Science.gov

Sample records for apical cup assembly

  1. Welding torch gas cup extension

    NASA Technical Reports Server (NTRS)

    Gordon, Stephen S. (Inventor)

    1988-01-01

    The invention relates to a gas shielded electric arc welding torch having a detachable gas cup extension which may be of any desired configuration or length. The gas cup extension assembly is mounted on a standard electric welding torch gas cup to enable welding in areas with limited access. The gas cup assembly has an upper tubular insert that fits within the gas cup such that its lower portion protrudes thereform and has a lower tubular extension that is screwed into the lower portion. The extension has a rim to define the outer perimeter of the seat edge about its entrance opening so a gasket may be placed to effect an airtight seal between the gas cup and extension. The tubular extension may be made of metal or cermaic material that can be machined. The novelty lies in the use of an extension assembly for a standard gas cup of an electric arc welding torch which extension assembly is detachable permitting the use of a number of extensions which may be of different configurations and materials and yet fit the standard gas cup.

  2. Use of DSC and DMA Techniques to Help Investigate a Material Anomaly for PTFE Used in Processing a Piston Cup for the Urine Processor Assembly (UPA) on International Space Station (ISS)

    NASA Technical Reports Server (NTRS)

    Wingard, Doug

    2010-01-01

    Human urine and flush water are eventually converted into drinking water with the Urine Processor Assembly (UPA) aboard the International Space Station (ISS). This conversion is made possible through the Distillation Assembly (DA) of the UPA. One component of the DA is a molded circular piston cup made of virgin polytetrafluoroethylene (PTFE). The piston cup is assembled to a titanium component using eight fasteners and washers. Molded PTFE produced for spare piston cups in the first quarter of 2010 was different in appearance and texture, and softer than material molded for previous cups. For the suspect newer PTFE material, cup fasteners were tightened to only one-half the required torque value, yet the washers embedded almost halfway into the material. The molded PTFE used in the DA piston cup should be Type II, based on AMS 3667D and ASTM D4894 specifications. The properties of molded PTFE are considerably different between Type I and II materials. Engineers working with the DA thought that if Type I PTFE was molded by mistake instead of Type II material, that could have resulted in the anomalous material properties. Typically, the vendor molds flat sheet PTFE from the same material lot used to mold the piston cups, and tensile testing as part of quality control should verify that the PTFE is Type II material. However, for this discrepant lot of material, such tensile data was not available. Differential scanning calorimetry (DSC) and dynamic mechanical analysis (DMA) were two of the testing techniques used at the NASA/Marshall Space Flight Center (MSFC) to investigate the anomaly for the PTFE material. Other techniques used on PTFE specimens were: Shore D hardness testing, tensile testing on dog bone specimens and a qualitative estimation of porosity by optical and scanning electron microscopy.

  3. Fast-response cup anemometer features cosine response

    NASA Technical Reports Server (NTRS)

    Frenzen, P.

    1968-01-01

    Six-cup, low-inertia anemometer combines high resolution and fast response with a unique ability to sense only the horizontal component of the winds fluctuating rapidly in three dimensions. Cup assemblies are fabricated of expanded polystyrene plastic.

  4. Exploring Volumetrically Indexed Cups

    ERIC Educational Resources Information Center

    Jones, Dustin L.

    2011-01-01

    This article was inspired by a set of 12 cylindrical cups, which are volumetrically indexed; that is to say, the volume of cup "n" is equal to "n" times the volume of cup 1. Various sets of volumetrically indexed cylindrical cups are explored. I demonstrate how this children's toy is ripe for mathematical investigation, with connections to…

  5. Exploring volumetrically indexed cups

    NASA Astrophysics Data System (ADS)

    Jones, Dustin L.

    2011-03-01

    This article was inspired by a set of 12 cylindrical cups, which are volumetrically indexed; that is to say, the volume of cup n is equal to n times the volume of cup 1. Various sets of volumetrically indexed cylindrical cups are explored. I demonstrate how this children's toy is ripe for mathematical investigation, with connections to geometry, algebra and differential calculus. Students with an understanding of these topics should be able to complete the analysis and related exercises contained herein.

  6. Apical domain polarization localizes actin-myosin activity to drive ratchet-like apical constriction.

    PubMed

    Mason, Frank M; Tworoger, Michael; Martin, Adam C

    2013-08-01

    Apical constriction promotes epithelia folding, which changes tissue architecture. During Drosophila gastrulation, mesoderm cells exhibit repeated contractile pulses that are stabilized such that cells apically constrict like a ratchet. The transcription factor Twist is required to stabilize cell shape. However, it is unknown how Twist spatially coordinates downstream signals to prevent cell relaxation. We find that during constriction, Rho-associated kinase (Rok) is polarized to the middle of the apical domain (medioapical cortex), separate from adherens junctions. Rok recruits or stabilizes medioapical myosin II (Myo-II), which contracts dynamic medioapical actin cables. The formin Diaphanous mediates apical actin assembly to suppress medioapical E-cadherin localization and form stable connections between the medioapical contractile network and adherens junctions. Twist is not required for apical Rok recruitment, but instead polarizes Rok medioapically. Therefore, Twist establishes radial cell polarity of Rok/Myo-II and E-cadherin and promotes medioapical actin assembly in mesoderm cells to stabilize cell shape fluctuations.

  7. Apical Dominance in Plants

    ERIC Educational Resources Information Center

    Tucker, D. J.

    1974-01-01

    Describes a tentative hypothesis for the control of plant branching (apical dominance). Explores the mechanism by which apical buds inhibit the growth of axillary buds on the same shoot. Presents an up-to-date picture of the problem and gives economic implications of the study. (BR)

  8. Rotary cup slurry atomization

    NASA Astrophysics Data System (ADS)

    Sommer, H. T.; Marnicio, R. J.

    1983-06-01

    The theory of a two-phase flow in a rotating cup atomizer is described. The analysis considers the separation of the solid and liquid media thus realistically modeling the flow of two layers along the inner cup wall: a slurry of increasing solids concentration and a supernatent liquid layer. The analysis is based on the earlier work of Hinze and Milborn (1950) which addressed the flow within a rotary cup for a homogeneous liquid. The superimposition of a settling velocity under conditions of high centrifugal acceleration permits the extended analysis of the separation of the two phases. Appropriate boundary conditions have been applied to the film's free surface and the cup wall and to match the flow characteristics at the liquid-slurry interface. The changing slurry viscosity, increasing nonlinearly with growing solid loading, was also considered. A parameter study illustrates the potential for a cup design to provide optimal slurry and liquid film thicknesses for effective atomization.

  9. Structure of Crumbs tail in complex with the PALS1 PDZ-SH3-GK tandem reveals a highly specific assembly mechanism for the apical Crumbs complex.

    PubMed

    Li, Youjun; Wei, Zhiyi; Yan, Yan; Wan, Qingwen; Du, Quansheng; Zhang, Mingjie

    2014-12-01

    The Crumbs (Crb) complex, formed by Crb, PALS1, and PATJ, is evolutionarily conserved in metazoans and acts as a master cell-growth and -polarity regulator at the apical membranes in polarized epithelia. Crb intracellular functions, including its direct binding to PALS1, are mediated by Crb's highly conserved 37-residue cytoplasmic tail. However, the mechanistic basis governing the highly specific Crb-PALS1 complex formation is unclear, as reported interaction between the Crb tail (Crb-CT) and PALS1 PSD-95/DLG/ZO-1 (PDZ) domain is weak and promiscuous. Here we have discovered that the PDZ-Src homolgy 3 (SH3)-Guanylate kinase (GK) tandem of PALS1 binds to Crb-CT with a dissociation constant of 70 nM, which is ∼ 100-fold stronger than the PALS1 PDZ-Crb-CT interaction. The crystal structure of the PALS1 PDZ-SH3-GK-Crb-CT complex reveals that PDZ-SH3-GK forms a structural supramodule with all three domains contributing to the tight binding to Crb. Mutations disrupting the tertiary interactions of the PDZ-SH3-GK supramodule weaken the PALS1-Crb interaction and compromise PALS1-mediated polarity establishment in Madin-Darby canine kidney (MDCK) cysts. We further show that specific target binding of other members of membrane-associated guanylate kinases (MAGUKs) (e.g., CASK binding to neurexin) also requires the presence of their PDZ-SH3-GK tandems.

  10. Bleeding and cupping.

    PubMed Central

    Turk, J. L.; Allen, E.

    1983-01-01

    Bleeding and cupping have been used in medicine since ancient times in the treatment of fevers and local inflammatory disorders. Local bleeding, by 'wet cupping', was effected by a scarificator or by leeches. John Hunter recommended venesection in moderation but preferred leeches for local bleeding. Bleeding as an accepted therapeutic practice went out of vogue in the middle of the nineteenth century as a result of the introduction of modern scientific methods. Dry cupping and the use of leeches, as counter irritants, persisted until the middle of this century. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 PMID:6338802

  11. Miniature modified Faraday cup for micro electron beams

    DOEpatents

    Teruya, Alan T.; Elmer, John W.; Palmer, Todd A.; Walton, Chris C.

    2008-05-27

    A micro beam Faraday cup assembly includes a refractory metal layer with an odd number of thin, radially positioned traces in this refractory metal layer. Some of the radially positioned traces are located at the edge of the micro modified Faraday cup body and some of the radially positioned traces are located in the central portion of the micro modified Faraday cup body. Each set of traces is connected to a separate data acquisition channel to form multiple independent diagnostic networks. The data obtained from the two diagnostic networks are combined and inputted into a computed tomography algorithm to reconstruct the beam shape, size, and power density distribution.

  12. Complementary Coffee Cups

    ERIC Educational Resources Information Center

    Banchoff, Thomas

    2006-01-01

    What may have been the birth of a new calculus problem took place when the author noticed that two coffee cups, one convex and one concave, fit nicely together, and he wondered which held more coffee. The fact that their volumes were about equal led to the topic of this article: complementary surfaces of revolution with equal volumes.

  13. Cups and Downs

    ERIC Educational Resources Information Center

    Stewart, Ian

    2012-01-01

    Martin Gardner wrote about a coin-flipping trick, performed by a blindfolded magician. The paper analyses this trick, and compares it with a similar trick using three cups flipped in pairs. Several different methods of analysis are discussed, including a graphical analysis of the state space and a representation in terms of a matrix. These methods…

  14. Hijama (Wet Cupping or Dry Cupping) for Diabetes Treatment

    PubMed Central

    Vakilinia, Seyed Reza; Bayat, Davood; Asghari, Majid

    2016-01-01

    Background: Diabetes is known as one of the most common diseases in the world and its treatment is one of the most important healthcare issues. Consequently, different treatment methods of complementary medicine and recent medicine have been used by scientific communities to control and predict the disease. This article considered the effects of dry cupping and wet cupping, based on traditional medicine and recent studies. Methods: At first, the benefits of dry cupping and wet cupping were taken from some original books of Iranian traditional medicine, such as Canon of Medicine, Kholasat-al-hekma, Tib-e-Akbari and Exir-e-Azam. Then, the information about scientific articles was obtained by studying some of the Iranian traditional medicine journals and searching through PubMed, SID and Google Scholar. Results: In traditional medicine, Hijama is divided into two kinds, namely wet cupping (with sharat, with incision, and blood giving) and dry cupping (without sharat, without incision). Dry cupping causes organ blood absorption, organ warming, and loss of organ humidity. The texts of Iranian traditional medicine refer to the Ziabites disease that its symptoms are like diabetes. This disease is divided into two types including warm and cold ziabetes. The treatments that are recommended for both types are dry cupping for cold ziabetes and wet cupping for warm ziabetes. In addition, according to scientific studies, dry cupping and wet cupping have been recommended for diabetes treatment. Conclusion: Dry cupping and wet cupping can be introduced as the complementary treatment methods beside other treatment methods. PMID:26722143

  15. Modified Faraday cup

    DOEpatents

    Elmer, John W.; Teruya, Alan T.; O'Brien, Dennis W.

    1996-01-01

    A tomographic technique for measuring the current density distribution in electron beams using electron beam profile data acquired from a modified Faraday cup to create an image of the current density in high and low power beams. The modified Faraday cup includes a narrow slit and is rotated by a stepper motor and can be moved in the x, y and z directions. The beam is swept across the slit perpendicular thereto and controlled by deflection coils, and the slit rotated such that waveforms are taken every few degrees form 0.degree. to 360.degree. and the waveforms are recorded by a digitizing storage oscilloscope. Two-din-tensional and three-dimensional images of the current density distribution in the beam can be reconstructed by computer tomography from this information, providing quantitative information about the beam focus and alignment.

  16. Modified Faraday cup

    DOEpatents

    Elmer, J.W.; Teruya, A.T.; O`Brien, D.W.

    1996-09-10

    A tomographic technique for measuring the current density distribution in electron beams using electron beam profile data acquired from a modified Faraday cup to create an image of the current density in high and low power beams is disclosed. The modified Faraday cup includes a narrow slit and is rotated by a stepper motor and can be moved in the x, y and z directions. The beam is swept across the slit perpendicular thereto and controlled by deflection coils, and the slit rotated such that waveforms are taken every few degrees from 0{degree} to 360{degree} and the waveforms are recorded by a digitizing storage oscilloscope. Two-dimensional and three-dimensional images of the current density distribution in the beam can be reconstructed by computer tomography from this information, providing quantitative information about the beam focus and alignment. 12 figs.

  17. ION PRODUCING MECHANISM (CHARGE CUPS)

    DOEpatents

    Brobeck, W.W.

    1959-04-21

    The problems of confining a charge material in a calutron and uniformly distributing heat to the charge is described. The charge is held in a cup of thermally conductive material removably disposed within the charge chamber of the ion source block. A central thermally conducting stem is incorporated within the cup for conducting heat to the central portion of the charge contained within the cup.

  18. Hip arthroplasty by matching cups.

    PubMed

    Gerard, Y

    1978-01-01

    A total hip surface arthroplasty consisting of matching cups and uncemented prosthetic components is a noteworthy operation. The femoral cup obtains cylindrical support from the femoral head which is reamed in the shape of a cylinder. The acetabular cup is metallic with a polyethylene liner. It is mobile over the bone but its position is constrained by contact with the femoral cup and therefore "self-centering." On the femoral side, the cup must be placed strictly in the axis of the femoral neck. The main consideration in femoral head surface replacement is the vitality of the underlying bone. Necrosis was observed in the earliest clinical trials but there have been no cases of necrosis in the past 3 1/2 years. This is attributed to a more limited surgical approach in which only the anterior part of the gluteus medius is divided and all the posterior elements of the hip are preserved. The acetabulum is sufficiently reamed to receive the cup, which protrudes beyond the external margins of the acetabulum in all positions. Errors have been committed while perfecting the prosthetic material, but the results as determined by a 6 1/2 year follow-up on purely metallic cups are encouraging. Metal-polyethylene cups presently under investigation have almost a 2 year follow-up. The reaction of the acetabulum to an uncemented cup is not yet known. However, the existence of 2 sliding surfaces and the fact that the acetabular cup moves only during the extremes of hip movement, is reason to assume that if the acetabulum is not reamed to expose cancellous bone, the risks of protrusion are minimal or delayed. Total surface arthroplasty by concentric cups has been performed in 335 hips to date. The operation is especially recommended when osteotomy is no longer possible and disabling coxarthrosis is present in relatively young patients. PMID:729253

  19. World Cup Hopes

    NASA Technical Reports Server (NTRS)

    2002-01-01

    From May 31 to June 30 the biggest single-sport event in the world, the 2002 FIFA World Cup (tm), will be taking place in Asia. South Korea and Japan are acting as hosts for the event which is being held in Asia for the first time. This true-color image of the southern Korean peninsula and southern Japan was acquired on May 25, 2002, by the Moderate-resolution Imaging Spectroradiometer (MODIS), flying aboard NASA's Terra satellite. Thirty-two nations are represented at this year's Finals including the 1998 champion France, European powers England and Italy, tournament favorite Argentina, and the United States. The finals are the culmination of a 2-year qualifying process which started with 132 nations competing in regional qualification tournaments. In the round-robin first round of the World Cup, the U.S. team will be competing against teams from Portugal, Poland, and South Korea. Image courtesy Jacques Descloitres, MODIS Land Rapid Response Team at NASA GSFC

  20. Captain James Cook's antimony cup.

    PubMed

    McCallum, R I

    2001-12-01

    Medicinal cups made of pure antimony metal were once common but are now rare and only about ten have been described. An unusual cup which belonged to Captain James Cook, the explorer, which has not previously been reported in the medical literature is described here. PMID:11958223

  1. On Cup Anemometer Rotor Aerodynamics

    PubMed Central

    Pindado, Santiago; Pérez, Javier; Avila-Sanchez, Sergio

    2012-01-01

    The influence of anemometer rotor shape parameters, such as the cups' front area or their center rotation radius on the anemometer's performance was analyzed. This analysis was based on calibrations performed on two different anemometers (one based on magnet system output signal, and the other one based on an opto-electronic system output signal), tested with 21 different rotors. The results were compared to the ones resulting from classical analytical models. The results clearly showed a linear dependency of both calibration constants, the slope and the offset, on the cups' center rotation radius, the influence of the front area of the cups also being observed. The analytical model of Kondo et al. was proved to be accurate if it is based on precise data related to the aerodynamic behavior of a rotor's cup. PMID:22778638

  2. On cup anemometer rotor aerodynamics.

    PubMed

    Pindado, Santiago; Pérez, Javier; Avila-Sanchez, Sergio

    2012-01-01

    The influence of anemometer rotor shape parameters, such as the cups' front area or their center rotation radius on the anemometer's performance was analyzed. This analysis was based on calibrations performed on two different anemometers (one based on magnet system output signal, and the other one based on an opto-electronic system output signal), tested with 21 different rotors. The results were compared to the ones resulting from classical analytical models. The results clearly showed a linear dependency of both calibration constants, the slope and the offset, on the cups' center rotation radius, the influence of the front area of the cups also being observed. The analytical model of Kondo et al. was proved to be accurate if it is based on precise data related to the aerodynamic behavior of a rotor's cup.

  3. From Baby Bottle to Cup: Choose Training Cups Carefully, Use Them Temporarily

    MedlinePlus

    ... DENTAL PATIENT ... From baby bottle to cup Choose training cups carefully, use them temporarily T ooth decay ... you make the change from baby bottle to training cup, be very careful about d what kind ...

  4. Spoon-to-cup fading as treatment for cup drinking in a child with intestinal failure.

    PubMed

    Groff, Rebecca A; Piazza, Cathleen C; Zeleny, Jason R; Dempsey, Jack R

    2011-01-01

    We treated a child with intestinal failure who consumed solids on a spoon but not liquids from a cup. We used spoon-to-cup fading, which consisted of taping a spoon to a cup and then gradually moving the bowl of the spoon closer to the edge of the cup. Spoon-to-cup fading was effective for increasing consumption of liquids from a cup. PMID:22219546

  5. SPOON-TO-CUP FADING AS TREATMENT FOR CUP DRINKING IN A CHILD WITH INTESTINAL FAILURE

    PubMed Central

    Groff, Rebecca A; Piazza, Cathleen C; Zeleny, Jason R; Dempsey, Jack R

    2011-01-01

    We treated a child with intestinal failure who consumed solids on a spoon but not liquids from a cup. We used spoon-to-cup fading, which consisted of taping a spoon to a cup and then gradually moving the bowl of the spoon closer to the edge of the cup. Spoon-to-cup fading was effective for increasing consumption of liquids from a cup. PMID:22219546

  6. Spoon-to-Cup Fading as Treatment for Cup Drinking in a Child with Intestinal Failure

    ERIC Educational Resources Information Center

    Groff, Rebecca A.; Piazza, Cathleen C.; Zeleny, Jason R.; Dempsey, Jack R.

    2011-01-01

    We treated a child with intestinal failure who consumed solids on a spoon but not liquids from a cup. We used spoon-to-cup fading, which consisted of taping a spoon to a cup and then gradually moving the bowl of the spoon closer to the edge of the cup. Spoon-to-cup fading was effective for increasing consumption of liquids from a cup. (Contains 2…

  7. [The initial CUP situation and CUP syndrome: pathological diagnostics].

    PubMed

    Moll, R

    2009-12-01

    "Cancer of unknown primary (site)" (CUP) represents a frequent and often difficult task for diagnostic histopathology. In the initial CUP situation, immunohistochemistry, which is relatively cost-efficient and non-burdensome for the patient, contributes substantially to the targeted search for and identification of the primary tumor. It may be performed in a two-step algorithm (keratins as the first step, group and selective markers as the second step). However, in true CUP syndrome--a heterogeneous disease whose etiology and pathogenesis is still poorly understood--the primary tumor is rarely identified, and the immunohistochemical marker profile is often anomalous. Nevertheless, immunohistochemistry remains the most important special method, aiming at the phenotypical classification and particularly the identification of certain favorable therapy-responsive subsets. Novel methods for subtyping of CUP based on the analysis of gene expression profiles need to be further evaluated before their possible diagnostic application. Future basic and clinical research is required to unravel the still enigmatic tumor biology of the CUP syndrome and to improve the hitherto very unfavorable prognosis by developing new efficient therapy regimens.

  8. World Cup Final

    NASA Technical Reports Server (NTRS)

    2006-01-01

    On July 9, hundreds of millions of fans worldwide will be glued to their television sets watching the final match of the 2006 FIFA World Cup, played in Berlin's Olympic stadium (Olympiastadion). The stadium was originally built for the 1936 Summer Olympics. The Olympic Stadium seats 76,000,; its roof rises 68 meters over the seats and is made up of transparent panels that allow sunlight to stream in during the day.

    With its 14 spectral bands from the visible to the thermal infrared wavelength region, and its high spatial resolution of 15 to 90 meters (about 50 to 300 feet), ASTER images Earth to map and monitor the changing surface of our planet.

    ASTER is one of five Earth-observing instruments launched December 18, 1999, on NASA's Terra satellite. The instrument was built by Japan's Ministry of Economy, Trade and Industry. A joint U.S./Japan science team is responsible for validation and calibration of the instrument and the data products.

    The broad spectral coverage and high spectral resolution of ASTER provides scientists in numerous disciplines with critical information for surface mapping, and monitoring of dynamic conditions and temporal change. Example applications are: monitoring glacial advances and retreats; monitoring potentially active volcanoes; identifying crop stress; determining cloud morphology and physical properties; wetlands evaluation; thermal pollution monitoring; coral reef degradation; surface temperature mapping of soils and geology; and measuring surface heat balance.

    The U.S. science team is located at NASA's Jet Propulsion Laboratory, Pasadena, Calif. The Terra mission is part of NASA's Science Mission Directorate.

    Size: 12.1 by 15.9 kilometers (7.5 by 9.5 miles) Location: 52.5 degrees North latitude, 13.3 degrees East longitude Orientation: North at top Image Data: ASTER bands 3, 2, and 1 Original Data Resolution: 15 meters (49.2 feet) Dates Acquired: October 15, 2005

  9. Does Cupping = Success for Olympic Athletes?

    MedlinePlus

    ... cupping actually help? There's an Eastern and a Western explanation for how this suction may help reduce pain, promote healing and improve flexibility, experts said. Traditional Chinese medicine holds that cupping helps improve the flow of ...

  10. Cup tool use by squirrel monkeys.

    PubMed

    Buckmaster, Christine L; Hyde, Shellie A; Parker, Karen J; Lyons, David M

    2015-12-01

    Captive-born male and female squirrel monkeys spontaneously 'invented' a cup tool use technique to Contain (i.e., hold and control) food they reduced into fragments for consumption and to Contain water collected from a valve to drink. Food cup use was observed more frequently than water cup use. Observations indicate that 68% (n = 39/57) of monkeys in this population used a cup (a plastic slip cap) to Contain food, and a subset of these monkeys, 10% (n = 4/39), also used a cup to Contain water. Cup use was optional and did not replace, but supplemented, the hand/arm-to-mouth eating and direct valve drinking exhibited by all members of the population. Strategies monkeys used to bring food and cups together for food processing activity at preferred upper-level perching areas, in the arboreal-like environment in which they lived, provides evidence that monkeys may plan food processing activity with the cups. Specifically, prior to cup use monkeys obtained a cup first before food, or obtained food and a cup from the floor simultaneously, before transporting both items to upper-level perching areas. After food processing activity with cups monkeys rarely dropped the cups and more often placed the cups onto perching. Monkeys subsequently returned to use cups that they previously placed on perching after food processing activity. The latter behavior is consistent with the possibility that monkeys may keep cups at preferred perching sites for future food processing activity and merits experimental investigation. Reports of spontaneous tool use by squirrel monkeys are rare and this is the first report of population-level tool use. These findings offer insights into the cognitive abilities of squirrel monkeys and provide a new context for behavior studies with this genus and for comparative studies with other primates.

  11. Dummy Cup Helps Robot-Welder Programmers

    NASA Technical Reports Server (NTRS)

    Gordon, Stephen S.

    1990-01-01

    Dummy gas cup used on torch of robotic welder during programming and practice runs. Made of metal or plastic, dummy cup inexpensive and durable. Withstands bumps caused by programming errors, and is sized for special welding jobs within limited clearances. After robot satisfactorily programmed, replaced by ceramic cup of same dimensions for actual welding.

  12. Coffee Cup Atomic Force Microscopy

    ERIC Educational Resources Information Center

    Ashkenaz, David E.; Hall, W. Paige; Haynes, Christy L.; Hicks, Erin M.; McFarland, Adam D.; Sherry, Leif J.; Stuart, Douglas A.; Wheeler, Korin E.; Yonzon, Chanda R.; Zhao, Jing; Godwin, Hilary A.; Van Duyne, Richard P.

    2010-01-01

    In this activity, students use a model created from a coffee cup or cardstock cutout to explore the working principle of an atomic force microscope (AFM). Students manipulate a model of an AFM, using it to examine various objects to retrieve topographic data and then graph and interpret results. The students observe that movement of the AFM…

  13. Apical transportation: two assessment methods.

    PubMed

    López, Fernanda Ullmann; Travessas, Juliana Andréa Corrêa; Fachin, Elaine; Fontanella, Vania; Grecca, Fabiana

    2009-08-01

    Root canal transportation can lead to treatment failure. A large number of methodologies for assessing root canal preparation have been tried in the past. This study compared two methods for apical transportation measurement: digitised images of longitudinal root sections and radiographs. Sixty upper molar mesiobuccal root canals prepared for endodontic treatment were assessed. The results did not demonstrate statistically significant differences between the two imaging methods used to evaluate root canal transportation. The two methods were proven to be equally reliable. PMID:19703081

  14. Structure of Crumbs tail in complex with the PALS1 PDZ–SH3–GK tandem reveals a highly specific assembly mechanism for the apical Crumbs complex

    PubMed Central

    Li, Youjun; Wei, Zhiyi; Yan, Yan; Wan, Qingwen; Du, Quansheng; Zhang, Mingjie

    2014-01-01

    The Crumbs (Crb) complex, formed by Crb, PALS1, and PATJ, is evolutionarily conserved in metazoans and acts as a master cell-growth and -polarity regulator at the apical membranes in polarized epithelia. Crb intracellular functions, including its direct binding to PALS1, are mediated by Crb’s highly conserved 37-residue cytoplasmic tail. However, the mechanistic basis governing the highly specific Crb–PALS1 complex formation is unclear, as reported interaction between the Crb tail (Crb-CT) and PALS1 PSD-95/DLG/ZO-1 (PDZ) domain is weak and promiscuous. Here we have discovered that the PDZ–Src homolgy 3 (SH3)–Guanylate kinase (GK) tandem of PALS1 binds to Crb-CT with a dissociation constant of 70 nM, which is ∼100-fold stronger than the PALS1 PDZ–Crb-CT interaction. The crystal structure of the PALS1 PDZ–SH3–GK–Crb-CT complex reveals that PDZ–SH3–GK forms a structural supramodule with all three domains contributing to the tight binding to Crb. Mutations disrupting the tertiary interactions of the PDZ–SH3–GK supramodule weaken the PALS1–Crb interaction and compromise PALS1-mediated polarity establishment in Madin–Darby canine kidney (MDCK) cysts. We further show that specific target binding of other members of membrane-associated guanylate kinases (MAGUKs) (e.g., CASK binding to neurexin) also requires the presence of their PDZ–SH3–GK tandems. PMID:25385611

  15. Cheaper Custom Shielding Cups For Arc Welding

    NASA Technical Reports Server (NTRS)

    Morgan, Gene E.

    1992-01-01

    New way of making special-purpose shielding cups for gas/tungsten arc welding from hobby ceramic greatly reduces cost. Pattern machined in plastic. Plaster-of-paris mold made, and liquid ceramic poured into mold. Cost 90 percent less than cup machined from lava rock.

  16. Solution structure of the NDH-1 complex subunit CupS from Thermosynechococcus elongatus.

    PubMed

    Korste, Annika; Wulfhorst, Hannes; Ikegami, Takahisa; Nowaczyk, Marc M; Stoll, Raphael

    2015-10-01

    The cyanobacterial multi-subunit membrane protein complex NDH-1 is both structurally and functionally related to Complex I of eubacteria and mitochondria. In addition to functions in respiration and cyclic electron transfer around photosystem I (PSI), the cyanobacterial NDH-1 complex is involved in a unique mechanism for inorganic carbon concentration. Although the crystal structures of the similar respiratory Complex I from Thermus thermophilus and Escherichia coli are known, atomic structural information is not available for the cyanobacterial NDH-1 complex yet. In particular, the structures of those subunits that are not homologous to Complex I will help to understand their distinct functions. The 15.7kDa protein CupS is a small soluble subunit of the complex variant NDH-1MS, which is thought to play a role in CO2 conversion. Here, we present the NMR structure of CupS from Thermosynechococcus elongatus, which is the very first structure of a specific cyanobacterial NDH-1 complex subunit. CupS shares a structural similarity with members of the Fasciclin protein superfamily. The structural comparison to Fasciclin type proteins based on known NMR structures and protein sequences of human TGFBIp, MPB70 from Mycobacterium bovis, and Fdp from Rhodobacter sphaeroides, together with a virtual docking model of CupS and NdhF3, provide first insight into the specific binding of CupS to the NDH-1MS complex at atomic resolution.

  17. Surgical treatments for vaginal apical prolapse

    PubMed Central

    Kong, Mi Kyung

    2016-01-01

    Pelvic organ prolapse is a common condition, occurring in up to 11% of women in the United States. Often, pelvic organ prolapse recurs after surgery; when it recurs after hysterectomy, it frequently presents as vaginal apical prolapse. There are many different surgical treatments for vaginal apical prolapse; among them, abdominal sacral colpopexy is considered the gold standard. However, recent data reveal that other surgical procedures also result in good outcome. This review discusses the various surgical treatments for vaginal apical prolapse including their risks and benefits. PMID:27462591

  18. Clathrin and AP-1 regulate apical polarity and lumen formation during C. elegans tubulogenesis

    PubMed Central

    Zhang, Hongjie; Kim, Ahlee; Abraham, Nessy; Khan, Liakot A.; Hall, David H.; Fleming, John T.; Gobel, Verena

    2012-01-01

    Clathrin coats vesicles in all eukaryotic cells and has a well-defined role in endocytosis, moving molecules away from the plasma membrane. Its function on routes towards the plasma membrane was only recently appreciated and is thought to be limited to basolateral transport. Here, an unbiased RNAi-based tubulogenesis screen identifies a role of clathrin (CHC-1) and its AP-1 adaptor in apical polarity during de novo lumenal membrane biogenesis in the C. elegans intestine. We show that CHC-1/AP-1-mediated polarized transport intersects with a sphingolipid-dependent apical sorting process. Depleting each presumed trafficking component mislocalizes the same set of apical membrane molecules basolaterally, including the polarity regulator PAR-6, and generates ectopic lateral lumens. GFP::CHC-1 and BODIPY-ceramide vesicles associate perinuclearly and assemble asymmetrically at polarized plasma membrane domains in a co-dependent and AP-1-dependent manner. Based on these findings, we propose a trafficking pathway for apical membrane polarity and lumen morphogenesis that implies: (1) a clathrin/AP-1 function on an apically directed transport route; and (2) the convergence of this route with a sphingolipid-dependent apical trafficking path. PMID:22535410

  19. Synthesis, characterization, and manipulation of nitrogen-doped carbon nanotube cups.

    PubMed

    Allen, Brett L; Kichambare, Padmakar D; Star, Alexander

    2008-09-23

    Isolated, carbon nanotube cups with diameters of 12-40 nm have been synthesized by chemical vapor deposition through incorporation of nitrogen atoms into graphitic carbon structure and subsequent mechanical separation. Incorporation of nitrogen affords carbon nanotube cups with a unique composition comprising multiwalled, graphitic lattice with nitrogen groups on the exterior rim and hollow interior cavities. These nanostructures demonstrate the ability to participate in hydrogen bonding because of nitrogen functionalities on their open edges. Furthermore, reaction with these nitrogen functionalities results in the coupling of gold nanoparticles (GNPs) to the open rim of carbon nanotube cups. Through atomic force microscopy manipulation and adhesion force measurements, we compare the mobility of these structures on a hydrophilic surface before and after GNP coupling. Understanding of these forces will aid in useful nanostructure assembly for energy and biomedical applications.

  20. Do the cup surface properties influence the initial stability?

    PubMed

    Goriainov, Vitali; Jones, Andrew; Briscoe, Adam; New, Andrew; Dunlop, Douglas

    2014-04-01

    This project tests the relationship between the acetabular cup surface characteristics and their initial stability by comparing uncemented (Trabecular Metal (TM) and Trilogy) and cemented polyethylene shells. We hypothesised that different surface properties of uncemented cups will influence the cup stability. Mounted directly onto host bone, TM and cemented cups were significantly more stable than Trilogy cups (P < 0.01), with minimal difference between TM and cemented cups (P > 0.1). On 100% graft bed, there was marginal difference between all three cup types (P > 0.1). Incremental cavitary and segmental defects resulted in reducing stability, with cemented cups being minimally more stable (P > 0.1). TM cups possess satisfactory initial stability in bone graft constructs. This study demonstrates that TM shells are marginally less stable than cemented cups in the absence of significant host bone contact.

  1. Clear plastic cups: a childhood choking hazard.

    PubMed

    Weiss, R L; Goldstein, M N; Dharia, A; Zahtz, G; Abramson, A L; Patel, M

    1996-11-01

    The disposable plastic beverage cup is not usually regarded as hazardous to young children. Certain varieties of these products however, are manufactured from a brittle, clear plastic that easily cracks and fragments. While most conscientious parents keep their children safe from peanuts, balloons, and other known choking hazards, a child can surreptitiously bite a cup edge and aspirate the fragment. We report two cases of foreign body aspiration involving clear plastic cups that went undetected one of which remained 21 months following a negative rigid bronchoscopy. Diagnostic difficulties are related to the transparency and radiolucency of these objects. When suspicious of foreign body aspiration in children, otolaryngologists should inquire about the availability of clear plastic cups in the household and be mindful of the diagnostic pitfalls. Further investigations including CT scanning and repeat bronchoscopy may be helpful in cases of suspected missed foreign bodies. An educational campaign aimed at prevention and placement of product package warning labels should be established.

  2. Advanced Pointing Imaging Camera (APIC) Concept

    NASA Astrophysics Data System (ADS)

    Park, R. S.; Bills, B. G.; Jorgensen, J.; Jun, I.; Maki, J. N.; McEwen, A. S.; Riedel, E.; Walch, M.; Watkins, M. M.

    2016-10-01

    The Advanced Pointing Imaging Camera (APIC) concept is envisioned as an integrated system, with optical bench and flight-proven components, designed for deep-space planetary missions with 2-DOF control capability.

  3. Rotor assembly and assay method

    DOEpatents

    Burtis, Carl A.; Johnson, Wayne F.; Walker, William A.

    1993-01-01

    A rotor assembly for carrying out an assay includes a rotor body which is rotatable about an axis of rotation, and has a central chamber and first, second, third, fourth, fifth, and sixth chambers which are in communication with and radiate from the central chamber. The rotor assembly further includes a shuttle which is movable through the central chamber and insertable into any of the chambers, the shuttle including a reaction cup carrying an immobilized antigen or an antibody for transport among the chambers. A method for carrying out an assay using the rotor assembly includes moving the reaction cup among the six chambers by passing the cup through the central chamber between centrifugation steps in order to perform the steps of: separating plasma from blood cells, binding plasma antibody or antigen, washing, drying, binding enzyme conjugate, reacting with enzyme substrate and optically comparing the resulting reaction product with unreacted enzyme substrate solution. The movement of the reaction cup can be provided by attaching a magnet to the reaction cup and supplying a moving magnetic field to the rotor.

  4. Rotor assembly and assay method

    DOEpatents

    Burtis, C.A.; Johnson, W.F.; Walker, W.A.

    1993-09-07

    A rotor assembly for carrying out an assay includes a rotor body which is rotatable about an axis of rotation, and has a central chamber and first, second, third, fourth, fifth, and sixth chambers which are in communication with and radiate from the central chamber. The rotor assembly further includes a shuttle which is movable through the central chamber and insertable into any of the chambers, the shuttle including a reaction cup carrying an immobilized antigen or an antibody for transport among the chambers. A method for carrying out an assay using the rotor assembly includes moving the reaction cup among the six chambers by passing the cup through the central chamber between centrifugation steps in order to perform the steps of: separating plasma from blood cells, binding plasma antibody or antigen, washing, drying, binding enzyme conjugate, reacting with enzyme substrate and optically comparing the resulting reaction product with unreacted enzyme substrate solution. The movement of the reaction cup can be provided by attaching a magnet to the reaction cup and supplying a moving magnetic field to the rotor. 34 figures.

  5. Apical root resorption in orthodontically treated adults.

    PubMed

    Baumrind, S; Korn, E L; Boyd, R L

    1996-09-01

    This study analyzed the relationship in orthodontically treated adults between upper central incisor displacement measured on lateral cephalograms and apical root resorption measured on anterior periapical x-ray films. A multiple linear regression examined incisor displacements in four directions (retraction, advancement, intrusion, and extrusion) as independent variables, attempting to account for observed differences in the dependent variable, resorption. Mean apical resorption was 1.36 mm (sd +/- 1.46, n = 73). Mean horizontal displacement of the apex was -0.83 mm (sd +/- 1.74, n = 67); mean vertical displacement was 0.19 mm (sd +/- 1.48, n = 67). The regression coefficients for the intercept and for retraction were highly significant; those for extrusion, intrusion, and advancement were not. At the 95% confidence level, an average of 0.99 mm (se = +/- 0.34) of resorption was implied in the absence of root displacement and an average of 0.49 mm (se = +/- 0.14) of resorption was implied per millimeter of retraction. R2 for all four directional displacement variables (DDVs) taken together was only 0.20, which implied that only a relatively small portion of the observed apical resorption could be accounted for by tooth displacement alone. In a secondary set of univariate analyses, the associations between apical resorption and each of 14 additional treatment-related variables were examined. Only Gender, Elapsed Time, and Total Apical Displacement displayed statistically significant associations with apical resorption. Additional multiple regressions were then performed in which the data for each of these three statistically significant variables were considered separately, with the data for the four directional displacement variables. The addition of information on Elapsed Time or Total Apical Displacement did not explain a significant additional portion of the variability in apical resorption. On the other hand, the addition of information on Gender to the

  6. Microbiology and Treatment of Acute Apical Abscesses

    PubMed Central

    Rôças, Isabela N.

    2013-01-01

    SUMMARY Acute apical abscess is the most common form of dental abscess and is caused by infection of the root canal of the tooth. It is usually localized intraorally, but in some cases the apical abscess may spread and result in severe complications or even mortality. The reasons why dental root canal infections can become symptomatic and evolve to severe spreading and sometimes life-threatening abscesses remain elusive. Studies using culture and advanced molecular microbiology methods for microbial identification in apical abscesses have demonstrated a multispecies community conspicuously dominated by anaerobic bacteria. Species/phylotypes commonly found in these infections belong to the genera Fusobacterium, Parvimonas, Prevotella, Porphyromonas, Dialister, Streptococcus, and Treponema. Advances in DNA sequencing technologies and computational biology have substantially enhanced the knowledge of the microbiota associated with acute apical abscesses and shed some light on the etiopathogeny of this disease. Species richness and abundance and the resulting network of interactions among community members may affect the collective pathogenicity and contribute to the development of acute infections. Disease modifiers, including transient or permanent host-related factors, may also influence the development and severity of acute abscesses. This review focuses on the current evidence about the etiology and treatment of acute apical abscesses and how the process is influenced by host-related factors and proposes future directions in research, diagnosis, and therapeutic approaches to deal with this disease. PMID:23554416

  7. An Updated Review of the Efficacy of Cupping Therapy

    PubMed Central

    Cao, Huijuan; Li, Xun; Liu, Jianping

    2012-01-01

    Background Since 1950, traditional Chinese medicine (TCM) cupping therapy has been applied as a formal modality in hospitals throughout China and elsewhere in the world. Based on a previous systematic literature review of clinical studies on cupping therapy, this study presents a thorough review of randomized controlled trials (RCTs) to evaluate the therapeutic effect of cupping therapy. Method Six databases were searched for articles published through 2010. RCTs on cupping therapy for various diseases were included. Studies on cupping therapy combined with other TCM treatments versus non-TCM therapies were excluded. Results 135 RCTs published from 1992 through 2010 were identified. The studies were generally of low methodological quality. Diseases for which cupping therapy was commonly applied were herpes zoster, facial paralysis (Bell palsy), cough and dyspnea, acne, lumbar disc herniation, and cervical spondylosis. Wet cupping was used in most trials, followed by retained cupping, moving cupping, and flash cupping. Meta-analysis showed cupping therapy combined with other TCM treatments was significantly superior to other treatments alone in increasing the number of cured patients with herpes zoster, facial paralysis, acne, and cervical spondylosis. No serious adverse effects were reported in the trials. Conclusions Numerous RCTs on cupping therapy have been conducted and published during the past decades. This review showed that cupping has potential effect in the treatment of herpes zoster and other specific conditions. However, further rigorously designed trials on its use for other conditions are warranted. PMID:22389674

  8. Organ boundary1 defines a gene expressed at the junction between the shoot apical meristem and lateral organs.

    PubMed

    Cho, Euna; Zambryski, Patricia C

    2011-02-01

    We identify a gene, organ boundary1 (OBO1), by its unique pattern of enhancer- driven GFP expression at the boundaries between the apical meristems and lateral organs in Arabidopsis embryos, seedlings, and mature plants. OBO1 also is expressed at the root apical meristem and in distinct cell files surrounding this area. OBO1 is one of a 10-member plant-specific gene family encoding a single small domain (133 amino acids) with unknown function. One member of this gene family, OBO2, is identical to a previously studied gene, light-sensitive hypocotyl1. Overexpression of OBO1 causes an abnormal number and size of petals and petal-stamen fusions. The patterns of OBO1 gene expression are distinct but overlap with other genes involved in boundary formation in the Arabidopsis shoot apical meristem, including cup-shaped cotyledon, lateral organ boundaries, blade-on-petiole, asymmetric leaves, and lateral organ fusion. Nuclear localization of OBO1 suggests that it might act with one or more of the transcription factors encoded by the foregoing genes. Ablation of the specific cells expressing OBO1 leads to loss of the shoot apical meristem and lateral organs. Thus, the cells expressing OBO1 are important for meristem maintenance and organogenesis in Arabidopsis. PMID:21245300

  9. Degrees with Almost Universal Cupping Property

    NASA Astrophysics Data System (ADS)

    Liu, Jiang; Wu, Guohua

    The notion of cupping/noncupping has played an essential role in the study of various degree structures in the Ershov hierarchy. As an approach to refute Shoenfield conjecture, Yates (see [2]) proved the existence of a nonzero noncuppable r.e. degree, a degree cupping no incomplete r.e. degree to 0'. In contrast to this, Arslanov proved in [1] that nonzero noncuppable degrees do not exist in the structure of d.r.e. degrees, which shows that the structures of r.e. degrees and d.r.e. degrees are not elementary equivalent.

  10. MicroRNAs as key regulators of GTPase-mediated apical actin reorganization in multiciliated epithelia

    PubMed Central

    Mercey, Olivier; Kodjabachian, Laurent; Barbry, Pascal; Marcet, Brice

    2016-01-01

    ABSTRACT Multiciliated cells (MCCs), which are present in specialized vertebrate tissues such as mucociliary epithelia, project hundreds of motile cilia from their apical membrane. Coordinated ciliary beating in MCCs contributes to fluid propulsion in several biological processes. In a previous work, we demonstrated that microRNAs of the miR-34/449 family act as new conserved regulators of MCC differentiation by specifically repressing cell cycle genes and the Notch pathway. Recently, we have shown that miR-34/449 also modulate small GTPase pathways to promote, in a later stage of differentiation, the assembly of the apical actin network, a prerequisite for proper anchoring of centrioles-derived neo-synthesized basal bodies. We characterized several miR-34/449 targets related to small GTPase pathways including R-Ras, which represents a key and conserved regulator during MCC differentiation. Direct RRAS repression by miR-34/449 is necessary for apical actin meshwork assembly, notably by allowing the apical relocalization of the actin binding protein Filamin-A near basal bodies. Our studies establish miR-34/449 as central players that orchestrate several steps of MCC differentiation program by regulating distinct signaling pathways. PMID:27144998

  11. Pathogenesis of Apical Periodontitis: a Literature Review

    PubMed Central

    Lodiene, Greta; Maciulskiene, Vita

    2011-01-01

    ABSTRACT Objectives This review article discusses the host response in apical periodontitis with the main focus on cytokines, produced under this pathological condition and contributing to the degradation of periradicular tissues. The pace of research in this field has greatly accelerated in the last decade. Here we provide an analysis of studies published in this area during this period. Material and methods Literature was selected through a search of PubMed electronic database. The keywords used for search were pathogenesis of apical periodontitis cytokines, periapical granuloma cytokines, inflammatory infiltrate apical periodontitis. The search was restricted to English language articles, published from 1999 to December 2010. Additionally, a manual search in the cytokine production, cytokine functions and periapical tissue destruction in the journals and books was performed. Results In total, 97 literature sources were obtained and reviewed. The topics covered in this article include cellular composition of an inflammatory infiltrate in the periapical lesions, mechanisms of the formation of the innate and specific immune response. Studies which investigated cytokine secretion and functions were identified and cellular and molecular interactions in the course of apical periodontitis described. Conclusions The abundance and interactions of various inflammatory and anti-inflammatory molecules can influence and alter the state and progression of the disease. Therefore, periapical inflammatory response offers a model, suited for the study of many facets of pathogenesis, biocompatibility of different materials to periapical tissues and development of novel treatment methods, based on the regulation of cytokines expression PMID:24421998

  12. Brassinosteroids regulate organ boundary formation in the shoot apical meristem of Arabidopsis.

    PubMed

    Gendron, Joshua M; Liu, Jiang-Shu; Fan, Min; Bai, Ming-Yi; Wenkel, Stephan; Springer, Patricia S; Barton, M Kathryn; Wang, Zhi-Yong

    2012-12-18

    Spatiotemporal control of the formation of organ primordia and organ boundaries from the stem cell niche in the shoot apical meristem (SAM) determines the patterning and architecture of plants, but the underlying signaling mechanisms remain poorly understood. Here we show that brassinosteroids (BRs) play a key role in organ boundary formation by repressing organ boundary identity genes. BR-hypersensitive mutants display organ-fusion phenotypes, whereas BR-insensitive mutants show enhanced organ boundaries. The BR-activated transcription factor BZR1 directly represses the cup-shaped cotyledon (CUC) family of organ boundary identity genes. In WT plants, BZR1 accumulates at high levels in the nuclei of central meristem and organ primordia but at a low level in organ boundary cells to allow CUC gene expression. Activation of BR signaling represses CUC gene expression and causes organ fusion phenotypes. This study uncovers a role for BR in the spatiotemporal control of organ boundary formation and morphogenesis in the SAM.

  13. Recycling disposable cups into paper plastic composites.

    PubMed

    Mitchell, Jonathan; Vandeperre, Luc; Dvorak, Rob; Kosior, Ed; Tarverdi, Karnik; Cheeseman, Christopher

    2014-11-01

    The majority of disposable cups are made from paper plastic laminates (PPL) which consist of high quality cellulose fibre with a thin internal polyethylene coating. There are limited recycling options for PPLs and this has contributed to disposable cups becoming a high profile, problematic waste. In this work disposable cups have been shredded to form PPL flakes and these have been used to reinforce polypropylene to form novel paper plastic composites (PPCs). The PPL flakes and polypropylene were mixed, extruded, pelletised and injection moulded at low temperatures to prevent degradation of the cellulose fibres. The level of PPL flake addition and the use of a maleated polyolefin coupling agent to enhance interfacial adhesion have been investigated. Samples have been characterised using tensile testing, dynamic mechanical analysis (DMA) and thermogravimetric analysis. Use of a coupling agent allows composites containing 40 wt.% of PPL flakes to increase tensile strength of PP by 50% to 30 MPa. The Young modulus also increases from 1 to 2.5 GPa and the work to fracture increases by a factor of 5. The work demonstrates that PPL disposable cups have potential to be beneficially reused as reinforcement in novel polypropylene composites.

  14. Fast Faraday Cup With High Bandwidth

    SciTech Connect

    Deibele, Craig E

    2006-03-14

    A circuit card stripline Fast Faraday cup quantitatively measures the picosecond time structure of a charged particle beam. The stripline configuration maintains signal integrity, and stitching of the stripline increases the bandwidth. A calibration procedure ensures the measurement of the absolute charge and time structure of the charged particle beam.

  15. Nuclear Physics in a Coffee Cup

    ERIC Educational Resources Information Center

    Higbie, J.

    1974-01-01

    Discusses physical phenomena which can be demonstrated by using a coffee cup, involving the short-range field, alpha-particle scattering, standing waves, and Bohr's closed electron orbits. Indicates that observation of the physics of the classroom in everyday objects can attract student interest in physics learning. (CC)

  16. The Impact of Apical Patency in the Success of Endodontic Treatment of Necrotic Teeth with Apical Periodontitis: A Brief Review

    PubMed Central

    Machado, Ricardo; Ferrari, Carlos Henrique; Back, Eduardo; Comparin, Daniel; Tomazinho, Luiz Fernando; Vansan, Luiz Pascoal

    2016-01-01

    Accumulation of soft tissue or dentinal remnants in the apical region is a common event that can cause blockage of root canals. This event can be avoided if apical patency is performed during the root canal shaping procedures. However, there is no consensus on the role of apical patency in relation to the success of endodontic treatment of necrotic teeth with apical periodontitis. Therefore, the purpose of this paper was to conduct a brief review on the role of apical patency in guaranteeing the success of endodontic treatments of necrotic teeth with apical periodontitis considering two other key points; the root canal anatomy and microbiology. PMID:26843880

  17. The apical disposition of the Caenorhabditis elegans intestinal terminal web is maintained by LET-413.

    PubMed

    Bossinger, Olaf; Fukushige, Tetsunari; Claeys, Myriam; Borgonie, Gaetan; McGhee, James D

    2004-04-15

    We wish to understand how organ-specific structures assemble during embryonic development. In the present paper, we consider what determines the subapical position of the terminal web in the intestinal cells of the nematode Caenorhabditis elegans. The terminal web refers to the organelle-depleted, intermediate filament-rich layer of cytoplasm that underlies the apical microvilli of polarized epithelial cells. It is generally regarded as the anchor for actin rootlets protruding from the microvillar cores. We demonstrate that: (i) the widely used monoclonal antibody MH33 reacts (only) with the gut-specific intermediate filament protein encoded by the ifb-2 gene; (ii) IFB-2 protein accumulates near the gut lumen beginning at the lima bean stage of embryogenesis and remains associated with the gut lumen into adulthood; and (iii) as revealed by immunoelectron microscopy, IFB-2 protein is confined to a discrete circumferential subapical layer within the intestinal terminal web (known in nematodes as the "endotube"); this layer joins directly to the apical junction complexes that connect adjacent gut cells. To investigate what determines the disposition of the IFB-2-containing structure as the terminal web assembles during development, RNAi was used to remove the functions of gene products previously shown to be involved in the overall apicobasal polarity of the developing gut cell. Removal of dlg-1, ajm-1, or hmp-1 function has little effect on the overall position or continuity of the terminal web IFB-2-containing layer. In contrast, removal of the function of the let-413 gene leads to a basolateral expansion of the terminal web, to the point where it can now extend around the entire circumference of the gut cell. The same treatment also leads to concordant basolateral expansion of both gut cell cortical actin and the actin-associated protein ERM-1. LET-413 has previously been shown to be basolaterally located and to prevent the basolateral expansion of several

  18. Microbiome in the Apical Root Canal System of Teeth with Post-Treatment Apical Periodontitis

    PubMed Central

    Siqueira, José F.; Antunes, Henrique S.; Rôças, Isabela N.; Rachid, Caio T. C. C.

    2016-01-01

    Introduction Bacteria present in the apical root canal system are directly involved with the pathogenesis of post-treatment apical periodontitis. This study used a next-generation sequencing approach to identify the bacterial taxa occurring in cryopulverized apical root samples from root canal-treated teeth with post-treatment disease. Methods Apical root specimens obtained during periradicular surgery of ten adequately treated teeth with persistent apical periodontitis were cryogenically ground. DNA was extracted from the powder and the microbiome was characterized on the basis of the V4 hypervariable region of the 16S rRNA gene by using paired-end sequencing on Illumina MiSeq device. Results All samples were positive for the presence of bacterial DNA. Bacterial taxa were mapped to 11 phyla and 103 genera composed by 538 distinct operational taxonomic units (OTUs) at 3% of dissimilarity. Over 85% of the sequences belonged to 4 phyla: Proteobacteria, Firmicutes, Fusobacteria and Actinobacteria. In general, these 4 phyla accounted for approximately 80% of the distinct OTUs found in the apical root samples. Proteobacteria was the most abundant phylum in 6/10 samples. Fourteen genera had representatives identified in all cases. Overall, the genera Fusobacterium and Pseudomonas were the most dominant. Enterococcus was found in 4 cases, always in relatively low abundance. Conclusions This study showed a highly complex bacterial community in the apical root canal system of adequately treated teeth with persistent apical periodontitis. This suggests that this disease is characterized by multispecies bacterial communities and has a heterogeneous etiology, because the community composition largely varied from case to case. PMID:27689802

  19. The Standardization of Bra Cup Measurements: Redefining Bra Sizing Language.

    PubMed

    Bengtson, Bradley P; Glicksman, Caroline A

    2015-10-01

    There are many challenges in developing a standardized bra cup system, the most significant being that bra cup sizes are a continuum. Women's breasts occur as a fluid range of shapes, sizes, and volumes. Patients have specific expectations regarding bra cup size, and failure to achieve expectations remains the leading cause of patient dissatisfaction. Implant selection that determines eventual bra cup size is critical in patient education and management of patient expectations; however, this is not achievable until all speak the same bra cup language. Patient and surgeon perceptions may never be exact, but it is important to establish guidelines and standards to bridge this gap. PMID:26408432

  20. The Standardization of Bra Cup Measurements: Redefining Bra Sizing Language.

    PubMed

    Bengtson, Bradley P; Glicksman, Caroline A

    2015-10-01

    There are many challenges in developing a standardized bra cup system, the most significant being that bra cup sizes are a continuum. Women's breasts occur as a fluid range of shapes, sizes, and volumes. Patients have specific expectations regarding bra cup size, and failure to achieve expectations remains the leading cause of patient dissatisfaction. Implant selection that determines eventual bra cup size is critical in patient education and management of patient expectations; however, this is not achievable until all speak the same bra cup language. Patient and surgeon perceptions may never be exact, but it is important to establish guidelines and standards to bridge this gap.

  1. Comparison of flanged and unflanged acetabular cup design

    PubMed Central

    2010-01-01

    Background and purpose Adequate depth of cement penetration and cement mantle thickness is important for the durability of cemented cups. A flanged cup, as opposed to unflanged, has been suggested to give a more uniform cement mantle and superior cement pressurization, thus improving the depth of cement penetration. This hypothesis was tested experimentally. Materials and methods The same cup design with and without flange (both without cement spacers) was investigated regarding intraacetabular pressure, cement mantle thickness, and depth of cement penetration. With machine control, the cups were inserted into open-pore ceramic acetabular models (10 flanged, 10 unflanged) and into paired cadaver acetabuli (10 flanged, 10 unflanged) with prior pressurization of the cement. Results No differences in intraacetabular pressures during cup insertion were found, but unflanged cups tended to migrate more towards the acetabular pole. Flanged cups resulted in thicker cement mantles because of less bottoming out, whereas no differences in cement penetration into the bone were observed. Interpretation Flanged cups do not generate higher cementation pressure or better cement penetration than unflanged cups. A possible advantage of the flange, however, may be to protect the cup from bottoming out, and there is possibly better closure of the periphery around the cup, sealing off the cement-bone interface. PMID:20860522

  2. [Wear and periprosthetic osteolysis of modular, hemispheric acetabular cups].

    PubMed

    Blacha, Jan; Bogacz, Alina

    2006-01-01

    Osteolysis associated with polyethylene wear has become one of the most prevalent complications associated with uncemented modular, hemispherical cups. Sixty-five consecutive total hip arthroplasties (ABG i, Howmedica, Stryker) were followed 6-12 years. Cumulative survivorship for the cup was 55.7% after 10 years. There were 20 cups revisions because of polyethylene wear and periprosthetic osteolysis (14 cups) or cup loosening (6 cups). Stability was assessed intraoperatively, 14 cups were revised, whereas 6 new polyethylene cups were cemented into stable metal-back of acetabular component. The average annual wear of revised cups was 0.32 mm. The annual wear of not revised cups was 0.12 mm. The differences were statistically significant (p = 0.002). The mean area of osteolysis was 472 mm2 (SD 257 mm2). There was no significant correlation between wear and area of osteolysis. There was significant correlation R = 0.54, p = 0.014) between time to revision and area of osteolysis. There were no significant differences of wear of polyethylene inlay or area of osteolysis between stable and unstable acetabular cups.

