DOE Office of Scientific and Technical Information (OSTI.GOV)
Gandhi, P.; Dhillon, V. S.; Durant, M.
2010-07-15
In a fast multi-wavelength timing study of black hole X-ray binaries (BHBs), we have discovered correlated optical and X-ray variability in the low/hard state of two sources: GX 339-4 and SWIFT J1753.5-0127. After XTE J1118+480, these are the only BHBs currently known to show rapid (sub-second) aperiodic optical flickering. Our simultaneous VLT/Ultracam and RXTE data reveal intriguing patterns with characteristic peaks, dips and lags down to very short timescales. Simple linear reprocessing models can be ruled out as the origin of the rapid, aperiodic optical power in both sources. A magnetic energy release model with fast interactions between the disk,more » jet and corona can explain the complex correlation patterns. We also show that in both the optical and X-ray light curves, the absolute source variability r.m.s. amplitude linearly increases with flux, and that the flares have a log-normal distribution. The implication is that variability at both wavelengths is not due to local fluctuations alone, but rather arises as a result of coupling of perturbations over a wide range of radii and timescales. These 'optical and X-ray rms-flux relations' thus provide new constraints to connect the outer and inner parts of the accretion flow, and the jet.« less
Creating aperiodic photonic structures by synthesized Mathieu-Gauss beams
NASA Astrophysics Data System (ADS)
Vasiljević, Jadranka M.; Zannotti, Alessandro; Timotijević, Dejan V.; Denz, Cornelia; Savić, Dragana M. Jović
2017-08-01
We demonstrate a kind of aperiodic photonic structure realized using the interference of multiple Mathieu-Gauss beams. Depending on the beam configurations, their mutual distances, angles of rotation, or phase relations we are able to observe different classes of such aperiodic optically induced refractive index structures. Our experimental approach is based on the optical induction in a single parallel writing process.
Variable Stars Observed in the Galactic Disk by AST3-1 from Dome A, Antarctica
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Lingzhi; Ma, Bin; Hu, Yi
AST3-1 is the second-generation wide-field optical photometric telescope dedicated to time-domain astronomy at Dome A, Antarctica. Here, we present the results of an i -band images survey from AST3-1 toward one Galactic disk field. Based on time-series photometry of 92,583 stars, 560 variable stars were detected with i magnitude ≤16.5 mag during eight days of observations; 339 of these are previously unknown variables. We tentatively classify the 560 variables as 285 eclipsing binaries (EW, EB, and EA), 27 pulsating variable stars ( δ Scuti, γ Doradus, δ Cephei variable, and RR Lyrae stars), and 248 other types of variables (unclassifiedmore » periodic, multiperiodic, and aperiodic variable stars). Of the eclipsing binaries, 34 show O’Connell effects. One of the aperiodic variables shows a plateau light curve and another variable shows a secondary maximum after peak brightness. We also detected a complex binary system with an RS CVn-like light-curve morphology; this object is being followed-up spectroscopically using the Gemini South telescope.« less
Sparse aperiodic arrays for optical beam forming and LIDAR.
Komljenovic, Tin; Helkey, Roger; Coldren, Larry; Bowers, John E
2017-02-06
We analyze optical phased arrays with aperiodic pitch and element-to-element spacing greater than one wavelength at channel counts exceeding hundreds of elements. We optimize the spacing between waveguides for highest side-mode suppression providing grating lobe free steering in full visible space while preserving the narrow beamwidth. Optimum waveguide placement strategies are derived and design guidelines for sparse (> 1.5 λ and > 3 λ average element spacing) optical phased arrays are given. Scaling to larger array areas by means of tiling is considered.
Broadband continuous-variable entanglement source using a chirped poling nonlinear crystal
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhao, J. S.; Sun, L.; Yu, X. Q.
2010-01-15
Aperiodically poled nonlinear crystal can be used as a broadband continuous-variable entanglement source and has strong stability under perturbations. We study the conversion dynamics of the sum-frequency generation and the quantum correlation of the two pump fields in a chirped-structure nonlinear crystal using the quantum stochastic method. The results show that there exists a frequency window for the pumps where two optical fields can perform efficient upconversion. The two pump fields are demonstrated to be entangled in the window and the chirped-structure crystal can be used as a continuous-variable entanglement source with a broad response bandwidth.
High performance EUV multilayer structures insensitive to capping layer optical parameters.
Pelizzo, Maria Guglielmina; Suman, Michele; Monaco, Gianni; Nicolosi, Piergiorgio; Windt, David L
2008-09-15
We have designed and tested a-periodic multilayer structures containing protective capping layers in order to obtain improved stability with respect to any possible changes of the capping layer optical properties (due to oxidation and contamination, for example)-while simultaneously maximizing the EUV reflection efficiency for specific applications, and in particular for EUV lithography. Such coatings may be particularly useful in EUV lithographic apparatus, because they provide both high integrated photon flux and higher stability to the harsh operating environment, which can affect seriously the performance of the multilayer-coated projector system optics. In this work, an evolutive algorithm has been developed in order to design these a-periodic structures, which have been proven to have also the property of stable performance with respect to random layer thickness errors that might occur during coating deposition. Prototypes have been fabricated, and tested with EUV and X-ray reflectometry, and secondary electron spectroscopy. The experimental results clearly show improved performance of our new a-periodic coatings design compared with standard periodic multilayer structures.
Photonic crystals: role of architecture and disorder on spectral properties.
Verma, Rupesh; Audhkhasi, Romil; Thyagarajan, Krishna; Banerjee, Varsha
2018-03-01
Many of the present-day optical devices use photonic crystals. These are multilayers of dielectric media that control the reflection and transmission of light falling on them. In this paper, we study the optical properties of periodic, fractal, and aperiodic photonic crystals and compare them based on their attributes. Our calculations of the band reflectivity and degree of robustness reveal novel features, e.g., fractal photonic crystals are found to reflect the maximum amount of incident light. On the other hand, aperiodic photonic crystals have the largest immunity to disorder. We believe that such properties will be useful in a variety of applications in the field of optical communication.
NASA Astrophysics Data System (ADS)
Namin, Frank Farhad A.
Quasicrystalline solids were first observed in nature in 1980s. Their lattice geometry is devoid of translational symmetry; however it possesses long-range order as well as certain orders of rotational symmetry forbidden by translational symmetry. Mathematically, such lattices are related to aperiodic tilings. Since their discovery there has been great interest in utilizing aperiodic geometries for a wide variety of electromagnetic (EM) and optical applications. The first thrust of this dissertation addresses applications of quasicrystalline geometries for wideband antenna arrays and plasmonic nano-spherical arrays. The first application considered is the design of suitable antenna arrays for micro-UAV (unmanned aerial vehicle) swarms based on perturbation of certain types of aperiodic tilings. Due to safety reasons and to avoid possible collision between micro-UAVs it is desirable to keep the minimum separation distance between the elements several wavelengths. As a result typical periodic planar arrays are not suitable, since for periodic arrays increasing the minimum element spacing beyond one wavelength will lead to the appearance of grating lobes in the radiation pattern. It will be shown that using this method antenna arrays with very wide bandwidths and low sidelobe levels can be designed. It will also be shown that in conjunction with a phase compensation method these arrays show a large degree of versatility to positional noise. Next aperiodic aggregates of gold nano-spheres are studied. Since traditional unit cell approaches cannot be used for aperiodic geometries, we start be developing new analytical tools for aperiodic arrays. A modified version of generalized Mie theory (GMT) is developed which defines scattering coefficients for aperiodic spherical arrays. Next two specific properties of quasicrystalline gold nano-spherical arrays are considered. The optical response of these arrays can be explained in terms of the grating response of the array (photonic resonance) and the plasmonic response of the spheres (plasmonic resonance). In particular the couplings between the photonic and plasmonic modes are studied. In periodic arrays this coupling leads to the formation of a so called photonic-plasmonic hybrid mode. The formation of hybrid modes is studied in quasicrystalline arrays. Quasicrystalline structures in essence possess several periodicities which in some cases can lead to the formation of multiple hybrid modes with wider bandwidths. It is also demonstrated that the performance of these arrays can be further enhanced by employing a perturbation method. The second property considered is local field enhancements in quasicrystalline arrays of gold nanospheres. It will be shown that despite a considerably smaller filling factor quasicrystalline arrays generate larger local field enhancements which can be even further enhanced by optimally placing perturbing spheres within the prototiles that comprise the aperiodic arrays. The second thrust of research in this dissertation focuses on designing all-dielectric filters and metamaterial coatings for the optical range. In higher frequencies metals tend to have a high loss and thus they are not suitable for many applications. Hence dielectrics are used for applications in optical frequencies. In particular we focus on designing two types of structures. First a near-perfect optical mirror is designed. The design is based on optimizing a subwavelength periodic dielectric grating to obtain appropriate effective parameters that will satisfy the desired perfect mirror condition. Second, a broadband anti-reflective all-dielectric grating with wide field of view is designed. The second design is based on a new computationally efficient genetic algorithm (GA) optimization method which shapes the sidewalls of the grating based on optimizing the roots of polynomial functions.
Aperiodic nanoplasmonic devices for directional colour filtering and sensing.
Davis, Matthew S; Zhu, Wenqi; Xu, Ting; Lee, Jay K; Lezec, Henri J; Agrawal, Amit
2017-11-07
Exploiting the wave-nature of light in its simplest form, periodic architectures have enabled a panoply of tunable optical devices with the ability to perform useful functions such as filtering, spectroscopy, and multiplexing. Here, we remove the constraint of structural periodicity to enhance, simultaneously, the performance and functionality of passive plasmonic devices operating at optical frequencies. By using a physically intuitive, first-order interference model of plasmon-light interactions, we demonstrate a simple and efficient route towards designing devices with flexible, multi-spectral optical response, fundamentally not achievable using periodic architectures. Leveraging this approach, we experimentally implement ultra-compact directional light-filters and colour-sorters exhibiting angle- or spectrally-tunable optical responses with high contrast, and low spectral or spatial crosstalk. Expanding the potential of aperiodic systems to implement tailored spectral and angular responses, these results hint at promising applications in solar-energy harvesting, optical signal multiplexing, and integrated sensing.
NASA Astrophysics Data System (ADS)
Semena, Andrey N.; Revnivtsev, Mikhail G.; Buckley, David A. H.; Kotze, Marissa M.; Khabibullin, Ildar I.; Breytenbach, Hannes; Gulbis, Amanda A. S.; Coppejans, Rocco; Potter, Stephen B.
2014-08-01
We present results of a study of the fast timing variability of the magnetic cataclysmic variable (mCV) EX Hya. It was previously shown that one may expect the rapid flux variability of mCVs to be smeared out at time-scales shorter than the cooling time of hot plasma in the post-shock region of the accretion curtain near the white dwarf (WD) surface. Estimates of the cooling time and the mass accretion rate, thus provide us with a tool to measure the density of the post-shock plasma and the cross-sectional area of the accretion funnel at the WD surface. We have probed the high frequencies in the aperiodic noise of one of the brightest mCV EX Hya with the help of optical telescopes, namely Southern African Large Telescope and the South African Astronomical Observatory 1.9 m telescope. We place upper limits on the plasma cooling time-scale τ < 0.3 s, on the fractional area of the accretion curtain footprint f < 1.6 × 10-4, and a lower limit on the specific mass accretion rate Ṁ/A>3 g s-1 cm-2. We show that measurements of accretion column footprints via eclipse mapping highly overestimate their areas. We deduce a value of Δr/r ≲ 10- 3 as an upper limit to the penetration depth of the accretion disc plasma at the boundary of the magnetosphere.
Wu, Jiaye; Yang, Xiangbo
2017-10-30
In this paper, we construct a 1D PT-symmetric Thue-Morse aperiodic optical waveguide network (PTSTMAOWN) and mainly investigate the ultrastrong extraordinary transmission and reflection. We propose an approach to study the photonic modes and solve the problem of calculating photonic modes distributions in aperiodic networks due to the lack of dispersion functions and find that in a PTSTMAOWN there exist more photonic modes and more spontaneous PT-symmetric breaking points, which are quite different from other reported PT-symmetric optical systems. Additionally, we develop a method to sort spontaneous PT-symmetric breaking point zones to seek the strongest extraordinary point and obtain that at this point the strongest extraordinary transmission and reflection arrive at 2.96316 × 10 5 and 1.32761 × 10 5 , respectively, due to the PT-symmetric coupling resonance and the special symmetry pattern of TM networks. These enormous gains are several orders of magnitude larger than the previous results. This optical system may possess potential in designing optical amplifier, optical logic elements in photon computers and ultrasensitive optical switches with ultrahigh monochromatity.
Analysis of Nonlinear Periodic and Aperiodic Media: Application to Optical Logic Gates
NASA Astrophysics Data System (ADS)
Yu, Yisheng
This dissertation is about the analysis of nonlinear periodic and aperiodic media and their application to the design of intensity controlled all optical logic gates: AND, OR, and NOT. A coupled nonlinear differential equation that characterizes the electromagnetic wave propagation in a nonlinear periodic (and aperiodic) medium has been derived from the first principle. The equations are general enough that it reflects the effect of transverse modal fields and can be used to analyze both co-propagating and counter propagating waves. A numerical technique based on the finite differences method and absorbing boundary condition has been developed to solve the coupled differential equations here. The numerical method is simple and accurate. Unlike the method based on characteristics that has been reported in the literature, this method does not involve integration and step sizes of time and space coordinates are decoupled. The decoupling provides independent choice for time and space step sizes. The concept of "gap soliton" has also been re-examined. The dissertation consists of four manuscripts. Manuscript I reports on the design of all optical logic gates: AND, OR, and NOT based on the bistability property of nonlinear periodic and aperiodic waveguiding structures. The functioning of the logic gates has been shown by analysis. The numerical technique that has been developed to solve the nonlinear differential equations are addressed in manuscript II. The effect of transverse modal fields on the bistable property of nonlinear periodic medium is reported in manuscript III. The concept of "gap soliton" that are generated in a nonlinear periodic medium has been re-examined. The details on the finding of the re-examination are discussed in manuscript IV.
NASA Astrophysics Data System (ADS)
Gerke, Tim D.
Presented in this thesis is an investigation into aperiodic volume optical devices. The three main topics of research and discussion are the aperiodic volume optical devices that we call computer-generated volume holograms (CGVH), defects within periodic 3D photonic crystals, and non-periodic, but ordered 3D quasicrystals. The first of these devices, CGVHs, are designed and investigated numerically and experimentally. We study the performance of multi-layered amplitude computer-generated volume holograms in terms of efficiency and angular/frequency selectivity. Simulation results show that such aperiodic devices can increase diffraction efficiency relative to periodic amplitude volume holograms while maintaining angular and wavelength selectivity. CGVHs are also designed as voxelated volumes using a new projection optimization algorithm. They are investigated using a volumetric diffraction simulation and a standard 3D beam propagation technique as well as experimentally. Both simulation and experiment verify that the structures function according to their design. These represent the first diffractive structures that have the capacity for generating arbitrary transmission and reflection wave fronts and that provide the ability for multiplexing arbitrary functionality given different illumination conditions. Also investigated and discussed in this thesis are 3D photonic crystals and quasicrystals. We demonstrate that these devices can be fabricated using a femtosecond laser direct writing system that is particularly appropriate for fabrication of such arbitrary 3D structures. We also show that these devices can provide 3D partial bandgaps which could become complete bandgaps if fabricated using high index materials or by coating lower index materials with high index metals. Our fabrication method is particularly suited to the fabrication of engineered defects within the periodic or quasi-periodic systems. We demonstrate the potential for fabricating defects within periodic and quasi-periodic systems for the manipulation of light in the IR regime. The general thesis of this document is that aperiodic three-dimensional structures provide additional degrees of freedom that can be utilized to improve on the performance of periodic volume devices. The results we will discuss suggest that, under certain circumstances, a departure from the Bragg paradigm provides enhanced volume diffraction properties.
NASA Astrophysics Data System (ADS)
Guo, Min; Su, Haijun; Zhang, Jun; Liu, Lin; Fu, Nianqing; Yong, Zehui; Huang, Haitao; Xie, Keyu
2017-03-01
Design of more effective broadband light-trapping elements to improve the light harvesting efficiency under both normal and tilted light for solar cells and other photonic devices is highly desirable. Herein we present a theoretical analysis on the optical properties of a novel TiO2 nanotube aperiodic photonic crystal (NT APC) following an aperiodic sequences and its photocurrent enhancement effect for dye-sensitized solar cells (DSSCs) under various incidence angles. It is found that, compared to regular PC, the designed TiO2 NT APC owns broader reflection region and a desired omnidirectional reflection (ODR) bandgaps, leading to considerable and stable photocurrent enhancement under both normal and oblique light. The effects of the structural parameters of the TiO2 NT APC, including the average lattice constant and the common sequence difference, on the optical properties, ODR bandgaps and absorption magnification of the integrated DSSCs are investigated in detail. Moreover, the angular dependence of photocurrent enhancement and angular compensation effect of such TiO2 NT APCs are also provided to offer a guidance on the optimum structural parameters design under different engineering application conditions.
Sale, Martin V.; Rogasch, Nigel C.; Nordstrom, Michael A.
2016-01-01
The amplitude of motor-evoked potentials (MEPs) elicited with transcranial magnetic stimulation (TMS) varies from trial-to-trial. Synchronous oscillations in cortical neuronal excitability contribute to this variability, however it is not known how different frequencies of stimulation influence MEP variability, and whether these oscillations are rhythmic or aperiodic. We stimulated the motor cortex with TMS at different regular (i.e., rhythmic) rates, and compared this with pseudo-random (aperiodic) timing. In 18 subjects, TMS was applied at three regular frequencies (0.05 Hz, 0.2 Hz, 1 Hz) and one aperiodic frequency (mean 0.2 Hz). MEPs (n = 50) were recorded from three intrinsic hand muscles of the left hand with different functional and anatomical relations. MEP amplitude correlation was highest for the functionally related muscle pair, less for the anatomically related muscle pair and least for the functionally- and anatomically-unrelated muscle pair. MEP correlations were greatest with 1 Hz, and least for stimulation at 0.05 Hz. Corticospinal neuron synchrony is higher with shorter TMS intervals. Further, corticospinal neuron synchrony is similar irrespective of whether the stimulation is periodic or aperiodic. These findings suggest TMS frequency is a crucial consideration for studies using TMS to probe correlated activity between muscle pairs. PMID:27014031
Gürkan Figen, Ziya; Aytür, Orhan; Arıkan, Orhan
2016-03-20
In this paper, we design aperiodic gratings based on orientation-patterned gallium arsenide (OP-GaAs) for converting 2.1 μm pump laser radiation into long-wave infrared (8-12 μm) in an idler-efficiency-enhanced scheme. These single OP-GaAs gratings placed in an optical parametric oscillator (OPO) or an optical parametric generator (OPG) can simultaneously phase match two optical parametric amplification (OPA) processes, OPA 1 and OPA 2. We use two design methods that allow simultaneous phase matching of two arbitrary χ(2) processes and also free adjustment of their relative strength. The first aperiodic grating design method (Method 1) relies on generating a grating structure that has domain walls located at the zeros of the summation of two cosine functions, each of which has a spatial frequency that equals one of the phase-mismatch terms of the two processes. Some of the domain walls are discarded considering the minimum domain length that is achievable in the production process. In this paper, we propose a second design method (Method 2) that relies on discretizing the crystal length with sample lengths that are much smaller than the minimum domain length and testing each sample's contribution in such a way that the sign of the nonlinearity maximizes the magnitude sum of the real and imaginary parts of the Fourier transform of the grating function at the relevant phase mismatches. Method 2 produces a similar performance as Method 1 in terms of the maximization of the height of either Fourier peak located at the relevant phase mismatch while allowing an adjustable relative height for the two peaks. To our knowledge, this is the first time that aperiodic OP-GaAs gratings have been proposed for efficient long-wave infrared beam generation based on simultaneous phase matching.
Broadband and broadangle SPP antennas based on plasmonic crystals with linear chirp.
Bouillard, J-S; Vilain, S; Dickson, W; Wurtz, G A; Zayats, A V
2012-01-01
Plasmonic technology relies on the coupling of light to surface electromagnetic modes on smooth or structured metal surfaces. While some applications utilise the resonant nature of surface polaritons, others require broadband characteristics. We demonstrate unidirectional and broadband plasmonic antennas with large acceptance angles based on chirped plasmonic gratings. Near-field optical measurements have been used to visualise the excitation of surface plasmon polaritons by such aperiodic structures. These weakly aperiodic plasmonic crystals allow the formation of a trapped rainbow-type effect in a two-dimensional geometry as surface polaritons of different frequencies are coherently excited in different locations over the plasmonic structure. Both the crystal's finite size and the finite lifetime of plasmonic states are crucial for the generation of broadband surface plasmon polaritons. This approach presents new opportunities for building unidirectional, broadband and broad-angle plasmonic couplers for sensing purposes, information processing, photovoltaic applications and shaping and manipulating ultrashort optical pulses.
Broadband and broadangle SPP antennas based on plasmonic crystals with linear chirp
Bouillard, J.-S; Vilain, S.; Dickson, W.; Wurtz, G. A.; Zayats, A. V.
2012-01-01
Plasmonic technology relies on the coupling of light to surface electromagnetic modes on smooth or structured metal surfaces. While some applications utilise the resonant nature of surface polaritons, others require broadband characteristics. We demonstrate unidirectional and broadband plasmonic antennas with large acceptance angles based on chirped plasmonic gratings. Near-field optical measurements have been used to visualise the excitation of surface plasmon polaritons by such aperiodic structures. These weakly aperiodic plasmonic crystals allow the formation of a trapped rainbow-type effect in a two-dimensional geometry as surface polaritons of different frequencies are coherently excited in different locations over the plasmonic structure. Both the crystal's finite size and the finite lifetime of plasmonic states are crucial for the generation of broadband surface plasmon polaritons. This approach presents new opportunities for building unidirectional, broadband and broad-angle plasmonic couplers for sensing purposes, information processing, photovoltaic applications and shaping and manipulating ultrashort optical pulses. PMID:23170197
Combinations of response-reinforcer relations in periodic and aperiodic schedules.
Kuroda, Toshikazu; Cançado, Carlos R X; Lattal, Kennon A; Elcoro, Mirari; Dickson, Chata A; Cook, James E
2013-03-01
Key pecking of 4 pigeons was studied under a two-component multiple schedule in which food deliveries were arranged according to a fixed and a variable interfood interval. The percentage of response-dependent food in each component was varied, first in ascending (0, 10, 30, 70 and 100%) and then in descending orders, in successive conditions. The change in response rates was positively related to the percentage of response-dependent food in each schedule component. Across conditions, positively accelerated and linear patterns of responding occurred consistently in the fixed and variable components, respectively. These results suggest that the response-food dependency determines response rates in periodic and aperiodic schedules, and that the temporal distribution of food determines response patterns independently of the response-food dependency. Running rates, but not postfood pauses, also were positively related to the percentage of dependent food in each condition, in both fixed and variable components. Thus, the relation between overall response rate and the percentage of dependent food was mediated by responding that occurred after postfood pausing. The findings together extend previous studies wherein the dependency was either always present or absent, and increase the generality of the effects of variations in the response-food dependency from aperiodic to periodic schedules. © Society for the Experimental Analysis of Behavior.
Testing the relativistic Doppler boost hypothesis for supermassive black hole binary candidates
NASA Astrophysics Data System (ADS)
Charisi, Maria; Haiman, Zoltán; Schiminovich, David; D'Orazio, Daniel J.
2018-06-01
Supermassive black hole binaries (SMBHBs) should be common in galactic nuclei as a result of frequent galaxy mergers. Recently, a large sample of sub-parsec SMBHB candidates was identified as bright periodically variable quasars in optical surveys. If the observed periodicity corresponds to the redshifted binary orbital period, the inferred orbital velocities are relativistic (v/c ≈ 0.1). The optical and ultraviolet (UV) luminosities are expected to arise from gas bound to the individual BHs, and would be modulated by the relativistic Doppler effect. The optical and UV light curves should vary in tandem with relative amplitudes which depend on the respective spectral slopes. We constructed a control sample of 42 quasars with aperiodic variability, to test whether this Doppler colour signature can be distinguished from intrinsic chromatic variability. We found that the Doppler signature can arise by chance in ˜20 per cent (˜37 per cent) of quasars in the nUV (fUV) band. These probabilities reflect the limited quality of the control sample and represent upper limits on how frequently quasars mimic the Doppler brightness+colour variations. We performed separate tests on the periodic quasar candidates, and found that for the majority, the Doppler boost hypothesis requires an unusually steep UV spectrum or an unexpectedly large BH mass and orbital velocity. We conclude that at most approximately one-third of these periodic candidates can harbor Doppler-modulated SMBHBs.
Single photons to multiple octaves: Engineering nonlinear optics in micro- and nano-structured media
2017-05-18
generation and amplification of ultrafast IR pulses. Both efforts took advantage of microstructured nonlinear media, e.g. quasi -phasematched (QPM...enhance the wave-mixing efficiency, especially for low-power devices. Because errors in fabrication of waveguides and quasi - phasematching gratings are... experimental demonstration of optical parametric chirped pulse amplifiers (OPCPA) in apodized aperiodic QPMgratings for high repetition rate, high
Quasi-periodic Pulse Amplitude Modulation in the Accreting Millisecond Pulsar IGR J00291+5934
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bult, Peter; Doesburgh, Marieke van; Klis, Michiel van der
We introduce a new method for analyzing the aperiodic variability of coherent pulsations in accreting millisecond X-ray pulsars (AMXPs). Our method involves applying a complex frequency correction to the time-domain light curve, allowing for the aperiodic modulation of the pulse amplitude to be robustly extracted in the frequency domain. We discuss the statistical properties of the resulting modulation spectrum and show how it can be correlated with the non-pulsed emission to determine if the periodic and aperiodic variability are coupled processes. Using this method, we study the 598.88 Hz coherent pulsations of the AMXP IGR J00291+5934 as observed with themore » Rossi X-ray Timing Explorer and XMM-Newton . We demonstrate that our method easily confirms the known coupling between the pulsations and a strong 8 mHz quasi-periodic oscillation (QPO) in XMM-Newton observations. Applying our method to the RXTE observations, we further show, for the first time, that the much weaker 20 mHz QPO and its harmonic are also coupled with the pulsations. We discuss the implications of this coupling and indicate how it may be used to extract new information on the underlying accretion process.« less
Lyapunov exponents for one-dimensional aperiodic photonic bandgap structures
NASA Astrophysics Data System (ADS)
Kissel, Glen J.
2011-10-01
Existing in the "gray area" between perfectly periodic and purely randomized photonic bandgap structures are the socalled aperoidic structures whose layers are chosen according to some deterministic rule. We consider here a onedimensional photonic bandgap structure, a quarter-wave stack, with the layer thickness of one of the bilayers subject to being either thin or thick according to five deterministic sequence rules and binary random selection. To produce these aperiodic structures we examine the following sequences: Fibonacci, Thue-Morse, Period doubling, Rudin-Shapiro, as well as the triadic Cantor sequence. We model these structures numerically with a long chain (approximately 5,000,000) of transfer matrices, and then use the reliable algorithm of Wolf to calculate the (upper) Lyapunov exponent for the long product of matrices. The Lyapunov exponent is the statistically well-behaved variable used to characterize the Anderson localization effect (exponential confinement) when the layers are randomized, so its calculation allows us to more precisely compare the purely randomized structure with its aperiodic counterparts. It is found that the aperiodic photonic systems show much fine structure in their Lyapunov exponents as a function of frequency, and, in a number of cases, the exponents are quite obviously fractal.
Infantile aperiodic alternating nystagmus.
Hertle, Richard W; Reznick, Leah; Yang, Dongsheng
2009-01-01
This study identifies the clinical and ocular motility characteristics of the periodic and aperiodic forms of infantile alternating nystagmus (IAPAN) and establishes the range of electrophysiological and clinical characteristics while providing clues to its presence and pathophysiology. Seventy-eight patients with ocular oscillations consistent with IAPAN were reported. Outcome variables were: age, follow-up in months, vision, strabismus, other eye and systemic abnormalities, head position, periodicity, cycle and null period duration, foveation time, waveforms, and cycle symmetry. Age range was 1 to 67 years, 50% had pure periodic and aperiodic forms, 46% had albinism, 26% had binocular acuity of 20/40 or greater, 72% had strabismus, 35% had amblyopia, 31% had other eye disease, 14% had systemic disease, 87% had an anomalous head posture, and 65% had binocular directional asymmetry. The periodic cycle averaged 224 seconds and the aperiodic cycle ranged from 2 to more than 300 seconds. One in three patients with strabismus and nystagmus periodicity had a static head posture. Fifteen percent of the infantile nystagmus syndrome population had either the periodic or aperiodic form. A changing null period is often clinically missed because of long or irregular cycles, decreased acuity, associated strabismus, and either a nonexistent or inconsistent head posture. The changing null period is easier to recognize using eye movement recordings or if the non-preferred eye is occluded and the preferred eye is examined with the head straight and gaze in primary position for at least 5 to 7 minutes. The recognition of this variant has profound treatment implications.
Periodic and Aperiodic Variability in the Molecular Cloud ρ Ophiuchus
NASA Astrophysics Data System (ADS)
Parks, J. Robert; Plavchan, Peter; White, Russel J.; Gee, Alan H.
2014-03-01
Presented are the results of a near-IR photometric survey of 1678 stars in the direction of the ρ Ophiuchus (ρ Oph) star forming region using data from the 2MASS Calibration Database. For each target in this sample, up to 1584 individual J-, H-, and Ks -band photometric measurements with a cadence of ~1 day are obtained over three observing seasons spanning ~2.5 yr it is the most intensive survey of stars in this region to date. This survey identifies 101 variable stars with ΔKs -band amplitudes from 0.044 to 2.31 mag and Δ(J - Ks ) color amplitudes ranging from 0.053 to 1.47 mag. Of the 72 young ρ Oph star cluster members included in this survey, 79% are variable; in addition, 22 variable stars are identified as candidate members. Based on the temporal behavior of the Ks time-series, the variability is distinguished as either periodic, long time-scale or irregular. This temporal behavior coupled with the behavior of stellar colors is used to assign a dominant variability mechanism. A new period-searching algorithm finds periodic signals in 32 variable stars with periods between 0.49 to 92 days. The chief mechanism driving the periodic variability for 18 stars is rotational modulation of cool starspots while 3 periodically vary due to accretion-induced hot spots. The time-series for six variable stars contains discrete periodic "eclipse-like" features with periods ranging from 3 to 8 days. These features may be asymmetries in the circumstellar disk, potentially sustained or driven by a proto-planet at or near the co-rotation radius. Aperiodic, long time-scale variations in stellar flux are identified in the time-series for 31 variable stars with time-scales ranging from 64 to 790 days. The chief mechanism driving long time-scale variability is variable extinction or mass accretion rates. The majority of the variable stars (40) exhibit sporadic, aperiodic variability over no discernable time-scale. No chief variability mechanism could be identified for these variable stars.
NASA Astrophysics Data System (ADS)
Semena, Andrey
It is widely accepted that accretion onto magnetized compact objects is channelled to some areas close to magnetic poles of the star. Thickness of this channelled accretion flow intimately depends on details of penetration of highly conducting plasma of the flow to the compact object magnetosphere, i.e. on magnetic diffusivity etc. Until now our knowledge of these plasma properties is scarce. In our work we present our attempts to estimate the thickness of the plasma flow on top of the magnetosphere from observations of accreting intermediate polars (magnetized white dwarfs). We show that properties of aperiodic noise of accreting intermediate polars can be used to put constrains on cooling time of hot plasma, heated in the standing shock wave above the WD surface. Estimates of the cooling time and the mass accretion rate provide us a tool to measure the density of post-shock plasma and the cross-sectional area of the accretion funnel at the WD surface. We have studied aperiodic noise of emission of one of the brightest intermediate polar EX Hya with the help of data in optical and X-ray energy bands. We put an upper limit on the plasma cooling timescale tau <0.2-0.5 sec, on the fractional area of the accretion curtain footprint f < 1.6 × 10(-4) . We show that measurements of accretion column footprints, combined with results of the eclipse mapping, can be used to obtain an upper limit on the penetration depth of the accretion disc plasma at the boundary of the magnetosphere, Delta r / r ≈ 10(-3) If the magnetospheres of accreting neutron stars have similar plasma penetration depths at their boundaries, we predict that footprints of their accretion columns should be very small, with fractional areas < 10(-6) .
AGN Variability: Probing Black Hole Accretion
NASA Astrophysics Data System (ADS)
Moreno, Jackeline; O'Brien, Jack; Vogeley, Michael S.; Richards, Gordon T.; Kasliwal, Vishal P.
2017-01-01
We combine the long temporal baseline of Sloan Digital Sky Survey (SDSS) for quasars in Stripe 82 with the high precision photometry of the Kepler/K2 Satellite to study the physics of optical variability in the accretion disk and supermassive black hole engine. We model the lightcurves directly as Continuous-time Auto Regressive Moving Average processes (C-ARMA) with the Kali analysis package (Kasliwal et al. 2016). These models are extremely robust to irregular sampling and can capture aperiodic variability structure on various timescales. We also estimate the power spectral density and structure function of both the model family and the data. A Green's function kernel may also be estimated for the resulting C-ARMA parameter fit, which may be interpreted as the response to driving impulses such as hotspots in the accretion disk. We also examine available spectra for our AGN sample to relate observed and modelled behavior to spectral properties. The objective of this work is twofold: to explore the proper physical interpretation of different families of C-ARMA models applied to AGN optical flux variability and to relate empirical characteristic timescales of our AGN sample to physical theory or to properties estimated from spectra or simulations like the disk viscosity and temperature. We find that AGN with strong variability features on timescales resolved by K2 are well modelled by a low order C-ARMA family while K2 lightcurves with weak amplitude variability are dominated by outliers and measurement errors which force higher order model fits. This work explores a novel approach to combining SDSS and K2 data sets and presents recovered characteristic timescales of AGN variability.
Miao, Houxun; Weiner, Andrew M; Langrock, Carsten; Roussev, Rostislav V; Fejer, Martin M
2007-04-01
We demonstrate polarization-insensitive ultralow-power second-harmonic generation frequency-resolved optical gating (FROG) measurements with a fiber-pigtailed, aperiodically poled lithium niobate waveguide. By scrambling the polarization much faster than the measurement integration time, we eliminate the impairment that frequency-independent random polarization fluctuations induce in FROG measurements. As a result we are able to retrieve intensity and phase profiles of few hundred femtosecond optical pulses with 50 MHz repetition rates at 5.2 nW coupled average power without control of the input polarization.
Effect of aperiodicity on the broadband reflection of silicon nanorod structures for photovoltaics.
Lin, Chenxi; Huang, Ningfeng; Povinelli, Michelle L
2012-01-02
We carry out a systematic numerical study of the effects of aperiodicity on silicon nanorod anti-reflection structures. We use the scattering matrix method to calculate the average reflection loss over the solar spectrum for periodic and aperiodic arrangements of nanorods. We find that aperiodicity can either improve or deteriorate the anti-reflection performance, depending on the nanorod diameter. We use a guided random-walk algorithm to design optimal aperiodic structures that exhibit lower reflection loss than both optimal periodic and random aperiodic structures.
NASA Astrophysics Data System (ADS)
Vishnyakov, E. A.; Kopylets, I. A.; Kondratenko, V. V.; Kolesnikov, A. O.; Pirozhkov, A. S.; Ragozin, E. N.; Shatokhin, A. N.
2018-03-01
Three broadband aperiodic Sb/B4C multilayer mirrors were synthesised for the purposes of soft X-ray optics and spectroscopy in the wavelength range beyond the L-edge of Si (λ < 124 Å), and their reflection spectra were measured. The multilayer structures were optimised for maximum uniform reflectivity in the ranges 100–120 Å, 95–105 Å and 90–100 Å. The reflection spectra were recorded using a laboratory laser-plasma radiation source and an electronic detector with a 2D spatial resolution (a CCD matrix with 13 × 13 μm sized pixels). The experimental spectra are compared with theoretical calculations. The effect of lower antimony and B4C layer densities on the reflection spectra is discussed.
NASA Technical Reports Server (NTRS)
Mccormick, M. P. (Editor); Lovill, J. E.
1982-01-01
The measurement of aerosols from space is discussed, taking into account the role of aerosols in climate, instrumentation and further measurement systems, retrieval procedures, measurements and observations, ground truth measurements, and effects on remote sensing and on climate. Aspects of ozone variability in the middle atmosphere are explored, giving attention to the quasi-biennial oscillation in equatorial stratospheric temperatures and total ozone, global pictures on the ozone field from high altitudes from DE-1, measurements of atmospheric ozone from aircraft and from balloons, a mesospheric ozone profile at sunset, periodic and aperiodic ozone variations in the middle and upper stratosphere, solar eclipse induced variations in mesospheric ozone concentrations, and solar UV and ozone balloon measurements. The determination of aerosol optical depth is considered along with a method for estimating cross radiance.
Applied optics. Gain modulation by graphene plasmons in aperiodic lattice lasers.
Chakraborty, S; Marshall, O P; Folland, T G; Kim, Y-J; Grigorenko, A N; Novoselov, K S
2016-01-15
Two-dimensional graphene plasmon-based technologies will enable the development of fast, compact, and inexpensive active photonic elements because, unlike plasmons in other materials, graphene plasmons can be tuned via the doping level. Such tuning is harnessed within terahertz quantum cascade lasers to reversibly alter their emission. This is achieved in two key steps: first, by exciting graphene plasmons within an aperiodic lattice laser and, second, by engineering photon lifetimes, linking graphene's Fermi energy with the round-trip gain. Modal gain and hence laser spectra are highly sensitive to the doping of an integrated, electrically controllable, graphene layer. Demonstration of the integrated graphene plasmon laser principle lays the foundation for a new generation of active, programmable plasmonic metamaterials with major implications across photonics, material sciences, and nanotechnology. Copyright © 2016, American Association for the Advancement of Science.
A New Catalog of Variable Stars in the Field of the Open Cluster M37
NASA Astrophysics Data System (ADS)
Chang, S.-W.; Byun, Y.-I.; Hartman, J. D.
2015-07-01
We present a comprehensive re-analysis of stellar photometric variability in the field of the open cluster M37 following the application of a new photometry and de-trending method to the MMT/Megacam image archive. This new analysis allows a rare opportunity to explore photometric variability over a broad range of timescales, from minutes to a month. The intent of this work is to examine the entire sample of more than 30,000 objects for periodic, aperiodic, and sporadic behaviors in their light curves. We show a modified version of the fast χ2 periodogram algorithm (Fχ2) and change-point analysis as tools for detecting and assessing the significance of periodic and non-periodic variations. The benefits of our new photometry and analysis methods are evident. A total of 2,306 stars exhibit convincing variations that are induced by flares, pulsations, eclipses, starspots, and unknown causes in some cases. This represents a 60% increase in the number of variables known in this field. Moreover, 30 of the previously identified variables are found to be false positives resulting from time-dependent systematic effects. The new catalog includes 61 eclipsing binary systems, 92 multiperiodic variable stars, 132 aperiodic variables, and 436 flare stars, as well as several hundreds of rotating variables. Based on extended and improved catalog of variables, we investigate the basic properties (e.g., period, amplitude, type) of all variables. The catalog can be accessed through the web interface (http://stardb.yonsei.ac.kr/).
The Effects of Aperiodic Perturbation on the Last Good Surface of a Single-Null Divertor Tokamak
NASA Astrophysics Data System (ADS)
Jordan, Joseph; Punjabi, Alkesh; Ali, Halima
2003-10-01
An area-preserving discrete mapping, called the Simple Map is used to analyze the effects of aperiodic perturbation on the last good magnetic surface of a single-null divertor tokamak. The SM was developed by Punjabi and Boozer /1/. The SM equations are modified to reflect the effect of aperiodic perturbation: Xn + 1 = Xn - (k+δ_aperiodics(n))Y_n(1-Y_n), Y_n+1 = Yn + kX_n+1 where δ_aperiodic is the amplitude of the aperiodic perturbation. The equations are coded into FORTRAN and used in conjunction with a graphing program to show the trajectories for different amplitudes of aperiodic perturbation. As the aperiodic perturbation is increased, the trajectories break from a clean curve and develop strange behavior as they approach chaos. The progression of the trajectories from a clean curve to a chaotic one is observed, and the results are presented in this paper. This project is supported by NASA SHARP and US DOE Grant Number DE-F02-02ER54673. The research was done under the mentorship of Profs. Punjabi and Ali. 1. Punjabi A., Verma A., and Boozer A., Phys. Rev. Lett, 69, 3322 (1992)
Kepler and K2 Light Curves of Active Galaxies: Optical Time Domain Windows into the Central Engine
NASA Astrophysics Data System (ADS)
Smith, Krista Lynne; Mushotzky, Richard; Boyd, Patricia T.; Howell, Steve B.; Gehrels, Neil; Gelino, Dawn M.
2017-01-01
We have used the Kepler spacecraft, the most precise photometer ever built, to measure aperiodic variability in active galactic nuclei. Kepler's high cadence and even sampling make it an exquisite instrument for astrophysics far beyond exoplanets, especially in the study of active galactic nuclei, which have long been known for their strong optical variability. Because of the very small size of accretion disks, this variability provides the only direct probe of their interior physics. In order to find AGN for study with the Kepler and K2 missions, we have conducted an X-ray survey of the Kepler and K2 fields of view with the Swift XRT, locating hundreds of new AGN that sample a wide parameter space in black hole mass and accretion rate. This survey also yielded an abundant sample of X-ray bright variable stellar targets. We then built a custom pipeline to handle Kepler light curves of extended objects (the AGN host galaxies) with stochastic variability. This was necessary, since the default Kepler pipeline was not optimized for such objects. Power spectral density (PSD) analysis of the AGN light curves exhibit characteristic timescales on the order of 2.5 days to 80 days, consistent with the physical timescales believed to be important in the disk. Optical spectral follow-up of the full sample enables comparison with physical parameters such as black hole mass, Eddington ratio and bolometric luminosity. The black hole mass relationship with characteristic timescale is consistent with an extrapolation of the relationship seen in stellar mass black holes, implying accretion similarities across many orders of magnitude. One object hosts a strong candidate for an optical quasi-periodic oscillation (QPO), the characteristic frequency of which correctly predicts the measured single-epoch black hole mass. The sample also contains bimodal flux distributions, which may indicate accretion states. Many of the high-frequency power spectral density (PSD) slopes are generally consistent with damped random walk models, but these fail to describe the full range of variability observed. The light curves continue to provide a fertile testing bed for the various predictions of accretion disk simulations.
Dynamics of a railway vehicle on a laterally disturbed track
NASA Astrophysics Data System (ADS)
Christiansen, Lasse Engbo; True, Hans
2018-02-01
In this article a theoretical investigation of the dynamics of a railway bogie running on a tangent track with a periodic disturbance of the lateral track geometry is presented. The dynamics is computed for two values of the speed of the vehicle in combination with different values of the wavelength and amplitude of the disturbance. Depending on the combinations of the speed, the wavelength and the amplitude, straight line forward motion, different modes of symmetric or asymmetric periodic oscillations or aperiodic motions, which are presumably chaotic, are found. Statistical methods are applied for the investigation. In the case of sinusoidal oscillations they provide information about the phase shift between the different variables and the amplitudes of the oscillations. In the case of an aperiodic motion the statistical measures indicate some non-smooth transitions.
Optimal design of aperiodic, vertical silicon nanowire structures for photovoltaics.
Lin, Chenxi; Povinelli, Michelle L
2011-09-12
We design a partially aperiodic, vertically-aligned silicon nanowire array that maximizes photovoltaic absorption. The optimal structure is obtained using a random walk algorithm with transfer matrix method based electromagnetic forward solver. The optimal, aperiodic structure exhibits a 2.35 times enhancement in ultimate efficiency compared to its periodic counterpart. The spectral behavior mimics that of a periodic array with larger lattice constant. For our system, we find that randomly-selected, aperiodic structures invariably outperform the periodic array.
A MODEL FOR (QUASI-)PERIODIC MULTIWAVELENGTH PHOTOMETRIC VARIABILITY IN YOUNG STELLAR OBJECTS
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kesseli, Aurora Y.; Petkova, Maya A.; Wood, Kenneth
We present radiation transfer models of rotating young stellar objects (YSOs) with hot spots in their atmospheres, inner disk warps, and other three-dimensional effects in the nearby circumstellar environment. Our models are based on the geometry expected from magneto-accretion theory, where material moving inward in the disk flows along magnetic field lines to the star and creates stellar hot spots upon impact. Due to rotation of the star and magnetosphere, the disk is variably illuminated. We compare our model light curves to data from the Spitzer YSOVAR project to determine if these processes can explain the variability observed at opticalmore » and mid-infrared wavelengths in young stars. We focus on those variables exhibiting “dipper” behavior that may be periodic, quasi-periodic, or aperiodic. We find that the stellar hot-spot size and temperature affects the optical and near-infrared light curves, while the shape and vertical extent of the inner disk warp affects the mid-IR light curve variations. Clumpy disk distributions with non-uniform fractal density structure produce more stochastic light curves. We conclude that magneto-accretion theory is consistent with certain aspects of the multiwavelength photometric variability exhibited by low-mass YSOs. More detailed modeling of individual sources can be used to better determine the stellar hot-spot and inner disk geometries of particular sources.« less
Numerical study of Potts models with aperiodic modulations: influence on first-order transitions
NASA Astrophysics Data System (ADS)
Branco, Nilton; Girardi, Daniel
2012-02-01
We perform a numerical study of Potts models on a rectangular lattice with aperiodic interactions along one spatial direction. The number of states q is such that the transition is a first-order one for the uniform model. The Wolff algorithm is employed, for many lattice sizes, allowing for a finite-size scaling analyses to be carried out. Three different self-dual aperiodic sequences are employed, such that the exact critical temperature is known: this leads to precise results for the exponents. We analyze models with q=6 and 15 and show that the Harris-Luck criterion, originally introduced in the study of continuous transitions, is obeyed also for first-order ones. The new universality class that emerges for relevant aperiodic modulations depends on the number of states of the Potts model, as obtained elsewhere for random disorder, and on the aperiodic sequence. We determine the occurrence of log-periodic behavior, as expected for models with aperiodic modulated interactions.
NASA Astrophysics Data System (ADS)
Kumar, Pawan; Parmananda, P.
2018-04-01
Experiments involving the Mercury Beating Heart (MBH) oscillator, exhibiting irregular (aperiodic) dynamics, are performed. In the first set of experiments, control over irregular dynamics of the MBH oscillator was obtained via a superimposed periodic voltage signal. These irregular (aperiodic) dynamics were recovered once the control was switched off. Subsequently, two MBH oscillators were coupled to attain synchronization of their aperiodic oscillations. Finally, two uncoupled MBH oscillators were subjected, repeatedly, to a common stochastic forcing, resulting in an enhancement of their mutual phase correlation.
Santos, Carlos; Espinosa, Felipe; Santiso, Enrique; Mazo, Manuel
2015-05-27
One of the main challenges in wireless cyber-physical systems is to reduce the load of the communication channel while preserving the control performance. In this way, communication resources are liberated for other applications sharing the channel bandwidth. The main contribution of this work is the design of a remote control solution based on an aperiodic and adaptive triggering mechanism considering the current network delay of multiple robotics units. Working with the actual network delay instead of the maximum one leads to abandoning this conservative assumption, since the triggering condition is fixed depending on the current state of the network. This way, the controller manages the usage of the wireless channel in order to reduce the channel delay and to improve the availability of the communication resources. The communication standard under study is the widespread IEEE 802.11g, whose channel delay is clearly uncertain. First, the adaptive self-triggered control is validated through the TrueTime simulation tool configured for the mentioned WiFi standard. Implementation results applying the aperiodic linear control laws on four P3-DX robots are also included. Both of them demonstrate the advantage of this solution in terms of network accessing and control performance with respect to periodic and non-adaptive self-triggered alternatives.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ansdell, M.; Williams, J. P.; Gaidos, E.
We present ten young (≲10 Myr) late-K and M dwarf stars observed in K2 Campaign 2 that host protoplanetary disks and exhibit quasi-periodic or aperiodic dimming events. Their optical light curves show ∼10–20 dips in flux over the 80-day observing campaign with durations of ∼0.5–2 days and depths of up to ∼40%. These stars are all members of the ρ Ophiuchus (∼1 Myr) or Upper Scorpius (∼10 Myr) star-forming regions. To investigate the nature of these “dippers” we obtained: optical and near-infrared spectra to determine stellar properties and identify accretion signatures; adaptive optics imaging to search for close companions thatmore » could cause optical variations and/or influence disk evolution; and millimeter-wavelength observations to constrain disk dust and gas masses. The spectra reveal Li i absorption and Hα emission consistent with stellar youth (<50 Myr), but also accretion rates spanning those of classical and weak-line T Tauri stars. Infrared excesses are consistent with protoplanetary disks extending to within ∼10 stellar radii in most cases; however, the sub-millimeter observations imply disk masses that are an order of magnitude below those of typical protoplanetary disks. We find a positive correlation between dip depth and WISE-2 (Wide-field Infrared Survey Explorer-2) excess, which we interpret as evidence that the dipper phenomenon is related to occulting structures in the inner disk, although this is difficult to reconcile with the weakly accreting aperiodic dippers. We consider three mechanisms to explain the dipper phenomenon: inner disk warps near the co-rotation radius related to accretion; vortices at the inner disk edge produced by the Rossby Wave Instability; and clumps of circumstellar material related to planetesimal formation.« less
Thermal Emission Control via Bandgap Engineering in Aperiodically Designed Nanophotonic Devices.
Maciá, Enrique
2015-05-20
Aperiodic photonic crystals can open up novel routes for more efficient photon management due to increased degrees of freedom in their design along with the unique properties brought about by the long-range aperiodic order as compared to their periodic counterparts. In this work we first describe the fundamental notions underlying the idea of thermal emission/absorption control on the basis of the systematic use of aperiodic multilayer designs in photonic quasicrystals. Then, we illustrate the potential applications of this approach in order to enhance the performance of daytime radiative coolers and solar thermoelectric energy generators.
Thermal Emission Control via Bandgap Engineering in Aperiodically Designed Nanophotonic Devices
Maciá, Enrique
2015-01-01
Aperiodic photonic crystals can open up novel routes for more efficient photon management due to increased degrees of freedom in their design along with the unique properties brought about by the long-range aperiodic order as compared to their periodic counterparts. In this work we first describe the fundamental notions underlying the idea of thermal emission/absorption control on the basis of the systematic use of aperiodic multilayer designs in photonic quasicrystals. Then, we illustrate the potential applications of this approach in order to enhance the performance of daytime radiative coolers and solar thermoelectric energy generators. PMID:28347037
Controlling the influence of elastic eigenmodes on nanomagnet dynamics through pattern geometry
NASA Astrophysics Data System (ADS)
Berk, C.; Yahagi, Y.; Dhuey, S.; Cabrini, S.; Schmidt, H.
2017-03-01
The effect of the nanoscale array geometry on the interaction between optically generated surface acoustic waves (SAWs) and nanomagnet dynamics is investigated using Time-Resolved Magneto-Optical Kerr Effect Microscopy (TR-MOKE). It is demonstrated that altering the nanomagnet geometry from a periodic to a randomized aperiodic pattern effectively removes the magneto-elastic effect of SAWs on the magnetization dynamics. The efficiency of this method depends on the extent of any residual spatial correlations and is quantified by spatial Fourier analysis of the two structures. Randomization allows observation and extraction of intrinsic magnetic parameters such as spin wave frequencies and damping to be resolvable using all-optical methods, enabling the conclusion that the fabrication process does not affect the damping.
Luo, Yuan; Castro, Jose; Barton, Jennifer K.; Kostuk, Raymond K.; Barbastathis, George
2010-01-01
A new methodology describing the effects of aperiodic and multiplexed gratings in volume holographic imaging systems (VHIS) is presented. The aperiodic gratings are treated as an ensemble of localized planar gratings using coupled wave methods in conjunction with sequential and non-sequential ray-tracing techniques to accurately predict volumetric diffraction effects in VHIS. Our approach can be applied to aperiodic, multiplexed gratings and used to theoretically predict the performance of multiplexed volume holographic gratings within a volume hologram for VHIS. We present simulation and experimental results for the aperiodic and multiplexed imaging gratings formed in PQ-PMMA at 488nm and probed with a spherical wave at 633nm. Simulation results based on our approach that can be easily implemented in ray-tracing packages such as Zemax® are confirmed with experiments and show proof of consistency and usefulness of the proposed models. PMID:20940823
Relationships between CSID and vocal fold vibratory function
NASA Astrophysics Data System (ADS)
Cooke, Melissa L.
High correlations have been reported between the acoustic-based Cepstral/Spectral Index of Dysphonia (CSID) and perceptual judgments of dysphonia. This study explores whether CSID provides additional insight and explains more of the variance in HSV-based properties of vocal fold vibratory function than has been reported for other acoustic measures. Using the Analysis of Dysphonia in Speech and Voice (ADSV) program, CSID and its component variables were correlated with HSV-based measures of glottal cycle aperiodicity and glottal area for 20 subjects who underwent phonomicrosurgery. Results indicate CSID is only marginally correlated with glottal cycle aperiodicity in pre- and post-surgical conditions and does not correlate as highly as the cepstral peak prominence alone. Additionally, results reveal higher correlations when examining within-subject change from pre-surgical to post-surgical assessments rather than correlating measures across subjects. Future directions are discussed that aim at improving our understanding of the relationships between acoustic parameters and underlying phonatory function.
Valley- and spin-polarized oscillatory magneto-optical absorption in monolayer MoS2 quantum rings
NASA Astrophysics Data System (ADS)
Oliveira, D.; Villegas-Lelovsky, L.; Soler, M. A. G.; Qu, Fanyao
2018-03-01
Besides optical valley selectivity, strong spin-orbit interaction along with Berry curvature effects also leads to unconventional valley- and spin-polarized Landau levels in monolayer transition metal dichalcogenides (TMDCs) under a perpendicular magnetic field. We find that these unique properties are inherited to the magneto-optical absorption spectrum of the TMDC quantum rings (QRs). In addition, it is robust against variation of the magnetic flux and of the QR geometry. In stark contrast to the monolayer bulk material, the MoS2 QRs manifest themselves in both the optical valley selectivity and unprecedented size tunability of the frequency of the light absorbed. We also find that when the magnetic field setup is changed, the phase transition from Aharonov-Bohm (AB) quantum interference to aperiodic oscillation of magneto-optical absorption spectrum takes place. The exciton spectrum in a realistic finite thickness MoS2 QR is also discussed.
High-speed three-dimensional shape measurement using GOBO projection
NASA Astrophysics Data System (ADS)
Heist, Stefan; Lutzke, Peter; Schmidt, Ingo; Dietrich, Patrick; Kühmstedt, Peter; Tünnermann, Andreas; Notni, Gunther
2016-12-01
A projector which uses a rotating slide structure to project aperiodic sinusoidal fringe patterns at high frame rates and with high radiant flux is introduced. It is used in an optical three-dimensional (3D) sensor based on coded-light projection, thus allowing the analysis of fast processes. Measurements of an inflating airbag, a rope skipper, and a soccer ball kick at a 3D frame rate of more than 1300 independent point clouds per second are presented.
NASA Astrophysics Data System (ADS)
Sinurat, E. N.; Yudiarsah, E.
2017-07-01
The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.
The binary millisecond pulsar PSR J1023+0038 during its accretion state - I. Optical variability
NASA Astrophysics Data System (ADS)
Shahbaz, T.; Linares, M.; Nevado, S. P.; Rodríguez-Gil, P.; Casares, J.; Dhillon, V. S.; Marsh, T. R.; Littlefair, S.; Leckngam, A.; Poshyachinda, S.
2015-11-01
We present time-resolved optical photometry of the binary millisecond `redback' pulsar PSR J1023+0038 (=AY Sex) during its low-mass X-ray binary phase. The light curves taken between 2014 January and April show an underlying sinusoidal modulation due to the irradiated secondary star and accretion disc. We also observe superimposed rapid flaring on time-scales as short as ˜20 s with amplitudes of ˜0.1-0.5 mag and additional large flare events on time-scales of ˜5-60 min with amplitudes of ˜0.5-1.0 mag. The power density spectrum of the optical flare light curves is dominated by a red-noise component, typical of aperiodic activity in X-ray binaries. Simultaneous X-ray and UV observations by the Swift satellite reveal strong correlations that are consistent with X-ray reprocessing of the UV light, most likely in the outer regions of the accretion disc. On some nights we also observe sharp-edged, rectangular, flat-bottomed dips randomly distributed in orbital phase, with a median duration of ˜250 s and a median ingress/egress time of ˜20 s. These rectangular dips are similar to the mode-switching behaviour between disc `active' and `passive' luminosity states, observed in the X-ray light curves of other redback millisecond pulsars. This is the first time that the optical analogue of the X-ray mode-switching has been observed. The properties of the passive- and active-state light curves can be explained in terms of clumpy accretion from a trapped inner accretion disc near the corotation radius, resulting in rectangular, flat-bottomed optical and X-ray light curves.
NASA Astrophysics Data System (ADS)
Zhang, Chuan; Wang, Xingyuan; Wang, Chunpeng; Xia, Zhiqiu
This paper concerns the outer synchronization problem between two complex delayed networks via the method of aperiodically intermittent pinning control. Apart from previous works, internal delay and coupling delay are both involved in this model, and the designed intermittent controllers can be aperiodic. The main work in this paper can be summarized as follows: First, two cases of aperiodically intermittent control with constant gain and adaptive gain are implemented, respectively. The intermittent control and pinning control are combined to reduce consumptions further. Then, based on the Lyapunov stability theory, synchronization protocols are given by strict derivation. Especially, the designed controllers are indeed simple and valid in application of theory to practice. Finally, numerical examples put the proposed control methods to the test.
Investigation of phonon coherence and backscattering using silicon nanomeshes
Lee, Jaeho; Lee, Woochul; Wehmeyer, Geoff; ...
2017-01-04
Phonons can display both wave-like and particle-like behaviour during thermal transport. While thermal transport in silicon nanomeshes has been previously interpreted by phonon wave effects due to interference with periodic structures, as well as phonon particle effects including backscattering, the dominant mechanism responsible for thermal conductivity reductions below classical predictions still remains unclear. Here we isolate the wave-related coherence effects by comparing periodic and aperiodic nanomeshes, and quantify the backscattering effect by comparing variable-pitch nanomeshes. We measure identical (within 6% uncertainty) thermal conductivities for periodic and aperiodic nanomeshes of the same average pitch, and reduced thermal conductivities for nanomeshes withmore » smaller pitches. Ray tracing simulations support the measurement results. We conclude phonon coherence is unimportant for thermal transport in silicon nanomeshes with periodicities of 100 nm and higher and temperatures above 14 K, and phonon backscattering, as manifested in the classical size effect, is responsible for the thermal conductivity reduction.« less
Fabrication of Nonperiodic Metasurfaces by Microlens Projection Lithography.
Gonidec, Mathieu; Hamedi, Mahiar M; Nemiroski, Alex; Rubio, Luis M; Torres, Cesar; Whitesides, George M
2016-07-13
This paper describes a strategy that uses template-directed self-assembly of micrometer-scale microspheres to fabricate arrays of microlenses for projection photolithography of periodic, quasiperiodic, and aperiodic infrared metasurfaces. This method of "template-encoded microlens projection lithography" (TEMPL) enables rapid prototyping of planar, multiscale patterns of similarly shaped structures with critical dimensions down to ∼400 nm. Each of these structures is defined by local projection lithography with a single microsphere acting as a lens. This paper explores the use of TEMPL for the fabrication of a broad range of two-dimensional lattices with varying types of nonperiodic spatial distribution. The matching optical spectra of the fabricated and simulated metasurfaces confirm that TEMPL can produce structures that conform to expected optical behavior.
Maestre, H; Torregrosa, A J; Fernández-Pousa, C R; Rico, M L; Capmany, J
2008-05-01
We report a dual-wavelength continuous-wave laser at 542.4 and 546.8 nm based on an Nd(3+)-doped aperiodically poled lithium niobate crystal. Two fundamental infrared (IR) wavelengths at 1084.8 and 1093.6 nm are simultaneously oscillated and self-frequency-doubled to green. The aperiodic domain distribution patterned in the crystal allows for quasi-phase matched self-frequency-doubling of both IR fundamentals while avoiding their sum-frequency mixing.
Martin, Bruno; Morand, Alain; Benech, Pierre; Leblond, Gregory; Blaize, Sylvain; Lerondel, Gilles; Royer, Pascal; Kern, Pierre; Le Coarer, Etienne
2009-01-15
A compact static Fourier transform spectrometer for integrated optics is proposed. It is based on a plane leaky loop structure combined with a plane waveguide. The interference pattern produced in the loop structure leaks outside of it and is guided in the plane waveguide to the photodetector array. This configuration allows one to control the shape of the field pattern at the end of the plane waveguide. A large fringe pattern with a high interference fringe contrast is obtained. A two-dimensional model based on an aperiodic Fourier modal method is used to modelize the coupling between the bent and the plane waveguides, completed with the Helmholtz-Kirchhoff propagation. This concept gives access to plan and compact spectrometers requiring only a single low-cost realization process step. The simulation has been done to realize a spectrometer in glass integrated optics (Deltalambda=6.1 nm at 1500 nm).
Deterministic composite nanophotonic lattices in large area for broadband applications
NASA Astrophysics Data System (ADS)
Xavier, Jolly; Probst, Jürgen; Becker, Christiane
2016-12-01
Exotic manipulation of the flow of photons in nanoengineered materials with an aperiodic distribution of nanostructures plays a key role in efficiency-enhanced broadband photonic and plasmonic technologies for spectrally tailorable integrated biosensing, nanostructured thin film solarcells, white light emitting diodes, novel plasmonic ensembles etc. Through a generic deterministic nanotechnological route here we show subwavelength-scale silicon (Si) nanostructures on nanoimprinted glass substrate in large area (4 cm2) with advanced functional features of aperiodic composite nanophotonic lattices. These nanophotonic aperiodic lattices have easily tailorable supercell tiles with well-defined and discrete lattice basis elements and they show rich Fourier spectra. The presented nanophotonic lattices are designed functionally akin to two-dimensional aperiodic composite lattices with unconventional flexibility- comprising periodic photonic crystals and/or in-plane photonic quasicrystals as pattern design subsystems. The fabricated composite lattice-structured Si nanostructures are comparatively analyzed with a range of nanophotonic structures with conventional lattice geometries of periodic, disordered random as well as in-plane quasicrystalline photonic lattices with comparable lattice parameters. As a proof of concept of compatibility with advanced bottom-up liquid phase crystallized (LPC) Si thin film fabrication, the experimental structural analysis is further extended to double-side-textured deterministic aperiodic lattice-structured 10 μm thick large area LPC Si film on nanoimprinted substrates.
A method to identify aperiodic disturbances in the ionosphere
NASA Astrophysics Data System (ADS)
Wang, J.-S.; Chen, Z.; Huang, C.-M.
2014-05-01
In this paper, variations in the ionospheric F2 layer's critical frequency are decomposed into their periodic and aperiodic components. The latter include disturbances caused both by geophysical impacts on the ionosphere and random noise. The spectral whitening method (SWM), a signal-processing technique used in statistical estimation and/or detection, was used to identify aperiodic components in the ionosphere. The whitening algorithm adopted herein is used to divide the Fourier transform of the observed data series by a real envelope function. As a result, periodic components are suppressed and aperiodic components emerge as the dominant contributors. Application to a synthetic data set based on significant simulated periodic features of ionospheric observations containing artificial (and, hence, controllable) disturbances was used to validate the SWM for identification of aperiodic components. Although the random noise was somewhat enhanced by post-processing, the artificial disturbances could still be clearly identified. The SWM was then applied to real ionospheric observations. It was found to be more sensitive than the often-used monthly median method to identify geomagnetic effects. In addition, disturbances detected by the SWM were characterized by a Gaussian-type probability density function over all timescales, which further simplifies statistical analysis and suggests that the disturbances thus identified can be compared regardless of timescale.
Deterministic composite nanophotonic lattices in large area for broadband applications
Xavier, Jolly; Probst, Jürgen; Becker, Christiane
2016-01-01
Exotic manipulation of the flow of photons in nanoengineered materials with an aperiodic distribution of nanostructures plays a key role in efficiency-enhanced broadband photonic and plasmonic technologies for spectrally tailorable integrated biosensing, nanostructured thin film solarcells, white light emitting diodes, novel plasmonic ensembles etc. Through a generic deterministic nanotechnological route here we show subwavelength-scale silicon (Si) nanostructures on nanoimprinted glass substrate in large area (4 cm2) with advanced functional features of aperiodic composite nanophotonic lattices. These nanophotonic aperiodic lattices have easily tailorable supercell tiles with well-defined and discrete lattice basis elements and they show rich Fourier spectra. The presented nanophotonic lattices are designed functionally akin to two-dimensional aperiodic composite lattices with unconventional flexibility- comprising periodic photonic crystals and/or in-plane photonic quasicrystals as pattern design subsystems. The fabricated composite lattice-structured Si nanostructures are comparatively analyzed with a range of nanophotonic structures with conventional lattice geometries of periodic, disordered random as well as in-plane quasicrystalline photonic lattices with comparable lattice parameters. As a proof of concept of compatibility with advanced bottom-up liquid phase crystallized (LPC) Si thin film fabrication, the experimental structural analysis is further extended to double-side-textured deterministic aperiodic lattice-structured 10 μm thick large area LPC Si film on nanoimprinted substrates. PMID:27941869
DOE Office of Scientific and Technical Information (OSTI.GOV)
Anderson, P. Duke; Koleske, Daniel D.; Povinelli, Michelle L.
For this study, we experimentally investigate a new class of quasi-aperiodic structures for improving the emission pattern in nanowire arrays. Efficient normal emission, as well as lasing, can be obtained from III-nitride photonic crystal (PhC) nanowire arrays that utilize slow group velocity modes near the Γ-point in reciprocal space. However, due to symmetry considerations, the emitted far-field pattern of such modes are often ‘donut’-like. Many applications, including lighting for displays or lasers, require a more uniform beam profile in the far-field. Previous work has improved far-field beam uniformity of uncoupled modes by changing the shape of the emitting structure. However,more » in nanowire systems, the shape of nanowires cannot always be arbitrarily changed due to growth or etch considerations. Here, we investigate breaking symmetry by instead changing the position of emitters. Using a quasi-aperiodic geometry, which changes the emitter position within a photonic crystal supercell (2x2), we are able to linearize the photonic bandstructure near the Γ-point and greatly improve emitted far-field uniformity. We realize the III-nitride nanowires structures using a top-down fabrication procedure that produces nanowires with smooth, vertical sidewalls. Comparison of room-temperature micro-photoluminescence (µ-PL) measurements between periodic and quasi-aperiodic nanowire arrays reveal resonances in each structure, with the simple periodic structure producing a donut beam in the emitted far-field and the quasi-aperiodic structure producing a uniform Gaussian-like beam. We investigate the input pump power vs. output intensity in both systems and observe the simple periodic array exhibiting a non-linear relationship, indicative of lasing. We believe that the quasi-aperiodic approach studied here provides an alternate and promising strategy for shaping the emission pattern of nanoemitter systems.« less
NASA Astrophysics Data System (ADS)
Kato, N.
2017-12-01
Numerical simulations of earthquake cycles are conducted to investigate the origin of complexity of earthquake recurrence. There are two main causes of the complexity. One is self-organized stress heterogeneity due to dynamical effect. The other is the effect of interaction between some fault patches. In the model, friction on the fault is assumed to obey a rate- and state-dependent friction law. Circular patches of velocity-weakening frictional property are assumed on the fault. On the remaining areas of the fault, velocity-strengthening friction is assumed. We consider three models: Single patch model, two-patch model, and three-patch model. In the first model, the dynamical effect is mainly examined. The latter two models take into consideration the effect of interaction as well as the dynamical effect. Complex multiperiodic or aperiodic sequences of slip events occur when slip behavior changes from the seismic to aseismic, and when the degree of interaction between seismic patches is intermediate. The former is observed in all the models, and the latter is observed in the two-patch model and the three-patch model. Evolution of spatial distribution of shear stress on the fault suggests that aperiodicity at the transition from seismic to aseismic slip is caused by self-organized stress heterogeneity. The iteration maps of recurrence intervals of slip events in aperiodic sequences are examined, and they are approximately expressed by simple curves for aperiodicity at the transition from seismic to aseismic slip. In contrast, the iteration maps for aperiodic sequences caused by interaction between seismic patches are scattered and they are not expressed by simple curves. This result suggests that complex sequences caused by different mechanisms may be distinguished.
NASA Astrophysics Data System (ADS)
Wang, Pengfei; Jin, Wei; Su, Huan
2018-04-01
This paper deals with the synchronization problem of a class of coupled stochastic complex-valued drive-response networks with time-varying delays via aperiodically intermittent adaptive control. Different from the previous works, the intermittent control is aperiodic and adaptive, and the restrictions on the control width and time delay are removed, which lead to a larger application scope for this control strategy. Then, based on the Lyapunov method and Kirchhoff's Matrix Tree Theorem as well as differential inequality techniques, several novel synchronization conditions are derived for the considered model. Specially, impulsive control is also considered, which can be seen as a special case of the aperiodically intermittent control when the control width tends to zero. And the corresponding synchronization criteria are given as well. As an application of the theoretical results, a class of stochastic complex-valued coupled oscillators with time-varying delays is studied, and the numerical simulations are also given to demonstrate the effectiveness of the control strategies.
