Targeted delivery of an antisense oligonucleotide in the retina: uptake, distribution, stability, and effect.

PubMed

Rakoczy, P E; Lai, M C; Watson, M; Seydel, U; Constable, I

1996-01-01

In this article, we describe the preliminary results of the development of an animal model that will enable us to study the effect of photoreceptor-derived debris accumulation on the normal function of the retina in vivo. An antisense oligonucleotide (Cat 5), saline, and two control oligonucleotides were injected into the vitreous of 7-week-old RCS-rdy+ rats. The uptake, distribution, and persistence of the antisense oligonucleotide in the retina was demonstrated by fluorescent confocal microscopy, and the stability of the oligonucleotide was shown by GeneScan analysis using a fluorescein-labeled derivative of Cat 5 (Cat 5F). The accumulation of photoreceptor-derived debris was monitored by the number of undigested phagosomes in the RPE layer by light microscopy. Following intravitreal injection of Cat 5F, penetration of the oligonucleotide was observed in the ganglion cell layer in 2 hours and in the photoreceptor and pigment epithelial layers 3 days later. However, at 7, 28, and 56 days postinjection, only the RPE layer had significant amounts of Cat 5F present. Using GeneScan analysis, it was demonstrated that the fluorescein-labeled oligonucleotide present in the RPE layer was not degraded and it retained its original 19-mer length. There was no statistically significant difference in the number of phagosomes found in the RPE layer of control uninjected, saline-injected, and two sense and two antisense oligonucleotides-injected animals at 7 and 28 days postinjection. In contrast, the number of phagosomes was significantly higher (p < 0.001) in the RPE layer of Cat 5 antisense oligonucleotide-injected animals at 7 and 28 days postinjection. This difference, however, disappeared by 56 days postinjection. The inner nuclear layers of the retina of control and experimental animals were not affected by the injections.

Repair of Thalassemic Human β -globin mRNA in Mammalian Cells by Antisense Oligonucleotides

NASA Astrophysics Data System (ADS)

Sierakowska, Halina; Sambade, Maria J.; Agrawal, Sudhir; Kole, Ryszard

1996-11-01

In one form of β -thalassemia, a genetic blood disorder, a mutation in intron 2 of the β -globin gene (IVS2-654) causes aberrant splicing of β -globin pre-mRNA and, consequently, β -globin deficiency. Treatment of mammalian cells stably expressing the IVS2-654 human β -globin gene with antisense oligonucleotides targeted at the aberrant splice sites restored correct splicing in a dose-dependent fashion, generating correct human β -globin mRNA and polypeptide. Both products persisted for up to 72 hr posttreatment. The oligonucleotides modified splicing by a true antisense mechanism without overt unspecific effects on cell growth and splicing of other pre-mRNAs. This novel approach in which antisense oligonucleotides are used to restore rather than to down-regulate the activity of the target gene is applicable to other splicing mutants and is of potential clinical interest.

Receptor-Mediated Uptake of Phosphorothioate Antisense Oligonucleotides in Different Cell Types of the Liver.

PubMed

Miller, Colton M; Tanowitz, Michael; Donner, Aaron J; Prakash, Thazha P; Swayze, Eric E; Harris, Edward N; Seth, Punit P

2018-06-01

Oligonucleotide therapeutics have emerged as a third distinct platform for drug discovery within the pharmaceutical industry. Five oligonucleotide-based drugs have been approved by the US FDA and over 100 oligonucleotides drugs are currently at different stages of human trials. Several of these oligonucleotide drugs are modified using the phosphorothioate (PS) backbone modification where one of the nonbridging oxygen atoms of the phosphodiester linkage is replaced with sulfur. In this review, we summarize our knowledge on receptor-mediated uptake of PS antisense oligonucleotides (ASOs) within different cell types of the liver-a privileged organ for the discovery of oligonucleotide-based therapeutics.

DNA/RNA heteroduplex oligonucleotide for highly efficient gene silencing

PubMed Central

Nishina, Kazutaka; Piao, Wenying; Yoshida-Tanaka, Kie; Sujino, Yumiko; Nishina, Tomoko; Yamamoto, Tsuyoshi; Nitta, Keiko; Yoshioka, Kotaro; Kuwahara, Hiroya; Yasuhara, Hidenori; Baba, Takeshi; Ono, Fumiko; Miyata, Kanjiro; Miyake, Koichi; Seth, Punit P.; Low, Audrey; Yoshida, Masayuki; Bennett, C. Frank; Kataoka, Kazunori; Mizusawa, Hidehiro; Obika, Satoshi; Yokota, Takanori

2015-01-01

Antisense oligonucleotides (ASOs) are recognized therapeutic agents for the modulation of specific genes at the post-transcriptional level. Similar to any medical drugs, there are opportunities to improve their efficacy and safety. Here we develop a short DNA/RNA heteroduplex oligonucleotide (HDO) with a structure different from double-stranded RNA used for short interfering RNA and single-stranded DNA used for ASO. A DNA/locked nucleotide acid gapmer duplex with an α-tocopherol-conjugated complementary RNA (Toc-HDO) is significantly more potent at reducing the expression of the targeted mRNA in liver compared with the parent single-stranded gapmer ASO. Toc-HDO also improves the phenotype in disease models more effectively. In addition, the high potency of Toc-HDO results in a reduction of liver dysfunction observed in the parent ASO at a similar silencing effect. HDO technology offers a novel concept of therapeutic oligonucleotides, and the development of this molecular design opens a new therapeutic field. PMID:26258894

Intravenous administration of stabilized antisense lipid particles (SALP) leads to activation and expansion of liver natural killer cells.

PubMed

Bramson, J L; Bodner, C A; Johnson, J; Semple, S; Hope, M J

2000-06-01

Stabilized antisense lipid particles (SALP) have been developed for the systemic delivery of oligonucleotides. The impact of intravenous SALP administration was measured with respect to activation of natural killer (NK) and NK1.1+ T (NKT) cells in the livers of immunocompetent mice. Treatment with a SALP containing a highly mitogenic oligonucleotide (INX-6295) generated an increase in NK cytolytic activity and cell number within the liver but did not appear to affect the number of hepatic NKT cells or their cytolytic activity. The same results were observed after intravenous administration of the mitogenic oligonucleotide alone. Interestingly, treatment with a SALP containing a weakly mitogenic oligonucleotide (INX-6300) also activated the liver NK cells, whereas the oligonucleotide alone was unable to elicit these effects. The NK stimulatory activity of a SALP containing INX-6300 required both lipid and oligonucleotide components. These results demonstrate that in addition to modifying the pharmacokinetics and biodistribution of intravenously administered oligonucleotides, SALP possess immunostimulatory activity independent of oligonucleotide mitogenicity, which can serve as an adjuvant to antisense therapies for cancer.

Review on investigations of antisense oligonucleotides with the use of mass spectrometry.

PubMed

Studzińska, Sylwia

2018-01-01

Antisense oligonucleotides have been investigated as potential drugs for years. They inhibit target gene or protein expression. The present review summarizes their modifications, modes of action, and applications of liquid chromatography coupled with mass spectrometry for qualitative and quantitative analysis of these compounds. The most recent reports on a given topic were given prominence, while some early studies were reviewed in order to provide a theoretical background. The present review covers the issues of using ion-exchange chromatography, ion-pair reversed-phase high performance liquid chromatography and hydrophilic interaction chromatography for the separation of antisense oligonucleotides. The application of mass spectrometry was described with regard to the ionization type used for the determination of these potential therapeutics. Moreover, the current approaches and applications of mass spectrometry for quantitative analysis of antisense oligonucleotides and their metabolites as well as their impurities during in vitro and in vivo studies were discussed. Finally, certain conclusions and perspectives on the determination of therapeutic oligonucleotides in various samples were briefly described. Copyright © 2017 Elsevier B.V. All rights reserved.

[Study toward practical use of oligonucleotide therapeutics].

PubMed

Inoue, Takao; Yoshida, Tokuyuki

2014-01-01

Over the past decade, oligonucleotide-based therapeutics such as antisense oligonucleotides and small interfering RNAs (siRNAs) have been developed extensively. For example, mipomersen (Kynamro; ISIS Pharmaceuticals), which is a second-generation antisense oligonucleotide administered by subcutaneous injection, has recently been approved by the FDA for the treatment of homozygous familial hypercholesterolemia. On the other hands, methods for the evaluation of quality, efficacy and safety of oligonucleotide therapeutics have not been fully discussed. Furthermore, the regulatory guidance specific for oligonucleotide therapeutics has not been established yet. Under these circumstances, we started to collaborate with Osaka University and PMDA to discuss regulatory science focused on oligonucleotide therapeutics. Through the collaboration, we would like to propose the possible design of quality evaluation and preclinical safety-evaluation of oligonucleotide therapeutics.

Construction of a directed hammerhead ribozyme library: towards the identification of optimal target sites for antisense-mediated gene inhibition.

PubMed Central

Pierce, M L; Ruffner, D E

1998-01-01

Antisense-mediated gene inhibition uses short complementary DNA or RNA oligonucleotides to block expression of any mRNA of interest. A key parameter in the success or failure of an antisense therapy is the identification of a suitable target site on the chosen mRNA. Ultimately, the accessibility of the target to the antisense agent determines target suitability. Since accessibility is a function of many complex factors, it is currently beyond our ability to predict. Consequently, identification of the most effective target(s) requires examination of every site. Towards this goal, we describe a method to construct directed ribozyme libraries against any chosen mRNA. The library contains nearly equal amounts of ribozymes targeting every site on the chosen transcript and the library only contains ribozymes capable of binding to that transcript. Expression of the ribozyme library in cultured cells should allow identification of optimal target sites under natural conditions, subject to the complexities of a fully functional cell. Optimal target sites identified in this manner should be the most effective sites for therapeutic intervention. PMID:9801305

Decoy Oligonucleotide Rescues IGF1R Expression from MicroRNA-223 Suppression

PubMed Central

Wang, Rong; He, Bao Mei; Qi, Bing; Xu, Chang Jun; Wu, Xing Zhong

2013-01-01

A mature miRNA generally suppresses hundreds of mRNA targets. To evaluate the selective effect of synthetic oligonucleotide decoys on hsa-miR-223 activity, reporters containing 3’ untranslated regions (UTR) of IGF1R, FOXO1, POLR3G, FOXO3, CDC27, FBXW7 and PAXIP1 mRNAs were constructed for the luciferase assay. The oligonucleotide decoys were designed and synthesized according to mature miR-223 sequence and its target mRNA sequence. Quantitative RT-PCR & western analysis were used to measure miR-223-targeted mRNA expression, Interestingly, apart from the antisense oligonucleotide, decoy nucleotides which were complementary to the 5’, central or 3’ region of mature miR-223 suppressed miR-223 targeting the 3’UTR of IGF1R, FOXO1, FOXO3, CDC27, POLR3G, and FBXW7 mRNAs and rescued the expression of these genes to varying degrees from miR-223 suppression at both mRNA and protein levels. All decoys had no effect on PAXIP1 which was not targeted by miR-223. The decoy 1 that was based on the sequence of IGF1R 3’UTR rescued the expression of IGF1R more significantly than other decoy nucleotides except the antisense decoy 4. Decoy 1 also rescued the expression of FOXO3 and POLR3G of which their 3’UTRs have similar binding sites for miR-223 with IGF1R 3’UTR. However decoy 1 failed to recover Sp1, CDC27 and FBXW7 expression. These data support that the sequence-specific decoy oligonucleotides might represent exogenous competing RNA which selectively inhibits microRNA targeting. PMID:24324762

Decoy oligonucleotide rescues IGF1R expression from MicroRNA-223 suppression.

PubMed

Wu, Li Hui; Cai, Qian Qian; Dong, Yi Wei; Wang, Rong; He, Bao Mei; Qi, Bing; Xu, Chang Jun; Wu, Xing Zhong

2013-01-01

A mature miRNA generally suppresses hundreds of mRNA targets. To evaluate the selective effect of synthetic oligonucleotide decoys on hsa-miR-223 activity, reporters containing 3' untranslated regions (UTR) of IGF1R, FOXO1, POLR3G, FOXO3, CDC27, FBXW7 and PAXIP1 mRNAs were constructed for the luciferase assay. The oligonucleotide decoys were designed and synthesized according to mature miR-223 sequence and its target mRNA sequence. Quantitative RT-PCR & western analysis were used to measure miR-223-targeted mRNA expression, Interestingly, apart from the antisense oligonucleotide, decoy nucleotides which were complementary to the 5', central or 3' region of mature miR-223 suppressed miR-223 targeting the 3'UTR of IGF1R, FOXO1, FOXO3, CDC27, POLR3G, and FBXW7 mRNAs and rescued the expression of these genes to varying degrees from miR-223 suppression at both mRNA and protein levels. All decoys had no effect on PAXIP1 which was not targeted by miR-223. The decoy 1 that was based on the sequence of IGF1R 3'UTR rescued the expression of IGF1R more significantly than other decoy nucleotides except the antisense decoy 4. Decoy 1 also rescued the expression of FOXO3 and POLR3G of which their 3'UTRs have similar binding sites for miR-223 with IGF1R 3'UTR. However decoy 1 failed to recover Sp1, CDC27 and FBXW7 expression. These data support that the sequence-specific decoy oligonucleotides might represent exogenous competing RNA which selectively inhibits microRNA targeting.

Pharmacology of Antisense Drugs.

PubMed

Bennett, C Frank; Baker, Brenda F; Pham, Nguyen; Swayze, Eric; Geary, Richard S

2017-01-06

Recent studies have led to a greater appreciation of the diverse roles RNAs play in maintaining normal cellular function and how they contribute to disease pathology, broadening the number of potential therapeutic targets. Antisense oligonucleotides are the most direct means to target RNA in a selective manner and have become an established platform technology for drug discovery. There are multiple molecular mechanisms by which antisense oligonucleotides can be used to modulate RNAs in cells, including promoting the degradation of the targeted RNA or modulating RNA function without degradation. Antisense drugs utilizing various antisense mechanisms are demonstrating therapeutic potential for the treatment of a broad variety of diseases. This review focuses on some of the advances that have taken place in translating antisense technology from the bench to the clinic.

Biological and molecular characterization of cellular differentiation in Tetrahymena vorax: a potential biocontrol protozoan.

PubMed

Green, M M; LeBoeuf, R D; Churchill, P F

2000-01-01

Tetrahymena vorax (T. vorax) is an indigenous fresh water protozoan with the natural biological potential to maintain a specific aquatic microbial flora by ingesting and eliminating specific microorganism. To investigate the molecular mechanisms controlling Tetrahymena vorax (T. vorax) cellular differentiation from a small-mouth vegetative cell to a voracious large-mouth carnivore capable of ingesting prey ciliates and bacteria from aquatic environments, we use DNA subtraction and gene discovery techniques to identify and isolate T. vorax differentiation-specific genes. The physiological necessity for one newly discovered gene, SUBII-TG, was determined in vivo using an antisense oligonucleotide directed against the 5' SUBII-TG DNA sequence. The barriers to delivering antisense oligonucleotides to the cytoplasm of T. vorax were circumvented by employing a new but simple procedure of processing the oligonucleotide with the differentiation stimulus, stomatin. In these studies, the antisense oligonucleotide down-regulated SUBII-TG mRNA expression, and blocked differentiation and ingestion of prey ciliates. The ability to down-regulate SUBII-TG expression with the antisense oligonucleotide suggests that the molecular mechanisms controlling the natural biological activities of T. vorax can be manipulated to further study its cellular differentiation and potential as a biocontrol microorganism.

TGF-beta antisense oligonucleotides reduce mRNA expression of matrix metalloproteinases in cultured wound-healing-related cells.

PubMed

Philipp, Katrin; Riedel, Frank; Germann, Günter; Hörmann, Karl; Sauerbier, Michael

2005-02-01

The pathology of chronic dermal ulcers is characterized by excessive proteolytic activity which degrades extracellular matrix. The transforming growth factor-beta (TGF-beta) has been identified as an important component of wound healing. Recent developments in molecular therapy offer exciting prospects for the modulation of wound healing, specifically those targeting TGF-beta. We investigated the effect of TGF-beta antisense oligonucleotides on the mRNA expression of matrix metalloproteinases in cultured human keratinocytes, fibroblasts and endothelial cells using multiplex RT-PCR. The treatment of keratinocytes and fibroblasts with TGF-beta antisense oligonucleotides resulted in a significant decrease of expression of mRNA of MMP-1 and MMP-9 compared to controls. Accordingly, a decreased expression of MMP-1 mRNA in endothelial cells was detectable. Other MMPs were not affected. Affecting all dermal wound-healing-related cell types, TGF-beta antisense oligonucleotide technology may be a potential therapeutic option for the inhibition of proteolytic tissue destruction in chronic wounds. Pharmaceutical intervention in this area ultimately may help clinicians to proactively intervene in an effort to prevent normal wounds from becoming chronic.

Antisense oligonucleotides as innovative therapeutic strategy in the treatment of high-grade gliomas.

PubMed

Caruso, Gerardo; Caffo, Mariella; Raudino, Giuseppe; Alafaci, Concetta; Salpietro, Francesco M; Tomasello, Francesco

2010-01-01

Despite the intensive recent research in cancer therapy, the prognosis in patients affected by high-grade gliomas is still very unfavorable. The efficacy of classical anti-cancer strategies is seriously limited by lack of specific therapies against malignant cells. The extracellular matrix plays a pivotal role in processes such as differentiation, apoptosis, and migration in both the normal and the pathologic nervous system. Glial tumors seem to be able to create a favorable environment for the invasion of glioma cells in cerebral parenchyma when they combine with the extracellular matrix via cell surface receptors. Glioma cells synthesize matrix proteins, such as tenascin, laminin, fibronectin that facilitate the tumor cell's motility. New treatments have shown to hit the acting molecules in the tumor growth and to increase the efficacy and minimize the toxicity. Antisense oligonucleotides are synthetic stretches of DNA which hybridize with specific mRNA strands. The specificity of hybridization makes antisense method an interesting strategy to selectively modulate the expression of genes involved in tumorigenesis. In this review we will focus on the mechanisms of action of antisense oligonucleotides and report clinical and experimental studies on the treatment of high-grade gliomas. We will also report the patents of preclinical and/or clinical studies that adopt the antisense oligonucleotide therapy list in cerebral gliomas.

VRP09 Reduction of Corneal Scarring Following Blast and Burn Injuries to Cornea Using siRNAs Targeting TGFb and CTGF

DTIC Science & Technology

2013-03-01

oligonucleotide-based drug approaches (better than ribozymes, antisense oligonucleotides ( ASO ), or microRNAs). (4) To accomplish these objectives, we...negative control scrambled ASO (designated NC). The combination of siRNAs T1 and R1 produced a knockdown of ~80% of TGFb1 protein in the conditioned...sequences (antisense oligonucleotides, ASOs ) into rabbit corneal cells and found that technique was very effective in delivering ASOs into the stroma and

Gene Silencing by Gold Nanoshell-Mediated Delivery and Laser-Triggered Release of Antisense Oligonucleotide and siRNA

PubMed Central

Huschka, Ryan; Barhoumi, Aoune; Liu, Qing; Roth, Jack A.; Ji, Lin; Halas, Naomi J.

2013-01-01

The approach of RNA interference (RNAi)- using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein- is very useful in dissecting genetic function and holds significant promise as a molecular therapeutic. A major obstacle in achieving gene silencing with RNAi technology is the systemic delivery of therapeutic oligonucleotides. Here we demonstrate an engineered gold nanoshell (NS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer covalently attached to the NS surface (NS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotides, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. Controlled release of the captured therapeutic oligonucleotides in each case is accomplished by continuous wave NIR laser irradiation at 800 nm, near the resonance wavelength of the nanoshell. Fluorescently tagged oligonucleotides were used to monitor the time-dependent release process and light-triggered endosomal release. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and gene silencing mediated by the NS-PLL carrying GFP gene-specific single-stranded DNA antisense oligonucleotide (AON-GFP), or a double-stranded siRNA (siRNA-GFP), in vitro. Light-triggered delivery resulted in ∼ 47% and ∼49% downregulation of the targeted GFP expression by AON-GFP and siRNA-GFP, respectively. Cytotoxicity induced by both the NS-PLL delivery vector and by laser irradiation is minimal, as demonstrated by a XTT cell proliferation assay. PMID:22862291

Antisense Oligonucleotide Therapy for Patients with Advanced Cancer | Center for Cancer Research

Cancer.gov

Colorectal cancer (CRC) is the second leading cause of cancer-related death in the U.S. Improvements in therapy have increased the survival of patients with CRC from 10 months to two years, but for patients who stop responding to treatments, such as irinotecan, options for additional therapy are limited. Antisense oligonucleotides (ASOs) may offer advantages over traditional

Antisense Oligonucleotides Modulating Activation of a Nonsense-Mediated RNA Decay Switch Exon in the ATM Gene.

PubMed

Kralovicova, Jana; Moreno, Pedro M D; Cross, Nicholas C P; Pêgo, Ana Paula; Vorechovsky, Igor

2016-12-01

ATM (ataxia-telangiectasia, mutated) is an important cancer susceptibility gene that encodes a key apical kinase in the DNA damage response pathway. ATM mutations in the germ line result in ataxia-telangiectasia (A-T), a rare genetic syndrome associated with hypersensitivity to double-strand DNA breaks and predisposition to lymphoid malignancies. ATM expression is limited by a tightly regulated nonsense-mediated RNA decay (NMD) switch exon (termed NSE) located in intron 28. In this study, we identify antisense oligonucleotides that modulate NSE inclusion in mature transcripts by systematically targeting the entire 3.1-kb-long intron. Their identification was assisted by a segmental deletion analysis of transposed elements, revealing NSE repression upon removal of a distant antisense Alu and NSE activation upon elimination of a long terminal repeat transposon MER51A. Efficient NSE repression was achieved by delivering optimized splice-switching oligonucleotides to embryonic and lymphoblastoid cells using chitosan-based nanoparticles. Together, these results provide a basis for possible sequence-specific radiosensitization of cancer cells, highlight the power of intronic antisense oligonucleotides to modify gene expression, and demonstrate transposon-mediated regulation of NSEs.

Synthesis, physicochemical and biochemical studies of 1',2'-oxetane constrained adenosine and guanosine modified oligonucleotides, and their comparison with those of the corresponding cytidine and thymidine analogues.

PubMed

Pradeepkumar, Pushpangadan I; Cheruku, Pradeep; Plashkevych, Oleksandr; Acharya, Parag; Gohil, Suresh; Chattopadhyaya, Jyoti

2004-09-22

We have earlier reported the synthesis and antisense properties of the conformationally constrained oxetane-C and -T containing oligonucleotides, which have shown effective down-regulation of the proto-oncogene c-myb mRNA in the K562 human leukemia cells. Here we report on the straightforward syntheses of the oxetane-A and oxetane-G nucleosides as well as their incorporations into antisense oligonucleotides (AONs), and compare their structural and antisense properties with those of the T and C modified AONs (including the thermostability and RNase H recruitment capability of the AON/RNA hybrid duplex by Michaelis-Menten kinetic analyses, their resistance in the human serum, as well as in the presence of exo and endonucleases).

The role of antisense oligonucleotide therapy in patients with familial hypercholesterolemia: risks, benefits, and management recommendations.

PubMed

Agarwala, Anandita; Jones, Peter; Nambi, Vijay

2015-01-01

Antisense oligonucleotide therapy is a promising approach for the treatment of a broad variety of medical conditions. It functions at the cellular level by interfering with RNA function, often leading to degradation of specifically targeted abnormal gene products implicated in the disease process. Mipomersen is a novel antisense oligonucleotide directed at apolipoprotein (apoB)-100, the primary apolipoprotein associated with low-density lipoprotein cholesterol (LDL-C), which has recently been approved for the treatment of familial hypercholesterolemia. A number of clinical studies have demonstrated its efficacy in lowering LDL-C and apoB levels in patients with elevated LDL-C despite maximal medical therapy using conventional lipid-lowering agents. This review outlines the risks and benefits of therapy and provides recommendations on the use of mipomersen.

Oligonucleotides as antivirals: dream or realistic perspective?

PubMed

Van Aerschot, Arthur

2006-09-01

Many reports have been published on antiviral activity of synthetic oligonucleotides, targeted to act either by a true antisense effect or via non-sequence specific interactions. This short review will try to evaluate the current status of the field by focusing on the effects as reported for inhibition of either HSV-1, HCMV or HIV-1. Following an introduction with a historical background and a brief discussion on the different types of constructs and mechanisms of action, the therapeutic potential of antisense oligonucleotides as antivirals, as well as possible pitfalls upon their evaluation will be discussed.

RNA therapeutics: Beyond RNA interference and antisense oligonucleotides

PubMed Central

Kole, Ryszard; Krainer, Adrian R.; Altman, Sidney

2016-01-01

Here we discuss three RNA therapeutic technologies exploiting various oligonucleotides that bind RNA by base-pairing in a sequence-specific manner yet have different mechanisms of action and effects. RNA interference and antisense oligonucleotides downregulate gene expression by enzyme-dependent degradation of targeted mRNA. Steric blocking oligonucleotides block access of cellular machinery to pre-mRNA and mRNA without degrading the RNA. Through this mechanism, blocking oligonucleotides can redirect alternative splicing, repair defective RNA, restore protein production or also downregulate gene expression. Moreover, they can be extensively chemically modified, resulting in more drug-like properties. The ability of RNA blocking oligonucleotides to restore gene function makes them suited for treatment of genetic disorders. Positive results from clinical trials for the treatment of Duchenne muscular dystrophy show that this technology is close to realizing its clinical potential. PMID:22262036

PCSK9 LNA antisense oligonucleotides induce sustained reduction of LDL cholesterol in nonhuman primates.

PubMed

Lindholm, Marie W; Elmén, Joacim; Fisker, Niels; Hansen, Henrik F; Persson, Robert; Møller, Marianne R; Rosenbohm, Christoph; Ørum, Henrik; Straarup, Ellen M; Koch, Troels

2012-02-01

Proprotein convertase subtilisin/kexin type 9 (PCSK9) has emerged as a therapeutic target for the reduction of low-density lipoprotein cholesterol (LDL-C). PCSK9 increases the degradation of the LDL receptor, resulting in high LDL-C in individuals with high PCSK9 activity. Here, we show that two locked nucleic acid (LNA) antisense oligonucleotides targeting PCSK9 produce sustained reduction of LDL-C in nonhuman primates after a loading dose (20 mg/kg) and four weekly maintenance doses (5 mg/kg). PCSK9 messenger RNA (mRNA) and serum PCSK9 protein were reduced by 85% which resulted in a 50% reduction in circulating LDL-C. Serum total cholesterol (TC) levels were reduced to the same extent as LDL-C with no reduction in high-density lipoprotein levels, demonstrating a specific pharmacological effect on LDL-C. The reduction in hepatic PCSK9 mRNA correlated with liver LNA oligonucleotide content. This verified that anti-PCSK9 LNA oligonucleotides regulated LDL-C through an antisense mechanism. The compounds were well tolerated with no observed effects on toxicological parameters (liver and kidney histology, alanine aminotransferase, aspartate aminotransferase, urea, and creatinine). The pharmacologic evidence and initial safety profile of the compounds used in this study indicate that LNA antisense oligonucleotides targeting PCSK9 provide a viable therapeutic strategy and are potential complements to statins in managing high LDL-C.

Caged circular antisense oligonucleotides for photomodulation of RNA digestion and gene expression in cells

PubMed Central

Wu, Li; Wang, Yuan; Wu, Junzhou; Lv, Cong; Wang, Jie; Tang, Xinjing

2013-01-01

We synthesized three 20mer caged circular antisense oligodeoxynucleotides (R20, R20B2 and R20B4) with a photocleavable linker and an amide bond linker between two 10mer oligodeoxynucleotides. With these caged circular antisense oligodeoxynucleotides, RNA-binding affinity and its digestion by ribonuclease H were readily photomodulated. RNA cleavage rates were upregulated ∼43-, 25- and 15-fold for R20, R20B2 and R20B4, respectively, upon light activation in vitro. R20B2 and R20B4 with 2- or 4-nt gaps in the target RNA lost their ability to bind the target RNA even though a small amount of RNA digestion was still observed. The loss of binding ability indicated promising gene photoregulation through a non-enzymatic strategy. To test this strategy, three caged circular antisense oligonucleotides (PS1, PS2 and PS3) with 2′-OMe RNA and phosphorothioate modifications were synthesized to target GFP expression. Upon light activation, photomodulation of target hybridization and GFP expression in cells was successfully achieved with PS1, PS2 and PS3. These caged circular antisense oligonucleotides show promising applications of photomodulating gene expression through both ribonuclease H and non-enzyme involved antisense strategies. PMID:23104375

Antisense apolipoprotein B therapy: where do we stand?

PubMed

Akdim, Fatima; Stroes, Erik S G; Kastelein, John J P

2007-08-01

Antisense oligonucleotides are novel therapeutic agents that reduce the number of specific mRNAs available for translation of the encoded protein. ISIS 301012 is an antisense oligonucleotide developed to reduce the hepatic synthesis of apolipoprotein B-100. Apolipoprotein B-100 is made in the liver, and antisense oligonucleotides preferentially distribute to that organ, so antisense apolipoprotein B-100 may have potential as an efficacious lipid-lowering agent. Recently, in healthy volunteers and in mild dyslipidaemic patients, this strategy as monotherapy or in conjunction with statins has shown unparalleled efficacy in reducing apolipoprotein B-100 and LDL-cholesterol. Tolerance for this novel therapy is encouraging and safety concerns currently only relate to mild injection-site reactions and rare liver-function test abnormalities. It should be noted, however, that these safety results were obtained in relatively few individuals. ISIS 301012 has initially shown promising results in experimental animal models, and in clinical trials in humans. Besides the effect of reducing apolipoprotein B-100 and LDL-cholesterol, this compound also significantly lowers plasma triglycerides. Safety concerns related to the drug include increased liver-function tests. To date no evidence of hepatic steatosis has been reported. Nonetheless, clinical trials of longer duration are required to demonstrate further safety.

Identification of sequence motifs significantly associated with antisense activity.

PubMed

McQuisten, Kyle A; Peek, Andrew S

2007-06-07

Predicting the suppression activity of antisense oligonucleotide sequences is the main goal of the rational design of nucleic acids. To create an effective predictive model, it is important to know what properties of an oligonucleotide sequence associate significantly with antisense activity. Also, for the model to be efficient we must know what properties do not associate significantly and can be omitted from the model. This paper will discuss the results of a randomization procedure to find motifs that associate significantly with either high or low antisense suppression activity, analysis of their properties, as well as the results of support vector machine modelling using these significant motifs as features. We discovered 155 motifs that associate significantly with high antisense suppression activity and 202 motifs that associate significantly with low suppression activity. The motifs range in length from 2 to 5 bases, contain several motifs that have been previously discovered as associating highly with antisense activity, and have thermodynamic properties consistent with previous work associating thermodynamic properties of sequences with their antisense activity. Statistical analysis revealed no correlation between a motif's position within an antisense sequence and that sequences antisense activity. Also, many significant motifs existed as subwords of other significant motifs. Support vector regression experiments indicated that the feature set of significant motifs increased correlation compared to all possible motifs as well as several subsets of the significant motifs. The thermodynamic properties of the significantly associated motifs support existing data correlating the thermodynamic properties of the antisense oligonucleotide with antisense efficiency, reinforcing our hypothesis that antisense suppression is strongly associated with probe/target thermodynamics, as there are no enzymatic mediators to speed the process along like the RNA Induced Silencing Complex (RISC) in RNAi. The independence of motif position and antisense activity also allows us to bypass consideration of this feature in the modelling process, promoting model efficiency and reducing the chance of overfitting when predicting antisense activity. The increase in SVR correlation with significant features compared to nearest-neighbour features indicates that thermodynamics alone is likely not the only factor in determining antisense efficiency.

The Contribution of the Activation Entropy to the Gas-Phase Stability of Modified Nucleic Acid Duplexes

NASA Astrophysics Data System (ADS)

Hari, Yvonne; Dugovič, Branislav; Istrate, Alena; Fignolé, Annabel; Leumann, Christian J.; Schürch, Stefan

2016-07-01

Tricyclo-DNA (tcDNA) is a sugar-modified analogue of DNA currently tested for the treatment of Duchenne muscular dystrophy in an antisense approach. Tandem mass spectrometry plays a key role in modern medical diagnostics and has become a widespread technique for the structure elucidation and quantification of antisense oligonucleotides. Herein, mechanistic aspects of the fragmentation of tcDNA are discussed, which lay the basis for reliable sequencing and quantification of the antisense oligonucleotide. Excellent selectivity of tcDNA for complementary RNA is demonstrated in direct competition experiments. Moreover, the kinetic stability and fragmentation pattern of matched and mismatched tcDNA heteroduplexes were investigated and compared with non-modified DNA and RNA duplexes. Although the separation of the constituting strands is the entropy-favored fragmentation pathway of all nucleic acid duplexes, it was found to be only a minor pathway of tcDNA duplexes. The modified hybrid duplexes preferentially undergo neutral base loss and backbone cleavage. This difference is due to the low activation entropy for the strand dissociation of modified duplexes that arises from the conformational constraint of the tc-sugar-moiety. The low activation entropy results in a relatively high free activation enthalpy for the dissociation comparable to the free activation enthalpy of the alternative reaction pathway, the release of a nucleobase. The gas-phase behavior of tcDNA duplexes illustrates the impact of the activation entropy on the fragmentation kinetics and suggests that tandem mass spectrometric experiments are not suited to determine the relative stability of different types of nucleic acid duplexes.

Antisense Oligonucleotide Therapy for Patients with Advanced Cancer | Center for Cancer Research

Cancer.gov

Colorectal cancer (CRC) is the second leading cause of cancer-related death in the U.S. Improvements in therapy have increased the survival of patients with CRC from 10 months to two years, but for patients who stop responding to treatments, such as irinotecan, options for additional therapy are limited. Antisense oligonucleotides (ASOs) may offer advantages over traditional therapies if an appropriate target can be identified.

Integrated Safety Assessment of 2′-O-Methoxyethyl Chimeric Antisense Oligonucleotides in NonHuman Primates and Healthy Human Volunteers

PubMed Central

Crooke, Stanley T; Baker, Brenda F; Kwoh, T Jesse; Cheng, Wei; Schulz, Dan J; Xia, Shuting; Salgado, Nelson; Bui, Huynh-Hoa; Hart, Christopher E; Burel, Sebastien A; Younis, Husam S; Geary, Richard S; Henry, Scott P; Bhanot, Sanjay

2016-01-01

The common chemical and biological properties of antisense oligonucleotides provide the opportunity to identify and characterize chemical class effects across species. The chemical class that has proven to be the most versatile and best characterized is the 2′-O-methoxyethyl chimeric antisense oligonucleotides. In this report we present an integrated safety assessment of data obtained from controlled dose-ranging studies in nonhuman primates (macaques) and healthy human volunteers for 12 unique 2′-O-methoxyethyl chimeric antisense oligonucleotides. Safety was assessed by the incidence of safety signals in standardized laboratory tests for kidney and liver function, hematology, and complement activation; as well as by the mean test results as a function of dose level over time. At high doses a number of toxicities were observed in nonhuman primates. However, no class safety effects were identified in healthy human volunteers from this integrated data analysis. Effects on complement in nonhuman primates were not observed in humans. Nonhuman primates predicted safe doses in humans, but over predicted risk of complement activation and effects on platelets. Although limited to a single chemical class, comparisons from this analysis are considered valid and accurate based on the carefully controlled setting for the specified study populations and within the total exposures studied. PMID:27357629

Regulation of adhesion and growth of fibrosarcoma cells by NF-kappa B RelA involves transforming growth factor beta.

PubMed Central

Perez, J R; Higgins-Sochaski, K A; Maltese, J Y; Narayanan, R

1994-01-01

The NF-kappa B transcription factor is a pleiotropic activator that participates in the induction of a wide variety of cellular genes. Antisense oligomer inhibition of the RelA subunit of NF-kappa B results in a block of cellular adhesion and inhibition of tumor cell growth. Investigation of the molecular basis for these effects showed that in vitro inhibition of the growth of transformed fibroblasts by relA antisense oligonucleotides can be reversed by the parental-cell-conditioned medium. Cytokine profile analysis of these cells treated with relA antisense oligonucleotides revealed inhibition of transforming growth factor beta 1 (TGF-beta 1 to the transformed fibroblasts reversed the inhibitory effects of relA antisense oligomers on soft agar colony formation and cell adhesion to the substratum. Direct inhibition of TGF-beta 1 expression by antisense phosphorothioates to TGF-beta 1 mimicked the in vitro effects of blocking cell adhesion that are elicited by antisense relA oligomers. These results may explain the in vitro effects of relA antisense oligomers on fibrosarcoma cell growth and adhesion. Images PMID:8035811

Antisense oligonucleotide technologies in drug discovery.

PubMed

Aboul-Fadl, Tarek

2006-09-01

The principle of antisense oligonucleotide (AS-OD) technologies is based on the specific inhibition of unwanted gene expression by blocking mRNA activity. It has long appeared to be an ideal strategy to leverage new genomic knowledge for drug discovery and development. In recent years, AS-OD technologies have been widely used as potent and promising tools for this purpose. There is a rapid increase in the number of antisense molecules progressing in clinical trials. AS-OD technologies provide a simple and efficient approach for drug discovery and development and are expected to become a reality in the near future. This editorial describes the established and emerging AS-OD technologies in drug discovery.

Generation of Soluble Receptor Activator of NF-kappa B Ligand is Critical for Osteolytic Bone Metastasis

DTIC Science & Technology

2009-10-01

differentiation and activation of osteoclast precursors. Targeting RANKL expression with antisense oligonucleotides (RANKL- ASO ) decreased RANKL expression and...1,175 Ci/mmol at 10 mCi/mL). Two microliters of the reaction mixture were separated on a 12% SDS-polyacrylamide gel and subsequently visualized...OPG), a decoy receptor for RANKL, at the TB-interface was also increased. Targeting RANKL expression with antisense oligonucleotides (RANKL- ASO

Safety of antisense oligonucleotide and siRNA-based therapeutics.

PubMed

Chi, Xuan; Gatti, Philip; Papoian, Thomas

2017-05-01

Oligonucleotide-based therapy is an active area of drug development designed to treat a variety of gene-specific diseases. Two of the more promising platforms are the antisense oligonucleotides (ASOs) and short interfering RNAs (siRNAs), both of which are often directed against similar targets. In light of recent reports on clinical trials of severe thrombocytopenia with two different ASO drugs and increased peripheral neuropathy with an siRNA drug, we compared and contrasted the specific safety characteristics of these two classes of oligonucleotide therapeutic. The objectives were to assess factors that could contribute to the specific toxicities observed with these two classes of promising drugs, and get a better understanding of the potential mechanism(s) responsible for these rare, but serious, adverse events. Published by Elsevier Ltd.

Cellular uptake mediated by epidermal growth factor receptor facilitates the intracellular activity of phosphorothioate-modified antisense oligonucleotides

PubMed Central

Wang, Shiyu; Allen, Nickolas; Vickers, Timothy A; Revenko, Alexey S; Sun, Hong; Liang, Xue-hai; Crooke, Stanley T

2018-01-01

Abstract Chemically modified antisense oligonucleotides (ASOs) with phosphorothioate (PS) linkages have been extensively studied as research and therapeutic agents. PS-ASOs can enter the cell and trigger cleavage of complementary RNA by RNase H1 even in the absence of transfection reagent. A number of cell surface proteins have been identified that bind PS-ASOs and mediate their cellular uptake; however, the mechanisms that lead to productive internalization of PS-ASOs are not well understood. Here, we characterized the interaction between PS-ASOs and epidermal growth factor receptor (EGFR). We found that PS-ASOs trafficked together with EGF and EGFR into clathrin-coated pit structures. Their co-localization was also observed at early endosomes and inside enlarged late endosomes. Reduction of EGFR decreased PS-ASO activity without affecting EGF-mediated signaling pathways and overexpression of EGFR increased PS-ASO activity in cells. Furthermore, reduction of EGFR delays PS-ASO trafficking from early to late endosomes. Thus, EGFR binds to PS-ASOs at the cell surface and mediates essential steps for active (productive) cellular uptake of PS-ASOs through its cargo-dependent trafficking processes which migrate PS-ASOs from early to late endosomes. This EGFR-mediated process can also serve as an additional model to better understand the mechanism of intracellular uptake and endosomal release of PS-ASOs. PMID:29514240

Sensible use of antisense: how to use oligonucleotides as research tools.

PubMed

Myers, K J; Dean, N M

2000-01-01

In the past decade, there has been a vast increase in the amount of gene sequence information that has the potential to revolutionize the way diseases are both categorized and treated. Old diagnoses, largely anatomical or descriptive in nature, are likely to be superceded by the molecular characterization of the disease. The recognition that certain genes drive key disease processes will also enable the rational design of gene-specific therapeutics. Antisense oligonucleotides represent a technology that should play multiple roles in this process.

Antisense oligonucleotides suppress cell-volume-induced activation of chloride channels.

PubMed

Gschwentner, M; Nagl, U O; Wöll, E; Schmarda, A; Ritter, M; Paulmichl, M

1995-08-01

Cell volume regulation is an essential feature of most cells. After swelling in hypotonic media, the simultaneous activation of potassium and chloride channels is believed to be the initial, time-determining step in cell volume regulation. The activation of both pathways is functionally linked and enables the cells to lose ions and water, subsequently leading to cell shrinkage and readjustment of the initial volume. NIH 3T3 fibroblasts efficiently regulate their volume after swelling and bear chloride channels that are activated by decreasing extracellular osmolarity. The chloride current elicited in these cells after swelling is reminiscent of the current found in oocytes expressing an outwardly rectifying chloride current termed ICln. Introduction of antisense oligodeoxynucleotides complementary to the first 30 nucleotides of the coding region of the ICln channel into NIH 3T3 fibroblasts suppresses the activation of the swelling-induced chloride current. The experiments directly demonstrate an unambiguous link between a volume-activated chloride current and a cloned protein involved in chloride transport.

Fluorescence Characterization of Gold Modified Liposomes with Antisense N-myc DNA Bound to the Magnetisable Particles with Encapsulated Anticancer Drugs (Doxorubicin, Ellipticine and Etoposide).

PubMed

Skalickova, Sylvie; Nejdl, Lukas; Kudr, Jiri; Ruttkay-Nedecky, Branislav; Jimenez, Ana Maria Jimenez; Kopel, Pavel; Kremplova, Monika; Masarik, Michal; Stiborova, Marie; Eckschlager, Tomas; Adam, Vojtech; Kizek, Rene

2016-02-25

Liposome-based drug delivery systems hold great potential for cancer therapy. The aim of this study was to design a nanodevice for targeted anchoring of liposomes (with and without cholesterol) with encapsulated anticancer drugs and antisense N-myc gene oligonucleotide attached to its surface. To meet this main aim, liposomes with encapsulated doxorubicin, ellipticine and etoposide were prepared. They were further characterized by measuring their fluorescence intensity, whereas the encapsulation efficiency was estimated to be 16%. The hybridization process of individual oligonucleotides forming the nanoconstruct was investigated spectrophotometrically and electrochemically. The concentrations of ellipticine, doxorubicin and etoposide attached to the nanoconstruct in gold nanoparticle-modified liposomes were found to be 14, 5 and 2 µg·mL(-1), respectively. The study succeeded in demonstrating that liposomes are suitable for the transport of anticancer drugs and the antisense oligonucleotide, which can block the expression of the N-myc gene.

Assessment of new biocompatible poly(N-(morpholino)ethyl methacrylate)-based copolymers by transfection of immortalized keratinocytes.

PubMed

Van Overstraeten-Schlögel, Nancy; Shim, Yong-Ho; Tevel, Virginie; Piel, Géraldine; Piette, Jacques; Dubois, Philippe; Raes, Martine

2012-02-01

Skin carcinomas are among the most commonly diagnosed tumors in the world. In this study, we investigated the transfection of immortalized keratinocytes, used as an in vitro model for skin carcinoma, using the antisense technology and poly(2-(dimethylamino)ethyl methacrylate) (PDMAEMA)-based copolymers. In order to improve the transfection efficiency of the classic PDMAEMA polymers, copolymers were synthesized including a poly(N-morpholino)ethylmethacrylate) (PMEMA) moiety for an improved proton-sponge effect, intended to favour the release of the oligonucleotide from the acidic endosome. These copolymers were synthesized either statistically (with alternating PDMAEMA and PMEMA fragments) or in blocks (one PDMAEMA block followed by one PMEMA block). MTT assays were performed using the PDMAEMA-PMEMA copolymers and revealed no significant cytotoxicity of these polymers at an N/P ratio of 7.3. Using fluorescent oligonucleotides and analyzing transfection efficiency by flow cytometry, we noticed no significant differences between the two kinds of copolymers. However copolymers with a higher DMAEMA content and a higher Mn were also those displaying the highest vectorization efficiency. Confocal microscopy showed that these copolymers induced a fine granular distribution of the transfected antisense oligonucleotides inside the cells. We also assessed the functionality of the transfected antisense oligonucleotide by transfecting immortalized GFP expressing keratinocytes with a GFP antisense oligonucleotide using these copolymers. A significant silencing was achieved with a PDMAEMA-PMEMA in block copolymer (Mn=41,000, 89 % PDMAEMA). Together, these results suggest that PDMAEMA-PMEMA copolymers combining low toxicity, vectorization and proton sponge properties, can be efficiently used to transfect immortalized keratinocytes and so open new perspectives in the therapy of skin carcinomas as well as of other skin diseases of genetic or immunological origin. © 2012 Informa Healthcare USA, Inc.

The Status of Exon Skipping as a Therapeutic Approach to Duchenne Muscular Dystrophy

PubMed Central

Lu, Qi-Long; Yokota, Toshifumi; Takeda, Shin'ichi; Garcia, Luis; Muntoni, Francesco; Partridge, Terence

2011-01-01

Duchenne muscular dystrophy (DMD) is associated with mutations in the dystrophin gene that disrupt the open reading frame whereas the milder Becker's form is associated with mutations which leave an in-frame mRNA transcript that can be translated into a protein that includes the N- and C- terminal functional domains. It has been shown that by excluding specific exons at, or adjacent to, frame-shifting mutations, open reading frame can be restored to an out-of-frame mRNA, leading to the production of a partially functional Becker-like dystrophin protein. Such targeted exclusion can be achieved by administration of oligonucleotides that are complementary to sequences that are crucial to normal splicing of the exon into the transcript. This principle has been validated in mouse and canine models of DMD with a number of variants of oligonucleotide analogue chemistries and by transduction with adeno-associated virus (AAV)-small nuclear RNA (snRNA) reagents encoding the antisense sequence. Two different oligonucleotide agents are now being investigated in human trials for splicing out of exon 51 with some early indications of success at the biochemical level. PMID:20978473

Motor neuron cell-nonautonomous rescue of spinal muscular atrophy phenotypes in mild and severe transgenic mouse models

PubMed Central

Liu, Ying Hsiu; Sahashi, Kentaro; Rigo, Frank; Bennett, C. Frank

2015-01-01

Survival of motor neuron (SMN) deficiency causes spinal muscular atrophy (SMA), but the pathogenesis mechanisms remain elusive. Restoring SMN in motor neurons only partially rescues SMA in mouse models, although it is thought to be therapeutically essential. Here, we address the relative importance of SMN restoration in the central nervous system (CNS) versus peripheral tissues in mouse models using a therapeutic splice-switching antisense oligonucleotide to restore SMN and a complementary decoy oligonucleotide to neutralize its effects in the CNS. Increasing SMN exclusively in peripheral tissues completely rescued necrosis in mild SMA mice and robustly extended survival in severe SMA mice, with significant improvements in vulnerable tissues and motor function. Our data demonstrate a critical role of peripheral pathology in the mortality of SMA mice and indicate that peripheral SMN restoration compensates for its deficiency in the CNS and preserves motor neurons. Thus, SMA is not a cell-autonomous defect of motor neurons in SMA mice. PMID:25583329

Gene silencing by siRNAs and antisense oligonucleotides in the laboratory and the clinic

PubMed Central

Watts, Jonathan K.; Corey, David R.

2014-01-01

Synthetic nucleic acids are commonly used laboratory tools for modulating gene expression and have the potential to be widely used in the clinic. Progress towards nucleic acid drugs, however, has been slow and many challenges remain to be overcome before their full impact on patient care can be understood. Antisense oligonucleotides (ASOs) and small interfering RNAs (siRNAs) are the two most widely used strategies for silencing gene expression. We first describe these two approaches and contrast their relative strengths and weaknesses for laboratory applications. We then review the choices faced during development of clinical candidates and the current state of clinical trials. Attitudes towards clinical development of nucleic acid silencing strategies have repeatedly swung from optimism to depression during the past twenty years. Our goal is to provide the information needed to design robust studies with oligonucleotides, making use of the strengths of each oligonucleotide technology. PMID:22069063

Knockdown of synaptic scaffolding protein Homer 1b/c attenuates secondary hyperalgesia induced by complete Freund's adjuvant in rats.

PubMed

Yao, Yong-Xing; Jiang, Zhen; Zhao, Zhi-Qi

2011-12-01

Previous studies have demonstrated that Homer 1b/c, a postsynaptic molecular scaffolding protein that binds and clusters metabotropic glutamate receptors at neuronal synapses, has an important role in the metabotropic glutamate receptor signaling process. In the current study, we investigated the possible involvement of Homer 1b/c in secondary hyperalgesia induced by complete Freund's adjuvant (CFA). Chronic inflammation was induced by injecting CFA into the left hind ankle of Wistar rats. Homer 1b/c antisense or missense oligonucleotides were intrathecally administrated (antisense, 10 μg/10 μL, 5 μg/10 μL, or 2.5 μg/10 μL, once a day; missense, 10 μg/10 μL) from 5 to 8 days after the onset of inflammation. The withdrawal threshold and withdrawal latency to mechanical or thermal stimuli were determined before and after the intrathecal administration. The expression and distribution of Homer 1b/c were examined in the spinal cord using immunological techniques. Mechanical allodynia and thermal hyperalgesia were induced within 24 hours and maintained for >2 weeks after the CFA injection. The expression of Homer 1b/c reached the highest level 7 days after inflammation and returned to baseline at day 28. Intrathecal administration of Homer 1b/c antisense oligonucleotides markedly reduced the expression of Homer 1b/c protein in the spinal cord. Additionally, administration of Homer 1b/c antisense oligonucleotides attenuated secondary mechanical hypersensitization on days 2 to 5 and reduced thermal hypersensitization on days 3 to 4. There were no effects of missense oligonucleotides on hypersensitization and the expression of Homer 1b/c. In the naïve rats, Homer 1b/c antisense oligonucleotides did not affect the mechanical and thermal responses or locomotor activity. These novel results demonstrate that Homer 1b/c in the spinal cord contributes to the maintenance of secondary hyperalgesia induced by CFA and suggest that Homer 1b/c may be a novel target for pain therapy.

Bcl-2 inhibitors potentiate the cytotoxic effects of radiation in Bcl-2 overexpressing radioresistant tumor cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hara, Takamitsu; Omura-Minamisawa, Motoko; Chao Cheng

Purpose: Bcl-2, an inhibitor of apoptosis frequently shows elevated expression in human tumors, thus resulting in resistance to radiation therapy. Therefore, inhibiting Bcl-2 function may enhance the radiosensitivity of tumor cells. Tetrocarcin A (TC-A) and bcl-2 antisense oligonucleotides exhibit antitumor activity by inhibiting Bcl-2 function and transcription, respectively. We investigated whether these antitumor agents would enhance the cytotoxic effects of radiation in tumor cells overexpressing Bcl-2. Methods and materials: We used HeLa/bcl-2 cells, a stable Bcl-2-expressing cell line derived from wild-type HeLa (HeLa/wt) cells. Cells were incubated with TC-A and bcl-2 antisense oligonucleotides for 24 h after irradiation, and cellmore » viability was then determined. Apoptotic cells were quantified by flow cytometric assay. Results: The HeLa/bcl-2 cells were more resistant to radiation than HeLa/wt cells. At concentrations that are not inherently cytotoxic, both TC-A and bcl-2 antisense oligonucleotides increased the cytotoxic effects of radiation in HeLa/bcl-2 cells, but not in HeLa/wt cells. However, in HeLa/bcl-2 cells, additional treatment with TC-A in combination with radiation did not significantly increase apoptosis. Conclusions: The present results suggest that TC-A and bcl-2 antisense oligonucleotides reduce radioresistance of tumor cells overexpressing Bcl-2. Therefore, a combination of radiotherapy and Bcl-2 inhibitors may prove to be a useful therapeutic approach for treating tumors that overexpress Bcl-2.« less

PTP1B antisense oligonucleotide lowers PTP1B protein, normalizes blood glucose, and improves insulin sensitivity in diabetic mice.

PubMed

Zinker, Bradley A; Rondinone, Cristina M; Trevillyan, James M; Gum, Rebecca J; Clampit, Jill E; Waring, Jeffrey F; Xie, Nancy; Wilcox, Denise; Jacobson, Peer; Frost, Leigh; Kroeger, Paul E; Reilly, Regina M; Koterski, Sandra; Opgenorth, Terry J; Ulrich, Roger G; Crosby, Seth; Butler, Madeline; Murray, Susan F; McKay, Robert A; Bhanot, Sanjay; Monia, Brett P; Jirousek, Michael R

2002-08-20

The role of protein-tyrosine phosphatase 1B (PTP1B) in diabetes was investigated using an antisense oligonucleotide in ob/ob and db/db mice. PTP1B antisense oligonucleotide treatment normalized plasma glucose levels, postprandial glucose excursion, and HbA(1C). Hyperinsulinemia was also reduced with improved insulin sensitivity. PTP1B protein and mRNA were reduced in liver and fat with no effect in skeletal muscle. Insulin signaling proteins, insulin receptor substrate 2 and phosphatidylinositol 3 (PI3)-kinase regulatory subunit p50alpha, were increased and PI3-kinase p85alpha expression was decreased in liver and fat. These changes in protein expression correlated with increased insulin-stimulated protein kinase B phosphorylation. The expression of liver gluconeogenic enzymes, phosphoenolpyruvate carboxykinase, and fructose-1,6-bisphosphatase was also down-regulated. These findings suggest that PTP1B modulates insulin signaling in liver and fat, and that therapeutic modalities targeting PTP1B inhibition may have clinical benefit in type 2 diabetes.

PTP1B antisense oligonucleotide lowers PTP1B protein, normalizes blood glucose, and improves insulin sensitivity in diabetic mice

PubMed Central

Zinker, Bradley A.; Rondinone, Cristina M.; Trevillyan, James M.; Gum, Rebecca J.; Clampit, Jill E.; Waring, Jeffrey F.; Xie, Nancy; Wilcox, Denise; Jacobson, Peer; Frost, Leigh; Kroeger, Paul E.; Reilly, Regina M.; Koterski, Sandra; Opgenorth, Terry J.; Ulrich, Roger G.; Crosby, Seth; Butler, Madeline; Murray, Susan F.; McKay, Robert A.; Bhanot, Sanjay; Monia, Brett P.; Jirousek, Michael R.

2002-01-01

The role of protein-tyrosine phosphatase 1B (PTP1B) in diabetes was investigated using an antisense oligonucleotide in ob/ob and db/db mice. PTP1B antisense oligonucleotide treatment normalized plasma glucose levels, postprandial glucose excursion, and HbA1C. Hyperinsulinemia was also reduced with improved insulin sensitivity. PTP1B protein and mRNA were reduced in liver and fat with no effect in skeletal muscle. Insulin signaling proteins, insulin receptor substrate 2 and phosphatidylinositol 3 (PI3)-kinase regulatory subunit p50α, were increased and PI3-kinase p85α expression was decreased in liver and fat. These changes in protein expression correlated with increased insulin-stimulated protein kinase B phosphorylation. The expression of liver gluconeogenic enzymes, phosphoenolpyruvate carboxykinase, and fructose-1,6-bisphosphatase was also down-regulated. These findings suggest that PTP1B modulates insulin signaling in liver and fat, and that therapeutic modalities targeting PTP1B inhibition may have clinical benefit in type 2 diabetes. PMID:12169659

Correction of a Cystic Fibrosis Splicing Mutation by Antisense Oligonucleotides.

PubMed

Igreja, Susana; Clarke, Luka A; Botelho, Hugo M; Marques, Luís; Amaral, Margarida D

2016-02-01

Cystic fibrosis (CF), the most common life-threatening genetic disease in Caucasians, is caused by ∼2,000 different mutations in the CF transmembrane conductance regulator (CFTR) gene. A significant fraction of these (∼13%) affect pre-mRNA splicing for which novel therapies have been somewhat neglected. We have previously described the effect of the CFTR splicing mutation c.2657+5G>A in IVS16, showing that it originates transcripts lacking exon 16 as well as wild-type transcripts. Here, we tested an RNA-based antisense oligonucleotide (AON) strategy to correct the aberrant splicing caused by this mutation. Two AONs (AON1/2) complementary to the pre-mRNA IVS16 mutant region were designed and their effect on splicing was assessed at the RNA and protein levels, on intracellular protein localization and function. To this end, we used the 2657+5G>A mutant CFTR minigene stably expressed in HEK293 Flp-In cells that express a single copy of the transgene. RNA data from AON1-treated mutant cells show that exon 16 inclusion was almost completely restored (to 95%), also resulting in increased levels of correctly localized CFTR protein at the plasma membrane (PM) and with increased function. A novel two-color CFTR splicing reporter minigene developed here allowed the quantitative monitoring of splicing by automated microscopy localization of CFTR at the PM. The AON strategy is thus a promising therapeutic approach for the specific correction of alternative splicing. © 2015 WILEY PERIODICALS, INC.

Morpholino-mediated Knockdown of DUX4 Toward Facioscapulohumeral Muscular Dystrophy Therapeutics.

PubMed

Chen, Jennifer Cj; King, Oliver D; Zhang, Yuanfan; Clayton, Nicholas P; Spencer, Carrie; Wentworth, Bruce M; Emerson, Charles P; Wagner, Kathryn R

2016-08-01

Derepression of DUX4 in skeletal muscle has emerged as a likely cause of pathology in facioscapulohumeral muscular dystrophy (FSHD). Here we report on the use of antisense phosphorodiamidate morpholino oligonucleotides to suppress DUX4 expression and function in FSHD myotubes and xenografts. The most effective was phosphorodiamidate morpholino oligonucleotide FM10, which targets the polyadenylation signal of DUX4. FM10 had no significant cell toxicity, and RNA-seq analyses of FSHD and control myotubes revealed that FM10 down-regulated many transcriptional targets of DUX4, without overt off-target effects. Electroporation of FM10 into FSHD patient muscle xenografts in mice also down-regulated DUX4 and DUX4 targets. These findings demonstrate the potential of antisense phosphorodiamidate morpholino oligonucleotides as an FSHD therapeutic option.

Antisense technology: an emerging platform for cardiovascular disease therapeutics.

PubMed

Lee, Richard G; Crosby, Jeff; Baker, Brenda F; Graham, Mark J; Crooke, Rosanne M

2013-12-01

Antisense oligonucleotides and small interfering RNAs, which suppress the translation of specific mRNA target proteins, are emerging as important therapeutic modalities for the treatment of cardiovascular disease. Over the last 25 years, the advances in all aspects of antisense technology, as well as a detailed understanding of the mechanism of action of antisense drugs, have enabled their use as therapeutic agents. These advancements culminated in the FDA approval of the first chronically administered cardiovascular antisense therapeutic, mipomersen, which targets hepatic apolipoprotein B mRNA. This review provides a brief history of antisense technology, highlights the progression of mipomersen from preclinical studies to multiple Phase III registration trials, and gives an update on the status of other cardiovascular antisense therapeutics currently in the clinic.

Central and peripheral administration of antisense oligonucleotide targeting amyloid-β protein precursor improves learning and memory and reduces neuroinflammatory cytokines in Tg2576 (AβPPswe) mice.

PubMed

Farr, Susan A; Erickson, Michelle A; Niehoff, Michael L; Banks, William A; Morley, John E

2014-01-01

Alzheimer's disease (AD) is a progressive neurodegenerative disease. Currently, there are no therapies to stop or reverse the symptoms of AD. We have developed an antisense oligonucleotide (OL-1) against the amyloid-β protein precursor (AβPP) that can decrease AβPP expression and amyloid-β protein (Aβ) production. This antisense rapidly crosses the blood-brain barrier, reverses learning and memory impairments, reduces oxidative stress, and restores brain-to-blood efflux of Aβ in SAMP8 mice. Here, we examined the effects of this AβPP antisense in the Tg2576 mouse model of AD. We administered the OL-1 antisense into the lateral ventricle 3 times at 2week intervals. Seventy-two hours after the third injection, we tested learning and memory in T-maze foot shock avoidance. In the second study, we injected the mice with OL-1 antisense 3 times at 2-week intervals via the tail vein. Seventy-two hours later, we tested learning and memory T-maze, novel object recognition, and elevated plus maze. At the end of behavioral testing, brain tissue was collected. OL-1 antisense administered centrally improved acquisition and retention of T-maze foot shock avoidance. OL-1 antisense administered via tail vein improved learning and memory in both T-maze foot shock avoidance and novel object-place recognition. In the elevated plus maze, the mice which received OL-1 antisense spent less time in the open arms and had fewer entries into the open arms indicating reduced disinhibitation. Biochemical analyses reveal significant reduction of AβPP signal and a reduction of measures of neuroinflammation. The current findings support the therapeutic potential of OL-1 AβPP antisense.

Peripheral administration of antisense oligonucleotides targeting the amyloid-β protein precursor reverses AβPP and LRP-1 overexpression in the aged SAMP8 mouse brain.

PubMed

Erickson, Michelle A; Niehoff, Michael L; Farr, Susan A; Morley, John E; Dillman, Lucy A; Lynch, Kristin M; Banks, William A

2012-01-01

The senescence accelerated mouse-prone 8 (SAMP8) mouse model of Alzheimer's disease has a natural mutation leading to age-related increases in the amyloid-β protein precursor (AβPP) and amyloid-β (Aβ) in the brain, memory impairment, and deficits in Aβ removal from the brain. Previous studies show that centrally administered antisense oligonucleotide directed against AβPP can decrease AβPP expression and Aβ production in the brains of aged SAMP8 mice, and improve memory. The same antisense crosses the blood-brain barrier and reverses memory deficits when injected intravenously. Here, we give 6 μg of AβPP or control antisense 3 times over 2 week intervals to 12 month old SAMP8 mice. Object recognition test was done 48 hours later, followed by removal of whole brains for immunoblot analysis of AβPP, low-density lipoprotein-related protein-1 (LRP-1), p-glycoprotein (Pgp), receptor for advanced glycation endproducts (RAGE), or ELISA of soluble Aβ(40). Our results show that AβPP antisense completely reverses a 30% age-associated increase in AβPP signal (p < 0.05 versus untreated 4 month old SAMP8). Soluble Aβ(40) increased with age, but was not reversed by antisense. LRP-1 large and small subunits increased significantly with age (147.7%, p < 0.01 and 123.7%, p < 0.05 respectively), and AβPP antisense completely reversed these increases (p < 0.05). Pgp and RAGE were not significantly altered with age or antisense. Antisense also caused improvements in memory (p < 0.001). Together, these data support the therapeutic potential of AβPP antisense and show a unique association between AβPP and LRP-1 expression in the SAMP8 mouse.

Antisense Therapy in Neurology

PubMed Central

Lee, Joshua J.A.; Yokota, Toshifumi

2013-01-01

Antisense therapy is an approach to fighting diseases using short DNA-like molecules called antisense oligonucleotides. Recently, antisense therapy has emerged as an exciting and promising strategy for the treatment of various neurodegenerative and neuromuscular disorders. Previous and ongoing pre-clinical and clinical trials have provided encouraging early results. Spinal muscular atrophy (SMA), Huntington’s disease (HD), amyotrophic lateral sclerosis (ALS), Duchenne muscular dystrophy (DMD), Fukuyama congenital muscular dystrophy (FCMD), dysferlinopathy (including limb-girdle muscular dystrophy 2B; LGMD2B, Miyoshi myopathy; MM, and distal myopathy with anterior tibial onset; DMAT), and myotonic dystrophy (DM) are all reported to be promising targets for antisense therapy. This paper focuses on the current progress of antisense therapies in neurology. PMID:25562650

Delivery of gene biotechnologies to plants: Pathogen and pest control

USDA-ARS?s Scientific Manuscript database

Treatment of oligonucleotides to plants for host delivered suppression of microbes and insect pests of citrus was successful. FANA_ASO, (2'-deoxy-2'-fluoro-D- arabinonucleic acid)_( antisense oligonucleotides- AUM LifeTech) designed to: Asian citrus psyllid; Citrus plant bacterial pathogen of citru...

The ICAM-1 antisense oligonucleotide ISIS-3082 prevents the development of postoperative ileus in mice.

PubMed

The, Frans O; de Jonge, Wouter J; Bennink, Roel J; van den Wijngaard, Rene M; Boeckxstaens, Guy E

2005-09-01

Intestinal manipulation (IM) during abdominal surgery triggers the influx of inflammatory cells, leading to postoperative ileus. Prevention of this local muscle inflammation, using intercellular adhesion molecule-1 (ICAM-1) and leukocyte function-associated antigen-1-specific antibodies, has been shown to shorten postoperative ileus. However, the therapeutic use of antibodies has considerable disadvantages. The aim of the current study was to evaluate the effect of ISIS-3082, a mouse-specific ICAM-1 antisense oligonucleotide, on postoperative ileus in mice. Mice underwent a laparotomy or a laparotomy combined with IM after treatment with ICAM-1 antibodies, 0.1-10 mg kg(-1) ISIS-3082, saline or ISIS-8997 (scrambled control antisense oligonucleotides, 1 and 3 mg kg(-1)). At 24 h after surgery, gastric emptying of a 99mTC labelled semi-liquid meal was determined using scintigraphy. Intestinal inflammation was assessed by myeloperoxidase (MPO) activity in ileal muscle whole mounts. IM significantly reduced gastric emptying compared to laparotomy. Pretreatment with ISIS-3082 (0.1-1 mg kg(-1)) as well as ICAM-1 antibodies (10 mg kg(-1)), but not ISIS-8997 or saline, improved gastric emptying in a dose-dependent manner. This effect diminished with higher doses of ISIS-3082 (3-10 mg kg(-1)). Similarly, ISIS-3082 (0.1-1 mg kg(-1)) and ICAM-1 antibodies, but not ISIS-8997 or higher doses of ISIS-3082 (3-10 mg kg(-1)), reduced manipulation-induced inflammation. Immunohistochemistry showed reduction of ICAM-1 expression with ISIS-3082 only. ISIS-3082 pretreatment prevents postoperative ileus in mice by reduction of manipulation-induced local intestinal muscle inflammation. Our data suggest that targeting ICAM-1 using antisense oligonucleotides may represent a new therapeutic approach to the prevention of postoperative ileus.

Antisense oligonucleotide inhibition of cholesteryl ester transfer protein enhances RCT in hyperlipidemic, CETP transgenic, LDLr-/- mice.

PubMed

Bell, Thomas A; Graham, Mark J; Lee, Richard G; Mullick, Adam E; Fu, Wuxia; Norris, Dan; Crooke, Rosanne M

2013-10-01

Due to their ability to promote positive effects across all of the lipoprotein classes, cholesteryl ester transfer protein (CETP) inhibitors are currently being developed as therapeutic agents for cardiovascular disease. In these studies, we compared an antisense oligonucleotide (ASO) inhibitor of CETP to the CETP small molecule inhibitor anacetrapib. In hyperlipidemic CETP transgenic (tg) mice, both drugs provided comparable reductions in total plasma cholesterol, decreases in CETP activity, and increases in HDL cholesterol. However, only mice treated with the antisense inhibitor showed an enhanced effect on macrophage reverse cholesterol transport, presumably due to differences in HDL apolipoprotein composition and decreases in plasma triglyceride. Additionally, the ASO-mediated reductions in CETP mRNA were associated with less accumulation of aortic cholesterol. These preliminary findings suggest that CETP ASOs may represent an alternative means to inhibit that target and to support their continued development as a treatment for cardiovascular disease in man.

Antisense oligonucleotides as therapeutics for hyperlipidaemias.

PubMed

Crooke, Rosanne M

2005-07-01

Hyperlipidaemia, due to elevations of low-density lipoprotein cholesterol (LDL-C) or triglycerides (TGs), is recognised as a significant risk factor contributing to the development of coronary heart disease (CHD), the leading cause of morbidity and mortality in the Western world. Even though a variety of established antihyperlipidaemic agents are available, the majority of high-risk patients do not reach their lipid goals, indicating the need for new and more effective therapeutics to be used alone or as combination agents with existing drugs. Antisense oligonucleotides (ASOs), designed to specifically and selectively inhibit novel targets involved in cholesterol/TG homeostasis, represent a new class of agents that may prove beneficial for the treatment of hyperlipidaemias resulting from various genetic, metabolic or behavioural factors. This article describes the antisense technology platform, highlights the advantages of these novel drugs for the treatment of hyperlipidaemia and reviews the current research in this area.

Synthesis of cis- and trans-α-l-[4.3.0]bicyclo-DNA monomers for antisense technology: methods for the diastereoselective formation of bicyclic nucleosides.

PubMed

Hanessian, Stephen; Schroeder, Benjamin R; Merner, Bradley L; Chen, Bin; Swayze, Eric E; Seth, Punit P

2013-09-20

Two α-L-ribo-configured bicyclic nucleic acid modifications, represented by analogues 12 and 13, which are epimeric at C3' and C5' have been synthesized using a carbohydrate-based approach to build the bicyclic core structure. An intramolecular L-proline-mediated aldol reaction was employed to generate the cis-configured ring junction of analogue 12 and represents a rare application of this venerable organocatalytic reaction to a carbohydrate system. In the case of analogue 13, where a trans-ring junction was desired, an intermolecular diastereoselective Grignard reaction followed by ring-closing metathesis was used. In order to set the desired stereochemistry at the C5' positions of both nucleoside targets, a study of diastereoselective Lewis acid mediated allylation reactions on a common bicyclic aldehyde precursor was carried out. Analogue 12 was incorporated in oligonucleotide sequences, and thermal denaturation experiments indicate that it is destabilizing when paired with complementary DNA and RNA. However, this construct shows a significant improvement in nuclease stability relative to a DNA oligonucleotide.

Degradation product characterization of therapeutic oligonucleotides using liquid chromatography mass spectrometry.

PubMed

Elzahar, N M; Magdy, N; El-Kosasy, Amira M; Bartlett, Michael G

2018-05-01

Synthetic antisense phosphorothioate oligonucleotides (PS) have undergone rapid development as novel therapeutic agents. The increasing significance of this class of drugs requires significant investment in the development of quality control methods. The determination of the many degradation pathways of such complex molecules presents a significant challenge. However, an understanding of the potential impurities that may arise is necessary to continue to advance these powerful new therapeutics. In this study, four different antisense oligonucleotides representing several generations of oligonucleotide therapeutic agents were evaluated under various stress conditions (pH, thermal, and oxidative stress) using ion-pairing reversed-phase liquid chromatography tandem mass spectrometry (IP-RPLC-MS/MS) to provide in-depth characterization and identification of the degradation products. The oligonucleotide samples were stressed under different pH values at 45 and 90 °C. The main degradation products were observed to be losses of nucleotide moieties from the 3'- and 5'-terminus, depurination, formation of terminal phosphorothioates, and production of ribose, ribophosphorothioates (Rp), and phosphoribophosphorothioates (pRp). Moreover, the effects of different concentrations of hydrogen peroxide were studied resulting in primarily extensive desulfurization and subsequent oxidation of the phosphorothioate linkage to produce the corresponding phosphodiester. The reaction kinetics for the degradation of the oligonucleotides under the different stress conditions were studied and were found to follow pseudo-first-order kinetics. Differences in rates exist even for oligonucleotides of similar length but consisting of different sequences. Graphical abstract Identification of degradation products across several generations of oligonucleotide therapeutics using LC-MS.

2′-O-[2-[(N,N-dimethylamino)oxy]ethyl]-modified oligonucleotides inhibit expression of mRNA in vitro and in vivo

PubMed Central

Prakash, Thazha P.; Johnston, Joseph F.; Graham, Mark J.; Condon, Thomas P.; Manoharan, Muthiah

2004-01-01

Synthesis and antisense activity of oligonucleotides modified with 2′-O-[2-[(N,N-dimethylamino)oxy] ethyl] (2′-O-DMAOE) are described. The 2′-O-DMAOE-modified oligonucleotides showed superior metabolic stability in mice. The phosphorothioate oligonucleotide ‘gapmers’, with 2′-O-DMAOE- modified nucleoside residues at the ends and 2′-deoxy nucleosides residues in the central region, showed dose-dependent inhibition of mRNA expression in cell culture for two targets. ‘Gapmer’ oligonucleotides have one or two 2′-O-modified regions and a 2′-deoxyoligonucleotide phosphorothioate region that allows RNase H digestion of target mRNA. To determine the in vivo potency and efficacy, BalbC mice were treated with 2′-O-DMAOE gapmers and a dose-dependent reduction in the targeted C-raf mRNA expression was observed. Oligonucleotides with 2′-O-DMAOE modifications throughout the sequences reduced the intercellular adhesion molecule-1 (ICAM-1) protein expression very efficiently in HUVEC cells with an IC50 of 1.8 nM. The inhibition of ICAM-1 protein expression by these uniformly modified 2′-O-DMAOE oligonucleotides may be due to selective interference with the formation of the translational initiation complex. These results demonstrate that 2′-O-DMAOE- modified oligonucleotides are useful for antisense-based therapeutics when either RNase H-dependent or RNase H-independent target reduction mechanisms are employed. PMID:14762210

Dose-Dependent Lowering of Mutant Huntingtin Using Antisense Oligonucleotides in Huntington Disease Patients.

PubMed

van Roon-Mom, Willeke M C; Roos, Raymund A C; de Bot, Susanne T

2018-04-01

On December 11 of 2017, Ionis Pharmaceuticals published a press release announcing dose-dependent reductions of mutant huntingtin protein in their HTTRx Phase 1/2a study in Huntington disease (HD) patients. The results from this Ionis trial have gained much attention from the patient community and the oligonucleotide therapeutics field, since it is the first trial targeting the cause of HD, namely the mutant huntingtin protein, using antisense oligonucleotides (ASOs). The press release also states that the primary endpoints of the study (safety and tolerability) were met, but does not contain data. This news follows the approval of another therapeutic ASO nusinersen (trade name Spinraza) for a neurological disease, spinal muscular atrophy, by the U.S. Food and Drug Administration and European Medicines Agency, in 2016 and 2017, respectively. Combined, this offers hope for the development of the HTTRx therapy for HD patients.

On the role of methacrylic acid copolymers in the intracellular delivery of antisense oligonucleotides.

PubMed

Yessine, Marie-Andrée; Meier, Christian; Petereit, Hans-Ulrich; Leroux, Jean-Christophe

2006-05-01

The delivery of active biomacromolecules to the cytoplasm is a major challenge as it is generally hindered by the endosomal/lysosomal barrier. Synthetic titratable polyanions can overcome this barrier by destabilizing membrane bilayers at pH values typically found in endosomes. This study investigates how anionic polyelectrolytes can enhance the cytoplasmic delivery of an antisense oligonucleotide (ODN). Novel methacrylic acid (MAA) copolymers were examined for their pH-sensitive properties and ability to destabilize cell membranes in a pH-dependent manner. Ternary complex formulations prepared with the ODN, a cationic lipid and a MAA copolymer were systematically characterized with respect to their size, zeta potential, antisense activity, cytotoxicity and cellular uptake using the A549 human lung carcinoma cell line. The MAA copolymer substantially increased the activity of the antisense ODN in inhibiting the expression of protein kinase C-alpha. Uptake, cytotoxicity and antisense activity were strongly dependent on copolymer concentration. Metabolic inhibitors demonstrated that endocytosis was the major internalization pathway of the complexes, and that endosomal acidification was essential for ODN activity. Confocal microscopy analysis of cells incubated with fluorescently-labeled complexes revealed selective delivery of the ODN, but not of the copolymer, to the cytoplasm/nucleus. This study provides new insight into the mechanisms of intracellular delivery of macromolecular drugs, using synthetic anionic polyelectrolytes.

The delivery of therapeutic oligonucleotides

PubMed Central

Juliano, Rudolph L.

2016-01-01

The oligonucleotide therapeutics field has seen remarkable progress over the last few years with the approval of the first antisense drug and with promising developments in late stage clinical trials using siRNA or splice switching oligonucleotides. However, effective delivery of oligonucleotides to their intracellular sites of action remains a major issue. This review will describe the biological basis of oligonucleotide delivery including the nature of various tissue barriers and the mechanisms of cellular uptake and intracellular trafficking of oligonucleotides. It will then examine a variety of current approaches for enhancing the delivery of oligonucleotides. This includes molecular scale targeted ligand-oligonucleotide conjugates, lipid- and polymer-based nanoparticles, antibody conjugates and small molecules that improve oligonucleotide delivery. The merits and liabilities of these approaches will be discussed in the context of the underlying basic biology. PMID:27084936

Synthesis of high quality phosphorothioate oligonucleotides as antisense drugs. Use of I-linker in the elimination of 3'-terminal phosphorothioate monoesters.

PubMed

Ravikumar, Vasulinga T; Kumar, R Krishna; Capaldi, Daniel C; Cole, Douglas L

2003-01-01

Detritylation of a 5'-O-DMT-2'-deoxyadenosine moiety attached to solid support under acidic condition leads to depurination during oligonucleotide synthesis. Deprotection followed by reversed phase HPLC purification leads to desired oligonucleotide contaminated with significant levels of 3'-terminal phosphorothiaote (3'-TPT) monoester (n-1)-mer. However, it is demonstrated that attachment of dA nucleoside through its exocyclic amino group to solid support leads to substantial reduction of 3'-TPT formation thereby improving the quality of oligonucleotide synthesized.

Cardiovascular and Metabolic Effects of ANGPTL3 Antisense Oligonucleotides.

PubMed

Graham, Mark J; Lee, Richard G; Brandt, Teresa A; Tai, Li-Jung; Fu, Wuxia; Peralta, Raechel; Yu, Rosie; Hurh, Eunju; Paz, Erika; McEvoy, Bradley W; Baker, Brenda F; Pham, Nguyen C; Digenio, Andres; Hughes, Steven G; Geary, Richard S; Witztum, Joseph L; Crooke, Rosanne M; Tsimikas, Sotirios

2017-07-20

Epidemiologic and genomewide association studies have linked loss-of-function variants in ANGPTL3, encoding angiopoietin-like 3, with low levels of plasma lipoproteins. We evaluated antisense oligonucleotides (ASOs) targeting Angptl3 messenger RNA (mRNA) for effects on plasma lipid levels, triglyceride clearance, liver triglyceride content, insulin sensitivity, and atherosclerosis in mice. Subsequently, 44 human participants (with triglyceride levels of either 90 to 150 mg per deciliter [1.0 to 1.7 mmol per liter] or >150 mg per deciliter, depending on the dose group) were randomly assigned to receive subcutaneous injections of placebo or an antisense oligonucleotide targeting ANGPTL3 mRNA in a single dose (20, 40, or 80 mg) or multiple doses (10, 20, 40, or 60 mg per week for 6 weeks). The main end points were safety, side-effect profile, pharmacokinetic and pharmacodynamic measures, and changes in levels of lipids and lipoproteins. The treated mice had dose-dependent reductions in levels of hepatic Angptl3 mRNA, Angptl3 protein, triglycerides, and low-density lipoprotein (LDL) cholesterol, as well as reductions in liver triglyceride content and atherosclerosis progression and increases in insulin sensitivity. After 6 weeks of treatment, persons in the multiple-dose groups had reductions in levels of ANGPTL3 protein (reductions of 46.6 to 84.5% from baseline, P<0.01 for all doses vs. placebo) and in levels of triglycerides (reductions of 33.2 to 63.1%), LDL cholesterol (1.3 to 32.9%), very-low-density lipoprotein cholesterol (27.9 to 60.0%), non-high-density lipoprotein cholesterol (10.0 to 36.6%), apolipoprotein B (3.4 to 25.7%), and apolipoprotein C-III (18.9 to 58.8%). Three participants who received the antisense oligonucleotide and three who received placebo reported dizziness or headache. There were no serious adverse events. Oligonucleotides targeting mouse Angptl3 retarded the progression of atherosclerosis and reduced levels of atherogenic lipoproteins in mice. Use of the same strategy to target human ANGPTL3 reduced levels of atherogenic lipoproteins in humans. (Funded by Ionis Pharmaceuticals; ClinicalTrials.gov number, NCT02709850 .).

Efficient exon skipping of SGCG mutations mediated by phosphorodiamidate morpholino oligomers.