  3. Inflammatory Myofibroblastic Tumor Mimicking Apical Periodontitis.

    PubMed

    Adachi, Makoto; Kiho, Kazuki; Sekine, Genta; Ohta, Takahisa; Matsubara, Makoto; Yoshida, Takakazu; Katsumata, Akitoshi; Tanuma, Jun-ichi; Sumitomo, Shinichiro

    2015-12-01

    Inflammatory myofibroblastic tumors (IMTs) are rare. IMTs of the head and neck occur in all age groups, from neonates to old age, with the highest incidence occurring in childhood and early adulthood. An IMT has been defined as a histologically distinctive lesion of uncertain behavior. This article describes an unusual case of IMT mimicking apical periodontitis in the mandible of a 42-year-old man. At first presentation, the patient showed spontaneous pain and percussion pain at teeth #28 to 30, which continued after initial endodontic treatment. Panoramic radiography revealed a radiolucent lesion at the site. Cone-beam computed tomographic imaging showed osteolytic lesions, suggesting an aggressive neoplasm requiring incisional biopsy. Histopathological examination indicated an IMT. The lesion was removed en bloc under general anesthesia, and the patient manifested no clinical evidence of recurrence for 24 months. Lesions of nonendodontic origin should be included in the differential diagnosis of apical periodontitis. Every available diagnostic tool should be used to confirm the diagnosis. Cone-beam computed tomographic imaging is very helpful for differential diagnosis in IMTs mimicking apical periodontitis. PMID:26602450

  4. Corrosion of Metal Modular Cup Liners.

    PubMed

    Hothi, Harry S; Ilo, Kevin; Whittaker, Robert K; Eskelinen, Antti; Skinner, John A; Hart, Alister J

    2015-09-01

    Numerous studies have reported on corrosion at the modular head taper, however less is known about the interface between the metal shell and liner of modular cups. This study examined the backside of a series of metal modular cup liners of two designs (DePuy Pinnacle and Smith & Nephew R3), retrieved from 67 patients. Visual inspection found evidence of corrosion in virtually all liners, with the engaging rim surface significantly more corroded than the polar regions (P<0.001). EDX confirmed that black surface deposits were chromium rich corrosion debris, while SEM analysis revealed considerable pitting in the vicinity of the black debris. The R3 liners were significantly more corroded that the Pinnacles (P<0.001); this may help to explain the higher revision rates of this design. PMID:25890504

  5. Corrosion of Metal Modular Cup Liners.

    PubMed

    Hothi, Harry S; Ilo, Kevin; Whittaker, Robert K; Eskelinen, Antti; Skinner, John A; Hart, Alister J

    2015-09-01

    Numerous studies have reported on corrosion at the modular head taper, however less is known about the interface between the metal shell and liner of modular cups. This study examined the backside of a series of metal modular cup liners of two designs (DePuy Pinnacle and Smith & Nephew R3), retrieved from 67 patients. Visual inspection found evidence of corrosion in virtually all liners, with the engaging rim surface significantly more corroded than the polar regions (P<0.001). EDX confirmed that black surface deposits were chromium rich corrosion debris, while SEM analysis revealed considerable pitting in the vicinity of the black debris. The R3 liners were significantly more corroded that the Pinnacles (P<0.001); this may help to explain the higher revision rates of this design.

  6. Analysis of Earing in Deep Drawn Cups

    NASA Astrophysics Data System (ADS)

    Aretz, Holger; Aegerter, Johannes; Engler, Olaf

    2010-06-01

    The cup-drawing of a strongly anisotropic sheet metal is simulated using a commercial finite element software along with a user material subroutine. In order to accurately describe the plastic anisotropy of the material the well-known recent yield function `Yld2004-18p' is extended. Regarding the experimental characterization of the considered material the occurrence of dynamic strain aging lead to an oscillating signal of the width change of the tensile samples, which prevented a reliable determination of plastic strain ratios (r-values). Thus, an improved measurement concept was developed that leads to a very robust and reproducible determination of r-values. Furthermore, a novel plane-strain tensile test sample is presented which is used for the characterization of the plastic anisotropy in biaxial loading states. A quantitative comparison with measured earing profiles of deep drawn cups illustrates the predictive capabilities of the numerical simulation.

  7. Crystal structure of the CupB6 adhesive tip from the chaperone-usher family of pili from Pseudomonas aeruginosa.

    PubMed

    Rasheed, Masooma; Garnett, James; Pérez-Dorado, Inmaculada; Muhl, Daniela; Filloux, Alain; Matthews, Steve

    2016-11-01

    Pseudomonas aeruginosa is a Gram-negative opportunistic bacterial pathogen that can cause chronic infection of the lungs of cystic fibrosis patients. Chaperone-usher systems in P. aeruginosa are known to translocate and assemble adhesive pili on the bacterial surface and contribute to biofilm formation within the host. Here, we report the crystal structure of the tip adhesion subunit CupB6 from the cupB1-6 gene cluster. The tip domain is connected to the pilus via the N-terminal donor strand from the main pilus subunit CupB1. Although the CupB6 adhesion domain bears structural features similar to other CU adhesins it displays an unusual polyproline helix adjacent to a prominent surface pocket, which are likely the site for receptor recognition. PMID:27481165

  8. Architecture of apical dendrites in the murine neocortex: dual apical dendritic systems.

    PubMed

    Escobar, M I; Pimienta, H; Caviness, V S; Jacobson, M; Crandall, J E; Kosik, K S

    1986-04-01

    A monoclonal antibody (5F9) against microtubule-associated protein 2 is a selective and sensitive marker for neocortical dendrites in the mouse. The marker stains all dendrites. It affords a particularly comprehensive picture of the patterns of arrangements of apical dendrites which are most intensely stained with this antibody. Dual systems of apical dendrites arise from the polymorphic neurons of layer VI, on the one hand, and the pyramidal neurons of layers II-V, on the other. Terminal arborization of the former is concentrated principally at the interface of layers V and IV, while that of the latter is in the molecular layer. Apical dendrites of both systems are grouped into fascicles. In supragranular layers and in upper layer VI-lower layer V, where apical dendrites are most abundant, the fascicles coalesce into septa. These generate a honeycomb-like pattern, subdividing these cortical levels into columnar spaces of approximately 20-40 micron diameter. At the level of layer IV, where the number of apical dendrites is greatly reduced, the fascicles are isolated bundles. These bundles have the form of circular, elliptical or rectangular columns in the primary somatosensory, temporal and frontal regions, respectively. Those in the barrel field are preferentially concentrated in the sides of barrels and the interbarrel septa. The configurations of the dendritic fascicles, particularly the midcortical bundles, may conform to the spatial configuration of investing axons of interneurons.

  9. Advanced material modelling in numerical simulation of primary acetabular press-fit cup stability.

    PubMed

    Souffrant, R; Zietz, C; Fritsche, A; Kluess, D; Mittelmeier, W; Bader, R

    2012-01-01

    Primary stability of artificial acetabular cups, used for total hip arthroplasty, is required for the subsequent osteointegration and good long-term clinical results of the implant. Although closed-cell polymer foams represent an adequate bone substitute in experimental studies investigating primary stability, correct numerical modelling of this material depends on the parameter selection. Material parameters necessary for crushable foam plasticity behaviour were originated from numerical simulations matched with experimental tests of the polymethacrylimide raw material. Experimental primary stability tests of acetabular press-fit cups consisting of static shell assembly with consecutively pull-out and lever-out testing were subsequently simulated using finite element analysis. Identified and optimised parameters allowed the accurate numerical reproduction of the raw material tests. Correlation between experimental tests and the numerical simulation of primary implant stability depended on the value of interference fit. However, the validated material model provides the opportunity for subsequent parametric numerical studies.

  10. Femtoliter silver cups as surface enhanced Raman scattering active containers.

    PubMed

    Bhuvana, T; Kulkarni, G U

    2009-01-28

    Femtoliter capacity Ag cups formed by the pulsed laser ablation of an Ag foil have been tried out as substrates for surface enhanced Raman scattering (SERS) measurements. The cups are formed as the impinging droplets from the laser plume undergo a flow pattern before freezing into cup-like structures, resulting in a surface roughness (approximately 35 nm) that makes them ideal for SERS studies. The internal volume of the cups is in the femtoliter (10(-15) l) range, well suited for small-scale reactions, particularly in biological studies. The cups exhibit enhancement factors of the order of 10(6) with the analyte molecule thiophenol. Individual cups have been dosed attoliter quantities (10(-18) l) of the analyte and detected. PMID:19417320

  11. Perceptual elements in Penn & Teller's "Cups and Balls" magic trick.

    PubMed

    Rieiro, Hector; Martinez-Conde, Susana; Macknik, Stephen L

    2013-01-01

    Magic illusions provide the perceptual and cognitive scientist with a toolbox of experimental manipulations and testable hypotheses about the building blocks of conscious experience. Here we studied several sleight-of-hand manipulations in the performance of the classic "Cups and Balls" magic trick (where balls appear and disappear inside upside-down opaque cups). We examined a version inspired by the entertainment duo Penn & Teller, conducted with three opaque and subsequently with three transparent cups. Magician Teller used his right hand to load (i.e. introduce surreptitiously) a small ball inside each of two upside-down cups, one at a time, while using his left hand to remove a different ball from the upside-down bottom of the cup. The sleight at the third cup involved one of six manipulations: (a) standard maneuver, (b) standard maneuver without a third ball, (c) ball placed on the table, (d) ball lifted, (e) ball dropped to the floor, and (f) ball stuck to the cup. Seven subjects watched the videos of the performances while reporting, via button press, whenever balls were removed from the cups/table (button "1") or placed inside the cups/on the table (button "2"). Subjects' perception was more accurate with transparent than with opaque cups. Perceptual performance was worse for the conditions where the ball was placed on the table, or stuck to the cup, than for the standard maneuver. The condition in which the ball was lifted displaced the subjects' gaze position the most, whereas the condition in which there was no ball caused the smallest gaze displacement. Training improved the subjects' perceptual performance. Occlusion of the magician's face did not affect the subjects' perception, suggesting that gaze misdirection does not play a strong role in the Cups and Balls illusion. Our results have implications for how to optimize the performance of this classic magic trick, and for the types of hand and object motion that maximize magic misdirection.

  12. Aerodynamic Analysis of Cup Anemometers Performance: The Stationary Harmonic Response

    PubMed Central

    Pindado, Santiago; Cubas, Javier; Sanz-Andrés, Ángel

    2013-01-01

    The effect of cup anemometer shape parameters, such as the cups' shape, their size, and their center rotation radius, was experimentally analyzed. This analysis was based on both the calibration constants of the transfer function and the most important harmonic term of the rotor's movement, which due to the cup anemometer design is the third one. This harmonic analysis represents a new approach to study cup anemometer performances. The results clearly showed a good correlation between the average rotational speed of the anemometer's rotor and the mentioned third harmonic term of its movement. PMID:24381512

  13. [The manipulation technique and clinical application of kinetic cupping].

    PubMed

    Luo, Rong; Liu, Qi; Sun, Dan

    2013-07-01

    The characteristic of kinetic cupping is explained from treatment principles, manipulation and clinical application. The kinetic cupping is a new particular therapy that combines traditional cupping and kinetic therapy. With cups on the patient, limb action like flexion-extension, adduction-abduction and rotation is made to reinforce clinical effects, which has simple and safe manipulation, obvious efficacy and is well accepted by patient. It has more obvious advantage for pain that was caused by large-area soft tissue injury and discomfort where acupuncture is not appropriate. PMID:24032211

  14. [Hemispheric hydroxyapatite coated cups in total hip arthroplasty].

    PubMed

    Blacha, J; Bednarek, A; Gagała, J

    1998-01-01

    The paper presents principles of implantation as well as clinical and radiological results of hemispheric hydroxyapatite coated cups use in total hip replacement. Eighty-seven patients (60 females, 27 males) aged from 16 to 72 years (mean 49 years) underwent 96 total hip replacements with the use of 51 ABG and 45 OCTOFIT hemispheric cups. Clinical results were satisfactory with an average Harris Hip Score of 89 to 91 at final follow-up. We have found total ingrowth and osteointegration of nearly all cups. In one case of acetabular reconstruction with bone grafts cup migration has been observed and revision was necessary.

  15. Demonstrated Performance of the Solar Probe Cup

    NASA Astrophysics Data System (ADS)

    Case, A. W.; Kasper, J. C.; Korreck, K. E.; Stevens, M. L.; Daigneau, P.; Freeman, M.; Caldwell, D.; Gauron, T.; Wright, K. H.; Bergner, H.; Cirtain, J. W.; Larson, D.; Brodu, E.; Balat-Pichelin, M.

    2013-12-01

    The Solar Probe Cup (SPC) is a Faraday Cup being developed for the Solar Probe Plus (SPP) mission. SPP will be the first spacecraft to directly measure the solar environment near the Alfven point in the atmosphere of the Sun, approaching to within 10 solar radii of the center of the Sun. In order to make the observations of radially flowing solar wind needed to address questions of coronal and solar wind heating and acceleration, SPC must operate while looking directly at the Sun. As a result, SPC will face a harsh and unprecidented environment, with component temperatures exceeding 1000C at closest approach. SPC is similar in design and operation to the two Faraday Cup instruments on the Wind spacecraft, which have been making stable measurements of the solar wind near Earth for two decades, with two key differences. SPC must survive and operate at extreme temperatures due to the levels of solar flux near the Sun, and it must record the solar wind approximately one thousand times faster than the instruments on Wind to keep up with the rapid variations expected near the Sun. We present results of a demonstration model of SPC operated in laboratory reproductions of the near-Sun environment. In the last year, SPC has been exposed to simulated encounter solar fluxes and resulting temperature profiles using a vaccum chamber and modified IMAX film projectors. In addition, SPC has been exposed to realistic ion beams. We show that SPC can operate in these environments, and make the measurements required for the sucess of the Solar Probe mission. Based on the performance of our prototype, the expected cadence and sensitivity of SPC will be discussed, with a focus on its ability to distinguish between models of heating in the solar corona.

  16. NCI Holds on to Defelice Cup | Poster

    Cancer.gov

    NCI kept the Defelice Cup trophy this year after beating Leidos Biomedical Research, 15 to 9, at the 10th annual Ronald H. Defelice Golf Tournament held on Columbus Day. Sixteen players on each team battled it out at the yearly contractor vs. government tournament held at Rattlewood Golf Course in Mount Airy, Md. NCI leads the series 6–4. “The score was the highest NCI margin of victory in the 10-year series,” said Denny Dougherty, retired senior subcontracts advisor at what was formerly SAIC-Frederick. “The intensity of the annual competition has increased each year and has become...

  17. Dual mobility cups in total hip arthroplasty

    PubMed Central

    De Martino, Ivan; Triantafyllopoulos, Georgios Konstantinos; Sculco, Peter Keyes; Sculco, Thomas Peter

    2014-01-01

    Total hip arthroplasty (THA) is considered one of the most successful surgical procedures in orthopaedics. With the increase in the number of THAs performed in the world in the next decades, reducing or preventing medical and mechanical complications such as post-operative THA instability will be of paramount importance, particularly in an emerging health care environment based on quality control and patient outcome. Dual mobility acetabular component (also known as unconstrained tripolar implant) was introduced in France at the end of the 1970s as an alternative to standard sockets, to reduce the risk of THA dislocation in patients undergoing primary THA in France. Dual mobility cups have recently gained wider attention in the United States as an alternative option in the prevention and treatment of instability in both primary and revision THA and offer the benefit of increased stability without compromising clinical outcomes and implant longevity. In this article, we review the use of dual mobility cup in total hip arthroplasty in terms of its history, biomechanics, outcomes and complications based on more than 20 years of medical literature. PMID:25035820

  18. A critical comparison of ten disposable cup LCAs

    SciTech Connect

    Harst, Eugenie van der; Potting, José

    2013-11-15

    Disposable cups can be made from conventional petro-plastics, bioplastics, or paperboard (coated with petro-plastics or bioplastics). This study compared ten life cycle assessment (LCA) studies of disposable cups with the aim to evaluate the robustness of their results. The selected studies have only one impact category in common, namely climate change with global warming potential (GWP) as its category indicator. Quantitative GWP results of the studies were closer examined. GWPs within and across each study show none of the cup materials to be consistently better than the others. Comparison of the absolute GWPs (after correction for the cup volume) also shows no consistent better or worse cup material. An evaluation of the methodological choices and the data sets used in the studies revealed their influence on the GWP. The differences in GWP can be attributed to a multitude of factors, i.e., cup material and weight, production processes, waste processes, allocation options, and data used. These factors basically represent different types of uncertainty. Sensitivity and scenario analyses provided only the influence of one factor at once. A systematic and simultaneous use of sensitivity and scenario analyses could, in a next research, result in more robust outcomes. -- Highlights: • Conflicting results from life cycle assessment (LCA) on disposable cups • GWP results of LCAs did not point to a best or worst cup material. • Differences in GWP results are due to methodological choices and data sets used. • Standardized LCA: transparency of LCA studies, but still different in approaches.

  19. Apical-basal polarity proteins are required cell-type specifically to direct photoreceptor morphogenesis.

    PubMed

    Hwa, Jennifer J; Clandinin, Thomas R

    2012-12-18

    Insect photoreceptor function is dependent on precise placement of the rhabdomeres, elaborated apical domains specialized for capturing light, within each facet of a compound eye. In Diptera, an asymmetric arrangement of rhabdomeres, combined with a particular pattern of axonal connections, enhances light sensitivity through the principle of neural superposition. To achieve the necessary retinal geometry, different photoreceptors (R cells) have distinct shapes. The Crumbs and Bazooka complexes play critical roles in directing rhabdomere development, but whether they might direct cell-type-specific apical architectures is unknown. We demonstrate that while mutations in Bazooka complex members cause pleiotropic morphogenesis defects in all R cell subtypes, Crumbs (Crb) and Stardust (Sdt) function cell autonomously to direct early stages in rhabdomere assembly in specific subsets of R cells. This requirement is reflected in the cell-type-specific expression of Crb protein and demonstrates that Sdt and Crb can act independently to similar effect. These two genes are also required for zonula adherens (ZA) assembly but display an unusual pattern of cellular redundancy for this function, as each gene is required in only one of two adjoining cells. Our results provide a direct link between fate specification and morphogenetic patterning and suggest a model for ZA assembly.

  20. Efficacy of Biodentine as an Apical Plug in Nonvital Permanent Teeth with Open Apices: An In Vitro Study.

    PubMed

    Bani, Mehmet; Sungurtekin-Ekçi, Elif; Odabaş, Mesut Enes

    2015-01-01

    The aim of this study was to evaluate the apical microleakage of Biodentine and MTA orthograde apical plugs and to compare the effect of thickness of these biomaterials on their sealing ability. A total of eighty maxillary anterior teeth were used. The apices were removed by cutting with a diamond disc (Jota, Germany) 2 mm from the apical root end in an attempt to standardize the working length of all specimens to 15 ± 1 mm. Both materials were placed in 1-4 mm thickness as apical plugs root canal. Root canal leakage was evaluated by the fluid filtration technique. One-way ANOVA was used in order to determine normality of dispersal distribution of parameters; thereafter, results were analyzed by Kolmogorov-Smirnov test. Overall, between microleakage values of MTA and Biodentine regardless of apical plug thickness, no difference was observed. In terms of plug thickness, a statistically significant difference was observed between the subgroups of MTA and Biodentine (p < 0.05). The apical sealing ability of Biodentine was comparable to MTA at any apical plug thickness. PMID:26436090

  1. Efficacy of Biodentine as an Apical Plug in Nonvital Permanent Teeth with Open Apices: An In Vitro Study

    PubMed Central

    Bani, Mehmet; Sungurtekin-Ekçi, Elif; Odabaş, Mesut Enes

    2015-01-01

    The aim of this study was to evaluate the apical microleakage of Biodentine and MTA orthograde apical plugs and to compare the effect of thickness of these biomaterials on their sealing ability. A total of eighty maxillary anterior teeth were used. The apices were removed by cutting with a diamond disc (Jota, Germany) 2 mm from the apical root end in an attempt to standardize the working length of all specimens to 15 ± 1 mm. Both materials were placed in 1–4 mm thickness as apical plugs root canal. Root canal leakage was evaluated by the fluid filtration technique. One-way ANOVA was used in order to determine normality of dispersal distribution of parameters; thereafter, results were analyzed by Kolmogorov-Smirnov test. Overall, between microleakage values of MTA and Biodentine regardless of apical plug thickness, no difference was observed. In terms of plug thickness, a statistically significant difference was observed between the subgroups of MTA and Biodentine (p < 0.05). The apical sealing ability of Biodentine was comparable to MTA at any apical plug thickness. PMID:26436090

  2. Photoelastic analysis of stresses produced by different acetabular cups.

    PubMed

    Ries, M D; Salehi, A; Shea, J

    1999-12-01

    Porous-coated acetabular components can provide long-term biologic fixation to bone. However, the periacetabular stress patterns and mechanisms by which different types of cementless acetabular cups obtain initial stability is not clear. In the current study, periacetabular stresses produced by different cementless acetabular cup geometries were quantitated using a three-dimensional photoelastic model. The cup geometries consisted of trispiked, finned, hemispherical, and nonhemispherical (wider than a hemisphere at the periphery) geometries. The cup models were loaded incrementally in the photoelastic material to simulate periacetabular stress distributions at the time of implantation during surgery rather than under physiologic weightbearing loads. The peripheral stress distributions and their magnitudes induced by the trispiked and oversized hemispherical cups were similar, but the trispiked cup induced localized high stress regions where the spikes penetrate the bone model. The fins separated the periacetabular material into quadrants, which was associated with decreased peripheral stresses. A nonhemispherical geometry with a wider diameter at the rim than a hemisphere increased peripheral stresses more than an oversized hemispherical geometry and required less force to seat the implant. Although various cementless acetabular cups can perform well clinically, they produce different periacetabular stresses and appear to obtain initial fixation by different mechanisms. PMID:10611871

  3. Feeding Neonates by Cup: A Systematic Review of the Literature.

    PubMed

    McKinney, Christy M; Glass, Robin P; Coffey, Patricia; Rue, Tessa; Vaughn, Matthew G; Cunningham, Michael

    2016-08-01

    Objective WHO and UNICEF recommend cup feeding for neonates unable to breastfeed in low-resource settings. In developed countries, cup feeding in lieu of bottle feeding in the neonatal period is hypothesized to improve breastfeeding outcomes for those initially unable to breastfeed. Our aim was to synthesize the entire body of evidence on cup feeding. Methods We searched domestic and international databases for original research. Our search criteria required original data on cup feeding in neonates published in English between January 1990 and December 2014. Results We identified 28 original research papers. Ten were randomized clinical trials, 7 non-randomized intervention studies, and 11 observational studies; 11 were conducted in developing country. Outcomes evaluated included physiologic stability, safety, intake, duration, spillage, weight gain, any and exclusive breastfeeding, length of hospital stay, compliance, and acceptability. Cup feeding appears to be safe though intake may be less and spillage greater relative to bottle or tube feeding. Overall, slightly higher proportions of cup fed versus bottle fed infants report any breastfeeding; a greater proportion of cup fed infants reported exclusive breastfeeding at discharge and beyond. Cup feeding increases breastfeeding in subgroups (e.g. those who intend to breastfeed or women who had a Caesarean section). Compliance and acceptability is problematic in certain settings. Conclusions Further research on long-term breastfeeding outcomes and in low-resource settings would be helpful. Research data on high risk infants (e.g. those with cleft palates) would be informative. Innovative cup feeding approaches to minimize spillage, optimize compliance, and increase breastfeeding feeding are needed. PMID:27016350

  4. Apical surgery: A review of current techniques and outcome

    PubMed Central

    von Arx, Thomas

    2010-01-01

    Apical surgery is considered a standard oral surgical procedure. It is often a last resort to surgically maintain a tooth with a periapical lesion that cannot be managed with conventional endodontic (re-)treatment. The main goal of apical surgery is to prevent bacterial leakage from the root-canal system into the periradicular tissues by placing a tight root-end filling following root-end resection. Clinicians are advised to utilize a surgical microscope to perform apical surgery to benefit from magnification and illumination. In addition, the application of microsurgical techniques in apical surgery, i.e., gentle incision and flap elevation, production of a small osteotomy, and the use of sonic- or ultrasonic driven microtips, will result in less trauma to the patient and faster postsurgical healing. A major step in apical surgery is to identify possible leakage areas at the cut root face and subsequently to ensure adequate root-end filling. Only a tight and persistent apical obturation will allow periapical healing with good long-term prognosis. The present paper describes current indications, techniques and outcome of apical surgery. PMID:24151412

  5. Effect of gravity on apical dominance in Pharbitis nil.

    PubMed

    Kitazawa, Daisuke; Fujii, Nobuharu; Suge, Hiroshi; Takahashi, Hideyuki

    2003-10-01

    When the upper part of main shoot of morning glory (Pharbitis nil) is gently bent down, lateral bud on the bending region is released from apical dominance and starts to elongate. But, clinorotating the bending shoots prevents the release of the lateral bud from apical dominance. These results suggest that gravity affects apical dominance in morning glory. Here we verified the gravity-regulated apical dominance by using a weeping morning glory defective in gravitropic response due to abnormal differentiation of endodermis. That is, bending main shoot of the weeping morning glory hardly caused the lateral bud to elongate. In addition, decapitation of apical bud released the lateral bud from apical dominance, and exogenous auxin applied to the cut surface of the decapitated stem was inhibitory to the outgrowth of the lateral bud in the wild type. However, the effect of auxin was much less in the weeping morning glory. Thus, apical dominance of the weeping morning glory was weaker and less influenced by gravity than that of the wild type, which could occur due to abnormal differentiation of endodermis required for graviperception.

  6. Hypercompliant Apical Membranes of Bladder Umbrella Cells

    PubMed Central

    Mathai, John C.; Zhou, Enhua H.; Yu, Weiqun; Kim, Jae Hun; Zhou, Ge; Liao, Yi; Sun, Tung-Tien; Fredberg, Jeffrey J.; Zeidel, Mark L.

    2014-01-01

    Urinary bladder undergoes dramatic volume changes during filling and voiding cycles. In the bladder the luminal surface of terminally differentiated urothelial umbrella cells is almost completely covered by plaques. These plaques (500 to 1000 nm) are made of a family of proteins called uroplakins that are known to form a tight barrier to prevent leakage of water and solutes. Electron micrographs from previous studies show these plaques to be interconnected by hinge regions to form structures that appear rigid, but these same structures must accommodate large changes in cell shape during voiding and filling cycles. To resolve this paradox, we measured the stiffness of the intact, living urothelial apical membrane and found it to be highly deformable, even more so than the red blood cell membrane. The intermediate cells underlying the umbrella cells do not have uroplakins but their membranes are an order of magnitude stiffer. Using uroplakin knockout mouse models we show that cell compliance is conferred by uroplakins. This hypercompliance may be essential for the maintenance of barrier function under dramatic cell deformation during filling and voiding of the bladder. PMID:25229135

  7. Apical control of conidiation in Aspergillus nidulans.

    PubMed

    Oiartzabal-Arano, Elixabet; Perez-de-Nanclares-Arregi, Elixabet; Espeso, Eduardo A; Etxebeste, Oier

    2016-05-01

    The infection cycle of filamentous fungi consists of two main stages: invasion (growth) and dispersion (development). After the deposition of a spore on a host, germination, polar extension and branching of vegetative cells called hyphae allow a fast and efficient invasion. Under suboptimal conditions, genetic reprogramming of hyphae results in the generation of asexual spores, allowing dissemination to new hosts and the beginning of a new infection cycle. In the model filamentous fungus Aspergillus nidulans, asexual development or conidiation is induced by the upstream developmental activation (UDA) pathway. UDA proteins transduce signals from the tip, the polarity site of hyphae, to nuclei, where developmental programs are transcriptionally activated. The present review summarizes the current knowledge on this tip-to-nucleus communication mechanism, emphasizing its dependence on hyphal polarity. Future approaches to the topic will also be suggested, as stimulating elements contributing to the understanding of how apical signals are coupled with the transcriptional control of development and pathogenesis in filamentous fungi. PMID:26782172

  8. Genetic Predisposition to Persistent Apical Periodontitis

    PubMed Central

    Morsani, Jussara M.; Aminoshariae, Anita; Han, Yiping Weng; Montagnese, Thomas A.; Mickel, Andre

    2013-01-01

    Introduction The proinflammatory cytokine interleukin (IL)-1 is a key regulator of host responses to microbial infection and a major modulator of extracellular matrix catabolism and bone resorption. Allele2 of IL-1b is associated with a four-fold increase in IL-1β production. The aim of this case-control study was to evaluate the gene polymorphism of IL-1β in the pathogenesis of endodontic failure. We hypothesized that the gene polymorphism (allele2 of IL-1β) would influence host response and enhance inflammatory reactions predisposing to persistent apical periodontitis (PAP). Materials and Methods Subjects with at least 1 year of follow-up after root canal therapy (RCT) were recalled. Inclusion and exclusion criteria were applied, and 34 subjects with signs/symptoms of PAP with otherwise acceptable RCT were included. Sixty-one controls showed healing with acceptable RCT. Genomic DNA from buccal mucosa was amplified by polymerase chain reaction followed by restriction fragment length polymorphism to distinguish the alleles of IL-1β gene polymorphism. Results A significant difference in the distribution of the polymorphic genotype among cases (70.6%) and controls (24.6%) (P < .001, Pearson χ2) was shown. Conclusions These findings suggest that specific genetic markers associated with increased IL-1β production may contribute to increased susceptibility to PAP. PMID:21419289

  9. Figuring out the Statistics of the ICC World Cup 2011

    ERIC Educational Resources Information Center

    Shiwalkar, Jyoti P.; Deshpande, M. N.

    2013-01-01

    This paper deals with the analysis of cricket match results from the ICC World Cup 2011. We believe that such data provide good material for interesting classroom exercises. (Contains 7 tables and 1 figure.)

  10. Space Coffee Cup: Capillary Flow Driven Fluids in Space

    NASA Video Gallery

    Interested in learning more about how fluids react in Space? In this video, Professor Mark Weislogel, and Dr. Marshall Porterfield will discuss the Space Coffee Cup and Capillary Flow Driven Fluids...

  11. Sound of a cup with and without instant coffee

    NASA Astrophysics Data System (ADS)

    Morrison, Andrew; Rossing, Thomas D.

    2002-05-01

    An empty coffee cup, like an ancient Chinese two-tone bell, emits two distinctly different tones, depending upon where it is tapped. When it is filled with hot water, and some instant coffee is added, however, a whole new set of sounds is heard when the cup is tapped. The pitch rises an octave or more as the foam clears due to the dramatic change in the speed of sound in the bubble-filled liquid. A similar, but smaller, effect was noted in beer by Bragg [The World of Sound (1968)] and in hot chocolate by Crawford [Am. J. Phys. (1982)]. We describe the modes of vibration in a coffee cup and the sound emitted by a coffee cup as filled with instant coffee as the bubble density changes.

  12. Degradation of protective organic coatings after cupping test

    SciTech Connect

    Deflorian, F.; Fedrizzi, L.; Rossi, S.

    1999-11-01

    Coil coating products generally are shaped by deforming and bending after coating. These deformations can produce defects inducing a significant deterioration of the protective properties of the organic coating. An empirical method for the evaluation of the deformation effects is the cupping test. in the present work, effects of the cupping test were studied by using electrochemical impedance spectroscopy (EIS) measurements to study the influence of deformation conditions on the mechanisms of degradation of the protective properties. The materials studied were environmentally friendly coatings based on ion exchange pigments. In addition to the electrochemical characterizations, a finite element model was developed for the estimation of the strain after the cupping test and some adhesion measurements were performed. The cupping test with an electrochemical characterization with EIS is a valid method for the evaluation of the protective behavior of coil coating products after deformation.

  13. Prevalence of disc cupping in non-glaucomatous eyes.

    PubMed

    Chiappe, José Pablo; Nahum, Pablo; Casiraghi, Javier F; Iribarren, Rafael

    2015-01-01

    This study assessed optic disc size and cupping, using a commercially available ophthalmoscope, in order to show norms of these values for clinical practice. Subjects were office-workers referred from their respective workplaces for a routine medical examination, which included eye examination. The optic disc size was classified as small, medium or large, for having a diameter < 1.0, 1.0-1.5, or > 1.5 times (respectively) the diameter of the ophthalmoscope's selected light spot on the posterior pole. The cupping was classified as the ratio of the vertical cupping diameter and the vertical disc diameter on a relative decimal scale from 0.0 to 1.0.This study included 184 subjects with a mean age of 40.5 ± 9.5 years; 149 (81%) were males. Their mean ocular pressure was 12.4 ± 1.5 mmHg (range 10-17 mmHg). There was a high correlation between optic disc sizes and cupping in the right and left eyes (Pearson Correlation r = 0.866, p < 0.001); therefore, for simplicity only the data for right eyes are presented. According to our definition, the optic discs in these eyes comprised 27 (14.7%) small, 141 (76.6%) medium and 16 (8.7%) large. The small optic discs were rarely cupped, and the large optic discs were always cupped. Optic disc cupping greater than 0.7 was rarely found and should be suspect of glaucoma. Clinical doctors should be aware of this and refer those subjects with abnormal cupping to the specialist. PMID:25637893

  14. Space Experiment Concepts: Cup-Burner Flame Extinguishment

    NASA Technical Reports Server (NTRS)

    Takahashi, Fumiaki

    2004-01-01

    Space Fire Suppression Processes & Technology. Space experiment concepts of cup-burner flame extinguishment have been conceived to address to the key issues (i.e., organizing questions) in space fire suppression. Cup-burner flame extinguishment experiment can reveal physical and chemical suppression processes and provide agent effectiveness data useful for technology development of space fire suppression systems in various reduced-gravity platforms.

  15. Prevalence of disc cupping in non-glaucomatous eyes.

    PubMed

    Chiappe, José Pablo; Nahum, Pablo; Casiraghi, Javier F; Iribarren, Rafael

    2015-01-01

    This study assessed optic disc size and cupping, using a commercially available ophthalmoscope, in order to show norms of these values for clinical practice. Subjects were office-workers referred from their respective workplaces for a routine medical examination, which included eye examination. The optic disc size was classified as small, medium or large, for having a diameter < 1.0, 1.0-1.5, or > 1.5 times (respectively) the diameter of the ophthalmoscope's selected light spot on the posterior pole. The cupping was classified as the ratio of the vertical cupping diameter and the vertical disc diameter on a relative decimal scale from 0.0 to 1.0.This study included 184 subjects with a mean age of 40.5 ± 9.5 years; 149 (81%) were males. Their mean ocular pressure was 12.4 ± 1.5 mmHg (range 10-17 mmHg). There was a high correlation between optic disc sizes and cupping in the right and left eyes (Pearson Correlation r = 0.866, p < 0.001); therefore, for simplicity only the data for right eyes are presented. According to our definition, the optic discs in these eyes comprised 27 (14.7%) small, 141 (76.6%) medium and 16 (8.7%) large. The small optic discs were rarely cupped, and the large optic discs were always cupped. Optic disc cupping greater than 0.7 was rarely found and should be suspect of glaucoma. Clinical doctors should be aware of this and refer those subjects with abnormal cupping to the specialist.

  16. An investigation of home disadvantage in Davis Cup tennis.

    PubMed

    Gayton, William F; Steinroeder, William; Bonnica, Corrine; Loignon, Andrew C

    2009-10-01

    Occurrence of the home disadvantage in Davis Cup tennis matches was examined by analyzing the outcome of Davis Cup finals matches from 1900 to 2007. There was no significant home disadvantage when Matches 1 and 2 were compared with Matches 4 and 5. However, there was a significant home disadvantage when Matches 1 and 2 were compared with Match 5. These findings are compared with those from earlier studies in which data from professional basketball and baseball were examined.

  17. A Zero-Gravity Cup for Drinking Beverages in Microgravity

    NASA Technical Reports Server (NTRS)

    Pettit, Donald R.; Weislogel, Mark; Concus, Paul; Finn, Robert

    2011-01-01

    To date, the method for astronauts to drink liquids in microgravity or weightless environments is to suck the liquid from a bag or pouch through a straw. A new beverage cup works in microgravity and allows astronauts to drink liquids from a cup in a manner consistent with that on Earth. The cup is capable of holding beverages with an angled channel running along the wall from the bottom to the lip. In microgravity, a beverage is placed into the cup using the galley dispenser. The angled channel acts as an open passage that contains only two sides where capillary forces move the liquid along the channel until it reaches the top lip where the forces reach an equilibrium and the flow stops. When one sips the liquid at the lip of the channel, the capillary force equilibrium is upset and more liquid flows to the lip from the reservoir at the bottom to re-establish the equilibrium. This sipping process can continue until the total liquid contents of the cup is consumed, leaving only a few residual drops about the same quantity as in a ceramic cup when it is drunk dry on Earth.

  18. Splash-cup plants accelerate raindrops to disperse seeds

    PubMed Central

    Amador, Guillermo J.; Yamada, Yasukuni; McCurley, Matthew; Hu, David L.

    2013-01-01

    The conical flowers of splash-cup plants Chrysosplenium and Mazus catch raindrops opportunistically, exploiting the subsequent splash to disperse their seeds. In this combined experimental and theoretical study, we elucidate their mechanism for maximizing dispersal distance. We fabricate conical plant mimics using three-dimensional printing, and use high-speed video to visualize splash profiles and seed travel distance. Drop impacts that strike the cup off-centre achieve the largest dispersal distances of up to 1 m. Such distances are achieved because splash speeds are three to five times faster than incoming drop speeds, and so faster than the traditionally studied splashes occurring upon horizontal surfaces. This anomalous splash speed is because of the superposition of two components of momentum, one associated with a component of the drop's motion parallel to the splash-cup surface, and the other associated with film spreading induced by impact with the splash-cup. Our model incorporating these effects predicts the observed dispersal distance within 6–18% error. According to our experiments, the optimal cone angle for the splash-cup is 40°, a value consistent with the average of five species of splash-cup plants. This optimal angle arises from the competing effects of velocity amplification and projectile launching angle. PMID:23235266

  19. The Neurospora crassa exocyst complex tethers Spitzenkörper vesicles to the apical plasma membrane during polarized growth

    PubMed Central

    Riquelme, Meritxell; Bredeweg, Erin L.; Callejas-Negrete, Olga; Roberson, Robert W.; Ludwig, Sarah; Beltrán-Aguilar, Alejandro; Seiler, Stephan; Novick, Peter; Freitag, Michael

    2014-01-01

    Fungal hyphae are among the most highly polarized cells. Hyphal polarized growth is supported by tip-directed transport of secretory vesicles, which accumulate temporarily in a stratified manner in an apical vesicle cluster, the Spitzenkörper. The exocyst complex is required for tethering of secretory vesicles to the apical plasma membrane. We determined that the presence of an octameric exocyst complex is required for the formation of a functional Spitzenkörper and maintenance of regular hyphal growth in Neurospora crassa. Two distinct localization patterns of exocyst subunits at the hyphal tip suggest the dynamic formation of two assemblies. The EXO-70/EXO-84 subunits are found at the peripheral part of the Spitzenkörper, which partially coincides with the outer macrovesicular layer, whereas exocyst components SEC-5, -6, -8, and -15 form a delimited crescent at the apical plasma membrane. Localization of SEC-6 and EXO-70 to the plasma membrane and the Spitzenkörper, respectively, depends on actin and microtubule cytoskeletons. The apical region of exocyst-mediated vesicle fusion, elucidated by the plasma membrane–associated exocyst subunits, indicates the presence of an exocytotic gradient with a tip-high maximum that dissipates gradually toward the subapex, confirming the earlier predictions of the vesicle supply center model for hyphal morphogenesis. PMID:24523289

  20. Localization of apical sushi protein in Plasmodium falciparum merozoites.

    PubMed

    Srivastava, Anand; Singh, Shailja; Dhawan, Shikha; Mahmood Alam, M; Mohmmed, Asif; Chitnis, Chetan E

    2010-11-01

    Plasmodium falciparum belongs to the Apicomplexan group of parasites and is characterised by presence of specialized secretory organelles at the apical end. These apical organelles, referred to as microneme and rhoptries, contain proteins that play important roles during host cell invasion by mediating specific functions such as initial attachment, apical reorientation and junction formation. Recently, a protein referred to as P. falciparum apical sushi protein (PfASP), which is expressed at late schizont stage, was localized to micronemes of P. falciparum merozoites. In the present study, we have used indirect immunofluorescence assays and immunoelectron microscopy to demonstrate that PfASP is localized in the neck of rhoptries and not in micronemes as previously described.

  1. Apical constriction and epithelial invagination are regulated by BMP activity

    PubMed Central

    Jidigam, Vijay K.; Srinivasan, Raghuraman C.; Patthey, Cedric; Gunhaga, Lena

    2015-01-01

    ABSTRACT Epithelial invagination is a morphological process in which flat cell sheets transform into three-dimensional structures through bending of the tissue. It is accompanied by apical constriction, in which the apical cell surface is reduced in relation to the basal cell surface. Although much is known about the intra-cellular molecular machinery driving apical constriction and epithelial invagination, information of how extra-cellular signals affect these processes remains insufficient. In this study we have established several in vivo assays of placodal invagination to explore whether the external signal BMP regulates processes connected to epithelial invagination. By inhibiting BMP activity in prospective cranial placodes, we provide evidence that BMP signals are required for RhoA and F-actin rearrangements, apical constriction, cell elongation and epithelial invagination. The failure of placode invagination after BMP inhibition appears to be a direct consequence of disrupted apical accumulation of RhoA and F-actin, rather than changes in cell death or proliferation. In addition, our results show that epithelial invagination and acquisition of placode-specific identities are two distinct and separable developmental processes. In summary, our results provide evidence that BMP signals promote epithelial invagination by acting upstream of the intracellular molecular machinery that drives apical constriction and cell elongation. PMID:26621830

  2. Haemostatic agents in apical surgery. A systematic review

    PubMed Central

    Clé-Ovejero, Adrià

    2016-01-01

    Background Blood presence in apical surgery can prevent the correct vision of the surgical field, change the physical properties of filling materials and reduce their sealing ability. Objetive To describe which are the most effective and safest haemostatic agents to control bleeding in patients undergoing apical surgery. Material and Methods TWe carried out a systematic review, using Medline and Cochrane Library databases, of human clinical studies published in the last 10 years. Results The agents that proved more effective in bleeding control were calcium sulphate (100%) and collagen plus epinephrine (92.9%) followed by ferric sulphate (60%), gauze packing (30%) and collagen (16.7%). When using aluminium chloride (Expasyl®), over 90% of the apical lesions improved, but this agent seemed to increase swelling. Epinephrine with collagen did not significantly raise either blood pressure or heart rate. Conclusions Despite the use of several haemostatic materials in apical surgery, there is little evidence on their effectiveness and safety. The most effective haemostatic agents were calcium sulphate and epinephrine plus collagen. Epinephrine plus collagen did not seem to significantly raise blood pressure or heart rate during surgery. Aluminium chloride did not increase postoperative pain but could slightly increase postoperative swelling. Randomized clinical trials are needed to assess the haemostatic effectiveness and adverse effects of haemostatic materials in apical surgery. Key words:Haemostasis, apical surgery. PMID:27475689

  3. Interactions of CUP-SHAPED COTYLEDON and SPATULA Genes Control Carpel Margin Development in Arabidopsis thaliana

    PubMed Central

    Nahar, Most. Altaf-Un; Ishida, Tetsuya; Smyth, David R; Tasaka, Masao; Aida, Mitsuhiro

    2012-01-01

    A characteristic feature of flowering plants is the fusion of carpels, which results in the formation of an enclosed gynoecium. In Arabidopsis thaliana, the gynoecium is formed by the fusion of two carpels along their margins, which also act as a meristematic site for the formation of internal structures such as ovules, the septum and transmitting tract. How gene interactions coordinate the fusion and differentiation of the marginal structures during gynoecium development is largely unknown. It was previously shown that the SPATULA (SPT) gene is required for carpel fusion, whereas overexpression of the CUP-SHAPED COTYLEDON genes CUC1 and CUC2 prevents it. Here we provide evidence that SPT promotes carpel fusion in the apical gynoecium partly through the negative regulation of CUC1 and CUC2 expression. In spt, transcripts of both CUC genes accumulated ectopically, and addition of cuc1 and cuc2 mutations to spt suppressed the split phenotype of carpels specifically along their lateral margins. In the basal gynoecium, on the other hand, all three genes promoted the formation of margin-derived structures, as revealed by the synergistic interactions of spt with each of the cuc mutations. Our results suggest that differential interactions among SPT, CUC1 and CUC2 direct the formation of domain-specific structures of the Arabidopsis gynoecium. PMID:22514090

  4. Effect of apical clearing technique on the treatment outcome of teeth with asymptomatic apical periodontitis: A randomized clinical trial

    PubMed Central

    Mittal, Priya; Logani, Ajay; Shah, Naseem; Pandey, R. M.

    2016-01-01

    Aim: This study aims to compare the periapical healing of teeth with asymptomatic apical periodontitis treated either by conventional apical preparation (CAP) or apical clearing technique (ACT). Materials and Methods: Twenty subjects with bilateral nonvital similar teeth exhibiting comparable periapical index (PAI) score were enrolled and randomly allocated. Group I (CAP, n = 20): Apical preparation three sizes greater (master apical file [MAF]) than the first binding file at the established working length. Group II (ACT, n = 20): Apical preparation three sizes greater than the MAF that was followed by dry reaming. Root canal therapy was accomplished in single-visit for all the teeth. They were pursued radiographically at 3, 6, 9 and 12 months. Pre- and post-treatment PAI scores were compared. To ascertain the proportion of healed teeth between the two groups, McNemar Chi-square test was applied. Results: At 3, 6, and 9 months’ time interval the proportion of healed teeth for Group II (ACT) was greater in comparison to Group I (CAP) (P < 0.05). However, at 12 months follow-up period this difference was not significant (P = 0.08). Conclusion: ACT enhanced the healing kinetics. However, the long-term (12 months) radiographic outcome was similar for either technique. PMID:27656054

  5. Effect of apical clearing technique on the treatment outcome of teeth with asymptomatic apical periodontitis: A randomized clinical trial

    PubMed Central

    Mittal, Priya; Logani, Ajay; Shah, Naseem; Pandey, R. M.

    2016-01-01

    Aim: This study aims to compare the periapical healing of teeth with asymptomatic apical periodontitis treated either by conventional apical preparation (CAP) or apical clearing technique (ACT). Materials and Methods: Twenty subjects with bilateral nonvital similar teeth exhibiting comparable periapical index (PAI) score were enrolled and randomly allocated. Group I (CAP, n = 20): Apical preparation three sizes greater (master apical file [MAF]) than the first binding file at the established working length. Group II (ACT, n = 20): Apical preparation three sizes greater than the MAF that was followed by dry reaming. Root canal therapy was accomplished in single-visit for all the teeth. They were pursued radiographically at 3, 6, 9 and 12 months. Pre- and post-treatment PAI scores were compared. To ascertain the proportion of healed teeth between the two groups, McNemar Chi-square test was applied. Results: At 3, 6, and 9 months’ time interval the proportion of healed teeth for Group II (ACT) was greater in comparison to Group I (CAP) (P < 0.05). However, at 12 months follow-up period this difference was not significant (P = 0.08). Conclusion: ACT enhanced the healing kinetics. However, the long-term (12 months) radiographic outcome was similar for either technique.

  6. Differentiation of Apical Bud Cells in a Newly Developed Apical Bud Transplantation Model Using GFP Transgenic Mice as Donor

    PubMed Central

    Sakagami, Ryuji; Yoshinaga, Yasunori; Okamura, Kazuhiko

    2016-01-01

    Rodent mandibular incisors have a unique anatomical structure that allows teeth to grow throughout the lifetime of the rodent. This report presents a novel transplantation technique for studying the apical bud differentiation of rodent mandibular incisors. Incisal apical end tissue with green fluorescent protein from transgenic mouse was transplanted to wild type mice, and the development of the transplanted cells were immunohistologically observed for 12 weeks after the transplantation. Results indicate that the green fluorescent apical end tissue replaced the original tissue, and cells from the apical bud differentiated and extended toward the incisal edge direction. The immunostaining with podoplanin also showed that the characteristics of the green fluorescent tissue were identical to those of the original. The green fluorescent cells were only found in the labial side of the incisor up to 4 weeks. After 12 weeks, however, they were also found in the lingual side. Here the green fluorescent cementocyte-like cells were only present in the cementum close to the dentin surface. This study suggests that some of the cells that form the cellular cementum come from the apical tissue including the apical bud in rodent incisors. PMID:26978064

  7. Fixation strength analysis of cup to bone material using finite element simulation

    NASA Astrophysics Data System (ADS)

    Anwar, Iwan Budiwan; Saputra, Eko; Ismail, Rifky; Jamari, J.; van der Heide, Emile

    2016-04-01

    Fixation of acetabular cup to bone material is an important initial stability for artificial hip joint. In general, the fixation in cement less-type acetabular cup uses press-fit and screw methods. These methods can be applied alone or together. Based on literature survey, the additional screw inside of cup is effective; however, it has little effect in whole fixation. Therefore, an acetabular cup with good fixation, easy manufacture and easy installation is required. This paper is aiming at evaluating and proposing a new cup fixation design. To prove the strength of the present cup fixation design, the finite element simulation of three dimensional cup with new fixation design was performed. The present cup design was examined with twist axial and radial rotation. Results showed that the proposed cup design was better than the general version.

  8. New is the well-forgotten old: The use of dry cupping in musculoskeletal medicine.

    PubMed

    Rozenfeld, Evgeni; Kalichman, Leonid

    2016-01-01

    Cupping is an ancient technique used in treating pain and various disorders. Different techniques have been developed over time, however, applying a cup to create suction over a painful area, is common to all. Dry or fire cupping, used on the intact skin, leaves bluish circular hematomas. Recently, interest in cupping has re-emerged and subsequently, several studies have begun to investigate the mechanisms of cupping therapy. Mechanically, cupping increases blood circulation, whereas physiologically it activates the immune system and stimulates the mechanosensitive fibers, thus leading to a reduction in pain. There is initial scientific evidence that dry cupping is able to reduce musculoskeletal pain. Since cupping is an inexpensive, noninvasive and low-risk (if performed by a trained practitioner) therapeutic modality, we believe that it should be included in the arsenal of musculoskeletal medicine. It is essential to perform additional studies clarifying the biological mechanism and clinical effects of cupping. PMID:26891653

  9. Short-term survival of the trabecular metal cup is similar to that of standard cups used in acetabular revision surgery

    PubMed Central

    Mohaddes, Maziar; Rolfson, Ola; Kärrholm, Johan

    2015-01-01

    Background and purpose The use of trabecular metal (TM) cups in revision surgery has increased worldwide during the last decade. Since the introduction of the TM cup in Sweden in 2006, this design has gradually replaced other uncemented designs used in Sweden. According to data from the Swedish Hip Arthroplasty Register (SHAR) in 2012, one-third of all uncemented first-time cup revisions were performed using a TM cup. We compared the risk of reoperation and re-revision for TM cups and the 2 other most frequently used cup designs in acetabular revisions reported to the SHAR. The hypothesis was that the performance of TM cups is as good as that of established designs in the short term. Patients and methods The study population consisted of 2,384 patients who underwent 2,460 revisions during the period 2006 through 2012. The most commonly used cup designs were the press-fit porous-coated cup (n = 870), the trabecular metal cup (n = 805), and the cemented all-polyethylene cup (n = 785). 54% of the patients were female, and the median age at index revision was 72 (19–95) years. Reoperation was defined as a second surgical intervention, and re-revision—meaning exchange or removal of the cup—was used as endpoint. The mean follow-up time was 3.3 (0–7) years. Results There were 215 reoperations, 132 of which were re-revisions. The unadjusted and adjusted risk of reoperation or re-revision was not significantly different for the TM cup and the other 2 cup designs. Interpretation Our data support continued use of TM cups in acetabular revisions. Further follow-up is necessary to determine whether trabecular metal cups can reduce the re-revision rate in the long term, compared to the less costly porous press-fit and cemented designs. PMID:25399966

  10. Apical branching in a temperature sensitive mutant of Aspergillus niger.

    PubMed

    Reynaga-Peña, C G; Bartnicki-Garcia, S

    1997-12-01

    An apical branching, temperature-sensitive, mutant of Aspergillus niger (ramosa-1) was isolated by UV mutagenesis. Ramosa-1 has a wild type morphology at 23 degrees C, but branches apically when shifted to 34 degrees C. The cytological events leading to apical branching were recorded by video-enhanced phase contrast microscopy. The first event was a momentary, localized, cytoplasmic contraction lasting approximately 1 s. This contraction was seen as a sudden unidirectional movement of visible organelles (mitochondria, spheroid bodies) toward the hyphal apex. During the contraction, there was a transitory sharp increase in refractive index in a localized area of cytoplasm in the apex or subapex of the cell. Within 5 s, the Spitzenkörper retracted from its normal position next to the apical pole and disappeared from view 20 to 50 s later. Hyphal elongation rate diminished sharply, and the typical distribution of organelles at the hyphal tip was disturbed. After 210-240 s, organelle distribution returned to normal, polarized growth resumed, but instead of one Spitzenkörper two new Spitzenkörper appeared, each giving rise to an apical branch. The second branch Spitzenkörper appeared with a 60- to 100-s delay. We did not observe the original Spitzenkörper dividing in two; instead, the new Spitzenkörper arose de novo from vesicle clouds that formed in the apical region next to the future site of branch emergence. In all instances that we examined, the dislocation and disappearance of the Spitzenkörper was preceded by cytoplasmic contractions. We therefore suspect the existence of an intimate connection between the cytoskeletal network and the Spitzenkörper. Accordingly, we propose that the apical branching phenotype in ramosa-1 is triggered by a molecular event that induces a transient alteration in cytoskeleton organization.

  11. Morphogenesis of the mouse neural plate depends on distinct roles of cofilin 1 in apical and basal epithelial domains

    PubMed Central

    Grego-Bessa, Joaquim; Hildebrand, Jeffrey; Anderson, Kathryn V.

    2015-01-01

    The genetic control of mammalian epithelial polarity and dynamics can be studied in vivo at cellular resolution during morphogenesis of the mouse neural tube. The mouse neural plate is a simple epithelium that is transformed into a columnar pseudostratified tube over the course of ∼24 h. Apical F-actin is known to be important for neural tube closure, but the precise roles of actin dynamics in the neural epithelium are not known. To determine how the organization of the neural epithelium and neural tube closure are affected when actin dynamics are blocked, we examined the cellular basis of the neural tube closure defect in mouse mutants that lack the actin-severing protein cofilin 1 (CFL1). Although apical localization of the adherens junctions, the Par complex, the Crumbs complex and SHROOM3 is normal in the mutants, CFL1 has at least two distinct functions in the apical and basal domains of the neural plate. Apically, in the absence of CFL1 myosin light chain does not become phosphorylated, indicating that CFL1 is required for the activation of apical actomyosin required for neural tube closure. On the basal side of the neural plate, loss of CFL1 has the opposite effect on myosin: excess F-actin and myosin accumulate and the ectopic myosin light chain is phosphorylated. The basal accumulation of F-actin is associated with the assembly of ectopic basal tight junctions and focal disruptions of the basement membrane, which eventually lead to a breakdown of epithelial organization. PMID:25742799

  12. Dielectric elastomer actuators for octopus inspired suction cups.

    PubMed

    Follador, M; Tramacere, F; Mazzolai, B

    2014-09-25

    Suction cups are often found in nature as attachment strategy in water. Nevertheless, the application of the artificial counterpart is limited by the dimension of the actuators and their usability in wet conditions. A novel design for the development of a suction cup inspired by octopus suckers is presented. The main focus of this research was on the modelling and characterization of the actuation unit, and a first prototype of the suction cup was realized as a proof of concept. The actuation of the suction cup is based on dielectric elastomer actuators. The presented device works in a wet environment, has an integrated actuation system, and is soft. The dimensions of the artificial suction cups are comparable to proximal octopus suckers, and the attachment mechanism is similar to the biological counterpart. The design approach proposed for the actuator allows the definition of the parameters for its development and for obtaining a desired pressure in water. The fabricated actuator is able to produce up to 6 kPa of pressure in water, reaching the maximum pressure in less than 300 ms.

  13. Octopus-like suction cups: from natural to artificial solutions.

    PubMed

    Tramacere, F; Follador, M; Pugno, N M; Mazzolai, B

    2015-05-13

    Octopus suckers are able to attach to all nonporous surfaces and generate a very strong attachment force. The well-known attachment features of this animal result from the softness of the sucker tissues and the surface morphology of the portion of the sucker that is in contact with objects or substrates. Unlike artificial suction cups, octopus suckers are characterized by a series of radial grooves that increase the area subjected to pressure reduction during attachment. In this study, we constructed artificial suction cups with different surface geometries and tested their attachment performances using a pull-off setup. First, smooth suction cups were obtained for casting; then, sucker surfaces were engraved with a laser cutter. As expected, for all the tested cases, the engraving treatment enhanced the attachment performance of the elastomeric suction cups compared with that of the smooth versions. Moreover, the results indicated that the surface geometry with the best attachment performance was the geometry most similar to octopus sucker morphology. The results obtained in this work can be utilized to design artificial suction cups with higher wet attachment performance.

  14. Octopus-like suction cups: from natural to artificial solutions.

    PubMed

    Tramacere, F; Follador, M; Pugno, N M; Mazzolai, B

    2015-06-01

    Octopus suckers are able to attach to all nonporous surfaces and generate a very strong attachment force. The well-known attachment features of this animal result from the softness of the sucker tissues and the surface morphology of the portion of the sucker that is in contact with objects or substrates. Unlike artificial suction cups, octopus suckers are characterized by a series of radial grooves that increase the area subjected to pressure reduction during attachment. In this study, we constructed artificial suction cups with different surface geometries and tested their attachment performances using a pull-off setup. First, smooth suction cups were obtained for casting; then, sucker surfaces were engraved with a laser cutter. As expected, for all the tested cases, the engraving treatment enhanced the attachment performance of the elastomeric suction cups compared with that of the smooth versions. Moreover, the results indicated that the surface geometry with the best attachment performance was the geometry most similar to octopus sucker morphology. The results obtained in this work can be utilized to design artificial suction cups with higher wet attachment performance. PMID:25970079

  15. Dielectric elastomer actuators for octopus inspired suction cups.

    PubMed

    Follador, M; Tramacere, F; Mazzolai, B

    2014-01-01

    Suction cups are often found in nature as attachment strategy in water. Nevertheless, the application of the artificial counterpart is limited by the dimension of the actuators and their usability in wet conditions. A novel design for the development of a suction cup inspired by octopus suckers is presented. The main focus of this research was on the modelling and characterization of the actuation unit, and a first prototype of the suction cup was realized as a proof of concept. The actuation of the suction cup is based on dielectric elastomer actuators. The presented device works in a wet environment, has an integrated actuation system, and is soft. The dimensions of the artificial suction cups are comparable to proximal octopus suckers, and the attachment mechanism is similar to the biological counterpart. The design approach proposed for the actuator allows the definition of the parameters for its development and for obtaining a desired pressure in water. The fabricated actuator is able to produce up to 6 kPa of pressure in water, reaching the maximum pressure in less than 300 ms. PMID:25253019

  16. Development of cup shaped microneedle array for transdermal drug delivery.

    PubMed

    Vinayakumar, Kadayar B; Hegde, Gopal M; Ramachandra, Subbaraya G; Nayak, Mangalore M; Dinesh, Narasimhian S; Rajanna, Konandur

    2015-01-01

    Microneedle technology is one of the attractive methods in transdermal drug delivery. However, the clinical applications of this method are limited owing to: complexity in the preparation of multiple coating solutions, drug leakage while inserting the microneedles into the skin and the outer walls of the solid microneedle can hold limited quantity of drug. Here, the authors present the fabrication of an array of rectangular cup shaped silicon microneedles, which provide for reduced drug leakage resulting in improvement of efficiency of drug delivery and possibility of introducing multiple drugs. The fabricated solid microneedles with rectangular cup shaped tip have a total height of 200 μm. These cup shaped tips have dimensions: 60 × 60 μm (length × breadth) with a depth of 60 μm. The cups are filled with drug using a novel in-house built drop coating system. Successful drug dissolution was observed when the coated microneedle was used on mice. Also, using the above method, it is possible to fill the cups selectively with different drugs, which enables simultaneous multiple drug delivery. PMID:25956180

  17. Mathematical analysis of the effect of rotor geometry on cup anemometer response.

    PubMed

    Sanz-Andrés, Ángel; Pindado, Santiago; Sorribes-Palmer, Félix

    2014-01-01

    The calibration coefficients of two commercial anemometers equipped with different rotors were studied. The rotor cups had the same conical shape, while the size and distance to the rotation axis varied. The analysis was based on the 2-cup positions analytical model, derived using perturbation methods to include second-order effects such as pressure distribution along the rotating cups and friction. The comparison with the experimental data indicates a nonuniform distribution of aerodynamic forces on the rotating cups, with higher forces closer to the rotating axis. The 2-cup analytical model is proven to be accurate enough to study the effect of complex forces on cup anemometer performance. PMID:25110735

  18. Mathematical Analysis of the Effect of Rotor Geometry on Cup Anemometer Response

    PubMed Central

    Sanz-Andrés, Ángel; Sorribes-Palmer, Félix

    2014-01-01

    The calibration coefficients of two commercial anemometers equipped with different rotors were studied. The rotor cups had the same conical shape, while the size and distance to the rotation axis varied. The analysis was based on the 2-cup positions analytical model, derived using perturbation methods to include second-order effects such as pressure distribution along the rotating cups and friction. The comparison with the experimental data indicates a nonuniform distribution of aerodynamic forces on the rotating cups, with higher forces closer to the rotating axis. The 2-cup analytical model is proven to be accurate enough to study the effect of complex forces on cup anemometer performance. PMID:25110735

  19. Mathematical analysis of the effect of rotor geometry on cup anemometer response.

    PubMed

    Sanz-Andrés, Ángel; Pindado, Santiago; Sorribes-Palmer, Félix

    2014-01-01

    The calibration coefficients of two commercial anemometers equipped with different rotors were studied. The rotor cups had the same conical shape, while the size and distance to the rotation axis varied. The analysis was based on the 2-cup positions analytical model, derived using perturbation methods to include second-order effects such as pressure distribution along the rotating cups and friction. The comparison with the experimental data indicates a nonuniform distribution of aerodynamic forces on the rotating cups, with higher forces closer to the rotating axis. The 2-cup analytical model is proven to be accurate enough to study the effect of complex forces on cup anemometer performance.

