particularly introducing nonribosomal AMPs into crops.

  14. Surveying the potential of secreted antimicrobial peptides to enhance plant disease resistance

    PubMed Central

    Breen, Susan; Solomon, Peter S.; Bedon, Frank; Vincent, Delphine


    Antimicrobial peptides (AMPs) are natural products found across diverse taxa as part of the innate immune system against pathogen attacks. Some AMPs are synthesized through the canonical gene expression machinery and are called ribosomal AMPs. Other AMPs are assembled by modular enzymes generating nonribosomal AMPs and harbor unusual structural diversity. Plants synthesize an array of AMPs, yet are still subject to many pathogen invasions. Crop breeding programs struggle to release new cultivars in which complete disease resistance is achieved, and usually such resistance becomes quickly overcome by the targeted pathogens which have a shorter generation time. AMPs could offer a solution by exploring not only plant-derived AMPs, related or unrelated to the crop of interest, but also non-plant AMPs produced by bacteria, fungi, oomycetes or animals. This review highlights some promising candidates within the plant kingdom and elsewhere, and offers some perspectives on how to identify and validate their bioactivities. Technological advances, particularly in mass spectrometry (MS) and nuclear magnetic resonance (NMR), have been instrumental in identifying and elucidating the structure of novel AMPs, especially nonribosomal peptides which cannot be identified through genomics approaches. The majority of non-plant AMPs showing potential for plant disease immunity are often tested using in vitro assays. The greatest challenge remains the functional validation of candidate AMPs in plants through transgenic experiments, particularly introducing nonribosomal AMPs into crops. PMID:26579150

  15. Antimicrobial activity and mechanism of PDC213, an endogenous peptide from human milk.


    Sun, Yazhou; Zhou, Yahui; Liu, Xiao; Zhang, Fan; Yan, Linping; Chen, Ling; Wang, Xing; Ruan, Hongjie; Ji, Chenbo; Cui, Xianwei; Wang, Jiaqin


    Human milk has always been considered an ideal source of elemental nutrients to both preterm and full term infants in order to optimally develop the infant's tissues and organs. Recently, hundreds of endogenous milk peptides were identified in human milk. These peptides exhibited angiotensin-converting enzyme inhibition, immunomodulation, or antimicrobial activity. Here, we report the antimicrobial activity and mechanism of a novel type of human antimicrobial peptide (AMP), termed PDC213 (peptide derived from β-Casein 213-226 aa). PDC213 is an endogenous peptide and is present at higher levels in preterm milk than in full term milk. The inhibitory concentration curve and disk diffusion tests showed that PDC213 had obvious antimicrobial against S. aureus and Y. enterocolitica, the common nosocomial pathogens in neonatal intensive care units (NICUs). Fluorescent dye methods, electron microscopy experiments and DNA-binding activity assays further indicated that PDC213 can permeabilize bacterial membranes and cell walls rather than bind intracellular DNA to kill bacteria. Together, our results suggest that PDC213 is a novel type of AMP that warrants further investigation.

  16. Conformational study of melectin and antapin antimicrobial peptides in model membrane environments

    NASA Astrophysics Data System (ADS)

    Kocourková, Lucie; Novotná, Pavlína; Čujová, Sabína; Čeřovský, Václav; Urbanová, Marie; Setnička, Vladimír


    Antimicrobial peptides have long been considered as promising compounds against drug-resistant pathogens. In this work, we studied the secondary structure of antimicrobial peptides melectin and antapin using electronic (ECD) and vibrational circular dichroism (VCD) spectroscopies that are sensitive to peptide secondary structures. The results from quantitative ECD spectral evaluation by Dichroweb and CDNN program and from the qualitative evaluation of the VCD spectra were compared. The antimicrobial activity of the selected peptides depends on their ability to adopt an amphipathic α-helical conformation on the surface of the bacterial membrane. Hence, solutions of different zwitterionic and negatively charged liposomes and micelles were used to mimic the eukaryotic and bacterial biological membranes. The results show a significant content of α-helical conformation in the solutions of negatively charged liposomes mimicking the bacterial membrane, thus correlating with the antimicrobial activity of the studied peptides. On the other hand in the solutions of zwitterionic liposomes used as models of the eukaryotic membranes, the fraction of α-helical conformation was lower, which corresponds with their moderate hemolytic activity.

  17. Activity of a novel-designed antimicrobial peptide and its interaction with lipids.


    Yu, Lanlan; Fan, Qiannan; Yue, Xiu; Mao, Yexuan; Qu, Lingbo


    A new antimicrobial peptide l-RW containing double amphipathic binding sequences was designed, and its biological activities were investigated in the present study. L-RW showed antibacterial activity against several bacterial strains but low cytotoxicity to mammalian cells and low hemolytic activity to red blood cells, which makes it a potential and promising peptide for further development. Microscale thermophoresis (MST), a new technique, was applied to study the antimicrobial peptide-lipid interaction for the first time, which examined the binding affinities of this new antimicrobial peptide to various lipids, including different phospholipids, mixture lipids and bacterial lipid extracts. The results demonstrated that l-RW bound preferentially to negatively charged lipids over neutral lipids, which was consistent with the biological activities, revealing the important role of electrostatic interaction in the binding process. L-RW also showed higher binding affinity for lipid extract from Staphyloccocus aureus compared with Pseudomonas aeruginosa and Escherichia coli, which were in good agreement with the higher antibacterial activity against S. aureus than P. aeruginosa and E. coli, suggesting that the binding affinity is capable to predict the antibacterial activity to some extent. Additionally, the binding of l-RW to phospholipids was also performed in fetal bovine serum solution by MST, which revealed that the components in biological solution may have interference with the binding event. The results proved that MST is a useful and potent tool in antimicrobial peptide-lipid interaction investigation.

  18. Characterization of Histone H2A Derived Antimicrobial Peptides, Harriottins, from Sicklefin Chimaera Neoharriotta pinnata (Schnakenbeck, 1931) and Its Evolutionary Divergence with respect to CO1 and Histone H2A.


    Sathyan, Naveen; Philip, Rosamma; Chaithanya, E R; Anil Kumar, P R; Sanjeevan, V N; Singh, I S Bright


    Antimicrobial peptides (AMPs) are humoral innate immune components of fishes that provide protection against pathogenic infections. Histone derived antimicrobial peptides are reported to actively participate in the immune defenses of fishes. Present study deals with identification of putative antimicrobial sequences from the histone H2A of sicklefin chimaera, Neoharriotta pinnata. A 52 amino acid residue termed Harriottin-1, a 40 amino acid Harriottin-2, and a 21 mer Harriottin-3 were identified to possess antimicrobial sequence motif. Physicochemical properties and molecular structure of Harriottins are in agreement with the characteristic features of antimicrobial peptides, indicating its potential role in innate immunity of sicklefin chimaera. The histone H2A sequence of sicklefin chimera was found to differ from previously reported histone H2A sequences. Phylogenetic analysis based on histone H2A and cytochrome oxidase subunit-1 (CO1) gene revealed N. pinnata to occupy an intermediate position with respect to invertebrates and vertebrates.

  19. Co-expression of Dorsal and Rel2 Negatively Regulates Antimicrobial Peptide Expression in the Tobacco Hornworm Manduca sexta

    PubMed Central

    Zhong, Xue; Rao, Xiang-Jun; Yi, Hui-Yu; Lin, Xin-Yu; Huang, Xiao-Hong; Yu, Xiao-Qiang


    Nuclear factor κB (NF-κB) plays an essential role in regulation of innate immunity. In mammals, NF-κB factors can form homodimers and heterodimers to activate gene expression. In insects, three NF-κB factors, Dorsal, Dif and Relish, have been identified to activate antimicrobial peptide (AMP) gene expression. However, it is not clear whether Dorsal (or Dif) and Relish can form heterodimers. Here we report the identification and functional analysis of a Dorsal homologue (MsDorsal) and two Relish short isoforms (MsRel2A and MsRel2B) from the tobacco hornworm, Manduca sexta. Both MsRel2A and MsRel2B contain only a Rel homology domain (RHD) and lack the ankyrin-repeat inhibitory domain. Overexpression of the RHD domains of MsDorsal and MsRel2 in Drosophila melanogaster S2 and Spodoptera frugiperda Sf9 cells can activate AMP gene promoters from M. sexta and D. melanogaster. We for the first time confirmed the interaction between MsDorsal-RHD and MsRel2-RHD, and suggesting that Dorsal and Rel2 may form heterodimers. More importantly, co-expression of MsDorsal-RHD with MsRel2-RHD suppressed activation of several M. sexta AMP gene promoters. Our results suggest that the short MsRel2 isoforms may form heterodimers with MsDorsal as a novel mechanism to prevent over-activation of antimicrobial peptides. PMID:26847920

  20. Inactivation of viruses infecting ectothermic animals by amphibian and piscine antimicrobial peptides.


    Chinchar, V G; Bryan, L; Silphadaung, U; Noga, E; Wade, D; Rollins-Smith, L


    The ability of five purified amphibian antimicrobial peptides (dermaseptin-1, temporin A, magainin I, and II, PGLa), crude peptide fractions isolated from the skin of Rana pipiens and R. catesbeiana, and four antimicrobial peptides (AMPs) from hybrid striped bass (piscidin-1N, -1H, -2, and -3) were examined for their ability to reduce the infectivity of channel catfish virus (CCV) and frog virus 3 (FV3). All compounds, with the exception of magainin I, markedly reduced the infectivity of CCV. In contrast to CCV, FV3 was 2- to 4-fold less sensitive to these agents. Similar to an earlier study employing two other amphibian peptides, the agents used here acted rapidly and over a wide, physiologically relevant, temperature range to reduce virus infectivity. These results extend our previous findings and strongly suggest that various amphibian and piscine AMPs may play important roles in protecting fish and amphibians from pathogenic viruses.