PREFACE: 6th International Conference on Aperiodic Crystals (APERIODIC'09)
NASA Astrophysics Data System (ADS)
Grimm, Uwe; McGrath, Rónán; Degtyareva, Olga; Sharma, Hem Raj
2010-04-01
Aperiodic Logo Aperiodic'09, the sixth International Conference on Aperiodic Crystals, took place in Liverpool 13-18 September 2009. It was the first major conference in this interdisciplinary research field held in the UK. The conference, which was organised under the auspices of the Commission on Aperiodic Crystals of the International Union of Crystallography (IUCr), followed on from Aperiodic'94 (Les Diablerets, Switzerland), Aperiodic'97 (Alpe d'Huez, France), Aperiodic'2000 (Nijmegen, The Netherlands), Aperiodic'03 (Belo Horizonte, Brazil) and Aperiodic'06 (Zao, Japan). The next conference in the series will take place in Australia in 2012. The Aperiodic conference series is itself the successor to a series of Conferences on Modulated Structures, Polytypes and Quasicrystals (MOSPOQ), which were held in Marseilles (France) in 1984, Wroclaw (Poland) in 1986, Varanasi (India) in 1988 and Balatonszeplak (Hungary) in 1991. The remit of the conference covers two broad areas of research on aperiodic crystals, incommensurately modulated and composite crystals on the one hand, and quasicrystals on the other hand, sharing the property that they are aperiodically ordered solids. In addition, the conference also featured recent research on complex metal alloys, which are in fact periodically ordered solids. However, the term complex refers to their large unit cells, which may contain thousands of atoms, and as a consequence complex metal alloys share some of the properties of quasicrystalline solids. Aperiodic'09 attracted about 110 participants from across the world, including 20 UK-based scientists (the second largest group after Japan who sent 21 delegates). A particular feature of the conference series is its interdisciplinary character, and once again the range of disciplines of participants included mathematics, physics, crystallography and materials science. The programme started with three tutorial lectures on Sunday afternoon, presenting introductory overviews on quasicrystals (Eiji Abe), complex metal alloys (Alessandra Beni) and incommensurately modulated structures (Gervais Chapuis). While these were mainly aimed at younger researchers in the field, the lectures were very well attended and appreciated by the participants. The main programme ran from Monday morning until Friday lunchtime. It comprised 13 invited and 40 contributed plenary talks, and more than 40 posters, which were presented at two afternoon/evening poster sessions. The topics covered in the programme range from mathematical foundations, mathematical models, new materials, sample preparation, structure determination, physical properties and surface properties to industrial applications. Every presenter was invited to submit an article for this proceedings volume, and the 36 peer-reviewed papers in this volume present a cross-section of the range of presentations at the conference. They have been arranged into four categories, (i) quasicrystals, (ii) modulated structures, (iii) mathematical and theoretical aspects of aperiodic order, and (iv) approximants and complex phases. Prizes for best student presentations were awarded to Heinrich Orsini-Rosenberg (ETH Zurich) for his poster Tailor-made sevenfold approximants: ab-initio investigations on formation and stability and to Holger Euchner (Universität Stuttgart) for his contributed talk on Lattice dynamics in complex metallic alloys - vibrational properties of Zn11Mg2. In addition to a cash prize, Heinrich Orsini-Rosenberg received an icosahedral teapot, which was manufactured and donated by David Warrington, and Holger Euchner received a book prize. The meeting started with a welcome reception in the University's recently refurbished Victoria Gallery and Museum. A public lecture Simple sets of shapes that tile the plane but cannot ever repeat by Professor Sir Roger Penrose FRS attracted a wide audience and gave a fascinating insight into the discovery of the Penrose tiling, which is still the paradigm of aperiodic order in two dimensions and used in modelling quasicrystalline materials, some ten years before quasicrystals were first seen in experiment. The conference excursion and dinner centred on the historic waterfront area of this 800-year old city that was designated European Capital of Culture in 2008. The enjoyment of the ferry trip on the Mersey and subsequent walk to the Albert dock museums was greatly enhanced by the fine weather, which lasted throughout the entire conference week. The guests of honour at the conference dinner were Professor Sir Roger Penrose FRS and Professor Alan L Mackay FRS, bringing together two distinguished UK scientists who made seminal contributions to the subject. Besides the scientific programme, the conference also offered a presentation by the author Ann Lingard, whose latest novel The Embalmer's Book of Recipes features a mathematician working on quasicrystals at the University of Liverpool as its main character. A related EPSRC-supported workshop on Mathematical Aspects of Aperiodic Order, organised by Alex Clark, John Hunton and Uwe Grimm, was held in Leicester in the week preceding the conference, and attracted about 40 participants. It is not possible to organise a conference without the help and support of a large number of people, and we would like to take this opportunity to acknowledge the support of everyone who was involved in organising and running this conference. We would like to thank the IUCr Aperiodic Commission, and in particular its chair Professor Marc de Boissieu, who not only entrusted us with hosting the event, but acted as the International Advisory Committee and provided valuable advice and guidance. We are indebted to the members of the International Programme Committee, who helped to put together an exciting programme by suggesting invited speakers and selecting presentations for contributed plenary talks. We are immensely grateful to all members of the National Organising Committee, who provided essential support during the organising stage and during the conference itself, and we would particularly like to thank the conference secretary, Mrs Angie Reid, for her excellent administrative support before, during and after the conference, and for her help in the production of this volume. We are very much indebted to out co-editors, Dr Olga Degtyareva (Edinburgh) and Dr Hem Raj Sharma (Liverpool), for their contributions to the editing of this volume. Finally, and most of all, we would like to thank all participants of the conference for coming to Liverpool, for contributing by presenting their recent work and taking part in discussions, and for creating such an enjoyable and fruitful collegiate atmosphere throughout the week. Last but not least we would like to express our gratitude for the generous financial support we received from the Open University, the University of Liverpool and the Institute of Physics (Mathematical and Theoretical Physics Group and Thin Films and Surfaces Group). The International Union of Crystallography provided financial sponsorship which was allocated to support the participation of 15 young scientists. The European Network of Excellence on Complex Metallic Alloys provided travel and subsistence support to members of participating organisations. Rónán McGrath Uwe Grimm Conference photograph
Via patterning in the 7-nm node using immersion lithography and graphoepitaxy directed self-assembly
NASA Astrophysics Data System (ADS)
Doise, Jan; Bekaert, Joost; Chan, Boon Teik; Hori, Masafumi; Gronheid, Roel
2017-04-01
Insertion of a graphoepitaxy directed self-assembly process as a via patterning technology into integrated circuit fabrication is seriously considered for the 7-nm node and beyond. At these dimensions, a graphoepitaxy process using a cylindrical block copolymer that enables hole multiplication can alleviate costs by extending 193-nm immersion-based lithography and significantly reducing the number of masks that would be required per layer. To be considered for implementation, it needs to be proved that this approach can achieve the required pattern quality in terms of defects and variability using a representative, aperiodic design. The patterning of a via layer from an actual 7-nm node logic layout is demonstrated using immersion lithography and graphoepitaxy directed self-assembly in a fab-like environment. The performance of the process is characterized in detail on a full 300-mm wafer scale. The local variability in an edge placement error of the obtained patterns (4.0 nm 3σ for singlets) is in line with the recent results in the field and significantly less than of the prepattern (4.9 nm 3σ for singlets). In addition, it is expected that pattern quality can be further improved through an improved mask design and optical proximity correction. No major complications for insertion of the graphoepitaxy directed self-assembly into device manufacturing were observed.
Kolakoski sequence as an element to radiate giant forward and backward second harmonic signals
DOE Office of Scientific and Technical Information (OSTI.GOV)
Parvini, T. S.; Tehranchi, M. M., E-mail: m-hamidi@sbu.ac.ir, E-mail: teranchi@sbu.ac.ir; Laser and Plasma Research Institute, Shahid Beheshti University, Tehran
2015-11-14
We propose a novel type of aperiodic one-dimensional photonic crystal structures which can be used for generating giant forward and backward second harmonic signals. The studied structure is formed by stacking together the air and nonlinear layers according to the Kolakoski self-generation scheme in which each nonlinear layer contains a pair of antiparallel 180° poled LiNbO{sub 3} crystal layers. For different generation stages of the structure, conversion efficiencies of forward and backward second harmonic waves have been calculated by nonlinear transfer matrix method. Numerical simulations show that conversion efficiencies in the Kolakoski-based multilayer are larger than the perfect ones formore » at least one order of magnitude. Especially for 33rd and 39th generation stages, forward second harmonic wave are 42 and 19 times larger, respectively. In this paper, we validate the strong fundamental field enhancement and localization within Kolakoski-based multilayer due to periodicity breaking which consequently leads to very strong radiation of backward and forward second harmonic signals. Following the applications of analogous aperiodic structures, we expect that Kolakosi-based multilayer can play a role in optical parametric devices such as multicolor second harmonic generators with high efficiency.« less
Ferroelectric domain building blocks for photonic and nonlinear optical microstructures in LiNbO3
NASA Astrophysics Data System (ADS)
Zisis, G.; Ying, C. Y. J.; Soergel, E.; Mailis, S.
2014-03-01
The ability to manipulate the size and depth of poling inhibited domains, which are produced by UV laser irradiation of the +z face of lithium niobate crystals followed by electric field poling, is demonstrated. It is shown that complex domain structures, much wider than the irradiating laser spot, can be obtained by partially overlapping the subsequent UV laser irradiated tracks. The result of this stitching process is one uniform domain without any remaining trace of its constituent components thus increasing dramatically the utility of this method for the fabrication of surface microstructures as well as periodic and aperiodic domain lattices for nonlinear optical and surface acoustic wave applications. Finally, the impact of multi exposure on the domain characteristics is also investigated indicating that some control over the domain depth can be attained.
ERIC Educational Resources Information Center
Skuk, Verena G.; Schweinberger, Stefan R.
2014-01-01
Purpose: To determine the relative importance of acoustic parameters (fundamental frequency [F0], formant frequencies [FFs], aperiodicity, and spectrum level [SL]) on voice gender perception, the authors used a novel parameter-morphing approach that, unlike spectral envelope shifting, allows the application of nonuniform scale factors to transform…
NASA Astrophysics Data System (ADS)
Schlickeiser, R.
2012-01-01
A systematic calculation of the electromagnetic properties (Poynting vector, electromagnetic energy, and pressure) of the collective transverse fluctuations in unmagnetized plasmas with velocity-anisotropic plasma particle distributions functions is presented. Time-averaged electromagnetic properties for monochromatic weakly damped wave-like fluctuations and space-averaged electromagnetic properties for monochromatic weakly propagating and aperiodic fluctuations are calculated. For aperiodic fluctuations, the Poynting vector as well as the sum of the space-averaged electric and magnetic field energy densities vanish. However, aperiodic fluctuations possess a positive pressure given by its magnetic energy density. This finite pressure density pa of aperiodic fluctuations has important consequences for the dynamics of cosmic unmagnetized plasmas such as the intergalactic medium after reionization. Adopting the standard cosmological evolution model, we show that this additional pressure changes the expansion law of the universe leading to further deceleration. Negative vacuum pressure counterbalances this deceleration to an accelerating universe provided that the negative vacuum pressure is greater than 1.5pa, which we estimate to be of the order 2.1 . 10-16 dyn cm-2.
Self-similarity and self-inversion of quasicrystals
NASA Astrophysics Data System (ADS)
Madison, A. E.
2014-08-01
The discovery of quasicrystals played a revolutionary role in the condensed matter science and forced to renounce the dogma of the classical crystallography that the regular filling of the space by identical blocks is reduced solely to the Fedorov space groups. It is shown that aperiodic crystals, apart from the similarity, exhibit the self-inversion property. In a broadened sense, the self-inversion implies the possible composition of the inversion with translations, rotations, and homothety, whereas pure reflection by itself in a circle can be absent as an independent symmetry element. It is demonstrated that the symmetry of aperiodic tilings is described by Schottky groups (which belong to a particular type of Kleinian groups generated by the linear fractional Möbius transformations); in the theory of aperiodic crystals, the Schottky groups play the same role that the Fedorov groups play in the theory of crystal lattices. The local matching rules for the Penrose fractal tiling are derived, the problem of choice of the fundamental region of the group of motions of a quasicrystal is discussed, and the relation between the symmetry of aperiodic tilings and the symmetry of constructive fractals is analyzed.
Mars dust storms - Interannual variability and chaos
NASA Technical Reports Server (NTRS)
Ingersoll, Andrew P.; Lyons, James R.
1993-01-01
The hypothesis is that the global climate system, consisting of atmospheric dust interacting with the circulation, produces its own interannual variability when forced at the annual frequency. The model has two time-dependent variables representing the amount of atmospheric dust in the northern and southern hemispheres, respectively. Absorption of sunlight by the dust drives a cross-equatorial Hadley cell that brings more dust into the heated hemisphere. The circulation decays when the dust storm covers the globe. Interannual variability manifests itself either as a periodic solution in which the period is a multiple of the Martian year, or as an aperiodic (chaotic) solution that never repeats. Both kinds of solution are found in the model, lending support to the idea that interannual variability is an intrinsic property of the global climate system. The next step is to develop a hierarchy of dust-circulation models capable of being integrated for many years.
Asynchronous sampled-data approach for event-triggered systems
NASA Astrophysics Data System (ADS)
Mahmoud, Magdi S.; Memon, Azhar M.
2017-11-01
While aperiodically triggered network control systems save a considerable amount of communication bandwidth, they also pose challenges such as coupling between control and event-condition design, optimisation of the available resources such as control, communication and computation power, and time-delays due to computation and communication network. With this motivation, the paper presents separate designs of control and event-triggering mechanism, thus simplifying the overall analysis, asynchronous linear quadratic Gaussian controller which tackles delays and aperiodic nature of transmissions, and a novel event mechanism which compares the cost of the aperiodic system against a reference periodic implementation. The proposed scheme is simulated on a linearised wind turbine model for pitch angle control and the results show significant improvement against the periodic counterpart.
Virtual active touch using randomly patterned intracortical microstimulation.
O'Doherty, Joseph E; Lebedev, Mikhail A; Li, Zheng; Nicolelis, Miguel A L
2012-01-01
Intracortical microstimulation (ICMS) has promise as a means for delivering somatosensory feedback in neuroprosthetic systems. Various tactile sensations could be encoded by temporal, spatial, or spatiotemporal patterns of ICMS. However, the applicability of temporal patterns of ICMS to artificial tactile sensation during active exploration is unknown, as is the minimum discriminable difference between temporally modulated ICMS patterns. We trained rhesus monkeys in an active exploration task in which they discriminated periodic pulse-trains of ICMS (200 Hz bursts at a 10 Hz secondary frequency) from pulse trains with the same average pulse rate, but distorted periodicity (200 Hz bursts at a variable instantaneous secondary frequency). The statistics of the aperiodic pulse trains were drawn from a gamma distribution with mean inter-burst intervals equal to those of the periodic pulse trains. The monkeys distinguished periodic pulse trains from aperiodic pulse trains with coefficients of variation 0.25 or greater. Reconstruction of movement kinematics, extracted from the activity of neuronal populations recorded in the sensorimotor cortex concurrent with the delivery of ICMS feedback, improved when the recording intervals affected by ICMS artifacts were removed from analysis. These results add to the growing evidence that temporally patterned ICMS can be used to simulate a tactile sense for neuroprosthetic devices.
High-pressure crystallography of periodic and aperiodic crystals
Hejny, Clivia; Minkov, Vasily S.
2015-01-01
More than five decades have passed since the first single-crystal X-ray diffraction experiments at high pressure were performed. These studies were applied historically to geochemical processes occurring in the Earth and other planets, but high-pressure crystallography has spread across different fields of science including chemistry, physics, biology, materials science and pharmacy. With each passing year, high-pressure studies have become more precise and comprehensive because of the development of instrumentation and software, and the systems investigated have also become more complicated. Starting with crystals of simple minerals and inorganic compounds, the interests of researchers have shifted to complicated metal–organic frameworks, aperiodic crystals and quasicrystals, molecular crystals, and even proteins and viruses. Inspired by contributions to the microsymposium ‘High-Pressure Crystallography of Periodic and Aperiodic Crystals’ presented at the 23rd IUCr Congress and General Assembly, the authors have tried to summarize certain recent results of single-crystal studies of molecular and aperiodic structures under high pressure. While the selected contributions do not cover the whole spectrum of high-pressure research, they demonstrate the broad diversity of novel and fascinating results and may awaken the reader’s interest in this topic. PMID:25866659
Borch, D Zangger; Sundberg, J; Lindestad, P A; Thalén, M
2004-01-01
The acoustic characteristics of so-called 'dist' tones, commonly used in singing rock music, are analyzed in a case study. In an initial experiment a professional rock singer produced examples of 'dist' tones. The tones were found to contain aperiodicity, SPL at 0.3 m varied between 90 and 96 dB, and subglottal pressure varied in the range of 20-43 cm H2O, a doubling yielding, on average, an SPL increase of 2.3 dB. In a second experiment, the associated vocal fold vibration patterns were recorded by digital high-speed imaging of the same singer. Inverse filtering of the simultaneously recorded audio signal showed that the aperiodicity was caused by a low frequency modulation of the flow glottogram pulse amplitude. This modulation was produced by an aperiodic or periodic vibration of the supraglottic mucosa. This vibration reduced the pulse amplitude by obstructing the airway for some of the pulses produced by the apparently periodically vibrating vocal folds. The supraglottic mucosa vibration can be assumed to be driven by the high airflow produced by the elevated subglottal pressure.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gentili, Pier Luigi, E-mail: pierluigi.gentili@unipg.it; Gotoda, Hiroshi; Dolnik, Milos
Forecasting of aperiodic time series is a compelling challenge for science. In this work, we analyze aperiodic spectrophotometric data, proportional to the concentrations of two forms of a thermoreversible photochromic spiro-oxazine, that are generated when a cuvette containing a solution of the spiro-oxazine undergoes photoreaction and convection due to localized ultraviolet illumination. We construct the phase space for the system using Takens' theorem and we calculate the Lyapunov exponents and the correlation dimensions to ascertain the chaotic character of the time series. Finally, we predict the time series using three distinct methods: a feed-forward neural network, fuzzy logic, and amore » local nonlinear predictor. We compare the performances of these three methods.« less
Deterministic Aperiodic Structures for on-chip Nanophotonics and Nanoplasmonics Device Applications
2013-04-01
the origin of the superior field enhancement and localization observed in several aperiodic plasmonic structures. Due to the ...removed by hot acetone bath, resulting in the Si nano-hole master . The Si master is first treated with a silanizing agent to reduce the adhesion of ...arrays needs to be utilized, as illustrated in Figs. 7(a-d). The nanodot master fabrication proceeds
NASA Astrophysics Data System (ADS)
Rozyczka, M.; Narloch, W.; Pietrukowicz, P.; Thompson, I. B.; Pych, W.; Poleski, R.
2018-03-01
We adapt the friends of friends algorithm to the analysis of light curves, and show that it can be succesfully applied to searches for transient phenomena in large photometric databases. As a test case we search OGLE-III light curves for known dwarf novae. A single combination of control parameters allows us to narrow the search to 1% of the data while reaching a ≍90% detection efficiency. A search involving ≍2% of the data and three combinations of control parameters can be significantly more effective - in our case a 100% efficiency is reached. The method can also quite efficiently detect semi-regular variability. In particular, 28 new semi-regular variables have been found in the field of the globular cluster M22, which was examined earlier with the help of periodicity-searching algorithms.
NASA Astrophysics Data System (ADS)
Mulaveesala, Ravibabu; Dua, Geetika; Arora, Vanita; Siddiqui, Juned A.; Muniyappa, Amarnath
2017-05-01
In recent years, aperiodic, transient pulse compression favourable infrared imaging methodologies demonstrated as reliable, quantitative, remote characterization and evaluation techniques for testing and evaluation of various biomaterials. This present work demonstrates a pulse compression favourable aperiodic thermal wave imaging technique, frequency modulated thermal wave imaging technique for bone diagnostics, especially by considering the bone with tissue, skin and muscle over layers. In order to find the capabilities of the proposed frequency modulated thermal wave imaging technique to detect the density variations in a multi layered skin-fat-muscle-bone structure, finite element modeling and simulation studies have been carried out. Further, frequency and time domain post processing approaches have been adopted on the temporal temperature data in order to improve the detection capabilities of frequency modulated thermal wave imaging.
Electromagnetic beam diffraction by a finite lamellar structure: an aperiodic coupled-wave method.
Guizal, Brahim; Barchiesi, Dominique; Felbacq, Didier
2003-12-01
We have developed a new formulation of the coupled-wave method (CWM) to handle aperiodic lamellar structures, and it will be referred to as the aperiodic coupled-wave method (ACWM). The space is still divided into three regions, but the fields are written by use of their Fourier integrals instead of the Fourier series. In the modulated region the relative permittivity is represented by its Fourier transform, and then a set of integro-differential equations is derived. Discretizing the last system leads to a set of ordinary differential equations that is reduced to an eigenvalue problem, as is usually done in the CWM. To assess the method, we compare our results with three independent formalisms: the Rayleigh perturbation method for small samples, the volume integral method, and the finite-element method.
Aperiodic crystals and beyond.
Grimm, Uwe
2015-06-01
Crystals are paradigms of ordered structures. While order was once seen as synonymous with lattice periodic arrangements, the discoveries of incommensurate crystals and quasicrystals led to a more general perception of crystalline order, encompassing both periodic and aperiodic crystals. The current definition of crystals rests on their essentially point-like diffraction. Considering a number of recently investigated toy systems, with particular emphasis on non-crystalline ordered structures, the limits of the current definition are explored.
High-efficiency aperiodic two-dimensional high-contrast-grating hologram
NASA Astrophysics Data System (ADS)
Qiao, Pengfei; Zhu, Li; Chang-Hasnain, Connie J.
2016-03-01
High efficiency phase holograms are designed and implemented using aperiodic two-dimensional (2D) high-contrast gratings (HCGs). With our design algorithm and an in-house developed rigorous coupled-wave analysis (RCWA) package for periodic 2D HCGs, the structural parameters are obtained to achieve a full 360-degree phase-tuning range of the reflected or transmitted wave, while maintaining the power efficiency above 90%. For given far-field patterns or 3D objects to reconstruct, we can generate the near-field phase distribution through an iterative process. The aperiodic HCG phase plates we design for holograms are pixelated, and the local geometric parameters for each pixel to achieve desired phase alternation are extracted from our periodic HCG designs. Our aperiodic HCG holograms are simulated using the 3D finite-difference time-domain method. The simulation results confirm that the desired far-field patterns are successfully produced under illumination at the designed wavelength. The HCG holograms are implemented on the quartz wafers, using amorphous silicon as the high-index material. We propose HCG designs at both visible and infrared wavelengths, and our simulation confirms the reconstruction of 3D objects. The high-contrast gratings allow us to realize low-cost, compact, flat, and integrable holograms with sub-micrometer thicknesses.
OPTICAL SETI OBSERVATIONS OF THE ANOMALOUS STAR KIC 8462852
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schuetz, Marlin; Vakoch, Douglas A.; Shostak, Seth
To explore the hypothesis that KIC 8462852's aperiodic dimming is caused by artificial megastructures in orbit, rather than a natural cause such as cometary fragments in a highly elliptical orbit, we searched for electromagnetic signals from KIC 8462852 indicative of extraterrestrial intelligence. The primary observations were in the visible optical regime using the Boquete Optical SETI Observatory in Panama. In addition, as a recommended preparatory exercise for the possible future detection of a candidate signal, three of six observing runs simultaneously searched radio frequencies at the Allen Telescope Array in California. No periodic optical signals greater than 67 photons m{supmore » −2} within a time frame of 25 ns were seen. If, for example, any inhabitants of KIC 8462852 were targeting our solar system with 5 MJ laser pulses, locally illuminating an approximately 3 au diameter disk, the signal could have been detected at the Boquete Observatory. The limits on narrowband radio signals were 180–300 Jy Hz at 1 and 8 GHz, respectively. While the power requirement for a detectable, isotropic narrowband radio transmission from KIC 8462852 is quite high, even modest targeting on the part of the putative extraterrestrials can lower this power substantially.« less
Optical SETI Observations of the Anomalous Star KIC 8462852
NASA Astrophysics Data System (ADS)
Schuetz, Marlin; Vakoch, Douglas A.; Shostak, Seth; Richards, Jon
2016-07-01
To explore the hypothesis that KIC 8462852's aperiodic dimming is caused by artificial megastructures in orbit, rather than a natural cause such as cometary fragments in a highly elliptical orbit, we searched for electromagnetic signals from KIC 8462852 indicative of extraterrestrial intelligence. The primary observations were in the visible optical regime using the Boquete Optical SETI Observatory in Panama. In addition, as a recommended preparatory exercise for the possible future detection of a candidate signal, three of six observing runs simultaneously searched radio frequencies at the Allen Telescope Array in California. No periodic optical signals greater than 67 photons m-2 within a time frame of 25 ns were seen. If, for example, any inhabitants of KIC 8462852 were targeting our solar system with 5 MJ laser pulses, locally illuminating an approximately 3 au diameter disk, the signal could have been detected at the Boquete Observatory. The limits on narrowband radio signals were 180-300 Jy Hz at 1 and 8 GHz, respectively. While the power requirement for a detectable, isotropic narrowband radio transmission from KIC 8462852 is quite high, even modest targeting on the part of the putative extraterrestrials can lower this power substantially.
NASA Astrophysics Data System (ADS)
Sun, Tianyi; Guo, Chuanfei; Kempa, Krzysztof; Ren, Zhifeng
2014-03-01
A Fabry-Perot reflection filter, consisting of semi-transparent metal and dielectric layers on opaque metals, is featured by selective absorption determined by the phase difference of waves from the two interfaces. In such systems, semi-transparency is usually realized by layers of reflective metals thinner than the penetration depth of the light. Here we present a filter cavity with entry windows not made of traditional thin layers, but of aperiodic metallic random nanomeshes thicker than the penetration depth, fabricated by grain boundary lithography. It is shown that due to the deteriorated phase caused by the interface between the random nanomesh and the dielectric layer, the width and location of the resonances can be tuned by metallic coverage. Further experiments show that this phenomenon can be used in designing aperiodic plasmonic metamaterial structures for visible and infrared applications.
Design of wide-angle solar-selective absorbers using aperiodic metal-dielectric stacks.
Sergeant, Nicholas P; Pincon, Olivier; Agrawal, Mukul; Peumans, Peter
2009-12-07
Spectral control of the emissivity of surfaces is essential in applications such as solar thermal and thermophotovoltaic energy conversion in order to achieve the highest conversion efficiencies possible. We investigated the spectral performance of planar aperiodic metal-dielectric multilayer coatings for these applications. The response of the coatings was optimized for a target operational temperature using needle-optimization based on a transfer matrix approach. Excellent spectral selectivity was achieved over a wide angular range. These aperiodic metal-dielectric stacks have the potential to significantly increase the efficiency of thermophotovoltaic and solar thermal conversion systems. Optimal coatings for concentrated solar thermal conversion were modeled to have a thermal emissivity <7% at 720K while absorbing >94% of the incident light. In addition, optimized coatings for solar thermophotovoltaic applications were modeled to have thermal emissivity <16% at 1750K while absorbing >85% of the concentrated solar radiation.
Wide-Stopband Aperiodic Phononic Filters
NASA Technical Reports Server (NTRS)
Rostem, Karwan; Chuss, David; Denis, K. L.; Wollack, E. J.
2016-01-01
We demonstrate that a phonon stopband can be synthesized from an aperiodic structure comprising a discrete set of phononic filter stages. Each element of the set has a dispersion relation that defines a complete bandgap when calculated under a Bloch boundary condition. Hence, the effective stopband width in an aperiodic phononic filter (PnF) may readily exceed that of a phononic crystal with a single lattice constant or a coherence scale. With simulations of multi-moded phononic waveguides, we discuss the effects of finite geometry and mode-converting junctions on the phonon transmission in PnFs. The principles described may be utilized to form a wide stopband in acoustic and surface wave media. Relative to the quantum of thermal conductance for a uniform mesoscopic beam, a PnF with a stopband covering 1.6-10.4 GHz is estimated to reduce the thermal conductance by an order of magnitude at 75 mK.
Virtual Active Touch Using Randomly Patterned Intracortical Microstimulation
O’Doherty, Joseph E.; Lebedev, Mikhail A.; Li, Zheng; Nicolelis, Miguel A.L.
2012-01-01
Intracortical microstimulation (ICMS) has promise as a means for delivering somatosensory feedback in neuroprosthetic systems. Various tactile sensations could be encoded by temporal, spatial, or spatiotemporal patterns of ICMS. However, the applicability of temporal patterns of ICMS to artificial tactile sensation during active exploration is unknown, as is the minimum discriminable difference between temporally modulated ICMS patterns. We trained rhesus monkeys in an active exploration task in which they discriminated periodic pulse-trains of ICMS (200 Hz bursts at a 10 Hz secondary frequency) from pulse trains with the same average pulse rate, but distorted periodicity (200 Hz bursts at a variable instantaneous secondary frequency). The statistics of the aperiodic pulse trains were drawn from a gamma distribution with mean inter-burst intervals equal to those of the periodic pulse trains. The monkeys distinguished periodic pulse trains from aperiodic pulse trains with coefficients of variation 0.25 or greater. Reconstruction of movement kinematics, extracted from the activity of neuronal populations recorded in the sensorimotor cortex concurrent with the delivery of ICMS feedback, improved when the recording intervals affected by ICMS artifacts were removed from analysis. These results add to the growing evidence that temporally patterned ICMS can be used to simulate a tactile sense for neuroprosthetic devices. PMID:22207642
Expectations about person identity modulate the face-sensitive N170.
Johnston, Patrick; Overell, Anne; Kaufman, Jordy; Robinson, Jonathan; Young, Andrew W
2016-12-01
Identifying familiar faces is a fundamentally important aspect of social perception that requires the ability to assign very different (ambient) images of a face to a common identity. The current consensus is that the brain processes face identity at approximately 250-300 msec following stimulus onset, as indexed by the N250 event related potential. However, using two experiments we show compelling evidence that where experimental paradigms induce expectations about person identity, changes in famous face identity are in fact detected at an earlier latency corresponding to the face-sensitive N170. In Experiment 1, using a rapid periodic stimulation paradigm presenting highly variable ambient images, we demonstrate robust effects of low frequency, periodic face-identity changes in N170 amplitude. In Experiment 2, we added infrequent aperiodic identity changes to show that the N170 was larger to both infrequent periodic and infrequent aperiodic identity changes than to high frequency identities. Our use of ambient stimulus images makes it unlikely that these effects are due to adaptation of low-level stimulus features. In line with current ideas about predictive coding, we therefore suggest that when expectations about the identity of a face exist, the visual system is capable of detecting identity mismatches at a latency consistent with the N170. Copyright © 2016 Elsevier Ltd. All rights reserved.
Real-time control systems: feedback, scheduling and robustness
NASA Astrophysics Data System (ADS)
Simon, Daniel; Seuret, Alexandre; Sename, Olivier
2017-08-01
The efficient control of real-time distributed systems, where continuous components are governed through digital devices and communication networks, needs a careful examination of the constraints arising from the different involved domains inside co-design approaches. Thanks to the robustness of feedback control, both new control methodologies and slackened real-time scheduling schemes are proposed beyond the frontiers between these traditionally separated fields. A methodology to design robust aperiodic controllers is provided, where the sampling interval is considered as a control variable of the system. Promising experimental results are provided to show the feasibility and robustness of the approach.
Intrinsic periodic and aperiodic stochastic resonance in an electrochemical cell
NASA Astrophysics Data System (ADS)
Tiwari, Ishant; Phogat, Richa; Parmananda, P.; Ocampo-Espindola, J. L.; Rivera, M.
2016-08-01
In this paper we show the interaction of a composite of a periodic or aperiodic signal and intrinsic electrochemical noise with the nonlinear dynamics of an electrochemical cell configured to study the corrosion of iron in an acidic media. The anodic voltage setpoint (V0) in the cell is chosen such that the anodic current (I ) exhibits excitable fixed point behavior in the absence of noise. The subthreshold periodic (aperiodic) signal consists of a train of rectangular pulses with a fixed amplitude and width, separated by regular (irregular) time intervals. The irregular time intervals chosen are of deterministic and stochastic origins. The amplitude of the intrinsic internal noise, regulated by the concentration of chloride ions, is then monotonically increased, and the provoked dynamics are analyzed. The signal to noise ratio and the cross-correlation coefficient versus the chloride ions' concentration curves have a unimodal shape indicating the emergence of an intrinsic periodic or aperiodic stochastic resonance. The abscissa for the maxima of these unimodal curves correspond to the optimum value of intrinsic noise where maximum regularity of the invoked dynamics is observed. In the particular case of the intrinsic periodic stochastic resonance, the scanning electron microscope images for the electrode metal surfaces are shown for certain values of chloride ions' concentrations. These images, qualitatively, corroborate the emergence of order as a result of the interaction between the nonlinear dynamics and the composite signal.
Reduced BOLD response to periodic visual stimulation.
Parkes, Laura M; Fries, Pascal; Kerskens, Christian M; Norris, David G
2004-01-01
The blood oxygenation level-dependent (BOLD) response to entrained neuronal firing in the human visual cortex and lateral geniculate nuclei was investigated. Periodic checkerboard flashes at a range of frequencies (4-20 Hz) were used to drive the visual cortex neurons into entrained oscillatory firing. This is compared to a checkerboard flashing aperiodically, with the same average number of flashes per unit time. A magnetoencephalography (MEG) measurement was made to confirm that the periodic paradigm elicited entrainment. We found that for frequencies of 10 and 15 Hz, the periodic stimulus gave a smaller BOLD response than for the aperiodic stimulus. Detailed investigation at 15 Hz showed that the aperiodic stimulus gave a similar BOLD increase regardless of the magnitude of jitter (+/-17 ms compared to +/-33 ms), indicating that flashes need to be precise to at least 17 ms to maintain entrainment. This is also evidence that for aperiodic stimuli, the amplitude of the BOLD response ordinarily reflects the total number of flashes per unit time, irrespective of the precise spacing between them, suggesting that entrainment is the main cause of the BOLD reduction in the periodic condition. The results indicate that, during entrainment, there is a reduction in the neuronal metabolic demand. We suggest that because of the selective frequency band of this effect, it could be connected to synchronised reverberations around an internal feedback loop.
Similar local order in disordered fluorite and aperiodic pyrochlore structures
Shamblin, Jacob; Tracy, Cameron; Palomares, Raul; ...
2017-10-01
A major challenge to understanding the response of materials to extreme environments (e.g., nuclear fuels/waste forms and fusion materials) is to unravel the processes by which a material can incorporate atomic-scale disorder, and at the same time, remain crystalline. While it has long been known that all condensed matter, even liquids and glasses, possess short-range order, the relation between fully-ordered, disordered, and aperiodic structures over multiple length scales is not well understood. For example, when defects are introduced (via pressure or irradiation) into materials adopting the pyrochlore structure, these complex oxides either disorder over specific crystallographic sites, remaining crystalline, ormore » become aperiodic. Here we present neutron total scattering results characterizing the irradiation response of two pyrochlores, one that is known to disorder (Er2Sn2O7) and the other to amorphize (Dy2Sn2O7) under ion irradiation. The results demonstrate that in both cases, the local pyrochlore structure is transformed into similar short range configurations that are best fit by the orthorhombic weberite structure, even though the two compositions have distinctly different structures, aperiodic vs. disordered-crystalline, at longer length scales. Thus, a material's resistance to amorphization may not depend primarily on local defect formation energies, but rather on the structure's compatibility with meso-scale modulations of the local order in a way that maintains long-range periodicity.« less
Flat-field VLS spectrometers for laboratory applications
NASA Astrophysics Data System (ADS)
Ragozin, Evgeny N.; Belokopytov, Aleksei A.; Kolesnikov, Aleksei O.; Muslimov, Eduard R.; Shatokhin, Aleksei N.; Vishnyakov, Eugene A.
2017-05-01
Our intention is to develop high-resolution stigmatic spectral imaging in the XUV (2 - 40 nm). We have designed, aligned and tested a broadband stigmatic spectrometer for a range of 12-30 nm, which makes combined use of a normalincidence multilayer mirror (MM) (in particular, a broadband aperiodic MM) and a grazing-incidence plane varied linespace (VLS) reflection grating. The concave MM produces a slightly astigmatic image of the radiation source (for instance, the entrance slit), and the VLS grating produces a set of its dispersed stigmatic spectral images. The multilayer structure determines the spectral width of the operating range, which may amount to more than an octave in wavelength (e.g. 12.5-30 nm for an aperiodic Mo/Si MM), while the VLS grating controls the spectral focal curve. The stigmatism condition is satisfied simultaneously for two wavelengths, 14 and 27 nm. In this case, the condition of non-rigorous stigmatism is fulfilled for the entire wavelength range. A LiF laser plasma spectrum was recorded in one 0.5 J laser shot. A spatial resolution of 26 μm and a spectral resolution of 900 were demonstrated in the 12.5 - 25 nm range. We also report the design of a set of flat-field spectrometers of Harada type with VLS gratings. VLS gratings were made by ebeam and interference lithography. A technique (analytical + numerical) was developed for calculating optical schemes for writing plane and concave VLS gratings with predefined line density variation.
Quasiperiodic one-dimensional photonic crystals with adjustable multiple photonic bandgaps.
Vyunishev, Andrey M; Pankin, Pavel S; Svyakhovskiy, Sergey E; Timofeev, Ivan V; Vetrov, Stepan Ya
2017-09-15
We propose an elegant approach to produce photonic bandgap (PBG) structures with multiple photonic bandgaps by constructing quasiperiodic photonic crystals (QPPCs) composed of a superposition of photonic lattices with different periods. Generally, QPPC structures exhibit both aperiodicity and multiple PBGs due to their long-range order. They are described by a simple analytical expression, instead of quasiperiodic tiling approaches based on substitution rules. Here we describe the optical properties of QPPCs exhibiting two PBGs that can be tuned independently. PBG interband spacing and its depth can be varied by choosing appropriate reciprocal lattice vectors and their amplitudes. These effects are confirmed by the proof-of-concept measurements made for the porous silicon-based QPPC of the appropriate design.
NASA Astrophysics Data System (ADS)
Rivinius, Th.; Baade, D.; Carciofi, A. C.
2016-09-01
Context. Classical Be stars have been established as pulsating stars. Space-based photometric monitoring missions contributed significantly to that result. However, whether Be stars are just rapidly rotating SPB or β Cep stars, or whether they have to be understood differently, remains debated in the view of their highly complex power spectra. Aims: Kepler data of three known Be stars are re-visited to establish their pulsational nature and assess the properties of additional, non-pulsational variations. The three program stars turned out to be one inactive Be star, one active, continuously outbursting Be star, and one Be star transiting from a non-outbursting into an outbursting phase, thus forming an excellent sample to distill properties of Be stars in the various phases of their life-cycle. Methods: The Kepler data was first cleaned from any long-term variability with Lomb-Scargle based pre-whitening. Then a Lomb-Scargle analysis of the remaining short-term variations was compared to a wavelet analysis of the cleaned data. This offers a new view on the variability, as it enables us to see the temporal evolution of the variability and phase relations between supposed beating phenomena, which are typically not visualized in a Lomb-Scargle analysis. Results: The short-term photometric variability of Be stars must be disentangled into a stellar and a circumstellar part. The stellar part is on the whole not different from what is seen in non-Be stars. However, some of the observed phenomena might be to be due to resonant mode coupling, a mechanism not typically considered for B-type stars. Short-term circumstellar variability comes in the form of either a group of relatively well-defined, short-lived frequencies during outbursts, which are called Štefl frequencies, and broad bumps in the power spectra, indicating aperiodic variability on a time scale similar to typical low-order g-mode pulsation frequencies, rather than true periodicity. Conclusions: From a stellar pulsation perspective, Be stars are rapidly rotating SPB stars, that is they pulsate in low order g-modes, even if the rapid rotation can project the observed frequencies into the traditional high-order p-mode regime above about 4 c/d. However, when a circumstellar disk is present, Be star power spectra are complicated by both cyclic, or periodic, and aperiodic circumstellar phenomena, possibly even dominating the power spectrum.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hayashi, Kenta; Department of Chemistry, Biology, and Biotechnology, University of Perugia, 06123 Perugia; Gotoda, Hiroshi
2016-05-15
The convective motions within a solution of a photochromic spiro-oxazine being irradiated by UV only on the bottom part of its volume, give rise to aperiodic spectrophotometric dynamics. In this paper, we study three nonlinear properties of the aperiodic time series: permutation entropy, short-term predictability and long-term unpredictability, and degree distribution of the visibility graph networks. After ascertaining the extracted chaotic features, we show how the aperiodic time series can be exploited to implement all the fundamental two-inputs binary logic functions (AND, OR, NAND, NOR, XOR, and XNOR) and some basic arithmetic operations (half-adder, full-adder, half-subtractor). This is possible duemore » to the wide range of states a nonlinear system accesses in the course of its evolution. Therefore, the solution of the convective photochemical oscillator results in hardware for chaos-computing alternative to conventional complementary metal-oxide semiconductor-based integrated circuits.« less
NASA Astrophysics Data System (ADS)
Devaraj, Rajesh; Sarkar, Arnab; Biswas, Santosh
2015-11-01
In the article 'Supervisory control for fault-tolerant scheduling of real-time multiprocessor systems with aperiodic tasks', Park and Cho presented a systematic way of computing a largest fault-tolerant and schedulable language that provides information on whether the scheduler (i.e., supervisor) should accept or reject a newly arrived aperiodic task. The computation of such a language is mainly dependent on the task execution model presented in their paper. However, the task execution model is unable to capture the situation when the fault of a processor occurs even before the task has arrived. Consequently, a task execution model that does not capture this fact may possibly be assigned for execution on a faulty processor. This problem has been illustrated with an appropriate example. Then, the task execution model of Park and Cho has been modified to strengthen the requirement that none of the tasks are assigned for execution on a faulty processor.
Aperiodicity Correction for Rotor Tip Vortex Measurements
NASA Technical Reports Server (NTRS)
Ramasamy, Manikandan; Paetzel, Ryan; Bhagwat, Mahendra J.
2011-01-01
The initial roll-up of a tip vortex trailing from a model-scale, hovering rotor was measured using particle image velocimetry. The unique feature of the measurements was that a microscope was attached to the camera to allow much higher spatial resolution than hitherto possible. This also posed some unique challenges. In particular, the existing methodologies to correct for aperiodicity in the tip vortex locations could not be easily extended to the present measurements. The difficulty stemmed from the inability to accurately determine the vortex center, which is a prerequisite for the correction procedure. A new method is proposed for determining the vortex center, as well as the vortex core properties, using a least-squares fit approach. This approach has the obvious advantage that the properties are derived from not just a few points near the vortex core, but from a much larger area of flow measurements. Results clearly demonstrate the advantage in the form of reduced variation in the estimated core properties, and also the self-consistent results obtained using three different aperiodicity correction methods.
Non-commutative Chern numbers for generic aperiodic discrete systems
NASA Astrophysics Data System (ADS)
Bourne, Chris; Prodan, Emil
2018-06-01
The search for strong topological phases in generic aperiodic materials and meta-materials is now vigorously pursued by the condensed matter physics community. In this work, we first introduce the concept of patterned resonators as a unifying theoretical framework for topological electronic, photonic, phononic etc (aperiodic) systems. We then discuss, in physical terms, the philosophy behind an operator theoretic analysis used to systematize such systems. A model calculation of the Hall conductance of a 2-dimensional amorphous lattice is given, where we present numerical evidence of its quantization in the mobility gap regime. Motivated by such facts, we then present the main result of our work, which is the extension of the Chern number formulas to Hamiltonians associated to lattices without a canonical labeling of the sites, together with index theorems that assure the quantization and stability of these Chern numbers in the mobility gap regime. Our results cover a broad range of applications, in particular, those involving quasi-crystalline, amorphous as well as synthetic (i.e. algorithmically generated) lattices.
Dejonckere, P H; Wieneke, G H; Bloemenkamp, D; Lebacq, J
1996-04-01
Sustained phonations were compared in two groups of children (aged 7-12), one with special artistic voice education and one from a normal school, without voice complaints or problems. The hypothesis of specific (better) biomechanical vocal fold properties in the first group is confronted with the hypothesis of differences solely related to training of voice control. In both groups, Fo-aperiodicity was measured in a sustained phonation at 3 different SPL levels. As a general rule, aperiodicity clearly decreases when the voice becomes louder. Aperiodicity is highly significantly lower, at all SPL-levels, in children with trained singing voices: this implies better mechanical properties of the vocal oscillator. The Fo/SPL relation on a sustained /a:/ does not differ in trained and untrained children's voices: out of singing context, trained children do not spontaneously control the Fo/SPL dynamics differently from untrained children. The higher regularity of vocal fold pulses is not related to the duration of training.
Chaos Versus Noisy Periodicity: Alternative Hypotheses for Childhood Epidemics
NASA Astrophysics Data System (ADS)
Olsen, L. F.; Schaffer, W. M.
1990-08-01
Whereas case rates for some childhood diseases (chickenpox) often vary according to an almost regular annual cycle, the incidence of more efficiently transmitted infections such as measles is more variable. Three hypotheses have been proposed to account for such fluctuations. (i) Irregular dynamics result from random shocks to systems with stable equilibria. (ii) The intrinsic dynamics correspond to biennial cycles that are subject to stochastic forcing. (iii) Aperiodic fluctuations are intrinsic to the epidemiology. Comparison of real world data and epidemiological models suggests that measles epidemics are inherently chaotic. Conversely, the extent to which chickenpox outbreaks approximate a yearly cycle depends inversely on the population size.
Resonant tunneling in GaAs/Al xGa 1-xAs superlattices with aperiodic potential profiles
NASA Astrophysics Data System (ADS)
Djelti, R.; Aziz, Z.; Bentata, S.; Besbes, A.
2011-12-01
Using the exact Airy function formalism and the transfer-matrix technique, we have numerically investigated in this paper the effect of intentional correlations in spatial disorder on transmission properties of one-dimensional superlattices. Such systems consist of two different structures randomly distributed along the growth direction, with the additional constraint that barriers (wells) of one kind always appear in triply. It is shown that the intentional correlations in disorder and superlattices structural parameters are responsible to obtain resonant tunneling in aperiodic structure.
Kondo necklace model in approximants of Fibonacci chains
NASA Astrophysics Data System (ADS)
Reyes, Daniel; Tarazona, H.; Cuba-Supanta, G.; Landauro, C. V.; Espinoza, R.; Quispe-Marcatoma, J.
2017-11-01
The low energy behavior of the one dimensional Kondo necklace model with structural aperiodicity is studied using a representation for the localized and conduction electron spins, in terms of local Kondo singlet and triplet operators at zero temperature. A decoupling scheme on the double time Green's functions is used to find the dispersion relation for the excitations of the system. We determine the dependence between the structural aperiodicity modulation and the spin gap in a Fibonacci approximant chain at zero temperature and in the paramagnetic side of the phase diagram.
Optimized emission in nanorod arrays through quasi-aperiodic inverse design.
Anderson, P Duke; Povinelli, Michelle L
2015-06-01
We investigate a new class of quasi-aperiodic nanorod structures for the enhancement of incoherent light emission. We identify one optimized structure using an inverse design algorithm and the finite-difference time-domain method. We carry out emission calculations on both the optimized structure as well as a simple periodic array. The optimized structure achieves nearly perfect light extraction while maintaining a high spontaneous emission rate. Overall, the optimized structure can achieve a 20%-42% increase in external quantum efficiency relative to a simple periodic design, depending on material quality.
Gbadebo, Adenowo A; Turitsyna, Elena G; Williams, John A R
2018-01-22
We demonstrate the design and fabrication of multichannel fibre Bragg gratings (FBGs) with aperiodic channel spacings. These will be suitable for the suppression of specific spectral lines such as OH emission lines in the near infrared (NIR) which degrade ground based astronomical imaging. We discuss the design process used to meet a given specification and the fabrication challenges that can give rise to errors in the final manufactured device. We propose and demonstrate solutions to meet these challenges.
NASA Astrophysics Data System (ADS)
Yin, Yiheng; Niu, Yanxiong; Zhang, Huiyun; Zhang, Yuping; Liu, Haiyue
2016-02-01
Utilizing the transfer matrix method, we develop the electronic band structure and transport properties in Thue-Morse aperiodic graphene superlattices with magnetic barriers. It is found that the normal transmission is blocked and the position of the Dirac point can be shifted along the wavevector axis by changing the height and width ratio of magnetic barriers, which is intrinsic different from electronic field modulated superlattices. In addition, the angular threshold property of the transmission spectra and the oscillatory property of the conductance have been studied.
Generalized Kubo formulas for the transport properties of incommensurate 2D atomic heterostructures
NASA Astrophysics Data System (ADS)
Cancès, Eric; Cazeaux, Paul; Luskin, Mitchell
2017-06-01
We give an exact formulation for the transport coefficients of incommensurate two-dimensional atomic multilayer systems in the tight-binding approximation. This formulation is based upon the C* algebra framework introduced by Bellissard and collaborators [Coherent and Dissipative Transport in Aperiodic Solids, Lecture Notes in Physics (Springer, 2003), Vol. 597, pp. 413-486 and J. Math. Phys. 35(10), 5373-5451 (1994)] to study aperiodic solids (disordered crystals, quasicrystals, and amorphous materials), notably in the presence of magnetic fields (quantum Hall effect). We also present numerical approximations and test our methods on a one-dimensional incommensurate bilayer system.
Gawthrop, Peter J.; Lakie, Martin; Loram, Ian D.
2017-01-01
Key points A human controlling an external system is described most easily and conventionally as linearly and continuously translating sensory input to motor output, with the inevitable output remnant, non‐linearly related to the input, attributed to sensorimotor noise.Recent experiments show sustained manual tracking involves repeated refractoriness (insensitivity to sensory information for a certain duration), with the temporary 200–500 ms periods of irresponsiveness to sensory input making the control process intrinsically non‐linear.This evidence calls for re‐examination of the extent to which random sensorimotor noise is required to explain the non‐linear remnant.This investigation of manual tracking shows how the full motor output (linear component and remnant) can be explained mechanistically by aperiodic sampling triggered by prediction error thresholds.Whereas broadband physiological noise is general to all processes, aperiodic sampling is associated with sensorimotor decision making within specific frontal, striatal and parietal networks; we conclude that manual tracking utilises such slow serial decision making pathways up to several times per second. Abstract The human operator is described adequately by linear translation of sensory input to motor output. Motor output also always includes a non‐linear remnant resulting from random sensorimotor noise from multiple sources, and non‐linear input transformations, for example thresholds or refractory periods. Recent evidence showed that manual tracking incurs substantial, serial, refractoriness (insensitivity to sensory information of 350 and 550 ms for 1st and 2nd order systems respectively). Our two questions are: (i) What are the comparative merits of explaining the non‐linear remnant using noise or non‐linear transformations? (ii) Can non‐linear transformations represent serial motor decision making within the sensorimotor feedback loop intrinsic to tracking? Twelve participants (instructed to act in three prescribed ways) manually controlled two systems (1st and 2nd order) subject to a periodic multi‐sine disturbance. Joystick power was analysed using three models, continuous‐linear‐control (CC), continuous‐linear‐control with calculated noise spectrum (CCN), and intermittent control with aperiodic sampling triggered by prediction error thresholds (IC). Unlike the linear mechanism, the intermittent control mechanism explained the majority of total power (linear and remnant) (77–87% vs. 8–48%, IC vs. CC). Between conditions, IC used thresholds and distributions of open loop intervals consistent with, respectively, instructions and previous measured, model independent values; whereas CCN required changes in noise spectrum deviating from broadband, signal dependent noise. We conclude that manual tracking uses open loop predictive control with aperiodic sampling. Because aperiodic sampling is inherent to serial decision making within previously identified, specific frontal, striatal and parietal networks we suggest that these structures are intimately involved in visuo‐manual tracking. PMID:28833126
Gradient metasurfaces: a review of fundamentals and applications
NASA Astrophysics Data System (ADS)
Ding, Fei; Pors, Anders; Bozhevolnyi, Sergey I.
2018-02-01
In the wake of intense research on metamaterials the two-dimensional analogue, known as metasurfaces, has attracted progressively increasing attention in recent years due to the ease of fabrication and smaller insertion losses, while enabling an unprecedented control over spatial distributions of transmitted and reflected optical fields. Metasurfaces represent optically thin planar arrays of resonant subwavelength elements that can be arranged in a strictly or quasi periodic fashion, or even in an aperiodic manner, depending on targeted optical wavefronts to be molded with their help. This paper reviews a broad subclass of metasurfaces, viz. gradient metasurfaces, which are devised to exhibit spatially varying optical responses resulting in spatially varying amplitudes, phases and polarizations of scattered fields. Starting with introducing the concept of gradient metasurfaces, we present classification of different metasurfaces from the viewpoint of their responses, differentiating electrical-dipole, geometric, reflective and Huygens’ metasurfaces. The fundamental building blocks essential for the realization of metasurfaces are then discussed in order to elucidate the underlying physics of various physical realizations of both plasmonic and purely dielectric metasurfaces. We then overview the main applications of gradient metasurfaces, including waveplates, flat lenses, spiral phase plates, broadband absorbers, color printing, holograms, polarimeters and surface wave couplers. The review is terminated with a short section on recently developed nonlinear metasurfaces, followed by the outlook presenting our view on possible future developments and perspectives for future applications.
Gradient metasurfaces: a review of fundamentals and applications.
Ding, Fei; Pors, Anders; Bozhevolnyi, Sergey I
2018-02-01
In the wake of intense research on metamaterials the two-dimensional analogue, known as metasurfaces, has attracted progressively increasing attention in recent years due to the ease of fabrication and smaller insertion losses, while enabling an unprecedented control over spatial distributions of transmitted and reflected optical fields. Metasurfaces represent optically thin planar arrays of resonant subwavelength elements that can be arranged in a strictly or quasi periodic fashion, or even in an aperiodic manner, depending on targeted optical wavefronts to be molded with their help. This paper reviews a broad subclass of metasurfaces, viz. gradient metasurfaces, which are devised to exhibit spatially varying optical responses resulting in spatially varying amplitudes, phases and polarizations of scattered fields. Starting with introducing the concept of gradient metasurfaces, we present classification of different metasurfaces from the viewpoint of their responses, differentiating electrical-dipole, geometric, reflective and Huygens' metasurfaces. The fundamental building blocks essential for the realization of metasurfaces are then discussed in order to elucidate the underlying physics of various physical realizations of both plasmonic and purely dielectric metasurfaces. We then overview the main applications of gradient metasurfaces, including waveplates, flat lenses, spiral phase plates, broadband absorbers, color printing, holograms, polarimeters and surface wave couplers. The review is terminated with a short section on recently developed nonlinear metasurfaces, followed by the outlook presenting our view on possible future developments and perspectives for future applications.
Downing, B.D.; Boss, E.; Bergamaschi, B.A.; Fleck, J.A.; Lionberger, M.A.; Ganju, N.K.; Schoellhamer, D.H.; Fujii, R.
2009-01-01
Studying the dynamics and geochemical behavior of dissolved and particulate organic material is difficult because concentration and composition may rapidly change in response to aperiodic as well as periodic physical and biological forcing. Here we describe a method useful for quantifying fluxes and analyzing dissolved organic matter (DOM) dynamics. The method uses coupled optical and acoustic measurements that provide robust quantitative estimates of concentrations and constituent characteristics needed to investigate processes and calculate fluxes of DOM in tidal and other lotic environments. Data were collected several times per hour for 2 weeks or more, with the frequency and duration limited only by power consumption and data storage capacity. We assessed the capabilities and limitations of the method using data from a winter deployment in a natural tidal wetland of the San Francisco Bay estuary. We used statistical correlation of in situ optical data with traditional laboratory analyses of discrete water samples to calibrate optical properties suited as proxies for DOM concentrations and characterizations. Coupled with measurements of flow velocity, we calculated long-term residual horizontal fluxes of DOC into and out from a tidal wetland. Subsampling the dataset provides an estimate for the maximum sampling interval beyond which the error in flux estimate is significantly increased.?? 2009, by the American Society of Limnology and Oceanography, Inc.
The intermediate-age pre-cataclysmic variables SDSS J172406+562003 and RE J2013+4002
NASA Astrophysics Data System (ADS)
Shimansky, V. V.; Borisov, N. V.; Nurtdinova, D. N.; Mitrofanova, A. A.; Vlasyuk, V. V.; Spiridonova, O. I.
2012-06-01
We have analyzed the physical status of the pre-cataclysmic variables SDSSJ172406+562003 and RE J2013+4002, which have evolved after their common-envelope stage a time t = 106-107 years. Spectroscopy and photometry of these systems were performed with the 6-m and 1-m telescopes of the Special Astrophysical Observatory. We demonstrate that emission lines in the spectra were formed solely by the reflection of radiation emitted by the white dwarfs on the surfaces of their cool companions, under conditions close to local thermodynamic equilibrium. These effects are also responsible for most of the objects' photometric variability amplitude. However, comparing the light curves of SDSS 172406 from different epochs, we find aperiodic brightness variations, probably due to spottedness of the surface of the secondary. Jointly analyzing the spectra, radial-velocity curves, and light curves of the pre-cataclysmic variables and modeling the reflection effects, we have derived their fundamental parameters. We demonstrate that the secondaries in these systems are consistent with evolutionary models for main-sequence stars and do not have the luminosity excesses characteristic of cool stars in young pre-cataclysmic variables.
NASA Astrophysics Data System (ADS)
Koju, Vijay
Photonic crystals and their use in exciting Bloch surface waves have received immense attention over the past few decades. This interest is mainly due to their applications in bio-sensing, wave-guiding, and other optical phenomena such as surface field enhanced Raman spectroscopy. Improvement in numerical modeling techniques, state of the art computing resources, and advances in fabrication techniques have also assisted in growing interest in this field. The ability to model photonic crystals computationally has benefited both the theoretical as well as experimental communities. It helps the theoretical physicists in solving complex problems which cannot be solved analytically and helps to acquire useful insights that cannot be obtained otherwise. Experimentalists, on the other hand, can test different variants of their devices by changing device parameters to optimize performance before fabrication. In this dissertation, we develop two commonly used numerical techniques, namely transfer matrix method, and rigorous coupled wave analysis, in C++ and MATLAB, and use two additional software packages, one open-source and another commercial, to model one-dimensional photonic crystals. Different variants of one-dimensional multilayered structures such as perfectly periodic dielectric multilayers, quasicrystals, aperiodic multilayer are modeled, along with one-dimensional photonic crystals with gratings on the top layer. Applications of Bloch surface waves, along with new and novel aperiodic dielectric multilayer structures that support Bloch surface waves are explored in this dissertation. We demonstrate a slow light configuration that makes use of Bloch Surface Waves as an intermediate excitation in a double-prism tunneling configuration. This method is simple compared to the more usual techniques for slowing light using the phenomenon of electromagnetically induced transparency in atomic gases or doped ionic crystals operated at temperatures below 4K. Using a semi-numerical approach, we show that a 1D photonic crystal, a multilayer structure composed of alternating layers of TiO2 and SiO2 , can be used to slow down light by a factor of up to 400. The results also show that better control of the speed of light can be achieved by changing the number of bilayers and the air-gap thickness appropriately. The existence of Bloch surface waves in periodic dielectric multilayer structures with a surface defect is well-known. Not yet recognized is that quasi-crystals and aperiodic dielectric multilayers can also support Bloch-like surface waves. We numerically show the excitation of Bloch-like surface waves in Fibonacci quasi-crystals, Thue-Morse aperiodic dielectric multilayers using the prism coupling method. We report improved surface electric field intensity and penetration depth of Bloch-like surface waves in the air side in such structures compared to their periodic counterparts. Bloch surface waves have also demonstrated significant potential in the field of bios-ensing technology. We further extend our study into a new type of multilayer structure based on Maximal-length sequence, which is a pseudo random sequence. We study the characteristics of Bloch surface waves in a 32 layered Maximal-length sequence multilayer and perform angular, as well as spectral sensitivity analysis for refractive index change detection. We demonstrate numerically that Maximal-length sequence multilayers significantly enhance the sensitivity of Bloch surface waves. Another type of structure that support Bloch surface waves are dielectric multilayer structures with a grating profile on the top-most layer. The grating profile adds an additional degree of freedom to the phase matching conditions for Bloch surface wave excitation. In such structures, the conditions for Bloch surface wave coupling can also be achieved by rotating both polar and azimuthal angles. The generation of Bloch surface waves as a function of azimuthal angle have similar characteristics to conventional grating coupled Bloch surface waves. However, azimuthal generated Bloch surface waves have enhanced angular sensitivity compared to conventional polar angle coupled modes, which makes them appropriate for detecting tiny variations in surface refractive index due to the addition of nano-particles such as protein molecules.
Periodic and aperiodic flow patterns around an airfoil with leading-edge protuberances
NASA Astrophysics Data System (ADS)
Cai, Chang; Zuo, Zhigang; Maeda, Takao; Kamada, Yasunari; Li, Qing'an; Shimamoto, Kensei; Liu, Shuhong
2017-11-01
Recently leading-edge protuberances have attracted great attention as a passive method for separation control. In this paper, the effect of multiple leading-edge protuberances on the performance of a two-dimensional airfoil is investigated through experimental measurement of aerodynamic forces, surface tuft visualization, and numerical simulation. In contrast to the sharp stall of the baseline airfoil with large hysteresis effect during AOA (angle of attack) increasing and decreasing, the stall process of the modified airfoil with leading-edge protuberances is gentle and stable. Flow visualization revealed that the flow past each protuberance is periodic and symmetric at small AOAs. Streamwise vortices are generated on the shoulders of the protuberance, leading to a larger separation around the valley sections and a longer attachment along the peak sections. When some critical AOA is exceeded, aperiodic and asymmetric flow patterns occur on the protuberances at different spanwise positions, with leading-edge separation on some of the valley sections and non-stalled condition elsewhere. A combined mechanism, involving both the compartmentalization effect of the slender momentum-enhanced attached flows on the protuberance peaks and the downwash effect of the local stalled region with low circulation, is proposed to explain the generation of the aperiodic flow patterns. The influence of the number of protuberances is also investigated, which shows similar aperiodic flow patterns. The distance between the neighboring local stalled valley sections is found to be in the range of 4-7 times the protuberance wavelength. According to the proposed mechanism, it is speculated that the distance between the neighboring local stalled valley sections is inclined to increase with a smaller protuberance amplitude or at a larger AOA.
NASA Astrophysics Data System (ADS)
du Jeu, Rémi; Dauliat, Romain; Darwich, Dia; Auguste, Jean-Louis; Benoît, Aurélien; Leconte, Baptiste; Malleville, Marie-Alicia; Jamier, Raphaël.; Schuster, Kay; Roy, Philippe
2018-02-01
The power scaling of fiber lasers and amplifiers has triggered an extensive development of large-mode area fibers among which the most promising are the distributed mode filtering fibers and the large-pitch fibers. These structures enable for an effective higher-order modes delocalization and subsequently a singlemode emission. An interesting alternative consists in using the fully-aperiodic large-pitch fibers, into which the standard air-silica photonic crystal cladding is replaced by an aperiodic pattern made of solid low-index inclusions cladding. However, in such a structure, the core and the background cladding material surrounding it must have rigorously the same refractive index. Current synthesis processes and measurement techniques offer respectively a maximum resolution of 5×10-4 and 1×10-4 while the indexmatching must be as precise as 1×10-5 . Lately a gain material with a refractive index 1.5×10-4 higher than that of the background cladding material was fabricated, thus re-confining the first higher-order modes in the core. A numerical study is carried out on the benefit of bending such fully-aperiodic fiber to counteract this phenomenon. Optimized bending axis and radius have been determined. Experiments are done in a laser cavity operating at 1030 nm using an 88cm-long 51μm core diameter ytterbium-doped fiber. Results demonstrate an improvement of the M2 from 1.7 when the fiber is kept straight to 1.2 when it is bent with a 100 to 60 cm bend radius. These primary results are promising for future power scaling.
The Application of Hilbert-Huang Transforms to Meteorological Datasets
NASA Technical Reports Server (NTRS)
Duffy, Dean G.
2003-01-01
Recently a new spectral technique as been developed for the analysis of aperiodic and nonlinear signals - the Hilbert-Huang transform. This paper shows how these transforms can be used to discover synoptic and climatic features: For sea level data, the transforms capture the oceanic tides as well as large, aperiodic river outflows. In the case of solar radiation, we observe variations in the diurnal and seasonal cycles. Finally, from barographic data, the Hilbert-Huang transform reveals the passage of extratropical cyclones, fronts, and troughs. Thus, this technique can flag significant weather events such its a flood or the passage of a squall line.
Penrose high-dynamic-range imaging
NASA Astrophysics Data System (ADS)
Li, Jia; Bai, Chenyan; Lin, Zhouchen; Yu, Jian
2016-05-01
High-dynamic-range (HDR) imaging is becoming increasingly popular and widespread. The most common multishot HDR approach, based on multiple low-dynamic-range images captured with different exposures, has difficulties in handling camera and object movements. The spatially varying exposures (SVE) technology provides a solution to overcome this limitation by obtaining multiple exposures of the scene in only one shot but suffers from a loss in spatial resolution of the captured image. While aperiodic assignment of exposures has been shown to be advantageous during reconstruction in alleviating resolution loss, almost all the existing imaging sensors use the square pixel layout, which is a periodic tiling of square pixels. We propose the Penrose pixel layout, using pixels in aperiodic rhombus Penrose tiling, for HDR imaging. With the SVE technology, Penrose pixel layout has both exposure and pixel aperiodicities. To investigate its performance, we have to reconstruct HDR images in square pixel layout from Penrose raw images with SVE. Since the two pixel layouts are different, the traditional HDR reconstruction methods are not applicable. We develop a reconstruction method for Penrose pixel layout using a Gaussian mixture model for regularization. Both quantitative and qualitative results show the superiority of Penrose pixel layout over square pixel layout.
NASA Astrophysics Data System (ADS)
Chaliyawala, Harsh A.; Purohit, Zeel; Khanna, Sakshum; Ray, Abhijit; Pati, Ranjan K.; Mukhopadhyay, Indrajit
2018-05-01
We report an alternative approach to fabricate the vertically aligned aperiodic Si nanowire arrays by controlling the diameter of the Ag nanoparticles and tuneable ultrasonic removal. The process begins by sputtering the Ag thin film (t=5 nm) on the Si/SiO2 substrates. Followed by Ag thin film, annealed for various temperature (T=300°C, 400°C, 500°C and 600°C) to selectively achieve a high density, well-spaced and diameter controlled Ag nanoparticles (AgNPs) on the Si/SiO2 substrates. The sacrificial layer of AgNPs size indicates the controlled diameter of the Si nanowire arrays. Image J analysis for various annealed samples gives an indication of the high density, uniformity and equal distribution of closely packed AgNPs. Furthermore, the AgNPs covered with Au/Pd mesh (5 nm) as a template, was removed by ultrasonication in the etchant solution for several times in different intervals of preparation. The conventional and facile metal assisted electroless etching approach was finally employed to fabricate the vertically aperiodic sub-50 nm SiNWAs, can be applicable to various nanoscale opto-electronic applications.
Gollee, Henrik; Gawthrop, Peter J; Lakie, Martin; Loram, Ian D
2017-11-01
A human controlling an external system is described most easily and conventionally as linearly and continuously translating sensory input to motor output, with the inevitable output remnant, non-linearly related to the input, attributed to sensorimotor noise. Recent experiments show sustained manual tracking involves repeated refractoriness (insensitivity to sensory information for a certain duration), with the temporary 200-500 ms periods of irresponsiveness to sensory input making the control process intrinsically non-linear. This evidence calls for re-examination of the extent to which random sensorimotor noise is required to explain the non-linear remnant. This investigation of manual tracking shows how the full motor output (linear component and remnant) can be explained mechanistically by aperiodic sampling triggered by prediction error thresholds. Whereas broadband physiological noise is general to all processes, aperiodic sampling is associated with sensorimotor decision making within specific frontal, striatal and parietal networks; we conclude that manual tracking utilises such slow serial decision making pathways up to several times per second. The human operator is described adequately by linear translation of sensory input to motor output. Motor output also always includes a non-linear remnant resulting from random sensorimotor noise from multiple sources, and non-linear input transformations, for example thresholds or refractory periods. Recent evidence showed that manual tracking incurs substantial, serial, refractoriness (insensitivity to sensory information of 350 and 550 ms for 1st and 2nd order systems respectively). Our two questions are: (i) What are the comparative merits of explaining the non-linear remnant using noise or non-linear transformations? (ii) Can non-linear transformations represent serial motor decision making within the sensorimotor feedback loop intrinsic to tracking? Twelve participants (instructed to act in three prescribed ways) manually controlled two systems (1st and 2nd order) subject to a periodic multi-sine disturbance. Joystick power was analysed using three models, continuous-linear-control (CC), continuous-linear-control with calculated noise spectrum (CCN), and intermittent control with aperiodic sampling triggered by prediction error thresholds (IC). Unlike the linear mechanism, the intermittent control mechanism explained the majority of total power (linear and remnant) (77-87% vs. 8-48%, IC vs. CC). Between conditions, IC used thresholds and distributions of open loop intervals consistent with, respectively, instructions and previous measured, model independent values; whereas CCN required changes in noise spectrum deviating from broadband, signal dependent noise. We conclude that manual tracking uses open loop predictive control with aperiodic sampling. Because aperiodic sampling is inherent to serial decision making within previously identified, specific frontal, striatal and parietal networks we suggest that these structures are intimately involved in visuo-manual tracking. © 2017 The Authors. The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society.
Identification of Young Stellar Variables with KELT for K2 . I. Taurus Dippers and Rotators
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rodriguez, Joseph E.; Cargile, Phillip A.; Ansdell, Megan
One of the most well-studied young stellar associations, Taurus–Auriga, was observed by the extended Kepler mission, K2 , in the spring of 2017. K2 Campaign 13 (C13) is a unique opportunity to study many stars in this young association at high photometric precision and cadence. Using observations from the Kilodegree Extremely Little Telescope (KELT) survey, we identify “dippers,” aperiodic and periodic variables among K2 C13 target stars. This release of the KELT data (light curve data in e-tables) provides the community with long-time baseline observations to assist in the understanding of the more exotic variables in the association. Transient-like phenomenamore » on timescales of months to years are known characteristics in the light curves of young stellar objects, making contextual pre- and post- K2 observations critical to understanding their underlying processes. We are providing a comprehensive set of the KELT light curves for known Taurus–Auriga stars in K2 C13. The combined data sets from K2 and KELT should permit a broad array of investigations related to star formation, stellar variability, and protoplanetary environments.« less
Digit replacement: A generic map for nonlinear dynamical systems.
García-Morales, Vladimir
2016-09-01
A simple discontinuous map is proposed as a generic model for nonlinear dynamical systems. The orbit of the map admits exact solutions for wide regions in parameter space and the method employed (digit manipulation) allows the mathematical design of useful signals, such as regular or aperiodic oscillations with specific waveforms, the construction of complex attractors with nontrivial properties as well as the coexistence of different basins of attraction in phase space with different qualitative properties. A detailed analysis of the dynamical behavior of the map suggests how the latter can be used in the modeling of complex nonlinear dynamics including, e.g., aperiodic nonchaotic attractors and the hierarchical deposition of grains of different sizes on a surface.