  20. The Equine Endometrial Cup Reaction: A Fetomaternal Signal of Significance

    PubMed Central

    Antczak, D. F.; de Mestre, Amanda M.; Wilsher, Sandra; Allen, W. R.

    2015-01-01

    A remarkable feature of equine pregnancy is the development of the invasive trophoblast of the chorionic girdle and its formation of the gonadotrophin-secreting endometrial cup cells in early gestation. The details of this process have been revealed only slowly over the past century, since the first description of the endometrial cups in 1912. This centennial presents an opportunity to review the characteristics of the cells and molecules involved in this early, critical phase of placentation in the mare. The invasiveness of the chorionic girdle trophoblast appears to represent an atavistic attribute more commonly associated with the hemochorial placentae of primates and rodents but not with the more recently derived epitheliochorial placentae of the odd-toed ungulates. The nature of and raison d’etre for the strong fetal signals transmitted to the mare by the endometrial cup reaction, and her responses to these messages, are the subject of the present review. PMID:25387026

  1. Fabrication of silica nanocomposite-cups using electrospraying

    NASA Astrophysics Data System (ADS)

    Deotare, P. B.; Kameoka, J.

    2006-03-01

    We have investigated a new process for the fabrication of nanocomposite cups by electrospraying blended polymer-sol-gel solutions followed by calcination. Due to the low viscosity and high surface tension of the blended polymer-sol-gel solutions, the electrostatically extruded continuous liquid jet from the spray source became tiny droplets with diameters of less than 1 µm. These droplets dried in transit and were collected at the counter electrode. To eliminate polymers, as well as cross-link sol-gel material, they were calcined at 850 °C for 3 h. We also investigated a probable method to control the morphology of the nanocups by changing the ionic concentration of the polymer solution. This is a simple and efficient approach for producing nanocomposite cups, which cannot be made by the aggregation method. These nanocomposite cups may find applications in drug delivery and filtration media.

  2. The response function of modulated grid Faraday cup plasma instruments

    NASA Technical Reports Server (NTRS)

    Barnett, A.; Olbert, S.

    1986-01-01

    Modulated grid Faraday cup plasma analyzers are a very useful tool for making in situ measurements of space plasmas. One of their great attributes is that their simplicity permits their angular response function to be calculated theoretically. An expression is derived for this response function by computing the trajectories of the charged particles inside the cup. The Voyager Plasma Science (PLS) experiment is used as a specific example. Two approximations to the rigorous response function useful for data analysis are discussed. The theoretical formulas were tested by multi-sensor analysis of solar wind data. The tests indicate that the formulas represent the true cup response function for all angles of incidence with a maximum error of only a few percent.

  3. Clinical and radiological results of hydroxyapatite-coated acetabular cups.

    PubMed

    Blacha, J; Gagała, J

    2004-12-01

    We prospectively studied a consecutive series of 60 primary total hip arthroplasties in 52 patients. All patients had a hydroxyapatite-coated hemispherical acetabular cup (OCTOFIT). Mean patient age was 52.5 (34-73) years. In 38 hips, a 28-mm and in 22 hips a 32-mm diameter cobalt-chrome femoral head was used. We could follow 53 hips for a mean of 81 (28-125) months. Four cups were revised because of osteolysis, and in another six cups, slight osteolysis without migration was seen. The average annual linear wear rate was 0.05 mm (+/-0.05) for 28-mm heads and 0.16 mm (+/-0.09) for 32-mm heads (p<0.0001). Survivorship analysis predicted a survival rate of 86+/-6.7% at 10 years.

  4. Versatile, high-sensitivity faraday cup array for ion implanters

    DOEpatents

    Musket, Ronald G.; Patterson, Robert G.

    2003-01-01

    An improved Faraday cup array for determining the dose of ions delivered to a substrate during ion implantation and for monitoring the uniformity of the dose delivered to the substrate. The improved Faraday cup array incorporates a variable size ion beam aperture by changing only an insertable plate that defines the aperture without changing the position of the Faraday cups which are positioned for the operation of the largest ion beam aperture. The design enables the dose sensitivity range, typically 10.sup.11 -10.sup.18 ions/cm.sup.2 to be extended to below 10.sup.6 ions/cm.sup.2. The insertable plate/aperture arrangement is structurally simple and enables scaling to aperture areas between <1 cm.sup.2 and >750 cm.sup.2, and enables ultra-high vacuum (UHV) applications by incorporation of UHV-compatible materials.

  5. Cryopreservation of Pelargonium apices by droplet-vitrification.

    PubMed

    Gallard, Anthony; Panis, Bart; Dorion, Nöelle; Swennen, Rony; Grapin, Agnès

    2008-01-01

    The droplet-vitrification method was adapted to Pelargonium apices by optimizing the duration of the loading solution (LS) as well as the plant vitrification solution 2 (PVS2). The excised apices were dehydrated in two steps (20 min in LS and 15 min in PVS2) and then immersed directly in liquid nitrogen (LN). After thawing and unloading in the recovery solution at room temperature for 15 min, apices were plated onto semi-solid Murashige and Skoog medium. This simple protocol without any pretreatment was successfully applied to eight cultivars with a survival level ranging between 55.6 - 96.2 percent and a regrowth level between 9.1 and 70.6 percent. These results prove the feasibility of the long-term storage of Pelargonium germplasm through cryopreservation.

  6. Single Step Endodontic Management of Immature Apices using MTA

    PubMed Central

    Mishra, SK; Kumar, Ashok; Garg, Amit Kumar; Jindal, MK; Juneja, Harish

    2011-01-01

    Aim To examine the clinical and radiographic appearance of teeth with immature apices that were treated by single step procedure using mineral trioxide aggregate (MTA). Summary Creation of a physiological hard tissue barrier with calcium hydroxide in a nonvital tooth although quite predictable has certain limitations, such as the very long duration of the treatment spread over multiple visits and increased risk of root fracture. Plugging the root canal end with MTA has been advocated as an alternative treatment modality for open apices. The technique has been proven to be successful in many recently reported cases. The cases reported here present the successful treatment of two traumatized maxillary central incisors with open apices and periapical lesions using MTA. In this case report, MTA has been used to create a hard tissue barrier after disinfection of the root canal.

  7. Single Step Endodontic Management of Immature Apices using MTA

    PubMed Central

    Mishra, SK; Kumar, Ashok; Garg, Amit Kumar; Jindal, MK; Juneja, Harish

    2011-01-01

    Aim To examine the clinical and radiographic appearance of teeth with immature apices that were treated by single step procedure using mineral trioxide aggregate (MTA). Summary Creation of a physiological hard tissue barrier with calcium hydroxide in a nonvital tooth although quite predictable has certain limitations, such as the very long duration of the treatment spread over multiple visits and increased risk of root fracture. Plugging the root canal end with MTA has been advocated as an alternative treatment modality for open apices. The technique has been proven to be successful in many recently reported cases. The cases reported here present the successful treatment of two traumatized maxillary central incisors with open apices and periapical lesions using MTA. In this case report, MTA has been used to create a hard tissue barrier after disinfection of the root canal. PMID:27678239

  8. Transient apical breakdown following subluxation injury: a case report.

    PubMed

    Boyd, K S

    1995-02-01

    Transient apical breakdown has been reported to occur in cases in which a periapical radiolucency develops and resolves without treatment following luxation injury. Diagnostic errors are inevitable if periapical breakdown is used as the sole criterion or as an overriding criterion in the decision to initiate root canal treatment. A clinical case report is presented in which transient apical breakdown occurred after a subluxation injury. The threshold to sensitivity tests increased yet sensitivity remained positive with the appearance of the periapical radiolucency. The decision was made not to initiate root canal treatment in spite of the radiographic appearance periapically. At the 10-month recall the tooth remained responsive to sensitivity tests and the apical radiolucency had disappeared.

  9. Earliest Directly-Dated Human Skull-Cups

    PubMed Central

    Bello, Silvia M.; Parfitt, Simon A.; Stringer, Chris B.

    2011-01-01

    Background The use of human braincases as drinking cups and containers has extensive historic and ethnographic documentation, but archaeological examples are extremely rare. In the Upper Palaeolithic of western Europe, cut-marked and broken human bones are widespread in the Magdalenian (∼15 to 12,000 years BP) and skull-cup preparation is an element of this tradition. Principal Findings Here we describe the post-mortem processing of human heads at the Upper Palaeolithic site of Gough's Cave (Somerset, England) and identify a range of modifications associated with the production of skull-cups. New analyses of human remains from Gough's Cave demonstrate the skilled post-mortem manipulation of human bodies. Results of the research suggest the processing of cadavers for the consumption of body tissues (bone marrow), accompanied by meticulous shaping of cranial vaults. The distribution of cut-marks and percussion features indicates that the skulls were scrupulously 'cleaned' of any soft tissues, and subsequently modified by controlled removal of the facial region and breakage of the cranial base along a sub-horizontal plane. The vaults were also ‘retouched’, possibly to make the broken edges more regular. This manipulation suggests the shaping of skulls to produce skull-cups. Conclusions Three skull-cups have been identified amongst the human bones from Gough's Cave. New ultrafiltered radiocarbon determinations provide direct dates of about 14,700 cal BP, making these the oldest directly dated skull-cups and the only examples known from the British Isles. PMID:21359211

  10. Slit disk for modified faraday cup diagnostic for determining power density of electron and ion beams

    DOEpatents

    Teruya, Alan T.; Elmer; John W.; Palmer, Todd A.

    2011-03-08

    A diagnostic system for characterization of an electron beam or an ion beam includes an electrical conducting disk of refractory material having a circumference, a center, and a Faraday cup assembly positioned to receive the electron beam or ion beam. At least one slit in the disk provides diagnostic characterization of the electron beam or ion beam. The at least one slit is located between the circumference and the center of the disk and includes a radial portion that is in radial alignment with the center and a portion that deviates from radial alignment with the center. The electron beam or ion beam is directed onto the disk and translated to the at least one slit wherein the electron beam or ion beam enters the at least one slit for providing diagnostic characterization of the electron beam or ion beam.

  11. User's Guide: An Enhanced Modified Faraday Cup for the Profiling of the Power Density Distribution in Electron Beams

    SciTech Connect

    Elmer, J W; Teruya, A T; Palmer, T A

    2002-06-01

    This handbook describes the assembly and operation of an enhanced Modified Faraday Cup (MFC) diagnostic device for measuring the power density distribution of high power electron beams used for welding. The most recent version of this diagnostic device, [1] Version 2.0, contains modifications to the hardware components of previous MFC designs.[2] These modifications allow for more complete capture of the electrons and better electrical grounding, thus improving the quality of the acquired data and enabling a more accurate computed tomographic (CT) reconstruction [3,4] of the power density distribution of the electron beam to be performed. [ 5-9

  12. NMII forms a contractile transcellular sarcomeric network to regulate apical cell junctions and tissue geometry.

    PubMed

    Ebrahim, Seham; Fujita, Tomoki; Millis, Bryan A; Kozin, Elliott; Ma, Xuefei; Kawamoto, Sachiyo; Baird, Michelle A; Davidson, Michael; Yonemura, Shigenobu; Hisa, Yasuo; Conti, Mary Anne; Adelstein, Robert S; Sakaguchi, Hirofumi; Kachar, Bechara

    2013-04-22

    Nonmuscle myosin II (NMII) is thought to be the master integrator of force within epithelial apical junctions, mediating epithelial tissue morphogenesis and tensional homeostasis. Mutations in NMII are associated with a number of diseases due to failures in cell-cell adhesion. However, the organization and the precise mechanism by which NMII generates and responds to tension along the intercellular junctional line are still not known. We discovered that periodic assemblies of bipolar NMII filaments interlace with perijunctional actin and α-actinin to form a continuous belt of muscle-like sarcomeric units (∼400-600 nm) around each epithelial cell. Remarkably, the sarcomeres of adjacent cells are precisely paired across the junctional line, forming an integrated, transcellular contractile network. The contraction/relaxation of paired sarcomeres concomitantly impacts changes in apical cell shape and tissue geometry. We show differential distribution of NMII isoforms across heterotypic junctions and evidence for compensation between isoforms. Our results provide a model for how NMII force generation is effected along the junctional perimeter of each cell and communicated across neighboring cells in the epithelial organization. The sarcomeric network also provides a well-defined target to investigate the multiple roles of NMII in junctional homeostasis as well as in development and disease.

  13. Apical potassium channels in the rat connecting tubule.

    PubMed

    Frindt, Gustavo; Palmer, Lawrence G

    2004-11-01

    Apical membrane K channels in the rat connecting tubule (CNT) were studied using the patch-clamp technique. Tubules were isolated from the cortical labyrinth of the kidney and split open to provide access to the apical membrane. Cell-attached patches were formed on presumed principal and/or connecting tubule cells. The major channel type observed had a single-channel conductance of 52 pS, high open probability and kinetics that were only weakly dependent on voltage. These correspond closely to the "SK"-type channels in the cortical collecting duct, identified with the ROMK (Kir1.1) gene product. A second channel type, which was less frequently observed, mediated larger currents and was strongly activated by depolarization of the apical membrane voltage. These were identified as BK or maxi-K channels. The density of active SK channels revealed a high degree of clustering. Although heterogeneity of tubules or of cell types within a tubule could not be excluded, the major factor underlying the distribution appeared to be the presence of channel clusters on the membrane of individual cells. The overall density of channels was higher than that previously found in the cortical collecting tubule (CCT). In contrast to results in the CCT, we did not detect an increase in the overall density of SK channels in the apical membrane after feeding the animals a high-K diet. However, the activity of amiloride-sensitive Na channels was undetectable under control conditions but was increased after both 1 day (90 +/- 24 pA/cell) or 7 days (385 +/- 82 pA/cell) of K loading. Thus one important factor leading to an increased K secretion in the CNT in response to increased dietary K is an increased apical Na conductance, leading to depolarization of the apical membrane voltage and an increased driving force for K movement out into the tubular lumen. PMID:15280155

  14. Dental Apical Papilla as Therapy for Spinal Cord Injury.

    PubMed

    De Berdt, P; Vanacker, J; Ucakar, B; Elens, L; Diogenes, A; Leprince, J G; Deumens, R; des Rieux, A

    2015-11-01

    Stem cells of the apical papilla (SCAP) represent great promise regarding treatment of neural tissue damage, such as spinal cord injury (SCI). They derive from the neural crest, express numerous neurogenic markers, and mediate neurite outgrowth and axonal targeting. The goal of the present work was to investigate for the first time their potential to promote motor recovery after SCI in a rat hemisection model when delivered in their original stem cell niche-that is, by transplantation of the human apical papilla tissue itself into the lesion. Control groups consisted of animals subjected to laminectomy only (shams) and to lesion either untreated or injected with a fibrin hydrogel with or without human SCAP. Basso-Beattie-Bresnahan locomotor scores at 1 and 3 d postsurgery confirmed early functional decline in all SCI groups. This significant impairment was reversed, as seen in CatWalk analyses, after transplantation of apical papilla into the injured spinal cord wound, whereas the other groups demonstrated persistent functional impairment. Moreover, tactile allodynia did not develop as an unwanted side effect in any of the groups, even though the SCAP hydrogel group showed higher expression of the microglial marker Iba-1, which has been frequently associated with allodynia. Notably, the apical papilla transplant group presented with reduced Iba-1 expression level. Masson trichrome and human mitochondria staining showed the preservation of the apical papilla integrity and the presence of numerous human cells, while human cells could no longer be detected in the SCAP hydrogel group at the 6-wk postsurgery time point. Altogether, our data suggest that the transplantation of a human apical papilla at the lesion site improves gait in spinally injured rats and reduces glial reactivity. It also underlines the potential interest for the application of delivering SCAP in their original niche, as compared with use of a fibrin hydrogel.

  15. Cohesive suction-cup force in cell separation dynamics

    NASA Astrophysics Data System (ADS)

    Vasseur, H.

    2010-07-01

    When an external pulling force is applied onto a cell stuck to its substrate, a reacting "suction-cup" force, due to the slow penetration of the surrounding fluid between the cell and the substrate, opposes to the separation. It can overcome other known adhesive forces when the process is sufficiently violent (typically 105 N/m2). The physical origin of this effect may be compared with that leaning a suction-cup against a bathroom wall. We address the consequences of this effect on i) the separation energy, ii) the fluid motion surrounding the cell, and iii) the inhibition of cell motion.

  16. Calibration and Lag of a Friez Type Cup Anemometer

    NASA Technical Reports Server (NTRS)

    Pinkerton, Robert M

    1930-01-01

    Tests on a Friez type cup anemometer have been made in the variable density wind tunnel of the Langley Memorial Aeronautical Laboratory to calibrate the instrument and to determine its suitability for velocity measurements of wind gusts. The instrument was calibrated against a Pitot-static tube placed directly above the anemometer at air densities corresponding to sea level, and to an altitude of approximately 6000 feet. Air-speed acceleration tests were made to determine the lag in the instrument reading. The calibration results indicate that there should be an altitude correction. It is concluded that the cup anemometer is too sluggish for velocity measurements of wind gusts.

  17. Multiple idiopathic external apical root resorption: A rare case report

    PubMed Central

    Bansal, Parul; Nikhil, Vineeta; Kapur, Sonali

    2015-01-01

    Multiple idiopathic external apical root resorption (MIEARR) is a relatively rare condition affecting multiple teeth in a dentition. As the condition is nonsymptomatic, a case is usually detected as an incidental radiographic finding. However, it may cause pain and mobility in severe cases. It is sometimes self-limiting or sometimes may progress to tooth loss. This paper presents a case of external apical root resorption involving multiple teeth in which etiology was not identified, so idiopathic root resorption was considered as a diagnosis of exclusion. PMID:25657532

  18. Plastic Straining of Iridium Alloy DOP-26 During Cup Sizing Operations

    SciTech Connect

    Ohriner, Evan Keith; Ulrich, George B; Sabau, Adrian S

    2007-09-01

    DOP-26 iridium alloy cups are used for fuel cladding for radioisotope power systems. The cups are deep drawn and recrystallized prior to final fabrication operations. This study characterizes the plastic deformation of cups during a sizing operation following the recrystallization heat treatment. The purpose of the sizing operation is to achieve the specified roundness, diameter, and radius dimensions of the cup. The operation introduces various levels of plastic strain in the cup. Plastic strain can be a cause of inhomogeneous or abnormal grain growth during subsequent exposure to elevated temperature during the service life of the fueled clad. This is particularly true in the case of cups which have irregularities in the cup walls from the deep drawing operations. Diameter and roundness measurements were made on two cups both before and after sizing. Plastic strain levels were calculated using the ABAQUSTM finite element software. The calculated plastic strain levels in both cups were below 0.025, a value shown to be below the critical strain for abnormal grain growth during a simulated service exposure. The calculated maximum plastic strain was found to increase with increased applied sizing load and was not sensitive to the input value for the clearance between the cup and the sizing die. The calculated geometry of the sized cups was in good agreement with the measurements on the finished cups.

  19. 77 FR 14423 - Certain Food Containers, Cups, Plates, Cutlery, and Related Items, and Packaging Thereof; Notice...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-03-09

    ... COMMISSION Certain Food Containers, Cups, Plates, Cutlery, and Related Items, and Packaging Thereof; Notice... Trade Commission has received a complaint entitled Certain Food Containers, Cups, Plates, Cutlery, and... containers, cups, plates, cutlery, and related items, and packaging thereof. The complaint names...

  20. Cup Stacking: Does It Deserve a Place in Physical Education Curricula?

    ERIC Educational Resources Information Center

    Udermann, Brian E.; Murray, Steven R.

    2006-01-01

    Cup stacking has become commonplace in today's physical education nomenclature. Proponents make claims that cup stacking improves cognitive, affective, and psychomotor abilities. At physical education conferences, scores of professional physical educators eagerly watch cup stacking representatives construct and deconstruct a variety of pyramids…

  1. 77 FR 46285 - Special Local Regulation and Safety Zone; America's Cup Sailing Events, San Francisco, CA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-08-03

    ... associated with the ``2012 America's Cup World Series'' regatta scheduled for August 21-26, 2012, on the... zone regulate the on-water activities associated with the ``2012 America's Cup World Series'' regatta... published in association with the ``2012 America's Cup World Series'' regattas. This program calendar...

  2. 77 FR 20846 - Certain Food Containers, Cups, Plates, Cutlery, and Related Items and Packaging Thereof...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-06

    ... COMMISSION Certain Food Containers, Cups, Plates, Cutlery, and Related Items and Packaging Thereof... importation of certain food containers, cups, plates, cutlery, and related items and packaging thereof by... importation of certain food containers, cups, plates, cutlery, and related items and packaging thereof...

  3. The cryptic enhancer elements of the tCUP promoter.

    PubMed

    Wu, Keqiang; Hu, Ming; Martin, Teresa; Wang, Changming; Li, Xiu-Qing; Tian, Lining; Brown, Dan; Miki, Brian

    2003-02-01

    Examination of the tCUP cryptic promoter from tobacco demonstrates that cryptic gene regulatory elements in the plant genome are functionally equivalent to elements responsible for the expression of plant genes. They are also organized in a similar fashion. Analysis of the expression pattern of the GUS reporter gene in transgenic Arabidopsis plants revealed that all of the information needed for strong constitutive expression was located in the truncated, -394tCUP promoter fragment. A series of 5' deletion and linker-scan mutagenesis constructs identified two separate enhancer elements. A long AT-rich region was identified between positions -350 and -161 bp relative to the transcription start site. 5' deletions that removed this A/T-rich fragment resulted in a significant decrease in promoter activity; whereas, oligomerization enhanced activity. A 21 bp sequence (TAGCCCCAATTTCAAATTCAA) spanning nucleotides -150 to -130 relative to transcription start site was also identified in a similar fashion and defined a novel cryptic constitutive enhancer element (Cce). Electrophoretic mobility-shift assays showed that tobacco nuclear proteins that interacted strongly with the tCUP promoter bound specifically to the 21-bp Cce element, suggesting that this sequence is probably a binding site(s) for transcription factors. The Cce element was dependent on the AT-rich element for activity indicating combinatorial control. The combined effects of the A/T rich and Cce elements appear to be responsible for the constitutive transcriptional activity of the tCUP promoter. PMID:12602866

  4. Teaching Transport Phenomena around a Cup of Coffee

    ERIC Educational Resources Information Center

    Condoret, Jean Stephane

    2007-01-01

    The very common situation of waiting for the cooling of a cup of coffee is addressed through a conventional engineering approach, where several important concepts of heat and mass transfer are used. A numerical and analytical solution of the differential equations of the problem are proposed, and assessed by comparing to simple experiments.…

  5. Our Everyday Cup of Coffee: The Chemistry behind Its Magic

    ERIC Educational Resources Information Center

    Petracco, Marino

    2005-01-01

    Coffee consumption has spread worldwide and differences in the raw bean consumption, in roasting conditions and in the extraction procedures used to prepare coffee brews result in a great diversity of chemical composition in the final product, the cup of coffee. Hence, beverage preparation is a fundamental step for enjoying the benefits of this…

  6. Leidos Reclaims Defelice Cup at Annual Golf Tournament | Poster

    Cancer.gov

    By Ashley DeVine, Staff Writer Leidos Biomedical Research reclaimed the Defelice Cup trophy from NCI at the eighth annual Ronald H. Defelice golf tournament, held October 14. The final score was 15–7, with Leidos Biomed tying the series 4 to 4. Fourteen players on each team battled it out at Rattlewood golf course in Mount Airy, Md.

  7. Adsorption of serum calcium by plastic sample cups.

    PubMed

    Hall, R A; Whitehead, T P

    1970-05-01

    Sera left overnight in plastic AutoAnalyzer sample cups may give low calcium values; the effect is attributed to adsorption of calcium onto the walls of the vessel. The adsorption is brought about by a rise in the pH of the sera, and factors which promote the rise in pH increase the adsorption. This phenomenon is of practical importance because as much as 10% of the calcium in the serum may be adsorbed. Adsorption occurs particularly onto the walls of polystyrene cups, and when polypropylene cups were used the adsorption was reduced. The phenomenon cannot be evaluated or controlled by the use of control sera. In order to avoid the sampling error, serum for calcium analysis should be used fresh or stored at 4 degrees C under conditions such that any change in pH is minimal. Sera should not be left to stand in AutoAnalyzer cups at room temperature for longer than three hours before analysis.

  8. Long-term Radiographic Assessment of Cemented Polyethylene Acetabular Cups

    PubMed Central

    Isaac, Graham; Porter, Neil; Fisher, John; Older, John

    2008-01-01

    In vitro studies demonstrating excessive wear in polyethylene cups sterilized using gamma irradiation and stored in air led to the abandonment of this sterilization technique. We evaluated the clinical wear performance of a metal femoral component on a polyethylene cup in a hip prosthesis from a selected subset of implants in a group of patients followed for at least 20 years and assessed the time dependency of variation in penetration rates. We measured penetration in 33 polyethylene cups in 25 patients who had a Charnley low-friction arthroplasty between 1982 and 1984. All patients had Charnley Ogee® cups implanted for more than 20 years and sterilized using the gamma irradiation in air technique. If degradation occurred over time in vivo, it was not reflected by an increased penetration rate with increasing time in vivo; even after 20 years of implantation, the degree of wear remained low. This suggests gamma irradiation affects wear on ultra-high-molecular-weight polyethylene by reducing wear secondary to the crosslinking, by increasing wear as shown through in vitro studies of heavily oxidized samples, or by oxidation resulting from prolonged shelf life. The effect of progressive oxidation in vivo does not appear to affect wear in vivo. Level of Evidence: Level IV, therapeutic study. See the Guidelines for Authors for a complete description of levels of evidence. PMID:18196419

  9. Infant Nutrition: Drinking from a Cup, Eating from a Spoon.

    ERIC Educational Resources Information Center

    Texas Child Care, 1994

    1994-01-01

    Discusses the developmental stages of infants' and children's eating habits. Provides directions for introducing cup and spoon to babies and for making homemade infant foods. Includes information on breast feeding and how child caregivers can support breast-feeding mothers. (HTH)

  10. Technology. The Hot Cup Caper. Probing for Scientific Knowledge.

    ERIC Educational Resources Information Center

    Ramondetta, June

    1994-01-01

    Students can explore temperature and heat conductivity by examining materials that make good cups for hot cocoa. Using temperature probes from computer-based science packages, students can measure gradual change in the liquid's temperature, watch as data are plotted on the computer, and explain why they chose a specific material. (SM)

  11. NASCAR Winston Cup Race Results for 1975-2003

    ERIC Educational Resources Information Center

    Winner, Larry

    2006-01-01

    Stock car racing has seen tremendous growth in popularity in recent years. We introduce two datasets containing results from all Winston Cup races between 1975 and 2003, inclusive. Students can use any number of statistical methods and applications of basic probability on the data to answer a wide range of practical questions. Instructors and…

  12. [Nonsurgical retreatment in a case of a radiolucent apical lesion].

    PubMed

    Vicente Gómez, A; Rodríguez Ponce, A

    1989-01-01

    We present a case of failure that was helpful solved without surgical endodontic treatment. We don't achieve clinical success besides endodontic treatment was twice remade. Finally we decided to put a temporary filling with calcium hydroxide and wait until apical radiolucency disappear and complete our treatment with gutta-percha, sealer and lateral condensation.

  13. Brefeldin A inhibition of apical Na+ channels in epithelia.

    PubMed

    Fisher, R S; Grillo, F G; Sariban-Sohraby, S

    1996-01-01

    Brefeldin A (BFA) is used to probe trafficking of proteins through the central vacuolar system (CVS) in a variety of cells. Transepithelial Na+ transport by high-resistance epithelia, such as A6 cultured cells, is inhibited by BFA. Apical Na+ channels, as well as basolateral pumps and K+ channels, are complex proteins that probably traverse the CVS for routing to the plasma membrane. BFA (5 micrograms/ml) decreases transepithelial Na+ current near zero and increases resistance reversibly after 4 h. Longer exposures are toxic. When tissues were treated for 20 h with 0.2 microgram/ml BFA, Na+ transport also was reversibly inhibited. Using noise analysis, we found that BFA drastically reduced apical Na+ channel density. The increase in single channel current was consistent with cell hyperpolarization. After apical permeabilization with nystatin, changes in transepithelial current reflect changes in basolateral membrane transport. Transport at this membrane was inhibited by ouabain and cycloheximide, but not by BFA. After BFA, aldosterone was ineffective, suggesting that an intact CVS is required for stimulation by this hormone. Thus BFA inhibition of Na+ transport is localized at the apical membrane. Implications for channel turnover as a mechanism for regulating the Na+ transport rate are discussed.

  14. Chapter Four - Shoot apical meristem form and function. In:

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The shoot apical meristem (SAM) generates above-ground aerial organs throughout the lifespan of higher plants. In order to fulfill this function, the meristem must maintain a balance between the self-renewal of a reservoir of central stem cells and organ initiation from peripheral cells. The activit...

  15. [Nonsurgical retreatment in a case of a radiolucent apical lesion].

    PubMed

    Vicente Gómez, A; Rodríguez Ponce, A

    1989-01-01

    We present a case of failure that was helpful solved without surgical endodontic treatment. We don't achieve clinical success besides endodontic treatment was twice remade. Finally we decided to put a temporary filling with calcium hydroxide and wait until apical radiolucency disappear and complete our treatment with gutta-percha, sealer and lateral condensation. PMID:2640036

  16. Echocardiographic assessment of takotsubo cardiomyopathy: beyond apical ballooning.

    PubMed

    Okura, Hiroyuki

    2016-03-01

    It has been >25 years since the first report of the takotsubo cardiomyopathy (TC). Although left ventriculography was originally used to depict its typical and impressive wall motion abnormality mimicking "takotsubo", or octopus pot, echocardiography plays a pivotal role in detecting not only its left ventricular (LV) wall motion abnormality, apical ballooning, but also various other findings. First of all, apical ballooning is not an essential finding for TC anymore. Mid-ventricular LV asynergy with or without apical involvement is a basic pattern of the LV wall motion abnormality. Distribution and time course of the asynergy may be best detected by echocardiography and echo provides useful information to differentiate between TC and acute coronary syndrome or acute myocarditis. In addition to the wall motion assessment, echo detects complications of TC such as systolic anterior motion of the mitral leaflet with or without LV outflow obstruction, mitral regurgitation, LV thrombus, right ventricular (RV) involvement. In particular, RV involvement is not an uncommon finding and is associated with worse short-term as well as long-term prognosis. Finally, coronary flow measurements and speckle tracking by echo may offer additional and useful information about pathophysiology and prognosis of TC. In conclusion, echocardiography is a standard imaging modality for detecting various dynamic findings beyond apical ballooning in patients with TC. PMID:26694809

  17. Failure of dual radius hydroxyapatite-coated acetabular cups

    PubMed Central

    D'Angelo, Fabio; Molina, Mauro; Riva, Giacomo; Zatti, Giovanni; Cherubino, Paolo

    2008-01-01

    Introduction Many kind of hydroxyapatite-coated cups were used, with favorable results in short term studies; it was supposed that its use could improve osteointegration of the cup, enhancing thus stability and survivorship. The purpose of this study is to analyze the long term behavior of the hemispheric HA coated, Dual Radius Osteonics cup and to discuss the way of failure through the exam of the revised components and of both periacetabular and osteolysis tissue. Materials and Methods Between 1994 and 1997, at the Department of Orthopedic Sciences of the Insubria University, using the posterolateral approach, were implanted 276 Dual Radius Osteonics® in 256 patients, with mean age of 63 years. Results At a mean follow-up of 10 years (range 8–12 years), 183 cups in 165 patients, were available for clinical and radiographical evaluation. 22 Cups among the 183 were revised (11%). The cause of revision was aseptic loosening in 17 cases, septic loosening in one case, periprosthetic fracture in another case, osteolysis and polyethylene wear in two cases and, finally, recurrent dislocations in the last one. In the remaining patients, mean HHS increased from a preoperative value of 50,15 to a postoperative value of 92,69. The mean polyethylene wear was 1,25 mm (min. 0,08, max. 3,9 mm), with a mean annual wear of 0,17 mm. The mean acetabular migration on the two axis was 1,6 mm and 1,8 mm. Peri-acetabular osteolysis were recorded in 89% of the implants (163 cases). The cumulative survivorship (revision as endpoint) at the time was 88,9%. Conclusion Our study confirms the bad behavior of this type of cup probably related to the design, to the method of HA fixation. The observations carried out on the revised cup confirm these hypotheses but did not clarify if the third body wear could be a further problem. Another interesting aspect is the high incidence of osteolysis, which are often asymptomatic becoming a problem for the surgeon as the patient refuses the

  18. Football injuries during the 2014 FIFA World Cup

    PubMed Central

    Junge, Astrid; Dvořák, Jiri

    2015-01-01

    Background FIFA has surveyed match injuries in its tournaments since 1998. Aim To analyse the incidence and characteristics of match injuries incurred during the 2014 FIFA World Cup in comparison to previous FIFA World Cups. Methods The chief physicians of the participating teams reported all newly incurred injuries of their players after the match on a standardised report form. 124 (97%) forms were returned. Results A total of 104 injuries were reported, equivalent to an incidence of 1.68 injuries per match (95% CI 1.36 to 2.00). 64 (63.4%) injuries were caused by contact with another player. Thigh (26; 25%) and head (19; 18%) were the most frequently injured body parts. The most frequent diagnosis was thigh strain (n=18). Five concussions and three fractures to the head were reported. While most thigh strains (15/17; 88.2%) occurred without contact, almost all head injuries (18/19; 94.7%) were caused by contact. 0.97 injuries per match (95% CI 0.72 to 1.22) were expected to result in absence from training or match. Eight injuries were classified as severe. The incidence of match injuries in the 2014 FIFA World Cup was significantly lower than the average of the four preceding FIFA World Cups, both for all injuries (2.34; 95% CI 2.15 to 2.53) and time-loss injuries (1.51; 95% CI 1.37 to 1.65). Conclusions The overall incidence of injury during the FIFA World Cups decreased from 2002 to 2014 by 37%. A detailed analysis of the injury mechanism is recommended to further improve prevention strategies. PMID:25878077

  19. Histogram-driven cupping correction (HDCC) in CT

    NASA Astrophysics Data System (ADS)

    Kyriakou, Y.; Meyer, M.; Lapp, R.; Kalender, W. A.

    2010-04-01

    Typical cupping correction methods are pre-processing methods which require either pre-calibration measurements or simulations of standard objects to approximate and correct for beam hardening and scatter. Some of them require the knowledge of spectra, detector characteristics, etc. The aim of this work was to develop a practical histogram-driven cupping correction (HDCC) method to post-process the reconstructed images. We use a polynomial representation of the raw-data generated by forward projection of the reconstructed images; forward and backprojection are performed on graphics processing units (GPU). The coefficients of the polynomial are optimized using a simplex minimization of the joint entropy of the CT image and its gradient. The algorithm was evaluated using simulations and measurements of homogeneous and inhomogeneous phantoms. For the measurements a C-arm flat-detector CT (FD-CT) system with a 30×40 cm2 detector, a kilovoltage on board imager (radiation therapy simulator) and a micro-CT system were used. The algorithm reduced cupping artifacts both in simulations and measurements using a fourth-order polynomial and was in good agreement to the reference. The minimization algorithm required less than 70 iterations to adjust the coefficients only performing a linear combination of basis images, thus executing without time consuming operations. HDCC reduced cupping artifacts without the necessity of pre-calibration or other scan information enabling a retrospective improvement of CT image homogeneity. However, the method can work with other cupping correction algorithms or in a calibration manner, as well.

  20. A confirmed case of toxic shock syndrome associated with the use of a menstrual cup

    PubMed Central

    Mitchell, Michael A; Bisch, Steve; Arntfield, Shannon; Hosseini-Moghaddam, Seyed M

    2015-01-01

    Menstrual cups have been reported to be an acceptable substitute for tampons. These flexible cups have also been reported to provide a sustainable solution to menstrual management, with modest cost savings and no significant health risk. The present article documents the first case of toxic shock syndrome associated with the use of a menstrual cup in a woman 37 years of age, using a menstrual cup for the first time. Toxic shock syndrome and the literature on menstrual cups is reviewed and a possible mechanism for the development of toxic shock syndrome in the patient is described. PMID:26361491

  1. An unusual ST-segment elevation: apical hypertrophic cardiomyopathy shows the ace up its sleeve.

    PubMed

    de Santis, Francesco; Pergolini, Amedeo; Zampi, Giordano; Pero, Gaetano; Pino, Paolo Giuseppe; Minardi, Giovanni

    2013-01-01

    Apical hypertrophic cardiomyopathy is part of the broad clinical and morphologic spectrum of hypertrophic cardiomyopathy. We report a patient with electrocardiographic abnormalities in whom acute coronary syndrome was excluded and apical hypertrophic cardiomyopathy was demonstrated by careful differential diagnosis.

  2. Reproducibility of Echocardiograph-Derived Multilevel Left Ventricular Apical Twist Mechanics.

    PubMed

    Stewart, Glenn M; Yamada, Akira; Kavanagh, Justin J; Haseler, Luke J; Chan, Jonathan; Sabapathy, Surendran

    2016-02-01

    Left ventricular (LV) twist mechanics are routinely assessed via echocardiography in clinical and research trials investigating the function of obliquely oriented myocardial fibers. However, echocardiograph-derived measures of LV twist may be compromised by nonstandardized acquisition of the apical image. This study examined the reproducibility of echocardiograph-derived parameters of apical twist mechanics at multiple levels of the apical myocardium. Two sets of 2D LV parasternal short-axis images were obtained in 30 healthy subjects (24 men; 19-57 year) via echocardiography. Images were acquired immediately distal to the papillary muscles (apical image 1), immediately above the point of LV cavity obliteration at end systole (apical image 3), and midway between apical image 1 and apical image 3 (apical image 2). Repeat scans were performed within 1 hour, and twist mechanics (rotation and rotation rate) were calculated via frame-by-frame tracking of natural acoustic echocardiographic markers (speckle tracking). The magnitude of apical rotation increased progressively toward the apex (apical image 1: 4.2 ± 2.1°, apical image 2: 7.2 ± 3.9°, apical image 3: 11.8 ± 4.6°). apical images 1, 2, and 3 each had moderate to good correlations between repeat scans (ICC: 0.531-0.856). When apical images 1, 2, and 3 were averaged, rotation was 7.7 ± 2.7° and between-scan correlation was excellent (ICC: 0.910). Similar results were observed for systolic and diastolic rotation rates. Averaging multiple standardized apical images, tending progressively toward the apex, generated the most reproducible rotation indices and may be optimal for the assessment of LV twist mechanics across therapeutic, interventional, and research studies; however, care should be taken given the influence of acquisition level on the magnitude of apical rotation.

  3. Displacement and Stress Analysis around the Artificial Acetabular Cup in a Total Hip Replacement

    NASA Astrophysics Data System (ADS)

    Kakunai, Satoshi; Tachibana, Hiroyuki; Sakamoto, Tohru; Abo, Masayoshi; Ikeda, Daisaku; Fujiwara, Hiroo

    In order to improve the service life of the artificial acetabular cup in a total hip replacement, it is important to determine the best material and design, and to assess the mechanical behavior around the cup. In this study, electronic speckle interferometry (ESPI) and the two-dimensional finite element method (FEM) are employed to investigate the mechanical behavior. The influence of the cancellous bone and cup thickness on mechanical behavior around the cup was investigated. Good agreement of the cup model was found between the ESPI measurements and FEM predictions. The following results were obtained. (1) Cancellous bone with a porous structure can be measured by the ESPI method. (2) There are discontinuities of the displacement distribution in the transverse direction in each boundary region of the cup, bone cement and cancellous bone. (3) The maximum shear stress exists in the boundary region of the cup and bone cement.

  4. Apical organs in echinoderm larvae: insights into larval evolution in the Ambulacraria.

    PubMed

    Byrne, Maria; Nakajima, Yoko; Chee, Francis C; Burke, Robert D

    2007-01-01

    The anatomy and cellular organization of serotonergic neurons in the echinoderm apical organ exhibits class-specific features in dipleurula-type (auricularia, bipinnaria) and pluteus-type (ophiopluteus, echinopluteus) larvae. The apical organ forms in association with anterior ciliary structures. Apical organs in dipleurula-type larvae are more similar to each other than to those in either of the pluteus forms. In asteroid bipinnaria and holothuroid auricularia the apical organ spans ciliary band sectors that traverse the anterior-most end of the larvae. The asteroid apical organ also has prominent bilateral ganglia that connect with an apical network of neurites. The simple apical organ of the auricularia is similar to that in the hemichordate tornaria larva. Apical organs in pluteus forms differ markedly. The echinopluteus apical organ is a single structure on the oral hood between the larval arms comprised of two groups of cells joined by a commissure and its cell bodies do not reside in the ciliary band. Ophioplutei have a pair of lateral ganglia associated with the ciliary band of larval arms that may be the ophiuroid apical organ. Comparative anatomy of the serotonergic nervous systems in the dipleurula-type larvae of the Ambulacraria (Echinodermata+Hemichordata) suggests that the apical organ of this deuterostome clade originated as a simple bilaterally symmetric nerve plexus spanning ciliary band sectors at the anterior end of the larva. From this structure, the apical organ has been independently modified in association with the evolution of class-specific larval forms. PMID:17845515

  5. Implantation of a left ventricular assist device in patients with a complex apical anatomy.

    PubMed

    Palmen, Meindert; Verwey, Harriette F; Haeck, Marlieke L A; Holman, Eduard R; Schalij, Martin J; Klautz, Robert J M

    2012-12-01

    Implantation of a left ventricular assist device can be challenging in patients with an altered apical anatomy after cardiac surgery or as the result of the presence of a calcified apical aneurysm. In this paper we present 2 cases with a challenging apical anatomy and introduce a new surgical technique facilitating left ventricular assist device implantation in these patients.

  6. Mid-ventricular obstructive hypertrophic cardiomyopathy with an apical aneurysm caused by vasospastic angina.

    PubMed

    Kiyooka, Takahiko; Satoh, Yasuhiro

    2014-03-20

    Mid-ventricular obstructive hypertrophic cardiomyopathy (MVOHCM) is a rare form of cardiomyopathy, characterized by the presence of a pressure gradient between the left ventricular basal and apical chambers and is frequently associated with an apical aneurysm. However, the exact cause of this aneurysm remains unknown. We here describe a patient with MVOHCM in whom the apical aneurysm may be caused by vasospastic angina.

  7. Apical organs in echinoderm larvae: insights into larval evolution in the Ambulacraria.

    PubMed

    Byrne, Maria; Nakajima, Yoko; Chee, Francis C; Burke, Robert D

    2007-01-01

    The anatomy and cellular organization of serotonergic neurons in the echinoderm apical organ exhibits class-specific features in dipleurula-type (auricularia, bipinnaria) and pluteus-type (ophiopluteus, echinopluteus) larvae. The apical organ forms in association with anterior ciliary structures. Apical organs in dipleurula-type larvae are more similar to each other than to those in either of the pluteus forms. In asteroid bipinnaria and holothuroid auricularia the apical organ spans ciliary band sectors that traverse the anterior-most end of the larvae. The asteroid apical organ also has prominent bilateral ganglia that connect with an apical network of neurites. The simple apical organ of the auricularia is similar to that in the hemichordate tornaria larva. Apical organs in pluteus forms differ markedly. The echinopluteus apical organ is a single structure on the oral hood between the larval arms comprised of two groups of cells joined by a commissure and its cell bodies do not reside in the ciliary band. Ophioplutei have a pair of lateral ganglia associated with the ciliary band of larval arms that may be the ophiuroid apical organ. Comparative anatomy of the serotonergic nervous systems in the dipleurula-type larvae of the Ambulacraria (Echinodermata+Hemichordata) suggests that the apical organ of this deuterostome clade originated as a simple bilaterally symmetric nerve plexus spanning ciliary band sectors at the anterior end of the larva. From this structure, the apical organ has been independently modified in association with the evolution of class-specific larval forms.

  8. Transient apical dyskinesia with a pacemaker: Electrocardiographic features.

    PubMed

    Núñez-Gil, Iván J; Feltes, Gisela I; Mejía-Rentería, Hernán D; Biagioni, Corina; De Agustín, J Alberto; Vivas, David; Fernández-Ortiz, Antonio

    2015-04-01

    Transient apical dyskinesia syndromes present features similar to acute coronary syndromes, but with normal coronary arteries and rapid complete resolution of wall motion alterations. We report the case of a 73-year-old woman who was admitted to hospital because of typical chest pain at rest after her brother's death. She had had a pacemaker implanted in 2001. Troponin levels were elevated and apical hypokinesia was shown by ventriculography and echocardiography, with normal coronary arteries. Evolving ECG alterations were observed in spite of the continued pacing rhythm. All these alterations were fully resolved after discharge. This case shows that, even in the presence of a pacemaker, evolving ECG alterations can be observed in Takotsubo syndrome.

  9. Transient apical dyskinesia with a pacemaker: Electrocardiographic features.

    PubMed

    Núñez-Gil, Iván J; Feltes, Gisela I; Mejía-Rentería, Hernán D; Biagioni, Corina; De Agustín, J Alberto; Vivas, David; Fernández-Ortiz, Antonio

    2015-04-01

    Transient apical dyskinesia syndromes present features similar to acute coronary syndromes, but with normal coronary arteries and rapid complete resolution of wall motion alterations. We report the case of a 73-year-old woman who was admitted to hospital because of typical chest pain at rest after her brother's death. She had had a pacemaker implanted in 2001. Troponin levels were elevated and apical hypokinesia was shown by ventriculography and echocardiography, with normal coronary arteries. Evolving ECG alterations were observed in spite of the continued pacing rhythm. All these alterations were fully resolved after discharge. This case shows that, even in the presence of a pacemaker, evolving ECG alterations can be observed in Takotsubo syndrome. PMID:25840647

  10. [An endodontic ultrasonic system for apical endodontic surgery].

    PubMed

    de Lange, I; Putters, T; Baas, E M; van Ingen, J M

    2009-09-01

    Apical endodontic surgery is applied frequently following a failed conventional endodontic treatment. The apical preparation can be carried out conventionally using a round bur or using an endodontic ultrasonic system. The purpose of this study was to compare the outcome of the 2 treatment options by a randomized prospective clinical study. Patients (n=399) were at random allocated to treatment using a conventional round bur or using an ultrasonic system (P-max Newtron) according to a for the rest similar treatment protocol. One year post treatment, the treatment outcomes were determined by 2 oral and maxillofacial surgeons, blinded for the treatment option. Adequate follow-up data were obtained from 290 patients. The overall success rate was 71% in the patients treated conventionally and 81% in the patients treated using the ultrasonic system. In molar teeth, the difference in success rate was statistically significant. PMID:19791493

  11. Pathogenesis of apical periodontitis and the causes of endodontic failures.

    PubMed

    Nair, P N R

    2004-01-01

    Apical periodontitis is a sequel to endodontic infection and manifests itself as the host defense response to microbial challenge emanating from the root canal system. It is viewed as a dynamic encounter between microbial factors and host defenses at the interface between infected radicular pulp and periodontal ligament that results in local inflammation, resorption of hard tissues, destruction of other periapical tissues, and eventual formation of various histopathological categories of apical periodontitis, commonly referred to as periapical lesions. The treatment of apical periodontitis, as a disease of root canal infection, consists of eradicating microbes or substantially reducing the microbial load from the root canal and preventing re-infection by orthograde root filling. The treatment has a remarkably high degree of success. Nevertheless, endodontic treatment can fail. Most failures occur when treatment procedures, mostly of a technical nature, have not reached a satisfactory standard for the control and elimination of infection. Even when the highest standards and the most careful procedures are followed, failures still occur. This is because there are root canal regions that cannot be cleaned and obturated with existing equipments, materials, and techniques, and thus, infection can persist. In very rare cases, there are also factors located within the inflamed periapical tissue that can interfere with post-treatment healing of the lesion. The data on the biological causes of endodontic failures are recent and scattered in various journals. This communication is meant to provide a comprehensive overview of the etio-pathogenesis of apical periodontitis and the causes of failed endodontic treatments that can be visualized in radiographs as asymptomatic post-treatment periapical radiolucencies. PMID:15574679

  12. Socket and cup surface replacement of the hip.

    PubMed

    Nishio, A; Eguchi, M; Kaibara, N

    1978-01-01

    To improve the surgical results of severe osteoarthritis of the hip, surface replacement of the hip using a double cup without cement was employed on 75 hips during the period from 1972 to 1977. The results of the procedures have been analyzed on 67 hips followed for more than 6 months. The most dramatic improvement following the procedure has been pain relief, observed in 58 of 67 hips (86%). Three reoperations were necessary. Failures were treated satisfactorily either by total hip replacement, or by arthrodesis and/or by placing a new cup on the head respectively. There was no operative death, pulmonary embolism, thrombophlebitis, nor deep infection. We do not think this procedure replaces more definitive surgery such as the Charnley-type total hip replacement, but it is a good adjunctive procedure particularly in patients younger than 60 years of age.

  13. Alignment Pins for Assembling and Disassembling Structures

    NASA Technical Reports Server (NTRS)

    Campbell, Oliver C.

    2008-01-01

    Simple, easy-to-use, highly effective tooling has been devised for maintaining alignment of bolt holes in mating structures during assembly and disassembly of the structures. The tooling was originally used during removal of a body flap from the space shuttle Atlantis, in which misalignments during removal of the last few bolts could cause the bolts to bind in their holes. By suitably modifying the dimensions of the tooling components, the basic design of the tooling can readily be adapted to other structures that must be maintained in alignment. The tooling includes tapered, internally threaded alignment pins designed to fit in the bolt holes in one of the mating structures, plus a draw bolt and a cup that are used to install or remove each alignment pin. In preparation for disassembly of two mating structures, external supports are provided to prevent unintended movement of the structures. During disassembly of the structures, as each bolt that joins the structures is removed, an alignment pin is installed in its place. Once all the bolts have been removed and replaced with pins, the pins maintain alignment as the structures are gently pushed or pulled apart on the supports. In assembling the two structures, one reverses the procedure described above: pins are installed in the bolt holes, the structures are pulled or pushed together on the supports, then the pins are removed and replaced with bolts. The figure depicts the tooling and its use. To install an alignment pin in a bolt hole in a structural panel, the tapered end of the pin is inserted from one side of the panel, the cup is placed over the pin on the opposite side of the panel, the draw bolt is inserted through the cup and threaded into the pin, the draw bolt is tightened to pull the pin until the pin is seated firmly in the hole, then the draw bolt and cup are removed, leaving the pin in place. To remove an alignment pin, the cup is placed over the pin on the first-mentioned side of the panel, the draw

  14. Enlargement of the apical gap after laser root resection

    NASA Astrophysics Data System (ADS)

    Mello, Guilherme P. S.; Paradella, Thais C.; Munin, Egberto; Mello, Jose B.; Pacheco, Marcos T. T.

    2000-11-01

    An apical filling material should establish, as perfect as possible, the hermetic sealing of an apical cavity. However, a gap is formed between the filling material (gutta-percha) and the root canal wall. The egress of irritants into the root canal system to the periapical tissues is considered the principal cause of fails in apicoectomy and retro-filling, being assumed that irritants penetrate mainly through the gap located between the gutta-percha and the dentin. In this paper, we report the observation of an enlargement of the apical gap, after laser apicoectomy, comparing to conventional apicoectomy. The samples were divided into groups, and the conventional apicoectomy group, together with the Er:YAG laser group (400 mJ/10 Hz) produced both similar results, being the gap unaltered. On the other hand, the samples that were irradiated with the Er:YAG laser, followed by Nd:YAG laser irradiation (1.5 W/10 Hz) presented a larger gap, conclusions that were drawn from Scanning Electronic Microscope analysis. The enlargement of the gap was due to the fusion of the dentin on the border, close to the gutta-percha. This pronounced behavior might have been caused by the surface discontinuity, imposing a non-homogeneous condition, in relation to heat propagation, existing many clinical applications of these observations.

  15. Apical Periodontitis - Is It Accountable for Cardiovascular Diseases?

    PubMed Central

    Chaman, Chandrakar

    2016-01-01

    The aim of this review was to assess the relationship between apical periodontitis and cardiovascular diseases and the predictive factors regarding this association. Cross sectional and observational studies have been included, which are mostly retrospective. A comprehensive search was performed in the Systematic Electronic Databases, PUBMED and MEDLINE from 1919 till September 2014. Articles were also hand searched. From 86 studies identified, all were read and 58 articles which were relevant were included in the text. Some articles were excluded because they were pertaining to periodontology and other systemic disorders. Some were solely animal studies and were thus excluded. Our results suggest an independent association between cardiovascular diseases and apical periodontitis. A causal relationship could not be established since weak parameters of risk have been assessed in the studies, population taken is difficult to compare and other confounding factors have not been ruled out. Only a more focused and better instituted scientific research can determine this association. Establishing a cause and effect relationship between apical periodontitis and cardiovascular diseases can affect the course of treatment of cardiovascular diseases. It is not only of interest from the scientific point of view but also from public health perspective. PMID:27656588

  16. An Apical-Membrane Chloride Channel in Human Tracheal Epithelium

    NASA Astrophysics Data System (ADS)

    Welsh, Michael J.

    1986-06-01

    The mechanism of chloride transport by airway epithelia has been of substantial interest because airway and sweat gland-duct epithelia are chloride-impermeable in cystic fibrosis. The decreased chloride permeability prevents normal secretion by the airway epithelium, thereby interfering with mucociliary clearance and contributing to the morbidity and mortality of the disease. Because chloride secretion depends on and is regulated by chloride conductance in the apical cell membrane, the patch-clamp technique was used to directly examine single-channel currents in primary cultures of human tracheal epithelium. The cells contained an anion-selective channel that was not strongly voltage-gated or regulated by calcium in cell-free patches. The channel was also blocked by analogs of carboxylic acid that decrease apical chloride conductance in intact epithelia. When attached to the cell, the channel was activated by isoproterenol, although the channel was also observed to open spontaneously. However, in some cases, the channel was only observed after the patch was excised from the cell. These results suggest that this channel is responsible for the apical chloride conductance in airway epithelia.

  17. Apical Periodontitis - Is It Accountable for Cardiovascular Diseases?

    PubMed

    Garg, Paridhi; Chaman, Chandrakar

    2016-08-01

    The aim of this review was to assess the relationship between apical periodontitis and cardiovascular diseases and the predictive factors regarding this association. Cross sectional and observational studies have been included, which are mostly retrospective. A comprehensive search was performed in the Systematic Electronic Databases, PUBMED and MEDLINE from 1919 till September 2014. Articles were also hand searched. From 86 studies identified, all were read and 58 articles which were relevant were included in the text. Some articles were excluded because they were pertaining to periodontology and other systemic disorders. Some were solely animal studies and were thus excluded. Our results suggest an independent association between cardiovascular diseases and apical periodontitis. A causal relationship could not be established since weak parameters of risk have been assessed in the studies, population taken is difficult to compare and other confounding factors have not been ruled out. Only a more focused and better instituted scientific research can determine this association. Establishing a cause and effect relationship between apical periodontitis and cardiovascular diseases can affect the course of treatment of cardiovascular diseases. It is not only of interest from the scientific point of view but also from public health perspective. PMID:27656588

  18. Ontogenetic contingency of tolerance mechanisms in response to apical damage

    PubMed Central

    Gruntman, Michal; Novoplansky, Ariel

    2011-01-01

    Background and Aims Plants are able to tolerate tissue loss through vigorous branching which is often triggered by release from apical dominance and activation of lateral meristems. However, damage-induced branching might not be a mere physiological outcome of released apical dominance, but an adaptive response to environmental signals, such as damage timing and intensity. Here, branching responses to both factors were examined in the annual plant Medicago truncatula. Methods Branching patterns and allocation to reproductive traits were examined in response to variable clipping intensities and timings in M. truncatula plants from two populations that vary in the onset of reproduction. Phenotypic selection analysis was used to evaluate the strength and direction of selection on branching under the damage treatments. Key Results Plants of both populations exhibited an ontogenetic shift in tolerance mechanisms: while early damage induced greater meristem activation, late damage elicited investment in late-determined traits, including mean pod and seed biomass, and supported greater germination rates. Severe damage mostly elicited simultaneous development of multiple-order lateral branches, but this response was limited to early damage. Selection analyses revealed positive directional selection on branching in plants under early- compared with late- or no-damage treatments. Conclusions The results demonstrate that damage-induced meristem activation is an adaptive response that could be modified according to the plant's developmental stage, severity of tissue loss and their interaction, stressing the importance of considering these effects when studying plastic responses to apical damage. PMID:21873259

  19. A new approach for miniaturization of multiple faraday cup collectors.

    SciTech Connect

    Banar, J. C.; Chamberlin, E. P.; Poths, J.; Perrin, R. E.; Chastagner, P.

    2002-01-01

    The mass spectrometry section in CST-7 has been working for several years on a novel so0lution to overcome the size and placement restrictions of multiple Faraday cup collectors. Use of simultaneous collection of multiple isotopes both increases precision in the isotopic measurements and shortens the data collection time. Our application is for the measurement of the isotopic composition of Xe, ionized in a source that produces a large (10{sup -11} amp) but variable ion beam.

  20. NOE distance and dihedral angle restraints to calculate the solution structure of the NDH-1 complex subunit CupS from Thermosynechococcus elongatus

    PubMed Central

    Korste, Annika; Wulfhorst, Hannes; Ikegami, Takahisa; Nowaczyk, Marc M.; Stoll, Raphael

    2015-01-01

    Here, we have compiled a nuclear magnetic resonance (NMR)-derived set of nuclear Overhauser enhancement (NOE) distance and dihedral angle restraints that allow for the calculation of the structure of the NDH-1 complex subunit CupS from Thermosynechococcus elongatus in solution. These restraints to calculate the structure in solution of CupS have been deposited to the Protein Data Bank (www.rcsb.org) under PDB-ID accession number 2MXA. This is the first experimental data set published to compute the three-dimensional structure of CupS. This structure is presented in the research article “Solution structure of the NDH-1 complex subunit CupS from Thermosynechococcus elongatus” published by Korste et al. in Biochim. Biophys. Acta 1847(2015)1212–1219 [1]. The cyanobacterial multi-subunit membrane protein complex NDH-1 structurally and functionally relates to Complex I of eubacteria and mitochondria. The NDH-1 complex is mechanistically involved in respiration and cyclic electron transfer around photosystem I (PSI) as well as in a unique mechanism for inorganic carbon concentration. PMID:26862566

  1. From Tonic-cups to Bitter-cups: Kwasi bita beker from Suriname Determination, past and present use of an ancient galenic artefact.