PubMed

Wyatt, Eugene J; Demonbreun, Alexis R; Kim, Ellis Y; Puckelwartz, Megan J; Vo, Andy H; Dellefave-Castillo, Lisa M; Gao, Quan Q; Vainzof, Mariz; Pavanello, Rita C M; Zatz, Mayana; McNally, Elizabeth M

2018-05-03

Exon skipping uses chemically modified antisense oligonucleotides to modulate RNA splicing. Therapeutically, exon skipping can bypass mutations and restore reading frame disruption by generating internally truncated, functional proteins to rescue the loss of native gene expression. Limb-girdle muscular dystrophy type 2C is caused by autosomal recessive mutations in the SGCG gene, which encodes the dystrophin-associated protein γ-sarcoglycan. The most common SGCG mutations disrupt the transcript reading frame abrogating γ-sarcoglycan protein expression. In order to treat most SGCG gene mutations, it is necessary to skip 4 exons in order to restore the SGCG transcript reading frame, creating an internally truncated protein referred to as Mini-Gamma. Using direct reprogramming of human cells with MyoD, myogenic cells were tested with 2 antisense oligonucleotide chemistries, 2'-O-methyl phosphorothioate oligonucleotides and vivo-phosphorodiamidate morpholino oligomers, to induce exon skipping. Treatment with vivo-phosphorodiamidate morpholino oligomers demonstrated efficient skipping of the targeted exons and corrected the mutant reading frame, resulting in the expression of a functional Mini-Gamma protein. Antisense-induced exon skipping of SGCG occurred in normal cells and those with multiple distinct SGCG mutations, including the most common 521ΔT mutation. These findings demonstrate a multiexon-skipping strategy applicable to the majority of limb-girdle muscular dystrophy 2C patients.

Inhibition of connective tissue growth factor (CTGF/CCN2) expression decreases the survival and myogenic differentiation of human rhabdomyosarcoma cells.

PubMed

Croci, Stefania; Landuzzi, Lorena; Astolfi, Annalisa; Nicoletti, Giordano; Rosolen, Angelo; Sartori, Francesca; Follo, Matilde Y; Oliver, Noelynn; De Giovanni, Carla; Nanni, Patrizia; Lollini, Pier-Luigi

2004-03-01

Connective tissue growth factor (CTGF/CCN2), a cysteine-rich protein of the CCN (Cyr61, CTGF, Nov) family of genes, emerged from a microarray screen of genes expressed by human rhabdomyosarcoma cells. Rhabdomyosarcoma is a soft tissue sarcoma of childhood deriving from skeletal muscle cells. In this study, we investigated the role of CTGF in rhabdomyosarcoma. Human rhabdomyosarcoma cells of the embryonal (RD/12, RD/18, CCA) and the alveolar histotype (RMZ-RC2, SJ-RH4, SJ-RH30), rhabdomyosarcoma tumor specimens, and normal skeletal muscle cells expressed CTGF. To determine the function of CTGF, we treated rhabdomyosarcoma cells with a CTGF antisense oligonucleotide or with a CTGF small interfering RNA (siRNA). Both treatments inhibited rhabdomyosarcoma cell growth, suggesting the existence of a new autocrine loop based on CTGF. CTGF antisense oligonucleotide-mediated growth inhibition was specifically due to a significant increase in apoptosis, whereas cell proliferation was unchanged. CTGF antisense oligonucleotide induced a strong decrease in the level of myogenic differentiation of rhabdomyosarcoma cells, whereas the addition of recombinant CTGF significantly increased the proportion of myosin-positive cells. CTGF emerges as a survival and differentiation factor and could be a new therapeutic target in human rhabdomyosarcoma.

Nanoparticle Delivery of Antisense Oligonucleotides and Their Application in the Exon Skipping Strategy for Duchenne Muscular Dystrophy

PubMed Central

Falzarano, Maria Sofia; Passarelli, Chiara

2014-01-01

Antisense therapy is a powerful tool for inducing post-transcriptional modifications and thereby regulating target genes associated with disease. There are several classes of antisense oligonucleotides (AONs) with therapeutic use, such as double-stranded RNAs (interfering RNAs, utilized for gene silencing, and single-stranded AONs with various chemistries, which are useful for antisense targeting of micro-RNAs and mRNAs. In particular, the use of AONs for exon skipping, by targeting pre-mRNA, is proving to be a highly promising therapy for some genetic disorders like Duchenne muscular dystrophy and spinal muscular atrophy. However, AONs are unable to cross the plasma membrane unaided, and several other obstacles still remain to be overcome, in particular their instability due to their nuclease sensitivity and their lack of tissue specificity. Various drug delivery systems have been explored to improve the bioavailability of nucleic acids, and nanoparticles (NPs) have been suggested as potential vectors for DNA/RNA. This review describes the recent progress in AON conjugation with natural and synthetic delivery systems, and provides an overview of the efficacy of NP-AON complexes as an exon-skipping treatment for Duchenne muscular dystrophy. PMID:24506782

The ICAM-1 antisense oligonucleotide ISIS-3082 prevents the development of postoperative ileus in mice

PubMed Central

The, Frans O; de Jonge, Wouter J; Bennink, Roel J; van den Wijngaard, Rene M; Boeckxstaens, Guy E

2005-01-01

Intestinal manipulation (IM) during abdominal surgery triggers the influx of inflammatory cells, leading to postoperative ileus. Prevention of this local muscle inflammation, using intercellular adhesion molecule-1 (ICAM-1) and leukocyte function-associated antigen-1-specific antibodies, has been shown to shorten postoperative ileus. However, the therapeutic use of antibodies has considerable disadvantages. The aim of the current study was to evaluate the effect of ISIS-3082, a mouse-specific ICAM-1 antisense oligonucleotide, on postoperative ileus in mice. Mice underwent a laparotomy or a laparotomy combined with IM after treatment with ICAM-1 antibodies, 0.1–10 mg kg−1 ISIS-3082, saline or ISIS-8997 (scrambled control antisense oligonucleotides, 1 and 3 mg kg−1). At 24 h after surgery, gastric emptying of a 99mTC labelled semi-liquid meal was determined using scintigraphy. Intestinal inflammation was assessed by myeloperoxidase (MPO) activity in ileal muscle whole mounts. IM significantly reduced gastric emptying compared to laparotomy. Pretreatment with ISIS-3082 (0.1–1 mg kg−1) as well as ICAM-1 antibodies (10 mg kg−1), but not ISIS-8997 or saline, improved gastric emptying in a dose-dependent manner. This effect diminished with higher doses of ISIS-3082 (3–10 mg kg−1). Similarly, ISIS-3082 (0.1–1 mg kg−1) and ICAM-1 antibodies, but not ISIS-8997 or higher doses of ISIS-3082 (3–10 mg kg−1), reduced manipulation-induced inflammation. Immunohistochemistry showed reduction of ICAM-1 expression with ISIS-3082 only. ISIS-3082 pretreatment prevents postoperative ileus in mice by reduction of manipulation-induced local intestinal muscle inflammation. Our data suggest that targeting ICAM-1 using antisense oligonucleotides may represent a new therapeutic approach to the prevention of postoperative ileus. PMID:15997238

A Phase I, Randomised, First-in-Human Study of an Antisense Oligonucleotide Directed Against SOD1 Delivered Intrathecally in SOD1-Familial ALS Patients

PubMed Central

Miller, Timothy; Pestronk, Alan; David, William; Rothstein, Jeffrey; Simpson, Ericka; Appel, Stanley H.; Andres, Patricia L.; Mahoney, Katy; Allred, Peggy; Alexander, Katie; Ostrow, Lyle W.; Schoenfeld, David; Macklin, Eric A.; Norris, Daniel A.; Manousakis, Georgios; Crisp, Matthew; Smith, Richard; Bennett, C.F.; Bishop, Kathie; Cudkowicz, Merit E

2013-01-01

Objective To evaluate the safety, tolerability, and pharmacokinetics of an antisense oligonucleotide designed to inhibit SOD1 expression (ISIS 333611) following intrathecal administration in patients with SOD1-related familial amyotrophic lateral sclerosis (ALS). Background Mutations in SOD1 cause 13% of familial ALS. In animal studies, ISIS 333611 delivered to the cerebrospinal fluid (CSF) distributed to the brain and spinal cord, decreased SOD1 mRNA and protein levels in spinal cord tissue, and prolonged survival in the SOD1G93A rat ALS model. Methods In a randomized, placebo controlled Phase 1 trial, ISIS 333611 was delivered by intrathecal infusion using an external pump over 11.5 hours at increasing doses to four cohorts of eight SOD1 positive ALS subjects (randomized 6 drug: 2 placebo/cohort). Subjects were allowed to re-enroll in subsequent cohorts. Safety and tolerability assessments were made during the infusion and periodically over 28 days following the infusion. CSF and plasma drug levels were measured. Findings No dose-limiting toxicities were identified at doses up to 3.0 mg. No safety or tolerability concerns related to ISIS 333611 were identified. There were no serious adverse events (AEs) in ISIS 333611-treated subjects. Re-enrollment and re-dosing of subjects with ISIS 333611 was also well tolerated. Dose-dependent CSF and plasma concentrations were observed. Interpretation In this first clinical study to report intrathecal delivery of an antisense oligonucleotide, ISIS 333611 was well tolerated when administered as an intrathecal infusion in subjects with SOD1 familial ALS. CSF and plasma drug levels were consistent with levels predicted from preclinical studies. These results suggest that antisense oligonucleotide delivery to the central nervous system may be a feasible therapeutic strategy for neurological disorders. Source of funding ALS Association, Muscular Dystrophy Association, Isis Pharmaceuticals PMID:23541756

RNA interference-based therapeutics: new strategies to fight infectious disease.

PubMed

López-Fraga, M; Wright, N; Jiménez, A

2008-12-01

For many years, there has been an ongoing search for new compounds that can selectively alter gene expression as a new way to treat human disease by addressing targets that are otherwise "undruggable" with traditional pharmaceutical approaches involving small molecules or proteins. RNA interference (RNAi) strategies have raised a lot of attention and several compounds are currently being tested in clinical trials. Viruses are the obvious target for RNAi-therapy, as most are difficult to treat with conventional drugs, they become rapidly resistant to drug treatment and their genes differ substantially from human genes, minimizing side effects. Antisense strategy offers very high target specificity, i.e., any viral sequence could potentially be targeted using the complementary oligonucleotide sequence. Consequently, new antisense-based therapeutics have the potential to lead a revolution in the anti-infective drug development field. Additionally, the relatively short turnaround for efficacy testing of potential RNAi molecules and that any pathogen is theoretically amenable to rapid targeting, make them invaluable tools for treating a wide range of diseases. This review will focus on some of the current efforts to treat infectious disease with RNAi-based therapies and some of the obstacles that have appeared on the road to successful clinical intervention.

Targeting of Repeated Sequences Unique to a Gene Results in Significant Increases in Antisense Oligonucleotide Potency

PubMed Central

Vickers, Timothy A.; Freier, Susan M.; Bui, Huynh-Hoa; Watt, Andrew; Crooke, Stanley T.

2014-01-01

A new strategy for identifying potent RNase H-dependent antisense oligonucleotides (ASOs) is presented. Our analysis of the human transcriptome revealed that a significant proportion of genes contain unique repeated sequences of 16 or more nucleotides in length. Activities of ASOs targeting these repeated sites in several representative genes were compared to those of ASOs targeting unique single sites in the same transcript. Antisense activity at repeated sites was also evaluated in a highly controlled minigene system. Targeting both native and minigene repeat sites resulted in significant increases in potency as compared to targeting of non-repeated sites. The increased potency at these sites is a result of increased frequency of ASO/RNA interactions which, in turn, increases the probability of a productive interaction between the ASO/RNA heteroduplex and human RNase H1 in the cell. These results suggest a new, highly efficient strategy for rapid identification of highly potent ASOs. PMID:25334092

Antisense Oligonucleotides Targeting Parasite Inositol 1,4,5-Trisphosphate Receptor Inhibits Mammalian Host Cell Invasion by Trypanosoma cruzi

NASA Astrophysics Data System (ADS)

Hashimoto, Muneaki; Nara, Takeshi; Hirawake, Hiroko; Morales, Jorge; Enomoto, Masahiro; Mikoshiba, Katsuhiko

2014-02-01

Chagas disease is caused by an intracellular parasitic protist, Trypanosoma cruzi. As there are no highly effective drugs against this agent that also demonstrate low toxicity, there is an urgent need for development of new drugs to treat Chagas disease. We have previously demonstrated that the parasite inositol 1,4,5-trisphosphate receptor (TcIP3R) is crucial for invasion of the mammalian host cell by T. cruzi. Here, we report that TcIP3R is a short-lived protein and that its expression is significantly suppressed in trypomastigotes. Treatment of trypomastigotes, an infective stage of T. cruzi, with antisense oligonucleotides specific to TcIP3R deceased TcIP3R protein levels and impaired trypomastigote invasion of host cells. Due to the resulting instability and very low expression level of TcIP3R in trypomastigotes indicates that TcIP3R is a promising target for antisense therapy in Chagas disease.

VRP09 Reduction of Corneal Scarring Following Blast and Burn Injuries to Cornea Using siRNAs Targeting TGFb and CTGF

DTIC Science & Technology

2012-10-01

selective of all gene-targeted, oligonucleotide-based drug approaches (better than ribozymes, antisense oligonucleotides ( ASO ), or microRNAs).(4) We will...respect to a scrambled siRNA control. For the migration assay, a circular region in the middle of the well was removed using a gel removal solution...oligonucleotides, ASOs ) into rabbit corneal cells and found that technique was very effective in delivering ASOs into the stroma and even into the endothelial cell

Natural Antisense Transcripts: Molecular Mechanisms and Implications in Breast Cancers

PubMed Central

Latgé, Guillaume; Poulet, Christophe; Bours, Vincent; Jerusalem, Guy

2018-01-01

Natural antisense transcripts are RNA sequences that can be transcribed from both DNA strands at the same locus but in the opposite direction from the gene transcript. Because strand-specific high-throughput sequencing of the antisense transcriptome has only been available for less than a decade, many natural antisense transcripts were first described as long non-coding RNAs. Although the precise biological roles of natural antisense transcripts are not known yet, an increasing number of studies report their implication in gene expression regulation. Their expression levels are altered in many physiological and pathological conditions, including breast cancers. Among the potential clinical utilities of the natural antisense transcripts, the non-coding|coding transcript pairs are of high interest for treatment. Indeed, these pairs can be targeted by antisense oligonucleotides to specifically tune the expression of the coding-gene. Here, we describe the current knowledge about natural antisense transcripts, their varying molecular mechanisms as gene expression regulators, and their potential as prognostic or predictive biomarkers in breast cancers. PMID:29301303

Natural Antisense Transcripts: Molecular Mechanisms and Implications in Breast Cancers.

PubMed

Latgé, Guillaume; Poulet, Christophe; Bours, Vincent; Josse, Claire; Jerusalem, Guy

2018-01-02

Natural antisense transcripts are RNA sequences that can be transcribed from both DNA strands at the same locus but in the opposite direction from the gene transcript. Because strand-specific high-throughput sequencing of the antisense transcriptome has only been available for less than a decade, many natural antisense transcripts were first described as long non-coding RNAs. Although the precise biological roles of natural antisense transcripts are not known yet, an increasing number of studies report their implication in gene expression regulation. Their expression levels are altered in many physiological and pathological conditions, including breast cancers. Among the potential clinical utilities of the natural antisense transcripts, the non-coding|coding transcript pairs are of high interest for treatment. Indeed, these pairs can be targeted by antisense oligonucleotides to specifically tune the expression of the coding-gene. Here, we describe the current knowledge about natural antisense transcripts, their varying molecular mechanisms as gene expression regulators, and their potential as prognostic or predictive biomarkers in breast cancers.

Mass spectrometric detection of siRNA in plasma samples for doping control purposes.

PubMed

Kohler, Maxie; Thomas, Andreas; Walpurgis, Katja; Schänzer, Wilhelm; Thevis, Mario

2010-10-01

Small interfering ribonucleic acid (siRNA) molecules can effect the expression of any gene by inducing the degradation of mRNA. Therefore, these molecules can be of interest for illicit performance enhancement in sports by affecting different metabolic pathways. An example of an efficient performance-enhancing gene knockdown is the myostatin gene that regulates muscle growth. This study was carried out to provide a tool for the mass spectrometric detection of modified and unmodified siRNA from plasma samples. The oligonucleotides are purified by centrifugal filtration and the use of an miRNA purification kit, followed by flow-injection analysis using an Exactive mass spectrometer to yield the accurate masses of the sense and antisense strands. Although chromatography and sensitive mass spectrometric analysis of oligonucleotides are still challenging, a method was developed and validated that has adequate sensitivity (limit of detection 0.25-1 nmol mL(-1)) and performance (precision 11-21%, recovery 23-67%) for typical antisense oligonucleotides currently used in clinical studies.

Oligonucleotides complementary to a promoter over the region -8...+2 as transcription primers for E. coli RNA polymerase.

PubMed Central

Grachev, M A; Zaychikov, E F; Ivanova, E M; Komarova, N I; Kutyavin, I V; Sidelnikova, N P; Frolova, I P

1984-01-01

Primer-dependent transcription by E. coli RNA polymerase on T7 promoter A2 has been studied. Synthetic deoxyribonucleotides complementary to the promoter over the region -8...+2 were taken as primers. A ribonucleoside residue was present at the 3'-end of some of these oligonucleotides. The octanucleotide complementary to the region -8...-1 appeared to be an active primer. Oligonucleotides having lengths from 3 to 6 nucleotide residues complementary to the promoter over the region -4...+2 also exhibited primer activity. The latter was some 5-10 times greater in the case of oligonucleotides having a ribonucleoside residue at the 3'-end. Oligonucleotides which on complementary binding do not reach the center of phosphodiester bond synthesis, as well as the decanucleotides (-8...+2) and octanucleotides (-6...+2) of both the ribo- and deoxyribo-series were inactive as primers. Images PMID:6390344

Intravesical NGF Antisense Therapy Using Lipid Nanoparticle for Interstitial Cystitis

DTIC Science & Technology

2016-12-01

bladder symptoms including urinary frequency and urgency. Previous studies have indicated that overexpression of nerve growth factor (NGF) is an... studies indicate overexpression of nerve growth factor (NGF) as a key factor in the symptom development of IC/BPS. NGF antisense oligonucleotides hold...Stability Testing  Ex -vivo stress testing II-2. Research Accomplishment Description AIM 1 Regulatory approval for animal research ; Obtain

Development of siRNA Technology to Prevent Scar Formation in Tendon Repair

DTIC Science & Technology

2013-12-01

Anti-sense RNA technologies: Under normal conditions cells produce small interfering (si) RNAs that inhibit protein synthesis and stimulate...stimulation of fibroblast proliferation and migration, collagen and fibronectin synthesis , and altered tissue remodeling through regulation of MMPs...expression by an antisense oligonucleotide protects mice from fulminant hepatitis. Nat Biotechnol 2000;18:862-7. 7. Guha M, Xu ZG, Tung D, Lanting L

Emerging LDL therapies: Mipomersen-antisense oligonucleotide therapy in the management of hypercholesterolemia.

PubMed

Toth, Peter P

2013-01-01

Familial hypercholesterolemia (FH) is characterized by severe elevations in low-density lipoprotein cholesterol (LDL-C) and poses considerable treatment challenges. Substantive LDL-C reductions are difficult to achieve with standard therapies, and many patients with FH do not tolerate currently available lipid-lowering medications. Mipomersen is an antisense oligonucleotide injectable drug that was recently approved by the Food and Drug Administration for the treatment of homozygous FH. It is complementary in sequence to a segment of the human apolipoprotein (Apo) B-100 messenger RNA and specifically binds to it, blocking translation of the gene product. Reducing the production of Apo B-100 reduces hepatic production of very low-density lipoprotein, consequently decreasing circulating levels of atherogenic very low-density lipoprotein remnants, intermediate-density lipoproteins, LDL, and lipoprotein(a) particles. Results from a pivotal trial conducted in patients with homozygous FH, and supporting trials in patients with heterozygous FH with coronary artery disease (CAD) (LDL-C ≥ 100 mg/dL, triglycerides < 200 mg/dL), severe hypercholesterolemia (LDL-C ≥ 300 mg/dL or ≥ 200 mg/dL with CAD), and individuals at high risk for CAD (LDL-C ≥ 100 mg/dL, triglycerides ≤ 200 mg/dL), have indicated that mipomersen reduces all Apo B-containing atherogenic lipoproteins. The average LDL-C reduction was >100 mg/dL in homozygous FH and severe hypercholesterolemia populations. The main on-treatment adverse events were mild-to-moderate injection site reactions and flu-like symptoms. Available data regarding the efficacy, safety and tolerability of mipomersen, including results at up to 104 weeks of therapy, support the use of mipomersen for the treatment of FH. Copyright © 2013 National Lipid Association. Published by Elsevier Inc. All rights reserved.

Mapping of RNA accessible sites by extension of random oligonucleotide libraries with reverse transcriptase.

PubMed Central

Allawi, H T; Dong, F; Ip, H S; Neri, B P; Lyamichev, V I

2001-01-01

A rapid and simple method for determining accessible sites in RNA that is independent of the length of target RNA and does not require RNA labeling is described. In this method, target RNA is allowed to hybridize with sequence-randomized libraries of DNA oligonucleotides linked to a common tag sequence at their 5'-end. Annealed oligonucleotides are extended with reverse transcriptase and the extended products are then amplified by using PCR with a primer corresponding to the tag sequence and a second primer specific to the target RNA sequence. We used the combination of both the lengths of the RT-PCR products and the location of the binding site of the RNA-specific primer to determine which regions of the RNA molecules were RNA extendible sites, that is, sites available for oligonucleotide binding and extension. We then employed this reverse transcription with the random oligonucleotide libraries (RT-ROL) method to determine the accessible sites on four mRNA targets, human activated ras (ha-ras), human intercellular adhesion molecule-1 (ICAM-1), rabbit beta-globin, and human interferon-gamma (IFN-gamma). Our results were concordant with those of other researchers who had used RNase H cleavage or hybridization with arrays of oligonucleotides to identify accessible sites on some of these targets. Further, we found good correlation between sites when we compared the location of extendible sites identified by RT-ROL with hybridization sites of effective antisense oligonucleotides on ICAM-1 mRNA in antisense inhibition studies. Finally, we discuss the relationship between RNA extendible sites and RNA accessibility. PMID:11233988

A sense oligonucleotide to inducible nitric oxide synthase mRNA increases the survival rate of rats in septic shock.

PubMed

Okuyama, Tetsuya; Nakatake, Richi; Kaibori, Masaki; Okumura, Tadayoshi; Kon, Masanori; Nishizawa, Mikio

2018-01-30

Natural antisense transcripts (asRNAs) that do not encode proteins are transcribed from rat, mouse, and human genes, encoding inducible nitric oxide synthase (iNOS), which catalyzes the production of the inflammatory mediator nitric oxide (NO). In septic shock, NO is excessively produced in hepatocytes and macrophages. The iNOS asRNA interacts with and stabilizes iNOS mRNA. We found that single-stranded 'sense' oligonucleotides corresponding to the iNOS mRNA sequence reduced iNOS mRNA levels by interfering with the mRNA-asRNA interactions in rat hepatocytes. The iNOS sense oligonucleotides that were substituted with phosphorothioate bonds and locked nucleic acids efficiently decreased the levels of iNOS mRNA and iNOS protein. In this study, the gene expression patterns in the livers of two endotoxemia model rats with acute liver failure were compared. Next, we optimized the sequence and modification of the iNOS sense oligonucleotides in interleukin 1β-treated rat hepatocytes. When a sense oligonucleotide was simultaneously administered with d-galactosamine and bacterial lipopolysaccharide (LPS) to rats, their survival rate significantly increased compared to the rats administered d-galactosamine and LPS alone. In the livers of the sense oligonucleotide-administered rats, apoptosis in the hepatocytes markedly decreased. These results suggest that natural antisense transcript-targeted regulation technology using iNOS sense oligonucleotides may be used to treat human inflammatory diseases, such as sepsis and septic shock. Copyright © 2017 Elsevier Inc. All rights reserved.

Selective Androgen Receptor Down-Regulators (SARDs): A New Prostate Cancer Therapy

DTIC Science & Technology

2007-10-01

PCa (9). Thus far, the techniques that have been used to down-regulate the AR include antisense oligonucleotides (10, 11), ribozyme treatments (12...Our findings suggest that ICI may present a useful treatment option for patients with AR-dependent PCa. Unlike the ribozyme , antisense, siRNA, or...Catalytic cleavage of the androgen receptor messenger RNA and functional inhibition of androgen receptor activity by a hammerhead ribozyme . Mol Endocrinol

ISS-N1 makes the First FDA-approved Drug for Spinal Muscular Atrophy

PubMed Central

Ottesen, Eric W.

2017-01-01

Abstract Spinal muscular atrophy (SMA) is one of the leading genetic diseases of children and infants. SMA is caused by deletions or mutations of Survival Motor Neuron 1 (SMN1) gene. SMN2, a nearly identical copy of SMN1, cannot compensate for the loss of SMN1 due to predominant skipping of exon 7. While various regulatory elements that modulate SMN2 exon 7 splicing have been proposed, intronic splicing silencer N1 (ISS-N1) has emerged as the most promising target thus far for antisense oligonucleotide-mediated splicing correction in SMA. Upon procuring exclusive license from the University of Massachussets Medical School in 2010, Ionis Pharmaceuticals (formerly ISIS Pharamaceuticals) began clinical development of Spinraza™ (synonyms: Nusinersen, IONIS-SMNRX, ISIS-SMNRX), an antisense drug based on ISS-N1 target. Spinraza™ showed very promising results at all steps of the clinical development and was approved by US Food and Drug Administration (FDA) on December 23, 2016. Spinraza™ is the first FDA-approved treatment for SMA and the first antisense drug to restore expression of a fully functional protein via splicing correction. The success of Spinraza™ underscores the potential of intronic sequences as promising therapeutic targets and sets the stage for further improvement of antisense drugs based on advanced oligonucleotide chemistries and delivery protocols. PMID:28400976

Solid phase synthesis of phosphorothioate oligonucleotides utilizing diethyldithiocarbonate disulfide (DDD) as an efficient sulfur transfer reagent.

PubMed

Cheruvallath, Zacharia S; Kumar, R Krishna; Rentel, Claus; Cole, Douglas L; Ravikumar, Vasulinga T

2003-04-01

Diethyldithiodicarbonate (DDD), a cheap and easily prepared compound, is found to be a rapid and efficient sulfurizing reagent in solid phase synthesis of phosphorothioate oligodeoxyribonucleotides via the phosphoramidite approach. Product yield and quality based on IP-LC-MS compares well with high quality oligonucleotides synthesized using phenylacetyl disulfide (PADS) which is being used for manufacture of our antisense drugs.

Tetrahedral DNA Nanoparticle Vector for Intracellular Delivery of Targeted Peptide Nucleic Acid Antisense Agents to Restore Antibiotic Sensitivity in Cefotaxime-Resistant Escherichia coli.

PubMed

Readman, John Benedict; Dickson, George; Coldham, Nick G

2017-06-01

The bacterial cell wall presents a barrier to the uptake of unmodified synthetic antisense oligonucleotides, such as peptide nucleic acids, and so is one of the greatest obstacles to the development of their use as therapeutic anti-bacterial agents. Cell-penetrating peptides have been covalently attached to antisense agents, to facilitate penetration of the bacterial cell wall and deliver their cargo into the cytoplasm. Although they are an effective vector for antisense oligonucleotides, they are not specific for bacterial cells and can exhibit growth inhibitory properties at higher doses. Using a bacterial cell growth assay in the presence of cefotaxime (CTX 16 mg/L), we have developed and evaluated a self-assembling non-toxic DNA tetrahedron nanoparticle vector incorporating a targeted anti-bla CTX-M-group 1 antisense peptide nucleic acid (PNA4) in its structure for penetration of the bacterial cell wall. A dose-dependent CTX potentiating effect was observed when PNA4 (0-40 μM) was incorporated into the structure of a DNA tetrahedron vector. The minimum inhibitory concentration (to CTX) of an Escherichia coli field isolate harboring a plasmid carrying bla CTX-M-3 was reduced from 35 to 16 mg/L in the presence of PNA4 carried by the DNA tetrahedron vector (40 μM), contrasting with no reduction in MIC in the presence of PNA4 alone. No growth inhibitory effects of the DNA tetrahedron vector alone were observed.

Inhaled ENaC antisense oligonucleotide ameliorates cystic fibrosis-like lung disease in mice.

PubMed

Crosby, Jeff R; Zhao, Chenguang; Jiang, Chong; Bai, Dong; Katz, Melanie; Greenlee, Sarah; Kawabe, Hiroshi; McCaleb, Michael; Rotin, Daniela; Guo, Shuling; Monia, Brett P

2017-11-01

Epithelial sodium channel (ENaC, Scnn1) hyperactivity in the lung leads to airway surface dehydration and mucus accumulation in cystic fibrosis (CF) patients and in mice with CF-like lung disease. We identified several potent ENaC specific antisense oligonucleotides (ASOs) and tested them by inhalation in mouse models of CF-like lung disease. The inhaled ASOs distributed into lung airway epithelial cells and decreased ENaC expression by inducing RNase H1-dependent degradation of the targeted Scnn1a mRNA. Aerosol delivered ENaC ASO down-regulated mucus marker expression and ameliorated goblet cell metaplasia, inflammation, and airway hyper-responsiveness. Lack of systemic activity of ASOs delivered via the aerosol route ensures the safety of this approach. Our results demonstrate that antisense inhibition of ENaC in airway epithelial cells could be an effective and safe approach for the prevention and reversal of lung symptoms in CF and potentially other inflammatory diseases of the lung. Copyright © 2017 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.

Antisense oligonucleotide directed to human apolipoprotein B-100 reduces lipoprotein(a) levels and oxidized phospholipids on human apolipoprotein B-100 particles in lipoprotein(a) transgenic mice.

PubMed

Merki, Esther; Graham, Mark J; Mullick, Adam E; Miller, Elizabeth R; Crooke, Rosanne M; Pitas, Robert E; Witztum, Joseph L; Tsimikas, Sotirios

2008-08-12

Lipoprotein (a) [Lp(a)] is a genetic cardiovascular risk factor that preferentially binds oxidized phospholipids (OxPL) in plasma. There is a lack of therapeutic agents that reduce plasma Lp(a) levels. Transgenic mice overexpressing human apolipoprotein B-100 (h-apoB-100 [h-apoB mice]) or h-apoB-100 plus human apo(a) to generate genuine Lp(a) particles [Lp(a) mice] were treated with the antisense oligonucleotide mipomersen directed to h-apoB-100 mRNA or control antisense oligonucleotide for 11 weeks by intraperitoneal injection. Mice were then followed up for an additional 10 weeks off therapy. Lp(a) levels [apo(a) bound to apoB-100] and apo(a) levels ["free" apo(a) plus apo(a) bound to apoB-100] were measured by chemiluminescent enzyme-linked immunoassay and commercial assays, respectively. The content of OxPL on h-apoB-100 particles (OxPL/h-apoB) was measured by capturing h-apoB-100 in microtiter wells and detecting OxPL by antibody E06. As expected, mipomersen significantly reduced plasma h-apoB-100 levels in both groups of mice. In Lp(a) mice, mipomersen significantly reduced Lp(a) levels by approximately 75% compared with baseline (P<0.0001) but had no effect on apo(a) levels or hepatic apo(a) mRNA expression. OxPL/h-apoB levels were much higher at baseline in Lp(a) mice compared with h-ApoB mice (P<0.0001) but decreased in a time-dependent fashion with mipomersen. There was no effect of the control antisense oligonucleotide on lipoprotein levels or oxidative parameters. Mipomersen significantly reduced Lp(a) and OxPL/apoB levels in Lp(a) mice. The present study demonstrates that h-apoB-100 is a limiting factor in Lp(a) particle synthesis in this Lp(a) transgenic model. If applicable to humans, mipomersen may represent a novel therapeutic approach to reducing Lp(a) levels and their associated OxPL.

Co-Administration of an Excipient Oligonucleotide Helps Delineate Pathways of Productive and Nonproductive Uptake of Phosphorothioate Antisense Oligonucleotides in the Liver.

PubMed

Donner, Aaron J; Wancewicz, Edward V; Murray, Heather M; Greenlee, Sarah; Post, Noah; Bell, Melanie; Lima, Walt F; Swayze, Eric E; Seth, Punit P

2017-08-01

Phosphorothioate (PS) modified antisense oligonucleotides (ASOs) have progressed rapidly in the clinic for treating a variety of disease indications. We previously demonstrated that the activity of PS ASOs in the liver can be enhanced by co-infusion of an excipient oligonucleotide (EON). It was posited that the EON saturates a nonproductive uptake pathway(s) thereby permitting accumulation of the PS ASO in a productive tissue compartment. In this report, we measured PS ASO activity following administration by bolus, infusion or co-fusion with EON within hepatocytes and nonparenchymal cells (NPCs), of the liver. This revealed that while ASOs accumulate preferentially in NPCs, they are intrinsically more active in hepatocytes. Furthermore, we show that the EON enhances ASO potency when infused up to 72 h before or after administration of the active ASO suggesting that the EON can saturate and displace the ASO from nonproductive to productive compartments. Physical presence of the EON in tissues was required for optimal potentiation suggesting that there is a dynamic distribution of the ASO and EON between the compartments. Lastly, using a candidate approach, we confirmed Stabilin-2 as a molecular pathway for ASO uptake in sinusoidal endothelial cells and the ASGR as a pathway for ASO uptake into hepatocytes in the liver.

FDA-Approved Oligonucleotide Therapies in 2017.

PubMed

Stein, Cy A; Castanotto, Daniela

2017-05-03

Oligonucleotides (oligos) have been under clinical development for approximately the past 30 years, beginning with antisense oligonucleotides (ASOs) and apatmers and followed about 15 years ago by siRNAs. During that lengthy period of time, numerous clinical trials have been performed and thousands of trial participants accrued onto studies. Of all the molecules evaluated as of January 2017, the regulatory authorities assessed that six provided clear clinical benefit in rigorously controlled trials. The story of these six is given in this review. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

ISS-N1 makes the First FDA-approved Drug for Spinal Muscular Atrophy.

PubMed

Ottesen, Eric W

2017-01-01

Spinal muscular atrophy (SMA) is one of the leading genetic diseases of children and infants. SMA is caused by deletions or mutations of Survival Motor Neuron 1 ( SMN1 ) gene. SMN2 , a nearly identical copy of SMN1 , cannot compensate for the loss of SMN1 due to predominant skipping of exon 7. While various regulatory elements that modulate SMN2 exon 7 splicing have been proposed, intronic splicing silencer N1 (ISS-N1) has emerged as the most promising target thus far for antisense oligonucleotide-mediated splicing correction in SMA. Upon procuring exclusive license from the University of Massachussets Medical School in 2010, Ionis Pharmaceuticals (formerly ISIS Pharamaceuticals) began clinical development of Spinraza ™ (synonyms: Nusinersen, IONIS-SMN RX , ISIS-SMN RX ), an antisense drug based on ISS-N1 target. Spinraza ™ showed very promising results at all steps of the clinical development and was approved by US Food and Drug Administration (FDA) on December 23, 2016. Spinraza ™ is the first FDA-approved treatment for SMA and the first antisense drug to restore expression of a fully functional protein via splicing correction. The success of Spinraza ™ underscores the potential of intronic sequences as promising therapeutic targets and sets the stage for further improvement of antisense drugs based on advanced oligonucleotide chemistries and delivery protocols.

Antisense oligonucleotide inhibition of apolipoprotein C-III reduces plasma triglycerides in rodents, nonhuman primates, and humans.

PubMed

Graham, Mark J; Lee, Richard G; Bell, Thomas A; Fu, Wuxia; Mullick, Adam E; Alexander, Veronica J; Singleton, Walter; Viney, Nick; Geary, Richard; Su, John; Baker, Brenda F; Burkey, Jennifer; Crooke, Stanley T; Crooke, Rosanne M

2013-05-24

Elevated plasma triglyceride levels have been recognized as a risk factor for the development of coronary heart disease. Apolipoprotein C-III (apoC-III) represents both an independent risk factor and a key regulatory factor of plasma triglyceride concentrations. Furthermore, elevated apoC-III levels have been associated with metabolic syndrome and type 2 diabetes mellitus. To date, no selective apoC-III therapeutic agent has been evaluated in the clinic. To test the hypothesis that selective inhibition of apoC-III with antisense drugs in preclinical models and in healthy volunteers would reduce plasma apoC-III and triglyceride levels. Rodent- and human-specific second-generation antisense oligonucleotides were identified and evaluated in preclinical models, including rats, mice, human apoC-III transgenic mice, and nonhuman primates. We demonstrated the selective reduction of both apoC-III and triglyceride in all preclinical pharmacological evaluations. We also showed that inhibition of apoC-III was well tolerated and not associated with increased liver triglyceride deposition or hepatotoxicity. A double-blind, placebo-controlled, phase I clinical study was performed in healthy subjects. Administration of the human apoC-III antisense drug resulted in dose-dependent reductions in plasma apoC-III, concomitant lowering of triglyceride levels, and produced no clinically meaningful signals in the safety evaluations. Antisense inhibition of apoC-III in preclinical models and in a phase I clinical trial with healthy subjects produced potent, selective reductions in plasma apoC-III and triglyceride, 2 known risk factors for cardiovascular disease. This compelling pharmacological profile supports further clinical investigations in hypertriglyceridemic subjects.

Hitting bacteria at the heart of the central dogma: sequence-specific inhibition.

PubMed

Rasmussen, Louise Carøe Vohlander; Sperling-Petersen, Hans Uffe; Mortensen, Kim Kusk

2007-08-10

An important objective in developing new drugs is the achievement of high specificity to maximize curing effect and minimize side-effects, and high specificity is an integral part of the antisense approach. The antisense techniques have been extensively developed from the application of simple long, regular antisense RNA (asRNA) molecules to highly modified versions conferring resistance to nucleases, stability of hybrid formation and other beneficial characteristics, though still preserving the specificity of the original nucleic acids. These new and improved second- and third-generation antisense molecules have shown promising results. The first antisense drug has been approved and more are in clinical trials. However, these antisense drugs are mainly designed for the treatment of different human cancers and other human diseases. Applying antisense gene silencing and exploiting RNA interference (RNAi) are highly developed approaches in many eukaryotic systems. But in bacteria RNAi is absent, and gene silencing by antisense compounds is not nearly as well developed, despite its great potential and the intriguing possibility of applying antisense molecules in the fight against multiresistant bacteria. Recent breakthrough and current status on the development of antisense gene silencing in bacteria including especially phosphorothioate oligonucleotides (PS-ODNs), peptide nucleic acids (PNAs) and phosphorodiamidate morpholino oligomers (PMOs) will be presented in this review.

Technology evaluation: AVI-4126, AVI BioPharma.

PubMed

Stephens, Alick C

2004-10-01

AVI BioPharma is developing AVI-4126, an antisense oligonucleotide targeted to c-myc mRNA for the potential treatment of restenosis, cancer and polycystic kidney disease. AVI-4126 is currently undergoing phase II clinical trials.

Advanced surface-enhanced Raman gene probe systems and methods thereof

DOEpatents

Vo-Dinh, Tuan

2001-01-01

The subject invention is a series of methods and systems for using the Surface-Enhanced Raman (SER)-labeled Gene Probe for hybridization, detection and identification of SER-labeled hybridized target oligonucleotide material comprising the steps of immobilizing SER-labeled hybridized target oligonucleotide material on a support means, wherein the SER-labeled hybridized target oligonucleotide material comprise a SER label attached either to a target oligonucleotide of unknown sequence or to a gene probe of known sequence complementary to the target oligonucleotide sequence, the SER label is unique for the target oligonucleotide strands of a particular sequence wherein the SER-labeled oligonucleotide is hybridized to its complementary oligonucleotide strand, then the support means having the SER-labeled hybridized target oligonucleotide material adsorbed thereon is SERS activated with a SERS activating means, then the support means is analyzed.

Lipophilic oligonucleotides spontaneously insert into lipid membranes, bind complementary DNA strands, and sequester into lipid-disordered domains.

PubMed

Bunge, Andreas; Kurz, Anke; Windeck, Anne-Kathrin; Korte, Thomas; Flasche, Wolfgang; Liebscher, Jürgen; Herrmann, Andreas; Huster, Daniel

2007-04-10

For the development of surface functionalized bilayers, we have synthesized lipophilic oligonucleotides to combine the molecular recognition mechanism of nucleic acids and the self-assembly characteristics of lipids in planar membranes. A lipophilic oligonucleotide consisting of 21 thymidine units and two lipophilic nucleotides with an alpha-tocopherol moiety as a lipophilic anchor was synthesized using solid-phase methods with a phosphoramadite strategy. The interaction of the water soluble lipophilic oligonucleotide with vesicular lipid membranes and its capability to bind complementary DNA strands was studied using complementary methods such as NMR, EPR, DSC, fluorescence spectroscopy, and fluorescence microscopy. This oligonucleotide inserted stably into preformed membranes from the aqueous phase. Thereby, no significant perturbation of the lipid bilayer and its stability was observed. However, the non-lipidated end of the oligonucleotide is exposed to the aqueous environment, is relatively mobile, and is free to interact with complementary DNA strands. Binding of the complementary single-stranded DNA molecules is fast and accomplished by the formation of Watson-Crick base pairs, which was confirmed by 1H NMR chemical shift analysis and fluorescence resonance energy transfer. The molecular structure of the membrane bound DNA double helix is very similar to the free double-stranded DNA. Further, the membrane bound DNA double strands also undergo regular melting. Finally, in raft-like membrane mixtures, the lipophilic oligonucleotide was shown to preferentially sequester into liquid-disordered membrane domains.

Inhibition of human papillomavirus expression using DNAzymes.

PubMed

Benítez-Hess, María Luisa; Reyes-Gutiérrez, Pablo; Alvarez-Salas, Luis Marat

2011-01-01

Deoxyribozymes (DXZs) are catalytic oligodeoxynucleotides capable of performing diverse functions including the specific cleavage of a target RNA. These molecules represent a new type of therapeutic oligonucleotides combining the efficiency of ribozymes and the intracellular endurance and simplicity of modified antisense oligonucleotides. Commonly used DXZs include the 8-17 and 10-23 motifs, which have been engineered to destroy disease-associated genes with remarkable efficiency. Targeting DXZs to disease-associated transcripts requires extensive biochemical testing to establish target RNA accessibility, catalytic efficiency, and nuclease sensibility. The usage of modified nucleotides to render nuclease-resistance DXZs must be counterweighted against deleterious consequences on catalytic activity. Further intracellular testing is required to establish the effect of microenvironmental conditions on DXZ activity and off-target issues. Application of modified DXZs to cervical cancer results in specific growth inhibition, cell death, and apoptosis. Thus, DXZs represent a highly effective antisense moiety with minimal secondary effects.

RNA interference for performance enhancement and detection in doping control.

PubMed

Kohler, Maxie; Schänzer, Wilhelm; Thevis, Mario

2011-10-01

RNA interference represents a comparably new route of regulating and manipulating specific gene expression. Promising results were obtained in experimental therapies aim at the treatment of different kinds of diseases including cancer, diabetes mellitus or Dychenne muscular dystrophy. While studies on down-regulation efficiency are often performed by analyzing the regulated protein, the direct detection of small, interfering RNA molecules and antisense oligonucleotides is of great interest for the investigation of the metabolism and degradation and also for the detection of a putative misuse of these molecules in sports. Myostatin down-regulation was shown to result in increased performance and muscle growth and the regulation of several other proteins could be relevant for performance enhancement. This mini-review summarizes current approaches for the mass spectrometric analysis of siRNA and antisense oligonucleotides from biological matrices and the available data on biodistribution, metabolism, and half-life of relevant substances are discussed. Copyright © 2011 John Wiley & Sons, Ltd.

Antisense oligonucleotide therapeutics for iron-sulphur cluster deficiency myopathy.

PubMed

Kollberg, Gittan; Holme, Elisabeth

2009-12-01

Iron-sulphur cluster deficiency myopathy is caused by a deep intronic mutation in ISCU resulting in inclusion of a cryptic exon in the mature mRNA. ISCU encodes the iron-sulphur cluster assembly protein IscU. Iron-sulphur clusters are essential for most basic redox transformations including the respiratory-chain function. Most patients are homozygous for the mutation with a phenotype characterized by a non-progressive myopathy with childhood onset of early fatigue, dyspnoea and palpitation on trivial exercise. A more severe phenotype with early onset of a slowly progressive severe muscle weakness, severe exercise intolerance and cardiomyopathy is caused by a missense mutation in compound with the intronic mutation. Treatment of cultured fibroblasts derived from three homozygous patients with an antisense phosphorodiamidate morpholino oligonucleotide for 48 h resulted in 100% restoration of the normal splicing pattern. The restoration was stable and after 21 days the correctly spliced mRNA still was the dominating RNA species.

Control of phosphorothioate stereochemistry substantially increases the efficacy of antisense oligonucleotides.

PubMed

Iwamoto, Naoki; Butler, David C D; Svrzikapa, Nenad; Mohapatra, Susovan; Zlatev, Ivan; Sah, Dinah W Y; Meena; Standley, Stephany M; Lu, Genliang; Apponi, Luciano H; Frank-Kamenetsky, Maria; Zhang, Jason Jingxin; Vargeese, Chandra; Verdine, Gregory L

2017-09-01

Whereas stereochemical purity in drugs has become the standard for small molecules, stereoisomeric mixtures containing as many as a half million components persist in antisense oligonucleotide (ASO) therapeutics because it has been feasible neither to separate the individual stereoisomers, nor to synthesize stereochemically pure ASOs. Here we report the development of a scalable synthetic process that yields therapeutic ASOs having high stereochemical and chemical purity. Using this method, we synthesized rationally designed stereopure components of mipomersen, a drug comprising 524,288 stereoisomers. We demonstrate that phosphorothioate (PS) stereochemistry substantially affects the pharmacologic properties of ASOs. We report that Sp-configured PS linkages are stabilized relative to Rp, providing stereochemical protection from pharmacologic inactivation of the drug. Further, we elucidated a triplet stereochemical code in the stereopure ASOs, 3'-SpSpRp, that promotes target RNA cleavage by RNase H1 in vitro and provides a more durable response in mice than stereorandom ASOs.

Antisense oligonucleotides effectively inhibit the co-transcriptional splicing of a Candida group I intron in vitro and in vivo: Implications for antifungal therapeutics.

PubMed

Zhang, Libin; Leibowitz, Michael J; Zhang, Yi

2009-02-18

Self-splicing of group I intron from the 26S rRNA of Candida albicans is essential for maturation of the host RNA. Here, we demonstrated that the co-transcriptional splicing of the intron in vitro was blocked by antisense oligonucleotides (AONs) targeting the P3-P7 core of the intron. The core-targeted AON effectively and specifically inhibited the intron splicing from its host RNA in living C. albicans. Furthermore, flow cytometry experiments showed that the growth inhibition was caused by a fungicidal effect. For the first time, we showed that an AON targeting the ribozyme core folding specifically inhibits the endogenous ribozyme splicing in living cells and specifically kills the intron-containing fungal strains, which sheds light on the development of antifungal drugs in the future.

Tritium labeling of antisense oligonucleotides by exchange with tritiated water.

PubMed Central

Graham, M J; Freier, S M; Crooke, R M; Ecker, D J; Maslova, R N; Lesnik, E A

1993-01-01

We describe a simple, efficient, procedure for labeling oligonucleotides to high specific activity (< 1 x 10(8) cpm/mumol) by hydrogen exchange with tritiated water at the C8 positions of purines in the presence of beta-mercaptoethanol, an effective radical scavenger. Approximately 90% of the starting material is recovered as intact, labeled oligonucleotide. The radiolabeled compounds are stable in biological systems; greater than 90% of the specific activity is retained after 72 hr incubation at 37 degrees C in serum-containing media. Data obtained from in vitro cellular uptake experiments using oligonucleotides labeled by this method are similar to those obtained using 35S or 14C-labeled compounds. Because this protocol is solely dependent upon the existence of purine residues, it should be useful for radiolabeling modified as well as unmodified phosphodiester oligonucleotides. Images PMID:8367289

Pressure-Mediated Oligonucleotide Transfection of Rat and Human Cardiovascular Tissues

NASA Astrophysics Data System (ADS)

Mann, Michael J.; Gibbons, Gary H.; Hutchinson, Howard; Poston, Robert S.; Hoyt, E. Grant; Robbins, Robert C.; Dzau, Victor J.

1999-05-01

The application of gene therapy to human disease is currently restricted by the relatively low efficiency and potential hazards of methods of oligonucleotide or gene delivery. Antisense or transcription factor decoy oligonucleotides have been shown to be effective at altering gene expression in cell culture expreriments, but their in vivo application is limited by the efficiency of cellular delivery, the intracellular stability of the compounds, and their duration of activity. We report herein the development of a highly efficient method for naked oligodeoxynucleotide (ODN) transfection into cardiovascular tissues by using controlled, nondistending pressure without the use of viral vectors, lipid formulations, or exposure to other adjunctive, potentially hazardous substances. In this study, we have documented the ability of ex vivo, pressure-mediated transfection to achieve nuclear localization of fluorescent (FITC)-labeled ODN in approximately 90% and 50% of cells in intact human saphenous vein and rat myocardium, respectively. We have further documented that pressure-mediated delivery of antisense ODN can functionally inhibited target gene expression in both of these tissues in a sequence-specific manner at the mRNA and protein levels. This oligonucleotide transfection system may represent a safe means of achieving the intraoperative genetic engineering of failure-resistant human bypass grafts and may provide an avenue for the genetic manipulation of cardiac allograft rejection, allograft vasculopathy, or other transplant diseases.

Identification and Characterization of a Cis Antisense RNA of the rpoH Gene of Salmonella enterica Serovar Typhi.

PubMed

Xiong, Changyan; Li, Xuejiao; Liu, Juanli; Zhao, Xin; Xu, Shungao; Huang, Xinxiang

2018-01-01

Antisense RNAs from complementary strands of protein coding genes regulate the expression of genes involved in many cellular processes. Using deep sequencing analysis of the Salmonella enterica serovar Typhi ( S. Typhi) transcriptome, a novel antisense RNA encoded on the strand complementary to the rpoH gene was revealed. In this study, the molecular features of this antisense RNA were assessed using northern blotting and rapid amplification of cDNA ends. The 3,508 nt sequence of RNA was identified as the antisense RNA of the rpoH gene and was named ArpH. ArpH was found to attenuate the invasion of HeLa cells by S. Typhi by regulating the expression of SPI-1 genes. In an rpoH mutant strain, the invasive capacity of S. Typhi was increased, whereas overexpression of ArpH positively regulates rpoH mRNA levels. Results of this study suggest that the cis -encoded antisense RNA ArpH is likely to affect the invasive capacity of S. Typhi by regulating the expression of rpoH .

Synthesis, Improved Antisense Activity and Structural Rationale for the Divergent RNA Affinities of 3;#8242;-Fluoro Hexitol Nucleic Acid (FHNA and Ara-FHNA) Modified Oligonucleotides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Egli, Martin; Pallan, Pradeep S.; Allerson, Charles R.

The synthesis, biophysical, structural, and biological properties of both isomers of 3'-fluoro hexitol nucleic acid (FHNA and Ara-FHNA) modified oligonucleotides are reported. Synthesis of the FHNA and Ara-FHNA thymine phosphoramidites was efficiently accomplished starting from known sugar precursors. Optimal RNA affinities were observed with a 3'-fluorine atom and nucleobase in a trans-diaxial orientation. The Ara-FHNA analog with an equatorial fluorine was found to be destabilizing. However, the magnitude of destabilization was sequence-dependent. Thus, the loss of stability is sharply reduced when Ara-FHNA residues were inserted at pyrimidine-purine (Py-Pu) steps compared to placement within a stretch of pyrimidines (Py-Py). Crystal structuresmore » of A-type DNA duplexes modified with either monomer provide a rationalization for the opposing stability effects and point to a steric origin of the destabilization caused by the Ara-FHNA analog. The sequence dependent effect can be explained by the formation of an internucleotide C-F {hor_ellipsis} H-C pseudo hydrogen bond between F3' of Ara-FHNA and C8-H of the nucleobase from the 3'-adjacent adenosine that is absent at Py-Py steps. In animal experiments, FHNA-modified antisense oligonucleotides formulated in saline showed a potent downregulation of gene expression in liver tissue without producing hepatotoxicity. Our data establish FHNA as a useful modification for antisense therapeutics and also confirm the stabilizing influence of F(Py) {hor_ellipsis} H-C(Pu) pseudo hydrogen bonds in nucleic acid structures.« less

[Anti-sense miRNA-21 oligonucleotide inhibits Tb 3.1 human tongue squamous cell carcinoma growth in vitro].

PubMed

Tao, Ying-jie; Ren, Yu; Dong, Jia-bin; Zhang, Lun; Cheng, Jun-ping; Zhou, Xuan

2011-02-01

To investigate the effect of micro RNA-21 (miRNA-21) knocking on the Tb3.1 human tongue squamous cell carcinoma growth. Anti-sense miRNA-21 oligonucleotide was delivered with oligofectamine to suppress Tb 3.1 tongue cancer cell growth in vitro. Real-time polymerase chain reaction (PCR) was conducted to detect the miRNA-21 expression after transfection. Methyl thiazolyl tetrazolium (MTT) assay was used to determine Tb 3.1 cell survival rate. Apoptosis were examined by flow-cytometry. Matrigel matrix and transwell assay were used to determine Tb 3.1 cell colony formation and migration ability. Antigen KI-67 (Ki67), B cell lymphoma (Bcl-2), phosphatase and tensin homolog (PTEN), matrirx metalloproteinase 2 (MMP-2, MMP-9) and tissue inhibitor of metalloproteinase 1 (TIMP-1) protein expression in Tb 3.1 cell were measured by Western blotting. miRNA-21 expression was decreased in miRNA-21 antisense oligonucleotide (ASODN) group. The survival rate of Tb 3.1 cells with AS-miRNA-21 transfection was significantly suppressed (F = 27.02, P = 0.00) and early phase apoptosis (F = 26.641, P = 0.001) induced in Tb 3.1 cell. Ki67, Bcl-2, MMP-2 and MMP-9 protein were down regulated while PTEN and TIMP-1 protein expression was increased. Blocking miRNA-21 expression in Tb3.1 cell could suppress cancer cell growth in vitro and miRNA-21 can serve as a novel target candidate for human tongue cancer gene therapy.

Comparison of Zebrafish tmem88a mutant and morpholino knockdown phenotypes

PubMed Central

Place, Elsie S.; Smith, James C.

2017-01-01

Tmem88a is a transmembrane protein that is thought to be a negative regulator of the Wnt signalling pathway. Several groups have used antisense morpholino oligonucleotides in an effort to characterise the role of tmem88a in zebrafish cardiovascular development, but they have not obtained consistent results. Here, we generate an 8 bp deletion in the coding region of the tmem88a locus using TALENs, and we have gone on to establish a viable homozygous tmem88aΔ8 mutant line. Although tmem88aΔ8 mutants have reduced expression of some key haematopoietic genes, differentiation of erythrocytes and neutrophils is unaffected, contradicting our previous study using antisense morpholino oligonucleotides. We find that expression of the tmem88a paralogue tmem88b is not significantly changed in tmem88aΔ8 mutants and injection of the tmem88a splice-blocking morpholino oligonucleotide into tmem88aΔ8 mutants recapitulates the reduction of erythrocytes observed in morphants using o-Dianisidine. This suggests that there is a partial, but inessential, requirement for tmem88a during haematopoiesis and that morpholino injection exacerbates this phenotype in tmem88a morpholino knockdown embryos. PMID:28192479

How the discovery of ISS-N1 led to the first medical therapy for spinal muscular atrophy

PubMed Central

Singh, Natalia N.; Howell, Matthew D.; Androphy, Elliot J.; Singh, Ravindra N.

2017-01-01

Spinal muscular atrophy (SMA), a prominent genetic disease of infant mortality, is caused by low levels of survival motor neuron (SMN) protein owing to deletions or mutations of the SMN1 gene. SMN2, a nearly identical copy of SMN1 present in humans, cannot compensate for the loss of SMN1 due to predominant skipping of exon 7 during pre-mRNA splicing. With the recent FDA approval of nusinersen (Spinraza™), the potential for correction of SMN2 exon 7 splicing as a SMA therapy has been affirmed. Nusinersen is an antisense oligonucleotide that targets intronic splicing silencer N1 (ISS-N1) discovered in 2004 at the University of Massachusetts Medical School. ISS-N1 has emerged as the model target for testing the therapeutic efficacy of antisense oligonucleotides using different chemistries as well as different mouse models of SMA. Here we provide a historical account of events that led to the discovery of ISS-N1 and describe the impact of independent validations that raised the profile of ISS-N1 as one of the most potent antisense targets for the treatment of a genetic disease. Recent approval of nusinersen provides a much-needed boost for antisense technology that is just beginning to realize its potential. Beyond treating SMA, the ISS-N1 target offers myriad potentials for perfecting various aspects of the nucleic-acid-based technology for the amelioration of the countless number of pathological conditions. PMID:28485722

How the discovery of ISS-N1 led to the first medical therapy for spinal muscular atrophy.

PubMed

Singh, N N; Howell, M D; Androphy, E J; Singh, R N

2017-09-01

Spinal muscular atrophy (SMA), a prominent genetic disease of infant mortality, is caused by low levels of survival motor neuron (SMN) protein owing to deletions or mutations of the SMN1 gene. SMN2, a nearly identical copy of SMN1 present in humans, cannot compensate for the loss of SMN1 because of predominant skipping of exon 7 during pre-mRNA splicing. With the recent US Food and Drug Administration approval of nusinersen (Spinraza), the potential for correction of SMN2 exon 7 splicing as an SMA therapy has been affirmed. Nusinersen is an antisense oligonucleotide that targets intronic splicing silencer N1 (ISS-N1) discovered in 2004 at the University of Massachusetts Medical School. ISS-N1 has emerged as the model target for testing the therapeutic efficacy of antisense oligonucleotides using different chemistries as well as different mouse models of SMA. Here, we provide a historical account of events that led to the discovery of ISS-N1 and describe the impact of independent validations that raised the profile of ISS-N1 as one of the most potent antisense targets for the treatment of a genetic disease. Recent approval of nusinersen provides a much-needed boost for antisense technology that is just beginning to realize its potential. Beyond treating SMA, the ISS-N1 target offers myriad potentials for perfecting various aspects of the nucleic-acid-based technology for the amelioration of the countless number of pathological conditions.

Targeted nanoparticle delivery overcomes off-target immunostimulatory effects of oligonucleotides and improves therapeutic efficacy in chronic lymphocytic leukemia

PubMed Central

Yu, Bo; Mao, Yicheng; Bai, Li-Yuan; Herman, Sarah E. M.; Wang, Xinmei; Ramanunni, Asha; Jin, Yan; Mo, Xiaokui; Cheney, Carolyn; Chan, Kenneth K.; Jarjoura, David; Marcucci, Guido; Lee, Robert J.; Byrd, John C.

2013-01-01

Several RNA-targeted therapeutics, including antisense oligonucleotides (ONs), small interfering RNAs, and miRNAs, constitute immunostimulatory CpG motifs as an integral part of their design. The limited success with free antisense ONs in hematologic malignancies in recent clinical trials has been attributed to the CpG motif–mediated, TLR-induced prosurvival effects and inefficient target modulation in desired cells. In an attempt to diminish their off-target prosurvival and proinflammatory effects and specific delivery, as a proof of principle, in the present study, we developed an Ab-targeted liposomal delivery strategy using a clinically relevant CD20 Ab (rituximab)–conjugated lipopolyplex nanoparticle (RIT-INP)– and Bcl-2–targeted antisense G3139 as archetypical antisense therapeutics. The adverse immunostimulatory responses were abrogated by selective B cell–targeted delivery and early endosomal compartmentalization of G3139-encapsulated RIT-INPs, resulting in reduced NF-κB activation, robust Bcl-2 down-regulation, and enhanced sensitivity to fludarabine-induced cytotoxicity. Furthermore, significant in vivo therapeutic efficacy was noted after RIT-INP–G3139 administration in a disseminated xenograft leukemia model. The results of the present study demonstrate that CD20-targeted delivery overcomes the immunostimulatory properties of CpG-containing ON therapeutics and improves efficient gene silencing and in vivo therapeutic efficacy for B-cell malignancies. The broader implications of similar approaches in overcoming immunostimulatory properties of RNA-directed therapeutics in hematologic malignancies are also discussed. PMID:23165478

Cholesterol-lowering Action of BNA-based Antisense Oligonucleotides Targeting PCSK9 in Atherogenic Diet-induced Hypercholesterolemic Mice.

PubMed

Yamamoto, Tsuyoshi; Harada-Shiba, Mariko; Nakatani, Moeka; Wada, Shunsuke; Yasuhara, Hidenori; Narukawa, Keisuke; Sasaki, Kiyomi; Shibata, Masa-Aki; Torigoe, Hidetaka; Yamaoka, Tetsuji; Imanishi, Takeshi; Obika, Satoshi

2012-05-15

Recent findings in molecular biology implicate the involvement of proprotein convertase subtilisin/kexin type 9 (PCSK9) in low-density lipoprotein receptor (LDLR) protein regulation. The cholesterol-lowering potential of anti-PCSK9 antisense oligonucleotides (AONs) modified with bridged nucleic acids (BNA-AONs) including 2',4'-BNA (also called as locked nucleic acid (LNA)) and 2',4'-BNA(NC) chemistries were demonstrated both in vitro and in vivo. An in vitro transfection study revealed that all of the BNA-AONs induce dose-dependent reductions in PCSK9 messenger RNA (mRNA) levels concomitantly with increases in LDLR protein levels. BNA-AONs were administered to atherogenic diet-fed C57BL/6J mice twice weekly for 6 weeks; 2',4'-BNA-AON that targeted murine PCSK9 induced a dose-dependent reduction in hepatic PCSK9 mRNA and LDL cholesterol (LDL-C); the 43% reduction of serum LDL-C was achieved at a dose of 20 mg/kg/injection with only moderate increases in toxicological indicators. In addition, the serum high-density lipoprotein cholesterol (HDL-C) levels increased. These results support antisense inhibition of PCSK9 as a potential therapeutic approach. When compared with 2',4'-BNA-AON, 2',4'-BNA(NC)-AON showed an earlier LDL-C-lowering effect and was more tolerable in mice. Our results validate the optimization of 2',4'-BNA(NC)-based anti-PCSK9 antisense molecules to produce a promising therapeutic agent for the treatment of hypercholesterolemia.

In Silico Screening Based on Predictive Algorithms as a Design Tool for Exon Skipping Oligonucleotides in Duchenne Muscular Dystrophy

PubMed Central

Echigoya, Yusuke; Mouly, Vincent; Garcia, Luis; Yokota, Toshifumi; Duddy, William

2015-01-01

The use of antisense ‘splice-switching’ oligonucleotides to induce exon skipping represents a potential therapeutic approach to various human genetic diseases. It has achieved greatest maturity in exon skipping of the dystrophin transcript in Duchenne muscular dystrophy (DMD), for which several clinical trials are completed or ongoing, and a large body of data exists describing tested oligonucleotides and their efficacy. The rational design of an exon skipping oligonucleotide involves the choice of an antisense sequence, usually between 15 and 32 nucleotides, targeting the exon that is to be skipped. Although parameters describing the target site can be computationally estimated and several have been identified to correlate with efficacy, methods to predict efficacy are limited. Here, an in silico pre-screening approach is proposed, based on predictive statistical modelling. Previous DMD data were compiled together and, for each oligonucleotide, some 60 descriptors were considered. Statistical modelling approaches were applied to derive algorithms that predict exon skipping for a given target site. We confirmed (1) the binding energetics of the oligonucleotide to the RNA, and (2) the distance in bases of the target site from the splice acceptor site, as the two most predictive parameters, and we included these and several other parameters (while discounting many) into an in silico screening process, based on their capacity to predict high or low efficacy in either phosphorodiamidate morpholino oligomers (89% correctly predicted) and/or 2’O Methyl RNA oligonucleotides (76% correctly predicted). Predictions correlated strongly with in vitro testing for sixteen de novo PMO sequences targeting various positions on DMD exons 44 (R2 0.89) and 53 (R2 0.89), one of which represents a potential novel candidate for clinical trials. We provide these algorithms together with a computational tool that facilitates screening to predict exon skipping efficacy at each position of a target exon. PMID:25816009

PLGA-PEG-PLGA microspheres as a delivery vehicle for antisense oligonucleotides to CTGF: Implications on post-surgical peritoneal adhesion prevention

NASA Astrophysics Data System (ADS)

Azeke, John Imuetinyan-Jesu, Jr.

Abdominal adhesions are the aberrant result of peritoneal wound healing commonly associated with surgery and inflammation. A subject of a large number of studies since the first half of the last century, peritoneal adhesion prevention has, for the most part, evaded the scientific community and continues to cost Americans an estimated $2-4 billion annually. It is known that transforming growth factor-beta (TGF-beta) plays a key role in the wound healing cascade; however, suppression of this multifunctional growth factor's activity may have more harmful consequences than can be tolerated. As a result, much attention has fallen on connective tissue growth factor (CTGF), a downstream mediator of TGF-beta's fibrotic action. It has been demonstrated in several in vitro models, that the suppression of CTGF hinders fibroblast proliferation, a necessary condition for fibrosis. Furthermore, antisense oligonucleotides (antisense oligos, AO) to CTGF have been shown to knock down CTGF mRNA levels by specifically hindering the translation of CTGF protein. Antisense technologies have met with a great deal of excitement as a viable means of preventing diseases such as adhesions by hindering protein translation at the mRNA level. However, the great challenge associated with the use of these drugs lies in the short circulation time when administered "naked". Viral delivery systems, although excellent platforms in metabolic studies, are not ideal for diagnostic use because of the inherent danger associated with viral vectors. Microparticles made of biodegradable polymers have therefore presented themselves as a viable means of delivering these drugs to target cells over extended periods. Herein, we present two in vivo studies confirming the up-regulation of TGF-beta protein and CTGF mRNA following injury to the uterine tissues of female rats. We were able to selectively knockdown post-operative CTGF protein levels following surgery, however, our observations led us to conclude that, while both cytokines are over-expressed within the first day following injury, CTGF protein levels could not be correlated with observed adhesion development. In addition, we synthesized linear triblock copolymers of polyethylene glycol (PEG) and poly(D,L-lactide-co-glycolide) (PLGA), two of the most widely studied biodegradable polymers in use today. Bulk gels and microparticles of the copolymers were then evaluated for gelling behavior, temperature stability, and drug loading and release kinetics in order assess their suitability as potential carriers of antisense therapeutics. A novel approach to affecting the antisense oligonucleotide release kinetics by varying the relative concentrations of co-encapsulated cationic lipid transfection agents was also presented.

A facile one-step fluorescence method for the quantitation of low-content single base deamination impurity in synthetic oligonucleotides.

PubMed

Su, Xiaoye; Liang, Ruiting; Stolee, Jessica A

2018-06-05

Oligonucleotides are being researched and developed as potential drug candidates for the treatment of a broad spectrum of diseases. The characterization of antisense oligonucleotide (ASO) impurities caused by base mutations (e.g. deamination) which are closely related to the target ASO is a significant analytical challenge. Herein, we describe a novel one-step method, utilizing a strategy that combines fluorescence-ON detection with competitive hybridization, to achieve single base mutation quantitation in extensively modified synthetic ASOs. Given that this method is highly specific and sensitive (LoQ = 4 nM), we envision that it will find utility for screening other impurities as well as sequencing modified oligonucleotides. Copyright © 2018 Elsevier B.V. All rights reserved.

Antisense reduction of tau in adult mice protects against seizures.

PubMed

DeVos, Sarah L; Goncharoff, Dustin K; Chen, Guo; Kebodeaux, Carey S; Yamada, Kaoru; Stewart, Floy R; Schuler, Dorothy R; Maloney, Susan E; Wozniak, David F; Rigo, Frank; Bennett, C Frank; Cirrito, John R; Holtzman, David M; Miller, Timothy M

2013-07-31

Tau, a microtubule-associated protein, is implicated in the pathogenesis of Alzheimer's Disease (AD) in regard to both neurofibrillary tangle formation and neuronal network hyperexcitability. The genetic ablation of tau substantially reduces hyperexcitability in AD mouse lines, induced seizure models, and genetic in vivo models of epilepsy. These data demonstrate that tau is an important regulator of network excitability. However, developmental compensation in the genetic tau knock-out line may account for the protective effect against seizures. To test the efficacy of a tau reducing therapy for disorders with a detrimental hyperexcitability profile in adult animals, we identified antisense oligonucleotides that selectively decrease endogenous tau expression throughout the entire mouse CNS--brain and spinal cord tissue, interstitial fluid, and CSF--while having no effect on baseline motor or cognitive behavior. In two chemically induced seizure models, mice with reduced tau protein had less severe seizures than control mice. Total tau protein levels and seizure severity were highly correlated, such that those mice with the most severe seizures also had the highest levels of tau. Our results demonstrate that endogenous tau is integral for regulating neuronal hyperexcitability in adult animals and suggest that an antisense oligonucleotide reduction of tau could benefit those with epilepsy and perhaps other disorders associated with tau-mediated neuronal hyperexcitability.

Temporal and Spatial Post-Transcriptional Regulation of Zebrafish Tie1 mRNA by Long Noncoding RNA During Brain Vascular Assembly.

PubMed

Chowdhury, Tamjid A; Koceja, Chris; Eisa-Beygi, Shahram; Kleinstiver, Benjamin P; Kumar, Suresh N; Lin, Chien-Wei; Li, Keguo; Prabhudesai, Shubhangi; Joung, J Keith; Ramchandran, Ramani

2018-05-03

Tie1 (tyrosine kinase containing immunoglobulin and epidermal growth factor homology 1), an endothelial and hematopoietic cell-specific receptor tyrosine kinase, is an important regulator of angiogenesis and critical for maintaining vascular integrity. The post-transcriptional regulation of tie1 mRNA expression is not understood, but it might partly explain Tie1's differential expression pattern in endothelium. Following up on our previous work that identified natural antisense transcripts from the tie1 locus- tie1 antisense ( tie1AS ), which regulates tie1 mRNA levels in zebrafish-we attempted to identify the mechanism of this regulation. Through in vitro and in vivo ribonucleoprotein binding studies, we demonstrated that tie1AS long noncoding RNA interacts with an RNA binding protein-embryonic lethal and abnormal vision Drosophila-like 1 (Elavl1)-that regulates tie1 mRNA levels. When we disrupted the interaction between tie1AS and Elavl1 by using constitutively active antisense morpholino oligonucleotides or photoactivatable morpholino oligonucleotides, tie1 mRNA levels increased between 26 and 31 hours post-fertilization, particularly in the head. This increase correlated with dilation of primordial midbrain channels, smaller eyes, and reduced ventricular space. We also observed these phenotypes when we used CRISPR (clustered regularly interspaced short palindromic repeats)-mediated CRISPRi (CRISPR-mediated interference) to knock down tie1AS . Treatment of the morpholino oligonucleotide-injected embryos with a small molecule that decreased tie1 mRNA levels rescued all 3 abnormal phenotypes. We identified a novel mode of temporal and spatial post-transcriptional regulation of tie1 mRNA. It involves long noncoding RNA, tie1AS, and Elavl1 (an interactor of tie1AS ). © 2018 American Heart Association, Inc.

Therapeutic Oligonucleotides Targeting Liver Disease: TTR Amyloidosis.

PubMed

Niemietz, Christoph; Chandhok, Gursimran; Schmidt, Hartmut

2015-09-30

The liver has become an increasingly interesting target for oligonucleotide therapy. Mutations of the gene encoding transthyretin (TTR), expressed in vast amounts by the liver, result in a complex degenerative disease, termed familial amyloid polyneuropathy (FAP). Misfolded variants of TTR are linked to the establishment of extracellular protein deposition in various tissues, including the heart and the peripheral nervous system. Recent progress in the chemistry and formulation of antisense (ASO) and small interfering RNA (siRNA) designed for a knockdown of TTR mRNA in the liver has allowed to address the issue of gene-specific molecular therapy in a clinical setting of FAP. The two therapeutic oligonucleotides bind to RNA in a sequence specific manner but exploit different mechanisms. Here we describe major developments that have led to the advent of therapeutic oligonucleotides for treatment of TTR-related disease.

Current progress on aptamer-targeted oligonucleotide therapeutics

PubMed Central

Dassie, Justin P; Giangrande, Paloma H

2014-01-01

Exploiting the power of the RNAi pathway through the use of therapeutic siRNA drugs has remarkable potential for treating a vast array of human disease conditions. However, difficulties in delivery of these and similar nucleic acid-based pharmacological agents to appropriate organs or tissues, remains a major impediment to their broad clinical application. Synthetic nucleic acid ligands (aptamers) have emerged as effective delivery vehicles for therapeutic oligonucleotides, including siRNAs. In this review, we summarize recent attractive developments in creatively employing cell-internalizing aptamers to deliver therapeutic oligonucleotides (e.g., siRNAs, miRNAs, anti-miRs and antisense oligos) to target cells. We also discuss advancements in aptamer-siRNA chimera technology, as well as, aptamer-functionalized nanoparticles for siRNA delivery. In addition, the challenges and future prospects of aptamer-targeted oligonucleotide drugs for clinical translation are further highlighted. PMID:24304250

The illusion of specific capture: surface and solution studies of suboptimal oligonucleotide hybridization

PubMed Central

2013-01-01

Background Hybridization based assays and capture systems depend on the specificity of hybridization between a probe and its intended target. A common guideline in the construction of DNA microarrays, for instance, is that avoiding complementary stretches of more than 15 nucleic acids in a 50 or 60-mer probe will eliminate sequence specific cross-hybridization reactions. Here we present a study of the behavior of partially matched oligonucleotide pairs with complementary stretches starting well below this threshold complementarity length – in silico, in solution, and at the microarray surface. The modeled behavior of pairs of oligonucleotide probes and their targets suggests that even a complementary stretch of sequence 12 nt in length would give rise to specific cross-hybridization. We designed a set of binding partners to a 50-mer oligonucleotide containing complementary stretches from 6 nt to 21 nt in length. Results Solution melting experiments demonstrate that stable partial duplexes can form when only 12 bp of complementary sequence are present; surface hybridization experiments confirm that a signal close in magnitude to full-strength signal can be obtained from hybridization of a 12 bp duplex within a 50mer oligonucleotide. Conclusions Microarray and other molecular capture strategies that rely on a 15 nt lower complementarity bound for eliminating specific cross-hybridization may not be sufficiently conservative. PMID:23445545

Anti-Urokinase Receptor Antisense Oligonucleotide (uPAR-aODN) to Prevent and Cure Long-Term Space Exploration-Related Retinal Pathological Angiogenesis

NASA Astrophysics Data System (ADS)

Lazzarano, Stefano; Lulli, Matteo; Fibbi, Gabriella; Margheri, Francesca; Papucci, Laura; Serrati, Simona; Witort, Ewa; Chilla, Anastasia; Lapucci, Andrea; Donnini, Martino; Quaglierini, Paolo; Romiti, Alice; Specogna, Rebecca; Del Rosso, Mario; Capaccioli, Sergio

2008-06-01

Angiogenesis underlies a variety of physiological processes and its possible deregulation during long term space exploration needs to be investigated. Angiogenesis is a multistep process of new blood capillary formation, where degradation of the extracellular matrix (ECM) by proteolytic enzymes, including uPA (urokinase plasminogen activator) and opening the way to migration of endothelial cells (EC), is critical. Plasminogen activation system regulates angiogenesis by both uPA-driven ECM degradation and uPA receptor (uPAR). Microgravity and low dose irradiations promote tissue neoangiogeenesis and neovascularization is often common occurence in ophthalmologic pathologies. We have designed and patented the uPAR antisense oligonucleotide (aODN) and evaluated its antiangiogenetic activity by EC cellular migration and capillary morphogenesis assays. The uPAR aODN treatment caused a 75% inhibition of human microvascular EC migration and a complete inhibition of capillary morphogenesis, suggesting its therapeutic application to prevent neoangiogenesis-related ophthalmologic pathologies during space exploration.

Augmenter of liver regeneration: An important intracellular survival factor for hepatocytes☆

PubMed Central

Thirunavukkarasu, Chinnasamy; Wang, Lian Fu; Harvey, Stephen A.K.; Watkins, Simon C.; Chaillet, J. Richard; Prelich, John; Starzl, Thomas E.; Gandhi, Chandrashekhar R.

2010-01-01

Background/Aims Augmenter of liver regeneration (ALR), a protein synthesized and stored in hepatocytes, is associated with mitochondria, and possesses sulfhydryl oxidase and cytochrome c reductase activities. We sought to determine the effects of ALR depletion in hepatocytes by antisense oligonucleotide transfection. Methods Rat hepatocytes in primary culture were transfected with antisense oligonucleotide for ALR mRNA (ALR-AS) or scrambled oligonucleotide. Various analyses were performed at times up to 24 h after transfection. Results Treatment with ALR-AS caused a decrease in ALR mRNA, cellular depletion of ALR protein primarily from mitochondria, and decreased viability. Flow cytometric analysis of ALR-AS-transfected hepatocytes stained with annexin-Vcy3 and 7-aminoactinomycin D revealed apoptosis as the predominant cause of death up to 6 h; incubation beyond this time resulted in necrosis in addition to apoptosis. ALR-AS-transfection caused release of mitochondrial cytochrome c, activation of caspase-3, profound reduction in the ATP content, and cellular release of LDH. Inhibition of caspase-3 inhibited the early phase of ALR-AS-induced death but not the late phase that included ALR and LDH release. Conclusions These results suggest that ALR is critically important for the survival of hepatocytes by its association with mitochondria and regulation of ATP synthesis. PMID:18272248

Small-scale high-throughput sequencing-based identification of new therapeutic tools in cystic fibrosis.

PubMed

Bonini, Jennifer; Varilh, Jessica; Raynal, Caroline; Thèze, Corinne; Beyne, Emmanuelle; Audrezet, Marie-Pierre; Ferec, Claude; Bienvenu, Thierry; Girodon, Emmanuelle; Tuffery-Giraud, Sylvie; Des Georges, Marie; Claustres, Mireille; Taulan-Cadars, Magali

2015-10-01

Although 97-99% of CFTR mutations have been identified, great efforts must be made to detect yet-unidentified mutations. We developed a small-scale next-generation sequencing approach for reliably and quickly scanning the entire gene, including noncoding regions, to identify new mutations. We applied this approach to 18 samples from patients suffering from cystic fibrosis (CF) in whom only one mutation had hitherto been identified. Using an in-house bioinformatics pipeline, we could rapidly identify a second disease-causing CFTR mutation for 16 of 18 samples. Of them, c.1680-883A>G was found in three unrelated CF patients. Analysis of minigenes and patients' transcripts showed that this mutation results in aberrantly spliced transcripts because of the inclusion of a pseudoexon. It is located only three base pairs from the c.1680-886A>G mutation (1811+1.6kbA>G), the fourth most frequent mutation in southwestern Europe. We next tested the effect of antisense oligonucleotides targeting splice sites on these two mutations on pseudoexon skipping. Oligonucleotide transfection resulted in the restoration of the full-length, in-frame CFTR transcript, demonstrating the effect of antisense oligonucleotide-induced pseudoexon skipping in CF. Our data confirm the importance of analyzing noncoding regions to find unidentified mutations, which is essential to designing targeted therapeutic approaches.

The Size of the Internal Loop in DNA Hairpins Influences Their Targeting with Partially Complementary Strands

PubMed Central

2015-01-01

Targeting of noncanonical DNA structures, such as hairpin loops, may have significant diagnostic and therapeutic potential. Oligonucleotides can be used for binding to mRNA, forming a DNA/RNA hybrid duplex that inhibits translation. This kind of modulation of gene expression is called the antisense approach. In order to determine the best strategy to target a common structural motif in mRNA, we have designed a set of stem-loop DNA molecules with sequence: d(GCGCTnGTAAT5GTTACTnGCGC), where n = 1, 3, or 5, “T5” is an end loop of five thymines. We used a combination of calorimetric and spectroscopy techniques to determine the thermodynamics for the reaction of a set of hairpins containing internal loops with their respective partially complementary strands. Our aim was to determine if internal- and end-loops are promising regions for targeting with their corresponding complementary strands. Indeed, all targeting reactions were accompanied by negative changes in free energy, indicating that reactions proceed spontaneously. Further investigation showed that these negative free energy terms result from a net balance of unfavorable entropy and favorable enthalpy contributions. In particular, unfolding of hairpins and duplexes is accompanied by positive changes in heat capacity, which may be a result of exposure of hydrophobic groups to the solvent. This study provides a new method for the targeting of mRNA in order to control gene expression. PMID:25486129

Stimulated-single fiber electromyography monitoring of anti-sense induced changes in experimental autoimmune myasthenia gravis.

PubMed

Boneva, Neli; Hamra-Amitay, Yasmine; Wirguin, Itzhak; Brenner, Talma

2006-05-01

The neuromuscular weakness associated with myasthenia gravis (MG) can be transiently relieved by pharmacological inhibitors of acetylcholinesterase (AChE). Here, we expand the anticholinesterase repertoire to include 2'-O-methyl-protected antisense oligonucleotides targeted to AChE mRNA (EN101). Using stimulated-single fiber electromyography, we show that EN101 treatment of rats with experimental autoimmune myasthenia gravis (EAMG), improved the mean consecutive difference (MCD) and blocking for 24h. This treatment was more efficient than pyridostigmine and was accompanied by marked improvement in stamina and clinical profile.

Assessing Specific Oligonucleotides and Small Molecule Antibiotics for the Ability to Inhibit the CRD-BP-CD44 RNA Interaction

PubMed Central

Thomsen, Dana; Lee, Chow H.