Aperiodic pressure pulsation under non optimal hydraulic turbine regimes at low swirl number
NASA Astrophysics Data System (ADS)
Skripkin, S. G.; Tsoy, M. A.; Kuibin, P. A.; Shtork, S. I.
2017-09-01
Off-design operating conditions of hydraulic turbines is hindered by pressure fluctuations in the draft tube of the turbine. A precessing helical vortex rope develops, which imperils the mechanical structure and limits the operation flexibility of hydropower station. Understanding of the underlying instabilities of precessing vortex rope at low swirl number is incomplete. In this paper flow regimes with different residual swirl is analysed, particular attention is paid to the regime with a small swirl parameter. Study defines upper and low boundaries of regime where aperiodic pressure surge is observed. Flow field at the runner exit is investigated by Laser Doppler Velocimetry and high-speed visualizations, which are complemented draft tube wall pressure measurements.
Spectral tailoring of nanoscale EUV and soft x-ray multilayer optics
NASA Astrophysics Data System (ADS)
Huang, Qiushi; Medvedev, Viacheslav; van de Kruijs, Robbert; Yakshin, Andrey; Louis, Eric; Bijkerk, Fred
2017-03-01
Extreme ultraviolet and soft X-ray (XUV) multilayer optics have experienced significant development over the past few years, particularly on controlling the spectral characteristics of light for advanced applications like EUV photolithography, space observation, and accelerator- or lab-based XUV experiments. Both planar and three dimensional multilayer structures have been developed to tailor the spectral response in a wide wavelength range. For the planar multilayer optics, different layered schemes are explored. Stacks of periodic multilayers and capping layers are demonstrated to achieve multi-channel reflection or suppression of the reflective properties. Aperiodic multilayer structures enable broadband reflection both in angles and wavelengths, with the possibility of polarization control. The broad wavelength band multilayer is also used to shape attosecond pulses for the study of ultrafast phenomena. Narrowband multilayer monochromators are delivered to bridge the resolution gap between crystals and regular multilayers. High spectral purity multilayers with innovated anti-reflection structures are shown to select spectrally clean XUV radiation from broadband X-ray sources, especially the plasma sources for EUV lithography. Significant progress is also made in the three dimensional multilayer optics, i.e., combining micro- and nanostructures with multilayers, in order to provide new freedom to tune the spectral response. Several kinds of multilayer gratings, including multilayer coated gratings, sliced multilayer gratings, and lamellar multilayer gratings are being pursued for high resolution and high efficiency XUV spectrometers/monochromators, with their advantages and disadvantages, respectively. Multilayer diffraction optics are also developed for spectral purity enhancement. New structures like gratings, zone plates, and pyramids that obtain full suppression of the unwanted radiation and high XUV reflectance are reviewed. Based on the present achievement of the spectral tailoring multilayer optics, the remaining challenges and opportunities for future researches are discussed.
A deep staring campaign in the σ Orionis cluster. Variability in substellar members
NASA Astrophysics Data System (ADS)
Elliott, P.; Scholz, A.; Jayawardhana, R.; Eislöffel, J.; Hébrard, E. M.
2017-12-01
Context. The young star cluster near σ Orionis is one of the primary environments to study the properties of young brown dwarfs down to masses comparable to those of giant planets. Aims: Deep optical imaging is used to study time-domain properties of young brown dwarfs over typical rotational timescales and to search for new substellar and planetary-mass cluster members. Methods: We used the Visible Multi Object Spectrograph (VIMOS) at the Very Large Telescope (VLT) to monitor a 24'× 16' field in the I-band. We stared at the same area over a total integration time of 21 h, spanning three observing nights. Using the individual images from this run we investigated the photometric time series of nine substellar cluster members with masses from 10 to 60 MJup. The deep stacked image shows cluster members down to ≈5 MJup. We searched for new planetary-mass objects by combining our deep I-band photometry with public J-band magnitudes and by examining the nearby environment of known very low mass members for possible companions. Results: We find two brown dwarfs, with significantly variable, aperiodic light curves, both with masses around 50 MJup, one of which was previously unknown to be variable. The physical mechanism responsible for the observed variability is likely to be different for the two objects. The variability of the first object, a single-lined spectroscopic binary, is most likely linked to its accretion disc; the second may be caused by variable extinction by large grains. We find five new candidate members from the colour-magnitude diagram and three from a search for companions within 2000 au. We rule all eight sources out as potential members based on non-stellar shape and/or infrared colours. The I-band photometry is made available as a public dataset. Conclusions: We present two variable brown dwarfs. One is consistent with ongoing accretion, the other exhibits apparent transient variability without the presence of an accretion disc. Our analysis confirms the existing census of substellar cluster members down to ≈7 MJup. The zero result from our companion search agrees with the low occurrence rate of wide companions to brown dwarfs found in other works. Based on observations made with ESO Telescopes at the Paranal Observatory under programme ID 078.C-0042.Full Table B.1 is only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/608/A66
Aperiodic Mo/Si multilayers for hard x-rays
Pardini, Tom; Alameda, Jennifer; Platonov, Yuriy; ...
2016-08-04
In this work we have developed aperiodic Molybdenum/Silicon (Mo/Si) multilayers (MLs) to reflect 16.25 keV photons at a grazing angle of incidence of 0.6° ± 0.05°. To the best of our knowledge this is the first time this material system has been used to fabricate aperiodic MLs for hard x-rays. At these energies new hurdles arise. First of all a large number of bilayers is required to reach saturation. This poses a challenge from the manufacturing point of view, as thickness control of each ML period becomes paramount. The latter is not well defined a priori, due to the thicknessmore » of the interfacial silicide layers which has been observed to vary as a function of Mo and Si thickness. Additionally an amorphous-to-crystalline transition for Mo must be avoided in order maintain reasonably low roughness at the interfaces. This transition is well within the range of thicknesses pertinent to this study. Despite these difficulties our data demonstrates that we achieved reasonably flat ML response across the angular acceptance of ± 0.05°, with an experimentally confirmed average reflectivity of 28%. Such a ML prescription is well suited for applications in the field of hard x-ray imaging of highly diverging sources.« less
Lau, Kai Lin; Sleiman, Hanadi F
2016-07-26
Given its highly predictable self-assembly properties, DNA has proven to be an excellent template toward the design of functional materials. Prominent examples include the remarkable complexity provided by DNA origami and single-stranded tile (SST) assemblies, which require hundreds of unique component strands. However, in many cases, the majority of the DNA assembly is purely structural, and only a small "working area" needs to be aperiodic. On the other hand, extended lattices formed by DNA tile motifs require only a few strands; but they suffer from lack of size control and limited periodic patterning. To overcome these limitations, we adopt a templation strategy, where an input strand of DNA dictates the size and patterning of resultant DNA tile structures. To prepare these templating input strands, a sequential growth technique developed in our lab is used, whereby extended DNA strands of defined sequence and length may be generated simply by controlling their order of addition. With these, we demonstrate the periodic patterning of size-controlled double-crossover (DX) and triple-crossover (TX) tile structures, as well as intentionally designed aperiodicity of a DX tile structure. As such, we are able to prepare size-controlled DNA structures featuring aperiodicity only where necessary with exceptional economy and efficiency.
Characteristics and instabilities of mode-locked quantum-dot diode lasers.
Li, Yan; Lester, Luke F; Chang, Derek; Langrock, Carsten; Fejer, M M; Kane, Daniel J
2013-04-08
Current pulse measurement methods have proven inadequate to fully understand the characteristics of passively mode-locked quantum-dot diode lasers. These devices are very difficult to characterize because of their low peak powers, high bandwidth, large time-bandwidth product, and large timing jitter. In this paper, we discuss the origin for the inadequacies of current pulse measurement techniques while presenting new ways of examining frequency-resolved optical gating (FROG) data to provide insight into the operation of these devices. Under the assumptions of a partial coherence model for the pulsed laser, it is shown that simultaneous time-frequency characterization is a necessary and sufficient condition for characterization of mode-locking. Full pulse characterization of quantum dot passively mode-locked lasers (QD MLLs) was done using FROG in a collinear configuration using an aperiodically poled lithium niobate waveguide-based FROG pulse measurement system.
NASA Astrophysics Data System (ADS)
Caballero-García, M. D.; Camero-Arranz, A.; Özbey Arabacı, M.; Zurita, C.; Suso, J.; Gutiérrez-Soto, J.; Beklen, E.; Kiaeerad, F.; Garrido, R.; Hudec, R.
2016-05-01
Aims: We present a study of the Be/X-ray binary system V 0332+53 with the main goal of characterizing its behaviour mainly during the intermediate-luminosity X-ray event in 2008. In addition, we aim to contribute to the understanding of the behaviour of the donor companion by including optical data from our dedicated campaign starting in 2006. Methods: V 0332+53 was observed by RXTE and Swift during the decay of the intermediate-luminosity X-ray outburst of 2008, and with Suzaku before the rising of the third normal outburst of the 2010 series. In addition, we present recent data from the Spanish ground-based astronomical observatories of El Teide (Tenerife), Roque de los Muchachos (La Palma), and Sierra Nevada (Granada), and since 2006 from the Turkish TÜBİTAK National Observatory (Antalya). We have performed temporal analyses to investigate the transient behaviour of this system during several outbursts. Results: Our optical study revealed that continuous mass ejection episodes from the Be star have been taking place since 2006 and another is currently ongoing. The broad-band 1-60 keV X-ray spectrum of the neutron star during the decay of the 2008 outburst was well fitted with standard phenomenological models that were enhanced by an absorption feature of unknown origin at about 10 keV and a narrow iron K-alpha fluorescence line at 6.4 keV. For the first time in V 0332+53 we tentatively see an increase in the cyclotron line energy with increasing flux (although further and more sensitive observations are needed to confirm this). The fast aperiodic variability shows a quasi-periodic oscillation (QPO) at 227 ± 9 mHz only during the lowest luminosities, which might indicate that the inner regions surrounding the magnetosphere are more visible during the lowest flux states.
Transition to chaos in an open unforced 2D flow
NASA Technical Reports Server (NTRS)
Pulliam, Thomas H.; Vastano, John A.
1993-01-01
The present numerical study of unsteady, low Reynolds number flow past a 2D airfoil attempts to ascertain the bifurcation sequence leading from simple periodic to complex aperiodic flow with rising Reynolds number, as well as to characterize the degree of chaos present in the aperiodic flow and assess the role of numerics in the modification and control of the observed bifurcation scenario. The ARC2D Navier-Stokes code is used in an unsteady time-accurate mode for most of these computations. The system undergoes a period-doubling bifurcation to chaos as the Reynolds number is increased from 800 to 1600; its chaotic attractors are characterized by estimates of the fractal dimension and partial Liapunov exponent spectra.
Design of an amplifier model accounting for thermal effect in fully aperiodic large pitch fibers
NASA Astrophysics Data System (ADS)
Tragni, K.; Molardi, C.; Poli, F.; Dauliat, R.; Leconte, B.; Darwich, D.; du Jeu, R.; Malleville, M. A.; Jamier, R.; Selleri, S.; Roy, P.; Cucinotta, A.
2018-02-01
Yb-doped Photonic Crystal Fibers (PCFs) have triggered a significant power scaling into fiber-based lasers. However thermally-induced effects, like mode instability, can compromise the output beam quality. PCF design with improved Higher Order Mode (HOM) delocalization and effective thermal resilience can contain the problem. In particular, Fully- Aperiodic Large-Pitch Fibers (FA-LPFs) have shown interesting properties in terms of resilience to thermal effects. In this paper the performances of a Yb-doped FA-LPF amplifier are experimentally and numerically investigated. Modal properties and gain competition between Fundamental Mode (FM) and first HOM have been calculated, in presence of thermal effects. The main doped fiber characteristics have been derived by comparison between experimental and numerical results.
Shi, Lifang; Du, Chunlei; Dong, Xiaochun; Deng, Qiling; Luo, Xiangang
2007-12-01
An aperiodic mask design method for fabricating a microlens array with an aspherical profile is proposed. The nonlinear relationship between exposure doses and lens profile is considered, and the select criteria of quantization interval and fabrication range of the method are given. The mask function of a quadrangle microlens array with a hyperboloid profile used in the infrared was constructed by using this method. The microlens array can be effectively fabricated during a one time exposure process using the mask. Reactive ion etching was carried out to transfer the structure into the substrate of germanium. The measurement results indicate that the roughness is less than 10 nm (pv), and the profile error is less than 40 nm (rms).
NASA Astrophysics Data System (ADS)
Zand, Iman; Dalir, Hamed; Chen, Ray T.; Dowling, Jonathan P.
2018-03-01
We investigate one-dimensional aperiodic multilayer microstructures in order to achieve near-total absorptions at preselected wavelengths in a graphene monolayer. The proposed structures are designed using a genetic optimization algorithm coupled to a transfer matrix code. Coupled-mode-theory analysis, consistent with transfer matrix method results, indicates the existence of a critical coupling in the graphene monolayer for perfect absorptions. Our findings show that the near-total-absorption peaks are highly tunable and can be controlled simultaneously or independently in a wide range of wavelengths in the near-infrared and visible ranges. The proposed approach is metal-free, does not require surface texturing or patterning, and can be also applied for other two-dimensional materials.
Ramanujan sums for signal processing of low-frequency noise.
Planat, Michel; Rosu, Haret; Perrine, Serge
2002-11-01
An aperiodic (low-frequency) spectrum may originate from the error term in the mean value of an arithmetical function such as Möbius function or Mangoldt function, which are coding sequences for prime numbers. In the discrete Fourier transform the analyzing wave is periodic and not well suited to represent the low-frequency regime. In place we introduce a different signal processing tool based on the Ramanujan sums c(q)(n), well adapted to the analysis of arithmetical sequences with many resonances p/q. The sums are quasiperiodic versus the time n and aperiodic versus the order q of the resonance. Different results arise from the use of this Ramanujan-Fourier transform in the context of arithmetical and experimental signals.
Ramanujan sums for signal processing of low-frequency noise
NASA Astrophysics Data System (ADS)
Planat, Michel; Rosu, Haret; Perrine, Serge
2002-11-01
An aperiodic (low-frequency) spectrum may originate from the error term in the mean value of an arithmetical function such as Möbius function or Mangoldt function, which are coding sequences for prime numbers. In the discrete Fourier transform the analyzing wave is periodic and not well suited to represent the low-frequency regime. In place we introduce a different signal processing tool based on the Ramanujan sums cq(n), well adapted to the analysis of arithmetical sequences with many resonances p/q. The sums are quasiperiodic versus the time n and aperiodic versus the order q of the resonance. Different results arise from the use of this Ramanujan-Fourier transform in the context of arithmetical and experimental signals.
K2 Variable Catalogue: Variable stars and eclipsing binaries in K2 campaigns 1 and 0
NASA Astrophysics Data System (ADS)
Armstrong, D. J.; Kirk, J.; Lam, K. W. F.; McCormac, J.; Walker, S. R.; Brown, D. J. A.; Osborn, H. P.; Pollacco, D. L.; Spake, J.
2015-07-01
Aims: We have created a catalogue of variable stars found from a search of the publicly available K2 mission data from Campaigns 1 and 0. This catalogue provides the identifiers of 8395 variable stars, including 199 candidate eclipsing binaries with periods up to 60 d and 3871 periodic or quasi-periodic objects, with periods up to 20 d for Campaign 1 and 15 d for Campaign 0. Methods: Lightcurves are extracted and detrended from the available data. These are searched using a combination of algorithmic and human classification, leading to a classifier for each object as an eclipsing binary, sinusoidal periodic, quasi periodic, or aperiodic variable. The source of the variability is not identified, but could arise in the non-eclipsing binary cases from pulsation or stellar activity. Each object is cross-matched against variable star related guest observer proposals to the K2 mission, which specifies the variable type in some cases. The detrended lightcurves are also compared to lightcurves currently publicly available. Results: The resulting catalogue gives the ID, type, period, semi-amplitude, and range of the variation seen. We also make available the detrended lightcurves for each object. The catalogue is available at http://deneb.astro.warwick.ac.uk/phrlbj/k2varcat/ and at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (ftp://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/579/A19
EXTraS: Exploring the X-ray Transient and variable Sky
NASA Astrophysics Data System (ADS)
De Luca, A.; Salvaterra, R.; Tiengo, A.; D'Agostino, D.; Watson, M.; Haberl, F.; Wilms, J.
2017-10-01
The EXTraS project extracted all temporal domain information buried in the whole database collected by the EPIC cameras onboard the XMM-Newton mission. This included a search and characterisation of variability, both periodic and aperiodic, in hundreds of thousands of sources spanning more than eight orders of magnitude in time scale and six orders of magnitude in flux, as well as a search for fast transients, missed by standard image analysis. Phenomenological classification of variable sources, based on X-ray and multiwavelength information, has also been performed. All results and products of EXTraS are made available to the scientific community through a web public data archive. A dedicated science gateway will allow scientists to apply EXTraS pipelines on new observations. EXTraS is the most comprehensive analysis of variability, on the largest ever sample of soft X-ray sources. The resulting archive and tools disclose an enormous scientific discovery space to the community, with applications ranging from the search for rare events to population studies, with impact on the study of virtually all astrophysical source classes. EXTraS, funded within the EU/FP7 framework, is carried out by a collaboration including INAF (Italy), IUSS (Italy), CNR/IMATI (Italy), University of Leicester (UK), MPE (Germany) and ECAP (Germany).
X-ray Observations of the Bright Old Nova V603 Aquilae
NASA Technical Reports Server (NTRS)
Mukai, K.; Orio, M.
2004-01-01
We report on our Chandra and RXTE observations of the bright old nova, V603 Aql, performed in 2001 April, supplemented by our analysis of archival X-ray data on this object. We find that the RXTE data are contaminated by the Galactic Ridge X-ray emission. After accounting for this effect, we find a high level of aperiodic variability in the RXTE data, at a level consistent with the uncontaminated Chandra data. The Chandra HETG spectrum clearly originates in a multi-temperature plasma. We constrain the possible emission measure distribution of the plasma through a combination of global and local fits. The X-ray luminosity and the spectral shape of V603 Aql resemble those of SS Cyg in transition between quiescence and outburst. The fact that the X-ray flux variability is only weakly energy dependent can be interpreted by supposing that the variability is due to changes in the maximum temperature of the plasma. The plasma density is likely to be high, and the emission region is likely to be compact. Finally, the apparent overabundance of Ne is consistent with V603 Aql being a young system.
Gain modulation by graphene plasmons in aperiodic lattice lasers
NASA Astrophysics Data System (ADS)
Chakraborty, S.; Marshall, O. P.; Folland, T. G.; Kim, Y.-J.; Grigorenko, A. N.; Novoselov, K. S.
2016-01-01
Two-dimensional graphene plasmon-based technologies will enable the development of fast, compact, and inexpensive active photonic elements because, unlike plasmons in other materials, graphene plasmons can be tuned via the doping level. Such tuning is harnessed within terahertz quantum cascade lasers to reversibly alter their emission. This is achieved in two key steps: first, by exciting graphene plasmons within an aperiodic lattice laser and, second, by engineering photon lifetimes, linking graphene’s Fermi energy with the round-trip gain. Modal gain and hence laser spectra are highly sensitive to the doping of an integrated, electrically controllable, graphene layer. Demonstration of the integrated graphene plasmon laser principle lays the foundation for a new generation of active, programmable plasmonic metamaterials with major implications across photonics, material sciences, and nanotechnology.
The FLAME-slab method for electromagnetic wave scattering in aperiodic slabs
NASA Astrophysics Data System (ADS)
Mansha, Shampy; Tsukerman, Igor; Chong, Y. D.
2017-12-01
The proposed numerical method, "FLAME-slab," solves electromagnetic wave scattering problems for aperiodic slab structures by exploiting short-range regularities in these structures. The computational procedure involves special difference schemes with high accuracy even on coarse grids. These schemes are based on Trefftz approximations, utilizing functions that locally satisfy the governing differential equations, as is done in the Flexible Local Approximation Method (FLAME). Radiation boundary conditions are implemented via Fourier expansions in the air surrounding the slab. When applied to ensembles of slab structures with identical short-range features, such as amorphous or quasicrystalline lattices, the method is significantly more efficient, both in runtime and in memory consumption, than traditional approaches. This efficiency is due to the fact that the Trefftz functions need to be computed only once for the whole ensemble.
NASA Technical Reports Server (NTRS)
Megie, G.; Chanin, M.-L.; Ehhalt, D.; Fraser, P.; Frederick, J. F.; Gille, J. C.; Mccormick, M. P.; Schoebert, M.; Bishop, L.; Bojkov, R. D.
1990-01-01
Measuring trends in ozone, and most other geophysical variables, requires that a small systematic change with time be determined from signals that have large periodic and aperiodic variations. Their time scales range from the day-to-day changes due to atmospheric motions through seasonal and annual variations to 11 year cycles resulting from changes in the sun UV output. Because of the magnitude of all of these variations is not well known and highly variable, it is necessary to measure over more than one period of the variations to remove their effects. This means that at least 2 or more times the 11 year sunspot cycle. Thus, the first requirement is for a long term data record. The second related requirement is that the record be consistent. A third requirement is for reasonable global sampling, to ensure that the effects are representative of the entire Earth. The various observational methods relevant to trend detection are reviewed to characterize their quality and time and space coverage. Available data are then examined for long term trends or recent changes in ozone total content and vertical distribution, as well as related parameters such as stratospheric temperature, source gases and aerosols.
Crystal nucleation of colloidal hard dumbbells
NASA Astrophysics Data System (ADS)
Ni, Ran; Dijkstra, Marjolein
2011-01-01
Using computer simulations, we investigate the homogeneous crystal nucleation in suspensions of colloidal hard dumbbells. The free energy barriers are determined by Monte Carlo simulations using the umbrella sampling technique. We calculate the nucleation rates for the plastic crystal and the aperiodic crystal phase using the kinetic prefactor as determined from event driven molecular dynamics simulations. We find good agreement with the nucleation rates determined from spontaneous nucleation events observed in event driven molecular dynamics simulations within error bars of one order of magnitude. We study the effect of aspect ratio of the dumbbells on the nucleation of plastic and aperiodic crystal phases, and we also determine the structure of the critical nuclei. Moreover, we find that the nucleation of the aligned close-packed crystal structure is strongly suppressed by a high free energy barrier at low supersaturations and slow dynamics at high supersaturations.
Noise induced aperiodic rotations of particles trapped by a non-conservative force
NASA Astrophysics Data System (ADS)
Ortega-Piwonka, Ignacio; Angstmann, Christopher N.; Henry, Bruce I.; Reece, Peter J.
2018-04-01
We describe a mechanism whereby random noise can play a constructive role in the manifestation of a pattern, aperiodic rotations, that would otherwise be damped by internal dynamics. The mechanism is described physically in a theoretical model of overdamped particle motion in two dimensions with symmetric damping and a non-conservative force field driven by noise. Cyclic motion only occurs as a result of stochastic noise in this system. However, the persistence of the cyclic motion is quantified by parameters associated with the non-conservative forcing. Unlike stochastic resonance or coherence resonance, where noise can play a constructive role in amplifying a signal that is otherwise below the threshold for detection, in the mechanism considered here, the signal that is detected does not exist without the noise. Moreover, the system described here is a linear system.
NASA Astrophysics Data System (ADS)
Fortunati, Alessandro; Wiggins, Stephen
Starting from the concept of invariant KAM tori for nearly-integrable Hamiltonian systems with periodic or quasi-periodic nonautonomous perturbation, the paper analyzes the “analogue” of this class of invariant objects when the dependence on time is aperiodic. The investigation is carried out in a model motivated by the problem of a traveling wave in a channel over a smooth, quasi- and asymptotically flat (from which the “transient” feature) bathymetry, representing a case in which the described structures play the role of barriers to fluid transport in phase space. The paper provides computational evidence for the existence of transient structures also for “large” values of the perturbation size, as a complement to the rigorous results already proven by the first author for real-analytic bathymetry functions.
Bucci, Davide; Martin, Bruno; Morand, Alain
2012-03-01
This paper deals with a full vectorial generalization of the aperiodic Fourier modal method (AFMM) in cylindrical coordinates. The goal is to predict some key characteristics such as the bending losses of waveguides having an arbitrary distribution of the transverse refractive index. After a description of the method, we compare the results of the cylindrical coordinates AFMM with simulations by the finite-difference time-domain (FDTD) method performed on an S-bend structure made by a 500 nm × 200 nm silicon core (n=3.48) in silica (n=1.44) at a wavelength λ=1550 nm, the bending radius varying from 0.5 up to 2 μm. The FDTD and AFMM results show differences comparable to the variations obtained by changing the parameters of the FDTD simulations.
Voltage dependency of transmission probability of aperiodic DNA molecule
NASA Astrophysics Data System (ADS)
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Self-similar transmission properties of aperiodic Cantor potentials in gapped graphene
NASA Astrophysics Data System (ADS)
Rodríguez-González, Rogelio; Rodríguez-Vargas, Isaac; Díaz-Guerrero, Dan Sidney; Gaggero-Sager, Luis Manuel
2016-01-01
We investigate the transmission properties of quasiperiodic or aperiodic structures based on graphene arranged according to the Cantor sequence. In particular, we have found self-similar behaviour in the transmission spectra, and most importantly, we have calculated the scalability of the spectra. To do this, we implement and propose scaling rules for each one of the fundamental parameters: generation number, height of the barriers and length of the system. With this in mind we have been able to reproduce the reference transmission spectrum, applying the appropriate scaling rule, by means of the scaled transmission spectrum. These scaling rules are valid for both normal and oblique incidence, and as far as we can see the basic ingredients to obtain self-similar characteristics are: relativistic Dirac electrons, a self-similar structure and the non-conservation of the pseudo-spin.
Vector MO magnetometry for mapping microwave currents
NASA Astrophysics Data System (ADS)
Višňovský, Š.; Lišková-Jakubisová, E.; Harward, I.; Celinski, Z.
2018-05-01
Magneto-optic (MO) effects in magnetic multilayers (MML) can be employed in non-invasive 2D mapping of microwave (mw) radiation on the surface of semiconductor chips. A typical sensor configuration consists of Fe nanolayers sandwiched with dielectrics on a thin Si substrate transparent to mw radiation. To extend the observation bandwidth, Δf, up to 100 GHz range the sensor works at ferromagnetic resonance (FMR) frequency in applied magnetic flux density, Bappl. The mw currents excite the precession of magnetization, M, in magnetic nanolayers proportional to their amplitude. The MO component reflected on the sensor surface is proportional to the amplitude of M component, M⊥. The laser source operates at the wavelength of 410 nm. Its plane of incidence is oriented perpendicular to the M⊥ plane. M⊥ oscillates between polar and transverse configurations. A substantial improvement of MO figure of merit takes place in aperiodic MML. More favorable Δf vs. Bappl dependence and MO response can potentially be achieved in MML imbedding hexagonal ferrite or Co nanolayers with in-plane magnetic anisotropy.
On Lashinsky's equation y'' plus alpha y' minus ay plus by cubed equals o
NASA Technical Reports Server (NTRS)
Cap, F. F.
1971-01-01
A differential equation proposed by H. Lashinsky to describe the nonlinear solution of aperiodic instabilities is investigated. Oscillatory and nonoscillatory solutions are discussed and a numerical integration is presented.
New Horizons in Time Domain Astronomy (IAU S285)
NASA Astrophysics Data System (ADS)
Griffin, Elizabeth; Hanisch, Robert; Seaman, Rob
2012-05-01
Introduction; Foreword; 1. Can our data meet the challenges?; 2. Explosive or irreversible changes; 3. Things that tick; 4. Irregular and aperiodic changes; 5. Preparing for the future; Workshop reports; Poster papers; Author index.
Optical and Acoustic Device Applications of Ferroelastic Crystals
NASA Astrophysics Data System (ADS)
Meeks, Steven Wayne
This dissertation presents the discovery of a means of creating uniformly periodic domain gratings in a ferroelastic crystal of neodymium pentaphosphate (NPP). The uniform and non-uniform domain structures which can be created in NPP have the potential applications as tunable active gratings for lasers, tunable diffraction gratings, tunable Bragg reflection gratings, tunable acoustic filters, optical modulators, and optical domain wall memories. The interaction of optical and acoustic waves with ferroelastic domain walls in NPP is presented in detail. Acoustic amplitude reflection coefficients from a single domain wall in NPP are much larger than other ferroelastic-ferroelectrics such as gadolinium molybdate (GMO). Domain walls of NPP are used to make two demonstration acoustic devices: a tunable comb filter and a tunable delay line. The tuning process is accomplished by moving the position of the reflecting surface (the domain wall). A theory of the reflection of optical waves from NPP domain walls is discussed. The optical reflection is due to a change in the polarization of the wave, and not a change in the index, as the wave crosses the domain wall. Theoretical optical power reflection coefficients show good agreement with the experimentally measured values. The largest optical reflection coefficient of a single domain wall is at a critical angle and is 2.2% per domain wall. Techniques of injecting periodic and aperiodic domain walls into NPP are presented. The nucleation process of the uniformly periodic domain gratings in NPP is described in terms of a newly-discovered domain structure, namely the ferroelastic bubble. A ferroelastic bubble is the elastic analogue to the well-known magnetic bubble. The period of the uniformly periodic domain grating is tunable from 100 to 0.5 microns and the grating period may be tuned relatively rapidly. The Bragg efficiency of these tunable gratings is 77% for an uncoated crystal. Several demonstration devices which use these periodic structures are discussed. These devices are a tunable active grating laser (TAG laser), a tunable active grating (TAG), and a tunable acoustic bulk wave filter.
Design and implementation of novel nonlinear processes in bulk and waveguide periodic structures
NASA Astrophysics Data System (ADS)
Kajal, Meenu
The telecommunication networks are facing increasing demand to implement all-optical network infrastructure for enabling the wide deployment of new triple play high-speed services (e.g. IPTV, Video On Demand, Voice over IP). One of the challenges with such video broadcasting applications is that these are much more distributed and multi-point in nature unlike the traditional point-to-point communication networks. Currently deployed high-speed electronic components in the optical networks are incapable of handling the unprecedented bandwidth demand for real-time multimedia based broadcasting. The solution essentially lies in increasing the transparency of networks i.e. by replacing high speed signal processing electronics with all-optical signal processors capable of performing signal manipulations such as wavelength switching, time and wavelength division multiplexing, optical pulse compression etc. all in optical domain. This thesis aims at providing an all-optical solution for broadband wavelength conversion and tunable broadcasting, a crucial optical network component, based on quasi-phase-matched wave mixing in nonlinear materials. The quasi phase matching (QPM) technique allows phase matching in long crystal lengths by employing domain-inverted gratings to periodically reverse the sign of nonlinearity, known as periodic poling. This results into new frequency components with high conversion efficiency and has been successfully implemented towards various processes such as second harmonic generation (SHG), sum- and difference- frequency generation (SFG and DFG). Conventionally, the optical networks has an operation window of ˜35 nm centered at 1.55 mum, known as C-band. The wavelength conversion of a signal channel in C-band to an output channel also in the C-band has been demonstrated in periodically poled lithium niobate (PPLN) waveguides via the process of difference frequency mixing, cascaded SHG/DFG and cascaded SFG/DFG. While a DFG process utilized a pump wavelength in 775nm regime, it suffered from low efficiency due to mode mismatch between the pump and the signal wavelengths; whereas the technique based on cSHG/DFG or cSFG/DFG eliminated the mode mismatch problem with pump(s) lying in the 1.55 mum wavelength regime. In this thesis, for the first time a flattened bandwidth of cSFG/DFG have been experimentally realized by slight detuning of the pump wavelengths from their phase matching condition. Moreover, employing two closely spaced pumps in a cSFG/DFG process in a PPLN waveguide, a signal has been broadcast to three idlers in C-band. Although a uniform period PPLN grating increases efficiency by the use of highest nonlinearity tensor coefficient via QPM, it suffers from the limitation of a narrow bandwidth of frequency doubling. The narrow bandwidth restricts the choice of pump wavelengths in a cascaded conversion process and consequently the converted signal wavelength is also fixed for a given signal wavelength. Enhancing the frequency doubling bandwidth is necessary for mainly two reasons: firstly, to achieve the tunability of wavelength conversion of a signal to any channel in the communication band; and secondly, to broadcast a signal to several channels simultaneously by employing multiple pump lasers within its broad bandwidth. The first engineered PPLN device proposed and demonstrated in this thesis for broadband wavelength conversion has an aperiodic domain in the center of an otherwise periodic grating. This phase-shifted or aperiodic (a-) PPLN has a dual-peak SH response with an increase in bandwidth compared to a uniform PPLN. It has also been shown that using temperature tuning, the phase matching conditions of the aPPLN can be varied and its SH bandwidth can be further enhanced. The triple-idler broadcasting is shown and for the first time, the idlers are tuned across 40 channels in C-band with flexible location and mutual spacing in the WDM grid assisted with pump detuning and temperature tuning. Although the temperature-tuning scheme solves the problem of narrow SH bandwidth and tunability of conversion, the slow speed of temperature change makes it inadequate for ultra-fast WDM applications. Therefore, a temperature-independent broadband device has been demonstrated for the first time in this dissertation, using a step-chirped grating (SCG), which has an inherent 30-nm SH bandwidth overlapping the C-band. This device obviates the need of temperature tuning and leads to tunable wavelength conversion and flexible broadcasting. Employing a single tuned pump wavelength in the SC-PPLN, conversion of a signal in C-band to tunable dual idlers via cSHG/DFG process is demonstrated for the first time. Also by taking advantage of the broad SH-SF bandwidth, for the first time, agile broadcasting of a signal to seven idlers spanning across C-band with variable position in the grid is realized based on cSHG/DFG and cSFG/DFG processes. By tuning the two pump wavelengths over less than 6 nm, broadcasting is achieved across ˜70 WDM channels within the 50 GHz spacing WDM grid. (Abstract shortened by UMI.).
Improved Spectral Calculations for Discrete Schrődinger Operators
NASA Astrophysics Data System (ADS)
Puelz, Charles
This work details an O(n2) algorithm for computing spectra of discrete Schrődinger operators with periodic potentials. Spectra of these objects enhance our understanding of fundamental aperiodic physical systems and contain rich theoretical structure of interest to the mathematical community. Previous work on the Harper model led to an O(n2) algorithm relying on properties not satisfied by other aperiodic operators. Physicists working with the Fibonacci Hamiltonian, a popular quasicrystal model, have instead used a problematic dynamical map approach or a sluggish O(n3) procedure for their calculations. The algorithm presented in this work, a blend of well-established eigenvalue/vector algorithms, provides researchers with a more robust computational tool of general utility. Application to the Fibonacci Hamiltonian in the sparsely studied intermediate coupling regime reveals structure in canonical coverings of the spectrum that will prove useful in motivating conjectures regarding band combinatorics and fractal dimensions.
NASA Astrophysics Data System (ADS)
Tito, M. A.; Pusep, Yu A.
2018-01-01
Time-resolved magneto-photoluminescence was employed to study the magnetic field induced quantum phase transition separating two phases with different distributions of electrons over quantum wells in an aperiodic multiple quantum well, embedded in a wide AlGaAs parabolic quantum well. Intensities, broadenings and recombination times attributed to the photoluminescence lines emitted from individual quantum wells of the multiple quantum well structure were measured as a function of the magnetic field near the transition. The presented data manifest themselves to the magnetic field driven migration of the free electrons between the quantum wells of the studied multiple quantum well structure. The observed charge transfer was found to influence the screening of the multiple quantum well and disorder potentials. Evidence of the localization of the electrons in the peripheral quantum wells in strong magnetic field is presented.
Reaction front barriers in time aperiodic fluid flows
NASA Astrophysics Data System (ADS)
Locke, Rory; Mitchell, Kevin
2016-11-01
Many chemical and biological systems can be characterized by the propagation of a front that separates different phases or species. One approach to formalizing a general theory is to apply frameworks developed in nonlinear dynamics. It has been shown that invariant manifolds form barriers to passive transport in time-dependent or time-periodic fluid flows. More recently, analogous manifolds termed burning- invariant-manifolds (BIMs), have been shown to form one-sided barriers to reaction fronts in advection-reaction-diffusion (ARD) systems. To model more realistic time-aperiodic systems, recent theoretical work has suggested that similar one-sided barriers, termed burning Lagrangian coherent structures (bLCSs), exist for fluid velocity data prescribed over a finite time interval. In this presentation, we use a stochastic "wind" to generate time dependence in a double-vortex channel flow and demonstrate the (locally) most attracting or repelling curves are the bLCSs.
The fossil record of evolution: Data on diversification and extinction
NASA Technical Reports Server (NTRS)
Sepkoski, J. J., Jr.
1986-01-01
Synoptic studies of the fossil record of complex life on Earth indicate increasingly that extinction, and especially mass extinction, were extremely important driving forces in the history of life. Analysis of a new compilation of geologic ranges for 25,000 genera of marine animals suggests that extinction events were much more frequent in occurrence and variable in magnitude than previously suspected. At least 30 well documented and potential mass extinctions were identified in the dataset. The most recent event, distributed over 260 to 0 ma. exhibit a stationary periodicity of 26.1 + or - 1 ma, implicating a cosmological forcing mechanism. Earlier events, especially in the 575 to 450 ma interval, are more frequent, possibly indicating either a breakdown of periodicity in the more distant past; and as yet undemonstrated diminution of the period length; or frequent aperiodic terrestrial perturbations of a less stable biota superimposed upon the cosmological periodicity.
NASA Technical Reports Server (NTRS)
Weisskopf, M. C.; Darbro, W. A.; Elsner, R. F.; Williams, A. C.; Kahn, S. M.; Grindlay, J. E.; Naranan, S.; Sutherland, P. G.
1983-01-01
A comparison is presented of the black hole candidates LMC X-3 and Cygnus X-1 based on Einstein observations of LMC X-3 with the monitor proportional counter. A spectral analysis shows LMC X-3 to be more like the typical bright galactic X-ray source than Cygnus X-1. A search for periodic pulsations over a period range from 0.2 ms to over 1000 s set upper limits at the 90 percent confidence level of the order of 10 percent. An analysis of the aperiodic variability of LMC X-3 shows none of the shot noise behavior characteristic of Cygnus X-1. The absence of distinctive X-ray properties common to both sources suggests that the identification of black hole candidates on the basis of X-ray properties similar to Cygnus X-1 (or LMC X-3) is not reliable.
Stabilization of dynamics of oscillatory systems by nonautonomous perturbation.
Lucas, Maxime; Newman, Julian; Stefanovska, Aneta
2018-04-01
Synchronization and stability under periodic oscillatory driving are well understood, but little is known about the effects of aperiodic driving, despite its abundance in nature. Here, we consider oscillators subject to driving with slowly varying frequency, and investigate both short-term and long-term stability properties. For a phase oscillator, we find that, counterintuitively, such variation is guaranteed to enlarge the Arnold tongue in parameter space. Using analytical and numerical methods that provide information on time-variable dynamical properties, we find that the growth of the Arnold tongue is specifically due to the growth of a region of intermittent synchronization where trajectories alternate between short-term stability and short-term neutral stability, giving rise to stability on average. We also present examples of higher-dimensional nonlinear oscillators where a similar stabilization phenomenon is numerically observed. Our findings help support the case that in general, deterministic nonautonomous perturbation is a very good candidate for stabilizing complex dynamics.
Stabilization of dynamics of oscillatory systems by nonautonomous perturbation
NASA Astrophysics Data System (ADS)
Lucas, Maxime; Newman, Julian; Stefanovska, Aneta
2018-04-01
Synchronization and stability under periodic oscillatory driving are well understood, but little is known about the effects of aperiodic driving, despite its abundance in nature. Here, we consider oscillators subject to driving with slowly varying frequency, and investigate both short-term and long-term stability properties. For a phase oscillator, we find that, counterintuitively, such variation is guaranteed to enlarge the Arnold tongue in parameter space. Using analytical and numerical methods that provide information on time-variable dynamical properties, we find that the growth of the Arnold tongue is specifically due to the growth of a region of intermittent synchronization where trajectories alternate between short-term stability and short-term neutral stability, giving rise to stability on average. We also present examples of higher-dimensional nonlinear oscillators where a similar stabilization phenomenon is numerically observed. Our findings help support the case that in general, deterministic nonautonomous perturbation is a very good candidate for stabilizing complex dynamics.
Choi, Seong Hee; Zhang, Yu; Jiang, Jack J.; Bless, Diane M.; Welham, Nathan V.
2011-01-01
Objective The primary goal of this study was to evaluate a nonlinear dynamic approach to the acoustic analysis of dysphonia associated with vocal fold scar and sulcus vocalis. Study Design Case-control study. Methods Acoustic voice samples from scar/sulcus patients and age/sex-matched controls were analyzed using correlation dimension (D2) and phase plots, time-domain based perturbation indices (jitter, shimmer, signal-to-noise ratio [SNR]), and an auditory-perceptual rating scheme. Signal typing was performed to identify samples with bifurcations and aperiodicity. Results Type 2 and 3 acoustic signals were highly represented in the scar/sulcus patient group. When data were analyzed irrespective of signal type, all perceptual and acoustic indices successfully distinguished scar/sulcus patients from controls. Removal of type 2 and 3 signals eliminated the previously identified differences between experimental groups for all acoustic indices except D2. The strongest perceptual-acoustic correlation in our dataset was observed for SNR; the weakest correlation was observed for D2. Conclusions These findings suggest that D2 is inferior to time-domain based perturbation measures for the analysis of dysphonia associated with scar/sulcus; however, time-domain based algorithms are inherently susceptible to inflation under highly aperiodic (i.e., type 2 and 3) signal conditions. Auditory-perceptual analysis, unhindered by signal aperiodicity, is therefore a robust strategy for distinguishing scar/sulcus patient voices from normal voices. Future acoustic analysis research in this area should consider alternative (e.g., frequency- and quefrency-domain based) measures alongside additional nonlinear approaches. PMID:22516315
The evolution of the Gutenberg-Richter, b-value, throughout periodic and aperiodic stick-slip cycles
NASA Astrophysics Data System (ADS)
Bolton, D. C.; Riviere, J.; Marone, C.; Johnson, P. A.
2017-12-01
The Gutenberg-Richter earthquake size statistic, b value, is a useful proxy for documenting the state of stress on a fault and understanding precursory phenomena preceding dynamic failure. It has been shown that the b value varies systematically as a function of position within the seismic cycle. Frictional studies on intact rock samples with saw-cut faults have shown that b value decreases continuously preceding failure. For intact rock samples, the spatiotemporal changes in b value are thought to be related to the evolution of asperities and micro-cracks. However, few studies have shown how b value evolves spatially and temporally for fault zones containing gouge and wear materials. We hypothesize that the micromechanical mechanisms acting within fault gouge, such as creation and destruction of force chains, grain rolling, sliding, jamming and fracturing play an important role in the evolution of b value and that they may have distinct signatures during periodic and aperiodic cycles of stick-slip frictional motion. We report results from experiments conducted on simulated fault gouge using a biaxial deformation apparatus in a double-direct shear configuration. Acoustic emissions (AEs) are recorded at 4 MHz from 36 P-polarized piezoelectric transducers, which are embedded in steel blocks located adjacent to the fault zone. We compute the frequency-magnitude distribution of detected AEs using a moving window in events where each window is overlapped by 75%. We report on the evolution of b value as a function of normal stress and gouge layer thickness. For periodic slip events, b value reaches a maximum value immediately after a slip event and decreases continuously until the next failure. Aperiodic slip events show similar trends in b-value initially, however unlike periodic slip events, b value reaches a steady state value before failure occurs. In addition, for periodic slip events the magnitude of the change in b value scales inversely with gouge layer thickness. Ongoing work is focused on correcting for attenuation and geometric spreading within the gouge layer in order to identify the mechanisms responsible for the evolution of b during the seismic cycle. In addition, we plan to characterize the spatial evolution of b values through periodic and aperiodic slip events.
Hard X-ray mirrors for Nuclear Security
DOE Office of Scientific and Technical Information (OSTI.GOV)
Descalle, M. A.; Brejnholt, N.; Hill, R.
Research performed under this LDRD aimed to demonstrate the ability to detect and measure hard X-ray emissions using multilayer X-ray reflective optics above 400 keV, to enable the development of inexpensive and high-accuracy mirror substrates, and to investigate applications of hard X-ray mirrors of interest to the nuclear security community. Experiments conducted at the European Synchrotron Radiation Facility demonstrated hard X-ray mirror reflectivity up to 650 keV for the first time. Hard X-ray optics substrates must have surface roughness under 3 to 4 Angstrom rms, and three materials were evaluated as potential substrates: polycarbonates, thin Schott glass and a newmore » type of flexible glass called Willow Glass®. Chemical smoothing and thermal heating of the surface of polycarbonate samples, which are inexpensive but have poor intrinsic surface characteristics, did not yield acceptable surface roughness. D263 Schott glass was used for the focusing optics of the NASA NuSTAR telescope. The required specialized hardware and process were costly and motivated experiments with a modified non-contact slumping technique. The surface roughness of the glass was preserved and the process yielded cylindrical shells with good net shape pointing to the potential advantage of this technique. Finally, measured surface roughness of 200 and 130 μm thick Willow Glass sheets was between 2 and 2.5 A rms. Additional results of flexibility tests and multilayer deposition campaigns indicated it is a promising substrate for hard X-ray optics. The detection of U and Pu characteristics X-ray lines and gamma emission lines in a high background environment was identified as an area for which X-ray mirrors could have an impact and where focusing optics could help reduce signal to noise ratio by focusing signal onto a smaller detector. Hence the first one twelvetant of a Wolter I focusing optics for the 90 to 140 keV energy range based on aperiodic multilayer coating was designed. Finally, we conducted the first demonstration that reflective multilayer mirrors could be used as diagnostic for HED experiment with an order of magnitude improvement in signal-to-noise ratio for the multilayer optic compared a transmission crystal spectrometer.« less
Analysis of continuous-time switching networks
NASA Astrophysics Data System (ADS)
Edwards, R.
2000-11-01
Models of a number of biological systems, including gene regulation and neural networks, can be formulated as switching networks, in which the interactions between the variables depend strongly on thresholds. An idealized class of such networks in which the switching takes the form of Heaviside step functions but variables still change continuously in time has been proposed as a useful simplification to gain analytic insight. These networks, called here Glass networks after their originator, are simple enough mathematically to allow significant analysis without restricting the range of dynamics found in analogous smooth systems. A number of results have been obtained before, particularly regarding existence and stability of periodic orbits in such networks, but important cases were not considered. Here we present a coherent method of analysis that summarizes previous work and fills in some of the gaps as well as including some new results. Furthermore, we apply this analysis to a number of examples, including surprising long and complex limit cycles involving sequences of hundreds of threshold transitions. Finally, we show how the above methods can be extended to investigate aperiodic behaviour in specific networks, though a complete analysis will have to await new results in matrix theory and symbolic dynamics.
Quasi-Periodic Pulse Amplitude Modulation in the Accreting Millisecond Pulsar IGR J00291+5934
NASA Technical Reports Server (NTRS)
Bult, Peter; van Doesburgh, Marieke; van der Klis, Michiel
2017-01-01
We introduce a new method for analyzing the a periodic variability of coherent pulsations in accreting millisecond X-ray pulsars (AMXPs). Our method involves applying a complex frequency correction to the time-domain lightcurve, allowing for the aperiodic modulation of the pulse amplitude to be robustly extracted in the frequency domain. We discuss the statistical properties of the resulting modulation spectrum and show how it can be correlated with the non-pulsed emission to determine if the periodic and a periodic variability are coupled processes. Using this method, we study the 598.88 Hz coherent pulsations of the AMXP IGR J00291+5934 as observed with the Rossi X-ray Timing Explorer and XMM-Newton. We demonstrate that our method easily confirms the known coupling between the pulsations and a strong 8 mHz quasi-periodic oscillation (QPO) in XMM-Newton observations. Applying our method to the RXTE observations, we further show, for the first time, that the much weaker 20 mHz QPO and its harmonic are also coupled with the pulsations. We discuss the implications of this coupling and indicate how it may be used to extract new information on the underlying accretion process.
NASA Astrophysics Data System (ADS)
Suresha, Suhas; Sujith, R. I.; Emerson, Benjamin; Lieuwen, Tim
2016-10-01
The flame or flow behavior of a turbulent reacting wake is known to be fundamentally different at high and low values of flame density ratio (ρu/ρb ), as the flow transitions from globally stable to unstable. This paper analyzes the nonlinear dynamics present in a bluff-body stabilized flame, and identifies the transition characteristics in the wake as ρu/ρb is varied over a Reynolds number (based on the bluff-body lip velocity) range of 1000-3300. Recurrence quantification analysis (RQA) of the experimentally obtained time series of the flame edge fluctuations reveals that the time series is highly aperiodic at high values of ρu/ρb and transitions to increasingly correlated or nearly periodic behavior at low values. From the RQA of the transverse velocity time series, we observe that periodicity in the flame oscillations are related to periodicity in the flow. Therefore, we hypothesize that this transition from aperiodic to nearly periodic behavior in the flame edge time series is a manifestation of the transition in the flow from globally stable, convective instability to global instability as ρu/ρb decreases. The recurrence analysis further reveals that the transition in periodicity is not a sudden shift; rather it occurs through an intermittent regime present at low and intermediate ρu/ρb . During intermittency, the flow behavior switches between aperiodic oscillations, reminiscent of a globally stable, convective instability, and periodic oscillations, reminiscent of a global instability. Analysis of the distribution of the lengths of the periodic regions in the intermittent time series and the first return map indicate the presence of type-II intermittency.
Exploring the tolerability of spatiotemporally complex electrical stimulation paradigms.
Nelson, Timothy S; Suhr, Courtney L; Lai, Alan; Halliday, Amy J; Freestone, Dean R; McLean, Karen J; Burkitt, Anthony N; Cook, Mark J
2011-10-01
A modified cortical stimulation model was used to investigate the effects of varying the synchronicity and periodicity of electrical stimuli delivered to multiple pairs of electrodes on seizure initiation. In this model, electrical stimulation of the motor cortex of rats, along four pairs of a microwire electrode array, results in an observable seizure with quantifiable electrographic duration and behavioural severity. Periodic stimuli had a constant inter-stimulus intervals across the two-second stimulus duration, whilst synchronous stimuli consisted of singular biphasic, bipolar pulses delivered to the four pairs of electrodes at precisely the same time for the entire two second stimulation period. In this way four combinations of stimulation were possible; periodic/synchronous (P/S), periodic/asynchronous (P/As), aperiodic/synchronous (Ap/S) and aperiodic/asynchronous (Ap/As). All stimulation types were designed with equal pulse width, current intensity and mean frequency of stimulation (60 Hz), standardizing net charge transfer. It was expected that the periodicity of the stimulus would be the primary determinant of seizure initiation and therefore severity and electrographic duration. However, the results showed that significant differences in both severity and duration only occurred when the synchronicity was altered. For periodic stimuli, synchronous delivery increased median seizure duration from 5 s to 13 s and increased median Racine severity from 1 to 3. In the aperiodic case, synchronous stimulus delivery increased median duration from 5.5 s to 11s and resulted in seizures of median severity 3 vs. 0 in the asynchronous case. These findings may have implications for the design of future neurostimulation waveform designs as higher numbers of electrodes and stimulator output channels become available in next generation implants. Copyright © 2011 Elsevier B.V. All rights reserved.
Design of crystal-like aperiodic solids with selective disorder–phonon coupling
Overy, Alistair R.; Cairns, Andrew B.; Cliffe, Matthew J.; Simonov, Arkadiy; Tucker, Matthew G.; Goodwin, Andrew L.
2016-01-01
Functional materials design normally focuses on structurally ordered systems because disorder is considered detrimental to many functional properties. Here we challenge this paradigm by showing that particular types of strongly correlated disorder can give rise to useful characteristics that are inaccessible to ordered states. A judicious combination of low-symmetry building unit and high-symmetry topological template leads to aperiodic ‘procrystalline' solids that harbour this type of disorder. We identify key classes of procrystalline states together with their characteristic diffraction behaviour, and establish mappings onto known and target materials. The strongly correlated disorder found in these systems is associated with specific sets of modulation periodicities distributed throughout the Brillouin zone. Lattice dynamical calculations reveal selective disorder-driven phonon broadening that resembles the poorly understood ‘waterfall' effect observed in relaxor ferroelectrics. This property of procrystalline solids suggests a mechanism by which strongly correlated topological disorder might allow independently optimized thermal and electronic transport behaviour, such as required for high-performance thermoelectrics. PMID:26842772
Electric fields yield chaos in microflows
Posner, Jonathan D.; Pérez, Carlos L.; Santiago, Juan G.
2012-01-01
We present an investigation of chaotic dynamics of a low Reynolds number electrokinetic flow. Electrokinetic flows arise due to couplings of electric fields and electric double layers. In these flows, applied (steady) electric fields can couple with ionic conductivity gradients outside electric double layers to produce flow instabilities. The threshold of these instabilities is controlled by an electric Rayleigh number, Rae. As Rae increases monotonically, we show here flow dynamics can transition from steady state to a time-dependent periodic state and then to an aperiodic, chaotic state. Interestingly, further monotonic increase of Rae shows a transition back to a well-ordered state, followed by a second transition to a chaotic state. Temporal power spectra and time-delay phase maps of low dimensional attractors graphically depict the sequence between periodic and chaotic states. To our knowledge, this is a unique report of a low Reynolds number flow with such a sequence of periodic-to-aperiodic transitions. Also unique is a report of strange attractors triggered and sustained through electric fluid body forces. PMID:22908251
The Time Is Up: Compression of Visual Time Interval Estimations of Bimodal Aperiodic Patterns
Duarte, Fabiola; Lemus, Luis
2017-01-01
The ability to estimate time intervals subserves many of our behaviors and perceptual experiences. However, it is not clear how aperiodic (AP) stimuli affect our perception of time intervals across sensory modalities. To address this question, we evaluated the human capacity to discriminate between two acoustic (A), visual (V) or audiovisual (AV) time intervals of trains of scattered pulses. We first measured the periodicity of those stimuli and then sought for correlations with the accuracy and reaction times (RTs) of the subjects. We found that, for all time intervals tested in our experiment, the visual system consistently perceived AP stimuli as being shorter than the periodic (P) ones. In contrast, such a compression phenomenon was not apparent during auditory trials. Our conclusions are: first, the subjects exposed to P stimuli are more likely to measure their durations accurately. Second, perceptual time compression occurs for AP visual stimuli. Lastly, AV discriminations are determined by A dominance rather than by AV enhancement. PMID:28848406
Stokes waves revisited: Exact solutions in the asymptotic limit
NASA Astrophysics Data System (ADS)
Davies, Megan; Chattopadhyay, Amit K.
2016-03-01
The Stokes perturbative solution of the nonlinear (boundary value dependent) surface gravity wave problem is known to provide results of reasonable accuracy to engineers in estimating the phase speed and amplitudes of such nonlinear waves. The weakling in this structure though is the presence of aperiodic "secular variation" in the solution that does not agree with the known periodic propagation of surface waves. This has historically necessitated increasingly higher-ordered (perturbative) approximations in the representation of the velocity profile. The present article ameliorates this long-standing theoretical insufficiency by invoking a compact exact n -ordered solution in the asymptotic infinite depth limit, primarily based on a representation structured around the third-ordered perturbative solution, that leads to a seamless extension to higher-order (e.g., fifth-order) forms existing in the literature. The result from this study is expected to improve phenomenological engineering estimates, now that any desired higher-ordered expansion may be compacted within the same representation, but without any aperiodicity in the spectral pattern of the wave guides.
Spectral statistics and scattering resonances of complex primes arrays
NASA Astrophysics Data System (ADS)
Wang, Ren; Pinheiro, Felipe A.; Dal Negro, Luca
2018-01-01
We introduce a class of aperiodic arrays of electric dipoles generated from the distribution of prime numbers in complex quadratic fields (Eisenstein and Gaussian primes) as well as quaternion primes (Hurwitz and Lifschitz primes), and study the nature of their scattering resonances using the vectorial Green's matrix method. In these systems we demonstrate several distinctive spectral properties, such as the absence of level repulsion in the strongly scattering regime, critical statistics of level spacings, and the existence of critical modes, which are extended fractal modes with long lifetimes not supported by either random or periodic systems. Moreover, we show that one can predict important physical properties, such as the existence spectral gaps, by analyzing the eigenvalue distribution of the Green's matrix of the arrays in the complex plane. Our results unveil the importance of aperiodic correlations in prime number arrays for the engineering of gapped photonic media that support far richer mode localization and spectral properties compared to usual periodic and random media.
Fiber facet gratings for high power fiber lasers
NASA Astrophysics Data System (ADS)
Vanek, Martin; Vanis, Jan; Baravets, Yauhen; Todorov, Filip; Ctyroky, Jiri; Honzatko, Pavel
2017-12-01
We numerically investigated the properties of diffraction gratings designated for fabrication on the facet of an optical fiber. The gratings are intended to be used in high-power fiber lasers as mirrors either with a low or high reflectivity. The modal reflectance of low reflectivity polarizing grating has a value close to 3% for TE mode while it is significantly suppressed for TM mode. Such a grating can be fabricated on laser output fiber facet. The polarizing grating with high modal reflectance is designed as a leaky-mode resonant diffraction grating. The grating can be etched in a thin layer of high index dielectric which is sputtered on fiber facet. We used refractive index of Ta2O5 for such a layer. We found that modal reflectance can be close to 0.95 for TE polarization and polarization extinction ratio achieves 18 dB. Rigorous coupled wave analysis was used for fast optimization of grating parameters while aperiodic rigorous coupled wave analysis, Fourier modal method and finite difference time domain method were compared and used to compute modal reflectance of designed gratings.
Huang, Yi-Fan; Chattopadhyay, Surojit; Jen, Yi-Jun; Peng, Cheng-Yu; Liu, Tze-An; Hsu, Yu-Kuei; Pan, Ci-Ling; Lo, Hung-Chun; Hsu, Chih-Hsun; Chang, Yuan-Huei; Lee, Chih-Shan; Chen, Kuei-Hsien; Chen, Li-Chyong
2007-12-01
Nature routinely produces nanostructured surfaces with useful properties, such as the self-cleaning lotus leaf, the colour of the butterfly wing, the photoreceptor in brittlestar and the anti-reflection observed in the moth eye. Scientists and engineers have been able to mimic some of these natural structures in the laboratory and in real-world applications. Here, we report a simple aperiodic array of silicon nanotips on a 6-inch wafer with a sub-wavelength structure that can suppress the reflection of light at a range of wavelengths from the ultraviolet, through the visible part of the spectrum, to the terahertz region. Reflection is suppressed for a wide range of angles of incidence and for both s- and p-polarized light. The antireflection properties of the silicon result from changes in the refractive index caused by variations in the height of the silicon nanotips, and can be simulated with models that have been used to explain the low reflection from moth eyes. The improved anti-reflection properties of the surfaces could have applications in renewable energy and electro-optical devices for the military.
Complex dynamic in ecological time series
Peter Turchin; Andrew D. Taylor
1992-01-01
Although the possibility of complex dynamical behaviors-limit cycles, quasiperiodic oscillations, and aperiodic chaos-has been recognized theoretically, most ecologists are skeptical of their importance in nature. In this paper we develop a methodology for reconstructing endogenous (or deterministic) dynamics from ecological time series. Our method consists of fitting...
Engineering quadratic nonlinear photonic crystals for frequency conversion of lasers
NASA Astrophysics Data System (ADS)
Chen, Baoqin; Hong, Lihong; Hu, Chenyang; Zhang, Chao; Liu, Rongjuan; Li, Zhiyuan
2018-03-01
Nonlinear frequency conversion offers an effective way to extend the laser wavelength range. Quadratic nonlinear photonic crystals (NPCs) are artificial materials composed of domain-inversion structures whose sign of nonlinear coefficients are modulated with desire to implement quasi-phase matching (QPM) required for nonlinear frequency conversion. These structures can offer various reciprocal lattice vectors (RLVs) to compensate the phase-mismatching during the quadratic nonlinear optical processes, including second-harmonic generation (SHG), sum-frequency generation and the cascaded third-harmonic generation (THG). The modulation pattern of the nonlinear coefficients is flexible, which can be one-dimensional or two-dimensional (2D), be periodic, quasi-periodic, aperiodic, chirped, or super-periodic. As a result, these NPCs offer very flexible QPM scheme to satisfy various nonlinear optics and laser frequency conversion problems via design of the modulation patterns and RLV spectra. In particular, we introduce the electric poling technique for fabricating QPM structures, a simple effective nonlinear coefficient model for efficiently and precisely evaluating the performance of QPM structures, the concept of super-QPM and super-periodically poled lithium niobate for finely tuning nonlinear optical interactions, the design of 2D ellipse QPM NPC structures enabling continuous tunability of SHG in a broad bandwidth by simply changing the transport direction of pump light, and chirped QPM structures that exhibit broadband RLVs and allow for simultaneous radiation of broadband SHG, THG, HHG and thus coherent white laser from a single crystal. All these technical, theoretical, and physical studies on QPM NPCs can help to gain a deeper insight on the mechanisms, approaches, and routes for flexibly controlling the interaction of lasers with various QPM NPCs for high-efficiency frequency conversion and creation of novel lasers.
The Pacific Northwest (PNW) is one of the leading regions of timber production in the United States. It also undergoes aperiodic episodes of catastrophic forest fires, and systematic slash burns following logging activities. Such conditions raise concerns regarding increased re...
Aperiodicity Correction for Rotor Tip Vortex Measurements
2011-05-01
where α = 1.25643. The Iversen and the transitional models are not closed-form solutions but are formulated as solutions to an ordinary differential ...edition, 1932, pp. 592– 593. [7] Oseen, C. W., “ Uber Wirbelbewegung in Einer Reibenden Flussigkeit,” Ark. J. Mat. Astrom. Fys., Vol. 7, (Nonumber), 1912
A physically-based earthquake recurrence model for estimation of long-term earthquake probabilities
Ellsworth, William L.; Matthews, Mark V.; Nadeau, Robert M.; Nishenko, Stuart P.; Reasenberg, Paul A.; Simpson, Robert W.
1999-01-01
A physically-motivated model for earthquake recurrence based on the Brownian relaxation oscillator is introduced. The renewal process defining this point process model can be described by the steady rise of a state variable from the ground state to failure threshold as modulated by Brownian motion. Failure times in this model follow the Brownian passage time (BPT) distribution, which is specified by the mean time to failure, μ, and the aperiodicity of the mean, α (equivalent to the familiar coefficient of variation). Analysis of 37 series of recurrent earthquakes, M -0.7 to 9.2, suggests a provisional generic value of α = 0.5. For this value of α, the hazard function (instantaneous failure rate of survivors) exceeds the mean rate for times > μ⁄2, and is ~ ~ 2 ⁄ μ for all times > μ. Application of this model to the next M 6 earthquake on the San Andreas fault at Parkfield, California suggests that the annual probability of the earthquake is between 1:10 and 1:13.
NASA Astrophysics Data System (ADS)
Feng, Di; Yang, Xingpeng; Jin, Guofan; Yan, Yingbai; Fan, Shoushan
2006-01-01
Liquid crystal displays (LCDs) with edge-lit backlight systems offer several advantages, such as low energy consuming, low weight, and high uniformity of intensity, over traditional cathode-ray tube displays, and make them ideal for many applications including monitors in notebook personal computers, screens for TV, and many portable information terminals, such as mobile phones, personal digital assistants, etc. To satisfy market requirements for mobile and personal display panels, it is more and more necessary to modify the backlight system and make it thinner, lighter, and brighter all at once. In this paper, we have proposed a new integrated LGP based on periodic and aperiodic microprism structures by using polymethyl methacrylate material, which can be designed to control the illumination angle, and to get high uniformity of intensity. So the backlight system will be simplified to use only light sources and one LGP without using other optical sheets, such as reflection sheet, diffusion sheet and prism sheets. By using optimizing program and ray tracing method, the designed LGPs can achieve a uniformity of intensity better than 86%, and get a peak illumination angle from +400 to -200, without requiring other optical sheets. We have designed a backlight system with only one LED light source and one LGP, and other LGP design examples with different sizes (1.8 inches and 14.1 inches) and different light source (LED or CCFL), are performed also.
Things that go bump in the light - On the optical specification of contact severity
NASA Technical Reports Server (NTRS)
Kaiser, Mary K.; Phatak, Anil V.
1993-01-01
Psychologists are intrigued with the idea that optical variables can specify not only the time until an object impacts an observer but also the severity of the impact. However, the mapping between the optical variables and the kinematic variables has been misstated, erroneously implying that there exist critical values of the optical variables used for locomotion and control. In this commentary, the mathematical relationship between the optical and kinematic variables is reexamined and the erroneous assumptions that have led to the proposal of critical values are shown. Also examined are the empirical data on deceleration to approach to assess whether the proposed optical variables are likely candidates for control strategies. Finally, problems associated with numerical approximations to dynamic systems, particularly when analytic solutions exist, are discussed.
The Chaotic Light Curves of Accreting Black Holes
NASA Technical Reports Server (NTRS)
Kazanas, Demosthenes
2007-01-01
We present model light curves for accreting Black Hole Candidates (BHC) based on a recently developed model of these sources. According to this model, the observed light curves and aperiodic variability of BHC are due to a series of soft photon injections at random (Poisson) intervals and the stochastic nature of the Comptonization process in converting these soft photons to the observed high energy radiation. The additional assumption of our model is that the Comptonization process takes place in an extended but non-uniform hot plasma corona surrounding the compact object. We compute the corresponding Power Spectral Densities (PSD), autocorrelation functions, time skewness of the light curves and time lags between the light curves of the sources at different photon energies and compare our results to observation. Our model reproduces the observed light curves well, in that it provides good fits to their overall morphology (as manifest by the autocorrelation and time skewness) and also to their PSDs and time lags, by producing most of the variability power at time scales 2 a few seconds, while at the same time allowing for shots of a few msec in duration, in accordance with observation. We suggest that refinement of this type of model along with spectral and phase lag information can be used to probe the structure of this class of high energy sources.
Tuning Into Brown Dwarfs: Long-Term Radio Monitoring of Two Very Low Mass Dwarfs
NASA Astrophysics Data System (ADS)
Van Linge, Russell; Burgasser, Adam J.; Melis, Carl; Williams, Peter K. G.
2017-01-01
The very lowest-mass (VLM) stars and brown dwarfs, with effective temperatures T < 3000 K, exhibit mixed magnetic activity trends, with H-alpha and X-ray emission that declines rapidly beyond type M7/M8, but persistent radio emission in roughly 10-20% of sources. The dozen or so VLM radio emitters known show a broad range of emission characteristics and time-dependent behavior, including steady persistent emission, periodic oscillations, periodic polarized bursts, and aperiodic flares. Understanding the evolution of these variability patterns, and in particular whether they undergo solar-like cycles, requires long-term monitoring. We report the results of a long-term JVLA monitoring program of two magnetically-active VLM dwarf binaries, the young M7 2MASS 1314+1320AB and older L5 2MASS 1315-2649AB. On the bi-weekly cadence, 2MASS 1314 continues to show variability by revealing regular flaring while 2MASS 1315 continues to be a quiescent emitter. On the daily time scale, both sources show a mean flux density that can vary significantly just over a few days. These results suggest long-term radio behavior in radio-emitting VLM dwarfs is just as diverse and complex as short-term behavior.
Empirical modeling ENSO dynamics with complex-valued artificial neural networks
NASA Astrophysics Data System (ADS)
Seleznev, Aleksei; Gavrilov, Andrey; Mukhin, Dmitry
2016-04-01
The main difficulty in empirical reconstructing the distributed dynamical systems (e.g. regional climate systems, such as El-Nino-Southern Oscillation - ENSO) is a huge amount of observational data comprising time-varying spatial fields of several variables. An efficient reduction of system's dimensionality thereby is essential for inferring an evolution operator (EO) for a low-dimensional subsystem that determines the key properties of the observed dynamics. In this work, to efficient reduction of observational data sets we use complex-valued (Hilbert) empirical orthogonal functions which are appropriate, by their nature, for describing propagating structures unlike traditional empirical orthogonal functions. For the approximation of the EO, a universal model in the form of complex-valued artificial neural network is suggested. The effectiveness of this approach is demonstrated by predicting both the Jin-Neelin-Ghil ENSO model [1] behavior and real ENSO variability from sea surface temperature anomalies data [2]. The study is supported by Government of Russian Federation (agreement #14.Z50.31.0033 with the Institute of Applied Physics of RAS). 1. Jin, F.-F., J. D. Neelin, and M. Ghil, 1996: El Ni˜no/Southern Oscillation and the annual cycle: subharmonic frequency locking and aperiodicity. Physica D, 98, 442-465. 2. http://iridl.ldeo.columbia.edu/SOURCES/.KAPLAN/.EXTENDED/.v2/.ssta/
Aperiodic Photonic-Plasmonic Structures with Broadband Field Enhancement
2012-10-15
monomer, (d and g) dimer, (e and i ) trimer...components of the radial distribution function. (a-d) numerator, (e-h) denominator, ( i -l) entire radial distribution function...in the Y direction is 400 nm. Fig 7 d- i shows the scattering efficiency and maximum field enhancement of each array compared with that of the
Periodic and Aperiodic Close Packing: A Spontaneous Hard-Sphere Model.
ERIC Educational Resources Information Center
van de Waal, B. W.
1985-01-01
Shows how to make close-packed models from balloons and table tennis balls to illustrate structural features of clusters and organometallic cluster-compounds (which are of great interest in the study of chemical reactions). These models provide a very inexpensive and tactile illustration of the organization of matter for concrete operational…
An intermittency route to global instability in low-density jets
NASA Astrophysics Data System (ADS)
Murugesan, Meenatchidevi; Zhu, Yuanhang; Li, Larry K. B.
2017-11-01
Above a critical Reynolds number (Re), a low-density jet can become globally unstable, transitioning from a steady state (i.e. a fixed point) to a self-excited oscillatory state (i.e. a limit cycle) via a Hopf bifurcation. In this experimental study, we show that this transition can sometimes involve intermittency. When Re is just slightly above the critical point, intermittent bursts of high-amplitude periodic oscillations emerge amidst a background of low-amplitude aperiodic fluctuations. As Re increases further, these intermittent bursts persist longer in time until they dominate the overall dynamics, causing the jet to transition fully to a periodic limit cycle. We identify this as Type-II Pomeau-Manneville intermittency by quantifying the statistical distribution of the duration of the aperiodic fluctuations at the onset of intermittency. This study shows that the transition to global instability in low-density jets is not always abrupt but can involve an intermediate state with characteristics of both the initial fixed point and the final limit cycle. This work was supported by the Research Grants Council of Hong Kong (Project No. 16235716 and 26202815).