  1. Nanomechanical Response of Pseudomonas aeruginosa PAO1 Bacterial Cells to Cationic Antimicrobial Peptides

    NASA Astrophysics Data System (ADS)

    Lu, Shun; Walters, Grant; Dutcher, John


    We have used an atomic force microscopy (AFM)-based creep deformation technique to study changes to the viscoelastic properties of individual Gram-negative Pseudomonas aeruginosa PAO1 cells as a function of time of exposure to two cationic peptides: polymyxin B (PMB), a cyclic antimicrobial peptide, and the structurally-related compound, polymyxin B nonapeptide (PMBN). The measurements provide a direct measure of the mechanical integrity of the bacterial cell envelope, and the results can be understood in terms of simple viscoelastic models of arrangements of springs and dashpots, which can be ascribed to different components within the bacterial cell. Time-resolved creep deformation experiments reveal abrupt changes to the viscoelastic properties of P. aeruginosa bacterial cells after exposure to both PMB and PMBN, with quantitatively different changes for the two cationic peptides. These measurements provide new insights into the kinetics and mechanism of action of antimicrobial peptides on bacterial cells.

  2. Anticancer Activity of the Antimicrobial Peptide Scolopendrasin VII Derived from the Centipede, Scolopendra subspinipes mutilans.


    Lee, Joon Ha; Kim, In-Woo; Kim, Sang-Hee; Kim, Mi-Ae; Yun, Eun-Young; Nam, Sung-Hee; Ahn, Mi-Young; Kang, Dongchul; Hwang, Jae Sam


    Previously, we performed de novo RNA sequencing of Scolopendra subspinipes mutilans using high-throughput sequencing technology and identified several antimicrobial peptide candidates. Among them, a cationic antimicrobial peptide, scolopendrasin VII, was selected based on its physicochemical properties, such as length, charge, and isoelectric point. Here, we assessed the anticancer activities of scolopendrasin VII against U937 and Jurkat leukemia cell lines. The results showed that scolopendrasin VII decreased the viability of the leukemia cells in MTS assays. Furthermore, flow cytometric analysis and acridine orange/ethidium bromide staining revealed that scolopendrasin VII induced necrosis in the leukemia cells. Scolopendrasin VII-induced necrosis was mediated by specific interaction with phosphatidylserine, which is enriched in the membrane of cancer cells. Taken together, these data indicated that scolopendrasin VII induced necrotic cell death in leukemia cells, probably through interaction with phosphatidylserine. The results provide a useful anticancer peptide candidate and an efficient strategy for new anticancer peptide development.

  3. Transcriptome of Dickeya dadantii Infecting Acyrthosiphon pisum Reveals a Strong Defense against Antimicrobial Peptides

    PubMed Central

    Costechareyre, Denis; Chich, Jean-François; Strub, Jean-Marc; Rahbé, Yvan; Condemine, Guy


    The plant pathogenic bacterium Dickeya dadantii has recently been shown to be able to kill the aphid Acyrthosiphon pisum. While the factors required to cause plant disease are now well characterized, those required for insect pathogeny remain mostly unknown. To identify these factors, we analyzed the transcriptome of the bacteria isolated from infected aphids. More than 150 genes were upregulated and 300 downregulated more than 5-fold at 3 days post infection. No homologue to known toxin genes could be identified in the upregulated genes. The upregulated genes reflect the response of the bacteria to the conditions encountered inside aphids. While only a few genes involved in the response to oxidative stress were induced, a strong defense against antimicrobial peptides (AMP) was induced. Expression of a great number of efflux proteins and transporters was increased. Besides the genes involved in LPS modification by addition of 4-aminoarabinose (the arnBCADTEF operon) and phosphoethanolamine (pmrC, eptB) usually induced in Gram negative bacteria in response to AMPs, dltBAC and pbpG genes, which confer Gram positive bacteria resistance to AMPs by adding alanine to teichoic acids, were also induced. Both types of modification confer D. dadantii resistance to the AMP polymyxin. A. pisum harbors symbiotic bacteria and it is thought that it has a very limited immune system to maintain these populations and do not synthesize AMPs. The arnB mutant was less pathogenic to A. pisum, which suggests that, in contrast to what has been supposed, aphids do synthesize AMP. PMID:23342088

  4. An Antiviral Role for Antimicrobial Peptides during the Arthropod Response to Alphavirus Replication

    PubMed Central

    Huang, Zhijing; Kingsolver, Megan B.; Avadhanula, Vasanthi


    Alphaviruses establish a persistent infection in arthropod vectors which is essential for the effective transmission of the virus to vertebrate hosts. The development of persistence in insects is not well understood, although it is thought to involve the innate immune response. Using a transgenic fly system expressing a self-replicating viral RNA genome analog, we have previously demonstrated antiviral roles of the Drosophila Imd (immune deficiency) and Jak-STAT innate immunity pathways in response to alphavirus replication. In the present study, comparative microarray analysis of flies harboring an alphavirus replicon and control green fluorescent protein flies identified 95 SINrep-sensitive genes. Furthermore, a subset of these genes is regulated by Rel or STAT transcription factors of the Imd and Jak-STAT pathways, respectively. We identified two antimicrobial peptide genes, attC and dptB, which are SINrep sensitive and regulated by STAT and Rel, respectively. SINrep flies heterozygous for attC had an increased viral RNA level, while knocking down dptB in SINrep flies resulted in impaired development. When injected with whole virus, the double-stranded RNA knockdowns of either attC or dptB showed a significant increase in virus titers. Our data demonstrate an antiviral response involving the Imd and Jak-STAT mediated expression of dptB and attC. PMID:23365449

  5. Yeast β-d-glucans induced antimicrobial peptide expressions against Salmonella infection in broiler chickens.


    Shao, Yujing; Wang, Zhong; Tian, Xiangyu; Guo, Yuming; Zhang, Haibo


    The present study was designed to investigate the effects of yeast β-d-glucans (YG) on gene expression of endogenous β-defensins (AvBDs), cathelicidins (Cath) and liver-expressed antimicrobial peptide-2 (LEAP-2) in broilers challenged with Salmonella enteritidis (SE). 240 day-old Cobb male broilers were randomly assigned to 2×2 factorial arrangements of treatments with two levels of dietary YG (0 or 200mg/kg in diet) and two levels of SE challenge (0 or 1×10(9) SE at 7-9 days of age). The results showed SE infection reduced growth performance,and increased salmonella cecal colonization and internal organs invasion, increased concentration of intestinal specific IgA and serum specific IgG antibody, as compared to uninfected birds. SE challenge differentially regulated AvBDs, Caths and LEAP-2 gene expression in the jejunum and spleen of broiler chickens during the infection period. However, YG supplementation inhibited the growth depression by SE challenge, and further increased level of serum specific IgG and intestinal specific IgA antibody. Higher level of salmonella colonization and internal organs invasion in the SE-infected birds were reduced by YG. SE-induced differentially expression patterns of AMPs genes was inhibited or changed by YG. Results indicated YG enhance chicken's resistance to salmonella infection.

  6. An antiviral role for antimicrobial peptides during the arthropod response to alphavirus replication.


    Huang, Zhijing; Kingsolver, Megan B; Avadhanula, Vasanthi; Hardy, Richard W


    Alphaviruses establish a persistent infection in arthropod vectors which is essential for the effective transmission of the virus to vertebrate hosts. The development of persistence in insects is not well understood, although it is thought to involve the innate immune response. Using a transgenic fly system expressing a self-replicating viral RNA genome analog, we have previously demonstrated antiviral roles of the Drosophila Imd (immune deficiency) and Jak-STAT innate immunity pathways in response to alphavirus replication. In the present study, comparative microarray analysis of flies harboring an alphavirus replicon and control green fluorescent protein flies identified 95 SINrep-sensitive genes. Furthermore, a subset of these genes is regulated by Rel or STAT transcription factors of the Imd and Jak-STAT pathways, respectively. We identified two antimicrobial peptide genes, attC and dptB, which are SINrep sensitive and regulated by STAT and Rel, respectively. SINrep flies heterozygous for attC had an increased viral RNA level, while knocking down dptB in SINrep flies resulted in impaired development. When injected with whole virus, the double-stranded RNA knockdowns of either attC or dptB showed a significant increase in virus titers. Our data demonstrate an antiviral response involving the Imd and Jak-STAT mediated expression of dptB and attC.

  7. Human lysozyme possesses novel antimicrobial peptides within its N-terminal domain that target bacterial respiration.


    Ibrahim, Hisham R; Imazato, Kenta; Ono, Hajime


    Human milk lysozyme is thought to be a key defense factor in protecting the gastrointestinal tract of newborns against bacterial infection. Recently, evidence was found that pepsin, under conditions relevant to the newborn stomach, cleaves chicken lysozyme (cLZ) at specific loops to generate five antimicrobial peptide motifs. This study explores the antimicrobial role of the corresponding peptides of human lysozyme (hLZ), the actual protein in breast milk. Five peptide motifs of hLZ, one helix-loop-helix (HLH), its two helices (H1 and H2), and two helix-sheet motifs, H2-β-strands 1-2 (H2-S12) or H2-β-strands 1-3 (H2-S13), were synthesized and examined for antimicrobial action. The five peptides of hLZ exhibit microbicidal activity to various degrees against several bacterial strains. The HLH peptide and its N-terminal helix (H1) were significantly the most potent bactericidal to Gram-positive and Gram-negative bacteria and the fungus Candida albicans . Outer and inner membrane permeabilization studies, as well as measurements of transmembrane electrochemical potentials, provided evidence that HLH peptide and its N-terminal helix (H1) kill bacteria by crossing the outer membrane of Gram-negative bacteria via self-promoted uptake and are able to dissipate the membrane potential-dependent respiration of Gram-positive bacteria. This finding is the first to describe that hLZ possesses multiple antimicrobial peptide motifs within its N-terminal domain, providing insight into new classes of antibiotic peptides with potential use in the treatment of infectious diseases.