2014-01-01

Studies on Coding Region Determinant-Binding Protein (CRD-BP) and its orthologs have confirmed their functional role in mRNA stability and localization. CRD-BP is present in extremely low levels in normal adult tissues, but it is over-expressed in many types of aggressive human cancers and in neonatal tissues. Although the exact role of CRD-BP in tumour progression is unclear, cumulative evidence suggests that its ability to physically associate with target mRNAs is an important criterion for its oncogenic role. CRD-BP has high affinity for the 3′UTR of the oncogenic CD44 mRNA and depletion of CRD-BP in cells led to destabilization of CD44 mRNA, decreased CD44 expression, reduced adhesion and disruption of invadopodia formation. Here, we further characterize the CRD-BP-CD44 RNA interaction and assess specific antisense oligonucleotides and small molecule antibiotics for their ability to inhibit the CRD-BP-CD44 RNA interaction. CRD-BP has a high affinity for binding to CD44 RNA nts 2862–3055 with a Kd of 645 nM. Out of ten antisense oligonucleotides spanning nts 2862–3055, only three antisense oligonucleotides (DD4, DD7 and DD10) were effective in competing with CRD-BP for binding to 32P-labeled CD44 RNA. The potency of DD4, DD7 and DD10 in inhibiting the CRD-BP-CD44 RNA interaction in vitro correlated with their ability to specifically reduce the steady-state level of CD44 mRNA in cells. The aminoglycoside antibiotics neomycin, paramomycin, kanamycin and streptomycin effectively inhibited the CRD-BP-CD44 RNA interaction in vitro. Assessing the potential inhibitory effect of aminoglycoside antibiotics including neomycin on the CRD-BP-CD44 mRNA interaction in cells proved difficult, likely due to their propensity to non-specifically bind nucleic acids. Our results have important implications for future studies in finding small molecules and nucleic acid-based inhibitors that interfere with protein-RNA interactions. PMID:24622399

Assessing specific oligonucleotides and small molecule antibiotics for the ability to inhibit the CRD-BP-CD44 RNA interaction.

PubMed

King, Dustin T; Barnes, Mark; Thomsen, Dana; Lee, Chow H

2014-01-01

Studies on Coding Region Determinant-Binding Protein (CRD-BP) and its orthologs have confirmed their functional role in mRNA stability and localization. CRD-BP is present in extremely low levels in normal adult tissues, but it is over-expressed in many types of aggressive human cancers and in neonatal tissues. Although the exact role of CRD-BP in tumour progression is unclear, cumulative evidence suggests that its ability to physically associate with target mRNAs is an important criterion for its oncogenic role. CRD-BP has high affinity for the 3'UTR of the oncogenic CD44 mRNA and depletion of CRD-BP in cells led to destabilization of CD44 mRNA, decreased CD44 expression, reduced adhesion and disruption of invadopodia formation. Here, we further characterize the CRD-BP-CD44 RNA interaction and assess specific antisense oligonucleotides and small molecule antibiotics for their ability to inhibit the CRD-BP-CD44 RNA interaction. CRD-BP has a high affinity for binding to CD44 RNA nts 2862-3055 with a Kd of 645 nM. Out of ten antisense oligonucleotides spanning nts 2862-3055, only three antisense oligonucleotides (DD4, DD7 and DD10) were effective in competing with CRD-BP for binding to 32P-labeled CD44 RNA. The potency of DD4, DD7 and DD10 in inhibiting the CRD-BP-CD44 RNA interaction in vitro correlated with their ability to specifically reduce the steady-state level of CD44 mRNA in cells. The aminoglycoside antibiotics neomycin, paramomycin, kanamycin and streptomycin effectively inhibited the CRD-BP-CD44 RNA interaction in vitro. Assessing the potential inhibitory effect of aminoglycoside antibiotics including neomycin on the CRD-BP-CD44 mRNA interaction in cells proved difficult, likely due to their propensity to non-specifically bind nucleic acids. Our results have important implications for future studies in finding small molecules and nucleic acid-based inhibitors that interfere with protein-RNA interactions.

Mucin-mediated nanocarrier disassembly for triggered uptake of oligonucleotides as a delivery strategy for the potential treatment of mucosal tumours

NASA Astrophysics Data System (ADS)

Martirosyan, A.; Olesen, M. J.; Fenton, R. A.; Kjems, J.; Howard, K. A.

2016-06-01

This work demonstrates gastric mucin-triggered nanocarrier disassembly for release of antisense oligonucleotides and consequent unassisted cellular entry as a novel oral delivery strategy. A fluorescence activation-based reporter system was used to investigate the interaction and mucin-mediated disassembly of chitosan-based nanocarriers containing a 13-mer DNA oligonucleotide with a flanked locked RNA nucleic acid gapmer design. Gastric mucins were shown to trigger gapmer release from nanocarriers that was dependent on the interaction time, mucin concentration and N : P ratio with a maximal release at N : P 10. In contrast to siRNA, naked gapmers exhibited uptake into mucus producing HT-MTX mono-cultures and HT-MTX co-cultured with the carcinoma epithelial cell line Caco-2. Importantly, in vivo gapmer uptake was observed in epithelial tissue 30 min post-injection in murine intestinal loops. The findings present a mucosal design-based system tailored for local delivery of oligonucleotides that may maximize the effectiveness of gene silencing therapeutics within tumours at mucosal sites.This work demonstrates gastric mucin-triggered nanocarrier disassembly for release of antisense oligonucleotides and consequent unassisted cellular entry as a novel oral delivery strategy. A fluorescence activation-based reporter system was used to investigate the interaction and mucin-mediated disassembly of chitosan-based nanocarriers containing a 13-mer DNA oligonucleotide with a flanked locked RNA nucleic acid gapmer design. Gastric mucins were shown to trigger gapmer release from nanocarriers that was dependent on the interaction time, mucin concentration and N : P ratio with a maximal release at N : P 10. In contrast to siRNA, naked gapmers exhibited uptake into mucus producing HT-MTX mono-cultures and HT-MTX co-cultured with the carcinoma epithelial cell line Caco-2. Importantly, in vivo gapmer uptake was observed in epithelial tissue 30 min post-injection in murine intestinal loops. The findings present a mucosal design-based system tailored for local delivery of oligonucleotides that may maximize the effectiveness of gene silencing therapeutics within tumours at mucosal sites. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr07206a

ISIS 301012 gene therapy for hypercholesterolemia: sense, antisense, or nonsense?

PubMed

Ito, Matthew K

2007-10-01

To present an overview of antisense technology and to review and assess available literature on the chemistry, pharmacology, pharmacokinetics, drug interactions, preclinical and clinical studies, dosing, and adverse events of ISIS 301012 in the treatment of hyperlipidemia. PubMed database searches were conducted from 1966 to May 2007 using the search terms ISIS 301012, antisense, oligonucleotide, hypercholesterolemia, hyperlipidemia, and apolipoprotein B. Bibliographies of relevant review articles and information from the manufacturer were reviewed for additional references. Available English-language literature, including abstracts, preclinical, and clinical trials, review articles, and scientific presentations were examined. Apolipoprotein B is an important structural protein on the surface of atherogenic lipoproteins such as remnant very-low-density lipoprotein and low-density lipoprotein and facilitates the clearance of these particles from the circulation by binding to the low-density lipoprotein receptor. Overproduction of apolipoprotein B or reduced receptor-mediated clearance of lipoproteins leads to elevated serum cholesterol levels and premature atherosclerosis. ISIS 301012 is an antisense oligonucleotide that inhibits apolipoprotein B production by binding directly to and reducing the expression of apolipoprotein B messenger RNA. In a clinical trial, ISIS 301012 50-400 mg administered weekly via subcutaneous injection for 4 weeks reduced apolipoprotein B by 14.3-47.4% and low-density lipoprotein cholesterol by 5.9-40% at 55 days. The most frequent adverse event was injection-site erythema that resolved spontaneously. Studies are ongoing to further define the safety, efficacy, and pharmacokinetics of ISIS 301012 as add-on therapy in patients with heterozygous and homozygous familial hypercholesterolemia. No pharmacokinetic interactions have been demonstrated with ezetimibe and simvastatin. ISIS 301012 is the first agent to enter clinical trials utilizing an antisense mechanism for reducing the production of apolipoprotein B. Further studies are needed to verify its safety, efficacy, and position of therapy in the dyslipidemic patient.

Modulation of lipoprotein metabolism by antisense technology: preclinical drug discovery methodology.

PubMed

Crooke, Rosanne M; Graham, Mark J

2013-01-01

Antisense oligonucleotides (ASOs) are a new class of specific therapeutic agents that alter the intermediary metabolism of mRNA, resulting in the suppression of disease-associated gene products. ASOs exert their pharmacological effects after hybridizing, via Watson-Crick base pairing, to a specific target RNA. If appropriately designed, this event results in the recruitment of RNase H, the degradation of targeted mRNA or pre-mRNA, and subsequent inhibition of the synthesis of a specific protein. A key advantage of the technology is the ability to selectively inhibit targets that cannot be modulated by traditional therapeutics such as structural proteins, transcription factors, and, of topical interest, lipoproteins. In this chapter, we will first provide an overview of antisense technology, then more specifically describe the status of lipoprotein-related genes that have been studied using the antisense platform, and finally, outline the general methodology required to design and evaluate the in vitro and in vivo efficacy of those drugs.

Targeting MicroRNAs with Small Molecules a Novel Approach to Treating Breast Cancer

DTIC Science & Technology

2011-10-01

pathogenesis of a disease. To date, the main RNA inhibition agents used in pre- clinical and clinical studies include antisense oligonucleotides, ribozymes ...antagomir Preclinical studies Ribozymes or DNAzymes A ribozyme , or RNA enzyme, is an RNA molecule that can catalyze a chemical reaction. A DNAzyme

Identification of a Peptide for Systemic Brain Delivery of a Morpholino Oligonucleotide in Mouse Models of Spinal Muscular Atrophy

PubMed Central

Shabanpoor, Fazel; Hammond, Suzan M; Abendroth, Frank; Hazell, Gareth; Wood, Matthew J.A.

2017-01-01

Splice-switching antisense oligonucleotides are emerging treatments for neuromuscular diseases, with several splice-switching oligonucleotides (SSOs) currently undergoing clinical trials such as for Duchenne muscular dystrophy (DMD) and spinal muscular atrophy (SMA). However, the development of systemically delivered antisense therapeutics has been hampered by poor tissue penetration and cellular uptake, including crossing of the blood–brain barrier (BBB) to reach targets in the central nervous system (CNS). For SMA application, we have investigated the ability of various BBB-crossing peptides for CNS delivery of a splice-switching phosphorodiamidate morpholino oligonucleotide (PMO) targeting survival motor neuron 2 (SMN2) exon 7 inclusion. We identified a branched derivative of the well-known ApoE (141–150) peptide, which as a PMO conjugate was capable of exon inclusion in the CNS following systemic administration, leading to an increase in the level of full-length SMN2 transcript. Treatment of newborn SMA mice with this peptide-PMO (P-PMO) conjugate resulted in a significant increase in the average lifespan and gains in weight, muscle strength, and righting reflexes. Systemic treatment of adult SMA mice with this newly identified P-PMO also resulted in small but significant increases in the levels of SMN2 pre-messenger RNA (mRNA) exon inclusion in the CNS and peripheral tissues. This work provides proof of principle for the ability to select new peptide paradigms to enhance CNS delivery and activity of a PMO SSO through use of a peptide-based delivery platform for the treatment of SMA potentially extending to other neuromuscular and neurodegenerative diseases. PMID:28118087

The human ubiquitin-conjugating enzyme Cdc34 controls cellular proliferation through regulation of p27{sup Kip1} protein levels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Butz, Nicole; Ruetz, Stephan; Natt, Francois

2005-02-15

Ubiquitin-mediated degradation of the cyclin-dependent kinase inhibitor p27{sup Kip1} was shown to be required for the activation of key cyclin-dependent kinases, thereby triggering the onset of DNA replication and cell cycle progression. Although the SCF{sup Skp2} ubiquitin ligase has been reported to mediate p27{sup Kip1} degradation, the nature of the human ubiquitin-conjugating enzyme involved in this process has not yet been determined at the cellular level. Here, we show that antisense oligonucleotides targeting the human ubiquitin-conjugating enzyme Cdc34 downregulate its expression, inhibit the degradation of p27{sup Kip1}, and prevent cellular proliferation. Elevation of p27{sup Kip1} protein level is found tomore » be the sole requirement for the inhibition of cellular proliferation induced upon downregulation of Cdc34. Indeed, reducing the expression of p27{sup Kip1} with a specific antisense oligonucleotide is sufficient to reverse the anti-proliferative phenotype elicited by the Cdc34 antisense. Furthermore, downregulation of Cdc34 is found to specifically increase the abundance of the SCF{sup Skp2} ubiquitin ligase substrate p27{sup Kip1}, but has no concomitant effect on the level of IkB{alpha} and {beta}-catenin, which are known substrates of a closely related SCF ligase.« less

Size-uniform 200 nm particles: fabrication and application to magnetofection.

PubMed

Mair, Lamar; Ford, Kris; Alam, M d Rowshon; Kole, Ryszard; Fisher, Michael; Superfine, Richard

2009-04-01

We report on the fabrication of arrays of mono- and multimetallic particles via metal evaporation onto lithographically patterned posts, as well as the magnetic force calibration and successful magnetofection of iron particles grown via this method. This work represents the first instance in which metal evaporation onto post structures was used for the formation of released, shape-defined metal particles. Also, our work represents the first use of lithographically defined particles as agents of magnetofection. Using these techniques it is possible to create particles with complex shapes and lateral dimensions as small as 40 nm. Our demonstrated compositionally flexible particles are highly size-uniform due to their photolithographically defined growth substrates, with particle dimensions along two axes fixed at 200 nm; the third axis dimension can be varied from 20 nm to 300 nm during the deposition procedure. Atomic percent of metals incorporated into the particle volume is highly tunable and particles have been synthesized with as many as four different metals. We performed magnetic force calibrations on a single particle size for iron particles using an axially magnetized NeFeB permanent magnet and comparisons are made with commercially available magnetic beads. In order to evalutate their usefulness as magnetofection agents, an antisense oligonucleotide (ODN) designed to correct the aberrant splicing of enhanced green fluorescent protein mRNA, was successfully transfected into a modified HeLa cell line. Magnetically enhanced gene delivery was accomplished in vitro using antisense ODN-laden iron particles followed by application of a field gradient. Magnetically enhanced transfection resulted in a 76% and 139% increase in fluorescence intensity when compared to Lipofectamine and antisense ODN-loaded particles delivered without magnetic treatment, respectively. To our knowledge, these experiments constitute the first use of lithographically defined particles as successful agents for magnetically enhanced transfection of an antisense oligonucleotide.

Cross-species comparison of in vivo PK/PD relationships for second-generation antisense oligonucleotides targeting apolipoprotein B-100.

PubMed

Yu, Rosie Z; Lemonidis, Kristina M; Graham, Mark J; Matson, John E; Crooke, Rosanne M; Tribble, Diane L; Wedel, Mark K; Levin, Arthur A; Geary, Richard S

2009-03-01

The in vivo pharmacokinetics/pharmacodynamics of 2'-O-(2-methoxyethyl) (2'-MOE) modified antisense oligonucleotides (ASOs), targeting apolipoprotein B-100 (apoB-100), were characterized in multiple species. The species-specific apoB antisense inhibitors demonstrated target apoB mRNA reduction in a drug concentration and time-dependent fashion in mice, monkeys, and humans. Consistent with the concentration-dependent decreases in liver apoB mRNA, reductions in serum apoB, and LDL-C, and total cholesterol were concurrently observed in animal models and humans. Additionally, the long duration of effect after cessation of dosing correlated well with the elimination half-life of 2'-MOE modified apoB ASOs studied in mice (t(1/2) congruent with 20 days) and humans (t(1/2) congruent with 30 days) following parental administrations. The plasma concentrations of ISIS 301012, observed in the terminal elimination phase of both mice and monkeys were in equilibrium with liver. The partition ratios between liver and plasma were similar, approximately 6000:1, across species, and thus provide a surrogate for tissue exposure in humans. Using an inhibitory E(max) model, the ASO liver EC(50s) were 101+/-32, 119+/-15, and 300+/-191 microg/g of ASO in high-fat-fed (HF) mice, transgenic mice containing the human apoB transgene, and monkeys, respectively. The estimated liver EC(50) in man, extrapolated from trough plasma exposure, was 81+/-122 microg/g. Therefore, extraordinary consistency of the exposure-response relationship for the apoB antisense inhibitor was observed across species, including human. The cross-species PK/PD relationships provide confidence in the use of pharmacology animal models to predict human dosing for second-generation ASOs targeting the liver.

Current Challenges in Delivery and Cytosolic Translocation of Therapeutic RNAs

PubMed Central

Lucchino, Marco

2018-01-01

RNA interference (RNAi) is a fundamental cellular process for the posttranscriptional regulation of gene expression. RNAi can exogenously be modulated by small RNA oligonucleotides, such as microRNAs (miRNAs) and small interfering RNAs (siRNAs), or by antisense oligonucleotides. These small oligonucleotides provided the scientific community with powerful and versatile tools to turn off the expression of genes of interest, and hold out the promise of new therapeutic solutions against a wide range of gene-associated pathologies. However, unmodified nucleic acids are highly instable in biological systems, and their weak interaction with plasma proteins confers an unfavorable pharmacokinetics. In this review, we first provide an overview of the most efficient chemical strategies that, over the past 30 years, have been used to significantly improve the therapeutic potential of oligonucleotides. Oligonucleotides targeting and delivery technologies are then presented, including covalent conjugates between oligonucleotides and targeting ligand, and noncovalent association with lipid or polymer nanoparticles. Finally, we specifically focus on the endosomal escape step, which represents a major stumbling block for the effective use of oligonucleotides as therapeutic agents. The need for approaches to quantitatively measure endosomal escape and cytosolic arrival of biomolecules is discussed in the context of the development of efficient oligonucleotide targeting and delivery vectors. PMID:29883296

Rapid method to detect duplex formation in sequencing by hybridization methods

DOEpatents

Mirzabekov, A.D.; Timofeev, E.N.; Florentiev, V.L.; Kirillov, E.V.

1999-01-19

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided. A plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex. Each duplex facilitates intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface and exposing the light-sensitive fluid to a light pattern. This causes the fluid exposed to the light to coalesce into discrete units and adhere to the surface. This places each of the units in contact with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units. 13 figs.

Rapid method to detect duplex formation in sequencing by hybridization methods

DOEpatents

Mirzabekov, Andrei Darievich; Timofeev, Edward Nikolaevich; Florentiev, Vladimer Leonidovich; Kirillov, Eugene Vladislavovich

1999-01-01

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to coalesce into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

Cellular uptake of modified oligonucleotides: fluorescence approach

NASA Astrophysics Data System (ADS)

Kočišová, Eva; Praus, Petr; Rosenberg, Ivan; Seksek, Olivier; Sureau, Franck; Štěpánek, Josef; Turpin, Pierre-Yves

2005-06-01

Cellular uptake and intracellular distribution of the synthetic antisense analogue of dT 15 oligonucleotide (homogenously containing 3'-O-P-CH 2-O-5' internucleotide linkages and labeled with tetramethylrhodamine dye) was studied on B16 melanoma cell line by fluorescence micro-imaging and time-resolved microspectrofluorimetry. By using amphotericin B 3-dimethylaminopropyl amide as an enhancer molecule for the uptake process, homogenous staining of the cells with rather distinct nucleoli staining was achieved after 4 h of incubation. Two spectral components of 2.7 and 1.3 ns lifetime, respectively, were resolved in the emission collected from the cell nucleus. The way of staining and the long-lived component differed from our previous experiments demonstrating complexity of the intracellular oligonucleotide distribution and in particular of the binding inside the nucleus.

Physicochemical and biological properties of self-assembled antisense/poly(amidoamine) dendrimer nanoparticles: the effect of dendrimer generation and charge ratio

PubMed Central

Nomani, Alireza; Haririan, Ismaeil; Rahimnia, Ramin; Fouladdel, Shamileh; Gazori, Tarane; Dinarvand, Rassoul; Omidi, Yadollah; Azizi, Ebrahim

2010-01-01

To gain a deeper understanding of the physicochemical phenomenon of self-assembled nanoparticles of different generations and ratios of poly (amidoamine) dendrimer (PAMAM) dendrimer and a short-stranded DNA (antisense oligonucleotide), multiple methods were used to characterize these nanoparticles including photon correlation spectroscopy (PCS); zeta potential measurement; and atomic force microscopy (AFM). PCS and AFM results revealed that, in contrast to larger molecules of DNA, smaller molecules produce more heterodisperse and large nanoparticles when they are condensed with a cationic dendrimer. AFM images also showed that such nanoparticles were spherical. The stability of the antisense content of the nanoparticles was investigated over different charge ratios using polyacrylamide gel electrophoresis. It was clear from such analyses that much more than charge neutrality point was required to obtain stable nanoparticles. For cell uptake, self-assembled nanoparticles were prepared with PAMAM G5 and 5’-FITC labeled antisense and the uptake experiment was carried out in T47D cell culture. This investigation also shows that the cytotoxicity of the nanoparticles was dependent upon the generation and charge ratio of the PAMAM dendrimer, and the antisense concentration had no significant effect on the cytotoxicity. PMID:20517481

Targeting Stat3 With G-Quartet Oligonucleotides in Metastatic Prostate Cancer

DTIC Science & Technology

2005-04-01

Wegenka UM, Lutticken C, Buschmann J, et al. The interleukin-6-activated acute- 34. Mazurmder A, Neamati N, Ojwang JO, Sunder S, Rando RF, Pommier Y...Chem 1995; 270: 1754-60. antisense directed against telomerase RNA. Oncogene 1998; 16: [8] Mazumder A, Neamati N, Ojwang JO, Sunder S, Rando RF, 3323

77 FR 62521 - Prospective Grant of Exclusive License: The Development of Therapeutic Agents for the Treatment...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-10-15

...- cell Lymphoma AGENCY: National Institutes of Health, Public Health Service, HHS. ACTION: Notice...) incorporating a p53 isoform antisense oligonucleotide as a single biologic therapy to treat T- cell lymphoma... inventions concern i) compositions and methods for targeted delivery of inhibitory nucleic acids to cells...

RNA splicing process analysis for identifying antisense oligonucleotide inhibitors with padlock probe-based isothermal amplification.

PubMed

Ren, Xiaojun; Deng, Ruijie; Wang, Lida; Zhang, Kaixiang; Li, Jinghong

2017-08-01

RNA splicing, which mainly involves two transesterification steps, is a fundamental process of gene expression and its abnormal regulation contributes to serious genetic diseases. Antisense oligonucleotides (ASOs) are genetic control tools that can be used to specifically control genes through alteration of the RNA splicing pathway. Despite intensive research, how ASOs or various other factors influence the multiple processes of RNA splicing still remains obscure. This is largely due to an inability to analyze the splicing efficiency of each step in the RNA splicing process with high sensitivity. We addressed this limitation by introducing a padlock probe-based isothermal amplification assay to achieve quantification of the specific products in different splicing steps. With this amplified assay, the roles that ASOs play in RNA splicing inhibition in the first and second steps could be distinguished. We identified that 5'-ASO could block RNA splicing by inhibiting the first step, while 3'-ASO could block RNA splicing by inhibiting the second step. This method provides a versatile tool for assisting efficient ASO design and discovering new splicing modulators and therapeutic drugs.

Oligonucleotides targeting TCF4 triplet repeat expansion inhibit RNA foci and mis-splicing in Fuchs' dystrophy.

PubMed

Hu, Jiaxin; Rong, Ziye; Gong, Xin; Zhou, Zhengyang; Sharma, Vivek K; Xing, Chao; Watts, Jonathan K; Corey, David R; Mootha, V Vinod

2018-03-15

Fuchs' endothelial corneal dystrophy (FECD) is the most common repeat expansion disorder. FECD impacts 4% of U.S. population and is the leading indication for corneal transplantation. Most cases are caused by an expanded intronic CUG tract in the TCF4 gene that forms nuclear foci, sequesters splicing factors and impairs splicing. We investigated the sense and antisense RNA landscape at the FECD gene and find that the sense-expanded repeat transcript is the predominant species in patient corneas. In patient tissue, sense foci number were negatively correlated with age and showed no correlation with sex. Each endothelial cell has ∼2 sense foci and each foci is single RNA molecule. We designed antisense oligonucleotides (ASOs) to target the mutant-repetitive RNA and demonstrated potent inhibition of foci in patient-derived cells. Ex vivo treatment of FECD human corneas effectively inhibits foci and reverses pathological changes in splicing. FECD has the potential to be a model for treating many trinucleotide repeat diseases and targeting the TCF4 expansion with ASOs represents a promising therapeutic strategy to prevent and treat FECD.

Prospects for nucleic acid-based therapeutics against hepatitis C virus.

PubMed

Lee, Chang Ho; Kim, Ji Hyun; Lee, Seong-Wook

2013-12-21

In this review, we discuss recent advances in nucleic acid-based therapeutic technologies that target hepatitis C virus (HCV) infection. Because the HCV genome is present exclusively in RNA form during replication, various nucleic acid-based therapeutic approaches targeting the HCV genome, such as ribozymes, aptamers, siRNAs, and antisense oligonucleotides, have been suggested as potential tools against HCV. Nucleic acids are potentially immunogenic and typically require a delivery tool to be utilized as therapeutics. These limitations have hampered the clinical development of nucleic acid-based therapeutics. However, despite these limitations, nucleic acid-based therapeutics has clinical value due to their great specificity, easy and large-scale synthesis with chemical methods, and pharmaceutical flexibility. Moreover, nucleic acid therapeutics are expected to broaden the range of targetable molecules essential for the HCV replication cycle, and therefore they may prove to be more effective than existing therapeutics, such as interferon-α and ribavirin combination therapy. This review focuses on the current status and future prospects of ribozymes, aptamers, siRNAs, and antisense oligonucleotides as therapeutic reagents against HCV.

Thermo-Responsive Complexes of c-Myc Antisense Oligonucleotide with Block Copolymer of Poly(OEGMA) and Quaternized Poly(4-Vinylpyridine).

PubMed

Topuzogullari, Murat; Elalmis, Yeliz Basaran; Isoglu, Sevil Dincer

2017-04-01

Solution behavior of thermo-responsive polymers and their complexes with biological macromolecules may be affected by environmental conditions, such as the concentration of macromolecular components, pH, ion concentration, etc. Therefore, a thermo-responsive polymer and its complexes should be characterized in detail to observe their responses against possible environments under physiological conditions before biological applications. To briefly indicate this important issue, thermo-responsive block copolymer of quaternized poly(4-vinylpyridine) and poly(oligoethyleneglycol methyl ether methacrylate) as a potential nonviral vector has been synthesized. Polyelectrolyte complexes of this copolymer with the antisense oligonucleotide of c-Myc oncogene are also thermo-responsive but, have lower LCST (lower critical solution temperature) values compared to individual copolymer. LCST values of complexes decrease with molar ratio of macromolecular components and presence of salt. Dilution of solutions also affects solution behavior of complexes and causes a significant decrease in size and an increase in LCST, which indicates possible effects of severe dilutions in the blood stream. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Scientific and Regulatory Policy Committee Points-to-consider Paper*: Drug-induced Vascular Injury Associated with Nonsmall Molecule Therapeutics in Preclinical Development: Part 2. Antisense Oligonucleotides.

PubMed

Engelhardt, Jeffery A; Fant, Pierluigi; Guionaud, Silvia; Henry, Scott P; Leach, Michael W; Louden, Calvert; Scicchitano, Marshall S; Weaver, James L; Zabka, Tanja S; Frazier, Kendall S

2015-10-01

Drug-induced vascular injury (DIVI) is a recurrent challenge in the development of novel pharmaceutical agents. In recent years, DIVI has been occasionally observed in nonhuman primates given RNA-targeting therapeutics such as antisense oligonucleotide therapies (ASOs) during chronic toxicity studies. While DIVI in laboratory animal species has been well characterized for vasoactive small molecules, and immune-mediated responses against large molecule biotherapeutics have been well described, there is little published information regarding DIVI induced by ASOs to date. Preclinical DIVI findings in monkeys have caused considerable delays in development of promising new ASO therapies, because of the uncertainty about whether DIVI in preclinical studies is predictive of effects in humans, and the lack of robust biomarkers of DIVI. This review of DIVI discusses clinical and microscopic features of vasculitis in monkeys, their pathogenic mechanisms, and points to consider for the toxicologist and pathologist when confronted with ASO-related DIVI. Relevant examples of regulatory feedback are included to provide insight into risk assessment of ASO therapies. © 2015 by The Author(s).

Therapeutic gene targeting approaches for the treatment of dyslipidemias and atherosclerosis.

PubMed

Mäkinen, Petri I; Ylä-Herttuala, Seppo

2013-04-01

Despite improved therapies, cardiovascular diseases are the leading cause of morbidity and mortality worldwide. Therefore, new therapeutic approaches are still needed. In the gene therapy field, RNA interference (RNAi) and regulation of microRNAs (miRNAs) have gained a lot of attention in addition to traditional overexpression based strategies. Here, recent findings in therapeutic gene silencing and modulation of small RNA expression related to atherogenesis and dyslipidemia are summarized. Novel gene therapy approaches for the treatment of hyperlipidemia have been addressed. Antisense oligonucleotide and RNAi-based therapies against apolipoprotein B100 and proprotein convertase subtilisin/kexin type 9 have shown already efficacy in preclinical and clinical trials. In addition, several miRNAs dysregulated in atherosclerotic lesions and regulating cholesterol homeostasis have been found, which may represent novel targets for future therapies. New therapies for lowering lipid levels are now being tested in clinical trials, and both antisense oligonucleotide and RNAi-based therapies have shown promising results in lowering cholesterol levels. However, the modulation of inflammatory component in atherosclerosis by gene therapy and targeting of the effects to plaques are still difficult challenges.

Specific DNA duplex formation at an artificial lipid bilayer: towards a new DNA biosensor technology.

PubMed

Werz, Emma; Korneev, Sergei; Montilla-Martinez, Malayko; Wagner, Richard; Hemmler, Roland; Walter, Claudius; Eisfeld, Jörg; Gall, Karsten; Rosemeyer, Helmut

2012-02-01

A novel technique is described which comprises a base-specific DNA duplex formation at a lipid bilayer-H(2) O-phase boundary layer. Two different probes of oligonucleotides both carrying a double-tailed lipid at the 5'-terminus were incorporated into stable artificial lipid bilayers separating two compartments (cis/trans-channel) of an optically transparent microfluidic sample carrier with perfusion capabilities. Both the cis- and trans-channels are filled with saline buffer. Injection of a cyanine-5-labeled target DNA sequence, which is complementary to only one of the oligonucleotide probes, into the cis-channel, followed by a thorough perfusion, leads to an immobilization of the labeled complementary oligonucleotide on the membrane as detected by single-molecule fluorescence spectroscopy and microscopy. In the case of fluorescent but non-complementary DNA sequences, no immobilized fluorescent oligonucleotide duplex could be detected on the membrane. This clearly verifies a specific duplex formation at the membrane interface. Copyright © 2012 Verlag Helvetica Chimica Acta AG, Zürich.

Oligonucleotide-based pharmaceuticals: Non-clinical and clinical safety signals and non-clinical testing strategies.

PubMed

Mustonen, Enni-Kaisa; Palomäki, Tiina; Pasanen, Markku

2017-11-01

Antisense oligonucleotides, short interfering RNAs (siRNAs) and aptamers are oligonucleotide-based pharmaceuticals with a promising role in targeted therapies. Currently, five oligonucleotide-based pharmaceuticals have achieved marketing authorization in Europe or USA and many more are undergoing clinical testing. However, several safety concerns have been raised in non-clinical and clinical studies. Oligonucleotides share properties with both chemical and biological pharmaceuticals and therefore they pose challenges also from the regulatory point of view. We have analyzed the safety data of oligonucleotides and evaluated the applicability of current non-clinical toxicological guidelines for assessing the safety of oligonucleotide-based pharmaceuticals. Oligonucleotide-based pharmaceuticals display a similar toxicological profile, exerting adverse effects on liver and kidney, evoking hematological alterations, as well as causing immunostimulation and prolonging the coagulation time. It is possible to extrapolate some of these effects from non-clinical studies to humans. However, evaluation strategies for genotoxicity testing of "non-natural" oligonucleotides should be revised. Additionally, the selective use of surrogates and prediction of clinical endpoints for non-clinically observed immunostimulation is complicated by its multiple potential manifestations, demanding improvements in the testing strategies. Utilizing more relevant and mechanistic-based approaches and taking better account of species differences, could possibly improve the prediction of relevant immunological/proinflammatory effects in humans. Copyright © 2017 Elsevier Inc. All rights reserved.

Propofol exposure during early gestation impairs learning and memory in rat offspring by inhibiting the acetylation of histone.

PubMed

Lin, Jiamei; Wang, Shengqiang; Feng, Yunlin; Zhao, Weihong; Zhao, Weilu; Luo, Foquan; Feng, Namin

2018-05-01

Propofol is widely used in clinical practice, including non-obstetric surgery in pregnant women. Previously, we found that propofol anaesthesia in maternal rats during the third trimester (E18) caused learning and memory impairment to the offspring rats, but how about the exposure during early pregnancy and the underlying mechanisms? Histone acetylation plays an important role in synaptic plasticity. In this study, propofol was administered to the pregnant rats in the early pregnancy (E7). The learning and memory function of the offspring were tested by Morris water maze (MWM) test on post-natal day 30. Two hours before each MWM trial, histone deacetylase 2 (HDAC2) inhibitor, suberoylanilide hydroxamic acid (SAHA), Senegenin (SEN, traditional Chinese medicine), hippyragranin (HGN) antisense oligonucleotide (HGNA) or vehicle were given to the offspring. The protein levels of HDAC2, acetylated histone 3 (H3) and 4 (H4), cyclic adenosine monophosphate (cAMP) response element-binding protein (CREB), N-methyl-D-aspartate receptor (NMDAR) 2 subunit B (NR2B), HGN and synaptophysin in offspring's hippocampus were determined by Western blot or immunofluorescence test. It was discovered that infusion with propofol in maternal rats on E7 leads to impairment of learning and memory in offspring, increased the protein levels of HDAC2 and HGN, decreased the levels of acetylated H3 and H4 and phosphorylated CREB, NR2B and synaptophysin. HDAC2 inhibitor SAHA, Senegenin or HGN antisense oligonucleotide reversed all the changes. Thus, present results indicate exposure to propofol during the early gestation impairs offspring's learning and memory via inhibiting histone acetylation. SAHA, Senegenin and HGN antisense oligonucleotide might have therapeutic value for the adverse effect of propofol. © 2018 The Authors. Journal of Cellular and Molecular Medicine published by John Wiley & Sons Ltd and Foundation for Cellular and Molecular Medicine.

A Duchenne Muscular Dystrophy Gene Hot Spot Mutation in Dystrophin-Deficient Cavalier King Charles Spaniels Is Amenable to Exon 51 Skipping

PubMed Central

Walmsley, Gemma L.; Arechavala-Gomeza, Virginia; Fernandez-Fuente, Marta; Burke, Margaret M.; Nagel, Nicole; Holder, Angela; Stanley, Rachael; Chandler, Kate; Marks, Stanley L.; Muntoni, Francesco; Shelton, G. Diane; Piercy, Richard J.

2010-01-01

Background Duchenne muscular dystrophy (DMD), which afflicts 1 in 3500 boys, is one of the most common genetic disorders of children. This fatal degenerative condition is caused by an absence or deficiency of dystrophin in striated muscle. Most affected patients have inherited or spontaneous deletions in the dystrophin gene that disrupt the reading frame resulting in unstable truncated products. For these patients, restoration of the reading frame via antisense oligonucleotide-mediated exon skipping is a promising therapeutic approach. The major DMD deletion “hot spot” is found between exons 45 and 53, and skipping exon 51 in particular is predicted to ameliorate the dystrophic phenotype in the greatest number of patients. Currently the mdx mouse is the most widely used animal model of DMD, although its mild phenotype limits its suitability in clinical trials. The Golden Retriever muscular dystrophy (GRMD) model has a severe phenotype, but due to its large size, is expensive to use. Both these models have mutations in regions of the dystrophin gene distant from the commonly mutated DMD “hot spot”. Methodology/Principal Findings Here we describe the severe phenotype, histopathological findings, and molecular analysis of Cavalier King Charles Spaniels with dystrophin-deficient muscular dystrophy (CKCS-MD). The dogs harbour a missense mutation in the 5′ donor splice site of exon 50 that results in deletion of exon 50 in mRNA transcripts and a predicted premature truncation of the translated protein. Antisense oligonucleotide-mediated skipping of exon 51 in cultured myoblasts from an affected dog restored the reading frame and protein expression. Conclusions/Significance Given the small size of the breed, the amiable temperament and the nature of the mutation, we propose that CKCS-MD is a valuable new model for clinical trials of antisense oligonucleotide-induced exon skipping and other therapeutic approaches for DMD. PMID:20072625

A multi-model approach to nucleic acid-based drug development.

PubMed

Gautherot, Isabelle; Sodoyer, Regís

2004-01-01

With the advent of functional genomics and the shift of interest towards sequence-based therapeutics, the past decades have witnessed intense research efforts on nucleic acid-mediated gene regulation technologies. Today, RNA interference is emerging as a groundbreaking discovery, holding promise for development of genetic modulators of unprecedented potency. Twenty-five years after the discovery of antisense RNA and ribozymes, gene control therapeutics are still facing developmental difficulties, with only one US FDA-approved antisense drug currently available in the clinic. Limited predictability of target site selection models is recognized as one major stumbling block that is shared by all of the so-called complementary technologies, slowing the progress towards a commercial product. Currently employed in vitro systems for target site selection include RNAse H-based mapping, antisense oligonucleotide microarrays, and functional screening approaches using libraries of catalysts with randomized target-binding arms to identify optimal ribozyme/DNAzyme cleavage sites. Individually, each strategy has its drawbacks from a drug development perspective. Utilization of message-modulating sequences as therapeutic agents requires that their action on a given target transcript meets criteria of potency and selectivity in the natural physiological environment. In addition to sequence-dependent characteristics, other factors will influence annealing reactions and duplex stability, as well as nucleic acid-mediated catalysis. Parallel consideration of physiological selection systems thus appears essential for screening for nucleic acid compounds proposed for therapeutic applications. Cellular message-targeting studies face issues relating to efficient nucleic acid delivery and appropriate analysis of response. For reliability and simplicity, prokaryotic systems can provide a rapid and cost-effective means of studying message targeting under pseudo-cellular conditions, but such approaches also have limitations. To streamline nucleic acid drug discovery, we propose a multi-model strategy integrating high-throughput-adapted bacterial screening, followed by reporter-based and/or natural cellular models and potentially also in vitro assays for characterization of the most promising candidate sequences, before final in vivo testing.

Rapid method to detect duplex formation in sequencing by hybridization methods, a method for constructing containment structures for reagent interaction

DOEpatents

Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moiseyevich; Guschin, Dmitry Yuryevich; Gemmell, Margaret Anne; Shick, Valentine V.; Proudnikov, Dmitri Y.; Timofeev, Edward N.

2002-01-01

A method for determining the existence of duplexes of oligonucleotide complementary molecules is provided whereby a plurality of immobilized oligonucleotide molecules, each of a specific length and each having a specific base sequence, is contacted with complementary, single stranded oligonucleotide molecules to form a duplex so as to facilitate intercalation of a fluorescent dye between the base planes of the duplex. The invention also provides for a method for constructing oligonucleotide matrices comprising confining light sensitive fluid to a surface, exposing said light-sensitive fluid to a light pattern so as to cause the fluid exposed to the light to polymerize into discrete units and adhere to the surface; and contacting each of the units with a set of different oligonucleotide molecules so as to allow the molecules to disperse into the units.

Pharmacodynamics and subchronic toxicity in mice and monkeys of ISIS 388626, a second-generation antisense oligonucleotide that targets human sodium glucose cotransporter 2.

PubMed

Zanardi, Thomas A; Han, Su-Cheol; Jeong, Eun Ju; Rime, Soyub; Yu, Rosie Z; Chakravarty, Kaushik; Henry, Scott P

2012-11-01

ISIS 388626, a 2'-methoxyethyl (MOE)-modified antisense oligonucleotide (ASO) that targets human sodium glucose cotransporter 2 (SGLT2) mRNA, is in clinical trials for the management of diabetes. SGLT2 plays a pivotal role in renal glucose reabsorption, and inhibition of SGLT2 is anticipated to reduce hyperglycemia in diabetic subjects by increasing urinary glucose elimination. To selectively inhibit SGLT2 in the kidney, ISIS 388626 was designed as a "shortmer" ASO, consisting of only 12 nucleotides with two 2'-MOE-modified nucleotides at the termini. Mice and monkeys received up to 30 mg/kg/week ISIS 388626 via subcutaneous injection for 6 or 13 weeks. Dose-dependent decreases in renal SGLT2 mRNA expression were observed, which correlated with dose-related increases in glucosuria without concomitant hypoglycemia. There were no histologic changes in the kidney attributed to SGLT2 inhibition after 6 or 13 weeks of treatment. The remaining changes observed in these studies were typical of those produced in these species by the administration of oligonucleotides, correlated with high doses of ISIS 388626, and were unrelated to the inhibition of SGLT2 expression. The kidney contained the highest concentration of ISIS 388626, and dose-dependent basophilic granule accumulation in tubular epithelial cells of the kidney, which is evidence of oligonucleotide accumulation in these cells, was the only histologic change identified. No changes in kidney function were observed. These results revealed only readily reversible changes after the administration of ISIS 388626 and support the continued investigation of the safety and efficacy of ISIS 388626 in human trials.

Method for phosphorothioate antisense DNA sequencing by capillary electrophoresis with UV detection.

PubMed

Froim, D; Hopkins, C E; Belenky, A; Cohen, A S

1997-11-01

The progress of antisense DNA therapy demands development of reliable and convenient methods for sequencing short single-stranded oligonucleotides. A method of phosphorothioate antisense DNA sequencing analysis using UV detection coupled to capillary electrophoresis (CE) has been developed based on a modified chain termination sequencing method. The proposed method reduces the sequencing cost since it uses affordable CE-UV instrumentation and requires no labeling with minimal sample processing before analysis. Cycle sequencing with ThermoSequenase generates quantities of sequencing products that are readily detectable by UV. Discrimination of undesired components from sequencing products in the reaction mixture, previously accomplished by fluorescent or radioactive labeling, is now achieved by bringing concentrations of undesired components below the UV detection range which yields a 'clean', well defined sequence. UV detection coupled with CE offers additional conveniences for sequencing since it can be accomplished with commercially available CE-UV equipment and is readily amenable to automation.

Method for phosphorothioate antisense DNA sequencing by capillary electrophoresis with UV detection.

PubMed Central

Froim, D; Hopkins, C E; Belenky, A; Cohen, A S

1997-01-01

The progress of antisense DNA therapy demands development of reliable and convenient methods for sequencing short single-stranded oligonucleotides. A method of phosphorothioate antisense DNA sequencing analysis using UV detection coupled to capillary electrophoresis (CE) has been developed based on a modified chain termination sequencing method. The proposed method reduces the sequencing cost since it uses affordable CE-UV instrumentation and requires no labeling with minimal sample processing before analysis. Cycle sequencing with ThermoSequenase generates quantities of sequencing products that are readily detectable by UV. Discrimination of undesired components from sequencing products in the reaction mixture, previously accomplished by fluorescent or radioactive labeling, is now achieved by bringing concentrations of undesired components below the UV detection range which yields a 'clean', well defined sequence. UV detection coupled with CE offers additional conveniences for sequencing since it can be accomplished with commercially available CE-UV equipment and is readily amenable to automation. PMID:9336449

As Technologies for Nucleotide Therapeutics Mature, Products Emerge.

PubMed

Beierlein, Jennifer M; McNamee, Laura M; Ledley, Fred D

2017-12-15

The long path from initial research on oligonucleotide therapies to approval of antisense products is not unfamiliar. This lag resembles those encountered with monoclonal antibodies, gene therapies, and many biological targets and is consistent with studies of innovation showing that technology maturation is a critical determinant of product success. We previously described an analytical model for the maturation of biomedical research, demonstrating that the efficiency of targeted and biological development is connected to metrics of technology growth. The present work applies this model to characterize the advance of oligonucleotide therapeutics. We show that recent oligonucleotide product approvals incorporate technologies and targets that are past the established point of technology growth, as do most of the oligonucleotide products currently in phase 3. Less mature oligonucleotide technologies, such as miRNAs and some novel gene targets, have not passed the established point and have not yielded products. This analysis shows that oligonucleotide product development has followed largely predictable patterns of innovation. While technology maturation alone does not ensure success, these data show that many oligonucleotide technologies are sufficiently mature to be considered part of the arsenal for therapeutic development. These results demonstrate the importance of technology assessment in strategic management of biomedical technologies. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Antisense Morpholino Oligonucleotides Reduce Neurofilament Synthesis and Inhibit Axon Regeneration in Lamprey Reticulospinal Neurons.

PubMed

Zhang, Guixin; Jin, Li-qing; Hu, Jianli; Rodemer, William; Selzer, Michael E

2015-01-01

The sea lamprey has been used as a model for the study of axonal regeneration after spinal cord injury. Previous studies have suggested that, unlike developing axons in mammal, the tips of regenerating axons in lamprey spinal cord are simple in shape, packed with neurofilaments (NFs), and contain very little F-actin. Thus it has been proposed that regeneration of axons in the central nervous system of mature vertebrates is not based on the canonical actin-dependent pulling mechanism of growth cones, but involves an internal protrusive force, perhaps generated by the transport or assembly of NFs in the distal axon. In order to assess this hypothesis, expression of NFs was manipulated by antisense morpholino oligonucleotides (MO). A standard, company-supplied MO was used as control. Axon retraction and regeneration were assessed at 2, 4 and 9 weeks after MOs were applied to a spinal cord transection (TX) site. Antisense MO inhibited NF180 expression compared to control MO. The effect of inhibiting NF expression on axon retraction and regeneration was studied by measuring the distance of axon tips from the TX site at 2 and 4 weeks post-TX, and counting the number of reticulospinal neurons (RNs) retrogradely labeled by fluorescently-tagged dextran injected caudal to the injury at 9 weeks post-TX. There was no statistically significant effect of MO on axon retraction at 2 weeks post-TX. However, at both 4 and 9 weeks post-TX, inhibition of NF expression inhibited axon regeneration.

Antisense-based RNA therapy of factor V deficiency: in vitro and ex vivo rescue of a F5 deep-intronic splicing mutation.

PubMed

Nuzzo, Francesca; Radu, Claudia; Baralle, Marco; Spiezia, Luca; Hackeng, Tilman M; Simioni, Paolo; Castoldi, Elisabetta

2013-11-28

Antisense molecules are emerging as a powerful tool to correct splicing defects. Recently, we identified a homozygous deep-intronic mutation (F5 c.1296+268A>G) activating a cryptic donor splice site in a patient with severe coagulation factor V (FV) deficiency and life-threatening bleeding episodes. Here, we assessed the ability of 2 mutation-specific antisense molecules (a morpholino oligonucleotide [MO] and an engineered U7 small nuclear RNA [snRNA]) to correct this splicing defect. COS-1 and HepG2 cells transfected with a F5 minigene construct containing the patient's mutation expressed aberrant messenger RNA (mRNA) in excess of normal mRNA. Treatment with mutation-specific antisense MO (1-5 µM) or a construct expressing antisense U7snRNA (0.25-2 µg) dose-dependently increased the relative amount of correctly spliced mRNA by 1 to 2 orders of magnitude, whereas control MO and U7snRNA were ineffective. Patient-derived megakaryocytes obtained by differentiation of circulating progenitor cells did not express FV, but became positive for FV at immunofluorescence staining after administration of antisense MO or U7snRNA. However, treatment adversely affected cell viability, mainly because of the transfection reagents used to deliver the antisense molecules. Our data provide in vitro and ex vivo proof of principle for the efficacy of RNA therapy in severe FV deficiency, but additional cytotoxicity studies are warranted.

Inhibition of adenovirus 5 replication in COS-1 cells by antisense RNAs against the viral E1a region.

PubMed

Miroshnichenko, O I; Ponomareva, T I; Tikchonenko, T I

1989-12-07

To study the effect of antisense E1a RNA (asRNA) on adenovirus development, two types of adenovirus 5 E1a antisense constructs have been engineered. One was complementary to the viral DNA region [nucleotide (nt) positions 500-720] regulated by the metallothionein-I promoter, and the other was complementary to the DNA regions (nt positions 630-1570) under control of the long terminal repeat Moloney mouse leukosis virus promoter. Both asRNA constructs were cloned into a plasmid containing the simian virus 40 origin of replication, the gene controlling geneticin (G418) resistance (G418R), and other regulatory elements. The COS-1 cells, which contained up to 100 copies of the engineered plasmids, synthesized antiviral asRNAs, which provided 71 to over 95% inhibition of adenoviral replication, in comparison to the control cells not synthesizing asRNAs.

Predicting oligonucleotide affinity to nucleic acid targets.

PubMed Central

Mathews, D H; Burkard, M E; Freier, S M; Wyatt, J R; Turner, D H

1999-01-01

A computer program, OligoWalk, is reported that predicts the equilibrium affinity of complementary DNA or RNA oligonucleotides to an RNA target. This program considers the predicted stability of the oligonucleotide-target helix and the competition with predicted secondary structure of both the target and the oligonucleotide. Both unimolecular and bimolecular oligonucleotide self structure are considered with a user-defined concentration. The application of OligoWalk is illustrated with three comparisons to experimental results drawn from the literature. PMID:10580474

Improved therapeutic effectiveness by combining recombinant p14(ARF) with antisense complementary DNA of EGFR in laryngeal squamous cell carcinoma.

PubMed

Liu, Feng; Du, JinTao; Xian, Junming; Liu, Yafeng; Liu, Shixi; Lin, Yan

2015-01-01

The tumor suppressor p14(ARF) and proto-oncogene epidermal growth factor receptor (EGFR) play important roles in the development of laryngeal squamous cell carcinoma (LSCC). This study was aimed to determine whether combining recombinant p14(ARF) with antisense complementary DNA of EGFR could improve the therapeutic effectiveness in LSCC. After human larynx cancer cells (Hep-2) were infected with recombinant adenoviruses (Ad-p14(ARF) and Ad-antisense EGFR) together or alone in vitro, the proliferation and cell cycle distribution of Hep-2 cells were detected by MTT assay and flow cytometer analysis, respectively. Furthermore, the antitumor effects of recombinant adenoviruses together or alone on Hep-2 xenografts were examined in vivo. The levels of p14(ARF) and EGFR expressed in Hep-2 cells and xenografts were determined by western blot assay. Ad-p14(ARF) combining with Ad-antisense EGFR markedly inhibited the Hep-2 proliferation compared with alone (P=0.001, P=0.002 respectively). Combination of Ad-p14(ARF) and Ad-antisense EGFR led to the proportion of Hep-2 cells in G0/G1 phases increased by up to 86.9%. The down-expression of EGFR protein and overexpression of p14(ARF) protein were observed in vitro and in vivo, and this effect was preserved when Ad-p14(ARF) was combined with Ad-antisense EGFR. Besides, Ad-p14(ARF) plus Ad-antisense EGFR significantly (P<0.05) increased the antitumor activity against Hep-2 tumor xenografts comparing with Ad-p14(ARF) or Ad-antisense EGFR alone. Combination Ad-p14(ARF) with Ad-antisense EGFR significantly increased the antitumor responses in LSCC. An effectively potential gene therapy to prevent proliferation of LSCC was provided. Copyright © 2015 Elsevier Inc. All rights reserved.

Peroxide-mediated desulfurization of phosphorothioate oligonucleotides and its prevention.

PubMed

Krotz, Achim H; Mehta, Rahul C; Hardee, Gregory E

2005-02-01

Desulfurization at the internucleotide phosphorothioate linkage of antisense oligonucleotides (ASOs) in dermatological formulations has been investigated using strong ion exchange chromatography and mass spectroscopy. The formation of phosphate diester linkages appeared to arise from a reaction between the phosphorothioate oligonucleotide and a potent oxidizing agent. Screening of excipients used in the formulation indicated that the cause of desulfurization was related to the presence of polyethylene glycol-derived nonionic surfactants MYRJ 52 or BRIJ 58. Autoxidation of the polyethylene glycol chain is suggested as the probable origin for the observed incompatibility. The ability of various antioxidants to prevent oxidative degradation of ASO-1 in simple test systems and in oil-in-water emulsions is described. It is found that in test systems both lipophilic and hydrophilic antioxidants are effective. However, in cream formulation (oil-in-water emulsions) of ASO-1 the addition of hydrophilic antioxidants L-cysteine or DL-alpha-lipoic acid has been shown to be superior in protecting the oligonucleotide from desulfurization upon storage. Copyright 2004 Wiley-Liss, Inc.

Therapeutic Antisense Oligonucleotides against Cancer: Hurdling to the Clinic

NASA Astrophysics Data System (ADS)

Moreno, Pedro; Pêgo, Ana

2014-10-01

Under clinical development since the early 90’s and with two successfully approved drugs (Fomivirsen and Mipomersen), oligonucleotide-based therapeutics have not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given towards a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field.

Therapeutic antisense oligonucleotides against cancer: hurdling to the clinic

PubMed Central

Moreno, Pedro M. D.; Pêgo, Ana P.

2014-01-01

Under clinical development since the early 90's and with two successfully approved drugs (Fomivirsen and Mipomersen), oligonucleotide-based therapeutics has not yet delivered a clinical drug to the market in the cancer field. Whilst many pre-clinical data has been generated, a lack of understanding still exists on how to efficiently tackle all the different challenges presented for cancer targeting in a clinical setting. Namely, effective drug vectorization, careful choice of target gene or synergistic multi-gene targeting are surely decisive, while caution must be exerted to avoid potential toxic, often misleading off-target-effects. Here a brief overview will be given on the nucleic acid chemistry advances that established oligonucleotide technologies as a promising therapeutic alternative and ongoing cancer related clinical trials. Special attention will be given toward a perspective on the hurdles encountered specifically in the cancer field by this class of therapeutic oligonucleotides and a view on possible avenues for success is presented, with particular focus on the contribution from nanotechnology to the field. PMID:25353019

Targeted self-assembly of functionalized carbon nanotubes on tumors

DOEpatents

Scheinberg, David A.; McDevitt, Michael R.; Villa, Carlos H.; Mulvey, J. Justin

2018-05-22

Provided herein are methods for delivering a molecule in situ to a cell and for treating a cancer via the in situ delivery. The methods comprise contacting or administering to the cell, as two separate components, a morpholino oligonucleotide comprising a targeting moiety followed by a single wall nanotube construct comprising second morpholino oligonucleotides complementary to the first morpholino oligonucleotides and one or both of a therapeutic or diagnostic payload molecule linked to the single wall nanotube construct. Upon self-assembly of a single wall nanotube complex via hybridization of the first morpholino and second complementary morpholino oligonucleotides at the cell, the payload molecule is delivered. Also provided is the two component self-assembly single wall nanotube system and the single wall nanotube construct comprising the second component.

Cyclic AMP-dependent regulation of P-type calcium channels expressed in Xenopus oocytes.

PubMed

Fournier, F; Bourinet, E; Nargeot, J; Charnet, P

1993-05-01

Xenopus oocytes injected with rat cerebellum mRNA, express voltage-dependent calcium channels (VDCC). These were identified as P-type Ca2+ channels by their insensitivity to dihydropyridines and omega-conotoxin and by their blockade by Agelenopsis aperta venom (containing the funnel-web spider toxins: FTX and omega-Aga-IV-A). Coinjection of cerebellar mRNA and antisense oligonucleotide complementary to the dihydropyridine-resistant brain Ca2+ channel, named BI [Mori Y. et al. (1991) Nature 350:398-402] or rbA [Starr T. V. B. et al. (1991) Proc Natl Acad Sci USA 88:5621-5625], strongly reduced the expressed Ba2+ current suggesting that these clones encode a P-type VDCC. The macroscopic Ca2+ channel activity was increased by direct intraoocyte injection of cAMP. This increase in current amplitude was concomitant with a slowing of current inactivation, and was attributed to activation of protein kinase A, since it could be antagonized by a peptidic inhibitor of this enzyme. Positive regulation of P-type VDCC could be of importance in Purkinje neurons and motor nerve terminals where this channel is predominant.

Central glucocorticoid receptors regulate the upregulation of spinal cannabinoid-1 receptors after peripheral nerve injury in rats.

PubMed

Wang, Shuxing; Lim, Grewo; Mao, Ji; Sung, Backil; Yang, Liling; Mao, Jianren

2007-09-01

Previous studies have shown that peripheral nerve injury upregulated both glucocorticoid receptors (GR) and cannabinoid-1 receptors (CB1R) within the spinal cord dorsal horn in rats. However, the relationship between the expression of spinal GR and CB1R after nerve injury remains unclear. Here, we examined the hypothesis that the upregulation of spinal CB1R induced by chronic constriction nerve injury (CCI) in rats would be regulated by spinal GR. CCI induced the upregulation of spinal CB1R primarily within the ipsilateral spinal cord dorsal horn as revealed by Western blot and immunohistochemistry. The expression of CB1R in CCI rats was substantially attenuated by intrathecal treatment with either the GR antagonist RU38486 or a GR antisense oligonucleotide given twice daily for postoperative day 1-6, whereas the expression of spinal CB1R was enhanced following intrathecal administration of a GR sense oligonucleotide twice daily for postoperative day 1-6. Furthermore, the upregulation of spinal CB1R after nerve injury was prevented in adrenalectomized rats, which was at least partially restored with the intrathecal administration of an exogenous GR agonist dexamethasone, indicating that corticosteroids (endogenous GR agonists) were critical to spinal GR actions. Since the development of neuropathic pain behaviors in CCI rats was attenuated by either RU38486 or a GR antisense oligonucleotide, these results suggest that CB1R is a downstream target for spinal GR actions contributory to the mechanisms of neuropathic pain.

Gene Therapy for Hemophilia and Duchenne Muscular Dystrophy in China.

PubMed

Liu, Xionghao; Liu, Mujun; Wu, Lingqian; Liang, Desheng

2018-02-01

Gene therapy is a new technology that provides potential for curing monogenic diseases caused by mutations in a single gene. Hemophilia and Duchenne muscular dystrophy (DMD) are ideal target diseases of gene therapy. Important advances have been made in clinical trials, including studies of adeno-associated virus vectors in hemophilia and antisense in DMD. However, issues regarding the high doses of viral vectors required and limited delivery efficiency of antisense oligonucleotides have not yet been fully addressed. As an alternative strategy to classic gene addition, genome editing based on programmable nucleases has also shown promise to correct mutations in situ. This review describes the recent progress made by Chinese researchers in gene therapy for hemophilia and DMD.

Targeting DMPK with Antisense Oligonucleotide Improves Muscle Strength in Myotonic Dystrophy Type 1 Mice.

PubMed

Jauvin, Dominic; Chrétien, Jessina; Pandey, Sanjay K; Martineau, Laurie; Revillod, Lucille; Bassez, Guillaume; Lachon, Aline; MacLeod, A Robert; Gourdon, Geneviève; Wheeler, Thurman M; Thornton, Charles A; Bennett, C Frank; Puymirat, Jack

2017-06-16

Myotonic dystrophy type 1 (DM1), a dominant hereditary muscular dystrophy, is caused by an abnormal expansion of a (CTG) n trinucleotide repeat in the 3' UTR of the human dystrophia myotonica protein kinase (DMPK) gene. As a consequence, mutant transcripts containing expanded CUG repeats are retained in nuclear foci and alter the function of splicing regulatory factors members of the MBNL and CELF families, resulting in alternative splicing misregulation of specific transcripts in affected DM1 tissues. In the present study, we treated DMSXL mice systemically with a 2'-4'-constrained, ethyl-modified (ISIS 486178) antisense oligonucleotide (ASO) targeted to the 3' UTR of the DMPK gene, which led to a 70% reduction in CUG exp RNA abundance and foci in different skeletal muscles and a 30% reduction in the heart. Furthermore, treatment with ISIS 486178 ASO improved body weight, muscle strength, and muscle histology, whereas no overt toxicity was detected. This is evidence that the reduction of CUG exp RNA improves muscle strength in DM1, suggesting that muscle weakness in DM1 patients may be improved following elimination of toxic RNAs. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.

Comparison of the pharmacological profiles of murine antisense oligonucleotides targeting apolipoprotein B and microsomal triglyceride transfer protein

PubMed Central

Lee, Richard G.; Fu, Wuxia; Graham, Mark J.; Mullick, Adam E.; Sipe, Donna; Gattis, Danielle; Bell, Thomas A.; Booten, Sheri; Crooke, Rosanne M.

2013-01-01

Therapeutic agents that suppress apolipoprotein B (apoB) and microsomal triglyceride transfer protein (MTP) levels/activity are being developed in the clinic to benefit patients who are unable to reach target LDL-C levels with maximally tolerated lipid-lowering drugs. To compare and contrast the metabolic consequences of reducing these targets, murine-specific apoB or MTP antisense oligonucleotides (ASOs) were administered to chow-fed and high fat-fed C57BL/6 or to chow-fed and Western diet-fed LDLr−/− mice for periods ranging from 2 to 12 weeks, and detailed analyses of various factors affecting fatty acid metabolism were performed. Administration of these drugs significantly reduced target hepatic mRNA and protein, leading to similar reductions in hepatic VLDL/triglyceride secretion. MTP ASO treatment consistently led to increases in hepatic triglyceride accumulation and biomarkers of hepatotoxicity relative to apoB ASO due in part to enhanced expression of peroxisome proliferator activated receptor γ target genes and the inability to reduce hepatic fatty acid synthesis. Thus, although both drugs effectively lowered LDL-C levels in mice, the apoB ASO produced a more positive liver safety profile. PMID:23220583

Synthesis, biophysical properties and biological activity of second generation antisense oligonucleotides containing chiral phosphorothioate linkages

PubMed Central

Wan, W. Brad; Migawa, Michael T.; Vasquez, Guillermo; Murray, Heather M.; Nichols, Josh G.; Gaus, Hans; Berdeja, Andres; Lee, Sam; Hart, Christopher E.; Lima, Walt F.; Swayze, Eric E.; Seth, Punit P.

2014-01-01

Bicyclic oxazaphospholidine monomers were used to prepare a series of phosphorothioate (PS)-modified gapmer antisense oligonucleotides (ASOs) with control of the chirality of each of the PS linkages within the 10-base gap. The stereoselectivity was determined to be 98% for each coupling. The objective of this work was to study how PS chirality influences biophysical and biological properties of the ASO including binding affinity (Tm), nuclease stability, activity in vitro and in vivo, RNase H activation and cleavage patterns (both human and E. coli) in a gapmer context. Compounds that had nine or more Sp-linkages in the gap were found to be poorly active in vitro, while compounds with uniform Rp-gaps exhibited activity very similar to that of the stereo-random parent ASOs. Conversely, when tested in vivo, the full Rp-gap compound was found to be quickly metabolized resulting in low activity. A total of 31 ASOs were prepared with control of the PS chirally of each linkage within the gap in an attempt to identify favorable Rp/Sp positions. We conclude that a mix of Rp and Sp is required to achieve a balance between good activity and nuclease stability. PMID:25398895

Asialoglycoprotein receptor 1 mediates productive uptake of N-acetylgalactosamine-conjugated and unconjugated phosphorothioate antisense oligonucleotides into liver hepatocytes

PubMed Central

Hettrick, Lisa; Revenko, Alexey; Kinberger, Garth A.; Prakash, Thazha P.; Seth, Punit P.

2017-01-01

Abstract Antisense oligonucleotide (ASO) therapeutics show tremendous promise for the treatment of previously intractable human diseases but to exert their effects on cellular RNA processing they must first cross the plasma membrane by endocytosis. The conjugation of ASOs to a receptor ligand can dramatically increase their entry into certain cells and tissues, as demonstrated by the implementation of N-acetylgalactosamine (GalNAc)-conjugated ASOs for Asialoglycoprotein Receptor (ASGR)-mediated uptake into liver hepatocytes. We compared the internalization and activity of GalNAc-conjugated ASOs and their parents in endogenous ASGR-expressing cells and were able to recapitulate hepatocyte ASO uptake and activity in cells engineered to heterologously express the receptor. We found that the minor receptor subunit, ASGR2, is not required for effective in vitro or in vivo uptake of GalNAc-conjugated ASO and that the major subunit, ASGR1, plays a small but significant role in the uptake of unconjugated phosphorothioate ASOs into hepatocytes. Moreover, our data demonstrates there is a large excess capacity of liver ASGR for the effective uptake of GalNAc–ASO conjugates, suggesting broad opportunities to exploit receptors with relatively moderate levels of expression. PMID:29069408

Antithrombotic Effect of Antisense Factor XI Oligonucleotide Treatment in Primates

PubMed Central

Crosby, Jeffrey R.; Marzec, Ulla; Revenko, Alexey S.; Zhao, Chenguang; Gao, Dacao; Matafonov, Anton; Gailani, David; MacLeod, A. Robert; Tucker, Erik I.; Gruber, Andras; Hanson, Stephen R.; Monia, Brett P.

2013-01-01

Objective During coagulation, factor IX (FIX) is activated by two distinct mechanisms mediated by the active proteases of either factors VII (FVIIa) or XI (FXIa). Both coagulation factors may contribute to thrombosis; factor XI, however, plays only a limited role in the arrest of bleeding. Therefore, therapeutic targeting of FXI may produce an antithrombotic effect with relatively low hemostatic risk. Approach and Results We have reported that reducing FXI levels with FXI antisense oligonucleotides (ASOs) produces antithrombotic activity in mice, and that administration of FXI ASOs to primates decreases circulating FXI levels and activity in a dose- and time-dependent manner. Here we evaluated the relationship between FXI plasma levels and thrombogenicity in an established baboon model of thrombosis and hemostasis. In previous studies with this model, antibody-induced inhibition of FXI produced potent antithrombotic effects. In the present report, ASO-mediated reduction of FXI plasma levels by ≥50% resulted in a demonstrable and sustained antithrombotic effect without an increased risk of bleeding. Conclusion These results indicate that reducing FXI levels using ASOs is a promising alternative to direct FXI inhibition, and that targeting FXI may be potentially safer than conventional antithrombotic therapies that can markedly impair primary hemostasis. PMID:23559626

Antisense Oligonucleotide-mediated Exon Skipping as a Systemic Therapeutic Approach for Recessive Dystrophic Epidermolysis Bullosa.

PubMed

Bremer, Jeroen; Bornert, Olivier; Nyström, Alexander; Gostynski, Antoni; Jonkman, Marcel F; Aartsma-Rus, Annemieke; van den Akker, Peter C; Pasmooij, Anna Mg

2016-10-18

The "generalized severe" form of recessive dystrophic epidermolysis bullosa (RDEB-gen sev) is caused by bi-allelic null mutations in COL7A1, encoding type VII collagen. The absence of type VII collagen leads to blistering of the skin and mucous membranes upon the slightest trauma. Because most patients carry exonic point mutations or small insertions/deletions, most exons of COL7A1 are in-frame, and low levels of type VII collagen already drastically improve the disease phenotype, this gene seems a perfect candidate for antisense oligonucleotide (AON)-mediated exon skipping. In this study, we examined the feasibility of AON-mediated exon skipping in vitro in primary cultured keratinocytes and fibroblasts, and systemically in vivo using a human skin-graft mouse model. We show that treatment with AONs designed against exon 105 leads to in-frame exon 105 skipping at the RNA level and restores type VII collagen protein production in vitro. Moreover, we demonstrate that systemic delivery in vivo induces de novo expression of type VII collagen in skin grafts generated from patient cells. Our data demonstrate strong proof-of-concept for AON-mediated exon skipping as a systemic therapeutic strategy for RDEB.

The Ras/Raf signaling pathway is required for progression of mouse embryos through the two-cell stage.

PubMed Central

Yamauchi, N; Kiessling, A A; Cooper, G M

1994-01-01

We have used microinjection of antisense oligonucleotides, monoclonal antibody, and the dominant negative Ras N-17 mutant to interfere with Ras expression and function in mouse oocytes and early embryos. Microinjection of either ras antisense oligonucleotides or anti-Ras monoclonal antibody Y13-259 did not affect normal progression of oocytes through meiosis and arrest at metaphase II. However, microinjection of fertilized eggs with constructs expressing Ras N-17 inhibited subsequent development through the two-cell stage. The inhibitory effect of Ras N-17 was overcome by simultaneous injection of a plasmid expressing an active raf oncogene, indicating that it resulted from interference with the Ras/Raf signaling pathway. In contrast to the inhibition of two-cell embryo development resulting from microinjection of pronuclear stage eggs, microinjection of late two-cell embryos with Ras N-17 expression constructs did not affect subsequent cleavages and development to morulae and blastocysts. It thus appears that the Ras/Raf signaling pathway, presumably activated by autocrine growth factor stimulation, is specifically required at the two-cell stage, which is the time of transition between maternal and embryonic gene expression in mouse embryos. Images PMID:7935384

Similar effects of substance P on learning and memory function between hippocampus and striatal marginal division

PubMed Central

Yu, Yan; Zeng, Changchun; Shu, Siyun; Liu, Xuemei; Li, Chuhua

2014-01-01

Substance P is an endogenous neurokinin that is present in the central and peripheral nervous systems. The neuropeptide substance P and its high-affinity receptor neurokinin 1 receptor are known to play an important role in the central nervous system in inflammation, blood pressure, motor behavior and anxiety. The effects of substance P in the hippocampus and the marginal division of the striatum on memory remain poorly understood. Compared with the hippocampus as a control, immunofluorescence showed high expression of the substance P receptor, neurokinin 1, in the marginal division of the striatum of normal rats. Unilateral or bilateral injection of an antisense oligonucleotide against neurokinin 1 receptor mRNA in the rat hippocampus or marginal division of the striatum effectively reduced neurokinin 1 receptor expression. Independent of injection site, rats that received this antisense oligonucleotide showed obviously increased footshock times in a Y-maze test. These results indicate that the marginal division of the striatum plays a similar function in learning and memory to the hippocampus, which is a valuable addition to our mechanistic understanding of the learning and memory functions of the marginal division of the striatum. PMID:25206901

Synthetic Nucleic Acids and Treatment of Neurological Diseases.

PubMed

Corey, David R

2016-10-01

The ability to control gene expression with antisense oligonucleotides (ASOs) could provide a new treatment strategy for disease. To review the use of ASOs for the treatment of neurological disorders. Articles were identified through a search of PubMed references from 2000 to 2016 for articles describing the use of ASOs to treat disease, with specific attention to neurological disease. We concentrated our review on articles pertaining to activation of frataxin expression (Friedreich's ataxia) and production of active survival motor neuron 2 (SMN2, spinal muscular atrophy). Many neurological diseases are caused by inappropriate expression of a protein. Mutations may reduce expression of a wild-type protein, and strategies to activate expression may provide therapeutic benefit. For other diseases, a mutant protein may be expressed too highly and methods that reduce mutant protein expression might form the basis for drug development. Synthetic ASOs can recognize cellular RNA and control gene expression. Antisense oligonucleotides are not a new concept, but successful clinical development has proceeded at a slow pace. Advances in ASO chemistry, biological understanding, and clinical design are making successful applications more likely. Both laboratory and clinical studies are demonstrating the potential of ASOs as a source of drugs to treat neurological disease.

Anti-sense oligonucleotide therapies for the treatment of hyperlipidaemia.

PubMed

Wierzbicki, Anthony S; Viljoen, Adie

2016-09-01

Anti-sense oligonucleotide (ASO) therapies are a new development in clinical pharmacology offering greater specificity compared to small molecule inhibitors and the ability to target intracellular process' not susceptible to antibody-based therapies. This article reviews the chemical biology of ASOs and related RNA therapeutics. It then reviews the data on their use to treat hyperlipidaemia. Data on mipomersen - an ASO to apolipoprotein B-100(apoB) licensed for treatment of homozygous familial hypercholesterolaemia (FH) is presented. Few effective therapies are available to reduce atehrogenic lipoprotein (a) levels. An ASO therapy to apolipoprotein(a) (ISIS Apo(a)Rx) specifically reduced lipoprotein (a) levels by up to 78%. Treatment options for patients with familial chylomicronaemia syndrome (lipoprotein lipase deficiency; LPLD) or lipodystrophies are highly limited and often inadequate. Volanesorsen, an ASO to apolipoprotein C-3, shows promise in the treatment of LPLD and severe hypertriglyceridaemia as it increases clearance of triglyceride-rich lipoproteins and can normalise triglycerides in these patients. The uptake of the novel ASO therapies is likely to be limited to selected niche groups or orphan diseases. These will include homozygous FH, severe heterozygous FH for mipomersen; LPLD deficiency and lipodystrophy syndromes for volanesorsen and treatment of patients with high elevated Lp(a) levels.

Size-Uniform 200 nm Particles: Fabrication and Application to Magnetofection

PubMed Central

Mair, Lamar; Ford, Kris; Alam, Rowshon; Kole, Ryszard; Fisher, Michael; Superfine, Richard

2009-01-01

We report on the fabrication of arrays of mono- and multimetallic particles via metal evaporation onto lithographically patterned posts, as well as the magnetic force calibration and successful magnetofection of iron particles grown via this method. This work represents the first instance in which metal evaporation onto post structures was used for the formation of released, shape-defined metal particles. Also, our work represents the first use of lithographically defined particles as agents of magnetofection. Using these techniques it is possible to create particles with complex shapes and lateral dimensions as small as 40 nm. Our demonstrated compositionally flexible particles are highly size-uniform due to their photolithographically defined growth substrates, with particle dimensions along two axes fixed at 200 nm; the third axis dimension can be varied from 20 nm to 300 nm during the deposition procedure. Atomic percent of metals incorporated into the particle volume is highly tunable and particles have been synthesized with as many as four different metals. We performed magnetic force calibrations on a single particle size for iron particles using an axially magnetized NeFeB permanent magnet and comparisons are made with commercially available magnetic beads. In order to evalutate their usefulness as magnetofection agents, an antisense oligonucleotide (ODN) designed to correct the aberrant splicing of enhanced green fluorescent protein mRNA, was successfully transfected into a modified HeLa cell line. Magnetically enhanced gene delivery was accomplished in vitro using antisense ODN-laden iron particles followed by application of a field gradient. Magnetically enhanced transfection resulted in a 76% and 139% increase in fluorescence intensity when compared to Lipofectamine and antisense ODN-loaded particles delivered without magnetic treatment, respectively. To our knowledge, these experiments constitute the first use of lithographically defined particles as successful agents for magnetically enhanced transfection of an antisense oligonucleotide. PMID:20055096

Antisense oligonucleotides for the treatment of dyslipidaemia.

PubMed

Visser, Maartje E; Witztum, Joseph L; Stroes, Erik S G; Kastelein, John J P

2012-06-01

Antisense oligonucleotides (ASOs) are short synthetic analogues of natural nucleic acids designed to specifically bind to a target messenger RNA (mRNA) by Watson-Crick hybridization, inducing selective degradation of the mRNA or prohibiting translation of the selected mRNA into protein. Antisense technology has the ability to inhibit unique targets with high specificity and can be used to inhibit synthesis of a wide range of proteins that could influence lipoprotein levels and other targets. A number of different classes of antisense agents are under development. To date, mipomersen, a 2'-O-methoxyethyl phosphorothioate 20-mer ASO, is the most advanced ASO in clinical development. It is a second-generation ASO developed to inhibit the synthesis of apolipoprotein B (apoB)-100 in the liver. In Phase 3 clinical trials, mipomersen has been shown to significantly reduce plasma low-density lipoprotein cholesterol (LDL-c) as well as other atherogenic apoB containing lipoproteins such as lipoprotein (a) [Lp(a)] and small-dense LDL particles. Although concerns have been raised because of an increase in intrahepatic triglyceride content, preliminary data from long-term studies suggest that with continued treatment, liver fat levels tend to stabilize or decline. Further studies are needed to evaluate potential clinical relevance of these changes. Proprotein convertase subtilisin/kexin-9 (PCSK9) is another promising novel target for lowering LDL-c by ASOs. Both second-generation ASOs and ASOs using locked nucleic acid technology have been developed to inhibit PCSK9 and are under clinical development. Other targets currently being addressed include apoC-III and apo(a) or Lp(a). By directly inhibiting the synthesis of specific proteins, ASO technology offers a promising new approach to influence the metabolism of lipids and to control lipoprotein levels. Its application to a wide variety of potential targets can be expected if these agents prove to be clinically safe and effective.

Clinical potential of oligonucleotide-based therapeutics in the respiratory system.

PubMed

Moschos, Sterghios A; Usher, Louise; Lindsay, Mark A

2017-01-01

The discovery of an ever-expanding plethora of coding and non-coding RNAs with nodal and causal roles in the regulation of lung physiology and disease is reinvigorating interest in the clinical utility of the oligonucleotide therapeutic class. This is strongly supported through recent advances in nucleic acids chemistry, synthetic oligonucleotide delivery and viral gene therapy that have succeeded in bringing to market at least three nucleic acid-based drugs. As a consequence, multiple new candidates such as RNA interference modulators, antisense, and splice switching compounds are now progressing through clinical evaluation. Here, manipulation of RNA for the treatment of lung disease is explored, with emphasis on robust pharmacological evidence aligned to the five pillars of drug development: exposure to the appropriate tissue, binding to the desired molecular target, evidence of the expected mode of action, activity in the relevant patient population and commercially viable value proposition. Copyright © 2016 Elsevier Inc. All rights reserved.

Rescue of peripheral vestibular function in Usher syndrome mice using a splice-switching antisense oligonucleotide.

PubMed

Vijayakumar, Sarath; Depreux, Frederic F; Jodelka, Francine M; Lentz, Jennifer J; Rigo, Frank; Jones, Timothy A; Hastings, Michelle L

2017-09-15

Usher syndrome type 1C (USH1C/harmonin) is associated with profound retinal, auditory and vestibular dysfunction. We have previously reported on an antisense oligonucleotide (ASO-29) that dramatically improves auditory function and balance behavior in mice homozygous for the harmonin mutation Ush1c c.216G > A following a single systemic administration. The findings were suggestive of improved vestibular function; however, no direct vestibular assessment was made. Here, we measured vestibular sensory evoked potentials (VsEPs) to directly assess vestibular function in Usher mice. We report that VsEPs are absent or abnormal in Usher mice, indicating profound loss of vestibular function. Strikingly, Usher mice receiving ASO-29 treatment have normal or elevated vestibular response thresholds when treated during a critical period between postnatal day 1 and 5, respectively. In contrast, treatment of mice with ASO-29 treatment at P15 was minimally effective at rescuing vestibular function. Interestingly, ASO-29 treatment at P1, P5 or P15 resulted in sufficient vestibular recovery to support normal balance behaviors, suggesting a therapeutic benefit to balance with ASO-29 treatment at P15 despite the profound vestibular functional deficits that persist with treatment at this later time. These findings provide the first direct evidence of an effective treatment of peripheral vestibular function in a mouse model of USH1C and reveal the potential for using antisense technology to treat vestibular dysfunction. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3;-terminus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yeo, Hyun Koo; Lee, Jae Young

2012-04-18

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapor diffusion and diffracted to 2.8 {angstrom} resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 {angstrom}, {alpha} = 91.37, {beta} = 93.21, {gamma} = 92.35{sup o}.

Crystallization and preliminary X-ray diffraction analysis of a self-complementary DNA heptacosamer with a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus.

PubMed

Yeo, Hyun Koo; Lee, Jae Young

2010-05-01

The self-complementary DNA heptacosamer (a 27-mer oligonucleotide) with sequence d(CGAGCACTGCGCAGTGCTCGTTGTTAT) forms a 20-base-pair duplex flanked by seven-nucleotide overhangs at the 3'-terminus. Crystals of the oligonucleotide were obtained by sitting-drop vapour diffusion and diffracted to 2.8 A resolution. The oligonucleotide was crystallized at 277 K using polyethylene glycol as a precipitant in the presence of magnesium chloride. The crystals belonged to the triclinic space group, with unit-cell parameters a = 48.74, b = 64.23, c = 79.34 A, alpha = 91.37, beta = 93.21, gamma = 92.35 degrees .

Antisense antibiotics: a brief review of novel target discovery and delivery.

PubMed

Bai, Hui; Xue, Xiaoyan; Hou, Zheng; Zhou, Ying; Meng, Jingru; Luo, Xiaoxing

2010-06-01

The nightmare of multi-drug resistant bacteria will still haunt if no panacea is ever found. Efforts on seeking desirable natural products with bactericidal property and screening chemically modified derivatives of traditional antibiotics have lagged behind the emergence of new multi-drug resistant bacteria. The concept of using antisense antibiotics, now as revolutionary as is on threshold has experienced ups and downs in the past decade. In the past five years, however, significant technology advances in the fields of microbial genomics, structural modification of oligonucleotides and efficient delivery system have led to fundamental progress in the research and in vivo application of this paradigm. The wealthy information provided in the microbial genomics era has allowed the identification and/or validation of a number of essential genes that may serve as possible targets for antisense inhibition; antisense oligodeoxynucleotides (ODNs) based on the 3rd generation of modified structures, e.g., peptide nucleic acids (PNAs) and phosphorodiamidate morpholino oligomers (PMOs) have shown great potency in gene expression inhibition in a sequence-specific and dosedependent manner at low micromolar concentrations; and cell penetrating peptide mediated delivery system has enabled the effective display of intracellular antisense inhibition of targeted genes both in vitro and in vivo. The new methods show promise in the discovery of novel gene-specific antisense antibiotics that will be useful in the future battle against drug-resistant bacterial infections. This review describes this promising paradigm, the targets that have been identified and the recent technologies on which it is delivered.