Internal twisting motion dependent conductance of an aperiodic DNA molecule
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta
The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less
CSI 2264: Probing the inner disks of AA Tauri-like systems in NGC 2264
NASA Astrophysics Data System (ADS)
McGinnis, P. T.; Alencar, S. H. P.; Guimarães, M. M.; Sousa, A. P.; Stauffer, J.; Bouvier, J.; Rebull, L.; Fonseca, N. N. J.; Venuti, L.; Hillenbrand, L.; Cody, A. M.; Teixeira, P. S.; Aigrain, S.; Favata, F.; Fűrész, G.; Vrba, F. J.; Flaccomio, E.; Turner, N. J.; Gameiro, J. F.; Dougados, C.; Herbst, W.; Morales-Calderón, M.; Micela, G.
2015-05-01
Context. The classical T Tauri star (CTTS) AA Tau has presented photometric variability that was attributed to an inner disk warp, caused by the interaction between the inner disk and an inclined magnetosphere. Previous studies of the young cluster NGC 2264 have shown that similar photometric behavior is common among CTTS. Aims: The goal of this work is to investigate the main causes of the observed photometric variability of CTTS in NGC 2264 that present AA Tau-like light curves, and verify if an inner disk warp could be responsible for their observed variability. Methods: In order to understand the mechanism causing these stars' photometric behavior, we investigate veiling variability in their spectra and u - r color variations and estimate parameters of the inner disk warp using an occultation model proposed for AA Tau. We also compare infrared Spitzer IRAC and optical CoRoT light curves to analyze the dust responsible for the occultations. Results: AA Tau-like variability proved to be transient on a timescale of a few years. We ascribe this variability to stable accretion regimes and aperiodic variability to unstable accretion regimes and show that a transition, and even coexistence, between the two is common. We find evidence of hot spots associated with occultations, indicating that the occulting structures could be located at the base of accretion columns. We find average values of warp maximum height of 0.23 times its radial location, consistent with AA Tau, with variations of on average 11% between rotation cycles. We also show that extinction laws in the inner disk indicate the presence of grains larger than interstellar grains. Conclusions: The inner disk warp scenario is consistent with observations for all but one star with AA Tau-like variability in our sample. AA Tau-like systems are fairly common, comprising 14% of CTTS observed in NGC 2264, though this number increases to 35% among systems of mass 0.7 M⊙ ≲ M ≲ 2.0 M⊙. Assuming random inclinations, we estimate that nearly all systems in this mass range likely possess an inner disk warp. We attribute this to a possible change in magnetic field configurations among stars of lower mass. Based on data from the Spitzer and CoRoT missions, as well as the Canada France Hawaii Telescope (CFHT) MegaCam CCD, the European Southern Observatory (ESO) Very Large Telescope, and the US Naval Observatory. The CoRoT space mission was developed and operated by the French space agency CNES, with participation of ESA's RSSD and Science Programmes, Austria, Belgium, Brazil, Germany, and Spain. MegaCam is a joint project of CFHT and CEA/DAPNIA, at the Canada-France-Hawaii Telescope (CFHT), operated by the National Research Council (NRC) of Canada, the Institut National des Sciences de l'Univers of the Centre National de la Recherche Scientifique (CNRS) of France, and the University of Hawaii. Figures 21-24 are available in electronic form at http://www.aanda.org
Su, Hui; Kondratko, Piotr; Chuang, Shun L
2006-05-29
We investigate variable optical delay of a microwave modulated optical beam in semiconductor optical amplifier/absorber waveguides with population oscillation (PO) and nearly degenerate four-wave-mixing (NDFWM) effects. An optical delay variable between 0 and 160 ps with a 1.0 GHz bandwidth is achieved in an InGaAsP/InP semiconductor optical amplifier (SOA) and shown to be electrically and optically controllable. An analytical model of optical delay is developed and found to agree well with the experimental data. Based on this model, we obtain design criteria to optimize the delay-bandwidth product of the optical delay in semiconductor optical amplifiers and absorbers.
The annual cycles of phytoplankton biomass
Winder, M.; Cloern, J.E.
2010-01-01
Terrestrial plants are powerful climate sentinels because their annual cycles of growth, reproduction and senescence are finely tuned to the annual climate cycle having a period of one year. Consistency in the seasonal phasing of terrestrial plant activity provides a relatively low-noise background from which phenological shifts can be detected and attributed to climate change. Here, we ask whether phytoplankton biomass also fluctuates over a consistent annual cycle in lake, estuarine-coastal and ocean ecosystems and whether there is a characteristic phenology of phytoplankton as a consistent phase and amplitude of variability. We compiled 125 time series of phytoplankton biomass (chloro-phyll a concentration) from temperate and subtropical zones and used wavelet analysis to extract their dominant periods of variability and the recurrence strength at those periods. Fewer than half (48%) of the series had a dominant 12-month period of variability, commonly expressed as the canonical spring-bloom pattern. About 20 per cent had a dominant six-month period of variability, commonly expressed as the spring and autumn or winter and summer blooms of temperate lakes and oceans. These annual patterns varied in recurrence strength across sites, and did not persist over the full series duration at some sites. About a third of the series had no component of variability at either the six-or 12-month period, reflecting a series of irregular pulses of biomass. These findings show that there is high variability of annual phytoplankton cycles across ecosystems, and that climate-driven annual cycles can be obscured by other drivers of population variability, including human disturbance, aperiodic weather events and strong trophic coupling between phytoplankton and their consumers. Regulation of phytoplankton biomass by multiple processes operating at multiple time scales adds complexity to the challenge of detecting climate-driven trends in aquatic ecosystems where the noise to signal ratio is high. ?? 2010 The Royal Society.
GNOSIS: The First Fiber Bragg Grating-based OH Suppression Unit
NASA Astrophysics Data System (ADS)
Trinh, Christopher; Ellis, S. C.; Bland-Hawthorn, J.; Lawrence, J. S.; Horton, A. J.; Leon-Saval, S. G.; Shortridge, K.; Bryant, J.; Case, S.; Colless, M.; Couch, W.; Freeman, K. C.; Löhmannsröben, H.; Gers, L.; Glazebrook, K.; Haynes, R.; Lee, S.; O'Byrne, J.; Miziarski, S.; Roth, M. M.; Schmidt, B.; Tinney, C. G.; Zheng, J.
2013-01-01
The sky background is over 1000 times brighter in the near-infrared (NIR) than in the visible placing severe limitations on our ability to study the redshifted light from the distant objects formed in the early Universe from the ground. It is well-known that 98% of the NIR background comes from the forest of bright and highly variable emission lines of atmospheric hydroxyl (OH) molecules. Unfortunately, astronomers have been unable to effectively remove this background from their data. We present the first OH suppression unit, GNOSIS, to utilize fiber Bragg gratings (FBGs). Simple FBGs are optical fibers with a periodic refractive index modulation imprinted within the fiber core, which induces a strong reflection in a narrow 0.2 nm) stopband. GNOSIS utilizes “OH suppression fibers” with a complex aperiodic refractive index modulation capable of removing the 103 brightest OH doublets between 1470 and 1700 nm by up 30 dB before dispersion and in a manner purely dependent on wavelength. The OH suppression fibers have high throughput 60%) and over 90% of the H band is available for spectroscopy. OH suppression units like GNOSIS may be utilized with any NIR telescope and spectrograph combination, but we commissioned GNOSIS at the 3.9-meter Anglo-Australian Telescope with the IRIS2 spectrograph for our first demonstration. Commissioning reveals excellent suppression performance. Approximately 78% of the OH lines were suppressed at the target level or greater. GNOSIS reduces the integrated background between 1500 and 1700 nm by a factor of ~ 9 but the signal-to-noise ratio is about the same as standard long-slit IRIS2 observations due to retrofitting to an un-optimized spectrograph. Nevertheless, if paired with a fiber-optimized spectrograph FBG OH suppression technology shows great promise for high sensitivity NIR spectroscopy at moderate to low resolutions from the ground.
Zhao, Xin-Dong; Li, Yan-Qing; Xiang, Heng-Yang; Zhang, Yi-Bo; Chen, Jing-De; Xu, Lu-Hai; Tang, Jian-Xin
2017-01-25
Inverted organic light-emitting diode (OLED) has attracted extensive attention due to the demand in active-matrix OLED display panels as its geometry enables the direct connection with n-channel transistor backplane on the substrate. One key challenge of high-performance inverted OLED is an efficient electron-injection layer with superior electrical and optical properties to match the indium tin oxide cathode on substrate. We here propose a synergistic electron-injection architecture using surface modification of ZnO layer to simultaneously promote electron injection into organic emitter and enhance out-coupling of waveguided light. An efficient inverted white OLED is realized by introducing the nanoimprinted aperiodic nanostructure of ZnO for broadband and angle-independent light out-coupling and inserting an n-type doped interlayer for energy level tuning and injection barrier lowering. As a result, the optimized inverted white OLEDs have an external quantum efficiency of 42.4% and a power efficiency of 85.4 lm W 1- , which are accompanied by the superiority of angular color stability over the visible wavelength range. Our results may inspire a promising approach to fabricate high-efficiency inverted OLEDs for large-scale display panels.
NASA Astrophysics Data System (ADS)
Kalmykov, Serge; Englesbe, Alexander; Elle, Jennifer; Domonkos, Matthew; Schmitt-Sody, Andreas
2017-10-01
A tightly focused femtosecond, weakly relativistic laser pulse partially ionizes the ambient gas, creating a string (a ``filament'') of electron density, locally reducing the nonlinear index and compensating for the self-focusing effect caused by bound electrons. While maintaining the filament over many Rayleigh lengths, the pulse drives inside it a three-dimensional (3D) wave of charge separation - the plasma wake. If the pulse waist size is much smaller than the Langmuir wavelength, electron current in the wake is mostly transverse. Electrons, driven by the wake across the sharp radial boundary of the filament, lose coherence within 2-3 periods of wakefield oscillations, and the wake decays. The laser pulse is thus accompanied by a short-lived, almost aperiodic electron current coupled to the sharp index gradient. The comprehensive 3D hydrodynamic model shows that this structure emits a broad-band THz radiation, with the highest power emitted in the near-forward direction. The THz radiation pattern contains information on wake currents surrounding the laser pulse, thus serving as an all-optical diagnostic tool. The results are tested in cylindrical and full 3D PIC simulations using codes WAKE and EPOCH.
Magnetoconductance signatures of subband structure in semiconductor nanowires
NASA Astrophysics Data System (ADS)
Holloway, Gregory; Haapamaki, Chris; Lapierre, Ray; Baugh, Jonathan
2015-03-01
Understanding the subband structure due to radial confinement in semiconductor nanowires can benefit technologies ranging from optical sensors to quantum information processing. An axial magnetic field couples to the orbital angular momentum, giving rise to non-trivial features in electronic transport as a function of magnetic field. Previous reports focused on conduction electrons confined to a thin shell near the nanowire surface, which lead to flux-periodic energies and conductance oscillations. Here, we calculate the eigenstates for more general radial potentials with moderate to low surface band bending such that electrons are distributed more uniformly across the nanowire cross-section. It is found that the energy spectrum becomes aperiodic in both gate voltage and magnetic field as the radial potential becomes flatter. The behavior of an energy level is dictated by its angular momentum, and this allows, in principle, each state to be identified based on its dependence on magnetic field and the chemical potential. We experimentally investigate a short-channel InAs nanowire FET in search of conductance features that reveal this subband structure. A quantitative measure for assigning conductance features to specific transverse states is introduced and applied to this device.
Maternal Nutrition and Four-Alternative Choice
ERIC Educational Resources Information Center
Davison, Michael; Krageloh, Christian U.; Fraser, Mhoyra; Breier, Bernhard H.
2007-01-01
Two groups of 10 male rats were trained to nose poke for food pellets at four alternatives that provided differing rates of pellet delivery on aperiodic schedules. After a fixed number of pellets had been delivered, 5, 10 or 20 in different conditions of the experiment, a 10-s blackout occurred, and the locations of the differing rates of pellet…
CSI 2264: Accretion process in classical T Tauri stars in the young cluster NGC 2264
NASA Astrophysics Data System (ADS)
Sousa, A. P.; Alencar, S. H. P.; Bouvier, J.; Stauffer, J.; Venuti, L.; Hillenbrand, L.; Cody, A. M.; Teixeira, P. S.; Guimarães, M. M.; McGinnis, P. T.; Rebull, L.; Flaccomio, E.; Fürész, G.; Micela, G.; Gameiro, J. F.
2016-02-01
Context. NGC 2264 is a young stellar cluster (~3 Myr) with hundreds of low-mass accreting stars that allow a detailed analysis of the accretion process taking place in the pre-main sequence. Aims: Our goal is to relate the photometric and spectroscopic variability of classical T Tauri stars to the physical processes acting in the stellar and circumstellar environment, within a few stellar radii from the star. Methods: NGC 2264 was the target of a multiwavelength observational campaign with CoRoT, MOST, Spitzer, and Chandra satellites and photometric and spectroscopic observations from the ground. We classified the CoRoT light curves of accreting systems according to their morphology and compared our classification to several accretion diagnostics and disk parameters. Results: The morphology of the CoRoT light curve reflects the evolution of the accretion process and of the inner disk region. Accretion burst stars present high mass-accretion rates and optically thick inner disks. AA Tau-like systems, whose light curves are dominated by circumstellar dust obscuration, show intermediate mass-accretion rates and are located in the transition of thick to anemic disks. Classical T Tauri stars with spot-like light curves correspond mostly to systems with a low mass-accretion rate and low mid-IR excess. About 30% of the classical T Tauri stars observed in the 2008 and 2011 CoRoT runs changed their light-curve morphology. Transitions from AA Tau-like and spot-like to aperiodic light curves and vice versa were common. The analysis of the Hα emission line variability of 58 accreting stars showed that 8 presented a periodicity that in a few cases was coincident with the photometric period. The blue and red wings of the Hα line profiles often do not correlate with each other, indicating that they are strongly influenced by different physical processes. Classical T Tauri stars have a dynamic stellar and circumstellar environment that can be explained by magnetospheric accretion and outflow models, including variations from stable to unstable accretion regimes on timescales of a few years. Full Tables 2 and 3 are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (ftp://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/586/A47
Koseff, Jeffrey R.; Holen, Jacqueline K.; Monismith, Stephen G.; Cloern, James E.
1993-01-01
Coastal ocean waters tend to have very different patterns of phytoplankton biomass variability from the open ocean, and the connections between physical variability and phytoplankton bloom dynamics are less well established for these shallow systems. Predictions of biological responses to physical variability in these environments is inherently difficult because the recurrent seasonal patterns of mixing are complicated by aperiodic fluctuations in river discharge and the high-frequency components of tidal variability. We might expect, then, less predictable and more complex bloom dynamics in these shallow coastal systems compared with the open ocean. Given this complex and dynamic physical environment, can we develop a quantitative framework to define the physical regimes necessary for bloom inception, and can we identify the important mechanisms of physical-biological coupling that lead to the initiation and termination of blooms in estuaries and shallow coastal waters? Numerical modeling provides one approach to address these questions. Here we present results of simulation experiments with a refined version of Cloern's (1991) model in which mixing processes are treated more realistically to reflect the dynamic nature of turbulence generation in estuaries. We investigated several simple models for the turbulent mixing coefficient. We found that the addition of diurnal tidal variation to Cloern's model greatly reduces biomass growth indicating that variations of mixing on the time scale of hours are crucial. Furthermore, we found that for conditions representative of South San Francisco Bay, numerical simulations only allowed for bloom development when the water column was stratified and when minimal mixing was prescribed in the upper layer. Stratification, however, itself is not sufficient to ensure that a bloom will develop: minimal wind stirring is a further prerequisite to bloom development in shallow turbid estuaries with abundant populations of benthic suspension feeders.
Surgical Treatment of Laser Induced Eye Injuries
1990-12-05
Continue on reverse if necessary and identify by block number) Subretinal blood within the macula may play a causative role in visual loss in a...period. Initial observations included clot organization with retraction of fibrin strands tearing photoreceptor outer segments. Later degeneration ...macular degeneration is the leading cause of permanent blindness in people over age 60 in the industrialized world’. Subretinal hemorrhage from
Mayer, A S; Phillips, C R; Keller, U
2018-04-11
The original version of this Article contained an error in Fig. 3a, in which the delay axis was incorrectly labeled in increments of 0.5 ps instead of the correct 0.2 ps. This has been corrected in both the PDF and HTML versions of the Article.
NASA Astrophysics Data System (ADS)
Walter, Christian
2015-03-01
The following sections are included: * Introduction * The Noah and Joseph effects and the non-Gaussian and non-Brownian issues of the financial theory * The first model of Mandelbrot (1962): α-stable motion with paretian tails * The second model of Mandelbrot (1965): fractional brownian motion with aperiodic cycles * The third model of Mandelbrot (1967): time changed Brownian motion with stochastic clock * Appendix: a tale of fat tails * Bibliography
The Game of Life Rules on Penrose Tilings: Still Life and Oscillators
NASA Astrophysics Data System (ADS)
Owens, Nick; Stepney, Susan
John Horton Conway's Game of Life is a simple two-dimensional, two state cellular automaton (CA), remarkable for its complex behaviour. That behaviour is known to be very sensitive to a change in the CA rules. Here we continue our investigations into its sensitivity to changes in the lattice, by the use of an aperiodic Penrose tiling lattice.
Niebuhr, Oliver
2012-01-01
The paper is concerned with the 'edge of intonation' in a twofold sense. It focuses on utterance-final F0 movements and crosses the traditional segment-prosody divide by investigating the interplay of F0 and voiceless fricatives in speech production. An experiment was performed for German with four types of voiceless fricatives: /f/, /s/, /ʃ/ and /x/. They were elicited with scripted dialogues in the contexts of terminal falling statement and high rising question intonations. Acoustic analyses show that fricatives concluding the high rising question intonations had higher mean centres of gravity (CoGs), larger CoG ranges and higher noise energy levels than fricatives concluding the terminal falling statement intonations. The different spectral-energy patterns are suitable to induce percepts of a high 'aperiodic pitch' at the end of the questions and of a low 'aperiodic pitch' at the end of the statements. The results are discussed with regard to the possible existence of 'segmental intonation' and its implication for F0 truncation and the segment-prosody dichotomy, in which segments are the alleged troublemakers for the production and perception of intonation. Copyright © 2012 S. Karger AG, Basel.
Optimized mid-infrared thermal emitters for applications in aircraft countermeasures
NASA Astrophysics Data System (ADS)
Lorenzo, Simón G.; You, Chenglong; Granier, Christopher H.; Veronis, Georgios; Dowling, Jonathan P.
2017-12-01
We introduce an optimized aperiodic multilayer structure capable of broad angle and high temperature thermal emission over the 3 μm to 5 μm atmospheric transmission band. This aperiodic multilayer structure composed of alternating layers of silicon carbide and graphite on top of a tungsten substrate exhibits near maximal emittance in a 2 μm wavelength range centered in the mid-wavelength infrared band traditionally utilized for atmospheric transmission. We optimize the layer thicknesses using a hybrid optimization algorithm coupled to a transfer matrix code to maximize the power emitted in this mid-infrared range normal to the structure's surface. We investigate possible applications for these structures in mimicking 800-1000 K aircraft engine thermal emission signatures and in improving countermeasure effectiveness against hyperspectral imagers. We find these structures capable of matching the Planck blackbody curve in the selected infrared range with relatively sharp cutoffs on either side, leading to increased overall efficiency of the structures. Appropriately optimized multilayer structures with this design could lead to matching a variety of mid-infrared thermal emissions. For aircraft countermeasure applications, this method could yield a flare design capable of mimicking engine spectra and breaking the lock of hyperspectral imaging systems.
Open-loop control of quasiperiodic thermoacoustic oscillations
NASA Astrophysics Data System (ADS)
Guan, Yu; Gupta, Vikrant; Kashinath, Karthik; Li, Larry K. B.
2017-11-01
The open-loop application of periodic acoustic forcing has been shown to be a potentially effective strategy for controlling periodic thermoacoustic oscillations, but its effectiveness on aperiodic thermoacoustic oscillations is less clear. In this experimental study, we apply periodic acoustic forcing to a ducted premixed flame oscillating quasiperiodically at two incommensurate natural frequencies, f1 and f2. We find that (i) above a critical forcing amplitude, the system locks into the forcing by oscillating only at the forcing frequency ff, producing a closed periodic orbit in phase space with no evidence of the original T2 torus attractor; (ii) the critical forcing amplitude required for lock-in decreases as ff approaches either f1 or f2, resulting in characteristic ∨-shaped lock-in boundaries around the two natural modes; and (iii) for a wide range of forcing frequencies, the system's oscillation amplitude can be reduced to less than 20% of that of the unforced system. These findings show that the open-loop application of periodic acoustic forcing can be an effective strategy for controlling aperiodic thermoacoustic oscillations. This work was supported by the Research Grants Council of Hong Kong (Project No. 16235716 and 26202815).
A novel scenario of aperiodical impacts appearance in the turbine draft tube
NASA Astrophysics Data System (ADS)
Alekseenko, S. V.; Kuibin, P. A.; Shtork, S. I.; Skripkin, S. G.; Sonin, V. I.; Tsoy, M. A.; Ustimenko, A. S.
2016-11-01
The swirling flow in the discharge cone of hydroturbine is characterized by various self-induced instabilities and associated low frequency phenomena when the turbine is operated far from the best efficiency point. In particular, the precessing vortex rope develops at part-load regimes in the draft tube. This rope can serve a reason of the periodical low- frequency pressure oscillations in the whole hydrodynamical system. During the experimental research of flow structure in the discharge cone in a regime of free runner new interesting phenomenon was discovered. Due to instability some coils of helical vortex close to each other and reconnection appears with generation of a vortex ring. The experiments were fulfilled at the cavitational conditions when a cavity arises in the vortex core. So the phenomenon was registered with help of visualization by the high speed video recording. The vortex ring after the reconnection moves apart from the main vortex rope toward the wall and downstream. When it reaches the area with high pressure the cavity collapses with generation of pressure impact. The mechanism of cavitational vortex rings generation and their further collapse can serve as a prototype of the aperiodical pressure impacts inside the turbine draft tube.
Chaos in a spatially-developing plane mixing layer
NASA Technical Reports Server (NTRS)
Broze, J. G.; Hussain, Fazle; Buell, J. C.
1988-01-01
A spatially-developing plane mixing layer was analyzed for chaotic behavior. A direct numerical simulation of the Navier-Stokes equations in a 2-D domain infinite in y and having inflow-outflow boundary conditions in x was used for data. Spectra, correlation dimension and the largest Lyapunov exponent were computed as functions of downstream distance x. When forced at a single (fundamental) frequency with maximum amplitude, the flow is periodic at the inflow but becomes aperiodic with increasing x. The aperiodic behavior is caused by the presence of a noisy subharmonic caused by the feedback between the necessarily nonphysical inflow and outflow boundary conditions. In order to overshadow this noise the flow was also studied with the same fundamental forcing and added random forcing of amplitude upsilon prime sub R/delta U = 0.01 at the inlet. Results were qualitatively the same in both cases: for small x, spectral peaks were sharp and dimension was nearly 1, but as x increased a narrowband spectral peak grew, spectra decayed exponentially at high frequencies and dimension increased to greater than 3. Based on these results, the flow appears to exhibit deterministic chaos. However, at no location was the largest Lyapunov exponent found to be significantly greater than zero.
Adductor spasmodic dysphonia: Relationships between acoustic indices and perceptual judgments
NASA Astrophysics Data System (ADS)
Cannito, Michael P.; Sapienza, Christine M.; Woodson, Gayle; Murry, Thomas
2003-04-01
This study investigated relationships between acoustical indices of spasmodic dysphonia and perceptual scaling judgments of voice attributes made by expert listeners. Audio-recordings of The Rainbow Passage were obtained from thirty one speakers with spasmodic dysphonia before and after a BOTOX injection of the vocal folds. Six temporal acoustic measures were obtained across 15 words excerpted from each reading sample, including both frequency of occurrence and percent time for (1) aperiodic phonation, (2) phonation breaks, and (3) fundamental frequency shifts. Visual analog scaling judgments were also obtained from six voice experts using an interactive computer interface to quantify four voice attributes (i.e., overall quality, roughness, brokenness, breathiness) in a carefully psychoacoustically controlled environment, using the same reading passages as stimuli. Number and percent aperiodicity and phonation breaks correlated significanly with perceived overall voice quality, roughness, and brokenness before and after the BOTOX injection. Breathiness was correlated with aperidocity only prior to injection, while roughness also correlated with frequency shifts following injection. Factor analysis reduced perceived attributes to two principal components: glottal squeezing and breathiness. The acoustic measures demonstrated a strong regression relationship with perceived glottal squeezing, but no regression relationship with breathiness was observed. Implications for an analysis of pathologic voices will be discussed.
NASA Astrophysics Data System (ADS)
Babayev, Elchin S.; Allahverdiyeva, Aysel A.
There are collaborative and cross-disciplinary space weather studies in the Azerbaijan National Academy of Sciences conducted with purposes of revealing possible effects of solar, geomagnetic and cosmic ray variability on certain technological, biological and ecological systems. This paper describes some results of the experimental studies of influence of the periodical and aperiodical changes of geomagnetic activity upon human brain, human health and psycho-emotional state. It also covers the conclusions of studies on influence of violent solar events and severe geomagnetic storms of the solar cycle 23 on the mentioned systems in middle-latitude location. It is experimentally established that weak and moderate geomagnetic storms do not cause significant changes in the brain's bioelectrical activity and exert only stimulating influence while severe disturbances of geomagnetic conditions cause negative influence, seriously disintegrate brain's functionality, activate braking processes and amplify the negative emotional background of an individual. It is concluded that geomagnetic disturbances affect mainly emotional and vegetative spheres of human beings while characteristics reflecting personality properties do not undergo significant changes.
Wang, Mingwu; Lu, Ake Tzu-Hui; Varma, Rohit; Schuman, Joel S; Greenfield, David S; Huang, David
2014-03-01
To improve the diagnosis of glaucoma by combining time-domain optical coherence tomography (TD-OCT) measurements of the optic disc, circumpapillary retinal nerve fiber layer (RNFL), and macular retinal thickness. Ninety-six age-matched normal and 96 perimetric glaucoma participants were included in this observational, cross-sectional study. Or-logic, support vector machine, relevance vector machine, and linear discrimination function were used to analyze the performances of combined TD-OCT diagnostic variables. The area under the receiver-operating curve (AROC) was used to evaluate the diagnostic accuracy and to compare the diagnostic performance of single and combined anatomic variables. The best RNFL thickness variables were the inferior (AROC=0.900), overall (AROC=0.892), and superior quadrants (AROC=0.850). The best optic disc variables were horizontal integrated rim width (AROC=0.909), vertical integrated rim area (AROC=0.908), and cup/disc vertical ratio (AROC=0.890). All macular retinal thickness variables had AROCs of 0.829 or less. Combining the top 3 RNFL and optic disc variables in optimizing glaucoma diagnosis, support vector machine had the highest AROC, 0.954, followed by or-logic (AROC=0.946), linear discrimination function (AROC=0.946), and relevance vector machine (AROC=0.943). All combination diagnostic variables had significantly larger AROCs than any single diagnostic variable. There are no significant differences among the combination diagnostic indices. With TD-OCT, RNFL and optic disc variables had better diagnostic accuracy than macular retinal variables. Combining top RNFL and optic disc variables significantly improved diagnostic performance. Clinically, or-logic classification was the most practical analytical tool with sufficient accuracy to diagnose early glaucoma.
NASA Astrophysics Data System (ADS)
Ruan, John J.; Anderson, Scott F.; MacLeod, Chelsea L.; Becker, Andrew C.; Burnett, T. H.; Davenport, James R. A.; Ivezić, Željko; Kochanek, Christopher S.; Plotkin, Richard M.; Sesar, Branimir; Stuart, J. Scott
2012-11-01
We investigate the use of optical photometric variability to select and identify blazars in large-scale time-domain surveys, in part to aid in the identification of blazar counterparts to the ~30% of γ-ray sources in the Fermi 2FGL catalog still lacking reliable associations. Using data from the optical LINEAR asteroid survey, we characterize the optical variability of blazars by fitting a damped random walk model to individual light curves with two main model parameters, the characteristic timescales of variability τ, and driving amplitudes on short timescales \\hat{\\sigma }. Imposing cuts on minimum τ and \\hat{\\sigma } allows for blazar selection with high efficiency E and completeness C. To test the efficacy of this approach, we apply this method to optically variable LINEAR objects that fall within the several-arcminute error ellipses of γ-ray sources in the Fermi 2FGL catalog. Despite the extreme stellar contamination at the shallow depth of the LINEAR survey, we are able to recover previously associated optical counterparts to Fermi active galactic nuclei with E >= 88% and C = 88% in Fermi 95% confidence error ellipses having semimajor axis r < 8'. We find that the suggested radio counterpart to Fermi source 2FGL J1649.6+5238 has optical variability consistent with other γ-ray blazars and is likely to be the γ-ray source. Our results suggest that the variability of the non-thermal jet emission in blazars is stochastic in nature, with unique variability properties due to the effects of relativistic beaming. After correcting for beaming, we estimate that the characteristic timescale of blazar variability is ~3 years in the rest frame of the jet, in contrast with the ~320 day disk flux timescale observed in quasars. The variability-based selection method presented will be useful for blazar identification in time-domain optical surveys and is also a probe of jet physics.
Optical properties of periodic, quasi-periodic, and disordered one-dimensional photonic structures
NASA Astrophysics Data System (ADS)
Bellingeri, Michele; Chiasera, Alessandro; Kriegel, Ilka; Scotognella, Francesco
2017-10-01
Photonic structures are building blocks for many optical applications in which light manipulation is required spanning optical filtering, lasing, light emitting diodes, sensing and photovoltaics. The fabrication of one-dimensional photonic structures is achievable with a variety of different techniques, such as spin coating, sputtering, evaporation, pulse laser deposition, or extrusion. Such different techniques enable facile integration of the photonic structure with many types of devices. Photonic crystals are characterized by a spatial modulation of the dielectric constant on the length scale of the wavelength of light giving rise to energy ranges where light cannot propagate through the crystal - the photonic band gap. While mostly photonic crystals are referred to as periodic arrangements, in this review we aim to highlight as well how aperiodicity and disorder affects light modulation. In this review article, we introduce the concepts of periodicity, quasi-periodicity, and disorder in photonic crystals, focussing on the one-dimensional case. We discuss in detail the physical peculiarities, the fabrication techniques, and the applications of periodic, quasi-periodic, and disorder photonic structures, highlighting how the degree of crystallinity matters in the manipulation of light. We report different types of disorder in 1D photonic structures and we discuss their properties in terms of light transmission. We discuss the relationship between the average total transmission, in a range of wavelengths around the photonic band gap of the corresponding photonic crystal, and the homogeneity of the photonic structures, quantified by the Shannon index. Then we discuss the light transmission in structures in which the high refractive index layers are aggregated in clusters following a power law distribution. Finally, in the case of structures in which the high refractive index layers are aggregated in clusters with a truncated uniform distribution, we discuss: i) how different refractive index contrast tailors the total light transmission; ii) how the total light transmission is affected by the introduction of defects made with a third material.
First Search for an X-Ray-Optical Reverberation Signal in an Ultraluminous X-Ray Source
NASA Technical Reports Server (NTRS)
Pasham, Dheeraj R.; Strohmayer, Tod E.; Cenko, S. Bradley; Trippe, Margaret L.; Mushotzky, Richard F.; Gandhi, Poshak
2016-01-01
Using simultaneous optical (VLT/FORS2) and X-ray (XMM-Newton) data of NGC 5408, we present the first ever attempt to search for a reverberation signal in an ultraluminous X-ray source (NGC 5408 X-1). The idea is similar to active galactic nucleus broad line reverberation mapping where a lag measurement between the X-ray and the optical flux combined with a Keplerian velocity estimate should enable us to weigh the central compact object. We find that although NGC 5408 X-1's X-rays are variable on a timescale of a few hundred seconds (rms of 9.0 +/- 0.5%), the optical emission does not show any statistically significant variations. We set a 3s upper limit on the rms optical variability of 3.3%. The ratio of the X-ray to the optical variability is an indicator of X-ray reprocessing efficiency. In X-ray binaries, this ratio is roughly 5. Assuming a similar ratio for NGC 5408 X-1, the expected rms optical variability is approximately equal to 2%, which is still a factor of roughly two lower than what was possible with the VLT observations in this study. We find marginal evidence (3 sigma) for optical variability on an approximately 24 hr timescale. Our results demonstrate that such measurements can be made, but photometric conditions, low sky background levels, and longer simultaneous observations will be required to reach optical variability levels similar to those of X-ray binaries.
Multi-band optical variability studies of Blazars
NASA Astrophysics Data System (ADS)
Agarwal, Aditi
2018-04-01
To search for optical variability on a wide range of timescales, we have carried out photometric monitoring of a dozen blazars. CCD magnitudes in B, V, R and I pass-bands were determined for > 10,000f new optical observations from 300 nights made during 2011 – 2016, with an average length of 4 h each, using seven optical telescopes: four in Bulgaria, one in Greece, and two in India. We measured multiband optical flux and colour variations on diverse timescales. Blazar variability studies helped us in understanding their nature and extreme conditions within the emission region. To explain possible physical causes of the observed spectral variability, we also investigated spectral energy distributions using B, V, R, I, J and K pass-band data.
Switching of High-Voltage Cable Lines with Shunt Reactors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sheskin, E. B., E-mail: evgeniy.sheskin@gmail.com; Evdokunin, G. A.
2016-05-15
The problem of disconnecting high-voltage cable lines with shunt reactors by SF{sub 6} circuit breakers is discussed. In these schemes it is possible to have a significant aperiodic component of the circuit breaker current that can prevent opening of the breaker. The authors propose methods for application to cable transmission lines which they believe will be optimal for ensuring normal disconnects.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Horita, Susumu; Kaki, Hirokazu; Nishioka, Kensuke
2007-07-01
Amorphous Si films of 60 and 10 nm thick on glass substrates were irradiated by a linearly polarized Nd:YAG pulse laser with the wavelength {lambda}=532 nm at the incident angle {theta}{sub i}=0. The surface of the irradiated 60-nm-thick film had both periodic ridges perpendicular to the electric field vector E and aperiodic ridges roughly parallel to E, where the spatial period of the periodic ridges was almost {lambda}. From the continuous 10-nm-thick film, the separate rectangular Si islands were formed with a periodic distance of {lambda}, with the edges parallel or perpendicular to E. When {theta}{sub i} was increased frommore » normal incidence of the s-polarized beam for a 60-nm-thick film, the aperiodic ridges were reduced while the periodic ridges were still formed. For a 10-nm-thick film, the Si stripes were formed perpendicular to E, using the s-polarized beam at {theta}{sub i}=12 deg. In order to investigate the mechanisms of the surface modifications of, in particular, aperiodic ridges, islands, and stripes, we improved the previous theoretical model of the periodic distribution of the beam energy density (periodic E-D) generated by irradiation of the linearly polarized laser beam, taking account of the multireflection effect in the Si film which is semitransparent for {lambda}. Further, the calculated E-D was corrected with respect to the thermal diffusion in the irradiated Si film. The calculation results show that the two-dimensional E-D consists of a constant or a dc term and a sinusoidal or an ac term which contains various spatial periods. The multireflection effect strongly influences the amplitude and phase of every ac term, which means that the amplitude and phase depend on the film thickness. The thermal diffusion during the heating of the irradiated film greatly reduces the amplitudes of the ac terms with periods below the thermal diffusion length. The theoretical calculation showed that, by increasing {theta}{sub i}, the temperature distribution in the irradiated Si film was changed from two-dimensional toward one-dimensional, which can explain the above experimental results reasonably.« less
Aperiodic dynamics in a deterministic adaptive network model of attitude formation in social groups
NASA Astrophysics Data System (ADS)
Ward, Jonathan A.; Grindrod, Peter
2014-07-01
Adaptive network models, in which node states and network topology coevolve, arise naturally in models of social dynamics that incorporate homophily and social influence. Homophily relates the similarity between pairs of nodes' states to their network coupling strength, whilst social influence causes coupled nodes' states to convergence. In this paper we propose a deterministic adaptive network model of attitude formation in social groups that includes these effects, and in which the attitudinal dynamics are represented by an activato-inhibitor process. We illustrate that consensus, corresponding to all nodes adopting the same attitudinal state and being fully connected, may destabilise via Turing instability, giving rise to aperiodic dynamics with sensitive dependence on initial conditions. These aperiodic dynamics correspond to the formation and dissolution of sub-groups that adopt contrasting attitudes. We discuss our findings in the context of cultural polarisation phenomena. Social influence. This reflects the fact that people tend to modify their behaviour and attitudes in response to the opinions of others [22-26]. We model social influence via diffusion: agents adjust their state according to a weighted sum (dictated by the evolving network) of the differences between their state and the states of their neighbours. Homophily. This relates the similarity of individuals' states to their frequency and strength of interaction [27]. Thus in our model, homophily drives the evolution of the weighted ‘social' network. A precise formulation of our model is given in Section 2. Social influence and homophily underpin models of social dynamics [21], which cover a wide range of sociological phenomena, including the diffusion of innovations [28-32], complex contagions [33-36], collective action [37-39], opinion dynamics [19,20,40,10,11,13,15,41,16], the emergence of social norms [42-44], group stability [45], social differentiation [46] and, of particular relevance here, cultural dissemination [47,12,48].Combining the effects of social influence and homophily naturally gives rise to an adaptive network, since social influence causes the states of agents that are strongly connected to become more similar, while homophily strengthens connections between agents whose states are already similar.1
NASA Astrophysics Data System (ADS)
Goodman, J. W.
This book is based on the thesis that some training in the area of statistical optics should be included as a standard part of any advanced optics curriculum. Random variables are discussed, taking into account definitions of probability and random variables, distribution functions and density functions, an extension to two or more random variables, statistical averages, transformations of random variables, sums of real random variables, Gaussian random variables, complex-valued random variables, and random phasor sums. Other subjects examined are related to random processes, some first-order properties of light waves, the coherence of optical waves, some problems involving high-order coherence, effects of partial coherence on imaging systems, imaging in the presence of randomly inhomogeneous media, and fundamental limits in photoelectric detection of light. Attention is given to deterministic versus statistical phenomena and models, the Fourier transform, and the fourth-order moment of the spectrum of a detected speckle image.
NASA Astrophysics Data System (ADS)
Guarcello, M. G.; Flaccomio, E.; Micela, G.; Argiroffi, C.; Sciortino, S.; Venuti, L.; Stauffer, J.; Rebull, L.; Cody, A. M.
2017-06-01
Context. Pre-main sequence stars are variable sources. The main mechanisms responsible for their variability are variable extinction, unsteady accretion, and rotational modulation of both hot and dark photospheric spots and X-ray-active regions. In stars with disks, this variability is related to the morphology of the inner circumstellar region (≤0.1 AU) and that of the photosphere and corona, all impossible to be spatially resolved with present-day techniques. This has been the main motivation for the Coordinated Synoptic Investigation of NGC 2264, a set of simultaneous observations of NGC 2264 with 15 different telescopes. Aims: In this paper, we focus on the stars with disks. We analyze the X-ray spectral properties extracted during optical bursts and dips in order to unveil the nature of these phenomena. Stars without disks are studied in a companion paper. Methods: We analyze simultaneous CoRoT and Chandra/ACIS-I observations to search for coherent optical and X-ray flux variability in stars with disks. Then, stars are analyzed in two different samples. In stars with variable extinction, we look for a simultaneous increase of optical extinction and X-ray absorption during the optical dips; in stars with accretion bursts, we search for soft X-ray emission and increasing X-ray absorption during the bursts. Results: We find evidence for coherent optical and X-ray flux variability among the stars with variable extinction. In 9 of the 24 stars with optical dips, we observe a simultaneous increase of X-ray absorption and optical extinction. In seven dips, it is possible to calculate the NH/AV ratio in order to infer the composition of the obscuring material. In 5 of the 20 stars with optical accretion bursts, we observe increasing soft X-ray emission during the bursts that we associate to the emission of accreting gas. It is not surprising that these properties are not observed in all the stars with dips and bursts, since favorable geometric configurations are required. Conclusions: The observed variable absorption during the dips is mainly due to dust-free material in accretion streams. In stars with accretion bursts, we observe, on average, a larger soft X-ray spectral component not observed in non-accreting stars.
Regression Analysis of Optical Coherence Tomography Disc Variables for Glaucoma Diagnosis.
Richter, Grace M; Zhang, Xinbo; Tan, Ou; Francis, Brian A; Chopra, Vikas; Greenfield, David S; Varma, Rohit; Schuman, Joel S; Huang, David
2016-08-01
To report diagnostic accuracy of optical coherence tomography (OCT) disc variables using both time-domain (TD) and Fourier-domain (FD) OCT, and to improve the use of OCT disc variable measurements for glaucoma diagnosis through regression analyses that adjust for optic disc size and axial length-based magnification error. Observational, cross-sectional. In total, 180 normal eyes of 112 participants and 180 eyes of 138 participants with perimetric glaucoma from the Advanced Imaging for Glaucoma Study. Diagnostic variables evaluated from TD-OCT and FD-OCT were: disc area, rim area, rim volume, optic nerve head volume, vertical cup-to-disc ratio (CDR), and horizontal CDR. These were compared with overall retinal nerve fiber layer thickness and ganglion cell complex. Regression analyses were performed that corrected for optic disc size and axial length. Area-under-receiver-operating curves (AUROC) were used to assess diagnostic accuracy before and after the adjustments. An index based on multiple logistic regression that combined optic disc variables with axial length was also explored with the aim of improving diagnostic accuracy of disc variables. Comparison of diagnostic accuracy of disc variables, as measured by AUROC. The unadjusted disc variables with the highest diagnostic accuracies were: rim volume for TD-OCT (AUROC=0.864) and vertical CDR (AUROC=0.874) for FD-OCT. Magnification correction significantly worsened diagnostic accuracy for rim variables, and while optic disc size adjustments partially restored diagnostic accuracy, the adjusted AUROCs were still lower. Axial length adjustments to disc variables in the form of multiple logistic regression indices led to a slight but insignificant improvement in diagnostic accuracy. Our various regression approaches were not able to significantly improve disc-based OCT glaucoma diagnosis. However, disc rim area and vertical CDR had very high diagnostic accuracy, and these disc variables can serve to complement additional OCT measurements for diagnosis of glaucoma.
NASA Astrophysics Data System (ADS)
Wang, Xuan-Yin; Du, Jia-Wei; Zhu, Shi-Qiang
2017-09-01
A bionic variable-focus lens with symmetrical layered structure was designed to mimic the crystalline lens. An optical imaging system based on this lens and with a symmetrical structure that mimics the human eye structure was proposed. The refractive index of the bionic variable-focus lens increases from outside to inside. The two PDMS lenses with a certain thickness were designed to improve the optical performance of the optical imaging system and minimise the gravity effect of liquid. The paper presents the overall structure of the optical imaging system and the detailed description of the bionic variable-focus lens. By pumping liquid in or out of the cavity, the surface curvatures of the rear PDMS lens were varied, resulting in a change in the focal length. The focal length range of the optical imaging system was 20.71-24.87 mm. The optical performance of the optical imaging system was evaluated by imaging experiments and analysed by ray tracing simulations. On the basis of test and simulation results, the optical performance of the system was quite satisfactory. Off-axis aberrations were well corrected, and the image quality was greatly improved.
The effect of virtual reality on gait variability.
Katsavelis, Dimitrios; Mukherjee, Mukul; Decker, Leslie; Stergiou, Nicholas
2010-07-01
Optic Flow (OF) plays an important role in human locomotion and manipulation of OF characteristics can cause changes in locomotion patterns. The purpose of the study was to investigate the effect of the velocity of optic flow on the amount and structure of gait variability. Each subject underwent four conditions of treadmill walking at their self-selected pace. In three conditions the subjects walked in an endless virtual corridor, while a fourth control condition was also included. The three virtual conditions differed in the speed of the optic flow displayed as follows--same speed (OFn), faster (OFf), and slower (OFs) than that of the treadmill. Gait kinematics were tracked with an optical motion capture system. Gait variability measures of the hip, knee and ankle range of motion and stride interval were analyzed. Amount of variability was evaluated with linear measures of variability--coefficient of variation, while structure of variability i.e., its organization over time, were measured with nonlinear measures--approximate entropy and detrended fluctuation analysis. The linear measures of variability, CV, did not show significant differences between Non-VR and VR conditions while nonlinear measures of variability identified significant differences at the hip, ankle, and in stride interval. In response to manipulation of the optic flow, significant differences were observed between the three virtual conditions in the following order: OFn greater than OFf greater than OFs. Measures of structure of variability are more sensitive to changes in gait due to manipulation of visual cues, whereas measures of the amount of variability may be concealed by adaptive mechanisms. Visual cues increase the complexity of gait variability and may increase the degrees of freedom available to the subject. Further exploration of the effects of optic flow manipulation on locomotion may provide us with an effective tool for rehabilitation of subjects with sensorimotor issues.
System-level power optimization for real-time distributed embedded systems
NASA Astrophysics Data System (ADS)
Luo, Jiong
Power optimization is one of the crucial design considerations for modern electronic systems. In this thesis, we present several system-level power optimization techniques for real-time distributed embedded systems, based on dynamic voltage scaling, dynamic power management, and management of peak power and variance of the power profile. Dynamic voltage scaling has been widely acknowledged as an important and powerful technique to trade off dynamic power consumption and delay. Efficient dynamic voltage scaling requires effective variable-voltage scheduling mechanisms that can adjust voltages and clock frequencies adaptively based on workloads and timing constraints. For this purpose, we propose static variable-voltage scheduling algorithms utilizing criticalpath driven timing analysis for the case when tasks are assumed to have uniform switching activities, as well as energy-gradient driven slack allocation for a more general scenario. The proposed techniques can achieve closeto-optimal power savings with very low computational complexity, without violating any real-time constraints. We also present algorithms for power-efficient joint scheduling of multi-rate periodic task graphs along with soft aperiodic tasks. The power issue is addressed through both dynamic voltage scaling and power management. Periodic task graphs are scheduled statically. Flexibility is introduced into the static schedule to allow the on-line scheduler to make local changes to PE schedules through resource reclaiming and slack stealing, without interfering with the validity of the global schedule. We provide a unified framework in which the response times of aperiodic tasks and power consumption are dynamically optimized simultaneously. Interconnection network fabrics point to a new generation of power-efficient and scalable interconnection architectures for distributed embedded systems. As the system bandwidth continues to increase, interconnection networks become power/energy limited as well. Variable-frequency links have been designed by circuit designers for both parallel and serial links, which can adaptively regulate the supply voltage of transceivers to a desired link frequency, to exploit the variations in bandwidth requirement for power savings. We propose solutions for simultaneous dynamic voltage scaling of processors and links. The proposed solution considers real-time scheduling, flow control, and packet routing jointly. It can trade off the power consumption on processors and communication links via efficient slack allocation, and lead to more power savings than dynamic voltage scaling on processors alone. For battery-operated systems, the battery lifespan is an important concern. Due to the effects of discharge rate and battery recovery, the discharge pattern of batteries has an impact on the battery lifespan. Battery models indicate that even under the same average power consumption, reducing peak power current and variance in the power profile can increase the battery efficiency and thereby prolong battery lifetime. To take advantage of these effects, we propose battery-driven scheduling techniques for embedded applications, to reduce the peak power and the variance in the power profile of the overall system under real-time constraints. The proposed scheduling algorithms are also beneficial in addressing reliability and signal integrity concerns by effectively controlling peak power and variance of the power profile.
Analysis of blocking probability for OFDM-based variable bandwidth optical network
NASA Astrophysics Data System (ADS)
Gong, Lei; Zhang, Jie; Zhao, Yongli; Lin, Xuefeng; Wu, Yuyao; Gu, Wanyi
2011-12-01
Orthogonal Frequency Division Multiplexing (OFDM) has recently been proposed as a modulation technique. For optical networks, because of its good spectral efficiency, flexibility, and tolerance to impairments, optical OFDM is much more flexible compared to traditional WDM systems, enabling elastic bandwidth transmissions, and optical networking is the future trend of development. In OFDM-based optical network the research of blocking rate has very important significance for network assessment. Current research for WDM network is basically based on a fixed bandwidth, in order to accommodate the future business and the fast-changing development of optical network, our study is based on variable bandwidth OFDM-based optical networks. We apply the mathematical analysis and theoretical derivation, based on the existing theory and algorithms, research blocking probability of the variable bandwidth of optical network, and then we will build a model for blocking probability.
Intensity-based readout of resonant-waveguide grating biosensors: Systems and nanostructures
NASA Astrophysics Data System (ADS)
Paulsen, Moritz; Jahns, Sabrina; Gerken, Martina
2017-09-01
Resonant waveguide gratings (RWG) - also called photonic crystal slabs (PCS) - have been established as reliable optical transducers for label-free biochemical assays as well as for cell-based assays. Current readout systems are based on mechanical scanning and spectrometric measurements with system sizes suitable for laboratory equipment. Here, we review recent progress in compact intensity-based readout systems for point-of-care (POC) applications. We briefly introduce PCSs as sensitive optical transducers and introduce different approaches for intensity-based readout systems. Photometric measurements have been realized with a simple combination of a light source and a photodetector. Recently a 96-channel, intensity-based readout system for both biochemical interaction analyses as well as cellular assays was presented employing the intensity change of a near cut-off mode. As an alternative for multiparametric detection, a camera system for imaging detection has been implemented. A portable, camera-based system of size 13 cm × 4.9 cm × 3.5 cm with six detection areas on an RWG surface area of 11 mm × 7 mm has been demonstrated for the parallel detection of six protein binding kinetics. The signal-to-noise ratio of this system corresponds to a limit of detection of 168 M (24 ng/ml). To further improve the signal-to-noise ratio advanced nanostructure designs are investigated for RWGs. Here, results on multiperiodic and deterministic aperiodic nanostructures are presented. These advanced nanostructures allow for the design of the number and wavelengths of the RWG resonances. In the context of intensity-based readout systems they are particularly interesting for the realization of multi-LED systems. These recent trends suggest that compact point-of-care systems employing disposable test chips with RWG functional areas may reach market in the near future.
Evan Brooks; Valerie Thomas; Wynne Randolph; John Coulston
2012-01-01
With the advent of free Landsat data stretching back decades, there has been a surge of interest in utilizing remotely sensed data in multitemporal analysis for estimation of biophysical parameters. Such analysis is confounded by cloud cover and other image-specific problems, which result in missing data at various aperiodic times of the year. While there is a wealth...
Further perspective on the theory of heteronuclear decoupling.
Skinner, Thomas E
2014-11-01
An exact general theory of heteronuclear decoupling is presented for spin-1/2 IS systems. RF irradiation applied to the I spins both modifies and generates additional couplings between states of the system. The recently derived equivalence between the dynamics of any N-level quantum system and a system of classical coupled harmonic oscillators makes explicit the exact physical couplings between states. Decoupling is thus more properly viewed as a complex intercoupling. The sign of antiphase magnetization plays a fundamental role in decoupling. A one-to-one correspondence is demonstrated between ±2SyIz and the sense of the S-spin coupling evolution. Magnetization Sx is refocused to obtain the desired decoupled state when ∫2SyIzdt=0. The exact instantaneous coupling at any time during the decoupling sequence is readily obtained in terms of the system states, showing that the creation of two-spin coherence is crucial for reducing the effective scalar coupling, as required for refocusing to occur. Representative examples from new aperiodic sequences as well as standard cyclic, periodic composite-pulse and adiabatic decoupling sequences illustrate the decoupling mechanism. The more general aperiodic sequences, obtained using optimal control, realize the potential inherent in the theory for significantly improved decoupling. Copyright © 2014 Elsevier Inc. All rights reserved.
Effects of Asymmetric Superior Laryngeal Nerve Stimulation on Glottic Posture, Acoustics, Vibration
Chhetri, Dinesh K.; Neubauer, Juergen; Bergeron, Jennifer L.; Sofer, Elazar; Peng, Kevin A.; Jamal, Nausheen
2013-01-01
Objectives Evaluate the effects of asymmetric superior laryngeal nerve stimulation on the vibratory phase, laryngeal posture, and acoustics. Study Design Basic science study using an in vivo canine model. Methods The superior laryngeal nerves were symmetrically and asymmetrically stimulated over eight activation levels to mimic laryngeal asymmetries representing various levels of superior laryngeal nerve paresis and paralysis conditions. Glottal posture change, vocal fold speed, and vibration of these 64 distinct laryngeal activation conditions were evaluated by high speed video and concurrent acoustic and aerodynamic recordings. Assessments were made at phonation onset. Results Vibratory phase was symmetric in all symmetric activation conditions but consistent phase asymmetry towards the vocal fold with higher superior laryngeal nerve activation was observed. Superior laryngeal nerve paresis and paralysis conditions had reduced vocal fold strain and fundamental frequency. Superior laryngeal nerve activation increased vocal fold closure speed, but this effect was more pronounced for the ipsilateral vocal fold. Increasing asymmetry led to aperiodic and chaotic vibration. Conclusions This study directly links vocal fold tension asymmetry with vibratory phase asymmetry; in particular the side with greater tension leads in the opening phase. The clinical observations of vocal fold lag, reduced vocal range, and aperiodic voice in superior laryngeal paresis and paralysis is also supported. PMID:23712542
Besmer, Michael D; Epting, Jannis; Page, Rebecca M; Sigrist, Jürg A; Huggenberger, Peter; Hammes, Frederik
2016-12-07
Detailed measurements of physical, chemical and biological dynamics in groundwater are key to understanding the important processes in place and their influence on water quality - particularly when used for drinking water. Measuring temporal bacterial dynamics at high frequency is challenging due to the limitations in automation of sampling and detection of the conventional, cultivation-based microbial methods. In this study, fully automated online flow cytometry was applied in a groundwater system for the first time in order to monitor microbial dynamics in a groundwater extraction well. Measurements of bacterial concentrations every 15 minutes during 14 days revealed both aperiodic and periodic dynamics that could not be detected previously, resulting in total cell concentration (TCC) fluctuations between 120 and 280 cells μL -1 . The aperiodic dynamic was linked to river water contamination following precipitation events, while the (diurnal) periodic dynamic was attributed to changes in hydrological conditions as a consequence of intermittent groundwater extraction. Based on the high number of measurements, the two patterns could be disentangled and quantified separately. This study i) increases the understanding of system performance, ii) helps to optimize monitoring strategies, and iii) opens the possibility for more sophisticated (quantitative) microbial risk assessment of drinking water treatment systems.
Kember, G C; Fenton, G A; Armour, J A; Kalyaniwalla, N
2001-04-01
Regional cardiac control depends upon feedback of the status of the heart from afferent neurons responding to chemical and mechanical stimuli as transduced by an array of sensory neurites. Emerging experimental evidence shows that neural control in the heart may be partially exerted using subthreshold inputs that are amplified by noisy mechanical fluctuations. This amplification is known as aperiodic stochastic resonance (ASR). Neural control in the noisy, subthreshold regime is difficult to see since there is a near absence of any correlation between input and the output, the latter being the average firing (spiking) rate of the neuron. This lack of correlation is unresolved by traditional energy models of ASR since these models are unsuitable for identifying "cause and effect" between such inputs and outputs. In this paper, the "competition between averages" model is used to determine what portion of a noisy, subthreshold input is responsible, on average, for the output of sensory neurons as represented by the Fitzhugh-Nagumo equations. A physiologically relevant conclusion of this analysis is that a nearly constant amount of input is responsible for a spike, on average, and this amount is approximately independent of the firing rate. Hence, correlation measures are generally reduced as the firing rate is lowered even though neural control under this model is actually unaffected.
Besmer, Michael D.; Epting, Jannis; Page, Rebecca M.; Sigrist, Jürg A.; Huggenberger, Peter; Hammes, Frederik
2016-01-01
Detailed measurements of physical, chemical and biological dynamics in groundwater are key to understanding the important processes in place and their influence on water quality – particularly when used for drinking water. Measuring temporal bacterial dynamics at high frequency is challenging due to the limitations in automation of sampling and detection of the conventional, cultivation-based microbial methods. In this study, fully automated online flow cytometry was applied in a groundwater system for the first time in order to monitor microbial dynamics in a groundwater extraction well. Measurements of bacterial concentrations every 15 minutes during 14 days revealed both aperiodic and periodic dynamics that could not be detected previously, resulting in total cell concentration (TCC) fluctuations between 120 and 280 cells μL−1. The aperiodic dynamic was linked to river water contamination following precipitation events, while the (diurnal) periodic dynamic was attributed to changes in hydrological conditions as a consequence of intermittent groundwater extraction. Based on the high number of measurements, the two patterns could be disentangled and quantified separately. This study i) increases the understanding of system performance, ii) helps to optimize monitoring strategies, and iii) opens the possibility for more sophisticated (quantitative) microbial risk assessment of drinking water treatment systems. PMID:27924920
Variability of the symbiotic X-ray binary GX 1+4. Enhanced activity near periastron passage
NASA Astrophysics Data System (ADS)
Iłkiewicz, Krystian; Mikołajewska, Joanna; Monard, Berto
2017-05-01
Context. GX 1+4 belongs to a rare class of X-ray binaries with red giant donors, symbiotic X-ray binaries. It has a history of complicated variability on multiple timescales in the optical light and X-rays. The nature of this variability remains poorly understood. Aims: We aim to study variability of GX 1+4 on long timescale in X-ray and optical bands. Methods: We took X-ray observations from the INTEGRAL Soft Gamma-Ray Imager and RXTE All Sky Monitor. Optical observations were made with the INTEGRAL Optical Monitoring Camera. Results: The variability of GX 1+4 both in optical light and hard X-ray emission (>17 keV) is dominated by 50-70 d quasi-periodic changes. The amplitude of this variability is highest during the periastron passage, while during the potential neutron star eclipse the system is always at minimum. This confirms the 1161 d orbital period that has had been proposed for the system based on radial velocity curve. Neither the quasi-periodic variability or the orbital period are detected in soft X-ray emission (1.3-12.2 keV), where the binary shows no apparent periodicity.
Searching for faint AGN in the CDFS: an X-ray (Chandra) vs optical variability (HST) comparison.
NASA Astrophysics Data System (ADS)
Georgantopoulos, I.; Pouliasis, E.; Bonanos, A.; Sokolovsky, K.; Yang, M.; Hatzidimitriou, D.; Bellas, I.; Gavras, P.; Spetsieri, Z.
2017-10-01
X-ray surveys are believed to be the most efficient way to detect AGN. Recently though, optical variability studies are claimed to probe even fainter AGN. We are presenting results from an HST study aimed to identify Active Galactic Nuclei (AGN) through optical variability selection in the CDFS.. This work is part of the 'Hubble Catalogue of Variables'project of ESA that aims to identify variable sources in the Hubble Source Catalogue.' In particular, we used Hubble Space Telescope (HST) z-band images taken over 5 epochs and performed aperture photometry to derive the lightcurves of the sources. Two statistical methods (standard deviation & interquartile range) resulting in a final sample of 175 variable AGN candidates, having removed the artifacts by visual inspection and known stars and supernovae. The fact that the majority of the sources are extended and variable indicates AGN activity. We compare the efficiency of the method by comparing with the 7Ms Chandra detections. Our work shows that the optical variability probes AGN at comparable redshifts but at deeper optical magnitudes. Our candidate AGN (non detected in X-rays) have luminosities of L_x<6×10^{40} erg/sec at z˜0.7 suggesting that these are associated with low luminosity Seyferts and LINERS.
NASA Astrophysics Data System (ADS)
Kokubo, Mitsuru
2015-05-01
The physical mechanisms of the quasar ultraviolet (UV)-optical variability are not well understood despite the long history of observations. Recently, Dexter & Agol presented a model of quasar UV-optical variability, which assumes large local temperature fluctuations in the quasar accretion discs. This inhomogeneous accretion disc model is claimed to describe not only the single-band variability amplitude, but also microlensing size constraints and the quasar composite spectral shape. In this work, we examine the validity of the inhomogeneous accretion disc model in the light of quasar UV-optical spectral variability by using five-band multi-epoch light curves for nearly 9 000 quasars in the Sloan Digital Sky Survey (SDSS) Stripe 82 region. By comparing the values of the intrinsic scatter σint of the two-band magnitude-magnitude plots for the SDSS quasar light curves and for the simulated light curves, we show that Dexter & Agol's inhomogeneous accretion disc model cannot explain the tight inter-band correlation often observed in the SDSS quasar light curves. This result leads us to conclude that the local temperature fluctuations in the accretion discs are not the main driver of the several years' UV-optical variability of quasars, and consequently, that the assumption that the quasar accretion discs have large localized temperature fluctuations is not preferred from the viewpoint of the UV-optical spectral variability.
Photonic variable delay devices based on optical birefringence
NASA Technical Reports Server (NTRS)
Yao, X. Steve (Inventor)
2005-01-01
Optical variable delay devices for providing variable true time delay to multiple optical beams simultaneously. A ladder-structured variable delay device comprises multiple basic building blocks stacked on top of each other resembling a ladder. Each basic building block has two polarization beamsplitters and a polarization rotator array arranged to form a trihedron; Controlling an array element of the polarization rotator array causes a beam passing through the array element either going up to a basic building block above it or reflect back towards a block below it. The beams going higher on the ladder experience longer optical path delay. An index-switched optical variable delay device comprises of many birefringent crystal segments connected with one another, with a polarization rotator array sandwiched between any two adjacent crystal segments. An array element in the polarization rotator array controls the polarization state of a beam passing through the element, causing the beam experience different refractive indices or path delays in the following crystal segment. By independently control each element in each polarization rotator array, variable optical path delays of each beam can be achieved. Finally, an index-switched variable delay device and a ladder-structured variable device are cascaded to form a new device which combines the advantages of the two individual devices. This programmable optic device has the properties of high packing density, low loss, easy fabrication, and virtually infinite bandwidth. The device is inherently two dimensional and has a packing density exceeding 25 lines/cm2. The delay resolution of the device is on the order of a femtosecond (one micron in space) and the total delay exceeds 10 nanosecond. In addition, the delay is reversible so that the same delay device can be used for both antenna transmitting and receiving.
NASA Astrophysics Data System (ADS)
Aoki, K.
2016-12-01
Aerosols and cloud play an important role in the climate change. We started the long-term monitoring of aerosol and cloud optical properties since 1990's by using sky radiometer (POM-01, 02; Prede Co. Ltd., Japan). We provide the information, in this presentation, on the aerosol optical properties with respect to their temporal and spatial variability in Japan site (ex. Sapporo, Toyama, Kasuga and etc). The global distributions of aerosols have been derived from earth observation satellite and have been simulated in numerical models, which assume optical parameters. However, these distributions are difficult to derive because of variability in time and space. Therefore, Aerosol optical properties were investigated using the measurements from ground-based and ship-borne sky radiometer. The sky radiometer is an automatic instrument that takes observations only in daytime under the clear sky conditions. Observation of diffuse solar intensity interval was made every ten or five minutes by once. The aerosol optical properties were computed using the SKYRAD.pack version 4.2. The obtained Aerosol optical properties (Aerosol optical thickness, Ångström exponent, Single scattering albedo, and etc.) and size distribution volume clearly showed spatial and temporal variability in Japan area. In this study, we present the temporal and spatial variability of Aerosol optical properties at several Japan sites, applied to validation of satellite and numerical models. This project is validation satellite of GCOM-C, JAXA. The GCOM-C satellite scheduled to be launched in early 2017.
Subwavelength grating enabled on-chip ultra-compact optical true time delay line
Wang, Junjia; Ashrafi, Reza; Adams, Rhys; Glesk, Ivan; Gasulla, Ivana; Capmany, José; Chen, Lawrence R.
2016-01-01
An optical true time delay line (OTTDL) is a basic photonic building block that enables many microwave photonic and optical processing operations. The conventional design for an integrated OTTDL that is based on spatial diversity uses a length-variable waveguide array to create the optical time delays, which can introduce complexities in the integrated circuit design. Here we report the first ever demonstration of an integrated index-variable OTTDL that exploits spatial diversity in an equal length waveguide array. The approach uses subwavelength grating waveguides in silicon-on-insulator (SOI), which enables the realization of OTTDLs having a simple geometry and that occupy a compact chip area. Moreover, compared to conventional wavelength-variable delay lines with a few THz operation bandwidth, our index-variable OTTDL has an extremely broad operation bandwidth practically exceeding several tens of THz, which supports operation for various input optical signals with broad ranges of central wavelength and bandwidth. PMID:27457024
Subwavelength grating enabled on-chip ultra-compact optical true time delay line.
Wang, Junjia; Ashrafi, Reza; Adams, Rhys; Glesk, Ivan; Gasulla, Ivana; Capmany, José; Chen, Lawrence R
2016-07-26
An optical true time delay line (OTTDL) is a basic photonic building block that enables many microwave photonic and optical processing operations. The conventional design for an integrated OTTDL that is based on spatial diversity uses a length-variable waveguide array to create the optical time delays, which can introduce complexities in the integrated circuit design. Here we report the first ever demonstration of an integrated index-variable OTTDL that exploits spatial diversity in an equal length waveguide array. The approach uses subwavelength grating waveguides in silicon-on-insulator (SOI), which enables the realization of OTTDLs having a simple geometry and that occupy a compact chip area. Moreover, compared to conventional wavelength-variable delay lines with a few THz operation bandwidth, our index-variable OTTDL has an extremely broad operation bandwidth practically exceeding several tens of THz, which supports operation for various input optical signals with broad ranges of central wavelength and bandwidth.
NASA Astrophysics Data System (ADS)
Yokota, Hirohisa; Sano, Tomohiko; Imai, Yoh
2018-06-01
Recently, an optical attenuator has been important in fiber optic communication systems, because a transmission power in fiber has become higher due to a channel increment in wavelength division multiplexing transmission. A photonic crystal fiber (PCF) optical attenuator is fabricated by air hole diameter reduction in a part of PCF in which radiations are caused in the air hole diameter reduced part of PCF. A PCF optical attenuator has a high power resistance feature due to its radiation-induced operation of optical attenuation. In this paper, we proposed a variable PCF optical attenuator in which a bend was applied to the air hole diameter reduced part in PCF optical attenuator that was fabricated by CO2 laser irradiation. In PCF optical attenuator fabrication, the attenuation was adjusted by the reduced air hole diameter with laser irradiation time control. It was demonstrated that 10.6-13.5 dB of variable attenuation was obtained at 1550 nm-wavelength with 0°-90° bending angle applied to the air hole diameter reduced part in PCF optical attenuator.
NASA Astrophysics Data System (ADS)
Yokota, Hirohisa; Sano, Tomohiko; Imai, Yoh
2018-02-01
Recently, an optical attenuator has been important in fiber optic communication systems, because a transmission power in fiber has become higher due to a channel increment in wavelength division multiplexing transmission. A photonic crystal fiber (PCF) optical attenuator is fabricated by air hole diameter reduction in a part of PCF in which radiations are caused in the air hole diameter reduced part of PCF. A PCF optical attenuator has a high power resistance feature due to its radiation-induced operation of optical attenuation. In this paper, we proposed a variable PCF optical attenuator in which a bend was applied to the air hole diameter reduced part in PCF optical attenuator that was fabricated by CO2 laser irradiation. In PCF optical attenuator fabrication, the attenuation was adjusted by the reduced air hole diameter with laser irradiation time control. It was demonstrated that 10.6-13.5 dB of variable attenuation was obtained at 1550 nm-wavelength with 0°-90° bending angle applied to the air hole diameter reduced part in PCF optical attenuator.
Periodic optical variability of radio-detected ultracool dwarfs
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harding, L. K.; Golden, A.; Singh, Navtej
2013-12-20
A fraction of very low mass stars and brown dwarfs are known to be radio active, in some cases producing periodic pulses. Extensive studies of two such objects have also revealed optical periodic variability, and the nature of this variability remains unclear. Here, we report on multi-epoch optical photometric monitoring of six radio-detected dwarfs, spanning the ∼M8-L3.5 spectral range, conducted to investigate the ubiquity of periodic optical variability in radio-detected ultracool dwarfs. This survey is the most sensitive ground-based study carried out to date in search of periodic optical variability from late-type dwarfs, where we obtained 250 hr of monitoring,more » delivering photometric precision as low as ∼0.15%. Five of the six targets exhibit clear periodicity, in all cases likely associated with the rotation period of the dwarf, with a marginal detection found for the sixth. Our data points to a likely association between radio and optical periodic variability in late-M/early-L dwarfs, although the underlying physical cause of this correlation remains unclear. In one case, we have multiple epochs of monitoring of the archetype of pulsing radio dwarfs, the M9 TVLM 513–46546, spanning a period of 5 yr, which is sufficiently stable in phase to allow us to establish a period of 1.95958 ± 0.00005 hr. This phase stability may be associated with a large-scale stable magnetic field, further strengthening the correlation between radio activity and periodic optical variability. Finally, we find a tentative spin-orbit alignment of one component of the very low mass binary, LP 349–25.« less
Smoke optical depths - Magnitude, variability, and wavelength dependence
NASA Technical Reports Server (NTRS)
Pueschel, R. F.; Russell, P. B.; Colburn, D. A.; Ackerman, T. P.; Allen, D. A.
1988-01-01
An airborne autotracking sun-photometer has been used to measure magnitudes, temporal/spatial variabilities, and the wavelength dependence of optical depths in the near-ultraviolet to near-infrared spectrum of smoke from two forest fires and one jet fuel fire and of background air. Jet fuel smoke optical depths were found to be generally less wavelength dependent than background aerosol optical depths. Forest fire smoke optical depths, however, showed a wide range of wavelength depedences, such as incidents of wavelength-independent extinction.
Approach to assess consequences of hypoxia disturbance events for benthic ecosystem functioning
NASA Astrophysics Data System (ADS)
Gogina, Mayya; Darr, Alexander; Zettler, Michael L.
2014-01-01
Our study challenges the functional approach for its usefulness in assessing the consequences of hypoxia disturbance events on macrofaunal communities in the south-western Baltic Sea. Time series for two decades of observations from two monitoring stations, one in the Fehmarnbelt (exposed to aperiodic hypoxia), and another in the Darss Rise (normoxic conditions) is used. Our results designate differences of functional structure of benthic fauna communities between sites based on biological traits that characterise species role in modifying the environment, behavioural strategies, morphology and life history, thus suggesting differences in functioning. Hypoxic years reveal sharp increase of the role of sedentary species, suspension filter feeders, epibenthic structures, globulose form, medium/large size of individuals, preponderance of species with long lifespan (caused for instance by remaining ocean quahog). The link of functional and species diversity to the stagnation periods is proposed for the Darss station that exhibit continuous changes and low temporal variability of traits distribution. Before the major inflow in 1993 the increased role of small size organisms, containing calcium carbonate, filter feeders and grazers, higher presence of semi-pelagic species is observed. The hypoxic events and water renewal processes impact the communities not only in respect to species composition but also functionally.