  8. Structural basis for hijacking siderophore receptors by antimicrobial lasso peptides

    PubMed Central

    Mathavan, Indran; Zirah, Séverine; Mehmood, Shahid; Choudhury, Hassanul G.; Goulard, Christophe; Li, Yanyan; Robinson, Carol V.; Rebuffat, Sylvie; Beis, Konstantinos


    The lasso peptide microcin J25 is known to hijack the siderophore receptor FhuA for initiating internalization. Here, we provide the first structural evidence on the recognition mechanism and our biochemical data show that another closely related lasso peptide cannot interact with FhuA. Our work provides an explanation on the narrow activity spectrum of lasso peptides and opens the path to the development of new antibacterials. PMID:24705590

  9. Derivatives of the Mouse Cathelicidin-Related Antimicrobial Peptide (CRAMP) Inhibit Fungal and Bacterial Biofilm Formation

    PubMed Central

    De Brucker, Katrijn; Delattin, Nicolas; Robijns, Stijn; Steenackers, Hans; Verstraeten, Natalie; Landuyt, Bart; Luyten, Walter; Schoofs, Liliane; Dovgan, Barbara; Fröhlich, Mirjam; Michiels, Jan; Vanderleyden, Jos; Thevissen, Karin


    We identified a 26-amino-acid truncated form of the 34-amino-acid cathelicidin-related antimicrobial peptide (CRAMP) in the islets of Langerhans of the murine pancreas. This peptide, P318, shares 67% identity with the LL-37 human antimicrobial peptide. As LL-37 displays antimicrobial and antibiofilm activity, we tested antifungal and antibiofilm activity of P318 against the fungal pathogen Candida albicans. P318 shows biofilm-specific activity as it inhibits C. albicans biofilm formation at 0.15 μM without affecting planktonic survival at that concentration. Next, we tested the C. albicans biofilm-inhibitory activity of a series of truncated and alanine-substituted derivatives of P318. Based on the biofilm-inhibitory activity of these derivatives and the length of the peptides, we decided to synthesize the shortened alanine-substituted peptide at position 10 (AS10; KLKKIAQKIKNFFQKLVP). AS10 inhibited C. albicans biofilm formation at 0.22 μM and acted synergistically with amphotericin B and caspofungin against mature biofilms. AS10 also inhibited biofilm formation of different bacteria as well as of fungi and bacteria in a mixed biofilm. In addition, AS10 does not affect the viability or functionality of different cell types involved in osseointegration of an implant, pointing to the potential of AS10 for further development as a lead peptide to coat implants. PMID:24982087

  10. Evaluation of short synthetic antimicrobial peptides for treatment of drug-resistant and intracellular Staphylococcus aureus

    PubMed Central

    Mohamed, Mohamed F.; Abdelkhalek, Ahmed; Seleem, Mohamed N.


    Methicillin-resistant Staphylococcus aureus (MRSA) infections present a serious challenge because of the emergence of resistance to numerous conventional antibiotics. Due to their unique mode of action, antimicrobial peptides are novel alternatives to traditional antibiotics for tackling the issue of bacterial multidrug resistance. Herein, we investigated the antibacterial activity of two short novel peptides (WR12, a 12 residue peptide composed exclusively of arginine and tryptophan, and D-IK8, an eight residue β-sheet peptide) against multidrug resistant staphylococci. In vitro, both peptides exhibited good antibacterial activity against MRSA, vancomycin-resistant S. aureus, linezolid-resistant S. aureus, and methicillin-resistant S. epidermidis. WR12 and D-IK8 were able to eradicate persisters, MRSA in stationary growth phase, and showed significant clearance of intracellular MRSA in comparison to both vancomycin and linezolid. In vivo, topical WR12 and D-IK8 significantly reduced both the bacterial load and the levels of the pro-inflammatory cytokines including tumor necrosis factor-α (TNF-α) and interleukin-6 (IL-6) in MRSA-infected skin lesions. Moreover, both peptides disrupted established in vitro biofilms of S. aureus and S. epidermidis significantly more so than traditional antimicrobials tested. Taken together, these results support the potential of WR12 and D-IK8 to be used as a topical antimicrobial agent for the treatment of staphylococcal skin infections. PMID:27405275

  11. Scolopendin 2, a cationic antimicrobial peptide from centipede, and its membrane-active mechanism.


    Lee, Heejeong; Hwang, Jae-Sam; Lee, Jaeho; Kim, Jae Il; Lee, Dong Gun


    Scolopendin 2 is a 16-mer peptide (AGLQFPVGRIGRLLRK) derived from the centipede Scolopendra subspinipes mutilans. We observed that this peptide exhibited antimicrobial activity in a salt-dependent manner against various fungal and bacterial pathogens and showed no hemolytic effect in the range of 1.6 μM to 100 μM. Circular dichroism analysis showed that the peptide has an α-helical properties. Furthermore, we determined the mechanism(s) of action using flow cytometry and by investigating the release of intracellular potassium. The results showed that the peptide permeabilized the membranes of Escherichia coli O157 and Candida albicans, resulting in loss of intracellular potassium ions. Additionally, bis-(1,3-dibutylbarbituric acid) trimethine oxonol and 3,3'-dipropylthiacarbocyanine iodide assays showed that the peptide caused membrane depolarization. Using giant unilamellar vesicles encapsulating calcein and large unilamellar vesicles containing fluorescein isothiocyanate-dextran, which were similar in composition to typical E. coli O157 and C. albicans membranes, we demonstrated that scolopendin 2 disrupts membranes, resulting in a pore size between 4.8 nm and 5.0 nm. Thus, we have demonstrated that a cationic antimicrobial peptide, scolopendin 2, exerts its broad-spectrum antimicrobial effects by forming pores in the cell membrane.

  12. Antimicrobial peptides from Phyllomedusa frogs: from biomolecular diversity to potential nanotechnologic medical applications.


    Azevedo Calderon, Leonardo de; Silva, Alexandre de Almeida E; Ciancaglini, Pietro; Stábeli, Rodrigo Guerino


    Screening for new bioactive peptides in South American anurans has been pioneered in frogs of the genus Phyllomedusa. All frogs of this genus have venomous skin secretions, i.e., a complex mixture of bioactive peptides against potential predators and pathogens that presumably evolved in a scenario of predator-prey interaction and defense against microbial invasion. For every new anuran species studied new peptides are found, with homologies to hormones, neurotransmitters, antimicrobials, and several other peptides with unknown biological activity. From Vittorio Erspamer findings, this genus has been reported as a "treasure store" of bioactive peptides, and several groups focus their research on these species. From 1966 to 2009, more than 200 peptide sequences from different Phyllomedusa species were deposited in UniProt and other databases. During the last decade, the emergence of high-throughput molecular technologies involving de novo peptide sequencing via tandem mass spectrometry, cDNA cloning, pharmacological screening, and surface plasmon resonance applied to peptide discovery, led to fast structural data acquisition and the generation of peptide molecular libraries. Research groups on bioactive peptides in Brazil using these new technologies, accounted for the exponential increase of new molecules described in the last decade, much higher than in any previous decades. Recently, these secretions were also reported as a rich source of multiple antimicrobial peptides effective against multidrug resistant strains of bacteria, fungi, protozoa, and virus, providing instructive lessons for the development of new and more efficient nanotechnological-based therapies for infectious diseases treatment. Therefore, novel drugs arising from the identification and analysis of bioactive peptides from South American anuran biodiversity have a promising future role on nanobiotechnology.

  13. Applications of Circular Dichroism for Structural Analysis of Gelatin and Antimicrobial Peptides

    PubMed Central

    Gopal, Ramamourthy; Park, Jin Soon; Seo, Chang Ho; Park, Yoonkyung


    Circular dichroism (CD) is a useful technique for monitoring changes in the conformation of antimicrobial peptides or gelatin. In this study, interactions between cationic peptides and gelatin were observed without affecting the triple helical content of the gelatin, which was more strongly affected by anionic surfactant. The peptides did not adopt a secondary structure in the presence of aqueous solution or Tween 80, but a peptide secondary structure formed upon the addition of sodium dodecyl sulfate (SDS). The peptides bound to the phosphate group of lipopolysaccharide (LPS) and displayed an alpha-helical conformation while (KW)4 adopted a folded conformation. Further, the peptides did not specifically interact with the fungal cell wall components of mannan or laminarin. Tryptophan blue shift assay indicated that these peptides interacted with SDS, LPS, and gelatin but not with Tween 80, mannan, or laminarin. The peptides also displayed antibacterial activity against P. aeruginosa without cytotoxicity against HaCaT cells at MIC, except for HPA3NT3-analog peptide. In this study, we used a CD spectroscopic method to demonstrate the feasibility of peptide characterization in numerous environments. The CD method can thus be used as a screening method of gelatin-peptide interactions for use in wound healing applications. PMID:22489150

  14. Antimicrobial activity of the synthetic peptide Lys-a1 against oral streptococci.


    da Silva, Bruno Rocha; de Freitas, Victor Aragão Abreu; Carneiro, Victor Alves; Arruda, Francisco Vassiliepe Sousa; Lorenzón, Esteban Nicolás; de Aguiar, Andréa Silvia Walter; Cilli, Eduardo Maffud; Cavada, Benildo Sousa; Teixeira, Edson Holanda


    The peptide LYS-[TRP(6)]-Hy-A1 (Lys-a1) is a synthetic derivative of the peptide Hy-A1, initially isolated from the frog species Hypsiboas albopunctatus. According to previous research, it is a molecule with broad antimicrobial activity. The objective of this study was to evaluate the antimicrobial activity of the synthetic peptide Lys-a1 (KIFGAIWPLALGALKNLIK-NH2) on the planktonic and biofilm growth of oral bacteria. The methods used to evaluate antimicrobial activity include the following: determination of the minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) in microtiter plates for growth in suspension and quantification of biomass by crystal violet staining and counting of colony forming units for biofilm growth. The microorganisms Streptococcus oralis, Streptococcus sanguinis, Streptococcus parasanguinis, Streptococcus salivarius, Streptococcus mutans and Streptococcus sobrinus were grown in Brain Heart Infusion broth at 37°C under atmospheric pressure with 10% CO2. The peptide was solubilized in 0.1% acetic acid (v/v) at various concentrations (500-1.9 μg mL(-1)). Chlorhexidine gluconate 0.12% was used as the positive control, and BHI culture medium was used as the negative control. The tested peptide demonstrated a remarkable antimicrobial effect, inhibiting the planktonic and biofilm growth of all strains tested, even at low concentrations. Thus, the peptide Lys-a1 is an important source for potential antimicrobial agents, especially for the control and prevention of microbial biofilms, which is one of the most important factors in cariogenic processes.