Using microRNA as an alternative treatment for hyperlipidemia and cardiovascular disease: cardio-miRs in the pipeline.

PubMed

Hennessy, Elizabeth J; Moore, Kathryn J

2013-09-01

It is now appreciated that over 90% of the human genome is comprised of noncoding RNAs that have the ability to affect other components of the genome and regulate gene expression. This has galvanized the development of RNA-based therapeutics for a myriad of diseases, including cancer, inflammatory conditions, and cardiovascular disease. Several classes of RNA therapeutics are currently under clinical development, including antisense oligonucleotides, small interfering RNA, and microRNA mimetics and inhibitors. The field of antisense technology saw a huge leap forward with the recent Food and Drug Administration approval of the first antisense therapy, directed against apolipoprotein B, for the treatment of familial hypercholesterolemia. In addition, recent progress in the development of approaches to inhibit microRNAs has helped to illuminate their roles in repressing gene networks and also revealed their potential as therapeutic targets. In this review, these exciting opportunities in the field of drug discovery, with a focus on emerging therapeutics in the field of cardiovascular disease, are summarized.

Antisense inhibition of proprotein convertase subtilisin/kexin type 9 reduces serum LDL in hyperlipidemic mice.

PubMed

Graham, Mark J; Lemonidis, Kristina M; Whipple, Charles P; Subramaniam, Amuthakannan; Monia, Brett P; Crooke, Stanley T; Crooke, Rosanne M

2007-04-01

Proprotein convertase subtilisin/kexin type 9 (PCSK9) is a member of a family of proteases that is thought to promote the degradation of the low density lipoprotein receptor (LDLR) through an as yet undefined mechanism. We developed second generation antisense oligonucleotide (ASO) inhibitors targeting murine PCSK9 to determine their potential as lipid-lowering agents. Administration of a PCSK9 ASO to high fat-fed mice for 6 weeks reduced total cholesterol and LDL by 53% and 38%, respectively. Moreover, inhibition of PCSK9 expression resulted in a 2-fold increase in hepatic LDLR protein levels. This phenotype closely resembles that reported previously in Pcsk9-deficient mice. The absence of cholesterol lowering in Ldlr-deficient mice effectively demonstrated a critical role for this receptor in mediating the lipid-lowering effects of PCSK9 inhibition. Antisense inhibition of PCSK9 is an attractive and novel therapeutic approach for treating hypercholesterolemia in human.

Clinical pharmacological properties of mipomersen (Kynamro), a second generation antisense inhibitor of apolipoprotein B

PubMed Central

Crooke, Stanley T; Geary, Richard S

2013-01-01

Mipomersen is a second generation antisense oligonucleotide that targets apolipoprotein B. It has been studied thoroughly in clinical trials (more than 800 subjects), including four randomized double-blind placebo controlled phase 3 studies involving 391 patients, and is in registration for the treatment of severe hypercholesterolaemia. The pharmacokinetic and pharmacodynamic properties of mipomersen are well characterized. Mipomersen is rapidly and extensively absorbed after subcutaneous administration and has an elimination half-life of approximately 30 days across species. It is cleared by nuclease metabolism and renal excretion of the metabolites. Mipomersen reduces all apolipoprotein B containing atherogenic particles and displays dose dependent reductions between 50–400 mg week−1, both as a single agent and in the presence of maximal lipid lowering therapy. No drug–drug interactions have been identified. Mipomersen is a representative of second generation antisense drugs, all of which have similar properties, and is thus representative of the behaviour of the class of drugs. PMID:23013161

Antiviral effects of herpes simplex virus specific anti-sense nucleic acids.

PubMed

Cantin, E M; Podsakoff, G; Willey, D E; Openshaw, H

1992-01-01

We have targeted mRNA sequences encompassing the translation initiation codon of the essential herpes simplex virus type 1 (HSV-1) IE3 gene with three kinds of anti-sense molecule. Addition of a 15mer oligodeoxyribonucleoside methylphosphonate to tissue culture cells resulted in suppression of viral replication. HSV-1 replication was also inhibited in cultured cells containing anti-sense vectors expressing transcripts complementary to the IE3 mRNA. We have also constructed a ribozyme which upon base pairing with the target IE3 mRNA induces cleavage at the predicted GUC site. A major obstacle to anti-sense studies in animals is drug delivery of preformed antisense molecules to ganglionic neurons, the site of HSV latency and reactivation. We speculate as to how this may be accomplished through carrier compounds which are taken up by nerve terminals and transported by retrograde axoplasmic flow. By the same route, HSV itself may be used as an anti-sense vector.

Sense-antisense (complementary) peptide interactions and the proteomic code; potential opportunities in biology and pharmaceutical science.

PubMed

Miller, Andrew D

2015-02-01

A sense peptide can be defined as a peptide whose sequence is coded by the nucleotide sequence (read 5' → 3') of the sense (positive) strand of DNA. Conversely, an antisense (complementary) peptide is coded by the corresponding nucleotide sequence (read 5' → 3') of the antisense (negative) strand of DNA. Research has been accumulating steadily to suggest that sense peptides are capable of specific interactions with their corresponding antisense peptides. Unfortunately, although more and more examples of specific sense-antisense peptide interactions are emerging, the very idea of such interactions does not conform to standard biology dogma and so there remains a sizeable challenge to lift this concept from being perceived as a peripheral phenomenon if not worse, into becoming part of the scientific mainstream. Specific interactions have now been exploited for the inhibition of number of widely different protein-protein and protein-receptor interactions in vitro and in vivo. Further, antisense peptides have also been used to induce the production of antibodies targeted to specific receptors or else the production of anti-idiotypic antibodies targeted against auto-antibodies. Such illustrations of utility would seem to suggest that observed sense-antisense peptide interactions are not just the consequence of a sequence of coincidental 'lucky-hits'. Indeed, at the very least, one might conclude that sense-antisense peptide interactions represent a potentially new and different source of leads for drug discovery. But could there be more to come from studies in this area? Studies on the potential mechanism of sense-antisense peptide interactions suggest that interactions may be driven by amino acid residue interactions specified from the genetic code. If so, such specified amino acid residue interactions could form the basis for an even wider amino acid residue interaction code (proteomic code) that links gene sequences to actual protein structure and function, even entire genomes to entire proteomes. The possibility that such a proteomic code should exist is discussed. So too the potential implications for biology and pharmaceutical science are also discussed were such a code to exist.

Phase I study of liposome-encapsulated c-raf antisense oligodeoxyribonucleotide infusion in combination with radiation therapy in patients with advanced malignancies.

PubMed

Dritschilo, Anatoly; Huang, Chao H; Rudin, Charles M; Marshall, John; Collins, Brian; Dul, Jeanne L; Zhang, Chuanbo; Kumar, Deepak; Gokhale, Prafulla C; Ahmad, Ateeq; Ahmad, Imran; Sherman, Jeffrey W; Kasid, Usha N

2006-02-15

Raf proteins are key elements of growth-related cellular signaling pathways and are a component of cancer cell resistance to radiation therapy. Antisense oligonucleotides to c-raf-1 permit highly selective inhibition of the gene product and offer a strategy for sensitizing cancer cells to radiation therapy. In this dose escalation study, we evaluated the safety of combined liposomal formulation of raf antisense oligonucleotide (LErafAON) and radiation therapy in patients with advanced malignancies. Patients with advanced solid tumors were treated with LErafAON in a phase I dose escalation study while receiving palliative radiation therapy. Drug-related and radiation-related toxicities were monitored. Pharmacokinetics and expression of c-raf-1 mRNA and Raf-1 protein were determined in peripheral blood mononuclear cells. Seventeen patients with palliative indications for radiation therapy were entered into this study. Thirteen patients received daily infusions of LErafAON and four received twice-weekly infusions. Radiation therapy was delivered in daily 300-cGy fractions over 2 weeks. Patients tolerated radiation, and no unexpected radiation-related side effects were observed. Drug-related reactions (grade > or =2), such as back pain, chills, dyspnea, fatigue, fever, flushing, and hypertension, were observed in most patients and were managed by premedication with corticosteroids and antihistamines. Serious adverse events occurred in five patients, including acute infusion-related symptoms, abnormal liver function tests, hypoxia, dehydration, diarrhea, esophagitis, fever, hypokalemia, pharyngitis, and tachypnea. Twelve of 17 patients were evaluable for tumor response at completion of treatment; four showed partial response, four showed stable disease, and four experienced progressive disease. The intact rafAON was detected in plasma for 30 minutes to several hours. Six patients with partial response or stable disease were evaluable for c-raf-1 mRNA and/or Raf-1 protein expression. Inhibition of c-raf-1 mRNA was observed in three of five patients. Raf-1 protein was inhibited in four of five patients. This is the first report of the combined modality treatment using antisense oligonucleotides with radiation therapy in patients with advanced cancer. A dose of 2.0 mg/kg of LErafAON administered twice weekly is tolerated with premedication and does not enhance radiation toxicity in patients. The observation of dose-dependent, infusion-related reactions has led to further modification of the liposomal composition for use in future clinical trials.

Selective Androgen Receptor Downregulators (SARDs): A New Prostate Cancer Therapy

DTIC Science & Technology

2006-10-01

of the androgen receptor messenger RNA and functional inhibition of androgen receptor activity by a hammerhead ribozyme . Mol Endocrinol, 12: 1558...cleavage of the androgen receptor messenger RNA and functional inhibition of androgen receptor activity by a hammerhead ribozyme . Mol Endocrinol...used to down-regulate the AR include antisense oligonucleotides (9, 10), ribozyme treatments (11, 12), AR dominant negatives (13) and small

Understanding RNA-Chromatin Interactions Using Chromatin Isolation by RNA Purification (ChIRP).

PubMed

Chu, Ci; Chang, Howard Y

2016-01-01

ChIRP is a novel and easy-to-use technique for studying long noncoding RNA (lncRNA)-chromatin interactions. RNA and chromatin are cross-linked in vivo using formaldehyde or glutaraldehyde, and purified using biotinylated antisense oligonucleotides that hybridize to the target RNA. Co-precipitated DNA is then purified and analyzed by quantitative PCR (qPCR) or high-throughput sequencing.

Development of siRNA Technology to Prevent Scar Formation in Tendon Repair

DTIC Science & Technology

2012-10-01

that inhibit protein synthesis and stimulate catabolism of target RNAs 1,2. This general concept can be harnessed experimentally and therapeutically...numerous mechanisms, including stimulation of fibroblast proliferation and migration, collagen and fibronectin synthesis , and altered tissue remodeling...antisense oligonucleotide protects mice from fulminant hepatitis. Nat Biotechnol 2000;18:862-7. 7. Guha M, Xu ZG, Tung D, Lanting L, Natarajan R

Antisense oligonucleotide-mediated correction of transcriptional dysregulation is correlated with behavioral benefits in the YAC128 mouse model of Huntington's disease.

PubMed

Stanek, Lisa M; Yang, Wendy; Angus, Stuart; Sardi, Pablo S; Hayden, Michael R; Hung, Gene H; Bennett, C Frank; Cheng, Seng H; Shihabuddin, Lamya S

2013-01-01

Huntington's disease (HD) is a neurological disorder caused by mutations in the huntingtin (HTT) gene, the product of which leads to selective and progressive neuronal cell death in the striatum and cortex. Transcriptional dysregulation has emerged as a core pathologic feature in the CNS of human and animal models of HD. It is still unclear whether perturbations in gene expression are a consequence of the disease or importantly, contribute to the pathogenesis of HD. To examine if transcriptional dysregulation can be ameliorated with antisense oligonucleotides that reduce levels of mutant Htt and provide therapeutic benefit in the YAC128 mouse model of HD. Quantitative real-time PCR analysis was used to evaluate dysregulation of a subset of striatal genes in the YAC128 mouse model. Transcripts were then evaluated following ICV delivery of antisense oligonucleotides (ASO). Rota rod and Porsolt swim tests were used to evaluate phenotypic deficits in these mice following ASO treatment. Transcriptional dysregulation was detected in the YAC128 mouse model and appears to progress with age. ICV delivery of ASOs directed against mutant Htt resulted in reduction in mutant Htt levels and amelioration in behavioral deficits in the YAC128 mouse model. These improvements were correlated with improvements in the levels of several dysregulated striatal transcripts. The role of transcriptional dysregulation in the pathogenesis of Huntington's disease is not well understood, however, a wealth of evidence now strongly suggests that changes in transcriptional signatures are a prominent feature in the brains of both HD patients and animal models of the disease. Our study is the first to show that a therapeutic agent capable of improving an HD disease phenotype is concomitantly correlated with normalization of a subset of dysregulated striatal transcripts. Our data suggests that correction of these disease-altered transcripts may underlie, at least in part, the therapeutic efficacy shown associated with ASO-mediated correction of HD phenotypes and may provide a novel set of early biomarkers for evaluating future therapeutic concepts for HD.

Comparison of three techniques for generation of tolerogenic dendritic cells: siRNA, oligonucleotide antisense, and antibody blocking.

PubMed

Karimi, Mohammad Hossein; Ebadi, Padideh; Pourfathollah, Ali Akbar; Moazzeni, Mohammad; Soheili, Zahra Soheila; Samiee, Shahram

2010-12-01

In recent years, a new view of dendritic cells (DCs) as a main regulator of immunity to induce and maintain tolerance has been established. In vitro manipulation of their development and maturation is a topic of DC therapeutic application, which utilizes their inherent tolerogenicity. In this field, the therapeutic potential of antisense, siRNA, and blocking antibody are an interesting goal. In the present study, the efficiency of these three methods--siRNA, antisense, and blocking antibody--against CD40 molecule and its function in DCs and BCL1 cell line are compared. DCs were separated from mouse spleen and then cultured in vitro using Lipofectamine 2000 to deliver both silencers; the efficacy of transfection was estimated by flow cytometry. mRNA expression and protein synthesis were assessed by real time-PCR and flow cytometry, respectively. By Annexin V and propidium iodine staining, we could evaluate the viability of transfected cells. Knocking down the CD40 gene into separate groups of DCs by siRNA, antisense, and blocking antibody treated DCs can cause an increase in IL-4, decrease in IL-12, IFN-γ production, and allostimulation activity. Our results indicated that, in comparison to antisense and blocking antibody, siRNAs appear to be quantitatively more efficient in CD40 downregulation and their differences are significant.

Oligonucleotides Containing Aminated 2'-Amino-LNA Nucleotides: Synthesis and Strong Binding to Complementary DNA and RNA.

PubMed

Lou, Chenguang; Samuelsen, Simone V; Christensen, Niels Johan; Vester, Birte; Wengel, Jesper

2017-04-19

Mono- and diaminated 2'-amino-LNA monomers were synthesized and introduced into oligonucleotides. Each modification imparts significant stabilization of nucleic acid duplexes and triplexes, excellent sequence selectivity, and significant nuclease resistance. Molecular modeling suggested that structural stabilization occurs via intrastrand electrostatic attraction between the protonated amino groups of the aminated 2'-amino-LNA monomers and the host oligonucleotide backbone.

Lack of pharmacokinetic interaction for ISIS 113715, a 2'-0-methoxyethyl modified antisense oligonucleotide targeting protein tyrosine phosphatase 1B messenger RNA, with oral antidiabetic compounds metformin, glipizide or rosiglitazone.

PubMed

Geary, Richard S; Bradley, JoAnn D; Watanabe, Tanya; Kwon, Younggil; Wedel, Mark; van Lier, Jan J; VanVliet, André A

2006-01-01

ISIS 113715 is a 20-mer phosphorothioate antisense oligonucleotide (ASO) that is complementary to the protein tyrosine phosphatase 1B (PTP-1B) messenger RNA and subsequently reduces translation of the PTP-1B protein, a negative regulator of insulin receptor. ISIS 113715 is currently being studied in early phase II clinical studies to determine its ability to improve or restore insulin receptor sensitivity in patients with type 2 diabetes mellitus. Future work will investigate the combination of ISIS 113715 with antidiabetic compounds. In vitro ultrafiltration human plasma protein binding displacement studies and a phase I clinical study were used to characterise the potential for pharmacokinetic interaction of ISIS 113715 and three marketed oral antidiabetic agents. ISIS 113715 was co-incubated with glipizide and rosiglitazone in whole human plasma and tested for increased free drug concentrations. In a phase I clinical study, 23 healthy volunteers received a single oral dose of an antidiabetic compound (either metformin, glipizide or rosiglitazone) both alone and together with subcutaneous ISIS 113715 200 mg in a sequential crossover design. A comparative pharmacokinetic analysis was performed to determine if there were any effects that resulted from coadministration of ISIS 113715 with these antidiabetic compounds. In vitro human plasma protein binding displacement studies showed only minor effects on rosiglitazone and no effect on glipizide when co-incubated with ISIS 113715. The results of the phase I clinical study further indicate that there were no measurable changes in glipizide (5 mg), metformin (500 mg) or rosiglitazone (2 mg) exposure parameters, maximum plasma concentration and the area under the concentration-time curve, or pharmacokinetic parameter, elimination half-life when coadministered with ISIS 113715. Furthermore, there was no effect of ISIS 113715, administered in combination with metformin, on the urinary excretion of metformin. Conversely, there were no observed alterations in ISIS 113715 pharmacokinetics when administered in combination with any of the oral antidiabetic compounds. These data provide evidence that ISIS 113715 exhibits no clinically relevant pharmacokinetic interactions on the disposition and clearance of the oral antidiabetic drugs. The results of these studies support further study of ISIS 113715 in combination with antidiabetic compounds.

In vitro and in vivo inhibition of proangiogenic retinal phenotype by an antisense oligonucleotide downregulating uPAR expression.

PubMed

Lulli, Matteo; Cammalleri, Maurizio; Granucci, Irene; Witort, Ewa; Bono, Silvia; Di Gesualdo, Federico; Lupia, Antonella; Loffredo, Rosa; Casini, Giovanni; Dal Monte, Massimo; Capaccioli, Sergio

2017-08-26

Neoangiogenesis is the main pathogenic event involved in a variety of retinal diseases. It has been recently demonstrated that inhibiting the urokinase-type plasminogen activator receptor (uPAR) results in reduced angiogenesis in a mouse model of oxygen-induced retinopathy (OIR), establishing uPAR as a therapeutic target in proliferative retinopathies. Here, we evaluated in cultured human retinal endothelial cells (HRECs) and in OIR mice the potential of a specific antisense oligodeoxyribonucleotide (ASO) in blocking the synthesis of uPAR and in providing antiangiogenic effects. uPAR expression in HRECs was inhibited by lipofection with the phosphorotioated 5'-CGGCGGGTGACCCATGTG-3' ASO-uPAR, complementary to the initial translation site of uPAR mRNA. Inhibition of uPAR expression via ASO-uPAR was evaluated in HRECs by analyzing VEGF-induced tube formation and migration. In addition, the well-established and reproducible murine OIR model was used to induce retinal neovascularization in vivo. OIR mice were injected intraperitoneally with ASO-uPAR and retinopathy was evaluated considering the extent of the avascular area in the central retina and neovascular tuft formation. The ASO-uPAR specifically decreased uPAR mRNA and protein levels in HRECs and mitigated VEGF-induced tube formation and cell migration. Noteworthy, in OIR mice ASO-uPAR administration reduced both the avascular area and the formation of neovascular tufts. In conclusion, although the extrapolation of these experimental findings to the clinic is not straightforward, ASO-uPAR may be considered a potential therapeutic tool for treatment of proliferative retinal diseases. Copyright © 2017 Elsevier Inc. All rights reserved.

Systemic peptide-mediated oligonucleotide therapy improves long-term survival in spinal muscular atrophy

PubMed Central

Hazell, Gareth; Shabanpoor, Fazel; Saleh, Amer F.; Bowerman, Melissa; Meijboom, Katharina E.; Zhou, Haiyan; Muntoni, Francesco; Talbot, Kevin; Gait, Michael J.; Wood, Matthew J. A.

2016-01-01

The development of antisense oligonucleotide therapy is an important advance in the identification of corrective therapy for neuromuscular diseases, such as spinal muscular atrophy (SMA). Because of difficulties of delivering single-stranded oligonucleotides to the CNS, current approaches have been restricted to using invasive intrathecal single-stranded oligonucleotide delivery. Here, we report an advanced peptide-oligonucleotide, Pip6a-morpholino phosphorodiamidate oligomer (PMO), which demonstrates potent efficacy in both the CNS and peripheral tissues in severe SMA mice following systemic administration. SMA results from reduced levels of the ubiquitously expressed survival motor neuron (SMN) protein because of loss-of-function mutations in the SMN1 gene. Therapeutic splice-switching oligonucleotides (SSOs) modulate exon 7 splicing of the nearly identical SMN2 gene to generate functional SMN protein. Pip6a-PMO yields SMN expression at high efficiency in peripheral and CNS tissues, resulting in profound phenotypic correction at doses an order-of-magnitude lower than required by standard naked SSOs. Survival is dramatically extended from 12 d to a mean of 456 d, with improvement in neuromuscular junction morphology, down-regulation of transcripts related to programmed cell death in the spinal cord, and normalization of circulating insulin-like growth factor 1. The potent systemic efficacy of Pip6a-PMO, targeting both peripheral as well as CNS tissues, demonstrates the high clinical potential of peptide-PMO therapy for SMA. PMID:27621445

Antisense oligonucleotide against GSK-3β in brain of SAMP8 mice improves learning and memory and decreases oxidative stress: Involvement of transcription factor Nrf2 and implications for Alzheimer disease.

PubMed

Farr, Susan A; Ripley, Jessica L; Sultana, Rukhsana; Zhang, Zhaoshu; Niehoff, Michael L; Platt, Thomas L; Murphy, M Paul; Morley, John E; Kumar, Vijaya; Butterfield, D Allan

2014-02-01

Glycogen synthase kinase (GSK)-3β is a multifunctional protein that has been implicated in the pathological characteristics of Alzheimer's disease (AD), including the heightened levels of neurofibrillary tangles, amyloid-beta (Aβ), and neurodegeneration. In this study we used 12-month-old SAMP8 mice, an AD model, to examine the effects GSK-3β may cause regarding the cognitive impairment and oxidative stress associated with AD. To suppress the level of GSK-3β, SAMP8 mice were treated with an antisense oligonucleotide (GAO) directed at this kinase. We measured a decreased level of GSK-3β in the cortex of the mice, indicating the success of the antisense treatment. Learning and memory assessments of the SAMP8 mice were tested post-antisense treatment using an aversive T-maze and object recognition test, both of which observably improved. In cortex samples of the SAMP8 mice, decreased levels of protein carbonyl and protein-bound HNE were measured, indicating decreased oxidative stress. Nuclear factor erythroid-2-related factor 2 (Nrf2) is a transcription factor known to increase the level of many antioxidants, including glutathione-S transferase (GST), and is negatively regulated by the activity of GSK-3β. Our results indicated the increased nuclear localization of Nrf2 and level of GST, suggesting the increased activity of the transcription factor as a result of GSK-3β suppression, consistent with the decreased oxidative stress observed. Consistent with the improved learning and memory, and consistent with GSK-3b being a tau kinase, we observed decreased tau phosphorylation in brain of GAO-treated SAMP8 mice compared to that of RAO-treated SAMP8 mice. Lastly, we examined the ability of GAO to cross the blood-brain barrier and determined it to be possible. The results presented in this study demonstrate that reducing GSK-3 with a phosphorothionated antisense against GSK-3 improves learning and memory, reduces oxidative stress, possibly coincident with increased levels of the antioxidant transcriptional activity of Nrf2, and decreases tau phosphorylation. Our study supports the notion of GAO as a possible treatment for AD. Copyright © 2013 Elsevier Inc. All rights reserved.

Modulation of tumor eIF4E by antisense inhibition: A phase I/II translational clinical trial of ISIS 183750-an antisense oligonucleotide against eIF4E-in combination with irinotecan in solid tumors and irinotecan-refractory colorectal cancer.

PubMed

Duffy, A G; Makarova-Rusher, O V; Ulahannan, S V; Rahma, O E; Fioravanti, S; Walker, M; Abdullah, S; Raffeld, M; Anderson, V; Abi-Jaoudeh, N; Levy, E; Wood, B J; Lee, S; Tomita, Y; Trepel, J B; Steinberg, S M; Revenko, A S; MacLeod, A R; Peer, C J; Figg, W D; Greten, T F

2016-10-01

The eukaryotic translation initiation factor 4E (eIF4E) is a potent oncogene that is found to be dysregulated in 30% of human cancer, including colorectal carcinogenesis (CRC). ISIS 183750 is a second-generation antisense oligonucleotide (ASO) designed to inhibit the production of the eIF4E protein. In preclinical studies we found that EIF4e ASOs reduced expression of EIF4e mRNA and inhibited proliferation of colorectal carcinoma cells. An additive antiproliferative effect was observed in combination with irinotecan. We then performed a clinical trial evaluating this combination in patients with refractory cancer. No dose-limiting toxicities were seen but based on pharmacokinetic data and tolerability the dose of irinotecan was reduced to 160 mg/m(2) biweekly. Efficacy was evaluated in 15 patients with irinotecan-refractory colorectal cancer. The median time of disease control was 22.1 weeks. After ISIS 183750 treatment, peripheral blood levels of eIF4E mRNA were decreased in 13 of 19 patients. Matched pre- and posttreatment tumor biopsies showed decreased eIF4E mRNA levels in five of nine patients. In tumor tissue, the intracellular and stromal presence of ISIS 183750 was detected by IHC in all biopsied patients. Although there were no objective responses stable disease was seen in seven of 15 (47%) patients who were progressing before study entry, six of whom were stable at the time of the week 16 CT scan. We were also able to confirm through mandatory pre- and posttherapy tumor biopsies penetration of the ASO into the site of metastasis. © 2016 UICC.

External Guide Sequences Targeting the aac(6′)-Ib mRNA Induce Inhibition of Amikacin Resistance▿

PubMed Central

Bistué, Alfonso J. C. Soler; Ha, Hongphuc; Sarno, Renee; Don, Michelle; Zorreguieta, Angeles; Tolmasky, Marcelo E.

2007-01-01

The dissemination of AAC(6′)-I-type acetyltransferases have rendered amikacin and other aminoglycosides all but useless in some parts of the world. Antisense technologies could be an alternative to extend the life of these antibiotics. External guide sequences are short antisense oligoribonucleotides that induce RNase P-mediated cleavage of a target RNA by forming a precursor tRNA-like complex. Thirteen-nucleotide external guide sequences complementary to locations within five regions accessible for interaction with antisense oligonucleotides in the mRNA that encodes AAC(6′)-Ib were analyzed. While small variations in the location targeted by different external guide sequences resulted in big changes in efficiency of binding to native aac(6′)-Ib mRNA, most of them induced high levels of RNase P-mediated cleavage in vitro. Recombinant plasmids coding for selected external guide sequences were introduced into Escherichia coli harboring aac(6′)-Ib, and the transformant strains were tested to determine their resistance to amikacin. The two external guide sequences that showed the strongest binding efficiency to the mRNA in vitro, EGSC3 and EGSA2, interfered with expression of the resistance phenotype at different degrees. Growth curve experiments showed that E. coli cells harboring a plasmid coding for EGSC3, the external guide sequence with the highest mRNA binding affinity in vitro, did not grow for at least 300 min in the presence of 15 μg of amikacin/ml. EGSA2, which had a lower mRNA-binding affinity in vitro than EGSC3, inhibited the expression of amikacin resistance at a lesser level; growth of E. coli harboring a plasmid coding for EGSA2, in the presence of 15 μg of amikacin/ml was undetectable for 200 min but reached an optical density at 600 nm of 0.5 after 5 h of incubation. Our results indicate that the use of external guide sequences could be a viable strategy to preserve the efficacy of amikacin. PMID:17387154

Alteration of hairpin ribozyme specificity utilizing PCR.

PubMed

DeGrandis, P; Hampel, A; Galasinski, S; Borneman, J; Siwkowski, A; Altschuler, M

1994-12-01

We have developed a method by which a researcher can quickly alter the specificity of a trans hairpin ribozyme. Utilizing this PCR method, two oligonucleotides, and any target vector, new ribozyme template sequences can be generated without the synthesis of longer oligonucleotides. We have produced templates with altered specificity for both standard and modified (larger) ribozymes. After transcription, these ribozymes show specific cleavage activity with the new substrate beta-glucuronidase (GUS), and no activity against the original substrate (HIV-1, 5' leader sequence). Utilizing this technique, it is also possible to produce an inactive ribozyme that can be used as an antisense control. Applications of this procedure would provide a rapid and economical system for the assessment of trans ribozyme activity.

DNA enzymes as potential therapeutics: towards clinical application of 10-23 DNAzymes.

PubMed

Fokina, Alesya A; Stetsenko, Dmitry A; François, Jean-Christophe

2015-05-01

Ongoing studies on the inhibition of gene expression at the mRNA level have identified several types of specific inhibitors such as antisense oligonucleotides, small interfering RNA, ribozymes and DNAzymes (Dz). After its discovery in 1997, the 10-23 Dz (which can cleave RNA efficiently and site-specifically, has flexible design, is independent from cell mechanisms, does not require expensive chemical modifications for effective use in vivo) has been employed to downregulate a range of therapeutically important genes. Recently, 10-23 Dzs have taken their first steps into clinical trials. This review focuses predominantly on Dz applications as potential antiviral, antibacterial, anti-cancer and anti-inflammatory agents as well as for the treatment of cardiovascular disease and diseases of CNS, summarizing results of their clinical trials up to the present day. In comparison with antisense oligonucleotides and small interfering RNAs, Dzs do not usually show off-target effects due to their high specificity and lack of immunogenicity in vivo. As more results of clinical trials carried out so far are gradually becoming available, Dzs may turn out to be safe and well-tolerated therapeutics in humans. Therefore, there is a good chance that we may witness a deoxyribozyme drug reaching the clinic in the near future.

RNA splicing process analysis for identifying antisense oligonucleotide inhibitors with padlock probe-based isothermal amplification† †Electronic supplementary information (ESI) available: Additional experimental materials, methods, DNA sequences and supplementary figures and tables. See DOI: 10.1039/c7sc01336a Click here for additional data file.

PubMed Central

Ren, Xiaojun; Deng, Ruijie; Wang, Lida; Zhang, Kaixiang

2017-01-01

RNA splicing, which mainly involves two transesterification steps, is a fundamental process of gene expression and its abnormal regulation contributes to serious genetic diseases. Antisense oligonucleotides (ASOs) are genetic control tools that can be used to specifically control genes through alteration of the RNA splicing pathway. Despite intensive research, how ASOs or various other factors influence the multiple processes of RNA splicing still remains obscure. This is largely due to an inability to analyze the splicing efficiency of each step in the RNA splicing process with high sensitivity. We addressed this limitation by introducing a padlock probe-based isothermal amplification assay to achieve quantification of the specific products in different splicing steps. With this amplified assay, the roles that ASOs play in RNA splicing inhibition in the first and second steps could be distinguished. We identified that 5′-ASO could block RNA splicing by inhibiting the first step, while 3′-ASO could block RNA splicing by inhibiting the second step. This method provides a versatile tool for assisting efficient ASO design and discovering new splicing modulators and therapeutic drugs. PMID:28989608

Reengineering a transmembrane protein to treat muscular dystrophy using exon skipping.

PubMed

Gao, Quan Q; Wyatt, Eugene; Goldstein, Jeff A; LoPresti, Peter; Castillo, Lisa M; Gazda, Alec; Petrossian, Natalie; Earley, Judy U; Hadhazy, Michele; Barefield, David Y; Demonbreun, Alexis R; Bönnemann, Carsten; Wolf, Matthew; McNally, Elizabeth M

2015-11-02

Exon skipping uses antisense oligonucleotides as a treatment for genetic diseases. The antisense oligonucleotides used for exon skipping are designed to bypass premature stop codons in the target RNA and restore reading frame disruption. Exon skipping is currently being tested in humans with dystrophin gene mutations who have Duchenne muscular dystrophy. For Duchenne muscular dystrophy, the rationale for exon skipping derived from observations in patients with naturally occurring dystrophin gene mutations that generated internally deleted but partially functional dystrophin proteins. We have now expanded the potential for exon skipping by testing whether an internal, in-frame truncation of a transmembrane protein γ-sarcoglycan is functional. We generated an internally truncated γ-sarcoglycan protein that we have termed Mini-Gamma by deleting a large portion of the extracellular domain. Mini-Gamma provided functional and pathological benefits to correct the loss of γ-sarcoglycan in a Drosophila model, in heterologous cell expression studies, and in transgenic mice lacking γ-sarcoglycan. We generated a cellular model of human muscle disease and showed that multiple exon skipping could be induced in RNA that encodes a mutant human γ-sarcoglycan. Since Mini-Gamma represents removal of 4 of the 7 coding exons in γ-sarcoglycan, this approach provides a viable strategy to treat the majority of patients with γ-sarcoglycan gene mutations.

Chimeric Antisense Oligonucleotide Conjugated to α-Tocopherol

PubMed Central

Nishina, Tomoko; Numata, Junna; Nishina, Kazutaka; Yoshida-Tanaka, Kie; Nitta, Keiko; Piao, Wenying; Iwata, Rintaro; Ito, Shingo; Kuwahara, Hiroya; Wada, Takeshi; Mizusawa, Hidehiro; Yokota, Takanori

2015-01-01

We developed an efficient system for delivering short interfering RNA (siRNA) to the liver by using α-tocopherol conjugation. The α-tocopherol–conjugated siRNA was effective and safe for RNA interference–mediated gene silencing in vivo. In contrast, when the 13-mer LNA (locked nucleic acid)-DNA gapmer antisense oligonucleotide (ASO) was directly conjugated with α-tocopherol it showed markedly reduced silencing activity in mouse liver. Here, therefore, we tried to extend the 5′-end of the ASO sequence by using 5′-α-tocopherol–conjugated 4- to 7-mers of unlocked nucleic acid (UNA) as a “second wing.” Intravenous injection of mice with this α-tocopherol–conjugated chimeric ASO achieved more potent silencing than ASO alone in the liver, suggesting increased delivery of the ASO to the liver. Within the cells, the UNA wing was cleaved or degraded and α-tocopherol was released from the 13-mer gapmer ASO, resulting in activation of the gapmer. The α-tocopherol–conjugated chimeric ASO showed high efficacy, with hepatic tropism, and was effective and safe for gene silencing in vivo. We have thus identified a new, effective LNA-DNA gapmer structure in which drug delivery system (DDS) molecules are bound to ASO with UNA sequences. PMID:25584900

Co-delivery of pemetrexed and miR-21 antisense oligonucleotide by lipid-polymer hybrid nanoparticles and effects on glioblastoma cells.

PubMed

Küçüktürkmen, Berrin; Devrim, Burcu; Saka, Ongun M; Yilmaz, Şükran; Arsoy, Taibe; Bozkir, Asuman

2017-01-01

Combination therapy using anticancer drugs and nucleic acid is a more promising strategy to overcome multidrug resistance in cancer and to enhance apoptosis. In this study, lipid-polymer hybrid nanoparticles (LPNs), which contain both pemetrexed and miR-21 antisense oligonucleotide (anti-miR-21), have been developed for treatment of glioblastoma, the most aggressive type of brain tumor. Prepared LPNs have been well characterized by particle size distribution and zeta potential measurements, determination of encapsulation efficiency, and in vitro release experiments. Morphology of LPNs was determined by transmission electron microscopy. LPNs had a hydrodynamic size below 100 nm and exhibited sustained release of pemetrexed up to 10 h. Encapsulation of pemetrexed in LPNs increased cellular uptake from 6% to 78%. Results of confocal microscopy analysis have shown that co-delivery of anti-miR-21 significantly improved accumulation of LPNs in the nucleus of U87MG cells. Nevertheless, more effective cytotoxicity results could not be obtained due to low concentration of anti-miR-21, loaded in LPNs. We expect that the effective drug delivery systems can be obtained with higher concentration of anti-miR-21 for the treatment of glioblastoma.

Evaluation of the electron transfer flavoprotein as an antibacterial target in Burkholderia cenocepacia.

PubMed

Stietz, Maria S; Lopez, Christina; Osifo, Osasumwen; Tolmasky, Marcelo E; Cardona, Silvia T

2017-10-01

There are hundreds of essential genes in multidrug-resistant bacterial genomes, but only a few of their products are exploited as antibacterial targets. An example is the electron transfer flavoprotein (ETF), which is required for growth and viability in Burkholderia cenocepacia. Here, we evaluated ETF as an antibiotic target for Burkholderia cepacia complex (Bcc). Depletion of the bacterial ETF during infection of Caenorhabditis elegans significantly extended survival of the nematodes, proving that ETF is essential for survival of B. cenocepacia in this host model. In spite of the arrest in respiration in ETF mutants, the inhibition of etf expression did not increase the formation of persister cells, when treated with high doses of ciprofloxacin or meropenem. To test if etf translation could be inhibited by RNA interference, antisense oligonucleotides that target the etfBA operon were synthesized. One antisense oligonucleotide was effective in inhibiting etfB translation in vitro but not in vivo, highlighting the challenge of reduced membrane permeability for the design of drugs against B. cenocepacia. This work contributes to the validation of ETF of B. cenocepacia as a target for antibacterial therapy and demonstrates the utility of a C. elegans liquid killing assay to validate gene essentiality in an in vivo infection model.

Reengineering a transmembrane protein to treat muscular dystrophy using exon skipping

PubMed Central

Gao, Quan Q.; Wyatt, Eugene; Goldstein, Jeff A.; LoPresti, Peter; Castillo, Lisa M.; Gazda, Alec; Petrossian, Natalie; Earley, Judy U.; Hadhazy, Michele; Barefield, David Y.; Demonbreun, Alexis R.; Bönnemann, Carsten; Wolf, Matthew; McNally, Elizabeth M.

2015-01-01

Exon skipping uses antisense oligonucleotides as a treatment for genetic diseases. The antisense oligonucleotides used for exon skipping are designed to bypass premature stop codons in the target RNA and restore reading frame disruption. Exon skipping is currently being tested in humans with dystrophin gene mutations who have Duchenne muscular dystrophy. For Duchenne muscular dystrophy, the rationale for exon skipping derived from observations in patients with naturally occurring dystrophin gene mutations that generated internally deleted but partially functional dystrophin proteins. We have now expanded the potential for exon skipping by testing whether an internal, in-frame truncation of a transmembrane protein γ-sarcoglycan is functional. We generated an internally truncated γ-sarcoglycan protein that we have termed Mini-Gamma by deleting a large portion of the extracellular domain. Mini-Gamma provided functional and pathological benefits to correct the loss of γ-sarcoglycan in a Drosophila model, in heterologous cell expression studies, and in transgenic mice lacking γ-sarcoglycan. We generated a cellular model of human muscle disease and showed that multiple exon skipping could be induced in RNA that encodes a mutant human γ-sarcoglycan. Since Mini-Gamma represents removal of 4 of the 7 coding exons in γ-sarcoglycan, this approach provides a viable strategy to treat the majority of patients with γ-sarcoglycan gene mutations. PMID:26457733

SNAP-25 in hippocampal CA3 region is required for long-term memory formation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hou Qiuling; Gao Xiang; Lu Qi

SNAP-25 is a synaptosomal protein of 25 kDa, a key component of synaptic vesicle-docking/fusion machinery, and plays a critical role in exocytosis and neurotransmitter release. We previously reported that SNAP-25 in the hippocampal CA1 region is involved in consolidation of contextual fear memory and water-maze spatial memory (Hou et al. European J Neuroscience, 20: 1593-1603, 2004). SNAP-25 is expressed not only in the CA1 region, but also in the CA3 region, and the SNAP-25 mRNA level in the CA3 region is higher than in the CA1 region. Here, we provide evidence that SNAP-25 in the CA3 region is also involvedmore » in learning/memory. Intra-CA3 infusion of SNAP-25 antisense oligonucleotide impaired both long-term contextual fear memory and water-maze spatial memory, with short-term memory intact. Furthermore, the SNAP-25 antisense oligonucleotide suppressed the long-term potentiation (LTP) of field excitatory post-synaptic potential (fEPSP) in the mossy-fiber pathway (DG-CA3 pathway), with no effect on paired-pulse facilitation of the fEPSP. These results are consistent with the notion that SNAP-25 in the hippocampal CA3 region is required for long-term memory formation.« less

Therapeutic correction of ApoER2 splicing in Alzheimer's disease mice using antisense oligonucleotides.

PubMed

Hinrich, Anthony J; Jodelka, Francine M; Chang, Jennifer L; Brutman, Daniella; Bruno, Angela M; Briggs, Clark A; James, Bryan D; Stutzmann, Grace E; Bennett, David A; Miller, Steven A; Rigo, Frank; Marr, Robert A; Hastings, Michelle L

2016-04-01

Apolipoprotein E receptor 2 (ApoER2) is an apolipoprotein E receptor involved in long-term potentiation, learning, and memory. Given its role in cognition and its association with the Alzheimer's disease (AD) risk gene, apoE, ApoER2 has been proposed to be involved in AD, though a role for the receptor in the disease is not clear. ApoER2 signaling requires amino acids encoded by alternatively spliced exon 19. Here, we report that the balance of ApoER2 exon 19 splicing is deregulated in postmortem brain tissue from AD patients and in a transgenic mouse model of AD To test the role of deregulated ApoER2 splicing in AD, we designed an antisense oligonucleotide (ASO) that increases exon 19 splicing. Treatment of AD mice with a single dose of ASO corrected ApoER2 splicing for up to 6 months and improved synaptic function and learning and memory. These results reveal an association between ApoER2 isoform expression and AD, and provide preclinical evidence for the utility of ASOs as a therapeutic approach to mitigate Alzheimer's disease symptoms by improving ApoER2 exon 19 splicing. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.

Clinical and preclinical pharmacokinetics and pharmacodynamics of mipomersen (kynamro(®)): a second-generation antisense oligonucleotide inhibitor of apolipoprotein B.

PubMed

Geary, Richard S; Baker, Brenda F; Crooke, Stanley T

2015-02-01

Mipomersen (Kynamro(®)), a second-generation 2'-O-methoxyethyl chimeric antisense oligonucleotide (ASO), inhibits the synthesis of apolipoprotein B (apoB) and is indicated in the US as an adjunct therapy for homozygous familial hypercholesterolemia (HoFH) at a dose of 200 mg subcutaneously (SC) once weekly. The pharmacokinetic (PK) properties of mipomersen are generally consistent across all species studied, including mouse, rat, monkey, and humans. After SC administration, mipomersen is rapidly and extensively absorbed. It has an apparent plasma and tissue terminal elimination half-life of approximately 30 days. Mipomersen achieves steady-state tissue concentrations within approximately 4-6 months of once-weekly dosing. It does not exhibit PK-based drug-drug interactions with other concomitant medications, either involving competition for plasma protein binding or alterations in disposition of any evaluated drugs. Furthermore, mipomersen does not prolong the corrected QT (QTc) interval. There have been no ethnic- or gender-related differences in PK observed. In clinical trials, both as a single agent and in the presence of maximal lipid-lowering therapy, mipomersen has demonstrated significant dose-dependent reductions in all measured apoB-containing atherogenic lipoproteins. Overall, mipomersen has well-characterized PK and pharmacodynamic properties in both animals and humans, and is an efficacious adjunct treatment for patients with HoFH.

Development of species-specific rDNA probes for Giardia by multiple fluorescent in situ hybridization combined with immunocytochemical identification of cyst wall antigens.

PubMed

Erlandsen, Stanley L; Jarroll, Edward; Wallis, Peter; van Keulen, Harry

2005-08-01

In this study, we describe the development of fluorescent oligonucleotide probes to variable regions in the small subunit of 16S rRNA in three distinct Giardia species. Sense and antisense probes (17-22 mer) to variable regions 1, 3, and 8 were labeled with digoxygenin or selected fluorochomes (FluorX, Cy3, or Cy5). Optimal results were obtained with fluorochome-labeled oligonucleotides for detection of rRNA in Giardia cysts. Specificity of fluorescent in situ hybridization (FISH) was shown using RNase digestion and high stringency to diminish the hybridization signal, and oligonucleotide probes for rRNA in Giardia lamblia, Giardia muris, and Giardia ardeae were shown to specifically stain rRNA only within cysts or trophozoites of those species. The fluorescent oligonucleotide specific for rRNA in human isolates of Giardia was positive for ten different strains. A method for simultaneous FISH detection of cysts using fluorescent antibody (genotype marker) and two oligonucleotide probes (species marker) permitted visualization of G. lamblia and G. muris cysts in the same preparation. Testing of an environmental water sample revealed the presence of FISH-positive G. lamblia cysts with a specific rDNA probe for rRNA, while negative cysts were presumed to be of animal or bird origin.

Identification and Characterization of a Cis-Encoded Antisense RNA Associated with the Replication Process of Salmonella enterica Serovar Typhi

PubMed Central

Dadzie, Isaac; Xu, Shungao; Ni, Bin; Zhang, Xiaolei; Zhang, Haifang; Sheng, Xiumei; Xu, Huaxi; Huang, Xinxiang

2013-01-01

Antisense RNAs that originate from the complementary strand of protein coding genes are involved in the regulation of gene expression in all domains of life. In bacteria, some of these antisense RNAs are transcriptional noise whiles others play a vital role to adapt the cell to changing environmental conditions. By deep sequencing analysis of transcriptome of Salmonella enterica serovar Typhi, a partial RNA sequence encoded in-cis to the dnaA gene was revealed. Northern blot and RACE analysis confirmed the transcription of this antisense RNA which was expressed mostly in the stationary phase of the bacterial growth and also under iron limitation and osmotic stress. Pulse expression analysis showed that overexpression of the antisense RNA resulted in a significant increase in the mRNA levels of dnaA, which will ultimately enhance their translation. Our findings have revealed that antisense RNA of dnaA is indeed transcribed not merely as a by-product of the cell's transcription machinery but plays a vital role as far as stability of dnaA mRNA is concerned. PMID:23637809

Method for promoting specific alignment of short oligonucleotides on nucleic acids

DOEpatents

Studier, F. William; Kieleczawa, Jan; Dunn, John J.

1996-01-01

Disclosed is a method for promoting specific alignment of short oligonucleotides on a nucleic acid polymer. The nucleic acid polymer is incubated in a solution containing a single-stranded DNA-binding protein and a plurality of oligonucleotides which are perfectly complementary to distinct but adjacent regions of a predetermined contiguous nucleotide sequence in the nucleic acid polymer. The plurality of oligonucleotides anneal to the nucleic acid polymer to form a contiguous region of double stranded nucleic acid. Specific application of the methods disclosed include priming DNA synthesis and template-directed ligation.

In vitro pharmacokinetics of phosphorothioate antisense oligonucleotides.

PubMed

Crooke, R M; Graham, M J; Cooke, M E; Crooke, S T

1995-10-01

ISIS 2105 (Afovirsen), a 20-mer phosphorothioate oligonucleotide that inhibits the production of a gene product essential to the growth of human papillomavirus, is in phase II clinical trials for the treatment of genital warts induced by human papillomavirus-6 and human papillomavirus-11. The uptake, subcellular distribution and metabolism of ISIS 2105 and three other similar length phosphorothioates have been studied in a variety of cell lines. Our experiments indicated that ISIS 2105 and other phosphorothioates are internalized and distributed in a time-, temperature-, concentration-, sequence- and cell line-dependent manner. Cell association was also influenced by the tissue culture medium. Several different analytical techniques revealed that phosphorothioates were more rapidly degraded in vitro than previously reported. These data suggest that phosphorothioate oligonucleotide uptake and stability observed in tissue culture can vary as a function of cellular assay conditions and analytical methods used. Comparison of these results with those obtained in vivo suggests that the pharmacokinetic behavior of this class of compounds cannot necessarily be predicted from in vitro studies.

Antagonists of the miRNA-Argonaute 2 Protein Complex: Anti-miR-AGOs.

PubMed

Schmidt, Marco F; Korb, Oliver; Abell, Chris

2017-01-01

microRNAs (miRNAs) have been identified as high-value drug targets. A widely applied strategy in miRNA inhibition is the use of antisense agents. However, it has been shown that oligonucleotides are poorly cell permeable because of their complex chemical structure and due to their negatively charged backbone. Consequently, the general application of oligonucleotides in therapy is limited. Since miRNAs' functions are executed exclusively by the Argonaute 2 protein, we therefore describe a protocol for the design of a novel miRNA inhibitor class: antagonists of the miRNA-Argonaute 2 protein complex, so-called anti-miR-AGOs, that not only block the crucial binding site of the target miRNA but also bind to the protein's active site. Due to their lower molecular weight and, thus, more drug-like chemical structure, the novel inhibitor class may show better pharmacokinetic properties than reported oligonucleotide inhibitors, enabling them for potential therapeutic use.

RNA therapeutics: RNAi and antisense mechanisms and clinical applications.

PubMed

Chery, Jessica

2016-07-01

RNA therapeutics refers to the use of oligonucleotides to target primarily ribonucleic acids (RNA) for therapeutic efforts or in research studies to elucidate functions of genes. Oligonucleotides are distinct from other pharmacological modalities, such as small molecules and antibodies that target mainly proteins, due to their mechanisms of action and chemical properties. Nucleic acids come in two forms: deoxyribonucleic acids (DNA) and ribonucleic acids (RNA). Although DNA is more stable, RNA offers more structural variety ranging from messenger RNA (mRNA) that codes for protein to non-coding RNAs, microRNA (miRNA), transfer RNA (tRNA), short interfering RNAs (siRNAs), ribosomal RNA (rRNA), and long-noncoding RNAs (lncRNAs). As our understanding of the wide variety of RNAs deepens, researchers have sought to target RNA since >80% of the genome is estimated to be transcribed. These transcripts include non-coding RNAs such as miRNAs and siRNAs that function in gene regulation by playing key roles in the transfer of genetic information from DNA to protein, the final product of the central dogma in biology 1 . Currently there are two main approaches used to target RNA: double stranded RNA-mediated interference (RNAi) and antisense oligonucleotides (ASO). Both approaches are currently in clinical trials for targeting of RNAs involved in various diseases, such as cancer and neurodegeneration. In fact, ASOs targeting spinal muscular atrophy and amyotrophic lateral sclerosis have shown positive results in clinical trials 2 . Advantages of ASOs include higher affinity due to the development of chemical modifications that increase affinity, selectivity while decreasing toxicity due to off-target effects. This review will highlight the major therapeutic approaches of RNA medicine currently being applied with a focus on RNAi and ASOs.

A multifactor regulatory circuit involving H-NS, VirF and an antisense RNA modulates transcription of the virulence gene icsA of Shigella flexneri.

PubMed

Tran, Chi Nhan; Giangrossi, Mara; Prosseda, Gianni; Brandi, Anna; Di Martino, Maria Letizia; Colonna, Bianca; Falconi, Maurizio

2011-10-01

The icsA gene of Shigella encodes a structural protein involved in colonization of the intestinal mucosa by bacteria. This gene is expressed upon invasion of the host and is controlled by a complex regulatory circuit involving the nucleoid protein H-NS, the AraC-like transcriptional activator VirF, and a 450 nt antisense RNA (RnaG) acting as transcriptional attenuator. We investigated on the interplay of these factors at the molecular level. DNase I footprints reveal that both H-NS and VirF bind to a region including the icsA and RnaG promoters. H-NS is shown to repress icsA transcription at 30°C but not at 37°C, suggesting a significant involvement of this protein in the temperature-regulated expression of icsA. We also demonstrate that VirF directly stimulates icsA transcription and is able to alleviate H-NS repression in vitro. According to these results, icsA expression is derepressed in hns- background and overexpressed when VirF is provided in trans. Moreover, we find that RnaG-mediated transcription attenuation depends on 80 nt at its 5'-end, a stretch carrying the antisense region. Bases engaged in the initial contact leading to sense-antisense pairing have been identified using synthetic RNA and DNA oligonucleotides designed to rebuild and mutagenize the two stem-loop motifs of the antisense region.

Clinical pharmacological properties of mipomersen (Kynamro), a second generation antisense inhibitor of apolipoprotein B.

PubMed

Crooke, Stanley T; Geary, Richard S

2013-08-01

Mipomersen is a second generation antisense oligonucleotide that targets apolipoprotein B. It has been studied thoroughly in clinical trials (more than 800 subjects), including four randomized double-blind placebo controlled phase 3 studies involving 391 patients, and is in registration for the treatment of severe hypercholesterolaemia. The pharmacokinetic and pharmacodynamic properties of mipomersen are well characterized. Mipomersen is rapidly and extensively absorbed after subcutaneous administration and has an elimination half-life of approximately 30 days across species. It is cleared by nuclease metabolism and renal excretion of the metabolites. Mipomersen reduces all apolipoprotein B containing atherogenic particles and displays dose dependent reductions between 50-400 mg week⁻¹ , both as a single agent and in the presence of maximal lipid lowering therapy. No drug-drug interactions have been identified. Mipomersen is a representative of second generation antisense drugs, all of which have similar properties, and is thus representative of the behaviour of the class of drugs. © 2012 The Authors. British Journal of Clinical Pharmacology © 2012 The British Pharmacological Society.

Characterization and Modulation of Proteins Involved in Sulfur Mustard Vesication

DTIC Science & Technology

2000-06-01

PARP staining was present throughout the nucleus, the DBD showed a more localized punctate pattern in the region of the nucleolus and throughout the...34 oligonucleotide is synthesized that is identical in base composition to the antisense, but had a randomly generated sequence. This is an important control...reversed this inhibitory effect. The roles of PARP in modulating the composition and enzyme activities of the DNA synthesome were further investigated by

Selective Amplification of SPR Biosensor Signal for Recognition of rpoB Gene Fragments by Use of Gold Nanoparticles Modified by Thiolated DNA

NASA Astrophysics Data System (ADS)

Matsishin, M.; Rachkov, A.; Lopatynskyi, A.; Chegel, V.; Soldatkin, A.; El'skaya, A.

2017-04-01

An experimental approach for improving the sensitivity of the surface plasmon resonance (SPR) DNA hybridization sensor using gold nanoparticles (GNPs), modified by specific oligonucleotides, was elaborated. An influence of the ionic strength on the aggregation stability of unmodified GNPs and GNPs modified by the thiolated oligonucleotides was investigated by monitoring a value of light extinction at 520 nm that can be considered as a measure of a quantity of the non-aggregated GNPs. While the unmodified GNPs started to aggregate in 0.2 × saline-sodium citrate (SSC), GNPs modified by the negatively charged oligonucleotides were more stable at increasing ionic strength up to 0.5 × SSC. A bioselective element of the SPR DNA hybridization sensor was formed by immobilization on the gold sensor surface of the thiolated oligonucleotides P2, the sequence of which is a fragment of the rpoB gene of Mycobacterium tuberculosis. The injections into the measuring flow cell of the SPR spectrometer of various concentrations of GNPs modified by the complementary oligonucleotides T2-18m caused the pronounced concentration-dependent sequence-specific sensor responses. The magnitude of the sensor responses was much higher than in the case of the free standing complementary oligonucleotides. According to the obtained experimental data, the usage of GNPs modified by specific oligonucleotides can amplify the sensor response of the SPR DNA hybridization sensor in 1200 times.

Capillary electrophoresis, a method for the determination of nucleic acid ligands covalently attached to quantum dots representing a donor of Förster resonance energy transfer.

PubMed

Datinská, Vladimíra; Klepárník, Karel; Belšánová, Barbora; Minárik, Marek; Foret, František

2018-05-09

The synthesis and determination of the structure of a Förster resonance energy transfer probe intended for the detection of specific nucleic acid sequences are described here. The probe is based on the hybridization of oligonucleotide modified quantum dots with a fluorescently labeled nucleic acid sample resulting in changes of the fluorescence emission due to the energy transfer effect. The stoichiometry distribution of oligonucleotides conjugated to quantum dots was determined by capillary electrophoresis separation. The results indicate that one to four molecules of oligonucleotide are conjugated to the surface of a single nanoparticle. This conclusion is confirmed by the course of the dependence of Förster resonance energy transfer efficiency on the concentration of fluorescently labeled complementary single-stranded nucleic acid, showing saturation. While the energy transfer efficiency of the probe hybridized with complementary nucleic acid strands was 30%, negligible efficiency was observed with a non-complementary strands. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Using RNA as a tool to modify lipid nanoparticles

NASA Astrophysics Data System (ADS)

Wilner, Samantha E.

Lipid nanoparticles (LNPs) provide an attractive option for therapeutic applications because they can self-assemble and carry a diverse set of cargoes ranging from hydrophobic drugs to small interfering RNA (siRNA). Liposomes and micelles represent two classes of LNPs that have been developed for medicinal purposes; however, active targeting of LNPs to specific tissues and LNP stability in vivo remain significant challenges. We have exploited the structural characteristics and targeting ability of nucleic acids to address these obstacles. Specifically, we have introduced short nucleic acid targeting species, called aptamers, to the surface of stable nucleic acid lipid particles (SNALPs), a subset of liposomes used in siRNA delivery. In this manner, we have actively targeted SNALPs to cancer cells that overexpress the transferrin receptor (TfR). HeLa cells expressing enhanced green fluorescent protein (EGFP) were treated with SNALPs bearing an antiTfR aptamer (C2) that was identified in our lab. C2-conjugated SNALPs showed increased levels of uptake by cells by flow cytometry. More importantly, the enhanced uptake by C2-conjugated SNALPs translated to an increased level of gene knockdown when SNALPs were loaded with anti-EGFP siRNA or anti-Lamin NC siRNA. Expression of EGFP and Lamin NC decreased, respectively. These preliminary studies illustrate that aptamer-conjugated SNALPs can be designed to knock down both endogenous and exogenous genes in cancer cells with high specificity. We have also used nucleic acids to stabilize lipid micelles by introducing short quadruplex forming oligonucleotide sequences at the lipid headgroup. Micelle formation was confirmed via dynamic light scattering, transmission electron microscopy, and small angle X-ray scattering. Micelle stability was assessed using NMR and by a FRET-based assay in the presence of serum proteins. Quadruplex-stabilized micelles demonstrated enhanced stability suggesting that alterations to oligonucleotide headgroup interactions could be used to tune micelle stability. Therefore, we engineered stabilized micelles with an oligonucleotide extension and have shown that the addition of an antisense oligonucleotide leads to micelle destabilization and cargo release. The ability to control particle stability with antisense oligonucleotides represents a new paradigm in the design of programmed nanoscale devices, which we envision will find utility in the development of novel diagnostics and therapeutics.

Synthesis and fluorescence studies of multiple labeled oligonucleotides containing dansyl fluorophore covalently attached at 2'-terminus of cytidine via carbamate linkage.

PubMed

Misra, Arvind; Mishra, Satyendra; Misra, Krishna

2004-01-01

Synthesis of modified oligonucleotides in which the specific cytidine nucleoside analogues linked at 2'-OH position via a carbamate bond with an amino ethyl derivative of dansyl fluorophore is reported. For the multiple labeling of oligonucleotides, a strategy involving prelabeling at the monomeric level followed by solid phase assembly of oligonucleotides to obtain regiospecifically labeled probes has been described. The labeled monomer was phosphitylated using 2-cyanoethyl-N,N,N',N'-tetraisopropyl-phosphoramidite (Bis-reagent) and pyridiniumtrifluoro acetate (Py.TFA) as an activator. To ascertain the minimal number of labeled monomers required for a specific length of oligonucleotide for detection and also to assess the effect of carbamate linkage on hybridization, hexamer and 20-mer sequences were selected. Both were labeled with 1, 2, and 3 monomers at the 5'-end and hybridized with normal (unmodified) complementary sequences. As compared to midsequence or 3'-terminal labeling reported earlier, the 5'-terminal labeling has been found to have minimal contact-mediated quenching on duplex formation. This may be due to complementary deoxyguanosine (dG) rich oligonucleotide sequences or CG base pairs at a terminus that is known to yield stronger binding. This is one reason for selecting cytidine for labeling. The results may aid rational design of multiple fluorescent DNA probes for nonradioactive detection of nucleic acids.

Programmable display of DNA-protein chimeras for controlling cell-hydrogel interactions via reversible intermolecular hybridization.

PubMed

Zhang, Zhaoyang; Li, Shihui; Chen, Niancao; Yang, Cheng; Wang, Yong

2013-04-08

Extensive studies have been recently carried out to achieve dynamic control of cell-material interactions primarily through physicochemical stimulation. The purpose of this study was to apply reversible intermolecular hybridization to program cell-hydrogel interactions in physiological conditions based on DNA-antibody chimeras and complementary oligonucleotides. The results showed that DNA oligonucleotides could be captured to and released from the immobilizing DNA-functionalized hydrogels with high specificity via DNA hybridization. Accordingly, DNA-antibody chimeras were captured to the hydrogels, successfully inducing specific cell attachment. The cell attachment to the hydrogels reached the plateau at approximately half an hour after the functionalized hydrogels and the cells were incubated together. The attached cells were rapidly released from the bound hydrogels when triggering complementary oligonucleotides were introduced to the system. However, the capability of the triggering complementary oligonucleotides in releasing cells was affected by the length of intermolecular hybridization. The length needed to be at least more than 20 base pairs in the current experimental setting. Notably, because the procedure of intermolecular hybridization did not involve any harsh condition, the released cells maintained the same viability as that of the cultured cells. The functionalized hydrogels also exhibited the potential to catch and release cells repeatedly. Therefore, this study demonstrates that it is promising to regulate cell-material interactions dynamically through the DNA-programmed display of DNA-protein chimeras.

New redox-active layer create via epoxy-amine reaction - The base of genosensor for the detection of specific DNA and RNA sequences of avian influenza virus H5N1.

PubMed

Malecka, Kamila; Stachyra, Anna; Góra-Sochacka, Anna; Sirko, Agnieszka; Zagórski-Ostoja, Włodzimierz; Dehaen, Wim; Radecka, Hanna; Radecki, Jerzy

2015-03-15

This paper concerns the development of a redox-active monolayer and its application for the construction of an electrochemical genosensor designed for the detection of specific DNA and RNA oligonucleotide sequences related to the avian influenza virus (AIV) type H5N1. This new redox layer was created on a gold electrode surface step by step. Cyclic Voltammetry, Osteryoung Square-Wave Voltammetry and Differential Pulse Voltammetry were used for its characterization. This new redox-active layer was applied for the construction of the DNA biosensor. The NH2-NC3 probe (20-mer) was covalently attached to the gold electrode surface via a "click" reaction between the amine and an epoxide group. The hybridization process was monitored using the Osteryoung Square-Wave Voltammetry. The 20-mer DNA and ca. 280-mer RNA oligonucleotides were used as the targets. The constructed genosensor was capable to determine complementary oligonucleotide sequences with a detection limit in the pM range. It is able to distinguish the different position of the part RNA complementary to the DNA probe. The genosensor was very selective. The 20-mer DNA as well as the 280-mer RNA oligonucleotides without a complementary sequence generated a weak signal. Copyright © 2014 Elsevier B.V. All rights reserved.

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

1999-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

Miniaturized reaction vessel system, method for performing site-specific biochemical reactions and affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

2000-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.

1999-05-18

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.

Controlled Enhancemnt of Long-Term Memory by Modulating Neuronal miRNA Function

DTIC Science & Technology

2012-09-20

Faraday Ave. Carlsbad CA 92008 Prepare antisense oligonucleotides 8/1/2007 12:00:00AM 2/1/2009 12:00:00AM Sub Contractor Numbers (c): Patent Clause...with ampakines. However, ampakines that accomplish positive modulation have shown undesired clinical side effects . Another approach is to improve...of times that a mouse touches objects introduced into the cage in a fixed period of time. Objects are either “old” (prior exposure) or “new” (not

Thiolated polycarbophil as an adjuvant for permeation enhancement in nasal delivery of antisense oligonucleotides.

PubMed

Vetter, A; Martien, R; Bernkop-Schnürch, A

2010-03-01

The purpose of this study was to investigate the effect of thiolated polycarbophil as an adjuvant to enhance the permeation and improve the stability of a phosphorothioate antisense oligonucleotide (PTO-ODN) on the nasal mucosa. Polycarbophil-cysteine (PCP-Cys) was synthesized by the covalent attachment of L-cysteine to the polymeric backbone. Cytotoxicity tests were examined on human nasal epithelial cells from surgery of nasal polyps confirmed by histological studies. Deoxyribonuclease I activity in respiratory region of the porcine nasal cavity was analyzed by an enzymatic assay. The enzymatic degradation of PTO-ODNs on freshly excised porcine nasal mucosa was analyzed and protection of PCP-cysteine toward DNase I degradation was evaluated. Permeation studies were performed in Ussing-type diffusion chambers. PCP-Cys/GSH did not arise a remarkable mortal effect. Porcine respiratory mucosa was shown to possess nuclease activity corresponding to 0.69 Kunitz units/mL. PTO-ODNs were degraded by incubation with nasal mucosa. In the presence of 0.45% thiolated polycarbophil and 0.5% glutathione (GSH), this degradation process could be lowered. In the presence of thiolated polycarbophil and GSH the uptake of PTO-ODNs from the nasal mucosa was 1.7-fold improved. According to these results thiolated polycarbophil/GSH might be a promising excipient for nasal administration of PTO-ODNs. 2009 Wiley-Liss, Inc. and the American Pharmacists Association

Overcoming imatinib resistance conferred by the BIM deletion polymorphism in chronic myeloid leukemia with splice-switching antisense oligonucleotides

PubMed Central

Liu, Jun; Bhadra, Malini; Sinnakannu, Joanna Rajeswary; Yue, Wan Lin; Tan, Cheryl Weiqi; Rigo, Frank; Ong, S.Tiong; Roca, Xavier

2017-01-01

Many tyrosine kinase-driven cancers, including chronic myeloid leukemia (CML), are characterized by high response rates to specific tyrosine kinase inhibitors (TKIs) like imatinib. In East Asians, primary imatinib resistance is caused by a deletion polymorphism in Intron 2 of the BIM gene, whose product is required for TKI-induced apoptosis. The deletion biases BIM splicing from exon 4 to exon 3, generating splice isoforms lacking the exon 4-encoded pro-apoptotic BH3 domain, which impairs the ability of TKIs to induce apoptosis. We sought to identify splice-switching antisense oligonucleotides (ASOs) that block exon 3 but enhance exon 4 splicing, and thereby resensitize BIM deletion-containing cancers to imatinib. First, we mapped multiple cis-acting splicing elements around BIM exon 3 by minigene mutations, and found an exonic splicing enhancer acting via SRSF1. Second, by a systematic ASO walk, we isolated ASOs that corrected the aberrant BIM splicing. Eight of 67 ASOs increased exon 4 levels in BIM deletion-containing cells, and restored imatinib-induced apoptosis and TKI sensitivity. This proof-of-principle study proves that resistant CML cells by BIM deletion polymorphism can be resensitized to imatinib via splice-switching BIM ASOs. Future optimizations might yield a therapeutic ASO as precision-medicine adjuvant treatment for BIM-polymorphism-associated TKI-resistant CML and other cancers. PMID:29100409

Overcoming imatinib resistance conferred by the BIM deletion polymorphism in chronic myeloid leukemia with splice-switching antisense oligonucleotides.

PubMed

Liu, Jun; Bhadra, Malini; Sinnakannu, Joanna Rajeswary; Yue, Wan Lin; Tan, Cheryl Weiqi; Rigo, Frank; Ong, S Tiong; Roca, Xavier

2017-09-29

Many tyrosine kinase-driven cancers, including chronic myeloid leukemia (CML), are characterized by high response rates to specific tyrosine kinase inhibitors (TKIs) like imatinib. In East Asians, primary imatinib resistance is caused by a deletion polymorphism in Intron 2 of the BIM gene, whose product is required for TKI-induced apoptosis. The deletion biases BIM splicing from exon 4 to exon 3, generating splice isoforms lacking the exon 4-encoded pro-apoptotic BH3 domain, which impairs the ability of TKIs to induce apoptosis. We sought to identify splice-switching antisense oligonucleotides (ASOs) that block exon 3 but enhance exon 4 splicing, and thereby resensitize BIM deletion-containing cancers to imatinib. First, we mapped multiple cis -acting splicing elements around BIM exon 3 by minigene mutations, and found an exonic splicing enhancer acting via SRSF1. Second, by a systematic ASO walk, we isolated ASOs that corrected the aberrant BIM splicing. Eight of 67 ASOs increased exon 4 levels in BIM deletion-containing cells, and restored imatinib-induced apoptosis and TKI sensitivity. This proof-of-principle study proves that resistant CML cells by BIM deletion polymorphism can be resensitized to imatinib via splice-switching BIM ASOs. Future optimizations might yield a therapeutic ASO as precision-medicine adjuvant treatment for BIM -polymorphism-associated TKI-resistant CML and other cancers.

Targeting density-enhanced phosphatase-1 (DEP-1) with antisense oligonucleotides improves the metabolic phenotype in high-fat diet-fed mice

PubMed Central

2013-01-01

Background Insulin signaling is tightly controlled by tyrosine dephosphorylation of the insulin receptor through protein-tyrosine-phosphatases (PTPs). DEP-1 is a PTP dephosphorylating tyrosine residues in a variety of receptor tyrosine kinases. Here, we analyzed whether DEP-1 activity is differentially regulated in liver, skeletal muscle and adipose tissue under high-fat diet (HFD), examined the role of DEP-1 in insulin resistance in vivo, and its function in insulin signaling. Results Mice were fed an HFD for 10 weeks to induce obesity-associated insulin resistance. Thereafter, HFD mice were subjected to systemic administration of specific antisense oligonucleotides (ASOs), highly accumulating in hepatic tissue, against DEP-1 or control ASOs. Targeting DEP-1 led to improvement of insulin sensitivity, reduced basal glucose level, and significant reduction of body weight. This was accompanied by lower insulin and leptin serum levels. Suppression of DEP-1 in vivo also induced hyperphosphorylation in the insulin signaling cascade of the liver. Moreover, DEP-1 physically associated with the insulin receptor in situ, and recombinant DEP-1 dephosphorylated the insulin receptor in vitro. Conclusions These results indicate that DEP-1 acts as an endogenous antagonist of the insulin receptor, and downregulation of DEP-1 results in an improvement of insulin sensitivity. DEP-1 may therefore represent a novel target for attenuation of metabolic diseases. PMID:23889985

Antisense Oligonucleotide (AON)-based Therapy for Leber Congenital Amaurosis Caused by a Frequent Mutation in CEP290

PubMed Central

Collin, Rob WJ; den Hollander, Anneke I; van der Velde-Visser, Saskia D; Bennicelli, Jeannette; Bennett, Jean; Cremers, Frans PM

2012-01-01

Leber congenital amaurosis (LCA) is the most severe form of inherited retinal degeneration, with an onset in the first year of life. The most frequent mutation that causes LCA, present in at least 10% of individuals with LCA from North-American and Northern-European descent, is an intronic mutation in CEP290 that results in the inclusion of an aberrant exon in the CEP290 mRNA. Here, we describe a genetic therapy approach that is based on antisense oligonucleotides (AONs), small RNA molecules that are able to redirect normal splicing of aberrantly processed pre-mRNA. Immortalized lymphoblastoid cells of individuals with LCA homozygously carrying the intronic CEP290 mutation were transfected with several AONs that target the aberrant exon that is incorporated in the mutant CEP290 mRNA. Subsequent RNA isolation and reverse transcription-PCR analysis revealed that a number of AONs were capable of almost fully redirecting normal CEP290 splicing, in a dose-dependent manner. Other AONs however, displayed no effect on CEP290 splicing at all, indicating that the rescue of aberrant CEP290 splicing shows a high degree of sequence specificity. Together, our data show that AON-based therapy is a promising therapeutic approach for CEP290-associated LCA that warrants future research in animal models to develop a cure for this blinding disease. PMID:23343883

Predictive dose-based estimation of systemic exposure multiples in mouse and monkey relative to human for antisense oligonucleotides with 2'-o-(2-methoxyethyl) modifications.

PubMed

Yu, Rosie Z; Grundy, John S; Henry, Scott P; Kim, Tae-Won; Norris, Daniel A; Burkey, Jennifer; Wang, Yanfeng; Vick, Andrew; Geary, Richard S

2015-01-20

Evaluation of species differences and systemic exposure multiples (or ratios) in toxicological animal species versus human is an ongoing exercise during the course of drug development. The systemic exposure ratios are best estimated by directly comparing area under the plasma concentration-time curves (AUCs), and sometimes by comparing the dose administered, with the dose being adjusted either by body surface area (BSA) or body weight (BW). In this study, the association between AUC ratio and the administered dose ratio from animals to human were studied using a retrospective data-driven approach. The dataset included nine antisense oligonucleotides (ASOs) with 2'-O-(2-methoxyethyl) modifications, evaluated in two animal species (mouse and monkey) following single and repeated parenteral administrations. We found that plasma AUCs were similar between ASOs within the same species, and are predictable to human exposure using a single animal species, either mouse or monkey. Between monkey and human, the plasma exposure ratio can be predicted directly based on BW-adjusted dose ratios, whereas between mouse and human, the exposure ratio would be nearly fivefold lower in mouse compared to human based on BW-adjusted dose values. Thus, multiplying a factor of 5 for the mouse BW-adjusted dose would likely provide a reasonable AUC exposure estimate in human at steady-state.

Specific Increase of Protein Levels by Enhancing Translation Using Antisense Oligonucleotides Targeting Upstream Open Frames.

PubMed

Liang, Xue-Hai; Shen, Wen; Crooke, Stanley T

2017-01-01

A number of diseases are caused by low levels of key proteins; therefore, increasing the amount of specific proteins in human bodies is of therapeutic interest. Protein expression is downregulated by some structural or sequence elements present in the 5' UTR of mRNAs, such as upstream open reading frames (uORF). Translation initiation from uORF(s) reduces translation from the downstream primary ORF encoding the main protein product in the same mRNA, leading to a less efficient protein expression. Therefore, it is possible to use antisense oligonucleotides (ASOs) to specifically inhibit translation of the uORF by base-pairing with the uAUG region of the mRNA, redirecting translation machinery to initiate from the primary AUG site. Here we review the recent findings that translation of specific mRNAs can be enhanced using ASOs targeting uORF regions. Appropriately designed and optimized ASOs are highly specific, and they act in a sequence- and position-dependent manner, with very minor off-target effects. Protein levels can be increased using this approach in different types of human and mouse cells, and, importantly, also in mice. Since uORFs are present in around half of human mRNAs, the uORF-targeting ASOs may thus have valuable potential as research tools and as therapeutics to increase the levels of proteins for a variety of genes.

Hepatotoxicity of high affinity gapmer antisense oligonucleotides is mediated by RNase H1 dependent promiscuous reduction of very long pre-mRNA transcripts

PubMed Central

Burel, Sebastien A.; Hart, Christopher E.; Cauntay, Patrick; Hsiao, Jill; Machemer, Todd; Katz, Melanie; Watt, Andy; Bui, Huynh-hoa; Younis, Husam; Sabripour, Mahyar; Freier, Susan M.; Hung, Gene; Dan, Amy; Prakash, T.P.; Seth, Punit P.; Swayze, Eric E.; Bennett, C. Frank; Crooke, Stanley T.; Henry, Scott P.

2016-01-01

High affinity antisense oligonucleotides (ASOs) containing bicylic modifications (BNA) such as locked nucleic acid (LNA) designed to induce target RNA cleavage have been shown to have enhanced potency along with a higher propensity to cause hepatotoxicity. In order to understand the mechanism of this hepatotoxicity, transcriptional profiles were collected from the livers of mice treated with a panel of highly efficacious hepatotoxic or non-hepatotoxic LNA ASOs. We observed highly selective transcript knockdown in mice treated with non-hepatotoxic LNA ASOs, while the levels of many unintended transcripts were reduced in mice treated with hepatotoxic LNA ASOs. This transcriptional signature was concurrent with on-target RNA reduction and preceded transaminitis. Remarkably, the mRNA transcripts commonly reduced by toxic LNA ASOs were generally not strongly associated with any particular biological process, cellular component or functional group. However, they tended to have much longer pre-mRNA transcripts. We also demonstrate that the off-target RNA knockdown and hepatotoxicity is attenuated by RNase H1 knockdown, and that this effect can be generalized to high affinity modifications beyond LNA. This suggests that for a certain set of ASOs containing high affinity modifications such as LNA, hepatotoxicity can occur as a result of unintended off-target RNase H1 dependent RNA degradation. PMID:26553810

Antisense oligonucleotide reduction of apoB-ameliorated atherosclerosis in LDL receptor-deficient mice[S

PubMed Central

Mullick, Adam E.; Fu, Wuxia; Graham, Mark J.; Lee, Richard G.; Witchell, Donna; Bell, Thomas A.; Whipple, Charles P.; Crooke, Rosanne M.

2011-01-01

Chronic elevations of plasma apolipoprotein B (apoB) are strongly associated with cardiovascular disease. We have previously demonstrated that inhibition of hepatic apoB mRNA using antisense oligonucleotides (ASO) results in reductions of apoB, VLDL, and LDL in several preclinical animal models and humans. In this study, we evaluated the anti-atherogenic effects of a murine-specific apoB ASO (ISIS 147764) in hypercholesterolemic LDLr deficient (LDLr−/−) mice. ISIS 147764 was administered weekly at 25-100 mg/kg for 10-12 weeks and produced dose-dependent reductions of hepatic apoB mRNA and plasma LDL by 60-90%. No effects on these parameters were seen in mice receiving control ASOs. ApoB ASO treatment also produced dose-dependent reductions of aortic en face and sinus atherosclerosis from 50-90%, with high-dose treatment displaying less disease than the saline-treated, chow-fed LDLr−/− mice. No changes in intestinal cholesterol absorption were seen with apoB ASO treatment, suggesting that the cholesterol-lowering pharmacology of 147764 was primarily due to inhibition of hepatic apoB synthesis and secretion. In summary, ASO-mediated suppression of apoB mRNA expression profoundly reduced plasma lipids and atherogenesis in LDLr−/− mice, leading to the hypothesis that apoB inhibition in humans with impaired LDLr activity may produce similar effects. PMID:21343632

Identification of transcribed sequences in Arabidopsis thaliana by using high-resolution genome tiling arrays

NASA Technical Reports Server (NTRS)

Stolc, Viktor; Samanta, Manoj Pratim; Tongprasit, Waraporn; Sethi, Himanshu; Liang, Shoudan; Nelson, David C.; Hegeman, Adrian; Nelson, Clark; Rancour, David; Bednarek, Sebastian;

Liver-specific inhibition of acyl-coenzyme a:cholesterol acyltransferase 2 with antisense oligonucleotides limits atherosclerosis development in apolipoprotein B100-only low-density lipoprotein receptor-/- mice.

PubMed

Bell, Thomas A; Brown, J Mark; Graham, Mark J; Lemonidis, Kristina M; Crooke, Rosanne M; Rudel, Lawrence L

2006-08-01

The purpose of this study was to determine the effects of liver-specific inhibition of acyl-coenzyme A:cholesterol acyltransferase 2 (ACAT2) on the development of hypercholesterolemia and atherosclerosis in mice. Apolipoprotein B100-only low-density lipoprotein (LDL) receptor-/- mice were given saline, a nontargeting control antisense oligonucleotide (ASO), or ASOs targeting ACAT2 biweekly for a period spanning 16 weeks. Mice treated with ACAT2 targeting ASOs had liver-specific reduction in ACAT2 mRNA, yet intestinal ACAT2 and cholesterol absorption was left undisturbed. ASO-mediated knockdown of ACAT2 resulted in reduction of total plasma cholesterol, increased levels of plasma triglyceride, and a shift in LDL cholesteryl ester (CE) fatty acid composition from mainly saturated and monounsaturated to polyunsaturated fatty acid enrichment. Furthermore, the liver-specific depletion of ACAT2 resulted in protection against diet-induced hypercholesterolemia and aortic CE deposition. This is the first demonstration that specific pharmacological inhibition of ACAT2, without affecting ACAT1, is atheroprotective. Hepatic ACAT2 plays a critical role in driving the production of atherogenic lipoproteins, and therapeutic interventions, such as the ACAT2-specific ASOs used here, which reduce acyltransferase 2 (ACAT2) function in the liver without affecting ACAT1, may provide clinical benefit for cardiovascular disease prevention.

Role of Insulin in the Regulation of Proprotein Convertase Subtilisin/Kexin Type 9.

PubMed

Miao, Ji; Manthena, Praveen V; Haas, Mary E; Ling, Alisha V; Shin, Dong-Ju; Graham, Mark J; Crooke, Rosanne M; Liu, Jingwen; Biddinger, Sudha B

2015-07-01

Proprotein convertase subtilisin/kexin type 9 (PCSK9), which binds the low-density lipoprotein receptor and targets it for degradation, has emerged as an important regulator of serum cholesterol levels and cardiovascular disease risk. Although much work is currently focused on developing therapies for inhibiting PCSK9, the endogenous regulation of PCSK9, particularly by insulin, remains unclear. The objective of these studies was to determine the effects of insulin on PCSK9 in vitro and in vivo. Using rat hepatoma cells and primary rat hepatocytes, we found that insulin increased PCSK9 expression and increased low-density lipoprotein receptor degradation in a PCSK9-dependent manner. In parallel, hepatic Pcsk9 mRNA and plasma PCSK9 protein levels were reduced by 55% to 75% in mice with liver-specific knockout of the insulin receptor; 75% to 88% in mice made insulin-deficient with streptozotocin; and 65% in ob/ob mice treated with antisense oligonucleotides against the insulin receptor. However, antisense oligonucleotide-mediated knockdown of insulin receptor in lean, wild-type mice had little effect. In addition, we found that fasting was able to reduce PCSK9 expression by 80% even in mice that lack hepatic insulin signaling. Taken together, these data indicate that although insulin induces PCSK9 expression, it is not the sole or even dominant regulator of PCSK9 under all conditions. © 2015 American Heart Association, Inc.