    PubMed

    Odonne, G; Bourdy, G; Beauchêne, J; Houël, E; Stien, D; Chevolot, L; Deharo, E

    2007-03-21

    In the main markets of Paramaribo (Suriname), many stands offer what is locally called "Bitter-cups", or "Kwasi bita beker", small footed-cups, roughly carved from a whitish wood. The use of these cups is strictly medicinal and it seems to be restricted to Suriname, as they are not found in neighbouring countries (Guyana, French Guiana). The aim of this study was to identify the botanical origin of Bitter-cups still in use in the Saramaka traditional medicine (as information from field people was controversial), and document the ethnopharmacology of this original galenical artefact. Microscopic and high performance liquid chromatography (HPLC) analyses were carried out on Bitter-cup, and anatomical criteria (marginal parenchyma band, size of intervessel and vessel-ray pits, rays width and rays composition, vessels clustering, frequency and size of parenchyma pits) together with HPLC profiles of the macerates showed that the wood cup was similar to Quassia amara L. (Simaroubaceae) wood. Ethnopharmacological investigation indicates that the use of these cups is simply due to the pharmacological properties attributed to "bitters", and is strongly linked to tradition and cultural attitudes. This study also emphasizes the long lasting use of these cups, now restricted to Suriname only, with almost no variation over one century.

  2. Technology development for the Solar Probe Plus Faraday Cup

    NASA Astrophysics Data System (ADS)

    Freeman, Mark D.; Kasper, Justin; Case, Anthony W.; Daigneau, Peter; Gauron, Thomas; Bookbinder, Jay; Brodu, Étienne; Balat-Pichelin, Marianne; Wright, Kenneth

    2013-09-01

    The upcoming Solar Probe Plus (SPP) mission requires novel approaches for in-situ plasma instrument design. SPP's Solar Probe Cup (SPC) instrument will, as part of the Solar Wind Electrons, Alphas, and Protons (SWEAP) instrument suite, operate over an enormous range of temperatures, yet must still accurately measure currents below 1 pico-amp, and with modest power requirements. This paper discusses some of the key technology development aspects of the SPC, a Faraday Cup and one of the few instruments on SPP that is directly exposed to the solar disk, where at closest approach to the Sun (less than 10 solar radii (Rs) from the center of the Sun) the intensity is greater than 475 earth-suns. These challenges range from materials characterization at temperatures in excess of 1400°C to thermal modeling of the behavior of the materials and their interactions at these temperatures. We discuss the trades that have resulted in the material selection for the current design of the Faraday Cup. Specific challenges include the material selection and mechanical design of insulators, particularly for the high-voltage (up to 8 kV) grid and coaxial supply line, and thermo-optical techniques to minimize temperatures in the SPC, with the specific intent of demonstrating Technology Readiness Level 6 by the end of 2013.

  3. Design and characterization of a versatile Faraday cup

    NASA Astrophysics Data System (ADS)

    Seamans, J. F.; Kimura, W. D.

    1993-02-01

    The design and characterization of a Faraday cup utilizing modular components are presented. Design specifications were primarily tailored to satisfy the specific electron beam (e-beam) energy (˜375 keV), rise time (˜60 ns), and magnitude (30 A/cm2, peak) used in this work and permit convenient sampling of large e-beam areas up to 7 cm×7 cm. Characterization during evacuated conditions included Z-dependence measurements using beryllium, carbon, aluminum, and lead collector plates. Electron beam transmission measurements were made utilizing combinations of various metal screens and Kapton foils in both gas and evacuated conditions. Gas environments tested were air, krypton, and a Kr/Ar mixture. An attacher gas, SF6, was also added inside the Faraday cup. Results reveal decreasing current densities with increasing gas stopping power and increasing electron propagation distance in a gas. Employing a carbon collector plate and a 25-μm Kapton foil insulator, current densities measured through a 3.6-cm thick 760 Torr air slab are reduced ≤6% from the evacuated Kapton-free condition. Applying profile and full-aperture Faraday cup measurements, a consistent description of the e-beam is also presented.

  4. 'Cup cell disease' in the colonial tunicate Botryllus schlosseri.

    PubMed

    Moiseeva, Elisabeth; Rabinowitz, Claudette; Yankelevich, Irena; Rinkevich, Baruch

    2004-07-01

    A new progressive, fatal disease called 'cup cell disease' was characterized in ex situ cultures of Botryllus schlosseri, a colonial tunicate. The disease originated as a few dark spots growing within zooids. The infected colonies then started to deteriorate, morphologically diagnosed by ampullar retraction, lethargic blood circulation and by a swollen and soft tunic matrix. In later stages of the disease, developed buds were also affected. Many large black dots were scattered within the tunic matrix, and zooids were transformed to opaque, dilated, sac-like structures, signaling impending death. Colonies were infected periodically, even without direct tissue contact. The time course from first appearance to colony death ranged between 30 and 45 d. Histological studies, in vitro culturing of blood cells and blood smears revealed the existence of numerous cup-like cells (up to 4.8 microm diameter on average) with a yellowish cell wall and transparent cytoplasm that was not stained by various dyes (except azocarmine-G). Cells were refractive under bright-field illumination and revealed a flattened wall with flanges, characteristic of species of the phylum Haplosporidia. Cup cells aggregated in blood vessels and in internal parts of zooids and buds and were phagocytosed by blood cells. In a single case, plasmodia-like structures were found only in the tunic matrix of an infected colony. This is the first record in botryllid ascidians of an infectious lethal disease associated with haplosporidian protists.

  5. Oxidative unzipping of stacked nitrogen-doped carbon nanotube cups.

    PubMed

    Dong, Haifeng; Zhao, Yong; Tang, Yifan; Burkert, Seth C; Star, Alexander

    2015-05-27

    We demonstrate a facile synthesis of different nanostructures by oxidative unzipping of stacked nitrogen-doped carbon nanotube cups (NCNCs). Depending on the initial number of stacked-cup segments, this method can yield graphene nanosheets (GNSs) or hybrid nanostructures comprised of graphene nanoribbons partially unzipped from a central nanotube core. Due to the stacked-cup structure of as-synthesized NCNCs, preventing complete exposure of graphitic planes, the unzipping mechanism is hindered, resulting in incomplete unzipping; however, individual, separated NCNCs are completely unzipped, yielding individual nitrogen-doped GNSs. Graphene-based materials have been employed as electrocatalysts for many important chemical reactions, and it has been proposed that increasing the reactive edges results in more efficient electrocatalysis. In this paper, we apply these graphene conjugates as electrocatalysts for the oxygen reduction reaction (ORR) to determine how the increase in reactive edges affects the electrocatalytic activity. This investigation introduces a new method for the improvement of ORR electrocatalysts by using nitrogen dopants more effectively, allowing for enhanced ORR performance with lower overall nitrogen content. Additionally, the GNSs were functionalized with gold nanoparticles (GNPs), resulting in a GNS/GNP hybrid, which shows efficient surface-enhanced Raman scattering and expands the scope of its application in advanced device fabrication and biosensing.

  6. SAS6-like protein in Plasmodium indicates that conoid-associated apical complex proteins persist in invasive stages within the mosquito vector

    PubMed Central

    Wall, Richard J.; Roques, Magali; Katris, Nicholas J.; Koreny, Ludek; Stanway, Rebecca R.; Brady, Declan; Waller, Ross F.; Tewari, Rita

    2016-01-01

    The SAS6-like (SAS6L) protein, a truncated paralogue of the ubiquitous basal body/centriole protein SAS6, has been characterised recently as a flagellum protein in trypanosomatids, but associated with the conoid in apicomplexan Toxoplasma. The conoid has been suggested to derive from flagella parts, but is thought to have been lost from some apicomplexans including the malaria-causing genus Plasmodium. Presence of SAS6L in Plasmodium, therefore, suggested a possible role in flagella assembly in male gametes, the only flagellated stage. Here, we have studied the expression and role of SAS6L throughout the Plasmodium life cycle using the rodent malaria model P. berghei. Contrary to a hypothesised role in flagella, SAS6L was absent during gamete flagellum formation. Instead, SAS6L was restricted to the apical complex in ookinetes and sporozoites, the extracellular invasive stages that develop within the mosquito vector. In these stages SAS6L forms an apical ring, as we show is also the case in Toxoplasma tachyzoites. The SAS6L ring was not apparent in blood-stage invasive merozoites, indicating that the apical complex is differentiated between the different invasive forms. Overall this study indicates that a conoid-associated apical complex protein and ring structure is persistent in Plasmodium in a stage-specific manner. PMID:27339728

  7. Age estimation by pulp/tooth ratio in canines by peri-apical X-rays.

    PubMed

    Cameriere, Roberto; Ferrante, Luigi; Belcastro, Maria Giovanna; Bonfiglioli, Benedetta; Rastelli, Elisa; Cingolani, Mariano

    2007-01-01

    Estimation of age in individuals has received considerable attention in forensic science, in which it is a widely used method for individual identification, together with paleo-demographic analyses to establish mortality patterns in past populations. The present investigation, which is a continuation of a previously published pilot study, was conducted to examine the possible application of the pulp/tooth area ratio by peri-apical images as an indicator of age at death. A total of 200 peri-apical X-rays of upper and lower canines were assembled from 57 male and 43 female skeletons of Caucasian origin, aged between 20 and 79 years. They belong to the Frassetto osteological collection of Sassari (Sardinia) and are housed in the Museum of Anthropology, Department of Experimental and Evolutionistic Biology, University of Bologna. For each skeleton, dental maturity was evaluated by measuring the pulp/tooth area ratio on upper (x(1)) and lower (x(2)) canines. Very good agreement was found between intraobserver measurements. Statistical analysis was performed in order to obtain multiple regression formulae for dental age calculation, with chronological age as dependent variable, and gender, and upper and lower canines as independent variables. Stepwise regression analysis showed that gender did not contribute significantly to the fit (p=0.881) whereas variables x(1) and x(2) and the first-order interaction between them did. These two variables explained 92.5% of variations in estimated chronological age and the residual standard error was 4.06 years. Lastly, two simple linear regression equations were obtained for age estimation using canines from the maxilla and mandible separately. Both models explained 86% of variations in estimated chronological age and allowed an age-at-death estimate with a residual standard error of about 5.4 years.

  8. Development of the ciliary body: morphological changes in the distal portion of the optic cup in the human.

    PubMed

    Peces-Peña, M D; de la Cuadra-Blanco, C; Vicente, A; Mérida-Velasco, J R

    2013-01-01

    This study seeks to determine the main events that occur in the development of the ciliary body (CB) in the 5-14th week of development. The CB develops from the distal portion of the optic cup (OC) and the neighboring mesenchyme. During the 5th week of development, 4 zones were observed in the distal portion of the OC: in zone 1, the epithelia of the outer and inner layers of the OC came into contact. This contact coincided with the appearance of mainly apical granule pigments. This zone corresponded to the anlage of the epithelial layers of the CB. In zone 2, the cells surrounded the marginal sinus and contained scarce pigment granules and nuclei in the basal position. This zone corresponded to the anlage of the iris. Zone 3 was triangular in shape and its vertex ran towards the marginal sinus and corresponded to common cell progenitors. Zone 4 corresponded to the retinal pigment epithelium anlage and the neural retina anlage. We determined the onset of the stroma and the ciliary muscle anlage at the end of the 7th week. In the 13-14th week, we observed the anlage of the orbicularis ciliaris (pars plana of the CB) and corona ciliaris (pars plicata of the CB), in addition to the anlage of the ciliary muscle. Our study, therefore, establishes a precise timetable of the development of the CB.

  9. Investigation of a cup-shaped ultrasonic transducer operated in the full-wave vibrational mode.

    PubMed

    Xu, Long

    2015-05-01

    Cup-shaped horn has significant applications in ultrasonic machining, such as continuous bonding of plastic sheet or strips. Generally, it is excited by a sandwich piezoelectric transducer and both together constitute a cup-shaped ultrasound transducer (CUT). To provide a concise theoretical model for its engineering applications, the equivalent circuit of the cup-shaped ultrasonic transducer is deduced and the resonance/anti-resonance frequency equations are obtained. Meanwhile, the vibrational characteristics of the cup-shaped ultrasonic transducer have been investigated by using the analytical and numerical methods, and then confirmed by the experiment. The results show that the cup-shaped horn has a distinctive equivalent circuit, and the cup-shaped ultrasonic transducer has a good vibrational performance.

  10. Equally good fixation of cemented and uncemented cups in total trapeziometacarpal joint prostheses

    PubMed Central

    2013-01-01

    Background and purpose Cup failure is a recognized problem in total trapeziometacarpal (TM) joint prostheses; it may be related to poor fixation, which can be revealed by radiostereometric analysis (RSA). We compared the early implant migration of cemented trapezium cups to that of uncemented screw cups. Patients and methods In a prospective, parallel-group, randomized patient-blinded clinical trial, we included 32 hands in 28 patients (5 males) with a mean age of 58 (40–77) years and with Eaton stage-2 or -3 osteoarthritis of the trapeziometacarpal joint. Patients were randomized to surgery with a cemented DLC all-polyethylene cup (C) (n = 16) or an uncemented hydroxyapatite-coated chrome-cobalt Elektra screw cup (UC) (n = 16). Uncemented cups were inserted without threading of the bone. Stereoradiographs for evaluation of cup migration (primary effect size) and DASH and pain scores were obtained during 2 years of follow-up. Results The 2-year total translation (TT) was similar (p = 0.2): 0.24 mm (SD 0.10) for the C (n = 11) and 0.19 mm (SD 0.16) for the UC (n = 11). Variances were similar (p = 0.4). Judged by RSA, 2 UC cups and 1 C cup became loose (TT > 1 mm). Both UC cups were found to be loose at revision. Grip strength, pain, and DASH scores were similar between groups at all measurement points. Interpretation Early implant fixation and clinical outcome were equally good with both cup designs. This is the first clinical RSA study on trapezium cups, and the method appears to be clinically useful for detection of loose implants. PMID:23343372

  11. Multiple data sets and modelling choices in a comparative LCA of disposable beverage cups.

    PubMed

    van der Harst, Eugenie; Potting, José; Kroeze, Carolien

    2014-10-01

    This study used multiple data sets and modelling choices in an environmental life cycle assessment (LCA) to compare typical disposable beverage cups made from polystyrene (PS), polylactic acid (PLA; bioplastic) and paper lined with bioplastic (biopaper). Incineration and recycling were considered as waste processing options, and for the PLA and biopaper cup also composting and anaerobic digestion. Multiple data sets and modelling choices were systematically used to calculate average results and the spread in results for each disposable cup in eleven impact categories. The LCA results of all combinations of data sets and modelling choices consistently identify three processes that dominate the environmental impact: (1) production of the cup's basic material (PS, PLA, biopaper), (2) cup manufacturing, and (3) waste processing. The large spread in results for impact categories strongly overlaps among the cups, however, and therefore does not allow a preference for one type of cup material. Comparison of the individual waste treatment options suggests some cautious preferences. The average waste treatment results indicate that recycling is the preferred option for PLA cups, followed by anaerobic digestion and incineration. Recycling is slightly preferred over incineration for the biopaper cups. There is no preferred waste treatment option for the PS cups. Taking into account the spread in waste treatment results for all cups, however, none of these preferences for waste processing options can be justified. The only exception is composting, which is least preferred for both PLA and biopaper cups. Our study illustrates that using multiple data sets and modelling choices can lead to considerable spread in LCA results. This makes comparing products more complex, but the outcomes more robust.

  12. The Cup'ik People of the Western Tundra: A Curriculum.

    ERIC Educational Resources Information Center

    Pingayak, John

    The Cup'ik people are a group of Yup'ik Eskimos who live in southwest Alaska. This curriculum aims to enhance Cup'ik students' interest in their own culture by making that culture a part of their daily activities; to teach students to practice the traditional Cup'ik respect for elders, fellow students, and others in the community; and to teach…

  13. Multiple data sets and modelling choices in a comparative LCA of disposable beverage cups.

    PubMed

    van der Harst, Eugenie; Potting, José; Kroeze, Carolien

    2014-10-01

    This study used multiple data sets and modelling choices in an environmental life cycle assessment (LCA) to compare typical disposable beverage cups made from polystyrene (PS), polylactic acid (PLA; bioplastic) and paper lined with bioplastic (biopaper). Incineration and recycling were considered as waste processing options, and for the PLA and biopaper cup also composting and anaerobic digestion. Multiple data sets and modelling choices were systematically used to calculate average results and the spread in results for each disposable cup in eleven impact categories. The LCA results of all combinations of data sets and modelling choices consistently identify three processes that dominate the environmental impact: (1) production of the cup's basic material (PS, PLA, biopaper), (2) cup manufacturing, and (3) waste processing. The large spread in results for impact categories strongly overlaps among the cups, however, and therefore does not allow a preference for one type of cup material. Comparison of the individual waste treatment options suggests some cautious preferences. The average waste treatment results indicate that recycling is the preferred option for PLA cups, followed by anaerobic digestion and incineration. Recycling is slightly preferred over incineration for the biopaper cups. There is no preferred waste treatment option for the PS cups. Taking into account the spread in waste treatment results for all cups, however, none of these preferences for waste processing options can be justified. The only exception is composting, which is least preferred for both PLA and biopaper cups. Our study illustrates that using multiple data sets and modelling choices can lead to considerable spread in LCA results. This makes comparing products more complex, but the outcomes more robust. PMID:25037049

  14. Performance of Porous Tantalum vs. Titanium Cup in Total Hip Arthroplasty: Randomized Trial with Minimum 10-Year Follow-Up.

    PubMed

    Wegrzyn, Julien; Kaufman, Kenton R; Hanssen, Arlen D; Lewallen, David G

    2015-06-01

    Porous tantalum monoblock cups have been proposed to improve survivorship of cementless primary THA. However, there are few direct comparative trials to established implants such as porous-coated titanium cups. 113 patients were randomized into two groups according to the cup: a porous tantalum monoblock cup (TM) or a porous-coated titanium monoblock cup (control). At a mean of 12 years after THA, no implants migrated in both groups. Two TM patients (4%) and 13 control patients (33%) presented with radiolucency around the cup (P<0.001). In the control group, 1 cup (2%) was revised for aseptic loosening. At 12 years post-implantation, porous tantalum monoblock cups demonstrated 100% survivorship, and significantly less radiolucency as compared to porous-coated titanium monoblock cups.

  15. Apical Na+ permeability of frog skin during serosal Cl- replacement.

    PubMed

    Leibowich, S; DeLong, J; Civan, M M

    1988-05-01

    Gluconate substitution for serosal Cl- reduces the transepithelial short-circuit current (Isc) and depolarizes short-circuited frog skins. These effects could result either from inhibition of basolateral K+ conductance, or from two actions to inhibit both apical Na+ permeability (PapNa) and basolateral pump activity. We have addressed this question by studying whole-and split-thickness frog skins. Intracellular Na+ concentration (CcNa) and PapNa have been monitored by measuring the current-voltage relationship for apical Na+ entry. This analysis was conducted by applying trains of voltage pulses, with pulse durations of 16 to 32 msec. Estimates of PapNa and CcNa were not detectably dependent on pulse duration over the range 16 to 80 msec. Serosal Cl- replacement uniformly depolarized short-circuited tissues. The depolarization was associated with inhibition of Isc across each split skin, but only occasionally across the whole-thickness preparations. This difference may reflect the better ionic exchange between the bulk medium and the extracellular fluid in contact with the basolateral membranes, following removal of the underlying dermis in the split-skin preparations. PapNa was either unchanged or increased, and CcNa either unchanged or reduced after the anionic replacement. These data are incompatible with the concept that serosal Cl- replacement inhibits PapNa and Na,K-pump activity. Gluconate substitution likely reduces cell volume, triggering inhibition of the basolateral K+ channels, consistent with the data and conclusions of S.A. Lewis, A.G. Butt, M.J. Bowler, J.P. Leader and A.D.C. Macknight (J. Membrane Biol. 83:119-137, 1985) for toad bladder. The resulting depolarization reduces the electrical force favoring apical Na+ entry. The volume-conductance coupling serves to conserve volume by reducing K+ solute loss. Its molecular basis remains to be identified.

  16. SEM investigation of Er:YAG laser apical preparation

    NASA Astrophysics Data System (ADS)

    Bǎlǎbuc, Cosmin; Todea, Carmen; Locovei, Cosmin; RǎduÅ£ǎ, Aurel

    2016-03-01

    Endodontic surgery involves the incision and flap elevation, the access to the root tip, its resection, the cavity retrograde preparation and filling it with biocompatible material that provides a good seal of the apex[1]. Apicoectomy is compulsory in endodontic surgery. The final stage involves the root retropreparation and the carrying out of the retrograde obturation. In order to perform the retrograde preparation the endodontist can use various tools such as lowspeed conventional handpieces, sonic and ultrasonic equipment. The ideal depth of the preparation should be 3 mm, exceeding this value may affect the long-term success of the obturation [2]. Resection at the depth of 3 mm reduces apical ramifications by 98% and lateral root canals by 93%. The ultrasonic retropreparation has numerous advantages compared to the dental drill. Firstly, the cavity will be in the axis of the tooth which implies a minimum destruction of the root canal morphology. The preparations are precise, and the cutting pattern is perpendicular to the long axis of the root, the advantage being the reduction in the number of dentinal tubules exposed at the resected area [3]. Therefore, the retrograde filling is the procedure when an inert and non-toxic material is compacted in the apically created cavity.[4,5]. The Er:YAG laser is the most common wavelength indicated for dental hard tissue preparation. Its natural selectivity offers a significant advantage compared to the conventional hard tissue preparation [6-9].The purpose of this in vitro study was to investigate the quality of Er:YAG laser apical third preparation using Scanning Electron Microscopy (SEM), in comparison with the conventional ultrasonic method.

  17. Cupping as a part of living finnish traditional healing. A remedy against pain.

    PubMed

    Hänninen, O; Vaskilampi, T

    1982-01-01

    Wet cupping appears to be a living reminiscence of the traditional Finnish healing methods. Fifteen persons practicing or having practiced cupping were interviewed in Savo Province, Eastern Finland. The knowledge and skills of cupping appear to be transferred by personal apprenticeship within a family or from a neighbour. No written material is nowadays available and known to be used in learning. Cupping is considered by healers to be useful in the treatment of aching and pains of teeth, head, neck, shoulders, back and legs. Cuppers report cupping effective also in hypertension and skin diseases. On the other hand, the method is not regarded to be useful in problems of internal organs. Cupping is done after a sauna and bathing of the patient in a warm environment (in sauna). It is often preceded by massage. The small wounds in the cupping sites are made with the aid of a small knife. The healers have the opinion that bad blood must be removed from the superficial areas of the ailing parts of the body, The cupping sites were more or less specific to the ailments of the patient and the number of cups varied from patient to patient depending on the condition and size.

  18. Plastic cup traps equipped with light-emitting diodes for monitoring adult Bemisia tabaci (Homoptera: Aleyrodidae).

    PubMed

    Chu, Chang-Chi; Jackson, Charles G; Alexander, Patrick J; Karut, Kamil; Henneberry, Thomas J

    2003-06-01

    Equipping the standard plastic cup trap, also known as the CC trap, with lime-green light-emitting diodes (LED-plastic cup trap) increased its efficacy for catching Bemisia tabaci by 100%. Few Eretmocerus eremicus Rose and Zolnerowich and Encarsia formosa Gahan were caught in LED-plastic cup traps. The LED-plastic cup traps are less expensive than yellow sticky card traps for monitoring adult whiteflies in greenhouse crop production systems and are more compatible with whitefly parasitoids releases for Bemisia nymph control.

  19. Electroviscous contribution to the rheology of colloidal unimolecular polymer (CUP) particles in water.

    PubMed

    Chen, Minghang; Riddles, Cynthia J; Van De Mark, Michael R

    2013-11-19

    The rheological characteristics of anionic colloidal unimolecular polymer (CUP) particles in water were investigated. The intrinsic viscosities were determined for CUPs with different molecular weights as a function of volume fraction. The specific viscosities were measured and fit with models considering hydrodynamic interaction and electroviscous effects. The rheological characteristics were consistent with a surface layer of water which increases with the particle size or molecular weight of CUPs. The effective charges on the surface of particle were calculated and correlated with the rheological behavior of the CUP particles from the dilute to semidilute range, a volume fraction of 0.0001-0.08.

  20. A lady with a broken heart: Apical ballooning syndrome.

    PubMed

    Rush, C; Ntsekhe, M

    2015-05-01

    Severe chest pain afteran emotional argumentresulted in the admissionof a healthy 72-year-oldwoman. She was haemodynamicallycompromised, with anelectrocardiogram (ECG) demonstratinganterior ST-depression and T-wave inversions(Fig. 1). Her 6-hour troponin T levelwas 132 ng/L. Cardiac catheterisationrevealed unobstructed coronary arteriesand a reduced left ventricular ejectionfraction (LVEF) of <35%, with basalhyperkinesia and apical segment ballooning(Figs 2 - 5). She was discharged home after3 days of supportive therapy. At 3 monthsshe was asymptomatic, with an equilibriumradionuclide angiography scan revealing anormal heart with an LVEF of 73%. PMID:26242680

  1. The DHL EuroCup: shots on goal.

    PubMed

    Hemp, Paul

    2003-11-01

    Deutsche Post World Net, the German postal monopoly, faced significant challenges as it began the process of integrating three businesses: Deutsche Post Euro Express, its own ground-based parcel delivery service, and two companies it had acquired-DHL, the worldwide express delivery service, and Danzas, a worldwide air and ocean freight company. The cultural differences alone were imposing. For example, DHL was a privately held, entrepreneurial company in which most managers had international experience; Deutsche Post was until recently a state-owned monopoly in which few managers had worked outside their home country. Enter EuroCup. For 20 years, DHL employees had held a soccer tournament to strengthen company culture across national boundaries. Canceled the previous year due to budget constraints, the EuroCup tournament was revived in 2003-in part to help with the postmerger integration. But did the event really help? HBR senior editor Paul Hemp attended EuroCup 2003, joining nearly 2,500 DHL employees--about 600 of them players, the rest cheerleaders and other supporters--in the small Belgian town of Lommel. He set out to answer a number of questions relevant to any company staging an ambitious off-site intended to encourage teamwork and boost morale. How does a company determine whether such a large-scale event, even one that generates goodwill, is worth the investment? Does the team building extend to those back home who don't get to attend? Can intense competition between teams begin to overshadow the spirit of cooperation that such an event is meant to engender? In short, can a soccer tournament help a company achieve its corporate goal of creating a strong common culture?

  2. Analysis of bone ingrowth on a tantalum cup

    PubMed Central

    D'Angelo, F; Murena, L; Campagnolo, M; Zatti, G; Cherubino, P

    2008-01-01

    Background: Trabecular Metal (TM) is a new highly porous material made of tantalum (Zimmer, Warsaw, Indiana, USA). Its three-dimensional structure is composed of a series of interconnected dodecahedron pores that are on average 550 μm in diameter. This size is considered optimal for bone ingrowth and is similar to trabecular bone. The elastic modulus of TM (3 GPa) is more similar to that of cancellous (0,1-1,5 GPa) or cortical (112-18 GPa) bone and is significantly less similar to that of Titanium (110 GPa) and Co-Cr alloys (220 GPa). These features enable bone apposition and remodeling. The purpose of the present study was to evaluate the histology of the bone-implant interface in a human specimen. Materials and Methods: A highly porous tantalum cup (Zimmer, Warsaw, Indiana, USA) was removed for recurrent dislocations three years after implantation. In order to obtain a slice of the cup, two cuts were made on the centre using an Exakt cutting machine. Then the slice was embedded in a Technovit resin and a Hematoxylin-eosin stain was used to study the bone tissue. Bone ingrowth was calculated using a method based on simple calculations of planar geometry. Results: The histological evaluation of the periprosthetic tissues revealed a typical chronic inflammation with few particles of polyethylene that were birefringent using polarized light. The quantitative evaluation of bone ingrowth revealed that more than 95% of voids were filled with bone. Discussion: In the literature, a lot of studies focused on tantalum were carried on animal model. Up to now little information is available about the histology of the bone-tantalum interface in a human artificial joint. We had an opportunity to remove a well integrated cup hence this study. The histology confirmed the strong relationship between the structure of this material and bone. The morphometric analysis revealed a high percentage of bone ingrowth. PMID:19753152

  3. Power output during women's World Cup road cycle racing.

    PubMed

    Ebert, Tammie R; Martin, David T; McDonald, Warren; Victor, James; Plummer, John; Withers, Robert T

    2005-12-01

    Little information exists on the power output demands of competitive women's road cycle racing. The purpose of our investigation was to document the power output generated by elite female road cyclists who achieved success in FLAT and HILLY World Cup races. Power output data were collected from 27 top-20 World Cup finishes (19 FLAT and 8 HILLY) achieved by 15 nationally ranked cyclists (mean +/- SD; age: 24.1+/-4.0 years; body mass: 57.9+/-3.6 kg; height: 168.7+/-5.6 cm; VO2max 63.6+/-2.4 mL kg(-1) min(-1); peak power during graded exercise test (GXT(peak power)): 310+/-25 W). The GXT determined GXT(peak power), VO2peak lactate threshold (LT) and anaerobic threshold (AT). Bicycles were fitted with SRM powermeters, which recorded power (W), cadence (rpm), distance (km) and speed (km h(-1)). Racing data were analysed to establish time in power output and metabolic threshold bands and maximal mean power (MMP) over different durations. When compared to HILLY, FLAT were raced at a similar cadence (75+/-8 vs. 75+/-4 rpm, P=0.93) but higher speed (37.6+/-2.6 vs. 33.9+/-2.7 km h(-1), P=0.008) and power output (192+/-21 vs. 169+/-17 W, P=0.04; 3.3+/-0.3 vs. 3.0+/-0.4 W kg(-1), P=0.04). During FLAT races, riders spent significantly more time above 500 W, while greater race time was spent between 100 and 300 W (LT-AT) for HILLY races, with higher MMPs for 180-300 s. Racing terrain influenced the power output profiles of our internationally competitive female road cyclists. These data are the first to define the unique power output requirements associated with placing well in both flat and hilly women's World Cup cycling events.

  4. Differential basal-to-apical accessibility of lamin A/C epitopes in the nuclear lamina regulated by changes in cytoskeletal tension

    NASA Astrophysics Data System (ADS)

    Ihalainen, Teemu O.; Aires, Lina; Herzog, Florian A.; Schwartlander, Ruth; Moeller, Jens; Vogel, Viola

    2015-12-01

    Nuclear lamins play central roles at the intersection between cytoplasmic signalling and nuclear events. Here, we show that at least two N- and C-terminal lamin epitopes are not accessible at the basal side of the nuclear envelope under environmental conditions known to upregulate cell contractility. The conformational epitope on the Ig-domain of A-type lamins is more buried in the basal than apical nuclear envelope of human mesenchymal stem cells undergoing osteogenesis (but not adipogenesis), and in fibroblasts adhering to rigid (but not soft) polyacrylamide hydrogels. This structural polarization of the lamina is promoted by compressive forces, emerges during cell spreading, and requires lamin A/C multimerization, intact nucleoskeleton-cytoskeleton linkages (LINC), and apical-actin stress-fibre assembly. Notably, the identified Ig-epitope overlaps with emerin, DNA and histone binding sites, and comprises various laminopathy mutation sites. Our findings should help decipher how the physical properties of cellular microenvironments regulate nuclear events.

  5. Larval body patterning and apical organs are conserved in animal evolution

    PubMed Central

    2014-01-01

    Background Planktonic ciliated larvae are characteristic for the life cycle of marine invertebrates. Their most prominent feature is the apical organ harboring sensory cells and neurons of largely undetermined function. An elucidation of the relationships between various forms of primary larvae and apical organs is key to understanding the evolution of animal life cycles. These relationships have remained enigmatic due to the scarcity of comparative molecular data. Results To compare apical organs and larval body patterning, we have studied regionalization of the episphere, the upper hemisphere of the trochophore larva of the marine annelid Platynereis dumerilii. We examined the spatial distribution of transcription factors and of Wnt signaling components previously implicated in anterior neural development. Pharmacological activation of Wnt signaling with Gsk3β antagonists abolishes expression of apical markers, consistent with a repressive role of Wnt signaling in the specification of apical tissue. We refer to this Wnt-sensitive, six3- and foxq2-expressing part of the episphere as the ‘apical plate’. We also unraveled a molecular signature of the apical organ - devoid of six3 but expressing foxj, irx, nkx3 and hox - that is shared with other marine phyla including cnidarians. Finally, we characterized the cell types that form part of the apical organ by profiling by image registration, which allows parallel expression profiling of multiple cells. Besides the hox-expressing apical tuft cells, this revealed the presence of putative light- and mechanosensory as well as multiple peptidergic cell types that we compared to apical organ cell types of other animal phyla. Conclusions The similar formation of a six3+, foxq2+ apical plate, sensitive to Wnt activity and with an apical tuft in its six3-free center, is most parsimoniously explained by evolutionary conservation. We propose that a simple apical organ - comprising an apical tuft and a basal plexus

  6. Missed opportunities: HIV and the 2010 FIFA World Cup.

    PubMed

    Beres, L K

    2011-10-01

    The international community missed opportunities to raise HIV awareness and reduce transmission risk during the World Cup held in South Africa from 11 June-11 July 2010. With the tournament captivating the entire region, the public health community should have better applied our knowledge and evidence-based interventions to raise the profile of HIV prevention, care and treatment. More should have been done to prevent possible new infections fueled by visitors, alcohol and sports celebrations. Considering the impact of HIV in southern Africa and the amount of funds and effort that go into addressing the problem each year, we cannot afford to miss these opportunities for action.

  7. Effect of masticatory cycles on apical leakage of obturated teeth.

    PubMed

    Esber, S; Blum, J Y; Chazel, J C; Parahy, E

    1998-05-01

    This study investigated the effect of apical leakage due to masticatory cycles on root canal treatment. Twenty upper maxillary molars were first obturated using the warm vertical compaction technique. Four maxillary casts were then built, with each holding four of the sample molars. The molars were embedded in resin with the roots separated from the resin by means of a light silicon. The four remaining teeth served as controls and were not submitted to occlusal forces. A mechanical device to simulate masticatory cycles subjected the teeth to 0.5 x 10(6) cycles (group A), 10(6) cycles (group B), 2 x 10(6) cycles (group C), and 3 x 10(6) cycles (group D); the control was group E. The roots were placed in 2% methylene blue dye solution for 72 h and then sectioned longitudinally so that dye penetration could be measured. The mean values of dye penetration were: 3.70 +/- 0.69 mm, group A; 5.00 +/- 1.14 mm, group B; 6.00 +/- 1.01 mm, group C; 7.23 +/- 0.66 mm, group D; and 2.74 +/- 0.75 mm, group E. The value of dye penetration increased in correlation with the number of masticatory cycles. This in vitro study suggests the significant effect of masticatory loads on apical leakage. PMID:9641106

  8. Torsional deformity of apical vertebra in adolescent idiopathic scoliosis.

    PubMed

    Kotwicki, Tomasz; Napiontek, Marek

    2002-01-01

    CT scans of structural thoracic idiopathic scoliosis were reviewed in nine patients admitted to our department for scoliosis surgery. The apical vertebra scans were chosen and the following parameters were evaluated: 1) alpha angle formed by the axis of vertebra and the axis of spinous process 2) beta concave and beta convex angle between the spinous process and the left and right transverse process, respectively, 3) gamma concave and gamma convex angle between the axis of vertebra and the left and right transverse process, respectively, 4) the rotation angle to the sagittal plane. The constant deviation of the spinous process towards the convex side of the curve was observed. The vertebral body itself was distorted towards the concavity of the curve. The angle between the spinous process and the transverse process was smaller on the convex side of the curve. The torsional, intravertebral deformity of the apical vertebra was a factor acting in the direction opposite to the rotation, in the sense to reduce the deformity of the spine in idiopathic scoliosis. PMID:15456062

  9. Hierarchy of hormone action controlling apical hook development in Arabidopsis.

    PubMed

    Gallego-Bartolomé, Javier; Arana, María V; Vandenbussche, Filip; Zádníková, Petra; Minguet, Eugenio G; Guardiola, Vicente; Van Der Straeten, Dominique; Benkova, Eva; Alabadí, David; Blázquez, Miguel A

    2011-08-01

    The apical hook develops in the upper part of the hypocotyl when seeds buried in the soil germinate, and serves to protect cotyledons and the shoot apical meristem from possible damage caused by pushing through the soil. The curvature is formed through differential cell growth that occurs at the two opposite sides of the hypocotyl, and it is established by a gradient of auxin activity and refined by the coordinated action of auxin and ethylene. Here we show that gibberellins (GAs) promote hook development through the transcriptional regulation of several genes of the ethylene and auxin pathways in Arabidopsis. The level of GA activity determines the speed of hook formation and the extent of the curvature during the formation phase independently of ethylene, probably by modulating auxin transport and response through HLS1, PIN3, and PIN7. Moreover, GAs cooperate with ethylene in preventing hook opening, in part through the induction of ethylene production mediated by ACS5/ETO2 and ACS8.

  10. Studies in Cup Drawing Behavior of Polymer Laminated Sheet Metal

    NASA Astrophysics Data System (ADS)

    Elnagmi, M.; Jain, M.; Bruhis, M.; Nielsen, K.

    2011-08-01

    Axisymmetric deep drawing behavior of a polymer laminated sheet metal (PLSM) is investigated using an axisymmetric cup drawing test. PLSMs are of interest as a replacement for painted finishes for automotive applications as they have the potential to achieve good quality long lasting and aesthetically appealing surfaces on stamped parts. However, there is limited understanding of PLSMs in automotive deep drawing situations to produce complex 3-D parts. The tests are carried out using well-controlled, laboratory-based, dual-action, servo-hydraulic forming presses under blank-holder force and punch displacement control conditions. An optical strain mapping system is used to measure the surface strains (and to construct 3D strain maps) from the film side of the deformed samples for a range of forming conditions. Deep drawing characteristics such as punch load versus punch displacement traces, strain distribution along the cup profile, flange wrinkling and fracture characteristics are experimentally assessed for stainless steel-plastic film laminated sheet materials. Also the effect of lamination pressure on wrinkling and delamination is investigated for a decorative pressure sensitive adhesive film affixed to the stainless steel sheet.

  11. Suppression Characteristics of Cup-Burner Flames in Low Gravity

    NASA Technical Reports Server (NTRS)

    Takahashi, Fumiaki; Linteris, Gregory T.; Katta, Viswanath R.

    2004-01-01

    The structure and suppression of laminar methane-air co-flow diffusion flames formed on a cup burner have been studied experimentally and numerically using physically acting fire-extinguishing agents (CO2, N2, He, and Ar) in normal earth (lg) and zero gravity (0g). The computation uses a direct numerical simulation with detailed chemistry and radiative heat-loss models. An initial observation of the flame without agent was also made at the NASA Glenn 2.2-Second Drop Tower. An agent was introduced into a low-speed coflowing oxidizing stream by gradually replacing the air until extinguishment occurred under a fixed minimal fuel velocity. The suppression of cup-burner flames, which resemble real fires, occurred via a blowoff process (in which the flame base drifted downstream) rather than the global extinction phenomenon typical of counterflow diffusion flames. The computation revealed that the peak reactivity spot (the reaction kernel) formed in the flame base was responsible for attachment and blowoff phenomena of the trailing diffusion flame. The thermal and transport properties of the agents affected the flame extinguishment limits.

  12. Property changes of UHMW polyethylene hip cup endoprostheses during implantation.

    PubMed

    Eyerer, P; Ke, Y C

    1984-01-01

    In this study it is demonstrated that the combined chemical and mechanical influences of the implant situation cause property changes of ultra-high-molecular-weight polyethylene (UHMW PE) hip joint cups. Nearly 30 out of 48 loosened cups, retrieved 3 weeks to 11 years after implantation, were investigated. Density measurements show a density increase with implantation time and a dependence of these changes from implant position and loading conditions. The rate of extractable constituents also increases with course of time. An increased in vivo conditioned oxidation of the UHMW PE can be demonstrated by infrared (IR) spectrometry. The density increase can be explained by post-crystallization, which is the result of oxidative chain scission. This leads to a reduction of the average molecular weight of the PE and to an increased extractability of constituents. Since these changes have been recognized as the reasons for aging and failing of UHMW PE, the methods of material characterization used in this study for retrieved implants will help to develop suitable in vitro testing and simulating methods. They are the prerequisite for the necessary improvements of the material properties of UHMW PE. PMID:6544798

  13. Joint assembly

    NASA Technical Reports Server (NTRS)

    Wilson, Andrew (Inventor); Punnoose, Andrew (Inventor); Strausser, Katherine (Inventor); Parikh, Neil (Inventor)

    2010-01-01

    A joint assembly is provided which includes a drive assembly and a swivel mechanism. The drive assembly features a motor operatively associated with a plurality of drive shafts for driving auxiliary elements, and a plurality of swivel shafts for pivoting the drive assembly. The swivel mechanism engages the swivel shafts and has a fixable element that may be attached to a foundation. The swivel mechanism is adapted to cooperate with the swivel shafts to pivot the drive assembly with at least two degrees of freedom relative to the foundation. The joint assembly allows for all components to remain encased in a tight, compact, and sealed package, making it ideal for space, exploratory, and commercial applications.

  14. Apical accumulation of the Sevenless receptor tyrosine kinase during Drosophila eye development is promoted by the small GTPase Rap1.

    PubMed

    Baril, Caroline; Lefrançois, Martin; Sahmi, Malha; Knævelsrud, Helene; Therrien, Marc

    2014-08-01

    The Ras/MAPK-signaling pathway plays pivotal roles during development of metazoans by controlling cell proliferation and cell differentiation elicited, in several instances, by receptor tyrosine kinases (RTKs). While the internal mechanism of RTK-driven Ras/MAPK signaling is well understood, far less is known regarding its interplay with other co-required signaling events involved in developmental decisions. In a genetic screen designed to identify new regulators of RTK/Ras/MAPK signaling during Drosophila eye development, we identified the small GTPase Rap1, PDZ-GEF, and Canoe as components contributing to Ras/MAPK-mediated R7 cell differentiation. Rap1 signaling has recently been found to participate in assembling cadherin-based adherens junctions in various fly epithelial tissues. Here, we show that Rap1 activity is required for the integrity of the apical domains of developing photoreceptor cells and that reduced Rap1 signaling hampers the apical accumulation of the Sevenless RTK in presumptive R7 cells. It thus appears that, in addition to its role in cell-cell adhesion, Rap1 signaling controls the partitioning of the epithelial cell membrane, which in turn influences signaling events that rely on apico-basal cell polarity.

  15. Magi Is Associated with the Par Complex and Functions Antagonistically with Bazooka to Regulate the Apical Polarity Complex

    PubMed Central

    Padash Barmchi, Mojgan; Samarasekera, Gayathri; Gilbert, Mary; Auld, Vanessa J.; Zhang, Bing

    2016-01-01

    The mammalian MAGI proteins play important roles in the maintenance of adherens and tight junctions. The MAGI family of proteins contains modular domains such as WW and PDZ domains necessary for scaffolding of membrane receptors and intracellular signaling components. Loss of MAGI leads to reduced junction stability while overexpression of MAGI can lead to increased adhesion and stabilization of epithelial morphology. However, how Magi regulates junction assembly in epithelia is largely unknown. We investigated the single Drosophila homologue of Magi to study the in vivo role of Magi in epithelial development. Magi is localized at the adherens junction and forms a complex with the polarity proteins, Par3/Bazooka and aPKC. We generated a Magi null mutant and found that Magi null mutants were viable with no detectable morphological defects even though the Magi protein is highly conserved with vertebrate Magi homologues. However, overexpression of Magi resulted in the displacement of Baz/Par3 and aPKC and lead to an increase in the level of PIP3. Interestingly, we found that Magi and Baz functioned in an antagonistic manner to regulate the localization of the apical polarity complex. Maintaining the balance between the level of Magi and Baz is an important determinant of the levels and localization of apical polarity complex. PMID:27074039

  16. Automated detection of kinks from blood vessels for optic cup segmentation in retinal images

    NASA Astrophysics Data System (ADS)

    Wong, D. W. K.; Liu, J.; Lim, J. H.; Li, H.; Wong, T. Y.

    2009-02-01

    The accurate localization of the optic cup in retinal images is important to assess the cup to disc ratio (CDR) for glaucoma screening and management. Glaucoma is physiologically assessed by the increased excavation of the optic cup within the optic nerve head, also known as the optic disc. The CDR is thus an important indicator of risk and severity of glaucoma. In this paper, we propose a method of determining the cup boundary using non-stereographic retinal images by the automatic detection of a morphological feature within the optic disc known as kinks. Kinks are defined as the bendings of small vessels as they traverse from the disc to the cup, providing physiological validation for the cup boundary. To detect kinks, localized patches are first generated from a preliminary cup boundary obtained via level set. Features obtained using edge detection and wavelet transform are combined using a statistical approach rule to identify likely vessel edges. The kinks are then obtained automatically by analyzing the detected vessel edges for angular changes, and these kinks are subsequently used to obtain the cup boundary. A set of retinal images from the Singapore Eye Research Institute was obtained to assess the performance of the method, with each image being clinically graded for the CDR. From experiments, when kinks were used, the error on the CDR was reduced to less than 0.1 CDR units relative to the clinical CDR, which is within the intra-observer variability of 0.2 CDR units.

  17. Good stability and minimal osteolysis with a biconical threaded cup at 10 years.

    PubMed

    Zweymüller, Karl A; Steindl, Martin; Schwarzinger, Ulrike

    2007-10-01

    In the literature there is no consensus on the value of threaded cementless cups. We primarily asked whether the newly constructed threaded double-cone cup without additional screw fixation would provide high survival at intermediate followup. We retrospectively reviewed 365 patients (376 hips) who underwent primary total hip arthroplasty using this cup made of pure titanium with ceramic-on-polyethylene articulating surfaces. At a minimum followup of 10.0 years (mean, 10.3 years; range, 10.0-13.1 years), 232 cups (61.7%) were available for analysis. We performed two revisions for early infection and cup breakage. No polyethylene liner was exchanged because of wear or instability. Three of the cup shells were radiographically loose at followup; one had periacetabular osteolysis. The mean liner wear rate was 0.13 mm per year. The Kaplan-Meier 10-year survivorship with revision of the cup shell for any reason was 99.3% (95% confidence interval, 96.9-99.8%) and with revision and radiographic loosening of the cup shell 98.6% (95% confidence interval, 96.0-99.5%). These intermediate results compare favorably with survivorship and periacetabular bone reaction data observed with the best cementless acetabular implant designs. PMID:17960675

  18. 78 FR 37712 - Safety Zone; Chicago Match Cup Race; Lake Michigan; Chicago, IL

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-06-24

    ... SECURITY Coast Guard 33 CFR Part 165 Safety Zone; Chicago Match Cup Race; Lake Michigan; Chicago, IL AGENCY... safety zone on Lake Michigan near Chicago, Illinois for the 2013 AWMRT Chicago Match Cup Race. This zone... being enforced without permission of the Captain of the Port, Lake Michigan. DATES: This regulation...

  19. 77 FR 7025 - Safety Zones; America's Cup World Series, East Passage, Narragansett Bay, RI

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-02-10

    ... Federal Register (73 FR 3316). Public Meeting We do not now plan to hold a public meeting. But you may... SECURITY Coast Guard 33 CFR Part 165 RIN 1625-AA00 Safety Zones; America's Cup World Series, East Passage... Bay, Rhode Island, during the America's Cup World Series sailing vessel racing event. This safety...

  20. 77 FR 54815 - Safety Zone: America's Cup World Series Regattas, San Francisco Bay; San Francisco, CA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-09-06

    ... INFORMATION: Table of Acronyms ACRM America's Cup Race Management DHS Department of Homeland Security FR... public dockets in the January 17, 2008, issue of the Federal Register (73 FR 3316). 4. Public Meeting We... SECURITY Coast Guard 33 CFR Part 165 RIN 1625-AA00 Safety Zone: America's Cup World Series Regattas,...

  1. 77 FR 60897 - Safety Zone: America's Cup World Series Finish-Line, San Francisco, CA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-10-05

    ... INFORMATION: Table of Acronyms APA Administrative Procedure Act DHS Department of Homeland Security FR Federal... SECURITY Coast Guard 33 CFR Part 165 RIN 1625-AA00 Safety Zone: America's Cup World Series Finish-Line, San... support of the 2012 America's Cup World Series sailing events. This safety zone is established to...

  2. 77 FR 28253 - Safety Zone; America's Cup World Series, East Passage, Narragansett Bay, RI

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-05-14

    ... Series, East Passage, Narragansett Bay, RI'' in the Federal Register (77 FR 7025). We received one... SECURITY Coast Guard 33 CFR Part 165 RIN 1625-AA00 Safety Zone; America's Cup World Series, East Passage... the America's Cup World Series (ACWS) sailing vessel racing event. DATES: This rule is effective...

  3. 33 CFR 165.T11-0551 - Safety Zone; America's Cup Sailing Events.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... provisions of 33 CFR 165.23 apply to this safety zone. No person or vessel underway may enter or remain... Sailing Events. 165.T11-0551 Section 165.T11-0551 Navigation and Navigable Waters COAST GUARD, DEPARTMENT... § 165.T11-0551 Safety Zone; America's Cup Sailing Events. (a) Definitions—(1) America's Cup...

  4. A mechanical bottleneck explains the variation in cup growth during FcγR phagocytosis

    PubMed Central

    van Zon, Jeroen S; Tzircotis, George; Caron, Emmanuelle; Howard, Martin

    2009-01-01

    Phagocytosis is the process by which cells internalize particulate material, and is of central importance to immunity, homeostasis and development. Here, we study the internalization of immunoglobulin G-coated particles in cells transfected with Fcγ receptors (FcγRs) through the formation of an enveloping phagocytic cup. Using confocal microscopy, we precisely track the location of fluorescently tagged FcγRs during cup growth. Surprisingly, we found that phagocytic cups growing around identical spherical particles showed great variability even within a single cell and exhibited two eventual fates: a cup either stalled before forming a half-cup or it proceeded until the particle was fully enveloped. We explain these observations in terms of a mechanical bottleneck using a simple mathematical model of the overall process of cup growth. The model predicts that reducing F-actin concentration levels, and hence the deforming force, does not necessarily lead to stalled cups, a prediction we verify experimentally. Our analysis gives a coherent explanation for the importance of geometry in phagocytic uptake and provides a unifying framework for integrating the key processes, both biochemical and mechanical, occurring during cup growth. PMID:19690567

  5. Effect of cup inclination on predicted contact stress-induced volumetric wear in total hip replacement.

    PubMed

    Rijavec, B; Košak, R; Daniel, M; Kralj-Iglič, V; Dolinar, D

    2015-01-01

    In order to increase the lifetime of the total hip endoprosthesis, it is necessary to understand mechanisms leading to its failure. In this work, we address volumetric wear of the artificial cup, in particular the effect of its inclination with respect to the vertical. Volumetric wear was calculated by using mathematical models for resultant hip force, contact stress and penetration of the prosthesis head into the cup. Relevance of the dependence of volumetric wear on inclination of the cup (its abduction angle ϑA) was assessed by the results of 95 hips with implanted endoprosthesis. Geometrical parameters obtained from standard antero-posterior radiographs were taken as input data. Volumetric wear decreases with increasing cup abduction angle ϑA. The correlation within the population of 95 hips was statistically significant (P = 0.006). Large cup abduction angle minimises predicted volumetric wear but may increase the risk for dislocation of the artificial head from the cup in the one-legged stance. Cup abduction angle and direction of the resultant hip force may compensate each other to achieve optimal position of the cup with respect to wear and dislocation in the one-legged stance for a particular patient.

  6. 76 FR 39289 - Special Local Regulation; Detroit APBA Gold Cup, Detroit River, Detroit, MI

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-07-06

    ..., 2008, issue of the Federal Register (73 FR 3316). Public Meeting We do not now plan to hold a public... SECURITY Coast Guard 33 CFR Part 100 RIN 1625-AA08 Special Local Regulation; Detroit APBA Gold Cup, Detroit... waters immediately prior to, during, and immediately after the Detroit APBA Gold Cup boat race....

  7. 75 FR 39448 - Special Local Regulation; Detroit APBA Gold Cup, Detroit River, Detroit, MI

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-07-09

    ... Federal Register (75 FR 21191). We received zero comments on the proposed rule. No public meeting was... SECURITY Coast Guard 33 CFR Part 100 RIN 1625-AA08 Special Local Regulation; Detroit APBA Gold Cup, Detroit... Detroit River during the Detroit APBA Gold Cup. This special local regulation is necessary to...

  8. 75 FR 21191 - Special Local Regulation; Detroit APBA Gold Cup, Detroit River, Detroit, MI

    Federal Register 2010, 2011, 2012, 2013, 2014

    2010-04-23

    ..., 2008 issue of the Federal Register (73 FR 3316). Public Meeting We do not now plan to hold a public... SECURITY Coast Guard 33 CFR Part 100 RIN 1625-AA08 Special Local Regulation; Detroit APBA Gold Cup, Detroit... vessels from portions of the Detroit River during the Detroit APBA Gold Cup. This special local...

  9. Faraday cup with nanosecond response and adjustable impedance for fast electron beam characterization

    SciTech Connect

    Hu Jing; Rovey, Joshua L.

    2011-07-15

    A movable Faraday cup design with simple structure and adjustable impedance is described in this work. This Faraday cup has external adjustable shunt resistance for self-biased measurement setup and 50 {Omega} characteristic impedance to match with 50 {Omega} standard BNC coaxial cable and vacuum feedthroughs for nanosecond-level pulse signal measurements. Adjustable shunt resistance allows self-biased measurements to be quickly acquired to determine the electron energy distribution function. The performance of the Faraday cup is validated by tests of response time and amplitude of output signal. When compared with a reference source, the percent difference of the Faraday cup signal fall time is less than 10% for fall times greater than 10 ns. The percent difference of the Faraday cup signal pulse width is below 6.7% for pulse widths greater than 10 ns. A pseudospark-generated electron beam is used to compare the amplitude of the Faraday cup signal with a calibrated F-70 commercial current transformer. The error of the Faraday cup output amplitude is below 10% for the 4-14 kV tested pseudospark voltages. The main benefit of this Faraday cup is demonstrated by adjusting the external shunt resistance and performing the self-biased method for obtaining the electron energy distribution function. Results from a 4 kV pseudospark discharge indicate a ''double-humped'' energy distribution.

  10. Acquisition of cup drinking using previously refused foods as positive and negative reinforcement.

    PubMed

    Kelley, Michael E; Piazza, Cathleen C; Fisher, Wayne W; Oberdorff, Amanda J

    2003-01-01

    We used previously refused foods as positive and negative reinforcement in the acquisition of cup drinking. Cup drinking increased with positive and negative reinforcement, both alone and in combination (without escape extinction), indicating that treatment of food refusal can establish some foods as appetitive stimuli whereas others remain aversive.

  11. 77 FR 22706 - Special Local Regulation and Safety Zone; America's Cup Sailing Events, San Francisco, CA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-04-17

    ... the ``America's Cup World Series,'' the ``Louis Vuitton Cup'' challenger selection series, and the... notice regarding our public dockets in the January 17, 2008, issue of the Federal Register (73 FR 3316... public input, we proposed a special local regulation and safety zone on January 30, 2012 (77 FR 4501)....

  12. 78 FR 40396 - Safety Zone; America's Cup Safety Zone and No Loitering Area, San Francisco, CA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-07-05

    ... activities associated with the ``America's Cup World Series'' regattas in 2012 and the ``Louis Vuitton Cup... Department of Homeland Security FR Federal Register A. Regulatory History and Information On January 30, 2012..., and September, 2013 (77 FR 04501). After reviewing all comments received in response to the NPRM,...

  13. Athletic Departments' Operating Expenses as a Predictor of Their Directors' Cup Standing

    ERIC Educational Resources Information Center

    Magner, Amber

    2014-01-01

    The NACDA Directors' Cup is a competition utilizing an unbiased scoring system that encourages a broad based athletic department as the standard for defining intercollegiate athletic success. Therefore, for NCAA DI athletic administrators the Directors' Cup should be the standard for defining intercollegiate athletic success. The purpose of this…

  14. Myocardial edema in Takotsubo syndrome mimicking apical hypertrophic cardiomyopathy: An insight into diagnosis by cardiovascular magnetic resonance.

    PubMed

    Izgi, Cemil; Ray, Sanjoy; Nyktari, Evangelia; Alpendurada, Francisco; Lyon, Alexander R; Rathore, Sudhir; Baksi, Arun John

    2015-01-01

    Myocardial edema is one of the characteristic features in the pathogenesis of Takotsubo syndrome. We report a middle aged man who presented with typical clinical and echocardiographic features of apical variant of Takotsubo syndrome. However, a cardiovascular magnetic resonance study performed 10 days after presentation did not show any apical 'ballooning' but revealed features of an apical hypertrophic cardiomyopathy on cine images. Tissue characterization with T2 weighted images proved severe edema as the cause of significantly increased apical wall thickness. A follow-up cardiovascular magnetic resonance study was performed 5 months later which showed that edema, wall thickening and the appearance of apical hypertrophic cardiomyopathy all resolved, confirming Takotsubo syndrome as the cause of the initial appearance. As the affected myocardium most commonly involves the apical segments, an edema induced increase in apical wall thickness may lead to appearances of an apical hypertrophic cardiomyopathy rather than apical ballooning in the acute to subacute phase of Takotsubo syndrome.

  15. Bigger size and defatting of bone chips will increase cup stability.

    PubMed

    Ullmark, G

    2000-01-01

    Morcellised bone allograft in an in vitro model was used to test the tendency towards cup rotation using small or larger fragment sizes of an impacted graft bed and different fat contents. A cup cemented on an impacted graft bed of larger sized bone chips from the Howex bone mill containing natural marrow fat was loaded eccentrically until the cup rotated. This required 3450 N. The same chips impacted in the same way, but defatted with warm saline solution required 7000 N for rotation. The smaller sized bone chips from the Tracer bone mill defatted in a similar manner required only 1950 N for cup rotation. The conclusion was that larger sized chips, partly defatted, prevent rotation of a cup cemented on a graft bed.