  15. Thermodynamics of RTA3 peptide binding to membranes and consequences for antimicrobial activity☆

    PubMed Central

    Hawrani, Ayman; Howe, Robin A.; Walsh, Timothy R.; Dempsey, Christopher E.


    RTA3 is an α-helical, amphipathic peptide with broad-spectrum activity against Gram-negative bacteria and low mammalian cell toxicity. RTA3 contains a cysteine residue, replacement of which with an alanine or serine (RTA3-C15S) virtually abolishes antimicrobial activity. Much of the activity of RTA3 can be recovered in RTA3-C15L, indicating that the C15 residue functions largely as a bulky hydrophobic side chain promoting target cell membrane interactions. The poorly active RTA3-C15S is a useful variant for assessing the mechanistic aspects of RTA3 activity. Binding and membrane perturbation in vesicles containing different proportions of negative surface charge are analyzed in terms of amino acid-specific free energy contributions to interfacial binding, which likely underlie variations in antimicrobial activity amongst RTA3 variants. Comparison with published free energy scales indicates that the reduced electrostatic contribution to binding to membranes having reduced negative surface charge can be compensated in RTA3 (but not RTA3-C15S) by a slightly deeper insertion of the C-terminus of the peptide to maximize hydrophobic contributions to binding. Analysis of inner membrane (IM)- and outer membrane (OM)-selective permeabilization of Escherichiacoli demonstrates a broad similarity between peptide effects on vesicles with low negative surface charge (20% negatively charged lipids), E.coli membrane perturbation, and antimicrobial activity, supporting a role for membrane perturbation in the killing mechanism of RTA3. The results demonstrate that large variations in antimicrobial activity on subtle changes in amino acid sequence in helical amphipathic peptides can be rationalized in terms of the thermodynamics of peptide binding to membranes, allowing a more systematic understanding of antimicrobial activity in these peptides. PMID:20346912

  16. Label-free detection of pathogenic bacteria via immobilized antimicrobial peptides.


    Dong, Zong-Mu; Zhao, Guang-Chao


    A novel label-free strategy for the detection of bacteria was developed by using a specific antimicrobial peptide (AMP)-functionalized quartz crystal microbalance (QCM) electrode. This electrode interface was successfully applied to detect pathogenic Escherichia coli O157:H7 based on the specific affinity between the small synthetic antimicrobial peptide and the bacterial cell of pathogenic E. coli O157:H7. The concentrations of pathogenic E. coli O157:H7 were sensitively measured by the frequency response of the QCM with a detection limit of 0.4 cfu μL(-1). The detection can be fulfilled within 10 min because it does not require germiculture process. On the other hand, if the specific antimicrobial peptides were immobilized on a gold electrode, this label-free strategy can also be performed by electrochemical impedance spectroscopy (EIS). Compared with QCM technique, the EIS measurement gives a lower sensitivity and needs a longer assay time. The combination of antimicrobial peptides with the real-time responses of QCM, as well as electronic read-out monitoring of EIS, may open a new way for the direct detection of bacteria.

  17. Antimicrobial Peptides: Insights into Membrane Permeabilization, Lipopolysaccharide Fragmentation and Application in Plant Disease Control.


    Datta, Aritreyee; Ghosh, Anirban; Airoldi, Cristina; Sperandeo, Paola; Mroue, Kamal H; Jiménez-Barbero, Jesús; Kundu, Pallob; Ramamoorthy, Ayyalusamy; Bhunia, Anirban


    The recent increase in multidrug resistance against bacterial infections has become a major concern to human health and global food security. Synthetic antimicrobial peptides (AMPs) have recently received substantial attention as potential alternatives to conventional antibiotics because of their potent broad-spectrum antimicrobial activity. These peptides have also been implicated in plant disease control for replacing conventional treatment methods that are polluting and hazardous to the environment and to human health. Here, we report de novo design and antimicrobial studies of VG16, a 16-residue active fragment of Dengue virus fusion peptide. Our results reveal that VG16KRKP, a non-toxic and non-hemolytic analogue of VG16, shows significant antimicrobial activity against Gram-negative E. coli and plant pathogens X. oryzae and X. campestris, as well as against human fungal pathogens C. albicans and C. grubii. VG16KRKP is also capable of inhibiting bacterial disease progression in plants. The solution-NMR structure of VG16KRKP in lipopolysaccharide features a folded conformation with a centrally located turn-type structure stabilized by aromatic-aromatic packing interactions with extended N- and C-termini. The de novo design of VG16KRKP provides valuable insights into the development of more potent antibacterial and antiendotoxic peptides for the treatment of human and plant infections.

  18. Multitasking antimicrobial peptides, plant development, and host defense against biotic/abiotic stress

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Crop losses due to pathogens are a major threat to global food security. Plants employ a multilayer defense system against pathogens including use of physical barriers (cell wall), induction of hypersensitive defense response (HR), resistance (R) proteins, and synthesis of antimicrobial peptides (AM...

  19. In vitro growth of growth of campylobacter spp. inhibited by selected antimicrobial peptides

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Novel alternatives to traditional antibiotics are urgently needed for food-animal production. A goal of our laboratory is to develop and evaluate antimicrobial peptides (AMP) to control and reduce foodborne pathogens in poultry. AMP have been found in most every class of living organism...

  20. Cationic antimicrobial peptides in psoriatic skin cooperate to break innate tolerance to self-DNA.


    Lande, Roberto; Chamilos, Georgios; Ganguly, Dipyaman; Demaria, Olivier; Frasca, Loredana; Durr, Sophie; Conrad, Curdin; Schröder, Jens; Gilliet, Michel


    Psoriasis is a T-cell-mediated skin autoimmune disease characterized by the aberrant activation of dermal dendritic cells (DCs) and the sustained epidermal expression of antimicrobial peptides. We have previously identified a link between these two events by showing that the cathelicidin antimicrobial peptide LL37 has the ability to trigger self-nucleic acid mediated activation of plasmacytoid DCs (pDCs) in psoriatic skin. Whether other cationic antimicrobial peptides exert similar activities is unknown. By analyzing heparin-binding HPLC fractions of psoriatic scales, we found that human beta-defensin (hBD)2, hBD3, and lysozyme are additional triggers of pDC activation in psoriatic skin lesions. Like LL37, hBD2, hBD3, and lysozyme are able to condense self-DNA into particles that are endocytosed by pDCs, leading to activation of TLR9. In contrast, other antimicrobial peptides expressed in psoriatic skin including elafin, hBD1, and psoriasin (S100A7) did not show similar activities. hBD2, hBD3, and lysozyme were detected in psoriatic skin lesions in the vicinity of pDCs and found to cooperate with LL37 to induce high levels of IFN production by pDCs, suggesting their concerted role in the pathogenesis of psoriasis.

  1. Novel family of antimicrobial peptides from the skin of Rana shuchinae.


    Zheng, Ruiqiang; Yao, Bin; Yu, Haining; Wang, Hanjin; Bian, Jianmin; Feng, Feifei


    So far numerous antimicrobial peptides have been characterized from amphibians. In this work, a new family of antimicrobial peptides, named shuchin, was purified and characterized from skin secretions of the frog, Rana shuchinae that lives in freezing mountains. Totally two members of shuchin (shuchin 1 and 2) were identified with the amino acid sequence of NALSMPRNKCNRALMCFG and NALSSPRNKCDRASSCFG, respectively. cDNAs encoding shuchins were cloned from the skin cDNA library of R. shuchinae. The precursors of shuchin are composed of 62 amino acid residues including the conserved signal peptides, acidic propieces, and mature antimicrobial peptides. Synthetic shuchins showed strong and broad antimicrobial activities against Gram-positive bacteria (Staphylococcus aureus, and Bacillus cereus; MICs<12.5 microg/ml), Gram-negative bacteria (Escherichia coli, Bacillus dysenteriae, Pseudomonas aeruginosa; most MICs from 3.1 to 12.5 microg/ml), and yeast (Candida albicans; MICs of 6.25 microg/ml), but no hemolytic activity under the effective concentration, thereby provide more leading templates for designing novel anti-infection agents.

  2. New cationic antimicrobial peptide screened from boiled-dried anchovies by immobilized bacterial membrane liposome chromatography.


    Tang, Wenting; Zhang, Hui; Wang, Li; Qian, Haifeng


    An efficient immobilized bacterial membrane liposome chromatography method was used to screen potential antimicrobial peptides from boiled-dried anchovies. A novel cationic antimicrobial peptide (Apep10) was successfully isolated by one-step chromatography. The sequence of Apep10 was identified as GLARCLAGTL by matrix-assisted laser desorption/ionization quadrupole time-of-flight tandem mass spectrometry (MALDI-Q-TOF MS). The antimicrobial activity assessment indicated that Apep10 inhibited the growth of the reference bacteria (Escherichia coli, Shigella dysenteriae, Pseudomonas aeruginosa, Salmonella typhimurium, Staphylococcus aureus, Bacillus subtilis, and Streptococcus pneumoniae), with minimal inhibitory concentration (MIC) values ranging from 8 to 64 μg/mL. Almost no cytotoxicity against mouse erythrocytes was observed at concentrations below 20 μg/mL. Nucleotide leakage induced by Apep10 showed that the peptide exhibited permeable activity on the cytoplasmic membrane. Alterations in morphology were observed by scanning electronic microscopy (SEM). Membrane disruption was confirmed by confocal laser scanning microscopy (CLSM) with propidium iodide (PI). The results demonstrate that immobilized bacterial membrane liposome chromatography is a straightforward technique for screening unknown antimicrobial peptides with cell-membrane-interacting activities from boiled-dried anchovies.