Antisense oligonucleotides targeting translation inhibitory elements in 5' UTRs can selectively increase protein levels.

PubMed

Liang, Xue-Hai; Sun, Hong; Shen, Wen; Wang, Shiyu; Yao, Joyee; Migawa, Michael T; Bui, Huynh-Hoa; Damle, Sagar S; Riney, Stan; Graham, Mark J; Crooke, Rosanne M; Crooke, Stanley T

2017-09-19

A variety of diseases are caused by deficiencies in amounts or activity of key proteins. An approach that increases the amount of a specific protein might be of therapeutic benefit. We reasoned that translation could be specifically enhanced using trans-acting agents that counter the function of negative regulatory elements present in the 5' UTRs of some mRNAs. We recently showed that translation can be enhanced by antisense oligonucleotides (ASOs) that target upstream open reading frames. Here we report the amount of a protein can also be selectively increased using ASOs designed to hybridize to other translation inhibitory elements in 5' UTRs. Levels of human RNASEH1, LDLR, and ACP1 and of mouse ACP1 and ARF1 were increased up to 2.7-fold in different cell types and species upon treatment with chemically modified ASOs targeting 5' UTR inhibitory regions in the mRNAs encoding these proteins. The activities of ASOs in enhancing translation were sequence and position dependent and required helicase activity. The ASOs appear to improve the recruitment of translation initiation factors to the target mRNA. Importantly, ASOs targeting ACP1 mRNA significantly increased the level of ACP1 protein in mice, suggesting that this approach has therapeutic and research potentials. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Lack of clinical pharmacodynamic and pharmacokinetic drug-drug interactions between warfarin and the antisense oligonucleotide mipomersen.

PubMed

Li, Zhaoyang; Hard, Marjie L; Grundy, John S; Singh, Tejdip; von Moltke, Lisa L; Boltje, Ingrid

2014-08-01

Mipomersen is a second-generation antisense oligonucleotide indicated as an adjunct therapy for homozygous familial hypercholesterolemia (HoFH). Warfarin is commonly prescribed for a variety of cardiac disorders in homozygous familial hypercholesterolemia population, and concurrent use of warfarin and mipomersen is likely. This open-label, single-sequence 2-period phase 1 study in healthy subjects evaluated the potential drug-drug interactions between mipomersen and warfarin. The subjects received a single oral 25 mg dose of warfarin alone on day 1, and after a 7-day washout period, received 200 mg mipomersen alone subcutaneously every other day on days 8-12, and received both concurrently on day 14. Coadministration of mipomersen did not change the pharmacodynamics (international normalized ratio, prothrombin time, and activated partial thromboplastin time) and pharmacokinetics (PK) of warfarin. There were no clinically significant changes in the PK of mipomersen with concurrent administration of warfarin. There were no events indicative of an increase in bleeding tendency when warfarin was coadministered with mipomersen, and the adverse event profile of mipomersen did not appear to be altered in combination with warfarin, as compared with that of the respective reference treatment. The combination of these 2 medications appeared to be safe and well tolerated. These results suggest that the dosage adjustment of warfarin or mipomersen is not expected to be necessary with coadministration.

The macrophage as a Trojan horse for antisense oligonucleotide delivery.

PubMed

Novak, James S; Jaiswal, Jyoti K; Partridge, Terence A

2018-06-04

The gateway to the promised land of gene therapy has been obstructed by the problem of accurate and efficient delivery of therapeutic agents to their target sites. This is true both of constructs designed to directly express proteins of interest, and of constructs or agents aimed at modifying the expression of endogenous genes. It is recognized as a major impediment to the effective application of genetic therapies currently or incipiently in clinical trial. Our recent study has examined the mechanism underlying delivery of therapeutic antisense oligonucleotides (ASO) for treating the devastating muscle disease Duchenne muscular dystrophy [1]. Working to understand the mode of ASO delivery in DMD, we discovered that inflammatory cells act as a depot that locally stores the intravenously administered ASO. This local depot of ASO then becomes available to the muscle fibres by way of satellite cells that deliver their cargo by fusion with damaged fibres during muscle repair. This finding points to a potentially novel strategy for systemic ASO delivery, involving the use of the inflammatory cell as a Trojan horse. Such an approach would have the benefit not only of enhancing tissue-specific delivery of ASO, but also of reducing the impact of their rapid clearance from the circulation. Here, we discuss the issues surrounding ASO-mediated exon skipping efficacy for DMD, and outline research aimed at improving targeted ASO delivery.

Synthesis and biophysical properties of 5'-thio-2',4'-BNA/LNA oligonucleotide.

PubMed

Islam, Md Ariful; Fujisaka, Aki; Mori, Shohei; Ito, Kosuke Ramon; Yamaguchi, Takao; Obika, Satoshi

2018-07-23

Phosphorothioate modification of oligonucleotides is one of the most promising chemical modifications in nucleic acid therapeutics. Structurally similar 5'-thio or phosphorothiolate-modified nucleotides, in which the 5'-bridging oxygen atom is replaced with a sulfur atom, are attracting attention and gaining importance in oligonucleotide-based research. In our present study, we synthesized 5'-thio-2',4'-BNA/LNA monomers bearing thymine or 5-methylcytosine nucleobase. The 5'-thio-2',4'-BNA/LNA monomers were successfully incorporated into target oligonucleotides, and their nuclease stability and binding affinity with complementary strands were evaluated. Copyright © 2018 Elsevier Ltd. All rights reserved.

Self-replication of chemical systems based on recognition within a double or a triple helix - A realistic hypothesis

NASA Technical Reports Server (NTRS)

Kanavarioti, Anastassia

1992-01-01

A scenario is proposed for the non-enzymatic self-replication of short RNA molecules. The self-replication of an oligopyrimidine strand is considered and the process of template-directed synthesis based on recognition within a double helix is discussed. Replication mechanisms are suggested for selected oligonucleotides. The mechanisms are based on Watson-Crick base pairing between complementary nucleotides as well as Hoogsteen base pairing between a duplex and the complementary third strand. It is suggested that self-replication based on these mechanisms may be accomplished but may result in a substantial amount of misinformation transfer when mixed oligonucleotides are used.

Surface-enhanced Raman scattering detection of DNA derived from the West Nile virus genome using magnetic capture of Raman-active gold nanoparticles

USDA-ARS?s Scientific Manuscript database

A model paramagnetic nanoparticle (MNP) assay is demonstrated for surface-enhanced Raman scattering (SERS) detection of DNA oligonucleotides derived from the West Nile virus (WNV) genome. Detection is based on the capture of WNV target sequences by hybridization with complementary oligonucleotide pr...

A cis-antisense RNA acts in trans in Staphylococcus aureus to control translation of a human cytolytic peptide.

PubMed

Sayed, Nour; Jousselin, Ambre; Felden, Brice

2011-12-25

Antisense RNAs (asRNAs) pair to RNAs expressed from the complementary strand, and their functions are thought to depend on nucleotide overlap with genes on the opposite strand. There is little information on the roles and mechanisms of asRNAs. We show that a cis asRNA acts in trans, using a domain outside its target complementary sequence. SprA1 small regulatory RNA (sRNA) and SprA1(AS) asRNA are concomitantly expressed in S. aureus. SprA1(AS) forms a complex with SprA1, preventing translation of the SprA1-encoded open reading frame by occluding translation initiation signals through pairing interactions. The SprA1 peptide sequence is within two RNA pseudoknots. SprA1(AS) represses production of the SprA1-encoded cytolytic peptide in trans, as its overlapping region is dispensable for regulation. These findings demonstrate that sometimes asRNA functional domains are not their gene-target complementary sequences, suggesting there is a need for mechanistic re-evaluation of asRNAs expressed in prokaryotes and eukaryotes.

Phosphorothioate backbone modifications of nucleotide-based drugs are potent platelet activators

PubMed Central

Flierl, Ulrike; Nero, Tracy L.; Lim, Bock; Arthur, Jane F.; Yao, Yu; Jung, Stephanie M.; Gitz, Eelo; Pollitt, Alice Y.; Zaldivia, Maria T.K.; Jandrot-Perrus, Martine; Schäfer, Andreas; Nieswandt, Bernhard; Andrews, Robert K.; Parker, Michael W.; Gardiner, Elizabeth E.

2015-01-01

Nucleotide-based drug candidates such as antisense oligonucleotides, aptamers, immunoreceptor-activating nucleotides, or (anti)microRNAs hold great therapeutic promise for many human diseases. Phosphorothioate (PS) backbone modification of nucleotide-based drugs is common practice to protect these promising drug candidates from rapid degradation by plasma and intracellular nucleases. Effects of the changes in physicochemical properties associated with PS modification on platelets have not been elucidated so far. Here we report the unexpected binding of PS-modified oligonucleotides to platelets eliciting strong platelet activation, signaling, reactive oxygen species generation, adhesion, spreading, aggregation, and thrombus formation in vitro and in vivo. Mechanistically, the platelet-specific receptor glycoprotein VI (GPVI) mediates these platelet-activating effects. Notably, platelets from GPVI function–deficient patients do not exhibit binding of PS-modified oligonucleotides, and platelet activation is fully abolished. Our data demonstrate a novel, unexpected, PS backbone–dependent, platelet-activating effect of nucleotide-based drug candidates mediated by GPVI. This unforeseen effect should be considered in the ongoing development programs for the broad range of upcoming and promising DNA/RNA therapeutics. PMID:25646267

Nucleic acids--genes, drugs, molecular lego and more.

PubMed

Häner, Robert

2010-01-01

Chemically modified nucleic acids find widespread use as tools in research, as diagnostic reagents and even as pharmaceutical compounds. On the background of antisense research and development, the synthesis and evaluation of modified oligonucleotides was intensively pursued in the early to mid nineties in corporate research of former Ciba. Most of these efforts concentrated on the development of sugar and/or backbone-modified derivatives for pharmaceutical applications. Additionally, oligonucleotide metal conjugates were investigated with the goal to develop artificial ribonucleases. Since the turn of the millennium also the potential of non-nucleosidic and non-hydrogen bonding building blocks has increasingly been recognized. Such derivatives possess unique properties that may have an impact in the fields of materials and genetic research. In this brief account, we take a personal look back on some past as well as some recent results.

Synthesis and biological evaluation of sialyl-oligonucleotide conjugates targeting leukocyte B trans-membranal receptor CD22 as delivery agents for nucleic acid drugs.

PubMed

St-Pierre, Gabrielle; Pal, Sudip; Østergaard, Michael E; Zhou, Tianyuan; Yu, Jinghua; Tanowitz, Michael; Seth, Punit P; Hanessian, Stephen

2016-06-01

Antisense oligonucleotides (ASOs) modified with ligands which target cell surface receptors have the potential to significantly improve potency in the target tissue. This has recently been demonstrated using triantennary N-acetyl d-galactosamine conjugated ASOs. CD22 is a cell surface receptor expressed exclusively on B cells thus presenting an attractive target for B cell specific delivery of drugs. Herein, we reported the synthesis of monovalent and trivalent ASO conjugates with biphenylcarbonyl (BPC) modified sialic acids and their study as ASO delivery agents into B cells. CD22 positive cells exhibited reduced potency when treated with ligand modified ASOs and mechanistic examination suggested reduced uptake into cells potentially as a result of sequestration of ASO by other cell-surface proteins. Copyright © 2016 Elsevier Ltd. All rights reserved.

Noncoding transcripts in sense and antisense orientation regulate the epigenetic state of ribosomal RNA genes.

PubMed

Bierhoff, H; Schmitz, K; Maass, F; Ye, J; Grummt, I

2010-01-01

Alternative transcription of the same gene in sense and antisense orientation regulates expression of protein-coding genes. Here we show that noncoding RNA (ncRNA) in sense and antisense orientation also controls transcription of rRNA genes (rDNA). rDNA exists in two types of chromatin--a euchromatic conformation that is permissive to transcription and a heterochromatic conformation that is transcriptionally silent. Silencing of rDNA is mediated by NoRC, a chromatin-remodeling complex that triggers heterochromatin formation. NoRC function requires RNA that is complementary to the rDNA promoter (pRNA). pRNA forms a DNA:RNA triplex with a regulatory element in the rDNA promoter, and this triplex structure is recognized by DNMT3b. The results imply that triplex-mediated targeting of DNMT3b to specific sequences may be a common pathway in epigenetic regulation. We also show that rDNA is transcribed in antisense orientation. The level of antisense RNA (asRNA) is down-regulated in cancer cells and up-regulated in senescent cells. Ectopic asRNA triggers trimethylation of histone H4 at lysine 20 (H4K20me3), suggesting that antisense transcripts guide the histone methyltransferase Suv4-20 to rDNA. The results reveal that noncoding RNAs in sense and antisense orientation are important determinants of the epigenetic state of rDNA.

Identification of Type VI Collagen Synthesizing Cells in Human Diabetic Glomerulosclerosis Using Renal Biopsy Sections

PubMed Central

Razzaque, Mohammed Shawkat; Koji, Takehiko; Harada, Takashi; Taguchi, Takashi

1997-01-01

Although the role of extracellular matrices in the development of glomerulosclerosis has been discussed widely, the cellular origin of type VI collagen in diabetic nephropathy (DN) has remained relatively unexplored. This study reports the distribution and cellular origin of type VI collagen in DN. Type VI collagen‐specific oligonucleotide probes and monoclonal antibody were used to assess the relative expression of mRNA for \\alpha1 (VI) chain and its translated protein in paraffin‐embedded renal biopsy sections of DN. By immunohistochemistry, compared to the control, increased deposition of type VI collagen was noted in the diffuse and nodular lesions of diabetic glomeruli. For cellular localization of type VI collagen mRNA, paraffin‐embedded renal sections of the control and DN were hybridized in situ with digoxigenin (Dig)‐labeled antisense oligo‐DNA probe complementary to a part of \\alpha1 (VI) mRNA. In comparison to the control kidney sections, increased numbers of intraglomerular cells (both mesangial and epithelial cells) were positive for α1 (VI) mRNA in renal biopsy sections of DN. From the results, we conclude that overexpression of type VI collagen by intraglomerular cells with its increased deposition might significantly contribute to the glomerulosclerosis found in DN. PMID:9497854

Huntingtin Haplotypes Provide Prioritized Target Panels for Allele-specific Silencing in Huntington Disease Patients of European Ancestry

PubMed Central

Kay, Chris; Collins, Jennifer A; Skotte, Niels H; Southwell, Amber L; Warby, Simon C; Caron, Nicholas S; Doty, Crystal N; Nguyen, Betty; Griguoli, Annamaria; Ross, Colin J; Squitieri, Ferdinando; Hayden, Michael R

2015-01-01

Huntington disease (HD) is a dominant neurodegenerative disorder caused by a CAG repeat expansion in the Huntingtin gene (HTT). Heterozygous polymorphisms in cis with the mutation allow for allele-specific suppression of the pathogenic HTT transcript as a therapeutic strategy. To prioritize target selection, precise heterozygosity estimates are needed across diverse HD patient populations. Here we present the first comprehensive investigation of all common target alleles across the HTT gene, using 738 reference haplotypes from the 1000 Genomes Project and 2364 haplotypes from HD patients and relatives in Canada, Sweden, France, and Italy. The most common HD haplotypes (A1, A2, and A3a) define mutually exclusive sets of polymorphisms for allele-specific therapy in the greatest number of patients. Across all four populations, a maximum of 80% are treatable using these three target haplotypes. We identify a novel deletion found exclusively on the A1 haplotype, enabling potent and selective silencing of mutant HTT in approximately 40% of the patients. Antisense oligonucleotides complementary to the deletion reduce mutant A1 HTT mRNA by 78% in patient cells while sparing wild-type HTT expression. By suppressing specific haplotypes on which expanded CAG occurs, we demonstrate a rational approach to the development of allele-specific therapy for a monogenic disorder. PMID:26201449

Oligonucleotide Antiviral Therapeutics: Antisense and RNA Interference for Highly Pathogenic RNA Viruses

DTIC Science & Technology

2008-01-01

siRNA delivery method in his animal model, it remains to be studied whether this general pproach is safe in humans. Often cited as an advantage of siRNAs...way studying the intravenous delivery f ASO drug candidates targeting Bcl-2 (Genasense®, Genta) nd c-myc (Resten-NG®, AVI BioPharma), while completed... studies have been published investigating MOs as a treatment for EBOV infection, with both showing fficacy in animal models. PMOs were designed to

Targeted Elimination of PCDH-PC Expressing Prostate Cancer Cells for Control of Hormone-Resistant Prostate Cancer

DTIC Science & Technology

2008-11-01

or antisense oligonucleotides ( ASOs ) might be useful in preventing the development of castration- recurrent prostate cancer in prostate cancer...patients. To this end, we have created functional shRNA vectors and ASOs capable of suppressing PCDH-PC expression and we have also created a monoclonal...electrophoresed on an SDS-PAGE gel and blotted onto a filter. The filter was probed with an anti-myc antibody. The levels of myc-tagged PCDH-PC protein

Targeted Elimination of PCDH-PC Expressing Prostate Cancer Cells for Control of Hormone-Resistant Prostate Cancer

DTIC Science & Technology

2007-11-01

SDS-PAGE gel . The Western blot made from this gel was probed with antibody that recognizes the myc-tag. When compared to the extracts from the...SDS-PAGE gel and blotted onto a filter. The filter was probed with an anti-myc antibody. The levels of myc-tagged PCDH-PC protein in cells co...Specific Aim 2. Design and test antisense oligonucleotides ( ASOs ) that suppress PCDH-PC expression in prostate cancer cells. Work Done: We used

Targeted Elimination of PCDH-PC Expressing Prostate Cancer Cells for Control of Hormone-Resistant Prostate Cancer

DTIC Science & Technology

2009-11-01

expression knockout by shRNAs or antisense oligonucleotides ( ASOs ) might be useful in preventing the development of castration-recurrent prostate...cancer in prostate cancer patients. To this end, we have created functional shRNA vectors and ASOs capable of suppressing PCDH-PC expression and we have...containing PCDH-PC cDNA. Cell extracts were prepared 48 hrs after co-transfection and were electrophoresed on an SDS-PAGE gel and blotted onto a

Translational and regulatory challenges for exon skipping therapies.

PubMed

Aartsma-Rus, Annemieke; Ferlini, Alessandra; Goemans, Nathalie; Pasmooij, Anna M G; Wells, Dominic J; Bushby, Katerine; Vroom, Elizabeth; Balabanov, Pavel

2014-10-01

Several translational challenges are currently impeding the therapeutic development of antisense-mediated exon skipping approaches for rare diseases. Some of these are inherent to developing therapies for rare diseases, such as small patient numbers and limited information on natural history and interpretation of appropriate clinical outcome measures. Others are inherent to the antisense oligonucleotide (AON)-mediated exon skipping approach, which employs small modified DNA or RNA molecules to manipulate the splicing process. This is a new approach and only limited information is available on long-term safety and toxicity for most AON chemistries. Furthermore, AONs often act in a mutation-specific manner, in which case multiple AONs have to be developed for a single disease. A workshop focusing on preclinical development, trial design, outcome measures, and different forms of marketing authorization was organized by the regulatory models and biochemical outcome measures working groups of Cooperation of Science and Technology Action: "Networking towards clinical application of antisense-mediated exon skipping for rare diseases." The workshop included participants from patient organizations, academia, and members of staff from the European Medicine Agency and Medicine Evaluation Board (the Netherlands). This statement article contains the key outcomes of this meeting.

Antisense-mediated exon skipping: A versatile tool with therapeutic and research applications

PubMed Central

Aartsma-Rus, Annemieke; van Ommen, Gert-Jan B.

2007-01-01

Antisense-mediated modulation of splicing is one of the few fields where antisense oligonucleotides (AONs) have been able to live up to their expectations. In this approach, AONs are implemented to restore cryptic splicing, to change levels of alternatively spliced genes, or, in case of Duchenne muscular dystrophy (DMD), to skip an exon in order to restore a disrupted reading frame. The latter allows the generation of internally deleted, but largely functional, dystrophin proteins and would convert a severe DMD into a milder Becker muscular dystrophy phenotype. In fact, exon skipping is currently one of the most promising therapeutic tools for DMD, and a successful first-in-man trial has recently been completed. In this review the applicability of exon skipping for DMD and other diseases is described. For DMD AONs have been designed for numerous exons, which has given us insight into their mode of action, splicing in general, and splicing of the DMD gene in particular. In addition, retrospective analysis resulted in guidelines for AON design for DMD and most likely other genes as well. This knowledge allows us to optimize therapeutic exon skipping, but also opens up a range of other applications for the exon skipping approach. PMID:17684229

Photoregulating RNA digestion using azobenzene linked dumbbell antisense oligodeoxynucleotides.

PubMed

Wu, Li; He, Yujian; Tang, Xinjing

2015-06-17

Introduction of 4,4'-bis(hydroxymethyl)-azobenzene (azo) to dumbbell hairpin oligonucleotides at the loop position was able to reversibly control the stability of the whole hairpin structure via UV or visible light irradiation. Here, we designed and synthesized a series of azobenzene linked dumbbell antisense oligodeoxynucleotides (asODNs) containing two terminal hairpins that are composed of an asODN and a short inhibitory sense strand. Thermal melting studies of these azobenzene linked dumbbell asODNs indicated that efficient trans to cis photoisomerization of azobenzene moieties induced large difference in thermal stability (ΔTm = 12.1-21.3 °C). In addition, photomodulation of their RNA binding abilities and RNA digestion by RNase H was investigated. The trans-azobenzene linked asODNs with the optimized base pairs between asODN strands and inhibitory sense strands could only bind few percentage of the target RNA, while it was able to recover their binding to the target RNA and degrade it by RNase H after light irradiation. Upon optimization, it is promising to use these azobenzene linked asODNs for reversible spatial and temporal regulation of antisense activities based on both steric binding and RNA digestion by RNase H.

Biodegradable polymer nanocarriers for therapeutic antisense microRNA delivery in living animals

NASA Astrophysics Data System (ADS)

Paulmurugan, Ramasamy; Sekar, Narayana M.; Sekar, Thillai V.

2012-03-01

MicroRNAs are endogenous regulators of gene expression, deregulated in several cellular diseases including cancer. Altering the cellular microenvironment by modulating the microRNAs functions can regulate different genes involved in major cellular processes, and this approach is now being investigated as a promising new generation of molecularly targeted anti-cancer therapies. AntagomiRs (Antisense-miRNAs) are a novel class of chemically modified stable oligonucleotides used for blocking the functions of endogenous microRNAs, which are overexpressed. A key challenge in achieving effective microRNAbased therapeutics lies in the development of an efficient delivery system capable of specifically delivering antisense oligonucleotides and target cancer cells in living animals. We are now developing an effective delivery system designed to selectively deliver antagomiR- 21 and antagomiR-10b to triple negative breast cancer cells, and to revert tumor cell metastasis and invasiveness. The FDA-approved biodegradable PLGA-nanoparticles were selected as a carrier for antagomiRs delivery. Chemically modified antagomiRs (antagomiR-21 and antagomiR-10b) were co-encapsulated in PEGylated-PLGA-nanoparticles by using the double-emulsification (W/O/W) solvent evaporation method, and the resulting average particle size of 150-200nm was used for different in vitro and in vivo experiments. The antagomiR encapsulated PLGA-nanoparticles were evaluated for their in vitro antagomiRs delivery, intracellular release profile, and antagomiRs functional effects, by measuring the endogenous cellular targets, and the cell growth and metastasis. The xenografts of tumor cells in living mice were used for evaluating the anti-metastatic and anti-invasive properties of cells. The results showed that the use of PLGA for antagomiR delivery is not only efficient in crossing cell membrane, but can also maintain functional intracellular antagomiRs level for a extended period of time and achieve therapeutic effect in living animals.

[Antisense polynucleotides and prospects for their use in fighting viruses].

PubMed

Tikhonenko, T I

1989-01-01

Natural or synthetic anti-sense (as) polynucleotides complementary to distinct functional regions of mRNA (asRNA or asDNA) are able to inhibit the expression of any target gene. If certain viral mRNAs important for virus replication are targeted the inhibition of viral infection by asRNA or asDNA takes place. Inhibitory effects of complementary polynucleotides on gene activity in eukaryotic cells is due to the disturbance of translation of corresponding mRNAs as well as to the impairment of their splicing or transportation from the nuclei to cytoplasm. In prokaryotic cells, obviously, only the first factor is operating. The recombinant genes programming anti-viral asRNA can confer the resistance to the infection by other virus to the transformed cells. The resistance to viral infection observed in transgenic animals, expressing asRNA genes, may be considered as a new unnatural form of informational immunity.

General method for labeling siRNA by click chemistry with fluorine-18 for the purpose of PET imaging.

PubMed

Mercier, Frédéric; Paris, Jérôme; Kaisin, Geoffroy; Thonon, David; Flagothier, Jessica; Teller, Nathalie; Lemaire, Christian; Luxen, André

2011-01-19

The alkyne-azide Cu(I)-catalyzed Huisgen cycloaddition, a click-type reaction, was used to label a double-stranded oligonucleotide (siRNA) with fluorine-18. An alkyne solid support CPG for the preparation of monostranded oligonucleotides functionalized with alkyne has been developed. Two complementary azide labeling agents (1-(azidomethyl)-4-[(18)F]fluorobenzene) and 1-azido-4-(3-[(18)F]fluoropropoxy)benzene have been produced with 41% and 35% radiochemical yields (decay-corrected), respectively. After annealing with the complementary strand, the siRNA was directly labeled by click chemistry with [(18)F]fluoroazide to produce the [(18)F]-radiolabeled siRNA with excellent radiochemical yield and purity.

Antisense transcription is pervasive but rarely conserved in enteric bacteria.

PubMed

Raghavan, Rahul; Sloan, Daniel B; Ochman, Howard

2012-01-01

Noncoding RNAs, including antisense RNAs (asRNAs) that originate from the complementary strand of protein-coding genes, are involved in the regulation of gene expression in all domains of life. Recent application of deep-sequencing technologies has revealed that the transcription of asRNAs occurs genome-wide in bacteria. Although the role of the vast majority of asRNAs remains unknown, it is often assumed that their presence implies important regulatory functions, similar to those of other noncoding RNAs. Alternatively, many antisense transcripts may be produced by chance transcription events from promoter-like sequences that result from the degenerate nature of bacterial transcription factor binding sites. To investigate the biological relevance of antisense transcripts, we compared genome-wide patterns of asRNA expression in closely related enteric bacteria, Escherichia coli and Salmonella enterica serovar Typhimurium, by performing strand-specific transcriptome sequencing. Although antisense transcripts are abundant in both species, less than 3% of asRNAs are expressed at high levels in both species, and only about 14% appear to be conserved among species. And unlike the promoters of protein-coding genes, asRNA promoters show no evidence of sequence conservation between, or even within, species. Our findings suggest that many or even most bacterial asRNAs are nonadaptive by-products of the cell's transcription machinery. IMPORTANCE Application of high-throughput methods has revealed the expression throughout bacterial genomes of transcripts encoded on the strand complementary to protein-coding genes. Because transcription is costly, it is usually assumed that these transcripts, termed antisense RNAs (asRNAs), serve some function; however, the role of most asRNAs is unclear, raising questions about their relevance in cellular processes. Because natural selection conserves functional elements, comparisons between related species provide a method for assessing functionality genome-wide. Applying such an approach, we assayed all transcripts in two closely related bacteria, Escherichia coli and Salmonella enterica serovar Typhimurium, and demonstrate that, although the levels of genome-wide antisense transcription are similarly high in both bacteria, only a small fraction of asRNAs are shared across species. Moreover, the promoters associated with asRNAs show no evidence of sequence conservation between, or even within, species. These findings indicate that despite the genome-wide transcription of asRNAs, many of these transcripts are likely nonfunctional.

Correlation of Fos expression and circling asymmetry during gerbil vestibular compensation

NASA Technical Reports Server (NTRS)

Kaufman, G. D.; Shinder, M. E.; Perachio, A. A.

1999-01-01

Vestibular compensation is a central nervous system process resulting in recovery of functional movement and control following a unilateral vestibular lesion. Small pressure injections of phosphorothioate 20mer oligonucleotides were used to probe the role of the Fos transcription protein during vestibular compensation in the gerbil brainstem. During isoflurane gas anesthesia, antisense probes against the c-fos mRNA sequence were injected into the medial vestibular and prepositus nuclei unilaterally prior to a unilateral surgical labyrinthectomy. Anionic dyes, which did not interact with the oligonucleotides, were used to mark the injection site and help determine the extent of diffusion. The antiFos oligonucleotide injections reduced Fos expression at the injection site in neurons which normally express Fos after the lesion, and also affected circling behavior induced by hemilabyrinthectomy. With both ipsilateral and contralateral medial vestibular and prepositus nuclei injections, less ipsilateral and more contralateral circling was noted in animals injected with antiFos injections as compared to non-injected controls. The degree of change in these behaviors was dependent upon the side of the injection. Histologically, antiFos injections reduced the number of Fos immunolabeled neurons around the injection site, and increased Fos expression contralaterally. The correlation of the number of neurons with Fos expression to turning behavior was stronger for contralateral versus ipsilateral turns, and for neurons in the caudal and ipsilateral sub-regions of the medial vestibular and prepositus nuclei. The results are discussed in terms of neuronal firing activity versus translational activity based on the asymmetrical expression of the Fos inducible transcription factor in the medial vestibular and prepositus nuclei. Although ubiquitous in the brain, transcription factors like Fos can serve localized and specific roles in sensory-specific adaptive stimuli. Antisense injections can be an effective procedure for localized intervention into complex physiological functions, e.g. vestibular compensation. Copyright 1999 Elsevier Science B.V.

A Cytoplasmic New Catalytic Subunit of Calcineurin in Trypanosoma cruzi and Its Molecular and Functional Characterization

PubMed Central

Orrego, Patricio R.; Olivares, Héctor; Cordero, Esteban M.; Bressan, Albert; Cortez, Mauro; Sagua, Hernán; Neira, Ivan; González, Jorge; da Silveira, José Franco; Yoshida, Nobuko; Araya, Jorge E.

2014-01-01

Parasitological cure for Chagas disease is considered extremely difficult to achieve because of the lack of effective chemotherapeutic agents against Trypanosoma cruzi at different stages of infection. There are currently only two drugs available. These have several limitations and can produce serious side effects. Thus, new chemotherapeutic targets are much sought after. Among T. cruzi components involved in key processes such as parasite proliferation and host cell invasion, Ca2+-dependent molecules play an important role. Calcineurin (CaN) is one such molecule. In this study, we cloned a new isoform of the gene coding for CL strain catalytic subunit CaNA (TcCaNA2) and characterized it molecularly and functionally. There is one copy of the TcCaNA2 gene per haploid genome. It is constitutively transcribed in all T. cruzi developmental forms and is localized predominantly in the cytosol. In the parasite, TcCaNA2 is associated with CaNB. The recombinant protein TcCaNA2 has phosphatase activity that is enhanced by Mn2+/Ni2+. The participation of TcCaNA2 in target cell invasion by metacyclic trypomastigotes was also demonstrated. Metacyclic forms with reduced TcCaNA2 expression following treatment with morpholino antisense oligonucleotides targeted to TcCaNA2 invaded HeLa cells at a lower rate than control parasites treated with morpholino sense oligonucleotides. Similarly, the decreased expression of TcCaNA2 following treatment with antisense morpholino oligonucleotides partially affected the replication of epimastigotes, although to a lesser extent than the decrease in expression following treatment with calcineurin inhibitors. Our findings suggest that the calcineurin activities of TcCaNA2/CaNB and TcCaNA/CaNB, which have distinct cellular localizations (the cytoplasm and the nucleus, respectively), may play a critical role at different stages of T. cruzi development, the former in host cell invasion and the latter in parasite multiplication. PMID:24498455

Simple and rapid enzymatic method for the synthesis of single-strand oligonucleotides containing trifluorothymidine.

PubMed

Suzuki, Norihiko; Fukushima, Masakazu

2010-11-01

To investigate the mechanism of trifluorothymidine (TFT)-induced DNA damage, we developed an enzymatic method for the synthesis of single-strand oligonucleotides containing TFT-monophosphate residues. Sixteen-mer oligonucleotides and 14-mer 5'-phosphorylated oligonucleotides were annealed to the template of 25-mer, so as to empty one nucleotide site. TFT-triphosphate was incorporated into the site by DNA polymerase and then ligated to 5'-phosphorylated oligonucleotides by DNA ligase. The synthesized 31-mer oligonucleotides containing TFT residues were isolated from the 25-mer complementary template by denaturing polyacrylamide electrophoresis. Using these single-strand oligonucleotides containing TFT residues, the cleavage of TFT residues from DNA, using mismatch uracil-DNA glycosylase (MUG) of E.coli origin, was compared with that of 5-fluorouracil (5FU) and 5-bromodeoxyuridine (BrdU). The TFT/A pair was not cleaved by MUG, while the other pairs, namely, 5FU/A, 5FU/G, BrdU/A, BrdU/G, and TFT/G, were easily cleaved from each synthesized DNA. Thus, this method is useful for obtaining some site-specifically modified oligonucleotides.

Human Immunodeficiency Virus-Type 1 LTR DNA contains an intrinsic gene producing antisense RNA and protein products

PubMed Central

Ludwig, Linda B; Ambrus, Julian L; Krawczyk, Kristie A; Sharma, Sanjay; Brooks, Stephen; Hsiao, Chiu-Bin; Schwartz, Stanley A

2006-01-01

Background While viruses have long been shown to capitalize on their limited genomic size by utilizing both strands of DNA or complementary DNA/RNA intermediates to code for viral proteins, it has been assumed that human retroviruses have all their major proteins translated only from the plus or sense strand of RNA, despite their requirement for a dsDNA proviral intermediate. Several studies, however, have suggested the presence of antisense transcription for both HIV-1 and HTLV-1. More recently an antisense transcript responsible for the HTLV-1 bZIP factor (HBZ) protein has been described. In this study we investigated the possibility of an antisense gene contained within the human immunodeficiency virus type 1 (HIV-1) long terminal repeat (LTR). Results Inspection of published sequences revealed a potential transcription initiator element (INR) situated downstream of, and in reverse orientation to, the usual HIV-1 promoter and transcription start site. This antisense initiator (HIVaINR) suggested the possibility of an antisense gene responsible for RNA and protein production. We show that antisense transcripts are generated, in vitro and in vivo, originating from the TAR DNA of the HIV-1 LTR. To test the possibility that protein(s) could be translated from this novel HIV-1 antisense RNA, recombinant HIV antisense gene-FLAG vectors were designed. Recombinant protein(s) were produced and isolated utilizing carboxy-terminal FLAG epitope (DYKDDDDK) sequences. In addition, affinity-purified antisera to an internal peptide derived from the HIV antisense protein (HAP) sequences identified HAPs from HIV+ human peripheral blood lymphocytes. Conclusion HIV-1 contains an antisense gene in the U3-R regions of the LTR responsible for both an antisense RNA transcript and proteins. This antisense transcript has tremendous potential for intrinsic RNA regulation because of its overlap with the beginning of all HIV-1 sense RNA transcripts by 25 nucleotides. The novel HAPs are encoded in a region of the LTR that has already been shown to be deleted in some HIV-infected long-term survivors and represent new potential targets for vaccine development. PMID:17090330

RNase III-Binding-mRNAs Revealed Novel Complementary Transcripts in Streptomyces

PubMed Central

Šetinová, Dita; Šmídová, Klára; Pohl, Pavel; Musić, Inesa; Bobek, Jan

2018-01-01

cis-Antisense RNAs (asRNAs) provide very simple and effective gene expression control due to the perfect complementarity between regulated and regulatory transcripts. In Streptomyces, the antibiotic-producing clade, the antisense control system is not yet understood, although it might direct the organism's complex development. Initial studies in Streptomyces have found a number of asRNAs. Apart from this, hundreds of mRNAs have been shown to bind RNase III, the double strand-specific endoribonuclease. In this study, we tested 17 mRNAs that have been previously co-precipitated with RNase III for antisense expression. Our RACE mapping showed that all of these mRNAs possess cognate asRNA. Additional tests for antisense expression uncovered as-adpA, as-rnc, as3983, as-sigB, as-sigH, and as-sigR RNAs. Northern blots detected the expression profiles of 18 novel transcripts. Noteworthy, we also found that only a minority of asRNAs respond to the absence of RNase III enzyme by increasing their cellular levels. Our findings suggest that antisense expression is widespread in Streptomyces, including genes of such important developmental regulators, as AdpA, RNase III, and sigma factors. PMID:29379487

RNase III-Binding-mRNAs Revealed Novel Complementary Transcripts in Streptomyces.

PubMed

Šetinová, Dita; Šmídová, Klára; Pohl, Pavel; Musić, Inesa; Bobek, Jan

2017-01-01

cis -Antisense RNAs (asRNAs) provide very simple and effective gene expression control due to the perfect complementarity between regulated and regulatory transcripts. In Streptomyces , the antibiotic-producing clade, the antisense control system is not yet understood, although it might direct the organism's complex development. Initial studies in Streptomyces have found a number of asRNAs. Apart from this, hundreds of mRNAs have been shown to bind RNase III, the double strand-specific endoribonuclease. In this study, we tested 17 mRNAs that have been previously co-precipitated with RNase III for antisense expression. Our RACE mapping showed that all of these mRNAs possess cognate asRNA. Additional tests for antisense expression uncovered as-adpA, as-rnc, as3983, as-sigB, as-sigH , and as-sigR RNAs. Northern blots detected the expression profiles of 18 novel transcripts. Noteworthy, we also found that only a minority of asRNAs respond to the absence of RNase III enzyme by increasing their cellular levels. Our findings suggest that antisense expression is widespread in Streptomyces , including genes of such important developmental regulators, as AdpA, RNase III, and sigma factors.

Pitx2c attenuation results in cardiac defects and abnormalities of intestinal orientation in developing Xenopus laevis.

PubMed

Dagle, John M; Sabel, Jaime L; Littig, Jennifer L; Sutherland, Lillian B; Kolker, Sandra J; Weeks, Daniel L

2003-10-15

The experimental manipulation of early embryologic events, resulting in the misexpression of the homeobox transcription factor pitx2, is associated with subsequent defects of laterality in a number of vertebrate systems. To clarify the role of one pitx2 isoform, pitx2c, in determining the left-right axis of amphibian embryos, we examined the heart and gut morphology of Xenopus laevis embryos after attenuating pitx2c mRNA levels using chemically modified antisense oligonucleotides. We demonstrate that the partial depletion of pitx2c mRNA in these embryos results in alteration of both cardiac morphology and intestinal coiling. The most common cardiac abnormality seen was a failure of rightward migration of the outflow tract, while the most common intestinal laterality phenotype seen was a full reversal in the direction of coiling, each present in 23% of embryos injected with the pitx2c antisense oligonucleotide. An abnormality in either the heart or gut further predisposed to a malformation in the other. In addition, a number of other cardiac anomalies were observed after pitx2c mRNA attenuation, including abnormalities of atrial septation, extracellular matrix restriction, relative atrial-ventricular chamber positioning, and restriction of ventricular development. Many of these findings correlate with cardiac defects previously reported in pitx2 null and hypomorphic mice, but can now be assigned specifically to attenuation of the pitx2c isoform in Xenopus.

Comparative inhibition of rabbit globin mRNA translation by modified antisense oligodeoxynucleotides.

PubMed Central

Cazenave, C; Stein, C A; Loreau, N; Thuong, N T; Neckers, L M; Subasinghe, C; Hélène, C; Cohen, J S; Toulmé, J J

1989-01-01

We have studied the translation of rabbit globin mRNA in cell free systems (reticulocyte lysate and wheat germ extract) and in microinjected Xenopus oocytes in the presence of anti-sense oligodeoxynucleotides. Results obtained with the unmodified all-oxygen compounds were compared with those obtained when phosphorothioate or alpha-DNA was used. In the wheat germ system a 17-mer sequence targeted to the coding region of beta-globin mRNA was specifically inhibitory when either the unmodified phosphodiester oligonucleotide or its phosphorothioate analogue were used. In contrast no effect was observed with the alpha-oligomer. These results were ascribed to the fact that phosphorothioate oligomers elicit an RNase-H activity comparable to the all-oxygen congeners, while alpha-DNA/mRNA hybrids were a poor substrate. Microinjected Xenopus oocytes followed a similar pattern. The phosphorothioate oligomer was more efficient to prevent translation than the unmodified 17-mer. Inhibition of beta-globin synthesis was observed in the nanomolar concentration range. This result can be ascribed to the nuclease resistance of phosphorothioates as compared to natural phosphodiester linkages, alpha-oligomers were devoid of any inhibitory effect up to 30 microM. Phosphorothioate oligodeoxyribonucleotides were shown to be non-specific inhibitors of protein translation, at concentrations in the micromolar range, in both cell-free systems and oocytes. Non-specific inhibition of translation was dependent on the length of the phosphorothioate oligomer. These non-specific effects were not observed with the unmodified or the alpha-oligonucleotides. Images PMID:2472605

Silencing neuronal mutant androgen receptor in a mouse model of spinal and bulbar muscular atrophy.

PubMed

Sahashi, Kentaro; Katsuno, Masahisa; Hung, Gene; Adachi, Hiroaki; Kondo, Naohide; Nakatsuji, Hideaki; Tohnai, Genki; Iida, Madoka; Bennett, C Frank; Sobue, Gen

2015-11-01

Spinal and bulbar muscular atrophy (SBMA), an adult-onset neurodegenerative disease that affects males, results from a CAG triplet repeat/polyglutamine expansions in the androgen receptor (AR) gene. Patients develop progressive muscular weakness and atrophy, and no effective therapy is currently available. The tissue-specific pathogenesis, especially relative pathological contributions between degenerative motor neurons and muscles, remains inconclusive. Though peripheral pathology in skeletal muscle caused by toxic AR protein has been recently reported to play a pivotal role in the pathogenesis of SBMA using mouse models, the role of motor neuron degeneration in SBMA has not been rigorously investigated. Here, we exploited synthetic antisense oligonucleotides to inhibit the RNA levels of mutant AR in the central nervous system (CNS) and explore its therapeutic effects in our SBMA mouse model that harbors a mutant AR gene with 97 CAG expansions and characteristic SBMA-like neurogenic phenotypes. A single intracerebroventricular administration of the antisense oligonucleotides in the presymptomatic phase efficiently suppressed the mutant gene expression in the CNS, and delayed the onset and progression of motor dysfunction, improved body weight gain and survival with the amelioration of neuronal histopathology in motor units such as spinal motor neurons, neuromuscular junctions and skeletal muscle. These findings highlight the importance of the neurotoxicity of mutant AR protein in motor neurons as a therapeutic target. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Antisense oligonucleotide therapy rescues disruptions in organization of exploratory movements associated with Usher syndrome type 1C in mice.

PubMed

Donaldson, Tia N; Jennings, Kelsey T; Cherep, Lucia A; McNeela, Adam M; Depreux, Frederic F; Jodelka, Francine M; Hastings, Michelle L; Wallace, Douglas G

2018-02-15

Usher syndrome, Type 1C (USH1C) is an autosomal recessive inherited disorder in which a mutation in the gene encoding harmonin is associated with multi-sensory deficits (i.e., auditory, vestibular, and visual). USH1C (Usher) mice, engineered with a human USH1C mutation, exhibit these multi-sensory deficits by circling behavior and lack of response to sound. Administration of an antisense oligonucleotide (ASO) therapeutic that corrects expression of the mutated USH1C gene, has been shown to increase harmonin levels, reduce circling behavior, and improve vestibular and auditory function. The current study evaluates the organization of exploratory movements to assess spatial organization in Usher mice and determine the efficacy of ASO therapy in attenuating any such deficits. Usher and heterozygous mice received the therapeutic ASO, ASO-29, or a control, non-specific ASO treatment at postnatal day five. Organization of exploratory movements was assessed under dark and light conditions at two and six-months of age. Disruptions in exploratory movement organization observed in control-treated Usher mice were consistent with impaired use of self-movement and environmental cues. In general, ASO-29 treatment rescued organization of exploratory movements at two and six-month testing points. These observations are consistent with ASO-29 rescuing processing of multiple sources of information and demonstrate the potential of ASO therapies to ameliorate topographical disorientation associated with other genetic disorders. Copyright © 2017 Elsevier B.V. All rights reserved.

Detection of Dystrophin Dp71 in Human Skeletal Muscle Using an Automated Capillary Western Assay System.

PubMed

Kawaguchi, Tatsuya; Niba, Emma Tabe Eko; Rani, Abdul Qawee Mahyoob; Onishi, Yoshiyuki; Koizumi, Makoto; Awano, Hiroyuki; Matsumoto, Masaaki; Nagai, Masashi; Yoshida, Shinobu; Sakakibara, Sachiko; Maeda, Naoyuki; Sato, Osamu; Nishio, Hisahide; Matsuo, Masafumi

2018-05-23

Dystrophin Dp71 is one of the isoforms produced by the DMD gene which is mutated in patients with Duchenne muscular dystrophy (DMD). Although Dp71 is expressed ubiquitously, it has not been detected in normal skeletal muscle. This study was performed to assess the expression of Dp71 in human skeletal muscle. Human skeletal muscle RNA and tissues were obtained commercially. Mouse skeletal muscle was obtained from normal and DMD mdx mice. Dp71 mRNA and protein were determined by reverse-transcription PCR and an automated capillary Western assay system, the Simple Western, respectively. Dp71 was over-expressed or suppressed using a plasmid expressing Dp71 or antisense oligonucleotide, respectively. Full-length Dp71 cDNA was PCR amplified as a single product from human skeletal muscle RNA. A ca. 70 kDa protein peak detected by the Simple Western was determined as Dp71 by over-expressing Dp71 in HEK293 cells, or suppressing Dp71 expression with antisense oligonucleotide in rhabdomyosarcoma cells. The Simple Western assay detected Dp71 in the skeletal muscles of both normal and DMD mice. In human skeletal muscle, Dp71 was also detected. The ratio of Dp71 to vinculin of human skeletal muscle samples varied widely, indicating various levels of Dp71 expression. Dp71 protein was detected in human skeletal muscle using a highly sensitive capillary Western blotting system.

Antisense Oligonucleotide-Based Splicing Correction in Individuals with Leber Congenital Amaurosis due to Compound Heterozygosity for the c.2991+1655A>G Mutation in CEP290.

PubMed

Duijkers, Lonneke; van den Born, L Ingeborgh; Neidhardt, John; Bax, Nathalie M; Pierrache, Laurence H M; Klevering, B Jeroen; Collin, Rob W J; Garanto, Alejandro

2018-03-07

Leber congenital amaurosis (LCA) is a rare inherited retinal disorder affecting approximately 1:50,000 people worldwide. So far, mutations in 25 genes have been associated with LCA, with CEP290 (encoding the Centrosomal protein of 290 kDa) being the most frequently mutated gene. The most recurrent LCA-causing CEP290 mutation, c.2991+1655A>G, causes the insertion of a pseudoexon into a variable proportion of CEP290 transcripts. We previously demonstrated that antisense oligonucleotides (AONs) have a high therapeutic potential for patients homozygously harbouring this mutation, although to date, it is unclear whether rescuing one single allele is enough to restore CEP290 function. Here, we assessed the AON efficacy at RNA, protein and cellular levels in samples that are compound heterozygous for this mutation, together with a protein-truncating mutation in CEP290 . We demonstrate that AONs can efficiently restore splicing and increase protein levels. However, due to a high variability in ciliation among the patient-derived cell lines, the efficacy of the AONs was more difficult to assess at the cellular level. This observation points towards the importance of the severity of the second allele and possibly other genetic variants present in each individual. Overall, AONs seem to be a promising tool to treat CEP290 -associated LCA, not only in homozygous but also in compound heterozygous carriers of the c.2991+1655A>G variant.

Antisense Oligonucleotides Used to Target the DUX4 mRNA as Therapeutic Approaches in FaciosScapuloHumeral Muscular Dystrophy (FSHD)

PubMed Central

Ansseau, Eugénie; Vanderplanck, Céline; Wauters, Armelle; Harper, Scott Q.; Coppée, Frédérique; Belayew, Alexandra

2017-01-01

FacioScapuloHumeral muscular Dystrophy (FSHD) is one of the most prevalent hereditary myopathies and is generally characterized by progressive muscle atrophy affecting the face, scapular fixators; upper arms and distal lower legs. The FSHD locus maps to a macrosatellite D4Z4 repeat array on chromosome 4q35. Each D4Z4 unit contains a DUX4 gene; the most distal of which is flanked by a polyadenylation site on FSHD-permissive alleles, which allows for production of stable DUX4 mRNAs. In addition, an open chromatin structure is required for DUX4 gene transcription. FSHD thus results from a gain of function of the toxic DUX4 protein that normally is only expressed in germ line and stem cells. Therapeutic strategies are emerging that aim to decrease DUX4 expression or toxicity in FSHD muscle cells. We review here the heterogeneity of DUX4 mRNAs observed in muscle and stem cells; and the use of antisense oligonucleotides (AOs) targeting the DUX4 mRNA to interfere either with transcript cleavage/polyadenylation or intron splicing. We show in primary cultures that DUX4-targeted AOs suppress the atrophic FSHD myotube phenotype; but do not improve the disorganized FSHD myotube phenotype which could be caused by DUX4c over-expression. Thus; DUX4c might constitute another therapeutic target in FSHD. PMID:28273791

Development of a simple, rapid, and robust intrathecal catheterization method in the rat.

PubMed

Mazur, Curt; Fitzsimmons, Bethany; Kamme, Fredrik; Nichols, Brandon; Powers, Berit; Wancewicz, Ed

2017-03-15

The blood brain barrier (BBB) is an impediment to the development of large and highly charged molecules as therapeutics for diseases and injuries of the central nervous system (CNS). Antisense oligonucleotides (ASOs) are large (6000-8000MW) and highly charged and therefore do not cross the BBB. A method of circumventing the blood brain barrier to test ASOs, and other non-BBB penetrant molecules, as CNS therapeutics is the direct administration of these molecules to the CNS tissue or cerebral spinal fluid. We developed a rapid, simple and robust method for the intrathecal catheterization of rats to test putatively therapeutic antisense oligonucleotides. This method utilizes 23-gauge needles, simply constructed ½in. long 19-gauge guide cannulas and 8cm long plastic PE-10 sized catheters. Unlike the cisterna magna approach, this method uses a lumbar approach for intrathecal catheterization with the catheter residing entirely in the cauda equina space minimizing spinal cord compression. Readily available materials and only a few specialized pieces of equipment, which are easily manufactured, are used for this intrathecal catheterization method. This method is easy to learn and has been taught to multiple in house surgeons, collaborators and contract laboratories. Greater than 90% catheterization success is routinely achieved with this method and as many as 100 catheters can be placed and test substance administered in one 6-h period. This method has allowed the pre-clinical testing of hundreds of ASOs as therapeutics for CNS indications. Copyright © 2017 Elsevier B.V. All rights reserved.

Behavioral and endocrine changes following antisense oligonucleotide-induced reduction in the rat NOP receptor.

PubMed

Blakley, Gregory G; Pohorecky, Larissa A; Benjamin, Daniel

2004-02-01

Compared with the use of classic receptor ligands, antisense oligonucleotides (ASO) targeted at specific central nervous system receptors are an effective alternative in experiments designed to examine the behavioral role of such systems. The nociception/orphaninFQ (N/OFQ) system has been implicated in mediating endocrine function, feeding, stress, pain, anxiety, and the rewarding effects of drugs of abuse. The objective of the current study was to examine whether long-term ASO-induced downregulation of N/OFQ's receptor (NOP) produced changes in endocrine, anxiety, nociception and ethanol's (EtOH's) locomotor activating properties. Male Long Evans rats were implanted with osmotic mini-pumps containing ASO for the NOP receptor. ASO was chronically infused for 26 days and, during this time, multiple behavioral and physiological measurements were conducted. ASO infusion significantly reduced expression of the NOP receptor in brain, confirmed by significant reductions of OFQ-stimulated [(35)S]-GTPgammaS binding in the paraventricular nucleus, prefrontal cortex, and septum. Behavioral changes were observed in ASO-treated animals including higher body temperature, increased water intake, decreased corticosterone (CORT) levels, decreased grooming in the open field, increased tail-flick latency, shorter durations on the open arms of the elevated plus maze, and heightened locomotor activity following EtOH. These behavioral, physiological and endocrine changes are relatively consistent with previous findings with agonists and antagonists for the NOP receptor and, taken together, suggest that ASO-induced downregulation of the NOP receptor is an effective method for studying the N/OFQ system.

Rescue of Outer Hair Cells with Antisense Oligonucleotides in Usher Mice Is Dependent on Age of Treatment.

PubMed

Ponnath, Abhilash; Depreux, Frederic F; Jodelka, Francine M; Rigo, Frank; Farris, Hamilton E; Hastings, Michelle L; Lentz, Jennifer J

2018-02-01

The absence of functional outer hair cells is a component of several forms of hereditary hearing impairment, including Usher syndrome, the most common cause of concurrent hearing and vision loss. Antisense oligonucleotide (ASO) treatment of mice with the human Usher mutation, Ush1c c.216G>A, corrects gene expression and significantly improves hearing, as measured by auditory-evoked brainstem responses (ABRs), as well as inner and outer hair cell (IHC and OHC) bundle morphology. However, it is not clear whether the improvement in hearing achieved by ASO treatment involves the functional rescue of outer hair cells. Here, we show that Ush1c c.216AA mice lack OHC function as evidenced by the absence of distortion product otoacoustic emissions (DPOAEs) in response to low-, mid-, and high-frequency tone pairs. This OHC deficit is rescued by treatment with an ASO that corrects expression of Ush1c c.216G>A. Interestingly, although rescue of inner hairs cells, as measured by ABR, is achieved by ASO treatment as late as 7 days after birth, rescue of outer hair cells, measured by DPOAE, requires treatment before post-natal day 5. These results suggest that ASO-mediated rescue of both IHC and OHC function is age dependent and that the treatment window is different for the different cell types. The timing of treatment for congenital hearing disorders is of critical importance for the development of drugs such ASO-29 for hearing rescue.

ZFP36L1 and ZFP36L2 control LDLR mRNA stability via the ERK-RSK pathway.

PubMed

Adachi, Shungo; Homoto, Masae; Tanaka, Rikou; Hioki, Yusaku; Murakami, Hiroshi; Suga, Hiroaki; Matsumoto, Masaki; Nakayama, Keiichi I; Hatta, Tomohisa; Iemura, Shun-ichiro; Natsume, Tohru

2014-09-01

Low-density lipoprotein receptor (LDLR) mRNA is unstable, but is stabilized upon extracellular signal-regulated kinase (ERK) activation, possibly through the binding of certain proteins to the LDLR mRNA 3'-untranslated region (UTR), although the detailed mechanism underlying this stability control is unclear. Here, using a proteomic approach, we show that proteins ZFP36L1 and ZFP36L2 specifically bind to the 3'-UTR of LDLR mRNA and recruit the CCR4-NOT-deadenylase complex, resulting in mRNA destabilization. We also show that the C-terminal regions of ZFP36L1 and ZFP36L2 are directly phosphorylated by p90 ribosomal S6 kinase, a kinase downstream of ERK, resulting in dissociation of the CCR4-NOT-deadenylase complex and stabilization of LDLR mRNA. We further demonstrate that targeted disruption of the interaction between LDLR mRNA and ZFP36L1 and ZFP36L2 using antisense oligonucleotides results in upregulation of LDLR mRNA and protein. These results indicate that ZFP36L1 and ZFP36L2 regulate LDLR protein levels downstream of ERK. Our results also show the usefulness of our method for identifying critical regulators of specific RNAs and the potency of antisense oligonucleotide-based therapeutics. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

The Effects of 2′-O-Methoxyethyl Containing Antisense Oligonucleotides on Platelets in Human Clinical Trials

PubMed Central

Baker, Brenda F.; Witztum, Joseph L.; Kwoh, T. Jesse; Pham, Nguyen C.; Salgado, Nelson; McEvoy, Bradley W.; Cheng, Wei; Hughes, Steven G.; Bhanot, Sanjay; Geary, Richard S.

2017-01-01

A thorough analysis of clinical trial data in the Ionis integrated safety database (ISDB) was performed to determine if there is a class effect on platelet numbers and function in subjects treated with 2′-O-methoxyethyl (2′MOE)-modified antisense oligonucleotides (ASOs). The Ionis ISDB includes over 2,600 human subjects treated with 16 different 2′MOE ASOs in placebo-controlled and open-label clinical trials over a range of doses up to 624 mg/week and treatment durations as long as 4.6 years. This analysis showed that there is no class generic effect on platelet numbers and no incidence of confirmed platelet levels below 50 K/μL in subjects treated with 2′MOE ASOs. Only 7 of 2,638 (0.3%) subjects treated with a 2′MOE ASO experienced a confirmed postbaseline (BSLN) platelet count between 100 and 50 K/μL. Three of sixteen 2′MOE ASOs had >10% incidence of platelet decreases >30% from BSLN, suggesting that certain sequences may associate with clinically insignificant platelet declines. Further to these results, we found no evidence that 2′MOE ASOs alter platelet function, as measured by the lack of clinically relevant bleeding in the presence or absence of other drugs that alter platelet function and/or number and by the results from trials conducted with the factor XI (FXI) ASO. PMID:28145801

Duplex and triplex formation of mixed pyrimidine oligonucleotides with stacking of phenyl-triazole moieties in the major groove.

PubMed

Andersen, Nicolai Krog; Døssing, Holger; Jensen, Frank; Vester, Birte; Nielsen, Poul

2011-08-05

5-(1-Phenyl-1,2,3-triazol-4-yl)-2'-deoxycytidine was synthesized from a modified CuAAC protocol and incorporated into mixed pyrimidine oligonucleotide sequences together with the corresponding 5-(1-phenyl-1,2,3-triazol-4-yl)-2'-deoxyuridine. With consecutive incorporations of the two modified nucleosides, improved duplex formation with a complementary RNA and improved triplex formation with a complementary DNA duplex were observed. The improvement is due to π-π stacking of the phenyl-triazole moieties in the major groove. The strongest stacking and most pronounced positive influence on thermal stability was found in between the uridine analogues or with the cytidine analogue placed in the 3' direction to the uridine analogue. Modeling indicated a different orientation of the phenyl-triazole moieties in the major groove to account for the difference between the two nucleotides. The modified oligonucleotides were all found to be significantly stabilized toward nucleolytic degration.

Poly(malic acid) nanoconjugates containing various antibodies and oligonucleotides for multitargeting drug delivery

PubMed Central

Fujita, Manabu; Ljubimov, Alexander V; Torchilin, Vladimir P; Black, Keith L; Holler, Eggehard

2009-01-01

Nanoconjugates are emerging as promising drug-delivery vehicles because of their multimodular structure enabling them to actively target discrete cells, pass through biological barriers and simultaneously carry multiple drugs of various chemical nature. Nanoconjugates have matured from simple devices to multifunctional, biodegradable, nontoxic and nonimmunogenic constructs, capable of delivering synergistically functioning drugs in vivo. This review mainly concerns the Polycefin family of natural-derived polymeric drug-delivery devices as an example. This type of vehicle is built by hierarchic conjugation of functional groups onto the backbone of poly(malic acid), an aliphatic polyester obtained from the microorganism Physarum polycephalum. Particular Polycefin variants target human brain and breast tumors implanted into animals specifically and actively and could be detected easily by noninvasive imaging analysis. Delivery of antisense oligonucleotides to a tumor-specific angiogenic marker using Polycefin resulted in significant inhibition of tumor angiogenesis and increase of animal survival. PMID:18373429

Gene knockdown by morpholino-modified oligonucleotides in the zebrafish (Danio rerio) model: applications for developmental toxicology.

PubMed

Timme-Laragy, Alicia R; Karchner, Sibel I; Hahn, Mark E

2012-01-01

The zebrafish (Danio rerio) has long been used as a model for developmental biology, making it an excellent model to use also in developmental toxicology. The many advantages of zebrafish include their small size, prolific spawning, rapid development, and transparent embryos. They can be easily manipulated genetically through the use of transgenic technology and gene knockdown via morpholino-modified antisense oligonucleotides (MOs). Knocking down specific genes to assess their role in the response to toxicant exposure provides a way to further our knowledge of how developmental toxicants work on a molecular and mechanistic level while establishing a relationship between these molecular events and morphological, behavioral, and/or physiological effects (i.e., phenotypic anchoring). In this chapter, we address important considerations for using MOs to study developmental toxicology in zebrafish embryos and provide a protocol for their use.

Oligonucleotide therapeutics in neurodegenerative diseases.

PubMed

Scoles, Daniel R; Pulst, Stefan M

2018-03-21

Therapeutics that directly target RNAs are promising for a broad spectrum of disorders, including the neurodegenerative diseases. This is exemplified by the FDA approval of Nusinersen, an antisense oligonucleotide (ASO) therapeutic for spinal muscular atrophy (SMA). RNA targeting therapeutics are currently under development for amyotrophic lateral sclerosis (ALS), Huntington's disease (HD), and spinocerebellar ataxias. We have used an ASO approach toward developing a treatment for spinocerebellar ataxia type 2 (SCA2), for targeting the causative gene ATXN2. We demonstrated that reduction of ATXN2 expression in SCA2 mice treated by intracerebroventicular injection (ICV) of ATXN2 ASO delayed motor phenotype onset, improved the expression of several genes demonstrated abnormally reduced by transcriptomic profiling of SCA2 mice, and restored abnormal Purkinje cell firing frequency in acute cerebellar sections. Here we discuss RNA abnormalities in disease and the prospects of targeting neurodegenerative diseases at the level of RNA control using ASOs and other RNA-targeted therapeutics.

Gene knockdown by morpholino-modified oligonucleotides in the zebrafish model: applications for developmental toxicology

PubMed Central

Timme-Laragy, Alicia R.; Karchner, Sibel I.; Hahn, Mark E.

2014-01-01

Summary The zebrafish (Danio rerio) has long been used as a model for developmental biology, making it an excellent model to use also in developmental toxicology. The many advantages of zebrafish include their small size, prolific spawning, rapid development, and transparent embryos. They can be easily manipulated genetically through the use of transgenic technology and gene knock-down via morpholino-modified antisense oligonucleotides (MOs). Knocking down specific genes to assess their role in the response to toxicant exposure provides a way to further our knowledge of how developmental toxicants work on a molecular and mechanistic level, while establishing a relationship between these molecular events and morphological, behavioral, and/or physiological effects (i.e. phenotypic anchoring). In this chapter we address important considerations for using MOs to study developmental toxicology in zebrafish embryos and provide a protocol for their use. PMID:22669659

The 5′-tail of antisense RNAII of pMV158 plays a critical role in binding to the target mRNA and in translation inhibition of repB

PubMed Central

López-Aguilar, Celeste; Romero-López, Cristina; Espinosa, Manuel; Berzal-Herranz, Alfredo; del Solar, Gloria

2015-01-01

Rolling-circle replication of streptococcal plasmid pMV158 is controlled by the concerted action of two trans-acting elements, namely transcriptional repressor CopG and antisense RNAII, which inhibit expression of the repB gene encoding the replication initiator protein. The pMV158-encoded antisense RNAII exerts its activity of replication control by inhibiting translation of the essential repB gene. RNAII is the smallest and simplest among the characterized antisense RNAs involved in control of plasmid replication. Structure analysis of RNAII revealed that it folds into an 8-bp-long stem containing a 1-nt bulge and closed by a 6-nt apical loop. This hairpin is flanked by a 17-nt-long single-stranded 5′-tail and an 8-nt-long 3′-terminal U-rich stretch. Here, the 3′ and 5′ regions of the 5′-tail of RNAII are shown to play a critical role in the binding to the target mRNA and in the inhibition of repB translation, respectively. In contrast, the apical loop of the single hairpin of RNAII plays a rather secondary role and the upper stem region hardly contributes to the binding or inhibition processes. The entire 5′-tail is required for efficient inhibition of repB translation, though only the 8-nt-long region adjacent to the hairpin seems to be essential for rapid binding to the mRNA. These results show that a “kissing” interaction involving base-pairing between complementary hairpin loops in RNAII and mRNA is not critical for efficient RNA/RNA binding or repB translation inhibition. A singular binding mechanism is envisaged whereby initial pairing between complementary single-stranded regions in the antisense and sense RNAs progresses upwards into the corresponding hairpin stems to form the intermolecular duplex. PMID:26175752

Post-injection hybridization of complementary DNA strands on capillary electrophoresis platforms: a novel solution for dsDNA artifacts.

PubMed

McLaren, Robert S; Ensenberger, Martin G; Budowle, Bruce; Rabbach, Dawn; Fulmer, Patricia M; Sprecher, Cindy J; Bessetti, Joseph; Sundquist, Terri M; Storts, Douglas R

2008-09-01

Several laboratories have reported the occurrence of a split or n-1 peak at the vWA locus in PowerPlex 16 and PowerPlex ES amplification products separated on 4- and 16-capillary electrophoresis instruments. The root cause of this artifact is post-PCR reannealing of the unlabeled, unincorporated vWA primer to the 3'-end of the tetramethylrhodamine (TMR)-labeled strand of the vWA amplicon. This reannealing occurs in the capillary post-electrokinetic injection. The split peak is eliminated by incorporation into the loading cocktail of a sacrificial hybridization sequence (SHS) oligonucleotide that is complementary to the vWA primer. The SHS preferentially anneals to the primer instead of the TMR-labeled strand of the vWA amplicon. In addition, the n-10/n-18 artifact that may be seen at the vWA locus was determined to be due to double-stranded amplicon formed post-electrokinetic injection into the capillary. This was also eliminated by adding in two Complementary Oligo Targets (COT1 and COT2) in addition to the SHS oligonucleotide into the loading cocktail. These three oligonucleotides are complementary to the 33 bases at the 5'-end of the unlabeled vWA amplicon strand and the 60 bases at its 3'-end and therefore compete for hybridization to the TMR-labeled amplicon strand. Incorporation of these three oligonucleotides in the Internal Lane Standard 600 (ILS600) eliminate both the split peak and n-10/n-18 artifact in PowerPlex 16 and PowerPlex ES amplification products without affecting sizing of alleles at the vWA locus or any locus in the PowerPlex 16, PowerPlex Y, PowerPlex ES, AmpFlSTR Profiler Plus ID, AmpFlSTR Cofiler, and AmpFlSTR SGM Plus kits.

[Oligonucleotide derivatives in the nucleic acid hybridization analysis. III. Synthesis and investigation of properties of oligonucleotides, bearing bifunctional non-nucleotide insert].

PubMed

Kupriushkin, M S; Pyshnyĭ, D V

2012-01-01

Non-nucleotide phosporamidites were synthetized, having branched backbone with different position of functional groups. Obtained phosphoramidite monomers contain intercalator moiety--6-chloro-2-methoxyacridine, and additional hydroxyl residue protected with dimethoxytrityl group or with tert-butyldimethylsilyl group for post-synthetic modification. Synthesized oligothymidilates contain one or more modified units in different positions of sequence. Melting temperature and thermodynamic parameters of formation of complementary duplexes formed by modified oligonucleotides was defined (change in enthalpy and entropy). The introduction of intercalating residue causes a significant stabilization of DNA duplexes. It is shown that the efficiency of the fluorescence of acridine residue in the oligonucleotide conjugate significantly changes upon hybridization with DNA.

Phosphorothioate oligonucleotides inhibit the intrinsic tenase complex.

PubMed

Sheehan, J P; Lan, H C

1998-09-01

Systemic administration of ISIS 2302, a 20-mer antisense phosphorothioate oligonucleotide targeting human intercellular adhesion molecule-1 mRNA, causes prolongation of plasma clotting times in both monkey and human studies. The anticoagulant effects of ISIS 2302 were investigated with both in vitro coagulation assays in human plasma and purified enzyme systems. At high oligonucleotide plasma concentrations (>100 microgram/mL), prolongation of the prothrombin and thrombin times was observed. In a thrombin time assay using purified components, high concentrations of ISIS 2302 inhibited thrombin clotting activity both by stimulating inhibition by heparin cofactor II and directly competing with fibrinogen for binding to anion binding exosite I. In contrast, low concentrations of ISIS 2302 (<100 microgram/mL) showed a selective, linear prolongation of the activated partial thromboplastin time (PTT). The rate limiting effect of 50 microgram/mL ISIS 2302, which prolonged the PTT to 1.5 times control, was identified by sequential modification of the clotting assay. Delaying addition of oligonucleotide until after contact activation failed to correct prolongation of the PTT. The calcium-dependent steps of the intrinsic pathway were individually assessed by adding sufficient activated coagulation factor to correct the PTT in plasma deficient in that specific factor. Addition of factor XIa, IXa, VIIIa, or Va failed to correct the PTT in the presence of ISIS 2302. In contrast, 0.2 nmol/L factor Xa corrected prolongation of the PTT in factor X-deficient plasma with or without oligonucleotide present. ISIS 2302 (50 microgram/mL) did not prolong a modified Russel viper venom time, suggesting no significant inhibition of prothrombinase. Thus, 50 microgram/mL ISIS 2302 prolonged the PTT by selectively inhibiting intrinsic tenase activity. ISIS 2302 showed partial inhibition of intrinsic tenase activity (to approximately 35% of control) at clinically relevant oligonucleotide concentrations in a chromogenic assay. This activity was oligonucleotide sequence-independent but required the phosphorothioate backbone, suggesting that inhibition of intrinsic tenase is a general property of this class of oligonucleotides. These results are relevant to both the therapeutic use of phosphorothioate oligonucleotides and the potential design of inhibitors of the intrinsic tenase complex, a novel target for anticoagulation. Copyright 1998 by The American Society of Hematology.

Light-Triggered Release of DNA from Plasmon-Resonant Nanoparticles

NASA Astrophysics Data System (ADS)

Huschka, Ryan

Plasmon-resonant nanoparticle complexes show promising potential for lighttriggered, controllable delivery of deoxyribonucleic acids (DNA) for research and therapeutic purposes. For example, the approach of RNA interference (RNAi) . using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein . is very useful in dissecting genetic function and holds promise as a molecular therapeutic. Herein, we investigate the mechanism and probe the in vitro therapeutic potential of DNA light-triggered release from plasmonic nanoparticles. First, we investigate the mechanism of light-triggered release by dehybridizing double-stranded (dsDNA) via laser illumination from two types of nanoparticle substrates: gold (Au) nanoshells and Au nanorods. Both light-triggered and thermally induced releases are distinctly observable from nanoshell-based complexes. Surprisingly, no analogous measurable light-triggered release was observable from nanorod-based complexes below the DNA melting temperature. These results suggest that a nonthermal mechanism may play a role in light-triggered DNA release. Second, we demonstrate the in vitro light-triggered release of molecules noncovalently attached within dsDNA bound to the Au nanoshell surface. DAPI (4',6- diamidino-2-phenylindole), a bright blue fluorescent molecule that binds reversibly to double-stranded DNA, was chosen to visualize this intracellular light-induced release process. Illumination through the cell membrane of the nanoshell-dsDNA-DAPI complexes dehybridizes the DNA and releases the DAPI molecules within living cells. The DAPI molecules diffuse to the nucleus and associate with the cell's endogenous DNA. This work could have future applications towards drug delivery of molecules that associate with dsDNA. Finally, we demonstrate an engineered Au nanoshell (AuNS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer coated onto the AuNS surface (AuNS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotide, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and GFP gene silencing mediated by AuNS-PLL delivery vector. The light-triggered release of oligonucleotides could have broad applications in the study of cellular processes and in the development of intracellular targeted therapies.

Mipomersen.

PubMed

2010-01-01

Genzyme Corporation and Isis Pharmaceuticals have a worldwide licensing and collaboration agreement for the development of subcutaneous mipomersen (ISIS 147764; ISIS 301012; ISIS301012; mipomersen-sodium). Mipomersen, an oligonucleotide antisense inhibitor directed against apolipoprotein B-100 (apoB-100) mRNA, is in phase III clinical evaluation for the treatment of familial hypercholesterolemia, a form of type IIa hyperlipoproteinemia, and hypercholesterolemia in patients with severely high cholesterol levels or at high risk for coronary heart disease in the US, European Union, Brazil, Canada, South Africa, and South East Asia. This review discusses the development history and scientific profile of this new compound.

Oligonucleotide-based strategies to combat polyglutamine diseases

PubMed Central

Fiszer, Agnieszka; Krzyzosiak, Wlodzimierz J.

2014-01-01

Considerable advances have been recently made in understanding the molecular aspects of pathogenesis and in developing therapeutic approaches for polyglutamine (polyQ) diseases. Studies on pathogenic mechanisms have extended our knowledge of mutant protein toxicity, confirmed the toxicity of mutant transcript and identified other toxic RNA and protein entities. One very promising therapeutic strategy is targeting the causative gene expression with oligonucleotide (ON) based tools. This straightforward approach aimed at halting the early steps in the cascade of pathogenic events has been widely tested for Huntington's disease and spinocerebellar ataxia type 3. In this review, we gather information on the use of antisense oligonucleotides and RNA interference triggers for the experimental treatment of polyQ diseases in cellular and animal models. We present studies testing non-allele-selective and allele-selective gene silencing strategies. The latter include targeting SNP variants associated with mutations or targeting the pathologically expanded CAG repeat directly. We compare gene silencing effectors of various types in a number of aspects, including their design, efficiency in cell culture experiments and pre-clinical testing. We discuss advantages, current limitations and perspectives of various ON-based strategies used to treat polyQ diseases. PMID:24848018

Combination Antisense Treatment for Destructive Exon Skipping of Myostatin and Open Reading Frame Rescue of Dystrophin in Neonatal mdx Mice.

PubMed

Lu-Nguyen, Ngoc B; Jarmin, Susan A; Saleh, Amer F; Popplewell, Linda; Gait, Michael J; Dickson, George

2015-08-01

The fatal X-linked Duchenne muscular dystrophy (DMD), characterized by progressive muscle wasting and muscle weakness, is caused by mutations within the DMD gene. The use of antisense oligonucleotides (AOs) modulating pre-mRNA splicing to restore the disrupted dystrophin reading frame, subsequently generating a shortened but functional protein has emerged as a potential strategy in DMD treatment. AO therapy has recently been applied to induce out-of-frame exon skipping of myostatin pre-mRNA, knocking-down expression of myostatin protein, and such an approach is suggested to enhance muscle hypertrophy/hyperplasia and to reduce muscle necrosis. Within this study, we investigated dual exon skipping of dystrophin and myostatin pre-mRNAs using phosphorodiamidate morpholino oligomers conjugated with an arginine-rich peptide (B-PMOs). Intraperitoneal administration of B-PMOs was performed in neonatal mdx males on the day of birth, and at weeks 3 and 6. At week 9, we observed in treated mice (as compared to age-matched, saline-injected controls) normalization of muscle mass, a recovery in dystrophin expression, and a decrease in muscle necrosis, particularly in the diaphragm. Our data provide a proof of concept for antisense therapy combining dystrophin restoration and myostatin inhibition for the treatment of DMD.

EvOligo: A Novel Software to Design and Group Libraries of Oligonucleotides Applicable for Nucleic Acid-Based Experiments.

PubMed

Milewski, Marek C; Kamel, Karol; Kurzynska-Kokorniak, Anna; Chmielewski, Marcin K; Figlerowicz, Marek

2017-10-01

Experimental methods based on DNA and RNA hybridization, such as multiplex polymerase chain reaction, multiplex ligation-dependent probe amplification, or microarray analysis, require the use of mixtures of multiple oligonucleotides (primers or probes) in a single test tube. To provide an optimal reaction environment, minimal self- and cross-hybridization must be achieved among these oligonucleotides. To address this problem, we developed EvOligo, which is a software package that provides the means to design and group DNA and RNA molecules with defined lengths. EvOligo combines two modules. The first module performs oligonucleotide design, and the second module performs oligonucleotide grouping. The software applies a nearest-neighbor model of nucleic acid interactions coupled with a parallel evolutionary algorithm to construct individual oligonucleotides, and to group the molecules that are characterized by the weakest possible cross-interactions. To provide optimal solutions, the evolutionary algorithm sorts oligonucleotides into sets, preserves preselected parts of the oligonucleotides, and shapes their remaining parts. In addition, the oligonucleotide sets can be designed and grouped based on their melting temperatures. For the user's convenience, EvOligo is provided with a user-friendly graphical interface. EvOligo was used to design individual oligonucleotides, oligonucleotide pairs, and groups of oligonucleotide pairs that are characterized by the following parameters: (1) weaker cross-interactions between the non-complementary oligonucleotides and (2) more uniform ranges of the oligonucleotide pair melting temperatures than other available software products. In addition, in contrast to other grouping algorithms, EvOligo offers time-efficient sorting of paired and unpaired oligonucleotides based on various parameters defined by the user.

Arrays of nucleic acid probes on biological chips

DOEpatents

Chee, Mark; Cronin, Maureen T.; Fodor, Stephen P. A.; Huang, Xiaohua X.; Hubbell, Earl A.; Lipshutz, Robert J.; Lobban, Peter E.; Morris, MacDonald S.; Sheldon, Edward L.

1998-11-17

DNA chips containing arrays of oligonucleotide probes can be used to determine whether a target nucleic acid has a nucleotide sequence identical to or different from a specific reference sequence. The array of probes comprises probes exactly complementary to the reference sequence, as well as probes that differ by one or more bases from the exactly complementary probes.

Therapeutic potential of mipomersen in the management of familial hypercholesterolaemia.

PubMed

Gelsinger, Carmen; Steinhagen-Thiessen, Elisabeth; Kassner, Ursula

2012-07-30

High levels of low-density lipoprotein cholesterol (LDL-C) and lipoprotein(a) [Lp(a)] are associated with early morbidity and mortality caused by cardiovascular disease (CVD). There are hints that a reduction of LDL-C levels beyond currently advocated targets, and the use of drugs that also have Lp(a)-lowering potential, could provide further clinical benefit. Today, LDL apheresis is the only available treatment option to achieve further lowering of apolipoprotein-B (apo-B)-containing lipoproteins, especially Lp(a). Mipomersen is currently being studied in patients with mild to severe hypercholesterolaemia as add-on therapy to other lipid-lowering therapy, as monotherapy in patients who are intolerant of HMG-CoA reductase inhibitors (statins) and who are at high risk for CVD. Patients affected by homozygous or heterozygous familial hypercholesterolaemia (FH), which are inherited autosomal co-dominant disorders characterized by a marked elevation of serum LDL-C concentration, remain a clinical challenge, especially when their CVD risk is aggravated by additionally elevated Lp(a) levels. Mipomersen is a 20-mer oligonucleotide [2'-O-(2-methoxy) ethyl-modified oligonucleotide], a second-generation antisense oligonucleotide (AOS), complementary to the coding region for human-specific apo-B-100 messenger RNA (mRNA). Mipomersen inhibits apo-B-100 synthesis and is consequently a new treatment strategy to lower apo-B-containing lipoproteins like LDL-C and Lp(a) in patients at high risk for CVD not on target or intolerant to statins. This article focuses on mipomersen and gives an overview of the current status of mipomersen as a promising treatment option. Recent studies have shown a decrease in LDL-C levels of 22-42.2% and in Lp(a) of 19.6-31.1% from baseline, depending on study design. Dose-dependent reductions of very low-density lipoprotein cholesterol (VLDL-C) and triglyceride levels have also been observed. Although the short-term efficacy and safety of mipomersen have been proven, side effects like injection-site reactions (up to 90-100%), increased liver enzymes, cephalgias, nasopharyngitis, myalgia, nausea and fatigue must be mentioned and critically discussed. Furthermore, we need more data on the long-term side effects, especially regarding the long-term potential for hepatic steatosis. Data on cardiovascular outcomes with mipomersen are also not yet available.

Inhibition of BRCA2 and Thymidylate Synthase Creates Multidrug Sensitive Tumor Cells via the Induction of Combined "Complementary Lethality".

PubMed

Rytelewski, Mateusz; Ferguson, Peter J; Maleki Vareki, Saman; Figueredo, Rene; Vincent, Mark; Koropatnick, James

2013-03-12

A high mutation rate leading to tumor cell heterogeneity is a driver of malignancy in human cancers. Paradoxically, however, genomic instability can also render tumors vulnerable to therapeutic attack. Thus, targeting DNA repair may induce an intolerable level of DNA damage in tumor cells. BRCA2 mediates homologous recombination repair, and BRCA2 polymorphisms increase cancer risk. However, tumors with BRCA2 mutations respond better to chemotherapy and are associated with improved patient prognosis. Thymidylate synthase (TS) is also involved in DNA maintenance and generates cellular thymidylate. We determined that antisense downregulation of BRCA2 synergistically potentiated drugs with mechanisms of action related to BRCA2 function (cisplatin, melphalan), a phenomenon we named "complementary lethality." TS knockdown induced complementary lethality to TS-targeting drugs (5-FUdR and pemetrexed) but not DNA cross-linking agents. Combined targeting of BRCA2 and TS induced complementary lethality to both DNA-damaging and TS-targeting agents, thus creating multidrug sensitive tumors. In addition, we demonstrated for the first time that simultaneous downregulation of both targets induced combined complementary lethality to multiple mechanistically different drugs in the same cell population. In this study, we propose and define the concept of "complementary lethality" and show that actively targeting BRCA2 and TS is of potential therapeutic benefit in multidrug treatment of human tumors. This work has contributed to the development of a BRCA2-targeting antisense oligdeoxynucleotide (ASO) "BR-1" which we will test in vivo in combination with our TS-targeting ASO "SARI 83" and attempt early clinical trials in the future.Molecular Therapy - Nucleic Acids (2013) 2, e78; doi:10.1038/mtna.2013.7 published online 12 March 2013.