  16. Receptor-mediated transcytosis of IgA in MDCK cells is via apical recycling endosomes

    PubMed Central

    1994-01-01

    Classically, the polymeric immunoglobulin receptor and its ligand, IgA, are thought to be sorted from basolateral early endosomes into transcytotic vesicles that directly fuse with the apical plasma membrane. In contrast, we have found that in MDCK cells IgA is delivered from basolateral endosomes to apical endosomes and only then to the apical cell surface. When internalized from the basolateral surface of MDCK cells IgA is found to accumulate under the apical plasma membrane in a compartment that is accessible to two apically added membrane markers: anti-secretory component Fab fragments, and avidin internalized from the biotinylated apical pole of the cell. This accumulation occurs in the presence of apical trypsin, which prevents internalization of the ligand from the apical cell surface. Using a modification of the diaminobenzidine density-shift assay, we estimate that approximately 80% of basolaterally internalized IgA resides in the apical endosomal compartment. In addition, approximately 50% of basolaterally internalized transferrin, a basolateral recycling protein, has access to this apical endosomal compartment and is efficiently recycled back to the basolateral surface. Microtubules are required for the organization of the apical endosomal compartment and it is dispersed in nocodazole-treated cells. Moreover, this compartment is largely inaccessible to fluid-phase markers added to either pole of the cell, and therefore seems analogous to the recycling endosome described in nonpolarized cells. We propose a model in which transcytosis is not a specialized pathway that uses unique transcytotic vesicles, but rather combines portions of pathways used by non- transcytosing molecules. PMID:8138576

  17. Germline genetics of cancer of unknown primary (CUP) and its specific subtypes.

    PubMed

    Hemminki, Kari; Chen, Bowang; Kumar, Abhishek; Melander, Olle; Manjer, Jonas; Hallmans, Göran; Pettersson-Kymmer, Ulrika; Ohlsson, Claes; Folprecht, Gunnar; Löffler, Harald; Krämer, Alwin; Försti, Asta

    2016-04-19

    Cancer of unknown primary site (CUP) is a fatal cancer diagnosed through metastases at various organs. Little is known about germline genetics of CUP which appears worth of a search in view of reported familial associations in CUP. In the present study, samples from CUP patients were identified from 2 Swedish biobanks and a German clinical trial, totaling 578 CUP patients and 7628 regionally matched controls. Diagnostic data specified the organ where metastases were diagnosed. We carried out a genome-wide association study on CUP cases and controls. In the whole sample set, 6 loci reached an allelic p-value in the range of 10-7 and were supported by data from the three centers. Three associations were located next to non-coding RNA genes. rs2660852 flanked 5'UTR of LTA4H (leukotriene A4 hydrolase), rs477145 was intronic to TIAM1 (T-cell lymphoma invasion and metastases) and rs2835931 was intronic to KCNJ6 (potassium channel, inwardly rectifying subfamily J, member 6). In analysis of subgroups of CUP patients (smokers, non-smokers and CUP with liver metastases) genome-wide significant associations were noted. For patients with liver metastases associations on chromosome 6 and 11, the latter including a cluster of genes DHCR7 and NADSYN1, encoding key enzymes in cholesterol and NAD synthesis, and KRTAP5-7, encoding a keratin associated protein. This first GWAS on CUP provide preliminary evidence that germline genes relating to inflammation (LTA4H), metastatic promotion (TIAM1) in association with lipid metabolic disturbance (chromosome 11 cluster) may contribute to the risk of CUP.

  18. Germline genetics of cancer of unknown primary (CUP) and its specific subtypes

    PubMed Central

    Hemminki, Kari; Chen, Bowang; Kumar, Abhishek; Melander, Olle; Manjer, Jonas; Hallmans, Göran; Pettersson-Kymmer, Ulrika; Ohlsson, Claes; Folprecht, Gunnar; Löffler, Harald; Krämer, Alwin; Försti, Asta

    2016-01-01

    Cancer of unknown primary site (CUP) is a fatal cancer diagnosed through metastases at various organs. Little is known about germline genetics of CUP which appears worth of a search in view of reported familial associations in CUP. In the present study, samples from CUP patients were identified from 2 Swedish biobanks and a German clinical trial, totaling 578 CUP patients and 7628 regionally matched controls. Diagnostic data specified the organ where metastases were diagnosed. We carried out a genome-wide association study on CUP cases and controls. In the whole sample set, 6 loci reached an allelic p-value in the range of 10−7 and were supported by data from the three centers. Three associations were located next to non-coding RNA genes. rs2660852 flanked 5′UTR of LTA4H (leukotriene A4 hydrolase), rs477145 was intronic to TIAM1 (T-cell lymphoma invasion and metastases) and rs2835931 was intronic to KCNJ6 (potassium channel, inwardly rectifying subfamily J, member 6). In analysis of subgroups of CUP patients (smokers, non-smokers and CUP with liver metastases) genome-wide significant associations were noted. For patients with liver metastases associations on chromosome 6 and 11, the latter including a cluster of genes DHCR7 and NADSYN1, encoding key enzymes in cholesterol and NAD synthesis, and KRTAP5-7, encoding a keratin associated protein. This first GWAS on CUP provide preliminary evidence that germline genes relating to inflammation (LTA4H), metastatic promotion (TIAM1) in association with lipid metabolic disturbance (chromosome 11 cluster) may contribute to the risk of CUP. PMID:26959888

  19. Congenital left ventricular apical aneurysm presenting as ventricular tachycardia.

    PubMed

    Amado, José; Marques, Nuno; Candeias, Rui; Gago, Paula; de Jesus, Ilídio

    2016-10-01

    The authors present the case of a 34-year-old male patient seen in our department due to palpitations. On the electrocardiogram monomorphic ventricular tachycardia (VT) was documented, treated successfully with amiodarone. The subsequent study revealed a normal echocardiogram and an apical aneurysm of the left ventricle on magnetic resonance imaging, confirmed by computed tomography coronary angiography that also excluded coronary disease. He underwent an electrophysiological study to determine the origin of the VT and to perform catheter ablation using electroanatomical mapping. VT was induced and radiofrequency applications were performed in the left ventricular aneurysm area. VT was no longer inducible, with acute success. Despite this it was decided to implant a subcutaneous implantable cardioverter-defibrillator (ICD). Eight months after the ablation the patient was admitted again due to VT, treated by the ICD.

  20. Emergence of an Apical Epithelial Cell Surface In Vivo.

    PubMed

    Sedzinski, Jakub; Hannezo, Edouard; Tu, Fan; Biro, Maté; Wallingford, John B

    2016-01-11

    Epithelial sheets are crucial components of all metazoan animals, enclosing organs and protecting the animal from its environment. Epithelial homeostasis poses unique challenges, as addition of new cells and loss of old cells must be achieved without disrupting the fluid-tight barrier and apicobasal polarity of the epithelium. Several studies have identified cell biological mechanisms underlying extrusion of cells from epithelia, but far less is known of the converse mechanism by which new cells are added. Here, we combine molecular, pharmacological, and laser-dissection experiments with theoretical modeling to characterize forces driving emergence of an apical surface as single nascent cells are added to a vertebrate epithelium in vivo. We find that this process involves the interplay between cell-autonomous actin-generated pushing forces in the emerging cell and mechanical properties of neighboring cells. Our findings define the forces driving this cell behavior, contributing to a more comprehensive understanding of epithelial homeostasis.

  1. Cryopreservation of Galanthus elwesii Hook. apical meristems by droplet vitrification.

    PubMed

    Maslanka, M; Panis, B; Bach, A

    2013-01-01

    The aim of this study was to develop an efficient cryopreservation protocol for the geophyte giant snowdrop (Galanthus elwesii Hook.) that guarantees a high rate of survival and plant regeneration after cryopreservation. The excised apical meristems were obtained from cultures of in vitro grown bulb scales. Using a vitrification procedure and optimizing the duration of the exposure to the loading solution (LS), meristem post-rewarm survival rates higher than 90 percent were achieved. Also regrowth percentages were very high, ranging from 87 to 91 percent. After optimizing the time of exposure to the plant vitrification solution (PVS2), the survival rate was between 83 and 97 percent. During post-rewarm regeneration, good growth recovery was as high as 76 percent; however, hyperhydration and callusing were also observed. The results demonstrate that cryopreservation of Galanthus elwesii germplasm seems to be feasible.

  2. Oscillation frequencies of plant stems with apical loads.

    PubMed

    Spatz, H C; Zebrowski, J

    2001-12-01

    The frequency of free oscillations of plant stems with apical loads, as found in some cereals, is different depending on whether the stems are oriented vertically or horizontally. Neglecting the stem's own weight the differential equations describing the oscillation can be solved for both cases, although in the vertical orientation only for a limited set of conditions including constant bending stiffness along the stem. Comparison with experimental data shows that the difference between the oscillation frequencies in vertical and horizontal orientations can be attributed to the fact that in the vertical orientation the top load due to gravity induces a bending moment varying with the oscillation, while in the horizontal case this bending moment is nearly constant.

  3. Growth and development of the root apical meristem.

    PubMed

    Perilli, Serena; Di Mambro, Riccardo; Sabatini, Sabrina

    2012-02-01

    A key question in plant developmental biology is how cell division and cell differentiation are balanced to modulate organ growth and shape organ size. In recent years, several advances have been made in understanding how this balance is achieved during root development. In the Arabidopsis root meristem, stem cells in the apical region of the meristem self-renew and produce daughter cells that differentiate in the distal meristem transition zone. Several factors have been implicated in controlling the different functional zones of the root meristem to modulate root growth; among these, plant hormones have been shown to play a main role. In this review, we summarize recent findings regarding the role of hormone signaling and transcriptional networks in regulating root development.

  4. Case of cheilitis granulomatosa associated with apical periodontitis.

    PubMed

    Kawakami, Tomoko; Fukai, Kazuyoshi; Sowa, Junko; Ishii, Masamitsu; Teramae, Hiroyuki; Kanazawa, Koutetsu

    2008-02-01

    The etiology of cheilitis granulomatosa is unknown. In some cases, rapid improvement and/or complete elimination of swelling of the lips after dental treatment has been reported. Here, we describe another case of improvement following dental treatment. A 57-year-old woman had developed asymptomatic swelling of the lower lip 2 months previously. Histological examination revealed non-caseous giant cell granulomas. Neither facial nerve palsy nor fissuring of the tongue was present. Patch testing for metal allergy revealed only mild irritation to zinc ion. Although topical corticosteroid ointment and oral tranilast for 4 months were ineffective, rapid and remarkable improvement of the swelling was noted soon after treatment of two lesions of apical periodontitis. Thorough examination for foci of infection is necessary when treating a patient with cheilitis granulomatosa. PMID:18271809

  5. Oral microbiota species in acute apical endodontic abscesses

    PubMed Central

    George, Noelle; Flamiatos, Erin; Kawasaki, Kellie; Kim, Namgu; Carriere, Charles; Phan, Brian; Joseph, Raphael; Strauss, Shay; Kohli, Richie; Choi, Dongseok; Craig Baumgartner, J.; Sedgley, Christine; Maier, Tom; Machida, Curtis A.

    2016-01-01

    Background and objectives Acute apical abscesses are serious endodontic diseases resulting from pulpal infection with opportunistic oral microorganisms. The objective of this study was to identify and compare the oral microbiota in patients (N=18) exhibiting acute apical abscesses, originating from the demographic region in Portland, Oregon. The study hypothesis is that abscesses obtained from this demographic region may contain unique microorganisms not identified in specimens from other regions. Design Endodontic abscesses were sampled from patients at the Oregon Health & Science University (OHSU) School of Dentistry. DNA from abscess specimens was subjected to polymerase chain reaction amplification using 16S rRNA gene-specific primers and Cy3-dCTP labeling. Labeled DNA was then applied to microbial microarrays (280 species) generated by the Human Oral Microbial Identification Microarray Laboratory (Forsyth Institute, Cambridge, MA). Results The most prevalent microorganisms, found across multiple abscess specimens, include Fusobacterium nucleatum, Parvimonas micra, Megasphaera species clone CS025, Prevotella multisaccharivorax, Atopobium rimae, and Porphyromonas endodontalis. The most abundant microorganisms, found in highest numbers within individual abscesses, include F. nucleatum, P. micra, Streptococcus Cluster III, Solobacterium moorei, Streptococcus constellatus, and Porphyromonas endodontalis. Strong bacterial associations were identified between Prevotella multisaccharivorax, Acidaminococcaceae species clone DM071, Megasphaera species clone CS025, Actinomyces species clone EP053, and Streptococcus cristatus (all with Spearman coefficients >0.9). Conclusions Cultivable and uncultivable bacterial species have been identified in endodontic abscesses obtained from the Portland, Oregon demographic region, and taxa identifications correlated well with other published studies, with the exception of Treponema and Streptococcus cristae, which were not commonly

  6. Dlg5 maintains apical polarity by promoting membrane localization of Crumbs during Drosophila oogenesis

    PubMed Central

    Luo, Jun; Wang, Heng; Kang, Di; Guo, Xuan; Wan, Ping; Wang, Dou; Chen, Jiong

    2016-01-01

    Apical-basal polarity plays critical roles in the functions of epithelial tissues. However, the mechanisms of epithelial polarity establishment and maintenance remain to be fully elucidated. Here we show that the membrane-associated guanylate kinase (MAGUK) family protein Dlg5 is required for the maintenance of apical polarity of follicle epithelium during Drosophila oogenesis. Dlg5 localizes at the apical membrane and adherens junction (AJ) of follicle epithelium in early stage egg chambers. Specifically, we demonstrate that the major function of Dlg5 is to promote apical membrane localization of Crumbs, since overexpression of Crumbs but not other major apical or AJ components could rescue epithelial polarity defects resulted from loss of Dlg5. Furthermore, we performed a structure-function analysis of Dlg5 and found that the C-terminal PDZ3 and PDZ4 domains are required for all Dlg5’s functions as well as its ability to localize to apical membrane. The N-terminal coiled-coil motif could be individually targeted to the apical membrane, while the central linker region could be targeted to AJ. Lastly, the MAGUK core domains of PDZ4-SH3-GUK could be individually targeted to apical, AJ and basolateral membranes. PMID:27211898

  7. Lulu Regulates Shroom-Induced Apical Constriction during Neural Tube Closure

    PubMed Central

    Chu, Chih-Wen; Gerstenzang, Emma; Ossipova, Olga; Sokol, Sergei Y.

    2013-01-01

    Apical constriction is an essential cell behavior during neural tube closure, but its underlying mechanisms are not fully understood. Lulu, or EPB4.1l5, is a FERM domain protein that has been implicated in apical constriction and actomyosin contractility in mouse embryos and cultured cells. Interference with the function of Lulu in Xenopus embryos by a specific antisense morpholino oligonucleotide or a carboxy-terminal fragment of Lulu impaired apical constriction during neural plate hinge formation. This effect was likely due to lack of actomyosin contractility in superficial neuroectodermal cells. By contrast, overexpression of Lulu RNA in embryonic ectoderm cells triggered ectopic apico-basal elongation and apical constriction, accompanied by the apical recruitment of F-actin. Depletion of endogenous Lulu disrupted the localization and activity of Shroom3, a PDZ-containing actin-binding protein that has also been implicated in apical constriction. Furthermore, Lulu and Shroom3 RNAs cooperated in triggering ectopic apical constriction in embryonic ectoderm. Our findings reveal that Lulu is essential for Shroom3-dependent apical constriction during vertebrate neural tube closure. PMID:24282618

  8. Arabidopsis FIM5 decorates apical actin filaments and regulates their organization in the pollen tube

    PubMed Central

    Zhang, Meng; Zhang, Ruihui; Qu, Xiaolu; Huang, Shanjin

    2016-01-01

    The actin cytoskeleton is increasingly recognized as a major regulator of pollen tube growth. Actin filaments have distinct distribution patterns and dynamic properties within different regions of the pollen tube. Apical actin filaments are highly dynamic and crucial for pollen tube growth. However, how apical actin filaments are generated and properly constructed remains an open question. Here we showed that Arabidopsis fimbrin5 (FIM5) decorates filamentous structures throughout the entire tube but is apically concentrated. Apical actin structures are disorganized to different degrees in the pollen tubes of fim5 loss-of-function mutants. Further observations suggest that apical actin structures are not constructed properly because apical actin filaments cannot be maintained at the cortex of fim5 pollen tubes. Actin filaments appeared to be more curved in fim5 pollen tubes and this was confirmed by measurements showing that the convolutedness and the rate of change of convolutedness of actin filaments was significantly increased in fim5 pollen tubes. This suggests that the rigidity of the actin filaments may be compromised in fim5 pollen tubes. Further, the apical cell wall composition is altered, implying that tip-directed vesicle trafficking events are impaired in fim5 pollen tubes. Thus, we found that FIM5 decorates apical actin filaments and regulates their organization in order to drive polarized pollen tube growth. PMID:27117336

  9. The articulatory and acoustical characteristics of the ``apical vowels'' in Beijing Mandarin

    NASA Astrophysics Data System (ADS)

    Lee, Wai-Sum

    2005-09-01

    The study investigates the articulatory and acoustical characteristics of the two so-called ``apical vowels'' in Beijing Mandarin, which have been referred to as ``apical anterior vowel'' and ``apical posterior vowel'' by the linguists in China. The ``apical posterior vowel'' has also been described as a retroflex. The results of an EMA (electromagnetic articulograph) analysis show that both vowels are apical, with the tip of tongue approaching the alveolar region for the ``anterior vowel'' and the postalveolar region for the ``posterior vowel.'' The ``posterior vowel'' is pharyngealized, as the body of tongue in particular the posterodorsal portion is pulled backward toward the pharynx. Acoustical data obtained using the CSL4400 speech analysis software show that the two ``apical vowels'' have similar F1 value. The F2 value is slightly larger for the ``posterior vowel'' than ``anterior vowel.'' Thus, the correlation between a larger F2 and the advanced tongue position is not applicable to these ``apical vowels.'' The main difference between the two ``apical vowels'' is in F3, where the value is much smaller for the ``posterior vowel'' than ``anterior vowel.'' It is assumed that the smaller F3 value for the ``posterior vowel'' is due to pharyngealization.

  10. The eternal tooth germ is formed at the apical end of continuously growing teeth.

    PubMed

    Ohshima, Hayato; Nakasone, Naohiro; Hashimoto, Emi; Sakai, Hideo; Nakakura-Ohshima, Kuniko; Harada, Hidemitsu

    2005-02-01

    Rodent incisors are known to be continuously growing teeth that are maintained by both the cell-proliferation at the apical end and the attrition of the incisal edge. This type of tooth had a special epithelial structure for the maintenance of stem cells, showing the bulbous epithelial protrusion at the apical end. The morphological transition of the epithelial-mesenchymal compartment by serial transverse sections of the apical end toward the incisal direction is likely to reflect the development of the tooth germ in the prenatal stage. Based on the present histological and previous molecular biological studies, the special structure at the apical end is obviously different from the cervical loop giving rise to Hertwig's epithelial root sheath (HERS), in human, mouse and rat molar tooth germs. Hence, we propose a new concept that the eternal tooth bud producing various dental progeny is formed at the apical end of continuously growing teeth, and a new term "apical bud" for indicating this specialized epithelial structure. Furthermore, BrdU labelling analysis suggested that the guinea-pig molars, which were continuously growing teeth, also possessed plural specific proliferative regions and "apical bud" at the apical end. PMID:15721143

  11. Domestic science: making chemistry your cup of tea.

    PubMed

    Keene, Melanie

    2008-03-01

    In the early Victorian home, there were plenty of scientific lessons to be uncovered. With the appropriate interrogation, everyday objects could transform seemingly mundane activities such as eating breakfast, washing clothes or reading by candle-light into household lectures that gave children a familiar base from which to explore the hidden properties and marvellous histories of common commodities. Responding to an unprecedented hunger for scientific knowledge, a profusion of introductory texts appeared in the mid-nineteenth century that directed lessons into homes across Britain and beyond. In particular, the science of chemistry found its way into this domestic setting, as writers promoted its practice and practitioners as a source of authoritative expertise on everyday life. One of the most compelling illustrations of this encounter between the public and chemistry took place over a simple cup of tea.

  12. Cup waveguide antenna with integrated polarizer and OMT

    NASA Technical Reports Server (NTRS)

    Acosta, Roberto J. (Inventor); Kory, Carol (Inventor); Lambert, Kevin M. (Inventor)

    2011-01-01

    A cup waveguide antenna with integrated polarizer and OMT for simultaneously communicating left and right hand circularly polarized electromagnetic waves is adjustable to obtain efficient propagation and reception of electromagnetic waves. The antenna includes a circular waveguide having an orthomode transducer utilizing first and second pins longitudinally spaced apart and oriented orthogonally with respect to each other. Six radially-oriented adjustable polarizer screws extend from the exterior to the interior of the waveguide. A septum intermediate the first and second pins is aligned with the first pin. Adjustment of the polarizer screws enables maximized propagation of and/or response to left hand circularly polarized electromagnetic waves by the first pin while simultaneously enabling maximized propagation of and/or response to right hand circularly polarized electromagnetic waves by the second pin.

  13. Fire Suppression in Low Gravity Using a Cup Burner

    NASA Technical Reports Server (NTRS)

    Takahashi, Fumiaki; Linteris, Gregory T.; Katta, Viswanath R.

    2004-01-01

    Longer duration missions to the moon, to Mars, and on the International Space Station increase the likelihood of accidental fires. The goal of the present investigation is to: (1) understand the physical and chemical processes of fire suppression in various gravity and O2 levels simulating spacecraft, Mars, and moon missions; (2) provide rigorous testing of numerical models, which include detailed combustion suppression chemistry and radiation sub-models; and (3) provide basic research results useful for advances in space fire safety technology, including new fire-extinguishing agents and approaches. The structure and extinguishment of enclosed, laminar, methane-air co-flow diffusion flames formed on a cup burner have been studied experimentally and numerically using various fire-extinguishing agents (CO2, N2, He, Ar, CF3H, and Fe(CO)5). The experiments involve both 1g laboratory testing and low-g testing (in drop towers and the KC-135 aircraft). The computation uses a direct numerical simulation with detailed chemistry and radiative heat-loss models. An agent was introduced into a low-speed coflowing oxidizing stream until extinguishment occurred under a fixed minimal fuel velocity, and thus, the extinguishing agent concentrations were determined. The extinguishment of cup-burner flames, which resemble real fires, occurred via a blowoff process (in which the flame base drifted downstream) rather than the global extinction phenomenon typical of counterflow diffusion flames. The computation revealed that the peak reactivity spot (the reaction kernel) formed in the flame base was responsible for attachment and blowoff of the trailing diffusion flame. Furthermore, the buoyancy-induced flame flickering in 1g and thermal and transport properties of the agents affected the flame extinguishment limits.

  14. VOCALS-CUpEx: the Chilean Upwelling Experiment

    NASA Astrophysics Data System (ADS)

    Garreaud, R. D.; Rutllant, J. A.; Muñoz, R. C.; Rahn, D. A.; Ramos, M.; Figueroa, D.

    2010-11-01

    The VAMOS Ocean-Cloud-Atmosphere-Land Study Regional Experiment (VOCALS-REx) was a major field experiment conducted in spring of 2008 off southern Peru and northern Chile, aimed at better understanding the coupled climate systems of the southeast Pacific. Because of logistical constrains, the coastal area around 30° S was not sampled during VOCALS-REx. This area not only marks the poleward edge of the subtropical stratocumulus cloud regime (thus acting as a source of transient disturbances) but is also one of the most active upwelling centers and source of surface ocean kinetic energy along the Chilean coast. To fill such an observational gap, a small, brief, but highly focused field experiment was conducted in late spring 2009 in the near-shore region around 30° S. The Chilean Upwelling Experiment (CUpEx) was endorsed by VOCALS as a regional component. CUpEx included long-term monitoring, an intensive two-week field campaign and off-shore research flights. Our goal was to obtain an atmospheric/oceanic dataset with enough temporal and spatial coverage to be able to document (a) the mean diurnal cycles of the lower-troposphere and upper-ocean in a region of complex topography and coastline geometry, and (b) the ocean-atmosphere response to the rapid changes in coastal winds from strong, upwelling-favorable southerly winds to relaxed southerlies or even downwelling-favorable northerlies. In this paper we describe the measurement platforms and sampling strategy, and provide an observational overview, highlighting some key mean and transient features.

  15. VOCALS-CUpEx: the Chilean Upwelling Experiment

    NASA Astrophysics Data System (ADS)

    Garreaud, R. D.; Rutllant, J. A.; Muñoz, R. C.; Rahn, D. A.; Ramos, M.; Figueroa, D.

    2011-03-01

    The VAMOS Ocean-Cloud-Atmosphere-Land Study Regional Experiment (VOCALS-REx) was a major field experiment conducted in spring of 2008 off southern Peru and northern Chile, aimed at better understanding the coupled climate systems of the southeast Pacific. Because of logistical constrains, the coastal area around 30° S was not sampled during VOCALS-REx. This area not only marks the poleward edge of the subtropical stratocumulus cloud regime (thus acting as a source of transient disturbances) but is also one of the most active upwelling centers and source of surface ocean kinetic energy along the Chilean coast. To fill such an observational gap, a small, brief, but highly focused field experiment was conducted in late spring 2009 in the near-shore region around 30° S. The Chilean Upwelling Experiment (CUpEx) was endorsed by VOCALS as a regional component. CUpEx included long-term monitoring, an intensive two-week field campaign and off-shore research flights. Our goal was to obtain an atmospheric/oceanic dataset with enough temporal and spatial coverage to be able to document (a) the mean diurnal cycles of the lower-troposphere and upper-ocean in a region of complex topography and coastline geometry, and (b) the ocean-atmosphere response to the rapid changes in coastal winds from strong, upwelling-favorable equatorward flow (southerly winds) to downwelling-favorable poleward flow (northerly winds). In this paper we describe the measurement platforms and sampling strategy, and provide an observational overview, highlighting some key mean-state and transient features.

  16. Fire Suppression in Low Gravity Using a Cup Burner

    NASA Technical Reports Server (NTRS)

    Takahashi, Fumiaki; Linteris, Gregory T.; Katta, Viswanath R.

    2004-01-01

    Longer duration missions to the moon, to Mars, and on the International Space Station increase the likelihood of accidental fires. The goal of the present investigation is to: (1) understand the physical and chemical processes of fire suppression in various gravity and O2 levels simulating spacecraft, Mars, and moon missions; (2) provide rigorous testing of numerical models, which include detailed combustion-suppression chemistry and radiation sub-models; and (3) provide basic research results useful for advances in space fire safety technology, including new fire-extinguishing agents and approaches.The structure and extinguishment of enclosed, laminar, methane-air co-flow diffusion flames formed on a cup burner have been studied experimentally and numerically using various fire-extinguishing agents (CO2, N2, He, Ar, CF3H, and Fe(CO)5). The experiments involve both 1g laboratory testing and low-g testing (in drop towers and the KC-135 aircraft). The computation uses a direct numerical simulation with detailed chemistry and radiative heat-loss models. An agent was introduced into a low-speed coflowing oxidizing stream until extinguishment occurred under a fixed minimal fuel velocity, and thus, the extinguishing agent concentrations were determined. The extinguishment of cup-burner flames, which resemble real fires, occurred via a blowoff process (in which the flame base drifted downstream) rather than the global extinction phenomenon typical of counterflow diffusion flames. The computation revealed that the peak reactivity spot (the reaction kernel) formed in the flame base was responsible for attachment and blowoff of the trailing diffusion flame. Furthermore, the buoyancy-induced flame flickering in 1g and thermal and transport properties of the agents affected the flame extinguishment limits.

  17. Glyphosate effects on the gene expression of the apical bud in soybean (Glycine max).

    PubMed

    Jiang, Ling-Xue; Jin, Long-Guo; Guo, Yong; Tao, Bo; Qiu, Li-Juan

    2013-08-01

    Glyphosate is a broad spectrum, non-selective herbicide which has been widely used for weed control. Much work has focused on elucidating the high accumulation of glyphosate in shoot apical bud (shoot apex). However, to date little is known about the molecular mechanisms of the sensitivity of shoot apical bud to glyphosate. Global gene expression profiling of the soybean apical bud response to glyphosate treatment was performed in this study. The results revealed that the glyphosate inhibited tryptophan biosynthesis of the shikimic acid pathway in the soybean apical bud, which was the target site of glyphosate. Glyphosate inhibited the expression of most of the target herbicide site genes. The promoter sequence analysis of key target genes revealed that light responsive elements were important regulators in glyphosate induction. These results will facilitate further studies of cloning genes and molecular mechanisms of glyphosate on soybean shoot apical bud.

  18. Apical Hypertrophic Cardiomyopathy: The Ace-of-Spades as the Disease Card

    PubMed Central

    Diaconu, Camelia C.; Dumitru, Nicoleta; Fruntelata, Ana G.; Lacau, Smarandita; Bartos, Daniela

    2015-01-01

    Apical cardiac hypertrophy (Yamaguchi syndrome) is a relatively rare form of hypertrophic cardiomyopathy. A 67-year-old woman presented with exertional angina and moderate dyspnea. Her electrocardiogram showed sinus rhythm, flattened T waves in the limb leads and a strain pattern in the V2-V6 leads. Echocardiographic examination showed that apical wall thickness of the left ventricle (LV) was 19 mm. Coronary angiography was normal, but left ventriculography revealed a spade-like shaped LV cavity, typical for apical cardiac hypertrophy. The diagnostic criteria for apical cardiac hypertrophy are: 1) asymmetric LV hypertrophy - predominantly at the apex of the ventricle; 2) LV wall thickness of 15 mm or more during diastole; and 3) apical to posterior wall thickness ratio of 1.5 or more determined by 2-dimensional echocardiography or cardiac magnetic resonance imaging. Although relatively rare, Yamaguchi syndrome must enter into the differential diagnosis of patients presenting with exertional angina pectoris. PMID:27122852

  19. Apical Ca2+-activated potassium channels in mouse parotid acinar cells.

    PubMed

    Almassy, Janos; Won, Jong Hak; Begenisich, Ted B; Yule, David I

    2012-02-01

    Ca(2+) activation of Cl and K channels is a key event underlying stimulated fluid secretion from parotid salivary glands. Cl channels are exclusively present on the apical plasma membrane (PM), whereas the localization of K channels has not been established. Mathematical models have suggested that localization of some K channels to the apical PM is optimum for fluid secretion. A combination of whole cell electrophysiology and temporally resolved digital imaging with local manipulation of intracellular [Ca(2+)] was used to investigate if Ca(2+)-activated K channels are present in the apical PM of parotid acinar cells. Initial experiments established Ca(2+)-buffering conditions that produced brief, localized increases in [Ca(2+)] after focal laser photolysis of caged Ca(2+). Conditions were used to isolate K(+) and Cl(-) conductances. Photolysis at the apical PM resulted in a robust increase in K(+) and Cl(-) currents. A localized reduction in [Ca(2+)] at the apical PM after photolysis of Diazo-2, a caged Ca(2+) chelator, resulted in a decrease in both K(+) and Cl(-) currents. The K(+) currents evoked by apical photolysis were partially blocked by both paxilline and TRAM-34, specific blockers of large-conductance "maxi-K" (BK) and intermediate K (IK), respectively, and almost abolished by incubation with both antagonists. Apical TRAM-34-sensitive K(+) currents were also observed in BK-null parotid acini. In contrast, when the [Ca(2+)] was increased at the basal or lateral PM, no increase in either K(+) or Cl(-) currents was evoked. These data provide strong evidence that K and Cl channels are similarly distributed in the apical PM. Furthermore, both IK and BK channels are present in this domain, and the density of these channels appears higher in the apical versus basolateral PM. Collectively, this study provides support for a model in which fluid secretion is optimized after expression of K channels specifically in the apical PM.

  20. Evaluation of the NexScreen and DrugCheck Waive RT urine drug detection cups.

    PubMed

    Lin, Chia-Ni; Nelson, Gordon J; McMillin, Gwendolyn A

    2013-01-01

    Urine drug testing is an important tool that is commonly used to assess patient compliance with prescription regimens. Point-of-collection immunoassay devices allow for timely availability of laboratory test results to guide therapy during the same office visit. Two waived immunoassay-based urine drug screen cups were evaluated in this study. The NexScreen cup and the DrugCheck Waive RT cup claim to detect 10-12 drug classes of commonly used and/or abused drugs. This study included a sensitivity and precision challenge with 4-6 replicates at concentrations 0-150% of the manufacture's claimed cutoff, using drug-free urine spiked with purified reference standards. The stability of test results was evaluated by reading the results at intervals between five and 1,440 min. Specificity was evaluated by parallel comparison of pooled patients' specimens, representing 56 patients and 41 known drug compounds. When comparing results to validated liquid chromatography-mass spectrometry results, false positives were observed in the NexScreen cups for benzodiazepine, methamphetamine, methadone, opiates and tricyclic antidepressant tests, but there were no false negatives. The DrugCheck Waive RT cups showed false negative results for barbiturates and opiates, but no false positives. Overall, the NexScreen cup demonstrated better sensitivity than claimed, whereas the sensitivity of the DrugCheck Waive RT cup did not meet claims.

  1. Effects of Aluminum Addition on Tensile and Cup Forming Properties of Three Twinning Induced Plasticity Steels

    NASA Astrophysics Data System (ADS)

    Hong, Seokmin; Shin, Sang Yong; Kim, Hyoung Seop; Lee, Sunghak; Kim, Sung-Kyu; Chin, Kwang-Geun; Kim, Nack J.

    2012-06-01

    In the present study, a high Mn twinning induced plasticity (TWIP) steel and two Al-added TWIP steels were fabricated, and their microstructures, tensile properties, and cup formability were analyzed to investigate the effects of Al addition on deformation mechanisms in tensile and cup forming tests. In the high Mn steel, the twin formation was activated to increase the strain hardening rate and ultimate tensile strength, which needed the high punch load during the cup forming test. In the Al-added TWIP steels, the twin formation was reduced, while the slip activation increased, thereby leading to the decrease in strain hardening rate and ultimate tensile strength. As twins and slips were homogeneously formed during the tensile or cup forming test, the punch load required for the cup forming and residual stresses were relatively low, and the tensile ductility was sufficiently high even after the cup forming test. This indicated that making use of twins and slips simultaneously in TWIP steels by the Al addition was an effective way to improve overall properties including cup formability.

  2. [Acetabular Osteolysis in Total Hip Replacement - When to Retain the Cup?].

    PubMed

    Lutz, B; Faschingbauer, M; Bieger, R; Reichel, H; Kappe, T

    2016-08-01

    Periacetabular osteolysis is a frequent long-term complication of cementless total hip arthroplasty. The decision whether to retain or to revise a cup in the presence of osteolysis remains a challenge. The options are regular clinical and radiological check-ups, isolated liner exchange with and without bone grafting, and complete cup revision. Thorough preoperative diagnostics, including a medical history, examination and imaging, are mandatory for correct decision making. In most patients, computed tomography is useful to assess periacetabular osteolysis. If the cup is well-fixed and positioned in an asymptomatic patient without progressive osteolysis and no implant defect or higher grade polyethylene wear and no signs of infection, continuous clinical and radiological monitoring is preferred. If imaging reveals cup loosening, malposition, osteolysis localised in a weight-bearing area, imminent or present periprosthetic fractures, rapid progressive osteolysis, implant defects or massive inlay wear, surgical treatment may be preferred. Cup revision is usually performed in such patients. If the cup is well-positioned and well-fixed in the X-ray, the procedure has to be discussed with the patient individually. Apart from patient-specific risk factors, the risk of further progression has to be assessed. Isolated liner exchange can be performed if the patient is asymptomatic and the cup proves to be stable intraoperatively. It is still unclear whether filling osteolyses through screw holes or osseous windows is of long-term benefit. PMID:27249047

  3. CUP-1 Is a Novel Protein Involved in Dietary Cholesterol Uptake in Caenorhabditis elegans

    PubMed Central

    Valdes, Victor J.; Athie, Alejandro; Salinas, Laura S.; Navarro, Rosa E.; Vaca, Luis

    2012-01-01

    Sterols transport and distribution are essential processes in all multicellular organisms. Survival of the nematode Caenorhabditis elegans depends on dietary absorption of sterols present in the environment. However the general mechanisms associated to sterol uptake in nematodes are poorly understood. In the present work we provide evidence showing that a previously uncharacterized transmembrane protein, designated Cholesterol Uptake Protein-1 (CUP-1), is involved in dietary cholesterol uptake in C. elegans. Animals lacking CUP-1 showed hypersensitivity to cholesterol limitation and were unable to uptake cholesterol. A CUP-1-GFP fusion protein colocalized with cholesterol-rich vesicles, endosomes and lysosomes as well as the plasma membrane. Additionally, by FRET imaging, a direct interaction was found between the cholesterol analog DHE and the transmembrane “cholesterol recognition/interaction amino acid consensus” (CRAC) motif present in C. elegans CUP-1. In-silico analysis identified two mammalian homologues of CUP-1. Most interestingly, CRAC motifs are conserved in mammalian CUP-1 homologous. Our results suggest a role of CUP-1 in cholesterol uptake in C. elegans and open up the possibility for the existence of a new class of proteins involved in sterol absorption in mammals. PMID:22479487

  4. An energy minimization method for the correction of cupping artifacts in cone-beam CT.

    PubMed

    Xie, Shipeng; Zhuang, Wenqin; Li, Haibo

    2016-01-01

    The purpose of this study was to reduce cupping artifacts and improve quantitative accuracy of the images in cone-beam CT (CBCT). An energy minimization method (EMM) is proposed to reduce cupping artifacts in reconstructed image of the CBCT. The cupping artifacts are iteratively optimized by using efficient matrix computations, which are verified to be numerically stable by matrix analysis. Moreover, the energy in our formulation is convex in each of its variables, which brings the robustness of the proposed energy minimization algorithm. The cupping artifacts are estimated as a result of minimizing this energy. The results indicate that proposed algorithm is effective for reducing the cupping artifacts and preserving the quality of the reconstructed image. The proposed method focuses on the reconstructed image without requiring any additional physical equipment; it is easily implemented and provides cupping correction using a single scan acquisition. The experimental results demonstrate that this method can successfully reduce the magnitude of cupping artifacts. The correction algorithm reported here may improve the uniformity of the reconstructed images, thus assisting the development of perfect volume visualization and threshold-based visualization techniques for reconstructed images. PMID:27455478

  5. Prediction of specialty coffee cup quality based on near infrared spectra of green coffee beans.

    PubMed

    Tolessa, Kassaye; Rademaker, Michael; De Baets, Bernard; Boeckx, Pascal

    2016-04-01

    The growing global demand for specialty coffee increases the need for improved coffee quality assessment methods. Green bean coffee quality analysis is usually carried out by physical (e.g. black beans, immature beans) and cup quality (e.g. acidity, flavour) evaluation. However, these evaluation methods are subjective, costly, time consuming, require sample preparation and may end up in poor grading systems. This calls for the development of a rapid, low-cost, reliable and reproducible analytical method to evaluate coffee quality attributes and eventually chemical compounds of interest (e.g. chlorogenic acid) in coffee beans. The aim of this study was to develop a model able to predict coffee cup quality based on NIR spectra of green coffee beans. NIR spectra of 86 samples of green Arabica beans of varying quality were analysed. Partial least squares (PLS) regression method was used to develop a model correlating spectral data to cupping score data (cup quality). The selected PLS model had a good predictive power for total specialty cup quality and its individual quality attributes (overall cup preference, acidity, body and aftertaste) showing a high correlation coefficient with r-values of 90, 90,78, 72 and 72, respectively, between measured and predicted cupping scores for 20 out of 86 samples. The corresponding root mean square error of prediction (RMSEP) was 1.04, 0.22, 0.27, 0.24 and 0.27 for total specialty cup quality, overall cup preference, acidity, body and aftertaste, respectively. The results obtained suggest that NIR spectra of green coffee beans are a promising tool for fast and accurate prediction of coffee quality and for classifying green coffee beans into different specialty grades. However, the model should be further tested for coffee samples from different regions in Ethiopia and test if one generic or region-specific model should be developed.

  6. Prediction of specialty coffee cup quality based on near infrared spectra of green coffee beans.

    PubMed

    Tolessa, Kassaye; Rademaker, Michael; De Baets, Bernard; Boeckx, Pascal

    2016-04-01

    The growing global demand for specialty coffee increases the need for improved coffee quality assessment methods. Green bean coffee quality analysis is usually carried out by physical (e.g. black beans, immature beans) and cup quality (e.g. acidity, flavour) evaluation. However, these evaluation methods are subjective, costly, time consuming, require sample preparation and may end up in poor grading systems. This calls for the development of a rapid, low-cost, reliable and reproducible analytical method to evaluate coffee quality attributes and eventually chemical compounds of interest (e.g. chlorogenic acid) in coffee beans. The aim of this study was to develop a model able to predict coffee cup quality based on NIR spectra of green coffee beans. NIR spectra of 86 samples of green Arabica beans of varying quality were analysed. Partial least squares (PLS) regression method was used to develop a model correlating spectral data to cupping score data (cup quality). The selected PLS model had a good predictive power for total specialty cup quality and its individual quality attributes (overall cup preference, acidity, body and aftertaste) showing a high correlation coefficient with r-values of 90, 90,78, 72 and 72, respectively, between measured and predicted cupping scores for 20 out of 86 samples. The corresponding root mean square error of prediction (RMSEP) was 1.04, 0.22, 0.27, 0.24 and 0.27 for total specialty cup quality, overall cup preference, acidity, body and aftertaste, respectively. The results obtained suggest that NIR spectra of green coffee beans are a promising tool for fast and accurate prediction of coffee quality and for classifying green coffee beans into different specialty grades. However, the model should be further tested for coffee samples from different regions in Ethiopia and test if one generic or region-specific model should be developed. PMID:26838420

  7. Crew Assembly

    NASA Video Gallery

    Train to improve your dexterity and hand-eye coordination by assembling a puzzle.The Train Like an Astronaut project uses the excitement of exploration to challenge students to set goals, practice ...

  8. RoboCup 3D Soccer Simulation Server: A Progressing Testbed for AI Researchers

    NASA Astrophysics Data System (ADS)

    Darab, Mohammad Ali Darvish; Ebrahimi, Mosalam

    RoboCup 3D Soccer Simulation is a growing domain that makes a wide variety of AI and Multi-Agent researches possible. The RoboCup 3D Soccer Simulation Server is a Multi-Agent environment that supports 22 independent agents to play a soccer match within a real-time and complex environment. Many researchers from all over the world have been using this simulator to pursue their researches in a wide variety of areas such as multiagent learning, cooperative actions and multiagent planning. This paper illustrates the current organization of RoboCup 3D Soccer Simulation Server.

  9. Operational experience using the novel FixCup collecting main valve

    SciTech Connect

    Giertz, J.; Huhn, F.; Spitz, J.

    1996-12-31

    On the occasion of the 1995 AIME conference the new PROven (Pressure Regulated Oven) process to control the pressure in coke ovens individually was introduced. This process was made feasible with a new collecting main valve, termed FixCup, with the aid of this valve a variable flow resistance to the raw gas discharge can be realized using a water immersion system. However, just the application of the FixCup system alone--without any pressure regulation--is very advantageous and cost saving. Thyssen has equipped 30 ovens with the new valve. The special constructive features as well as the operational experience using the FixCup valve are treated.

  10. In vitro experiments with an injection technique for cup fixation in total hip arthroplasty.

    PubMed

    Somville, J M; Moldenaers, P F; Mulier, J C; Mewis, J J

    1987-01-01

    A new technique has been developed to position the cup rigidly into the acetabulum during total hip joint replacement. After positioning the flanged cup on the acetabulum by means of screws, a low-viscosity cement is injected through a hole in the rim of the cup. A comparison with the standard cementing technique was made on the basis of in vitro experiments. For this purpose a mold was constructed to produce castings simulating the human acetabulum. The distribution of the cement, the pressure developed in the acetabulum, and the penetration of the cement are compared for the two cementing techniques. PMID:3606358

  11. Seal assembly

    SciTech Connect

    Johnson, Roger Neal; Longfritz, William David

    2001-01-01

    A seal assembly that seals a gap formed by a groove comprises a seal body, a biasing element, and a connection that connects the seal body to the biasing element to form the seal assembly. The seal assembly further comprises a concave-shaped center section and convex-shaped contact portions at each end of the seal body. The biasing element is formed from an elastic material and comprises a convex-shaped center section and concave-shaped biasing zones that are opposed to the convex-shaped contact portions. The biasing element is adapted to be compressed to change a width of the seal assembly from a first width to a second width that is smaller than the first width. In the compressed state, the seal assembly can be disposed in the groove. After release of the compressing force, the seal assembly expands. The contact portions will move toward a surface of the groove and the biasing zones will move into contact with another surface of the groove. The biasing zones will bias the contact portions of the seal body against the surface of the groove.

  12. The use of regenerative techniques in apical surgery: A literature review

    PubMed Central

    von Arx, Thomas; AlSaeed, Mohammed

    2011-01-01

    Apical surgery has become a standard of care for tooth maintenance if conventional endodontic retreatment is not possible or associated with risks. However, in certain situations, the outcome of apical surgery may be compromised due to the extent or location of the periapical or periradicular lesions. The present review article including clinical and experimental studies reports and discusses the outcome of regenerative techniques (RT) in conjunction with apical surgery, with regard to the type of periradicular lesions: Apical lesions The majority of studies have shown no benefit for healing in test sites treated with RT compared to control sites treated without RT. The use of a radio-opaque bone filler/substitute may even compound the radiographic interpretation of periapical healing. Currently, the use of RT for lesions <10 mm limited to the apical area is not warranted. Through-and-through lesions All reviewed studies demonstrated a better outcome for test sites with RT compared to the control sites without RT; hence the use of RT for treatment of tunnel lesions in apical surgery is recommended. Apico-marginal lesions All clinical studies assessed cohorts without controls, and, therefore, no firm conclusion about the benefit of RT for treatment of apico-marginal lesions in conjunction with apical surgery can be drawn. However, the experimental animal studies have shown that healing of teeth with apico-marginal lesions appears to benefit from RT. PMID:24151420

  13. The fast-recycling receptor Megalin defines the apical recycling pathway of epithelial cells.

    PubMed

    Perez Bay, Andres E; Schreiner, Ryan; Benedicto, Ignacio; Paz Marzolo, Maria; Banfelder, Jason; Weinstein, Alan M; Rodriguez-Boulan, Enrique J

    2016-01-01

    The basolateral recycling and transcytotic pathways of epithelial cells were previously defined using markers such as transferrin (TfR) and polymeric IgA (pIgR) receptors. In contrast, our knowledge of the apical recycling pathway remains fragmentary. Here we utilize quantitative live-imaging and mathematical modelling to outline the recycling pathway of Megalin (LRP-2), an apical receptor with key developmental and renal functions, in MDCK cells. We show that, like TfR, Megalin is a long-lived and fast-recycling receptor. Megalin enters polarized MDCK cells through segregated apical sorting endosomes and subsequently intersects the TfR and pIgR pathways at a perinuclear Rab11-negative compartment termed common recycling endosomes (CRE). Whereas TfR recycles to the basolateral membrane from CRE, Megalin, like pIgR, traffics to subapical Rab11-positive apical recycling endosomes (ARE) and reaches the apical membrane in a microtubule- and Rab11-dependent manner. Hence, Megalin defines the apical recycling pathway of epithelia, with CRE as its apical sorting station.

  14. The fast-recycling receptor Megalin defines the apical recycling pathway of epithelial cells.

    PubMed

    Perez Bay, Andres E; Schreiner, Ryan; Benedicto, Ignacio; Paz Marzolo, Maria; Banfelder, Jason; Weinstein, Alan M; Rodriguez-Boulan, Enrique J

    2016-01-01

    The basolateral recycling and transcytotic pathways of epithelial cells were previously defined using markers such as transferrin (TfR) and polymeric IgA (pIgR) receptors. In contrast, our knowledge of the apical recycling pathway remains fragmentary. Here we utilize quantitative live-imaging and mathematical modelling to outline the recycling pathway of Megalin (LRP-2), an apical receptor with key developmental and renal functions, in MDCK cells. We show that, like TfR, Megalin is a long-lived and fast-recycling receptor. Megalin enters polarized MDCK cells through segregated apical sorting endosomes and subsequently intersects the TfR and pIgR pathways at a perinuclear Rab11-negative compartment termed common recycling endosomes (CRE). Whereas TfR recycles to the basolateral membrane from CRE, Megalin, like pIgR, traffics to subapical Rab11-positive apical recycling endosomes (ARE) and reaches the apical membrane in a microtubule- and Rab11-dependent manner. Hence, Megalin defines the apical recycling pathway of epithelia, with CRE as its apical sorting station. PMID:27180806

  15. Apical constriction initiates new bud formation during monopodial branching of the embryonic chicken lung.

    PubMed

    Kim, Hye Young; Varner, Victor D; Nelson, Celeste M

    2013-08-01

    Branching morphogenesis sculpts the airway epithelium of the lung into a tree-like structure to conduct air and promote gas exchange after birth. In the avian lung, a series of buds emerges from the dorsal surface of the primary bronchus via monopodial branching to form the conducting airways; anatomically, these buds are similar to those formed by domain branching in the mammalian lung. Here, we show that monopodial branching is initiated by apical constriction of the airway epithelium, and not by differential cell proliferation, using computational modeling and quantitative imaging of embryonic chicken lung explants. Both filamentous actin and phosphorylated myosin light chain were enriched at the apical surface of the airway epithelium during monopodial branching. Consistently, inhibiting actomyosin contractility prevented apical constriction and blocked branch initiation. Although cell proliferation was enhanced along the dorsal and ventral aspects of the primary bronchus, especially before branch formation, inhibiting proliferation had no effect on the initiation of branches. To test whether the physical forces from apical constriction alone are sufficient to drive the formation of new buds, we constructed a nonlinear, three-dimensional finite element model of the airway epithelium and used it to simulate apical constriction and proliferation in the primary bronchus. Our results suggest that, consistent with the experimental results, apical constriction is sufficient to drive the early stages of monopodial branching whereas cell proliferation is dispensable. We propose that initial folding of the airway epithelium is driven primarily by apical constriction during monopodial branching of the avian lung.

  16. The fast-recycling receptor Megalin defines the apical recycling pathway of epithelial cells

    PubMed Central

    Perez Bay, Andres E.; Schreiner, Ryan; Benedicto, Ignacio; Paz Marzolo, Maria; Banfelder, Jason; Weinstein, Alan M.; Rodriguez-Boulan, Enrique J.

    2016-01-01

    The basolateral recycling and transcytotic pathways of epithelial cells were previously defined using markers such as transferrin (TfR) and polymeric IgA (pIgR) receptors. In contrast, our knowledge of the apical recycling pathway remains fragmentary. Here we utilize quantitative live-imaging and mathematical modelling to outline the recycling pathway of Megalin (LRP-2), an apical receptor with key developmental and renal functions, in MDCK cells. We show that, like TfR, Megalin is a long-lived and fast-recycling receptor. Megalin enters polarized MDCK cells through segregated apical sorting endosomes and subsequently intersects the TfR and pIgR pathways at a perinuclear Rab11-negative compartment termed common recycling endosomes (CRE). Whereas TfR recycles to the basolateral membrane from CRE, Megalin, like pIgR, traffics to subapical Rab11-positive apical recycling endosomes (ARE) and reaches the apical membrane in a microtubule- and Rab11-dependent manner. Hence, Megalin defines the apical recycling pathway of epithelia, with CRE as its apical sorting station. PMID:27180806

  17. Annexin XIIIb Associates with Lipid Microdomains to Function in Apical Delivery

    PubMed Central

    Lafont, Frank; Lecat, Sandra; Verkade, Paul; Simons, Kai

    1998-01-01

    A member of the annexin XIII sub-family, annexin XIIIb, has been implicated in the apical exocytosis of epithelial kidney cells. Annexins are phospholipid-binding proteins that have been suggested to be involved in membrane trafficking events although their actual physiological function remains open. Unlike the other annexins, annexin XIIIs are myristoylated. Here, we show by immunoelectron microscopy that annexin XIIIb is localized to the trans-Golgi network (TGN), vesicular carriers and the apical cell surface. Polarized apical sorting involves clustering of apical proteins into dynamic sphingolipid-cholesterol rafts. We now provide evidence for the raft association of annexin XIIIb. Using in vitro assays and either myristoylated or unmyristoylated recombinant annexin XIIIb, we demonstrate that annexin XIIIb in its native myristoylated form stimulates specifically apical transport whereas the unmyristoylated form inhibits this route. Moreover, we show that formation of apical carriers from the TGN is inhibited by an anti-annexin XIIIb antibody whereas it is stimulated by myristoylated recombinant annexin XIIIb. These results suggest that annexin XIIIb directly participates in apical delivery. PMID:9744874

  18. Apical constriction initiates new bud formation during monopodial branching of the embryonic chicken lung

    PubMed Central

    Kim, Hye Young; Varner, Victor D.; Nelson, Celeste M.

    2013-01-01

    Branching morphogenesis sculpts the airway epithelium of the lung into a tree-like structure to conduct air and promote gas exchange after birth. In the avian lung, a series of buds emerges from the dorsal surface of the primary bronchus via monopodial branching to form the conducting airways; anatomically, these buds are similar to those formed by domain branching in the mammalian lung. Here, we show that monopodial branching is initiated by apical constriction of the airway epithelium, and not by differential cell proliferation, using computational modeling and quantitative imaging of embryonic chicken lung explants. Both filamentous actin and phosphorylated myosin light chain were enriched at the apical surface of the airway epithelium during monopodial branching. Consistently, inhibiting actomyosin contractility prevented apical constriction and blocked branch initiation. Although cell proliferation was enhanced along the dorsal and ventral aspects of the primary bronchus, especially before branch formation, inhibiting proliferation had no effect on the initiation of branches. To test whether the physical forces from apical constriction alone are sufficient to drive the formation of new buds, we constructed a nonlinear, three-dimensional finite element model of the airway epithelium and used it to simulate apical constriction and proliferation in the primary bronchus. Our results suggest that, consistent with the experimental results, apical constriction is sufficient to drive the early stages of monopodial branching whereas cell proliferation is dispensable. We propose that initial folding of the airway epithelium is driven primarily by apical constriction during monopodial branching of the avian lung. PMID:23824575

  19. Profilin Regulates Apical Actin Polymerization to Control Polarized Pollen Tube Growth.

    PubMed

    Liu, Xiaonan; Qu, Xiaolu; Jiang, Yuxiang; Chang, Ming; Zhang, Ruihui; Wu, Youjun; Fu, Ying; Huang, Shanjin

    2015-12-01

    Pollen tube growth is an essential step during flowering plant reproduction, whose growth depends on a population of dynamic apical actin filaments. Apical actin filaments were thought to be involved in the regulation of vesicle fusion and targeting in the pollen tube. However, the molecular mechanisms that regulate the construction of apical actin structures in the pollen tube remain largely unclear. Here, we identify profilin as an important player in the regulation of actin polymerization at the apical membrane in the pollen tube. Downregulation of profilin decreased the amount of filamentous actin and induced disorganization of apical actin filaments, and reduced tip-directed vesicle transport and accumulation in the pollen tube. Direct visualization of actin dynamics revealed that the elongation of actin filaments originating at the apical membrane decreased in profilin mutant pollen tubes. Mutant profilin that is defective in binding poly-L-proline only partially rescues the actin polymerization defect in profilin mutant pollen tubes, although it fully rescues the actin turnover phenotype. We propose that profilin controls the construction of actin structures at the pollen tube tip, presumably by favoring formin-mediated actin polymerization at the apical membrane.

  20. Emergence of an Apical Epithelial Cell Surface In Vivo.

    PubMed

    Sedzinski, Jakub; Hannezo, Edouard; Tu, Fan; Biro, Maté; Wallingford, John B

    2016-01-11

    Epithelial sheets are crucial components of all metazoan animals, enclosing organs and protecting the animal from its environment. Epithelial homeostasis poses unique challenges, as addition of new cells and loss of old cells must be achieved without disrupting the fluid-tight barrier and apicobasal polarity of the epithelium. Several studies have identified cell biological mechanisms underlying extrusion of cells from epithelia, but far less is known of the converse mechanism by which new cells are added. Here, we combine molecular, pharmacological, and laser-dissection experiments with theoretical modeling to characterize forces driving emergence of an apical surface as single nascent cells are added to a vertebrate epithelium in vivo. We find that this process involves the interplay between cell-autonomous actin-generated pushing forces in the emerging cell and mechanical properties of neighboring cells. Our findings define the forces driving this cell behavior, contributing to a more comprehensive understanding of epithelial homeostasis. PMID:26766441

  1. Sulfate transport in apical membrane vesicles isolated from tracheal epithelium

    SciTech Connect

    Elgavish, A.; DiBona, D.R.; Norton, P.; Meezan, E.

    1987-09-01

    Sulfate uptake in apical membrane vesicles isolated from bovine tracheal epithelium is shown to occur into an osmotically sensitive intravesicular space, via a carrier-mediated system. This conclusion is based on three lines of evidence: 1) saturation kinetics: 2) substrate specificity; and 3) inhibition by the anion transport inhibitors SITS and DIDS. The affinity of the transport system is highest in low ionic strength media and decreases in the presence of gluconate. Chloride appears to cis-inhibit sulfate uptake and to trans-stimulate sulfate efflux. Cis-inhibition and trans-stimulation studies with a variety of anions indicate that this exchange system may be shared by HCO/sub 3//sup -/, S/sub 2/O/sub 3//sup 2 -/, SeO/sub 4//sup 2 -/, and MoO/sub 4//sup 2 -/ but not by H/sub 2/PO/sub 4//sup -/ or HAsO/sub 4//sup 2/. Studies indicate that protons may play two distinct roles in sulfate transport in this system. These studies show that the carrier-mediated system can function in the absence of chloride. The overshoot observed in the presence of a proton gradient indicates that under those conditions the mechanism of transport may be a SO/sub 4//sup 2 -/-OH/sup -/ exchange.

  2. Structural development and energy dissipation in simulated silicon apices.

    PubMed

    Jarvis, Samuel Paul; Kantorovich, Lev; Moriarty, Philip

    2013-12-20

    In this paper we examine the stability of silicon tip apices by using density functional theory (DFT) calculations. We find that some tip structures - modelled as small, simple clusters - show variations in stability during manipulation dependent on their orientation with respect to the sample surface. Moreover, we observe that unstable structures can be revealed by a characteristic hysteretic behaviour present in the F(z) curves that were calculated with DFT, which corresponds to a tip-induced dissipation of hundreds of millielectronvolts resulting from reversible structural deformations. Additionally, in order to model the structural evolution of the tip apex within a low temperature NC-AFM experiment, we simulated a repeated tip-surface indentation until the tip structure converged to a stable termination and the characteristic hysteretic behaviour was no longer observed. Our calculations suggest that varying just a single rotational degree of freedom can have as measurable an impact on the tip-surface interaction as a completely different tip structure.

  3. Takotsubo syndrome (or apical ballooning syndrome) secondary to Zolmitriptan.

    PubMed

    Garg, Jalaj; Aronow, Wilbert S; Devabhaktuni, Srikala; Ahmad, Hasan

    2015-01-01

    Takotsubo syndrome (TS), also known as broken heart syndrome, is characterized by left ventricle apical ballooning with elevated cardiac biomarkers and electrocardiographic changes suggestive of an acute coronary syndrome (ie, ST-segment elevation, T wave inversions, and pathologic Q waves). We report a case of 54-year-old woman with medical history of mitral valve prolapse and migraines, who was admitted to the hospital for substernal chest pain and electrocardiogram demonstrated 1/2 mm ST-segment elevation in leads II, III, aVF, V5, and V6 and positive troponin I. Emergent coronary angiogram revealed normal coronary arteries with moderately reduced left ventricular ejection fraction with wall motion abnormalities consistent with TS. Detailed history obtained retrospectively revealed that the patient took zolmitriptan sparingly only when she had migraines. But before this event, she was taking zolmitriptan 2-3 times daily for several days because of a persistent migraine headache. She otherwise reported that she is quite active, rides horses, and does show jumping without any limitations in her physical activity. There was no evidence of any recent stress or status migrainosus. Extensive literature search revealed multiple cases of coronary artery vasospasm secondary to zolmitriptan, but none of the cases were associated with TS. PMID:24100257

  4. Pathological studies of cheek teeth apical infections in the horse: 5. Aetiopathological findings in 57 apically infected maxillary cheek teeth and histological and ultrastructural findings.