  3. Antimicrobial Peptides: Insights into Membrane Permeabilization, Lipopolysaccharide Fragmentation and Application in Plant Disease Control

    PubMed Central

    Datta, Aritreyee; Ghosh, Anirban; Airoldi, Cristina; Sperandeo, Paola; Mroue, Kamal H.; Jiménez-Barbero, Jesús; Kundu, Pallob; Ramamoorthy, Ayyalusamy; Bhunia, Anirban


    The recent increase in multidrug resistance against bacterial infections has become a major concern to human health and global food security. Synthetic antimicrobial peptides (AMPs) have recently received substantial attention as potential alternatives to conventional antibiotics because of their potent broad-spectrum antimicrobial activity. These peptides have also been implicated in plant disease control for replacing conventional treatment methods that are polluting and hazardous to the environment and to human health. Here, we report de novo design and antimicrobial studies of VG16, a 16-residue active fragment of Dengue virus fusion peptide. Our results reveal that VG16KRKP, a non-toxic and non-hemolytic analogue of VG16, shows significant antimicrobial activity against Gram-negative E. coli and plant pathogens X. oryzae and X. campestris, as well as against human fungal pathogens C. albicans and C. grubii. VG16KRKP is also capable of inhibiting bacterial disease progression in plants. The solution-NMR structure of VG16KRKP in lipopolysaccharide features a folded conformation with a centrally located turn-type structure stabilized by aromatic-aromatic packing interactions with extended N- and C-termini. The de novo design of VG16KRKP provides valuable insights into the development of more potent antibacterial and antiendotoxic peptides for the treatment of human and plant infections. PMID:26144972

  4. Antimicrobial peptides trigger a division block in Escherichia coli through stimulation of a signalling system

    PubMed Central

    Yadavalli, Srujana S.; Carey, Jeffrey N.; Leibman, Rachel S.; Chen, Annie I.; Stern, Andrew M.; Roggiani, Manuela; Lippa, Andrew M.; Goulian, Mark


    Antimicrobial peptides are an important component of the molecular arsenal employed by hosts against bacteria. Many bacteria in turn possess pathways that provide protection against these compounds. In Escherichia coli and related bacteria, the PhoQ/PhoP signalling system is a key regulator of this antimicrobial peptide defence. Here we show that treating E. coli with sublethal concentrations of antimicrobial peptides causes cells to filament, and that this division block is controlled by the PhoQ/PhoP system. The filamentation results from increased expression of QueE, an enzyme that is part of a tRNA modification pathway but that, as we show here, also affects cell division. We also find that a functional YFP–QueE fusion localizes to the division septum in filamentous cells, suggesting QueE blocks septation through interaction with the divisome. Regulation of septation by PhoQ/PhoP may protect cells from antimicrobial peptide-induced stress or other conditions associated with high-level stimulation of this signalling system. PMID:27471053

  5. Structure and antimicrobial activity of platypus 'intermediate' defensin-like peptide.


    Torres, Allan M; Bansal, Paramjit; Koh, Jennifer M S; Pagès, Guilhem; Wu, Ming J; Kuchel, Philip W


    The three-dimensional structure of a chemically synthesized peptide that we have called 'intermediate' defensin-like peptide (Int-DLP), from the platypus genome, was determined by nuclear magnetic resonance (NMR) spectroscopy; and its antimicrobial activity was investigated. The overall structural fold of Int-DLP was similar to that of the DLPs and β-defensins, however the presence of a third antiparallel β-strand makes its structure more similar to the β-defensins than the DLPs. Int-DLP displayed potent antimicrobial activity against Staphylococcus aureus and Pseudomonas aeruginosa. The four arginine residues at the N-terminus of Int-DLP did not affect the overall fold, but were important for its antimicrobial potency.

  6. Development of a catheter functionalized by a polydopamine peptide coating with antimicrobial and antibiofilm properties.


    Lim, Kaiyang; Chua, Ray Rong Yuan; Bow, Ho; Tambyah, Paul Anantharajah; Hadinoto, Kunn; Leong, Susanna Su Jan


    Catheter-associated urinary tract infections (CAUTIs) are the most common hospital-acquired infections worldwide, aggravating the problem of antimicrobial resistance and patient morbidity. There is a need for a potent and robust antimicrobial coating for catheters to prevent these infections. An ideal coating agent should possess high antimicrobial efficacy and be easily and economically conjugated to the catheter surface. In this study, we report a simple yet effective immobilization strategy to tether a potent synthetic antimicrobial peptide, CWR11, onto catheter-relevant surfaces. Polydopamine (PD) was deposited as a thin adherent film onto a polydimethylsiloxane (PDMS) surface to facilitate attachment of CWR11 onto the PD-functionalized polymer. Surface characterization of the CWR11-tethered surfaces confirmed the successful immobilization of peptides onto the PD-coated PDMS. The CWR11-immobilized PDMS slides displayed excellent antimicrobial (significant inhibition of 5×10(4) colony-forming units of CAUTI-relevant microbes) and antibiofilm (∼92% enhanced antibacterial adherence) properties. To assess its clinical relevance, the PD-based immobilization platform was translated onto commercial silicone-coated Foley catheters. The CWR11-impregnated catheter displayed potent bactericidal properties against both Gram-positive and Gram-negative bacteria, and retained its antimicrobial functionality for at least 21days, showing negligible cytotoxicity against human erythrocyte and uroepithelial cells. The outcome of this study demonstrates the proof-of-concept potential of a polydopamine-CWR11-functionalized catheter to combat CAUTIs.

  7. Toward the de novo design of antimicrobial peptides: Lack of correlation between peptide permeabilization of lipid vesicles and antimicrobial, cytolytic, or cytotoxic activity in living cells.


    He, Jing; Krauson, Aram J; Wimley, William C


    We previously performed a lipid vesicle-based, high-throughput screen on a 26-residue combinatorial peptide library that was designed de novo to yield membrane-permeabilizing peptides that fold into β-sheets. The most active and soluble library members that were identified permeabilized lipid vesicles detectably, but not with high potency. Nonetheless, they were broad-spectrum, membrane-permeabilizing antibiotics with minimum sterilizing activity at low µM concentrations. In an expansion of that work, we recently performed an iterative screen in which an active consensus sequence from that first-generation library was used as a template to design a second-generation library which was then screened against lipid vesicles at very high stringency. Compared to the consensus sequence from the first library, the most active second-generation peptides are highly potent, equilibrium pore-formers in synthetic lipid vesicles. Here, we use these first- and second-generation families of peptides to test the hypothesis that a large increase in potency in bacteria-like lipid vesicles will correlate with a large improvement in antimicrobial activity. The results do not support the hypothesis. Despite a 20-fold increase in potency against bacteria-like lipid vesicles, the second-generation peptides are only slightly more active against bacteria, and at the same time, are also more toxic against mammalian cells. The results suggest that a "pipeline" strategy toward the optimization of antimicrobial peptides could begin with a vesicle-based screen for identifying families with broad-spectrum activity, but will also need to include screening or optimization steps that are done under conditions that are more directly relevant to possible therapeutic applications.

  8. Occurrence of antimicrobials and antimicrobial resistance genes in beef cattle storage ponds and swine treatment lagoons.


    Zhang, Yuping; Zhang, Chiqian; Parker, David B; Snow, Daniel D; Zhou, Zhi; Li, Xu


    Livestock manure treatment and storage structures are potential environmental sources of antimicrobials and antimicrobial resistance genes (ARGs). In this study, the occurrence of antimicrobials and ARGs was investigated in the water and the sludge compartments of beef cattle storage ponds and swine lagoons. Analysis was focused on two families of antimicrobials (sulfonamide and tetracycline) and the corresponding ARGs (sul1, sul2, tetO, tetQ and tetX). Results showed that the pseudo-partitioning coefficients of tetracyclines were higher than those of sulfonamides, suggesting different distributions of these two classes of antimicrobials between water and sludge. The ARGs tested were detected in nearly all ponds and lagoons, with the highest relative abundance in sul2 at 6.3×10(-1) copies per 16S rRNA gene. A positive correlation was observed between total sul genes and total sulfonamides in water while the correlation was negative in sludge. No significant correlation was found between total tet genes and total tetracyclines in either water or sludge, but significant correlations were observed for certain individual tet genes. Ammonia concentrations strongly correlated with all ARGs except tetX. This study provided quantitative information on the occurrence of antimicrobials and ARGs in the liquid and solid compartments of typical manure treatment and storage structures.