Antisense Transcription Is Pervasive but Rarely Conserved in Enteric Bacteria

PubMed Central

Raghavan, Rahul; Sloan, Daniel B.; Ochman, Howard

2012-01-01

ABSTRACT Noncoding RNAs, including antisense RNAs (asRNAs) that originate from the complementary strand of protein-coding genes, are involved in the regulation of gene expression in all domains of life. Recent application of deep-sequencing technologies has revealed that the transcription of asRNAs occurs genome-wide in bacteria. Although the role of the vast majority of asRNAs remains unknown, it is often assumed that their presence implies important regulatory functions, similar to those of other noncoding RNAs. Alternatively, many antisense transcripts may be produced by chance transcription events from promoter-like sequences that result from the degenerate nature of bacterial transcription factor binding sites. To investigate the biological relevance of antisense transcripts, we compared genome-wide patterns of asRNA expression in closely related enteric bacteria, Escherichia coli and Salmonella enterica serovar Typhimurium, by performing strand-specific transcriptome sequencing. Although antisense transcripts are abundant in both species, less than 3% of asRNAs are expressed at high levels in both species, and only about 14% appear to be conserved among species. And unlike the promoters of protein-coding genes, asRNA promoters show no evidence of sequence conservation between, or even within, species. Our findings suggest that many or even most bacterial asRNAs are nonadaptive by-products of the cell’s transcription machinery. PMID:22872780

Cadmium sulfide nanocluster-based electrochemical stripping detection of DNA hybridization.

PubMed

Zhu, Ningning; Zhang, Aiping; He, Pingang; Fang, Yuzhi

2003-03-01

A novel, sensitive electrochemical DNA hybridization detection assay, using cadmium sulfide (CdS) nanoclusters as the oligonucleotide labeling tag, is described. The assay relies on the hybridization of the target DNA with the CdS nanocluster oligonucleotide DNA probe, followed by the dissolution of the CdS nanoclusters anchored on the hybrids and the indirect determination of the dissolved cadmium ions by sensitive anodic stripping voltammetry (ASV) at a mercury-coated glassy carbon electrode (GCE). The results showed that only a complementary sequence could form a double-stranded dsDNA-CdS with the DNA probe and give an obvious electrochemical response. A three-base mismatch sequence and non-complementary sequence had negligible response. The combination of the large number of cadmium ions released from each dsDNA hybrid with the remarkable sensitivity of the electrochemical stripping analysis for cadmium at mercury-film GCE allows detection at levels as low as 0.2 pmol L(-1) of the complementary sequence of DNA.

Regulation of corneal repair by particle-mediated gene transfer of opioid growth factor receptor complementary DNA.

PubMed

Zagon, Ian S; Sassani, Joseph W; Malefyt, Kristin J; McLaughlin, Patricia J

2006-11-01

To determine whether molecular manipulation of the opioid growth factor receptor (OGFr) alters corneal reepithelialization following central corneal abrasion in rats. The plasmid pcDNA3.1 + OGFr, carrying the rat OGFr complementary DNA in both the sense and antisense orientations, and empty vector (EV), were delivered by gene gun to the rat cornea. After 24 hours, corneas were abraded and reepithelialization was documented by fluorescein photography. Twenty-four hours after wounding, DNA synthesis (with bromodeoxyuridine) was examined. Eyes transfected with sense constructs of OGFr had corneal defects that were 24%, 52%, and 50% larger than the EV group at 16, 24, and 28 hours, respectively. Conversely, corneas transfected with antisense constructs of OGFr had corneal defects that were 56% and 48% smaller than the EV group at 16 and 24 hours, respectively. Bromodeoxyuridine labeling in the basal and suprabasal layers of the antisense group were increased 3.3- and 3.7-fold, respectively, in DNA synthesis from corresponding EV layers; DNA synthesis was comparable in the sense and EV groups. Excess OGFr delays reepithelialization, whereas attenuation of OGFr accelerates repair of the corneal surface. Clinical Relevance Inhibition of opioid growth factor action using gene therapy could be important in the treatment of corneal diseases such as nonhealing and recurrent erosions, diabetic keratopathy, and neurotrophic keratitis.

Antisense targeting of 3' end elements involved in DUX4 mRNA processing is an efficient therapeutic strategy for facioscapulohumeral dystrophy: a new gene-silencing approach.

PubMed

Marsollier, Anne-Charlotte; Ciszewski, Lukasz; Mariot, Virginie; Popplewell, Linda; Voit, Thomas; Dickson, George; Dumonceaux, Julie

2016-04-15

Defects in mRNA 3'end formation have been described to alter transcription termination, transport of the mRNA from the nucleus to the cytoplasm, stability of the mRNA and translation efficiency. Therefore, inhibition of polyadenylation may lead to gene silencing. Here, we choose facioscapulohumeral dystrophy (FSHD) as a model to determine whether or not targeting key 3' end elements involved in mRNA processing using antisense oligonucleotide drugs can be used as a strategy for gene silencing within a potentially therapeutic context. FSHD is a gain-of-function disease characterized by the aberrant expression of the Double homeobox 4 (DUX4) transcription factor leading to altered pathogenic deregulation of multiple genes in muscles. Here, we demonstrate that targeting either the mRNA polyadenylation signal and/or cleavage site is an efficient strategy to down-regulate DUX4 expression and to decrease the abnormally high-pathological expression of genes downstream of DUX4. We conclude that targeting key functional 3' end elements involved in pre-mRNA to mRNA maturation with antisense drugs can lead to efficient gene silencing and is thus a potentially effective therapeutic strategy for at least FSHD. Moreover, polyadenylation is a crucial step in the maturation of almost all eukaryotic mRNAs, and thus all mRNAs are virtually eligible for this antisense-mediated knockdown strategy. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

A fiber optic biosensor for fluorimetric detection of triple-helical DNA.

PubMed

Uddin, A H; Piunno, P A; Hudson, R H; Damha, M J; Krull, U J

1997-10-15

A fiber optic biosensor was used for the fluorimetric detection of T/AT triple-helical DNA formation. The surfaces of two sets of fused silica optical fibers were functionalized with hexaethylene oxide linkers from which decaadenylic acid oligonucleotides were grown in the 3'to 5'and 5'to 3'direction, respectively, using a DNA synthesizer. Fluorescence studies of hybridization showed unequivocal hybridization between oligomers immobilized on the fibers and complementary oligonucleotides from the solution phase, as detected by fluorescence from intercalated ethidium bromide. The complementary oligonucleotide, dT10, which was expected to Watson-Crick hybridize upon cooling the system below the duplex melting temperature ( T m), provided a fluorescence intensity with a negative temperature coefficient. Upon further cooling, to the point where the pyrimidine motif T*AT triple-helix formation occurred, a fluorescence intensity change with a positive temperature coefficient was observed. The reverse-Hoogsteen T.AT triplex, which is known to form with branched nucleic acids, provided a corresponding decrease in fluorescence intensity with decreasing temperature. Full analytical signal evolution was attainable in minutes.

Suppression of vasoactive intestinal polypeptide in the suprachiasmatic nucleus leads to aging-like alterations in cAMP rhythms and activation of gonadotropin-releasing hormone neurons.

PubMed

Gerhold, Lynnette M; Rosewell, Katherine L; Wise, Phyllis M

2005-01-05

Input from the suprachiasmatic nucleus (SCN) to gonadotropin-releasing hormone (GnRH) neurons is critical to the occurrence of regular cyclic GnRH secretion. It is thought that an essential neuropeptide in the SCN that communicates this cyclic information to GnRH neurons is vasoactive intestinal polypeptide (VIP) and that it may act through cAMP. We tested the hypothesis that (1) aging involves a blunting of cAMP diurnal rhythmicity in the SCN; (2) administration of antisense oligonucleotides (anti-oligos) against VIP, which produces an aging-like pattern in VIP, would lead to an aging-like suppression of cAMP; and (3) this in turn would lead to inhibition of the steroid-induced activation of GnRH neurons. We measured cAMP concentrations in the SCN and rostral preoptic nucleus throughout the day in young and middle-aged rats that were ovariectomized (OVX) or OVX and treated with estradiol. Our results show that cAMP concentrations exhibit a diurnal rhythm in young rats, and that this rhythm is totally abolished by the time rats are middle age. Administration of antisense oligonucleotides against VIP or random oligos suppresses VIP concentrations and abolishes the cAMP rhythm, leading to significantly reduced activation of GnRH neurons. Together, these findings strongly suggest that the SCN conveys diurnal information to GnRH neurons by driving VIP-dependent cAMP rhythms. In addition, aging involves deterioration in this VIP-driven rhythmicity, which impacts the ability of steroids to induce GnRH neuronal activation.

Inhibition of Survivin and Aurora B Kinase Sensitizes Mesothelioma Cells by Enhancing Mitotic Arrests

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Kwang Woon; Mutter, Robert W.; Willey, Christopher D.

2007-04-01

Purpose: Survivin, a member of the inhibitor of apoptosis gene family, has also been shown to regulate mitosis. It binds Aurora B kinase and the inner centromere protein to form the chromosome passenger complex. Both Aurora B and survivin are overexpressed in many tumors. In this study, we examined whether irradiation affected survivin and Aurora B expression in mesothelioma cells, and how inhibition of these molecules affected radiosensitivity. Methods and Materials: ZM447439 and survivin antisense oligonucleotides were used to inhibit survivin and Aurora B kinase respectively. Western blot was performed to determine the expression of survivin, Aurora B, phosphorylated-histone H3more » (Ser 10), and caspase cleavage. Multinucleated cells were counted using flow cytometry, and cell survival after treatment was determined using clonogenic assay. Results: At 3-Gy irradiation an increase was observed in levels of survivin and Aurora B as well as the kinase activity of Aurora B, with an increase in G2/M phase. The radiation-induced upregulation of these molecules was effectively attenuated by antisense oligonucleotides against survivin and a small-molecule inhibitor of Aurora B, ZM447439. Dual inhibition of survivin and Aurora B synergistically radiosensitized mesothelioma cells with a dose enhancement ratio of 2.55. This treatment resulted in increased formation of multinucleated cells after irradiation but did not increase levels of cleaved caspase 3. Conclusion: Inhibition of survivin and Aurora B induces mitotic cell arrest in mesothelioma cells after irradiation. These two proteins may be potential therapeutic targets for the enhancement of radiotherapy in malignant pleural mesothelioma.« less

Motor Neuron Gene Therapy: Lessons from Spinal Muscular Atrophy for Amyotrophic Lateral Sclerosis

PubMed Central

Tosolini, Andrew P.; Sleigh, James N.

2017-01-01

Spinal muscular atrophy (SMA) and amyotrophic lateral sclerosis (ALS) are severe nervous system diseases characterized by the degeneration of lower motor neurons. They share a number of additional pathological, cellular, and genetic parallels suggesting that mechanistic and clinical insights into one disorder may have value for the other. While there are currently no clinical ALS gene therapies, the splice-switching antisense oligonucleotide, nusinersen, was recently approved for SMA. This milestone was achieved through extensive pre-clinical research and patient trials, which together have spawned fundamental insights into motor neuron gene therapy. We have thus tried to distil key information garnered from SMA research, in the hope that it may stimulate a more directed approach to ALS gene therapy. Not only must the type of therapeutic (e.g., antisense oligonucleotide vs. viral vector) be sensibly selected, but considerable thought must be applied to the where, which, what, and when in order to enhance treatment benefit: to where (cell types and tissues) must the drug be delivered and how can this be best achieved? Which perturbed pathways must be corrected and can they be concurrently targeted? What dosing regime and concentration should be used? When should medication be administered? These questions are intuitive, but central to identifying and optimizing a successful gene therapy. Providing definitive solutions to these quandaries will be difficult, but clear thinking about therapeutic testing is necessary if we are to have the best chance of developing viable ALS gene therapies and improving upon early generation SMA treatments. PMID:29270111

Species-specific inflammatory responses as a primary component for the development of glomerular lesions in mice and monkeys following chronic administration of a second-generation antisense oligonucleotide.

PubMed

Frazier, Kendall S; Sobry, Cécile; Derr, Victoria; Adams, Mike J; Besten, Cathaline Den; De Kimpe, Sjef; Francis, Ian; Gales, Tracy L; Haworth, Richard; Maguire, Shaun R; Mirabile, Rosanna C; Mullins, David; Palate, Bernard; Doorten, Yolanda Ponstein-Simarro; Ridings, James E; Scicchitano, Marshall S; Silvano, Jérémy; Woodfine, Jennie

2014-07-01

Chronic administration of drisapersen, a 2'-OMe phosphorothioate antisense oligonucleotide (AON) to mice and monkeys resulted in renal tubular accumulation, with secondary tubular degeneration. Glomerulopathy occurred in both species with species-specific characteristics. Glomerular lesions in mice were characterized by progressive hyaline matrix accumulation, accompanied by the presence of renal amyloid and with subsequent papillary necrosis. Early changes involved glomerular endothelial hypertrophy and degeneration, but the chronic glomerular amyloid and hyaline alterations in mice appeared to be species specific. An immune-mediated mechanism for the glomerular lesions in mice was supported by early inflammatory changes including increased expression of inflammatory cytokines and other immunomodulatory genes within the renal cortex, increased stimulation of CD68 protein, and systemic elevation of monocyte chemotactic protein 1. In contrast, kidneys from monkeys given drisapersen chronically showed less severe glomerular changes characterized by increased mesangial and inflammatory cells, endothelial cell hypertrophy, and subepithelial and membranous electron-dense deposits, with ultrastructural and immunohistochemical characteristics of complement and complement-related fragments. Lesions in monkeys resembled typical features of C3 glomerulopathy, a condition described in man and experimental animals to be linked to dysregulation of the alternative complement pathway. Thus, inflammatory/immune mechanisms appear critical to glomerular injury with species-specific sensitivities for mouse and monkey. The lower observed proinflammatory activity in humans as compared to mice and monkeys may reflect a lower risk of glomerular injury in patients receiving AON therapy. © 2014 by The Author(s).

Self-Assembly into Nanoparticles Is Essential for Receptor Mediated Uptake of Therapeutic Antisense Oligonucleotides.

PubMed

Ezzat, Kariem; Aoki, Yoshitsugu; Koo, Taeyoung; McClorey, Graham; Benner, Leif; Coenen-Stass, Anna; O'Donovan, Liz; Lehto, Taavi; Garcia-Guerra, Antonio; Nordin, Joel; Saleh, Amer F; Behlke, Mark; Morris, John; Goyenvalle, Aurelie; Dugovic, Branislav; Leumann, Christian; Gordon, Siamon; Gait, Michael J; El-Andaloussi, Samir; Wood, Matthew J A

2015-07-08

Antisense oligonucleotides (ASOs) have the potential to revolutionize medicine due to their ability to manipulate gene function for therapeutic purposes. ASOs are chemically modified and/or incorporated within nanoparticles to enhance their stability and cellular uptake, however, a major challenge is the poor understanding of their uptake mechanisms, which would facilitate improved ASO designs with enhanced activity and reduced toxicity. Here, we study the uptake mechanism of three therapeutically relevant ASOs (peptide-conjugated phosphorodiamidate morpholino (PPMO), 2'Omethyl phosphorothioate (2'OMe), and phosphorothioated tricyclo DNA (tcDNA) that have been optimized to induce exon skipping in models of Duchenne muscular dystrophy (DMD). We show that PPMO and tcDNA have high propensity to spontaneously self-assemble into nanoparticles. PPMO forms micelles of defined size and their net charge (zeta potential) is dependent on the medium and concentration. In biomimetic conditions and at low concentrations, PPMO obtains net negative charge and its uptake is mediated by class A scavenger receptor subtypes (SCARAs) as shown by competitive inhibition and RNAi silencing experiments in vitro. In vivo, the activity of PPMO was significantly decreased in SCARA1 knockout mice compared to wild-type animals. Additionally, we show that SCARA1 is involved in the uptake of tcDNA and 2'OMe as shown by competitive inhibition and colocalization experiments. Surface plasmon resonance binding analysis to SCARA1 demonstrated that PPMO and tcDNA have higher binding profiles to the receptor compared to 2'OMe. These results demonstrate receptor-mediated uptake for a range of therapeutic ASO chemistries, a mechanism that is dependent on their self-assembly into nanoparticles.

Targeted delivery of antisense oligonucleotides to hepatocytes using triantennary N-acetyl galactosamine improves potency 10-fold in mice.

PubMed

Prakash, Thazha P; Graham, Mark J; Yu, Jinghua; Carty, Rick; Low, Audrey; Chappell, Alfred; Schmidt, Karsten; Zhao, Chenguang; Aghajan, Mariam; Murray, Heather F; Riney, Stan; Booten, Sheri L; Murray, Susan F; Gaus, Hans; Crosby, Jeff; Lima, Walt F; Guo, Shuling; Monia, Brett P; Swayze, Eric E; Seth, Punit P

2014-07-01

Triantennary N-acetyl galactosamine (GalNAc, GN3: ), a high-affinity ligand for the hepatocyte-specific asialoglycoprotein receptor (ASGPR), enhances the potency of second-generation gapmer antisense oligonucleotides (ASOs) 6-10-fold in mouse liver. When combined with next-generation ASO designs comprised of short S-cEt (S-2'-O-Et-2',4'-bridged nucleic acid) gapmer ASOs, ∼ 60-fold enhancement in potency relative to the parent MOE (2'-O-methoxyethyl RNA) ASO was observed. GN3: -conjugated ASOs showed high affinity for mouse ASGPR, which results in enhanced ASO delivery to hepatocytes versus non-parenchymal cells. After internalization into cells, the GN3: -ASO conjugate is metabolized to liberate the parent ASO in the liver. No metabolism of the GN3: -ASO conjugate was detected in plasma suggesting that GN3: acts as a hepatocyte targeting prodrug that is detached from the ASO by metabolism after internalization into the liver. GalNAc conjugation also enhanced potency and duration of the effect of two ASOs targeting human apolipoprotein C-III and human transthyretin (TTR) in transgenic mice. The unconjugated ASOs are currently in late stage clinical trials for the treatment of familial chylomicronemia and TTR-mediated polyneuropathy. The ability to translate these observations in humans offers the potential to improve therapeutic index, reduce cost of therapy and support a monthly dosing schedule for therapeutic suppression of gene expression in the liver using ASOs. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.

Different effects of antisense RelA p65 and NF-kappaB1 p50 oligonucleotides on the nuclear factor-kappaB mediated expression of ICAM-1 in human coronary endothelial and smooth muscle cells.

PubMed

Voisard, R; Huber, N; Baur, R; Susa, M; Ickrath, O; Both, A; Koenig, W; Hombach, V

2001-01-01

Activation of nuclear factor-kappaB (NF-kappaB) is one of the key events in early atherosclerosis and restenosis. We hypothesized that tumor necrosis factor-alpha (TNF-alpha) induced and NF-kappaB mediated expression of intercellular adhesion molecule-1 (ICAM-1) can be inhibited by antisense RelA p65 and NF-kappaB1 p50 oligonucleotides (RelA p65 and NF-kappaB1 p50). Smooth muscle cells (SMC) from human coronary plaque material (HCPSMC, plaque material of 52 patients), SMC from the human coronary media (HCMSMC), human endothelial cells (EC) from umbilical veins (HUVEC), and human coronary EC (HCAEC) were successfully isolated (HCPSMC, HUVEC), identified and cultured (HCPSMC, HCMSMC, HUVEC, HCAEC). 12 hrs prior to TNF-alpha stimulus (20 ng/mL, 6 hrs) RelA p65 and NF-kappaB1 p50 (1, 2, 4, 10, 20, and 30 microM) and controls were added for a period of 18 hrs. In HUVEC and HCAEC there was a dose dependent inhibition of ICAM-1 expression after adding of both RelA p65 and NF-kappaB1 p50. No inhibitory effect was seen after incubation of HCMSMC with RelA p65 and NF-kappaB1 p50. A moderate inhibition of ICAM-1 expression was found after simultaneous addition of RelA p65 and NF-kappaB1 p50 to HCPSMC, no inhibitory effect was detected after individual addition of RelA p65 and NF-kappaB1 p50. The data point out that differences exist in the NF-kappaB mediated expression of ICAM-1 between EC and SMC. Experimental antisense strategies directed against RelA p65 and NF-kappaB1 p50 in early atherosclerosis and restenosis are promising in HCAEC but will be confronted with redundant pathways in HCMSMC and HCPSMC.

Label-Free Electrochemical Detection of the Specific Oligonucleotide Sequence of Dengue Virus Type 1 on Pencil Graphite Electrodes

PubMed Central

Souza, Elaine; Nascimento, Gustavo; Santana, Nataly; Ferreira, Danielly; Lima, Manoel; Natividade, Edna; Martins, Danyelly; Lima-Filho, José

2011-01-01

A biosensor that relies on the adsorption immobilization of the 18-mer single-stranded nucleic acid related to dengue virus gene 1 on activated pencil graphite was developed. Hybridization between the probe and its complementary oligonucleotides (the target) was investigated by monitoring guanine oxidation by differential pulse voltammetry (DPV). The pencil graphite electrode was made of ordinary pencil lead (type 4B). The polished surface of the working electrode was activated by applying a potential of 1.8 V for 5 min. Afterward, the dengue oligonucleotides probe was immobilized on the activated electrode by applying 0.5 V to the electrode in 0.5 M acetate buffer (pH 5.0) for 5 min. The hybridization process was carried out by incubating at the annealing temperature of the oligonucleotides. A time of five minutes and concentration of 1 μM were found to be the optimal conditions for probe immobilization. The electrochemical detection of annealing between the DNA probe (TS-1P) immobilized on the modified electrode, and the target (TS-1T) was achieved. The target could be quantified in a range from 1 to 40 nM with good linearity and a detection limit of 0.92 nM. The specificity of the electrochemical biosensor was tested using non-complementary sequences of dengue virus 2 and 3. PMID:22163916

Aptamer-based electrochemical sensors with aptamer-complementary DNA oligonucleotides as probe.

PubMed

Lu, Ying; Li, Xianchan; Zhang, Limin; Yu, Ping; Su, Lei; Mao, Lanqun

2008-03-15

This study describes a facile and general strategy for the development of aptamer-based electrochemical sensors with a high specificity toward the targets and a ready regeneration feature. Very different from the existing strategies for the development of electrochemical aptasensors with the aptamers as the probes, the strategy proposed here is essentially based on the utilization of the aptamer-complementary DNA (cDNA) oligonucleotides as the probes for electrochemical sensing. In this context, the sequences at both ends of the cDNA are tailor-made to be complementary and both the redox moiety (i.e., ferrocene in this study) and thiol group are labeled onto the cDNA. The labeled cDNA are hybridized with their respective aptamers (i.e., ATP- and thrombin-binding aptamers in this study) to form double-stranded DNA (ds-DNA) and the electrochemical aptasensors are prepared by self-assembling the labeled ds-DNA onto Au electrodes. Upon target binding, the aptamers confined onto electrode surface dissociate from their respective cDNA oligonucleotides into the solution and the single-stranded cDNA could thus tend to form a hairpin structure through the hybridization of the complementary sequences at both its ends. Such a conformational change of the cDNA resulting from the target binding-induced dissociation of the aptamers essentially leads to the change in the voltammetric signal of the redox moiety labeled onto the cDNA and thus constitutes the mechanism for the electrochemical aptasensors for specific target sensing. The aptasensors demonstrated here with the cDNA as the probe are readily regenerated and show good responses toward the targets. This study may offer a new and relatively general approach to electrochemical aptasensors with good analytical properties and potential applications.

Potential treatments for genetic hearing loss in humans: current conundrums.

PubMed

Minoda, R; Miwa, T; Ise, M; Takeda, H

2015-08-01

Genetic defects are a major cause of hearing loss in newborns. Consequently, hearing loss has a profound negative impact on human daily living. Numerous causative genes for genetic hearing loss have been identified. However, presently, there are no truly curative treatments for this condition. There have been several recent reports on successful treatments in mice using embryonic gene therapy, neonatal gene therapy and neonatal antisense oligonucleotide therapy. Herein, we describe state-of-the-art research on genetic hearing loss treatment through gene therapy and discuss the obstacles to overcome in curative treatments of genetic hearing loss in humans.

Methods of DNA sequencing by hybridization based on optimizing concentration of matrix-bound oligonucleotide and device for carrying out same

DOEpatents

Khrapko, Konstantin R [Moscow, RU; Khorlin, Alexandr A [Moscow, RU; Ivanov, Igor B [Moskovskaya, RU; Ershov, Gennady M [Moscow, RU; Lysov, Jury P [Moscow, RU; Florentiev, Vladimir L [Moscow, RU; Mirzabekov, Andrei D [Moscow, RU

1996-09-03

A method for sequencing DNA by hybridization that includes the following steps: forming an array of oligonucleotides at such concentrations that either ensure the same dissociation temperature for all fully complementary duplexes or allows hybridization and washing of such duplexes to be conducted at the same temperature; hybridizing said oligonucleotide array with labeled test DNA; washing in duplex dissociation conditions; identifying single-base substitutions in the test DNA by analyzing the distribution of the dissociation temperatures and reconstructing the DNA nucleotide sequence based on the above analysis. A device for carrying out the method comprises a solid substrate and a matrix rigidly bound to the substrate. The matrix contains the oligonucleotide array and consists of a multiplicity of gel portions. Each gel portion contains one oligonucleotide of desired length. The gel portions are separated from one another by interstices and have a thickness not exceeding 30 .mu.m.

Photomodulating Gene Expression by Using Caged siRNAs with Single-Aptamer Modification.

PubMed

Zhang, Liangliang; Chen, Changmai; Fan, Xinli; Tang, Xinjing

2018-06-18

Caged siRNAs incorporating terminal modification were rationally designed for photochemical regulation of gene silencing induced by RNA interference (RNAi). Through the conjugation of a single oligonucleotide aptamer at the 5' terminus of the antisense RNA strand, enhancement of the blocking effect for RNA-induced silencing complex (RISC) formation/processing was expected, due both/either to the aptamers themselves and/or to their interaction with large binding proteins. Two oligonucleotide aptamers (AS1411 and MUC-1) were chosen for aptamer-siRNA conjugation through a photolabile linker. This caging strategy was successfully used to photoregulate gene expression both of firefly luciferase and of green fluorescent protein (GFP) in cells. Further patterning experiments revealed that spatial regulation of GFP expression was successfully achieved by using the aptamer-modified caged siRNA and light activation. We expect that further optimized caged siRNAs featuring aptamer conjugation will be promising for practical applications to spatiotemporal photoregulation of gene expression in the future. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Development of Novel Antisense Oligonucleotides for the Functional Regulation of RNA-Induced Silencing Complex (RISC) by Promoting the Release of microRNA from RISC.

PubMed

Ariyoshi, Jumpei; Momokawa, Daiki; Eimori, Nao; Kobori, Akio; Murakami, Akira; Yamayoshi, Asako

2015-12-16

MicroRNAs (miRNAs) are known to be important post-transcription regulators of gene expression. Aberrant miRNA expression is associated with pathological disease processes, including carcinogenesis. Therefore, miRNAs are considered significant therapeutic targets for cancer therapy. MiRNAs do not act alone, but exhibit their functions by forming RNA-induced silencing complex (RISC). Thus, the regulation of RISC activity is a promising approach for cancer therapy. MiRNA is a core component of RISC and is an essential to RISC for recognizing target mRNA. Thereby, it is expected that development of the method to promote the release of miRNA from RISC would be an effective approach for inhibition of RISC activity. In this study, we synthesized novel peptide-conjugated oligonucleotides (RINDA-as) to promote the release of miRNA from RISC. RINDA-as showed a high rate of miRNA release from RISC and high level of inhibitory effect on RISC activity.

Synthesis and antisense properties of fluoro cyclohexenyl nucleic acid (F-CeNA), a nuclease stable mimic of 2'-fluoro RNA.

PubMed

Seth, Punit P; Yu, Jinghua; Jazayeri, Ali; Pallan, Pradeep S; Allerson, Charles R; Østergaard, Michael E; Liu, Fengwu; Herdewijn, Piet; Egli, Martin; Swayze, Eric E

2012-06-01

We report the design and synthesis of 2'-fluoro cyclohexenyl nucleic acid (F-CeNA) pyrimidine phosphoramidites and the synthesis and biophysical, structural, and biological evaluation of modified oligonucleotides. The synthesis of the nucleoside phosphoramidites was accomplished in multigram quantities starting from commercially available methyl-D-mannose pyranoside. Installation of the fluorine atom was accomplished using nonafluorobutanesulfonyl fluoride, and the cyclohexenyl ring system was assembled by means of a palladium-catalyzed Ferrier rearrangement. Installation of the nucleobase was carried out under Mitsunobu conditions followed by standard protecting group manipulations to provide the desired pyrimidine phosphoramidites. Biophysical evaluation indicated that F-CeNA shows behavior similar to that of a 2'-modified nucleotide, and duplexes with RNA showed slightly lower duplex thermostability as compared to that of the more rigid 3'-fluoro hexitol nucleic acid (FHNA). However, F-CeNA modified oligonucleotides were significantly more stable against digestion by snake venom phosphodiesterases (SVPD) as compared to unmodified DNA, 2'-fluoro RNA (FRNA), 2'-methoxyethyl RNA (MOE), and FHNA modified oligonucleotides. Examination of crystal structures of a modified DNA heptamer duplex d(GCG)-T*-d(GCG):d(CGCACGC) by X-ray crystallography indicated that the cyclohexenyl ring system exhibits both the (3)H(2) and (2)H(3) conformations, similar to the C3'-endo/C2'-endo conformation equilibrium seen in natural furanose nucleosides. In the (2)H(3) conformation, the equatorial fluorine engages in a relatively close contact with C8 (2.94 Å) of the 3'-adjacent dG nucleotide that may represent a pseudo hydrogen bond. In contrast, the cyclohexenyl ring of F-CeNA was found to exist exclusively in the (3)H(2) (C3'-endo like) conformation in the crystal structure of the modified A-form DNA decamer duplex [d(GCGTA)-T*-d(ACGC)](2.) In an animal experiment, a 16-mer F-CeNA gapmer ASO showed similar RNA affinity but significantly improved activity compared to that of a sequence matched MOE ASO, thus establishing F-CeNA as a useful modification for antisense applications.

Induction of apoptosis in rhabdomyosarcoma cells through down-regulation of PAX proteins

PubMed Central

Bernasconi, Michele; Remppis, Andrew; Fredericks, William J.; Rauscher, Frank J.; Schäfer, Beat W.

1996-01-01

The expression of a number of human paired box-containing (PAX) genes has been correlated with various types of tumors. Novel fusion genes encoding chimeric fusion proteins have been found in the pediatric malignant tumor alveolar rhabdomyosarcoma (RMS). They are generated by two chromosomal translocations t(2;13) and t(1;13) juxtaposing PAX3 or PAX7, respectively, with a forkhead domain gene FKHR. Here we describe that specific down-regulation of the t(2;13) translocation product in alveolar RMS cells by antisense oligonucleotides results in reduced cellular viability. Cells of embryonal RMS, the other major histiotype of this tumor, were found to express either wild type PAX3 or PAX7 at elevated levels when compared with primary human myoblasts. Treatment of corresponding embryonal RMS cells with antisense olignucleotides directed against the mRNA translational start site of either one of these two transcription factors similarly triggers cell death, which is most likely due to induction of apoptosis. Retroviral mediated ectopic expression of mouse Pax3 in a PAX7 expressing embryonal RMS cell line could partially rescue antisense induced apoptosis. These data suggest that the PAX3/FKHR fusion gene and wild-type PAX genes play a causative role in the formation of RMS and presumably other tumor types, possibly by suppressing the apoptotic program that would normally eliminate these cells. PMID:8917562

Quantitative Antisense Screening and Optimization for Exon 51 Skipping in Duchenne Muscular Dystrophy.

PubMed

Echigoya, Yusuke; Lim, Kenji Rowel Q; Trieu, Nhu; Bao, Bo; Miskew Nichols, Bailey; Vila, Maria Candida; Novak, James S; Hara, Yuko; Lee, Joshua; Touznik, Aleksander; Mamchaoui, Kamel; Aoki, Yoshitsugu; Takeda, Shin'ichi; Nagaraju, Kanneboyina; Mouly, Vincent; Maruyama, Rika; Duddy, William; Yokota, Toshifumi

2017-11-01

Duchenne muscular dystrophy (DMD), the most common lethal genetic disorder, is caused by mutations in the dystrophin (DMD) gene. Exon skipping is a therapeutic approach that uses antisense oligonucleotides (AOs) to modulate splicing and restore the reading frame, leading to truncated, yet functional protein expression. In 2016, the US Food and Drug Administration (FDA) conditionally approved the first phosphorodiamidate morpholino oligomer (morpholino)-based AO drug, eteplirsen, developed for DMD exon 51 skipping. Eteplirsen remains controversial with insufficient evidence of its therapeutic effect in patients. We recently developed an in silico tool to design antisense morpholino sequences for exon skipping. Here, we designed morpholino AOs targeting DMD exon 51 using the in silico tool and quantitatively evaluated the effects in immortalized DMD muscle cells in vitro. To our surprise, most of the newly designed morpholinos induced exon 51 skipping more efficiently compared with the eteplirsen sequence. The efficacy of exon 51 skipping and rescue of dystrophin protein expression were increased by up to more than 12-fold and 7-fold, respectively, compared with the eteplirsen sequence. Significant in vivo efficacy of the most effective morpholino, determined in vitro, was confirmed in mice carrying the human DMD gene. These findings underscore the importance of AO sequence optimization for exon skipping. Copyright © 2017 The American Society of Gene and Cell Therapy. Published by Elsevier Inc. All rights reserved.

Reduction of PTP1B induces differential expression of PI3-kinase (p85alpha) isoforms.

PubMed

Rondinone, Cristina M; Clampit, Jill; Gum, Rebecca J; Zinker, Bradley A; Jirousek, Michael R; Trevillyan, James M

2004-10-15

Protein tyrosine phosphatase 1B (PTP1B) inhibition increases insulin sensitivity and normalizes blood glucose levels in animals. The molecular events associated with PTP1B inhibition that increase insulin sensitivity remain controversial. Insulin resistant, diabetic ob/ob mice, dosed with PTP1B antisense for 3 weeks exhibited a decrease in PTP1B protein levels and a change in the expression level of p85alpha isoforms in liver, characterized by a reduction in p85alpha and an upregulation of the p50alpha and p55alpha isoforms. Transfection of mouse hepatocytes with PTP1B antisense caused a downregulation PTP1B and p85alpha protein levels. Furthermore, transfection of mouse hepatocytes with PTP1B siRNA downregulated p85alpha protein expression and enhanced insulin-induced PKB phosphorylation. Treatment of mouse hepatocytes with p85alpha antisense oligonucleotide caused a reduction of p85alpha and an increase in p50alpha and p55alpha isoforms and enhanced insulin-stimulated PKB activation. These results demonstrate that PTP1B inhibition causes a direct differential regulation of p85alpha isoforms of PI3-kinase in liver and that reduction of p85alpha may be one mechanism by which PTP1B inhibition improves insulin sensitivity and glucose metabolism in insulin-resistant states. Copyright 2004 Elsevier Inc.

Mipomersen, an antisense apolipoprotein B synthesis inhibitor.

PubMed

Bell, Damon A; Hooper, Amanda J; Burnett, John R

2011-02-01

mipomersen is a second-generation antisense oligonucleotide (ASO) targeted to human apolipoprotein (apo) B-100, a large protein synthesized by the liver that plays a fundamental role in human lipoprotein metabolism. Mipomersen predominantly distributes to the liver and decreases the production of apoB-100, the primary structural protein of the atherogenic lipoproteins including low density lipoprotein (LDL), thereby reducing plasma LDL-cholesterol and apoB-100 concentrations. the mode of action, preclinical development and clinical trials of mipomersen, an antisense apoB synthesis inhibitor. The paper provides an understanding of the pharmacokinetic and pharmacodynamic characteristics of mipomersen and insight into its clinical efficacy and safety. In clinical trials, mipomersen produced dose-dependent and prolonged reductions in LDL-cholesterol and other apoB-containing lipoproteins, including lipoprotein (a) [Lp(a)] in healthy volunteers and in patients with mild to moderate hypercholesterolemia. Mipomersen has been shown to decrease apoB, LDL-cholesterol and Lp(a) in patients with heterozygous and homozygous familial hypercholesterolemia on maximally tolerated lipid-lowering therapy. mipomersen shows promise as an adjunctive agent by reducing apoB-containing lipoproteins in patients at high risk of atherosclerotic cardiovascular disease who are not at target or are intolerant of statins. Although the short-term efficacy and safety of mipomersen has been established, concern exists regarding the long-term potential for hepatic steatosis with this ASO.

Efficient encapsulation of antisense oligonucleotides in lipid vesicles using ionizable aminolipids: formation of novel small multilamellar vesicle structures.

PubMed

Semple, S C; Klimuk, S K; Harasym, T O; Dos Santos, N; Ansell, S M; Wong, K F; Maurer, N; Stark, H; Cullis, P R; Hope, M J; Scherrer, P

2001-02-09

Typical methods used for encapsulating antisense oligodeoxynucleotides (ODN) and plasmid DNA in lipid vesicles result in very low encapsulation efficiencies or employ cationic lipids that exhibit unfavorable pharmacokinetic and toxicity characteristics when administered intravenously. In this study, we describe and characterize a novel formulation process that utilizes an ionizable aminolipid (1,2-dioleoyl-3-dimethylammonium propane, DODAP) and an ethanol-containing buffer system for encapsulating large quantities (0.15--0.25 g ODN/g lipid) of polyanionic ODN in lipid vesicles. This process requires the presence of up to 40% ethanol (v/v) and initial formulation at acidic pH values where the DODAP is positively charged. In addition, the presence of a poly(ethylene glycol)-lipid was required during the formulation process to prevent aggregation. The 'stabilized antisense-lipid particles' (SALP) formed are stable on adjustment of the external pH to neutral pH values and the formulation process allows encapsulation efficiencies of up to 70%. ODN encapsulation was confirmed by nuclease protection assays and (31)P NMR measurements. Cryo-electron microscopy indicated that the final particles consisted of a mixed population of unilamellar and small multilamellar vesicles (80--140 nm diameter), the relative proportion of which was dependent on the initial ODN to lipid ratio. Finally, SALP exhibited significantly enhanced circulation lifetimes in mice relative to free antisense ODN, cationic lipid/ODN complexes and SALP prepared with quaternary aminolipids. Given the small particle sizes and improved encapsulation efficiency, ODN to lipid ratios, and circulation times of this formulation compared to others, we believe SALP represent a viable candidate for systemic applications involving nucleic acid therapeutics.

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, Andrei Darievich; Yershov, Gennadiy Moseyevich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Lysov, Yuri Petrovich

1999-01-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates.

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, A.D.; Yershov, G.M.; Kirillov, E.V.; Parinov, S.V.; Barski, V.E.; Lysov, Y.P.

1999-06-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. 5 figs.

Silver Nanoparticle Oligonucleotide Conjugates Based on DNA with Triple Cyclic Disulfide Moieties

PubMed Central

Lee, Jae-Seung; Lytton-Jean, Abigail K. R.; Hurst, Sarah J.; Mirkin, Chad A.

2011-01-01

We report a new strategy for preparing silver nanoparticle oligonucleotide conjugates that are based upon DNA with cyclic disulfide-anchoring groups. These particles are extremely stable and can withstand NaCl concentrations up to 1.0 M. When silver nanoparticles functionalized with complementary sequences are combined, they assemble to form DNA-linked nanoparticle networks. This assembly process is reversible with heating and is associated with a red-shifting of the particle surface plasmon resonance and a concomitant color change from yellow to pale red. Analogous to the oligonucleotide-functionalized gold nanoparticles, these particles also exhibit highly cooperative binding properties with extremely sharp melting transitions. This work is an important step towards being able to use silver nanoparticle oligonucleotide conjugates for a variety of purposes, including molecular diagnostic labels, synthons in programmable materials synthesis approaches, and functional components for nanoelectronic and plasmonic devices. PMID:17571909

A bimetallic nanocomposite modified genosensor for recognition and determination of thalassemia gene.

PubMed

Hamidi-Asl, Ezat; Raoof, Jahan Bakhsh; Naghizadeh, Nahid; Akhavan-Niaki, Haleh; Ojani, Reza; Banihashemi, Ali

2016-10-01

The main roles of DNA in the cells are to maintain and properly express genetic information. It is important to have analytical methods capable of fast and sensitive detection of DNA damage. DNA hybridization sensors are well suited for diagnostics and other purposes, including determination of bacteria and viruses. Beta thalassemias (βth) are due to mutations in the β-globin gene. In this study, an electrochemical biosensor which detects the sequences related to the β-globin gene issued from real samples amplified by polymerase chain reaction (PCR) is described for the first time. The biosensor relies on the immobilization of 20-mer single stranded oligonucleotide (probe) related to βth sequence on the carbon paste electrode (CPE) modified by 15% silver (Ag) and platinum (Pt) nanoparticles to prepare the bimetallic nanocomposite electrode and hybridization of this oligonucleotide with its complementary sequence (target). The extent of hybridization between the probe and target sequences was shown by using linear sweep voltammetry (LSV) with methylene blue (MB) as hybridization indicator. The selectivity of sensor was investigated using PCR samples containing non-complementary oligonucleotides. The detection limit of biosensor was calculated about 470.0pg/μL. Copyright © 2016 Elsevier B.V. All rights reserved.

Dacarbazine with or without oblimersen (a Bcl-2 antisense oligonucleotide) in chemotherapy-naive patients with advanced melanoma and low-normal serum lactate dehydrogenase: 'The AGENDA trial'.

PubMed

Bedikian, Agop Y; Garbe, Claus; Conry, Robert; Lebbe, Celeste; Grob, Jean J

2014-06-01

In a previous large randomized, open-label study, retrospective subset analysis revealed that the addition of the Bcl-2 antisense oligonucleotide oblimersen to dacarbazine (Dac) significantly improved overall survival, progression-free survival, and the response rate in chemotherapy-naive patients with advanced melanoma and normal baseline serum lactate dehydrogenase (LDH) levels. To confirm and expand on this observation, we conducted a prospective double-blind, placebo-controlled study to determine whether oblimersen augmented the efficacy of Dac in advanced melanoma patients with low-normal baseline LDH levels. A total of 314 chemotherapy-naive patients were randomly assigned to receive Dac (1000 mg/m(2)) preceded by a 5-day continuous intravenous infusion of either oblimersen sodium (7 mg/kg/day) or placebo every 21 days for less than eight cycles. Co-primary efficacy endpoints were overall survival and progression-free survival. Response and progression of the disease were assessed by independent blinded review of computed tomography scan images. No difference in overall nor progression-free survival was observed between the Dac-oblimersen and Dac-placebo groups. Although the overall (17.2 vs. 12.1%) and durable (10.8 vs. 7.6%) response rates numerically favored Dac-oblimersen over Dac-placebo, they did not differ significantly (P=0.19 and 0.32, respectively). The incidence of hematologic adverse events, particularly thrombocytopenia and neutropenia, was higher in the Dac-oblimersen group than in the Dac-placebo group. Withdrawals from the study because of treatment-related adverse events were low (i.e. <2.5%) in both groups. The addition of oblimersen to Dac did not significantly improve overall survival nor progression-free survival in patients with advanced melanoma and low-normal levels of LDH at baseline.

Safety and Pharmacokinetics of the Antisense Oligonucleotide (ASO) LY2181308 as a Single-Agent or in Combination with Idarubicin and Cytarabine in Patients with Refractory or Relapsed Acute Myeloid Leukemia (AML)

PubMed Central

Erba, Harry P.; Sayar, Hamid; Juckett, Mark; Lahn, Michael; Andre, Valerie; Callies, Sophie; Schmidt, Shelly; Kadam, Sunil; Brandt, John T.; Van Bockstaele, Dirk; Andreeff, Michael

2014-01-01

Summary Survivin is expressed in tumor cells, including acute myeloid leukemia (AML), regulates mitosis, and prevents tumor cell death. The antisense oligonucleotide sodium LY2181308 (LY2181308) inhibits survivin expression and may cause cell cycle arrest and restore apoptosis in AML. Methods In this study, the safety, pharmacokinetics, and pharmacodynamics/efficacy of LY2181308 was examined in AML patients, first in a cohort with monotherapy (n=8) and then post-amendment in a cohort with the combination of cytarabine and idarubicin treatment (n=16). LY2181308 was administered with a loading dosage of 3 consecutive daily infusions of 750 mg followed by weekly intravenous (IV) maintenance doses of 750 mg. Cytarabine 1.5 g/m2 was administered as a 4-hour IV infusion on Days 3, 4, and 5 of Cycle 1, and idarubicin 12 mg/m2 was administered as a 30-minute IV infusion on Days 3, 4, and 5 of Cycle 1. Cytarabine and idarubicin were administered on Days 1, 2, and 3 of each subsequent 28-day cycle. Reduction of survivin was evaluated in peripheral blasts and bone marrow. Results Single-agent LY2181308 was well tolerated and survivin was reduced only in patients with a high survivin expression. In combination with chemotherapy, 4/16 patients had complete responses, 1/16 patients had incomplete responses, and 4/16 patients had cytoreduction. Nine patients died on study: 6 (monotherapy), 3 (combination). Conclusions LY2181308 alone is well tolerated in patients with AML. In combination with cytarabine and idarubicin, LY2181308 does not appear to cause additional toxicity, and has shown some clinical benefit needing confirmation in future clinical trials. PMID:23397500

Peripheral Administration of GSK-3β Antisense Oligonucleotide Improves Learning and Memory in SAMP8 and Tg2576 Mouse Models of Alzheimer's Disease.

PubMed

Farr, Susan A; Sandoval, Karin E; Niehoff, Michael L; Witt, Ken A; Kumar, Vijaya B; Morley, John E

2016-10-18

Glycogen synthase kinase (GSK)-3β is a multifunctional protein that has been implicated in the pathological characteristics of Alzheimer's disease (AD), including the heightened levels of neurofibrillary tangles, amyloid-beta (Aβ), and neurodegeneration. We have previously shown that an antisense oligonucleotide directed at the Tyr 216 site on GSK-3β (GAO) when injected centrally can decrease GSK-3β levels, improve learning and memory, and decrease oxidative stress. In addition, we showed that GAO can cross the blood-brain barrier. Herein the impact of peripherally administered GAO in both the non-transgenic SAMP8 and transgenic Tg2576 (APPswe) models of AD were examined respective to learning and memory. Brain tissues were then evaluated for expression changes in the phosphorylated-Tyr 216 residue, which leads to GSK-3β activation, and the phosphorylated-Ser9 residue, which reduces GSK-3β activity. SAMP8 GAO-treated mice showed improved acquisition and retention using aversive T-maze, and improved declarative memory as measured by the novel object recognition (NOR) test. Expression of the phosphorylated-Tyr 216 was decreased and the phosphorylated-Ser9 was increased in GAO-treated SAMP8 mice. Tg2576 GAO-treated mice improved acquisition and retention in both the T-maze and NOR tests, with an increased phosphorylated-Ser9 GSK-3β expression. Results demonstrate that peripheral administration of GAO improves learning and memory, corresponding with alterations in GSK-3β phosphorylation state. This study supports peripherally administered GAO as a viable means to mediate GSK-3β activity within the brain and a possible treatment for AD.

Mycophenolate mofetil increases adhesion capacity of tumor cells in vitro.

PubMed

Blaheta, Roman A; Bogossian, Harilaos; Beecken, Wolf-Dietrich; Jonas, Dietger; Hasenberg, Christoph; Makarevic, Jasmina; Ogbomo, Henry; Bechstein, Wolf O; Oppermann, Elsie; Leckel, Kerstin; Cinatl, Jindrich

2003-12-27

The immunosuppressive drug mycophenolate mofetil (MMF) reduces expression of the heterophilic binding elements intercellular adhesion molecule-1 and vascular cell adhesion molecule-1 and thereby prevents attachment of alloactivated leukocytes to donor endothelium. The authors speculated that MMF might further diminish receptors of the immunoglobulin superfamily which, however, act as homophilic binding elements. Because decrease of homophilic adhesion receptors correlates with tumor dissemination and metastasis, MMF could trigger development or recurrence of neoplastic tumors. The authors analyzed the influence of MMF on homotypic adhesion receptors and its consequence for tumor cell attachment to an endothelial cell monolayer. Neuroblastoma (NB) cells, which self-aggregate by means of the homophilic-binding element neural cell adhesion molecule (NCAM), were used. Effects of MMF on the 140- and 180-kDa NCAM isoforms were investigated quantitatively by flow cytometry, Western blot, and reverse-transcriptase (RT) polymerase chain reaction (PCR). The relevance of NCAM for tumor cell binding was proven by treating NB with NCAM antisense oligonucleotides. MMF profoundly increased the number of adherent NB cells, with a maximum effect at 0.1 microM, compared with controls. Decrease of NCAM on the cell surface was detected by flow cytometry. Western blot and RT-PCR demonstrated reduced protein and RNA levels of the 140- and 180-kDa isoforms. Treatment of NB cells with NCAM antisense oligonucleotides showed that reduced NCAM expression leads to enhanced tumor cell adhesion. MMF decreases NCAM receptors, which is associated with enhanced tumor cell invasiveness. The authors conclude that an MMF-based immunosuppressive regimen might increase the risk of tumor metastasis if this process is predominantly conveyed by means of homophilic adhesion proteins.

Effects of an Antisense Oligonucleotide Inhibitor of C‐Reactive Protein Synthesis on the Endotoxin Challenge Response in Healthy Human Male Volunteers

PubMed Central

Noveck, Robert; Stroes, Erik S. G.; Flaim, JoAnn D.; Baker, Brenda F.; Hughes, Steve; Graham, Mark J.; Crooke, Rosanne M.; Ridker, Paul M

2014-01-01

Background C‐reactive protein (CRP) binds to damaged cells, activates the classical complement pathway, is elevated in multiple inflammatory conditions, and provides prognostic information on risk of future atherosclerotic events. It is controversial, however, as to whether inhibiting CRP synthesis would have any direct anti‐inflammatory effects in humans. Methods and Results A placebo‐controlled study was used to evaluate the effects of ISIS 329993 (ISIS‐CRPRx) on the acute‐phase response after endotoxin challenge in 30 evaluable subjects. Healthy adult males were randomly allocated to receive 6 injections over a 22‐day period of placebo or active therapy with ISIS 329993 at 400‐ or 600‐mg doses. Eligible subjects were subsequently challenged with a bolus of endotoxin (2 ng/kg). Inflammatory and hematological biomarkers were measured before and serially after the challenge. ISIS‐CRPRx was well tolerated with no serious adverse events. Median CRP levels increased more than 50‐fold from baseline 24 hours after endotoxin challenge in the placebo group. In contrast, the median increase in CRP levels was attenuated by 37% (400 mg) and 69% (600 mg) in subjects pretreated with ISIS‐CRPRx (P<0.05 vs. placebo). All other aspects of the acute inflammatory response were similar between treatment groups. Conclusion Pretreatment of subjects with ISIS‐CRPRx selectively reduced the endotoxin‐induced increase in CRP levels in a dose‐dependent manner, without affecting other components of the acute‐phase response. These data demonstrate the specificity of antisense oligonucleotides and provide an investigative tool to further define the role of CRP in human pathological conditions. PMID:25012289

Physical and Functional Interaction of NCX1 and EAAC1 Transporters Leading to Glutamate-Enhanced ATP Production in Brain Mitochondria

PubMed Central

Arcangeli, Sara; Nasti, Annamaria Assunta; Giordano, Antonio; Amoroso, Salvatore

2012-01-01

Glutamate is emerging as a major factor stimulating energy production in CNS. Brain mitochondria can utilize this neurotransmitter as respiratory substrate and specific transporters are required to mediate the glutamate entry into the mitochondrial matrix. Glutamate transporters of the Excitatory Amino Acid Transporters (EAATs) family have been previously well characterized on the cell surface of neuronal and glial cells, representing the primary players for glutamate uptake in mammalian brain. Here, by using western blot, confocal microscopy and immunoelectron microscopy, we report for the first time that the Excitatory Amino Acid Carrier 1 (EAAC1), an EAATs member, is expressed in neuronal and glial mitochondria where it participates in glutamate-stimulated ATP production, evaluated by a luciferase-luciferin system. Mitochondrial metabolic response is counteracted when different EAATs pharmacological blockers or selective EAAC1 antisense oligonucleotides were used. Since EAATs are Na+-dependent proteins, this raised the possibility that other transporters regulating ion gradients across mitochondrial membrane were required for glutamate response. We describe colocalization, mutual activity dependency, physical interaction between EAAC1 and the sodium/calcium exchanger 1 (NCX1) both in neuronal and glial mitochondria, and that NCX1 is an essential modulator of this glutamate transporter. Only NCX1 activity is crucial for such glutamate-stimulated ATP synthesis, as demonstrated by pharmacological blockade and selective knock-down with antisense oligonucleotides. The EAAC1/NCX1-dependent mitochondrial response to glutamate may be a general and alternative mechanism whereby this neurotransmitter sustains ATP production, since we have documented such metabolic response also in mitochondria isolated from heart. The data reported here disclose a new physiological role for mitochondrial NCX1 as the key player in glutamate-induced energy production. PMID:22479505

XRN2 is required for the degradation of target RNAs by RNase H1-dependent antisense oligonucleotides

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hori, Shin-Ichiro; Yamamoto, Tsuyoshi; Obika, Satoshi, E-mail: obika@phs.osaka-u.ac.jp

Antisense oligonucleotides (ASOs) can suppress the expression of a target gene by cleaving pre-mRNA and/or mature mRNA via RNase H1. Following the initial endonucleolytic cleavage by RNase H1, the target RNAs are degraded by a mechanism that is poorly understood. To better understand this degradation pathway, we depleted the expression of two major 5′ to 3′ exoribonucleases (XRNs), named XRN1 and XRN2, and analyzed the levels of 3′ fragments of the target RNAs in vitro. We found that the 3′ fragments of target pre-mRNA generated by ASO were almost completely degraded from their 5′ ends by nuclear XRN2 after RNase H1-mediatedmore » cleavage, whereas the 3′ fragments of mature mRNA were partially degraded by XRN2. In contrast to ASO, small interference RNA (siRNA) could reduce the expression level of only mature mRNA, and the 3′ fragment was degraded by cytoplasmic XRN1. Our findings indicate that the RNAs targeted by RNase H1-dependent ASO are rapidly degraded in the nucleus, contrary to the cytoplasmic degradation pathway mediated by siRNA. - Highlights: • We compared the degradation mechanism of the transcript targeted by ASO and siRNA. • We focused on two 5′ to 3′ exoribonucleases, cytoplasmic XRN1, and nuclear XRN2. • The 3′ fragment of target pre-mRNA generated by ASO was degraded by XRN2. • The 3′ fragment of target mRNA generated by ASO was partially degraded by XRN2. • XRN1 depletion promoted accumulation of the 3′ fragment of mRNA generated by siRNA.« less

Proliferation marker pKi-67 affects the cell cycle in a self-regulated manner.

PubMed

Schmidt, Mirko H H; Broll, Rainer; Bruch, Hans-Peter; Duchrow, Michael

2002-01-01

The proliferation marker pKi-67 is commonly used in research and pathology to detect proliferating cells. In a previous work, we found the protein to be associated with regulators of the cell cycle, controlling S-phase progression, as well as entry into and exit from mitosis. Here we investigate whether pKi-67 has a regulative effect on the cell cycle itself. For that purpose we cloned four fragments of pKi-67, together representing nearly the whole protein, and an N-terminal pKi-67 antisense oligonucleotide into a tetracycline inducible gene expression system. The sense fragments were C-terminally modified by addition of either a nuclear localization sequence (NLS) or a STOP codon to address the impact of their intracellular distribution. FACS based cell cycle analysis revealed that expression of nearly all pKi-67 domains and the antisense oligonucleotide led to a decreased amount of cells in S-phase and an increased number of cells in G(2)/M- and G(1)-phase. Subsequent analysis of the endogenous pKi-67 mRNA and protein levels revealed that the constructs with the most significant impact on the cell cycle were able to silence pKi-67 transcription as well. We conclude from the data that pKi-67 influences progression of S-phase and mitosis in a self-regulated manner and, therefore, effects the cell cycle checkpoints within both phases. Furthermore, we found pKi-67 mediates an anti-apoptotic effect on the cell and we verified that this marker, although it is a potential ribosomal catalyst, is not expressed in differentiated tissues with a high transcriptional activity. Copyright 2002 Wiley-Liss, Inc.

Investigation into the mechanism(s) that leads to platelet decreases in cynomolgus monkeys during administration of ISIS-104838, a 2'-MOE-modified antisense oligonucleotide.

PubMed

Narayanan, P K; Shen, L; Curtis, B R; Bourdon, M; Nolan, J P; Zhou, F; Christian, B; Gupta, S; Schaubhut, J L; Greenlee, S; Hoffmaster, C; Burel, S; Witztum, J L; Engelhardt, J A; Henry, S P

2018-05-29

ISIS 104838, a 2'-O-methoxyethyl (2'-MOE)-modified antisense oligonucleotide (ASO), causes a moderate, reproducible, dose-dependent, but self-limiting decrease in platelet (PLT) counts in monkeys and humans. To determine the etiology of PLT decrease in cynomolgus monkeys, a 12-week repeat dose toxicology study in 5 cynomolgus monkeys given subcutaneous injections of ISIS 104838 (30 to 60 mg/kg/week). Monkeys were also injected intravenously with 111In-oxine-labeled PLTs to investigate PLT sequestration. In response to continued dosing, PLT counts were decreased by 50 to 90% by day 30 in all monkeys. PLT decreases were accompanied by 2- to 4.5-fold increases in immunoglobulin M(IgM), which were typified by a 2-to-5-fold increase in anti-platelet factor 4 (PF4) IgM and anti-PLT IgM, respectively. Monocyte chemotactic protein 1 (MCP-1) increased upon dosing of ISIS 104838, concomitant with a 2- to 6-fold increase in monocyte-derived extracellular vesicles (EVs), indicating monocyte activation but not PLT activation. Despite a 2- to- 3-fold increase in von Willebrand factor (VWF) antigen in all monkeys following ASO administration, only two monkeys showed a 2 to 4-fold increase in endothelial EVs. Additionally, a 25-45% increase in PLT sequestration in liver and spleen was also observed. Collectively, these results suggest the overall increase in total IgM, anti-PLT IgM and/or anti-PF4 IgM, in concert with monocyte activation contributed to increased PLT sequestration in spleen and liver, leading to decreased PLTs in peripheral blood.

Identification and Characterization of Modified Antisense Oligonucleotides Targeting DMPK in Mice and Nonhuman Primates for the Treatment of Myotonic Dystrophy Type 1

PubMed Central

Wheeler, Thurman M.; Justice, Samantha L.; Kim, Aneeza; Younis, Husam S.; Gattis, Danielle; Jauvin, Dominic; Puymirat, Jack; Swayze, Eric E.; Freier, Susan M.; Bennett, C. Frank; Thornton, Charles A.; MacLeod, A. Robert

2015-01-01

Myotonic dystrophy type 1 (DM1) is the most common form of muscular dystrophy in adults. DM1 is caused by an expanded CTG repeat in the 3′-untranslated region of DMPK, the gene encoding dystrophia myotonica protein kinase (DMPK). Antisense oligonucleotides (ASOs) containing 2′,4′-constrained ethyl-modified (cEt) residues exhibit a significantly increased RNA binding affinity and in vivo potency relative to those modified with other 2′-chemistries, which we speculated could translate to enhanced activity in extrahepatic tissues, such as muscle. Here, we describe the design and characterization of a cEt gapmer DMPK ASO (ISIS 486178), with potent activity in vitro and in vivo against mouse, monkey, and human DMPK. Systemic delivery of unformulated ISIS 486718 to wild-type mice decreased DMPK mRNA levels by up to 90% in liver and skeletal muscle. Similarly, treatment of either human DMPK transgenic mice or cynomolgus monkeys with ISIS 486178 led to up to 70% inhibition of DMPK in multiple skeletal muscles and ∼50% in cardiac muscle in both species. Importantly, inhibition of DMPK was well tolerated and was not associated with any skeletal muscle or cardiac toxicity. Also interesting was the demonstration that the inhibition of DMPK mRNA levels in muscle was maintained for up to 16 and 13 weeks post-treatment in mice and monkeys, respectively. These results demonstrate that cEt-modified ASOs show potent activity in skeletal muscle, and that this attractive therapeutic approach warrants further clinical investigation to inhibit the gain-of-function toxic RNA underlying the pathogenesis of DM1. PMID:26330536

Allele-Specific Inhibition of Rhodopsin With an Antisense Oligonucleotide Slows Photoreceptor Cell Degeneration

PubMed Central

Murray, Susan F.; Jazayeri, Ali; Matthes, Michael T.; Yasumura, Douglas; Yang, Haidong; Peralta, Raechel; Watt, Andy; Freier, Sue; Hung, Gene; Adamson, Peter S.; Guo, Shuling; Monia, Brett P.; LaVail, Matthew M.; McCaleb, Michael L.

2015-01-01

Purpose To preserve photoreceptor cell structure and function in a rodent model of retinitis pigmentosa with P23H rhodopsin by selective inhibition of the mutant rhodopsin allele using a second generation antisense oligonucleotide (ASO). Methods Wild-type mice and rats were treated with ASO by intravitreal (IVT) injection and rhodopsin mRNA and protein expression were measured. Transgenic rats expressing the murine P23H rhodopsin gene (P23H transgenic rat Line 1) were administered either a mouse-specific P23H ASO or a control ASO. The contralateral eye was injected with PBS and used as a comparator control. Electroretinography (ERG) measurements and analyses of the retinal outer nuclear layer were conducted and correlated with rhodopsin mRNA levels. Results Rhodopsin mRNA and protein expression was reduced after a single ASO injection in wild-type mice with a rhodopsin-specific ASO. Transgenic rat eyes that express a murine P23H rhodopsin gene injected with a murine P23H ASO had a 181 ± 39% better maximum amplitude response (scotopic a-wave) as compared with contralateral PBS-injected eyes; the response in control ASO eyes was not significantly different from comparator contralateral eyes. Morphometric analysis of the outer nuclear layer showed a significantly thicker nuclear layer in eyes injected with murine P23H ASO (18%) versus contralateral PBS-injected eyes. Conclusions Allele-specific ASO-mediated knockdown of mutant P23H rhodopsin expression slowed the rate of photoreceptor degeneration and preserved the function of photoreceptor cells in eyes of the P23H rhodopsin transgenic rat. Our data indicate that ASO treatment is a potentially effective therapy for the treatment of retinitis pigmentosa. PMID:26436889

Identification and characterization of modified antisense oligonucleotides targeting DMPK in mice and nonhuman primates for the treatment of myotonic dystrophy type 1.

PubMed

Pandey, Sanjay K; Wheeler, Thurman M; Justice, Samantha L; Kim, Aneeza; Younis, Husam S; Gattis, Danielle; Jauvin, Dominic; Puymirat, Jack; Swayze, Eric E; Freier, Susan M; Bennett, C Frank; Thornton, Charles A; MacLeod, A Robert

2015-11-01

Myotonic dystrophy type 1 (DM1) is the most common form of muscular dystrophy in adults. DM1 is caused by an expanded CTG repeat in the 3'-untranslated region of DMPK, the gene encoding dystrophia myotonica protein kinase (DMPK). Antisense oligonucleotides (ASOs) containing 2',4'-constrained ethyl-modified (cEt) residues exhibit a significantly increased RNA binding affinity and in vivo potency relative to those modified with other 2'-chemistries, which we speculated could translate to enhanced activity in extrahepatic tissues, such as muscle. Here, we describe the design and characterization of a cEt gapmer DMPK ASO (ISIS 486178), with potent activity in vitro and in vivo against mouse, monkey, and human DMPK. Systemic delivery of unformulated ISIS 486718 to wild-type mice decreased DMPK mRNA levels by up to 90% in liver and skeletal muscle. Similarly, treatment of either human DMPK transgenic mice or cynomolgus monkeys with ISIS 486178 led to up to 70% inhibition of DMPK in multiple skeletal muscles and ∼50% in cardiac muscle in both species. Importantly, inhibition of DMPK was well tolerated and was not associated with any skeletal muscle or cardiac toxicity. Also interesting was the demonstration that the inhibition of DMPK mRNA levels in muscle was maintained for up to 16 and 13 weeks post-treatment in mice and monkeys, respectively. These results demonstrate that cEt-modified ASOs show potent activity in skeletal muscle, and that this attractive therapeutic approach warrants further clinical investigation to inhibit the gain-of-function toxic RNA underlying the pathogenesis of DM1. Copyright © 2015 by The American Society for Pharmacology and Experimental Therapeutics.

Calcium-activated potassium channels in insect pacemaker neurons as unexpected target site for the novel fumigant dimethyl disulfide.

PubMed

Gautier, Hélène; Auger, Jacques; Legros, Christian; Lapied, Bruno

2008-01-01

Dimethyl disulfide (DMDS), a plant-derived insecticide, is a promising fumigant as a substitute for methyl bromide. To further understand the mode of action of DMDS, we examined its effect on cockroach octopaminergic neurosecretory cells, called dorsal unpaired median (DUM) neurons, using whole-cell patch-clamp technique, calcium imaging and antisense oligonucleotide strategy. At low concentration (1 microM), DMDS modified spontaneous regular spike discharge into clear bursting activity associated with a decrease of the amplitude of the afterhyperpolarization. This effect led us to suspect alterations of calcium-activated potassium currents (IKCa) and [Ca(2+)](i) changes. We showed that DMDS reduced amplitudes of both peak transient and sustained components of the total potassium current. IKCa was confirmed as a target of DMDS by using iberiotoxin, cadmium chloride, and pSlo antisense oligonucleotide. In addition, we showed that DMDS induced [Ca(2+)](i) rise in Fura-2-loaded DUM neurons. Using calcium-free solution, and (R,S)-(3,4-dihydro-6,7-dimethoxy-isoquinoline-1-yl)-2-phenyl-N,N-di-[2-(2,3,4-trimethoxy-phenyl)ethyl]-acetamide (LOE 908) [an inhibitor of transient receptor potential (TRP)gamma], we demonstrated that TRPgamma initiated calcium influx. By contrast, omega-conotoxin GVIA (an inhibitor of N-type high-voltage-activated calcium channels), did not affect the DMDS-induced [Ca(2+)](i) rise. Finally, the participation of the calcium-induced calcium release mechanism was investigated using thapsigargin, caffeine, and ryanodine. Our study revealed that DMDS-induced elevation in [Ca(2+)](i) modulated IKCa in an unexpected bell-shaped manner via intracellular calcium. In conclusion, DMDS affects multiple targets, which could be an effective way to improve pest control efficacy of fumigation.

Antisense Oligonucleotides for the Treatment of Spinal Muscular Atrophy

PubMed Central

Porensky, Paul N.

2013-01-01

Abstract Spinal muscular atrophy (SMA) is an autosomal recessive disease affecting ∼1 in 10,000 live births. The most striking component is the loss of α-motor neurons in the ventral horn of the spinal cord, resulting in progressive paralysis and eventually premature death. There is no current treatment paradigm other than supportive care, though the past 15 years has seen a striking advancement in understanding of both SMA genetics and molecular mechanisms. A variety of disease-modifying interventions are rapidly bridging the translational gap from the laboratory to clinical trials, including the application of antisense oligonucleotide (ASO) therapy for the correction of aberrant RNA splicing characteristic of SMA. Survival motor neuron (SMN) is a ubiquitously expressed 38-kD protein. Humans have two genes that produce SMN, SMN1 and SMN2, the former of which is deleted or nonfunctional in the majority of patients with SMA. These two genes are nearly identical with one exception, a C to T transition (C6T) within exon 7 of SMN2. C6T disrupts a modulator of splicing, leading to the exclusion of exon 7 from ∼90% of the mRNA transcript. The resultant truncated Δ7SMN protein does not oligomerize efficiently and is rapidly degraded. SMA can therefore be considered a disease of too little SMN protein. A number of cis-acting splice modifiers have been identified in the region of exon 7, the steric block of which enhances the retention of the exon and a resultant full-length mRNA sequence. ASOs targeted to these splice motifs have shown impressive phenotype rescue in multiple SMA mouse models. PMID:23544870

Antisense oligonucleotide-induced alternative splicing of the APOB mRNA generates a novel isoform of APOB.

PubMed

Khoo, Bernard; Roca, Xavier; Chew, Shern L; Krainer, Adrian R

2007-01-17

Apolipoprotein B (APOB) is an integral part of the LDL, VLDL, IDL, Lp(a) and chylomicron lipoprotein particles. The APOB pre-mRNA consists of 29 constitutively-spliced exons. APOB exists as two natural isoforms: the full-length APOB100 isoform, assembled into LDL, VLDL, IDL and Lp(a) and secreted by the liver in humans; and the C-terminally truncated APOB48, assembled into chylomicrons and secreted by the intestine in humans. Down-regulation of APOB100 is a potential therapy to lower circulating LDL and cholesterol levels. We investigated the ability of 2'O-methyl RNA antisense oligonucleotides (ASOs) to induce the skipping of exon 27 in endogenous APOB mRNA in HepG2 cells. These ASOs are directed towards the 5' and 3' splice-sites of exon 27, the branch-point sequence (BPS) of intron 26-27 and several predicted exonic splicing enhancers within exon 27. ASOs targeting either the 5' or 3' splice-site, in combination with the BPS, are the most effective. The splicing of other alternatively spliced genes are not influenced by these ASOs, suggesting that the effects seen are not due to non-specific changes in alternative splicing. The skip 27 mRNA is translated into a truncated isoform, APOB87SKIP27. The induction of APOB87SKIP27 expression in vivo should lead to decreased LDL and cholesterol levels, by analogy to patients with hypobetalipoproteinemia. As intestinal APOB mRNA editing and APOB48 expression rely on sequences within exon 26, exon 27 skipping should not affect APOB48 expression unlike other methods of down-regulating APOB100 expression which also down-regulate APOB48.

Downregulation of spinal glutamate transporter EAAC1 following nerve injury is regulated by central glucocorticoid receptors in rats.

PubMed

Wang, Shuxing; Lim, Grewo; Yang, Liling; Sung, Backil; Mao, Jianren

2006-01-01

Previous studies have shown that glucocorticoid receptors (GR) were upregulated, whereas glutamate transporters were downregulated, within the spinal cord dorsal horn after peripheral nerve injury. However, the relationship between the expression of spinal GR and glutamate transporter after nerve injury remains unknown. In the present study, we examined the hypothesis that central GR would regulate the expression of spinal glutamate transporter EAAC1 following chronic constriction nerve injury (CCI) in rats. CCI induced a significant downregulation of EAAC1 expression primarily within the ipsilateral spinal cord dorsal horn when examined on postoperative day 7 using both Western blot and immunohistochemistry. The downregulation of EAAC1 was significantly diminished after either the GR antagonist RU38486 (4 > 2 = 0.5 microg = vehicle) or a GR antisense oligonucleotide was administered intrathecally twice daily for postoperative day 1-6. Moreover, CCI induced a significant downregulation of nuclear factor kappaB (NF-kappaB) within the ipsilateral spinal cord dorsal horn, which also was attenuated by either RU38486 (4 > 2 = 0.5 microg = vehicle) or a GR antisense oligonucleotide. The immunohistochemical data indicated a pattern of colocalization between GR and EAAC1 as well as GR and NF-kappaB within the spinal cord dorsal horn. Since, NF-kappaB has been shown to regulate the expression of those cellular elements linked to inflammation and tissue injury and its activity can be negatively regulated by GR activation, these results suggest that spinal GR through NF-kappaB may play a significant role in the regulation of EAAC1 expression after peripheral nerve injury, a cellular pathway that may contribute to the development of neuropathic pain behaviors in rats.

Neurite differentiation is modulated in neuroblastoma cells engineered for altered acetylcholinesterase expression.

PubMed

Koenigsberger, C; Chiappa, S; Brimijoin, S

1997-10-01

Previous observations from several groups suggest that acetylcholinesterase (AChE) may have a role in neural morphogenesis, but not solely by virtue of its ability to hydrolyze acetylcholine. We tested the possibility that AChE influences neurite outgrowth in nonenzymatic ways. With this aim, antisense oligonucleotides were used to decrease AChE levels transiently, and N1E.115 cell lines were engineered for permanently altered AChE protein expression. Cells stably transfected with a sense AChE cDNA construct increased their AChE expression 2.5-fold over the wild type and displayed significantly increased neurite outgrowth. Levels of the differentiation marker, tau, also rose. In contrast, AChE expression in cell lines containing an antisense construct was half of that observed in the wild type. Significant reductions in neurite outgrowth and tau protein accompanied this effect. Overall, these measures correlated statistically with the AChE level (p < 0.01). Furthermore, treatment of AChE-overexpressing cells with a polyclonal antibody against AChE decreased neurite outgrowth by 43%. We conclude that AChE may have a novel, noncholinergic role in neuronal differentiation.

Targeting mRNA for the treatment of facioscapulohumeral muscular dystrophy

PubMed Central

Bao, Bo; Maruyama, Rika; Yokota, Toshifumi

2016-01-01

Summary Facioscapulohumeral muscular dystrophy (FSHD) is an inherited autosomal dominant disorder characterized clinically by progressive muscle degeneration. Currently, no curative treatment for this disorder exists. FSHD patients are managed through physiotherapy to improve function and quality of life. Over the last two decades, FSHD has been better understood as a disease genetically characterized by a pathogenic contraction of a subset of macrosatellite repeats on chromosome 4. Specifically, several studies support an FSHD pathogenesis model involving the aberrant expression of the double homeobox protein 4 (DUX4) gene. Hence, potential therapies revolving around inhibition of DUX4 have been explored. One of the potential treatment options is the use of effective antisense oligonucleotides (AOs) to knockdown expression of the myopathic DUX4 gene and its downstream molecules including paired-like homeodomain transcription factor 1 (PITX1). Success in the suppression of PITX1 expression has already been demonstrated systemically in vivo in recent studies. In this article, we will review the pathogenesis of FSHD and the latest research involving the use of antisense knockdown therapy. PMID:27672539

Isolation of a complementary DNA clone for the human complement protein C2 and its use in the identification of a restriction fragment length polymorphism.

PubMed Central

Woods, D E; Edge, M D; Colten, H R

1984-01-01

Complementary DNA (cDNA) clones corresponding to the major histocompatibility (MHC) class III antigen, complement protein C2, have been isolated from human liver cDNA libraries with the use of a complex mixture of synthetic oligonucleotides (17 mer) that contains 576 different oligonucleotide sequences. The C2 cDNA were used to identify a DNA restriction enzyme fragment length polymorphism that provides a genetic marker within the MHC that was not detectable at the protein level. An extensive search for genomic polymorphisms using a cDNA clone for another MHC class III gene, factor B, failed to reveal any DNA variants. The genomic variants detected with the C2 cDNA probe provide an additional genetic marker for analysis of MHC-linked diseases. Images PMID:6086718

Chimeric RNase H–Competent Oligonucleotides Directed to the HIV-1 Rev Response Element

PubMed Central

Prater, Chrissy E.; Saleh, Anthony D.; Wear, Maggie P.; Miller, Paul S.

2007-01-01

Chimeric oligo-2′-O-methylribonucleotides containing centrally located patches of contiguous 2′-deoxyribonucleotides and terminating in a nuclease resistant 3′-methylphosphonate internucleotide linkage were prepared. The oligonucleotides were targeted to the 3′-side of HIV Rev response element (RRE) stem-loop IIB RNA, which is adjacent to the high affinity Rev protein binding site and is critical to virus function. Thermal denaturation experiments showed that chimeric oligonucleotides form very stable duplexes with a complementary single-stranded RNA, and gel electrophoretic mobility shift assays (EMSA) showed that they bind with high affinity and specificity to RRE stem-loop II RNA (KD approximately 200 nM). The chimeric oligonucleotides promote RNase H-mediated hydrolysis of RRE stem-loop II RNA and have half lives exceeding 24 h when incubated in cell culture medium containing 10% fetal calf serum. One of the chimeric oligonucleotides inhibited RRE mediated expression of chloramphenicol acetyl transferase (CAT) approximately 60% at a concentration of 300 nM in HEK 293T cells co-transfected with p-RRE/CAT and p-Rev mammalian expression vectors. PMID:17566743

Oligonucleotide-Gold Nanoparticle Networks for Detection of Cryptosporidium parvum Heat Shock Protein 70 mRNA ▿

PubMed Central

Javier, David J.; Castellanos-Gonzalez, Alejandro; Weigum, Shannon E.; White, A. Clinton; Richards-Kortum, Rebecca

2009-01-01

We report on a novel strategy for the detection of mRNA targets derived from Cryptosporidium parvum oocysts by the use of oligonucleotide-gold nanoparticles. Gold nanoparticles are functionalized with oligonucleotides which are complementary to unique sequences present on the heat shock protein 70 (HSP70) DNA/RNA target. The results indicate that the presence of HPS70 targets of increasing complexity causes the formation of oligonucleotide-gold nanoparticle networks which can be visually monitored via a simple colorimetric readout measured by a total internal reflection imaging setup. Furthermore, the induced expression of HSP70 mRNA in Cryptosporidium parvum oocysts via a simple heat shock process provides nonenzymatic amplification such that the HSP70 mRNA derived from as few as 5 × 103 purified C. parvum oocysts was successfully detected. Taken together, these results support the use of oligonucleotide-gold nanoparticles for the molecular diagnosis of cryptosporidiosis, offering new opportunities for the further development of point-of-care diagnostic assays with low-cost, robust reagents and simple colorimetric detection. PMID:19828740

Two Case Studies in the Scientific Method: Antisense Experiments and HIV Vaccination Studies.

ERIC Educational Resources Information Center

Guilfoile, Patrick

1999-01-01

Presents two recent cases that can be used in the classroom to illustrate the application of scientific methods in biological research: (1) the use of a complementary RNA or DNA molecule to block the production or translation of an mRNA molecule; and (2) the development of HIV trial vaccines. Contains 20 references. (WRM)

Biorecognition by DNA oligonucleotides after Exposure to Photoresists and Resist Removers

PubMed Central

Dean, Stacey L.; Morrow, Thomas J.; Patrick, Sue; Li, Mingwei; Clawson, Gary; Mayer, Theresa S.; Keating, Christine D.

2013-01-01

Combining biological molecules with integrated circuit technology is of considerable interest for next generation sensors and biomedical devices. Current lithographic microfabrication methods, however, were developed for compatibility with silicon technology rather than bioorganic molecules and consequently it cannot be assumed that biomolecules will remain attached and intact during on-chip processing. Here, we evaluate the effects of three common photoresists (Microposit S1800 series, PMGI SF6, and Megaposit SPR 3012) and two photoresist removers (acetone and 1165 remover) on the ability of surface-immobilized DNA oligonucleotides to selectively recognize their reverse-complementary sequence. Two common DNA immobilization methods were compared: adsorption of 5′-thiolated sequences directly to gold nanowires and covalent attachment of 5′-thiolated sequences to surface amines on silica coated nanowires. We found that acetone had deleterious effects on selective hybridization as compared to 1165 remover, presumably due to incomplete resist removal. Use of the PMGI photoresist, which involves a high temperature bake step, was detrimental to the later performance of nanowire-bound DNA in hybridization assays, especially for DNA attached via thiol adsorption. The other three photoresists did not substantially degrade DNA binding capacity or selectivity for complementary DNA sequences. To determine if the lithographic steps caused more subtle damage, we also tested oligonucleotides containing a single base mismatch. Finally, a two-step photolithographic process was developed and used in combination with dielectrophoretic nanowire assembly to produce an array of doubly-contacted, electrically isolated individual nanowire components on a chip. Post-fabrication fluorescence imaging indicated that nanowire-bound DNA was present and able to selectively bind complementary strands. PMID:23952639

Use of synthetic oligonucleotide DNA probes for the identification of Bacteroides gingivalis.

PubMed Central

Moncla, B J; Braham, P; Dix, K; Watanabe, S; Schwartz, D

1990-01-01

Six different oligonucleotide probes complementary to the hypervariable regions of 16S rRNA of Bacteroides gingivalis were tested for specificity and sensitivity against 77 field strains of B. gingivalis and 105 strains of 12 other Bacteroides species. The data demonstrated that these probes were very specific (range, 0.85 to 1.00) and sensitive (1.00). Some limited cross-reactions with other Bacteroides species were observed. Four of these probes should be useful for rapid detection and identification of B. gingivalis. Images PMID:1690217

Poly(ester amine) Composed of Polyethylenimine and Pluronic Enhance Delivery of Antisense Oligonucleotides In Vitro and in Dystrophic mdx Mice

PubMed Central

Wang, Mingxing; Wu, Bo; Tucker, Jason D; Bollinger, Lauren E; Lu, Peijuan; Lu, Qilong

2016-01-01

A series of poly(esteramine)s (PEAs) constructed from low molecular weight polyethyleneimine (LPEI) and Pluronic were evaluated for the delivery of antisense oligonuclotides (AOs), 2′-O-methyl phosphorothioate RNA (2′-OMePS) and phosphorodiamidate morpholino oligomer (PMO) in cell culture and dystrophic mdx mice. Improved exon-skipping efficiency of both 2′-OMePS and PMO was observed in the C2C12E50 cell line with all PEA polymers compared with PEI 25k or LF-2k. The degree of efficiency was found in the order of PEA 01, PEA 04 > PEA 05 > others. The in vivo study in mdx mice demonstrated enhanced exon-skipping of 2′-OMePS with the order of PEA 06 > PEA 04, PEA 07 > PEA 03 > PEA 01 > others, and much higher than PEI 25k formulated 2′-OMePS. Exon-skipping efficiency of PMO in formulation with the PEAs were significantly enhanced in the order of PEA 02 > PEA 10 > PEA 01, PEA 03 > PEA 05, PEA 07, PEA 08 > others, with PEA 02 reaching fourfold of Endo-porter formulated PMO. PEAs improve PMO delivery more effectively than 2′-OMePS delivery in vivo, and the systemic delivery evaluation further highlight the efficiency of PEA for PMO delivery in all skeletal muscle. The results suggest that the flexibility of PEA polymers could be explored for delivery of different AO chemistries, especially for antisense therapy. PMID:27483024

Effect of antisense oligonucleotides against cholesteryl ester transfer protein on the development of atherosclerosis in cholesterol-fed rabbits.