    PubMed

    Dacre, Ian; Kempson, S; Dixon, P M

    2008-12-01

    Examination of 57 apically infected maxillary cheek teeth (CT) showed one or more viable pulps and minimal apical calcified tissue changes present in recently infected CT. With chronic infections, pulps were necrotic or absent, pulp horns were filled with food if occlusal pulpar exposure was present, and gross caries of dentine was occasionally present. With chronic infections, the apical changes varied from gross destructive changes in some teeth, to extensive proliferative calcified apical changes in others. Infundibular caries was believed to cause apical infection in just 16% of infected (maxillary) CT, anachoretic infection in 51%, periodontal spread in 12%, fractures and fissures in 9%, dysplasia in 5% and miscellaneous or undiagnosed causes in 7%. Histology showed viable pulp and absence of circumpulpar dentinal changes in some recently infected CT, but chronically infected teeth had loss of predentine and progressive destruction of the circumpulpar secondary, and even primary dentine, with bacteria identified within the dentinal tubules surrounding infected pulps. Tertiary dentine deposition was rarely detected. Scanning and transmission electron microscopy confirmed these histological findings and showed extensive destructive changes, especially to the dentinal architecture surrounding the pulp chambers of some infected teeth. PMID:19022689

  5. Core-glycosylated mucin-like repeats from MUC1 are an apical targeting signal.

    PubMed

    Kinlough, Carol L; Poland, Paul A; Gendler, Sandra J; Mattila, Polly E; Mo, Di; Weisz, Ora A; Hughey, Rebecca P

    2011-11-11

    MUC1 is efficiently delivered to the apical surface of polarized Madin-Darby canine kidney (MDCK) cells by transit through apical recycling endosomes, a route associated with delivery of apical proteins with glycan-dependent targeting signals. However, a role for glycans in MUC1 sorting has not been established. A key feature of MUC1 is a heavily O-glycosylated mucin-like domain with a variable number of nearly perfect tandem repeats and adjacent imperfect repeats. Metabolic labeling, cell surface biotinylation, immobilized lectins, and confocal immunofluorescence microscopy were used to characterize the polarized delivery of MUC1 mutants and chimeras in MDCK cells to identify the apical targeting signal. Both the interleukin-2 receptor α subunit (Tac) and a chimera where the Tac ectodomain replaced that of MUC1 were delivered primarily to the basolateral surface. Attachment of the MUC1 mucin-like domain to the N terminus of Tac enhanced apical but not basolateral delivery when compared with Tac. Conversely, deletions within the mucin-like domain in MUC1 reduced apical but not basolateral delivery when compared with MUC1. In pull-down assays with lectins, we found a notable difference in the presence of core 1 O-glycans, but not poly-N-acetyllactosamine, in apically targeted MUC1 and chimeras when compared with Tac. Consistent with these data, we found no effect on MUC1 targeting when galectin-3, with preference for poly-N-acetyllactosamine, was depleted from polarized MDCK cells. However, we did block the apical targeting activity of the mucin-like repeats when we overexpressed CMP-Neu5Ac:GalNAc-Rα2,6-sialyltransferase-1 to block core O-glycan synthesis. The cumulative data indicate that the core-glycosylated mucin-like repeats of MUC1 constitute an apical targeting signal. PMID:21937430

  6. Molecular characterization of the apical organ of the anthozoan Nematostella vectensis

    PubMed Central

    Sinigaglia, Chiara; Busengdal, Henriette; Lerner, Avi; Oliveri, Paola; Rentzsch, Fabian

    2015-01-01

    Apical organs are sensory structures present in many marine invertebrate larvae where they are considered to be involved in their settlement, metamorphosis and locomotion. In bilaterians they are characterised by a tuft of long cilia and receptor cells and they are associated with groups of neurons, but their relatively low morphological complexity and dispersed phylogenetic distribution have left their evolutionary relationship unresolved. Moreover, since apical organs are not present in the standard model organisms, their development and function are not well understood. To provide a foundation for a better understanding of this structure we have characterised the molecular composition of the apical organ of the sea anemone Nematostella vectensis. In a microarray-based comparison of the gene expression profiles of planulae with either a wildtype or an experimentally expanded apical organ, we identified 78 evolutionarily conserved genes, which are predominantly or specifically expressed in the apical organ of Nematostella. This gene set comprises signalling molecules, transcription factors, structural and metabolic genes. The majority of these genes, including several conserved, but previously uncharacterized ones, are potentially involved in different aspects of the development or function of the long cilia of the apical organ. To demonstrate the utility of this gene set for comparative analyses, we further analysed the expression of a subset of previously uncharacterized putative orthologs in sea urchin larvae and detected expression for twelve out of eighteen of them in the apical domain. Our study provides a molecular characterization of the apical organ of Nematostella and represents an informative tool for future studies addressing the development, function and evolutionary history of apical organ cells. PMID:25478911

  7. Molecular characterization of the apical organ of the anthozoan Nematostella vectensis.

    PubMed

    Sinigaglia, Chiara; Busengdal, Henriette; Lerner, Avi; Oliveri, Paola; Rentzsch, Fabian

    2015-02-01

    Apical organs are sensory structures present in many marine invertebrate larvae where they are considered to be involved in their settlement, metamorphosis and locomotion. In bilaterians they are characterised by a tuft of long cilia and receptor cells and they are associated with groups of neurons, but their relatively low morphological complexity and dispersed phylogenetic distribution have left their evolutionary relationship unresolved. Moreover, since apical organs are not present in the standard model organisms, their development and function are not well understood. To provide a foundation for a better understanding of this structure we have characterised the molecular composition of the apical organ of the sea anemone Nematostella vectensis. In a microarray-based comparison of the gene expression profiles of planulae with either a wildtype or an experimentally expanded apical organ, we identified 78 evolutionarily conserved genes, which are predominantly or specifically expressed in the apical organ of Nematostella. This gene set comprises signalling molecules, transcription factors, structural and metabolic genes. The majority of these genes, including several conserved, but previously uncharacterized ones, are potentially involved in different aspects of the development or function of the long cilia of the apical organ. To demonstrate the utility of this gene set for comparative analyses, we further analysed the expression of a subset of previously uncharacterized putative orthologs in sea urchin larvae and detected expression for twelve out of eighteen of them in the apical domain. Our study provides a molecular characterization of the apical organ of Nematostella and represents an informative tool for future studies addressing the development, function and evolutionary history of apical organ cells.

  8. Forecasting a winner for Malaysian Cup 2013 using soccer simulation model

    NASA Astrophysics Data System (ADS)

    Yusof, Muhammad Mat; Fauzee, Mohd Soffian Omar; Latif, Rozita Abdul

    2014-07-01

    This paper investigates through soccer simulation the calculation of the probability for each team winning Malaysia Cup 2013. Our methodology used here is we predict the outcomes of individual matches and then we simulate the Malaysia Cup 2013 tournament 5000 times. As match outcomes are always a matter of uncertainty, statistical model, in particular a double Poisson model is used to predict the number of goals scored and conceded for each team. Maximum likelihood estimation is use to measure the attacking strength and defensive weakness for each team. Based on our simulation result, LionXII has a higher probability in becoming the winner, followed by Selangor, ATM, JDT and Kelantan. Meanwhile, T-Team, Negeri Sembilan and Felda United have lower probabilities to win Malaysia Cup 2013. In summary, we find that the probability for each team becominga winner is small, indicating that the level of competitive balance in Malaysia Cup 2013 is quite high.

  9. Corking Nitrogen-Doped Carbon Nanotube Cups with Gold Nanoparticles for Biodegradable Drug Delivery Applications.

    PubMed

    Burkert, Seth C; Star, Alexander

    2015-12-02

    Carbon nanomaterials have been proposed as effective drug delivery devices; however their perceived biopersistence and toxicological profile may hinder their applications in medical therapeutics. Nitrogen doping of carbon nanotubes results in a unique "stacked-cup" structure, with cups held together through van der Waals forces. Disrupting these weak interactions yields individual and short-stacked nanocups that can subsequently be corked with gold nanoparticles, resulting in sealed containers for delivery of cargo. Peroxidase-catalyzed reactions can effectively uncork these containers, followed by complete degradation of the graphitic capsule, resulting in effective release of therapeutic cargo while minimizing harmful side effects. The protocols reported herein describe the synthesis of stacked nitrogen-doped carbon nanotube cups followed by effective separation into individual cups and gold nanoparticle cork formation resulting in loaded and sealed containers.

  10. Improving acetabular cup orientation in total hip arthroplasty by using smartphone technology.

    PubMed

    Peters, Frank M; Greeff, Richard; Goldstein, Neal; Frey, Chris T

    2012-08-01

    Acetabular cup placement in total hip arthroplasty is often difficult to assess, especially in the lateral position and using the posterior approach. Conventional techniques and computer-assisted surgery are the 2 most popular methods for proper placement of the acetabular cup in Lewinnek's safe zone of orientation (anteversion 15° ± 10° and lateral inclination 40° ± 10°). We developed a system that uses the accelerometer and camera function of the iPhone. A level indicator application and protractor application were downloaded to the iPhone and used to improve acetabular cup placement. This system has proven to be accurate and quick. Our series of 50 prospective cases showed good results with all our acetabular cups being placed within a narrow range in the safe zone and with less than 5% difference between the preoperative, intraoperative, and postoperative acetabular inclinations. PMID:22245126

  11. Early failure of a polyethylene acetabular liner cemented into a metal cup.

    PubMed

    Wilson, David A J; Corkum, Joseph P; Teeter, Matthew G; Holdsworth, David W; Dunbar, Michael J

    2012-05-01

    In 2002, a patient underwent revision total hip arthroplasty for polyethylene wear. The acetabular cup was well fixed, and it was decided to cement a new polyethylene liner into the existing cup. In 2006, the patient presented with inability to weight bear and easy subluxation of the hip. Revision surgery was performed, and all components were examined postoperatively. Investigation with microcomputed tomography revealed that the liner had plastically deformed at the superior pole resulting in the hip instability. The reasons for this are suspected to be related to the abducted nature of the original cup and an uneven cement mantle. This report suggests that cementation of polyethylene liners into metal cups has limitations and is not appropriate in all circumstances.

  12. Cupping therapy: A prudent remedy for a plethora of medical ailments.

    PubMed

    Mehta, Piyush; Dhapte, Vividha

    2015-07-01

    Since ancient times, complementary and alternative medicine (CAM; bǔ chōng yǔ tì dài yī xué) have played an important role in human health and welfare. Many therapeutic approaches in healthcare outside the realm of conventional medicine persist in various parts of the world. There is considerable scientific and commercial potential in CAM, which needs to be explored precisely. Cupping therapy ( bá guàn liáo fǎ), one of the CAM, is practiced across the world. This therapy is believed to act by correcting imbalances in the internal bio field, such as by restoring the flow of "Qi (qì)". Cupping involves applying a heated cup to generate a partial vacuum that mobilizes the blood flow and promotes effective healing. This review outlines various tools and techniques of cupping therapy. PMID:26151023

  13. Mechanistic Based DEM Simulation of Particle Attrition in a Jet Cup

    SciTech Connect

    Xu, Wei; DeCroix, David; Sun, Xin

    2014-02-01

    The attrition of particles is a major industrial concern in many fluidization systems as it can have undesired effects on the product quality and on the reliable operation of process equipment. Therefore, to accomodate the screening and selection of catalysts for a specific process in fluidized beds, risers, or cyclone applications, their attrition propensity is usually estimated through jet cup attrition testing, where the test material is subjected to high gas velocities in a jet cup. However, this method is far from perfect despite its popularity, largely due to its inconsistency in different testing set-ups. In order to better understand the jet cup testing results as well as their sensitivity to different operating conditions, a coupled computational fluid dynamic (CFD) - discrete element method (DEM) model has been developed in the current study to investigate the particle attrition in a jet cup and its dependence on various factors, e.g. jet velocity, initial particle size, particle density, and apparatus geometry.

  14. Region-based multi-step optic disk and cup segmentation from color fundus image

    NASA Astrophysics Data System (ADS)

    Xiao, Di; Lock, Jane; Manresa, Javier Moreno; Vignarajan, Janardhan; Tay-Kearney, Mei-Ling; Kanagasingam, Yogesan

    2013-02-01

    Retinal optic cup-disk-ratio (CDR) is a one of important indicators of glaucomatous neuropathy. In this paper, we propose a novel multi-step 4-quadrant thresholding method for optic disk segmentation and a multi-step temporal-nasal segmenting method for optic cup segmentation based on blood vessel inpainted HSL lightness images and green images. The performance of the proposed methods was evaluated on a group of color fundus images and compared with the manual outlining results from two experts. Dice scores of detected disk and cup regions between the auto and manual results were computed and compared. Vertical CDRs were also compared among the three results. The preliminary experiment has demonstrated the robustness of the method for automatic optic disk and cup segmentation and its potential value for clinical application.

  15. Corking Nitrogen-Doped Carbon Nanotube Cups with Gold Nanoparticles for Biodegradable Drug Delivery Applications.

    PubMed

    Burkert, Seth C; Star, Alexander

    2015-01-01

    Carbon nanomaterials have been proposed as effective drug delivery devices; however their perceived biopersistence and toxicological profile may hinder their applications in medical therapeutics. Nitrogen doping of carbon nanotubes results in a unique "stacked-cup" structure, with cups held together through van der Waals forces. Disrupting these weak interactions yields individual and short-stacked nanocups that can subsequently be corked with gold nanoparticles, resulting in sealed containers for delivery of cargo. Peroxidase-catalyzed reactions can effectively uncork these containers, followed by complete degradation of the graphitic capsule, resulting in effective release of therapeutic cargo while minimizing harmful side effects. The protocols reported herein describe the synthesis of stacked nitrogen-doped carbon nanotube cups followed by effective separation into individual cups and gold nanoparticle cork formation resulting in loaded and sealed containers. PMID:26629615

  16. Obturating teeth with wide open apices using mineral trioxide aggregate: a case report.

    PubMed

    Levenstein, H

    2002-07-01

    The conventional approach in handling a tooth with a wide open apex requiring endodontic treatment is by means of a procedure called apexification. The objective of treatment is to introduce calcium hydroxide mixed with sterile water or local anaesthetic into the root canal to create a hard-tissue-like formation or an apical plug to prevent extrusion of filling materials during obturation of teeth with wide open apices. This procedure may take anything from 6 months to 2 years. In 1999 a new material called mineral trioxide aggregate (MTA) was introduced to the dental profession for clinical use which has the ability to create an apical plug within a few weeks.

  17. Second-order motor planning in children: insights from a cup-manipulation-task.

    PubMed

    Wunsch, Kathrin; Weiss, Daniel J; Schack, Thomas; Weigelt, Matthias

    2015-07-01

    The present study examined the development of anticipatory motor planning in an object manipulation task that has been used to successfully demonstrate motor planning in non-human primates (Weiss et al. in Psychol Sci 18:1063-1068, 2007). Seventy-five participants from four different age groups participated in a cup-manipulation task. One group was preschool children (average age of 5.1 years), two groups were primary school children (7.7 and 9.8 years old respectively) and the final group was comprised of adults. The experimental task entailed reaching for a plastic cup that was vertically suspended in an apparatus in either upright or inverted orientation, removing the cup by its stem and then retrieving a small toy from the inside of the cup. When the cup was inverted in the apparatus, evidence for anticipatory motor planning could be achieved by initially gripping the stem using an inverted (thumb-down) grip posture. We found that when the cup was in upright orientation, all participants reached for the cup using an upright grip (i.e., thumb-up posture). However, when the cup was inverted in the apparatus, only adults consistently used an inverted grasping posture, though the percentage of inverted grips among participants did increase with age. These results suggest a protracted development for anticipatory motor planning abilities in children. Surprisingly, the performance of adults on this task more closely resembles the performance of several nonhuman primate species as opposed to children even at approximately 10 years of age. We discuss how morphological constraints on flexibility may help account for these findings.

  18. Hinge assembly

    DOEpatents

    Vandergriff, D.H.

    1999-08-31

    A hinge assembly is disclosed having a first leaf, a second leaf and linking member. The first leaf has a contact surface. The second leaf has a first contact surface and a second contact surface. The linking member pivotally connects to the first leaf and to the second leaf. The hinge assembly is capable of moving from a closed position to an open position. In the closed position, the contact surface of the first leaf merges with the first contact surface of the second leaf. In the open position, the contact surface of the first leaf merges with the second contact surface of the second leaf. The hinge assembly can include a seal on the contact surface of the first leaf. 8 figs.

  19. Hinge assembly

    DOEpatents

    Vandergriff, David Houston

    1999-01-01

    A hinge assembly having a first leaf, a second leaf and linking member. The first leaf has a contact surface. The second leaf has a first contact surface and a second contact surface. The linking member pivotally connects to the first leaf and to the second leaf. The hinge assembly is capable of moving from a closed position to an open position. In the closed position, the contact surface of the first leaf merges with the first contact surface of the second leaf. In the open position, the contact surface of the first leaf merges with the second contact surface of the second leaf. The hinge assembly can include a seal on the contact surface of the first leaf.

  20. Clad vent set cup open end (closure weld zone) wall-thickness study

    SciTech Connect

    Ulrich, G.B.; Sherrill, M.W.

    1994-09-01

    The wall thickness at the open end of Clad Vent Set (CVS) cups is a very important parameter for maintaining control of the fueled CVS closure weld process. Ideally, the wall thickness in the closure weld zone should be constant. The DOP-26 iridium alloy is very difficult to machine; therefore, key dimensional features are established during the two-draw warm-forming operation. Unfortunately, anisotropy in the forming blanks produces four ears at the open end of each cup. Formation of these ears produces axial and circumferential variations in wall thickness. The cup certification requirement is that the wall thickness in the closure weld zone, defined as the 2.5-mm band at the open end of a cup, measure from 0.63 to 0.73 mm. The wall thickness certification data for the open end of the CVS cups have been statistically evaluated. These data show that the cups recently produced for the Cassini mission have well-controlled open-end wall thicknesses.

  1. Enhancement of optic cup detection through an improved vessel kink detection framework

    NASA Astrophysics Data System (ADS)

    Wong, Damon W. K.; Liu, Jiang; Tan, Ngan Meng; Zhang, Zhuo; Lu, Shijian; Lim, Joo Hwee; Li, Huiqi; Wong, Tien Yin

    2010-03-01

    Glaucoma is a leading cause of blindness. The presence and extent of progression of glaucoma can be determined if the optic cup can be accurately segmented from retinal images. In this paper, we present a framework which improves the detection of the optic cup. First, a region of interest is obtained from the retinal fundus image, and a pallor-based preliminary cup contour estimate is determined. Patches are then extracted from the ROI along this contour. To improve the usability of the patches, adaptive methods are introduced to ensure the patches are within the optic disc and to minimize redundant information. The patches are then analyzed for vessels by an edge transform which generates pixel segments of likely vessel candidates. Wavelet, color and gradient information are used as input features for a SVM model to classify the candidates as vessel or non-vessel. Subsequently, a rigourous non-parametric method is adopted in which a bi-stage multi-resolution approach is used to probe and localize the location of kinks along the vessels. Finally, contenxtual information is used to fuse pallor and kink information to obtain an enhanced optic cup segmentation. Using a batch of 21 images obtained from the Singapore Eye Research Institute, the new method results in a 12.64% reduction in the average overlap error against a pallor only cup, indicating viable improvements in the segmentation and supporting the use of kinks for optic cup detection.

  2. Optic Disc and Optic Cup Segmentation Methodologies for Glaucoma Image Detection: A Survey

    PubMed Central

    Almazroa, Ahmed; Burman, Ritambhar; Raahemifar, Kaamran; Lakshminarayanan, Vasudevan

    2015-01-01

    Glaucoma is the second leading cause of loss of vision in the world. Examining the head of optic nerve (cup-to-disc ratio) is very important for diagnosing glaucoma and for patient monitoring after diagnosis. Images of optic disc and optic cup are acquired by fundus camera as well as Optical Coherence Tomography. The optic disc and optic cup segmentation techniques are used to isolate the relevant parts of the retinal image and to calculate the cup-to-disc ratio. The main objective of this paper is to review segmentation methodologies and techniques for the disc and cup boundaries which are utilized to calculate the disc and cup geometrical parameters automatically and accurately to help the professionals in the glaucoma to have a wide view and more details about the optic nerve head structure using retinal fundus images. We provide a brief description of each technique, highlighting its classification and performance metrics. The current and future research directions are summarized and discussed. PMID:26688751

  3. Enhanced modified faraday cup for determination of power density distribution of electron beams

    DOEpatents

    Elmer, John W.; Teruya, Alan T.

    2001-01-01

    An improved tomographic technique for determining the power distribution of an electron or ion beam using electron beam profile data acquired by an enhanced modified Faraday cup to create an image of the current density in high and low power ion or electron beams. A refractory metal disk with a number of radially extending slits, one slit being about twice the width of the other slits, is placed above a Faraday cup. The electron or ion beam is swept in a circular pattern so that its path crosses each slit in a perpendicular manner, thus acquiring all the data needed for a reconstruction in one circular sweep. The enlarged slit enables orientation of the beam profile with respect to the coordinates of the welding chamber. A second disk having slits therein is positioned below the first slit disk and inside of the Faraday cup and provides a shield to eliminate the majority of secondary electrons and ions from leaving the Faraday cup. Also, a ring is located below the second slit disk to help minimize the amount of secondary electrons and ions from being produced. In addition, a beam trap is located in the Faraday cup to provide even more containment of the electron or ion beam when full beam current is being examined through the center hole of the modified Faraday cup.

  4. Optic Disc and Optic Cup Segmentation Methodologies for Glaucoma Image Detection: A Survey.

    PubMed

    Almazroa, Ahmed; Burman, Ritambhar; Raahemifar, Kaamran; Lakshminarayanan, Vasudevan

    2015-01-01

    Glaucoma is the second leading cause of loss of vision in the world. Examining the head of optic nerve (cup-to-disc ratio) is very important for diagnosing glaucoma and for patient monitoring after diagnosis. Images of optic disc and optic cup are acquired by fundus camera as well as Optical Coherence Tomography. The optic disc and optic cup segmentation techniques are used to isolate the relevant parts of the retinal image and to calculate the cup-to-disc ratio. The main objective of this paper is to review segmentation methodologies and techniques for the disc and cup boundaries which are utilized to calculate the disc and cup geometrical parameters automatically and accurately to help the professionals in the glaucoma to have a wide view and more details about the optic nerve head structure using retinal fundus images. We provide a brief description of each technique, highlighting its classification and performance metrics. The current and future research directions are summarized and discussed. PMID:26688751

  5. The RoboCup Mixed Reality League - A Case Study

    NASA Astrophysics Data System (ADS)

    Gerndt, Reinhard; Bohnen, Matthias; da Silva Guerra, Rodrigo; Asada, Minoru

    In typical mixed reality systems there is only a one-way interaction from real to virtual. A human user or the physics of a real object may influence the behavior of virtual objects, but real objects usually cannot be influenced by the virtual world. By introducing real robots into the mixed reality system, we allow a true two-way interaction between virtual and real worlds. Our system has been used since 2007 to implement the RoboCup mixed reality soccer games and other applications for research and edutainment. Our framework system is freely programmable to generate any virtual environment, which may then be further supplemented with virtual and real objects. The system allows for control of any real object based on differential drive robots. The robots may be adapted for different applications, e.g., with markers for identification or with covers to change shape and appearance. They may also be “equipped” with virtual tools. In this chapter we present the hardware and software architecture of our system and some applications. The authors believe this can be seen as a first implementation of Ivan Sutherland’s 1965 idea of the ultimate display: “The ultimate display would, of course, be a room within which the computer can control the existence of matter …” (Sutherland, 1965, Proceedings of IFIPS Congress 2:506-508).

  6. Our Everyday Cup of Coffee: The Chemistry behind Its Magic

    NASA Astrophysics Data System (ADS)

    Petracco, Marino

    2005-08-01

    Coffee beverages are so popular all over the world that there is hardly any need to describe them. But underlying this seemingly commonplace beverage there is a whole realm worth serious scientific study. The complexity of the raw seed matrix, made even more intricate when roasted, requires a deep understanding of its chemical nature. While coffee is not consumed for nutritional purposes, it is appreciated for its taste appeal along with its stimulating effects on mental and physical activity. The attention to quality is of paramount importance to both of these aspects to supply the customers with a pleasant and wholesome product. The chemical approach to the sensory sphere has seen the development of increasingly sophisticated analytical methods where the parts per billion of volatile aromas are not the ultimate frontier of detection limits. In spite of the progress of instrumental techniques, the cup-testing approach still remains the final assessment tool to obtain the approval for choosing the right plant and for conveying the product to the market. This is even truer when espresso, the fashionable type of coffee brewing methods, is considered.

  7. Latch assembly

    DOEpatents

    Frederickson, James R.; Harper, William H.; Perez, Raymond

    1986-01-01

    A latch assembly for releasably securing an article in the form of a canister within a container housing. The assembly includes a cam pivotally mounted on the housing wall and biased into the housing interior. The cam is urged into a disabled position by the canister as it enters the housing and a latch release plate maintains the cam disabled when the canister is properly seated in the housing. Upon displacement of the release plate, the cam snaps into latching engagement against the canister for securing the same within the housing.

  8. Latch assembly

    DOEpatents

    Frederickson, J.R.; Harper, W.H.; Perez, R.

    1984-08-17

    A latch assembly for releasably securing an article in the form of a canister within a container housing. The assembly includes a cam pivotally mounted on the housing wall and biased into the housing interior. The cam is urged into a disabled position by the canister as it enters the housing and a latch release plate maintains the cam disabled when the canister is properly seated in the housing. Upon displacement of the release plate, the cam snaps into latching engagement against the canister for securing the same within the housing. 2 figs.

  9. Valve assembly

    SciTech Connect

    Marshala, D.L.

    1986-12-16

    This patent describes a subsurface pump actuated by a reciprocatable sucker rod for producing well liquids from a subsurface reservoir involving a piston adapted to reciprocate within a cylinder immersed in the reservoir, the piston being provided with a traveling valve. The improvement described here comprises valve means connected to the sucker tod for lifting a body of fluid during upstrokes of the sucker rod, the valve means comprising: a barrel assembly having an internal bore and comprising: a lower barrel member; and an upper barrel assembly connected to the lower barrel and having a beveled seating surface with at least one fluid port therethrough.

  10. Webs, cell assemblies, and chunking in neural nets: introduction.

    PubMed

    Wickelgren, W A

    1999-03-01

    This introduction to Wickelgren (1992), describes a theory of idea representation and learning in the cerebral cortex and seven properties of Hebb's (1949) formulation of cell assemblies that have played a major role in all such neural net models. Ideas are represented in the cerebral cortex by webs (innate cell assemblies), using sparse coding with sparse, all-or-none, innate linking. Recruiting a web to represent a new idea is called chunking. The innate links that bind the neurons of a web are basal dendritic synapses. Learning modifies the apical dendritic synapses that associate neurons in one web to neurons in another web.

  11. Genetic Control of Maize Shoot Apical Meristem Architecture

    PubMed Central

    Thompson, Addie M.; Crants, James; Schnable, Patrick S.; Yu, Jianming; Timmermans, Marja C. P.; Springer, Nathan M.; Scanlon, Michael J.; Muehlbauer, Gary J.

    2014-01-01

    The shoot apical meristem contains a pool of undifferentiated stem cells and generates all above-ground organs of the plant. During vegetative growth, cells differentiate from the meristem to initiate leaves while the pool of meristematic cells is preserved; this balance is determined in part by genetic regulatory mechanisms. To assess vegetative meristem growth and genetic control in Zea mays, we investigated its morphology at multiple time points and identified three stages of growth. We measured meristem height, width, plastochron internode length, and associated traits from 86 individuals of the intermated B73 × Mo17 recombinant inbred line population. For meristem height-related traits, the parents exhibited markedly different phenotypes, with B73 being very tall, Mo17 short, and the population distributed between. In the outer cell layer, differences appeared to be related to number of cells rather than cell size. In contrast, B73 and Mo17 were similar in meristem width traits and plastochron internode length, with transgressive segregation in the population. Multiple loci (6−9 for each trait) were mapped, indicating meristem architecture is controlled by many regions; none of these coincided with previously described mutants impacting meristem development. Major loci for height and width explaining 16% and 19% of the variation were identified on chromosomes 5 and 8, respectively. Significant loci for related traits frequently coincided, whereas those for unrelated traits did not overlap. With the use of three near-isogenic lines, a locus explaining 16% of the parental variation in meristem height was validated. Published expression data were leveraged to identify candidate genes in significant regions. PMID:24855316

  12. Characterization of actin microfilaments at the apical pole of thyroid cells.

    PubMed

    Gabrion, J; Travers, F; Benyamin, Y; Sentein, P; Van Thoai, N

    1980-01-01

    In thyroid cells (rat or hog), actin has been detected by immunofluorescence with an antiactin antibody and, in electron microscopy by decoration "in situ" with heavy meromyosin. The antibody as the heavy meromyosin method have shown that actin microfilaments are especially localized at the apical pole of the cells, in a region where thin filaments are usually observed by conventional methods of electron microscopy. These microfilaments are attached to the apical membrane at the ends of the microvilli and form dense bundles at their cores. They are polarized towards the interior of the cell. Decorated filaments are also organized in a clear network, parallel to the apical membrane; they are associated with microvillar bundles, but also with small apical vesicles and lateral membranes, in tight or gap junctions.

  13. Isolation of gibberellin A8-glucoside from shoot apices of Althaea rosea.

    PubMed

    Harada, H; Yokota, T

    1970-03-01

    Gibberellin A8-glucoside has been isolated from shoot apices of Althaea rosea. It showed a weak growth-promoting activity on rice seedlings and oat mesocotyl sections but did not induce germination of lettuce seeds in darkness.

  14. Apical constriction: themes and variations on a cellular mechanism driving morphogenesis

    PubMed Central

    Martin, Adam C.; Goldstein, Bob

    2014-01-01

    Apical constriction is a cell shape change that promotes tissue remodeling in a variety of homeostatic and developmental contexts, including gastrulation in many organisms and neural tube formation in vertebrates. In recent years, progress has been made towards understanding how the distinct cell biological processes that together drive apical constriction are coordinated. These processes include the contraction of actin-myosin networks, which generates force, and the attachment of actin networks to cell-cell junctions, which allows forces to be transmitted between cells. Different cell types regulate contractility and adhesion in unique ways, resulting in apical constriction with varying dynamics and subcellular organizations, as well as a variety of resulting tissue shape changes. Understanding both the common themes and the variations in apical constriction mechanisms promises to provide insight into the mechanics that underlie tissue morphogenesis. PMID:24803648

  15. Isolated Left Ventricular Apical Hypoplasia: Reporting a Case With Mild Manifestations and Different Echocardiography Features

    PubMed Central

    Mirdamadi, Ahmad; Ashrafi, Samira

    2016-01-01

    Introduction Isolated left ventricular apical hypoplasia is an unusual type of cardiomyopathy that presents with different clinical manifestations according to the age of the disease, ranging from no symptoms in children to congestive heart failure, pulmonary edema, or even malignant tachycardia in adults. To our knowledge, only a few cases of isolated left ventricular apical hypoplasia have been reported in Asian adults. Case Presentation Herein, we described an adult case of isolated left ventricular apical hypoplasia referred to our heart center in Isfahan, Iran in 2015 with a complaint of mild dyspnea with the absence of obvious fatty tissue in the heart’s apex and an absence of any shunt, which are common findings in patients with this phenomenon. Conclusions Patients faced with isolated left ventricular apical hypoplasia should be monitored by echocardiography because of this disease’s possible progressive trend to life-threatening consequences. PMID:27800175

  16. Age estimation by pulp/tooth ratio in canines by mesial and vestibular peri-apical X-rays.

    PubMed

    Cameriere, Roberto; Ferrante, Luigi; Belcastro, Maria Giovanna; Bonfiglioli, Benedetta; Rastelli, Elisa; Cingolani, Mariano

    2007-09-01

    Changes in the size of the pulp canal, caused by apposition of secondary dentine, are the best morphometric parameters for estimating age by X-rays. The apposition of secondary dentine is the most frequently used method for age estimation in adult subjects. In two previous papers, we studied the application of the pulp/tooth area ratio by peri-apical X-rays as an indicator of age at death. The aim of the present study was to test the accuracy of age evaluation by combined analysis of labio-lingual and mesial peri-apical X-rays of lower and upper canines. A total of 200 such X-rays were assembled from 57 male and 43 female skeletons of Caucasian origin, aged between 20 and 79 years. For each skeleton, dental maturity was evaluated by measuring the pulp/tooth area ratio according to labio-lingual and mesial X-rays on upper (x(1), x(2)) and lower (x(3), x(4)) canines. Very good agreement was found between intra-observer measurements. Statistical analysis showed that all variables x(1), x(2), x(3), and x(4) and the first-order interaction between x(1) and x(3) contributed significantly to the fit, so that they were included in the regression model, yielding the following regression formula: Age = 120.737 - 337.112x(1) - 79.709x(2) - 364.534x(3) - 65.655x(4) + 1531.918x(1)x(3) . The residual standard error of estimated ages was 3.62 years, with 94 degrees of freedom, and the median of the residuals was -0.155 years, with an interquartile range of 4.96 years. The accuracy of the method was ME = 2.8 years, where ME is the mean prediction error. The model also explained 94% of total variance (R(2) = 0.94).

  17. Furnace assembly

    DOEpatents

    Panayotou, N.F.; Green, D.R.; Price, L.S.

    A method of and apparatus for heating test specimens to desired elevated temperatures for irradiation by a high energy neutron source. A furnace assembly is provided for heating two separate groups of specimens to substantially different, elevated, isothermal temperatures in a high vacuum environment while positioning the two specimen groups symmetrically at equivalent neutron irradiating positions.

  18. Furnace assembly

    DOEpatents

    Panayotou, Nicholas F.; Green, Donald R.; Price, Larry S.

    1985-01-01

    A method of and apparatus for heating test specimens to desired elevated temperatures for irradiation by a high energy neutron source. A furnace assembly is provided for heating two separate groups of specimens to substantially different, elevated, isothermal temperatures in a high vacuum environment while positioning the two specimen groups symmetrically at equivalent neutron irradiating positions.

  19. EVALUATION OF THE APICAL INFILTRATION AFTER ROOT CANAL DISRUPTION AND OBTURATION

    PubMed Central

    Gomes, João Eduardo; Hopp, Renato Nicolás; Bernabé, Pedro Felício Estrada; Nery, Mauro Juvenal; Otoboni, José Arlindo; Dezan, Elói

    2008-01-01

    The aim of this study was to evaluate two root canal filling techniques used in teeth that had their apical foramen disrupted and compare the apical infiltration with an ideal clinical situation. Twenty-seven freshly extracted single-rooted teeth were selected and radiographed to confirm the existence of a single and straight root canal. The crowns were removed at a mean distance of 11 mm from the apex. The teeth had the root canals instrumented and were randomly assigned to 3 groups (n=9): ND group - root canals were filled using the lateral compaction technique and no disruption was performed; DRF group - the apical constriction was disrupted by advancing a #40 K-file 1 mm beyond the original working length, the canals were reinstrumented to create an apical ledge at 1 mm from the apical foramen and were obturated with a master gutta-percha cone with same size as the last file used for reinstrumentation; DF group - the teeth had the apical constriction disrupted and the canals were obturated with a master gutta-percha cone that fit at 1 mm from the apex. The teeth were submitted to dye leakage test with Rhodamine B for 7 days, using vaccum on the initial 5 min. The teeth were sectioned longitudinally and the leakage was measured in a linear fashion from apex to crown. There was no statistically significant difference (p>0.05) between the groups that had the apical foramen disrupted (DF, DRF), but significant difference was found between the disrupted groups and the non-disrupted one (p<0.01). In conclusion, none of the evaluated techniques was able to prevent apical infiltration, so working length so the working length determination has to be established and maintained carefully. PMID:19089232

  20. Light and nitrogen nutrition regulate apical control in Rosa hybrida L.

    PubMed

    Furet, Pierre-Maxime; Lothier, Jérémy; Demotes-Mainard, Sabine; Travier, Sandrine; Henry, Clémence; Guérin, Vincent; Vian, Alain

    2014-03-01

    Apical control is defined as the inhibition of basal axillary bud outgrowth by an upper actively growing axillary axis, whose regulation is poorly understood yet differs markedly from the better-known apical dominance. We studied the regulation of apical control by environmental factors in decapitated Rosa hybrida in order to remove the apical hormonal influence and nutrient sink. In this plant model, all the buds along the main axis have a similar morphology and are able to burst in vitro. We concentrated on the involvement of light intensity and nitrate nutrition on bud break and axillary bud elongation in the primary axis pruned above the fifth leaf of each rose bush. We observed that apical control took place in low light (92 μmol m(-2)s(-1)), where only the 2-apical buds grew out, both in low (0.25 mM) and high (12.25 mM) nitrate. In contrast, in high light (453 μmol m(-2)s(-1)), the apical control only operates in low nitrate while all the buds along the stem grew out when the plant was supplied with a high level of nitrate. We found a decreasing photosynthetic activity from the top to the base of the plant concomitant with a light gradient along the stem. The quantity of sucrose, fructose, glucose and starch are higher in high light conditions in leaves and stem. The expression of the sucrose transporter RhSUC2 was higher in internodes and buds in this lighting condition, suggesting an increased capacity for sucrose transport. We propose that light intensity and nitrogen availability both contribute to the establishment of apical control.

  1. Cochlear outer hair cells undergo an apical circumference remodeling constrained by the hair bundle shape.

    PubMed

    Etournay, Raphaël; Lepelletier, Léa; Boutet de Monvel, Jacques; Michel, Vincent; Cayet, Nadège; Leibovici, Michel; Weil, Dominique; Foucher, Isabelle; Hardelin, Jean-Pierre; Petit, Christine

    2010-04-01

    Epithelial cells acquire diverse shapes relating to their different functions. This is particularly relevant for the cochlear outer hair cells (OHCs), whose apical and basolateral shapes accommodate the functioning of these cells as mechano-electrical and electromechanical transducers, respectively. We uncovered a circumferential shape transition of the apical junctional complex (AJC) of OHCs, which occurs during the early postnatal period in the mouse, prior to hearing onset. Geometric analysis of the OHC apical circumference using immunostaining of the AJC protein ZO1 and Fourier-interpolated contour detection characterizes this transition as a switch from a rounded-hexagon to a non-convex circumference delineating two lateral lobes at the neural side of the cell, with a negative curvature in between. This shape tightly correlates with the 'V'-configuration of the OHC hair bundle, the apical mechanosensitive organelle that converts sound-evoked vibrations into variations in cell membrane potential. The OHC apical circumference remodeling failed or was incomplete in all the mouse mutants affected in hair bundle morphogenesis that we tested. During the normal shape transition, myosin VIIa and myosin II (A and B isoforms) displayed polarized redistributions into and out of the developing lobes, respectively, while Shroom2 and F-actin transiently accumulated in the lobes. Defects in these redistributions were observed in the mutants, paralleling their apical circumference abnormalities. Our results point to a pivotal role for actomyosin cytoskeleton tensions in the reshaping of the OHC apical circumference. We propose that this remodeling contributes to optimize the mechanical coupling between the basal and apical poles of mature OHCs.

  2. Pulsatile dry cupping in patients with osteoarthritis of the knee – a randomized controlled exploratory trial

    PubMed Central

    2012-01-01

    Introduction Cupping is used in various traditional medicine forms to relieve pain in musculoskeletal diseases. The aim of this study was to investigate the effectiveness of cupping in relieving the symptoms of knee osteoarthritis (OA). Methods In a two-group, randomized controlled exploratory pilot study patients with a clinically and radiological confirmed knee OA (Kellgren-Lawrence Grading Scale: 2-4) and a pain intensity > 40 mm on a 100 mm visual analogue scale (VAS) were included. 40 Patients were randomized to either 8 sessions of pulsatile dry cupping within 4 weeks or no intervention (control). Paracetamol was allowed on demand for both groups. Outcomes were the Western Ontario and McMaster Universities Osteoarthritis (WOMAC) score, the pain intensity on a VAS (0 mm = no pain to 100 mm = maximum intensity) and Quality of Life (SF-36) 4 and 12 weeks after randomization. Use of Paracetamol was documented within the 4-week treatment period. Analyses were performed by analysis of covariance adjusting for the baseline value for each outcome. Results 21 patients were allocated to the cupping group (5 male; mean age 68 ± SD 7.2) and 19 to the control group (8 male; 69 ± 6.8). After 4 weeks the WOMAC global score improved significantly more in the cupping group with a mean of 27.7 (95% confidence interval 22.1; 33.3) compared to 42.2 (36.3; 48.1) in the control group (p = 0.001). After 12 weeks the WOMAC global score were still significantly different in favor for cupping (31.0 (24.9; 37.2) vs. 40.8 (34.4; 47.3) p = 0.032), however the WOMAC subscores for pain and stiffness were not significant anymore. Significantly better outcomes in the cupping group were also observed for pain intensity on VAS and for the SF-36 Physical Component Scale compared to the control group after 4 and 12 weeks. No significant difference was observed for the SF-36 Mental Component Scale and the total number of consumed Paracetamol tablets

  3. Isotropic actomyosin dynamics promote organization of the apical cell cortex in epithelial cells

    PubMed Central

    Klingner, Christoph; Cherian, Anoop V.; Fels, Johannes; Diesinger, Philipp M.; Aufschnaiter, Roland; Maghelli, Nicola; Keil, Thomas; Beck, Gisela; Tolić-Nørrelykke, Iva M.; Bathe, Mark

    2014-01-01

    Although cortical actin plays an important role in cellular mechanics and morphogenesis, there is surprisingly little information on cortex organization at the apical surface of cells. In this paper, we characterize organization and dynamics of microvilli (MV) and a previously unappreciated actomyosin network at the apical surface of Madin–Darby canine kidney cells. In contrast to short and static MV in confluent cells, the apical surfaces of nonconfluent epithelial cells (ECs) form highly dynamic protrusions, which are often oriented along the plane of the membrane. These dynamic MV exhibit complex and spatially correlated reorganization, which is dependent on myosin II activity. Surprisingly, myosin II is organized into an extensive network of filaments spanning the entire apical membrane in nonconfluent ECs. Dynamic MV, myosin filaments, and their associated actin filaments form an interconnected, prestressed network. Interestingly, this network regulates lateral mobility of apical membrane probes such as integrins or epidermal growth factor receptors, suggesting that coordinated actomyosin dynamics contributes to apical cell membrane organization. PMID:25313407

  4. Proliferative effects of apical, but not basal, matrix metalloproteinase-7 activity in polarized MDCK cells

    SciTech Connect

    Harrell, Permila C.; McCawley, Lisa J.; Fingleton, Barbara; McIntyre, J. Oliver; Matrisian, Lynn M. . E-mail: lynn.matrisian@vanderbilt.edu

    2005-02-15

    Matrix metalloproteinase-7 (MMP-7) is primarily expressed in glandular epithelium. Therefore, its mechanism of action may be influenced by its regulated vectorial release to either the apical and/or basolateral compartments, where it would act on its various substrates. To gain a better understanding of where MMP-7 is released in polarized epithelium, we have analyzed its pattern of secretion in polarized MDCK cells expressing stably transfected human MMP-7 (MDCK-MMP-7), and HCA-7 and Caco2 human colon cancer cell lines. In all cell lines, latent MMP-7 was secreted to both cellular compartments, but was 1.5- to 3-fold more abundant in the basolateral compartment as compared to the apical. However, studies in the MDCK system demonstrated that MMP-7 activity was 2-fold greater in the apical compartment of MDCK-MMP-7{sup HIGH}-polarized monolayers, which suggests the apical co-release of an MMP-7 activator. In functional assays, MMP-7 over-expression increased cell saturation density as a result of increased cell proliferation with no effect on apoptosis. Apical MMP-7 activity was shown to be responsible for the proliferative effect, which occurred, as demonstrated by media transfer experiments, through cleavage of an apical substrate and not through the generation of a soluble factor. Taken together, our findings demonstrate the importance of MMP-7 secretion in relation to its mechanism of action when expressed in a polarized epithelium.

  5. aPKC Phosphorylation of Bazooka Defines the Apical/Lateral Border in Drosophila Epithelial Cells

    PubMed Central

    Morais-de-Sá, Eurico; Mirouse, Vincent; St Johnston, Daniel

    2010-01-01

    Summary Bazooka (PAR-3), PAR-6, and aPKC form a complex that plays a key role in the polarization of many cell types. In epithelial cells, however, Bazooka localizes below PAR-6 and aPKC at the apical/lateral junction. Here, we show that Baz is excluded from the apical aPKC domain in epithelia by aPKC phosphorylation, which disrupts the Baz/aPKC interaction. Removal of Baz from the complex is epithelial-specific because it also requires the Crumbs complex, which prevents the Baz/PAR-6 interaction. In the absence of Crumbs or aPKC phosphorylation of Baz, mislocalized Baz recruits adherens junction components apically, leading to a loss of the apical domain and an expansion of lateral. Thus, apical exclusion of Baz by Crumbs and aPKC defines the apical/lateral border. Although Baz acts as an aPKC targeting and specificity factor in nonepithelial cells, our results reveal that it performs a complementary function in positioning the adherens junction in epithelia. PMID:20434988

  6. Vangl2 cooperates with Rab11 and Myosin V to regulate apical constriction during vertebrate gastrulation

    PubMed Central

    Ossipova, Olga; Chuykin, Ilya; Chu, Chih-Wen; Sokol, Sergei Y.

    2015-01-01

    Core planar cell polarity (PCP) proteins are well known to regulate polarity in Drosophila and vertebrate epithelia; however, their functions in vertebrate morphogenesis remain poorly understood. In this study, we describe a role for PCP signaling in the process of apical constriction during Xenopus gastrulation. The core PCP protein Vangl2 is detected at the apical surfaces of cells at the blastopore lip, and it functions during blastopore formation and closure. Further experiments show that Vangl2, as well as Daam1 and Rho-associated kinase (Rock), regulate apical constriction of bottle cells at the blastopore and ectopic constriction of ectoderm cells triggered by the actin-binding protein Shroom3. At the blastopore lip, Vangl2 is required for the apical accumulation of the recycling endosome marker Rab11. We also show that Rab11 and the associated motor protein Myosin V play essential roles in both endogenous and ectopic apical constriction, and might be involved in Vangl2 trafficking to the cell surface. Overexpression of Rab11 RNA was sufficient to partly restore normal blastopore formation in Vangl2-deficient embryos. These observations suggest that Vangl2 affects Rab11 to regulate apical constriction during blastopore formation. PMID:25480917

  7. Defective calmodulin-dependent rapid apical endocytosis in zebrafish sensory hair cell mutants.

    PubMed

    Seiler, C; Nicolson, T

    1999-11-15

    Vertebrate mechanosensory hair cells contain a narrow "pericuticular" zone which is densely populated with small vesicles between the cuticular plate and cellular junctions near the apical surface. The presence of many cytoplasmic vesicles suggests that the apical surface of hair cells has a high turnover rate. The significance of intense membrane trafficking at the apical surface is not known. Using a marker of endocytosis, the styryl dye FM1-43, this report shows that rapid apical endocytosis in zebrafish lateral line sensory hair cells is calcium and calmodulin dependent and is partially blocked by the presence of amiloride and dihydrostreptomycin, known inhibitors of mechanotransduction channels. As seen in lateral line hair cells, sensory hair cells within the larval otic capsule also exhibit rapid apical endocytosis. Defects in internalization of the dye in both lateral line and inner ear hair cells were found in five zebrafish auditory/vestibular mutants: sputnik, mariner, orbiter, mercury, and skylab. In addition, lateral line hair cells in these mutants were not sensitive to prolonged exposure to streptomycin, which is toxic to hair cells. The presence of endocytic defects in the majority of zebrafish mechanosensory mutants points to a important role of apical endocytosis in hair cell function. PMID:10526320

  8. Local effects of apical oxygen on superconductivity in high-Tc cuprates

    NASA Astrophysics Data System (ADS)

    Mori, Michiyasu; Tohyama, Takami; Maekawa, Sadamichi

    2008-03-01

    The superconducting critical temperature (Tc) of high- Tc cuprates widely distributes among various series of crystal structures, even if the doping rate is optimized in the CuO2 planes. In addition, the Tc is enhanced by applying pressure[1]. These material- and pressure dependences have meaningful correlation with an energy difference of oxygen sites in an apical site and in the CuO2 plane (VA)[2]. On the other hand, Slezak et al. has found that locally modulated gap energy has anti-correlation with a distance between a Cu- and an apical O-sites, i.e., the larger distance is related to the smaller gap energy[3]. We study such a local effect of apical oxygen on superconductivity by calculating the Madelung potential. In particular, we focus on a local variation of VA, whose value approximately corresponds to stability of the Zhang- Rice singlet state[2]. It is found that, on neighboring sites of apical sites close to Cu sites, VA are locally enhanced compared to other sites. To estimate the gap energy, we propose a toy model like a BCS mean field Hamiltonian with an additional degree of freedom, which describes a role of apical oxygen. We will discuss an anti-correlation between the gap energy and the position of apical oxygen. [1] N. Tanahashi et al: Jpn. J. Appl. Phys. 28, L762 (1989). [2] Y. Ohta, T. Tohyama, and S. Maekawa: Phys. Rev. B 43, 2968 (1991). [3] J. Slezak, PhD thesis.

  9. Aerobic power and peak power of elite America's Cup sailors.

    PubMed

    Neville, Vernon; Pain, Matthew T G; Folland, Jonathan P

    2009-05-01

    Big-boat yacht racing is one of the only able bodied sporting activities where standing arm-cranking ('grinding') is the primary physical activity. However, the physiological capabilities of elite sailors for standing arm-cranking have been largely unreported. The purpose of the study was to assess aerobic parameters, VO(2peak) and onset of blood lactate (OBLA), and anaerobic performance, torque-crank velocity and power-crank velocity relationships and therefore peak power (P (max)) and optimum crank-velocity (omega(opt)), of America's Cup sailors during standing arm-cranking. Thirty-three elite professional sailors performed a step test to exhaustion, and a subset of ten grinders performed maximal 7 s isokinetic sprints at different crank velocities, using a standing arm-crank ergometer. VO(2peak) was 4.7 +/- 0.5 L/min (range 3.6-5.5 L/min) at a power output of 332 +/- 44 W (range 235-425 W). OBLA occurred at a power output of 202 +/- 31 W (61% of W(max)) and VO(2) of 3.3 +/- 0.4 L/min (71% of VO(2peak)). The torque-crank velocity relationship was linear for all participants (r = 0.9 +/- 0.1). P (max) was 1,420 +/- 37 W (range 1,192-1,617 W), and omega(opt) was 125 +/- 6 rpm. These data are among the highest upper-body anaerobic and aerobic power values reported. The unique nature of these athletes, with their high fat-free mass and specific selection and training for standing arm cranking, likely accounts for the high values. The influence of crank velocity on peak power implies that power production during on-board 'grinding' may be optimised through the use of appropriate gear-ratios and the development of efficient gear change mechanisms. PMID:19234715

  10. Aerobic power and peak power of elite America's Cup sailors.

    PubMed

    Neville, Vernon; Pain, Matthew T G; Folland, Jonathan P

    2009-05-01

    Big-boat yacht racing is one of the only able bodied sporting activities where standing arm-cranking ('grinding') is the primary physical activity. However, the physiological capabilities of elite sailors for standing arm-cranking have been largely unreported. The purpose of the study was to assess aerobic parameters, VO(2peak) and onset of blood lactate (OBLA), and anaerobic performance, torque-crank velocity and power-crank velocity relationships and therefore peak power (P (max)) and optimum crank-velocity (omega(opt)), of America's Cup sailors during standing arm-cranking. Thirty-three elite professional sailors performed a step test to exhaustion, and a subset of ten grinders performed maximal 7 s isokinetic sprints at different crank velocities, using a standing arm-crank ergometer. VO(2peak) was 4.7 +/- 0.5 L/min (range 3.6-5.5 L/min) at a power output of 332 +/- 44 W (range 235-425 W). OBLA occurred at a power output of 202 +/- 31 W (61% of W(max)) and VO(2) of 3.3 +/- 0.4 L/min (71% of VO(2peak)). The torque-crank velocity relationship was linear for all participants (r = 0.9 +/- 0.1). P (max) was 1,420 +/- 37 W (range 1,192-1,617 W), and omega(opt) was 125 +/- 6 rpm. These data are among the highest upper-body anaerobic and aerobic power values reported. The unique nature of these athletes, with their high fat-free mass and specific selection and training for standing arm cranking, likely accounts for the high values. The influence of crank velocity on peak power implies that power production during on-board 'grinding' may be optimised through the use of appropriate gear-ratios and the development of efficient gear change mechanisms.

  11. No increased risk of early revision during the implementation phase of new cup designs

    PubMed Central

    Björk, Mathias; Nemes, Szilard; Rolfson, Ola; Jolbäck, Per; Kärrholm, Johan

    2016-01-01

    Background and purpose — In Sweden, less than 5% of patients who undergo total hip arthroplasty (THA) have revision. Younger patients have an increased risk of revision. New prosthetic designs are being introduced in order to improve outcomes further. We investigated whether the introductory phase of new cup designs would increase the revision rate. Patients and methods — All THAs and first-time cup revisions performed from 1993 through 2011 were identified in the Swedish Hip Arthroplasty Register. The 15 types of cups used in more than 500 operations and inserted in more than 50 cases in each hospital (n = 52,903) were selected. All cups were given an order number, based on the order in which the cup had been inserted at each hospital. The influence of order number on the risk of revision was analyzed in a regression model, which was adjusted for potentially confounding demographic and surgical data. Revision within 2 years for all reasons (n = 940) was used as primary endpoint. Changes in the risk of revision based on the order number were analyzed using a spline. Results — The order number of the cup had no influence on the risk of early revision (p ≥ 0.7). Categorizing the order number using cutoff values obtained from the splines did not result in any statistically significant changes in risk of revision (p ≥ 0.2). Interpretation — We did not find any increased risk of early revision during the implementation phase of new cup designs. This finding is unexpected, and partly conflicts with data from other registries. The structured and stepwise introduction of new prosthesis designs, facilitated by the annual feedback from the Swedish Hip Arthroplasty Register, may partly explain this discrepancy. PMID:27168095

  12. Relative merits of polystyrene foam and paper in hot drink cups: Implications for packaging

    NASA Astrophysics Data System (ADS)

    Hocking, Martin B.

    1991-11-01

    An analysis of the overall relative merits of the use of uncoated paper vs molded polystyrene bead foam in single-use 8-oz cups is described here as a manageable example of the use of paper vs plastics in packaging. In raw material requirements the paper cup required about 2.5 times its finished weight of raw wood and about the same hydrocarbon fueling requirement as is needed for the polystyrene foam cup. To process the raw materials about six times as much steam, 13 times as much electric power, and twice as much cooling water are consumed to produce the paper cup as compared to the polystyrene foam cup. Emission rates to air are similar and to water are generally higher for the paper cup. Virtually all primary use factors favor polystyrene foam over paper. Once used both cup types may be recycled. Landfill disposal of the two items under dry conditions will occupy similar landfill volumes after compaction and will confer similarly slow to nonexistent decomposition to either option. Under wet conditions polystyrene foam will not readily degrade, but may help other materials to do so. Paper under wet conditions will biodegrade to produce methane, a significant greenhouse gas, biochemical oxygen demand to any leachate, and instability to the land surface during the process. Both materials can be incinerated cleanly in a municipal waste stream with the option of energy recovery, to yield an ash volume of 2% 5% of the incoming waste volume. Overall this analysis would suggest that polystyrene foam, with an extension to plastics in general, should be given more evenhanded consideration relative to paper in packaging applications than is currently the case.

  13. Preclinical, Clinical, and Over-the-Counter Postmarketing Experience with a New Vaginal Cup: Menstrual Collection

    PubMed Central

    North, Barbara B.

    2011-01-01

    Abstract Background Menstrual cups have been available for decades, but their use is limited by bulky design and the need for multiple sizes. The Softcup® (Instead, Inc., San Diego, CA) is a simple single-size disposable over-the-counter (OTC) menstrual cup that compresses to tampon shape to facilitate insertion and can be worn during coitus. This report describes preclinical evaluation, clinical testing, and postmarketing monitoring of the Softcup. Methods Preclinical testing complied with U.S. Food and Drug Administration (FDA) guidelines and used standard United States Pharmacopoeia methodologies for assessment of potential toxicity. Clinical testing enrolled 406 women in seven U.S. centers. A detailed written questionnaire assessed safety, acceptability, and effectiveness for menstrual collection. Study safety parameters included pelvic examinations, Pap smears, colposcopy, urinalysis, vaginal pH, wet mounts, gram stain, and vaginal microflora cultures. Postmarketing surveillance of over 100 million Softcups has been conducted by the manufacturer and by the FDA Medwatch system. Results No toxicity or mutagenicity was observed in preclinical evaluations. In clinical testing, after three cycles of cup use, 37% of subjects rated the cup as better than, 29% as worse than, and 34% as equal to pads or tampons. The cup was preferred for comfort, dryness, and less odor. Cups received lower ratings for disposal and convenience. Eighty-one percent of enrolled women were able to insert and remove their first cup using only written instructions. Use difficulties resulting in study discontinuations included cramping (1%), leakage (1%), and improper fit (3%). No safety parameters were adversely affected. No significant health risks were reported during postmarketing surveillance. Conclusions These results demonstrate that a single-size vaginal device has no significant health risks and is acceptable to many women without the need for fitting or other medical services. PMID

  14. Yeast CUP1 protects HeLa cells against copper-induced stress.

    PubMed

    Xie, X X; Ma, Y F; Wang, Q S; Chen, Z L; Liao, R R; Pan, Y C

    2015-07-01

    As an essential trace element, copper can be toxic in mammalian cells when present in excess. Metallothioneins (MTs) are small, cysteine-rich proteins that avidly bind copper and thus play an important role in detoxification. Yeast CUP1 is a member of the MT gene family. The aim of this study was to determine whether yeast CUP1 could bind copper effectively and protect cells against copper stress. In this study, CUP1 expression was determined by quantitative real-time PCR, and copper content was detected by inductively coupled plasma mass spectrometry. Production of intracellular reactive oxygen species (ROS) was evaluated using the 2',7'-dichlorofluorescein-diacetate (DCFH-DA) assay. Cellular viability was detected using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay, and the cell cycle distribution of CUP1 was analyzed by fluorescence-activated cell sorting. The data indicated that overexpression of yeast CUP1 in HeLa cells played a protective role against copper-induced stress, leading to increased cellular viability (P<0.05) and decreased ROS production (P<0.05). It was also observed that overexpression of yeast CUP1 reduced the percentage of G1 cells and increased the percentage of S cells, which suggested that it contributed to cell viability. We found that overexpression of yeast CUP1 protected HeLa cells against copper stress. These results offer useful data to elucidate the mechanism of the MT gene on copper metabolism in mammalian cells.