  9. Synthetic antimicrobial and LPS-neutralising peptides suppress inflammatory and immune responses in skin cells and promote keratinocyte migration

    PubMed Central

    Pfalzgraff, Anja; Heinbockel, Lena; Su, Qi; Gutsmann, Thomas; Brandenburg, Klaus; Weindl, Günther


    The stagnation in the development of new antibiotics and the concomitant high increase of resistant bacteria emphasize the urgent need for new therapeutic options. Antimicrobial peptides are promising agents for the treatment of bacterial infections and recent studies indicate that Pep19-2.5, a synthetic anti-lipopolysaccharide (LPS) peptide (SALP), efficiently neutralises pathogenicity factors of Gram-negative (LPS) and Gram-positive (lipoprotein/-peptide, LP) bacteria and protects against sepsis. Here, we investigated the potential of Pep19-2.5 and the structurally related compound Pep19-4LF for their therapeutic application in bacterial skin infections. SALPs inhibited LP-induced phosphorylation of NF-κB p65 and p38 MAPK and reduced cytokine release and gene expression in primary human keratinocytes and dermal fibroblasts. In LPS-stimulated human monocyte-derived dendritic cells and Langerhans-like cells, the peptides blocked IL-6 secretion, downregulated expression of maturation markers and inhibited dendritic cell migration. Both SALPs showed a low cytotoxicity in all investigated cell types. Furthermore, SALPs markedly promoted cell migration via EGFR transactivation and ERK1/2 phosphorylation and accelerated artificial wound closure in keratinocytes. Peptide-induced keratinocyte migration was mediated by purinergic receptors and metalloproteases. In contrast, SALPs did not affect proliferation of keratinocytes. Conclusively, our data suggest a novel therapeutic target for the treatment of patients with acute and chronic skin infections. PMID:27509895

  10. Antimicrobial Dendrimeric Peptides: Structure, Activity and New Therapeutic Applications.


    Scorciapino, Mariano A; Serra, Ilaria; Manzo, Giorgia; Rinaldi, Andrea C


    Microbial resistance to conventional antibiotics is one of the most outstanding medical and scientific challenges of our times. Despite the recognised need for new anti-infective agents, however, very few new drugs have been brought to the market and to the clinic in the last three decades. This review highlights the properties of a new class of antibiotics, namely dendrimeric peptides. These intriguing novel compounds, generally made of multiple peptidic sequences linked to an inner branched core, display an array of antibacterial, antiviral and antifungal activities, usually coupled to low haemolytic activity. In addition, several peptides synthesized in oligobranched form proved to be promising tools for the selective treatment of cancer cells.

  11. Lacrain: the first antimicrobial peptide from the body extract of the Brazilian centipede Scolopendra viridicornis.


    Chaparro, E; da Silva, P I


    Antimicrobial activities have previously been described by traditional Eastern medicine in Chilopoda body extracts, but until now no bioactive peptides have been described. In this study, a novel antimicrobial peptide, lacrain, was isolated from the body extract of the Brazilian Chilopoda Scolopendra viridicornis. The peptide was isolated by reverse-phase high-performance liquid chromatography (RP-HPLC). Its activity was tested using a liquid growth inhibition assay and the peptide was characterised using mass spectrometry. Lacrain has a sequence composed of eight amino acid residues and a molecular mass of 925.5 Da. A synthetic peptide of the native lacrain had identical characteristics to those of the isolated material, confirming its sequence. The synthetic peptide was active only against Gram-negative bacteria, showing strong bactericidal activity. Moreover, the peptide did not present haemolytic activity against human erythrocytes. Lacrain represents a novel molecule with powerful antibacterial activity that could be used as a new template for the development of drugs against clinically resistant bacterial strains.

  12. Chemoselective surface attachment of antimicrobial peptides and its effects on interfacial behavior

    NASA Astrophysics Data System (ADS)

    North, Stella H.; So, Christopher; Fears, Kenan; Taitt, Chris R.


    Peptide-based biological recognition elements are valuable tools for detection in biodefense systems. The utilization of such biomolecules for detection purposes relies on the ability to immobilize them on the surface of a detection platform in a predictable and reliable manner that facilitates target binding. Numerous immobilization methods have been used to improve the performance of peptide-based biosensors; however, the molecular details of how surface attachment affects structure and activity require further investigation to establish general approaches for obtaining consistent sensor surfaces. This has been largely due to the lack of analytical techniques. Using surface spectroscopy techniques, we examined the secondary structure of peptides tethered to solid support. Different tethering parameters were investigated by substituting a cysteine residue to the N-terminus or C-terminus in cationic antimicrobial peptides, and its effects on antimicrobial activity against gram-negative bacteria, E. coli. Spectroscopic analysis showed that surface immobilization drives transition of peptides secondary structures, resulting in different interfacial behaviors that may influence the secondary structure of the peptides once they interact with the bacterial cells. We have begun to gain insight into how surface attachment may have direct implications for peptide presentation and function and is an important advance in preparing a robust sensing interface.

  13. Antimicrobial peptides with atypical structural features from the skin of the Japanese brown frog Rana japonica.


    Isaacson, Todd; Soto, AnaMaria; Iwamuro, Shawichi; Knoop, Floyd C; Conlon, J Michael


    Japonicin-1 (FFPIGVFCKIFKTC) and japonicin-2 (FGLPMLSILPKALCILLKRKC), two peptides with differential growth-inhibitory activity against the Gram-negative bacterium, Escherichia coli and the Gram-positive bacterium Staphylococcus aureus, were isolated from an extract of the skin of the Japanese brown frog Rana japonica. Both peptides show little amino acid sequence similarity to previously characterized antimicrobial peptides isolated from the skins of Ranid frogs. Circular dichroism studies, however, demonstrate that japonicin-2 adopts an alpha-helical conformation in 50% trifluoroethanol in common with many other cationic antimicrobial peptides synthesized in amphibian skin. Peptides belonging to the brevinin-1, brevinin-2, and tigerinin families, previously identified in the skins of Asian Ranid frogs, were not detected but a temporin-related peptide (ILPLVGNLLNDLL.NH(2); temporin-1Ja), that atypically bears no net positive charge, was isolated from the extract. The minimum inhibitory concentrations (MICs) of the peptides against E. coli were japonicin-1, 30 microM; japonicin-2, 12 microM; and temporin-1Ja > 100 microM. The MICs against S. aureus were japonicin-1, > 100 microM; japonicin-2, 20 microM; and temporin-1Ja, > 100 microM.

  14. Identification and Expression Profile Analysis of Antimicrobial Peptide/Protein in Asian Corn Borer, Ostrinia furnacalis (Guenée)

    PubMed Central

    Zhang, Mingming; Zhou, Fan; Chu, Yuan; Zhao, Zhangwu; An, Chunju


    Antimicrobial peptides/proteins (AMPs) are a group of immune proteins that exhibit strong antibiotic properties against numerous infectious bacterial strains. They are evolutionarily conserved and present in every kingdom and phylum, ranging from prokaryotes to humans. We analyzed the transciptome from the larvae of Asian corn borer, Ostrinia furnacalis (Guenée), and identified several putative AMP transcripts, OfgLys5, OfgLys6, OfgLys10, OfgAtt, and OfgIID. OfgLys5, OfgLys6, and OfgLys10 are all highly homologous with c-type lysozymes, and OfgAtt shows significant identities with Lepidoptera attacin. The amino acid sequence of OfgLys5 and OfgLys6 possessed all conserved features critical for fundamental structure and function of c-type lysozyme, including the two catalytic sites, Glu32 and Asp50. OfgAtt is a typical glycine-rich protein. The antimicrobial activity of O. furnacalis hemolymph increased significantly after injection with Escherichia coli, Micrococcus luteus, or Beauveria bassiana. OfgAtt, IDD, and Lys6 are expressed at low level prior to the challenge, but strongly induced against Gram-positive and negative bacteria, and fungi. Under the same inducement conditions, the transcripts of these three genes elevated most when fifth instar larvae were injected. Therefore, O. furnacalis larvae are induced to produce antimicrobial materials in the hemolymph after the infection, and increase of lysozyme and attacin may contribute to the antimicrobial activity. PMID:24155672

  15. Characterization of antimicrobial activity and mechanisms of low amphipathic peptides with different α-helical propensity.


    Zhu, Xin; Zhang, Licong; Wang, Jue; Ma, Zhi; Xu, Wei; Li, Jianping; Shan, Anshan


    Antimicrobial peptides (AMPs) serve as a defense mechanism within multicellular organisms and are attracting increasing attention because of their potential application in the treatment of multidrug-resistant infections. Amphipathicity has long been believed to be the most important consideration for the structural modification and design of both naturally occurring and synthetic AMPs. Previous studies indicated that disruptive amphipathicity formed by replacing the paired charged amino acid residues on the polar face of an amphipathic helix with tryptophan residues linked with hydrogen bonds on the basis of α-helical protein folding principles endowed the AMPs with increased cell selectivity. In an attempt to augment and hone this strategy further, we designed a series of imperfect amphipathic peptides by placing different types of amino acid residues at the hydrogen bond linked positions of α-helix structures to characterize their antimicrobial properties and mechanism of action. The d-Trp-substituted sequence (PRW4-d) showed greater antimicrobial potency than Cys-(C4), Asp-(D4), Ile-(I4), and Pro-(P4) substituted sequences, comparable to the l-Trp-substituted parent sequence (PRW4). Furthermore, the total replacement of Lys residues with Arg residues along the peptide sequence (PRW4-R) exhibited enhanced antimicrobial activity and cell selectivity. In addition, no cytotoxicity was observed among these synthetic peptides. PRW4-d and PRW4-R maintained their activities in the presence of physiological salts and human serum. The fluorescence spectroscopy, flow cytometry, and electron microscopy observations indicated that the optimized sequences exhibited excellent antimicrobial potency by inducing cytoplasmic membrane potential loss, membrane permeabilization and disruption. Collectively, the results could be useful for designing short AMPs with great antimicrobial activity and cell selectivity.