PubMed

Sugano, M; Makino, N; Sawada, S; Otsuka, S; Watanabe, M; Okamoto, H; Kamada, M; Mizushima, A

1998-02-27

Cholesteryl ester transfer protein (CETP) is the enzyme that facilitates the transfer of cholesteryl ester from high density lipoprotein (HDL) to apolipoprotein B (apoB)-containing lipoproteins. However, the exact role of CETP in the development of atherosclerosis has not been determined. In the present study, we examined the effect of the suppression of increased plasma CETP by intravenous injection with antisense oligodeoxynucleotides (ODNs) against CETP targeted to the liver on the development of atherosclerosis in rabbits fed a cholesterol diet. The ODNs against rabbit CETP were coupled to asialoglycoprotein (ASOR) carrier molecules, which serve as an important method to regulate liver gene expression. Twenty-two male Japanese White rabbits were used in the experiment. Eighteen animals were fed a standard rabbit chow supplemented with 0.3% cholesterol throughout the experiment for 16 weeks. At 8 weeks, they were divided into three groups (six animals in each group), among which the plasma total and HDL cholesterol concentrations did not significantly change. The control group received nothing, the sense group were injected with the sense ODNs complex, and the antisense group were injected with the antisense ODNs complex, respectively, for subsequent 8 weeks. ASOR. poly(L-lysine) ODNs complex were injected via the ear veins twice a week. Four animals were fed a standard rabbit diet for 16 weeks. The total cholesterol concentrations and the CETP mass in the animals injected with antisense ODNs were all significantly decreased in 12 and 16 weeks compared with those injected with sense ODNs and the control animals. The HDL cholesterol concentrations measured by the precipitation assay did not significantly change among the groups fed a cholesterol diet, and triglyceride concentrations did not significantly change in the four groups. However, at the end of the study, when the HDL cholesterol concentrations were measured after the isolation by ultracentrifugation and a column chromotography, they were significantly higher in the animals injected with antisense ODNs than in the animals injected with sense ODNs and in the control animals. A reduction of CETP mRNA and an increase of LDL receptor mRNA in the liver were observed in the animals injected with antisense ODNs compared with those injected with sense ODNs and the control animals. Aortic cholesterol contents and the aortic percentage lesion to total surface area were significantly lower in the animals injected with antisense ODNs than in the animals injected with sense ODNs and in the control animals. These findings showed for the first time that suppression of increased plasma CETP by the injection with antisense ODNs against CETP coupled to ASOR carrier molecules targeted to the liver could thus inhibit the atherosclerosis possibly by decreasing the plasma LDL + very low density lipoprotein (VLDL) cholesterol in cholesterol-fed rabbits.

Covalent Strategies for Targeting Messenger and Non-Coding RNAs: An Updated Review on siRNA, miRNA and antimiR Conjugates

PubMed Central

Grijalvo, Santiago; Alagia, Adele

2018-01-01

Oligonucleotide-based therapy has become an alternative to classical approaches in the search of novel therapeutics involving gene-related diseases. Several mechanisms have been described in which demonstrate the pivotal role of oligonucleotide for modulating gene expression. Antisense oligonucleotides (ASOs) and more recently siRNAs and miRNAs have made important contributions either in reducing aberrant protein levels by sequence-specific targeting messenger RNAs (mRNAs) or restoring the anomalous levels of non-coding RNAs (ncRNAs) that are involved in a good number of diseases including cancer. In addition to formulation approaches which have contributed to accelerate the presence of ASOs, siRNAs and miRNAs in clinical trials; the covalent linkage between non-viral vectors and nucleic acids has also added value and opened new perspectives to the development of promising nucleic acid-based therapeutics. This review article is mainly focused on the strategies carried out for covalently modifying siRNA and miRNA molecules. Examples involving cell-penetrating peptides (CPPs), carbohydrates, polymers, lipids and aptamers are discussed for the synthesis of siRNA conjugates whereas in the case of miRNA-based drugs, this review article makes special emphasis in using antagomiRs, locked nucleic acids (LNAs), peptide nucleic acids (PNAs) as well as nanoparticles. The biomedical applications of siRNA and miRNA conjugates are also discussed. PMID:29415514

In vitro transcription in the presence of DNA oligonucleotides can generate strong anomalous initiation sites.

PubMed

Chow, C W; Clark, M P; Rinaldo, J E; Chalkley, R

1996-03-01

In the present study, we have explored an unexpected observation in transcription initiation that is mediated by single-stranded oligonucleotides. Initially, our goal was to understand the function of different upstream regulatory elements/initiation sites in the rat xanthine dehydrogenase/oxidase (XDH/XO) promoter. We performed in vitro transcription with HeLa nuclear extracts in the presence of different double-stranded oligonucleotides against upstream elements as competitors. A new and unusual transcription initiation site was detected by primer extension. This new initiation site maps to the downstream region of the corresponding competitor. Subsequent analyses have indicated that the induction of a new transcription initiation site is anomalous which is due to the presence of a small amount of single-stranded oligonucleotide in the competitor. We found that this anomalous initiation site is insensitive to the orientation of the promoter and requires only a small amount of single-stranded oligonucleotide (< 2-fold molar excess relative to template). We surmise that a complementary interaction between the single-stranded oligonucleotide and transiently denatured promoter template may be responsible for this sequence-specific transcription initiation artifact. To study the regulation of transcription initiation by in vitro transcription approaches, we propose that one should probe the effect of removing transacting factors by adding an excess of a cognate oligonucleotide which does not bear exact sequence identity to the template.

DNA microdevice for electrochemical detection of Escherichia coli 0157:H7 molecular markers.

PubMed

Berganza, J; Olabarria, G; García, R; Verdoy, D; Rebollo, A; Arana, S

2007-04-15

An electrochemical DNA sensor based on the hybridization recognition of a single-stranded DNA (ssDNA) probe immobilized onto a gold electrode to its complementary ssDNA is presented. The DNA probe is bound on gold surface electrode by using self-assembled monolayer (SAM) technology. An optimized mixed SAM with a blocking molecule preventing the nonspecific adsorption on the electrode surface has been prepared. In this paper, a DNA biosensor is designed by means of the immobilization of a single stranded DNA probe on an electrochemical transducer surface to recognize specifically Escherichia coli (E. coli) 0157:H7 complementary target DNA sequence via cyclic voltammetry experiments. The 21 mer DNA probe including a C6 alkanethiol group at the 5' phosphate end has been synthesized to form the SAM onto the gold surface through the gold sulfur bond. The goal of this paper has been to design, characterise and optimise an electrochemical DNA sensor. In order to investigate the oligonucleotide probe immobilization and the hybridization detection, experiments with different concentration of DNA and mismatch sequences have been performed. This microdevice has demonstrated the suitability of oligonucleotide Self-assembled monolayers (SAMs) on gold as immobilization method. The DNA probes deposited on gold surface have been functional and able to detect changes in bases sequence in a 21-mer oligonucleotide.

Efficient self-assembly of DNA-functionalized fluorophores and gold nanoparticles with DNA functionalized silicon surfaces: the effect of oligomer spacers

PubMed Central

Milton, James A.; Patole, Samson; Yin, Huabing; Xiao, Qiang; Brown, Tom; Melvin, Tracy

2013-01-01

Although strategies for the immobilization of DNA oligonucleotides onto surfaces for bioanalytical and top-down bio-inspired nanobiofabrication approaches are well developed, the effect of introducing spacer molecules between the surface and the DNA oligonucleotide for the hybridization of nanoparticle–DNA conjugates has not been previously assessed in a quantitative manner. The hybridization efficiency of DNA oligonucleotides end-labelled with gold nanoparticles (1.4 or 10 nm diameter) with DNA sequences conjugated to silicon surfaces via hexaethylene glycol phosphate diester oligomer spacers (0, 1, 2, 6 oligomers) was found to be independent of spacer length. To quantify both the density of DNA strands attached to the surfaces and hybridization with the surface-attached DNA, new methodologies have been developed. Firstly, a simple approach based on fluorescence has been developed for determination of the immobilization density of DNA oligonucleotides. Secondly, an approach using mass spectrometry has been created to establish (i) the mean number of DNA oligonucleotides attached to the gold nanoparticles and (ii) the hybridization density of nanoparticle–oligonucleotide conjugates with the silicon surface–attached complementary sequence. These methods and results will be useful for application with nanosensors, the self-assembly of nanoelectronic devices and the attachment of nanoparticles to biomolecules for single-molecule biophysical studies. PMID:23361467

Spherical Nucleic Acids as Intracellular Agents for Nucleic Acid Based Therapeutics

NASA Astrophysics Data System (ADS)

Hao, Liangliang

Recent functional discoveries on the noncoding sequences of human genome and transcriptome could lead to revolutionary treatment modalities because the noncoding RNAs (ncRNAs) can be applied as therapeutic agents to manipulate disease-causing genes. To date few nucleic acid-based therapeutics have been translated into the clinic due to challenges in the delivery of the oligonucleotide agents in an effective, cell specific, and non-toxic fashion. Unmodified oligonucleotide agents are destroyed rapidly in biological fluids by enzymatic degradation and have difficulty crossing the plasma membrane without the aid of transfection reagents, which often cause inflammatory, cytotoxic, or immunogenic side effects. Spherical nucleic acids (SNAs), nanoparticles consisting of densely organized and highly oriented oligonucleotides, pose one possible solution to circumventing these problems in both the antisense and RNA interference (RNAi) pathways. The unique three dimensional architecture of SNAs protects the bioactive oligonucleotides from unspecific degradation during delivery and supports their targeting of class A scavenger receptors and endocytosis via a lipid-raft-dependent, caveolae-mediated pathway. Owing to their unique structure, SNAs are able to cross cell membranes and regulate target genes expression as a single entity, without triggering the cellular innate immune response. Herein, my thesis has focused on understanding the interactions between SNAs and cellular components and developing SNA-based nanostructures to improve therapeutic capabilities. Specifically, I developed a novel SNA-based, nanoscale agent for delivery of therapeutic oligonucleotides to manipulate microRNAs (miRNAs), the endogenous post-transcriptional gene regulators. I investigated the role of SNAs involving miRNAs in anti-cancer or anti-inflammation responses in cells and in in vivo murine disease models via systemic injection. Furthermore, I explored using different strategies to construct novel SNA-based nanomaterials with desired properties and applying targeting moieties to the SNA platform to achieve cell type specific gene regulation effects. Due to the flexibility of the SNA approach, the SNA platform can potentially be applied to many genetic disorders through tailored target specificities.

Improved silencing properties using small internally segmented interfering RNAs

PubMed Central

Bramsen, Jesper B.; Laursen, Maria B.; Damgaard, Christian K.; Lena, Suzy W.; Ravindra Babu, B.; Wengel, Jesper; Kjems, Jørgen

2007-01-01

RNA interference is mediated by small interfering RNAs (siRNAs) that upon incorporation into the RNA-induced silencing complex (RISC) can target complementary mRNA for degradation. Standard siRNA design usually feature a 19–27 base pair contiguous double-stranded region that is believed to be important for RISC incorporation. Here, we describe a novel siRNA design composed of an intact antisense strand complemented with two shorter 10–12 nt sense strands. This three-stranded construct, termed small internally segmented interfering RNA (sisiRNA), is highly functional demonstrating that an intact sense strand is not a prerequisite for RNA interference. Moreover, when using the sisiRNA design only the antisense strand is functional in activated RISC thereby completely eliminating unintended mRNA targeting by the sense strand. Interestingly, the sisiRNA design supports the function of chemically modified antisense strands, which are non-functional within the context of standard siRNA designs. This suggests that the sisiRNA design has a clear potential of improving the pharmacokinetic properties of siRNA in vivo. PMID:17726057

Renal uptake and tolerability of a 2'-O-methoxyethyl modified antisense oligonucleotide (ISIS 113715) in monkey.

PubMed

Henry, Scott P; Johnson, Mark; Zanardi, Thomas A; Fey, Robert; Auyeung, Diana; Lappin, Patrick B; Levin, Arthur A

2012-11-15

The primary target organ for uptake of systemically administered phosphorothioate oligonucleotides is the kidney cortex and the proximal tubular epithelium in particular. To determine the effect of oligonucleotide uptake on renal function, a detailed renal physiology study was performed in cynomolgus monkeys treated with 10-40 mg/kg/week ISIS 113715 for 4 weeks. The concentrations of oligonucleotide in the kidney cortex ranged from 1400 to 2600 μg/g. These concentrations were associated with histologic changes in proximal tubular epithelial cells that ranged from the appearance of cytoplasmic basophilic granules to atrophic and degenerative changes at higher concentrations. However, there were no renal functional abnormalities as determined by the typical measurements of blood urea nitrogen, serum creatinine, creatinine clearance, or urine specific gravity. Nor were there changes in glomerular filtration rate, or renal blood flow. Specific urinary markers of tubular epithelial cell damage, such as N-acetyl-glucosaminidase, and α-glutathione-s-transferase were not affected. Tubular function was further evaluated by monitoring the urinary excretion of amino acids, β(2)-microglobulin, or glucose. Renal function was challenged by administering a glucose load and by examining concentrating ability after a 4-h water deprivation. Neither challenge produced any evidence of change in renal function. The only change observed was a low incidence of increased urine protein/creatinine ratio in monkeys treated with ≥40 mg/kg/week which was rapidly reversible. Collectively, these data indicate that ISIS 113715-uptake by the proximal tubular epithelium has little or no effect on renal function at concentrations of 2600 μg/g. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

DETECTION OF DNA DAMAGE USING A FIBEROPTIC BIOSENSOR

EPA Science Inventory

A rapid and sensitive fiber optic biosensor assay for radiation-induced DNA damage is reported. For this assay, a biotin-labeled capture oligonucleotide (38 mer) was immobilized to an avidin-coated quartz fiber. Hybridization of a dye-labeled complementary sequence was observed...

In-silico analysis for RNA-interference mechanism of α-synuclein to treat Parkinson's disease.

PubMed

Seema, S; Seenivasagam, R; Hemavathi, K

2013-01-01

Parkinson's Disease (PD) causing mutations in α-synuclein gene are ALA30PRO, GLU46LYS and ALA53THR. The conformational changes in proteins with respect to all the three mutations were analysed. These were used to predict the structures of Short Interfering RNA (siRNA) antisense strand and siRNA region. The siRNA binds with the argonaute protein forming RNA Induced Silencing Complex (RISC). Then, siRNA antisense-strand was attached to RISC. The structure of dicer (RNase-III-enzyme) cleaves double-stranded RNA (dsRNA) into two siRNA-strands. Incorporation of single siRNA-strand into RISC guides to pair with the complementary α-synuclein target-messenger RNA (mRNA) thereby enabling it to cleave the target.

Heated oligonucleotide ligation assay (HOLA): an affordable single nucleotide polymorphism assay.

PubMed

Black, W C; Gorrochotegui-Escalante, N; Duteau, N M

2006-03-01

Most single nucleotide polymorphism (SNP) detection requires expensive equipment and reagents. The oligonucleotide ligation assay (OLA) is an inexpensive SNP assay that detects ligation between a biotinylated "allele-specific detector" and a 3' fluorescein-labeled "reporter" oligonucleotide. No ligation occurs unless the 3' detector nucleotide is complementary to the SNP nucleotide. The original OLA used chemical denaturation and neutralization. Heated OLA (HOLA) instead uses a thermal stable ligase and cycles of denaturing and hybridization for ligation and SNP detection. The cost per genotype is approximately US$1.25 with two-allele SNPs or approximately US$1.75 with three-allele SNPs. We illustrate the development of HOLA for SNP detection in the Early Trypsin and Abundant Trypsin loci in the mosquito Aedes aegypti (L.) and at the a-glycerophosphate dehydrogenase locus in the mosquito Anopheles gambiae s.s.

Preparation of genosensor for detection of specific DNA sequence of the hepatitis B virus

NASA Astrophysics Data System (ADS)

Honorato Castro, Ana C.; França, Erick G.; de Paula, Lucas F.; Soares, Marcia M. C. N.; Goulart, Luiz R.; Madurro, João M.; Brito-Madurro, Ana G.

2014-09-01

An electrochemical genosensor was constructed for detection of specific DNA sequence of the hepatitis B virus, based on graphite electrodes modified with poly(4-aminophenol) and incorporating a specific oligonucleotide probe. The modified electrode containing the probe was evaluated by differential pulse voltammetry, before and after incubation with the complementary oligonucleotide target. Detection was performed by monitoring oxidizable DNA bases (direct detection) or using ethidium bromide as indicator of the hybridization process (indirect detection). The device showed a detection limit for the oligonucleotide target of 2.61 nmol L-1. Indirect detection using ethidium bromide was promising in discriminating mismatches, which is a very desirable attribute for detection of disease-related point mutations. In addition, it was possible to observe differences between hybridized and non-hybridized surfaces by atomic force microscopy.

RNA-targeted therapeutics in cancer clinical trials: Current status and future directions.

PubMed

Barata, Pedro; Sood, Anil K; Hong, David S

2016-11-01

Recent advances in RNA delivery and target selection provide unprecedented opportunities for cancer treatment, especially for cancers that are particularly hard to treat with existing drugs. Small interfering RNAs, microRNAs, and antisense oligonucleotides are the most widely used strategies for silencing gene expression. In this review, we summarize how these approaches were used to develop drugs targeting RNA in human cells. Then, we review the current state of clinical trials of these agents for different types of cancer and outcomes from published data. Finally, we discuss lessons learned from completed studies and future directions for this class of drugs. Copyright © 2016 Elsevier Ltd. All rights reserved.

Transcriptome analysis by strand-specific sequencing of complementary DNA

PubMed Central

Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

2009-01-01

High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online. PMID:19620212

Transcriptome analysis by strand-specific sequencing of complementary DNA.

PubMed

Parkhomchuk, Dmitri; Borodina, Tatiana; Amstislavskiy, Vyacheslav; Banaru, Maria; Hallen, Linda; Krobitsch, Sylvia; Lehrach, Hans; Soldatov, Alexey

2009-10-01

High-throughput complementary DNA sequencing (RNA-Seq) is a powerful tool for whole-transcriptome analysis, supplying information about a transcript's expression level and structure. However, it is difficult to determine the polarity of transcripts, and therefore identify which strand is transcribed. Here, we present a simple cDNA sequencing protocol that preserves information about a transcript's direction. Using Saccharomyces cerevisiae and mouse brain transcriptomes as models, we demonstrate that knowing the transcript's orientation allows more accurate determination of the structure and expression of genes. It also helps to identify new genes and enables studying promoter-associated and antisense transcription. The transcriptional landscapes we obtained are available online.

Specific RNP capture with antisense LNA/DNA mixmers

PubMed Central

Rogell, Birgit; Fischer, Bernd; Rettel, Mandy; Krijgsveld, Jeroen; Castello, Alfredo; Hentze, Matthias W.

2017-01-01

RNA-binding proteins (RBPs) play essential roles in RNA biology, responding to cellular and environmental stimuli to regulate gene expression. Important advances have helped to determine the (near) complete repertoires of cellular RBPs. However, identification of RBPs associated with specific transcripts remains a challenge. Here, we describe “specific ribonucleoprotein (RNP) capture,” a versatile method for the determination of the proteins bound to specific transcripts in vitro and in cellular systems. Specific RNP capture uses UV irradiation to covalently stabilize protein–RNA interactions taking place at “zero distance.” Proteins bound to the target RNA are captured by hybridization with antisense locked nucleic acid (LNA)/DNA oligonucleotides covalently coupled to a magnetic resin. After stringent washing, interacting proteins are identified by quantitative mass spectrometry. Applied to in vitro extracts, specific RNP capture identifies the RBPs bound to a reporter mRNA containing the Sex-lethal (Sxl) binding motifs, revealing that the Sxl homolog sister of Sex lethal (Ssx) displays similar binding preferences. This method also revealed the repertoire of RBPs binding to 18S or 28S rRNAs in HeLa cells, including previously unknown rRNA-binding proteins. PMID:28476952

Specific RNP capture with antisense LNA/DNA mixmers.

PubMed

Rogell, Birgit; Fischer, Bernd; Rettel, Mandy; Krijgsveld, Jeroen; Castello, Alfredo; Hentze, Matthias W

2017-08-01

RNA-binding proteins (RBPs) play essential roles in RNA biology, responding to cellular and environmental stimuli to regulate gene expression. Important advances have helped to determine the (near) complete repertoires of cellular RBPs. However, identification of RBPs associated with specific transcripts remains a challenge. Here, we describe "specific ribonucleoprotein (RNP) capture," a versatile method for the determination of the proteins bound to specific transcripts in vitro and in cellular systems. Specific RNP capture uses UV irradiation to covalently stabilize protein-RNA interactions taking place at "zero distance." Proteins bound to the target RNA are captured by hybridization with antisense locked nucleic acid (LNA)/DNA oligonucleotides covalently coupled to a magnetic resin. After stringent washing, interacting proteins are identified by quantitative mass spectrometry. Applied to in vitro extracts, specific RNP capture identifies the RBPs bound to a reporter mRNA containing the Sex-lethal (Sxl) binding motifs, revealing that the Sxl homolog sister of Sex lethal (Ssx) displays similar binding preferences. This method also revealed the repertoire of RBPs binding to 18S or 28S rRNAs in HeLa cells, including previously unknown rRNA-binding proteins. © 2017 Rogell et al.; Published by Cold Spring Harbor Laboratory Press for the RNA Society.

Antisense pre-treatment increases gene therapy efficacy in dystrophic muscles.

PubMed

Peccate, Cécile; Mollard, Amédée; Le Hir, Maëva; Julien, Laura; McClorey, Graham; Jarmin, Susan; Le Heron, Anita; Dickson, George; Benkhelifa-Ziyyat, Sofia; Piétri-Rouxel, France; Wood, Matthew J; Voit, Thomas; Lorain, Stéphanie

2016-08-15

In preclinical models for Duchenne muscular dystrophy, dystrophin restoration during adeno-associated virus (AAV)-U7-mediated exon-skipping therapy was shown to decrease drastically after six months in treated muscles. This decline in efficacy is strongly correlated with the loss of the therapeutic AAV genomes, probably due to alterations of the dystrophic myofiber membranes. To improve the membrane integrity of the dystrophic myofibers at the time of AAV-U7 injection, mdx muscles were pre-treated with a single dose of the peptide-phosphorodiamidate morpholino (PPMO) antisense oligonucleotides that induced temporary dystrophin expression at the sarcolemma. The PPMO pre-treatment allowed efficient maintenance of AAV genomes in mdx muscles and enhanced the AAV-U7 therapy effect with a ten-fold increase of the protein level after 6 months. PPMO pre-treatment was also beneficial to AAV-mediated gene therapy with transfer of micro-dystrophin cDNA into muscles. Therefore, avoiding vector genome loss after AAV injection by PPMO pre-treatment would allow efficient long-term restoration of dystrophin and the use of lower and thus safer vector doses for Duchenne patients. © The Author 2016. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Effect on embryos of injection of phosphorothioate-modified oligonucleotides into pregnant mice.

PubMed

Gaudette, M F; Hampikian, G; Metelev, V; Agrawal, S; Crain, W R

1993-01-01

Phosphorothioate-modified oligonucleotides were injected into pregnant female mice to assess the effect on developing embryos. Injections were carried out during two different time periods, one when embryos were in preimplantation stages of development (about 3.5 days of development) and the other after implantation, when both a fetus and placenta are present (from days 9.5 to 11.5 of development). Three different phosphorothioate-modified oligonucleotides were injected. One, which had a sequence not present in the mouse genome, was used to ask whether nonspecific toxic or teratogenic effects on embryos result from treatment of the mother. A second was complementary to the mRNA of the testis-determining factor gene Sry and was used to ask whether a specific developmental pathway (i.e., sex determination) could be disrupted in embryos in vivo. The third was the complement of the anti-Sry sequence. None of these oligonucleotides reduced the frequency of successful pregnancy after mating or the average litter size from that observed in controls animals. Furthermore, examination of 291 pups or fetuses from all oligonucleotide-injected pregnant females revealed no developmental defects regardless of which sequence was used. It is concluded that injection of phosphorothioate-modified oligonucleotides into pregnant females according to the protocols described here is not toxic or teratogenic to embryos in a nonspecific way. Also, anti-Sry oligonucleotides did not influence sex determination in embryos, although there are several possible explanations for this.

Detection of target-probe oligonucleotide hybridization using synthetic nanopore resistive pulse sensing.

PubMed

Booth, Marsilea Adela; Vogel, Robert; Curran, James M; Harbison, SallyAnn; Travas-Sejdic, Jadranka

2013-07-15

Despite the plethora of DNA sensor platforms available, a portable, sensitive, selective and economic sensor able to rival current fluorescence-based techniques would find use in many applications. In this research, probe oligonucleotide-grafted particles are used to detect target DNA in solution through a resistive pulse nanopore detection technique. Using carbodiimide chemistry, functionalized probe DNA strands are attached to carboxylated dextran-based magnetic particles. Subsequent incubation with complementary target DNA yields a change in surface properties as the two DNA strands hybridize. Particle-by-particle analysis with resistive pulse sensing is performed to detect these changes. A variable pressure method allows identification of changes in the surface charge of particles. As proof-of-principle, we demonstrate that target hybridization is selectively detected at micromolar concentrations (nanomoles of target) using resistive pulse sensing, confirmed by fluorescence and phase analysis light scattering as complementary techniques. The advantages, feasibility and limitations of using resistive pulse sensing for sample analysis are discussed. Copyright © 2013 Elsevier B.V. All rights reserved.

Electrochemical DNA biosensor for detection of porcine oligonucleotides using ruthenium(II) complex as intercalator label redox

DOE Office of Scientific and Technical Information (OSTI.GOV)

Halid, Nurul Izni Abdullah; Hasbullah, Siti Aishah; Heng, Lee Yook

2014-09-03

A DNA biosensor detection of oligonucleotides via the interactions of porcine DNA with redox active complex based on the electrochemical transduction is described. A ruthenium(II) complex, [Ru(bpy){sub 2}(PIP)]{sup 2+}, (bpy = 2,2′bipyridine, PIP = 2-phenylimidazo[4,5-f[[1,10-phenanthroline]) as DNA label has been synthesized and characterized by 1H NMR and mass spectra. The study was carried out by covalent bonding immobilization of porcine aminated DNA probes sequences on screen printed electrode (SPE) modified with succinimide-acrylic microspheres and [Ru(bpy){sub 2}(PIP)]{sup 2+} was used as electrochemical redox intercalator label to detect DNA hybridization event. Electrochemical detection was performed by cyclic voltammetry (CV) and differential pulsemore » voltammetry (DPV) over the potential range where the ruthenium (II) complex was active. The results indicate that the interaction of [Ru(bpy){sub 2}(PIP)]{sup 2+} with hybridization complementary DNA has higher response compared to single-stranded and mismatch complementary DNA.« less

Liver as a target for oligonucleotide therapeutics.

PubMed

Sehgal, Alfica; Vaishnaw, Akshay; Fitzgerald, Kevin

2013-12-01

Oligonucleotide-based therapeutics are an emerging class of drugs that hold the promise for silencing "un-druggable" targets,thus creating unique opportunities for innovative medicines. As opposed to gene therapy, oligonucleotides are considered to be more akin to small molecule therapeutics because they are small,completely synthetic in origin, do not integrate into the host genome,and have a defined duration of therapeutic activity after which effects recover to baseline. They offer a high degree of specificity at the genetic level, thereby reducing off-target effects.At the same time, they provide a strategy for targeting any gene in the genome, including transcripts that produce mutated proteins.Oligonucleotide-based therapeutics include short interfering RNA (siRNA), that degrade target mRNA through RISC mediated RNAi; anti-miRs, that target miRNAs; miRNA mimics, that regulate target mRNA; antisense oligonucleotides, that may be working through RNAseH mediated mRNA decay; mRNA upregulation,by targeting long non-coding RNAs; and oligonucleotides induced alternative splicing [1]. All these approaches require some minimal degree of homology at the nucleic acid sequence level for them to be functional. The different mechanisms of action and their relevant activity are outlined in Fig. 1. Besides homology,RNA secondary structure has also been exploited in the case of ribozymes and aptamers, which act by binding to nucleic acids or proteins, respectively. While there have been many reports of gene knockdown and gene modulation in cell lines and mice with all these methods, very few have advanced to clinical stages.The main obstacle to date has been the safe and effective intracellular delivery of these compounds in higher species, including humans. Indeed, their action requires direct interaction with DNA/RNA within the target cell so even when one solves the issues of tissue and cellular access, intracellular/intranuclear location represents yet another barrier to overcome. To date,hepatic delivery of oligonucleotides has been the area with greatest progress, and thus we have focused on liver-targeted therapeutics that have shown promise at the preclinical and/or clinical level.The liver is the largest internal organ in the body, playing a central role in metabolism, detoxification, synthesis, and secretion of major plasma proteins (carrier proteins, coagulation factors,complement components, hormones, and apolipoproteins),and iron homeostasis. It is therefore not surprising that a large number of disease targets reside in the liver where they are susceptible to modulation by oligonucleotide therapies.

Antisense inhibition of apoB synthesis with mipomersen reduces plasma apoC-III and apoC-III-containing lipoproteins.

PubMed

Furtado, Jeremy D; Wedel, Mark K; Sacks, Frank M

2012-04-01

Mipomersen, an antisense oligonucleotide that reduces hepatic production of apoB, has been shown in phase 2 studies to decrease plasma apoB, LDL cholesterol (LDL-C), and triglycerides. ApoC-III inhibits VLDL and LDL clearance, and it stimulates inflammatory responses in vascular cells. Concentrations of VLDL or LDL with apoC-III independently predict cardiovascular disease. We performed an exploratory posthoc analysis on a subset of hypercholesterolemic subjects obtained from a randomized controlled dose-ranging phase 2 study of mipomersen receiving 100, 200, or 300 mg/wk, or placebo for 13 wk (n = 8 each). ApoC-III-containing lipoproteins were isolated by immuno-affinity chromatography and ultracentrifugation. Mipomersen 200 and 300 mg/wk reduced total apoC-III from baseline by 6 mg/dl (38-42%) compared with placebo group (P < 0.01), and it reduced apoC-III in both apoB lipoproteins and HDL. Mipomersen 100, 200, and 300 mg doses reduced apoB concentration of LDL with apoC-III (27%, 38%, and 46%; P < 0.05). Mipomersen reduced apoC-III concentration in HDL. The drug had no effect on apoE concentration in total plasma and in apoB lipoproteins. In summary, antisense inhibition of apoB synthesis reduced plasma concentrations of apoC-III and apoC-III-containing lipoproteins. Lower concentrations of apoC-III and LDL with apoC-III are associated with reduced risk of coronary heart disease (CHD) in epidemiologic studies independent of traditional risk factors.

Antisense inhibition of apoB synthesis with mipomersen reduces plasma apoC-III and apoC-III-containing lipoproteins

PubMed Central

Furtado, Jeremy D.; Wedel, Mark K.; Sacks, Frank M.

2012-01-01

Mipomersen, an antisense oligonucleotide that reduces hepatic production of apoB, has been shown in phase 2 studies to decrease plasma apoB, LDL cholesterol (LDL-C), and triglycerides. ApoC-III inhibits VLDL and LDL clearance, and it stimulates inflammatory responses in vascular cells. Concentrations of VLDL or LDL with apoC-III independently predict cardiovascular disease. We performed an exploratory posthoc analysis on a subset of hypercholesterolemic subjects obtained from a randomized controlled dose-ranging phase 2 study of mipomersen receiving 100, 200, or 300 mg/wk, or placebo for 13 wk (n = 8 each). ApoC-III–containing lipoproteins were isolated by immuno-affinity chromatography and ultracentrifugation. Mipomersen 200 and 300 mg/wk reduced total apoC-III from baseline by 6 mg/dl (38–42%) compared with placebo group (P < 0.01), and it reduced apoC-III in both apoB lipoproteins and HDL. Mipomersen 100, 200, and 300 mg doses reduced apoB concentration of LDL with apoC-III (27%, 38%, and 46%; P < 0.05). Mipomersen reduced apoC-III concentration in HDL. The drug had no effect on apoE concentration in total plasma and in apoB lipoproteins. In summary, antisense inhibition of apoB synthesis reduced plasma concentrations of apoC-III and apoC-III–containing lipoproteins. Lower concentrations of apoC-III and LDL with apoC-III are associated with reduced risk of coronary heart disease (CHD) in epidemiologic studies independent of traditional risk factors. PMID:22301884

DNA-binding and oxidative properties of cationic phthalocyanines and their dimeric complexes with anionic phthalocyanines covalently linked to oligonucleotides.

PubMed

Kuznetsova, A A; Lukyanets, E A; Solovyeva, L I; Knorre, D G; Fedorova, O S

2008-12-01

Design of chemically modified oligonucleotides for regulation of gene expression has attracted considerable attention over the past decades. One actively pursued approach involves antisense or antigene oligonucleotide constructs carrying reactive groups, many of these based on transition metal complexes. The complexes of Fe(II) and Co(II) with phthalocyanines are extremely good catalysts of oxidation of organic compounds with molecular oxygen and hydrogen peroxide. The binding of positively charged Fe(II) and Co(II) phthalocyanines with single- and double-stranded DNA was investigated. It was shown that these phthalocyanines interact with nucleic acids through an outside binding mode. The site-directed modification of single-stranded DNA by O2 and H2O2 in the presence of dimeric complexes of negatively and positively charged Fe(II) and Co(II) phthalocyanines was investigated. These complexes were formed directly on single-stranded DNA through interaction between negatively charged phthalocyanine in conjugate and positively charged phthalocyanine in solution. The resulting oppositely charged phthalocyanine complexes showed significant increase of catalytic activity compared with monomeric forms of phthalocyanines Fe(II) and Co(II). These complexes catalyzed the DNA oxidation with high efficacy and led to direct DNA strand cleavage. It was determined that oxidation of DNA by molecular oxygen catalyzed by complex of Fe(II)-phthalocyanines proceeds with higher rate than in the case of Co(II)-phthalocyanines but the latter led to a greater extent of target DNA modification.

The field effect transistor DNA biosensor based on ITO nanowires in label-free hepatitis B virus detecting compatible with CMOS technology.

PubMed

Shariati, Mohsen

2018-05-15

In this paper the field-effect transistor DNA biosensor for detecting hepatitis B virus (HBV) based on indium tin oxide nanowires (ITO NWs) in label free approach has been fabricated. Because of ITO nanowires intensive conductance and functional modified surface, the probe immobilization and target hybridization were increased strongly. The high resolution transmission electron microscopy (HRTEM) measurement showed that ITO nanowires were crystalline and less than 50nm in diameter. The single-stranded hepatitis B virus DNA (SS-DNA) was immobilized as probe on the Au-modified nanowires. The DNA targets were measured in a linear concentration range from 1fM to 10µM. The detection limit of the DNA biosensor was about 1fM. The time of the hybridization process for defined single strand was 90min. The switching ratio of the biosensor between "on" and "off" state was ~ 1.1 × 10 5 . For sensing the specificity of the biosensor, non-complementary, mismatch and complementary DNA oligonucleotide sequences were clearly discriminated. The HBV biosensor confirmed the highly satisfied specificity for differentiating complementary sequences from non-complementary and the mismatch oligonucleotides. The response time of the DNA sensor was 37s with a high reproducibility. The stability and repeatability of the DNA biosensor showed that the peak current of the biosensor retained 98% and 96% of its initial response for measurements after three and five weeks, respectively. Copyright © 2018 Elsevier B.V. All rights reserved.

A Single Molecular Beacon Probe Is Sufficient for the Analysis of Multiple Nucleic Acid Sequences

PubMed Central

Gerasimova, Yulia V.; Hayson, Aaron; Ballantyne, Jack; Kolpashchikov, Dmitry M.

2010-01-01

Molecular beacon (MB) probes are dual-labeled hairpin-shaped oligodeoxyribonucleotides that are extensively used for real-time detection of specific RNA/DNA analytes. In the MB probe, the loop fragment is complementary to the analyte: therefore, a unique probe is required for the analysis of each new analyte sequence. The conjugation of an oligonucleotide with two dyes and subsequent purification procedures add to the cost of MB probes, thus reducing their application in multiplex formats. Here we demonstrate how one MB probe can be used for the analysis of an arbitrary nucleic acid. The approach takes advantage of two oligonucleotide adaptor strands, each of which contains a fragment complementary to the analyte and a fragment complementary to an MB probe. The presence of the analyte leads to association of MB probe and the two DNA strands in quadripartite complex. The MB probe fluorescently reports the formation of this complex. In this design, the MB does not bind the analyte directly; therefore, the MB sequence is independent of the analyte. In this study one universal MB probe was used to genotype three human polymorphic sites. This approach promises to reduce the cost of multiplex real-time assays and improve the accuracy of single-nucleotide polymorphism genotyping. PMID:20665615

Genomic analysis of wig-1 pathways.

PubMed

Sedaghat, Yalda; Mazur, Curt; Sabripour, Mahyar; Hung, Gene; Monia, Brett P

2012-01-01

Wig-1 is a transcription factor regulated by p53 that can interact with hnRNP A2/B1, RNA Helicase A, and dsRNAs, which plays an important role in RNA and protein stabilization. in vitro studies have shown that wig-1 binds p53 mRNA and stabilizes it by protecting it from deadenylation. Furthermore, p53 has been implicated as a causal factor in neurodegenerative diseases based in part on its selective regulatory function on gene expression, including genes which, in turn, also possess regulatory functions on gene expression. In this study we focused on the wig-1 transcription factor as a downstream p53 regulated gene and characterized the effects of wig-1 down regulation on gene expression in mouse liver and brain. Antisense oligonucleotides (ASOs) were identified that specifically target mouse wig-1 mRNA and produce a dose-dependent reduction in wig-1 mRNA levels in cell culture. These wig-1 ASOs produced marked reductions in wig-1 levels in liver following intraperitoneal administration and in brain tissue following ASO administration through a single striatal bolus injection in FVB and BACHD mice. Wig-1 suppression was well tolerated and resulted in the reduction of mutant Htt protein levels in BACHD mouse brain but had no effect on normal Htt protein levels nor p53 mRNA or protein levels. Expression microarray analysis was employed to determine the effects of wig-1 suppression on genome-wide expression in mouse liver and brain. Reduction of wig-1 caused both down regulation and up regulation of several genes, and a number of wig-1 regulated genes were identified that potentially links wig-1 various signaling pathways and diseases. Antisense oligonucleotides can effectively reduce wig-1 levels in mouse liver and brain, which results in specific changes in gene expression for pathways relevant to both the nervous system and cancer.

Biological Role and Therapeutic Targeting of TGF-β3 in Glioblastoma.

PubMed

Seystahl, Katharina; Papachristodoulou, Alexandros; Burghardt, Isabel; Schneider, Hannah; Hasenbach, Kathy; Janicot, Michel; Roth, Patrick; Weller, Michael

2017-06-01

Transforming growth factor (TGF)-β contributes to the malignant phenotype of glioblastoma by promoting invasiveness and angiogenesis and creating an immunosuppressive microenvironment. So far, TGF-β 1 and TGF-β 2 isoforms have been considered to act in a similar fashion without isoform-specific function in glioblastoma. A pathogenic role for TGF-β 3 in glioblastoma has not been defined yet. Here, we studied the expression and functional role of endogenous and exogenous TGF-β 3 in glioblastoma models. TGF-β 3 mRNA is expressed in human and murine long-term glioma cell lines as well as in human glioma-initiating cell cultures with expression levels lower than TGF-β 1 or TGF-β 2 in most cell lines. Inhibition of TGF-β 3 mRNA expression by ISTH2020 or ISTH2023, two different isoform-specific phosphorothioate locked nucleic acid (LNA)-modified antisense oligonucleotide gapmers, blocks downstream SMAD2 and SMAD1/5 phosphorylation in human LN-308 cells, without affecting TGF-β 1 or TGF-β 2 mRNA expression or protein levels. Moreover, inhibition of TGF-β 3 expression reduces invasiveness in vitro Interestingly, depletion of TGF-β 3 also attenuates signaling evoked by TGF-β 1 or TGF-β 2 In orthotopic syngeneic (SMA-560) and xenograft (LN-308) in vivo glioma models, expression of TGF-β 3 as well as of the downstream target, plasminogen-activator-inhibitor (PAI)-1 , was reduced, while TGF-β 1 and TGF-β 2 levels were unaffected following systemic treatment with TGF-β 3 -specific antisense oligonucleotides. We conclude that TGF-β 3 might function as a gatekeeper controlling downstream signaling despite high expression of TGF-β 1 and TGF-β 2 isoforms. Targeting TGF-β 3 in vivo may represent a promising strategy interfering with aberrant TGF-β signaling in glioblastoma. Mol Cancer Ther; 16(6); 1177-86. ©2017 AACR . ©2017 American Association for Cancer Research.

Molecular Imaging and Pharmacokinetic Analysis of Carbon-11 Labeled Antisense Oligonucleotide LY2181308 in Cancer Patients

PubMed Central

Saleem, Azeem; Matthews, Julian C.; Ranson, Malcolm; Callies, Sophie; André, Valérie; Lahn, Michael; Dickinson, Claire; Prenant, Christian; Brown, Gavin; McMahon, Adam; Talbot, Denis C.; Jones, Terry; Price, Patricia M.

2011-01-01

Antisense oligonucleotides (ASOs) have potential as anti-cancer agents by specifically modulating genes involved in tumorigenesis. However, little is known about ASO biodistribution and tissue pharmacokinetics (PKs) in humans, including whether sufficient delivery to target tumor tissue may be achieved. In this preliminary study in human subjects, we used combined positron emission and computed tomography (PET-CT) imaging and subsequent modeling analysis of acquired dynamic data, to examine the in vivo biodistribution and PK properties of LY2181308 - a second generation ASO which targets the apoptosis inhibitor protein survivin. Following radiolabeling of LY2181308 with methylated carbon-11 ([11C]methylated-LY2181308), micro-doses (<1mg) were administered to three patients with solid tumors enrolled in a phase I trial. Moderate uptake of [11C]methylated-LY2181308 was observed in tumors (mean=32.5ng*h /mL, per mg administered intravenously). Highest uptake was seen in kidney and liver and lowest uptake was seen in lung and muscle. One patient underwent repeat analysis on day 15 of multiple dose therapy, during administration of LY2181308 (750mg), when altered tissue PKs and a favorable change in biodistribution was seen. [11C]methylated-LY2181308 exposure increased in tumor, lung and muscle, whereas renal and hepatic exposure decreased. This suggests that biological barriers to ASO tumor uptake seen at micro-doses were overcome by therapeutic dosing. In addition, 18F-labeled fluorodeoxyglucose (FDG) scans carried out in the same patient before and after treatment showed up to 40% decreased tumor metabolism. For the development of anti-cancer ASOs, the results provide evidence of LY2181308 tumor tissue delivery and add valuable in vivo pharmacological information. For the development of novel therapeutic agents in general, the study exemplifies the merits of applying PET imaging methodology early in clinical investigations. PMID:21772926

Trastuzumab down-regulates Bcl-2 expression and potentiates apoptosis induction by Bcl-2/Bcl-XL bispecific antisense oligonucleotides in HER-2 gene--amplified breast cancer cells.

PubMed

Milella, Michele; Trisciuoglio, Daniela; Bruno, Tiziana; Ciuffreda, Ludovica; Mottolese, Marcella; Cianciulli, Anna; Cognetti, Francesco; Zangemeister-Wittke, Uwe; Del Bufalo, Donatella; Zupi, Gabriella

2004-11-15

To investigate the possible existence of an antiapoptotic cross-talk between HER-2 and antiapoptotic Bcl-2 family members. Bcl-2 and Bcl-XL expression and apoptosis induction were analyzed in HER-2 gene-amplified (BT474) and nonamplified (ZR 75-1) breast cancer cell lines exposed to trastuzumab, alone or in combination with either Bcl-2/Bcl-XL bispecific antisense oligonucleotides (AS-4625) or the small-molecule Bcl-2 antagonist HA14-1. In addition to HER-2 and epidermal growth factor receptor, trastuzumab down-regulated Bcl-2, but not Bcl-XL, protein, and mRNA expression in BT474 cells. Interestingly, trastuzumab-induced down-regulation of HER-2 and Bcl-2 was also observed in three of five and two of three breast cancer patients undergoing trastuzumab treatment, respectively. Despite Bcl-2 down-regulation, however, trastuzumab only marginally increased the rate of apoptosis (7.3 +/- 3.5%). We therefore investigated whether a combination of AS-4625 and trastuzumab might increase proapoptotic efficiency. AS-4625 treatment of BT474 cells decreased both Bcl-2 and Bcl-XL expression, resulting in a 21 +/- 7% net apoptosis induction; the combination of AS-4625 followed by trastuzumab resulted in a significantly stronger induction of apoptosis (37 +/- 6%, P <0.01) that was not observed with the reverse treatment sequence (trastuzumab followed by AS-4625). Similar results were obtained with the Bcl-2 antagonist HA14-1; indeed, exposure of BT474 cells to HA14-1 followed by trastuzumab resulted in a striking proapoptotic synergism (combination index=0.58 +/- 0.18), as assessed by isobologram analysis. Altogether our findings suggest that combined targeting of HER-2 and Bcl-2 may represent a novel, rational approach to more effective breast cancer therapy.

Genomic Analysis of wig-1 Pathways

PubMed Central

Sedaghat, Yalda; Mazur, Curt; Sabripour, Mahyar; Hung, Gene; Monia, Brett P.

2012-01-01

Background Wig-1 is a transcription factor regulated by p53 that can interact with hnRNP A2/B1, RNA Helicase A, and dsRNAs, which plays an important role in RNA and protein stabilization. in vitro studies have shown that wig-1 binds p53 mRNA and stabilizes it by protecting it from deadenylation. Furthermore, p53 has been implicated as a causal factor in neurodegenerative diseases based in part on its selective regulatory function on gene expression, including genes which, in turn, also possess regulatory functions on gene expression. In this study we focused on the wig-1 transcription factor as a downstream p53 regulated gene and characterized the effects of wig-1 down regulation on gene expression in mouse liver and brain. Methods and Results Antisense oligonucleotides (ASOs) were identified that specifically target mouse wig-1 mRNA and produce a dose-dependent reduction in wig-1 mRNA levels in cell culture. These wig-1 ASOs produced marked reductions in wig-1 levels in liver following intraperitoneal administration and in brain tissue following ASO administration through a single striatal bolus injection in FVB and BACHD mice. Wig-1 suppression was well tolerated and resulted in the reduction of mutant Htt protein levels in BACHD mouse brain but had no effect on normal Htt protein levels nor p53 mRNA or protein levels. Expression microarray analysis was employed to determine the effects of wig-1 suppression on genome-wide expression in mouse liver and brain. Reduction of wig-1 caused both down regulation and up regulation of several genes, and a number of wig-1 regulated genes were identified that potentially links wig-1 various signaling pathways and diseases. Conclusion Antisense oligonucleotides can effectively reduce wig-1 levels in mouse liver and brain, which results in specific changes in gene expression for pathways relevant to both the nervous system and cancer. PMID:22347364

17beta-estradiol stimulates the growth of human keratinocytes by inducing cyclin D2 expression.

PubMed

Kanda, Naoko; Watanabe, Shinichi

2004-08-01

Estrogen is reported to prevent age-associated epidermal thinning in the skin. We examined if 17beta-estradiol (E2) may enhance the growth of human keratinocytes, focusing on its effects on the expression of cell cycle-regulatory proteins. E2 enhanced proliferation, bromodeoxyuridine incorporation of keratinocytes, and increased the proportion of cells in the S phase. The E2-induced stimulation of proliferation and bromodeoxyuridine incorporation was suppressed by antisense oligonucleotide against cyclin D2, which induces G1 to S phase progression. E2 increased protein and mRNA levels of cyclin D2, and resultantly enhanced assembly and kinase activities of cyclin D2-cyclin-dependent kinases 4 or 6 complexes. E2 enhanced cyclin D2 promoter activity, and the element homologous to cAMP response element (CRE) on the promoter was responsible for the effect. Cyclin D2 expression was enhanced by antiestrogens, ICI 182,780 and 4-hydroxytamoxifen, and membrane-impermeable bovine serum albumin-conjugated E2, indicating the effects via membrane E2-binding sites. E2 increased the enhancer activity of CRE-like element and the amount of phosphorylated cAMP response element binding protein (CREB) binding this element, and the increases were suppressed by H-89, an inhibitor of cAMP-dependent protein kinase A. H-89 also suppressed E2-induced cyclin D2 expression, proliferation, and bromodeoxyuridine incorporation in keratinocytes. Antisense oligonucleotide against G-protein-coupled receptor GPR30 suppressed the E2-induced increases of phosphorylated CREB, cyclin D2 level, proliferation, and bromodeoxyuridine incorporation in keratinocytes. These results suggest that E2 may stimulate the growth of keratinocytes by inducing cyclin D2 expression via CREB phosphorylation by protein kinase A, dependent on cAMP. These effects of E2 may be mediated via cell surface GPR30.

Sirtuin-1 (SIRT1) Is Required for Promoting Chondrogenic Differentiation of Mesenchymal Stem Cells

PubMed Central

Buhrmann, Constanze; Busch, Franziska; Shayan, Parviz; Shakibaei, Mehdi

2014-01-01

Sirtuin-1 (SIRT1), NAD+-dependent deacetylase, has been linked to anabolic effects in cartilage, although the mechanisms of SIRT1 signaling during differentiation of mesenchymal stem cells (MSCs) to chondrocytes are poorly understood. Therefore, we investigated the role of SIRT1-mediated signaling during chondrogenic differentiation of MSCs in vitro. High density and alginate cultures of MSCs were treated with chondrogenic induction medium with/without the SIRT1 inhibitor nicotinamide, antisense oligonucleotides against SIRT1 (SIRT1-ASO), IL-1β, and/or resveratrol. Transient transfection of MSCs with SIRT1-antisense oligonucleotides, nicotinamide, and IL-1β inhibited chondrogenesis-induced down-regulation of cartilage-specific proteins, cartilage-specific transcription factor Sox9, and enhanced NF-κB-regulated gene products involved in the inflammatory and degradative processes in cartilage (MMP-9, COX-2, and caspase-3), and NF-κB phosphorylation, acetylation, and activation of IκBα kinase. In contrast, the SIRT1 activator resveratrol or BMS-345541 (inhibitor of IKK) inhibited IL-1β- and NAM-induced suppression of cartilage-specific proteins, Sox9, and up-regulation of NF-κB-regulated gene products. Moreover, SIRT1 was found to interact directly with NF-κB and resveratrol-suppressed IL-1β and NAM but not SIRT1-ASO-induced NF-κB phosphorylation, acetylation, and activation of IκBα kinase. Knockdown of SIRT1 by mRNA abolished the inhibitory effects of resveratrol on inflammatory and apoptotic signaling and Sox9 expression, suggesting the essential role of this enzyme. Finally, the modulatory effects of resveratrol were found to be mediated at least in part by the association between SIRT1 and Sox9. These results indicate for the first time that SIRT1 supports chondrogenic development of MSCs at least in part through inhibition/deacetylation of NF-κB and activation of Sox9. PMID:24962570

A locked nucleic acid antisense oligonucleotide (LNA) silences PCSK9 and enhances LDLR expression in vitro and in vivo.

PubMed

Gupta, Nidhi; Fisker, Niels; Asselin, Marie-Claude; Lindholm, Marie; Rosenbohm, Christoph; Ørum, Henrik; Elmén, Joacim; Seidah, Nabil G; Straarup, Ellen Marie

2010-05-17

The proprotein convertase subtilisin/kexin type 9 (PCSK9) is an important factor in the etiology of familial hypercholesterolemia (FH) and is also an attractive therapeutic target to reduce low density lipoprotein (LDL) cholesterol. PCSK9 accelerates the degradation of hepatic low density lipoprotein receptor (LDLR) and low levels of hepatic PCSK9 activity are associated with reduced levels of circulating LDL-cholesterol. The present study presents the first evidence for the efficacy of a locked nucleic acid (LNA) antisense oligonucleotide (LNA ASO) that targets both human and mouse PCSK9. We employed human hepatocytes derived cell lines HepG2 and HuH7 and a pancreatic mouse beta-TC3 cell line known to express high endogenous levels of PCSK9. LNA ASO efficiently reduced the mRNA and protein levels of PCSK9 with a concomitant increase in LDLR protein levels after transfection in these cells. In vivo efficacy of LNA ASO was further investigated in mice by tail vein intravenous administration of LNA ASO in saline solution. The level of PCSK9 mRNA was reduced by approximately 60%, an effect lasting more than 16 days. Hepatic LDLR protein levels were significantly up-regulated by 2.5-3 folds for at least 8 days and approximately 2 fold for 16 days. Finally, measurement of liver alanine aminotransferase (ALT) levels revealed that long term LNA ASO treatment (7 weeks) does not cause hepatotoxicity. LNA-mediated PCSK9 mRNA inhibition displayed potent reduction of PCSK9 in cell lines and mouse liver. Our data clearly revealed the efficacy and safety of LNA ASO in reducing PCSK9 levels, an approach that is now ready for testing in primates. The major significance and take home message of this work is the development of a novel and promising approach for human therapeutic intervention of the PCSK9 pathway and hence for reducing some of the cardiovascular risk factors associated with the metabolic syndrome.

MicroRNA-9 Inhibits NLRP3 Inflammasome Activation in Human Atherosclerosis Inflammation Cell Models through the JAK1/STAT Signaling Pathway.

PubMed

Wang, Yue; Han, Zhihua; Fan, Yuqi; Zhang, Junfeng; Chen, Kan; Gao, Lin; Zeng, Huasu; Cao, Jiatian; Wang, Changqian

2017-01-01

MicroRNA-9 (miR-9) is involved in inflammatory reaction in atherosclerosis; however, its function and regulatory mechanisms remain unclear. We aimed to uncover the exact roles of miR-9 and downstream signaling pathways using in vitro human atherosclerosis models. We used oxidized low-density lipoprotein (oxLDL)-stimulated human THP-1 derived macrophages, oxLDL-stimulated human primary peripheral blood monocytes and lipopolysaccharides (LPS) or Alum-stimulated human THP-1 derived macrophages as in vitro atherosclerosis inflammation models. Transient transfection of over-expression vectors, small interference RNAs (siRNAs) or antisense oligonucleotides was used to regulate intracellular protein or miR-9 levels. Cell responses and signal transduction were detected by multiple assays including Western blotting, enzyme-linked immunosorbent assay (ELISA) and luciferase reporter assay. MiR-9 inhibited while anti-miR-9 antisense oligonucleotides induced interleukin-1 beta (IL-1β) and NLRP3 inflammasome activation in all in vitro models. Janus kinase 1 (JAK1) and matrix metalloproteinase 13 (MMP-13) were identified as the target genes of miR-9. In oxLDL-stimulated human THP-1 derived macrophages, knockdown of JAK1 by siRNA blocked the phosphorylation of signal transducer and activator of transcription 1 (STAT1) and mimicked the effects of miR-9. In the same model, JAK1 knockdown blocked the phosphorylation of NF-κB p65 in the nuclei and the phosphorylation of NF-κB IκBα in the cytoplasm. Our study demonstrated that miR-9 could inhibit activation of the NLRP3 inflammasome and attenuate atherosclerosis-related inflammation, likely through the JAK1/STAT1 signaling pathway. Therefore, miR-9 may serve as a potential therapeutic target for atherosclerosis. © 2017 The Author(s)Published by S. Karger AG, Basel.

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna

2002-01-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.

Use of continuous/contiguous stacking hybridization as a diagnostic tool

DOEpatents

Mirzabekov, Andrei Darievich; Kirillov, Eugene Vladislavovich; Parinov, Sergei Valeryevich; Barski, Victor Evgenievich; Dubiley, Svetlana Alekseevna

2000-01-01

A method for detecting disease-associated alleles in patient genetic material is provided whereby a first group of oligonucleotide molecules, synthesized to compliment base sequences of the disease associated alleles is immobilized on a predetermined position on a substrate, and then contacted with patient genetic material to form duplexes. The duplexes are then contacted with a second group of oligonucleotide molecules which are synthesized to extend the predetermined length of the oligonucleotide molecules of the first group, and where each of the oligonucleotide molecules of the second group are tagged and either incorporate universal bases or a mixture of guanine, cytosine, thymine, and adenine, or complementary nucleotide strands that are tagged with a different fluorochrome which radiates light at a predetermined wavelength. The treated substrate is then washed and the light patterns radiating therefrom are compared with predetermined light patterns of various diseases that were prepared on identical substrates. A method is also provided for determining the length of a repeat sequence in DNA or RNA, and also for determining the base sequence of unknown DNA or RNA.

Targeting the r(CGG) repeats that cause FXTAS with modularly assembled small molecules and oligonucleotides.

PubMed

Tran, Tuan; Childs-Disney, Jessica L; Liu, Biao; Guan, Lirui; Rzuczek, Suzanne; Disney, Matthew D

2014-04-18

We designed small molecules that bind the structure of the RNA that causes fragile X-associated tremor ataxia syndrome (FXTAS), an incurable neuromuscular disease. FXTAS is caused by an expanded r(CGG) repeat (r(CGG)(exp)) that inactivates a protein regulator of alternative pre-mRNA splicing. Our designed compounds modulate r(CGG)(exp) toxicity in cellular models of FXTAS, and pull-down experiments confirm that they bind r(CGG)(exp) in vivo. Importantly, compound binding does not affect translation of the downstream open reading frame (ORF). We compared molecular recognition properties of our optimal compound to oligonucleotides. Studies show that r(CGG)(exp)'s self-structure is a significant energetic barrier for oligonucleotide binding. A fully modified 2'-OMethyl phosphorothioate is incapable of completely reversing an FXTAS-associated splicing defect and inhibits translation of the downstream ORF, which could have deleterious effects. Taken together, these studies suggest that a small molecule that recognizes structure may be more well suited for targeting highly structured RNAs that require strand invasion by a complementary oligonucleotide.

Targeting the r(CGG) Repeats That Cause FXTAS with Modularly Assembled Small Molecules and Oligonucleotides

PubMed Central

2015-01-01

We designed small molecules that bind the structure of the RNA that causes fragile X-associated tremor ataxia syndrome (FXTAS), an incurable neuromuscular disease. FXTAS is caused by an expanded r(CGG) repeat (r(CGG)exp) that inactivates a protein regulator of alternative pre-mRNA splicing. Our designed compounds modulate r(CGG)exp toxicity in cellular models of FXTAS, and pull-down experiments confirm that they bind r(CGG)expin vivo. Importantly, compound binding does not affect translation of the downstream open reading frame (ORF). We compared molecular recognition properties of our optimal compound to oligonucleotides. Studies show that r(CGG)exp’s self-structure is a significant energetic barrier for oligonucleotide binding. A fully modified 2′-OMethyl phosphorothioate is incapable of completely reversing an FXTAS-associated splicing defect and inhibits translation of the downstream ORF, which could have deleterious effects. Taken together, these studies suggest that a small molecule that recognizes structure may be more well suited for targeting highly structured RNAs that require strand invasion by a complementary oligonucleotide. PMID:24506227

RNA-Catalyzed RNA Ligation on an External RNA Template

NASA Technical Reports Server (NTRS)

McGinness, Kathleen E.; Joyce, Gerald F.

2002-01-01

Variants of the hc ligase ribozyme, which catalyzes ligation of the 3' end of an RNA substrate to the 5' end of the ribozyme, were utilized to evolve a ribozyme that catalyzes ligation reactions on an external RNA template. The evolved ribozyme catalyzes the joining of an oligonucleotide 3'-hydroxyl to the 5'-triphosphate of an RNA hairpin molecule. The ribozyme can also utilize various substrate sequences, demonstrating a largely sequence-independent mechanism for substrate recognition. The ribozyme also carries out the ligation of two oligonucleotides that are bound at adjacent positions on a complementary template. Finally, it catalyzes addition of mononucleoside '5-triphosphates onto the '3 end of an oligonucleotide primer in a template-dependent manner. The development of ribozymes that catalyze polymerase-type reactions contributes to the notion that an RNA world could have existed during the early history of life on Earth.

Prebiotic chemistry and nucleic acid replication

NASA Technical Reports Server (NTRS)

Orgel, L. E.; Lohrmann, R.

1974-01-01

Recent work is reviewed on some reactions that could have occurred on the primitive earth and that could have played a part in the evolution of a self-replicating system. The transition from the primitive atmosphere to the simplest replicating molecules is considered in four stages: (1) the formation of a 'prebiotic soup' of organic precursors, including the purine and pyrimidine bases and the pentose sugars; (2) the condensation of these precursors and inorganic phosphate to form monomeric nucleotides and activated nucleotide derivatives; (3) the polymerization of nucleotide derivatives to oligonucleotides; and (4) the complementary replication of oligonucleotides in a template-directed process that depends on Watson-Crick base pairing.

Identification and characterization of intracellular proteins that bind oligonucleotides with phosphorothioate linkages

PubMed Central

Liang, Xue-hai; Sun, Hong; Shen, Wen; Crooke, Stanley T.

2015-01-01

Although the RNase H-dependent mechanism of inhibition of gene expression by chemically modified antisense oligonucleotides (ASOs) has been well characterized, little is known about the interactions between ASOs and intracellular proteins that may alter cellular localization and/or potency of ASOs. Here, we report the identification of 56 intracellular ASO-binding proteins using multi-step affinity selection approaches. Many of the tested proteins had no significant effect on ASO activity; however, some proteins, including La/SSB, NPM1, ANXA2, VARS and PC4, appeared to enhance ASO activities, likely through mechanisms related to subcellular distribution. VARS and ANXA2 co-localized with ASOs in endocytic organelles, and reduction in the level of VARS altered lysosome/ASO localization patterns, implying that these proteins may facilitate ASO release from the endocytic pathway. Depletion of La and NPM1 reduced nuclear ASO levels, suggesting potential roles in ASO nuclear accumulation. On the other hand, Ku70 and Ku80 proteins inhibited ASO activity, most likely by competition with RNase H1 for ASO/RNA duplex binding. Our results demonstrate that phosphorothioate-modified ASOs bind a set of cellular proteins that affect ASO activity via different mechanisms. PMID:25712094

Antimicrobial Nanoplexes meet Model Bacterial Membranes: the key role of Cardiolipin

NASA Astrophysics Data System (ADS)

Marín-Menéndez, Alejandro; Montis, Costanza; Díaz-Calvo, Teresa; Carta, Davide; Hatzixanthis, Kostas; Morris, Christopher J.; McArthur, Michael; Berti, Debora

2017-01-01

Antimicrobial resistance to traditional antibiotics is a crucial challenge of medical research. Oligonucleotide therapeutics, such as antisense or Transcription Factor Decoys (TFDs), have the potential to circumvent current resistance mechanisms by acting on novel targets. However, their full translation into clinical application requires efficient delivery strategies and fundamental comprehension of their interaction with target bacterial cells. To address these points, we employed a novel cationic bolaamphiphile that binds TFDs with high affinity to form self-assembled complexes (nanoplexes). Confocal microscopy revealed that nanoplexes efficiently transfect bacterial cells, consistently with biological efficacy on animal models. To understand the factors affecting the delivery process, liposomes with varying compositions, taken as model synthetic bilayers, were challenged with nanoplexes and investigated with Scattering and Fluorescence techniques. Thanks to the combination of results on bacteria and synthetic membrane models we demonstrate for the first time that the prokaryotic-enriched anionic lipid Cardiolipin (CL) plays a key-role in the TFDs delivery to bacteria. Moreover, we can hypothesize an overall TFD delivery mechanism, where bacterial membrane reorganization with permeability increase and release of the TFD from the nanoplexes are the main factors. These results will be of great benefit to boost the development of oligonucleotides-based antimicrobials of superior efficacy.

Therapeutic NOTCH3 cysteine correction in CADASIL using exon skipping: in vitro proof of concept.

PubMed

Rutten, Julie W; Dauwerse, Hans G; Peters, Dorien J M; Goldfarb, Andrew; Venselaar, Hanka; Haffner, Christof; van Ommen, Gert-Jan B; Aartsma-Rus, Annemieke M; Lesnik Oberstein, Saskia A J

2016-04-01

Cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy, or CADASIL, is a hereditary cerebral small vessel disease caused by characteristic cysteine altering missense mutations in the NOTCH3 gene. NOTCH3 mutations in CADASIL result in an uneven number of cysteine residues in one of the 34 epidermal growth factor like-repeat (EGFr) domains of the NOTCH3 protein. The consequence of an unpaired cysteine residue in an EGFr domain is an increased multimerization tendency of mutant NOTCH3, leading to toxic accumulation of the protein in the (cerebro)vasculature, and ultimately reduced cerebral blood flow, recurrent stroke and vascular dementia. There is no therapy to delay or alleviate symptoms in CADASIL. We hypothesized that exclusion of the mutant EGFr domain from NOTCH3 would abolish the detrimental effect of the unpaired cysteine and thus prevent toxic NOTCH3 accumulation and the negative cascade of events leading to CADASIL. To accomplish this NOTCH3 cysteine correction by EGFr domain exclusion, we used pre-mRNA antisense-mediated skipping of specific NOTCH3 exons. Selection of these exons was achieved using in silico studies and based on the criterion that skipping of a particular exon or exon pair would modulate the protein in such a way that the mutant EGFr domain is eliminated, without otherwise corrupting NOTCH3 structure and function. Remarkably, we found that this strategy closely mimics evolutionary events, where the elimination and fusion of NOTCH EGFr domains led to the generation of four functional NOTCH homologues. We modelled a selection of exon skip strategies using cDNA constructs and show that the skip proteins retain normal protein processing, can bind ligand and be activated by ligand. We then determined the technical feasibility of targeted NOTCH3 exon skipping, by designing antisense oligonucleotides targeting exons 2-3, 4-5 and 6, which together harbour the majority of distinct CADASIL-causing mutations. Transfection of these antisense oligonucleotides into CADASIL patient-derived cerebral vascular smooth muscle cells resulted in successful exon skipping, without abrogating NOTCH3 signalling. Combined, these data provide proof of concept for this novel application of exon skipping, and are a first step towards the development of a rational therapeutic approach applicable to up to 94% of CADASIL-causing mutations. © The Author (2016). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Frodo proteins: modulators of Wnt signaling in vertebrate development.

PubMed

Brott, Barbara K; Sokol, Sergei Y

2005-09-01

The Frodo/dapper (Frd) proteins are recently discovered signaling adaptors, which functionally and physically interact with Wnt and Nodal signaling pathways during vertebrate development. The Frd1 and Frd2 genes are expressed in dynamic patterns in early embryos, frequently in cells undergoing epithelial-mesenchymal transition. The Frd proteins function in multiple developmental processes, including mesoderm and neural tissue specification, early morphogenetic cell movements, and organogenesis. Loss-of-function studies using morpholino antisense oligonucleotides demonstrate that the Frd proteins regulate Wnt signal transduction in a context-dependent manner and may be involved in Nodal signaling. The identification of Frd-associated factors and cellular targets of the Frd proteins should shed light on the molecular mechanisms underlying Frd functions in embryonic development and in cancer.

Novel Targeted Therapies for Inflammatory Bowel Disease.

PubMed

Coskun, Mehmet; Vermeire, Severine; Nielsen, Ole Haagen

2017-02-01

Our growing understanding of the immunopathogenesis of inflammatory bowel disease (IBD) has opened new avenues for developing targeted therapies. These advances in treatment options targeting different mechanisms of action offer new hope for personalized management. In this review we highlight emerging novel and easily administered therapeutics that may be viable candidates for the management of IBD, such as antibodies against interleukin 6 (IL-6) and IL-12/23, small molecules including Janus kinase inhibitors, antisense oligonucleotide against SMAD7 mRNA, and inhibitors of leukocyte trafficking to intestinal sites of inflammation (e.g., sphingosine 1-phosphate receptor modulators). We also provide an update on the current status in clinical development of these new classes of therapeutics. Copyright © 2016 Elsevier Ltd. All rights reserved.

Gene Editing and Gene-Based Therapeutics for Cardiomyopathies.

PubMed

Ohiri, Joyce C; McNally, Elizabeth M

2018-04-01

With an increasing understanding of genetic defects leading to cardiomyopathy, focus is shifting to correcting these underlying genetic defects. One approach involves treating mutant RNA through antisense oligonucleotides; the first drug has received regulatory approval to treat specific mutations associated with Duchenne muscular dystrophy. Gene editing is being evaluated in the preclinical setting. For inherited cardiomyopathies, genetic correction strategies require tight specificity for the mutant allele. Gene-editing methods are being tested to create deletions that may be useful to restore protein expression by through the bypass of mutations that restore protein production. Site-specific gene editing, which is required to correct many point mutations, is a less efficient process than inducing deletions. Copyright © 2017 Elsevier Inc. All rights reserved.

Role of Kv 4.3 in vibration-induced muscle pain in the rat

PubMed Central

Conner, Lindsay; Alvarez, Pedro; Bogen, Oliver; Levine, Jon D.

2015-01-01

We hypothesized that changes in the expression of Kv4.3 contribute to the mechanical hyperalgesia induced by vibration injury, a rodent model for hand-arm vibration syndrome in humans. Here we show that the exposure of the gastrocnemius muscle to vibration injury induces muscle hyperalgesia that is accompanied by a significant down-regulation of Kv4.3 in affected sensory nerve fibers in dorsal root ganglia (DRG). We additionally demonstrate that the intrathecal administration of antisense oligonucleotides for Kv4.3 mRNA itself induces muscle hyperalgesia in the rat. Our results suggest that attenuation in the expression of Kv4.3 may contribute to neuropathic pain in people affected by hand-arm vibration syndrome. PMID:26721612

Overcoming cellular barriers for RNA therapeutics.

PubMed

Dowdy, Steven F

2017-03-01

RNA-based therapeutics, such as small-interfering (siRNAs), microRNAs (miRNAs), antisense oligonucleotides (ASOs), aptamers, synthetic mRNAs and CRISPR-Cas9, have great potential to target a large part of the currently undruggable genes and gene products and to generate entirely new therapeutic paradigms in disease, ranging from cancer to pandemic influenza to Alzheimer's disease. However, for these RNA modalities to reach their full potential, they first need to overcome a billion years of evolutionary defenses that have kept RNAs on the outside of cells from invading the inside of cells. Overcoming the lipid bilayer to deliver RNA into cells has remained the major problem to solve for widespread development of RNA therapeutics, but recent chemistry advances have begun to penetrate this evolutionary armor.

Convergent Pathways for Steroid Hormone-and Neurotransmitter-Induced Rat Sexual Behavior

NASA Astrophysics Data System (ADS)

Mani, S. K.; Allen, J. M. C.; Clark, J. H.; Blaustein, J. D.; O'Malley, B. W.

1994-08-01

Estrogen and progesterone modulate gene expression in rodents by activation of intracellular receptors in the hypothalamus, which regulate neuronal networks that control female sexual behavior. However, the neurotransmitter dopamine has been shown to activate certain steroid receptors in a ligand-independent manner. A dopamine receptor stimulant and a D_1 receptor agonist, but not a D_2 receptor agonist, mimicked the effects of progesterone in facilitating sexual behavior in female rats. The facilitatory effect of the neurotransmitter was blocked by progesterone receptor antagonists, a D_1 receptor antagonist, or antisense oligonucleotides to the progesterone receptor. The results suggest that in rodents neurotransmitters may regulate in vivo gene expression and behavior by means of cross-talk with steroid receptors in the brain.

Identification of a novel protein for memory regulation in the hippocampus.

PubMed

Zhang, Xue-Han; Zhang, Hui; Tu, Yanyang; Gao, Xiang; Zhou, Changfu; Jin, Meilei; Zhao, Guoping; Jing, Naihe; Li, Bao-Ming; Yu, Lei

2005-08-26

Memory formation, maintenance, and retrieval are a dynamic process, reflecting a combined outcome of new memory formation on one hand, and older memory suppression/clearance on the other. Although much knowledge has been gained regarding new memory formation, less is known about the molecular components and processes that serve the function of memory suppression/clearance. Here, we report the identification of a novel protein, termed hippyragranin (HGN), that is expressed in the rat hippocampus and its expression is reduced by hippocampal denervation. Inhibition of HGN by antisense oligonucleotide in area CA1 results in enhanced performance in Morris water maze, as well as elevated long-term potentiation. These results suggest that HGN is involved in negative memory regulation.

[Current status and future prospects of research on Fukuyama muscular dystrophy].

PubMed

Toda, Tatsushi

2015-08-01

Fukuyama congenital muscular dystrophy(FCMD) is a second common childhood muscular dystrophy in Japan. All FCMD patients have ancestral insertion of the SVA retrotransposal element into fukutin. We show that aberrant mRNA splicing induced by SVA exon-trapping caused FCMD. Introduction of 3 cocktailed antisense oligonucleotides(AONs) targeting around these splice sites prevented pathogenic splicing in FCMD patient cells and model mice, and normalized protein production and functions of Fukutin as well as O-glycosylation of α-dystroglycan. We show the promise of splicing modulation therapy as the first radical clinical treatment for FCMD in the near future. We also show that fukutin is prerequisite to ameliorate muscular dystrophic phenotype by myofiber-selective LARGE expression. Recent advances in FCMD are discussed.

Antisense oligonucleotides targeting apolipoprotein(a) in people with raised lipoprotein(a): two randomised, double-blind, placebo-controlled, dose-ranging trials.

PubMed

Viney, Nicholas J; van Capelleveen, Julian C; Geary, Richard S; Xia, Shuting; Tami, Joseph A; Yu, Rosie Z; Marcovina, Santica M; Hughes, Steven G; Graham, Mark J; Crooke, Rosanne M; Crooke, Stanley T; Witztum, Joseph L; Stroes, Erik S; Tsimikas, Sotirios

2016-11-05

Elevated lipoprotein(a) (Lp[a]) is a highly prevalent (around 20% of people) genetic risk factor for cardiovascular disease and calcific aortic valve stenosis, but no approved specific therapy exists to substantially lower Lp(a) concentrations. We aimed to assess the efficacy, safety, and tolerability of two unique antisense oligonucleotides designed to lower Lp(a) concentrations. We did two randomised, double-blind, placebo-controlled trials. In a phase 2 trial (done in 13 study centres in Canada, the Netherlands, Germany, Denmark, and the UK), we assessed the effect of IONIS-APO(a) Rx , an oligonucleotide targeting apolipoprotein(a). Participants with elevated Lp(a) concentrations (125-437 nmol/L in cohort A; ≥438 nmol/L in cohort B) were randomly assigned (in a 1:1 ratio in cohort A and in a 4:1 ratio in cohort B) with an interactive response system to escalating-dose subcutaneous IONIS-APO(a) Rx (100 mg, 200 mg, and then 300 mg, once a week for 4 weeks each) or injections of saline placebo, once a week, for 12 weeks. Primary endpoints were mean percentage change in fasting plasma Lp(a) concentration at day 85 or 99 in the per-protocol population (participants who received more than six doses of study drug) and safety and tolerability in the safety population. In a phase 1/2a first-in-man trial, we assessed the effect of IONIS-APO(a)-L Rx , a ligand-conjugated antisense oligonucleotide designed to be highly and selectively taken up by hepatocytes, at the BioPharma Services phase 1 unit (Toronto, ON, Canada). Healthy volunteers (Lp[a] ≥75 nmol/L) were randomly assigned to receive a single dose of 10-120 mg IONIS-APO(a)L Rx subcutaneously in an ascending-dose design or placebo (in a 3:1 ratio; single-ascending-dose phase), or multiple doses of 10 mg, 20 mg, or 40 mg IONIS-APO(a)L Rx subcutaneously in an ascending-dose design or placebo (in an 8:2 ratio) at day 1, 3, 5, 8, 15, and 22 (multiple-ascending-dose phase). Primary endpoints were mean percentage change in fasting plasma Lp(a) concentration, safety, and tolerability at day 30 in the single-ascending-dose phase and day 36 in the multiple-ascending-dose phase in participants who were randomised and received at least one dose of study drug. In both trials, the randomised allocation sequence was generated by Ionis Biometrics or external vendor with a permuted-block randomisation method. Participants, investigators, sponsor personnel, and clinical research organisation staff who analysed the data were all masked to the treatment assignments. Both trials are registered with ClinicalTrials.gov, numbers NCT02160899 and NCT02414594. From June 25, 2014, to Nov 18, 2015, we enrolled 64 participants to the phase 2 trial (51 in cohort A and 13 in cohort B). 35 were randomly assigned to IONIS-APO(a) Rx and 29 to placebo. At day 85/99, participants assigned to IONIS-APO(a) Rx had mean Lp(a) reductions of 66·8% (SD 20·6) in cohort A and 71·6% (13·0) in cohort B (both p<0·0001 vs pooled placebo). From April 15, 2015, to Jan 11, 2016, we enrolled 58 healthy volunteers to the phase 1/2a trial of IONIS-APO(a)-L Rx . Of 28 participants in the single-ascending-dose phase, three were randomly assigned to 10 mg, three to 20 mg, three to 40 mg, six to 80 mg, six to 120 mg, and seven to placebo. Of 30 participants in the multiple-ascending-dose phase, eight were randomly assigned to 10 mg, eight to 20 mg, eight to 40 mg, and six to placebo. Significant dose-dependent reductions in mean Lp(a) concentrations were noted in all single-dose IONIS-APO(a)-L Rx groups at day 30. In the multidose groups, IONIS-APO(a)-L Rx resulted in mean reductions in Lp(a) of 66% (SD 21·8) in the 10 mg group, 80% (SD 13·7%) in the 20 mg group, and 92% (6·5) in the 40 mg group (p=0·0007 for all vs placebo) at day 36. Both antisense oligonucleotides were safe. There were two serious adverse events (myocardial infarctions) in the IONIS-APO(a) Rx phase 2 trial, one in the IONIS-APO(a) Rx and one in the placebo group, but neither were thought to be treatment related. 12% of injections with IONIS-APO(a) Rx were associated with injection-site reactions. IONIS-APO(a)-L Rx was associated with no injection-site reactions. IONIS-APO(a)-L Rx is a novel, tolerable, potent therapy to reduce Lp(a) concentrations. IONIS-APO(a)-L Rx might mitigate Lp(a)-mediated cardiovascular risk and is being developed for patients with elevated Lp(a) concentrations with existing cardiovascular disease or calcific aortic valve stenosis. Ionis Pharmaceuticals. Copyright © 2016 Elsevier Ltd. All rights reserved.

Cellular Interactions and Immune Response of Spherical Nucleic Acid (SNA) Nanoconjugates

NASA Astrophysics Data System (ADS)

Massich, Matthew David

Spherical nucleic acid (SNA) nanoconjugates consist of a densely packed monolayer shell of highly-oriented oligonucleotides covalently bound to a gold nanoparticle core. The nanoconjugates exhibit several important qualities, which make them useful for various biological applications, such as antisense gene regulation strategies and the intracellular detection of biomolecules. The focus of this thesis was to characterize the nanoconjugates interaction with cultured cells and specifically the immune response to their intracellular presence. The immune response of macrophage cells to internalized nanoconjugates was studied, and due to the dense functionalization of oligonucleotides on the surface of the nanoparticle and the resulting high localized salt concentration the innate immune response to the nanoconjugates is ˜25-fold less when compared to a lipoplex carrying the same sequence. Additionally, genome-wide expression profiling was used to study the biological response of cultured cells to the nanoconjugates. The biological response of HeLa cells to gold nanoparticles stabilized by weakly bound ligands was significant, yet when these same nanoparticles were stably functionalized with covalently attached oligonucleotides the cells showed no measurable response. In human keratinocytes, the oligonucleotide sequences caused 427 genes to be differentially expressed when complexed with Dharmafect, but when the oligonucleotides were conjugated to nanoparticles only 7 genes were differentially expressed. Beyond characterizing the cellular interactions and immune response of the nanoconjugates, the optimal length of siRNA (from 19--34 base pairs) that induces the most gene knockdown while maintaining limited immune activation was determined to be 24 base pairs. Further, the SNAs were shown to be useful as a potential antiviral gene therapy by demonstrating approximately 50% knockdown of the Ebola VP35 gene. Lastly, a scanning probe-enabled method was used to rapidly create nanoscale fibronectin patterns over large areas with a range of feature sizes, thereby opening the field of nanocombinatorics. This allowed the investigation of the relationship between fibronectin feature size and stem cell fate. MSCs cultured on nanoscale fibronectin features directed differentiation toward osteogenesis to a greater extent than cells grown on both microscale features and cells grown on non-patterned fibronectin substrates with osteogenic inducing media, demonstrating a new method for controlling stem cell fate.