  15. The effect of cup outer sizes on the contact mechanics and cement fixation of cemented total hip replacements.

    PubMed

    Hua, Xijin; Li, Junyan; Wang, Ling; Wilcox, Ruth; Fisher, John; Jin, Zhongmin

    2015-10-01

    One important loosening mechanism of the cemented total hip arthroplasty is the mechanical overload at the bone-cement interface and consequent failure of the cement fixation. Clinical studies have revealed that the outer diameter of the acetabular component is a key factor in influencing aseptic loosening of the hip arthroplasty. The aim of the present study was to investigate the influence of the cup outer diameter on the contact mechanics and cement fixation of a cemented total hip replacement (THR) with different wear penetration depths and under different cup inclination angles using finite element (FE) method. A three-dimensional FE model was developed based on a typical Charnley hip prosthesis. Two acetabular cup designs with outer diameters of 40 and 43 mm were modelled and the effect of cup outer diameter, penetration depth and cup inclination angle on the contact mechanics and cement fixation stresses in the cemented THR were studied. The results showed that for all penetration depths and cup inclination angles considered, the contact mechanics in terms of peak von Mises stress in the acetabular cup and peak contact pressure at the bearing surface for the two cup designs were similar (within 5%). However, the peak von Mises stress, the peak maximum principal stress and peak shear stress in the cement mantle at the bone-cement interface for the 43 mm diameter cup design were predicted to be lower compared to those for the 40 mm diameter cup design. The differences were predicted to be 15-19%, 15-22% and 18-20% respectively for different cup penetration depths and inclination angles, which compares to the clinical difference of aseptic loosening incidence of about 20% between the two cup designs.

  16. The effect of cup outer sizes on the contact mechanics and cement fixation of cemented total hip replacements.

    PubMed

    Hua, Xijin; Li, Junyan; Wang, Ling; Wilcox, Ruth; Fisher, John; Jin, Zhongmin

    2015-10-01

    One important loosening mechanism of the cemented total hip arthroplasty is the mechanical overload at the bone-cement interface and consequent failure of the cement fixation. Clinical studies have revealed that the outer diameter of the acetabular component is a key factor in influencing aseptic loosening of the hip arthroplasty. The aim of the present study was to investigate the influence of the cup outer diameter on the contact mechanics and cement fixation of a cemented total hip replacement (THR) with different wear penetration depths and under different cup inclination angles using finite element (FE) method. A three-dimensional FE model was developed based on a typical Charnley hip prosthesis. Two acetabular cup designs with outer diameters of 40 and 43 mm were modelled and the effect of cup outer diameter, penetration depth and cup inclination angle on the contact mechanics and cement fixation stresses in the cemented THR were studied. The results showed that for all penetration depths and cup inclination angles considered, the contact mechanics in terms of peak von Mises stress in the acetabular cup and peak contact pressure at the bearing surface for the two cup designs were similar (within 5%). However, the peak von Mises stress, the peak maximum principal stress and peak shear stress in the cement mantle at the bone-cement interface for the 43 mm diameter cup design were predicted to be lower compared to those for the 40 mm diameter cup design. The differences were predicted to be 15-19%, 15-22% and 18-20% respectively for different cup penetration depths and inclination angles, which compares to the clinical difference of aseptic loosening incidence of about 20% between the two cup designs. PMID:26343226

  17. Sensor assembly

    DOEpatents

    Bennett, Thomas E.; Nelson, Drew V.

    2004-04-13

    A ribbon-like sensor assembly is described wherein a length of an optical fiber embedded within a similar lengths of a prepreg tow. The fiber is ""sandwiched"" by two layers of the prepreg tow which are merged to form a single consolidated ribbon. The consolidated ribbon achieving a generally uniform distribution of composite filaments near the embedded fiber such that excess resin does not ""pool"" around the periphery of the embedded fiber.

  18. Radiographic and retrieval wear analyses of the first generation highly cross-linked polyethylene cup against a ceramic femoral head.

    PubMed

    Oonishi, Hiroyuki; Kyomoto, Masayuki; Iwamoto, Mikio; Ueno, Masaru; Oonishi, Hironobu

    2013-11-01

    In this study, the in vivo wear of highly cross-linked polyethylene (CLPE) cups against alumina ceramic femoral heads was evaluated by radiographic and retrieval analysis. The radiographic wear of six ethylene oxide gas-sterilized (i.e., non-cross-linked) conventional polyethylene (PE) cups with the mean follow-up of 20.9 years and 60 CLPE cups with the mean follow-up of 7.4 years was measured. The retrieved 16 PE cups with clinical use for mean 21.5 years and 10 CLPE cups with clinical use for mean 2.9 years was evaluated as a retrieval analysis. In the radiographic analysis, the linear wear of CLPE cups was significantly lower (99% reduction) compared to conventional polyethylene cups. The results of retrieval analyses for both cups were similar to those of radiographic analyses. Even when third-body wear occurred during clinical use, no surface damage was observed on the surface of ceramic femoral heads. The surface is not sensitive to third-body wear, and hence, the ceramic femoral head has a great advantage in terms of the wear of CLPE under third-body wear conditions. In conclusion, CLPE cups used with alumina ceramic femoral heads in total hip arthroplasty should have favorable wear resistance in several in vivo situations.

  19. Release of Apical Dominance in Potato Tuber Is Accompanied by Programmed Cell Death in the Apical Bud Meristem[C][W

    PubMed Central

    Teper-Bamnolker, Paula; Buskila, Yossi; Lopesco, Yael; Ben-Dor, Shifra; Saad, Inbal; Holdengreber, Vered; Belausov, Eduard; Zemach, Hanita; Ori, Naomi; Lers, Amnon; Eshel, Dani

    2012-01-01

    Potato (Solanum tuberosum) tuber, a swollen underground stem, is used as a model system for the study of dormancy release and sprouting. Natural dormancy release, at room temperature, is initiated by tuber apical bud meristem (TAB-meristem) sprouting characterized by apical dominance (AD). Dormancy is shortened by treatments such as bromoethane (BE), which mimics the phenotype of dormancy release in cold storage by inducing early sprouting of several buds simultaneously. We studied the mechanisms governing TAB-meristem dominance release. TAB-meristem decapitation resulted in the development of increasing numbers of axillary buds with time in storage, suggesting the need for autonomous dormancy release of each bud prior to control by the apical bud. Hallmarks of programmed cell death (PCD) were identified in the TAB-meristems during normal growth, and these were more extensive when AD was lost following either extended cold storage or BE treatment. Hallmarks included DNA fragmentation, induced gene expression of vacuolar processing enzyme1 (VPE1), and elevated VPE activity. VPE1 protein was semipurified from BE-treated apical buds, and its endogenous activity was fully inhibited by a cysteinyl aspartate-specific protease-1-specific inhibitor N-Acetyl-Tyr-Val-Ala-Asp-CHO (Ac-YVAD-CHO). Transmission electron microscopy further revealed PCD-related structural alterations in the TAB-meristem of BE-treated tubers: a knob-like body in the vacuole, development of cytoplasmic vesicles, and budding-like nuclear segmentations. Treatment of tubers with BE and then VPE inhibitor induced faster growth and recovered AD in detached and nondetached apical buds, respectively. We hypothesize that PCD occurrence is associated with the weakening of tuber AD, allowing early sprouting of mature lateral buds. PMID:22362870

  20. Deformation T-Cup: A new multi-anvil apparatus for controlled strain-rate deformation experiments at pressures above 18 GPa

    SciTech Connect

    Hunt, Simon A. McCormack, Richard J.; Bailey, Edward; Dobson, David P.; Weidner, Donald J.; Whitaker, Matthew L.; Li, Li; Vaughan, Michael T.

    2014-08-15

    A new multi-anvil deformation apparatus, based on the widely used 6-8 split-cylinder, geometry, has been developed which is capable of deformation experiments at pressures in excess of 18 GPa at room temperature. In 6-8 (Kawai-type) devices eight cubic anvils are used to compress the sample assembly. In our new apparatus two of the eight cubes which sit along the split-cylinder axis have been replaced by hexagonal cross section anvils. Combining these anvils hexagonal-anvils with secondary differential actuators incorporated into the load frame, for the first time, enables the 6-8 multi-anvil apparatus to be used for controlled strain-rate deformation experiments to high strains. Testing of the design, both with and without synchrotron-X-rays, has demonstrated the Deformation T-Cup (DT-Cup) is capable of deforming 1–2 mm long samples to over 55% strain at high temperatures and pressures. To date the apparatus has been calibrated to, and deformed at, 18.8 GPa and deformation experiments performed in conjunction with synchrotron X-rays at confining pressures up to 10 GPa at 800 °C.

  1. Deformation T-Cup: a new multi-anvil apparatus for controlled strain-rate deformation experiments at pressures above 18 GPa.

    PubMed

    Hunt, Simon A; Weidner, Donald J; McCormack, Richard J; Whitaker, Matthew L; Bailey, Edward; Li, Li; Vaughan, Michael T; Dobson, David P

    2014-08-01

    A new multi-anvil deformation apparatus, based on the widely used 6-8 split-cylinder, geometry, has been developed which is capable of deformation experiments at pressures in excess of 18 GPa at room temperature. In 6-8 (Kawai-type) devices eight cubic anvils are used to compress the sample assembly. In our new apparatus two of the eight cubes which sit along the split-cylinder axis have been replaced by hexagonal cross section anvils. Combining these anvils hexagonal-anvils with secondary differential actuators incorporated into the load frame, for the first time, enables the 6-8 multi-anvil apparatus to be used for controlled strain-rate deformation experiments to high strains. Testing of the design, both with and without synchrotron-X-rays, has demonstrated the Deformation T-Cup (DT-Cup) is capable of deforming 1-2 mm long samples to over 55% strain at high temperatures and pressures. To date the apparatus has been calibrated to, and deformed at, 18.8 GPa and deformation experiments performed in conjunction with synchrotron X-rays at confining pressures up to 10 GPa at 800 °C .

  2. Deformation T-Cup: A new multi-anvil apparatus for controlled strain-rate deformation experiments at pressures above 18 GPa

    NASA Astrophysics Data System (ADS)

    Hunt, Simon A.; Weidner, Donald J.; McCormack, Richard J.; Whitaker, Matthew L.; Bailey, Edward; Li, Li; Vaughan, Michael T.; Dobson, David P.

    2014-08-01

    A new multi-anvil deformation apparatus, based on the widely used 6-8 split-cylinder, geometry, has been developed which is capable of deformation experiments at pressures in excess of 18 GPa at room temperature. In 6-8 (Kawai-type) devices eight cubic anvils are used to compress the sample assembly. In our new apparatus two of the eight cubes which sit along the split-cylinder axis have been replaced by hexagonal cross section anvils. Combining these anvils hexagonal-anvils with secondary differential actuators incorporated into the load frame, for the first time, enables the 6-8 multi-anvil apparatus to be used for controlled strain-rate deformation experiments to high strains. Testing of the design, both with and without synchrotron-X-rays, has demonstrated the Deformation T-Cup (DT-Cup) is capable of deforming 1-2 mm long samples to over 55% strain at high temperatures and pressures. To date the apparatus has been calibrated to, and deformed at, 18.8 GPa and deformation experiments performed in conjunction with synchrotron X-rays at confining pressures up to 10 GPa at 800 °C .

  3. Do Parameters Of Irradiation Influences The Apical Sealing Of Er:YAG Laser Apicetomies?

    NASA Astrophysics Data System (ADS)

    Marques, Aparecida Maria Cordeiro; dos Santos, Jean Nunes; Pinheiro, Antonio Luiz Barbosa

    2011-08-01

    Failures on the sealing of the tooth apex are responsible for many failures of apical surgeries. The Er:YAG laser has been proposed as an alternative for the use of rotator instruments on surgical endodontics. 12 human extracted canines had root endodontic treatment being the apical limit was set at 1mm before the apical foramen and were distributed into 2 groups. On group I, apicectomy was performed with the Er:YAG laser (250 mJ/15 Hz). Apical cut was performed of perpendicular mode with 3mm from the apical foramen. On Group II, the same procedures and the same sequence as above was used, varying only the parameters of the Er:YAG laser (400 mJ/6 Hz). The specimens were divided into groups and fixed, by the cervical third, on wax. Impermeabilization of the residual root apical third was performed following the same procedures used in the cervical third but the residual apex was left free from the impermeabilization. After that, the roots were immersed in a 2% methylene blue solution and placed in a bacteriological oven for 48 h. The segments were visually observed and the one showing greatest level of dye leakage was selected and kept in individual container and coded accordingly. Apical staining was measured using a stereoscopic magnifying glass; a compass; and caliper. The results showed that Group I showed significantly different higher mean level of dye leakage (5.67±4.9, p<0.05). There was a significantly difference between the groups. It is concluded that the apicectomies carried out with 400 mJ/6 Hz showed the smallest infiltration value.

  4. The Apical Sorting Signal for human GLUT9b resides in the N-terminus

    PubMed Central

    Bibee, Kristin P.; Augustin, Robert; Gazit, Vered; Moley, Kelle H.

    2016-01-01

    The two splice variants of human glucose transporter 9 (hGLUT9) are targeted to different polarized membranes. hGLUT9a traffics to the basolateral membrane, whereas hGLUT9b traffics to the apical region. This study examines the sorting mechanism of these variants, which differ only in their N-terminal domain. Mutating a di-leucine motif unique to GLUT9a did not affect targeting. Chimeric proteins were made using GLUT1, a basolaterally targeted transporter, and GLUT3, an apically targeted protein whose signal lies in the C-terminus. Overexpression of the chimeric proteins in polarized cells demonstrates that the N-terminus of hGLUT9b contains a signal capable of redirecting GLUT1 to the apical membrane. The N-terminus of hGLUT9a, however, does not contain a basolateral signal sufficient enough to redirect GLUT3. Portions of the GLUT9a N-terminus were substituted with corresponding portions of the GLUT9b N-terminus to determine the motif responsible for apical targeting. The first 16 amino acids were not found to be a sufficient apical signal. The last ten amino acids of the N-termini differ only in amino acid class at one location. In the B-form, leucine, a hydrophobic residue, is substituted for lysine, a basic residue, found in the A-form. However, mutation of the leucine in hGLUT9b to a lysine resulted in retention of the apical signal. We therefore believe the apical signal exists as an interplay between the final ten amino acids of the N-terminus and another motif within the protein such as the intracellular loop or other motifs within the N-terminus. PMID:23361362

  5. Ex vivo accuracy of three electronic apex locators using different apical file sizes.

    PubMed

    Vasconcelos, Bruno Carvalho de; Matos, Leonardo de Alencar; Pinheiro-Júnior, Elilton Cavalcante; Menezes, Antônio Sérgio Teixeira de; Vivacqua-Gomes, Nilton

    2012-01-01

    This study evaluated the accuracy of three electronic apex locators (Root ZX, Novapex, and Justy II) in root canal length determinations using different apical file sizes, considering the apical constriction (AC) and the major foramen (MF) as anatomic references. The diameter of the apical foramina of 40 single-rooted teeth was determined by direct visual measurement and the master apical file was established. Electronic measurements were then performed using 3 instruments: the selected master apical file (adjusted file), one size smaller (intermediate file), and two sizes smaller (misfit file). The distances from the tip of files fixed in the canals to the MF and to the AC were measured digitally. Precision at AC and at MF for the misfit, intermediate and adjusted apical files was as follows: 80%/88%/83% and 78%/83%/95% (Root ZX); 80%/85%/80% and 68%/73%/73% (Novapex); and 78%/80%/78% and 65%/78%/70% (Justy II). Considering the mean discrepancies, statistically significant differences were found only for the adjusted file at MF, with Root ZX presenting the best results at MF. The chi-square test showed significant differences between the acceptable measurements at AC and at MF for the Justy II and Novapex (± 0.5 mm) regardless of file adjustment. Under the conditions of the present study, all devices provided acceptable electronic measurements regardless of file adjustment, except for Root ZX which had its performance improved significantly when the precisely fit apical file was used. Justy II and Novapex provided electronic measurements nearest to the AC.

  6. Characteristics of Kcnn4 channels in the apical membranes of an intestinal epithelial cell line.

    PubMed

    Basalingappa, Kanthesh M; Rajendran, Vazhaikkurichi M; Wonderlin, William F

    2011-11-01

    Intermediate-conductance K(+) (Kcnn4) channels in the apical and basolateral membranes of epithelial cells play important roles in agonist-induced fluid secretion in intestine and colon. Basolateral Kcnn4 channels have been well characterized in situ using patch-clamp methods, but the investigation of Kcnn4 channels in apical membranes in situ has been hampered by a layer of mucus that prevents seal formation. In the present study, we used patch-clamp methods to characterize Kcnn4 channels in the apical membrane of IEC-18 cells, a cell line derived from rat small intestine. A monolayer of IEC-18 cells grown on a permeable support is devoid of mucus, and tight junctions enable selective access to the apical membrane. In inside-out patches, Ca(2+)-dependent K(+) channels observed with iberiotoxin (a Kcnma1/large-conductance, Ca(2+)-activated K(+) channel blocker) and apamin (a Kcnn1-3/small-conductance, Ca(2+)-activated K(+) channel blocker) present in the pipette solution exhibited a single-channel conductance of 31 pS with inward rectification. The currents were reversibly blocked by TRAM-34 (a Kcnn4 blocker) with an IC(50) of 8.7 ± 2.0 μM. The channels were not observed when charybdotoxin, a peptide inhibitor of Kcnn4 channels, was added to the pipette solution. TRAM-34 was less potent in inhibiting Kcnn4 channels in patches from apical membranes than in patches from basolateral membranes, which was consistent with a preferential expression of Kcnn4c and Kcnn4b isoforms in apical and basolateral membranes, respectively. The expression of both isoforms in IEC-18 cells was confirmed by RT-PCR and Western blot analyses. This is the first characterization of Kcnn4 channels in the apical membrane of intestinal epithelial cells.

  7. A somitic contribution to the apical ectodermal ridge is essential for fin formation.

    PubMed

    Masselink, Wouter; Cole, Nicholas J; Fenyes, Fruzsina; Berger, Silke; Sonntag, Carmen; Wood, Alasdair; Nguyen, Phong D; Cohen, Naomi; Knopf, Franziska; Weidinger, Gilbert; Hall, Thomas E; Currie, Peter D

    2016-07-28

    The transition from fins to limbs was an important terrestrial adaptation, but how this crucial evolutionary shift arose developmentally is unknown. Current models focus on the distinct roles of the apical ectodermal ridge (AER) and the signaling molecules that it secretes during limb and fin outgrowth. In contrast to the limb AER, the AER of the fin rapidly transitions into the apical fold and in the process shuts off AER-derived signals that stimulate proliferation of the precursors of the appendicular skeleton. The differing fates of the AER during fish and tetrapod development have led to the speculation that fin-fold formation was one of the evolutionary hurdles to the AER-dependent expansion of the fin mesenchyme required to generate the increased appendicular structure evident within limbs. Consequently, a heterochronic shift in the AER-to-apical-fold transition has been postulated to be crucial for limb evolution. The ability to test this model has been hampered by a lack of understanding of the mechanisms controlling apical fold induction. Here we show that invasion by cells of a newly identified somite-derived lineage into the AER in zebrafish regulates apical fold induction. Ablation of these cells inhibits apical fold formation, prolongs AER activity and increases the amount of fin bud mesenchyme, suggesting that these cells could provide the timing mechanism proposed in Thorogood's clock model of the fin-to-limb transition. We further demonstrate that apical-fold inducing cells are progressively lost during gnathostome evolution;the absence of such cells within the tetrapod limb suggests that their loss may have been a necessary prelude to the attainment of limb-like structures in Devonian sarcopterygian fish. PMID:27437584

  8. Optimizing the physical conditioning of the NASCAR sprint cup pit crew athlete.

    PubMed

    Ferguson, David P; Davis, Adam M; Lightfoot, J Timothy

    2015-03-01

    Stock car racing is the largest spectator sport in the United States. As a result, National Association for Stock Car Automobile Racing (NASCAR) Sprint Cup teams have begun to invest in strength and conditioning programs for their pit crew athletes. However, there is limited knowledge regarding the physical characteristics of elite NASCAR pit crew athletes, how the NASCAR Sprint Cup season affects basic physiological parameters such as body composition, and what is the most appropriate physical training program that meets the needs of a pit crew athlete. We conducted 3 experiments involving Sprint Cup motorsport athletes to determine predictors of success at the elite level, seasonal physiological changes, and appropriate physical training programs. Our results showed that hamstring flexibility (p = 0.015) and the score on the 2-tire front run test (p = 0.012) were significant predictors of NASCAR Sprint Cup Pit Crew athlete performance. Additionally, during the off season, pit crew athletes lost lean body mass, which did not return until the middle of the season. Therefore, a strength and conditioning program was developed to optimize pit crew athlete performance throughout the season. Implementation of this strength and conditioning program in 1 NASCAR Sprint Cup team demonstrated that pit crew athletes were able to prevent lean body mass loss and have increased muscle power output from the start of the season to the end of the season.

  9. High Cup Angle and Microseparation Increase the Wear of Hip Surface Replacements

    PubMed Central

    Williams, Sophie; Isaac, Graham; Ingham, Eileen; Fisher, John

    2009-01-01

    High wear rates and high patient ion levels have been associated with high (> 55°) cup inclination angles for metal-on-metal surface replacements. Wear rates and patterns have been simulated for ceramic-on-ceramic bearings by applying microseparation to replicate head offset deficiency. We tested 39-mm metal-on-metal surface replacements (n = 5) in a hip simulator with (A) an increased cup inclination angle of 60° and (B) an increased cup inclination angle and microseparation over 2 million cycles. (A) resulted in a ninefold increase in wear rate and (B) resulted in a 17-fold increase in wear rate compared to a standard gait condition study. Wear particles produced under microseparation conditions were larger than those produced under standard conditions but of similar shape (round to oval). The data suggest both head and cup position influence the wear of surface replacements; we believe it likely bearings with high wear either have a high cup inclination angle, an offset deficient head, or a combination of both. PMID:19363640

  10. Improved automated optic cup segmentation based on detection of blood vessel bends in retinal fundus images.

    PubMed

    Hatanaka, Yuji; Nagahata, Yuuki; Muramatsu, Chisako; Okumura, Susumu; Ogohara, Kazunori; Sawada, Akira; Ishida, Kyoko; Yamamoto, Tetsuya; Fujita, Hiroshi

    2014-01-01

    Glaucoma is a leading cause of permanent blindness. Retinal imaging is useful for early detection of glaucoma. In order to evaluate the presence of glaucoma, ophthalmologists may determine the cup and disc areas and diagnose glaucoma using a vertical optic cup-to-disc (C/D) ratio and a rim-to-disc (R/D) ratio. Previously we proposed a method to determine cup edge by analyzing a vertical profile of pixel values, but this method provided a cup edge smaller than that of an ophthalmologist. This paper describes an improved method using the locations of the blood vessel bends. The blood vessels were detected by a concentration feature determined from the density gradient. The blood vessel bends were detected by tracking the blood vessels from the disc edge to the primary cup edge, which was determined by our previous method. Lastly, the vertical C/D ratio and the R/D ratio were calculated. Using forty-four images, including 32 glaucoma images, the AUCs of both the vertical C/D ratio and R/D ratio by this proposed method were 0.966 and 0.936, respectively.

  11. Antidoping programme and biological monitoring before and during the 2014 FIFA World Cup Brazil

    PubMed Central

    Baume, Norbert; Jan, Nicolas; Emery, Caroline; Mandanis, Béatrice; Schweizer, Carine; Giraud, Sylvain; Leuenberger, Nicolas; Marclay, François; Nicoli, Raul; Perrenoud, Laurent; Robinson, Neil; Dvorak, Jiri; Saugy, Martial

    2015-01-01

    Background The FIFA has implemented an important antidoping programme for the 2014 FIFA World Cup. Aim To perform the analyses before and during the World Cup with biological monitoring of blood and urine samples. Methods All qualified players from the 32 teams participating in the World Cup were tested out-of-competition. During the World Cup, 2–8 players per match were tested. Over 1000 samples were collected in total and analysed in the WADA accredited Laboratory of Lausanne. Results The quality of the analyses was at the required level as described in the WADA technical documents. The urinary steroid profiles of the players were stable and consistent with previously published papers on football players. During the competition, amphetamine was detected in a sample collected on a player who had a therapeutic use exemption for attention deficit hyperactivity disorder. The blood passport data showed no significant difference in haemoglobin values between out-of-competition and postmatch samples. Conclusions Logistical issues linked to biological samples collection, and the overseas shipment during the World Cup did not impair the quality of the analyses, especially when used as the biological passport of football players. PMID:25878079

  12. Early polyethylene wear and osteolysis with ABG acetabular cups (7- to 12-year follow-up)

    PubMed Central

    Livesley, Peter

    2005-01-01

    We reviewed 81 consecutive ABG I primary total hip replacements implanted in 72 patients between January 1993 and December 1998. The mean follow-up was 8.2 (range 7–12) years. There was significant polyethylene wear and osteolysis associated with the acetabular cup .The cumulative survival of the cup with revision being the end point at 8.2 years was 95.1% (95% CI: 92–97.6%). However, the cumulative survival of the cup with revision and aseptic loosening together was 72% (95% CI: 61–78%) and survival of the acetabular liner for wear was 62% (95% CI: 48–74%). Stem survival with revision being the end point was 100%. In spite of significant radiological failures of the cups, most patients remained asymptomatic. Though results of the ABG stems in this series were good, we advocate a regular follow-up of all these hips in view of the poor outcome of the cups. PMID:16283307

  13. Development of cup-shaped micro-electromechanical systems-based vector hydrophone

    NASA Astrophysics Data System (ADS)

    Xu, Wei; Liu, Yuan; Zhang, Guojun; Wang, Renxin; Xue, Chenyang; Zhang, Wendong; Liu, Jun

    2016-09-01

    Similar to the vital performance factors, the receiving sensitivity and the bandwidth exist interactively in the micro-electromechanical systems (MEMS)-based vector hydrophones. Some existing methods can improve the sensitivity of the hydrophone, but these improvements are usually gained at a cost of the bandwidth. However, the cup-shaped MEMS vector hydrophone that is presented in this paper can improve its sensitivity while retaining a sufficient bandwidth. The cup-shaped structure acts as a new sensing unit in the MEMS vector hydrophone, replacing the bionic columnar hair that was previously used for sensing. The relationships between the parameters of the cup-shaped structure and the sensitivity of the vector hydrophone were determined by a theoretical deduction. In addition, simulation analyses were performed, and optimized structural parameters were obtained in this work. ANSYS 15.0 simulation was used to derive the optimum characteristics for the cup-shaped structure. The results of the calibration experiments showed that the sensitivity reached up to -188.5 dB (gain of 40 dB, 1 kHz, 0 dB@1 V/μPa), and the bandwidth was in the 20 Hz-1 kHz range, which is sufficient for an underwater acoustic detection at low frequencies. This work has, thus, proved that the cup-shaped vector hydrophone has superior properties for the engineering applications.

  14. Cupping artifacts analysis and correction for a FPD-based cone-beam CT

    NASA Astrophysics Data System (ADS)

    Zhang, Li; Gao, Hewei; Li, Shuanglei; Chen, Zhiqiang; Xing, Yuxiang

    2006-02-01

    Cupping artifact is one of the most serious problems in a middle-low energy X-ray Flat panel detector (FPD)-based cone beam CT system. Both beam hardening effects and scatter could induce cupping artifacts in reconstructions and degrade image quality. In this paper, a two-step cupping-correction method is proposed to eliminate cupping: 1) scatter removal; 2) beam hardening correction. By experimental measurement using Beam Stop Array (BSA), the X-ray scatter distribution of a specific object is estimated in the projection image. After interpolation and subtraction, the primary intensity of the projection image is computed. The scatter distribution can also be obtained using convolution with a low-pass filter as kernel. The linearization is used as beam hardening correction method for one-material object. For two-material cylindrical objects, a new approach without iteration involved is present. There are three processes in this approach. Firstly, correct raw projections by the mapping function of the outer material. Secondly, reconstruct the cross-section image from the modified projections. Finally, scale the image by a simple weighting function. After scatter removal and beam hardening correction, the cupping artifacts are well removed, and the contrast of the reconstructed image is remarkably improved.

  15. The efficacy of a "double-D-shaped" wire marker for radiographic measurement of acetabular cup orientation and wear.

    PubMed

    Derbyshire, Brian; Raut, Videshnandan V

    2013-01-01

    Historically, wire markers were attached to cemented all-plastic acetabular cups to demarcate the periphery and to measure socket wear. The wire shape was either a semi-circle passing over the pole of the cup, or a circle around the cup equator. More recently, "double-D" shaped markers were introduced with a part-circular aspect passing over the pole and a semi-circular aspect parallel to the equatorial plane. This configuration enabled cup retroversion to be distinguished from anteversion. In this study, the accuracy of radiographic measurement of cup orientation and wear was assessed for cups with "double-D" and circular markers. Each cup was attached to a measurement jig which could vary the anteversion/retroversion and internal/external rotation of the cup. A metal femoral head was fixed within the socket and radiographic images were created for all combinations of cup orientation settings. The images were measured using software with automatic edge detection, and cup orientation and zero-wear accuracies were determined for each setting. The median error for cup version measurements was similar for both types of wire marker (0.2° double-D marker, -0.24° circular marker), but measurements of the circular marker were more repeatable. The median inclination errors were 2.05° (double-D marker) and 0.23° (circular marker). The median overall "zero wear" errors were 0.19 mm (double-D marker) and 0.03 mm (circular marker). Measurements of the circular wire marker were much more repeatable.

  16. Effect of acetabular cup abduction angle on wear of ultrahigh-molecular-weight polyethylene in hip simulator testing.

    PubMed

    Korduba, Laryssa A; Essner, Aaron; Pivec, Robert; Lancin, Perry; Mont, Michael A; Wang, Aiguo; Delanois, Ronald E

    2014-10-01

    The effect of acetabular component positioning on the wear rates of metal-on-polyethylene articulations has not been extensively studied. Placement of acetabular cups at abduction angles of more than 40° has been noted as a possible reason for early failure caused by increased wear. We conducted a study to evaluate the effects of different acetabular cup abduction angles on polyethylene wear rate, wear area, contact pressure, and contact area. Our in vitro study used a hip joint simulator and finite element analysis to assess the effects of cup orientation at 4 angles (0°, 40°, 50°, 70°) on wear and contact properties. Polyethylene bearings with 28-mm cobalt-chrome femoral heads were cycled in an environment mimicking in vivo joint fluid to determine the volumetric wear rate after 10 million cycles. Contact pressure and contact area for each cup abduction angle were assessed using finite element analysis. Results were correlated with cup abduction angles to determine if there were any differences among the 4 groups. The inverse relationship between volumetric wear rate and acetabular cup inclination angle demonstrated less wear with steeper cup angles. The largest abduction angle (70°) had the lowest contact area, largest contact pressure, and smallest head coverage. Conversely, the smallest abduction angle (0°) had the most wear and most head coverage. Polyethylene wear after total hip arthroplasty is a major cause of osteolysis and aseptic loosening, which may lead to premature implant failure. Several studies have found that high wear rates for cups oriented at steep angles contributed to their failure. Our data demonstrated that larger cup abduction angles were associated with lower, not higher, wear. However, this potentially "protective" effect is likely counteracted by other complications of steep cup angles, including impingement, instability, and edge loading. These factors may be more relevant in explaining why implants fail at a higher rate if

  17. Effect of acetabular cup abduction angle on wear of ultrahigh-molecular-weight polyethylene in hip simulator testing.

    PubMed

    Korduba, Laryssa A; Essner, Aaron; Pivec, Robert; Lancin, Perry; Mont, Michael A; Wang, Aiguo; Delanois, Ronald E

    2014-10-01

    The effect of acetabular component positioning on the wear rates of metal-on-polyethylene articulations has not been extensively studied. Placement of acetabular cups at abduction angles of more than 40° has been noted as a possible reason for early failure caused by increased wear. We conducted a study to evaluate the effects of different acetabular cup abduction angles on polyethylene wear rate, wear area, contact pressure, and contact area. Our in vitro study used a hip joint simulator and finite element analysis to assess the effects of cup orientation at 4 angles (0°, 40°, 50°, 70°) on wear and contact properties. Polyethylene bearings with 28-mm cobalt-chrome femoral heads were cycled in an environment mimicking in vivo joint fluid to determine the volumetric wear rate after 10 million cycles. Contact pressure and contact area for each cup abduction angle were assessed using finite element analysis. Results were correlated with cup abduction angles to determine if there were any differences among the 4 groups. The inverse relationship between volumetric wear rate and acetabular cup inclination angle demonstrated less wear with steeper cup angles. The largest abduction angle (70°) had the lowest contact area, largest contact pressure, and smallest head coverage. Conversely, the smallest abduction angle (0°) had the most wear and most head coverage. Polyethylene wear after total hip arthroplasty is a major cause of osteolysis and aseptic loosening, which may lead to premature implant failure. Several studies have found that high wear rates for cups oriented at steep angles contributed to their failure. Our data demonstrated that larger cup abduction angles were associated with lower, not higher, wear. However, this potentially "protective" effect is likely counteracted by other complications of steep cup angles, including impingement, instability, and edge loading. These factors may be more relevant in explaining why implants fail at a higher rate if

  18. Assembly and Folding of Twisted Baskets in Organic Solvents.

    PubMed

    Pratumyot, Yaowalak; Chen, Shigui; Hu, Lei; Polen, Shane M; Hadad, Christopher M; Badjić, Jovica D

    2016-09-01

    A synthetic method for obtaining enantiopure and twisted baskets of type (P)-3 is described. These chiral cavitands were found to fold quinoline gates, at the rim of their twisted platform, in acetonitrile and give molecular capsules that assemble into large unilamellar vesicles. In a less polar dichloromethane, however, cup-shaped (P)-3 packed into vesicles but with the quinoline gates in an unfolded orientation. The ability of twisted baskets to form functional nanostructured materials could be of interest for building stereoselective sensors and catalysts. PMID:27513214

  19. Pushrod assembly

    DOEpatents

    Potter, J.D.

    1984-03-30

    A pushrod assembly including a carriage mounted on a shaft for movement therealong and carrying a pushrod engageable with a load to be moved is described. A magnet is mounted on a supporting bracket for movement along such shaft. Means are provided for adjustably spacing magnet away from the carriage to obtain a selected magnetic attractive or coupling force therebetween. Movement of the supporting bracket and the magnet carried thereby pulls the carriage along with it until the selected magnetic force is exceeded by a resistance load acting on the carriage.

  20. Pushrod assembly

    DOEpatents

    Potter, Jerry D.

    1987-01-01

    A pushrod assembly including a carriage mounted on a shaft for movement therealong and carrying a pushrod engageable with a load to be moved. A magnet is mounted on a supporting bracket for movement along such shaft. Means are provided for adjustably spacing said magnet away from said carriage to obtain a selected magnetic attractive or coupling force therebetween. Movement of the supporting bracket and the magnet carried thereby pulls the carriage along with it until the selected magnetic force is exceeded by a resistance load acting on the carriage.

  1. Shingle assembly

    DOEpatents

    Dinwoodie, Thomas L.

    2007-02-20

    A barrier, such as a PV module, is secured to a base by a support to create a shingle assembly with a venting region defined between the barrier and base for temperature regulation. The first edge of one base may be interengageable with the second edge of an adjacent base to be capable of resisting first and second disengaging forces oriented perpendicular to the edges and along planes oriented parallel to and perpendicular to the base. A deflector may be used to help reduce wind uplift forces.

  2. Dump assembly

    DOEpatents

    Goldmann, L.H.

    1984-12-06

    This is a claim for a dump assembly having a fixed conduit and a rotatable conduit provided with overlapping plates, respectively, at their adjacent ends. The plates are formed with openings, respectively, normally offset from each other to block flow. The other end of the rotatable conduit is provided with means for securing the open end of a filled container thereto. Rotation of the rotatable conduit raises and inverts the container to empty the contents while concurrently aligning the conduit openings to permit flow of material therethrough. 4 figs.

  3. Apical extrusion of debris: a literature review of an inherent occurrence during root canal treatment.

    PubMed

    Tanalp, J; Güngör, T

    2014-03-01

    Extrusion of intracanal debris as well as irrigants is a common occurrence during root canal treatment, and no instrument or technique has thoroughly solved this problem. Because flare-ups may arise with any irritation directed towards periapical tissues, a shaping or irrigation technique should minimize the risk of apical extrusion, even though it may not be prevented. There has been a rapid evolution of root canal instruments and irrigation systems through the last decade, and many have been assessed for their debris extrusion potential. The purpose of this review was to identify publications regarding the evaluation of debris, bacteria and irrigant extrusion during root canal treatment. A PubMed, Ovid and MEDLINE search was conducted using the keywords "apical extrusion", "debris extrusion" and "endodontic treatment". The literature search extended over a period of more than 30 years up to 2012. Content of the review was limited to apical extrusion of debris and irrigants, extrusion of liquid by irrigation methods and bacterial extrusion. Issues relevant to apical extrusion were obtained by further search in the reference sections of the retrieved articles. The review provides an update on the current status of apical extrusion.

  4. Role of PIN-mediated auxin efflux in apical hook development of Arabidopsis thaliana.

    PubMed

    Zádníková, Petra; Petrásek, Jan; Marhavy, Peter; Raz, Vered; Vandenbussche, Filip; Ding, Zhaojun; Schwarzerová, Katerina; Morita, Miyo T; Tasaka, Masao; Hejátko, Jan; Van Der Straeten, Dominique; Friml, Jirí; Benková, Eva

    2010-02-01

    The apical hook of dark-grown Arabidopsis seedlings is a simple structure that develops soon after germination to protect the meristem tissues during emergence through the soil and that opens upon exposure to light. Differential growth at the apical hook proceeds in three sequential steps that are regulated by multiple hormones, principally auxin and ethylene. We show that the progress of the apical hook through these developmental phases depends on the dynamic, asymmetric distribution of auxin, which is regulated by auxin efflux carriers of the PIN family. Several PIN proteins exhibited specific, partially overlapping spatial and temporal expression patterns, and their subcellular localization suggested auxin fluxes during hook development. Genetic manipulation of individual PIN activities interfered with different stages of hook development, implying that specific combinations of PIN genes are required for progress of the apical hook through the developmental phases. Furthermore, ethylene might modulate apical hook development by prolonging the formation phase and strongly suppressing the maintenance phase. This ethylene effect is in part mediated by regulation of PIN-dependent auxin efflux and auxin signaling.

  5. Local auxin sources orient the apical-basal axis in Arabidopsis embryos.

    PubMed

    Robert, Hélène S; Grones, Peter; Stepanova, Anna N; Robles, Linda M; Lokerse, Annemarie S; Alonso, Jose M; Weijers, Dolf; Friml, Jiří

    2013-12-16

    Establishment of the embryonic axis foreshadows the main body axis of adults both in plants and in animals, but underlying mechanisms are considered distinct. Plants utilize directional, cell-to-cell transport of the growth hormone auxin to generate an asymmetric auxin response that specifies the embryonic apical-basal axis. The auxin flow directionality depends on the polarized subcellular localization of PIN-FORMED (PIN) auxin transporters. It remains unknown which mechanisms and spatial cues guide cell polarization and axis orientation in early embryos. Herein, we provide conceptually novel insights into the formation of embryonic axis in Arabidopsis by identifying a crucial role of localized tryptophan-dependent auxin biosynthesis. Local auxin production at the base of young embryos and the accompanying PIN7-mediated auxin flow toward the proembryo are required for the apical auxin response maximum and the specification of apical embryonic structures. Later in embryogenesis, the precisely timed onset of localized apical auxin biosynthesis mediates PIN1 polarization, basal auxin response maximum, and specification of the root pole. Thus, the tight spatiotemporal control of distinct local auxin sources provides a necessary, non-cell-autonomous trigger for the coordinated cell polarization and subsequent apical-basal axis orientation during embryogenesis and, presumably, also for other polarization events during postembryonic plant life.

  6. Influence of participation in a cup-stacking unit on timing tasks.

    PubMed

    Hart, Melanie A; Smith, Lori A; DeChant, Ann

    2005-12-01

    Cup stacking is a relatively new activity which has been promoted at conferences for physical educators as having many direct and indirect benefits, such as improved quickness. This study examined the influence of a cup-stacking instructional unit on reaction and anticipation times of 69 children in Grades 2 and 4. Within each grade participants were assigned to an experimental or a control group. The former received a 3-wk. instructional unit following the lesson plans provided by the promoters of cup stacking. The control groups received a standard physical education curriculum. Analysis indicated no significant differences in reaction and anticipation times between the groups before and after practicing the instructional unit. PMID:16491691

  7. Cultural change--empowerment at Sweetheart Cup Company, Inc., Bakery Division.

    PubMed

    Altomonte, W; Mooney, W; Sheldon, D H

    1999-08-01

    Sweetheart Cup Company always has been associated with fun products--fast food containers, straws, ballpark drink glasses, and maybe the most fun of all--ice cream cones! But making these products of pleasantry at times has not been as festive as it would seem. Sweetheart Cup Company has had its ups and downs in terms of many of the typical manufacturing measurements, but in 1994--under the direction of newly appointed Chief Operating Officer Bill McLaughlin--Sweetheart Cup Company embarked on a new mission. This time everyone would be involved, from headquarters staff in Owings Mills to the fourth-floor oven area workers in the Dallas bakery. The new process goal, "Business Excellence," as we called it, was really an implementation of Class A ERP/MRP II.

  8. Dykes, cups, saucers and sills: Analogue experiments on magma intrusion into brittle rocks

    NASA Astrophysics Data System (ADS)

    Mathieu, L.; van Wyk de Vries, B.; Holohan, Eoghan P.; Troll, Valentin R.

    2008-07-01

    Magma is transported in the crust by blade-like intrusions such as dykes, sills, saucers, and also collects in thicker laccoliths, lopoliths and plutons. Recently, the importance and great number of shallow (< 5 km) saucer-shaped intrusions has been recognized. Lopoliths and cup-shaped intrusions have also been reported in many geological contexts. Our field observations indicate that many intrusions, especially those emplaced into breccias or fractured rocks, have bulging, lobate margins and have shear faults at their bulbous terminations. Such features suggest that magma can propagate along a self-induced shear fault rather than a hydraulic tension-fracture. To investigate this we use analogue models to explore intrusion propagation in a brittle country rock. The models consist of the injection of analogue magma (honey or Golden syrup) in a granular material (sand or sieved ignimbrite) that is a good analogue for brittle or brecciated rocks. These models have the advantage (over other models that use gelatin) to well represent the properties of brittle materials by allowing both shear-faults and tension fractures to be produced at suitable stresses. In our experiments we mainly obtain vertical dykes and inverted-cone like structures that we call cup-shaped intrusions. Dykes bifurcate into cup-shaped intrusions at depths depending on their viscosity. All cup-shaped intrusions uplift a central block. By injecting against a vertical glass plate we obtain detailed observations of the intrusion propagation style. We observe that dykes commonly split and produce cup-shaped intrusions near the surface and that shear zone-related intrusions develop at the dyke tip. We conclude that many dykes propagate as a viscous indenter resulting from shear failure of host rock rather than tensional hydraulic fracturing of host rocks. The shear propagation model provides an explanation for the shape and formation of cup-shaped intrusions, saucer-sills and lopoliths.

  9. HiCUP: pipeline for mapping and processing Hi-C data

    PubMed Central

    Wingett, Steven; Ewels, Philip; Furlan-Magaril, Mayra; Nagano, Takashi; Schoenfelder, Stefan; Fraser, Peter; Andrews, Simon

    2015-01-01

    HiCUP is a pipeline for processing sequence data generated by Hi-C and Capture Hi-C (CHi-C) experiments, which are techniques used to investigate three-dimensional genomic organisation. The pipeline maps data to a specified reference genome and removes artefacts that would otherwise hinder subsequent analysis. HiCUP also produces an easy-to-interpret yet detailed quality control (QC) report that assists in refining experimental protocols for future studies. The software is freely available and has already been used for processing Hi-C and CHi-C data in several recently published peer-reviewed studies. PMID:26835000

  10. HiCUP: pipeline for mapping and processing Hi-C data.

    PubMed

    Wingett, Steven; Ewels, Philip; Furlan-Magaril, Mayra; Nagano, Takashi; Schoenfelder, Stefan; Fraser, Peter; Andrews, Simon

    2015-01-01

    HiCUP is a pipeline for processing sequence data generated by Hi-C and Capture Hi-C (CHi-C) experiments, which are techniques used to investigate three-dimensional genomic organisation. The pipeline maps data to a specified reference genome and removes artefacts that would otherwise hinder subsequent analysis. HiCUP also produces an easy-to-interpret yet detailed quality control (QC) report that assists in refining experimental protocols for future studies. The software is freely available and has already been used for processing Hi-C and CHi-C data in several recently published peer-reviewed studies.

  11. Effects of the 2010 World Cup football tournament on emergency department assault attendances in England.

    PubMed

    Quigg, Zara; Hughes, Karen; Bellis, Mark A

    2013-06-01

    We explore the impact of the 2010 World Cup, held in South Africa, on levels of assault attendances to 15 emergency departments in England. The majority (70.1%) of assault attendees during the 2010 World Cup was male and aged 18-34 years (52.5%). Assault attendances increased by 37.5% on the days that England played (P 001). Preparation for major sporting events in non-host countries should include violence prevention activity. Emergency department data can be used to identify violence associated with such events and thus inform both the targeting of prevention efforts and assessments of their effectiveness. PMID:22874732

  12. Cup-shaped Intrusions, Morphology and Emplacement Mechanism Investigate Through Analogue Modelling

    NASA Astrophysics Data System (ADS)

    Mathieu, L.; van Wyk de Vries, B.

    2007-12-01

    We investigate the morphology of large-scale shallow-depth magma intrusions and sub-volcanic complexes with analogue models. Intrusions of analogue magma are done in a granular material that can contain a ductile layer. The model surface is flat to model the formation of plutonic intrusions and it is overlain by a cone when modelling late sub-volcanic complexes. For flat-top models, we obtain cup-shaped intrusions fed by dykes. Cup-shaped intrusions are inverted-cone like bodies. They are different from saucer-shaped intrusions as they possess neither a well developed sill-base, nor an outer rim. However, like saucers, cups are shallow depth intrusions that dome the country rocks. They initiate from an advancing dyke and first develop an inverted-cone like morphology. Then, the central thickness increases and thrusts form at the edge of the domed country rocks. At this stage, the intrusions progressively involve toward a lopolith shape. By using analogue magma of various viscosities we have been able to constrain key relationships: higher intrusion viscosity causes deeper initiation and the deeper they initiate, the larger is the intrusion diameter. A natural example of such intrusion might by the circles of volcanoes like the Azufre-Lastaria (Peru) that might be overlain be a large-scale cup-shaped intrusion. When adding a cone at the surface of the model and, sometimes, a thin ductile layer in the substratum, the morphology of cup-shaped intrusions vary. Note that the ductile layer of our models is not thick enough to induce the gravitational spreading of the cone. Generally, cup-shaped intrusions are asymmetric in cross section and elliptical in plan view. Their formation creates extension structures in the cone (croissant-shaped rift, straight rift or normal fault) and thrusts in some sectors below the cone. Both types of structures are bordered by strike-slip faults. Cups and saucers share many similarities, but differ probably in the fact that saucers are

  13. Stripline fast faraday cup for measuring GHz structure of ion beams

    DOEpatents

    Bogaty, John M.

    1992-01-01

    The Stripline Fast Faraday Cup is a device which is used to quantitatively and qualitatively measure gigahertz time structure characteristics of ion beams with energies up to at least 30 Mev per nucleon. A stripline geometry is employed in conjunction with an electrostatic screen and a Faraday cup to provide for analysis of the structural characteristics of an ion beam. The stripline geometry allows for a large reduction in the size of the instrument while the electrostatic screen permits measurements of the properties associated with low speed ion beams.

  14. Cup-Drawing Behavior of High-Strength Steel Sheets Containing Different Volume Fractions of Martensite

    NASA Astrophysics Data System (ADS)

    Choi, Shi-Hoon; Kim, Dae-Wan; Yang, Hoe-Seok; Han, Seong-Ho; Yoon, Jeong Whan

    2010-06-01

    Planar anisotropy and cup-drawing behavior were investigated for high-strength steel sheets containing different volume fractions of martensite. Macrotexture analysis using XRD was conducted to capture the effect of crystallographic orientation on the planar anisotropy of high-strength steel sheets. A phenomenological yield function, Yld96, which accounts for the anisotropy of yield stress and r-values, was implemented into ABAQUS using the user subroutine UMAT. Cup drawing of high-strength steel sheets was simulated using the FEM code. The profiles of earing and thickness strain were compared with the experimentally measured results.

  15. NCI Takes Back the Defelice Cup at Ninth Annual Golf Tournament | Poster

    Cancer.gov

    By Ashley DeVine, Staff Writer After being down by a point in the morning, NCI reclaimed the Defelice Cup trophy from Leidos Biomedical Research, with a final score of 12 ½ to 11 ½, at the ninth annual Ronald H. Defelice Golf Tournament, held Oct. 13. “The tightest matches in the nine-year history of this cup competition resulted in a narrow victory for NCI and allowed NCI to take a 5–4 victory total,” said Denny Dougherty, one of the team captains for Leidos Biomed and a retired senior subcontracts advisor at what was formerly SAIC-Frederick.

  16. Local mapping for the middle-size league of RoboCup

    NASA Astrophysics Data System (ADS)

    He, Qicheng; Yang, Yimin; Zhang, Xuexi; Huang, Yanbiao

    2007-11-01

    Aiming at making up the limitation of catadioptric vision system that lacks of nearby image information, which is used for the middle-size league of RoboCup - The World Cup of Soccer Robots, this paper introduces the monocular front vision process with the purpose of improving the primary system. The paper puts forward the idea of the monocular front vision process at first, explains the algorithm of every module in detail, and comes up with the result as well as analyzes it according to the experiment at last.

  17. Electronic Nose for Quality Control of Colombian Coffee Through the Detection of Defects in ``Cup Tests''

    NASA Astrophysics Data System (ADS)

    Rodríguez, Juan C.; Duran, Cristhian M.; Reyes, Adriana X.

    2009-05-01

    This article presents a preliminary study on the analysis of samples of Colombian coffee for the detection and classification of defects (i.e. using "Cup Tests"), which was conducted in Almacafé quality control laboratory Almacafé in Cúcuta, Colombia). The results obtained show the application of an Electronic Nose (EN), called "A-NOSE," used in the coffee sector for the cupping tests. The results show that e-nose technology can be a useful tool as quality control of coffee grain.

  18. MRCK-1 Drives Apical Constriction in C. elegans by Linking Developmental Patterning to Force Generation.

    PubMed

    Marston, Daniel J; Higgins, Christopher D; Peters, Kimberly A; Cupp, Timothy D; Dickinson, Daniel J; Pani, Ariel M; Moore, Regan P; Cox, Amanda H; Kiehart, Daniel P; Goldstein, Bob

    2016-08-22

    Apical constriction is a change in cell shape that drives key morphogenetic events including gastrulation and neural tube formation. Apical force-producing actomyosin networks drive apical constriction by contracting while connected to cell-cell junctions. The mechanisms by which developmental patterning regulates these actomyosin networks and associated junctions with spatial precision are not fully understood. Here we identify a myosin light-chain kinase MRCK-1 as a key regulator of C. elegans gastrulation that integrates spatial and developmental patterning information. We show that MRCK-1 is required for activation of contractile actomyosin dynamics and elevated cortical tension in the apical cell cortex of endoderm precursor cells. MRCK-1 is apically localized by active Cdc42 at the external, cell-cell contact-free surfaces of apically constricting cells, downstream of cell fate determination mechanisms. We establish that the junctional components α-catenin, β-catenin, and cadherin become highly enriched at the apical junctions of apically constricting cells and that MRCK-1 and myosin activity are required in vivo for this enrichment. Taken together, our results define mechanisms that position a myosin activator to a specific cell surface where it both locally increases cortical tension and locally enriches junctional components to facilitate apical constriction. These results reveal crucial links that can tie spatial information to local force generation to drive morphogenesis. PMID:27451898

  19. A technique to remove a well-fixed titanium-coated RM acetabular cup in revision hip arthroplasty.

    PubMed

    Judas, Fernando M J; Dias, Rui F; Lucas, Francisco M

    2011-01-01

    A major concern during revision hip arthroplasty is acetabular bone loss and bleeding during the extraction of well-fixed cementless acetabular cup, because no interface exists between the host bone and the cup. Forceful removal of such component using curved gouges and osteotomes often leads to extended bone loss and compromises reimplantation of a new socket. In the following case report, we removed a well-fixed polyethylene titanium-coated RM acetabular cup with 20 years of follow-up, by significant wear of the polyethylene layer. The isoelastic femoral stem was also removed by mechanical failure. We report a technique for removal of the cementless acetabular cup using powered acetabular reamers. The RM cup was sequentially reamed and when the polyethylene layer was thin enough, the remaining cup was removed easily by hand tools. The acetabular bone stock is preserved and the risks of bone fractures and bleeding are minimized. To our knowledge, these principles were applied only in cemented cups. We have used this technique in 10 cases with excellent results and no complications were noted. This is a simple, reproducible, non-costly, non-timing consuming, safe and successful technique to remove well-fixed titanium-coated RM acetabular cups.

  20. Design of a tapered stripline fast Faraday cup for measurements on heavy ion beams: problems and solutions

    SciTech Connect

    Marcellini, F.; Poggi, M.

    1998-12-10

    The design of a tapered stripline fast Faraday cup (TSFFC) to perform the impedance matching between the fast cup itself and the signal line (connector, cable, and amplifier) is reported here. The frequency response of the TSFFC as a high-pass filter is analyzed from a theoretical point of view and some solutions to achieve a broadband response are given.

  1. Demonstrating the Effects of Processing on the Structure and Physical Properties of Plastic Using Disposable PETE Cups

    ERIC Educational Resources Information Center

    Erk, Kendra A.; Rhein, Morgan; Krafcik, Matthew J.; Ydstie, Sophie

    2015-01-01

    An educational activity is described in which the structure and physical properties of disposable plastic cups were directly related to the method of processing. The mechanical properties of specimens cut from the walls of poly(ethylene terephthalate) (PETE) cups, oriented parallel and perpendicular to the thermoforming direction, were measured in…

  2. Loss of apical monocilia on collecting duct principal cells impairs ATP secretion across the apical cell surface and ATP-dependent and flow-induced calcium signals.

    PubMed

    Hovater, Michael B; Olteanu, Dragos; Hanson, Elizabeth L; Cheng, Nai-Lin; Siroky, Brian; Fintha, Attila; Komlosi, Peter; Liu, Wen; Satlin, Lisa M; Bell, P Darwin; Yoder, Bradley K; Schwiebert, Erik M

    2008-06-01

    Renal epithelial cells release ATP constitutively under basal conditions and release higher quantities of purine nucleotide in response to stimuli. ATP filtered at the glomerulus, secreted by epithelial cells along the nephron, and released serosally by macula densa cells for feedback signaling to afferent arterioles within the glomerulus has important physiological signaling roles within kidneys. In autosomal recessive polycystic kidney disease (ARPKD) mice and humans, collecting duct epithelial cells lack an apical central cilium or express dysfunctional proteins within that monocilium. Collecting duct principal cells derived from an Oak Ridge polycystic kidney (orpk ( Tg737 ) ) mouse model of ARPKD lack a well-formed apical central cilium, thought to be a sensory organelle. We compared these cells grown as polarized cell monolayers on permeable supports to the same cells where the apical monocilium was genetically rescued with the wild-type Tg737 gene that encodes Polaris, a protein essential to cilia formation. Constitutive ATP release under basal conditions was low and not different in mutant versus rescued monolayers. However, genetically rescued principal cell monolayers released ATP three- to fivefold more robustly in response to ionomycin. Principal cell monolayers with fully formed apical monocilia responded three- to fivefold greater to hypotonicity than mutant monolayers lacking monocilia. In support of the idea that monocilia are sensory organelles, intentionally harsh pipetting of medium directly onto the center of the monolayer induced ATP release in genetically rescued monolayers that possessed apical monocilia. Mechanical stimulation was much less effective, however, on mutant orpk collecting duct principal cell monolayers that lacked apical central monocilia. Our data also show that an increase in cytosolic free Ca(2+) primes the ATP pool that is released in response to mechanical stimuli. It also appears that hypotonic cell swelling and

  3. Analyses of Interactions Between Heparin and the Apical Surface Proteins of Plasmodium falciparum

    NASA Astrophysics Data System (ADS)

    Kobayashi, Kyousuke; Takano, Ryo; Takemae, Hitoshi; Sugi, Tatsuki; Ishiwa, Akiko; Gong, Haiyan; Recuenco, Frances C.; Iwanaga, Tatsuya; Horimoto, Taisuke; Akashi, Hiroomi; Kato, Kentaro

    2013-11-01

    Heparin, a sulfated glycoconjugate, reportedly inhibits the blood-stage growth of the malaria parasite Plasmodium falciparum. Elucidation of the inhibitory mechanism is valuable for developing novel invasion-blocking treatments based on heparin. Merozoite surface protein 1 has been reported as a candidate target of heparin; however, to better understand the molecular mechanisms involved, we characterized the molecules that bind to heparin during merozoite invasion. Here, we show that heparin binds only at the apical tip of the merozoite surface and that multiple heparin-binding proteins localize preferentially in the apical organelles. To identify heparin-binding proteins, parasite proteins were fractionated by means of heparin affinity chromatography and subjected to immunoblot analysis with ligand-specific antibodies. All tested members of the Duffy and reticulocyte binding-like families bound to heparin with diverse affinities. These findings suggest that heparin masks the apical surface of merozoites and blocks interaction with the erythrocyte membrane after initial attachment.

  4. Breaking into the epithelial apical-junctional complex--news from pathogen hackers.

    PubMed

    Vogelmann, Roger; Amieva, Manuel R; Falkow, Stanley; Nelson, W James

    2004-02-01

    The epithelial apical-junctional complex is a key regulator of cellular functions. In addition, it is an important target for microbial pathogens that manipulate the cell to survive, proliferate and sometimes persist within a host. Out of a myriad of potential molecular targets, some bacterial and viral pathogens have selected a subset of protein targets at the apical-junctional complex of epithelial cells. Studying how microbes use these targets also teaches us about the inherent physiological properties of host molecules in the context of normal junctional structure and function. Thus, we have learned that three recently uncovered components of the apical-junctional complex of the Ig superfamily--junctional adhesion molecule, Nectin and the coxsackievirus and adenovirus receptor--are important regulators of junction structure and function and represent critical targets of microbial virulence gene products.