Sánchez Pérez, A; Honrubia López, F M; Larrosa Poves, J M; Polo Llorens, V; Melcon Sánchez-Frieras, B
2001-09-01
To develop a lens planimetry technique for the optic disc using AutoCAD. To determine variability magnitude of the optic disc morphological measurements. We employed AutoCAD R.14.0 Autodesk: image acquisition, contour delimitation by multiple lines fitting or ellipse adjustment, image sectorialization and measurements quantification (optic disc and excavation, vertical diameters, optic disc area, excavation area, neuroretinal sector area and Beta atrophy area). Intraimage or operator and interimage o total reproducibility was studied by coefficient of variability (CV) (n=10) in normal and myopic optic discs. This technique allows to obtain optic disc measurement in 5 to 10 minutes time. Total or interimage variability of measurements introduced by one observer presents CV range from 1.18-4.42. Operator or intraimage measurement presents CV range from 0.30-4.21. Optic disc contour delimitation by ellipse adjustment achieved better reproducibility results than multiple lines adjustment in all measurements. Computer assisted AutoCAD planimetry is an interactive method to analyse the optic disc, feasible to incorporate to clinical practice. Reproducibility results are comparable to other analyzers in quantification optic disc morphology. Ellipse adjustment improves results in optic disc contours delimitation.
The Subaru/XMM-Newton Deep Survey (SXDS). V. Optically Faint Variable Object Survey
NASA Astrophysics Data System (ADS)
Morokuma, Tomoki; Doi, Mamoru; Yasuda, Naoki; Akiyama, Masayuki; Sekiguchi, Kazuhiro; Furusawa, Hisanori; Ueda, Yoshihiro; Totani, Tomonori; Oda, Takeshi; Nagao, Tohru; Kashikawa, Nobunari; Murayama, Takashi; Ouchi, Masami; Watson, Mike G.; Richmond, Michael W.; Lidman, Christopher; Perlmutter, Saul; Spadafora, Anthony L.; Aldering, Greg; Wang, Lifan; Hook, Isobel M.; Knop, Rob A.
2008-03-01
We present our survey for optically faint variable objects using multiepoch (8-10 epochs over 2-4 years) i'-band imaging data obtained with Subaru Suprime-Cam over 0.918 deg2 in the Subaru/XMM-Newton Deep Field (SXDF). We found 1040 optically variable objects by image subtraction for all the combinations of images at different epochs. This is the first statistical sample of variable objects at depths achieved with 8-10 m class telescopes or the Hubble Space Telescope. The detection limit for variable components is i'vari ~ 25.5 mag. These variable objects were classified into variable stars, supernovae (SNe), and active galactic nuclei (AGNs), based on the optical morphologies, magnitudes, colors, and optical-mid-infrared colors of the host objects, spatial offsets of variable components from the host objects, and light curves. Detection completeness was examined by simulating light curves for periodic and irregular variability. We detected optical variability for 36% +/- 2% (51% +/- 3% for a bright sample with i' < 24.4 mag) of X-ray sources in the field. Number densities of variable objects as functions of time intervals Δ t and variable component magnitudes i'vari are obtained. Number densities of variable stars, SNe, and AGNs are 120, 489, and 579 objects deg-2, respectively. Bimodal distributions of variable stars in the color-magnitude diagrams indicate that the variable star sample consists of bright (V ~ 22 mag) blue variable stars of the halo population and faint (V ~ 23.5 mag) red variable stars of the disk population. There are a few candidates of RR Lyrae providing a possible number density of ~10-2 kpc-3 at a distance of >150 kpc from the Galactic center. Based in part on data collected at Subaru Telescope, which is operated by the National Astronomical Observatory of Japan. Based on observations (program GN-2002B-Q-30) obtained at the Gemini Observatory, which is operated by the Association of Universities for Research in Astronomy, Inc., under a cooperative agreement with the NSF on behalf of the Gemini partnership: the National Science Foundation (US), the Particle Physics and Astronomy Research Council (UK), the National Research Council (Canada), CONICYT (Chile), the Australian Research Council (Australia), CNPq (Brazil), and CONICET (Argentina).
Complex optical/UV and X-ray variability of the Seyfert 1 galaxy 1H 0419-577
NASA Astrophysics Data System (ADS)
Pal, Main; Dewangan, Gulab C.; Kembhavi, Ajit K.; Misra, Ranjeev; Naik, Sachindra
2018-01-01
We present detailed broad-band UV/optical to X-ray spectral variability of the Seyfert 1 galaxy 1H 0419-577 using six XMM-Newton observations performed during 2002-2003. These observations covered a large amplitude variability event in which the soft X-ray (0.3-2 keV) count rate increased by a factor of ∼4 in six months. The X-ray spectra during the variability are well described by a model consisting of a primary power law, blurred and distant reflection. The 2-10 keV power-law flux varied by a factor of ∼7 while the 0.3-2 keV soft X-ray excess flux derived from the blurred reflection component varied only by a factor of ∼2. The variability event was also observed in the optical and UV bands but the variability amplitudes were only at the 6-10 per cent level. The variations in the optical and UV bands appear to follow the variations in the X-ray band. During the rising phase, the optical bands appear to lag behind the UV band but during the declining phase, the optical bands appear to lead the UV band. Such behaviour is not expected in the reprocessing models where the optical/UV emission is the result of reprocessing of X-ray emission in the accretion disc. The delayed contribution of the broad emission lines in the UV band or the changes in the accretion disc/corona geometry combined with X-ray reprocessing may give rise to the observed behaviour of the variations.
NASA Astrophysics Data System (ADS)
Stankovic, Miljan R.; Fujii, Alan M.; Kirby, Debra; Boas, David A.; Ntziachristos, Vasilis; Stubblefield, Phillip G.
1997-12-01
The present study demonstrated that optical variables HbT and SmcO2 can be used to monitor changes in cerebral hemodynamics and oxygenation during asphyxia. Unfortunately none of the individual optical variables alone could be used to monitor changes in cerebral hemodynamics and oxygenation under a variety of possible clinical circumstances. However, all variables together, forming patterns unique to the commonly occurring physiological conditions, might potentially serve as a `silver standard' to aid interpretations of optical signals in clinical settings where `gold standard' techniques are not available, i.g. in the human fetus and neonate.
NASA Astrophysics Data System (ADS)
Stankovic, Miljan R.; Fujii, Alan M.; Kirby, Debra; Boas, David A.; Ntziachristos, Vasilis; Stubblefield, Phillip G.
1998-01-01
The present study demonstrated that optical variables HbT and SmcO2 can be used to monitor changes in cerebral hemodynamics and oxygenation during asphyxia. Unfortunately none of the individual optical variables alone could be used to monitor changes in cerebral hemodynamics and oxygenation under a variety of possible clinical circumstances. However, all variables together, forming patterns unique to the commonly occurring physiological conditions, might potentially serve as a `silver standard' to aid interpretations of optical signals in clinical settings where `gold standard' techniques are not available, i.g. in the human fetus and neonate.
Mikš, Antonín; Novák, Pavel
2018-05-10
In this article, we analyze the problem of the paraxial design of an active optical element with variable focal length, which maintains the positions of its principal planes fixed during the change of its optical power. Such optical elements are important in the process of design of complex optical systems (e.g., zoom systems), where the fixed position of principal planes during the change of optical power is essential for the design process. The proposed solution is based on the generalized membrane tunable-focus fluidic lens with several membrane surfaces.
Compact programmable photonic variable delay devices
NASA Technical Reports Server (NTRS)
Yao, X. Steve (Inventor)
1999-01-01
Optical variable delay devices for providing variable true time delay to multiple optical beams simultaneously. A ladder-structured variable delay device comprises multiple basic building blocks stacked on top of each other resembling a ladder. Each basic building block has two polarization beamsplitters and a polarization rotator array arranged to form a trihedron; Controlling an array element of the polarization rotator array causes a beam passing through the array element either going up to a basic building block above it or reflect back towards a block below it. The beams going higher on the ladder experience longer optical path delay. An index-switched optical variable delay device comprises of many birefringent crystal segments connected with one another, with a polarization rotator array sandwiched between any two adjacent crystal segments. An array element in the polarization rotator array controls the polarization state of a beam passing through the element, causing the beam experience different refractive indices or path delays in the following crystal segment. By independently control each element in each polarization rotator array, variable optical path delays of each beam can be achieved. Finally, an index-switched variable delay device and a ladder-structured variable device are cascaded to form a new device which combines the advantages of the two individual devices. This programmable optic device has the properties of high packing density, low loss, easy fabrication, and virtually infinite bandwidth. The device is inherently two dimensional and has a packing density exceeding 25 lines/cm.sup.2. The delay resolution of the device is on the order of a femtosecond (one micron in space) and the total delay exceeds 10 nanosecond. In addition, the delay is reversible so that the same delay device can be used for both antenna transmitting and receiving.
NASA Astrophysics Data System (ADS)
Xu, Si-Yao; Li, Zhuo
2014-04-01
Complete high-resolution light curves of GRB 080319B observed by Swift present an opportunity for detailed temporal analysis of prompt optical emission. With a two-component distribution of initial Lorentz factors, we simulate the dynamical process of shells being ejected from the central engine in the framework of the internal shock model. The emitted radiations are decomposed into different frequency ranges for a temporal correlation analysis between the light curves in different energy bands. The resulting prompt optical and gamma-ray emissions show similar temporal profiles, with both showing a superposition of a component with slow variability and a component with fast variability, except that the gamma-ray light curve is much more variable than its optical counterpart. The variability in the simulated light curves and the strong correlation with a time lag between the optical and gamma-ray emissions are in good agreement with observations of GRB 080319B. Our simulations suggest that the variations seen in the light curves stem from the temporal structure of the shells injected from the central engine of gamma-ray bursts. Future observations with high temporal resolution of prompt optical emission from GRBs, e.g., by UFFO-Pathfinder and SVOM-GWAC, will provide a useful tool for investigating the central engine activity.
Environment and Structure Influence in DNA Conduction
NASA Technical Reports Server (NTRS)
Adessi, C.; Walch, S.; Anantram, M. P.; Biegel, Bryan (Technical Monitor)
2002-01-01
Results for transmission through the poly(G) DNA molecule are presented. We show that (i) periodically arranged sodium counter-ions in close proximity to dry DNA gives rise to a new conduction channel and aperiodicity in the counter-ion sequence can lead to a significant reduction in conduction, (ii) modification of the rise of B-DNA induces a change in the width of the transmission window, and (iii) specifically designed sequences are predicted to show intrinsic resonant tunneling behavior.
2009-12-01
events. Work associated with aperiodic tasks have the same statistical behavior and the same timing requirements. The timing deadlines are soft. • Sporadic...answers, but it is possible to calculate how precise the estimates are. Simulation-based performance analysis of a model includes a statistical ...to evaluate all pos- sible states in a timely manner. This is the principle reason for resorting to simulation and statistical analysis to evaluate
Kinetic energy equations for the average-passage equation system
NASA Technical Reports Server (NTRS)
Johnson, Richard W.; Adamczyk, John J.
1989-01-01
Important kinetic energy equations derived from the average-passage equation sets are documented, with a view to their interrelationships. These kinetic equations may be used for closing the average-passage equations. The turbulent kinetic energy transport equation used is formed by subtracting the mean kinetic energy equation from the averaged total instantaneous kinetic energy equation. The aperiodic kinetic energy equation, averaged steady kinetic energy equation, averaged unsteady kinetic energy equation, and periodic kinetic energy equation, are also treated.
Low-Dimensional Model of a Cylinder Wake
NASA Astrophysics Data System (ADS)
Luchtenburg, Mark; Cohen, Kelly; Siegel, Stefan; McLaughlin, Tom
2003-11-01
In a two-dimensional cylinder wake, self-excited oscillations in the form of periodic shedding of vortices are observed above a critical Reynolds number of about 47. These flow-induced non-linear oscillations lead to some undesirable effects associated with unsteady pressures such as fluid-structure interactions. An effective way of suppressing the self-excited flow oscillations is by the incorporation of closed-loop flow control. In this effort, a low dimensional, proper orthogonal decomposition (POD) model is based on data obtained from direct numerical simulations of the Navier Stokes equations for the two dimensional circular cylinder wake at a Reynolds number of 100. Three different conditions are examined, namely, the unforced wake experiencing steady-state vortex shedding, the transient behavior of the unforced wake at the startup of the simulation, and transient response to open-loop harmonic forcing by translation. We discuss POD mode selection and the number of modes that need to be included in the low-dimensional model. It is found that the transient dynamics need to be represented by a coupled system that includes an aperiodic mean-flow mode, an aperiodic shift mode and the periodic von Karman modes. Finally, a least squares mapping method is introduced to develop the non-linear state equations. The predictive capability of the state equations demonstrates the ability of the above approach to model the transient dynamics of the wake.
NASA Astrophysics Data System (ADS)
Semenchuk, Philipp R.; Gillespie, Mark A. K.; Rumpf, Sabine B.; Baggesen, Nanna; Elberling, Bo; Cooper, Elisabeth J.
2016-12-01
The duration of specific periods within a plant’s life cycle are critical for plant growth and performance. In the High Arctic, the start of many of these phenological periods is determined by snowmelt date, which may change in a changing climate. It has been suggested that the end of these periods during late-season are triggered by external cues, such as day length, light quality or temperature, leading to the hypothesis that earlier or later snowmelt dates will lengthen or shorten the duration of these periods, respectively, and thereby affect plant performance. We tested whether snowmelt date controls phenology and phenological period duration in High Arctic Svalbard using a melt timing gradient from natural and experimentally altered snow depths. We investigated the response of early- and late-season phenophases from both vegetative and reproductive phenological periods of eight common species. We found that all phenophases follow snowmelt patterns, irrespective of timing of occurrence, vegetative or reproductive nature. Three of four phenological period durations based on these phenophases were fixed for most species, defining the studied species as periodic. Periodicity can thus be considered an evolutionary trait leading to disadvantages compared with aperiodic species and we conclude that the mesic and heath vegetation types in Svalbard are at risk of being outcompeted by invading, aperiodic species from milder biomes.
NASA Astrophysics Data System (ADS)
Tian, Xiange; Xi Gu, James; Rehab, Ibrahim; Abdalla, Gaballa M.; Gu, Fengshou; Ball, A. D.
2018-02-01
Envelope analysis is a widely used method for rolling element bearing fault detection. To obtain high detection accuracy, it is critical to determine an optimal frequency narrowband for the envelope demodulation. However, many of the schemes which are used for the narrowband selection, such as the Kurtogram, can produce poor detection results because they are sensitive to random noise and aperiodic impulses which normally occur in practical applications. To achieve the purposes of denoising and frequency band optimisation, this paper proposes a novel modulation signal bispectrum (MSB) based robust detector for bearing fault detection. Because of its inherent noise suppression capability, the MSB allows effective suppression of both stationary random noise and discrete aperiodic noise. The high magnitude features that result from the use of the MSB also enhance the modulation effects of a bearing fault and can be used to provide optimal frequency bands for fault detection. The Kurtogram is generally accepted as a powerful means of selecting the most appropriate frequency band for envelope analysis, and as such it has been used as the benchmark comparator for performance evaluation in this paper. Both simulated and experimental data analysis results show that the proposed method produces more accurate and robust detection results than Kurtogram based approaches for common bearing faults under a range of representative scenarios.
Feng, Shijie; Chen, Qian; Zuo, Chao; Tao, Tianyang; Hu, Yan; Asundi, Anand
2017-01-23
Fringe projection is an extensively used technique for high speed three-dimensional (3-D) measurements of dynamic objects. To precisely retrieve a moving object at pixel level, researchers prefer to project a sequence of fringe images onto its surface. However, the motion often leads to artifacts in reconstructions due to the sequential recording of the set of patterns. In order to reduce the adverse impact of the movement, we present a novel high speed 3-D scanning technique combining the fringe projection and stereo. Firstly, promising measuring speed is achieved by modifying the traditional aperiodic sinusoidal patterns so that the fringe images can be cast at kilohertz with the widely used defocusing strategy. Next, a temporal intensity tracing algorithm is developed to further alleviate the influence of motion by accurately tracing the ideal intensity for stereo matching. Then, a combined cost measure is suggested to robustly estimate the cost for each pixel and lastly a three-step framework of refinement follows not only to eliminate outliers caused by the motion but also to obtain sub-pixel disparity results for 3-D reconstructions. In comparison with the traditional method where the effect of motion is not considered, experimental results show that the reconstruction accuracy for dynamic objects can be improved by an order of magnitude with the proposed method.
AlN-based piezoelectric bimorph microgenerator utilizing low-level non-resonant excitation
NASA Astrophysics Data System (ADS)
Hampl, Stefan; Cimalla, Volker; Polster, Tobias; Hoffmann, Martin
2011-06-01
This work aims for utilizing human ocular motion for the self-sufficient power supply of a minimally invasive implantable monitoring system for intraocular pressure (IOP). With a proven piezoelectric functionality (d33>5 pm/V), nanocrystalline thin films of aluminum nitride (AlN) provide a good capability for micromechanical energy harvesting (EH) in medical applications. Many d31-mode microcantilever architectures are poorly suited for human-induced EH: Resonant mass-spring-damper systems are tested under high, narrow-band excitation frequencies. However, human motions, e.g. vibrations of eyeballs are marked by their low frequency, unpredictable, mainly aperiodic and time-varying signature. Different vibration types and directions are 3-dimensionally superimposed. Saccadic eye movements are favorable for inertial microgenerators because of their high dynamic loading (ω<=1000°/s). Our generator concept (symmetric active/active-parallel-bimorph cantilever) enables a high structural compliance by maximizing the piezoactive volume at very low cantilever thicknesses (<1 μm). An increased length and seismic mass enable an effective excitation by low-level aperiodic vibrations such as saccadic acceleration impulses. Analytic calculations and FEA-simulations investigate the potential distribution and transient response of different bimorph structures (length 200- 1000 μm, width 20-200 μm) on broadband vibrations. First released monomorph and bimorph structures show very low resonant frequencies and an adequate robustness.
Varn, D P; Crutchfield, J P
2016-03-13
Erwin Schrödinger famously and presciently ascribed the vehicle transmitting the hereditary information underlying life to an 'aperiodic crystal'. We compare and contrast this, only later discovered to be stored in the linear biomolecule DNA, with the information-bearing, layered quasi-one-dimensional materials investigated by the emerging field of chaotic crystallography. Despite differences in functionality, the same information measures capture structure and novelty in both, suggesting an intimate coherence between the information character of biotic and abiotic matter-a broadly applicable physics of information. We review layered solids and consider three examples of how information- and computation-theoretic techniques are being applied to understand their structure. In particular, (i) we review recent efforts to apply new kinds of information measures to quantify disordered crystals; (ii) we discuss the structure of ice I in information-theoretic terms; and (iii) we recount recent investigations into the structure of tris(bicyclo[2.1.1]hexeno)benzene, showing how an information-theoretic analysis yields additional insight into its structure. We then illustrate a new Second Law of Thermodynamics that describes information processing in active low-dimensional materials, reviewing Maxwell's Demon and a new class of molecular devices that act as information catalysts. Lastly, we conclude by speculating on how these ideas from informational materials science may impact biology. © 2016 The Author(s).
NASA Astrophysics Data System (ADS)
Sosik, Heidi M.; Green, Rebecca E.; Pegau, W. Scott; Roesler, Collin S.
2001-05-01
Relationships between optical and physical properties were examined on the basis of intensive sampling at a site on the New England continental shelf during late summer 1996 and spring 1997. During both seasons, particles were found to be the primary source of temporal and vertical variability in optical properties since light absorption by dissolved material, though significant in magnitude, was relatively constant. Within the particle pool, changes in phytoplankton were responsible for much of the observed optical variability. Physical processes associated with characteristic seasonal patterns in stratification and mixing contributed to optical variability mostly through effects on phytoplankton. An exception to this generalization occurred during summer as the passage of a hurricane led to a breakdown in stratification and substantial resuspension of nonphytoplankton particulate material. Prior to the hurricane, conditions in summer were highly stratified with subsurface maxima in absorption and scattering coefficients. In spring, stratification was much weaker but increased over the sampling period, and a modest phytoplankton bloom caused surface layer maxima in absorption and scattering coefficients. These seasonal differences in the vertical distribution of inherent optical properties were evident in surface reflectance spectra, which were elevated and shifted toward blue wavelengths in the summer. Some seasonal differences in optical properties, including reflectance spectra, suggest that a significant shift toward a smaller particle size distribution occurred in summer. Shorter timescale optical variability was consistent with a variety of influences including episodic events such as the hurricane, physical processes associated with shelfbreak frontal dynamics, biological processes such as phytoplankton growth, and horizontal patchiness combined with water mass advection.
On-chip optical phase locking of single growth monolithically integrated Slotted Fabry Perot lasers.
Morrissey, P E; Cotter, W; Goulding, D; Kelleher, B; Osborne, S; Yang, H; O'Callaghan, J; Roycroft, B; Corbett, B; Peters, F H
2013-07-15
This work investigates the optical phase locking performance of Slotted Fabry Perot (SFP) lasers and develops an integrated variable phase locked system on chip for the first time to our knowledge using these lasers. Stable phase locking is demonstrated between two SFP lasers coupled on chip via a variable gain waveguide section. The two lasers are biased differently, one just above the threshold current of the device with the other at three times this value. The coupling between the lasers can be controlled using the variable gain section which can act as a variable optical attenuator or amplifier depending on bias. Using this, the width of the stable phase locking region on chip is shown to be variable.
Searching for X-ray variability/periodicity in HD 4004.
NASA Astrophysics Data System (ADS)
Wessolowski, U.; Niedzielski, A.
1996-02-01
The authors present preliminary results of a combined X-ray and optical search for variability/periodicity in HD 4004 (WR 1, WN5-s), an apparently single Wolf-Rayet star known to show radial velocity variations (Lamontagne 1983) and some variability both in photometry (Moffat and Shara 1986) and in optical line profiles (Niedzielski 1995). The two ROSAT PSPC pointed observations of HD 4004 (total effective exposure time of 35 ks) do not provide significant evidence for variability in X-rays. Line profile variations present in newly obtained optical spectra are similar to those of EZ CMa (WR 6, WN5-s+c?), the banner WR+compact companion candidate.
NASA Astrophysics Data System (ADS)
Edmonds, Peter D.; Gilliland, Ronald L.; Heinke, Craig O.; Grindlay, Jonathan E.
2003-10-01
We report in this study of 47 Tucanae the largest number of optical identifications of X-ray sources yet obtained in a single globular cluster. Using deep Chandra ACIS-I imaging and extensive Hubble Space Telescope studies with Wide Field Planetary Camera 2 (WFPC2; including a 120 orbit program giving superb V and I images), we have detected optical counterparts to at least 22 cataclysmic variables (CVs) and 29 chromospherically active binaries (BY Dra and RS CVn systems) in 47 Tuc. These identifications are all based on tight astrometric matches between X-ray sources and objects with unusual (non-main-sequence [non-MS]) optical colors and/or optical variability. Several other CVs and active binaries have likely been found, but these have marginal significance because of larger offsets between the X-ray and optical positions, or colors and variability that are not statistically convincing. These less secure optical identifications are not subsequently discussed in detail. In the U versus U-V color-magnitude diagram (CMD), where the U band corresponds to either F336W or F300W, the CVs all show evidence for blue colors compared with the MS, but most of them fall close to the main sequence in the V versus V-I CMD, showing that the secondary stars dominate the optical light. The X-ray-detected active binaries have magnitude offsets above the MS (in both the U versus U-V or V versus V-I CMDs) that are indistinguishable from those of the much larger sample of optical variables (eclipsing and contact binaries and BY Dra variables) detected in the recent WFPC2 studies of Albrow et al. We also present the results of a new, deeper search for optical companions to millisecond pulsars (MSPs). One possible optical companion to an MSP (47 Tuc T) was found, adding to the two optical companions already known. Finally, we study several blue stars with periodic variability from Albrow et al. that show little or no evidence for X-ray emission. The optical colors of these objects differ from those of 47 Tuc (and field) CVs. An accompanying paper will present time series results for these optical identifications and will discuss X-ray-to-optical flux ratios, spatial distributions, and an overall interpretation of the results. Based on observations with the NASA/ESA Hubble Space Telescope obtained at STScI, which is operated by AURA, Inc., under NASA contract NAS 5-26555.
Tunable graded rod laser assembly
NASA Technical Reports Server (NTRS)
AuYeung, John C. (Inventor)
1985-01-01
A tunable laser assembly including a pair of radially graded indexed optical segments aligned to focus the laser to form an external resonant cavity with an optical axis, the respective optical segments are retativity moveable along the optical axis and provide a variable et aion gap sufficient to permit variable tuning of the laser wavelength without altering the effective length of the resonant cavity. The gap also include a saturable absorbing material providing a passive mode-locking of the laser.
NASA Astrophysics Data System (ADS)
Harding, L. K.; Hallinan, G.; Boyle, R. P.; Butler, R. F.; Sheehan, B.; Golden, A.
2011-12-01
A number of ultracool dwarfs have been unexpectedly detected as radio sources in the last decade, four of which have been found to be producing periodic pulses. More recently, two of these pulsing dwarfs have also been found to be periodically variable in broadband optical photometry. The detected periods match the periods of the radio pulses which have previously been associated with the rotation period of the dwarf. For one of these objects, it has also been established that the optical and radio periodic variability are possibly linked, being a consequence of magnetically-driven auroral processes. In order to investigate the ubiquity of the periodic optical variability in radio detected sources, the GUFI instrument (Galway Ultra Fast Imager) was commissioned on the 1.8m Vatican Advanced Technology Telescope, on Mt. Graham, Arizona, and has been obtaining data for the past eighteen months. More than two hundred hours of multi-epoch photometric monitoring observations of radio detected ultracool dwarfs have been completed. We present initial results confirming optical periodic variability for four of this sample, three of which have been newly confirmed using GUFI.
Engineering photonic and plasmonic light emission enhancement
NASA Astrophysics Data System (ADS)
Lawrence, Nathaniel
Semiconductor photonic devices are a rapidly maturing technology which currently occupy multi-billion dollar markets in the areas of LED lighting and optical data communication. LEDs currently demonstrate the highest luminous efficiency of any light source for general lighting. Long-haul optical data communication currently forms the backbone of the global communication network. Proper design of light management is required for photonic devices, which can increase the overall efficiency or add new device functionality. In this thesis, novel methods for the control of light propagation and confinement are developed for the use in integrated photonic devices. The first part of this work focuses on the engineering of field confinement within deep subwavelength plasmonic resonators for the enhancement of light-matter interaction. In this section, plasmonic ring nanocavities are shown to form gap plasmon modes confined to the dielectric region between two metal layers. The scattering properties, near-field enhancement and photonic density of states of nanocavity devices are studied using analytic theory and 3D finite difference time domain simulations. Plasmonic ring nanocavities are fabricated and characterized using photoluminescence intensity and decay rate measurements. A 25 times increase in the radiative decay rate of Er:Si02 is demonstrated in nanocavities where light is confined to volumes as small as 0.01( ln )3. The potential to achieve lasing, due to the enhancement of stimulated emission rate in ring nanocavities, is studied as a route to Si-compatible plasmon-enhanced nanolasers. The second part of this work focuses on the manipulation of light generated in planar semiconductor devices using arrays of dielectric nanopillars. In particular, aperiodic arrays of nanopillars are engineered for omnidirectional light extraction enhancement. Arrays of Er:SiNx, nanopillars are fabricated and a ten times increase in light extraction is experimentally demonstrated, while simultaneously controlling far-field radiation patterns in ways not possible with periodic arrays. Additionally, analytical scalar diffraction theory is used to study light propagation from Vogel spiral arrays and demonstrate generation of OAM. Using phase shifting interferometry, the presence of OAM is experimentally verified. The use of Vogel spirals presents a new method for the generation of OAM with applications for secure optical communications.
Time-varying metamaterials based on graphene-wrapped microwires: Modeling and potential applications
NASA Astrophysics Data System (ADS)
Salary, Mohammad Mahdi; Jafar-Zanjani, Samad; Mosallaei, Hossein
2018-03-01
The successful realization of metamaterials and metasurfaces requires the judicious choice of constituent elements. In this paper, we demonstrate the implementation of time-varying metamaterials in the terahertz frequency regime by utilizing graphene-wrapped microwires as building blocks and modulation of graphene conductivity through exterior electrical gating. These elements enable enhancement of light-graphene interaction by utilizing optical resonances associated with Mie scattering, yielding a large tunability and modulation depth. We develop a semianalytical framework based on transition-matrix formulation for modeling and analysis of periodic and aperiodic arrays of such time-varying building blocks. The proposed method is validated against full-wave numerical results obtained using the finite-difference time-domain method. It provides an ideal tool for mathematical synthesis and analysis of space-time gradient metamaterials, eliminating the need for computationally expensive numerical models. Moreover, it allows for a wider exploration of exotic space-time scattering phenomena in time-modulated metamaterials. We apply the method to explore the role of modulation parameters in the generation of frequency harmonics and their emerging wavefronts. Several potential applications of such platforms are demonstrated, including frequency conversion, holographic generation of frequency harmonics, and spatiotemporal manipulation of light. The presented results provide key physical insights to design time-modulated functional metadevices using various building blocks and open up new directions in the emerging paradigm of time-modulated metamaterials.
NASA Astrophysics Data System (ADS)
Boyle, Richard P.; Harding, L. K.; Hallinan, G.; Butler, R. F.; Golden, A.
2011-05-01
In the past ten years or so, radio observations of ultracool dwarfs have yielded the detection of both quiescent and time-variable radio emission in the late-M and L dwarf regime. Four of these dwarfs have been found to produce periodic pulses, determined to be associated with the dwarf's rotation. More recently, two of these radio pulsing dwarfs have been shown to be periodically variable in broadband optical photometry, where the detected periods match the periods of the radio pulses. For one of these dwarfs in particular, it has been established that the mechanism which is driving the optical and radio periodic variability are possibly linked, being a consequence of a magnetically-driven auroral process. We therefore undertook a campaign to investigate the ubiquity of optical periodicity for known radio detected ultracool dwarfs, via multi-color photometric monitoring. To facilitate this research, the GUFI instrument (Galway Ultra Fast Imager) was commissioned on the 1.8m VATT observatory, on Mt. Graham, Arizona. We present the recently published results from this observation campaign, where we have confirmed periodic variability for five of these dwarfs, three of which have been detected for the first time by GUFI. These data provide an insight into the cause of this optical emission, its connection to the radio processes, and most importantly determine whether optical periodic signals are present only in radio pulsing dwarfs.
Modeling of an Adjustable Beam Solid State Light Project
NASA Technical Reports Server (NTRS)
Clark, Toni
2015-01-01
This proposal is for the development of a computational model of a prototype variable beam light source using optical modeling software, Zemax Optics Studio. The variable beam light source would be designed to generate flood, spot, and directional beam patterns, while maintaining the same average power usage. The optical model would demonstrate the possibility of such a light source and its ability to address several issues: commonality of design, human task variability, and light source design process improvements. An adaptive lighting solution that utilizes the same electronics footprint and power constraints while addressing variability of lighting needed for the range of exploration tasks can save costs and allow for the development of common avionics for lighting controls.
Feedback controlled optics with wavefront compensation
NASA Technical Reports Server (NTRS)
Breckenridge, William G. (Inventor); Redding, David C. (Inventor)
1993-01-01
The sensitivity model of a complex optical system obtained by linear ray tracing is used to compute a control gain matrix by imposing the mathematical condition for minimizing the total wavefront error at the optical system's exit pupil. The most recent deformations or error states of the controlled segments or optical surfaces of the system are then assembled as an error vector, and the error vector is transformed by the control gain matrix to produce the exact control variables which will minimize the total wavefront error at the exit pupil of the optical system. These exact control variables are then applied to the actuators controlling the various optical surfaces in the system causing the immediate reduction in total wavefront error observed at the exit pupil of the optical system.
Fluid elasticity and the transition to chaos in thermal convection
DOE Office of Scientific and Technical Information (OSTI.GOV)
Khayat, R.E.
1995-01-01
The influence of fluid elasticity on the onset of aperiodic or chaotic motion of an upper-convected Maxwellian fluid is examined in the context of the Rayleigh-Benard thermal convection problem. A truncated Fourier representation of the flow and temperature fields leads to a four-dimensional dynamical system that constitutes a generalization of the classical Lorenz system for Newtonian fluids. It is found that, to the order of the present truncation and above a critical value of the Deborah number De[sup [ital c
Wiring Zinc in Three Dimensions Re-writes Battery Performance - Dendrite-Free Cycling
2014-01-01
surfaces throughout the electrode structure (Fig. 5D–I). The positive Zn@ZnO sponge exhibits a compact morphology uniformly distributed throughout (Fig...monolithic, three-dimensional (3D) aperiodic architecture. Utilization approaches 90% (728 mA h gZn 1) when the zinc “ sponge ” is used as the anode in...a primary (single-use) zinc–air cell. To probe rechargeability of the 3D Zn sponge , we cycled Zn–vs.–Zn symmetric cells and Ag–Zn full cells under
Parametric synthesis of a robust controller on a base of mathematical programming method
NASA Astrophysics Data System (ADS)
Khozhaev, I. V.; Gayvoronskiy, S. A.; Ezangina, T. A.
2018-05-01
Considered paper is dedicated to deriving sufficient conditions, linking root indices of robust control quality with coefficients of interval characteristic polynomial, on the base of mathematical programming method. On the base of these conditions, a method of PI- and PID-controllers, providing aperiodic transient process with acceptable stability degree and, subsequently, acceptable setting time, synthesis was developed. The method was applied to a problem of synthesizing a controller for a depth control system of an unmanned underwater vehicle.
Randomness Testing of the Advanced Encryption Standard Finalist Candidates
2000-03-28
Excursions Variant 18 168-185 Rank 1 7 Serial 2 186-187 Spectral DFT 1 8 Lempel - Ziv Compression 1 188 Aperiodic Templates 148 9-156 Linear Complexity...256 bits) for each of the algorithms , for a total of 80 different data sets10. These data sets were selected based on the belief that they would be...useful in evaluating the randomness of cryptographic algorithms . Table 2 lists the eight data types. For a description of the data types, see Appendix
1983-03-01
AN ANALYSIS OF A FINITE ELEMENT METHOD FOR CONVECTION- DIFFUSION PROBLEMS PART II: A POSTERIORI ERROR ESTIMATES AND ADAPTIVITY by W. G. Szymczak Y 6a...PERIOD COVERED AN ANALYSIS OF A FINITE ELEMENT METHOD FOR final life of the contract CONVECTION- DIFFUSION PROBLEM S. Part II: A POSTERIORI ERROR ...Element Method for Convection- Diffusion Problems. Part II: A Posteriori Error Estimates and Adaptivity W. G. Szvmczak and I. Babu~ka# Laboratory for
Distributed Digital Subarray Antennas
2013-12-01
subarrays in space). Linear, planar, volumetric. Periodic, aperiodic or random. Rotation and tilt relative to a global reference. Based on the...sm N , and ( ), ( ), ( )s s sx m y m z m coordinates of subarray m in the global system. The subarrays can be rotated and tilted with respect...to the global origin. In the global system ( , ) the direction cosines are sin cos sin sin cos . u v w (1) The scan
NASA Astrophysics Data System (ADS)
Wang, Qingzhi; Tan, Guanzheng; He, Yong; Wu, Min
2017-10-01
This paper considers a stability analysis issue of piecewise non-linear systems and applies it to intermittent synchronisation of chaotic systems. First, based on piecewise Lyapunov function methods, more general and less conservative stability criteria of piecewise non-linear systems in periodic and aperiodic cases are presented, respectively. Next, intermittent synchronisation conditions of chaotic systems are derived which extend existing results. Finally, Chua's circuit is taken as an example to verify the validity of our methods.
The Effect of Dihydroxyacetone on the Liquid Storage Properties of Human Blood.
Addition of dihydroxyacetone (DHA) to acid-citrate-phosphate (ACD) blood is effective in partially maintaining 2,3- diphosphoglycerate levels for a...period of 21 to 28 days. DHA has no effect on adenosine triphosphate (ATP) levels or cell viability. The overall effect of adenine with DHA is...unfavorable since it retards the effect of the DHA while only slightly raising ATP levels . DHA may be valuable in maintaining increased hemoglobin function levels throughout the present 21 day storage period. (Author)
Optical Variability of Narrow-line and Broad-line Seyfert 1 Galaxies
NASA Astrophysics Data System (ADS)
Rakshit, Suvendu; Stalin, C. S.
2017-06-01
We studied the optical variability (OV) of a large sample of narrow-line Seyfert 1 (NLSy1) and broad-line Seyfert 1 (BLSy1) galaxies with z < 0.8 to investigate any differences in their OV properties. Using archival optical V-band light curves from the Catalina Real Time Transient Survey that span 5-9 years and modeling them using damped random walk, we estimated the amplitude of variability. We found that NLSy1 galaxies as a class show lower amplitude of variability than their broad-line counterparts. In the sample of both NLSy1 and BLSy1 galaxies, radio-loud sources are found to have higher variability amplitude than radio-quiet sources. Considering only sources that are detected in the X-ray band, NLSy1 galaxies are less optically variable than BLSy1 galaxies. The amplitude of variability in the sample of both NLSy1 and BLSy1 galaxies is found to be anti-correlated with Fe II strength but correlated with the width of the Hβ line. The well-known anti-correlation of variability-luminosity and the variability-Eddington ratio is present in our data. Among the radio-loud sample, variability amplitude is found to be correlated with radio-loudness and radio-power, suggesting that jets also play an important role in the OV in radio-loud objects, in addition to the Eddington ratio, which is the main driving factor of OV in radio-quiet sources.
Methodology for the AutoRegressive Planet Search (ARPS) Project
NASA Astrophysics Data System (ADS)
Feigelson, Eric; Caceres, Gabriel; ARPS Collaboration
2018-01-01
The detection of periodic signals of transiting exoplanets is often impeded by the presence of aperiodic photometric variations. This variability is intrinsic to the host star in space-based observations (typically arising from magnetic activity) and from observational conditions in ground-based observations. The most common statistical procedures to remove stellar variations are nonparametric, such as wavelet decomposition or Gaussian Processes regression. However, many stars display variability with autoregressive properties, wherein later flux values are correlated with previous ones. Providing the time series is evenly spaced, parametric autoregressive models can prove very effective. Here we present the methodology of the Autoregessive Planet Search (ARPS) project which uses Autoregressive Integrated Moving Average (ARIMA) models to treat a wide variety of stochastic short-memory processes, as well as nonstationarity. Additionally, we introduce a planet-search algorithm to detect periodic transits in the time-series residuals after application of ARIMA models. Our matched-filter algorithm, the Transit Comb Filter (TCF), replaces the traditional box-fitting step. We construct a periodogram based on the TCF to concentrate the signal of these periodic spikes. Various features of the original light curves, the ARIMA fits, the TCF periodograms, and folded light curves at peaks of the TCF periodogram can then be collected to provide constraints for planet detection. These features provide input into a multivariate classifier when a training set is available. The ARPS procedure has been applied NASA's Kepler mission observations of ~200,000 stars (Caceres, Dissertation Talk, this meeting) and will be applied in the future to other datasets.
Electrowetting Variable Optics for Visible and Infrared Applications
NASA Astrophysics Data System (ADS)
Watson, Alexander Maxwell
Miniaturized variable optical devices are important for the fields of medical technology, optical communication, and consumer imaging devices. Areas ranging from endoscopy and optogenetics to atomic clocks and imaging all benefit from versatile optical systems. These applications all require precise and rapid control of imaging focal depth and lateral scanning. Electrowetting variable optics is one emergent technology that has the capability to provide focus tuning, beam steering, and even phase modulation in a small and robust package which requires no moving parts. Furthermore, electrowetting based devices there are attractive due to their transmissive nature, polarization insensitivity, low insertion loss, low electrical power requirements, and high optical quality. These features mean that electrowetting adaptive optical components are an attractive solution, compared with MEMS and liquid crystal optical components. Electrowetting is a technique that enables control of the shape of a liquid droplet with applied voltage. A conductive droplet on a dielectric surface alters its contact angle due to charges that build up between an underlying electrode and the surface of the droplet. This effect can be used to tune the curvature and tilt of liquids within cavities. The liquid boundary creates a high quality surface to use for lensing or steering applications. This thesis will focus on the development of electrowetting based lenses and prisms and applications in imaging for both visible and infrared wavelengths. Within this dissertation is the first demonstration of electrowetting lenses for phase control, as well as the investigation of non-aqueous electrowetting lens liquids for electrowetting lenses operation in the infrared. Key considerations that affect the performance and reliability are dielectric material and thickness, liquid selection and source of ionic conduction. The optical devices presented herein utilize judicious selection of dielectric material and electrowetting liquids to enable low voltage variable optics and demonstrate applications in microscopy and microendoscopy.
Optical fundamentals of an adaptive substance-on-surface chemical recognizer
NASA Astrophysics Data System (ADS)
Fauconier, Richard; Ndoye, Mandoye; Montlouis, Webert
2017-10-01
The objective is to identify the chemical composition of (isotropic and homogeneous) thin liquid and gel films on various surfaces by their infrared reflectance spectra. A bistatic optical sensing concept is proposed here in which a multi-wavelength laser source and a detector are physically displaced from each other. With the aid of the concept apparatus proposed, key optical variables can be measured in real time. The variables in question (substance thickness, refractive index, etc.) are those whose un-observability causes many types of monostatic sensor (in use today) to give ambiguous identifications. Knowledge of the aforementioned key optical variables would allow an adaptive signal-processing algorithm to make unambiguous identifications of the unknown chemicals by their infrared spectra, despite their variable presentations. The proposed bistatic sensor system consists of an optical transmitter and an optical receiver. The whole system can be mounted on a stable platform. Both the optical transmitter subsystem and the optical receiver subsystem contain auxiliary sensors to determine their relative spatial positions and orientations. For each subsystem, these auxiliary sensors include an orientation sensor, and rotational sensors for absolute angular position. A profilometer-and-machine-vision subsystem is also included. An important aspect of determining the necessary optical variables is an aperture that limits the interrogatory beams to a coherent pair, rejecting those resulting from successive multiple reflections. A set of equations is developed to characterize the propagation of a coherent pair of frequency-modulated thin beams through the system. It is also shown that frequency modulation can produce easily measurable beat frequencies for determination of sample thicknesses on the order of microns to millimeters. Also shown is how the apparatus's polarization features allow it to measure the refractive index of any isotropic, homogeneous dielectric surface on which the unknown substance can sit. Concave, convex and flat supporting surfaces and menisci are discussed.
NASA Astrophysics Data System (ADS)
Boutsia, K.; Leibundgut, B.; Trevese, D.; Vagnetti, F.
2009-04-01
Context: Supermassive black holes with masses of 10^5-109 M⊙ are believed to inhabit most, if not all, nuclear regions of galaxies, and both observational evidence and theoretical models suggest a scenario where galaxy and black hole evolution are tightly related. Luminous AGNs are usually selected by their non-stellar colours or their X-ray emission. Colour selection cannot be used to select low-luminosity AGNs, since their emission is dominated by the host galaxy. Objects with low X-ray to optical ratio escape even the deepest X-ray surveys performed so far. In a previous study we presented a sample of candidates selected through optical variability in the Chandra Deep Field South, where repeated optical observations were performed in the framework of the STRESS supernova survey. Aims: The analysis is devoted to breaking down the sample in AGNs, starburst galaxies, and low-ionisation narrow-emission line objects, to providing new information about the possible dependence of the emission mechanisms on nuclear luminosity and black-hole mass, and eventually studying the evolution in cosmic time of the different populations. Methods: We obtained new optical spectroscopy for a sample of variability selected candidates with the ESO NTT telescope. We analysed the new spectra, together with those existing in the literature and studied the distribution of the objects in U-B and B-V colours, optical and X-ray luminosity, and variability amplitude. Results: A large fraction (17/27) of the observed candidates are broad-line luminous AGNs, confirming the efficiency of variability in detecting quasars. We detect: i) extended objects which would have escaped the colour selection and ii) objects of very low X-ray to optical ratio, in a few cases without any X-ray detection at all. Several objects resulted to be narrow-emission line galaxies where variability indicates nuclear activity, while no emission lines were detected in others. Some of these galaxies have variability and X-ray to optical ratio close to active galactic nuclei, while others have much lower variability and X-ray to optical ratio. This result can be explained by the dilution of the nuclear light due to the host galaxy. Conclusions: Our results demonstrate the effectiveness of supernova search programmes to detect large samples of low-luminosity AGNs. A sizable fraction of the AGN in our variability sample had escaped X-ray detection (5/47) and/or colour selection (9/48). Spectroscopic follow-up to fainter flux limits is strongly encouraged. Based on observations collected at the European Southern Observatory, Chile, 080.B-0187(A).
Spatial and temporal variability in response to hybrid electro-optical stimulation
NASA Astrophysics Data System (ADS)
Duke, Austin R.; Lu, Hui; Jenkins, Michael W.; Chiel, Hillel J.; Jansen, E. Duco
2012-06-01
Hybrid electro-optical neural stimulation is a novel paradigm combining the advantages of optical and electrical stimulation techniques while reducing their respective limitations. However, in order to fulfill its promise, this technique requires reduced variability and improved reproducibility. Here we used a comparative physiological approach to aid the further development of this technique by identifying the spatial and temporal factors characteristic of hybrid stimulation that may contribute to experimental variability and/or a lack of reproducibility. Using transient pulses of infrared light delivered simultaneously with a bipolar electrical stimulus in either the marine mollusk Aplysia californica buccal nerve or the rat sciatic nerve, we determined the existence of a finite region of excitability with size altered by the strength of the optical stimulus and recruitment dictated by the polarity of the electrical stimulus. Hybrid stimulation radiant exposures yielding 50% probability of firing (RE50) were shown to be negatively correlated with the underlying changes in electrical stimulation threshold over time. In Aplysia, but not in the rat sciatic nerve, increasing optical radiant exposures (J cm-2) beyond the RE50 ultimately resulted in inhibition of evoked potentials. Accounting for the sources of variability identified in this study increased the reproducibility of stimulation from 35% to 93% in Aplysia and 23% to 76% in the rat with reduced variability.
Wick, David V.
2005-12-20
An active optical zoom system changes the magnification (or effective focal length) of an optical imaging system by utilizing two or more active optics in a conventional optical system. The system can create relatively large changes in system magnification with very small changes in the focal lengths of individual active elements by leveraging the optical power of the conventional optical elements (e.g., passive lenses and mirrors) surrounding the active optics. The active optics serve primarily as variable focal-length lenses or mirrors, although adding other aberrations enables increased utility. The active optics can either be LC SLMs, used in a transmissive optical zoom system, or DMs, used in a reflective optical zoom system. By appropriately designing the optical system, the variable focal-length lenses or mirrors can provide the flexibility necessary to change the overall system focal length (i.e., effective focal length), and therefore magnification, that is normally accomplished with mechanical motion in conventional zoom lenses. The active optics can provide additional flexibility by allowing magnification to occur anywhere within the FOV of the system, not just on-axis as in a conventional system.
Optical design of laser zoom projective lens with variable total track
NASA Astrophysics Data System (ADS)
He, Yulan; Xiao, Xiangguo; Lu, Feng; Li, Yuan; Han, Kunye; Wang, Nanxi; Qiang, Hua
2017-02-01
In order to project the laser command information to the proper distance , so a laser zoom projective lens with variable total track optical system is designed in the carrier-based aircraft landing system. By choosing the zoom structure, designing of initial structure with PW solution, correcting and balancing the aberration, a large variable total track with 35 × zoom is carried out. The size of image is invariable that is φ25m, the distance of projective image is variable from 100m to 3500m. Optical reverse design, the spot is less than 8μm, the MTF is near the diffraction limitation, the value of MTF is bigger than 0.4 at 50lp/mm.
NASA Astrophysics Data System (ADS)
Leh, Barbara; Siebert, Rainer; Hamzeh, Hussein; Menard, Laurent; Duval, Marie-Alix; Charon, Yves; Abi Haidar, Darine
2012-10-01
Growing interest in optical instruments for biomedical applications has increased the use of optically calibrated phantoms. Often associated with tissue modeling, phantoms allow the characterization of optical devices for clinical purposes. Fluorescent gel phantoms have been developed, mimicking optical properties of healthy and tumorous brain tissues. Specific geometries of dedicated molds offer multiple-layer phantoms with variable thicknesses and monolayer phantoms with cylindrical inclusions at various depths and diameters. Organic chromophores are added to allow fluorescence spectroscopy. These phantoms are designed to be used with 405 nm as the excitation wavelength. This wavelength is then adapted to excite large endogenous molecules. The benefits of these phantoms in understanding fluorescence tissue analysis are then demonstrated. In particular, detectability aspects as a function of geometrical and optical parameters are presented and discussed.
On-chip continuous-variable quantum entanglement
NASA Astrophysics Data System (ADS)
Masada, Genta; Furusawa, Akira
2016-09-01
Entanglement is an essential feature of quantum theory and the core of the majority of quantum information science and technologies. Quantum computing is one of the most important fruits of quantum entanglement and requires not only a bipartite entangled state but also more complicated multipartite entanglement. In previous experimental works to demonstrate various entanglement-based quantum information processing, light has been extensively used. Experiments utilizing such a complicated state need highly complex optical circuits to propagate optical beams and a high level of spatial interference between different light beams to generate quantum entanglement or to efficiently perform balanced homodyne measurement. Current experiments have been performed in conventional free-space optics with large numbers of optical components and a relatively large-sized optical setup. Therefore, they are limited in stability and scalability. Integrated photonics offer new tools and additional capabilities for manipulating light in quantum information technology. Owing to integrated waveguide circuits, it is possible to stabilize and miniaturize complex optical circuits and achieve high interference of light beams. The integrated circuits have been firstly developed for discrete-variable systems and then applied to continuous-variable systems. In this article, we review the currently developed scheme for generation and verification of continuous-variable quantum entanglement such as Einstein-Podolsky-Rosen beams using a photonic chip where waveguide circuits are integrated. This includes balanced homodyne measurement of a squeezed state of light. As a simple example, we also review an experiment for generating discrete-variable quantum entanglement using integrated waveguide circuits.
Development and application of variable-magnification x-ray Bragg optics
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hirano, Keiichi, E-mail: keiichi.hirano@kek.jp; Takahashi, Yumiko; Sugiyama, Hiroshi
2016-07-27
A novel x-ray Bragg optics was developed for variable-magnification of an x-ray beam, and was combined with a module of the PILATUS pixel detector. A feasibility test of this optical system was carried out at the vertical-wiggler beamline BL-14B of the Photon Factory. By tuning the magnification factor, we could successfully control the spatial resolution of the optical system between 28 μm and 280 μm. X-ray absorption-contrast images of a leaf were observed at various magnification factors.
Directed nucleation assembly of DNA tile complexes for barcode-patterned lattices
NASA Astrophysics Data System (ADS)
Yan, Hao; Labean, Thomas H.; Feng, Liping; Reif, John H.
2003-07-01
The programmed self-assembly of patterned aperiodic molecular structures is a major challenge in nanotechnology and has numerous potential applications for nanofabrication of complex structures and useful devices. Here we report the construction of an aperiodic patterned DNA lattice (barcode lattice) by a self-assembly process of directed nucleation of DNA tiles around a scaffold DNA strand. The input DNA scaffold strand, constructed by ligation of shorter synthetic oligonucleotides, provides layers of the DNA lattice with barcode patterning information represented by the presence or absence of DNA hairpin loops protruding out of the lattice plane. Self-assembly of multiple DNA tiles around the scaffold strand was shown to result in a patterned lattice containing barcode information of 01101. We have also demonstrated the reprogramming of the system to another patterning. An inverted barcode pattern of 10010 was achieved by modifying the scaffold strands and one of the strands composing each tile. A ribbon lattice, consisting of repetitions of the barcode pattern with expected periodicity, was also constructed by the addition of sticky ends. The patterning of both classes of lattices was clearly observable via atomic force microscopy. These results represent a step toward implementation of a visual readout system capable of converting information encoded on a 1D DNA strand into a 2D form readable by advanced microscopic techniques. A functioning visual output method would not only increase the readout speed of DNA-based computers, but may also find use in other sequence identification techniques such as mutation or allele mapping.
Directed nucleation assembly of DNA tile complexes for barcode-patterned lattices.
Yan, Hao; LaBean, Thomas H; Feng, Liping; Reif, John H
2003-07-08
The programmed self-assembly of patterned aperiodic molecular structures is a major challenge in nanotechnology and has numerous potential applications for nanofabrication of complex structures and useful devices. Here we report the construction of an aperiodic patterned DNA lattice (barcode lattice) by a self-assembly process of directed nucleation of DNA tiles around a scaffold DNA strand. The input DNA scaffold strand, constructed by ligation of shorter synthetic oligonucleotides, provides layers of the DNA lattice with barcode patterning information represented by the presence or absence of DNA hairpin loops protruding out of the lattice plane. Self-assembly of multiple DNA tiles around the scaffold strand was shown to result in a patterned lattice containing barcode information of 01101. We have also demonstrated the reprogramming of the system to another patterning. An inverted barcode pattern of 10010 was achieved by modifying the scaffold strands and one of the strands composing each tile. A ribbon lattice, consisting of repetitions of the barcode pattern with expected periodicity, was also constructed by the addition of sticky ends. The patterning of both classes of lattices was clearly observable via atomic force microscopy. These results represent a step toward implementation of a visual readout system capable of converting information encoded on a 1D DNA strand into a 2D form readable by advanced microscopic techniques. A functioning visual output method would not only increase the readout speed of DNA-based computers, but may also find use in other sequence identification techniques such as mutation or allele mapping.
Two- and three-dimensional growth of Bi on i -Al-Pd-Mn studied using medium-energy ion scattering
NASA Astrophysics Data System (ADS)
Noakes, T. C. Q.; Bailey, P.; McConville, C. F.; Draxler, M.; Walker, M.; Brown, M. G.; Hentz, A.; Woodruff, D. P.; Lograsso, T. A.; Ross, A. R.; Smerdon, J. A.; Leung, L.; McGrath, R.
2010-11-01
Recent work on the growth of thin metal films on quasicrystalline substrates has indicated the formation of so-called “magic height” islands with multiples of 4 atomic layers (AL) arising as a result of quantum size effects, which lead to enhanced stability. Here the results of a study are reported of Bi deposition on i -Al-Pd-Mn using medium-energy ion scattering to characterize the island thickness and the structural arrangement of Bi atoms within the islands. In addition, data were taken from annealed surfaces after Bi cluster desorption to leave a single aperiodic monolayer of Bi at the surface. Scattered-ion energy spectra from the Bi islands are consistent with a single Bi monolayer covered with mainly 4 AL islands for both 1.8 and 3.2 monolayer equivalent coverages but with some occupation of 2 and 8 Al islands as well. The angular dependence of the scattered-ion intensity (“blocking curve”) from Bi has been compared with simulations for various models of both rhombohedral Bi and a distorted “black-phosphorus”-like structure. The data demonstrate bilayer formation within the Bi islands. In the case of the aperiodic Bi monolayer, the blocking curves from substrate scattering are found to be inconsistent with two high-symmetry sites on the quasicrystalline surface that theory indicates are energetically favorable but do not exclude the formation of pentagonal arrangements of Bi atoms as seen in other recent experimental work.
NASA Astrophysics Data System (ADS)
Lambrou, George I.; Chatziioannou, Aristotelis; Vlahopoulos, Spiros; Moschovi, Maria; Chrousos, George P.
Biological systems are dynamic and possess properties that depend on two key elements: initial conditions and the response of the system over time. Conceptualizing this on tumor models will influence conclusions drawn with regard to disease initiation and progression. Alterations in initial conditions dynamically reshape the properties of proliferating tumor cells. The present work aims to test the hypothesis of Wolfrom et al., that proliferation shows evidence for deterministic chaos in a manner such that subtle differences in the initial conditions give rise to non-linear response behavior of the system. Their hypothesis, tested on adherent Fao rat hepatoma cells, provides evidence that these cells manifest aperiodic oscillations in their proliferation rate. We have tested this hypothesis with some modifications to the proposed experimental setup. We have used the acute lymphoblastic leukemia cell line CCRF-CEM, as it provides an excellent substrate for modeling proliferation dynamics. Measurements were taken at time points varying from 24h to 48h, extending the assayed populations beyond that of previous published reports that dealt with the complex dynamic behavior of animal cell populations. We conducted flow cytometry studies to examine the apoptotic and necrotic rate of the system, as well as DNA content changes of the cells over time. The cells exhibited a proliferation rate of nonlinear nature, as this rate presented oscillatory behavior. The obtained data have been fit in known models of growth, such as logistic and Gompertzian growth.
Developmental weighting shifts for noise components of fricative-vowel syllables.
Nittrouer, S; Miller, M E
1997-07-01
Previous studies have convincingly shown that the weight assigned to vocalic formant transitions in decisions of fricative identity for fricative-vowel syllables decreases with development. Although these same studies suggested a developmental increase in the weight assigned to the noise spectrum, the role of the aperiodic-noise portions of the signals in these fricative decisions have not been as well-studied. The purpose of these experiments was to examine more closely developmental shifts in the weight assigned to the aperiodic-noise components of the signals in decisions of syllable-initial fricative identity. Two experiments used noises varying along continua from a clear /s/ percept to a clear /[symbol: see text]/ percept. In experiment 1, these noises were created by combining /s/ and /[symbol: see text]/ noises produced by a human vocal tract at different amplitude ratios, a process that resulted in stimuli differing primarily in the amplitude of a relatively low-frequency (roughly 2.2-kHz) peak. In experiment 2, noises that varied only in the amplitude of a similar low-frequency peak were created with a software synthesizer. Both experiments used synthetic /a/ and /u/ portions, and efforts were made to minimize possible contributions of vocalic formant transitions to fricative labeling. Children and adults labeled the resulting stimuli as /s/ vowel or /[symbol: see text]/ vowel. Combined results of the two experiments showed that children's responses were less influenced than those of adults by the amplitude of the low-frequency peak of fricative noises.
NASA Astrophysics Data System (ADS)
Colacchio, Giorgio
In the present paper, we investigate the chaotic implications of a seven-equation model of the business cycle. The main distinguishing features of the model are related to: (a) the role played by the bargaining power in the process of income redistribution; (b) the consideration of hysteresis effects on workers’ consumption demand; (c) the effect of public expenditure on labor productivity. In addition, the role played by the agents’ memory on the actual dynamics of the economic system, with particular regard to their learning-by-doing process, is particularly emphasized. Under all these assumptions, the system exhibits a rich and complex phenomenology, characterized by a number of transitions to chaos (in particular via sequences of period doubling bifurcations), aperiodic behavior, bistability, tristability, etc. We maintain that our analysis takes us another step forward in the building of a more general model of the business cycle. In particular, the model we propose may be of help in the explanation of some peculiar features of advanced capitalist economies, with particular regard to the role played by the State in the determination of agents’ disposable income, to the debt dynamics of the various macroagents, and to the main dilemmas of economic policy. More in general, the main lesson one learns from our investigation is that “disequilibrium paths”, characterized by “complicated” dynamics which, more often than not, takes the form of aperiodic motion, should be considered as the “normal” state of the system.
Marx, Michael Thomas; Guhmann, Patrick; Decker, Peter
2012-01-01
Simple Summary This review summarizes adaptations and predispositions of different arthropod taxa (springtails, web spiders, millipedes and centipedes) to flood and drought conditions. The main focus sis directed to arthropod species, which are living in Middle European floodplain forests and wetlands, because of the fast change of flood and drought conditions in these habitats. Furthermore the effects of the predicted regional climate change like increasing aperiodic summer flooding and decreasing winter and spring floods are also discussed. Abstract Floodplain forests and wetlands are amongst the most diverse and species rich habitats on earth. Arthropods are a key group for the high diversity pattern of these landscapes, due to the fact that the change between flooding and drought causes in different life cycles and in a variety of adaptations in the different taxa. The floodplain forests and wetlands of Central Amazonia are well investigated and over the last 50 years many adaptations of several hexapod, myriapod and arachnid orders were described. In contrast to Amazonia the Middle European floodplains were less investigated concerning the adaptations of arthropods to flood and drought conditions. This review summarizes the adaptations and predispositions of springtails, web spiders, millipedes and centipedes to the changeable flood and drought conditions of Middle European floodplain forests and wetlands. Furthermore the impact of regional climate change predictions like increasing aperiodic summer floods and the decrease of typical winter and spring floods are discussed in this article. PMID:26487164
Acoustic and Perceptual Analyses of Adductor Spasmodic Dysphonia in Mandarin-speaking Chinese.
Chen, Zhipeng; Li, Jingyuan; Ren, Qingyi; Ge, Pingjiang
2018-02-12
The objective of this study was to examine the perceptual structure and acoustic characteristics of speech of patients with adductor spasmodic dysphonia (ADSD) in Mandarin. Case-Control Study MATERIALS AND METHODS: For the estimation of dysphonia level, perceptual and acoustic analysis were used for patients with ADSD (N = 20) and the control group (N = 20) that are Mandarin-Chinese speakers. For both subgroups, a sustained vowel and connected speech samples were obtained. The difference of perceptual and acoustic parameters between the two subgroups was assessed and analyzed. For acoustic assessment, the percentage of phonatory breaks (PBs) of connected reading and the percentage of aperiodic segments and frequency shifts (FS) of vowel and reading in patients with ADSD were significantly worse than controls, the mean harmonics-to-noise ratio and the fundamental frequency standard deviation of vowel as well. For perceptual evaluation, the rating of speech and vowel in patients with ADSD are significantly higher than controls. The percentage of aberrant acoustic events (PB, frequency shift, and aperiodic segment) and the fundamental frequency standard deviation and mean harmonics-to-noise ratio were significantly correlated with the perceptual rating in the vowel and reading productions. The perceptual and acoustic parameters of connected vowel and reading in patients with ADSD are worse than those in normal controls, and could validly and reliably estimate dysphonia of ADSD in Mandarin-speaking Chinese. Copyright © 2017 The Voice Foundation. Published by Elsevier Inc. All rights reserved.
Donner, K; Hemilä, S
1996-01-01
Difference-of-Gaussians (DOG) models for the receptive fields of retinal ganglion cells accurately predict linear responses to both periodic stimuli (typically moving sinusoidal gratings) and aperiodic stimuli (typically circular fields presented as square-wave pulses). While the relation of spatial organization to retinal anatomy has received considerable attention, temporal characteristics have been only loosely connected to retinal physiology. Here we integrate realistic photoreceptor response waveforms into the DOG model to clarify how far a single set of physiological parameters predict temporal aspects of linear responses to both periodic and aperiodic stimuli. Traditional filter-cascade models provide a useful first-order approximation of the single-photon response in photoreceptors. The absolute time scale of these, plus a time for retinal transmission, here construed as a fixed delay, are obtained from flash/step data. Using these values, we find that the DOG model predicts the main features of both the amplitude and phase response of linear cat ganglion cells to sinusoidal flicker. Where the simplest model formulation fails, it serves to reveal additional mechanisms. Unforeseen facts are the attenuation of low temporal frequencies even in pure center-type responses, and the phase advance of the response relative to the stimulus at low frequencies. Neither can be explained by any experimentally documented cone response waveform, but both would be explained by signal differentiation, e.g. in the retinal transmission pathway, as demonstrated at least in turtle retina.
Ladder-structured photonic variable delay device
NASA Technical Reports Server (NTRS)
Yao, X. Steve (Inventor)
1998-01-01
An ladder-structured variable delay device for providing variable true time delay to multiple optical beams simultaneously. The device comprises multiple basic units stacked on top of each other resembling a ladder. Each basic unit comprises a polarization sensitive corner reflector formed by two polarization beamsplitters and a polarization rotator array placed parallel to the hypotenuse of the corner reflector. Controlling an array element of the polarization rotator array causes an optical beam passing through the array element to either go up to a basic unit above it or reflect back towards output. The beams going higher on the ladder experience longer optical path delay. Finally, the ladder-structured variable device can be cascaded with another multi-channel delay device to form a new device which combines the advantages of the two individual devices. This programmable optic device has the properties of high packing density, low loss, easy fabrication, and virtually infinite bandwidth. In addition, the delay is reversible so that the same delay device can be used for both antenna transmitting and receiving.
Tomperi, Jani; Leiviskä, Kauko
2018-06-01
Traditionally the modelling in an activated sludge process has been based on solely the process measurements, but as the interest to optically monitor wastewater samples to characterize the floc morphology has increased, in the recent years the results of image analyses have been more frequently utilized to predict the characteristics of wastewater. This study shows that the traditional process measurements or the automated optical monitoring variables by themselves are not capable of developing the best predictive models for the treated wastewater quality in a full-scale wastewater treatment plant, but utilizing these variables together the optimal models, which show the level and changes in the treated wastewater quality, are achieved. By this early warning, process operation can be optimized to avoid environmental damages and economic losses. The study also shows that specific optical monitoring variables are important in modelling a certain quality parameter, regardless of the other input variables available.
Community variability and ecological functioning: 40 years of change in the North Sea benthos.
Clare, D S; Robinson, L A; Frid, C L J
2015-06-01
Using established associations between species traits (life history, morphological and behavioural characteristics) and key ecological functions, we applied biological traits analysis (BTA) to investigate the consequences of 40 years of change in two North Sea benthic communities. Ecological functioning (trait composition) was found to be statistically indistinguishable across periods that differed significantly in taxonomic composition. A temporary alteration to functioning was, however, inferred at both sampling stations; coinciding with the North Sea regime shift of the 1980s. Trait composition recovered after 1 year at the station located inside the grounds of a trawl fishery, whereas the station located outside the main area of fishing activity underwent a six-year period of significantly altered, and temporally unstable, trait composition. A further alteration to functioning was inferred at the fished station, when the population of a newly established species rapidly increased in numbers. The results suggest that density compensation by characteristically similar (redundant) taxa acts to buffer changes to ecological functioning over time, but that functional stability is subject to aperiodic disruption due to substitutions of dissimilar taxa or uncompensated population fluctuations. The rate at which ecological functioning stabilises and recovers appears to be dependent on environmental context; e.g. disturbance regime. Copyright © 2015 Elsevier Ltd. All rights reserved.
On X-Ray Variability in Seyfert Galaxies
NASA Technical Reports Server (NTRS)
Turner, T. J.; George, I. M.; Nandra, K.; Turcan, D.
1999-01-01
This paper presents a quantification of the X-ray variability amplitude for 79 ASCA observations of 36 Seyfert 1 galaxies. We find that consideration of sources with the narrowest permitted lines in the optical band introduces scatter into the established correlation between X-ray variability and nuclear luminosity. Consideration of the X-ray spectral index and variability properties together shows distinct groupings in parameter space for broad and narrow-line Seyfert 1 galaxies, confirming previous studies. A strong correlation is found between hard X-ray variability and FWHM Hbeta. A range of nuclear mass and accretion rate across the Seyfert population can explain the differences observed in X-ray and optical properties. An attractive alternative model, which does not depend on any systematic difference in central mass, is that the circumnuclear gas of NLSy1s is different to BLSy1s in temperature, optical depth, density or geometry.
Schoellhamer, D.H.; Wright, S.A.; Bogen, J.; Fergus, T.; Walling, D.
2003-01-01
Optical sensors have been used to measure turbidity and suspended-sediment concentration by many marine and estuarine studies, and optical sensors can provide automated, continuous time series of suspended-sediment concentration and discharge in rivers. Three potential problems with using optical sensors are biological fouling, particle-size variability, and particle-reflectivity variability. Despite varying particle size, output from an optical backscatterance sensor in the Sacramento River at Freeport, California, USA, was calibrated successfully to discharge-weighted, cross-sectionally averaged suspended-sediment concentration, which was measured with the equal discharge-, or width-increment, methods and an isokinetic sampler. A correction for sensor drift was applied to the 3-year time series. However, the calibration of an optical backscatterance sensor used in the Colorado River at Cisco, Utah, USA, was affected by particle-size variability. The adjusted time series at Freeport was used to calculate hourly suspended-sediment discharge that compared well with daily values from a sediment station at Freeport. The appropriateness of using optical sensors in rivers should be evaluated on a site-specific basis and measurement objectives, potential particle size effects, and potential fouling should be considered.
The impact of large-scale, long-term optical surveys on pulsating star research
NASA Astrophysics Data System (ADS)
Soszyński, Igor
2017-09-01
The era of large-scale photometric variability surveys began a quarter of a century ago, when three microlensing projects - EROS, MACHO, and OGLE - started their operation. These surveys initiated a revolution in the field of variable stars and in the next years they inspired many new observational projects. Large-scale optical surveys multiplied the number of variable stars known in the Universe. The huge, homogeneous and complete catalogs of pulsating stars, such as Cepheids, RR Lyrae stars, or long-period variables, offer an unprecedented opportunity to calibrate and test the accuracy of various distance indicators, to trace the three-dimensional structure of the Milky Way and other galaxies, to discover exotic types of intrinsically variable stars, or to study previously unknown features and behaviors of pulsators. We present historical and recent findings on various types of pulsating stars obtained from the optical large-scale surveys, with particular emphasis on the OGLE project which currently offers the largest photometric database among surveys for stellar variability.
Time Resolved X-Ray Spectral Analysis of Class II YSOs in NGC 2264 During Optical Dips and Bursts
NASA Astrophysics Data System (ADS)
Guarcello, Mario Giuseppe; Flaccomio, Ettore; Micela, Giuseppina; Argiroffi, Costanza; Venuti, Laura
2016-07-01
Pre-Main Sequence stars are variable sources. The main mechanisms responsible for their variability are variable extinction, unsteady accretion, and rotational modulation of both hot and dark photospheric spots and X-ray active regions. In stars with disks this variability is thus related to the morphology of the inner circumstellar region (<0.1 AU) and that of photosphere and corona, all impossible to be spatially resolved with present day techniques. This has been the main motivations of the Coordinated Synoptic Investigation of NGC2264, a set of simultaneous observations of NGC2264 with 15 different telescopes.We analyze the X-ray spectral properties of stars with disks extracted during optical bursts and dips in order to unveil the nature of these phenomena. Stars are analyzed in two different samples. In stars with variable extinction a simultaneous increase of optical extinction and X-ray absorption is searched during the optical dips; in stars with accretion bursts we search for soft X-ray emission and increasing X-ray absorption during the bursts. In 9/33 stars with variable extinction we observe simultaneous increase of X-ray absorption and optical extinction. In seven dips it is possible to calculate the NH/AV ratio in order to infer the composition of the obscuring material. In 5/27 stars with optical accretion bursts, we observe soft X-ray emission during the bursts that we associate to the emission of accreting gas. It is not surprising that these properties are not observed in all the stars with dips and bursts since favorable geometric configurations are required. The observed variable absorption during the dips is mainly due to dust-free material in accretion streams. In stars with accretion bursts we observe in average a larger soft X-ray spectral component not observed in non accreting stars. This indicates that this soft X-ray emission arises from the accretion shocks.