  16. Structural Insights into and Activity Analysis of the Antimicrobial Peptide Myxinidin

    PubMed Central

    Cantisani, Marco; Finamore, Emiliana; Mignogna, Eleonora; Falanga, Annarita; Nicoletti, Giovanni Francesco; Pedone, Carlo; Morelli, Giancarlo; Leone, Marilisa


    The marine environment has been poorly explored in terms of potential new molecules possessing antibacterial activity. Antimicrobial peptides (AMPs) offer a new potential class of pharmaceuticals; however, further optimization is needed if AMPs are to find broad use as antibiotics. We focused our studies on a peptide derived from the epidermal mucus of hagfish (Myxine glutinosa L.), which was previously characterized and showed high antimicrobial activity against human and fish pathogens. In the present work, the activities of myxinidin peptide analogues were analyzed with the aim of widening the original spectrum of action of myxinidin by suitable changes in the peptide primary structure. The analysis of key residues by alanine scanning allowed for the design of novel peptides with increased activity. We identified the amino acids that are of the utmost importance for the observed antimicrobial activities against a set of pathogens comprising both Gram-negative and Gram-positive bacteria. Overall, optimized bactericidal potency was achieved by adding a tryptophan residue at the N terminus and by the simultaneous substitution of residues present in positions 3, 4, and 11 with arginine. These results indicate that the myxinidin analogues emerge as an attractive alternative for treating drug-resistant infectious diseases and provide key insights into a rational design for novel agents against these pathogens. PMID:24957834

  17. Correlation of charge, hydrophobicity, and structure with antimicrobial activity of S1 and MIRIAM peptides.


    Leptihn, Sebastian; Har, Jia Yi; Wohland, Thorsten; Ding, Jeak Ling


    Antimicrobial peptides are key elements of the innate immune system. Many of them interact with membranes of bacteria leading to perturbation of the lipid bilayer and eventually to inactivation of the pathogen. The emergence of multidrug-resistant bacteria has necessitated innovations of new and more powerful classes of antimicrobials. Here we present the in-depth study of an antimicrobial peptide, MIRIAM, derived from Sushi1 (S1), a well-characterized peptide from the horseshoe crab. MIRIAM interacts strongly with negatively charged lipids, forming an α-helical structure. MIRIAM was found to neutralize LPS and kill Gram-negative bacteria with high efficiency, while not releasing LPS. The promising therapeutic potential of MIRIAM is shown by hemolytic assays, which demonstrate that eukaryotic membranes are unaffected at bactericidal concentrations. Nanoparticle-conjugated MIRIAM used in single-molecule fluorescence and electron microscopy experiments showed that MIRIAM targets bacterial membranes to kill bacteria similarly to parental S1. Furthermore, fragments derived from MIRIAM and S1 provided insights on their molecular mechanisms of action, in particular, the relationships of functional motifs comprised by charge, hydrophobicity, and structure within each peptide. We conclude that the combination of charge, hydrophobicity, and length of the peptide is important. A close interaction of amino acids in a single molecule in a carefully balanced ensemble of sequence position and secondary structure is crucial.

  18. Two novel antimicrobial peptides purified from the symbiotic bacteria Xenorhabdus budapestensis NMC-10.


    Xiao, Yao; Meng, Fanlu; Qiu, Dewen; Yang, Xiufen


    Symbiotic bacteria, which are carried in the intestinal vesicle of the infective stage of juvenile entomopathogenic nematodes, produce broad-spectrum antibiotics. In this study, we aimed to isolate the antimicrobial peptides from the culture of the entomopathogenic bacterium Xenorhabdus budapestensis NMC-10. By screening chromatography columns and optimizing flow rate, pH, salinity and other purification conditions, we identified the final purification procedures which consisted of Q ion-exchange chromatography, gel filtration chromatography and two-step reverse-phase chromatography. Two novel antimicrobial peptides were identified via Q-TOF-TOF and de novo sequencing, and designated as GP-19 and EP-20. Both natural and synthetic peptides demonstrated broad-spectrum antimicrobial activities. The synthetic GP-19 peptide was active against Verticillium dahlia with EC(50) values of 17.54 μg/ml and highly inhibited the growth of a variety of bacteria, while the synthetic EP-20 peptide was highly active against Phytophthora capsici with EC(50) values of 3.14 μg/ml.

  19. Lipid membrane structure and dynamics in the presence of tamoxifen and antimicrobial peptides

    NASA Astrophysics Data System (ADS)

    Hebenstreit, Samuel; Khadka, Nawal; Pan, Jianjun


    Lipids are organic molecules composed of hydrophobic fatty acid tails and hydrophilic head groups that can form a multitude of structures, including lipid vesicles which provides an excellent model representing cell membranes. In this study, we examine the effects of antimicrobial peptides and drugs on lipid vesicles. Fourier transform infrared spectroscopy measurements are performed with and without the antimicrobial peptide. A change in absorbance corresponding to the wavenumber regimes associated with the stretching of the carbonyl and phosphate groups is observed. Also, a dye leakage assay is performed with vesicles composed of neutral and charged lipids. Calcein dye is enclosed within these vesicles in solution. Different concentrations of the active and inactive antimicrobial peptides, and tamoxifen are incubated with the vesicles. Concentration dependent dye leakage is determined by measuring fluorescence intensity before and after the addition of the peptides and tamoxifen. Different leakage behavior is observed for the active and inactive peptides, and the lipid composition of the vesicle is found to have a large effect. Supported by an NSF grant.

  20. Purification and characterization of a novel antimicrobial peptide from Brevibacillus laterosporus strain A60.


    Zhao, Jing; Guo, Lihua; Zeng, Hongmei; Yang, Xiufen; Yuan, Jingjing; Shi, Huaixing; Xiong, Yehui; Chen, Mingjia; Han, Lei; Qiu, Dewen


    A novel antimicrobial peptide, with molecular mass of 1602.0469Da, produced by Brevibacillus laterosporus strain A60 was isolated and purified from the soil of mango plants. The purification procedure consisted of ammonium sulfate precipitation, cation exchange chromatography on an HiTrap SP HP column, thin layer chromatography and High Performance Liquid Chromatography (HPLC) on C18 reversed-phase column. After the four isolation procedures, one peptide with antimicrobial activity was obtained and named BL-A60. The determination of the complete amino acid sequences of this peptide showed that it contains eleven amino acid residues, L-Y-K-L-V-K-V-V-L-N-M, and a choline connected to the N-terminal and a tenuazonic acid modified of the C-terminal. This peptide shows relatively low identification to other antimicrobial peptides from bacteria. Purified BL-A60 showed high pH and thermal stability and a strong inhibition of different stages of the life cycle of Phytophthora capsici, including mycelial growth, sporangia formation and cystospore germination, with EC(50) values of 7.89, 0.60 and 21.96 μg ml(-1), respectively.

  1. Antimicrobial and host-defense peptides as new anti-infective therapeutic strategies.


    Hancock, Robert E W; Sahl, Hans-Georg


    Short cationic amphiphilic peptides with antimicrobial and/or immunomodulatory activities are present in virtually every life form, as an important component of (innate) immune defenses. These host-defense peptides provide a template for two separate classes of antimicrobial drugs. Direct-acting antimicrobial host-defense peptides can be rapid-acting and potent, and possess an unusually broad spectrum of activity; consequently, they have prospects as new antibiotics, although clinical trials to date have shown efficacy only as topical agents. But for these compounds to fulfill their therapeutic promise and overcome clinical setbacks, further work is needed to understand their mechanisms of action and reduce the potential for unwanted toxicity, to make them more resistant to protease degradation and improve serum half-life, as well as to devise means of manufacturing them on a large scale in a consistent and cost-effective manner. In contrast, the role of cationic host-defense peptides in modulating the innate immune response and boosting infection-resolving immunity while dampening potentially harmful pro-inflammatory (septic) responses gives these peptides the potential to become an entirely new therapeutic approach against bacterial infections.

  2. Evaluation of the in vitro cytotoxicity of the antimicrobial peptide P34.


    Vaucher, Rodrigo Almeida; da Motta, Amanda de Souza; Brandelli, Adriano


    The in vitro cytotoxicity of the antimicrobial peptide P34 was evaluated in different eukaryotic cells. The food-grade bacteriocin nisin was also analysed for comparison. Vero cells were treated with different concentrations (0.02-2.5 microg x ml(-1)) of antimicrobial peptide P34 and nisin. Cell viability and plasma membrane integrity were checked by MTT [3-(4,5-dimethylthiazole-2-yl)-2,5-diphenyltetrazolium bromide], NRU (Neutral Red dye uptake) and LDH (lactate dehydrogenase) assays. The EC50 values of the peptide P34 in MTT and NRU assays were 0.60 and 1.25 microg x ml(-1) respectively, while values of nisin found were 0.50 and 1.04 microg x ml(-1). In the LDH assay, the EC50 values were 0.65 and 0.62 microg x ml(-1) for P34 and nisin, respectively. The peptide P34 revealed similar haemolytic activity on human erythrocytes (5.8%) when compared with nisin (4.9%). The effects on viability, motility and acrosomal exocytosis of human sperm were also evaluated. Nisin and P34 showed similar effects on sperm parameters. The evaluation of cytotoxicity of antimicrobial peptides is a critical step to guarantee their safe use.

  3. Characterization of IL-22 and antimicrobial peptide production in mice protected against pulmonary Cryptococcus neoformans infection.


    Wozniak, Karen L; Hole, Camaron R; Yano, Junko; Fidel, Paul L; Wormley, Floyd L


    Cryptococcus neoformans is a significant cause of fungal meningitis in patients with impaired T cell-mediated immunity (CMI). Experimental pulmonary infection with a C. neoformans strain engineered to produce IFN-γ, H99γ, results in the induction of Th1-type CMI, resolution of the acute infection, and protection against challenge with WT Cryptococcus. Given that individuals with suppressed CMI are highly susceptible to pulmonary C. neoformans infection, we sought to determine whether antimicrobial peptides were produced in mice inoculated with H99γ. Thus, we measured levels of antimicrobial peptides lipocalin-2, S100A8, S100A9, calprotectin (S100A8/A9 heterodimer), serum amyloid A-3 (SAA3), and their putative receptors Toll-like receptor 4 (TLR4) and the receptor for advanced glycation end products (RAGE) in mice during primary and recall responses against C. neoformans infection. Results showed increased levels of IL-17A and IL-22, cytokines known to modulate antimicrobial peptide production. We also observed increased levels of lipocalin-2, S100A8, S100A9 and SAA3 as well as TLR4(+) and RAGE(+) macrophages and dendritic cells in mice inoculated with H99γ compared with WT H99. Similar results were observed in the lungs of H99γ-immunized, compared with heat-killed C. neoformans-immunized, mice following challenge with WT yeast. However, IL-22-deficient mice inoculated with H99γ demonstrated antimicrobial peptide production and no change in survival rates compared with WT mice. These studies demonstrate that protection against cryptococcosis is associated with increased production of antimicrobial peptides in the lungs of protected mice that are not solely in response to IL-17A and IL-22 production and may be coincidental rather than functional.