Microchip method for the enrichment of specific DNA sequences

DOEpatents

Mirzabekov, A.D.; Lysov, Y.P.; Shick, V.V.; Dubiley, S.A.

1998-12-22

A method for enriching specific genetic material sequences is provided, whereby oligonucleotide molecules complementary to the desired genetic material is first used to isolate the genetic material from a first source of genomic material. Then the genetic material is used as a label to isolate similar genetic sequences from other sources. 4 figs.

Microchip method for the enrichment of specific DNA sequences

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Shick, Valentine Vladimirovich; Dubiley, Svetlana Alekseevna

1998-01-01

A method for enriching specific genetic material sequences is provided, whereby oligonucleotide molecules complementary to the desired genetic material is first used to isolate the genetic material from a first source of genomic material. Then the genetic material is used as a label to isolate similar genetic sequences from other sources.

Dmpk gene deletion or antisense knockdown does not compromise cardiac or skeletal muscle function in mice

PubMed Central

Carrell, Samuel T.; Carrell, Ellie M.; Auerbach, David; Pandey, Sanjay K.; Bennett, C. Frank; Dirksen, Robert T.; Thornton, Charles A.

2016-01-01

Myotonic dystrophy type 1 (DM1) is a genetic disorder in which dominant-active DM protein kinase (DMPK) transcripts accumulate in nuclear foci, leading to abnormal regulation of RNA processing. A leading approach to treat DM1 uses DMPK-targeting antisense oligonucleotides (ASOs) to reduce levels of toxic RNA. However, basal levels of DMPK protein are reduced by half in DM1 patients. This raises concern that intolerance for further DMPK loss may limit ASO therapy, especially since mice with Dmpk gene deletion reportedly show cardiac defects and skeletal myopathy. We re-examined cardiac and muscle function in mice with Dmpk gene deletion, and studied post-maturity knockdown using Dmpk-targeting ASOs in mice with heterozygous deletion. Contrary to previous reports, we found no effect of Dmpk gene deletion on cardiac or muscle function, when studied on two genetic backgrounds. In heterozygous knockouts, the administration of ASOs reduced Dmpk expression in cardiac and skeletal muscle by > 90%, yet survival, electrocardiogram intervals, cardiac ejection fraction and muscle strength remained normal. The imposition of cardiac stress by pressure overload, or muscle stress by myotonia, did not unmask a requirement for DMPK. Our results support the feasibility and safety of using ASOs for post-transcriptional silencing of DMPK in muscle and heart. PMID:27522499

Abnormal cerebellar development and ataxia in CARP VIII morphant zebrafish.

PubMed

Aspatwar, Ashok; Tolvanen, Martti E E; Jokitalo, Eija; Parikka, Mataleena; Ortutay, Csaba; Harjula, Sanna-Kaisa E; Rämet, Mika; Vihinen, Mauno; Parkkila, Seppo

2013-02-01

Congenital ataxia and mental retardation are mainly caused by variations in the genes that affect brain development. Recent reports have shown that mutations in the CA8 gene are associated with mental retardation and ataxia in humans and ataxia in mice. The gene product, carbonic anhydrase-related protein VIII (CARP VIII), is predominantly present in cerebellar Purkinje cells, where it interacts with the inositol 1,4,5-trisphosphate receptor type 1, a calcium channel. In this study, we investigated the effects of the loss of function of CARP VIII during embryonic development in zebrafish using antisense morpholino oligonucleotides against the CA8 gene. Knockdown of CA8 in zebrafish larvae resulted in a curved body axis, pericardial edema and abnormal movement patterns. Histologic examination revealed gross morphologic defects in the cerebellar region and in the muscle. Electron microscopy studies showed increased neuronal cell death in developing larvae injected with CA8 antisense morpholinos. These data suggest a pivotal role for CARP VIII during embryonic development. Furthermore, suppression of CA8 expression leads to defects in motor and coordination functions, mimicking the ataxic human phenotype. This work reveals an evolutionarily conserved function of CARP VIII in brain development and introduces a novel zebrafish model in which to investigate the mechanisms of CARP VIII-related ataxia and mental retardation in humans.

Human Herpesvirus-8-Transformed Endothelial Cells Have Functionally Activated Vascular Endothelial Growth Factor/Vascular Endothelial Growth Factor Receptor

PubMed Central

Masood, Rizwan; Cesarman, Ethel; Smith, D. Lynne; Gill, Parkash S.; Flore, Ornella

2002-01-01

Kaposi’s sarcoma is a vascular tumor commonly associated with human immunodeficiency virus (HIV)-1 and human herpesvirus (HHV-8) also known as Kaposi’s sarcoma-associated herpesvirus. The principal features of this tumor are abnormal proliferation of vascular structures lined with spindle-shaped endothelial cells. HHV-8 may transform a subpopulation of endothelial cells in vitro via viral and cellular gene expression. We hypothesized that among the cellular genes, vascular endothelial growth factors (VEGFs) and their cognate receptors may be involved in viral-mediated transformation. We have shown that HHV-8-transformed endothelial cells (EC-HHV-8) express higher levels of VEGF, VEGF-C, VEGF-D, and PlGF in addition to VEGF receptors-1, -2, and -3. Furthermore, antibodies to VEGF receptor-2 inhibited cell proliferation and viability. Similarly, inhibition of VEGF gene expression with antisense oligonucleotides inhibited EC-HHV-8 cell proliferation/viability. The growth and viability of primary endothelial cells and a fibroblast cell line however were unaffected by either the VEGF receptor-2 antibody or the VEGF antisense oligodeoxynucleotides. VEGF and VEGF receptors are thus induced in EC-HHV-8 and participate in the transformation. Inhibitors of VEGF may thus modulate the disease process during development and progression. PMID:11786394

Antisense inhibition of hyaluronan synthase-2 in human osteosarcoma cells inhibits hyaluronan retention and tumorigenicity

DOE Office of Scientific and Technical Information (OSTI.GOV)

Nishida, Yoshihiro; Knudson, Warren; Knudson, Cheryl B.

2005-07-01

Osteosarcoma is a common malignant bone tumor associated with childhood and adolescence. The results of numerous studies have suggested that hyaluronan plays an important role in regulating the aggressive behavior of various types of cancer cells. However, no studies have addressed hyaluronan with respect to osteosarcomas. In this investigation, the mRNA expression copy number of three mammalian hyaluronan synthases (HAS) was determined using competitive RT-PCR in the osteoblastic osteosarcoma cell line, MG-63. MG-63 are highly malignant osteosarcoma cells with an abundant hyaluronan-rich matrix. The results demonstrated that HAS-2 is the predominant HAS in MG-63. Accumulation of intracellular hyaluronan increased inmore » association with the proliferative phase of these cells. The selective inhibition of HAS-2 mRNA in MG-63 cells by antisense phosphorothioate oligonucleotides resulted in reduced hyaluronan accumulation by these cells. As expected, the reduction in hyaluronan disrupted the assembly of cell-associated matrices. However, of most interest, coincident with the reduction in hyaluronan, there was a substantial decrease in cell proliferation, a decrease in cell motility and a decrease in cell invasiveness. These data suggest that hyaluronan synthesized by HAS-2 in MG-63 plays a crucial role in osteosarcoma cell proliferation, motility, and invasion.« less

Role of redox signaling in the autonomous proliferative response of endothelial cells to hypoxia.

PubMed

Schäfer, M; Schäfer, C; Ewald, N; Piper, H M; Noll, Th

2003-05-16

Endothelial cells exhibit an autonomous proliferative response to hypoxia, independent of paracrine effectors. In cultured endothelial cells of porcine aorta, we analyzed the signaling of this response, with a focus on the roles of redox signaling and the MEK/ERK pathway. Transient hypoxia (1 hour) stimulated proliferation by 61+/-4% (n=16; P<0.05 versus control), quantified after 24 hours normoxic postincubation. Hypoxia induced an activation of ERK2 and of NAD(P)H oxidase and a burst of reactive oxygen species (ROS), determined by DCF fluorescence. To inhibit the MEK/ERK pathway, we used PD 98059 (PD, 20 micromol/L); to downregulate NAD(P)H oxidase, we applied p22phox antisense oligonucleotides; and to inhibit mitochondrial ROS generation, we used the ubiquinone derivate mitoQ (MQ, 10 micromol/L). All three inhibitions suppressed the proliferative response: PD inhibited NAD(P)H oxidase activation; p22phox antisense transfection did not inhibit ERK2 activation, but suppressed ROS production; and MQ inhibited ERK2 activation and ROS production. The autonomous proliferative response depends on the MEK/ERK pathway and redox signaling steps upstream and downstream of ERK. Located upstream is ROS generation by mitochondria, downstream is NAD(P)H oxidase.

Glycogen Reduction in Myotubes of Late-Onset Pompe Disease Patients Using Antisense Technology.

PubMed

Goina, Elisa; Peruzzo, Paolo; Bembi, Bruno; Dardis, Andrea; Buratti, Emanuele

2017-09-06

Glycogen storage disease type II (GSDII) is a lysosomal disorder caused by the deficient activity of acid alpha-glucosidase (GAA) enzyme, leading to the accumulation of glycogen within the lysosomes. The disease has been classified in infantile and late-onset forms. Most late-onset patients share a splicing mutation c.-32-13T > G in intron 1 of the GAA gene that prevents efficient recognition of exon 2 by the spliceosome. In this study, we have mapped the splicing silencers of GAA exon 2 and developed antisense morpholino oligonucleotides (AMOs) to inhibit those regions and rescue normal splicing in the presence of the c.-32-13T > G mutation. Using a minigene approach and patient fibroblasts, we successfully increased inclusion of exon 2 in the mRNA and GAA enzyme production by targeting a specific silencer with a combination of AMOs. Most importantly, the use of these AMOs in patient myotubes results in a decreased accumulation of glycogen. To our knowledge, this is the only therapeutic approach resulting in a decrease of glycogen accumulation in patient tissues beside enzyme replacement therapy (ERT) and TFEB overexpression. As a result, it may represent a highly novel and promising therapeutic line for GSDII. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.

Mipomersen: a safe and effective antisense therapy adjunct to statins in patients with hypercholesterolemia.

PubMed

Ricotta, Daniel N; Frishman, William

2012-01-01

Mipomersen is an antisense oligonucleotide inhibitor of apolipoprotein (apo) B-100 currently in phase 3 of development for the treatment of hyperlipidemia in patients with a high risk for cardiovascular disease. The drug acts by inhibiting the production of apoB-100, which is the structural core for all atherogenic lipids, including low-density lipoprotein cholesterol (LDL-C). The agent has been shown to produce significant reductions in LDL-C from baseline values compared with placebos. Clinical trials have demonstrated that mipomersen reduces LDL-C up to 44% in patients with familial hypercholesterolemia and patients with significantly elevated LDL despite taking maximum doses of statins. Unlike other medications that target apoB-100, such as microsomal triglyceride transfer proteins, mipomersen does not cause hepatic steatosis or intestinal steatosis and does not affect dietary fat absorption. Adverse side effects encountered with mipomersen include flu-like symptoms, injection site reactions, and elevated liver transaminases. If future studies continue to show such promising results, mipomersen would likely be a viable additional lipid-lowering therapy for patients who are at high cardiovascular risk, intolerant to statins, and/or not at target lipid levels despite maximum doses of statin therapy. Clinical outcome studies looking at cardiovascular disease end points still need to be done.

Bioresponsive antisense DNA gold nanobeacons as a hybrid in vivo theranostics platform for the inhibition of cancer cells and metastasis

NASA Astrophysics Data System (ADS)

Bao, Chenchen; Conde, João; Curtin, James; Artzi, Natalie; Tian, Furong; Cui, Daxiang

2015-07-01

Gold nanobeacons can be used as a powerful tool for cancer theranostics. Here, we proposed a nanomaterial platform based on gold nanobeacons to detect, target and inhibit the expression of a mutant Kras gene in an in vivo murine gastric cancer model. The conjugation of fluorescently-labeled antisense DNA hairpin oligonucleotides to the surface of gold nanoparticles enables using their localized surface plasmon resonance properties to directly track the delivery to the primary gastric tumor and to lung metastatic sites. The fluorescently labeled nanobeacons reports on the interaction with the target as the fluorescent Cy3 signal is quenched by the gold nanoparticle and only emit light following conjugation to the Kras target owing to reorganization and opening of the nanobeacons, thus increasing the distance between the dye and the quencher. The systemic administration of the anti-Kras nanobeacons resulted in approximately 60% tumor size reduction and a 90% reduction in tumor vascularization. More important, the inhibition of the Kras gene expression in gastric tumors prevents the occurrence of metastasis to lung (80% reduction), increasing mice survival in more than 85%. Our developed platform can be easily adjusted to hybridize with any specific target and provide facile diagnosis and treatment for neoplastic diseases.

Aminosilane functionalizations of mesoporous oxidized silicon for oligonucleotide synthesis and detection

PubMed Central

De Stefano, Luca; Oliviero, Giorgia; Amato, Jussara; Borbone, Nicola; Piccialli, Gennaro; Mayol, Luciano; Rendina, Ivo; Terracciano, Monica; Rea, Ilaria

2013-01-01

Direct solid phase synthesis of peptides and oligonucleotides (ONs) requires high chemical stability of the support material. In this work, we have investigated the passivation ability of porous oxidized silicon multilayered structures by two aminosilane compounds, 3-aminopropyltriethoxysilane and 3-aminopropyldimethylethoxysilane (APDMES), for optical label-free ON biosensor fabrication. We have also studied by spectroscopic reflectometry the hybridization between a 13 bases ON, directly grown on the aminosilane modified porous oxidized silicon by in situ synthesis, and its complementary sequence. Even if the results show that both devices are stable to the chemicals (carbonate/methanol) used, the porous silica structure passivated by APDMES reveals higher functionalization degree due to less steric hindrance of pores. PMID:23536541

Triple helix purification and sequencing

DOEpatents

Wang, Renfeng; Smith, Lloyd M.; Tong, Xinchun E.

1995-01-01

Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis.

Triazole-linked DNA as a primer surrogate in the synthesis of first-strand cDNA.

PubMed

Fujino, Tomoko; Yasumoto, Ken-ichi; Yamazaki, Naomi; Hasome, Ai; Sogawa, Kazuhiro; Isobe, Hiroyuki

2011-11-04

A phosphate-eliminated nonnatural oligonucleotide serves as a primer surrogate in reverse transcription reaction of mRNA. Despite of the nonnatural triazole linkages in the surrogate, the reverse transcriptase effectively elongated cDNA sequences on the 3'-downstream of the primer by transcription of the complementary sequence of mRNA. A structure-activity comparison with the reference natural oligonucleotides shows the superior priming activity of the surrogate containing triazole-linkages. The nonnatural linkages also protect the transcribed cDNA from digestion reactions with 5'-exonuclease and enable us to remove noise transcripts of unknown origins. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Triple helix purification and sequencing

DOEpatents

Wang, R.; Smith, L.M.; Tong, X.E.

1995-03-28

Disclosed herein are methods, kits, and equipment for purifying single stranded circular DNA and then using the DNA for DNA sequencing purposes. Templates are provided with an insert having a hybridization region. An elongated oligonucleotide has two regions that are complementary to the insert and the oligo is bound to a magnetic anchor. The oligo hybridizes to the insert on two sides to form a stable triple helix complex. The anchor can then be used to drag the template out of solution using a magnet. The system can purify sequencing templates, and if desired the triple helix complex can be opened up to a double helix so that the oligonucleotide will act as a primer for further DNA synthesis. 4 figures.

probeBase—an online resource for rRNA-targeted oligonucleotide probes and primers: new features 2016

PubMed Central

Greuter, Daniel; Loy, Alexander; Horn, Matthias; Rattei, Thomas

2016-01-01

probeBase http://www.probebase.net is a manually maintained and curated database of rRNA-targeted oligonucleotide probes and primers. Contextual information and multiple options for evaluating in silico hybridization performance against the most recent rRNA sequence databases are provided for each oligonucleotide entry, which makes probeBase an important and frequently used resource for microbiology research and diagnostics. Here we present a major update of probeBase, which was last featured in the NAR Database Issue 2007. This update describes a complete remodeling of the database architecture and environment to accommodate computationally efficient access. Improved search functions, sequence match tools and data output now extend the opportunities for finding suitable hierarchical probe sets that target an organism or taxon at different taxonomic levels. To facilitate the identification of complementary probe sets for organisms represented by short rRNA sequence reads generated by amplicon sequencing or metagenomic analysis with next generation sequencing technologies such as Illumina and IonTorrent, we introduce a novel tool that recovers surrogate near full-length rRNA sequences for short query sequences and finds matching oligonucleotides in probeBase. PMID:26586809

Autoimmunity to the alpha 3 chain of type IV collagen in glomerulonephritis is triggered by ‘autoantigen complementarity’

PubMed Central

Reynolds, John; Preston, Gloria A.; Pressler, Barrak M.; Hewins, Peter; Brown, Michael; Roth, Aleeza; Alderman, Elizabeth; Bunch, Donna; Jennette, J. Charles; Cook, H. Terence; Falk, Ronald J.; Pusey, Charles D.

2015-01-01

‘Autoantigen complementarity’ is a theory proposing that the initiator of an autoimmune response is not necessarily the autoantigen or its molecular mimic, but may instead be a peptide that is ‘antisense/complementary’ to the autoantigen. We investigated whether such complementary proteins play a role in the immunopathogenesis of autoimmune glomerulonephritis. Experimental autoimmune glomerulonephritis, a model of anti-glomerular basement membrane (GBM) disease, can be induced in Wistar Kyoto (WKY) rats by immunization with the α3 chain of type IV collagen. In this study, WKY rats were immunized with a complementary α3 peptide (c-α3-Gly) comprised of amino acids that ‘complement’ the well characterized epitope on α3(IV)NC1, pCol(24–38). Within 8 weeks post-immunization, these animals developed cresentic glomerulonephritis, similar to pCol(24–38)-immunized rats, while animals immunized with scrambled peptide were normal. Anti-idiotypic antibodies to epitopes from c-α3-Gly-immunized animals were shown to be specific for α3 protein, binding in a region containing sense pCol(24–38) sequence. Interestingly, anticomplementary α3 antibodies were identified in sera from patients with anti-GBM disease, suggesting a role for ‘autoantigen complementarity’ in immunopathogenesis of the human disease. This work supports the idea that autoimmune glomerulonephritis can be initiated through an immune response against a peptide that is anti-sense or complementary to the autoantigen. The implications of this discovery may be far reaching, and other autoimmune diseases could be due to responses to these once unsuspected ‘complementary’ antigens. PMID:25841937

Attenuation of alpha2A-adrenergic receptor expression in neonatal rat brain by RNA interference or antisense oligonucleotide reduced anxiety in adulthood.

PubMed

Shishkina, G T; Kalinina, T S; Dygalo, N N

2004-01-01

Brain alpha2-adrenergic receptors (alpha2-ARs) have been implicated in the regulation of anxiety, which is associated with stress. Environmental treatments during neonatal development could modulate the level of brain alpha2-AR expression and alter anxiety in adults, suggesting possible involvement of these receptors in early-life programming of anxiety state. The present study was undertaken to determine whether the reduction of the expression of A subtype of these receptors most abundant in the neonatal brain affects anxiety-related behavior in adulthood. We attenuated the expression of alpha2A-ARs during neonatal life by two different sequence specific approaches, antisense technology and RNA interference. Treatment of rats with the antisense oligodeoxynucleotide or short interfering RNA (siRNA) against alpha2A-ARs on the days 2-4 of their life, produced a marked acute decrease in the levels of both alpha2A-AR mRNA and [3H]RX821002 binding sites in the brainstem into which drugs were injected. The decrease of alpha2A-AR expression in the neonatal brainstem influenced the development of this receptor system in the brain regions as evidenced by the increased number of [3H]RX821002 binding sites in the hypothalamus of adult animals with both neonatal alpha2A-AR knockdown treatments; also in the frontal cortex of antisense-treated, and in the hippocampus of siRNA-treated adult rats. These adult animals also demonstrated a decreased anxiety in the elevated plus-maze as evidenced by an increased number of the open arm entries, greater proportion of time spent in the open arms, and more than a two-fold increase in the number of exploratory head dips. The results provide the first evidence that the reduction in the brain expression of a gene encoding for alpha2A-AR during neonatal life led to the long-term neurochemical and behavioral alterations. The data suggests that alterations in the expression of the receptor-specific gene during critical periods of brain development may be involved in early-life programming of anxiety-related behavior.

Template switching between PNA and RNA oligonucleotides

NASA Technical Reports Server (NTRS)

Bohler, C.; Nielsen, P. E.; Orgel, L. E.; Miller, S. L. (Principal Investigator)

1995-01-01

The origin of the RNA world is not easily understood, as effective prebiotic syntheses of the components of RNA, the beta-ribofuranoside-5'-phosphates, are hard to envisage. Recognition of this difficulty has led to the proposal that other genetic systems, the components of which are more easily formed, may have preceded RNA. This raises the question of how transitions between one genetic system and another could occur. Peptide nucleic acid (PNA) resembles RNA in its ability to form double-helical complexes stabilized by Watson-Crick hydrogen bonding between adenine and thymine and between cytosine and guanine, but has a backbone that is held together by amide rather than by phosphodiester bonds. Oligonucleotides bases on RNA are known to act as templates that catalyse the non-enzymatic synthesis of their complements from activated mononucleotides, we now show that RNA oligonucleotides facilitate the synthesis of complementary PNA strands and vice versa. This suggests that a transition between different genetic systems can occur without loss of information.

Photouncaged Sequence-specific Interstrand DNA Cross-Linking with Photolabile 4-oxo-enal-modified Oligonucleotides

PubMed Central

Sun, Jingjing; Tang, Xinjing

2015-01-01

DNA cross-linking technology is an attractive tool for the detection, regulation, and manipulation of genes. In this study, a series of photolabile 4-oxo-enal-modified oligonucleotides functionalized with photosensitive ο-nitrobenzyl derivatives were rationally designed as a new kind of photocaged cross-linking agents. A comprehensive evaluation of cross-linking reactions for different nucleobases in complementary strands under different conditions suggested that the modified DNA oligonucleotides tended to form interstrand cross-linking to nucleobases with the potential of thymidine > guanosine » cytidine ~ adenosine. Different from previous literature reports that cytidine and adenosine were preferential cross-linked nucleobases with 4-oxo-enal moieties, our study represents the first example of DNA cross-linking for T and G selectivity using 4-oxo-enal moiety. The cross-linked adducts were identified and their cross-linking mechanism was also illustrated. This greatly expands the applications of 4-oxo-enal derivatives in the studies of DNA damage and RNA structure PMID:26020694

Photouncaged Sequence-specific Interstrand DNA Cross-Linking with Photolabile 4-oxo-enal-modified Oligonucleotides.

PubMed

Sun, Jingjing; Tang, Xinjing

2015-05-28

DNA cross-linking technology is an attractive tool for the detection, regulation, and manipulation of genes. In this study, a series of photolabile 4-oxo-enal-modified oligonucleotides functionalized with photosensitive ο-nitrobenzyl derivatives were rationally designed as a new kind of photocaged cross-linking agents. A comprehensive evaluation of cross-linking reactions for different nucleobases in complementary strands under different conditions suggested that the modified DNA oligonucleotides tended to form interstrand cross-linking to nucleobases with the potential of thymidine > guanosine » cytidine ~ adenosine. Different from previous literature reports that cytidine and adenosine were preferential cross-linked nucleobases with 4-oxo-enal moieties, our study represents the first example of DNA cross-linking for T and G selectivity using 4-oxo-enal moiety. The cross-linked adducts were identified and their cross-linking mechanism was also illustrated. This greatly expands the applications of 4-oxo-enal derivatives in the studies of DNA damage and RNA structure.

Diatomaceous Fungal and Bacterial Building Blocks for Material Synthesis

DTIC Science & Technology

2008-04-08

Thalassiosira-templated metallic microshells. Thalassiosira, only 1mM rhodamine 6G (d) lmM, (e) I piM ,(f 100 nM R6G. 4 concentrations gave detectable...hybridized with a 27-mer 7 oligonucleotide containing a 7-mer TAG GAA TAG TTA TA AT OTT ATT AGO complementary region 2, which produces TAIOATCCTTA TACAATAATCC

Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania.

PubMed

Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

2012-12-01

Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved.

An in silico model for identification of small RNAs in whole bacterial genomes: characterization of antisense RNAs in pathogenic Escherichia coli and Streptococcus agalactiae strains.

PubMed

Pichon, Christophe; du Merle, Laurence; Caliot, Marie Elise; Trieu-Cuot, Patrick; Le Bouguénec, Chantal

2012-04-01

Characterization of small non-coding ribonucleic acids (sRNA) among the large volume of data generated by high-throughput RNA-seq or tiling microarray analyses remains a challenge. Thus, there is still a need for accurate in silico prediction methods to identify sRNAs within a given bacterial species. After years of effort, dedicated software were developed based on comparative genomic analyses or mathematical/statistical models. Although these genomic analyses enabled sRNAs in intergenic regions to be efficiently identified, they all failed to predict antisense sRNA genes (asRNA), i.e. RNA genes located on the DNA strand complementary to that which encodes the protein. The statistical models enabled any genomic region to be analyzed theorically but not efficiently. We present a new model for in silico identification of sRNA and asRNA candidates within an entire bacterial genome. This model was successfully used to analyze the Gram-negative Escherichia coli and Gram-positive Streptococcus agalactiae. In both bacteria, numerous asRNAs are transcribed from the complementary strand of genes located in pathogenicity islands, strongly suggesting that these asRNAs are regulators of the virulence expression. In particular, we characterized an asRNA that acted as an enhancer-like regulator of the type 1 fimbriae production involved in the virulence of extra-intestinal pathogenic E. coli.

An in silico model for identification of small RNAs in whole bacterial genomes: characterization of antisense RNAs in pathogenic Escherichia coli and Streptococcus agalactiae strains

PubMed Central

Pichon, Christophe; du Merle, Laurence; Caliot, Marie Elise; Trieu-Cuot, Patrick; Le Bouguénec, Chantal

2012-01-01

Characterization of small non-coding ribonucleic acids (sRNA) among the large volume of data generated by high-throughput RNA-seq or tiling microarray analyses remains a challenge. Thus, there is still a need for accurate in silico prediction methods to identify sRNAs within a given bacterial species. After years of effort, dedicated software were developed based on comparative genomic analyses or mathematical/statistical models. Although these genomic analyses enabled sRNAs in intergenic regions to be efficiently identified, they all failed to predict antisense sRNA genes (asRNA), i.e. RNA genes located on the DNA strand complementary to that which encodes the protein. The statistical models enabled any genomic region to be analyzed theorically but not efficiently. We present a new model for in silico identification of sRNA and asRNA candidates within an entire bacterial genome. This model was successfully used to analyze the Gram-negative Escherichia coli and Gram-positive Streptococcus agalactiae. In both bacteria, numerous asRNAs are transcribed from the complementary strand of genes located in pathogenicity islands, strongly suggesting that these asRNAs are regulators of the virulence expression. In particular, we characterized an asRNA that acted as an enhancer-like regulator of the type 1 fimbriae production involved in the virulence of extra-intestinal pathogenic E. coli. PMID:22139924

The dopamine precursor L-dihydroxyphenylalanine is transported by the amino acid transporters rBAT and LAT2 in renal cortex.

PubMed

Quiñones, Henry; Collazo, Roberto; Moe, Orson W

2004-07-01

The intrarenal autocrine-paracrine dopamine (DA) system is critical for Na(+) homeostasis. l-Dihydroxyphenylalanine (l-DOPA) uptake from the glomerular filtrate and plasma provides the substrate for DA generation by the renal proximal tubule. The transporter(s) responsible for proximal tubule l-DOPA uptake has not been characterized. Renal cortical poly-A(+) RNA injected into Xenopus laevis oocytes induced l-DOPA uptake in a time- and dose-dependent fashion with biphasic K(m)s in the millimolar and micromolar range and independent of inward Na(+), K(+), or H(+) gradients, suggesting the presence of low- and high-affinity l-DOPA carriers. Complementary RNA from two amino acid transporters yielded l-DOPA uptake significantly above water-injected controls the rBAT/b(0,+)AT dimer (rBAT) and the LAT2/4F2 dimer (LAT2). In contradistinction to renal cortical poly-A(+), l-DOPA kinetics of rBAT and LAT2 showed classic Michaelis-Menton kinetics with K(m)s in the micromolar and millimolar range, respectively. Sequence-specific antisense oligonucleotides to rBAT or LAT2 (AS) caused inhibition of rBAT and LAT2 cRNA-induced l-DOPA transport and cortical poly-A(+)-induced arginine and phenylalanine transport. However, the same ASs only partially blocked poly-A(+)-induced l-DOPA transport. In cultured kidney cells, silencing inhibitory RNA (siRNA) to rBAT significantly inhibited l-DOPA uptake. We conclude that rBAT and LAT2 can mediate apical and basolateral l-DOPA uptake into the proximal tubule, respectively. Additional l-DOPA transport mechanisms exist in the renal cortex that remain to be identified.

Development of an aptamer beacon for detection of interferon-gamma.

PubMed

Tuleuova, Nazgul; Jones, Caroline N; Yan, Jun; Ramanculov, Erlan; Yokobayashi, Yohei; Revzin, Alexander

2010-03-01

Traditional antibody-based affinity sensing strategies employ multiple reagents and washing steps and are unsuitable for real-time detection of analyte binding. Aptamers, on the other hand, may be designed to monitor binding events directly, in real-time, without the need for secondary labels. The goal of the present study was to design an aptamer beacon for fluorescence resonance energy transfer (FRET)-based detection of interferon-gamma (IFN-gamma)--an important inflammatory cytokine. Variants of DNA aptamer modified with biotin moieties and spacers were immobilized on avidin-coated surfaces and characterized by surface plasmon resonance (SPR). The SPR studies showed that immobilization of aptamer via the 3' end resulted in the best binding IFN-gamma (K(d) = 3.44 nM). This optimal aptamer variant was then used to construct a beacon by hybridizing fluorophore-labeled aptamer with an antisense oligonucleotide strand carrying a quencher. SPR studies revealed that IFN-gamma binding with an aptamer beacon occurred within 15 min of analyte introduction--suggesting dynamic replacement of the quencher-complementary strand by IFN-gamma molecules. To further highlight biosensing applications, aptamer beacon molecules were immobilized inside microfluidic channels and challenged with varying concentration of analyte. Fluorescence microscopy revealed low fluorescence in the absence of analyte and high fluorescence after introduction of IFN-gamma. Importantly, unlike traditional antibody-based immunoassays, the signal was observed directly upon binding of analyte without the need for multiple washing steps. The surface immobilized aptamer beacon had a linear range from 5 to 100 nM and a lower limit of detection of 5 nM IFN-gamma. In conclusion, we designed a FRET-based aptamer beacon for monitoring of an inflammatory cytokine-IFN-gamma. In the future, this biosensing strategy will be employed to monitor dynamics of cytokine production by the immune cells.

Role of AIF in human coronary artery endothelial cell apoptosis.

PubMed

Zhang, Wenguang; Li, Dayuan; Mehta, Jawahar L

2004-01-01

Apoptosis-inducing factor (AIF), which exerts its effect via a caspase-independent pathway, has been suggested to be a mediator of cell injury. We have recently identified the expression of AIF in human coronary artery endothelial cells (HCAECs). The present study was designed to determine the pathophysiological role of AIF in oxidized low-density lipoprotein (ox-LDL)-induced apoptosis of HCAECs. The cells were cultured and treated with ox-LDL (40 microg/ml) for 24 h. Ox-LDL increased AIF expression, caused apoptosis of HCAECs (determined by terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling staining and large-scale DNA fragmentation), and induced translocation of AIF from the cytoplasm to the nucleus (fluorescence immunocytochemistry). Pretreatment of HCAECs with a caspase inhibitor (ZVAD-fmk) did not influence AIF-mediated apoptosis in response to ox-LDL. We developed a specific antisense oligonucleotide targeted to the 5'-TCG CCG AAA TGT TCC GGT GTG GA-3' portion of the human AIF mRNA sequence (AIF-AS) to bind a complementary sequence overlapping the translational start site. Pretreatment of cells with the AIF-AS for 24 h resulted in suppression of ox-LDL-upregulated AIF protein, as measured by immunoblot analysis. AIF-AS also reduced apoptosis and AIF translocation (P < 0.01 vs. ox-LDL alone). Next, we constructed a recombinant AIF plasmid by inserting whole-length AIF cDNA into the expression vector pcDNA3.1 with a cytomegalovirus promoter. HCAECs transfected with plasmid showed a two- to fourfold increase in AIF expression, extensive apoptosis, and translocation of AIF from the cytoplasm to the nucleus. These results from two approaches indicate that AIF plays an important role in ox-LDL-induced endothelial injury.

Targeting Cancer with Antisense Oligomers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hnatowich, DJ

With financial assistance from the Department of Energy, we have shown definitively that radiolabeled antisense DNAs and other oligomers will accumulate in target cancer cells in vitro and in vivo by an antisense mechanism. We have also shown that the number of mRNA targets for our antisense oligomers in the cancer cell types that we have investigated so far is sufficient to provide and antisense image and/or radiotherapy of cancer in mice. These studies have been reported in about 10 publications. However our observation over the past several years has shown that radiolabeled antisense oligomers administered intravenously in their nativemore » and naked form will accumulate and be retained in target xenografts by an antisense mechanism but will also accumulate at high levels in normal organs such as liver, spleen and kidneys. We have investigated unsuccessfully several commercially available vectors. Thus the use of radiolabeled antisense oligomers for the imaging of cancer must await novel approaches to delivery. This laboratory has therefore pursued two new paths, optical imaging of tumor and Auger radiotherapy. We are developing a novel method of optical imaging tumor using antisense oligomers with a fluorophore is administered while hybridized with a shorter complementary oligomer with an inhibitor. In culture and in tumored mice that the duplex remains intact and thus nonfluorescent until it encounters its target mRNA at which time it dissociates and the antisense oligomer binds along with its fluorophore to the target. Simultaneous with the above, we have also observed, as have others, that antisense oligomers migrate rapidly and quantitatively to the nucleus upon crossing cell membranes. The Auger electron radiotherapy path results from this observation since the nuclear migration properties could be used effectively to bring and to retain in the nucleus an Auger emitting radionuclide such as 111In or 125I bound to the antisense oligomer. Since the object becomes radiotherapy rather than imaging, the delivery problem may be obviated by attaching the antisense oligomer to an antitumor antibody to improve delivery following intravenous administration. Since many antibodies are trapped in endosomes following internalization, a cell penetrating peptide such as tat will also be included to ensure transport of the complex without entrapment. Rather than covalent conjugation of the three entities, we are using streptavidin as linker after biotinylated each component. Our recent efforts have concentrated on establishing the influence of the streptavidin linker on the properties of each component within the delivery nanoparticle. Thus, we have shown that the Herceptin antibody, when linked to a labeled oligomer via streptavidin, remains capable of directing the label oligomer to Her2+ tumor cells in vitro and Her2+ tumor xenografts in mice. In addition, we have demonstrated that a labeled antisense oligomer within the nanoparticle remains capable of migrating to the nucleus and binding to its target mRNA in vitro and in vivo. We have shown that the tat peptide also preserves its properties of cell transport when incubated as one component of the nanoparticle. Most recently, we have addressed another of our concerns, namely whether the streptavidin would adversely effect the biodistribution of the antisense oligomer. We were pleased to find that the 99mTc-labeled antisense MORF within the Herceptin three component and two component nanoparticles accumulated and was retained in tumor in a manner suggestive of radiolabeled Herceptin itself. Thus the preserved properties within the streptavidin delivery nanoparticle of the Herceptin antibody, the tat peptide and the 111In labeled antisense MORF oligomer will explain why we have successfully demonstrated an Auger electron-mediated, antisense-mediated radiotherapy in cells in culture. One remaining concern is that the delivery nanoparticle may deliver the Auger electron emitting radionuclide to the nucleus of normal cells as well as tumor cells. We have now performed tumored mice studies of the three component delivery nanoparticle with the antisense MORF labeled with Cy3 so that tissue slices could be examined by immunohistology for evidence of MORF accumulations in the nuclei of both tumor and normal tissues. Microscopic examination shows nuclear staining in approximately 20% of the tumor cells in animals injected with the antisense nanoparticle and 10% of the tumor cells in animals receiving the sense nanoparticle, whereas no nuclear staining is seen in the tumor cells of mice given the PBS injection as another control. No nuclear staining was observed in all sections from all normal organs. Finally, my colleagues and I wish to express our gratitude to the DOE for their generous support of our research at a time when the NIH was unwilling to fund what they believed to be a risky« less

Antisense RNAs transcribed from the upstream region of the precore/core promoter of hepatitis B virus.

PubMed

Moriyama, Kosei; Hayashida, Kazuhiro; Shimada, Mitsuo; Nakano, Shuji; Nakashima, Yoshiyuki; Fukumaki, Yasuyuki

2003-07-01

The bidirectional activity of the precore/core promoter of hepatitis B virus (HBV) has been demonstrated in cultured cell lines. However, HBV antisense transcripts (asRNAs) have not been demonstrated in vivo. In the present study using liver tissue from patients with chronic hepatitis, an anchored 5'RACE mapping the 5' ends at position 1680/1681, 1655 or 1609/1602 was carried out. In limited cases, RLM-3'RACE detected asRNAs to terminate at four or five consecutive dT residues in the 0.7 kb downstream region. PCR of oligo(dT)-primed cDNA did not amplify a typical polyadenylated asRNA. RT-PCR using various primers did not detect any spliced forms. Competitive RT-PCR estimated the copy numbers of the asRNAs to be 0.05-0.4 % of total sense RNAs. All sequenced asRNAs had ORF6 but, in one patient, the asRNA initiating at position 1680/1681 had additional initiation and termination codons in front of ORF6. Therefore, asRNAs are transcribed by RNA polymerase III at a low level, encompass a dispensable ORF6 gene and might be retained in the nucleus. The endogenous asRNAs complementary to the common ends of all sense RNAs suggest antisense-mediated self-regulation of hepadnavirus.

Role of spinal p38α and β MAPK in inflammatory hyperalgesia and spinal COX-2 expression

PubMed Central

Fitzsimmons, Bethany L.; Zattoni, Michela; Svensson, Camilla I.; Steinauer, Joanne; Hua, Xiao-Ying; Yaksh, Tony L.

2010-01-01

Pharmacological studies indicate that spinal p38 MAPK plays a role in the development of hyperalgesia. We investigated whether either the spinal isoform p38α or p38β is involved in peripheral inflammation-evoked pain state and increased expression of spinal COX-2. Using intrathecal antisense oligonucleotides, we show that hyperalgesia is prevented by downregulation of p38β but not p38α, while increases in spinal COX-2 protein expression at eight hours is mediated by both p38α and β isoforms. These data suggest that early activation of spinal p38β isoform may affect acute facilitatory processing, and both p38β and α isforms mediate temporally delayed upregulation of spinal COX-2. PMID:20134354

Ninth international symposium on radiopharmacology

DOE Office of Scientific and Technical Information (OSTI.GOV)

NONE

The goal of this Symposium is to provide a forum for those international scientists involved in applying the principles of pharmacology and radiation biology to the development of agents for the diagnosis and treatment of disease. The program will highlight state-of-the-art progress in the development of those agents used in conjunction with some form of radiation such as radiopharmaceuticals, radiopaques, photo- and radiosensitizing drugs, and neutron capture agents. An underlying pharmacokinetic parameter associated with all these agents is the need for site-specific delivery to an organ or tumor. Therefore, a major goal of the symposium will be to address thosemore » pharmacologic principles for targeting molecules to specific tissue sites. Accordingly, session themes will include receptor-mediated processes, membrane transporters, antibody interactions, metabolic trapping, and oligonucleotide-antisense mechanisms.« less

Cadherin-17 is required to maintain pronephric duct integrity during zebrafish development.

PubMed

Horsfield, Julia; Ramachandran, Anassuya; Reuter, Katja; LaVallie, Edward; Collins-Racie, Lisa; Crosier, Kathryn; Crosier, Philip

2002-07-01

We have isolated a zebrafish cadherin that is orthologous to human LI-cadherin (CDH17). Zebrafish cdh17 is expressed exclusively in the pronephric ducts during embryogenesis, and in the mesonephros during larval development and adulthood. Like its mammalian ortholog, cdh17 is also expressed in liver and intestine in adult zebrafish. We show that cdh17-positive mesodermal cells do not contribute to the hematopoietic system. Consistent with a cell adhesion role for Cdh17, depletion of Cdh17 function using antisense morpholino oligonucleotides compromised cell cohesion during pronephric duct formation. Our results indicate that Cdh17 is necessary for maintaining the integrity of the pronephric ducts during zebrafish embryogenesis. This finding contrasts with the role of mammalian CDH17, which does not appear to be involved in nephric development.

Single-fluorophore monitoring of DNA hybridization for investigating the effect of secondary structure on the nucleation step.

PubMed

Jo, Joon-Jung; Kim, Min-Ji; Son, Jung-Tae; Kim, Jandi; Shin, Jong-Shik

2009-07-17

Nucleic acid hybridization is one of the essential biological processes involved in storage and transmission of genetic information. Here we quantitatively determined the effect of secondary structure on the hybridization activation energy using structurally defined oligonucleotides. It turned out that activation energy is linearly proportional to the length of a single-stranded region flanking a nucleation site, generating a 0.18 kcal/mol energy barrier per nucleotide. Based on this result, we propose that the presence of single-stranded segments available for non-productive base pairing with a nucleation counterpart extends the searching process for nucleation sites to find a perfect match. This result may provide insights into rational selection of a target mRNA site for siRNA and antisense gene silencing.

An ATM-independent S-phase checkpoint response involves CHK1 pathway

NASA Technical Reports Server (NTRS)

Zhou, Xiang-Yang; Wang, Xiang; Hu, Baocheng; Guan, Jun; Iliakis, George; Wang, Ya

2002-01-01

After exposure to genotoxic stress, proliferating cells actively slow down the DNA replication through a S-phase checkpoint to provide time for repair. We report that in addition to the ataxia-telangiectasia mutated (ATM)-dependent pathway that controls the fast response, there is an ATM-independent pathway that controls the slow response to regulate the S-phase checkpoint after ionizing radiation in mammalian cells. The slow response of S-phase checkpoint, which is resistant to wortmannin, sensitive to caffeine and UCN-01, and related to cyclin-dependent kinase phosphorylation, is much stronger in CHK1 overexpressed cells, and it could be abolished by Chk1 antisense oligonucleotides. These results provide evidence that the ATM-independent slow response of S-phase checkpoint involves CHK1 pathway.

Biological activity and biotechnological aspects of locked nucleic acids.

PubMed

Lundin, Karin E; Højland, Torben; Hansen, Bo R; Persson, Robert; Bramsen, Jesper B; Kjems, Jørgen; Koch, Troels; Wengel, Jesper; Smith, C I Edvard

2013-01-01

Locked nucleic acid (LNA) is one of the most promising new nucleic acid analogues that has been produced under the past two decades. In this chapter, we have tried to cover many of the different areas, where this molecule has been used to improve the function of synthetic oligonucleotides (ONs). The use of LNA in antisense ONs, including gapmers, splice-switching ONs, and siLNA, as well as antigene ONs, is reviewed. Pharmacokinetics as well as pharmacodynamics of LNA ONs and a description of selected compounds in, or close to, clinical testing are described. In addition, new LNA modifications and the adaptation of enzymes for LNA incorporation are reviewed. Such enzymes may become important for the development of stabilized LNA-containing aptamers. Copyright © 2013 Elsevier Inc. All rights reserved.

Method for widespread microRNA-155 inhibition prolongs survival in ALS-model mice

PubMed Central

Koval, Erica D.; Shaner, Carey; Zhang, Peter; du Maine, Xavier; Fischer, Kimberlee; Tay, Jia; Chau, B. Nelson; Wu, Gregory F.; Miller, Timothy M.

2013-01-01

microRNAs (miRNAs) are dysregulated in a variety of disease states, suggesting that this newly discovered class of gene expression repressors may be viable therapeutic targets. A microarray of miRNA changes in ALS-model superoxide dismutase 1 (SOD1)G93A rodents identified 12 miRNAs as significantly changed. Six miRNAs tested in human ALS tissues were confirmed increased. Specifically, miR-155 was increased 5-fold in mice and 2-fold in human spinal cords. To test miRNA inhibition in the central nervous system (CNS) as a potential novel therapeutic, we developed oligonucleotide-based miRNA inhibitors (anti-miRs) that could inhibit miRNAs throughout the CNS and in the periphery. Anti-miR-155 caused global derepression of targets in peritoneal macrophages and, following intraventricular delivery, demonstrated widespread functional distribution in the brain and spinal cord. After treating SOD1G93A mice with anti-miR-155, we significantly extended survival by 10 days and disease duration by 15 days (38%) while a scrambled control anti-miR did not significantly improve survival or disease duration. Therefore, antisense oligonucleotides may be used to successfully inhibit miRNAs throughout the brain and spinal cord, and miR-155 is a promising new therapeutic target for human ALS. PMID:23740943

Pharmacology of a Central Nervous System Delivered 2′-O-Methoxyethyl–Modified Survival of Motor Neuron Splicing Oligonucleotide in Mice and Nonhuman Primates

PubMed Central

Chun, Seung J.; Norris, Daniel A.; Hung, Gene; Lee, Sam; Matson, John; Fey, Robert A.; Gaus, Hans; Hua, Yimin; Grundy, John S.; Krainer, Adrian R.; Henry, Scott P.; Bennett, C. Frank

2014-01-01

Spinal muscular atrophy (SMA) is a debilitating neuromuscular disease caused by the loss of survival of motor neuron (SMN) protein. Previously, we demonstrated that ISIS 396443, an antisense oligonucleotide (ASO) targeted to the SMN2 pre-mRNA, is a potent inducer of SMN2 exon 7 inclusion and SMN protein expression, and improves function and survival of mild and severe SMA mouse models. Here, we demonstrate that ISIS 396443 is the most potent ASO in central nervous system (CNS) tissues of adult mice, compared with several other chemically modified ASOs. We evaluated methods of ISIS 396443 delivery to the CNS and characterized its pharmacokinetics and pharmacodynamics in rodents and nonhuman primates (NHPs). Intracerebroventricular bolus injection is a more efficient method of delivering ISIS 396443 to the CNS of rodents, compared with i.c.v. infusion. For both methods of delivery, the duration of ISIS 396443–mediated SMN2 splicing correction is long lasting, with maximal effects still observed 6 months after treatment discontinuation. Administration of ISIS 396443 to the CNS of NHPs by a single intrathecal bolus injection results in widespread distribution throughout the spinal cord. Based upon these preclinical studies, we have advanced ISIS 396443 into clinical development. PMID:24784568

Identification and characterization of intracellular proteins that bind oligonucleotides with phosphorothioate linkages.

PubMed

Liang, Xue-hai; Sun, Hong; Shen, Wen; Crooke, Stanley T

2015-03-11

Although the RNase H-dependent mechanism of inhibition of gene expression by chemically modified antisense oligonucleotides (ASOs) has been well characterized, little is known about the interactions between ASOs and intracellular proteins that may alter cellular localization and/or potency of ASOs. Here, we report the identification of 56 intracellular ASO-binding proteins using multi-step affinity selection approaches. Many of the tested proteins had no significant effect on ASO activity; however, some proteins, including La/SSB, NPM1, ANXA2, VARS and PC4, appeared to enhance ASO activities, likely through mechanisms related to subcellular distribution. VARS and ANXA2 co-localized with ASOs in endocytic organelles, and reduction in the level of VARS altered lysosome/ASO localization patterns, implying that these proteins may facilitate ASO release from the endocytic pathway. Depletion of La and NPM1 reduced nuclear ASO levels, suggesting potential roles in ASO nuclear accumulation. On the other hand, Ku70 and Ku80 proteins inhibited ASO activity, most likely by competition with RNase H1 for ASO/RNA duplex binding. Our results demonstrate that phosphorothioate-modified ASOs bind a set of cellular proteins that affect ASO activity via different mechanisms. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Synthesis and conformational properties of oligonucleotides incorporating 2'-O-phosphorylated ribonucleotides as structural motifs of pre-tRNA splicing intermediates.

PubMed

Tsuruoka, H; Shohda, K; Wada, T; Sekine, M

2000-11-03

To synthesize oligonucleotides containing 2'-O-phosphate groups, four kinds of ribonucleoside 3'-phosphoramidite building blocks 6a-d having the bis(2-cyano-1,1-dimethylethoxy)thiophosphoryl (BCMETP) group were prepared according to our previous phosphorylation procedure. These phosphoramidite units 6a-d were not contaminated with 3'-regioisomers and were successfully applied to solid-phase synthesis to give oligodeoxyuridylates 15, 16 and oligouridylates 21, 22. Self-complementary Drew-Dickerson DNA 12mers 24-28 replaced by a 2'-O-phosphorylated ribonucleotide at various positions were similarly synthesized. In these syntheses, it turned out that KI(3) was the most effective reagent for oxidative desulfurization of the initially generated thiophosphate group to the phosphate group on polymer supports. Without using this conversion step, a tridecadeoxyuridylate 17 incorporating a 2'-O-thiophosphorylated uridine derivative was also synthesized. To investigate the effect of the 2'-phosphate group on the thermal stability and 3D-structure of DNA(RNA) duplexes, T(m) measurement of the self-complementary oligonucleotides obtained and MD simulation of heptamer duplexes 33-36 were carried out. According to these analyses, it was suggested that the nucleoside ribose moiety phosphorylated at the 2'-hydroxyl function predominantly preferred C2'-endo to C3'-endo conformation in DNA duplexes so that it did not significantly affect the stability of the DNA duplex. On the other hand, the 2'-modified ribose moiety was expelled to give a C3'-endo conformation in RNA duplexes so that the RNA duplexes were extremely destabilized.

Efficient transfer of information from hexitol nucleic acids to RNA during nonenzymatic oligomerization

NASA Technical Reports Server (NTRS)

Kozlov, I. A.; De Bouvere, B.; Van Aerschot, A.; Herdewijn, P.; Orgel, L. E.

1999-01-01

Hexitol nucleic acids (HNAs) are DNA analogues that contain the standard nucleoside bases attached to a phosphorylated 1,5-anhydrohexitol backbone. We find that HNAs support efficient information transfer in nonensymatic template-directed reactions. HNA heterosequences appeared to be superior to the corresponding DNA heterosequences in facilitating synthesis of complementary oligonucleotides from nucleoside-5'-phosphoro-2-methyl imidazolides.

Electron transfer of plurimodified DNA SAMs.

PubMed

Rospigliosi, Alessandro; Ehlich, Rudolf; Hoerber, Heinrich; Middelberg, Anton; Moggridge, Geoff

2007-07-17

An STM-based current-voltage (I/V) investigation of deoxyribonucleic acid (DNA) 18 base pair (bp) oligonucleotide monolayers on gold is presented. Three bases of each of the immobilized and complementary strands were modified with either iodine or phenylethylene moieties. The oligonucleotides were immobilized on template stripped gold (tsg) surfaces and characterized by atomic force microscopy (AFM) and scanning tunneling microscopy (STM). AFM imaging showed that monolayers of the expected height were formed. A comparative study of normal, halogenated, and phenyl-modified DNA was made with the STM in tunneling spectroscopy (TS) mode. I/V spectroscopic measurements in the range +/-250 mV on both single- and double-stranded (ds) DNA monolayers (modified and unmodified) showed that for negative substrate bias (U(sub)) electron transfer is more efficient through a phenyl-modified monolayer than through normal or halogenated DNA. This effect was particularly clear below a threshold bias of -100 mV. For positive U(sub), unmodified ds DNA was found to conduct slightly better than the modified strands. This is presumably caused by greater order in the unmodified versus modified DNA monolayers. Modifications on the immobilized (thiolated) strand seem to improve electron transport through the DNA monolayer more than modifications on the complementary (not surface-bound) strand.

Array of nucleic acid probes on biological chips for diagnosis of HIV and methods of using the same

DOEpatents

Chee, Mark; Gingeras, Thomas R.; Fodor, Stephen P. A.; Hubble, Earl A.; Morris, MacDonald S.

1999-01-19

The invention provides an array of oligonucleotide probes immobilized on a solid support for analysis of a target sequence from a human immunodeficiency virus. The array comprises at least four sets of oligonucleotide probes 9 to 21 nucleotides in length. A first probe set has a probe corresponding to each nucleotide in a reference sequence from a human immunodeficiency virus. A probe is related to its corresponding nucleotide by being exactly complementary to a subsequence of the reference sequence that includes the corresponding nucleotide. Thus, each probe has a position, designated an interrogation position, that is occupied by a complementary nucleotide to the corresponding nucleotide. The three additional probe sets each have a corresponding probe for each probe in the first probe set. Thus, for each nucleotide in the reference sequence, there are four corresponding probes, one from each of the probe sets. The three corresponding probes in the three additional probe sets are identical to the corresponding probe from the first probe or a subsequence thereof that includes the interrogation position, except that the interrogation position is occupied by a different nucleotide in each of the four corresponding probes.

[Drug resistance reversal of HL-60/ADR cells by simultaneous suppression of XIAP and MRP].

PubMed

Wang, Xiao-Fang; Wang, Chun; Qin, You-Wen; Yan, Shi-Ke; Gao, Yan-Rong

2006-12-01

This study was purposed to explore the mechanisms of drug resistance of HL-60/ADR cells and to compare the reversal drug-resistance effects of antisense oligonucleotides (AS ODN) of XIAP (X-linked inhibitor of apoptosis protein) and AS ODNs of MRP (multidrug resistance-associated protein) by use alone or in combination. Reverse transcription-PCR and Western blot were applied to detect the expression of XIAP, BCL-2, MRP and MDR1 in mRNA and protein levels of HL-60 cells and HL-60/ADR cells, respectively. Fully phosphorothioated AS ODN of XIAP and MRP was delivered into HL-60/ADR cells with Lipofectamine 2000 in the form of liposome-ODN complexes alone or in combination. CCK-8 cell viability assay was used to determine the effect of AS ODN of XIAP and MRP used alone or in combination on the chemotherapy sensitivity of HL-60/ADR cells to daunorubicin (DNR). Reverse transcription-PCR and Western blot were applied to examine the changes of XIAP, MRP in mRNA and protein levels respectively. The results showed that MRP and XIAP were both significantly higher in HL-60/ADR cells than those in HL-60 cells. AS ODN of XIAP and MRP down-regulated the expression of XIAP and MRP in HL-60/ADR cells and increased the sensitivity of HL-60/ADR cells to DNR, respectively. AS ODN of XIAP + MRP did not enhance the inhibition expression of XIAP in HL-60/ADR cells but increased the sensitivity of HL-60/ADR cells to DNR significantly as compared with AS ODN of XIAP (P < 0.05). AS ODN of XIAP + MRP did not increase the concentration of DNR nor enhanced the inhibition expression of MRP in HL-60/ADR cells but increased the sensitivity of HL-60/ADR cells to DNR significantly (P < 0.05), as compared with AS ODN of MRP. It is concluded that both XIAP and MRP may be involved in the drug resistance mechanisms of HL-60/ADR cells. Drug-resistance of HL-60/ADR cells can be reversed significantly when antisense oligonucleotides of XIAP and MRP were used in combination.

Factor XI Antisense Oligonucleotide for Prevention of Venous Thrombosis

PubMed Central

Büller, Harry R.; Bethune, Claudette; Bhanot, Sanjay; Gailani, David; Monia, Brett P.; Raskob, Gary E.; Segers, Annelise; Verhamme, Peter; Weitz, Jeffrey I.

2015-01-01

BACKGROUND Experimental data indicate that reducing factor XI levels attenuates thrombosis without causing bleeding, but the role of factor XI in the prevention of postoperative venous thrombosis in humans is unknown. FXI-ASO (ISIS 416858) is a second-generation antisense oligonucleotide that specifically reduces factor XI levels. We compared the efficacy and safety of FXI-ASO with those of enoxaparin in patients undergoing total knee arthroplasty. METHODS In this open-label, parallel-group study, we randomly assigned 300 patients who were undergoing elective primary unilateral total knee arthroplasty to receive one of two doses of FXI-ASO (200 mg or 300 mg) or 40 mg of enoxaparin once daily. The primary efficacy outcome was the incidence of venous thromboembolism (assessed by mandatory bilateral venography or report of symptomatic events). The principal safety outcome was major or clinically relevant nonmajor bleeding. RESULTS Around the time of surgery, the mean (±SE) factor XI levels were 0.38±0.01 units per milliliter in the 200-mg FXI-ASO group, 0.20±0.01 units per milliliter in the 300-mg FXI-ASO group, and 0.93±0.02 units per milliliter in the enoxaparin group. The primary efficacy outcome occurred in 36 of 134 patients (27%) who received the 200-mg dose of FXI-ASO and in 3 of 71 patients (4%) who received the 300-mg dose of FXI-ASO, as compared with 21 of 69 patients (30%) who received enoxaparin. The 200-mg regimen was noninferior, and the 300-mg regimen was superior, to enoxaparin (P<0.001). Bleeding occurred in 3%, 3%, and 8% of the patients in the three study groups, respectively. CONCLUSIONS This study showed that factor XI contributes to postoperative venous thromboembolism; reducing factor XI levels in patients undergoing elective primary unilateral total knee arthroplasty was an effective method for its prevention and appeared to be safe with respect to the risk of bleeding. (Funded by Isis Pharmaceuticals; FXI-ASO TKA ClinicalTrials.gov number, NCT01713361.) PMID:25482425

Innovative approaches to the use of polyamines for DNA nanoparticle preparation for gene therapy.

PubMed

Vijayanathan, Veena; Agostinelli, Enzo; Thomas, Thresia; Thomas, T J

2014-03-01

Advances in genomic technologies, such as next generation sequencing and disease specific gene targeting through anti-sense, anti-gene, siRNA and microRNA approaches require the transport of nucleic acid drugs through the cell membrane. Membrane transport of DNA/RNA drugs is an inefficient process, and the mechanism(s) by which this process occurs is not clear. A pre-requisite for effective transport of DNA and RNA in cells is their condensation to nanoparticles of ~100 nm size. Although viral vectors are effective in gene therapy, the immune response elicited by viral proteins poses a major challenge. Multivalent cations, such as natural polyamines are excellent promoters of DNA/RNA condensation to nanoparticles. During the past 20 years, our laboratory has synthesized and tested several analogs of the natural polyamine, spermine, for their efficacy to provoke DNA condensation to nanoparticles. We determined the thermodynamics of polyamine-mediated DNA condensation, measured the structural specificity effects of polyamine analogs in facilitating the cellular uptake of oligonucleotides, and evaluated the gene silencing activity of DNA nanoparticles in breast cancer cells. Polyamine-complexed oligonucleotides showed a synergistic effect on target gene inhibition at the mRNA level compared to the use of polyamines and oligonucleotides as single agents. Ionic and structural specificity effects were evident in DNA condensation and cellular transportation effects of polyamines. In condensed DNA structures, correlation exists between the attractive and repulsive forces with structurally different polyamines and cobalt hexamine, indicating the existence of a common force in stabilizing the condensed structures. Future studies aimed at defining the mechanism(s) of DNA compaction and structural features of DNA nanoparticles might aid in the development of novel gene delivery vehicles.

The role of helper lipids in lipid nanoparticles (LNPs) designed for oligonucleotide delivery.

PubMed

Cheng, Xinwei; Lee, Robert J

2016-04-01

Lipid nanoparticles (LNPs) have shown promise as delivery vehicles for therapeutic oligonucleotides, including antisense oligos (ONs), siRNA, and microRNA mimics and inhibitors. In addition to a cationic lipid, LNPs are typically composed of helper lipids that contribute to their stability and delivery efficiency. Helper lipids with cone-shape geometry favoring the formation hexagonal II phase, such as dioleoylphosphatidylethanolamine (DOPE), can promote endosomal release of ONs. Meanwhile, cylindrical-shaped lipid phosphatidylcholine can provide greater bilayer stability, which is important for in vivo application of LNPs. Cholesterol is often included as a helper that improves intracellular delivery as well as LNP stability in vivo. Inclusion of a PEGylating lipid can enhance LNP colloidal stability in vitro and circulation time in vivo but may reduce uptake and inhibit endosomal release at the cellular level. This problem can be addressed by choosing reversible PEGylation in which the PEG moiety is gradually released in blood circulation. pH-sensitive anionic helper lipids, such as fatty acids and cholesteryl hemisuccinate (CHEMS), can trigger low-pH-induced changes in LNP surface charge and destabilization that can facilitate endosomal release of ONs. Generally speaking, there is no correlation between LNP activity in vitro and in vivo because of differences in factors limiting the efficiency of delivery. Designing LNPs requires the striking of a proper balance between the need for particle stability, long systemic circulation time, and the need for LNP destabilization inside the target cell to release the oligonucleotide cargo, which requires the proper selection of both the cationic and helper lipids. Customized design and empirical optimization is needed for specific applications. Copyright © 2016 Elsevier B.V. All rights reserved.

Strategies for In Vivo Screening and Mitigation of Hepatotoxicity Associated with Antisense Drugs.

PubMed

Kamola, Piotr J; Maratou, Klio; Wilson, Paul A; Rush, Kay; Mullaney, Tanya; McKevitt, Tom; Evans, Paula; Ridings, Jim; Chowdhury, Probash; Roulois, Aude; Fairchild, Ann; McCawley, Sean; Cartwright, Karen; Gooderham, Nigel J; Gant, Timothy W; Moores, Kitty; Hughes, Stephen A; Edbrooke, Mark R; Clark, Kenneth; Parry, Joel D

2017-09-15

Antisense oligonucleotide (ASO) gapmers downregulate gene expression by inducing enzyme-dependent degradation of targeted RNA and represent a promising therapeutic platform for addressing previously undruggable genes. Unfortunately, their therapeutic application, particularly that of the more potent chemistries (e.g., locked-nucleic-acid-containing gapmers), has been hampered by their frequent hepatoxicity, which could be driven by hybridization-mediated interactions. An early de-risking of this liability is a crucial component of developing safe, ASO-based drugs. To rank ASOs based on their effect on the liver, we have developed an acute screen in the mouse that can be applied early in the drug development cycle. A single-dose (3-day) screen with streamlined endpoints (i.e., plasma transaminase levels and liver weights) was observed to be predictive of ASO hepatotoxicity ranking established based on a repeat-dose (15 day) study. Furthermore, to study the underlying mechanisms of liver toxicity, we applied transcriptome profiling and pathway analyses and show that adverse in vivo liver phenotypes correlate with the number of potent, hybridization-mediated off-target effects (OTEs). We propose that a combination of in silico OTE predictions, streamlined in vivo hepatotoxicity screening, and a transcriptome-wide selectivity screen is a valid approach to identifying and progressing safer compounds. Copyright © 2017 GSK R&D. Published by Elsevier Inc. All rights reserved.

STEROID RECEPTOR COACTIVATOR 2 (SRC-2) MODULATES STEROID-DEPENDENT MALE SEXUAL BEHAVIOR AND NEUROPLASTICITY IN JAPANESE QUAIL (COTURNIX JAPONICA)

PubMed Central

Niessen, Neville-Andrew; Balthazart, Jacques; Ball, Gregory F.; Charlier, Thierry D.

2011-01-01

Steroid receptor coactivators are necessary for efficient transcriptional regulation by ligand-bound nuclear receptors, including estrogen and androgen receptors. SRC-2 modulates estrogen- and progesterone-dependent sexual behavior in female rats but its implication in the control of male sexual behavior has not been studied to our knowledge. We cloned and sequenced the complete quail SRC-2 transcript and showed by semi-quantitative PCR that SRC-2 expression is nearly ubiquitous, with high levels of expression in the kidney, cerebellum and diencephalon. Real time quantitative PCR did not reveal any differences between intact males and females the medial preoptic nucleus (POM), optic lobes and cerebellum. We next investigated the physiological and behavioral role of this coactivator using in vivo antisense oligonucleotide (AS) techniques. Daily injections in the third ventricle at the level of the POM of locked nucleic acid antisense targeting SRC-2 significantly reduced the expression of testosterone-dependent male-typical copulatory behavior but no inhibition of one aspect of the appetitive sexual behavior was observed. The volume of POM, defined by aromatase-immunoreactive cells, was markedly decreased in animals treated with AS as compared to controls. These results demonstrate that SRC-2 plays a prominent role in the control of steroid-dependent male sexual behavior and its associated neuroplasticity in Japanese quail. PMID:21854393

TSUNAMI: an antisense method to phenocopy splicing-associated diseases in animals

PubMed Central

Sahashi, Kentaro; Hua, Yimin; Ling, Karen K.Y.; Hung, Gene; Rigo, Frank; Horev, Guy; Katsuno, Masahisa; Sobue, Gen; Ko, Chien-Ping; Bennett, C. Frank; Krainer, Adrian R.

2012-01-01

Antisense oligonucleotides (ASOs) are versatile molecules that can be designed to specifically alter splicing patterns of target pre-mRNAs. Here we exploit this feature to phenocopy a genetic disease. Spinal muscular atrophy (SMA) is a motor neuron disease caused by loss-of-function mutations in the SMN1 gene. The related SMN2 gene expresses suboptimal levels of functional SMN protein due to alternative splicing that skips exon 7; correcting this defect—e.g., with ASOs—is a promising therapeutic approach. We describe the use of ASOs that exacerbate SMN2 missplicing and phenocopy SMA in a dose-dependent manner when administered to transgenic Smn−/− mice. Intracerebroventricular ASO injection in neonatal mice recapitulates SMA-like progressive motor dysfunction, growth impairment, and shortened life span, with α-motor neuron loss and abnormal neuromuscular junctions. These SMA-like phenotypes are prevented by a therapeutic ASO that restores correct SMN2 splicing. We uncovered starvation-induced splicing changes, particularly in SMN2, which likely accelerate disease progression. These results constitute proof of principle that ASOs designed to cause sustained splicing defects can be used to induce pathogenesis and rapidly and accurately model splicing-associated diseases in animals. This approach allows the dissection of pathogenesis mechanisms, including spatial and temporal features of disease onset and progression, as well as testing of candidate therapeutics. PMID:22895255

Involvement of neuron-derived orphan receptor-1 (NOR-1) in LDL-induced mitogenic stimulus in vascular smooth muscle cells: role of CREB.

PubMed

Rius, Jordi; Martínez-González, José; Crespo, Javier; Badimon, Lina

2004-04-01

Low density lipoproteins (LDLs) modulate the expression of key genes involved in atherogenesis. Recently, we have shown that the transcription factor neuron-derived orphan receptor-1 (NOR-1) is involved in vascular smooth muscle cell (VSMC) proliferation. Our aim was to analyze whether NOR-1 is involved in LDL-induced mitogenic effects in VSMC. LDL induced NOR-1 expression in a time- and dose-dependent manner. Antisense oligonucleotides against NOR-1 inhibit DNA synthesis induced by LDL in VSMCs as efficiently as antisense against the protooncogene c-fos. The upregulation of NOR-1 mRNA levels by LDL involves pertusis-sensitive G protein-coupled receptors, Ca2+ mobilization, protein kinases A (PKA) and C (PKC) activation, and mitogen-activated protein kinase pathways (MAPK) (p44/p42 and p38). LDL promotes cAMP response element binding protein (CREB) activation (phosphorylation in Ser133). In transfection assays a dominant-negative of CREB inhibits NOR-1 promoter activity, while mutation of specific (cAMP response element) CRE sites in the NOR-1 promoter abolishes LDL-induced NOR-1 promoter activity. In VSMCs, LDL-induced mitogenesis involves NOR-1 upregulation through a CREB-dependent mechanism. CREB could play a role in the modulation by LDL of key genes (containing CRE sites) involved in atherogenesis.

Pseudogene PHBP1 promotes esophageal squamous cell carcinoma proliferation by increasing its cognate gene PHB expression.

PubMed

Feng, Feiyue; Qiu, Bin; Zang, Ruochuan; Song, Peng; Gao, Shugeng

2017-04-25

Natural antisense transcripts (NATs) as one of the most diverse classes of long noncoding RNAs (lncRNAs), have been demonstrated involved in fundamental biological processes in human. Here, we reported that human prohibitin gene pseudogene 1 (PHBP1) was upregulated in ESCC, and increased PHBP1 expression in ESCC was associated with clinical advanced stage. Functional experiments showed that PHBP1 knockdown inhibited ESCC cells proliferation, colony formation and xenograft tumor growth in vitro and in vivo by causing cell-cycle arrest at the G1-G0 phase. Mechanisms analysis revealed that PHBP1 transcript as an antisense transcript of PHB is partially complementary to PHB mRNA and formed an RNA-RNA hybrid with PHB, consequently inducing an increase of PHB expression at both the mRNA and protein levels. Furthermore, PHBP1 expression is strongly correlated with PHB expression in ESCC tissues. Collectively, this study elucidates an important role of PHBP1 in promoting ESCC partly via increasing PHB expression.

Oligonucleotide Array for Identification and Detection of Pythium Species†

PubMed Central

Tambong, J. T.; de Cock, A. W. A. M.; Tinker, N. A.; Lévesque, C. A.

2006-01-01

A DNA array containing 172 oligonucleotides complementary to specific diagnostic regions of internal transcribed spacers (ITS) of more than 100 species was developed for identification and detection of Pythium species. All of the species studied, with the exception of Pythium ostracodes, exhibited a positive hybridization reaction with at least one corresponding species-specific oligonucleotide. Hybridization patterns were distinct for each species. The array hybridization patterns included cluster-specific oligonucleotides that facilitated the recognition of species, including new ones, belonging to groups such as those producing filamentous or globose sporangia. BLAST analyses against 500 publicly available Pythium sequences in GenBank confirmed that species-specific oligonucleotides were unique to all of the available strains of each species, of which there were numerous economically important ones. GenBank entries of newly described species that are not putative synonyms showed no homology to sequences of the spotted species-specific oligonucleotides, but most new species did match some of the cluster-specific oligonucleotides. Further verification of the specificity of the DNA array was done with 50 additional Pythium isolates obtained by soil dilution plating. The hybridization patterns obtained were consistent with the identification of these isolates based on morphology and ITS sequence analyses. In another blind test, total DNA of the same soil samples was amplified and hybridized on the array, and the results were compared to those of 130 Pythium isolates obtained by soil dilution plating and root baiting. The 13 species detected by the DNA array corresponded to the isolates obtained by a combination of soil dilution plating and baiting, except for one new species that was not represented on the array. We conclude that the reported DNA array is a reliable tool for identification and detection of the majority of Pythium species in environmental samples. Simultaneous detection and identification of multiple species of soilborne pathogens such as Pythium species could be a major step forward for epidemiological and ecological studies. PMID:16597974

A novel method for size uniform 200nm particles: multimetallic particles and in vitro gene delivery

NASA Astrophysics Data System (ADS)

Mair, Lamar; Ford, Kris; Superfine, Richard

2008-10-01

We report on the fabrication of arrays of mono- and multimetallic particles via metal evaporation onto lithographically patterned posts. Metal particles evaporated on cylindrical structures 0.20μm in diameter and 0.33μm tall are released via photoresist dissolution, resulting in freely suspended, shape defined particles. These Post-Particles have highly tunable composition, as demonstrated by our deposition of five different multimetallic particle blends. We calculate the susceptibility and magnetization of 200nm Fe particles in an applied 0.081T magnetic field. In order to evaluate their usefulness as magnetofection agents an antisense oligonucleotide designed to correct the aberrant splicing of enhanced green fluorescent protein mRNA was successfully attached to Fe Post-Particles via a polyethyleneimine linker and transfected into a modified HeLa cell line.

Participation of Xenopus Elr-type Proteins in Vegetal mRNA Localization during Oogenesis*

PubMed Central

Arthur, Patrick K.; Claussen, Maike; Koch, Susanne; Tarbashevich, Katsiaryna; Jahn, Olaf; Pieler, Tomas

2009-01-01

Directional transport of specific mRNAs is of primary biological relevance. In Xenopus oocytes, mRNA localization to the vegetal pole is important for germ layer formation and germ cell development. Using a biochemical approach, we identified Xenopus Elr-type proteins, homologs of the Hu/ELAV proteins, as novel components of the vegetal mRNA localization machinery. They bind specifically to the localization elements of several different vegetally localizing Xenopus mRNAs, and they are part of one RNP together with other localization proteins, such as Vg1RBP and XStaufen 1. Blocking Elr-type protein binding by either localization element mutagenesis or antisense morpholino oligonucleotide-mediated masking of their target RNA structures, as well as overexpression of wild type and mutant ElrB proteins, interferes with vegetal localization in Xenopus oocytes. PMID:19458392

Upregulation of PEDF expression by PARP inhibition contributes to the decrease in hyperglycemia-induced apoptosis in HUVECs

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chen Haibing; Department of Ophthalmology, Anhui Provincial Hospital, Hefei; Jia Weiping

2008-05-02

Poly(ADP-ribose)polymerase (PARP) inhibitors decrease angiogenesis through reducing vascular endothelium growth factor (VEGF) induced proliferation, migration, and tube formation of human umbilical vein endothelial cells (HUVECs). In contrast to VEGF, pigment epithelium-derived factor (PEDF) has been demonstrated to act as a strong endogenous inhibitor of angiogenesis. Here, we show that PARP inhibition with a specific inhibitor PJ-34 or specific PARP antisense oligonucleotide upregulates hyperglycemia-induced PEDF expression in HUVECs in a dose-dependent manner. This results in the retard of activation of p38 MAP kinase and the concomitant decrease in cell apoptosis. These results give the first direct demonstration that PEDF might representmore » a target for PARP inhibition treatment and the effects of PEDF on endothelial cells growth are context dependent.« less

Systemic Delivery of Morpholinos to Skip Multiple Exons in a Dog Model of Duchenne Muscular Dystrophy.

PubMed

Maruyama, Rika; Echigoya, Yusuke; Caluseriu, Oana; Aoki, Yoshitsugu; Takeda, Shin'ichi; Yokota, Toshifumi

2017-01-01

Exon-skipping therapy is an emerging approach that uses synthetic DNA-like molecules called antisense oligonucleotides (AONs) to splice out frame-disrupting parts of mRNA, restore the reading frame, and produce truncated yet functional proteins. Multiple exon skipping utilizing a cocktail of AONs can theoretically treat 80-90% of patients with Duchenne muscular dystrophy (DMD). The success of multiple exon skipping by the systemic delivery of a cocktail of AONs called phosphorodiamidate morpholino oligomers (PMOs) in a DMD dog model has made a significant impact on the development of therapeutics for DMD, leading to clinical trials of PMO-based drugs. Here, we describe the systemic delivery of a cocktail of PMOs to skip multiple exons in dystrophic dogs and the evaluation of the efficacies and toxicity in vivo.

Apoptosis-like programmed cell death induces antisense ribosomal RNA (rRNA) fragmentation and rRNA degradation in Leishmania

PubMed Central

Padmanabhan, P K; Samant, M; Cloutier, S; Simard, M J; Papadopoulou, B

2012-01-01

Few natural antisense (as) RNAs have been reported as yet in the unicellular protozoan Leishmania. Here, we describe that Leishmania produces natural asRNAs complementary to all ribosomal RNA (rRNA) species. Interestingly, we show that drug-induced apoptosis-like programmed cell death triggers fragmentation of asRNA complementary to the large subunit gamma (LSU-γ) rRNA, one of the six 28S rRNA processed fragments in Leishmania. Heat and oxidative stress also induce fragmentation of asrRNA, but to a lesser extent. Extensive asrRNA cleavage correlates with rRNA breakdown and translation inhibition. Indeed, overexpression of asLSU-γ rRNA accelerates rRNA degradation upon induction of apoptosis. In addition, we provide mechanistic insight into the regulation of apoptosis-induced asrRNA fragmentation by a 67 kDa ATP-dependent RNA helicase of the DEAD-box subfamily. This helicase binds both sense (s)LSU-γ and asLSU-γ rRNAs, and appears to have a key role in protecting rRNA from degradation by preventing asrRNA cleavage and thus cell death. Remarkably, the asrRNA fragmentation process operates not only in trypanosomatid protozoa but also in mammals. Our findings uncover a novel mechanism of regulation involving asrRNA fragmentation and rRNA breakdown, that is triggered by apoptosis and conditions of reduced translation under stress, and seems to be evolutionary conserved. PMID:22767185

Visualization of nucleic acids with synthetic exciton-controlled fluorescent oligonucleotide probes.

PubMed

Wang, Dan Ohtan; Okamoto, Akimitsu

2015-01-01

Engineered probes to adapt new photochemical properties upon recognition of target nucleic acids offer powerful tools to DNA and RNA visualization technologies. Herein, we describe a rapid and effective visualization method of nucleic acids in both fixed and living cells with hybridization-sensitive fluorescent oligonucleotide probes. These probes are efficiently quenched in an aqueous environment due to the homodimeric, excitonic interactions between fluorophores but become highly fluorescent upon hybridization to DNA or RNA with complementary sequences. The fast hybridization kinetics and quick fluorescence activation of the new probes allow applications to simplify the conventional fluorescent in situ hybridization protocols and reduce the amount of time to process the samples. Furthermore, hybridization-sensitive fluorescence emission of the probes allows monitoring dynamic behaviors of RNA in living cells.

Spiky gold shells on magnetic particles for DNA biosensors.

PubMed

Bedford, Erin E; Boujday, Souhir; Pradier, Claire-Marie; Gu, Frank X

2018-05-15

Combined separation and detection of biomolecules has the potential to speed up and improve the sensitivity of disease detection, environmental testing, and biomolecular analysis. In this work, we synthesized magnetic particles coated with spiky nanostructured gold shells and used them to magnetically separate out and detect oligonucleotides using SERS. The distance dependence of the SERS signal was then harnessed to detect DNA hybridization using a Raman label bound to a hairpin probe. The distance of the Raman label from the surface increased upon complementary DNA hybridization, leading to a decrease in signal intensity. This work demonstrates the use of the particles for combined separation and detection of oligonucleotides without the use of an extrinsic tag or secondary hybridization step. Copyright © 2018 Elsevier B.V. All rights reserved.

Surface enhanced Raman gene probe and methods thereof

DOEpatents

Vo-Dinh, T.

1998-09-29

The subject invention disclosed herein is a new gene probe biosensor and methods based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed thereon. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means supporting the SERS active substrate includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays. 18 figs.

Surface enhanced Raman gene probe and methods thereof

DOEpatents

Vo-Dinh, Tuan

1998-01-01

The subject invention disclosed herein is a new gene probe biosensor and methods thereof based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed thereon. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means supporting the SERS active substrate includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays.

Surface enhanced Raman gene probe and methods thereof

DOEpatents

Vo-Dinh, T.

1998-02-24

The subject invention disclosed is a new gene probe biosensor and methods based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed thereon. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays. 18 figs.

Boron nitride nanotubes for gene silencing.

PubMed

Şen, Özlem; Çobandede, Zehra; Emanet, Melis; Bayrak, Ömer Faruk; Çulha, Mustafa

2017-09-01

Non-viral gene delivery is increasingly investigated as an alternative to viral vectors due to low toxicity and immunogenicity, easy preparation, tissue specificity, and ability to transfer larger sizes of genes. In this study, boron nitride nanotubes (BNNTs) are functionalized with oligonucleotides (oligo-BNNTs). The morpholinos complementary to the oligonucleotides attached to the BNNTs (morpholino/oligo-BNNTs) are hybridized to silence the luciferase gene. The morpholino/oligo-BNNTs conjugates are administered to luciferase-expressing cells (MDA-MB-231-luc2) and the luciferase activity is monitored. The luciferase activity is decreased when MDA-MB-231-luc2 cells were treated with morpholino/oligo-BNNTs. The study suggests that BNNTs can be used as a potential vector to transfect cells. BNNTs are potential new nanocarriers for gene delivery applications. Copyright © 2017 Elsevier B.V. All rights reserved.

Surface enhanced Raman gene probe and methods thereof

DOEpatents

Vo-Dinh, T.

1998-07-21

The subject invention disclosed is a new gene probe biosensor and methods based on surface enhanced Raman scattering (SERS) label detection. The SER gene probe biosensor comprises a support means, a SER gene probe having at least one oligonucleotide strand labeled with at least one SERS label, and a SERS active substrate disposed on the support means and having at least one of the SER gene probes adsorbed. Biotargets such as bacterial and viral DNA, RNA and PNA are detected using a SER gene probe via hybridization to oligonucleotide strands complementary to the SER gene probe. The support means supporting the SERS active substrate includes a fiberoptic probe, an array of fiberoptic probes for performance of multiple assays and a waveguide microsensor array with charge-coupled devices or photodiode arrays. 18 figs.

Biology of Symbioses between Marine Invertebrates and Intracellular Bacteria

DTIC Science & Technology

1990-01-30

bisphosphate carboxylase We designed from published sequence information oligonucleotide primers which are complementary to conserved regions on RubisCO ...large and small subunit genes. These primers were used successfully to amplify using polymerase chain reaction (PCR) specific regions of RubisCO ...for the large subunit of ribulose bisphosphate carboxylase/oxygenase ( RubisCO ) to symbiont DNA shows that the symbionts from both deep-sea and shallow

Labeled nucleotide phosphate (NP) probes

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2009-02-03

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Composition for nucleic acid sequencing

DOEpatents

Korlach, Jonas [Ithaca, NY; Webb, Watt W [Ithaca, NY; Levene, Michael [Ithaca, NY; Turner, Stephen [Ithaca, NY; Craighead, Harold G [Ithaca, NY; Foquet, Mathieu [Ithaca, NY

2008-08-26

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-06-06

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.