NASA Astrophysics Data System (ADS)
Jinxia, Feng; Zhenju, Wan; Yuanji, Li; Kuanshou, Zhang
2018-01-01
Continuous variable quantum entanglement at a telecommunication wavelength of 1550 nm is experimentally generated using a single nondegenerate optical parametric amplifier based on a type-II periodically poled KTiOPO4 crystal. The triply resonant of the nondegenerate optical parametric amplifier is adjusted by tuning the crystal temperature and tilting the orientation of the crystal in the optical cavity. Einstein-Podolsky-Rosen-entangled beams with quantum correlations of 8.3 dB for both the amplitude and phase quadratures are experimentally generated. This system can be used for continuous variable fibre-based quantum communication.
Optical Variability of Narrow-line and Broad-line Seyfert 1 Galaxies
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rakshit, Suvendu; Stalin, C. S., E-mail: suvenduat@gmail.com
We studied the optical variability (OV) of a large sample of narrow-line Seyfert 1 (NLSy1) and broad-line Seyfert 1 (BLSy1) galaxies with z < 0.8 to investigate any differences in their OV properties. Using archival optical V -band light curves from the Catalina Real Time Transient Survey that span 5–9 years and modeling them using damped random walk, we estimated the amplitude of variability. We found that NLSy1 galaxies as a class show lower amplitude of variability than their broad-line counterparts. In the sample of both NLSy1 and BLSy1 galaxies, radio-loud sources are found to have higher variability amplitude thanmore » radio-quiet sources. Considering only sources that are detected in the X-ray band, NLSy1 galaxies are less optically variable than BLSy1 galaxies. The amplitude of variability in the sample of both NLSy1 and BLSy1 galaxies is found to be anti-correlated with Fe ii strength but correlated with the width of the H β line. The well-known anti-correlation of variability–luminosity and the variability–Eddington ratio is present in our data. Among the radio-loud sample, variability amplitude is found to be correlated with radio-loudness and radio-power, suggesting that jets also play an important role in the OV in radio-loud objects, in addition to the Eddington ratio, which is the main driving factor of OV in radio-quiet sources.« less
NASA Astrophysics Data System (ADS)
Ugryumova, Nadezhda; Gangnus, Sergei V.; Matcher, Stephen J.
2006-08-01
Polarization optical coherence tomography (PSOCT) is a powerful technique to nondestructively map the retardance and fast-axis orientation of birefringent biological tissues. Previous studies have concentrated on the case where the optic axis lies on the plane of the surface. We describe a method to determine the polar angle of the optic axis of a uniaxial birefringent tissue by making PSOCT measurements with a number of incident illumination directions. The method is validated on equine flexor tendon, yielding a variability of 4% for the true birefringence and 3% for the polar angle. We use the method to map the polar angle of fibers in the transitional region of equine cartilage.
Choi, Eunseo; Na, Jihoon; Ryu, Seon; Mudhana, Gopinath; Lee, Byeong
2005-02-21
We have implemented an all-fiber optical delay line using two linearly chirped fiber Bragg gratings cascaded in reverse order and all-fiber optics components. The features of the proposed all-fiber based technique for variable delay line are discussed theoretically and demonstrated experimentally. The non-invasive cross-sectional images of biomedical samples as well as a transparent glass plate obtained with implemented all-fiber delay line having the axial resolution of 100 mum and the dynamic range of 50dB are presented to validates the imaging performance and demonstrate the feasibility of the delay line for optical coherence tomography.
Method for using polarization gating to measure a scattering sample
Baba, Justin S.
2015-08-04
Described herein are systems, devices, and methods facilitating optical characterization of scattering samples. A polarized optical beam can be directed to pass through a sample to be tested. The optical beam exiting the sample can then be analyzed to determine its degree of polarization, from which other properties of the sample can be determined. In some cases, an apparatus can include a source of an optical beam, an input polarizer, a sample, an output polarizer, and a photodetector. In some cases, a signal from a photodetector can be processed through attenuation, variable offset, and variable gain.
USDA-ARS?s Scientific Manuscript database
Soil temperature (Ts) exerts critical controls on hydrologic and biogeochemical processes but magnitude and nature of Ts variability in a landscape setting are rarely documented. Fiber optic distributed temperature sensing systems (FO-DTS) potentially measure Ts at high density over a large extent. ...
Optimal Control for Aperiodic Dual-Rate Systems With Time-Varying Delays
Salt, Julián; Guinaldo, María; Chacón, Jesús
2018-01-01
In this work, we consider a dual-rate scenario with slow input and fast output. Our objective is the maximization of the decay rate of the system through the suitable choice of the n-input signals between two measures (periodic sampling) and their times of application. The optimization algorithm is extended for time-varying delays in order to make possible its implementation in networked control systems. We provide experimental results in an air levitation system to verify the validity of the algorithm in a real plant. PMID:29747441
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vdovin, S. A.; Shalimov, A. S.
2013-05-15
The use of the function of effective current braking of the longitudinal differential protection of shunt reactors to offset current surges, which enables the sensitivity of differential protection to be increased when there are short circuits with low damage currents, is considered. It is shown that the use of the calculated braking characteristic enables the reliability of offset protection from transients to be increased when the reactor is connected, which is accompanied by the flow of asymmetric currents containing an aperiodic component.
Diffusion Maps and Geometric Harmonics for Automatic Target Recognition (ATR). Volume 2. Appendices
2007-11-01
of the Perron - Frobenius theorem, it suffices to prove that the chain is irreducible and aperiodic. • The irreducibility is a mere consequence of the...of each atom; this is due to the linear programming constraint that the coefficients be nonnegative 4. Chen et al. [20, 21] describe two algorithms for...projection of x onto the convex cone spanned by Ψ(t) with the origin at the apex; we provide details on computing x̃(t) in Section 4.1.3. Let x̃ (t) H
Long, Jeffrey W
2007-09-01
Ultraporous aperiodic solids, such as aerogels and ambigels, are sol-gel-derived equivalents of architectures. The walls are defined by the nanoscopic, covalently bonded solid network of the gel. The vast open, interconnected space characteristic of a building is represented by the three-dimensionally continuous nanoscopic pore network. We discuss how an architectural construct serves as a powerful metaphor that guides the chemist in the design of aerogel-like nanoarchitectures and in their physical and chemical transformation into multifunctional objects that yield high performance for rate-critical applications.
NASA Astrophysics Data System (ADS)
Li, Husheng; Betz, Sharon M.; Poor, H. Vincent
2007-05-01
This paper examines the performance of decision feedback based iterative channel estimation and multiuser detection in channel coded aperiodic DS-CDMA systems operating over multipath fading channels. First, explicit expressions describing the performance of channel estimation and parallel interference cancellation based multiuser detection are developed. These results are then combined to characterize the evolution of the performance of a system that iterates among channel estimation, multiuser detection and channel decoding. Sufficient conditions for convergence of this system to a unique fixed point are developed.
A statistical physics viewpoint on the dynamics of the bouncing ball
NASA Astrophysics Data System (ADS)
Chastaing, Jean-Yonnel; Géminard, Jean-Christophe; Bertin, Eric
2016-06-01
We compute, in a statistical physics perspective, the dynamics of a bouncing ball maintained in a chaotic regime thanks to collisions with a plate experiencing an aperiodic vibration. We analyze in details the energy exchanges between the bead and the vibrating plate, and show that the coupling between the bead and the plate can be modeled in terms of both a dissipative process and an injection mechanism by an energy reservoir. An analysis of the injection statistics in terms of fluctuation relation is also provided.
Optimal Control for Aperiodic Dual-Rate Systems With Time-Varying Delays.
Aranda-Escolástico, Ernesto; Salt, Julián; Guinaldo, María; Chacón, Jesús; Dormido, Sebastián
2018-05-09
In this work, we consider a dual-rate scenario with slow input and fast output. Our objective is the maximization of the decay rate of the system through the suitable choice of the n -input signals between two measures (periodic sampling) and their times of application. The optimization algorithm is extended for time-varying delays in order to make possible its implementation in networked control systems. We provide experimental results in an air levitation system to verify the validity of the algorithm in a real plant.
Nanostructured MnO2 as Electrode Materials for Energy Storage
Mauger, Alain
2017-01-01
Manganese dioxides, inorganic materials which have been used in industry for more than a century, now find great renewal of interest for storage and conversion of energy applications. In this review article, we report the properties of MnO2 nanomaterials with different morphologies. Techniques used for the synthesis, structural, physical properties, and electrochemical performances of periodic and aperiodic frameworks are discussed. The effect of the morphology of nanosized MnO2 particles on their fundamental features is evidenced. Applications as electrodes in lithium batteries and supercapacitors are examined. PMID:29149066
[The ways in which variations in space and atmospheric factors act upon the biosphere and humans].
Chernogor, L F
2010-01-01
The system analysis is validated to be an efficient means for studying the channels through which variations in space and tropospheric weather affect the biosphere (humans). The basics of the system analysis paradigm are presented. The causes of variations in space and tropospheric weather are determined, and the interrelations between them are demonstrated. The ways in which these variations affect the biosphere (humans) are discussed. Aperiodic and quasi-periodic disturbances in the physical fields that influence the biosphere (humans) are intercompared.
Optimization of an Offset Receiver Optics for Radio Telescopes
NASA Astrophysics Data System (ADS)
Yeap, Kim Ho; Tham, Choy Yoong
2018-01-01
The latest generation of Cassegrain radio astronomy antennas is designed for multiple frequency bands with receivers for individual bands offset from the antenna axis. The offset feed arrangement typically has two focusing elements in the form of ellipsoidal mirrors in the optical path between the feed horn and the antenna focus. This arrangement aligns the beam from the offset feed horn to illuminate the subreflector. The additional focusing elements increase the number of design variables, namely the distances between the horn aperture and the first mirror and that between the two mirrors, and their focal lengths. There are a huge number of possible combinations of these four variables in which the optics system can take on. The design aim is to seek the combination that will give the optimum antenna efficiency, not only at the centre frequency of the particular band but also across its bandwidth. To pick the optimum combination of the variables, it requires working through, by computational mean, a continuum range of variable values at different frequencies which will fit the optics system within the allocated physical space. Physical optics (PO) is a common technique used in optics design. However, due to the repeated iteration of the huge number of computation involved, the use of PO is not feasible. We present a procedure based on using multimode Gaussian optics to pick the optimum design and using PO for final verification of the system performance. The best antenna efficiency is achieved when the beam illuminating the subreflector is truncated with the optimum edge taper. The optimization procedure uses the beam's edge taper at the subreflector as the iteration target. The band 6 receiver optics design for the Atacama Large Millimetre Array (ALMA) antenna is used to illustrate the optimization procedure.
NASA Astrophysics Data System (ADS)
Chai, Jun; Tian, Bo; Chai, Han-Peng
2018-02-01
Investigation in this paper is given to the reduced Maxwell-Bloch equations with variable coefficients, describing the propagation of the intense ultra-short optical pulses through an inhomogeneous two-level dielectric medium. We apply the Hirota method and symbolic computation to study such equations. With the help of the dependent variable transformations, we present the variable-coefficient-dependent bilinear forms. Then, we construct the one-, two- and N-soliton solutions in analytic forms for them. Supported by the National Natural Science Foundation of China under Grant Nos. 11772017, 11272023, 11471050, the Fund of State Key Laboratory of Information Photonics and Optical Communications (Beijing University of Posts and Telecommunications), China (IPOC: 2017ZZ05), and the Fundamental Research Funds for the Central Universities of China under Grant No. 2011BUPTYB02
NASA Technical Reports Server (NTRS)
Drechsel, H. (Editor); Rahe, J. (Editor); Kondo, Y. (Editor)
1987-01-01
Papers are presented on the formation and evolution of low-mass close binaries with compact components, the periods of cataclysmic variables, multiwavelength observations of dwarf novae during outbursts, and radio emission from cataclysmic variables. Also considered are long-term optical photometry of the dwarf nova VW Hyi, periodic modulations in the optical light curves of EX Hydrae, and Echelle-Mepsicron time-resolved spectroscopy of the dwarf nova SS Cygni. Other topics include UV and X-ray observations of cataclysmic variables, new EXOSAT observations of TV Columbae, accretion disk evolution, and the boundary layer in cataclysmic variables.
A link between prompt optical and prompt gamma-ray emission in gamma-ray bursts.
Vestrand, W T; Wozniak, P R; Wren, J A; Fenimore, E E; Sakamoto, T; White, R R; Casperson, D; Davis, H; Evans, S; Galassi, M; McGowan, K E; Schier, J A; Asa, J W; Barthelmy, S D; Cummings, J R; Gehrels, N; Hullinger, D; Krimm, H A; Markwardt, C B; McLean, K; Palmer, D; Parsons, A; Tueller, J
2005-05-12
The prompt optical emission that arrives with the gamma-rays from a cosmic gamma-ray burst (GRB) is a signature of the engine powering the burst, the properties of the ultra-relativistic ejecta of the explosion, and the ejecta's interactions with the surroundings. Until now, only GRB 990123 had been detected at optical wavelengths during the burst phase. Its prompt optical emission was variable and uncorrelated with the prompt gamma-ray emission, suggesting that the optical emission was generated by a reverse shock arising from the ejecta's collision with surrounding material. Here we report prompt optical emission from GRB 041219a. It is variable and correlated with the prompt gamma-rays, indicating a common origin for the optical light and the gamma-rays. Within the context of the standard fireball model of GRBs, we attribute this new optical component to internal shocks driven into the burst ejecta by variations of the inner engine. The correlated optical emission is a direct probe of the jet isolated from the medium. The timing of the uncorrelated optical emission is strongly dependent on the nature of the medium.
Scales of variability of bio-optical properties as observed from near-surface drifters
NASA Technical Reports Server (NTRS)
Abbott, Mark R.; Brink, Kenneth H.; Booth, C. R.; Blasco, Dolors; Swenson, Mark S.; Davis, Curtiss O.; Codispoti, L. A.
1995-01-01
A drifter equipped with bio-optical sensors and an automated water sampler was deployed in the California Current as part of the coastal transition zone program to study the biological, chemical, and physical dynamics of the meandering filaments. During deployments in 1987 and 1988, measurements were made of fluorescence, downwelling irradiance, upwelling radiance, and beam attenuation using several bio-optical sensors. Samples were collected by an automated sampler for later analysis of nutrients and phytoplankton species compositon. Large-scale spatial and temporal changes in the bio-optical and biological properties of the region were driven by changes in phytoplankton species composition which, in turn, were associated with the meandering circulation. Variance spectra of the bio-optical paramenters revealed fluctuations on both diel and semidiurnal scales, perhaps associated with solar variations and internal tides, respectively. Offshore, inertial-scale fluctuations were apparent in the variance spectra of temperature, fluorescence, and beam attenuation. Although calibration samples can help remove some of these variations, these results suggest that the use of bio-optical data from unattended platforms such as moorings and drifters must be analyzed carefully. Characterization of the scaled of phytoplankton variability must account for the scales of variability in the algorithms used to convert bio-optical measurments into biological quantities.
Vassilev, Angel; Murzac, Adrian; Zlatkova, Margarita B; Anderson, Roger S
2009-03-01
Weber contrast, DeltaL/L, is a widely used contrast metric for aperiodic stimuli. Zele, Cao & Pokorny [Zele, A. J., Cao, D., & Pokorny, J. (2007). Threshold units: A correct metric for reaction time? Vision Research, 47, 608-611] found that neither Weber contrast nor its transform to detection-threshold units equates human reaction times in response to luminance increments and decrements under selective rod stimulation. Here we show that their rod reaction times are equated when plotted against the spatial luminance ratio between the stimulus and its background (L(max)/L(min), the larger and smaller of background and stimulus luminances). Similarly, reaction times to parafoveal S-cone selective increments and decrements from our previous studies [Murzac, A. (2004). A comparative study of the temporal characteristics of processing of S-cone incremental and decremental signals. PhD thesis, New Bulgarian University, Sofia, Murzac, A., & Vassilev, A. (2004). Reaction time to S-cone increments and decrements. In: 7th European conference on visual perception, Budapest, August 22-26. Perception, 33, 180 (Abstract).], are better described by the spatial luminance ratio than by Weber contrast. We assume that the type of stimulus detection by temporal (successive) luminance discrimination, by spatial (simultaneous) luminance discrimination or by both [Sperling, G., & Sondhi, M. M. (1968). Model for visual luminance discrimination and flicker detection. Journal of the Optical Society of America, 58, 1133-1145.] determines the appropriateness of one or other contrast metric for reaction time.
A liquid lens switching-based motionless variable fiber-optic delay line
NASA Astrophysics Data System (ADS)
Khwaja, Tariq Shamim; Reza, Syed Azer; Sheikh, Mumtaz
2018-05-01
We present a Variable Fiber-Optic Delay Line (VFODL) module capable of imparting long variable delays by switching an input optical/RF signal between Single Mode Fiber (SMF) patch cords of different lengths through a pair of Electronically Controlled Tunable Lenses (ECTLs) resulting in a polarization-independent operation. Depending on intended application, the lengths of the SMFs can be chosen accordingly to achieve the desired VFODL operation dynamic range. If so desired, the state of the input signal polarization can be preserved with the use of commercially available polarization-independent ECTLs along with polarization-maintaining SMFs (PM-SMFs), resulting in an output polarization that is identical to the input. An ECTL-based design also improves power consumption and repeatability. The delay switching mechanism is electronically-controlled, involves no bulk moving parts, and can be fully-automated. The VFODL module is compact due to the use of small optical components and SMFs that can be packaged compactly.
Optical Variability of Two High-Luminosity Radio-Quiet Quasars, PDS 456 and PHL 1811
NASA Astrophysics Data System (ADS)
Gaskell, C. M.; Benker, A. J.; Campbell, J. S.; Crowley, K. A.; George, T. A.; Hedrick, C. H.; Hiller, M. E.; Klimek, E. S.; Leonard, J. P.; Peterson, B. W.; Sanders, K. M.
2003-12-01
PDS 456 and PHL 1811 are two of the highest luminosity low-redshift quasars. Both have optical luminosities comparable to 3C 273, but they have low radio luminosities. PDS 456 is a broad line object but PHL 1811 could be classified as a high-luminosity Narrow-Line Seyfert 1 (NLS1) object. We present the results of optical (V-band) continuum monitoring of PDS 456 and PHL 1811. We compare the variability properties of these two very different AGNs compared with the radio-loud AGN 3C 273, and we discuss the implications for the origin of the optical continuum variability in AGNs. This research has been supported in part by the Howard Hughes Foundation, Nebraska EPSCoR, the University of Nebraska Layman Fund, the University of Nebraska Undergraduate Creative Activities and Research Experiences, Pepsi-Cola, and the National Science Foundation through grant AST 03-07912.
Remote creation of hybrid entanglement between particle-like and wave-like optical qubits
NASA Astrophysics Data System (ADS)
Morin, Olivier; Huang, Kun; Liu, Jianli; Le Jeannic, Hanna; Fabre, Claude; Laurat, Julien
2014-07-01
The wave-particle duality of light has led to two different encodings for optical quantum information processing. Several approaches have emerged based either on particle-like discrete-variable states (that is, finite-dimensional quantum systems) or on wave-like continuous-variable states (that is, infinite-dimensional systems). Here, we demonstrate the generation of entanglement between optical qubits of these different types, located at distant places and connected by a lossy channel. Such hybrid entanglement, which is a key resource for a variety of recently proposed schemes, including quantum cryptography and computing, enables information to be converted from one Hilbert space to the other via teleportation and therefore the connection of remote quantum processors based upon different encodings. Beyond its fundamental significance for the exploration of entanglement and its possible instantiations, our optical circuit holds promise for implementations of heterogeneous network, where discrete- and continuous-variable operations and techniques can be efficiently combined.
Teleportation of Two-Mode Quantum State of Continuous Variables
NASA Astrophysics Data System (ADS)
Song, Tong-Qiang
2004-03-01
Using two Einstein-Podolsky-Rosen pair eigenstates |η> as quantum channels, we study the teleportation of two-mode quantum state of continuous variables. The project supported by Natural Science Foundation of Zhejiang Province of China and Open Foundation of Laboratory of High-Intensity Optics, Shanghai Institute of Optics and Fine Mechanics
Simple and practical approach for computing the ray Hessian matrix in geometrical optics.
Lin, Psang Dain
2018-02-01
A method is proposed for simplifying the computation of the ray Hessian matrix in geometrical optics by replacing the angular variables in the system variable vector with their equivalent cosine and sine functions. The variable vector of a boundary surface is similarly defined in such a way as to exclude any angular variables. It is shown that the proposed formulations reduce the computation time of the Hessian matrix by around 10 times compared to the previous method reported by the current group in Advanced Geometrical Optics (2016). Notably, the method proposed in this study involves only polynomial differentiation, i.e., trigonometric function calls are not required. As a consequence, the computation complexity is significantly reduced. Five illustrative examples are given. The first three examples show that the proposed method is applicable to the determination of the Hessian matrix for any pose matrix, irrespective of the order in which the rotation and translation motions are specified. The last two examples demonstrate the use of the proposed Hessian matrix in determining the axial and lateral chromatic aberrations of a typical optical system.
Optofluidic waveguide as a transformation optics device for lightwave bending and manipulation.
Yang, Y; Liu, A Q; Chin, L K; Zhang, X M; Tsai, D P; Lin, C L; Lu, C; Wang, G P; Zheludev, N I
2012-01-31
Transformation optics represents a new paradigm for designing light-manipulating devices, such as cloaks and field concentrators, through the engineering of electromagnetic space using materials with spatially variable parameters. Here we analyse liquid flowing in an optofluidic waveguide as a new type of controllable transformation optics medium. We show that a laminar liquid flow in an optofluidic channel exhibits spatially variable dielectric properties that support novel wave-focussing and interference phenomena, which are distinctively different from the discrete diffraction observed in solid waveguide arrays. Our work provides new insight into the unique optical properties of optofluidic waveguides and their potential applications.
Wavelength tunable and broadband variable fiber-optic attenuators using liquid crystals
NASA Astrophysics Data System (ADS)
Khan, Sajjad A.; Riza, Nabeel A.
2005-05-01
Fiber-Optic Variable Optical Attenuators (VOAs) are demonstrated using Liquid Crystals (LC) for broadband as well as wavelength tunable applications. Attenuation is achieved by using a beam spoiling approach implemented via electrically reconfigurable non-pixelated no moving parts Nematic LC deflectors. The VOAs feature in-line architecture and polarization insensitive design without the use of bulky polarization splitting and combining optics. The proof-of-concept VOAs in the 1550 nm band demonstrate >30 dB attenuation ranges, low polarization dependent losses and low power consumption. Applications for these VOAs include agile wavelength tunable secure data communications networks and RF sensor systems.
Development of variable-magnification X-ray Bragg optics.
Hirano, Keiichi; Yamashita, Yoshiki; Takahashi, Yumiko; Sugiyama, Hiroshi
2015-07-01
A novel X-ray Bragg optics is proposed for variable-magnification of an X-ray beam. This X-ray Bragg optics is composed of two magnifiers in a crossed arrangement, and the magnification factor, M, is controlled through the azimuth angle of each magnifier. The basic properties of the X-ray optics such as the magnification factor, image transformation matrix and intrinsic acceptance angle are described based on the dynamical theory of X-ray diffraction. The feasibility of the variable-magnification X-ray Bragg optics was verified at the vertical-wiggler beamline BL-14B of the Photon Factory. For X-ray Bragg magnifiers, Si(220) crystals with an asymmetric angle of 14° were used. The magnification factor was calculated to be tunable between 0.1 and 10.0 at a wavelength of 0.112 nm. At various magnification factors (M ≥ 1.0), X-ray images of a nylon mesh were observed with an air-cooled X-ray CCD camera. Image deformation caused by the optics could be corrected by using a 2 × 2 transformation matrix and bilinear interpolation method. Not only absorption-contrast but also edge-contrast due to Fresnel diffraction was observed in the magnified images.
Multiwavelength variability properties of Fermi blazar S5 0716+714
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liao, N. H.; Bai, J. M.; Liu, H. T.
S5 0716+714 is a typical BL Lacertae object. In this paper we present the analysis and results of long-term simultaneous observations in the radio, near-infrared, optical, X-ray, and γ-ray bands, together with our own photometric observations for this source. The light curves show that the variability amplitudes in γ-ray and optical bands are larger than those in the hard X-ray and radio bands and that the spectral energy distribution (SED) peaks move to shorter wavelengths when the source becomes brighter, which is similar to other blazars, i.e., more variable at wavelengths shorter than the SED peak frequencies. Analysis shows thatmore » the characteristic variability timescales in the 14.5 GHz, the optical, the X-ray, and the γ-ray bands are comparable to each other. The variations of the hard X-ray and 14.5 GHz emissions are correlated with zero lag, and so are the V band and γ-ray variations, which are consistent with the leptonic models. Coincidences of γ-ray and optical flares with a dramatic change of the optical polarization are detected. Hadronic models do not have the same natural explanation for these observations as the leptonic models. A strong optical flare correlating a γ-ray flare whose peak flux is lower than the average flux is detected. The leptonic model can explain this variability phenomenon through simultaneous SED modeling. Different leptonic models are distinguished by average SED modeling. The synchrotron plus synchrotron self-Compton (SSC) model is ruled out because of the extreme input parameters. Scattering of external seed photons, such as the hot-dust or broad-line region emission, and the SSC process are probably both needed to explain the γ-ray emission of S5 0716+714.« less
Solar Cycle Variability and Surface Differential Rotation from Ca II K-line Time Series Data
NASA Astrophysics Data System (ADS)
Scargle, Jeffrey D.; Keil, Stephen L.; Worden, Simon P.
2013-07-01
Analysis of over 36 yr of time series data from the NSO/AFRL/Sac Peak K-line monitoring program elucidates 5 components of the variation of the 7 measured chromospheric parameters: (a) the solar cycle (period ~ 11 yr), (b) quasi-periodic variations (periods ~ 100 days), (c) a broadband stochastic process (wide range of periods), (d) rotational modulation, and (e) random observational errors, independent of (a)-(d). Correlation and power spectrum analyses elucidate periodic and aperiodic variation of these parameters. Time-frequency analysis illuminates periodic and quasi-periodic signals, details of frequency modulation due to differential rotation, and in particular elucidates the rather complex harmonic structure (a) and (b) at timescales in the range ~0.1-10 yr. These results using only full-disk data suggest that similar analyses will be useful for detecting and characterizing differential rotation in stars from stellar light curves such as those being produced by NASA's Kepler observatory. Component (c) consists of variations over a range of timescales, in the manner of a 1/f random process with a power-law slope index that varies in a systematic way. A time-dependent Wilson-Bappu effect appears to be present in the solar cycle variations (a), but not in the more rapid variations of the stochastic process (c). Component (d) characterizes differential rotation of the active regions. Component (e) is of course not characteristic of solar variability, but the fact that the observational errors are quite small greatly facilitates the analysis of the other components. The data analyzed in this paper can be found at the National Solar Observatory Web site http://nsosp.nso.edu/cak_mon/, or by file transfer protocol at ftp://ftp.nso.edu/idl/cak.parameters.
SOLAR CYCLE VARIABILITY AND SURFACE DIFFERENTIAL ROTATION FROM Ca II K-LINE TIME SERIES DATA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Scargle, Jeffrey D.; Worden, Simon P.; Keil, Stephen L.
Analysis of over 36 yr of time series data from the NSO/AFRL/Sac Peak K-line monitoring program elucidates 5 components of the variation of the 7 measured chromospheric parameters: (a) the solar cycle (period {approx} 11 yr), (b) quasi-periodic variations (periods {approx} 100 days), (c) a broadband stochastic process (wide range of periods), (d) rotational modulation, and (e) random observational errors, independent of (a)-(d). Correlation and power spectrum analyses elucidate periodic and aperiodic variation of these parameters. Time-frequency analysis illuminates periodic and quasi-periodic signals, details of frequency modulation due to differential rotation, and in particular elucidates the rather complex harmonic structuremore » (a) and (b) at timescales in the range {approx}0.1-10 yr. These results using only full-disk data suggest that similar analyses will be useful for detecting and characterizing differential rotation in stars from stellar light curves such as those being produced by NASA's Kepler observatory. Component (c) consists of variations over a range of timescales, in the manner of a 1/f random process with a power-law slope index that varies in a systematic way. A time-dependent Wilson-Bappu effect appears to be present in the solar cycle variations (a), but not in the more rapid variations of the stochastic process (c). Component (d) characterizes differential rotation of the active regions. Component (e) is of course not characteristic of solar variability, but the fact that the observational errors are quite small greatly facilitates the analysis of the other components. The data analyzed in this paper can be found at the National Solar Observatory Web site http://nsosp.nso.edu/cak{sub m}on/, or by file transfer protocol at ftp://ftp.nso.edu/idl/cak.parameters.« less
NASA Technical Reports Server (NTRS)
Scargle, Jeffrey D.; Keil, Stephen L.; Worden, Simon P.
2014-01-01
Analysis of more than 36 years of time series of seven parameters measured in the NSO/AFRL/Sac Peak K-line monitoring program elucidates five elucidates five components of the variation: (1) the solar cycle (period approx. 11 years), (2) quasi-periodic variations (periods approx 100 days), (3) a broad band stochastic process (wide range of periods), (4) rotational modulation, and (5) random observational errors. Correlation and power spectrum analyses elucidate periodic and aperiodic variation of the chromospheric parameters. Time-frequency analysis illuminates periodic and quasi periodic signals, details of frequency modulation due to differential rotation, and in particular elucidates the rather complex harmonic structure (1) and (2) at time scales in the range approx 0.1 - 10 years. These results using only full-disk data further suggest that similar analyses will be useful at detecting and characterizing differential rotation in stars from stellar light-curves such as those being produced by NASA's Kepler observatory. Component (3) consists of variations over a range of timescales, in the manner of a 1/f random noise process. A timedependent Wilson-Bappu effect appears to be present in the solar cycle variations (1), but not in the stochastic process (3). Component (4) characterizes differential rotation of the active regions, and (5) is of course not characteristic of solar variability, but the fact that the observational errors are quite small greatly facilitates the analysis of the other components. The recent data suggest that the current cycle is starting late and may be relatively weak. The data analyzed in this paper can be found at the National Solar Observatory web site http://nsosp.nso.edu/cak_mon/, or by file transfer protocol at ftp://ftp.nso.edu/idl/cak.parameters.
NEUTRON STAR RADIUS MEASUREMENT WITH THE QUIESCENT LOW-MASS X-RAY BINARY U24 IN NGC 6397
DOE Office of Scientific and Technical Information (OSTI.GOV)
Guillot, Sebastien; Rutledge, Robert E.; Brown, Edward F., E-mail: guillots@physics.mcgill.ca, E-mail: rutledge@physics.mcgill.ca
This paper reports the spectral and timing analyses of the quiescent low-mass X-ray binary (qLMXB) U24 observed during five archived Chandra/ACIS exposures of the nearby globular cluster NGC 6397, for a total of 350 ks. We find that the X-ray flux and the parameters of the hydrogen atmosphere spectral model are consistent with those previously published for this source. On short timescales, we find no evidence of aperiodic intensity variability, with 90% confidence upper limits during five observations ranging between <8.6% rms and <19% rms, in the 0.0001-0.1 Hz frequency range (0.5-8.0 keV); and no evidence of periodic variability, withmore » maximum observed powers in this frequency range having a chance probability of occurrence from a Poisson-deviated light curve in excess of 10%. We also report the improved neutron star (NS) physical radius measurement, with statistical accuracy of the order of {approx}10%: R{sub NS} = 8.9{sup +0.9}{sub -0.6} km for M{sub NS} = 1.4 M{sub sun}. Alternatively, we provide the confidence regions in mass-radius space as well as the best-fit projected radius R{sub {infinity}} = 11.9{sup +1.0}{sub -0.8} km, as seen by an observer at infinity. The best-fit effective temperature, kT{sub eff} = 80{sup +4}{sub -5} eV, is used to estimate the NS core temperature which falls in the range T{sub core} = (3.0-9.8) x 10{sup 7} K, depending on the atmosphere model considered. This makes U24 the third most precisely measured NS radius among qLMXBs, after those in {omega} Cen and M13.« less
Perceptual structure of adductor spasmodic dysphonia and its acoustic correlates.
Cannito, Michael P; Doiuchi, Maki; Murry, Thomas; Woodson, Gayle E
2012-11-01
To examine the perceptual structure of voice attributes in adductor spasmodic dysphonia (ADSD) before and after botulinum toxin treatment and identify acoustic correlates of underlying perceptual factors. Reliability of perceptual judgments is considered in detail. Pre- and posttreatment trial with comparison to healthy controls, using single-blind randomized listener judgments of voice qualities, as well as retrospective comparison with acoustic measurements. Oral readings were recorded from 42 ADSD speakers before and after treatment as well as from their age- and sex-matched controls. Experienced judges listened to speech samples and rated attributes of overall voice quality, breathiness, roughness, and brokenness, using computer-implemented visual analog scaling. Data were adjusted for regression to the mean and submitted to principal components factor analysis. Acoustic waveforms, extracted from the reading samples, were analyzed and measurements correlated with perceptual factor scores. Four reliable perceptual variables of ADSD voice were effectively reduced to two underlying factors that corresponded to hyperadduction, most strongly associated with roughness, and hypoadduction, most strongly associated with breathiness. After treatment, the hyperadduction factor improved, whereas the hypoadduction factor worsened. Statistically significant (P<0.01) correlations were observed between perceived roughness and four acoustic measures, whereas breathiness correlated with aperiodicity and cepstral peak prominence (CPPs). This study supported a two-factor model of ADSD, suggesting perceptual characterization by both hyperadduction and hypoadduction before and after treatment. Responses of the factors to treatment were consistent with previous research. Correlations among perceptual and acoustic variables suggested that multiple acoustic features contributed to the overall impression of roughness. Although CPPs appears to be a partial correlate of perceived breathiness, a physical basis of this percept remained less clear. Copyright © 2012 The Voice Foundation. Published by Mosby, Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wu Xuebing; Wang Ran; Bian Fuyan
2011-09-15
The identification of quasars in the redshift range 2.2 < z < 3 is known to be very inefficient because the optical colors of such quasars are indistinguishable from those of stars. Recent studies have proposed using optical variability or near-infrared (near-IR) colors to improve the identification of the missing quasars in this redshift range. Here we present a case study combining both methods. We select a sample of 70 quasar candidates from variables in Sloan Digital Sky Survey (SDSS) Stripe 82, which are non-ultraviolet excess sources and have UKIDSS near-IR public data. They are clearly separated into two partsmore » on the Y - K/g - z color-color diagram, and 59 of them meet or lie close to a newly proposed Y - K/g - z selection criterion for z < 4 quasars. Of these 59 sources, 44 were previously identified as quasars in SDSS DR7, and 35 of them are quasars at 2.2 < z < 3. We present spectroscopic observations of 14 of 15 remaining quasar candidates using the Bok 2.3 m telescope and the MMT 6.5 m telescope, and successfully identify all of them as new quasars at z = 2.36-2.88. We also apply this method to a sample of 643 variable quasar candidates with SDSS-UKIDSS nine-band photometric data selected from 1875 new quasar candidates in SDSS Stripe 82 given by Butler and Bloom based on the time-series selections, and find that 188 of them are probably new quasars with photometric redshifts at 2.2 < z < 3. Our results indicate that the combination of optical variability and optical/near-IR colors is probably the most efficient way to find 2.2 < z < 3 quasars and is very helpful for constructing a complete quasar sample. We discuss its implications for ongoing and upcoming large optical and near-IR sky surveys.« less
Irregular Variability In Kepler Photometry
NASA Astrophysics Data System (ADS)
Schlecker, Martin
2016-12-01
The transit method is the most successful tool for exoplanet discovery to date. With more than half of all known exoplanets discovered by Kepler using this method, the mission also revealed a number of objects with dimming events that defy the common explanations, the most prominent being KIC 8462852 aka ``Tabby's star''. I embarked on a search for objects with such irregular transit signatures in the data of K2, the two-wheeled successor mission of Kepler. My method is a combination of automated pre-selection of targets showing downward flux excursions and visual light curve inspection of the selected subset comprising about SI{1.5}% of the initial sample. In addition, I developed a tool to constrain the effective temperature of a planet-hosting star from photometry alone. This software finds broad application in any science case where a photometric spectral type estimate is necessary. I used existing transit models and Bayesian inference to perform a Markov Chain Monte Carlo (MCMC) analysis of a planetary candidate I discovered. This putative gas giant is in a SI{1.32}day circular orbit with an exceptionally tight orbital radius of a ≈ 0.012 AU. My analysis revealed a scaled planetary radius of R_{p}/R_star = 0.0927±0.0026 and an edge-on orientation with an inclination i=89.8+3.0-3.4. EPIC 217393088.01 is one of the closest-orbiting exoplanets ever detected and the first giant planet with such a small orbital radius. An additional major finding of my search is EPIC 220262993, which exhibits aperiodic, asymmetric dips in flux with rapid dimming rates and up to SI{˜25}% depth, lasting for SIrange{2}{4} day. In previous works based on optical and mid-infrared photometry, this object was inconsistently classified as a possible quasar or a white dwarf. We conducted follow-up observations both photometrically with GROND on the MPI/ESO SI{2.2} meter telescope in La Silla (Chile) and spectroscopically with FIRE on the Magellan/Baade SI{6.5} meter telescope. With additional spectroscopy using ESI on the Keck rom{2} SI{10} meter telescope we were able to distinguish between these cases: EPIC 220262993 is a quasar with redshift z=1.42. This is the only known exemplar showing deep dips in flux on such a short time scale.
Kobashi, Hidenaga; Kamiya, Kazutaka; Yanome, Kyohei; Igarashi, Akihito; Shimizu, Kimiya
2013-01-01
To assess the longitudinal changes in optical quality including intraocular scattering in normal eyes and eyes with short tear breakup time (TBUT). We prospectively examined twenty eyes of 20 healthy subjects, and age-matched twenty eyes of 20 short TBUT subjects. The modulation transfer function (MTF) cutoff frequency, the Strehl ratio, and the objective scattering index (OSI) were quantitatively assessed using an Optical Quality Analysis System. We investigated the changes in these variables measured consecutively at the initial examination, 5, and 10 seconds without blinking. We also compared these variables in eyes with short TBUT with those in normal eyes. No significant differences in the MTF cutoff frequency, Strehl ratio, or OSI were detected over a 10-second period in normal eyes. These variables also became significantly degraded even over a 5-second period in eyes with short TBUT (p<0.01). We found significant differences in these variables at 5 and 10 seconds (p<0.05), but none immediately after the blink between normal and short TBUT eyes. Optical quality including intraocular scattering deteriorated significantly with time in eyes with short TBUT, whereas we found significant differences over a 10-second period in normal eyes. Eyes with short TBUT showed greater deterioration in optical quality after the blink than normal eyes. The longitudinal assessment of optical quality may be effective in distinguishing eyes with short TBUT from normal eyes.
Directed nucleation assembly of DNA tile complexes for barcode-patterned lattices
Yan, Hao; LaBean, Thomas H.; Feng, Liping; Reif, John H.
2003-01-01
The programmed self-assembly of patterned aperiodic molecular structures is a major challenge in nanotechnology and has numerous potential applications for nanofabrication of complex structures and useful devices. Here we report the construction of an aperiodic patterned DNA lattice (barcode lattice) by a self-assembly process of directed nucleation of DNA tiles around a scaffold DNA strand. The input DNA scaffold strand, constructed by ligation of shorter synthetic oligonucleotides, provides layers of the DNA lattice with barcode patterning information represented by the presence or absence of DNA hairpin loops protruding out of the lattice plane. Self-assembly of multiple DNA tiles around the scaffold strand was shown to result in a patterned lattice containing barcode information of 01101. We have also demonstrated the reprogramming of the system to another patterning. An inverted barcode pattern of 10010 was achieved by modifying the scaffold strands and one of the strands composing each tile. A ribbon lattice, consisting of repetitions of the barcode pattern with expected periodicity, was also constructed by the addition of sticky ends. The patterning of both classes of lattices was clearly observable via atomic force microscopy. These results represent a step toward implementation of a visual readout system capable of converting information encoded on a 1D DNA strand into a 2D form readable by advanced microscopic techniques. A functioning visual output method would not only increase the readout speed of DNA-based computers, but may also find use in other sequence identification techniques such as mutation or allele mapping. PMID:12821776
A record of large earthquakes on the southern Hayward fault for the past 1800 years
Lienkaemper, J.J.; Williams, P.L.
2007-01-01
This is the second article presenting evidence of the occurrence and timing of paleoearthquakes on the southern Hayward fault as interpreted from trenches excavated within a sag pond at the Tyson's Lagoon site in Fremont, California. We use the information to estimate the mean value and aperiodicity of the fault's recurrence interval (RI): two fundamental parameters for estimation of regional seismic hazard. An earlier article documented the four most recent earthquakes, including the historic 1868 earthquake. In this article we present evidence for at least seven earlier paleoruptures since about A.D. 170. We document these events with evidence for ground rupture, such as the presence of blocky colluvium at the base of the main trace fault scarp, and by corroborating evidence such as simultaneous liquefaction or an increase in deformation immediately below event horizons. The mean RI is 170 ?? 82 yr (1??, standard deviation of the sample), aperiodicity is 0.48, and individual intervals may be expected to range from 30 to 370 yr (95.4% confidence). The mean RI is consistent with the recurrence model of the Working Group on California Earthquake Probabilities (2003) (mean, 161 yr; range, 99 yr [2.5%]; 283 yr [97.5%]). We note that the mean RI for the five most recent events may have been only 138 ?? 58 yr (1??). Hypothesis tests for the shorter RI do not demonstrate that any recent acceleration has occurred compared to the earlier period or the entire 1800-yr record, principally because of inherent uncertainties of the event ages.
A unified framework for physical print quality
NASA Astrophysics Data System (ADS)
Eid, Ahmed; Cooper, Brian; Rippetoe, Ed
2007-01-01
In this paper we present a unified framework for physical print quality. This framework includes a design for a testbed, testing methodologies and quality measures of physical print characteristics. An automatic belt-fed flatbed scanning system is calibrated to acquire L* data for a wide range of flat field imagery. Testing methodologies based on wavelet pre-processing and spectral/statistical analysis are designed. We apply the proposed framework to three common printing artifacts: banding, jitter, and streaking. Since these artifacts are directional, wavelet based approaches are used to extract one artifact at a time and filter out other artifacts. Banding is characterized as a medium-to-low frequency, vertical periodic variation down the page. The same definition is applied to the jitter artifact, except that the jitter signal is characterized as a high-frequency signal above the banding frequency range. However, streaking is characterized as a horizontal aperiodic variation in the high-to-medium frequency range. Wavelets at different levels are applied to the input images in different directions to extract each artifact within specified frequency bands. Following wavelet reconstruction, images are converted into 1-D signals describing the artifact under concern. Accurate spectral analysis using a DFT with Blackman-Harris windowing technique is used to extract the power (strength) of periodic signals (banding and jitter). Since streaking is an aperiodic signal, a statistical measure is used to quantify the streaking strength. Experiments on 100 print samples scanned at 600 dpi from 10 different printers show high correlation (75% to 88%) between the ranking of these samples by the proposed metrologies and experts' visual ranking.
Agladze, Konstantin; Wang, Xin; Romeo, Tony
2005-01-01
Using fast Fourier transform (FFT) analysis, we previously observed that cells within Escherichia coli biofilm are organized in nonrandom or periodic spatial patterns (K. Agladze et al., J. Bacteriol. 185:5632-5638, 2003). Here, we developed a gravity displacement assay for examining cell adherence and used it to quantitatively monitor the formation of two distinct forms of cell attachment, temporary and permanent, during early biofilm development. Temporarily attached cells were mainly surface associated by a cell pole; permanent attachments were via the lateral cell surface. While temporary attachment precedes permanent attachment, both forms can coexist in a population. Exposure of attached cells to gravity liberated an unattached population capable of rapidly reassembling a new monolayer, composed of temporarily attached cells, and possessing periodicity. A csrA mutant, which forms biofilm more vigorously than its wild-type parent, exhibited an increased proportion of permanently attached cells and a form of attachment that was not apparent in the parent strain, permanent polar attachment. Nevertheless, it formed periodic attachment patterns. In contrast, biofilm mutants with altered lipopolysaccharide synthesis (waaG) exhibited increased cell-cell interactions, bypassed the polar attachment step, and produced FFT spectra characteristic of aperiodic cell distribution. Mutants lacking the polysaccharide adhesin β-1,6-N-acetyl-d-glucosamine (ΔpgaC) also exhibited aperiodic cell distribution, but without apparent cell-cell interactions, and were defective in forming permanent attachments. Thus, spatial periodicity of biofilm microstructure is genetically determined and evident during the formation of temporary cell surface attachments. PMID:16321928
NASA Astrophysics Data System (ADS)
Malleville, Marie-Alicia; Benoît, Aurélien; Dauliat, Romain; Leconte, Baptiste; Darwich, Dia; du Jeu, Rémi; Jamier, Raphaël.; Schwuchow, Anka; Schuster, Kay; Roy, Philippe
2018-02-01
Over the last decade, significant work has been carried out in order to increase the energy/peak power provided by fiber lasers. Indeed, new microstructured fibers with large (or very large) mode area cores (LMA) such as Distributed Mode Filtering (DMF) fibers and Large-Pitch Fibers (LPF) have been developed to address this concern. These technologies have allowed diffraction-limited emission with core diameters higher than 80 μm, and have state-of-the-art performances in terms of pulse energy or peak power while keeping an excellent spatial beam quality. Although these fibers were designed to reach high power levels while maintaining a single transverse mode propagation, power scaling becomes quickly limited by the onset of transverse modal instabilities (TMI). This effect suddenly arises when a certain average power threshold is exceeded, drastically degrading the emitted beam quality. In this work, we investigate the influence of the core dimensions and the refractive index mismatch between the active core and the background cladding material, on the TMI power threshold in rod-type Fully-Aperiodic-LPF. This fiber structure was specifically designed to enhance the higher-order modes (HOMs) delocalization out of the gain region and thus push further the onset of modal instabilities. Using a 400W pump diode at 976 nm, the power scaling, as well as the spatial beam quality and its temporal behavior were investigated in laser configuration, which theoretically provides a lower TMI power threshold than the amplifier one due to the lack of selective excitation of the fundamental mode.
Significance of stress transfer in time-dependent earthquake probability calculations
Parsons, T.
2005-01-01
A sudden change in stress is seen to modify earthquake rates, but should it also revise earthquake probability? Data used to derive input parameters permits an array of forecasts; so how large a static stress change is require to cause a statistically significant earthquake probability change? To answer that question, effects of parameter and philosophical choices are examined through all phases of sample calculations, Drawing at random from distributions of recurrence-aperiodicity pairs identifies many that recreate long paleoseismic and historic earthquake catalogs. Probability density funtions built from the recurrence-aperiodicity pairs give the range of possible earthquake forecasts under a point process renewal model. Consequences of choices made in stress transfer calculations, such as different slip models, fault rake, dip, and friction are, tracked. For interactions among large faults, calculated peak stress changes may be localized, with most of the receiving fault area changed less than the mean. Thus, to avoid overstating probability change on segments, stress change values should be drawn from a distribution reflecting the spatial pattern rather than using the segment mean. Disparity resulting from interaction probability methodology is also examined. For a fault with a well-understood earthquake history, a minimum stress change to stressing rate ratio of 10:1 to 20:1 is required to significantly skew probabilities with >80-85% confidence. That ratio must be closer to 50:1 to exceed 90-95% confidence levels. Thus revision to earthquake probability is achievable when a perturbing event is very close to the fault in question or the tectonic stressing rate is low.
Studies of an x ray selected sample of cataclysmic variables. Ph.D. Thesis
NASA Technical Reports Server (NTRS)
Silber, Andrew D.
1986-01-01
Just prior to the thesis research, an all-sky survey in hard x rays with the HEAO-1 satellite and further observations in the optical resulted in a catalog of about 700 x-ray sources with known optical counterparts. This sample includes 43 cataclysmic variables, which are binaries consisting of a detached white-dwarf and a Roche lobe filling companion star. This thesis consists of studies of the x-ray selected sample of catalcysmic variables.
NASA Technical Reports Server (NTRS)
Frank, A. M.
1974-01-01
Investigations are conducted into the optical properties of the glass and Kapton substrate materials, and three variables were chosen: deposition rate, sputter gas pressure, and film contamination time. Substrate tests have shown that fabrication of an dielectric broadband reflector would require an extremely complex and expensive filter design.
NASA Astrophysics Data System (ADS)
Yoshikawa, Jun-ichi; Yokoyama, Shota; Kaji, Toshiyuki; Sornphiphatphong, Chanond; Shiozawa, Yu; Makino, Kenzo; Furusawa, Akira
2016-09-01
In recent quantum optical continuous-variable experiments, the number of fully inseparable light modes has drastically increased by introducing a multiplexing scheme either in the time domain or in the frequency domain. Here, modifying the time-domain multiplexing experiment reported in the work of Yokoyama et al. [Nat. Photonics 7, 982 (2013)], we demonstrate the successive generation of fully inseparable light modes for more than one million modes. The resulting multi-mode state is useful as a dual-rail continuous variable cluster state. We circumvent the previous problem of optical phase drifts, which has limited the number of fully inseparable light modes to around ten thousands, by continuous feedback control of the optical system.
NASA Astrophysics Data System (ADS)
Bon, Edi; Jovanović, Predrag; Marziani, Paola; Bon, Nataša; Otašević, Aleksandar
2018-06-01
Here we investigate the connection of broad emission line shapes and continuum light curve variability time scales of type-1 Active Galactic Nuclei (AGN). We developed a new model to describe optical broad emission lines as an accretion disk model of a line profile with additional ring emission. We connect ring radii with orbital time scales derived from optical light curves, and using Kepler's third law, we calculate mass of central supermassive black hole (SMBH). The obtained results for central black hole masses are in a good agreement with other methods. This indicates that the variability time scales of AGN may not be stochastic, but rather connected to the orbital time scales which depend on the central SMBH mass.
A detailed X-ray investigation of ζ Puppis. IV. Further characterization of the variability
NASA Astrophysics Data System (ADS)
Nazé, Yaël; Ramiaramanantsoa, Tahina; Stevens, Ian R.; Howarth, Ian D.; Moffat, Anthony F. J.
2018-01-01
Context. One of the optically brightest and closest massive stars, ζ Pup, is also a bright X-ray source. Previously, its X-ray emission was found to be variable with light curves harbouring "trends" with a typical timescale longer than the exposure length, i.e. >1 d. The origin of these changes was proposed to be linked to large-scale structures in the wind of ζ Pup, but further characterization of the variability at high energies was needed to investigate this scenario. Aims: Since the previous papers of this series, a number of new X-ray observations have become available. Furthermore, a cyclic behaviour with a 1.78 d period was identified in long optical photometric runs, which is thought to be associated with the launching mechanism of large-scale wind structures. Methods: We analysed these new X-ray data, revisited the old data, and compared the X-ray light curves with the optical data, notably those taken simultaneously. Results: The behaviour of ζ Pup in X-rays cannot be explained in terms of a perfect clock because the amplitude and shape of its variations change with time. For example, ζ Pup was much more strongly variable between 2007 and 2011 than before and after this interval. Comparing the X-ray spectra of the star at maximum and minimum brightness yields no compelling difference beyond the overall flux change: the temperatures, absorptions, and line shapes seem to remain constant, well within errors. The only common feature between X-ray datasets is that the variation amplitudes appear maximum in the medium (0.6-1.2 keV) energy band. Finally, no clear and coherent correlation can be found between simultaneous X-ray and optical data. Only a subgroup of observations may be combined coherently with the optical period of 1.78 d, although the simultaneous optical behaviour is unknown. Conclusions: The currently available data do not reveal any obvious, permanent, and direct correlation between X-ray and optical variations. The origin of the X-ray variability therefore still needs to be ascertained, highlighting the need for long-term monitoring in multiwavelengths, i.e. X-ray, UV, and optical.
Radio to gamma-ray variability study of blazar S5 0716+714
Rani, B.; Krichbaum, T. P.; Fuhrmann, L.; ...
2013-03-13
In this paper, we present the results of a series of radio, optical, X-ray, and γ-ray observations of the BL Lac object S50716+714 carried out between April 2007 and January 2011. The multifrequency observations were obtained using several ground- and space-based facilities. The intense optical monitoring of the source reveals faster repetitive variations superimposed on a long-term variability trend on a time scale of ~350 days. Episodes of fast variability recur on time scales of ~60-70 days. The intense and simultaneous activity at optical and γ-ray frequencies favors the synchrotron self-Compton mechanism for the production of the high-energy emission. Twomore » major low-peaking radio flares were observed during this high optical/γ-ray activity period. The radio flares are characterized by a rising and a decaying stage and agrees with the formation of a shock and its evolution. We found that the evolution of the radio flares requires a geometrical variation in addition to intrinsic variations of the source. Different estimates yield robust and self-consistent lower limits of δ ≥ 20 and equipartition magnetic field B eq ≥ 0.36 G. Causality arguments constrain the size of emission region θ ≤ 0.004 mas. We found a significant correlation between flux variations at radio frequencies with those at optical and γ-rays. Theoptical/GeV flux variations lead the radio variability by ~65 days. The longer time delays between low-peaking radio outbursts and optical flares imply that optical flares are the precursors of radio ones. An orphan X-ray flare challenges the simple, one-zone emission models, rendering them too simple. Finally, here we also describe the spectral energy distribution modeling of the source from simultaneous data taken through different activity periods.« less
Role of optical computers in aeronautical control applications
NASA Technical Reports Server (NTRS)
Baumbick, R. J.
1981-01-01
The role that optical computers play in aircraft control is determined. The optical computer has the potential high speed capability required, especially for matrix/matrix operations. The optical computer also has the potential for handling nonlinear simulations in real time. They are also more compatible with fiber optic signal transmission. Optics also permit the use of passive sensors to measure process variables. No electrical energy need be supplied to the sensor. Complex interfacing between optical sensors and the optical computer is avoided if the optical sensor outputs can be directly processed by the optical computer.
Identification of Active Galactic Nuclei through HST optical variability in the GOODS South field
NASA Astrophysics Data System (ADS)
Pouliasis, Ektoras; Georgantopoulos; Bonanos, A.; HCV Team
2016-08-01
This work aims to identify AGN in the GOODS South deep field through optical variability. This method can easily identify low-luminosity AGN. In particular, we use images in the z-band obtained from the Hubble Space Telescope with the ACS/WFC camera over 5 epochs separated by ~45 days. Aperture photometry has been performed using SExtractor to extract the lightcurves. Several variability indices, such as the median absolute deviation, excess variance, and sigma were applied to automatically identify the variable sources. After removing artifacts, stars and supernovae from the variable selected sample and keeping only those sources with known photometric or spectroscopic redshift, the optical variability was compared to variability in other wavelengths (X-rays, mid-IR, radio). This multi-wavelength study provides important constraints on the structure and the properties of the AGN and their relation to their hosts. This work is a part of the validation of the Hubble Catalog of Variables (HCV) project, which has been launched at the National Observatory of Athens by ESA, and aims to identify all sources (pointlike and extended) showing variability, based on the Hubble Source Catalog (HSC, Whitmore et al. 2015). The HSC version 1 was released in February 2015 and includes 80 million sources imaged with the WFPC2, ACS/WFC, WFC3/UVIS and WFC3/IR cameras.
Modeling and properties of an ion-exchanged optical variable attenuator
NASA Astrophysics Data System (ADS)
Orignac, Xavier; Ingenhoff, Jan; Fabricius, Norbert
1999-03-01
The optical signal power needs to be regulated at some locations in transmission lines. That can be done with the help of optical variable attenuators (OVA), devices which allows for the control of their insertion loss. This work describes the design and properties of some OVAs fabricated by the ion-exchange technique. The OVA functionality relies on a Mach-Zehnder structure, where the output optical intensity is tuned via the change in optical path along one of the two interferometer arms. Here, the optical path is varied through thermo-optic effect (change of refractive index with temperature). Modelling is first addressed: a mostly qualitative theoretical investigation is used to clarify how the fabrication parameters (burial depth and Mach-Zehnder arm separation distance) can be related to the OVAs properties (attenuation dynamic, switching power, settling time, PDL). Properties of fabricated OVAs are presented in a second part. They are compared with other existing products. The relationship between fabrication parameters and properties is also re-examined in light of these results.
Choi, Seung Tae; Son, Byeong Soo; Seo, Gye Won; Park, Si-Young; Lee, Kyung-Sick
2014-03-10
Nonlinear large deformation of a transparent elastomer membrane under hydraulic pressure was analyzed to investigate its optical performance for a variable-focus liquid-filled membrane microlens. In most membrane microlenses, actuators control the hydraulic pressure of optical fluid so that the elastomer membrane together with the internal optical fluid changes its shape, which alters the light path of the microlens to adapt its optical power. A fluid-structure interaction simulation was performed to estimate the transient behavior of the microlens under the operation of electroactive polymer actuators, demonstrating that the viscosity of the optical fluid successfully stabilizes the fluctuations within a fairly short period of time during dynamic operations. Axisymmetric nonlinear plate theory was used to calculate the deformation profile of the membrane under hydrostatic pressure, with which optical characteristics of the membrane microlens were estimated. The effects of gravitation and viscoelastic behavior of the elastomer membrane on the optical performance of the membrane microlens were also evaluated with finite element analysis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Haixia; Zhang, Jing
We propose a scheme for continuous-variable quantum cloning of coherent states with phase-conjugate input modes using linear optics. The quantum cloning machine yields M identical optimal clones from N replicas of a coherent state and N replicas of its phase conjugate. This scheme can be straightforwardly implemented with the setups accessible at present since its optical implementation only employs simple linear optical elements and homodyne detection. Compared with the original scheme for continuous-variable quantum cloning with phase-conjugate input modes proposed by Cerf and Iblisdir [Phys. Rev. Lett. 87, 247903 (2001)], which utilized a nondegenerate optical parametric amplifier, our scheme losesmore » the output of phase-conjugate clones and is regarded as irreversible quantum cloning.« less
Stoichiometric Lithium Niobate (SLN) Based Linearized Electro-Optic (EO) Modulator
2006-01-01
AFRL-SN-RS-TR-2006-15 Final Technical Report January 2006 STOICHIOMETRIC LITHIUM NIOBATE (SLN) BASED LINEARIZED ELECTRO - OPTIC (EO...LITHIUM NIOBATE (SLN) BASED LINEARIZED ELECTRO - OPTIC (EO) MODULATOR 6. AUTHOR(S) Dr Stuart Kingsley, Dr Sri Sriram 5. FUNDING NUMBERS C...SUBJECT TERMS electro - optic modulator, linearization, directional coupler, variable coupling, optical waveguide, Mach-Zehnder, photonic link, lithium
NASA Astrophysics Data System (ADS)
Alfonso-Garzón, J.; Fabregat, J.; Reig, P.; Kajava, J. J. E.; Sánchez-Fernández, C.; Townsend, L. J.; Mas-Hesse, J. M.; Crawford, S. M.; Kretschmar, P.; Coe, M. J.
2017-11-01
Context. Multiwavelength monitoring of Be/X-ray binaries is crucial to understand the mechanisms producing their outbursts. H 1145-619 is one of these systems, which has recently displayed X-ray activity. Aims: We investigate the correlation between the optical emission and X-ray activity to predict the occurrence of new X-ray outbursts from the inferred state of the circumstellar disc. Methods: We have performed a multiwavelength study of H 1145-619 from 1973 to 2017 and present here a global analysis of its variability over the last 40 yr. We used optical spectra from the SAAO, SMARTS, and SALT telescopes and optical photometry from the Optical Monitoring Camera (OMC) onboard INTEGRAL and from the All Sky Automated Survey (ASAS). We also used X-ray observations from INTEGRAL/JEM-X, and IBIS to generate the light curves and combined them with Swift/XRT to extract the X-ray spectra. In addition, we compiled archival observations and measurements from the literature to complement these data. Results: Comparing the evolution of the optical continuum emission with the Hα line variability, we identified three different patterns of optical variability: first, global increases and decreases of the optical brightness, observed from 1982 to 1994 and from 2009 to 2017, which can be explained by the dissipation and replenishment of the circumstellar disc; second, superorbital variations with a period of Psuperorb ≈ 590 days, observed in 2002-2009, which seems to be related to the circumstellar disc; and third, optical outbursts, observed in 1998-1999 and 2002-2005, which we interpret as mass ejections from the Be star. We discovered the presence of a retrograde one-armed density wave, which appeared in 2016 and is still present in the circumstellar disc. Conclusions: We carried out the most complete long-term optical study of the Be/X-ray binary H 1145-619 in correlation with its X-ray activity. For the first time, we found the presence of a retrograde density perturbation in the circumstellar disc of a Be/X-ray binary.
Space Object Radiometric Modeling for Hardbody Optical Signature Database Generation
2009-09-01
Introduction This presentation summarizes recent activity in monitoring spacecraft health status using passive remote optical nonimaging ...Approved for public release; distribution is unlimited. Space Object Radiometric Modeling for Hardbody Optical Signature Database Generation...It is beneficial to the observer/analyst to understand the fundamental optical signature variability associated with these detection and
SYSTEMATIC STUDY OF GAMMA-RAY-BRIGHT BLAZARS WITH OPTICAL POLARIZATION AND GAMMA-RAY VARIABILITY
DOE Office of Scientific and Technical Information (OSTI.GOV)
Itoh, Ryosuke; Fukazawa, Yasushi; Kanda, Yuka
Blazars are highly variable active galactic nuclei that emit radiation at all wavelengths from radio to gamma rays. Polarized radiation from blazars is one key piece of evidence for synchrotron radiation at low energies, and it also varies dramatically. The polarization of blazars is of interest for understanding the origin, confinement, and propagation of jets. However, even though numerous measurements have been performed, the mechanisms behind jet creation, composition, and variability are still debated. We performed simultaneous gamma-ray and optical photopolarimetry observations of 45 blazars between 2008 July and 2014 December to investigate the mechanisms of variability and search formore » a basic relation between the several subclasses of blazars. We identify a correlation between the maximum degree of optical linear polarization and the gamma-ray luminosity or the ratio of gamma-ray to optical fluxes. Since the maximum polarization degree depends on the condition of the magnetic field (chaotic or ordered), this result implies a systematic difference in the intrinsic alignment of magnetic fields in parsec-scale relativistic jets between different types of blazars (flat-spectrum radio quasars vs. BL Lacs) and consequently between different types of radio galaxies (FR I versus FR II).« less
Leaky unstable modes and electromagnetic radiation amplification by an anisotropic plasma slab
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vagin, K. Yu., E-mail: vagin@sci.lebedev.ru; Uryupin, S. A., E-mail: uryupin@sci.lebedev.ru
2015-09-15
The interaction between electromagnetic radiation and a photoionized plasma slab with an anisotropic electron velocity distribution is studied. It is shown that the fields of leaky modes are amplified due to the development of aperiodic instability in the slab, which leads to an increase in both the reflected and transmitted fields. The transmitted field can significantly increase only if the slab thickness does not exceed the ratio of the speed of light to the electron plasma frequency, whereas there is no upper bound on the slab thickness for the reflected signal to be amplified.
1989-08-01
number) Using chi-square tests of homogeneity, a selected sample of Army Basic Trainees at Ft. Jackso was studied to determine if there was a...Period of training for sample soldiers was January to May 1985. Results of testing for the female trainees indicated no significant difference in incidence...of ARD among three barracks groups. Results of testing for male trainees indicated statistically significant dif -erences of ARD among each of three
On the spectra of Pisot-cyclotomic numbers
NASA Astrophysics Data System (ADS)
Hare, Kevin G.; Masáková, Zuzana; Vávra, Tomáš
2018-07-01
We investigate the complex spectra X^A(β )= \\sum _{j=0}^na_jβ ^j : n\\in N, a_j\\in A where β is a quadratic or cubic Pisot-cyclotomic number and the alphabet A is given by 0 along with a finite collection of roots of unity. Such spectra are discrete aperiodic structures with crystallographically forbidden symmetries. We discuss in general terms under which conditions they possess the Delone property required for point sets modeling quasicrystals. We study the corresponding Voronoi tilings and we relate these structures to quasilattices arising from the cut-and-project method.
An application of synthetic seismicity in earthquake statistics - The Middle America Trench
NASA Technical Reports Server (NTRS)
Ward, Steven N.
1992-01-01
The way in which seismicity calculations which are based on the concept of fault segmentation incorporate the physics of faulting through static dislocation theory can improve earthquake recurrence statistics and hone the probabilities of hazard is shown. For the Middle America Trench, the spread parameters of the best-fitting lognormal or Weibull distributions (about 0.75) are much larger than the 0.21 intrinsic spread proposed in the Nishenko Buland (1987) hypothesis. Stress interaction between fault segments disrupts time or slip predictability and causes earthquake recurrence to be far more aperiodic than has been suggested.
Measures with locally finite support and spectrum.
Meyer, Yves F
2016-03-22
The goal of this paper is the construction of measures μ on R(n)enjoying three conflicting but fortunately compatible properties: (i) μ is a sum of weighted Dirac masses on a locally finite set, (ii) the Fourier transform μ f μ is also a sum of weighted Dirac masses on a locally finite set, and (iii) μ is not a generalized Dirac comb. We give surprisingly simple examples of such measures. These unexpected patterns strongly differ from quasicrystals, they provide us with unusual Poisson's formulas, and they might give us an unconventional insight into aperiodic order.
Measures with locally finite support and spectrum
Meyer, Yves F.
2016-01-01
The goal of this paper is the construction of measures μ on Rn enjoying three conflicting but fortunately compatible properties: (i) μ is a sum of weighted Dirac masses on a locally finite set, (ii) the Fourier transform μ^ of μ is also a sum of weighted Dirac masses on a locally finite set, and (iii) μ is not a generalized Dirac comb. We give surprisingly simple examples of such measures. These unexpected patterns strongly differ from quasicrystals, they provide us with unusual Poisson's formulas, and they might give us an unconventional insight into aperiodic order. PMID:26929358
Maintenance and suppression of chaos by weak harmonic perturbations: a unified view.
Chacón, R
2001-02-26
General results concerning maintenance or enhancement of chaos are presented for dissipative systems subjected to two harmonic perturbations (one chaos inducing and the other chaos enhancing). The connection with previous results on chaos suppression is also discussed in a general setting. It is demonstrated that, in general, a second harmonic perturbation can reliably play an enhancer or inhibitor role by solely adjusting its initial phase. Numerical results indicate that general theoretical findings concerning periodic chaos-inducing perturbations also work for aperiodic chaos-inducing perturbations, and in arrays of identical chaotic coupled oscillators.
Transparent ITO electrode in the polymer network liquid crystal variable optical attenuator
NASA Astrophysics Data System (ADS)
Zhang, Xindong; Dong, Wei; Liu, Caixia; Chen, Yinghua; Ruan, Shengping; Zhang, Shuang; Guo, Wenbin; Yang, Dong; Han, Lin; Chen, Weiyou
2004-05-01
Indium tin oxide (ITO) films as transparent conductors have caused a great deal of interest due to their prominent electro-optical behavior. This paper describes a study of the properties of ITO thin films that are used for a new type variable optical attenuator using polymer network liquid crystal (PNLC). The mechanism of PNLC optical attenuator operation is that the light from the input fiber is scattered when no voltage is applied, and the light passes through the attenuator when sufficient voltage is applied. So the ITO thin films can provide transparent electrodes for PNLC. They were deposited under various preparation conditions using the radio-frequency (rf) magnetron sputtering technique. Here discuss the results of the structural, electrical and optical properties of the ITO films. The paper presents some experimental results obtained in laboratory.
Chow, Robert; Loomis, Gary E.; Thomas, Ian M.
1999-01-01
Variable index optical single-layers, optical multilayer, and laser-resistant coatings were made from a perfluorinated amorphous polymer material by physical vapor deposition. This was accomplished by physically vapor depositing a polymer material, such as bulk Teflon AF2400, for example, to form thin layers that have a very low refractive index (.about.1.10-1.31) and are highly transparent from the ultra-violet through the near infrared regime, and maintain the low refractive index of the bulk material. The refractive index can be varied by simply varying one process parameter, either the deposition rate or the substrate temperature. The thus forming coatings may be utilized in anti-reflectors and graded anti-reflection coatings, as well as in optical layers for laser-resistant coatings at optical wavelengths of less than about 2000 nm.
Measuring In-Plane Displacements with Variable Sensitivity Using Diffractive Optic Interferometry
NASA Technical Reports Server (NTRS)
Shepherd, Robert L.; Gilbert, John A.; Cole, Helen J.; Ashley, Paul R.
1998-01-01
This paper introduces a method called diffractive optic interferometry (DOI) which allows in-plane displacement components to be measured with variable sensitivity. DOI relies on binary optical elements fabricated as phase-type Dammann gratings which produce multiple diffraction orders of nearly equal intensity. Sensitivity is varied by combining the different wavefronts produced by a conjugate pair of these binary optical elements; a transmission element is used to produce several illumination beams while a reflective element, replicated on the surface of a specimen, provides the reference for the undeformed state. The steps taken to design and fabricate these binary optical elements are described. The specimen grating is characterized, and tested on a disk subjected to diametrical compression. Overall, the results are excellent, with experimental data agreeing to within a few percent of the theoretical predictions.