  4. Leukotriene B4 induces release of antimicrobial peptides in lungs of virally infected mice.


    Gaudreault, Eric; Gosselin, Jean


    Leukotriene B(4) (LTB(4)) is a lipid mediator of inflammation that was recently shown to exert antiviral activities. In this study, we demonstrate that the release of antimicrobial proteins by neutrophils contribute to an early host defense against influenza virus infection in vitro as well as in vivo. Daily i.v. treatments with LTB(4) lead to a significant decrease in lung viral loads at day 5 postinfection in mice infected with influenza A virus compared with the placebo-treated group. This reduction in viral load was not present in mice deficient in the high-affinity LTB(4) receptor. Viral clearance in lungs was associated with up-regulated presence of antimicrobial peptides such as beta-defensin-3, members of the mouse eosinophil-related RNase family, and the mouse cathelicidin-related antimicrobial peptide. Our results also indicate that neutrophils are important in the antiviral effect of LTB(4). Viral loads in neutrophil-depleted mice were not diminished by LTB(4) administration, and a substantial reduction in the presence of murine cathelicidin-related antimicrobial peptide and the murine eosinophil-related RNase family in lung tissue was observed. Moreover, in vitro treatment of human neutrophil cultures with LTB(4) led rapidly to the secretion of the human cathelicidin LL-37 and eosinophil-derived neurotoxin, known as antiviral peptides. Pretreatment of cell cultures with specific LTB(4) receptor antagonists clearly demonstrate the implication of the high-affinity LTB(4) receptor in the LTB(4)-mediated activity. Together, these results demonstrate the importance of neutrophils and the secretion of antimicrobial peptides during the early immune response mediated by LTB(4) against a viral pathogen.

  5. Extremely abundant antimicrobial peptides existed in the skins of nine kinds of Chinese odorous frogs.


    Yang, Xinwang; Lee, Wen-Hui; Zhang, Yun


    Peptide agents are regarded as hopeful candidates to solve life-threatening resistance of pathogenic microorganisms to classic antibiotics due to their unique action mechanisms. Peptidomic and genomic investigation of natural antimicrobial peptides (AMPs) from amphibian skin secretions can provide a large amount of structure-functional information to design peptide antibiotics with therapeutic potential. In the present study, we identified a large number of AMPs from the skins of nine kinds of Chinese odorous frogs. Eighty AMPs were purified from three different odorous frogs and confirmed by peptidomic analysis. Our results indicated that post-translational modification of AMPs rarely happened in odorous frogs. cDNAs encoding precursors of 728 AMPs, including all the precursors of the confirmed 80 native peptides, were cloned from the constructed AMP cDNA libraries of nine Chinese odorous frogs. On the basis of the sequence similarity of deduced mature peptides, these 728 AMPs were grouped into 97 different families in which 71 novel families were identified. Out of these 728 AMPs, 662 AMPs were novel and 28 AMPs were reported previously in other frog species. Our results revealed that identical AMPs were widely distributed in odorous frogs; 49 presently identified AMPs could find their identical molecules in different amphibian species. Purified peptides showed strong antimicrobial activities against 4 tested microbe strains. Twenty-three deduced peptides were synthesized and their bioactivities, including antimicrobial, antioxidant, hemolytic, immunomodulatory and insulin-releasing activities, were evaluated. Our findings demonstrate the extreme diversity of AMPs in amphibian skins and provide plenty of templates to develop novel peptide antibiotics.

  6. Salt-resistant alpha-helical cationic antimicrobial peptides.


    Friedrich, C; Scott, M G; Karunaratne, N; Yan, H; Hancock, R E


    Analogues based on the insect cecropin-bee melittin hybrid peptide (CEME) were studied and analyzed for activity and salt resistance. The new variants were designed to have an increase in amphipathic alpha-helical content (CP29 and CP26) and in overall positive charge (CP26). The alpha-helicity of these peptides was demonstrated by circular dichroism spectroscopy in the presence of liposomes. CP29 was shown to have activity against gram-negative bacteria that was similar to or better than those of the parent peptides, and CP26 had similar activity. CP29 had cytoplasmic membrane permeabilization activity, as assessed by the unmasking of cytoplasmic beta-galactosidase, similar to that of CEME and its more positively charged derivative named CEMA, whereas CP26 was substantially less effective. The activity of the peptides was not greatly attenuated by an uncoupler of membrane potential, carbonyl cyanide-m-chlorophenylhydrazone. The tryptophan residue in position 2 was shown to be necessary for interaction with cell membranes, as demonstrated by a complete lack of activity in the peptide CP208. Peptides CP29, CEME, and CEMA were resistant to antagonism by 0.1 to 0.3 M NaCl; however, CP26 was resistant to antagonism only by up to 160 mM NaCl. The peptides were generally more antagonized by 3 and 5 mM Mg2+ and by the polyanion alginate. It appeared that the positively charged C terminus in CP26 altered its ability to permeabilize the cytoplasmic membrane of Escherichia coli, although CP26 maintained its ability to kill gram-negative bacteria. These peptides are potential candidates for future therapeutic drugs.

  7. Novel antimicrobial peptides that inhibit gram positive bacterial exotoxin synthesis.


    Merriman, Joseph A; Nemeth, Kimberly A; Schlievert, Patrick M


    Gram-positive bacteria, such as Staphylococcus aureus, cause serious human illnesses through combinations of surface virulence factors and secretion of exotoxins. Our prior studies using the protein synthesis inhibitor clindamycin and signal transduction inhibitors glycerol monolaurate and α-globin and β-globin chains of hemoglobin indicate that their abilities to inhibit exotoxin production by S. aureus are separable from abilities to inhibit growth of the organism. Additionally, our previous studies suggest that inhibition of exotoxin production, in absence of ability to kill S. aureus and normal flora lactobacilli, will prevent colonization by pathogenic S. aureus, while not interfering with lactobacilli colonization. These disparate activities may be important in development of novel anti-infective agents that do not alter normal flora. We initiated studies to explore the exotoxin-synthesis-inhibition activity of hemoglobin peptides further to develop potential agents to prevent S. aureus infections. We tested synthesized α-globin chain peptides, synthetic variants of α-globin chain peptides, and two human defensins for ability to inhibit exotoxin production without significantly inhibiting S. aureus growth. All of these peptides were weakly or not inhibitory to bacterial growth. However, the peptides were inhibitory to exotoxin production with increasing activity dependent on increasing numbers of positively-charged amino acids. Additionally, the peptides could be immobilized on agarose beads or have amino acid sequences scrambled and still retain exotoxin-synthesis-inhibition. The peptides are not toxic to human vaginal epithelial cells and do not inhibit growth of normal flora L. crispatus. These peptides may interfere with plasma membrane signal transduction in S. aureus due to their positive charges.

  8. Killer peptide: a novel paradigm of antimicrobial, antiviral and immunomodulatory auto-delivering drugs.


    Magliani, Walter; Conti, Stefania; Ciociola, Tecla; Giovati, Laura; Zanello, Pier Paolo; Pertinhez, Thelma; Spisni, Alberto; Polonelli, Luciano


    The incidence of life-threatening viral and microbial infections has dramatically increased over recent decades. Despite significant developments in anti-infective chemotherapy, many issues have increasingly narrowed the therapeutic options, making it imperative to discover new effective molecules. Among them, small peptides are arousing great interest. This review will focus in particular on a killer peptide, engineered from an anti-idiotypic recombinant antibody that mimics the activity of a wide-spectrum antimicrobial yeast killer toxin targeting β-glucan cell-wall receptors. The in vitro and in vivo antimicrobial, antiviral and immunomodulatory activities of killer peptide and its ability to spontaneously and reversibly self-assemble and slowly release its active dimeric form over time will be discussed as a novel paradigm of targeted auto-delivering drugs.

  9. Antimicrobial peptides incorporating non-natural amino acids as agents for plant protection.


    Ng-Choi, Iteng; Soler, Marta; Güell, Imma; Badosa, Esther; Cabrefiga, Jordi; Bardaji, Eduard; Montesinos, Emilio; Planas, Marta; Feliu, Lidia


    The control of plant pathogens is mainly based on copper compounds and antibiotics. However, the use of these compounds has some limitations. They have a high environmental impact and the use of antibiotics is not allowed in several countries. Moreover, resistance has been developed to these pathogens. The identification of new agents able to fight plant pathogenic bacteria and fungi will represent an alternative to currently used antibiotics or pesticides. Antimicrobial peptides are widely recognized as promising candidates, however naturally occurring sequences present drawbacks that limit their development. These include susceptibility to protease degradation and low bioavailability. To overcome these problems, research has focused on the introduction of unnatural amino acids into lead peptide sequences. In particular, we have improved the biological profile of antimicrobial peptides active against plant pathogenic bacteria and fungi by incorporating triazolyl, biaryl and D-amino acids into their sequence. These modifications and their influence on the biological activity are summarized.

  10. Three novel antimicrobial peptides from the skin of the Indian bronzed frog Hylarana temporalis (Anura: Ranidae).


    Reshmy, V; Preeji, V; Parvin, A; Santhoshkumar, K; George, S


    Amphibian skin secretion is considered as a rich source of bioactive peptides. The present work describes the successful identification of three novel peptides named brevinin-1TEa, brevinin-2TEa and brevinin-2TEb present in the skin secretion of Indian bronzed frog Hylarana temporalis. The deduced open reading frame encoding the biosynthetic precursor of brevinin-1TEa consisted of 70 amino acid residues and brevinin-2TEa and brevinin