All optical controlled photonic integrated circuits using azo dye functionized sol-gel material
NASA Astrophysics Data System (ADS)
Ke, Xianjun
The main focus of this dissertation is development and characterization of all-optical controllable azo dye functionized sol gel material, demonstrating a PIC fabrication technique on glass substrate using such material, and exploration and feasibility demonstration of three PIC functional devices namely optical variable attenuator, optical switches, and optical tunable filters using the material. The realization of all the devices in this dissertation are based on one material: dye functionalized sol-gel material. A photochromic sol-gel material functionalized with azo dye was synthesized and characterized. It possesses a photochromic characteristic under the control of green laser beam illumination. The material characteristics suggest the possibility of a new promising material platform candidate for the fabrication of alloptical controlled photonic integrated circuits. As the first potential application of the dye functionalized sol-gel material, an alloptical variable attenuator was designed and demonstrated. The optical variable attenuation is achieved in Mach-Zehnder interferometric configuration through all-optical modulation of sol-gel waveguide phase shifters. A 2 x 2 optical switch based on multimode interference (MMI) waveguide structure is proposed in the dissertation. The schematic configuration of the optical switch consists of a cascade of two identical MMIs with two all-optical controlled phase shifters realized by using the photochromic sol-gel material. The cross or bar switch state of the optical switch is determined by the phase difference between the two sol-gel waveguide phase shifters. An all-optical tunable filter is designed and its feasibility demonstrated by using the sol-gel photochromic material. Except for the phase change demonstrated on sol-gel waveguide phase shifters, dynamic gratings were observed on sol-gel film when exposed to two interference beams. This reveals the possibility of realizing Bragg grating-based tunable filters. The schematic configuration of proposed tunable filters consists of a single straight waveguide embedded with a sol-gel waveguide. The wavelength tuning of the tunable filters is accomplished by varying the grating period.
A possible close supermassive black-hole binary in a quasar with optical periodicity.
Graham, Matthew J; Djorgovski, S G; Stern, Daniel; Glikman, Eilat; Drake, Andrew J; Mahabal, Ashish A; Donalek, Ciro; Larson, Steve; Christensen, Eric
2015-02-05
Quasars have long been known to be variable sources at all wavelengths. Their optical variability is stochastic and can be due to a variety of physical mechanisms; it is also well-described statistically in terms of a damped random walk model. The recent availability of large collections of astronomical time series of flux measurements (light curves) offers new data sets for a systematic exploration of quasar variability. Here we report the detection of a strong, smooth periodic signal in the optical variability of the quasar PG 1302-102 with a mean observed period of 1,884 ± 88 days. It was identified in a search for periodic variability in a data set of light curves for 247,000 known, spectroscopically confirmed quasars with a temporal baseline of about 9 years. Although the interpretation of this phenomenon is still uncertain, the most plausible mechanisms involve a binary system of two supermassive black holes with a subparsec separation. Such systems are an expected consequence of galaxy mergers and can provide important constraints on models of galaxy formation and evolution.
Ontology of Earth's nonlinear dynamic complex systems
NASA Astrophysics Data System (ADS)
Babaie, Hassan; Davarpanah, Armita
2017-04-01
As a complex system, Earth and its major integrated and dynamically interacting subsystems (e.g., hydrosphere, atmosphere) display nonlinear behavior in response to internal and external influences. The Earth Nonlinear Dynamic Complex Systems (ENDCS) ontology formally represents the semantics of the knowledge about the nonlinear system element (agent) behavior, function, and structure, inter-agent and agent-environment feedback loops, and the emergent collective properties of the whole complex system as the result of interaction of the agents with other agents and their environment. It also models nonlinear concepts such as aperiodic, random chaotic behavior, sensitivity to initial conditions, bifurcation of dynamic processes, levels of organization, self-organization, aggregated and isolated functionality, and emergence of collective complex behavior at the system level. By incorporating several existing ontologies, the ENDCS ontology represents the dynamic system variables and the rules of transformation of their state, emergent state, and other features of complex systems such as the trajectories in state (phase) space (attractor and strange attractor), basins of attractions, basin divide (separatrix), fractal dimension, and system's interface to its environment. The ontology also defines different object properties that change the system behavior, function, and structure and trigger instability. ENDCS will help to integrate the data and knowledge related to the five complex subsystems of Earth by annotating common data types, unifying the semantics of shared terminology, and facilitating interoperability among different fields of Earth science.
Li, Yunji; Wu, QingE; Peng, Li
2018-01-23
In this paper, a synthesized design of fault-detection filter and fault estimator is considered for a class of discrete-time stochastic systems in the framework of event-triggered transmission scheme subject to unknown disturbances and deception attacks. A random variable obeying the Bernoulli distribution is employed to characterize the phenomena of the randomly occurring deception attacks. To achieve a fault-detection residual is only sensitive to faults while robust to disturbances, a coordinate transformation approach is exploited. This approach can transform the considered system into two subsystems and the unknown disturbances are removed from one of the subsystems. The gain of fault-detection filter is derived by minimizing an upper bound of filter error covariance. Meanwhile, system faults can be reconstructed by the remote fault estimator. An recursive approach is developed to obtain fault estimator gains as well as guarantee the fault estimator performance. Furthermore, the corresponding event-triggered sensor data transmission scheme is also presented for improving working-life of the wireless sensor node when measurement information are aperiodically transmitted. Finally, a scaled version of an industrial system consisting of local PC, remote estimator and wireless sensor node is used to experimentally evaluate the proposed theoretical results. In particular, a novel fault-alarming strategy is proposed so that the real-time capacity of fault-detection is guaranteed when the event condition is triggered.
NASA Astrophysics Data System (ADS)
Bachetti, Matteo; Huppenkothen, Daniela
2018-02-01
Dead time affects many of the instruments used in X-ray astronomy, by producing a strong distortion in power density spectra. This can make it difficult to model the aperiodic variability of the source or look for quasi-periodic oscillations. Whereas in some instruments a simple a priori correction for dead-time-affected power spectra is possible, this is not the case for others such as NuSTAR, where the dead time is non-constant and long (∼2.5 ms). Bachetti et al. (2015) suggested the cospectrum obtained from light curves of independent detectors within the same instrument as a possible way out, but this solution has always only been a partial one: the measured rms was still affected by dead time because the width of the power distribution of the cospectrum was modulated by dead time in a frequency-dependent way. In this Letter, we suggest a new, powerful method to normalize dead-time-affected cospectra and power density spectra. Our approach uses the difference of the Fourier amplitudes from two independent detectors to characterize and filter out the effect of dead time. This method is crucially important for the accurate modeling of periodograms derived from instruments affected by dead time on board current missions like NuSTAR and Astrosat, but also future missions such as IXPE.
Monsoons: Processes, predictability, and the prospects for prediction
NASA Astrophysics Data System (ADS)
Webster, P. J.; Magaña, V. O.; Palmer, T. N.; Shukla, J.; Thomas, R. A.; Yanai, M.; Yasunari, T.
1998-06-01
The Tropical Ocean-Global Atmosphere (TOGA) program sought to determine the predictability of the coupled ocean-atmosphere system. The World Climate Research Programme's (WCRP) Global Ocean-Atmosphere-Land System (GOALS) program seeks to explore predictability of the global climate system through investigation of the major planetary heat sources and sinks, and interactions between them. The Asian-Australian monsoon system, which undergoes aperiodic and high amplitude variations on intraseasonal, annual, biennial and interannual timescales is a major focus of GOALS. Empirical seasonal forecasts of the monsoon have been made with moderate success for over 100 years. More recent modeling efforts have not been successful. Even simulation of the mean structure of the Asian monsoon has proven elusive and the observed ENSO-monsoon relationships has been difficult to replicate. Divergence in simulation skill occurs between integrations by different models or between members of ensembles of the same model. This degree of spread is surprising given the relative success of empirical forecast techniques. Two possible explanations are presented: difficulty in modeling the monsoon regions and nonlinear error growth due to regional hydrodynamical instabilities. It is argued that the reconciliation of these explanations is imperative for prediction of the monsoon to be improved. To this end, a thorough description of observed monsoon variability and the physical processes that are thought to be important is presented. Prospects of improving prediction and some strategies that may help achieve improvement are discussed.
WEATHER ON OTHER WORLDS. III. A SURVEY FOR T DWARFS WITH HIGH-AMPLITUDE OPTICAL VARIABILITY
DOE Office of Scientific and Technical Information (OSTI.GOV)
Heinze, Aren N.; Metchev, Stanimir; Kellogg, Kendra, E-mail: aren.heinze@stonybrook.edu, E-mail: smetchev@uwo.ca
2015-03-10
We have monitored 12 T dwarfs with the Kitt Peak 2.1 m telescope using an F814W filter (0.7-0.95 μm) to place in context the remarkable 10%-20% variability exhibited by the nearby T dwarf Luhman 16B in this wavelength regime. The motivation was the poorly known red optical behavior of T dwarfs, which have been monitored almost exclusively at infrared wavelengths, where variability amplitudes greater than 10% have been found to be very rare. We detect highly significant variability in two T dwarfs. The T2.5 dwarf 2MASS 13243559+6358284 shows consistent ∼17% variability on two consecutive nights. The T2 dwarf 2MASS J16291840+0335371 exhibits ∼10% variability thatmore » may evolve from night to night, similarly to Luhman 16B. Both objects were previously known to be variable in the infrared, but with considerably lower amplitudes. We also find evidence for variability in the T6 dwarf J162414.37+002915.6, but since it has lower significance, we conservatively refrain from claiming this object as a variable. We explore and rule out various telluric effects, demonstrating that the variations we detect are astrophysically real. We suggest that high-amplitude photometric variability for T dwarfs is likely more common in the red optical than at longer wavelengths. The two new members of the growing class of high-amplitude variable T dwarfs offer excellent prospects for further study of cloud structures and their evolution.« less
An analysis of haze effects on LANDSAT multispectral scanner data
NASA Technical Reports Server (NTRS)
Johnson, W. R.; Sestak, M. L. (Principal Investigator)
1981-01-01
Early season changes in optical depth change brightness, primarily along the soil line; and during crop development, changes in optical depth change both greenness and brightness. Thus, the existence of haze in the imagery could cause an unsuspecting analyst to interpret the spectral appearance as indicating an episodal event when, in fact, haze was present. The techniques for converting LANDSAT-3 data to simulate LANDSAT-2 data are in error. The yellowness and none such computations are affected primarily. Yellowness appears well correlated to optical depth. Experimental evidence with variable background and variable optical depth is needed, however. The variance of picture elements within a spring wheat field is related to its equivalent in optical depth changes caused by haze. This establishes the sensitivity of channel 1 (greenness) pixels to changes in haze levels. The between field picture element means and variances were determined for the spring wheat fields. This shows the variability of channel data on two specific dates, emphasizing that crop development can be influenced by many factors. The atmospheric correction program ATCOR reduces segment data from LANDSAT acquisitions to a common haze level and improves the results of analysis.
A variable partially polarizing beam splitter.
Flórez, Jefferson; Carlson, Nathan J; Nacke, Codey H; Giner, Lambert; Lundeen, Jeff S
2018-02-01
We present designs for variably polarizing beam splitters. These are beam splitters allowing the complete and independent control of the horizontal and vertical polarization splitting ratios. They have quantum optics and quantum information applications, such as quantum logic gates for quantum computing and non-local measurements for quantum state estimation. At the heart of each design is an interferometer. We experimentally demonstrate one particular implementation, a displaced Sagnac interferometer configuration, that provides an inherent instability to air currents and vibrations. Furthermore, this design does not require any custom-made optics but only common components which can be easily found in an optics laboratory.
A variable partially polarizing beam splitter
NASA Astrophysics Data System (ADS)
Flórez, Jefferson; Carlson, Nathan J.; Nacke, Codey H.; Giner, Lambert; Lundeen, Jeff S.
2018-02-01
We present designs for variably polarizing beam splitters. These are beam splitters allowing the complete and independent control of the horizontal and vertical polarization splitting ratios. They have quantum optics and quantum information applications, such as quantum logic gates for quantum computing and non-local measurements for quantum state estimation. At the heart of each design is an interferometer. We experimentally demonstrate one particular implementation, a displaced Sagnac interferometer configuration, that provides an inherent instability to air currents and vibrations. Furthermore, this design does not require any custom-made optics but only common components which can be easily found in an optics laboratory.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pirandola, Stefano; Mancini, Stefano; Vitali, David
2003-12-01
We study an isolated, perfectly reflecting, mirror illuminated by an intense laser pulse. We show that the resulting radiation pressure efficiently entangles a mirror vibrational mode with the two reflected optical sideband modes of the incident carrier beam. The entanglement of the resulting three-mode state is studied in detail and it is shown to be robust against the mirror mode temperature. We then show how this continuous-variable entanglement can be profitably used to teleport an unknown quantum state of an optical mode onto the vibrational mode of the mirror.
Optical Polarization and Spectral Variability in the M87 Jet
NASA Technical Reports Server (NTRS)
Perlman, Eric S.; Adams, Steven C.; Cara, Mihai; Bourque, Matthew; Harris, D. E.; Madrid, Juan P.; Simons, Raymond C.; Clausen-Brown, Eric; Cheung, C. C.; Stawarz, Lukasz;
2011-01-01
During the last decade, M87's jet has been the site of an extraordinary variability event, with one knot (HST-1) increasing by over a factor 100 in brightness. Variability was also seen on timescales of months in the nuclear flux. Here we discuss the optical-UV polarization and spectral variability of these components, which show vastly different behavior. HST -1 shows a highly significant correlation between flux and polarization, with P increasing from approx 20% at minimum to > 40% at maximum, while the orientation of its electric vector stayed constant. HST-l's optical-UV spectrum is very hard (alpha(sub uv-0) approx. 0.5, F(sub v) varies as (v(exp -alpha)), and displays "hard lags" during epochs 2004.9-2005.5, including the peak of the flare, with soft lags at later epochs. We interpret the behavior of HST-1 as enhanced particle acceleration in a shock, with cooling from both particle aging and the relaxation of the compression. We set 2alpha upper limits of 0.5 delta parsecs and 1.02c on the size and advance speed of the flaring region. The slight deviation of the electric vector orientation from the jet PA, makes it likely that on smaller scales the flaring region has either a double or twisted structure. By contrast, the nucleus displays much more rapid variability, with a highly variable electric vector orientation and 'looping' in the (I, P) plane. The nucleus has a much steeper spectrum ((alpha(sub uv-0) approx. 1.5) but does not show UV-optical spectral variability. Its behavior can be interpreted as either a helical distortion to a steady jet or a shock propagating through a helical jet.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Goyal, Arti; Stawarz, Łukasz; Ostrowski, Michał
We present the results of our power spectral analysis for the BL Lac object PKS 0735+178, utilizing the Fermi -LAT survey at high-energy γ -rays, several ground-based optical telescopes, and single-dish radio telescopes operating at GHz frequencies. The novelty of our approach is that, by combining long-term and densely sampled intra-night light curves in the optical regime, we were able to construct for the first time the optical power spectrum of the blazar for a time domain extending from 23 years down to minutes. Our analysis reveals that: (1) the optical variability is consistent with a pure red noise, formore » which the power spectral density can be well approximated by a single power law throughout the entire time domain probed; (2) the slope of power spectral density at high-energy γ -rays (∼1) is significantly flatter than that found at radio and optical frequencies (∼2) within the corresponding time variability range; (3) for the derived power spectra, we did not detect any low-frequency flattening, nor do we see any evidence for cutoffs at the highest frequencies down to the noise floor levels due to measurement uncertainties. We interpret our findings in terms of a model where the blazar variability is generated by the underlying single stochastic process (at radio and optical frequencies), or a linear superposition of such processes (in the γ -ray regime). Along with the detailed PSD analysis, we also present the results of our extended (1998–2015) intra-night optical monitoring program and newly acquired optical photo-polarimetric data for the source.« less
NASA Astrophysics Data System (ADS)
Phillips, Stephen Robert; Costa, Maycira
2017-12-01
The use of standard ocean colour reflectance based algorithms to derive surface chlorophyll may have limited applicability for optically dynamic coastal waters due to the pre-defined coefficients based on global datasets. Reflectance based algorithms adjusted to regional optical water characteristics are a promising alternative. A class-based definition of optically diverse coastal waters was investigated as a first step towards the development of temporal and spatial constrained reflectance based algorithms for optically variable coastal waters. A large set of bio-optical data were collected as part of five research cruises and bi-weekly trips aboard a ship of opportunity in the west coast of Canada, to assess the spatial and temporal variability of above-water reflectance in this contrasted coastal environment. To accomplish this, in situ biophysical and optical measurements were collected in conjunction with above-water hyperspectral remote sensing reflectance (Rrs) at 145 stations. The concentrations of measured biophysical data varied considerably; chlorophyll a (Chla) (mean = 1.64, range: 0.10-7.20 μg l-1), total suspended matter (TSM) (3.09, 0.82-20.69 mg l-1), and absorption by chromophoric dissolved organic matter (CDOM) (acdom(443 nm)) (0.525, 0.007-3.072 m-1), thus representing the spatio-temporal variability of the Salish Sea. Optically, a similar large range was also found; particulate scattering (bp(650 nm)) (1.316, 0.250-7.450 m-1), particulate backscattering (bbp(650 nm)) (0.022, 0.005-0.097 m-1), total beam attenuation coefficient (ct(650)) (1.675, 0.371-9.537 m-1) and particulate absorption coefficient (ap(650 nm)) (0.345, 0.048-2.020 m-1). An empirical orthogonal function (EOF) analysis revealed that Rrs variability was highly correlated to bp (r = 0.90), bbp (r = 0.82) and concentration of TSM (r = 0.80), which highlighted the dominant role of water turbidity in this region. Hierarchical clustering analysis was applied to the normalized Rrs spectra to define optical water classes. Class 1 was defined by the highest Rrs values, particularly above 570 nm, indicating more turbid waters; Class 2 was dominated by high Chla and TSM concentrations, which is shown by high Rrs at 570 nm as well as fluorescence and absorption peaks; Class 3 shows strong fluorescence signatures accompanied by low TSM influence; and Class 4 is most representative of clear waters with a less defined absorption peak around 440 nm. By understanding the bio-optical factors which control the variability of the Rrs spectra this study aims to develop a sub-regional characterization of this coastal region aiming to improve bio-optical algorithms in this complex coastal area.
NASA Astrophysics Data System (ADS)
Ghosh, Supriyo; Mondal, Soumen; Das, Ramkrishna; Banerjee, D. P. K.; Ashok, N. M.; Hambsch, Franz-Josef; Dutta, Somnath
2018-05-01
We describe the time-dependent properties of a new spectroscopically confirmed Mira variable, which was discovered in 2013 as MASTER-Net Optical Transient J212444.87+321738.3 toward the Cygnus constellation. We have performed long-term optical/near-infrared (NIR) photometric and spectroscopic observations to characterize the object. From the optical/NIR light curves, we estimate a variability period of 465 ± 30 days. The wavelength-dependent amplitudes of the observed light curves range from ΔI ∼ 4 mag to ΔK ∼ 1.5 mag. The (J ‑ K) color index varies from 1.78 to 2.62 mag over phases. Interestingly, a phase lag of ∼60 days between optical and NIR light curves is also seen, as in other Miras. Our optical/NIR spectra show molecular features of TiO, VO, CO, and strong water bands that are a typical signature of oxygen-rich Mira. We rule out S- or C-type as ZrO bands at 1.03 and 1.06 μm and C2 band at 1.77 μm are absent. We estimate the effective temperature of the object from the Spectral Energy Distribution, and distance and luminosity from standard Period–Luminosity relations. The optical/NIR spectra display time-dependent atomic and molecular features (e.g., TiO, Na I, Ca I, H2O, CO), as commonly observed in Miras. Such spectroscopic observations are useful for studying pulsation variability in Miras.
Study of Linearization of Optical Polymer Modulators
2004-02-01
To improve the Spur Free Dynamic Range of analog electro - optic modulators in the 10 GHz regime, techniques for improving the linearity of these...devices must be developed. This report discusses an investigation into electro - optic directional couplers that use variable coupling in polymer-based
NASA Astrophysics Data System (ADS)
Yagi, Shogo; Fujiura, Kazuo
We have grown KTN crystals with optical quality, and developed high-speed beam deflectors and variable focal length lenses based on KTN's large electro-optic effect. Furthermore, by using the KTN beam deflectors, we have developed a swept light source for OCT operable at 200 kHz.
Three-parameter optical studies in Scottish coastal waters
NASA Astrophysics Data System (ADS)
McKee, David; Cunningham, Alex; Jones, Ken
1997-02-01
A new submersible optical instrument has been constructed which allows chlorophyll fluorescence, attenuation and wide- angle scattering measurements to be made simultaneously at he same point in a body of water. The instrument sues a single xenon flashlamp as the light source, and incorporates its own power supply and microprocessor based data logging system. It has ben cross-calibrated against commercial single-parameter instruments using a range of non-algal particles and phytoplankton cultures. The equipment has been deployed at sea in the Firth of Clyde and Loch Linnhe, where is has been used to study seasonal variability in optical water column structure. Results will be presented to illustrate how ambiguity in the interpretation of measurements of a single optical parameter can be alleviated by measuring several parameters simultaneously. Comparative studies of differences in winter and spring relationships between optical variable shave also ben carried out.
Chow, R.; Loomis, G.E.; Thomas, I.M.
1999-03-16
Variable index optical single-layers, optical multilayer, and laser-resistant coatings were made from a perfluorinated amorphous polymer material by physical vapor deposition. This was accomplished by physically vapor depositing a polymer material, such as bulk Teflon AF2400, for example, to form thin layers that have a very low refractive index (ca. 1.10--1.31) and are highly transparent from the ultra-violet through the near infrared regime, and maintain the low refractive index of the bulk material. The refractive index can be varied by simply varying one process parameter, either the deposition rate or the substrate temperature. The thus forming coatings may be utilized in anti-reflectors and graded anti-reflection coatings, as well as in optical layers for laser-resistant coatings at optical wavelengths of less than about 2000 nm. 2 figs.
Unitary synaptic connections among substantia nigra pars reticulata neurons
Wilson, Charles J.
2016-01-01
Neurons in substantia nigra pars reticulata (SNr) are synaptically coupled by local axon collaterals, providing a potential mechanism for local signal processing. Because SNr neurons fire spontaneously, these synapses are constantly active. To investigate their properties, we recorded spontaneous inhibitory postsynaptic currents (sIPSCs) from SNr neurons in brain slices, in which afferents from upstream nuclei are severed, and the cells fire rhythmically. The sIPSC trains contained a mixture of periodic and aperiodic events. Autocorrelation analysis of sIPSC trains showed that a majority of cells had one to four active unitary inputs. The properties of the unitary IPSCs (uIPSCs) were analyzed for cells with one unitary input, using a model of periodic presynaptic firing and stochastic synaptic transmission. The inferred presynaptic firing rates and coefficient of variation of interspike intervals (ISIs) corresponded well with direct measurements of spiking in SNr neurons. Methods were developed to estimate the success probability, amplitude distributions, and kinetics of the uIPSCs, while removing the contribution from aperiodic sIPSCs. The sIPSC amplitudes were not increased upon release from halorhodopsin silencing, suggesting that most synapses were not depressed at the spontaneous firing rate. Gramicidin perforated-patch recordings indicated that the average reversal potential of spontaneous inhibitory postsynaptic potentials was −64 mV. Because of the change in driving force across the ISI, the unitary inputs are predicted to have a larger postsynaptic impact when they arrive late in the ISI. Simulations of network activity suggest that this very sparse inhibitory coupling may act to desynchronize the activity of SNr neurons while having only a small effect on firing rate. PMID:26961101
Optic variables used to judge future ball arrival position in expert and novice soccer players.
Craig, Cathy M; Goulon, Cédric; Berton, Eric; Rao, Guillaume; Fernandez, Laure; Bootsma, Reinoud J
2009-04-01
Although many studies have looked at the perceptual-cognitive strategies used to make anticipatory judgments in sport, few have examined the informational invariants that our visual system may be attuned to. Using immersive interactive virtual reality to simulate the aerodynamics of the trajectory of a ball with and without sidespin, the present study examined the ability of expert and novice soccer players to make judgments about the ball's future arrival position. An analysis of their judgment responses showed how participants were strongly influenced by the ball's trajectory. The changes in trajectory caused by sidespin led to erroneous predictions about the ball's future arrival position. An analysis of potential informational variables that could explain these results points to the use of a first-order compound variable combining optical expansion and optical displacement.
NASA Astrophysics Data System (ADS)
Rigon, Laura
2016-03-01
Stars form from the collapse of molecular clouds and evolve in an environment rich in gas and dust before becoming Main Sequence stars. During this phase, characterised by the presence of a protoplanetary disc, stars manifest changes in the structure and luminosity. This thesis performs a multi-wavelength analysis, from optical to mm range, on a sample of young stars (YSOs), mainly Classical T Tauri (CTTS). The purpose is to study optical and infrared variability and its relation with the protoplanetary disc. Longer wavelength, in the mm range, are used instead to investigate the evolution of the disc, in terms of dust growth. In optical, an F-test on a sample of 39 CTTS reveals that 67% of the stars are variable. The variability, quantified through pooled sigma, is visible both in magnitude amplitudes and changes over time. Time series analysis applied on the more variable stars finds the presence of quasi periodicity, with periods longer than two weeks, interpreted either as eclipsing material in the disc happening on a non-regular basis, or as a consequence of star-disc interaction via magnetic field lines. The variability of YSOs is confirmed also in infrared, even if with lower amplitude. No strong correlations are found between optical and infrared variability, which implies a different cause or a time shift in the two events. By using a toy model to explore their origin, I find that infrared variations are likely to stem from emissions in the inner disc. The evolution of discs in terms of dust growth is confirmed in most discs by the analysis of the slope of the spectral energy distribution (SED), after correcting for wind emission and optical depth effects. However, the comparison with a radiative transfer model highlights that a number of disc parameters, in particular disc masses and temperature, dust size distribution and composition, can also affect the slope of the SED.
Swift Monitoring of NGC 4151: Evidence for a Second X-Ray/UV Reprocessing
NASA Astrophysics Data System (ADS)
Edelson, R.; Gelbord, J.; Cackett, E.; Connolly, S.; Done, C.; Fausnaugh, M.; Gardner, E.; Gehrels, N.; Goad, M.; Horne, K.; McHardy, I.; Peterson, B. M.; Vaughan, S.; Vestergaard, M.; Breeveld, A.; Barth, A. J.; Bentz, M.; Bottorff, M.; Brandt, W. N.; Crawford, S. M.; Dalla Bontà, E.; Emmanoulopoulos, D.; Evans, P.; Figuera Jaimes, R.; Filippenko, A. V.; Ferland, G.; Grupe, D.; Joner, M.; Kennea, J.; Korista, K. T.; Krimm, H. A.; Kriss, G.; Leonard, D. C.; Mathur, S.; Netzer, H.; Nousek, J.; Page, K.; Romero-Colmenero, E.; Siegel, M.; Starkey, D. A.; Treu, T.; Vogler, H. A.; Winkler, H.; Zheng, W.
2017-05-01
Swift monitoring of NGC 4151 with an ˜6 hr sampling over a total of 69 days in early 2016 is used to construct light curves covering five bands in the X-rays (0.3-50 keV) and six in the ultraviolet (UV)/optical (1900-5500 Å). The three hardest X-ray bands (>2.5 keV) are all strongly correlated with no measurable interband lag, while the two softer bands show lower variability and weaker correlations. The UV/optical bands are significantly correlated with the X-rays, lagging ˜3-4 days behind the hard X-rays. The variability within the UV/optical bands is also strongly correlated, with the UV appearing to lead the optical by ˜0.5-1 days. This combination of ≳3 day lags between the X-rays and UV and ≲1 day lags within the UV/optical appears to rule out the “lamp-post” reprocessing model in which a hot, X-ray emitting corona directly illuminates the accretion disk, which then reprocesses the energy in the UV/optical. Instead, these results appear consistent with the Gardner & Done picture in which two separate reprocessings occur: first, emission from the corona illuminates an extreme-UV-emitting toroidal component that shields the disk from the corona; this then heats the extreme-UV component, which illuminates the disk and drives its variability.
Ploner, Stefan B; Moult, Eric M; Choi, WooJhon; Waheed, Nadia K; Lee, ByungKun; Novais, Eduardo A; Cole, Emily D; Potsaid, Benjamin; Husvogt, Lennart; Schottenhamml, Julia; Maier, Andreas; Rosenfeld, Philip J; Duker, Jay S; Hornegger, Joachim; Fujimoto, James G
2016-12-01
Currently available optical coherence tomography angiography systems provide information about blood flux but only limited information about blood flow speed. The authors develop a method for mapping the previously proposed variable interscan time analysis (VISTA) algorithm into a color display that encodes relative blood flow speed. Optical coherence tomography angiography was performed with a 1,050 nm, 400 kHz A-scan rate, swept source optical coherence tomography system using a 5 repeated B-scan protocol. Variable interscan time analysis was used to compute the optical coherence tomography angiography signal from B-scan pairs having 1.5 millisecond and 3.0 milliseconds interscan times. The resulting VISTA data were then mapped to a color space for display. The authors evaluated the VISTA visualization algorithm in normal eyes (n = 2), nonproliferative diabetic retinopathy eyes (n = 6), proliferative diabetic retinopathy eyes (n = 3), geographic atrophy eyes (n = 4), and exudative age-related macular degeneration eyes (n = 2). All eyes showed blood flow speed variations, and all eyes with pathology showed abnormal blood flow speeds compared with controls. The authors developed a novel method for mapping VISTA into a color display, allowing visualization of relative blood flow speeds. The method was found useful, in a small case series, for visualizing blood flow speeds in a variety of ocular diseases and serves as a step toward quantitative optical coherence tomography angiography.
Xu, Wei-Jian; He, Chun-Ting; Ji, Cheng-Min; Chen, Shao-Li; Huang, Rui-Kang; Lin, Rui-Biao; Xue, Wei; Luo, Jun-Hua; Zhang, Wei-Xiong; Chen, Xiao-Ming
2016-07-01
The changeable molecular dynamics of flexible polar cations in the variable confined space between inorganic chains brings about a new type of two-step nonlinear optical (NLO) switch with genuine "off-on-off" second harmonic generation (SHG) conversion between one NLO-active state and two NLO-inactive states. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Real-time optical laboratory solution of parabolic differential equations
NASA Technical Reports Server (NTRS)
Casasent, David; Jackson, James
1988-01-01
An optical laboratory matrix-vector processor is used to solve parabolic differential equations (the transient diffusion equation with two space variables and time) by an explicit algorithm. This includes optical matrix-vector nonbase-2 encoded laboratory data, the combination of nonbase-2 and frequency-multiplexed data on such processors, a high-accuracy optical laboratory solution of a partial differential equation, new data partitioning techniques, and a discussion of a multiprocessor optical matrix-vector architecture.
Electrowetting-Based Variable-Focus Lens for Miniature Systems
NASA Astrophysics Data System (ADS)
Hendriks, B. H. W.; Kuiper, S.; van As, M. A. J.; et al.
The meniscus between two immiscible liquids of different refractive indices can be used as a lens. A change in curvature of this meniscus by electrostatic control of the solid/liquid interfacial tension leads to a change in focal distance. It is demonstrated that two liquids in a tube form a self-centred variable-focus lens. The optical properties of this lens were investigated experimentally. We designed and constructed a miniature camera module based on this variable lens suitable for mobile applications. Furthermore, the liquid lens was applied in a Blu-ray Disc optical recording system to enable dual layer disc reading/writing.
Optical Spectra of Four Objects Identified with Variable Radio Sources
NASA Astrophysics Data System (ADS)
Chavushyan, V.; Mujica, R.; Gorshkov, A. G.; Konnikova, V. K.; Mingaliev, M. G.
2000-06-01
We obtained optical spectra of four objects identified with variable radio sources. Three objects (0029+0554, 0400+0550, 2245+0500) were found to be quasars with redshifts of 1.314, 0.761, and 1.091. One object (2349+0534) has a continuum spectrum characteristic of BL Lac objects. We analyze spectra of the radio sources in the range 0.97-21.7 GHz for the epoch 1997 and in the range 3.9-11.1 GHz for the epoch 1990, as well as the pattern of variability of their flux densities on time scales of 1.5 and 7 years.
Kepler Observations of Rapid Optical Variability in Active Galactic Nuclei
NASA Technical Reports Server (NTRS)
Mushotzky, R. F.; Edelson, R.; Baumgartner, W. H.; Gandhi, P.
2012-01-01
Over three quarters in 2010 - 2011, Kepler monitored optical emission from four active galactic nuclei (AGN) with approx 30 min sampling, > 90% duty cycle and approx < 0.1% repeatability. These data determined the AGN optical fluctuation power spectral density functions (PSDs) over a wide range in temporal frequency. Fits to these PSDs yielded power law slopes of -2.6 to -3.3, much steeper than typically seen in the X-rays. We find evidence that individual AGN exhibit intrinsically different PSD slopes. The steep PSD fits are a challenge to recent AGN variability models but seem consistent with first order MRI theoretical calculations of accretion disk fluctuations.
Double degree master program: Optical Design
NASA Astrophysics Data System (ADS)
Bakholdin, Alexey; Kujawinska, Malgorzata; Livshits, Irina; Styk, Adam; Voznesenskaya, Anna; Ezhova, Kseniia; Ermolayeva, Elena; Ivanova, Tatiana; Romanova, Galina; Tolstoba, Nadezhda
2015-10-01
Modern tendencies of higher education require development of master programs providing achievement of learning outcomes corresponding to quickly variable job market needs. ITMO University represented by Applied and Computer Optics Department and Optical Design and Testing Laboratory jointly with Warsaw University of Technology represented by the Institute of Micromechanics and Photonics at The Faculty of Mechatronics have developed a novel international master double-degree program "Optical Design" accumulating the expertise of both universities including experienced teaching staff, educational technologies, and experimental resources. The program presents studies targeting research and professional activities in high-tech fields connected with optical and optoelectronics devices, optical engineering, numerical methods and computer technologies. This master program deals with the design of optical systems of various types, assemblies and layouts using computer modeling means; investigation of light distribution phenomena; image modeling and formation; development of optical methods for image analysis and optical metrology including optical testing, materials characterization, NDT and industrial control and monitoring. The goal of this program is training a graduate capable to solve a wide range of research and engineering tasks in optical design and metrology leading to modern manufacturing and innovation. Variability of the program structure provides its flexibility and adoption according to current job market demands and personal learning paths for each student. In addition considerable proportion of internship and research expands practical skills. Some special features of the "Optical Design" program which implements the best practices of both Universities, the challenges and lessons learnt during its realization are presented in the paper.
The nature of the cataclysmic variable PT Per
NASA Astrophysics Data System (ADS)
Watson, M. G.; Bruce, A.; MacLeod, C.; Osborne, J. P.; Schwope, A. D.
2016-08-01
We present a study of the cataclysmic variable star PT Per based on archival XMM-Newton X-ray data and new optical spectroscopy from the William Herschel Telescope (WHT) with Intermediate dispersion Spectrograph and Imaging System (ISIS). The X-ray data show deep minima which recur at a period of 82 min and a hard, unabsorbed X-ray spectrum. The optical spectra of PT Per show a relatively featureless blue continuum. From an analysis of the X-ray and optical data we conclude that PT Per is likely to be a magnetic cataclysmic variable of the polar class in which the minima correspond to those phase intervals when the accretion column rotates out of the field of view of the observer. We suggest that the optical spectrum, obtained around 4 yr after the X-ray coverage, is dominated by the white dwarf in the system, implying that PT Per was in a low accretion state at the time of the observations. An analysis of the likely system parameters for PT Per suggests a distance of ≈90 pc and a very low mass secondary, consistent with the idea that PT Per is a `period-bounce' binary. Matching the observed absorption features in the optical spectrum with the expected Zeeman components constrains the white dwarf polar field to be Bp ≈ 25-27 MG.
Modeling, Simulation, and Analysis of a Decoy State Enabled Quantum Key Distribution System
2015-03-26
through the fiber , we assume Alice and Bob have correct basis alignment and timing control for reference frame correction and precise photon detection...optical components ( laser , polarization modulator, electronic variable optical attenuator, fixed optical attenuator, fiber channel, beamsplitter...generated by the laser in the CPG propagate through multiple optical components, each with a unique propagation delay before reaching the OPM. Timing
Light refraction in sapphire plates with a variable angle of crystal optical axis to the surface
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vetrov, V. N., E-mail: vasvetrov@mail.ru; Ignatenkov, B. A.
2013-05-15
The modification of sapphire by inhomogeneous plastic deformation makes it possible to obtain plates with a variable angle of inclination of the crystal optical axis to the plate surface. The refraction of light in this plate at perpendicular and oblique incidence of a parallel beam of rays is considered. The algorithm of calculating the refractive index of extraordinary ray and the birefringence is proposed.
A multichannel fiber optic photometer present performance and future developments
NASA Technical Reports Server (NTRS)
Barwig, H.; Schoembs, R.; Huber, G.
1988-01-01
A three channel photometer for simultaneous multicolor observations was designed with the aim of making possible highly efficient photometry of fast variable objects like cataclysmic variables. Experiences with this instrument over a period of three years are presented. Aspects of the special techniques applied are discussed with respect to high precision photometry. In particular, the use of fiber optics is critically analyzed. Finally, the development of a new photometer concept is discussed.
The eclipsing AM Herculis variable H1907 + 690
NASA Technical Reports Server (NTRS)
Remillard, R. A.; Silber, A.; Stroozas, B. A.; Tapia, S.
1991-01-01
The discovery is reported of an eclipsing cataclysmic variable that exhibits up to 10 percent circular polarization at optical wavelengths, securing its classification as an AM Herculis type binary. The object, H1907 + 609, was located with the guidance of X-ray positions from the HEAO 1 survey. Optical CCD photometry exhibits deep eclipses, from which is derived a precise orbital period of 1.743750 hr. The eclipse duration suggests an inclination angle about 80 deg for a main-sequence secondary star. The optical flux has been persistently faint during observations spanning 1987-1990, while the X-ray measurements suggest long-term X-ray variability. The polarization and photometric light curves can be interpreted with a geometric model in which most of the accretion is directed toward a single magnetic pole, with an accretion spot displaced about 17 deg in longitude from the projection of the secondary star on the white dwarf surface.
Variability of cirrus clouds in a convective outflow during the Hibiscus campaign
NASA Astrophysics Data System (ADS)
Fierli, F.; di Donfrancesco, G.; Cairo, F.; Marécal, V.; Zampieri, M.; Orlandi, E.; Durry, G.
2008-08-01
Light-weight microlidar and water vapour measurements were taken on-board a stratospheric balloon during the HIBISCUS 2004 campaign, held in Bauru, Brazil (49° W, 22° S). Cirrus clouds were observed throughout the flight between 12 and 15 km height with a high mesoscale variability in optical and microphysical properties. It was found that the cirrus clouds were composed of different layers characterized by marked differences in height, thickness and optical properties. Simultaneous water vapour observations show that the different layers are characterized by different values of the saturation with respect to ice. A mesoscale simulation and a trajectory analysis clearly revealed that the clouds had formed in the outflow of a large and persistent convective region and that the observed variability of the optical properties and of the cloud structure is likely linked to the different residence times of the convectively-processed air in the upper troposphere.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lipunov, Vladimir M.; Kornilov, V.; Vlasenko, D.
On 2015 June 15, the Swift space observatory discovered that the Galactic black hole candidate V404 Cyg was undergoing another active X-ray phase, after 25 years of inactivity. The 12 telescopes of the MASTER Global Robotic Net located at six sites across four continents were the first ground-based observatories to start optical monitoring of the microquasar after its gamma-ray wake up at 18{sup h} 34{sup m} 09{sup s} U.T. on 2015 June 15. In this paper, we report, for the first time, the discovery of variable optical linear polarization, changing by 4%–6% over a timescale of ∼1 hr, on twomore » different epochs. We can conclude that the additional variable polarization arises from the relativistic jet generated by the black hole in V404 Cyg. The polarization variability correlates with optical brightness changes, increasing when the flux decreases.« less
Bidirectional optical bistability in a dual-pumped erbium doped fiber ring laser.
Lai, W J; Shum, P; Binh, L
2004-11-15
We investigate bidirectional optical wave propagations in a dual-pumped erbium doped fiber ring laser without isolator, and observe optical bistability behaviors. Consequently, we propose and construct a NOLM-NALM fiber ring laser to demonstrate and exploit this bidirectional optical bistability phenomenon in optical switching by introducing two tunable variable ratio couplers in the system. Numerical analyses based on the proposed laser structure have also been demonstrated corroborated with the experimental results.
From crystal morphology to molecular and scale crystallography
NASA Astrophysics Data System (ADS)
Janner, A.; Janssen, T.
2015-08-01
A number of topics, ranging from morphology of aperiodic crystals to indexed enclosing forms of axial-symmetric proteins, nucleic acids and viruses, have been selected among those investigated by the authors in 50 years of research. The basic symmetries involved in fields like superspace, molecular and scale crystallography, are considered from a personal point of view in their time evolution. A number of specific subjects follow, chosen among a few highlights and presented according to the experience of the authors: snow crystals, calaverite {{AuTe}}2, the incommensurately modulated crystals {{Rb}}2{{ZnBr}}4, {[{N}{({{CH}}3)}4]}2{{ZnCl}}4 and the mitochondrial ferritin.
1 Hz FLARING IN SAX J1808.4-3658: FLOW INSTABILITIES NEAR THE PROPELLER STAGE
DOE Office of Scientific and Technical Information (OSTI.GOV)
Patruno, Alessandro; Watts, Anna; Klein Wolt, Marc
2009-12-20
We present a simultaneous periodic and aperiodic timing study of the accreting millisecond X-ray pulsar SAX J1808.4-3658. We analyze five outbursts of the source and for the first time provide a full and systematic investigation of the enigmatic phenomenon of the 1 Hz flares observed during the final stages of some of the outbursts. We show that links between pulsations and 1 Hz flares might exist, and suggest that they are related with hydrodynamic disk instabilities that are triggered close to the disk-magnetosphere boundary layer when the system is entering the propeller regime.
Searching for intermediate-mass black holes via optical variability
NASA Astrophysics Data System (ADS)
Adler-Levine, Ryan; Moran, Edward C.; Kay, Laura
2018-01-01
A handful of nearby dwarf galaxies with intermediate-mass black holes (IMBHs) in their nuclei display significant optical variability on short timescales. To investigate whether dwarf galaxy AGNs as a class exhibit similar variability, we have monitored a sample of low-mass galaxies that possess spectroscopically confirmed type 1 AGNs. However, because of the variations in seeing, focus, and guiding errors that occur in images taken at different epochs, analyses based on aperture photometry are ineffective. We have thus developed a new method for matching point-spread functions in images that permits use of image subtraction photometry techniques. Applying this method to our photometric data, we have confirmed that several galaxies with IMBHs are indeed variable, which suggests that variability can be used to search for IMBHs in low-mass galaxies whose emission-line properties are ambiguous.
Nath, Shikhasmita; Nath, Arun Jyoti; Das, Ashesh Kumar
2016-03-01
Vegetative and reproductive phenology of Barringtonia acutangula, a floodplain tree species was studied at Chatla floodplain, Assam North East India with the aim to investigate vegetative and reproductive phenology under stressful environment of seasonal submergence and to assess the impact of environmental variables (temperature and precipitation) on tree phenophases. Quantitative assessment was made at 15 day interval for all the phenophases (leaf initiation, leaf-fall, flowering and fruiting) by tagging 40 (forty) trees over aperiod of two years (2012-14).To test seasonal influence on the phenology of Barringtonia acutangula different phenophases were correlated with environmental variables and statistical spearman's rank correlation coefficient was employed. Aridity index was computed that delineate influence of rainfall and temperature together on any phenophases. Leaf initiation showed positively significant correlation with temperature (r(s) = 0.601, p = < .05) during the year 2012-2013 whereas it was significantly correlated with rainfall (r(s) = 0.583, p = < .05) and aridity index (r(s) = 0.583, p = < .05) during the year 2013-2014. Leaf-fall was significant negatively correlated with temperature (r(s) = -0.623, p = < .05), rainfall (r(s) = -0.730, p = < .01) and aridity index (r(s) = -0.730, p = < .01) for both the studied years. Flowering was significantly influenced by temperature (r(s) = 0.639, p = < .05), rainfall (r(s) = 0.890, p = < .01) and aridity index (r(s) = 0.890, p = < .01) while in one month lag flowering was significantly correlated with rainfall (r(s) = 0.678, p = < .01) in 2012-13. Fruiting was also positively significant with temperature (r(s) = 0.795, P < .05), rainfall (r(s) = 0.835, P < .01) and aridity index (r(s) = 0.835, P < .01) for both the years. During one month lag period fruiting was positively correlated with temperature, rainfall and aridity index in both the years. Temperature, rainfall and aridity index were major determinants of the various vegetative and reproductive phenology of B. acutangula and any changes in these variables in future due to climate change, might have profound effect on phenophases of this tree species.
NASA Astrophysics Data System (ADS)
Matteo, D.; Wright, S. J.; Davies, S. J.; Muller-Landau, H. C.; Wolfe, B.; Detto, M.
2016-12-01
Phenology, by controlling the rhythms of plants, plays a fundamental role in regulating access to resources, ecosystem processes, competition among species, interactions with consumers and feedbacks to the climate. In high biodiverse tropical forests, where phenology of flowering and leafing are complex, an adequate representation of phenology must take into account a given set of climatic, edaphic and biotic factors. Climatic factors are particularly important because plants may use them as cues for timing different phenological phases and be influenced by their intensity. Climatic variability can be periodic, if events occur with regular frequency, or aperiodic. One prominent periodic large-scale pattern that causes unusual weather is ENSO event. In general, Central America tends to be dry and warm during a mature phase of an ENSO event, which usually peaks between October and January with a frequency of 2-3 events per decade. Because in many tropical areas the effect of ENSO is highly prominent, it is plausible that plants have adapted their growth and reproduction mechanisms to synchronize ENSO phases, in a similar way that plants do during the seasonal cycle. We used a long dataset (30+ years) of fruits and leaves rains of tropical trees and lianas to determine ecosystem response and species specific response of these phenological events to local climate variability corresponding to the modes of ENSO. Specifically, we tested the hypothesis that phenological responses to ENSO are similar to response to seasonal cycles, i.e., higher litterfall before a warm-dry phase and higher fruiting after such phase, with strong correlation between seeds and leaves. At sub-community level, we evaluated whether evergreen and deciduous, biotic and abiotic dispersers and free and climbing life forms, have the same response to ENSO in terms of leaves and seeds rain. At species level we tested the hypothesis that species with low photosynthetic capacity leaves are more responsive to ENSO in relation to variation in solar radiation. High Amax is usually associated with light-demanding, fast growing, gap species. These species must disperse seeds to ephemeral gaps to germinate successfully. Consequently they strategize to have more even seed fall across years
Results of X-ray and optical monitoring of SCO X-1
NASA Technical Reports Server (NTRS)
Mook, D. E.; Messina, R. J.; Hiltner, W. A.; Belian, R.; Conner, J.; Evans, W. D.; Strong, I.; Blanco, V.; Hesser, J.; Kunkel, W.
1974-01-01
Sco X-1 was monitored at optical and X-ray wavelengths from 1970 April 26 to 1970 May 21. The optical observations were made at six observatories around the world and the X-ray observations were made by the Vela satellites. There was a tendency for the object to show greater variability in X-ray when the object is optically bright. A discussion of the intensity histograms is presented for both the optical and X-ray observations. No evidence for optical or X-ray periodicity was detected.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Beskin, G.; Karpov, S.; Bondar, S.
We imaged the position of the naked-eye burst, GRB080319B, before, during, and after its gamma-ray activity with sub-second temporal resolution using the TORTORA wide-field camera. The burst optical prompt emission, which reached 5.3 mag, has been detected, and its periodic optical variability has been discovered in the form of four equidistant flashes with a duration of several seconds. We also detected a strong correlation (r {approx} 0.82) between optical and gamma-ray light curves with a 2 s delay of the optical emission with respect to the gamma-ray emission. The revealed temporal structure of the optical light curve in comparison withmore » the gamma-ray light curve can be interpreted in the framework of the model of shell collisions in the ejecta containing a significant neutron component. All observed emission features reflect the non-stationary behavior of the burst internal engine-supposedly, a hyperaccreting solar-mass black hole formed in the collapse of a massive stellar core.« less
Relaxation method of compensation in an optical correlator
NASA Technical Reports Server (NTRS)
Juday, Richard D.; Daiuto, Brian J.
1987-01-01
An iterative method is proposed for the sharpening of programmable filters in a 4-f optical correlator. Continuously variable spatial light modulators (SLMs) permit the fine adjustment of optical processing filters so as to compensate for the departures from ideal behavior of a real optical system. Although motivated by the development of continuously variable phase-only SLMs, the proposed sharpening method is also applicable to amplitude modulators and, with appropriate adjustments, to binary modulators as well. A computer simulation is presented that illustrates the potential effectiveness of the method: an image is placed on the input to the correlator, and its corresponding phase-only filter is adjusted (allowed to relax) so as to produce a progressively brighter and more centralized peak in the correlation plane. The technique is highly robust against the form of the system's departure from ideal behavior.
Design of a variable-focal-length optical system
NASA Technical Reports Server (NTRS)
Ricks, D.; Shannon, R. R.
1984-01-01
Requirements to place an entire optical system with a variable focal length ranging from 20 to 200 cm within a overall length somewhat less than 100 cm placed severe restrictions on the design of a zoom lens suitable for use on a comet explorer. The requirements of a wavelength range of 0.4 to 1.0 microns produced even greater limitations on the possibilities for a design that included a catadioptric (using mirrors and glass) front and followed by a zooming refractive portion. Capabilities available commercial zoom lenses as well as patents of optical systems are reviewed. Preliminary designs of the refractive optics zoom lens and the catadioptric system are presented and evaluated. Of the two, the latter probably has the best chance of success, so long as the shortest focal lengths are not really needed.
Swift Monitoring of NGC 4151: Evidence for a Second X-Ray/UV Reprocessing
DOE Office of Scientific and Technical Information (OSTI.GOV)
Edelson, R.; Gelbord, J.; Cackett, E.
Swift monitoring of NGC 4151 with an ∼6 hr sampling over a total of 69 days in early 2016 is used to construct light curves covering five bands in the X-rays (0.3–50 keV) and six in the ultraviolet (UV)/optical (1900–5500 Å). The three hardest X-ray bands (>2.5 keV) are all strongly correlated with no measurable interband lag, while the two softer bands show lower variability and weaker correlations. The UV/optical bands are significantly correlated with the X-rays, lagging ∼3–4 days behind the hard X-rays. The variability within the UV/optical bands is also strongly correlated, with the UV appearing to leadmore » the optical by ∼0.5–1 days. This combination of ≳3 day lags between the X-rays and UV and ≲1 day lags within the UV/optical appears to rule out the “lamp-post” reprocessing model in which a hot, X-ray emitting corona directly illuminates the accretion disk, which then reprocesses the energy in the UV/optical. Instead, these results appear consistent with the Gardner and Done picture in which two separate reprocessings occur: first, emission from the corona illuminates an extreme-UV-emitting toroidal component that shields the disk from the corona; this then heats the extreme-UV component, which illuminates the disk and drives its variability.« less
T.F. Eck; B.N. Holben; J.S. Reid; A. Sinyuk; E.J. Hyer; N.T. O' Neill; G.E. Shaw; J.R. Vande Castle; F.S. Chapin; O. Dubovik; A. Smirnov; E. Vermote; J.S. Schafer; D. Giles; I. Slutsker; M. Sorokine; W.W. Newcomb
2009-01-01
Long-term monitoring of aerosol optical properties at a boreal forest AERONET site in interior Alaska was performed from 1994 through 2008 (excluding winter), Large interannual variability was observed, with some years showing near background aerosol optical depth (AOD) levels while 2004 and 2005 had August monthly means similar in magnitude to peak months at major...
Phytoplankton production in the Sargasso Sea as determined using optical mooring data
NASA Technical Reports Server (NTRS)
Waters, K. J.; Smith, R. C.; Marra, J.
1994-01-01
Optical measurements from an untended mooring provide high-frequency observations of in-water optical properties and permit the estimation of important biological parameters continuously as a function of time. A 9-month time series, composed of three separate deployments, of optical data from the BIOWATT 1987 deep-sea mooring located in the oligotrophic waters of the Sargasso Sea at 34 deg N, 70 deg W are presented. These data have been tested using several bio-optical models for the purpose of providing a continuous estimate of phytoplankton productivity. The data are discussed in the context of contemporaneous shipboard observations and for future ocean color satellite observations. We present a continuous estimation of phytoplankton productivity for the 9-month time series. Results from the first 70-day deployment are emphasized to demonstrate the utility of optical observations as proxy measures of biological parameters, to present preliminary analysis, and to compare our bio-optical observations with concurrent physical observations. The bio-optical features show variation in response to physical forcings including diel variations of incident solar irradiance, episodic changes corresponding to wind forcing, variability caused by advective mesoscale eddy events in the vicinity of the mooring, and seasonal variability corresponding to changes in solar radiation, shoaling of the mixed layer depth, and succession of phytoplankton populations.
NASA Technical Reports Server (NTRS)
Zhou, Andy F.; Erwin, J. Kevin; Mansuripur, M.
1992-01-01
A new and comprehensive dielectric tensor characterization instrument is presented for characterization of magneto-optical recording media and non-magnetic thin films. Random and systematic errors of the system are studied. A series of TbFe, TbFeCo, and Co/Pt samples with different composition and thicknesses are characterized for their optical and magneto-optical properties. The optical properties of several non-magnetic films are also measured.
Study of optical microvariability in the blazar 1ES1011+496
NASA Astrophysics Data System (ADS)
Sosa, M. S.; von Essen, C.; Cellone, S. A.; Andruchow, I.; Schmitt, J. H. M. M.
We carried out a study of photometric variability of the blazar 1ES1011+496 using the 1.20 m Oskar Lühning telescope located at Ham- burger Sternwarte Institute, Germany. This object has been detected at hight energies ( 200 GeV), so it is of interest to characterize its behavior in the optical range. We obtained the light curves in B, V and R bands through dif- ferential photometry, with a time resolution of 15 minutes over 8 nights. We did not detect inter-night variability, but we detected a marginally sig- nificant variability in temporal scales of a few days.
2013-09-30
Vision Floc Camera (MVFC), a Sequoia Scientific LISST 100x Type B, an RBR CTD, and two pressure-actuated Niskin bottles. The Niskin bottles were...Eco bb2fl, that measures 3 backscattering at 532 and 650 nm and CDOM fluorescence, a WetLabs WetStar CDOM fluorometer, a Sequoia Scientific flow
Integrated Microfluidic Variable Optical Attenuator
2005-11-28
Quantum Electron. 5, pp. 1289–1297 (1999). 5. G. Z. Xiao, Z. Zhang, and C. P. Grover, “A variable optical attenuator based on a straight polymer –silica...1998). 18. Y. Huang, G.T. Paloczi, J. K. S. Poon, and A. Yariv, “Bottom-up soft-lithographic fabrication of three- dimensional multilayer polymer ...quality without damaging polymer materials under high temperatures, resulting in a core index of 1.561 and cladding index of 1.546. The refractive
Development and characterisation of FPGA modems using forward error correction for FSOC
NASA Astrophysics Data System (ADS)
Mudge, Kerry A.; Grant, Kenneth J.; Clare, Bradley A.; Biggs, Colin L.; Cowley, William G.; Manning, Sean; Lechner, Gottfried
2016-05-01
In this paper we report on the performance of a free-space optical communications (FSOC) modem implemented in FPGA, with data rate variable up to 60 Mbps. To combat the effects of atmospheric scintillation, a 7/8 rate low density parity check (LDPC) forward error correction is implemented along with custom bit and frame synchronisation and a variable length interleaver. We report on the systematic performance evaluation of an optical communications link employing the FPGA modems using a laboratory test-bed to simulate the effects of atmospheric turbulence. Log-normal fading is imposed onto the transmitted free-space beam using a custom LabVIEW program and an acoustic-optic modulator. The scintillation index, transmitted optical power and the scintillation bandwidth can all be independently varied allowing testing over a wide range of optical channel conditions. In particular, bit-error-ratio (BER) performance for different interleaver lengths is investigated as a function of the scintillation bandwidth. The laboratory results are compared to field measurements over 1.5km.
NASA Astrophysics Data System (ADS)
Ram, Kirpa; Singh, Sunita; Sarin, M. M.; Srivastava, A. K.; Tripathi, S. N.
2016-06-01
In this study, we report on three important optical parameters, viz. absorption and scattering coefficients (babs, bscat) and single scattering abledo (SSA) based on one-year chemical-composition data collected from an urban site (Kanpur) in the Indo-Gangetic-Plain (IGP) of northern India. In addition, absorption Ängstrom exponent (AAE) was also estimated in order to understand the wavelength dependence of absorption and to decipher emission sources of carbonaceous aerosols, in particular of black carbon. The absorption and scattering coefficients ranged between 8.3 to 95.2 Mm- 1 (1 Mm- 1 = 10- 6 m- 1) and 58 to 564 Mm- 1, respectively during the study period (for n = 66; from January 2007 to March 2008) and exhibit large seasonal variability with higher values occurring in winter and lower in the summer. Single scattering albedo varied from 0.65 to 0.92 whereas AAE ranged from 0.79 to 1.40 during pre-monsoon and winter seasons, respectively. The strong seasonal variability in aerosol optical properties is attributed to varying contribution from different emission sources of carbonaceous aerosols in the IGP. A case study of haze and dust events further provide information on extreme variability in aerosol optical parameters, particularly SSA, a crucial parameter in atmospheric radiative forcing estimates.
NASA Technical Reports Server (NTRS)
Courvoisier, T. J.-L.; Blecha, A.; Bouchet, P.; Bratschi, P.; Carini, M. T.; Donahue, M.; Edelson, R.; Feigelson, E. D.; Filippenko, A. V.; Glass, I. S.
1995-01-01
We present ground-based observations of the BL Lac object PKS 2155-304 during 1991 November. These data were obtained as part of a large international campaign of observations spanning the electro-magnetic spectrum from the radio waves to the X-rays. The data presented here include radio and UBVRI fluxes, as well as optical polarimetry. The U to I data show the same behavior in all bands and that only upper limits to any lag can be deduced from the cross-correlation of the light curves. The spectral slope in the U-I domain remained constant on all epochs but 2. There is no correlation between changes in the spectral slope and large variations in the total or polarized flux. The radio flux variations did not follow the same pattern of variability as the optical and infrared fluxes. The polarized flux varied by a larger factor than the total flux. The variations of the polarized flux are poorly correlated with those of the total flux in the optical (and hence UV domain; see the accompanying paper by Edelson et al.) nor with those of the soft X-rays. We conclude that the variability of PKS 2155-304 in the optical and near-infrared spectral domains are easier to understand in the context of variable geometry or bulk Lorentz factor than of variable electron acceleration and cooling rates.
NASA Astrophysics Data System (ADS)
Zeng, Wei; Zhao, Qing-Jiang; Dai, Ben-Zhong; Jiang, Ze-Jun; Geng, Xiong-Fei; Yang, Shen-Bang; Liu, Zhen; Wang, Dong-Dong; Feng, Zhang-Jing; Zhang, Li
2018-02-01
We present long-term optical multi-band photometric monitoring of blazar 3C 273, from 2006 May 19 to 2015 March 31 with high temporal resolution in the BVRI bands. The source is in a steady state and showed very small variability, with the values of the fractional variability amplitude of {F}{var}=0.457+/- 0.014 % , 0.391+/- 0.012 % , 0.264+/- 0.043 % and 0.460+/- 0.014 % in B, V, R and I, respectively. The intra-night point-to-point fractional variability (F pp ) in each band is below 1.0%, and the F pp variation amplitude increase from the B-band to the I-band. We find a variability with the timescale of 5.8 ± 2.9 minutes in the I-band on 2009 March 11. This fast variability requires the comoving magnetic field strength in the jet above 18 G with a Doppler factor {δ }D∼ 10. Using the discrete correlation function (DCF), the B- and I-band light curves are examined for correlation on whole campaign. Low significance (∼99.73 percent confidence) correlations with the I-band lags the B-band variations are observed. The spectral behaviors in the different variability episodes are studied. “Bluer-when-brighter” spectral behavior is presented for the whole campaign, while there is an opposite tendency when {{{F}}}V> 30.2 {mJy}. The weak of the correlation between B- and I-band and the spectrum analysis indicate that the optical radiation consists of two variable components.
Anatomy of the AGN in NGC 5548. VII. Swift study of obscuration and broadband continuum variability
NASA Astrophysics Data System (ADS)
Mehdipour, M.; Kaastra, J. S.; Kriss, G. A.; Cappi, M.; Petrucci, P.-O.; De Marco, B.; Ponti, G.; Steenbrugge, K. C.; Behar, E.; Bianchi, S.; Branduardi-Raymont, G.; Costantini, E.; Ebrero, J.; Di Gesu, L.; Matt, G.; Paltani, S.; Peterson, B. M.; Ursini, F.; Whewell, M.
2016-04-01
We present our investigation into the long-term variability of the X-ray obscuration and optical-UV-X-ray continuum in the Seyfert 1 galaxy NGC 5548. In 2013 and 2014, the Swift observatory monitored NGC 5548 on average every day or two, with archival observations reaching back to 2005, totalling about 670 ks of observing time. Both broadband spectral modelling and temporal rms variability analysis are applied to the Swift data. We disentangle the variability caused by absorption, due to an obscuring weakly-ionised outflow near the disk, from variability of the intrinsic continuum components (the soft X-ray excess and the power law) originating in the disk and its associated coronae. The spectral model that we apply to this extensive Swift data is the global model that we derived for NGC 5548 from analysis of the stacked spectra from our multi-satellite campaign of 2013 (including XMM-Newton, NuSTAR, and HST). The results of our Swift study show that changes in the covering fraction of the obscurer is the primary and dominant cause of variability in the soft X-ray band on timescales of 10 days to ~5 months. The obscuring covering fraction of the X-ray source is found to range between 0.7 and nearly 1.0. The contribution of the soft excess component to the X-ray variability is often much less than that of the obscurer, but it becomes comparable when the optical-UV continuum flares up. We find that the soft excess is consistent with being the high-energy tail of the optical-UV continuum and can be explained by warm Comptonisation: up-scattering of the disk seed photons in a warm, optically thick corona as part of the inner disk. To this date, the Swift monitoring of NGC 5548 shows that the obscurer has been continuously present in our line of sight for at least 4 years (since at least February 2012).
NASA Astrophysics Data System (ADS)
Li, Ming-Zhen; Tian, Bo; Qu, Qi-Xing; Chai, Han-Peng; Liu, Lei; Du, Zhong
2017-12-01
In this paper, under investigation is a coupled variable-coefficient higher-order nonlinear Schrödinger system, which describes the simultaneous propagation of optical pulses in an inhomogeneous optical fiber. Based on the Lax pair and binary Darboux transformation, we present the nondegenerate N-dark-dark soliton solutions. With the graphical simulation, soliton propagation and interaction are discussed with the group velocity dispersion and fourth-order dispersion effects, which affect the velocity but have no effect on the amplitude. Linear, parabolic and periodic one dark-dark solitons are displayed. Interactions between the two solitons are presented as well, which are all elastic.
NASA Astrophysics Data System (ADS)
Sun, Yan; Tian, Bo; Wu, Xiao-Yu; Liu, Lei; Yuan, Yu-Qiang
2017-04-01
Under investigation in this paper is a variable-coefficient higher-order nonlinear Schrödinger equation, which has certain applications in the inhomogeneous optical fiber communication. Through the Hirota method, bilinear forms, dark one- and two-soliton solutions for such an equation are obtained. We graphically study the solitons with d1(z), d2(z) and d3(z), which represent the variable coefficients of the group-velocity dispersion, third-order dispersion and fourth-order dispersion, respectively. With the different choices of the variable coefficients, we obtain the parabolic, periodic and V-shaped dark solitons. Head-on and overtaking collisions are depicted via the dark two soliton solutions. Velocities of the dark solitons are linearly related to d1(z), d2(z) and d3(z), respectively, while the amplitudes of the dark solitons are not related to such variable coefficients.
Optoacoustic Monitoring of Physiologic Variables
Esenaliev, Rinat O.
2017-01-01
Optoacoustic (photoacoustic) technique is a novel diagnostic platform that can be used for noninvasive measurements of physiologic variables, functional imaging, and hemodynamic monitoring. This technique is based on generation and time-resolved detection of optoacoustic (thermoelastic) waves generated in tissue by short optical pulses. This provides probing of tissues and individual blood vessels with high optical contrast and ultrasound spatial resolution. Because the optoacoustic waves carry information on tissue optical and thermophysical properties, detection, and analysis of the optoacoustic waves allow for measurements of physiologic variables with high accuracy and specificity. We proposed to use the optoacoustic technique for monitoring of a number of important physiologic variables including temperature, thermal coagulation, freezing, concentration of molecular dyes, nanoparticles, oxygenation, and hemoglobin concentration. In this review we present origin of contrast and high spatial resolution in these measurements performed with optoacoustic systems developed and built by our group. We summarize data obtained in vitro, in experimental animals, and in humans on monitoring of these physiologic variables. Our data indicate that the optoacoustic technology may be used for monitoring of cerebral blood oxygenation in patients with traumatic brain injury and in neonatal patients, central venous oxygenation monitoring, total hemoglobin concentration monitoring, hematoma detection and characterization, monitoring of temperature, and coagulation and freezing boundaries during thermotherapy. PMID:29311964
Optoacoustic Monitoring of Physiologic Variables.
Esenaliev, Rinat O
2017-01-01
Optoacoustic (photoacoustic) technique is a novel diagnostic platform that can be used for noninvasive measurements of physiologic variables, functional imaging, and hemodynamic monitoring. This technique is based on generation and time-resolved detection of optoacoustic (thermoelastic) waves generated in tissue by short optical pulses. This provides probing of tissues and individual blood vessels with high optical contrast and ultrasound spatial resolution. Because the optoacoustic waves carry information on tissue optical and thermophysical properties, detection, and analysis of the optoacoustic waves allow for measurements of physiologic variables with high accuracy and specificity. We proposed to use the optoacoustic technique for monitoring of a number of important physiologic variables including temperature, thermal coagulation, freezing, concentration of molecular dyes, nanoparticles, oxygenation, and hemoglobin concentration. In this review we present origin of contrast and high spatial resolution in these measurements performed with optoacoustic systems developed and built by our group. We summarize data obtained in vitro , in experimental animals, and in humans on monitoring of these physiologic variables. Our data indicate that the optoacoustic technology may be used for monitoring of cerebral blood oxygenation in patients with traumatic brain injury and in neonatal patients, central venous oxygenation monitoring, total hemoglobin concentration monitoring, hematoma detection and characterization, monitoring of temperature, and coagulation and freezing boundaries during thermotherapy.
NASA Astrophysics Data System (ADS)
Mizubayashi, Keiko; Kuwahara, Victor S.; Segaran, Thirukanthan C.; Zaleha, Kassim; Effendy, A. W. M.; Kushairi, M. R. M.; Toda, Tatsuki
2013-07-01
The East coast of Peninsular Malaysia is strongly influenced by the North-East (NE) monsoon, and may significantly influence the optical environment of coral-reef ecosystems. However, our knowledge of temporal variability, including episodic events, of environmental factors in Asian tropical regions is still limited. The objectives of this study were to (1) observe temporal variability in ultraviolet radiation (UVR) and photosynthetically active radiation (PAR) attenuation and (2) determine the bio-optical factors regulating the optical environment in shallow coral-reef waters. Downwelling UVR and PAR irradiance and in situ bio-optical factors were measured monthly near Bidong Island on the East coast of Peninsular Malaysia from June 2010 to June 2011. The NE monsoon was recognized between November 2010 and January 2011. The highest diffuse attenuation coefficient at 305 nm was 2.05 ± 0.03 m-1 in a coral-reef area on December 2010. The most significant bio-optical factor at 305, 380, 440 nm during the NE monsoon season was CDOM (89 ± 8% at 305 nm, 84 ± 9% at 380 nm and 49 ± 17% at 440 nm). All UVR attenuation coefficients showed significant correlations with the CDOM absorption coefficients (aCDOM). CDOM with relatively low S275-295 during the NE monsoon season (0.0177 ± 0.0020 nm-1) suggests terrestrial sources, which is also supported by the correlation between salinity and aCDOM(305). A significant correlation between S275-295 and the carbon specific absorbance coefficient (a*(305)) suggest the potential to measure DOC optically in these waters. The high CDOM during the NE monsoon season may have an important role to reduce harmful UVR exposure reaching benthic communities.
Polarization imaging apparatus
NASA Technical Reports Server (NTRS)
Zou, Yingyin Kevin (Inventor); Chen, Qiushui (Inventor); Zhao, Hongzhi (Inventor)
2010-01-01
A polarization imaging apparatus measures the Stokes image of a sample. The apparatus consists of an optical lens set 11, a linear polarizer 14 with its optical axis 18, a first variable phase retarder 12 with its optical axis 16 aligned 22.5.degree. to axis 18, a second variable phase retarder 13 with its optical axis 17 aligned 45.degree. to axis 18, a imaging sensor 15 for sensing the intensity images of the sample, a controller 101 and a computer 102. Two variable phase retarders 12 and 13 were controlled independently by a computer 102 through a controller unit 101 which generates a sequential of voltages to control the phase retardations of VPRs 12 and 13. A set of four intensity images, I.sub.0, I.sub.1, I.sub.2 and I.sub.3 of the sample were captured by imaging sensor 15 when the phase retardations of VPRs 12 and 13 were set at (0,0), (.pi.,0), (.pi.,.pi.) and (.pi./2,.pi.), respectively Then four Stokes components of a Stokes image, S.sub.0, S.sub.1, S.sub.2 and S.sub.3 were calculated using the four intensity images.
NASA Astrophysics Data System (ADS)
Oelkers, Ryan J.; Macri, Lucas M.; Marshall, Jennifer L.; DePoy, Darren L.; Lambas, Diego G.; Colazo, Carlos; Stringer, Katelyn
2016-09-01
The past two decades have seen a significant advancement in the detection, classification, and understanding of exoplanets and binaries. This is due, in large part, to the increase in use of small-aperture telescopes (<20 cm) to survey large areas of the sky to milli-mag precision with rapid cadence. The vast majority of the planetary and binary systems studied to date consists of main-sequence or evolved objects, leading to a dearth of knowledge of properties at early times (<50 Myr). Only a dozen binaries and one candidate transiting Hot Jupiter are known among pre-main-sequence objects, yet these are the systems that can provide the best constraints on stellar formation and planetary migration models. The deficiency in the number of well characterized systems is driven by the inherent and aperiodic variability found in pre-main-sequence objects, which can mask and mimic eclipse signals. Hence, a dramatic increase in the number of young systems with high-quality observations is highly desirable to guide further theoretical developments. We have recently completed a photometric survey of three nearby (<150 pc) and young (<50 Myr) moving groups with a small-aperture telescope. While our survey reached the requisite photometric precision, the temporal coverage was insufficient to detect Hot Jupiters. Nevertheless, we discovered 346 pre-main-sequence binary candidates, including 74 high-priority objects for further study. This paper includes data taken at The McDonald Observatory of The University of Texas at Austin.
Saunders, Jeffrey A.
2014-01-01
Direction of self-motion during walking is indicated by multiple cues, including optic flow, nonvisual sensory cues, and motor prediction. I measured the reliability of perceived heading from visual and nonvisual cues during walking, and whether cues are weighted in an optimal manner. I used a heading alignment task to measure perceived heading during walking. Observers walked toward a target in a virtual environment with and without global optic flow. The target was simulated to be infinitely far away, so that it did not provide direct feedback about direction of self-motion. Variability in heading direction was low even without optic flow, with average RMS error of 2.4°. Global optic flow reduced variability to 1.9°–2.1°, depending on the structure of the environment. The small amount of variance reduction was consistent with optimal use of visual information. The relative contribution of visual and nonvisual information was also measured using cue conflict conditions. Optic flow specified a conflicting heading direction (±5°), and bias in walking direction was used to infer relative weighting. Visual feedback influenced heading direction by 16%–34% depending on scene structure, with more effect with dense motion parallax. The weighting of visual feedback was close to the predictions of an optimal integration model given the observed variability measures. PMID:24648194
Optical, near, infrared and ultraviolet monitoring of the Seyfert 1 galaxy Markarian 335
NASA Technical Reports Server (NTRS)
Shrader, Chris R.; Sun, W.-H.; Turner, T. J.; Hintzen, P. M.
1990-01-01
Preliminary results of a multifrequency monitoring campaign for the bright, Seyfert 1 galactic nuclei Mkn335 are presented. Nearly uniform sampling at 3 day intervals is achieved quasi simultaneously at each wavelength band. Wavelength dependent variability is seen at the 20 to 30 percent level. Interpretation of variability in terms of geometrically thin, optically thick accretion disk models is discussed. The inferred blackhole masses and accretion rates are discussed. Possible correlation between continuum and emission line variations is discussed.
X-ray and optical observations of 2 new cataclysmic variables
NASA Technical Reports Server (NTRS)
Singh, K. P.; Szkody, P.; Barrett, P.; Schlegel, E.; White, N. E.; Silber, A.; Fierce, E.; Hoard, D.; Hakala, P. J.; Piirola, V.;
1996-01-01
The light curves and spectra of two ultra soft X-ray sources are presented. The sources, WGAJ 1047.1+6335 and WGAJ 1802.1+1804 were discovered during a search using the Rosat position sensitive proportional counter (PSPC). The X-ray spectra of both objects show an unusually strong black body component with respect to the harder bremsstrahlung component. Based on the optical observations and on the analysis of the X-ray data, the two objects are identified with new AM Her type cataclysmic variables.
Stitching of near-nulled subaperture measurements
NASA Technical Reports Server (NTRS)
Devries, Gary (Inventor); Brophy, Christopher (Inventor); Forbes, Greg (Inventor); Murphy, Paul (Inventor)
2012-01-01
A metrology system for measuring aspheric test objects by subaperture stitching. A wavefront-measuring gauge having a limited capture range of wavefront shapes collects partially overlapping subaperture measurements over the test object. A variable optical aberrator reshapes the measurement wavefront with between a limited number of the measurements to maintain the measurement wavefront within the capture range of the wavefront-measuring gauge. Various error compensators are incorporated into a stitching operation to manage residual errors associated with the use of the variable optical aberrator.
Spencer, R.G.M.; Pellerin, B.A.; Bergamaschi, B.A.; Downing, B.D.; Kraus, T.E.C.; Smart, D.R.; Dahlgren, R.A.; Hernes, P.J.
2007-01-01
Dissolved organic matter (DOM) concentration and composition in riverine and stream systems are known to vary with hydrological and productivity cycles over the annual and interannual time scales. Rivers are commonly perceived as homogeneous with respect to DOM concentration and composition, particularly under steady flow conditions over short time periods. However, few studies have evaluated the impact of short term variability ( < 1 day) on DOM dynamics. This study examined whether diurnal processes measurably altered DOM concentration and composition in the hypereutrophic San Joaquin River (California) during a relatively quiescent period. We evaluated the efficacy of using optical in situ measurements to reveal changes in DOM which may not be evident from bulk dissolved organic carbon (DOC) measurement alone. The in situ optical measurements described in this study clearly showed for the first time diurnal variations in DOM measurements, which have previously been related to both composition and concentration, even though diurnal changes were not well reflected in bulk DOC concentrations. An apparent asynchronous trend of DOM absorbance and chlorophyll-a in comparison to chromophoric dissolved organic matter (CDOM) fluorescence and spectral slope S290-350 suggests that no one specific CDOM spectrophotometric measurement explains absolutely DOM diurnal variation in this system; the measurement of multiple optical parameters is therefore recommended. The observed diurnal changes in DOM composition, measured by in situ optical instrumentation likely reflect both photochemical and biologically-mediated processes. The results of this study highlight that short-term variability in DOM composition may complicate trends for studies aiming to distinguish different DOM sources in riverine systems and emphasizes the importance of sampling specific study sites to be compared at the same time of day. The utilization of in situ optical technology allows short-term variability in DOM dynamics to be monitored and serves to increase our understanding of its processing and fundamental role in the aquatic environment. Copyright ?? 2007 John Wiley & Sons, Ltd.
NASA Technical Reports Server (NTRS)
Ku, W. H.-M.; Helfand, D. J.; Lucy, L. B.
1980-01-01
The X-ray properties of 111 catalogued quasars have been examined with the imaging proportional counter on board the Einstein Observatory. Thirty-five of the objects, of redshift between 0.064 and 3.53, were detected as X-ray sources. The 0.5-4.5-keV X-ray properties of these quasars are correlated with their optical and radio continuum properties and with their redshifts and variability characteristics. The X-ray luminosity of quasars tends to be highest for those objects which are bright in the optical and radio regimes and which exhibit optically violent variability. These observations suggest that quasars should be divided into two classes on the basis of radio luminosities, spectra, evolution and underlying morphology and that quasars can make up a significant portion of the diffuse soft X-ray background only if the slope of the optical quasar log N-log S relation is steeper than 2 to m sub b of about 21.5.
NASA Astrophysics Data System (ADS)
Berryhill, A. B.; Coffey, D. M.; McGhee, R. W.; Burkhardt, E. E.
2008-03-01
Cryomagnetics' new "C-Mag Optical" Magneto-Optic Property Measurement System is a versatile materials and device characterization system that allows the researcher to simultaneously control the applied magnetic field and temperature of a sample while studying its electrical and optic properties. The system integrates a totally liquid cryogen-free 6T superconducting split-pair magnet with a variable temperature sample space, both cooled using a single 4.2K pulse tube refrigerator. To avoid warming the magnet when operating a sample at elevated temperatures, a novel heat switch was developed. The heat switch allows the sample temperature to be varied from 10K to 300K while maintaining the magnet at 4.2K or below. In this paper, the design and performance of the overall magnet system and the heat switch will be presented. New concepts for the next generation system will also be discussed.
Expanding understanding of optical variability in Lake Superior with a 4-year dataset
NASA Astrophysics Data System (ADS)
Mouw, Colleen B.; Ciochetto, Audrey B.; Grunert, Brice; Yu, Angela
2017-07-01
Lake Superior is one of the largest freshwater lakes on our planet, but few optical observations have been made to allow for the development and validation of visible spectral satellite remote sensing products. The dataset described here focuses on coincidently observing inherent and apparent optical properties along with biogeochemical parameters. Specifically, we observe remote sensing reflectance, absorption, scattering, backscattering, attenuation, chlorophyll concentration, and suspended particulate matter over the ice-free months of 2013-2016. The dataset substantially increases the optical knowledge of the lake. In addition to visible spectral satellite algorithm development, the dataset is valuable for characterizing the variable light field, particle, phytoplankton, and colored dissolved organic matter distributions, and helpful in food web and carbon cycle investigations. The compiled data can be freely accessed at https://seabass.gsfc.nasa.gov/archive/URI/Mouw/LakeSuperior/.
LONG-TERM OPTICAL POLARIZATION VARIABILITY OF THE TeV BLAZAR 1ES 1959+650
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sorcia, Marco; Benitez, Erika; Cabrera, Jose I.
A detailed analysis of the optical polarimetric variability of the TeV blazar 1ES 1959+650 from 2007 October 18 to 2011 May 5 is presented. The source showed maximum and minimum brightness states in the R band of 14.08 {+-} 0.03 mag and 15.20 {+-} 0.03 mag, respectively, with a maximum variation of 1.12 mag, and a maximum polarization degree of P = (12.2 {+-} 0.7)%, with a maximum variation of 10.7%. From 2009 August to November, a correlation between the optical R-band flux and the degree of linear polarization was found with a correlation coefficient r {sub pol} = 0.984more » {+-} 0.025. The source presented a preferential position angle of optical polarization of {approx}153 Degree-Sign , with variations of 10 Degree-Sign -50 Degree-Sign , which is in agreement with the projected position angle of the parsec-scale jet found at 43 GHz. From the Stokes parameters we infer the existence of two optically thin synchrotron components that contribute to the polarized flux. One of them is stable with a constant polarization degree of 4%. Assuming a stationary shock for the variable component, we estimated some parameters associated with the physics of the relativistic jet: the magnetic field, B {approx} 0.06 G, the Doppler factor, {delta}{sub 0} {approx} 23, the viewing angle, {Phi} {approx} 2. Degree-Sign 4, and the size of the emission region r{sub b} {approx} 5.6 Multiplication-Sign 10{sup 17} cm. Our study is consistent with the spine-sheath model of explaining the polarimetric variability displayed by this source during our monitoring.« less
Intensive HST, RXTE, and ASCA Monitoring of NGC 3516: Evidence against Thermal Reprocessing
NASA Technical Reports Server (NTRS)
Edelson, Rick; Koratkar, Anuradha; Nandra, Kirpal; Goad, Michael; Peterson, Bradley M.; Collier, Stefan; Krolik, Julian; Malkan, Matthew; Maoz, Dan; OBrien, Paul
2000-01-01
During 1998 April 1316, the bright, strongly variable Seyfert 1 galaxy NGC 3516 was monitored almost continuously with HST for 10.3 hr at ultraviolet wavelengths and 2.8 days at optical wavelengths, and simultaneous RXTE and ASCA monitoring covered the same period. The X-ray fluxes were strongly variable with the soft (0.5-2 keV) X-rays showing stronger variations (approx. 65% peak to peak) than the hard (2-10 keV) X-rays (approx. 50% peak to peak). The optical continuum showed much smaller but still highly significant variations: a slow approx. 2.5% rise followed by a faster approx. 3.5% decline. The short ultraviolet observation did not show significant variability. The soft and hard X-ray light curves were strongly correlated, with no evidence for a significant interband lag. Likewise, the optical continuum bands (3590 and 5510 A) were also strongly correlated, with no measurable lag, to 3(sigma) limits of approx. less than 0.15 day. However, the optical and X-ray light curves showed very different behavior, and no significant correlation or simple relationship could be found. These results appear difficult to reconcile with previous reports of correlations between X-ray and optical variations and of measurable lags within the optical band for some other Seyfert 1 galaxies. These results also present serious problems for "reprocessing" models in which the X-ray source heats a stratified accretion disk, which then reemits in the optical/ultraviolet : the synchronous variations within the optical would suggest that the emitting region is approx. less than 0.3 It-day across, while the lack of correlation between X-ray and optical variations would indicate, in the context of this model, that any reprocessing region must be approx. greater than 1 It-day in size. It may be possible to resolve this conflict by invoking anisotropic emission or special geometry, but the most natural explanation appears to be that the bulk of the optical luminosity is generated by some mechanism other than reprocessing.
NASA Astrophysics Data System (ADS)
Reza, Syed Azer
This dissertation proposes the use of the emerging Micro-Electro-Mechanical Systems (MEMS) and agile lensing optical device technologies to design novel and powerful signal conditioning and sensing modules for advanced applications in optical communications, physical parameter sensing and RF/optical signal processing. For example, these new module designs have experimentally demonstrated exceptional features such as stable loss broadband operations and high > 60 dB optical dynamic range signal filtering capabilities. The first part of the dissertation describes the design and demonstration of digital MEMS-based signal processing modules for communication systems and sensor networks using the TI DLP (Digital Light Processing) technology. Examples of such modules include optical power splitters, narrowband and broadband variable fiber optical attenuators, spectral shapers and filters. Compared to prior works, these all-digital designs have advantages of repeatability, accuracy, and reliability that are essential for advanced communications and sensor applications. The next part of the dissertation proposes, analyzes and demonstrates the use of analog opto-fluidic agile lensing technology for sensor networks and test and measurement systems. Novel optical module designs for distance sensing, liquid level sensing, three-dimensional object shape sensing and variable photonic delay lines are presented and experimentally demonstrated. Compared to prior art module designs, the proposed analog-mode modules have exceptional performances, particularly for extreme environments (e.g., caustic liquids) where the free-space agile beam-based sensor provide remote non-contact access for physical sensing operations. The dissertation also presents novel modules involving hybrid analog-digital photonic designs that make use of the different optical device technologies to deliver the best features of both analog and digital optical device operations and controls. Digital controls are achieved through the use of the digital MEMS technology and analog controls are realized by employing opto-fluidic agile lensing technology and acousto-optic technology. For example, variable fiber-optic attenuators and spectral filters are proposed using the hybrid design. Compared to prior art module designs, these hybrid designs provide a higher module dynamic range and increased resolution that are critical in various advanced system applications. In summary, the dissertation shows the added power of hybrid optical designs using both the digital and analog photonic signal processing versus just all-digital or all-analog module designs.
Two-Decade Monitoring of MWC349 in Optical and Radio: New Results
NASA Astrophysics Data System (ADS)
Thomashow, Eydon; Jorgenson, Regina A.; Strelnitski, Vladimir; Walker, Gary; Maria Mitchell Observatory (MMO) Research Experiences for Undergraduate (REU) Interns, 2017
2018-01-01
Maria Mitchell Observatory (MMO) has completed the two-decade long monitoring of MWC 349 in the optical and radio domains. This poster presentation will be primarily devoted to the new results obtained by optical photometry with broad and narrow band filters and observations of the variability in the masing H30 radio line during the observational season of 2017. The H30 emission arises in the circumstellar disk of the MWC 349A component of the visual double star (with 2.4 arcsec separation between the A and B components). Variable optical emission is also believed to be due to star A. By combining our optical observations with earlier MMO observations, we not only confirmed the previously known quasi-period of ~230 days, but confirmed a second period of ~700 days. One of the most interesting results of radio monitoring is the long-term variability of the systemic radial velocity of star A, as determined through averaging the radial velocities of the two masing peaks arising in the circumstellar disk. This may be the first case where a possible hidden close companion of a star (a lower mass star or a massive protoplanet) is detected by monitoring the radial velocity of the star via the spectral line radiation from its disk. E.T. completed this project as a 2017 MMO NSF REU intern and would like to thank the other interns for their help in conducting the optical observations. This project was supported in part by the NSF REU grant AST-1358980 and by the Nantucket Maria Mitchell Association.
NASA Astrophysics Data System (ADS)
Le, Chengfeng; Hu, Chuanmin; English, David; Cannizzaro, Jennifer; Chen, Zhiqiang; Kovach, Charles; Anastasiou, Christopher J.; Zhao, Jun; Carder, Kendall L.
2013-01-01
Inherent and apparent optical properties (IOPs and AOPs) of Tampa Bay (Florida, USA) were measured during fourteen cruises between February 1998 and October 2010 to understand how these properties relate to one another and what controls light absorption and diffuse attenuation in this moderately sized (˜1000 km2), shallow estuary (average depth ˜4 m). The IOPs and AOPs included: 1) absorption coefficients of three optically significant constituents: phytoplankton pigments, detrital particles, and colored dissolved organic matter (CDOM); 2) particulate backscattering coefficients; 3) chlorophyll-a concentrations; 4) above-water remote sensing reflectance; 5) downwelling diffuse attenuation coefficients (Kd) at eight wavelengths and photosynthetically active radiation (PAR). Results showed substantial variability in all IOPs and AOPs in both space and time, with most IOPs spanning more than two orders of magnitude and showing strong co-variations. Of all four bay segments, Old Tampa Bay showed unique optical characteristics. During the wet season, the magnitude of blue-green-light absorption was dominated by CDOM, while during the dry season all three constituents contributed significantly. However, the variability in Kd (PAR, 490 nm, 555 nm) was driven mainly by the variability of detrital particles and phytoplankton as opposed to CDOM. This observation explained, at least to first order, why a nutrient reduction management strategy used by the Tampa Bay Estuary Program since the 1990s led to improved water clarity in most of Tampa Bay. The findings of this study provided the optical basis to fine tune existing or develop new algorithms to estimate the various optical water quality parameters from space.
NASA Astrophysics Data System (ADS)
Lauinger, Norbert
1994-10-01
In photopic vision, two physical variables (luminance and wavelength) are transformed into three psychological variables (brightness, hue, and saturation). Following on from 3D grating optical explanations of aperture effects (Stiles-Crawford effects SCE I and II), all three variables can be explained via a single 3D chip effect. The 3D grating optical calculations are carried out using the classical von Laue equation and demonstrated using the example of two experimentally confirmed observations in human vision: saturation effects for monochromatic test lights between 485 and 510 nm in the SCE II and the fact that many test lights reverse their hue shift in the SCE II when changing from moderate to high luminances compared with that on changing from low to medium luminances. At the same time, information is obtained on the transition from the trichromatic color system in the retina to the opponent color system.
Characterization facility for magneto-optic media and systems
NASA Technical Reports Server (NTRS)
Mansuripur, M.; Fu, H.; Gadetsky, S.; Sugaya, S.; Wu, T. H.; Zambuto, J.; Gerber, R.; Goodman, T.; Erwin, J. K.
1993-01-01
Objectives of this research are: (1) to measure the hysteresis loop, Kerr rotation angle, anisotropy energy profile, Hall voltage, and magnetoresistance of thin-film magneto-optic media using our loop-tracer; (2) measure the wavelength-dependence of the Kerr rotation angle, Theta(sub k), and ellipticity, epsilon(sub k), for thin-film media using our magneto-optic Kerr spectrometer (MOKS); (3) measure the dielectric tensor of thin-film and multilayer samples using our variable-angle magneto-optic ellipsometer (VAMOE); (4) measure the hysteresis loop, coercivity, remanent magnetization, saturation magnetization, and anisotropy energy constant for thin film magnetic media using vibrating sample magnetometry; (5) observe small magnetic domains and investigate their interaction with defects using magnetic force microscopy; (6) perform static read/write/erase experiments on thin-film magneto-optic media using our static test station; (7) integrate the existing models of magnetization, magneto-optic effects, coercivity, and anisotropy in an interactive and user-friendly environment, and analyze the characterization data obtained in the various experiments, using this modeling package; (8) measure focusing- and tracking-error signals on a static testbed, determine the 'feedthrough' for various focusing schemes, investigate the effects of polarization and birefringence, and compare the results with diffraction-based calculations; and (9) measure the birefringence of optical disk substrates using two variable angle ellipsometers.
Bio-Optics of the Chesapeake Bay from Measurements and Radiative Transfer Calculations
NASA Technical Reports Server (NTRS)
Tzortziou, Maria; Herman, Jay R.; Gallegos, Charles L.; Neale, Patrick J.; Subramaniam, Ajit; Harding, Lawrence W., Jr.; Ahmad, Ziauddin
2005-01-01
We combined detailed bio-optical measurements and radiative transfer (RT) modeling to perform an optical closure experiment for optically complex and biologically productive Chesapeake Bay waters. We used this experiment to evaluate certain assumptions commonly used when modeling bio-optical processes, and to investigate the relative importance of several optical characteristics needed to accurately model and interpret remote sensing ocean-color observations in these Case 2 waters. Direct measurements were made of the magnitude, variability, and spectral characteristics of backscattering and absorption that are critical for accurate parameterizations in satellite bio-optical algorithms and underwater RT simulations. We found that the ratio of backscattering to total scattering in the mid-mesohaline Chesapeake Bay varied considerably depending on particulate loading, distance from land, and mixing processes, and had an average value of 0.0128 at 530 nm. Incorporating information on the magnitude, variability, and spectral characteristics of particulate backscattering into the RT model, rather than using a volume scattering function commonly assumed for turbid waters, was critical to obtaining agreement between RT calculations and measured radiometric quantities. In situ measurements of absorption coefficients need to be corrected for systematic overestimation due to scattering errors, and this correction commonly employs the assumption that absorption by particulate matter at near infrared wavelengths is zero.
Optical Variability Properties of High Luminosity AGN Classes
NASA Astrophysics Data System (ADS)
Stalin, C. S.; Gopal Krishna; Sagar, Ram; Wiita, Paul J.
2004-03-01
We present the results of a comparative study of the intranight optical variability (INOV) characteristics of radio-loud and radioquiet quasars, which involves a systematic intra-night optical monitoring of seven sets of high luminosity AGNs covering the redshift range z ' 0:2 to z ' 2:2. The sample, matched in the optical luminosity - redshift .MB?z/ plane, consists of seven radio-quiet quasars (RQQs), eight radio lobedominated quasars (LDQs), five radio core-dominated quasars (CDQs) and six BL Lac objects (BLs). Systematic CCD observations, aided by a careful data analysis procedure, have allowed us to detect INOV with amplitudes as low as about 1%. Present observations cover a total of 113 nights (720 hours) with only a single quasar monitored as continuously as possible on a given night. Considering the cases of only unambiguous detections of INOV we have estimated duty cycles (DCs) of 17%, 12%, 20% and 61% for RQQs, LDQs, CDQs, and BLs, respectively. The much lower amplitude and DC of INOV shown by RQQs compared to BLs may be understood in terms of their having optical synchrotron jets which are modestly misdirected from us. From our fairly extensive dataset, no general trend of a correlation between the INOVamplitude and the apparent optical brightness of the quasar is noticed. This suggests that the physical mechanisms of INOV and long term optical variability (LTOV) do not have a one-to-one relationship and different factors are involved. Also, the absence of a clear negative correlation between the INOV and LTOV characteristics of blazars of our sample points toward an inconspicuous contribution of accretion disk fluctuations to the observed INOV. The INOVduty cycle of theAGNs observed in this program suggests that INOV is associated predominantly with the highly polarized optical emission components. We also report new VLA imaging of two RQQs .1029C329&1252C020/ in our sample which has yielded a 5 GHz detection in one of them .1252 C 020I S5 GHz ' 1 mJy/.
Polarization Imaging Apparatus with Auto-Calibration
NASA Technical Reports Server (NTRS)
Zou, Yingyin Kevin (Inventor); Zhao, Hongzhi (Inventor); Chen, Qiushui (Inventor)
2013-01-01
A polarization imaging apparatus measures the Stokes image of a sample. The apparatus consists of an optical lens set, a first variable phase retarder (VPR) with its optical axis aligned 22.5 deg, a second variable phase retarder with its optical axis aligned 45 deg, a linear polarizer, a imaging sensor for sensing the intensity images of the sample, a controller and a computer. Two variable phase retarders were controlled independently by a computer through a controller unit which generates a sequential of voltages to control the phase retardations of the first and second variable phase retarders. A auto-calibration procedure was incorporated into the polarization imaging apparatus to correct the misalignment of first and second VPRs, as well as the half-wave voltage of the VPRs. A set of four intensity images, I(sub 0), I(sub 1), I(sub 2) and I(sub 3) of the sample were captured by imaging sensor when the phase retardations of VPRs were set at (0,0), (pi,0), (pi,pi) and (pi/2,pi), respectively. Then four Stokes components of a Stokes image, S(sub 0), S(sub 1), S(sub 2) and S(sub 3) were calculated using the four intensity images.
Polarization imaging apparatus with auto-calibration
Zou, Yingyin Kevin; Zhao, Hongzhi; Chen, Qiushui
2013-08-20
A polarization imaging apparatus measures the Stokes image of a sample. The apparatus consists of an optical lens set, a first variable phase retarder (VPR) with its optical axis aligned 22.5.degree., a second variable phase retarder with its optical axis aligned 45.degree., a linear polarizer, a imaging sensor for sensing the intensity images of the sample, a controller and a computer. Two variable phase retarders were controlled independently by a computer through a controller unit which generates a sequential of voltages to control the phase retardations of the first and second variable phase retarders. A auto-calibration procedure was incorporated into the polarization imaging apparatus to correct the misalignment of first and second VPRs, as well as the half-wave voltage of the VPRs. A set of four intensity images, I.sub.0, I.sub.1, I.sub.2 and I.sub.3 of the sample were captured by imaging sensor when the phase retardations of VPRs were set at (0,0), (.pi.,0), (.pi.,.pi.) and (.pi./2,.pi.), respectively. Then four Stokes components of a Stokes image, S.sub.0, S.sub.1, S.sub.2 and S.sub.3 were calculated using the four intensity images.
Optical phase conjugation assisted scattering lens: variable focusing and 3D patterning
Ryu, Jihee; Jang, Mooseok; Eom, Tae Joong; Yang, Changhuei; Chung, Euiheon
2016-01-01
Variable light focusing is the ability to flexibly select the focal distance of a lens. This feature presents technical challenges, but is significant for optical interrogation of three-dimensional objects. Numerous lens designs have been proposed to provide flexible light focusing, including zoom, fluid, and liquid-crystal lenses. Although these lenses are useful for macroscale applications, they have limited utility in micron-scale applications due to restricted modulation range and exacting requirements for fabrication and control. Here, we present a holographic focusing method that enables variable light focusing without any physical modification to the lens element. In this method, a scattering layer couples low-angle (transverse wave vector) components into a full angular spectrum, and a digital optical phase conjugation (DOPC) system characterizes and plays back the wavefront that focuses through the scattering layer. We demonstrate micron-scale light focusing and patterning over a wide range of focal distances of 22–51 mm. The interferometric nature of the focusing scheme also enables an aberration-free scattering lens. The proposed method provides a unique variable focusing capability for imaging thick specimens or selective photoactivation of neuronal networks. PMID:27049442
Lighthouse in the dust: infrared echoes of periodic emission from massive black hole binaries★
NASA Astrophysics Data System (ADS)
D'Orazio, Daniel J.; Haiman, Zoltán
2017-09-01
The optical and UV emission from sub-parsec massive black hole binaries (MBHBs) in active galactic nuclei (AGNs) is believed to vary periodically, on time-scales comparable to the binary's orbital time. If driven by accretion rate fluctuations, the variability could be isotropic. If dominated by relativistic Doppler modulation, the variability should instead be anisotropic, resembling a rotating forward-beamed lighthouse. We consider the infrared (IR) reverberation of either type of periodic emission by pc-scale circumbinary dust tori. We predict the phase and amplitude of IR variability as a function of the ratio of dust light crossing time to the source variability period, and of the torus inclination and opening angle. We enumerate several differences between the isotropic and anisotropic cases. Interestingly, for a nearly face-on binary with an inclined dust torus, the Doppler boost can produce IR variability without any observable optical/UV variability. Such orphan-IR variability would have been missed in optical searches for periodic AGNs. We apply our models to time-domain WISE IR data from the MBHB candidate PG 1302-102 and find consistency with dust reverberation by both isotropically emitting and Doppler-boosted sources in the shorter wavelength W1-W2 (2.8 → 5.3 μm) bands. We constrain the dust torus to be thin (aspect ratio ˜ 0.1), with an inner radius at 1-5 pc. More generally, our dust-echo models will aid in identifying new MBHB candidates, determining their nature and constraining the physical properties of MBHBs and their dust tori.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kaluzny, J.; Rozanska, A.; Rozyczka, M.
2012-05-01
We show that the optical counterpart of the X-ray source CX 1 in M4 is a {approx}20th magnitude star, located in the color-magnitude diagram on (or very close to) the main sequence of the cluster, and exhibiting sinusoidal variations of the flux. We find the X-ray flux to be also periodically variable, with X-ray and optical minima coinciding. Stability of the optical light curve, lack of UV-excess, and unrealistic mean density resulting from period-density relation for semidetached systems speak against the original identification of CX 1 as a cataclysmic variable. We argue that the X-ray active component of this systemmore » is a neutron star (probably a millisecond pulsar).« less
Liquid-crystal variable retarders for aerospace polarimetry applications
DOE Office of Scientific and Technical Information (OSTI.GOV)
Heredero, R. L.; Uribe-Patarroyo, N.; Belenguer, T.
2007-02-10
We present the optical effects of different tests that simulate the aerospace environment on the liquid-crystal variable retarders (LCVRs) used in the Imaging Magnetograph eXperiment postfocal instrument of the SUNRISE payload within the NASA Long Duration Balloon program. Analysis of the influence of vacuum,temperature, vibration, and gamma and ultraviolet radiation is performed by measuring the effects of these tests on the optical retardance, the response time, the wavefront distortion,and the transmittance, including some in situ measurements. Outgassing measurements of the different parts of the LCVRs are also shown. From the results obtained it can be concluded that these optical devicesmore » are suitable and seem to be excellent candidates for aerospace platforms.« less
Tsunashima, Satoshi; Nakajima, Fumito; Nasu, Yusuke; Kasahara, Ryoichi; Nakanishi, Yasuhiko; Saida, Takashi; Yamada, Takashi; Sano, Kimikazu; Hashimoto, Toshikazu; Fukuyama, Hiroyuki; Nosaka, Hideaki; Murata, Koichi
2012-11-19
We demonstrate a compact and variable-optical-attenuator (VOA) integrated coherent receiver with a silica-based planar lightwave circuit (PLC). To realize the compact receiver, we integrate a VOA in a single PLC chip with polarization beam splitters and optical 90-degree hybrids, and employ a stable optoelectronic coupling system consisting of micro lens arrays and photodiode (PD) subcarriers with high-speed right-angled signal lines. We integrate a VOA and a coherent receiver in a 27x40x6 mm package, and successfully demodulate a 128-Gbit/s polarization division multiplexed (PDM) quadrature phase shift keying (QPSK) signal with a VOA-assisted wide dynamic range of more than 30 dB.
A search for optical variability of type 2 quasars in SDSS stripe 82
DOE Office of Scientific and Technical Information (OSTI.GOV)
Barth, Aaron J.; Carson, Daniel J.; Voevodkin, Alexey
Hundreds of Type 2 quasars have been identified in Sloan Digital Sky Survey (SDSS) data, and there is substantial evidence that they are generally galaxies with highly obscured central engines, in accord with unified models for active galactic nuclei (AGNs). A straightforward expectation of unified models is that highly obscured Type 2 AGNs should show little or no optical variability on timescales of days to years. As a test of this prediction, we have carried out a search for variability in Type 2 quasars in SDSS Stripe 82 using difference-imaging photometry. Starting with the Type 2 AGN catalogs of Zakamskamore » et al. and Reyes et al., we find evidence of significant g-band variability in 17 out of 173 objects for which light curves could be measured from the Stripe 82 data. To determine the nature of this variability, we obtained new Keck spectropolarimetry observations for seven of these variable AGNs. The Keck data show that these objects have low continuum polarizations (p ≲ 1% in most cases) and all seven have broad Hα and/or Mg II emission lines in their total (unpolarized) spectra, indicating that they should actually be classified as Type 1 AGNs. We conclude that the primary reason variability is found in the SDSS-selected Type 2 AGN samples is that these samples contain a small fraction of Type 1 AGNs as contaminants, and it is not necessary to invoke more exotic possible explanations such as a population of 'naked' or unobscured Type 2 quasars. Aside from misclassified Type 1 objects, the Type 2 quasars do not generally show detectable optical variability over the duration of the Stripe 82 survey.« less
Very fast optical flaring from a possible new Galactic magnetar.
Stefanescu, A; Kanbach, G; Słowikowska, A; Greiner, J; McBreen, S; Sala, G
2008-09-25
Highly luminous rapid flares are characteristic of processes around compact objects like white dwarfs, neutron stars and black holes. In the high-energy regime of X-rays and gamma-rays, outbursts with variabilities on timescales of seconds or less are routinely observed, for example in gamma-ray bursts or soft gamma-ray repeaters. At optical wavelengths, flaring activity on such timescales has not been observed, other than from the prompt phase of one exceptional gamma-ray burst. This is mostly due to the fact that outbursts with strong, fast flaring are usually discovered in the high-energy regime; most optical follow-up observations of such transients use instruments with integration times exceeding tens of seconds, which are therefore unable to resolve fast variability. Here we show the observation of extremely bright and rapid optical flaring in the Galactic transient SWIFT J195509.6+261406. Our optical light curves are phenomenologically similar to high-energy light curves of soft gamma-ray repeaters and anomalous X-ray pulsars, which are thought to be neutron stars with extremely high magnetic fields (magnetars). This suggests that similar processes are in operation, but with strong emission in the optical, unlike in the case of other known magnetars.
Clustered-dot halftoning with direct binary search.
Goyal, Puneet; Gupta, Madhur; Staelin, Carl; Fischer, Mani; Shacham, Omri; Allebach, Jan P
2013-02-01
In this paper, we present a new algorithm for aperiodic clustered-dot halftoning based on direct binary search (DBS). The DBS optimization framework has been modified for designing clustered-dot texture, by using filters with different sizes in the initialization and update steps of the algorithm. Following an intuitive explanation of how the clustered-dot texture results from this modified framework, we derive a closed-form cost metric which, when minimized, equivalently generates stochastic clustered-dot texture. An analysis of the cost metric and its influence on the texture quality is presented, which is followed by a modification to the cost metric to reduce computational cost and to make it more suitable for screen design.
2012-01-01
There is considerable debate over whether plants are conscious and this, indeed, is an important question. Here I look at developments in neuroscience, physics and mathematics that may impact on this question. Two major concomitants of consciousness in animals are microtubule function and electrical gamma wave synchrony. Both these factors may also play a role in plant consciousness. I show that plants possess aperiodic quasicrystal structures composed of ribosomes that may enable quantum computing, which has been suggested to lie at the core of animal consciousness. Finally I look at whether a microtubule fractal suggests that electric current plays a part in conventional neurocomputing processes in plants. PMID:22899055
Akinci, A.; Galadini, F.; Pantosti, D.; Petersen, M.; Malagnini, L.; Perkins, D.
2009-01-01
We produce probabilistic seismic-hazard assessments for the central Apennines, Italy, using time-dependent models that are characterized using a Brownian passage time recurrence model. Using aperiodicity parameters, ?? of 0.3, 0.5, and 0.7, we examine the sensitivity of the probabilistic ground motion and its deaggregation to these parameters. For the seismic source model we incorporate both smoothed historical seismicity over the area and geological information on faults. We use the maximum magnitude model for the fault sources together with a uniform probability of rupture along the fault (floating fault model) to model fictitious faults to account for earthquakes that cannot be correlated with known geologic structural segmentation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Littlefield, Colin; Garnavich, Peter; Kennedy, Mark
We analyze long-cadence Kepler K2 observations of AR Sco from 2014, along with survey photometry obtained between 2005 and 2016 by the Catalina Real-Time Sky Survey and the All-Sky Automated Survey for Supernovae. The K2 data show the orbital modulation to have been fairly stable during the 78 days of observations, but we detect aperiodic deviations from the average waveform with an amplitude of ∼2% on a timescale of a few days. A comparison of the K2 data with the survey photometry reveals that the orbital waveform gradually changed between 2005 and 2010, with the orbital maximum shifting to earliermore » phases. We compare these photometric variations with proposed models of this unusual system.« less
Multi-fractality in aeroelastic response as a precursor to flutter
NASA Astrophysics Data System (ADS)
Venkatramani, J.; Nair, Vineeth; Sujith, R. I.; Gupta, Sayan; Sarkar, Sunetra
2017-01-01
Wind tunnel tests on a NACA 0012 airfoil have been carried out to study the transition in aeroelastic response from an initial state characterised by low-amplitude aperiodic fluctuations to aeroelastic flutter when the system exhibits limit cycle oscillations. An analysis of the aeroelastic measurements reveals multi-fractal characteristics in the pre-flutter regime. This has not been studied in the literature. As the flow velocity approaches the flutter velocity from below, a gradual loss in multi-fractality is observed. Measures based on the generalised Hurst exponents are developed and are shown to have the potential to warn against impending aeroelastic flutter. The results of this study could be useful for health monitoring of aeroelastic structures.
Chirp and temperature effects in parametric down conversion from crystals pumped at 800 nm
NASA Astrophysics Data System (ADS)
Sánchez-Lozano, X.; Wiechers, C.; Lucio, J. L.
2018-04-01
We consider spontaneous parametric down conversion from aperiodic poled crystals pumped at 800 nm. Our analyses account the effect of internal and external parameters, where, in the former, we include the crystal chirp and length, while in the latter temperature, also the pump chirp and other beam properties. The typical distribution produced is a pop-tab like structure in frequency-momentum space, and our results show that this system is a versatile light source, appropriated to manipulate the frequency and transverse momentum properties of the light produced. We briefly comment on the potential usefulness of the types of telecom wavelength light produced, in particular for quantum information applications.
NASA Astrophysics Data System (ADS)
Essen, Jonathan; Ruiz-Garcia, Miguel; Jenkins, Ian; Carretero, Manuel; Bonilla, Luis L.; Birnir, Björn
2018-04-01
We explore the design parameter space of short (5-25 period), n-doped, Ga/(Al,Ga)As semiconductor superlattices (SSLs) in the sequential resonant tunneling regime. We consider SSLs at cool (77 K) and warm (295 K) temperatures, simulating the electronic response to variations in (a) the number of SSL periods, (b) the contact conductivity, and (c) the strength of disorder (aperiodicities). Our analysis shows that the chaotic dynamical phases exist on a number of sub-manifolds of codimension zero within the design parameter space. This result provides an encouraging guide towards the experimental observation of high-frequency intrinsic dynamical chaos in shorter SSLs.
Gardiner, John
2012-09-01
There is considerable debate over whether plants are conscious and this, indeed, is an important question. Here I look at developments in neuroscience, physics and mathematics that may impact on this question. Two major concomitants of consciousness in animals are microtubule function and electrical gamma wave synchrony. Both these factors may also play a role in plant consciousness. I show that plants possess aperiodic quasicrystal structures composed of ribosomes that may enable quantum computing, which has been suggested to lie at the core of animal consciousness. Finally I look at whether a microtubule fractal suggests that electric current plays a part in conventional neurocomputing processes in plants.
Temperature, ordering, and equilibrium with time-dependent confining forces
Schiffer, J. P.; Drewsen, M.; Hangst, J. S.; Hornekær, L.
2000-01-01
The concepts of temperature and equilibrium are not well defined in systems of particles with time-varying external forces. An example is a radio frequency ion trap, with the ions laser cooled into an ordered solid, characteristic of sub-mK temperatures, whereas the kinetic energies associated with the fast coherent motion in the trap are up to 7 orders of magnitude higher. Simulations with 1,000 ions reach equilibrium between the degrees of freedom when only aperiodic displacements (secular motion) are considered. The coupling of the periodic driven motion associated with the confinement to the nonperiodic random motion of the ions is very small at low temperatures and increases quadratically with temperature. PMID:10995471
Climatology and Characteristics of Aerosol Optical Properties in the Arctic
NASA Astrophysics Data System (ADS)
Schmeisser, Lauren; Ogren, John; Backman, John; Asmi, Eija; Andrews, Elisabeth; Jefferson, Anne; Bergin, Michael; Tunved, Peter; Sharma, Sangeeta; Starkweather, Sandra
2016-04-01
Within the Arctic, climate forcers like atmospheric aerosols are important contributors to the observed warming and environmental changes in the region. Quantifying the forcing by aerosols in the Arctic is especially difficult, given short aerosol lifetimes, annual variability in illumination and surface albedo, stratified atmospheric conditions, complex feedbacks, and long-range aerosol transport. However, in-situ surface measurements of Arctic aerosol optical properties can be used to constrain variability of light scattering and absorption, identify potential particle sources, and help evaluate the resulting forcing. Data from six WMO Global Atmosphere Watch stations are presented: Alert, Canada (ALT); Barrow, Alaska (BRW); Pallas, Finland (PAL); Summit, Greenland (SUM); Tiksi, Russia (TIK); and Zeppelin Mountain, Norway (ZEP). These sites contribute to the International Arctic System for Observing the Atmosphere (IASOA), which facilitates Arctic-wide data collection and analysis. Climatologies of aerosol optical properties from each station show differences in magnitude and variability of observed parameters. For example, most stations (ALT, BRW, SUM, TIK, ZEP) experience maximum scattering in winter/spring, while PAL exhibits maximum scattering in the summer. The observed range in scattering across these sites is large (almost an order of magnitude) - SUM has the lowest annual median scattering at 0.82 Mm-1 while BRW has the highest at 6.9 Mm-1. A closer look at systematic variability between optical properties at each station, as well as site back trajectories, suggest differences in aerosol processes, sources and transport. The development of consistent climatologies and additional analyses like the ones presented here can help provide a better understanding of trans-Arctic aerosol variability, which can be an asset for improving aerosol models in this unique and remote region.
NASA Astrophysics Data System (ADS)
Flores-Bustamante, Mario C.; Rosete-Aguilar, Martha; Calixto, Sergio
2016-03-01
A lens containing a liquid medium and having at least one elastic membrane as one of its components is known as an elastic membrane lens (EML). The elastic membrane may have a constant or variable thickness. The optical properties of the EML change by modifying the profile of its elastic membrane(s). The EML formed of elastic constant thickness membrane(s) have been studied extensively. However, EML information using elastic membrane of variable thickness is limited. In this work, we present simulation results of the mechanical and optical behavior of two EML with variable thickness membranes (convex-plane membranes). The profile of its surfaces were modified by liquid medium volume increases. The model of the convex-plane membranes, as well as the simulation of its mechanical behavior, were performed using Solidworks® software; and surface's points of the deformed elastic lens were obtained. Experimental stress-strain data, obtained from a silicone rubber simple tensile test, according to ASTM D638 norm, were used in the simulation. Algebraic expressions, (Schwarzschild formula, up to four deformation coefficients, in a cylindrical coordinate system (r, z)), of the meridional profiles of the first and second surfaces of the deformed convex-plane membranes, were obtained using the results from Solidworks® and a program in the software Mathematica®. The optical performance of the EML was obtained by simulation using the software OSLO® and the algebraic expressions obtained in Mathematica®.
QKD Via a Quantum Wavelength Router Using Spatial Soliton
NASA Astrophysics Data System (ADS)
Kouhnavard, M.; Amiri, I. S.; Afroozeh, A.; Jalil, M. A.; Ali, J.; Yupapin, P. P.
2011-05-01
A system for continuous variable quantum key distribution via a wavelength router is proposed. The Kerr type of light in the nonlinear microring resonator (NMRR) induces the chaotic behavior. In this proposed system chaotic signals are generated by an optical soliton or Gaussian pulse within a NMRR system. The parameters, such as input power, MRRs radii and coupling coefficients can change and plays important role in determining the results in which the continuous signals are generated spreading over the spectrum. Large bandwidth signals of optical soliton are generated by the input pulse propagating within the MRRs, which is allowed to form the continuous wavelength or frequency with large tunable channel capacity. The continuous variable QKD is formed by using the localized spatial soliton pulses via a quantum router and networks. The selected optical spatial pulse can be used to perform the secure communication network. Here the entangled photon generated by chaotic signals has been analyzed. The continuous entangled photon is generated by using the polarization control unit incorporating into the MRRs, required to provide the continuous variable QKD. Results obtained have shown that the application of such a system for the simultaneous continuous variable quantum cryptography can be used in the mobile telephone hand set and networks. In this study frequency band of 500 MHz and 2.0 GHz and wavelengths of 775 nm, 2,325 nm and 1.55 μm can be obtained for QKD use with input optical soliton and Gaussian beam respectively.
NASA Astrophysics Data System (ADS)
Kuwahara, Victor S.; Nozaki, Sena; Nakano, Junji; Toda, Tatsuki; Kikuchi, Tomohiko; Taguchi, Satoru
2015-07-01
The 18-year time-series shows in situ ultraviolet radiation (UVR) and photosynthetically active radiation (PAR) diffuse attenuation coefficient Kd(λ) have recurrent seasonal variability of high/low attenuation during summer/winter months, respectively, dependent on variability in water column stratification and concentrations of bio-optical properties. The mid-latitude coastal survey station displayed significant seasonality of the mixed layer depth (MLD) between 12 and 82 m which modified the distribution of chlorophyll a (4.6-24.9 mg m-2) and absorption of colored dissolved organic matter [aCDOM(320 nm) 0.043-1.34 m-1]. The median Kd(320 nm) displayed significant seasonality at 0.19-0.74 m-1 (C.V. = 44.1%) and seasonal variability within the euphotic layer [Z10%(320 nm) = 7-20%]. High attenuation of UVR with relatively moderate attenuation of PAR was consistently observed during the summer months when increased concentrations of terrestrially derived CDOM coupled with a shallow MLD were present. The winter season showed the opposite of low UVR and PAR attenuation due to a relatively deeper MLD coupled with low concentrations of bio-optical properties. Although the long term Kd(λ) did not vary significantly during the time-series, analysis of the interannual variability suggests there are positive and negative phases following the Pacific Decadal Oscillation (PDO) vis-a-vis variability in bio-optical properties (p < 0.001).
NASA Technical Reports Server (NTRS)
Shafter, A. W.; Szkody, P.; Thorstensen, J. R.
1986-01-01
Time-resolved X-ray and optical photometric and optical spectroscopic observations of the ultrashort period cataclysmic variable SW UMa are reported. The spectroscopic observations reveal the presence of an s-wave component which is almost in phase with the extreme line wings and presumably the white dwarf. This very unusual phasing in conjunction with the available optical and X-ray data seems to indicate that a region of enhanced emission exists on the opposite side of the disk from the expected location of the hot spot. The photometric observations reveal the presence of a hump in the light curve occurring at an orbital phase which is consistent with the phase at which the region of enhanced line emission is most favorably seen. Changes in the hump amplitude are seen from night to night, and a 15.9 min periodicity is evident in the light curve. The optical and X-ray periodicities suggest that SW UMa is a member of the DQ Her class of cataclysmic variables.
NASA Astrophysics Data System (ADS)
Tatchyn, Roman
1992-01-01
Insertion devices that are tuned by electrical period variation, in contrast to the conventional method of mechanically varying the field strength, offer a number of advantages for the successful development of the next generation of higher-brightness storage rings and associated experimental techniques [R. Tatchyn, Nucl. Instrum. Methods A 275, 430 (1989); J. Appl. Phys. 65, 4107 (1989); R. Tatchyn and T. Cremer, IEEE Trans. Mag. 26, 3102 (1990)]. for example, due to the inherently low total output power levels of variable-period devices, their use can do more to relax power loading constraints on beamline optics at existing and future facilities than many of the alternative approaches explored in recent years, such as, e.g., gallium-cooled optics, multilayer premonochromator structures, or adaptive/deformable optics. With regard to machine optics, variable-period structures can be operated without varying the tune of the host machine lattice, enabling the design and flexible operation of ultralarge, yet reliable and versatile multiuser facilities. In the area of synchrotron radiation (SR) science, variable-period fields can be naturally configure in a literally infinite number of ways, permitting, e.g., fully flexible polarizing field profiles, dynamical field profiles, and multicolor field configurations, all of which serve to expand the possible modes and means of SR experimentation. In this paper we report on recent results obtained at SSRL in the development of variable-period insertion devices that indicate the possibility of extending this technology into short-period (<10 cm), high-field (≳0.05 T) regimes, i.e., into parameter ranges presently occupied by conventional variable-gap, permanent magnet structures. General theoretical arguments, specific designs and their projected performance, as well as an outline of current activities related to the implementation of polarizing and nonpolarizing prototypes on Beam Line V at SSRL, are summarized.
NASA Technical Reports Server (NTRS)
Aurin, Dirk Alexander; Mannino, Antonio; Franz, Bryan
2013-01-01
Satellite remote sensing of ocean color in dynamic coastal, inland, and nearshorewaters is impeded by high variability in optical constituents, demands specialized atmospheric correction, and is limited by instrument sensitivity. To accurately detect dispersion of bio-optical properties, remote sensors require ample signal-to-noise ratio (SNR) to sense small variations in ocean color without saturating over bright pixels, an atmospheric correction that can accommodate significantwater-leaving radiance in the near infrared (NIR), and spatial and temporal resolution that coincides with the scales of variability in the environment. Several current and historic space-borne sensors have met these requirements with success in the open ocean, but are not optimized for highly red-reflective and heterogeneous waters such as those found near river outflows or in the presence of sediment resuspension. Here we apply analytical approaches for determining optimal spatial resolution, dominant spatial scales of variability ("patches"), and proportions of patch variability that can be resolved from four river plumes around the world between 2008 and 2011. An offshore region in the Sargasso Sea is analyzed for comparison. A method is presented for processing Moderate Resolution Imaging Spectroradiometer (MODIS) Aqua and Terra imagery including cloud detection, stray lightmasking, faulty detector avoidance, and dynamic aerosol correction using short-wave- and near-infrared wavebands in extremely turbid regions which pose distinct optical and technical challenges. Results showthat a pixel size of approx. 520 mor smaller is generally required to resolve spatial heterogeneity in ocean color and total suspended materials in river plumes. Optimal pixel size increases with distance from shore to approx. 630 m in nearshore regions, approx 750 m on the continental shelf, and approx. 1350 m in the open ocean. Greater than 90% of the optical variability within plume regions is resolvable with 500 m resolution, and small, but significant, differences were found between peak and nadir river flow periods in terms of optimal resolution and resolvable proportion of variability.
NASA Technical Reports Server (NTRS)
Liu, Tsuen-Hsi (Inventor); Psaltis, Demetri (Inventor); Mok, Fai H. (Inventor); Zhou, Gan (Inventor)
2005-01-01
An optical memory for storing and/or reading data on an optical disk. The optical disk incorporates a material in which holographic gratings can be created, and subsequently detected, at plural locations within the disk by an electro-optical head. Creation and detection of holographic gratings with variable diffraction efficiency is possible with the electro-optical head. Multiple holographic gratings can also be created at each one of the plural locations via a beam of light which has a different wavelength or point of focus. These data elements can be read by the electro-optical head using a beam of light sequentially varied in wavelength or point of focus to correspond to the multiple holographic gratings to be recorded.
Tunable resonator-based devices for producing variable delays and narrow spectral linewidths
NASA Technical Reports Server (NTRS)
Savchenkov, Anatoliy (Inventor); Maleki, Lutfollah (Inventor); Matsko, Andrey B. (Inventor); Ilchenko, Vladimir (Inventor)
2006-01-01
Devices with two or more coupled resonators to produce narrow spectral responses due to interference of signals that transmit through the resonators and techniques for operating such devices to achieve certain operating characteristics are described. The devices may be optical devices where optical resonators such as whispering gallery mode resonators may be used. In one implementation, at least one of the coupled optical resonators is a tunable resonator and is tuned to change its resonance frequency to tune the spectral response of the device. The described devices and techniques may be applied in optical filters, optical delays, optical waveform generators, and other applications.
NASA Technical Reports Server (NTRS)
Tzortziou, Maria; Neale, Patrick J.; Megonigal, J. Patrick; Butterworth, Megan; Jaffe, Rudolf; Yamashita, Youhei
2010-01-01
Coastal wetlands are highly dynamic environments at the land-ocean interface where human activities, short-term physical forcings and intense episodic events result in high biological and chemical variability. Long being recognized as among the most productive ecosystems in the world, tidally-influenced coastal marshes are hot spots of biogeochemical transformation and exchange. High temporal resolution observations that we performed in several marsh-estuarine systems of the Chesapeake Bay revealed significant variability in water optical and biogeochemical characteristics at hourly time scales, associated with tidally-driven hydrology. Water in the tidal creek draining each marsh was sampled every hour during several semi-diurnal tidal cycles using ISCO automated samplers. Measurements showed that water leaving the marsh during ebbing tide was consistently enriched in dissolved organic carbon (DOC), frequently by more than a factor of two, compared to water entering the marsh during flooding tide. Estimates of DOC fluxes showed a net DOC export from the marsh to the estuary during seasons of both low and high biomass of marsh vegetation. Chlorophyll amounts were typically lower in the water draining the marsh, compared to that entering the marsh during flooding tide, suggesting that marshes act as transformers of particulate to dissolved organic matter. Moreover, detailed optical and compositional analyses demonstrated that marshes are important sources of optically and chemically distinctive, relatively complex, high molecular weight, aromatic-rich and highly colored dissolved organic compounds. Compared to adjacent estuarine waters, marsh-exported colored dissolved organic matter (CDOM) was characterized by considerably stronger absorption (more than a factor of three in some cases), larger DOC-specific absorption, lower exponential spectral slope, larger fluorescence signal, lower fluorescence per unit absorbance, and higher fluorescence at visible wavelengths. Observed patterns in water optical and biogeochemical variables were very consistent among different marsh systems and throughout the year, despite continued tidal exchange, implying rapid transformation of marsh DOM in the estuary through both photochemical and microbial processes. These findings illustrate the importance of tidal marsh ecosystems as sources, sinks and/or transformers of biologically important nutrients, carbon and colored dissolved organic compounds, and their influence on short-term biological, optical and biogeochemical variability in coastal waters.
NASA Astrophysics Data System (ADS)
Ciprini, S.; Takalo, L. O.; Tosti, G.; Raiteri, C. M.; Fiorucci, M.; Villata, M.; Nucciarelli, G.; Lanteri, L.; Nilsson, K.; Ros, J. A.
2007-05-01
Aims:New data and results on the optical behavior of the prominent blazar PKS 0735+178 (also known as OI 158, S3 0735+17, DA 237, 1ES 0735+178, 3EG J0737+1721) are presented, through the most continuous BVRI data available in the period 1994-2004 (about 500 nights of observations). In addition, the whole historical light curve, and a new photometric calibration of comparison stars in the field of this source are reported. Methods: Several methods for time series analysis of sparse data sets are developed, adapted, and applied to the reconstructed historical light curve and to each observing season of our unpublished optical database on PKS 0735+178. Optical spectral indexes are calculated from the multi-band observations and studied on long-term (years) durations as well. For the first time in this source, variability modes, characteristic timescales, and the signal power spectrum are explored and identified over 3 decades in time with sufficient statistics. The novel investigation of mid-term optical scales (days, weeks), could be also applied and compared to blazar gamma-ray light curves that will be provided, on the same timescales, by the forthcoming GLAST observatory. Results: In the last 10 years the optical emission of PKS 0735+178 exhibited a rather achromatic behavior and a variability mode resembling the shot-noise. The source was at an intermediate or low brightness level, showing a mild flaring activity and a superimposition/succession of rapid and slower flares, without extraordinary and isolated outbursts, but, at any rate, characterized by one major active phase in 2001. Several mid-term scales of variability were found, the more common falling into duration intervals of about 27-28 days, 50-56 days and 76-79 days. Rapid variability in the historical light curve appears to be modulated by a general, slower, and rather oscillating temporal trend, where typical amplitudes of about 4.5, 8.5, and 11-13 years can be identified. This spectral and temporal analysis, accompanying our data publication, suggests the occurrence of distinctive signatures at mid-term durations that can likely be of transitory nature. On the other hand the possible pseudo-cyclical or multi-component modulations at long times could be more stable, recurrent and correlated to the bimodal radio flux behavior and the twisted radio structure observed over several years in this blazar.
CFRP variable curvature mirror used for realizing non-moving-element optical zoom imaging
NASA Astrophysics Data System (ADS)
Zhao, Hui; Fan, Xuewu; Pang, Zhihai; Ren, Guorui; Wang, Wei; Xie, Yongjie; Ma, Zhen; Du, Yunfei; Su, Yu; Wei, Jingxuan
2014-12-01
In recent years, how to eliminate moving elements while realizing optical zoom imaging has been paid much attention. Compared with the conventional optical zooming techniques, removing moving elements would bring in many benefits such as reduction in weight, volume and power cost and so on. The key to implement non-moving-element optical zooming lies in the design of variable curvature mirror (VCM). In order to obtain big enough optical magnification, the VCM should be capable of generating a large variation of saggitus. Hence, the mirror material should not be brittle, in other words the corresponding ultimate strength should be high enough to ensure that mirror surface would not be broken during large curvature variation. Besides that, the material should have a not too big Young's modulus because in this case less force is required to generate a deformation. Among all available materials, for instance SiC, Zerodur and et.al, CFRP (carbon fiber reinforced polymer) satisfies all these requirements and many related research have proven this. In this paper, a CFRP VCM is designed, fabricated and tested. With a diameter of 100mm, a thickness of 2mm and an initial curvature radius of 1740mm, this component could change its curvature radius from 1705mm to 1760mm, which correspond to a saggitus variation of nearly 23μm. The work reported further proves the suitability of CFRP in constructing variable curvature mirror which could generate a large variation of saggitus.
Non-Contact Optical Ultrasound Concept for Biomedical Imaging
2016-11-03
Non -Contact Optical Ultrasound Concept for Biomedical Imaging Robert Haupt1, Charles Wynn1, Jonathan Fincke2, Shawn Zhang2, Brian Anthony2...results. Lastly, we present imaging capabilities using a non -contact laser ultrasound proof-of-concept system. Two and three dimensional time... non -contact, standoff optical ultrasound has the potential to provide a fixed reference measurement capability that minimizes operator variability as
Scalable Active Optical Access Network Using Variable High-Speed PLZT Optical Switch/Splitter
NASA Astrophysics Data System (ADS)
Ashizawa, Kunitaka; Sato, Takehiro; Tokuhashi, Kazumasa; Ishii, Daisuke; Okamoto, Satoru; Yamanaka, Naoaki; Oki, Eiji
This paper proposes a scalable active optical access network using high-speed Plumbum Lanthanum Zirconate Titanate (PLZT) optical switch/splitter. The Active Optical Network, called ActiON, using PLZT switching technology has been presented to increase the number of subscribers and the maximum transmission distance, compared to the Passive Optical Network (PON). ActiON supports the multicast slot allocation realized by running the PLZT switch elements in the splitter mode, which forces the switch to behave as an optical splitter. However, the previous ActiON creates a tradeoff between the network scalability and the power loss experienced by the optical signal to each user. It does not use the optical power efficiently because the optical power is simply divided into 0.5 to 0.5 without considering transmission distance from OLT to each ONU. The proposed network adopts PLZT switch elements in the variable splitter mode, which controls the split ratio of the optical power considering the transmission distance from OLT to each ONU, in addition to PLZT switch elements in existing two modes, the switching mode and the splitter mode. The proposed network introduces the flexible multicast slot allocation according to the transmission distance from OLT to each user and the number of required users using three modes, while keeping the advantages of ActiON, which are to support scalable and secure access services. Numerical results show that the proposed network dramatically reduces the required number of slots and supports high bandwidth efficiency services and extends the coverage of access network, compared to the previous ActiON, and the required computation time for selecting multicast users is less than 30msec, which is acceptable for on-demand broadcast services.
Transceivers and receivers for quantum key distribution and methods pertaining thereto
DOE Office of Scientific and Technical Information (OSTI.GOV)
DeRose, Christopher; Sarovar, Mohan; Soh, Daniel B.S.
Various technologies for performing continuous-variable (CV) and discrete-variable (DV) quantum key distribution (QKD) with integrated electro-optical circuits are described herein. An integrated DV-QKD system uses Mach-Zehnder modulators to modulate a polarization of photons at a transmitter and select a photon polarization measurement basis at a receiver. An integrated CV-QKD system uses wavelength division multiplexing to send and receive amplitude-modulated and phase-modulated optical signals with a local oscillator signal while maintaining phase coherence between the modulated signals and the local oscillator signal.
Compact silicon photonic resonance-assisted variable optical attenuator
Wang, Xiaoxi; Aguinaldo, Ryan; Lentine, Anthony; ...
2016-11-17
Here, a two-part silicon photonic variable optical attenuator is demonstrated in a compact footprint which can provide a high extinction ratio at wavelengths between 1520 nm and 1620 nm. The device was made by following the conventional p-i-n waveguide section by a high-extinction-ratio second-order microring filter section. The rings provide additional on-off contrast by utilizing a thermal resonance shift, which harvested the heat dissipated by current injection in the p-i-n junction. Finally, we derive and discuss a simple thermal-resistance model in explanation of these effects.
Compact silicon photonic resonance-sssisted variable optical attenuator.
Wang, Xiaoxi; Aguinaldo, Ryan; Lentine, Anthony; DeRose, Christopher; Starbuck, Andrew L; Trotter, Douglas; Pomerene, Andrew; Mookherjea, Shayan
2016-11-28
A two-part silicon photonic variable optical attenuator is demonstrated in a compact footprint which can provide a high extinction ratio at wavelengths between 1520 nm and 1620 nm. The device was made by following the conventional p-i-n waveguide section by a high-extinction-ratio second-order microring filter section. The rings provide additional on-off contrast by utilizing a thermal resonance shift, which harvested the heat dissipated by current injection in the p-i-n junction. We derive and discuss a simple thermal-resistance model in explanation of these effects.
Wan, Yuhang; Carlson, John A; Kesler, Benjamin A; Peng, Wang; Su, Patrick; Al-Mulla, Saoud A; Lim, Sung Jun; Smith, Andrew M; Dallesasse, John M; Cunningham, Brian T
2016-07-08
A compact analysis platform for detecting liquid absorption and emission spectra using a set of optical linear variable filters atop a CMOS image sensor is presented. The working spectral range of the analysis platform can be extended without a reduction in spectral resolution by utilizing multiple linear variable filters with different wavelength ranges on the same CMOS sensor. With optical setup reconfiguration, its capability to measure both absorption and fluorescence emission is demonstrated. Quantitative detection of fluorescence emission down to 0.28 nM for quantum dot dispersions and 32 ng/mL for near-infrared dyes has been demonstrated on a single platform over a wide spectral range, as well as an absorption-based water quality test, showing the versatility of the system across liquid solutions for different emission and absorption bands. Comparison with a commercially available portable spectrometer and an optical spectrum analyzer shows our system has an improved signal-to-noise ratio and acceptable spectral resolution for discrimination of emission spectra, and characterization of colored liquid's absorption characteristics generated by common biomolecular assays. This simple, compact, and versatile analysis platform demonstrates a path towards an integrated optical device that can be utilized for a wide variety of applications in point-of-use testing and point-of-care diagnostics.
DISCOVERY OF FAST, LARGE-AMPLITUDE OPTICAL VARIABILITY OF V648 Car (=SS73-17)
DOE Office of Scientific and Technical Information (OSTI.GOV)
Angeloni, R.; Di Mille, F.; Ferreira Lopes, C. E.
We report on the discovery of large-amplitude flickering from V648 Car (= SS73-17), a poorly studied object listed among the very few hard X-ray-emitting symbiotic stars. We performed millimagnitude precision optical photometry with the Swope Telescope at the Las Campanas Observatory, Chile, and found that V648 Car shows large U-band variability over timescales of minutes. To our knowledge, it exhibits some of the largest flickering of a symbiotic star ever reported. Our finding supports the hypothesis that symbiotic white dwarfs producing hard X-rays are predominantly powered by accretion, rather than quasi-steady nuclear burning, and have masses close to the Chandrasekharmore » limit. No significant periodicity is evident from the flickering light curve. The All Sky Automated Survey long-term V light curve suggests the presence of a tidally distorted giant accreting via Roche lobe overflow, and a binary period of {approx}520 days. On the basis of the outstanding physical properties of V648 Car as hinted at by its fast and long-term optical variability, as well as by its nature as a hard X-ray emitter, we therefore call for simultaneous follow-up observations in different bands, ideally combined with time-resolved optical spectroscopy.« less
Pérez Bartolomé, Francisco; Martínez de la Casa, Jose María; Camacho Bosca, Irene; Sáenz-Francés, Federico; Aguilar Munoa, Soledad; Martín Juan, Alberto; Garcia-Feijoo, Julian
2018-01-01
To examine interrelations between corneal biomechanics, ocular biometric variables and optic disc size (ODS), lamina cribosa depth (LCD) or thickness (LCT) in a healthy population. In a cross-sectional case-control study, the following measurements were made in 81 eyes of 81 participants: axial length, anterior chamber depth, lens thickness, and central corneal thickness using the optical biometer Lenstar LS900; and corneal hysteresis (CH), corneal resistance factor (CRF), Goldman-correlated intraocular pressure (IOPg), and corneal-compensated IOP (IOPcc) using the Ocular Response Analyzer. Serial horizontal enhanced depth imaging optical coherence tomography (EDI OCT) B-scans of the optic nerve head were obtained in each participant. Mean ODS, mean LCD, and mean LCT were measured in 11 equally spaced horizontal B-scans, excluding the LC insertion area under Bruch's membrane and scleral rim. LCD was measured in 74 of 81 eyes (91.36%); LCT in 60/81 (75.3%); ODS in 81/81 (100%). CRF was poorly, but significantly, correlated with LCT (Pearson's R = 0.264; P = 0.045). IOPcc, IOPg, CH, and ocular biometrics variables were poorly (non-significantly) correlated with LCD, LCT, and ODS. CRF was poorly but directly correlated with LCT. No association was detected between CH or ocular biometric variables and ODS, LCD, or LCT.
Power smart in-door optical wireless link design
NASA Astrophysics Data System (ADS)
Marraccini, P. J.; Riza, N. A.
2011-12-01
Presented for the first time, to the best of the authors´ knowledge, is the design of a power smart in-door optical wireless link that provides lossless beam propagation between Transmitter (T) and Receiver (R) for changing link distances. Each T/R unit uses a combination of fixed and variable focal length optics to smartly adjust the laser beam propagation parameters of minimum beam waist size and its location to produce the optimal zero propagation loss coupling condition at the R for that link distance. An Electronically Controlled Variable Focus Lens (ECVFL) is used to form the wide field-of-view search beam and change the beam size at R to form a low loss beam. The T/R unit can also deploy camera optics and thermal energy harvesting electronics to improve link operational smartness and efficiency. To demonstrate the principles of the beam conditioned low loss indoor link, a visible 633 nm laser link using an electro-wetting technology liquid ECVFL is demonstrated for a variable 1 to 4 m link range. Measurements indicate a 53% improvement over an unconditioned laser link at 4 m. Applications for this power efficient wireless link includes mobile computer platform communications and agile server rack interconnections in data centres.
NASA Astrophysics Data System (ADS)
Gezari, S.; Martin, D. C.; Forster, K.; Neill, J. D.; Huber, M.; Heckman, T.; Bianchi, L.; Morrissey, P.; Neff, S. G.; Seibert, M.; Schiminovich, D.; Wyder, T. K.; Burgett, W. S.; Chambers, K. C.; Kaiser, N.; Magnier, E. A.; Price, P. A.; Tonry, J. L.
2013-03-01
We present the selection and classification of over a thousand ultraviolet (UV) variable sources discovered in ~40 deg2 of GALEX Time Domain Survey (TDS) NUV images observed with a cadence of 2 days and a baseline of observations of ~3 years. The GALEX TDS fields were designed to be in spatial and temporal coordination with the Pan-STARRS1 Medium Deep Survey, which provides deep optical imaging and simultaneous optical transient detections via image differencing. We characterize the GALEX photometric errors empirically as a function of mean magnitude, and select sources that vary at the 5σ level in at least one epoch. We measure the statistical properties of the UV variability, including the structure function on timescales of days and years. We report classifications for the GALEX TDS sample using a combination of optical host colors and morphology, UV light curve characteristics, and matches to archival X-ray, and spectroscopy catalogs. We classify 62% of the sources as active galaxies (358 quasars and 305 active galactic nuclei), and 10% as variable stars (including 37 RR Lyrae, 53 M dwarf flare stars, and 2 cataclysmic variables). We detect a large-amplitude tail in the UV variability distribution for M-dwarf flare stars and RR Lyrae, reaching up to |Δm| = 4.6 mag and 2.9 mag, respectively. The mean amplitude of the structure function for quasars on year timescales is five times larger than observed at optical wavelengths. The remaining unclassified sources include UV-bright extragalactic transients, two of which have been spectroscopically confirmed to be a young core-collapse supernova and a flare from the tidal disruption of a star by dormant supermassive black hole. We calculate a surface density for variable sources in the UV with NUV < 23 mag and |Δm| > 0.2 mag of ~8.0, 7.7, and 1.8 deg-2 for quasars, active galactic nuclei, and RR Lyrae stars, respectively. We also calculate a surface density rate in the UV for transient sources, using the effective survey time at the cadence appropriate to each class, of ~15 and 52 deg-2 yr-1 for M dwarfs and extragalactic transients, respectively.
How to decompose arbitrary continuous-variable quantum operations.
Sefi, Seckin; van Loock, Peter
2011-10-21
We present a general, systematic, and efficient method for decomposing any given exponential operator of bosonic mode operators, describing an arbitrary multimode Hamiltonian evolution, into a set of universal unitary gates. Although our approach is mainly oriented towards continuous-variable quantum computation, it may be used more generally whenever quantum states are to be transformed deterministically, e.g., in quantum control, discrete-variable quantum computation, or Hamiltonian simulation. We illustrate our scheme by presenting decompositions for various nonlinear Hamiltonians including quartic Kerr interactions. Finally, we conclude with two potential experiments utilizing offline-prepared optical cubic states and homodyne detections, in which quantum information is processed optically or in an atomic memory using quadratic light-atom interactions. © 2011 American Physical Society
Milewski, John O.; Sklar, Edward
1998-01-01
A laser welding process including: (a) using optical ray tracing to make a model of a laser beam and the geometry of a joint to be welded; (b) adjusting variables in the model to choose variables for use in making a laser weld; and (c) laser welding the joint to be welded using the chosen variables.
Milewski, J.O.; Sklar, E.
1998-06-02
A laser welding process including: (a) using optical ray tracing to make a model of a laser beam and the geometry of a joint to be welded; (b) adjusting variables in the model to choose variables for use in making a laser weld; and (c) laser welding the joint to be welded using the chosen variables. 34 figs.
The optical counterpart of GX 339-4, a possible black hole X-ray source
NASA Technical Reports Server (NTRS)
Grindlay, J. E.
1979-01-01
Optical studies of the galactic X-ray source GX 339-4 (4U 1658-48), which led to its recent identification as reported by Doxsey et al. (1979), are presented. Reddening and distance estimates are given, as well as evidence for optical variability on differing time scales. The emission-line spectra and UBV photometry suggest that GX 339-4 may be at about 8 kpc and have a main-sequence B star binary companion. Both the optical spectrum and optical/X-ray luminosity ratio for GX 339-4 may be similar to Cir X-1.