  5. Alterations of the apical junctional complex and actin cytoskeleton and their role in colorectal cancer progression

    PubMed Central

    Gehren, Adriana Sartorio; Rocha, Murilo Ramos; de Souza, Waldemir Fernandes; Morgado-Díaz, José Andrés

    2015-01-01

    Colorectal cancer represents the fourth highest mortality rate among cancer types worldwide. An understanding of the molecular mechanisms that regulate their progression can prevents or reduces mortality due to this disease. Epithelial cells present an apical junctional complex connected to the actin cytoskeleton, which maintains the dynamic properties of this complex, tissue architecture and cell homeostasis. Several studies have indicated that apical junctional complex alterations and actin cytoskeleton disorganization play a critical role in epithelial cancer progression. However, few studies have examined the existence of an interrelation between these 2 components, particularly in colorectal cancer. This review discusses the recent progress toward elucidating the role of alterations of apical junctional complex constituents and of modifications of actin cytoskeleton organization and discusses how these events are interlinked to modulate cellular responses related to colorectal cancer progression toward successful metastasis. PMID:26451338

  6. Distinct apical and basolateral mechanisms drive PCP-dependent convergent extension of the mouse neural plate

    PubMed Central

    Williams, Margot; Yen, Weiwei; Lu, Xiaowei; Sutherland, Ann

    2014-01-01

    Summary The mechanisms of tissue convergence and extension (CE) driving axial elongation in mammalian embryos, and in particular, the cellular behaviors underlying CE in the epithelial neural tissue, have not been identified. Here we show that mouse neural cells undergo mediolaterally biased cell intercalation and exhibit both apical boundary rearrangement and polarized basolateral protrusive activity. Planar polarization and coordination of these two cell behaviors is essential for neural CE, as shown by failure of mediolateral intercalation in embryos mutant for two proteins associated with planar cell polarity signaling: Vangl2 and Ptk7. Embryos with mutations in Ptk7 fail to polarize cell behaviors within the plane of the tissue, while Vangl2 mutant embryos maintain tissue polarity and basal protrusive activity, but are deficient in apical neighbor exchange. Neuroepithelial cells in both mutants fail to apically constrict, leading to craniorachischisis. These results reveal a cooperative mechanism for cell rearrangement during epithelial morphogenesis. PMID:24703875

  7. Integrins regulate apical constriction via microtubule stabilization in the Drosophila eye disc epithelium.

    PubMed

    Fernandes, Vilaiwan M; McCormack, Kasandra; Lewellyn, Lindsay; Verheyen, Esther M

    2014-12-24

    During morphogenesis, extracellular signals trigger actomyosin contractility in subpopulations of cells to coordinate changes in cell shape. To illuminate the link between signaling-mediated tissue patterning and cytoskeletal remodeling, we study the progression of the morphogenetic furrow (MF), the wave of apical constriction that traverses the Drosophila eye imaginal disc preceding photoreceptor neurogenesis. Apical constriction depends on actomyosin contractility downstream of the Hedgehog (Hh) and bone morphogenetic protein (BMP) pathways. We identify a role for integrin adhesion receptors in MF progression. We show that Hh and BMP regulate integrin expression, the loss of which disrupts apical constriction and slows furrow progression; conversely, elevated integrins accelerate furrow progression. We present evidence that integrins regulate MF progression by promoting microtubule stabilization, since reducing microtubule stability rescues integrin-mediated furrow acceleration. Thus, integrins act as a genetic link between tissue-level signaling events and morphological change at the cellular level, leading to morphogenesis and neurogenesis in the eye.

  8. The apical oblique view of the clavicle: its usefulness in neonatal and childhood trauma.

    PubMed

    Weinberg, B; Seife, B; Alonso, P

    1991-01-01

    We analyzed clavicular radiographs of 26 patients with a history of trauma. The apical oblique projection of the clavicle was obtained with the injured side of the patient angled 45 degrees towards the X-ray tube and a 20 degrees cephalad angulation of the X-ray beam. This view proved to be more informative than the routine apical anteroposterior projection. It is especially effective in detecting nondisplaced fractures of the middle third of the clavicle in neonates and children. To verify our findings, we obtained apical anteroposterior and oblique radiographs of a specimen adult clavicle. On the oblique view with 20 degrees cephalad angulation of the X-ray beam, the measurements of the projected lengths of the anatomical specimen, especially those of the middle portion of the clavicle, were very close to the corresponding anatomical lengths.

  9. Apical Closure of Nonvital Permanent Teeth: 15 Months Follow-up Study of Four Cases

    PubMed Central

    Umashetty, Girish; Patil, Basanagouda; Rao, Nandan; Ajgaonkar, Nishant

    2015-01-01

    Obtaining a complete seal of the root canal system is a major problem in performing root canal treatment in nonvital teeth with incomplete root development and wide open apices. The aim was to study apexification using mineral trioxide aggregate (MTA), clinically and radiographically over a period of 15 months. MTA was used in four cases of teeth with incomplete root development in order to achieve an apical seal and the remaining canal was obturated with gutta-percha. Clinical and radiographic assessments of teeth were done. The clinical and radiographic results indicated that apexification procedure was predictable by using MTA. The total number of patients’ visits and the total time duration required to obtain an apical barrier using MTA was markedly less than that of conventional techniques using calcium hydroxide. PMID:26028910

  10. 'Our struggles are bigger than the World Cup': civic activism, state-society relations and the socio-political legacies of the 2010 FIFA World Cup.

    PubMed

    Cornelissen, Scarlett

    2012-06-01

    South Africa's hosting of the 2010 FIFA World Cup saw a large number of public demonstrations, strikes and other forms of civic campaigning. World Cup activism was both preceded and followed by extensive and intensifying public unrest and industrial action that in the period before the tournament, threatened to derail the event. This paper assesses the motivations, forms and implications of the activism during South Africa's staging of the FIFA finals and interprets them against the larger context of shifting state-society relations in the country. There are two purposes to the analysis. First, to explore the underlying internal social forces that gave shape to the protests at the time, and the possible influence of the exogenous politics of mega-event social mobilization. Second, the implications and outcomes of these dynamics for longer term socio-political processes in the country are considered. The activism displayed many of the features of the politics of contestation of sport mega-events today. Importantly, however, the activism stemmed from a particular systemic dynamic and reflected changing relations in the post-apartheid political community. Therefore, while the World Cup was used as a strategic opportunity by many advocacy groups, it was one that rather fleetingly and ambivalently presented an additional platform to such groups in an otherwise on-going set of political battles. Rather than a strong case study of sport's transformative capacity, the civic campaigning during South Africa's World Cup demonstrates the way a sport mega-event can be used as a strategic entry point by civil society groups in their engagement with the state, although this can occur with greater or lesser success.

  11. Apical access and closure devices for transapical transcatheter heart valve procedures.

    PubMed

    Ferrari, Enrico

    2016-01-01

    The majority of transcatheter aortic valve implantations, structural heart procedures and the newly developed transcatheter mitral valve repair and replacement are traditionally performed either through a transfemoral or a transapical access site, depending on the presence of severe peripheral vascular disease or anatomic limitations. The transapical approach, which carries specific advantages related to its antegrade nature and the short distance between the introduction site and the cardiac target, is traditionally performed through a left anterolateral mini-thoracotomy and requires rib retractors, soft tissue retractors and reinforced apical sutures to secure, at first, the left ventricular apex for the introduction of the stent-valve delivery systems and then to seal the access site at the end of the procedure. However, despite the advent of low-profile apical sheaths and newly designed delivery systems, the apical approach represents a challenge for the surgeon, as it has the risk of apical tear, life-threatening apical bleeding, myocardial damage, coronary damage and infections. Last but not least, the use of large-calibre stent-valve delivery systems and devices through standard mini-thoracotomies compromises any attempt to perform transapical transcatheter structural heart procedures entirely percutaneously, as happens with the transfemoral access site, or via a thoracoscopic or a miniaturised video-assisted percutaneous technique. During the past few years, prototypes of apical access and closure devices for transapical heart valve procedures have been developed and tested to make this standardised successful procedure easier. Some of them represent an important step towards the development of truly percutaneous transcatheter transapical heart valve procedures in the clinical setting. PMID:26900765

  12. Cytokinin is required for escape but not release from auxin mediated apical dominance

    PubMed Central

    Müller, Dörte; Waldie, Tanya; Miyawaki, Kaori; To, Jennifer PC; Melnyk, Charles W; Kieber, Joseph J; Kakimoto, Tatsuo; Leyser, Ottoline

    2015-01-01

    Auxin produced by an active primary shoot apex is transported down the main stem and inhibits the growth of the axillary buds below it, contributing to apical dominance. Here we use Arabidopsis thaliana cytokinin (CK) biosynthetic and signalling mutants to probe the role of CK in this process. It is well established that bud outgrowth is promoted by CK, and that CK synthesis is inhibited by auxin, leading to the hypothesis that release from apical dominance relies on an increased supply of CK to buds. Our data confirm that decapitation induces the expression of at least one ISOPENTENYLTRANSFERASE (IPT) CK biosynthetic gene in the stem. We further show that transcript abundance of a clade of the CK-responsive type-A Arabidopsis response regulator (ARR) genes increases in buds following CK supply, and that, contrary to their typical action as inhibitors of CK signalling, these genes are required for CK-mediated bud activation. However, analysis of the relevant arr and ipt multiple mutants demonstrates that defects in bud CK response do not affect auxin-mediated bud inhibition, and increased IPT transcript levels are not needed for bud release following decapitation. Instead, our data suggest that CK acts to overcome auxin-mediated bud inhibition, allowing buds to escape apical dominance under favourable conditions, such as high nitrate availability. Significance Statement It has been proposed that the release of buds from auxin-mediated apical dominance following decapitation requires increased cytokinin biosynthesis and consequent increases in cytokinin supply to buds. Here we show that in Arabidopsis, increases in cytokinin appear to be unnecessary for the release of buds from apical dominance, but rather allow buds to escape the inhibitory effect of apical auxin, thereby promoting bud activation in favourable growth conditions. PMID:25904120

  13. Apical access and closure devices for transapical transcatheter heart valve procedures.

    PubMed

    Ferrari, Enrico

    2016-01-01

    The majority of transcatheter aortic valve implantations, structural heart procedures and the newly developed transcatheter mitral valve repair and replacement are traditionally performed either through a transfemoral or a transapical access site, depending on the presence of severe peripheral vascular disease or anatomic limitations. The transapical approach, which carries specific advantages related to its antegrade nature and the short distance between the introduction site and the cardiac target, is traditionally performed through a left anterolateral mini-thoracotomy and requires rib retractors, soft tissue retractors and reinforced apical sutures to secure, at first, the left ventricular apex for the introduction of the stent-valve delivery systems and then to seal the access site at the end of the procedure. However, despite the advent of low-profile apical sheaths and newly designed delivery systems, the apical approach represents a challenge for the surgeon, as it has the risk of apical tear, life-threatening apical bleeding, myocardial damage, coronary damage and infections. Last but not least, the use of large-calibre stent-valve delivery systems and devices through standard mini-thoracotomies compromises any attempt to perform transapical transcatheter structural heart procedures entirely percutaneously, as happens with the transfemoral access site, or via a thoracoscopic or a miniaturised video-assisted percutaneous technique. During the past few years, prototypes of apical access and closure devices for transapical heart valve procedures have been developed and tested to make this standardised successful procedure easier. Some of them represent an important step towards the development of truly percutaneous transcatheter transapical heart valve procedures in the clinical setting.

  14. The Zweymüller threaded cup: a choice in revision? Migration analysis and follow-up after 6 years.

    PubMed

    Schröder, Jörg Hartmut; Matziolis, Georg; Tuischer, Jens; Leutloff, Dirk; Duda, Georg Norbert; Perka, Carsten

    2006-06-01

    Excellent long-term results are reported for threaded cups with an osteointegrable surface in primary interventions. So far, little data are available on the use of such implants in revision cases. We investigated 30 loosened Aesculap PM threaded cups (Tuttlingen, Germany) with a smooth surface, revised with a conical, corundum-blasted Zweymüller threaded cup (Zweymüller Alloclassic CSF cup, Zimmer, Warsaw, Ind). Aseptic radiological loosening was seen in 8% of cases, and a survival rate of 95% was achieved after 6.1 years. Average migration was 1.4 mm cranially and 0.7 mm medially. The Harris hip score improved from 42 points preoperatively to 75 points at follow-up. Good medium-term results are possible after revision using a threaded cup with an osteointegrable surface, but not if segmental acetabular margin defects are present. PMID:16781400

  15. Non-destructively differentiating the roles of creep, wear and oxidation in long-term in vivo exposed polyethylene cups.

    PubMed

    Pezzotti, Giuseppe; Takahashi, Yasuhito; Takamatsu, Seita; Puppulin, Leonardo; Nishii, Takashi; Miki, Hidenobu; Sugano, Nobuhiko

    2011-01-01

    Wear of polyethylene acetabular cups in patients of total hip arthroplasty is routinely deduced from the penetration of the femoral head into the acetabular liner as observed in the radiographs. However, the linear penetration thus measured represents the cumulative contribution of two components, one due to wear, and the other due to creep or irreversible deformation of the polyethylene structure. The erroneous attribution to wear of the entire penetration displacement of the head in the cup might lead to misinterpretation of the actual performance of acetabular cups. The aim of this study was to quantify the head displacement components due to wear and to creep, as they occur in vivo in acetabular cups, and to relate them to the oxidation state of the material by means of advanced Raman spectroscopy procedures. Throughout the investigation, we compared the behaviors on the molecular scale of acetabular cups subjected to different sterilization methods (i.e., γ-irradiation and ethylene oxide treatment). PMID:21067657

  16. Reasons for Apical Surgery Treatment in an Underserved New York City Population.

    PubMed

    Hasselgren, Gunnar; Patel, Pratik; Alhassany, Hashim; Kunzel, Carol

    2016-04-01

    Endodontic retreatment often involves remaking restorations. The total cost may steer the treatment towards surgery. The aim of this study was to retrospectively record the reasons for performing apical surgery in an economically deprived patient population. The clinical reasons (59%) for apical surgery were most common, but the nonclinical (financial) reasons (41%) emerged as a major cause. The finding that 41% of the apicoectomies were performed because of nonclinical constraints is a high figure and may not reflect the situation generally. Still, economic factors potentially play a major role in the selection of surgical versus nonsurgical endodontic retreatment. PMID:27348949

  17. Ultrastructural changes in shoot apical meristem of canola (Brassica napus cv. Symbol) treated with sodium chloride.

    PubMed

    Mahmoodzadeh, Homa

    2008-04-15

    In the present research, structure and ultrastructure of shoot apical meristem of canola (Brassica napus cv. Symbol) under salinity conditions were investigated. The experiments were conducted in five groups (0, 3, 6, 9, 12 dS m(-1)) under greenhouse conditions. Sampling of apical meristem and TEM tissue preparation procedure were carried out. Semithin and ultrathin sections were prepared and viewed in light and electron microscopy, respectively. The results included reduction of meristem size, disorders in meristem structure. Also formation of autophagic vacuoles was observed that is probably one of the plant responses to salt stress for more water storage in these vacuoles and decreasing of cell water requirements.

  18. Gravity-induced buds formation from protonemata apical cells in the mosses

    NASA Astrophysics Data System (ADS)

    Kyyak, Natalia; Khorkavtsiv, Yaroslava

    The acceleration of moss protonemata development after the exit it to light from darkness is important gravidependent morphogenetic manifestation of the moss protonemata. The accelerated development of mosses shows in transformation of apical protonemata cells into the gametophores buds (Ripetskyj et al., 1999). In order to establish, that such reaction on gravitation is general property of gravisensity species, or its typical only for single moss species, experiments with the following moss species - Bryum intermedium (Ludw.) Brig., Bryum caespiticium Hedw., Bryum argenteum Hedw., Dicranodontium denudatum (Brid.) Britt. were carried out. All these species in response to influence of gravitation were capable to form rich bunches of gravitropical protonemata in darkness, that testified to their gravisensity. After the transference of Petri dishes with gravitropical protonemata from darkness on light was revealed, that in 3 of the investigated species the gametophores buds were absent. Only B. argenteum has reacted to action of gravitation by buds formation from apical cells of the gravitropical protonemata. With the purpose of strengthening of buds formation process, the experiments with action of exogenous kinetin (in concentration of 10 (-6) M) were carried out. Kinetin essentially stimulated apical buds formation of B. argenteum. The quantity of apical buds has increased almost in three times in comparison with the control. Besides, on separate stolons a few (3-4) buds from one apical cell were formed. Experimentally was established, that the gametophores buds formation in mosses is controlled by phytohormones (Bopp, 1985; Demkiv et al., 1991). In conditions of gravity influence its essentially accelerated. Probably, gravity essentially strengthened acropetal transport of phytohormones and formation of attractive center in the protonemata apical cell. Our investigations have allowed to make the conclusion, that gravi-dependent formation of the apical buds is

  19. Thermocouple assembly

    DOEpatents

    Thermos, Anthony Constantine; Rahal, Fadi Elias

    2002-01-01

    A thermocouple assembly includes a thermocouple; a plurality of lead wires extending from the thermocouple; an insulating jacket extending along and enclosing the plurality of leads; and at least one internally sealed area within the insulating jacket to prevent fluid leakage along and within the insulating jacket. The invention also provides a method of preventing leakage of a fluid along and through an insulating jacket of a thermocouple including the steps of a) attaching a plurality of lead wires to a thermocouple; b) adding a heat sensitive pseudo-wire to extend along the plurality of lead wires; c) enclosing the lead wires and pseudo-wire inside an insulating jacket; d) locally heating axially spaced portions of the insulating jacket to a temperature which melts the pseudo-wire and fuses it with an interior surface of the jacket.

  20. Swivel assembly

    DOEpatents

    Hall, David R.; Pixton, David S.; Briscoe, Michael; Bradford, Kline; Rawle, Michael; Bartholomew, David B.; McPherson, James

    2007-03-20

    A swivel assembly for a downhole tool string comprises a first and second coaxial housing cooperatively arranged. The first housing comprises a first transmission element in communication with surface equipment. The second housing comprises a second transmission element in communication with the first transmission element. The second housing further comprises a third transmission element adapted for communication with a network integrated into the downhole tool string. The second housing may be rotational and adapted to transmit a signal between the downhole network and the first housing. Electronic circuitry is in communication with at least one of the transmission elements. The electronic circuitry may be externally mounted to the first or second housing. Further, the electronic circuitry may be internally mounted in the second housing. The electronic circuitry may be disposed in a recess in either first or second housing of the swivel.

  1. Oscillatory behaviors and hierarchical assembly of contractile structures in intercalating cells

    NASA Astrophysics Data System (ADS)

    Fernandez-Gonzalez, Rodrigo; Zallen, Jennifer A.

    2011-08-01

    Fluctuations in the size of the apical cell surface have been associated with apical constriction and tissue invagination. However, it is currently not known if apical oscillatory behaviors are a unique property of constricting cells or if they constitute a universal feature of the force balance between cells in multicellular tissues. Here, we set out to determine whether oscillatory cell behaviors occur in parallel with cell intercalation during the morphogenetic process of axis elongation in the Drosophila embryo. We applied multi-color, time-lapse imaging of living embryos and SIESTA, an integrated tool for automated and semi-automated cell segmentation, tracking, and analysis of image sequences. Using SIESTA, we identified cycles of contraction and expansion of the apical surface in intercalating cells and characterized them at the molecular, cellular, and tissue scales. We demonstrate that apical oscillations are anisotropic, and this anisotropy depends on the presence of intact cell-cell junctions and spatial cues provided by the anterior-posterior patterning system. Oscillatory cell behaviors during axis elongation are associated with the hierarchical assembly and disassembly of contractile actomyosin structures at the medial cortex of the cell, with actin localization preceding myosin II and with the localization of both proteins preceding changes in cell shape. We discuss models to explain how the architecture of cytoskeletal networks regulates their contractile behavior and the mechanisms that give rise to oscillatory cell behaviors in intercalating cells.

  2. Clinical and radiographic results and wear performance in different generations of a cementless porous-coated acetabular cup

    PubMed Central

    García-Cimbrelo, E.

    2007-01-01

    We compared clinical results and wear performance in two different generations of a cementless porous-coated cup, analysing the long-term results of 83 uncemented Harris-Galante I cups (32-mm femoral head) and 93 uncemented Harris-Galante II cups (28-mm femoral head). All polyethylene liners were gamma irradiated in air. Polyethylene linear wear was estimated using a software package. The minimum follow-up was 10 years. Nine Harris-Galante I cups and two Harris-Galante II cups were revised due to aseptic loosening or polyethylene problems. The mean femoral head penetration at 6 weeks after surgery was 0.15 ± 0.05 mm for the Harris-Galante I cups and 0.12 ± 0.03 for the Harris-Galante II cups (p < 0.001);but mean wear was 0.13 ± 0.23 mm per year for the Harris-Galante I cups and 0.11 ± 0.10 for the Harris-Galante II cups (p = 0.740). Most of the metallic shells in both groups showed stable fixation. The so-called second-generation cups had lower initial polyethylene wear that resulted in less polyethylene wear at the latest the follow-up, but the overall wear rate was similar in both groups despite the different femoral head sizes and the improved locking mechanism. PMID:17265157

  3. 77 FR 73311 - Special Local Regulation and Safety Zone; America's Cup Sailing Events, San Francisco, CA...

    Federal Register 2010, 2011, 2012, 2013, 2014

    2012-12-10

    ...'' scheduled to occur in July, August, and September, 2013 (77 FR 41902). Among the regulations established by... published on July 17, 2012, (77 FR 41902), make the following correction: Sec. 100.T11-0551B 0 1. On page... coordinates of the transit zone established for the 2013 America's Cup events. This document corrects...

  4. Controlling the volumetric parameters of nitrogen-doped carbon nanotube cups.

    PubMed

    Allen, Brett L; Keddie, Matthew B; Star, Alexander

    2010-07-01

    Analogous to multiwalled carbon nanotubes, nitrogen-doped carbon nanotube cups (NCNCs) have been synthesized with defined volumetric parameters (diameter and segment lengths) by controlling the catalyst particle size and the concentration of nitrogen precursor utilized in the chemical vapor deposition (CVD) reaction, allowing for tailored interior cavity space of cross-linked NCNCs, i.e. nanocapsules.

  5. Cupping therapy: A prudent remedy for a plethora of medical ailments

    PubMed Central

    Mehta, Piyush; Dhapte, Vividha

    2015-01-01

    Since ancient times, complementary and alternative medicine (CAM; 補充與替代醫學 bǔ chōng yǔ tì dài yī xué) have played an important role in human health and welfare. Many therapeutic approaches in healthcare outside the realm of conventional medicine persist in various parts of the world. There is considerable scientific and commercial potential in CAM, which needs to be explored precisely. Cupping therapy (拔罐療法 bá guàn liáo fǎ), one of the CAM, is practiced across the world. This therapy is believed to act by correcting imbalances in the internal bio field, such as by restoring the flow of “Qi (氣qì)”. Cupping involves applying a heated cup to generate a partial vacuum that mobilizes the blood flow and promotes effective healing. This review outlines various tools and techniques of cupping therapy. PMID:26151023

  6. Offside decision making in the 2002 and 2006 FIFA World Cups.

    PubMed

    Catteeuw, Peter; Gilis, Bart; García-Aranda, José-María; Tresaco, Fernando; Wagemans, Johan; Helsen, Werner

    2010-08-01

    The first objective of the present study was to examine the accuracy of offside judgements of assistant referees during the 2006 World Cup and to compare overall results with performances of assistant referees during the 2002 World Cup. Second, we also examined underlying mechanisms leading to incorrect decisions. According to the definition used for the 2002 World Cup, the results revealed a decrease in the number of incorrect flag signals during the 2006 (24/240 or 10.0%) compared with the 2002 World Cup (58/222 or 26.1%) (P < 0.001). For accuracy of all potential offside situations, according to a new definition (with the attacker 2 m in front or behind the second-last defender), the error percentage was 7.6% (17 flag errors and 9 non-flag errors out of 342 situations). Overall, quality of offside decisions was not influenced by the position of the assistant referee relative to the offside line. In addition, flag errors can best be explained by the perceptual illusion induced by the flash-lag effect. PMID:20686996

  7. Biostereometrics In Ophthalmology For Measurement Of The Optic Disc Cup In Glaucoma

    NASA Astrophysics Data System (ADS)

    Schwartz, Bernard; Takamoto, Takenori

    1980-07-01

    Glaucoma is a disease characterized by increased ocular pressure with optic nerve atrophy and loss of visual field or side vision which eventually leads to blindness. The surface of the portion of the optic nerve within the eye, the optic disc, becomes depressed and its contours are altered. The optic disc becomes more cupped with increasing progress of the disease. For measurement of the cup, retinal cameras can provide simultaneous stereo photographs of the optic disc taken through the pupil. However, the photographs have to be obtained at a narrow angle due to the limit of the size of the dilated pupil. Our studies of the geometry of the stereo photographs show a greater error in depth compared to horizontal dimensions because of this biological limit. Similarly, data for the optimal conditions for photography of the optic disc, including aperture size and magnification have been obtained. Since the changes in the optic disc can progress with increase of the desease, photogrammetric techniques for measuring relative changes in the dimensions of the cup have been developed. Both subsequent and initial photographs are measured after being similarly oriented in space. The photogrammetric measurement of changes in the optic disc cup in glaucoma has potential as a useful technique which can have wide clinical application.

  8. Design optimization of cementless metal-backed cup prostheses using the concept of functionally graded material.

    PubMed

    Hedia, H S; El-Midany, T T; Shabara, M A N; Fouda, N

    2006-09-01

    Metal backing has been widely used in acetabular cup design. A stiff backing for a polyethylene liner was initially believed to be mechanically favourable. Yet, recent studies of the load transfer around acetabular cups have shown that a stiff backing causes two problems. It generates higher stress peaks around the acetabular rim than those caused by full polyethylene cups and reduces the stresses transferred to the dome of the acetabulum causing stress shielding. The aim of this study is to overcome these two problems by improving the design of cementless metal-backed acetabular cups using the two-dimensional functionally graded material (FGM) concept through finite-element analysis and optimization techniques. It is found that the optimal 2D FGM model must have three bioactive materials of hydroxyapatite, Bioglass and collagen. This optimal material reduces the stress shielding at the dome of the acetabulum by 40% and 37% compared with stainless steel and titanium metal backing shells, respectively. In addition, using the 2D FGM model reduces the maximum interface shear stress in the bone by 31% compared to the titanium metal backing shell.

  9. 76 FR 58108 - Safety Zone; Ryder Cup Captain's Duel Golf Shot, Chicago River, Chicago, IL

    Federal Register 2010, 2011, 2012, 2013, 2014

    2011-09-20

    ... SECURITY Coast Guard 33 CFR Part 165 RIN 1625-AA00 Safety Zone; Ryder Cup Captain's Duel Golf Shot, Chicago... restrict vessels from a portion of the Chicago River during a golfing event that will involve hitting golf... the public and their vessels from the hazards associated with golf balls being hit from land onto...

  10. ESCRT-III drives the final stages of CUPS maturation for unconventional protein secretion

    PubMed Central

    Curwin, Amy J; Brouwers, Nathalie; Alonso Y Adell, Manuel; Teis, David; Turacchio, Gabriele; Parashuraman, Seetharaman; Ronchi, Paolo; Malhotra, Vivek

    2016-01-01

    The unconventional secretory pathway exports proteins that bypass the endoplasmic reticulum. In Saccharomyces cerevisiae, conditions that trigger Acb1 secretion via this pathway generate a Grh1 containing compartment composed of vesicles and tubules surrounded by a cup-shaped membrane and collectively called CUPS. Here we report a quantitative assay for Acb1 secretion that reveals requirements for ESCRT-I, -II, and -III but, surprisingly, without the involvement of the Vps4 AAA-ATPase. The major ESCRT-III subunit Snf7 localizes transiently to CUPS and this was accelerated in vps4Δ cells, correlating with increased Acb1 secretion. Microscopic analysis suggests that, instead of forming intraluminal vesicles with the help of Vps4, ESCRT-III/Snf7 promotes direct engulfment of preexisting Grh1 containing vesicles and tubules into a saccule to generate a mature Acb1 containing compartment. This novel multivesicular / multilamellar compartment, we suggest represents the stable secretory form of CUPS that is competent for the release of Acb1 to cells exterior. DOI: http://dx.doi.org/10.7554/eLife.16299.001 PMID:27115345

  11. Influence of cementless cup surface on stability and bone fixation 2 years after total hip arthroplasty.

    PubMed

    Urbański, Wiktor; Krawczyk, Artur; Dragan, Szymon Ł; Kulej, Mirosław; Dragan, Szymon F

    2012-01-01

    Loss of fixation between bone and implant surface is one of the main treatment problems in total hip arthroplasty. It might lead to implant instability, bone loss and treatment failure resulting in revision surgery. Surface modification is a method for improving bone response to implant and increasing implant osseointegration. However, the currently applied modifications such as hydroxyapatite coatings do not meet expectation and do not provide good clinical result. The object of the study was to evaluate the influence of acetabular cup surface modification on fixation and bone remodelling in total hip arthroplasty. Clinical and radiological outcomes were evaluated in patients two years after cementless total hip replacement. Two groups were compared: patients with acetabular component with uncoated titanium surface and patients with hydroxyapatite-coated acetabular surface. Hips X-rays were analysed for early signs of losing stability of acetabular cups. Two years after surgery the analysis of X-rays did not reveal any statistical differences in stability, migration of acetabular components of endoprosthesis between both groups. No differences were also observed in bone remodelling around implants. Particularly high percentage of cups, i.e. 17.64%, were classified into the group with high risk of early implant loosening, i.e., the group with HA coatings. Hydroxyapatite coatings on titanium cementless acetabular cups implanted by press-fit technique have no influence on their stability, bone-implant fixation and the remodelling of bone surrounding an implant two years after surgery.

  12. 33 CFR 100.916 - Chris Craft Silver Cup Races, Algonac, MI.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Chris Craft Silver Cup Races, Algonac, MI. 100.916 Section 100.916 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY REGATTAS AND MARINE PARADES SAFETY OF LIFE ON NAVIGABLE WATERS § 100.916 Chris Craft Silver...

  13. 33 CFR 100.916 - Chris Craft Silver Cup Races, Algonac, MI.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Chris Craft Silver Cup Races, Algonac, MI. 100.916 Section 100.916 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY REGATTAS AND MARINE PARADES SAFETY OF LIFE ON NAVIGABLE WATERS § 100.916 Chris Craft Silver...

  14. 33 CFR 100.916 - Chris Craft Silver Cup Races, Algonac, MI.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Chris Craft Silver Cup Races, Algonac, MI. 100.916 Section 100.916 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY REGATTAS AND MARINE PARADES SAFETY OF LIFE ON NAVIGABLE WATERS § 100.916 Chris Craft Silver...

  15. 33 CFR 100.916 - Chris Craft Silver Cup Races, Algonac, MI.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Chris Craft Silver Cup Races, Algonac, MI. 100.916 Section 100.916 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY REGATTAS AND MARINE PARADES SAFETY OF LIFE ON NAVIGABLE WATERS § 100.916 Chris Craft Silver...

  16. 33 CFR 100.916 - Chris Craft Silver Cup Races, Algonac, MI.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Chris Craft Silver Cup Races, Algonac, MI. 100.916 Section 100.916 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY REGATTAS AND MARINE PARADES SAFETY OF LIFE ON NAVIGABLE WATERS § 100.916 Chris Craft Silver...

  17. 33 CFR 100.918 - Detroit APBA Gold Cup, Detroit, MI.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 33 Navigation and Navigable Waters 1 2014-07-01 2014-07-01 false Detroit APBA Gold Cup, Detroit, MI. 100.918 Section 100.918 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY REGATTAS AND MARINE PARADES SAFETY OF LIFE ON NAVIGABLE WATERS § 100.918 Detroit APBA Gold...

  18. 33 CFR 100.918 - Detroit APBA Gold Cup, Detroit, MI.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 33 Navigation and Navigable Waters 1 2012-07-01 2012-07-01 false Detroit APBA Gold Cup, Detroit, MI. 100.918 Section 100.918 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY REGATTAS AND MARINE PARADES SAFETY OF LIFE ON NAVIGABLE WATERS § 100.918 Detroit APBA Gold...

  19. 33 CFR 100.918 - Detroit APBA Gold Cup, Detroit, MI.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 33 Navigation and Navigable Waters 1 2010-07-01 2010-07-01 false Detroit APBA Gold Cup, Detroit, MI. 100.918 Section 100.918 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY REGATTAS AND MARINE PARADES SAFETY OF LIFE ON NAVIGABLE WATERS § 100.918 Detroit APBA Gold...

  20. [Recommendations for Chilean travelers to the FIFA World Cup 2014 in Brazil].

    PubMed

    Perret, Cecilia; Weitzel, Thomas

    2014-04-01

    This article provides a checklist of precautions and vaccines for Chilean travelers attending the FIFA World Cup 2014 in Brazil. It aims to help physicians to prepare visitors of this mass gathering and summarizes useful hints to avoid infectious diseases considering the circumstances and availabilities in Chile.

  1. 78 FR 21260 - Safety Zone; Lubbers Cup Regatta; Spring Lake, MI

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-04-10

    .... SUPPLEMENTARY INFORMATION: Table of Acronyms DHS Department of Homeland Security FR Federal Register NPRM Notice... SECURITY Coast Guard 33 CFR PART 165 RIN 1625-AA00 Safety Zone; Lubbers Cup Regatta; Spring Lake, MI AGENCY... safety zone on Spring Lake in Spring Lake, Michigan. This safety zone is intended to restrict...

  2. Simultaneous GC-MS determination of seven phthalates in total and migrated portions of paper cups.

    PubMed

    Park, Yu Na; Choi, Min Sun; Rehman, Shaheed Ur; Gye, Myung Chan; Yoo, Hye Hyun

    2016-05-01

    Phthalate acid esters are widely used as plasticizers to impart plastic flexibility in various industrial applications. In this study, the content of seven phthalates, dibutyl phthalate (DBP), benzyl butyl phthalate (BBP), di-(2-ethylhexyl) adipate (DEHA), di-2-ethylhexyl phthalate (DEHP), di-n-octyl phthalate (DNOP), di-isononyl phthalate (DINP), and di-isodecyl phthalate (DIDP) were determined in paper cups using gas chromatography-mass spectrometry (GC-MS). In addition, the potential migration of these seven phthalates from paper cups into various food stimulants under different conditions was evaluated. The levels of DBP, DEHA, DEHP, and DNOP were in the ranges of 0.07-3.14, 0.16-42.69, 0.45-58.56, and 0.3-2.4 mg/kg, respectively. Meanwhile, BBP, DINP, and DIDP were not detected in most of the tested samples. In the migration test, DEHA was released to 50 % ethanol and n-heptane in a time-dependent manner and the maximum migration levels were 65.62 ± 3.61 and 95.56 ± 19.76 μg/L, respectively. The release of other phthalates was very low or negligible. These results demonstrated that paper cups are not a significant source of phthalate exposure; however, DEHA could be released from paper cups into alcoholic beverages or oily liquid beverages in the human diet. PMID:27053047

  3. Using RoboCup in University-Level Computer Science Education

    ERIC Educational Resources Information Center

    Sklar, Elizabeth; Parsons, Simon; Stone, Peter

    2004-01-01

    In the education literature, team-based projects have proven to be an effective pedagogical methodology. We have been using "RoboCup" challenges as the basis for class projects in undergraduate and masters level courses. This article discusses several independent efforts in this direction and presents our work in the development of shared…

  4. The Dislocating Hip Replacement – Revision with a Dual Mobility Cup in 56 Consecutive Patients

    PubMed Central

    Jakobsen, Thomas; Kappel, Andreas; Hansen, Flemming; Krarup, Niels

    2014-01-01

    Introduction: Recurrent dislocations of hip replacements are a difficult challenge. One treatment option for recurrent dislocations is the use of a dual mobility cup. The aim of this study was to retrospective investigate the effect of dual mobility cups as a treatment for recurrent dislocations in a consecutive series. Materials and Methods: 56 consecutive patients were revised in the period November 2000 to December 2010. The mean age at revision was 72 years (SD 11, range 37-92)) and median number of dislocations before revision surgery were 4 (IQR, 2-11). In all cases, revision was made with a Saturne dual mobility cup (Amplitude, Neyron, France). The mean follow-up period was 44 months (SD 30, range 0.1-119). Results: One patient (1.8%) experienced a re-dislocation. Three patients (5.3%) had to be revised. One due to disintegration between the femoral head and inner shell, one due to loosening of the acetabular component, and one due to infection. Harris Hip Score improved from a mean of 76 before index surgery to 87 within one year after index surgery. Conclusion: This study advocates the use of a dual mobility cup for treatment of recurrent dislocations of THR. However, studies with a longer follow up are needed in order to evaluate implant survival. PMID:25246992

  5. Iatrogenic artefacts attributable to traditional cupping therapy in a shotgun fatality.

    PubMed

    Cavlak, Mehmet; Özkök, Alper; Sarı, Serhat; Dursun, Ahmet; Akar, Taner; Karapirli, Mustafa; Demirel, Birol

    2015-10-01

    Cupping is a traditional treatment method that has been used for thousands of years to diminish pain, restore appetite and improve digestion, remove tendency to faint or remove 'bad blood' from the body. The suction of the cup is created by fire or mechanical devices. This procedure may result in circular erythema, petechiae, purpura, ecchymosis, burns and may be mistaken for trauma-related ecchymosis or livor mortis. Forty-year-old male was died by shotgun injuries in the same day of the wounding. Circular ecchymoses were observed on the forehead, within the scalp of occipital region, the back of the neck, and on the back. They were defined as ecchymoses in the first examination made by a general practitioner. In the external examination during the legal autopsy superficial incisions were observed on the circular ecchymoses. The shape, localization and color of and the characteristics of incisions on the circular lesions were concluded to be caused by the dry cupping therapy and wet cupping therapy procedures. These lesions and their formation mechanisms should be well-known by the forensic medical examiners and the other medical personnel involved in the forensic medical examination.

  6. Simultaneous GC-MS determination of seven phthalates in total and migrated portions of paper cups.

    PubMed

    Park, Yu Na; Choi, Min Sun; Rehman, Shaheed Ur; Gye, Myung Chan; Yoo, Hye Hyun

    2016-05-01

    Phthalate acid esters are widely used as plasticizers to impart plastic flexibility in various industrial applications. In this study, the content of seven phthalates, dibutyl phthalate (DBP), benzyl butyl phthalate (BBP), di-(2-ethylhexyl) adipate (DEHA), di-2-ethylhexyl phthalate (DEHP), di-n-octyl phthalate (DNOP), di-isononyl phthalate (DINP), and di-isodecyl phthalate (DIDP) were determined in paper cups using gas chromatography-mass spectrometry (GC-MS). In addition, the potential migration of these seven phthalates from paper cups into various food stimulants under different conditions was evaluated. The levels of DBP, DEHA, DEHP, and DNOP were in the ranges of 0.07-3.14, 0.16-42.69, 0.45-58.56, and 0.3-2.4 mg/kg, respectively. Meanwhile, BBP, DINP, and DIDP were not detected in most of the tested samples. In the migration test, DEHA was released to 50 % ethanol and n-heptane in a time-dependent manner and the maximum migration levels were 65.62 ± 3.61 and 95.56 ± 19.76 μg/L, respectively. The release of other phthalates was very low or negligible. These results demonstrated that paper cups are not a significant source of phthalate exposure; however, DEHA could be released from paper cups into alcoholic beverages or oily liquid beverages in the human diet.

  7. 33 CFR 100.918 - Detroit APBA Gold Cup, Detroit, MI.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 33 Navigation and Navigable Waters 1 2013-07-01 2013-07-01 false Detroit APBA Gold Cup, Detroit, MI. 100.918 Section 100.918 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY REGATTAS AND MARINE PARADES SAFETY OF LIFE ON NAVIGABLE WATERS § 100.918 Detroit APBA Gold...

  8. 33 CFR 100.918 - Detroit APBA Gold Cup, Detroit, MI.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 33 Navigation and Navigable Waters 1 2011-07-01 2011-07-01 false Detroit APBA Gold Cup, Detroit, MI. 100.918 Section 100.918 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY REGATTAS AND MARINE PARADES SAFETY OF LIFE ON NAVIGABLE WATERS § 100.918 Detroit APBA Gold...

  9. Spinal Epidural Hematoma Following Cupping Glass Treatment in an Infant With Hemophilia A.

    PubMed

    Fruchtman, Yariv; Dardik, Rima; Barg, Assaf Arie; Livnat, Tami; Feldman, Zeev; Rubinstein, Marina; Grinberg, Gahl; Rosenberg, Nurit; Kenet, Gili

    2016-06-01

    A 6 months old infant, diagnosed with a rare mutation causing severe hemophilia A, presented with spinal epidural hematoma. Parents later admitted the infant had glass cupping therapy performed within 2 weeks of the onset of symptoms. The rare mutation, rare bleeding complication, and the eventual course of therapy applied in this case will be discussed in our case report.

  10. 78 FR 57482 - Safety Zone; America's Cup Aerobatic Box, San Francisco Bay, San Francisco, CA

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-09-19

    ... COTP Captain of the Port DHS Department of Homeland Security FR Federal Register NPRM Notice of... FR 04501). After reviewing all comments received in response to the NPRM, the Coast Guard published a... during the America's Cup sailing events (77 FR 41902). The Coast Guard is issuing this temporary...

  11. The Empty Cup (Power Teaching in a Digital Age). Occasional Paper #9

    ERIC Educational Resources Information Center

    Fluellen, Jerry E., Jr.

    2011-01-01

    What might count as a world class, national public education system in 2020? That empty cup took the floor at the 2010 Future of Learning (FoL) Summer Institute at Harvard University. It traveled from Longfellow Hall's lecture room on Appian Way to several learning groups scattered around campus. Though not deliberately created to think about…

  12. The Empty Cup: "Teaching for Understanding" at 21st Century Edward Waters College. Occasional Paper #6

    ERIC Educational Resources Information Center

    Fluellen, Jerry E., Jr.

    2008-01-01

    What happens in a final project that fosters teaching for understanding? That inquiry calls to mind the Taoist belief that emptiness makes a cup useful. In the context of this paper, the inquiry organizes a narrative about how teaching for understanding surfaced in a "Theories of Learning" course at Edward Waters College. At a deeper level, the…

  13. Eighth Grade Students' Representations of Linear Equations Based on a Cups and Tiles Model

    ERIC Educational Resources Information Center

    Caglayan, Gunhan; Olive, John

    2010-01-01

    This study examines eighth grade students' use of a representational metaphor (cups and tiles) for writing and solving equations in one unknown. Within this study, we focused on the obstacles and difficulties that students experienced when using this metaphor, with particular emphasis on the operations that can be meaningfully represented through…

  14. Multimodal segmentation of optic disc and cup from stereo fundus and SD-OCT images

    NASA Astrophysics Data System (ADS)

    Miri, Mohammad Saleh; Lee, Kyungmoo; Niemeijer, Meindert; Abràmoff, Michael D.; Kwon, Young H.; Garvin, Mona K.

    2013-03-01

    Glaucoma is one of the major causes of blindness worldwide. One important structural parameter for the diagnosis and management of glaucoma is the cup-to-disc ratio (CDR), which tends to become larger as glaucoma progresses. While approaches exist for segmenting the optic disc and cup within fundus photographs, and more recently, within spectral-domain optical coherence tomography (SD-OCT) volumes, no approaches have been reported for the simultaneous segmentation of these structures within both modalities combined. In this work, a multimodal pixel-classification approach for the segmentation of the optic disc and cup within fundus photographs and SD-OCT volumes is presented. In particular, after segmentation of other important structures (such as the retinal layers and retinal blood vessels) and fundus-to-SD-OCT image registration, features are extracted from both modalities and a k-nearest-neighbor classification approach is used to classify each pixel as cup, rim, or background. The approach is evaluated on 70 multimodal image pairs from 35 subjects in a leave-10%-out fashion (by subject). A significant improvement in classification accuracy is obtained using the multimodal approach over that obtained from the corresponding unimodal approach (97.8% versus 95.2%; p < 0:05; paired t-test).

  15. [Constructing recombinant plasmid pSH-CUP and knockout of acid trehalase gene in baker's yeast].

    PubMed

    He, Dongqin; Xiao, Dongguang; Lv, Ye

    2008-02-01

    The ATH1 gene encoded acid trehalase in Saccharomyces cerevisiae. The gene disruption cassette combined the heterologous dominant kan(r) resistance marker with a Cre/loxP-mediated marker removal procedure. The gene disruption cassette was produced by PCR using the same long oligonucleotides comprising 50 nucleotides that annealed to sites upstream or downstream of the genomic target sequence to be deleted. After transformation of the linear disruption cassettes with a Cre/loxP-mediated marker into the cells of Saccharomyces cerevisiae BY-6, selected transformants were checked by PCR for correct the integration of the cassette and concurrent deletion of the chromosomal target sequence. The copper-resistance gene (CUP1-MT1) was cloned into pSH47, which yielded pSH-CUP. The recombinant plasmid pSH-CUP was transformed into the cells of Saccharomyces cerevisiae BY-6(delta ATH1, G418(r)), and transformants were selected for copper resistance. Upon expression of the Cre recombinase results in removal of the kan(r) gene, leaving behind a single loxP site at the chromosomal locus. Construction of the recombinant plasmid pSH-CUP avoided inserting non-yeast gene and made the loxP - kanMX - loxP gene disruption cassette more conventional for eukaryotic organism gene disruption.

  16. Iatrogenic artefacts attributable to traditional cupping therapy in a shotgun fatality.

    PubMed

    Cavlak, Mehmet; Özkök, Alper; Sarı, Serhat; Dursun, Ahmet; Akar, Taner; Karapirli, Mustafa; Demirel, Birol

    2015-10-01

    Cupping is a traditional treatment method that has been used for thousands of years to diminish pain, restore appetite and improve digestion, remove tendency to faint or remove 'bad blood' from the body. The suction of the cup is created by fire or mechanical devices. This procedure may result in circular erythema, petechiae, purpura, ecchymosis, burns and may be mistaken for trauma-related ecchymosis or livor mortis. Forty-year-old male was died by shotgun injuries in the same day of the wounding. Circular ecchymoses were observed on the forehead, within the scalp of occipital region, the back of the neck, and on the back. They were defined as ecchymoses in the first examination made by a general practitioner. In the external examination during the legal autopsy superficial incisions were observed on the circular ecchymoses. The shape, localization and color of and the characteristics of incisions on the circular lesions were concluded to be caused by the dry cupping therapy and wet cupping therapy procedures. These lesions and their formation mechanisms should be well-known by the forensic medical examiners and the other medical personnel involved in the forensic medical examination. PMID:26344454

  17. Spinal Epidural Hematoma Following Cupping Glass Treatment in an Infant With Hemophilia A.

    PubMed

    Fruchtman, Yariv; Dardik, Rima; Barg, Assaf Arie; Livnat, Tami; Feldman, Zeev; Rubinstein, Marina; Grinberg, Gahl; Rosenberg, Nurit; Kenet, Gili

    2016-06-01

    A 6 months old infant, diagnosed with a rare mutation causing severe hemophilia A, presented with spinal epidural hematoma. Parents later admitted the infant had glass cupping therapy performed within 2 weeks of the onset of symptoms. The rare mutation, rare bleeding complication, and the eventual course of therapy applied in this case will be discussed in our case report. PMID:26844816

  18. Empirical cupping correction: A first-order raw data precorrection for cone-beam computed tomography

    SciTech Connect

    Kachelriess, Marc; Sourbelle, Katia; Kalender, Willi A.

    2006-05-15

    We propose an empirical cupping correction (ECC) algorithm to correct for CT cupping artifacts that are induced by nonlinearities in the projection data. The method is raw data based, empirical, and requires neither knowledge of the x-ray spectrum nor of the attenuation coefficients. It aims at linearizing the attenuation data using a precorrection function of polynomial form. The coefficients of the polynomial are determined once using a calibration scan of a homogeneous phantom. Computing the coefficients is done in image domain by fitting a series of basis images to a template image. The template image is obtained directly from the uncorrected phantom image and no assumptions on the phantom size or of its positioning are made. Raw data are precorrected by passing them through the once-determined polynomial. As an example we demonstrate how ECC can be used to perform water precorrection for an in vivo micro-CT scanner (TomoScope 30 s, VAMP GmbH, Erlangen, Germany). For this particular case, practical considerations regarding the definition of the template image are given. ECC strives to remove the cupping artifacts and to obtain well-calibrated CT values. Although ECC is a first-order correction and cannot compete with iterative higher-order beam hardening or scatter correction algorithms, our in vivo mouse images show a significant reduction of bone-induced artifacts as well. A combination of ECC with analytical techniques yielding a hybrid cupping correction method is possible and allows for channel-dependent correction functions.

  19. The Use of Wet Cupping for Persistent Nonspecific Low Back Pain: Randomized Controlled Clinical Trial

    PubMed Central

    AlBedah, Abdullah; Elolemy, Ahmed; Hussein, Asim A.; AlQaed, Meshari; Al Mudaiheem, Abdullah; Abutalib, Raid A.; Bazaid, Faisal Mohamed; Bafail, Ahmad Saeed; Essa, AboBakr; Bakrain, Mohammed Yahia

    2015-01-01

    Abstract Objectives: To evaluate the effectiveness and safety of wet cupping therapy as a single treatment for persistent nonspecific low back pain (PNSLBP). Design: Randomized controlled trial comparing wet cupping versus no treatment in PNSLBP. Setting: Outpatient clinic in three secondary care hospitals in Saudi Arabia. Patients: Eighty eligible participants with PNSLBP for at least 3 months were randomly allocated to an intervention group (n=40) or to a control group (n=40). Interventions: Six wet cupping sessions within 2 weeks, each of which were done at two bladder meridian (BL) acupuncture points among BL23, BL24, and BL25. Only acetaminophen was allowed as a rescue treatment in both groups. Outcome measures: The Numeric Rating Scale (NRS), McGill Present Pain Intensity (PPI), and Oswestry Disability Questionnaire (ODQ) were used as outcome measures. Numbers of acetaminophen tablets taken were compared at 4 weeks from baseline. Adverse events were recorded. Results: At the end of the intervention, statistically significant differences in the three outcome measures favoring the wet cupping group compared with the control group were seen: NRS score, 29.2 (95% confidence interval [CI], 24.6–33.8) versus 57.9 (95% CI, 53.3–62.6), respectively; PPI score, 1.17 (95% CI, 0.96–1.4) versus 2.3 (95% CI, 2.1– 2.7); and ODQ score, 19.6 (95% CI, 16.5–22.7) versus 35.4 (95% CI, 32.3–38.5) (p=0.0001). This improvement continued for another 2 weeks after the end of the intervention. Acetaminophen was used less in the wet cupping group, but this difference was not statistically significant. No adverse events were reported. Conclusions: Wet cupping is potentially effective in reducing pain and improving disability associated with PNSLBP at least for 2 weeks after the end of the wet cupping period. Placebo-controlled trials are needed. PMID:26069973

  20. The ERECTA receptor kinase regulates Arabidopsis shoot apical meristem size, phyllotaxy and floral meristem identity

    Technology Transfer Automated Retrieval System (TEKTRAN)

    In plants, the shoot apical meristem (SAM) serves as a reservoir of pluripotent stem cells from which all above ground organs originate. To sustain proper growth, the SAM must maintain homeostasis between the self-renewal of pluripotent stem cells and cell recruitment for lateral organ formation. At...

  1. Genetic and phenotypic analysis of shoot apical and floral meristem development

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The shoot apical and floral meristems (SAM and FM, respectively) of Arabidopsis thaliana contain reservoirs of self-renewing stem cells that function as sources of progenitor cells for organ formation during development. The primary SAM produces all of the aerial structures of the adult plant, where...

  2. The corono-apically varying ultrasonic velocity in human hard dental tissues

    NASA Astrophysics Data System (ADS)

    John, Christoph

    2004-07-01

    The speed of ultrasound at 20 MHz is measured for hard dental tissues inside human teeth. This includes the cementum, for which no data are available. The spatial distribution, extrema, and means of the longitudinal ultrasound velocity (LUV) are determined with an emphasis on the apical thirds and an extended spectrum. Tissue areas are investigated by optical means and by acoustical scanning, in order to compare apical regions-of-interest with the complete mineralized wet porous tissue that lies beneath the enamel cap. The maximal LUV in a single dentin specimen varies from 3903 m/s to 4226 m/s. The dentin's frequency distribution of LUV at 20 °C exhibits a predominant peak feature comprising several Voigt functions. Introducing standardized relative tooth width portions, the corono-apical decrease in LUV of 21 specimens is approximated by LUV=4224-(257 * ln(y)) along reduced distances in dentin. Abnormal teeth require a higher resolution and an approximate equation of the form LUV=(∑(ai * yi))/(1+∑(bi+1 * y(i+1))). It can be used each time the corono-apical variation has to be quantified in each of the three tissues. Ten coefficients are numerically exemplified. An error evaluation is performed, which denotes errors of 0.2%+/-1.3% (enamel), -0.1%+/-1.6% (cementum), and acceptable residual errors for dentin.

  3. Differential growth at the apical hook: all roads lead to auxin

    PubMed Central

    Abbas, Mohamad; Alabadí, David; Blázquez, Miguel A.

    2013-01-01

    The apical hook is a developmentally regulated structure that appears in dicotyledonous seedlings when seeds germinate buried in the soil. It protects the shoot apical meristem and cotyledons from damage while the seedling is pushing upwards seeking for light, and it is formed by differential cell expansion between both sides of the upper part of the hypocotyl. Its apparent simplicity and the fact that it is dispensable when seedlings are grown in vitro have converted the apical hook in one of the favorite experimental models to study the regulation of differential growth. The involvement of hormones –especially auxin—in this process was manifested already in the early studies. Remarkably, a gradient of this hormone across the hook curvature is instrumental to complete its development, similar to what has been proposed for other processes involving the bending of an organ, such as tropic responses. In agreement with this, other hormones—mainly gibberellins and ethylene—and the light, regulate in a timely and interconnected manner the auxin gradient to promote hook development and its opening, respectively. Here, we review the latest findings obtained mainly with the apical hook of Arabidopsis thaliana, paying special attention to the molecular mechanisms for the cross-regulation between the different hormone signaling pathways that underlie this developmental process. PMID:24204373

  4. Physical fitness after apical resection for the treatment of primary spontaneous pneumothorax.

    PubMed

    Fackeldey, Volker; Franke, Axel; Schachtrupp, Alexander; Becker, H Peter; Schwab, Robert

    2005-09-01

    The objective of the present study was to assess the physical fitness of patients after apical resection and partial apical pleurectomy for the treatment of primary spontaneous pneumothorax (PSP). Between 1982 and 1999, 58 patients received surgical treatment for PSP in our department. Twelve patients needed bilateral surgical intervention. At an average of 121 months after surgery (range, 16-231 months), the patients underwent follow-up assessments. Information was obtained on the basis of a questionnaire and from clinical examinations, including spirometry/body plethysmography and exercise testing with a bicycle ergometer. High-resolution computed tomography was used to identify postoperative changes of the lung apex. Forty-eight of 58 patients took part in the study, and all were found to be fully fit. High-resolution computed tomography gave evidence of new postoperative fibrocystic processes in 26 of the 31 affected apexes. One recurrence was observed (3.2%). Because apical resection cannot counteract pathogenetic mechanisms underlying parenchymal destruction and the formation of postoperative bullae among patients with a history of PSP, additional treatment of the apical pleura is necessary to prevent recurrences. Our results suggest that the physical fitness of patients with PSP can be completely restored postoperatively. PMID:16261980

  5. Cingulin and actin mediate midbody-dependent apical lumen formation during polarization of epithelial cells

    PubMed Central

    Mangan, Anthony J.; Sietsema, Daniel V.; Li, Dongying; Moore, Jeffrey K.; Citi, Sandra; Prekeris, Rytis

    2016-01-01

    Coordinated polarization of epithelial cells is a key step during morphogenesis that leads to the formation of an apical lumen. Rab11 and its interacting protein FIP5 are necessary for the targeting of apical endosomes to the midbody and apical membrane initiation site (AMIS) during lumenogenesis. However, the machinery that mediates AMIS establishment and FIP5-endosome targeting remains unknown. Here we identify a FIP5-interacting protein, Cingulin, which localizes to the AMIS and functions as a tether mediating FIP5-endosome targeting. We analysed the machinery mediating AMIS recruitment to the midbody and determined that both branched actin and microtubules are required for establishing the site of the nascent lumen. We demonstrate that the Rac1-WAVE/Scar complex mediates Cingulin recruitment to the AMIS by inducing branched actin formation, and that Cingulin directly binds to microtubule C-terminal tails through electrostatic interactions. We propose a new mechanism for apical endosome targeting and AMIS formation around the midbody during epithelial lumenogenesis. PMID:27484926

  6. Morphology of the Physiological Apical Foramen in Maxillary and Mandibular First Molars

    PubMed Central

    Abarca, J.; Zaror, C.; Monardes, H.; Hermosilla, V.; Muñoz, C.; Cantin, M.

    2015-01-01

    SUMMARY Information regarding the anatomy of the physiological apical foramen is limited. Knowing its diameter and shapes contributes to clinical work, specifically to the cleaning and shaping of the apical third. The aim of this ex vivo study was to determine the minimum and maximum diameters and shape of the physiological apical foramen in the roots of maxillary and mandibular first molars. A descriptive study was conducted on 89 recently extracted first molars. Roots 3–5 mm from the apex were sectioned and prepared for analysis at 40× magnification. The minimum and maximum diameters of each physiological foramen were measured using the program Motic Images plus 2.0 ML. The shape of the foramina, classified as round, oval or irregular, was determined by the difference between the maximum and minimum diameters. A total of 174 physiological foramina were analyzed. The average of the minimum and maximum diameters was between 0.24–0.33 mm in maxillary first molars and between 0.25–0.33 mm in mandibular first molars. In maxillary molars, the most common shape of the foramen was oval (50%), then irregular (32%), then round (18%). In mandibular molars, the oval shape was also the most frequent (59%), followed by irregular (23%) and round (18%). The findings of this study regarding the morphology of physiological apical foramina in first molars make it easier for the operator to choose the appropriately-sized instruments to perform endodontic therapy successfully. PMID:25937698

  7. Microbial infection and its control in cases of symptomatic apical periodontitis: a review.

    PubMed

    Skucaite, Neringa; Peciuliene, Vytaute; Maciulskiene, Vita

    2009-01-01

    Apical periodontitis is an inflammation of dental periapical tissues developed as a response to colonization of microorganisms in root canal system. Etiology of periapical pathology is associated with different species of microorganisms that are not fully defined yet. The changes in the composition of root canal microbiota as well as other factors, such as host resistance to various infections and concomitant viral infection, etc., can influence development of the symptomatic apical periodontitis. Etiology of disease is reviewed in this article. The purpose of treatment of symptomatic apical periodontitis is to eliminate the infection in root canal system and to obtain relief of symptoms. It can be done by conventional root canal therapy, which can be combined with anti-inflammatory medication. Indications for antibiotic therapy in such cases are limited to particular occasions, which are considered in article. Nevertheless, findings show that usually dentists prescribe antibiotics improperly in clinical practice. It can render drugs ineffective against diseases of dental origin as well as against potentially fatal infectious diseases. Selection of antibiotics for the treatment of root canal infections is reviewed in this article. Importance of antimicrobial susceptibility testing is emphasized. There is a need for more research on microbial causes and interactions in different forms of apical periodontitis to improve diagnosis and treatment.

  8. Drosophila Patj plays a supporting role in apical-basal polarity but is essential for viability.

    PubMed

    Zhou, Wenke; Hong, Yang

    2012-08-01

    Patj has been characterized as one of the so-called polarity proteins that play essential and conserved roles in regulating cell polarity in many different cell types. Studies of Drosophila and mammalian cells suggest that Patj is required for the apical polarity protein complex Crumbs-Stardust (Pals1 or Mpp5 in mammalian cells) to establish apical-basal polarity. However, owing to the lack of suitable genetic mutants, the exact in vivo function of Patj in regulating apical-basal polarity and development remains to be elucidated. Here, we generated molecularly defined null mutants of Drosophila Patj (dPatj). Our data show conclusively that dPatj only plays supporting and non-essential roles in regulating apical-basal polarity, although such a supporting role may become crucial in cells such as photoreceptors that undergo complex cellular morphogenesis. In addition, our results confirm that dPatj possesses an as yet unidentified function that is essential for pupal development.

  9. Limited elimination of two viruses by cryotherapy of pelargonium apices related to virus distribution.

    PubMed

    Gallard, A; Mallet, R; Chevalier, M; Grapin, A

    2011-01-01

    The possibility of eradicating the pelargonium flower break virus (PFBV) and pelargonium line pattern virus (PLPV) by cryotherapy of axillary shoot apices was investigated using five Pelargonium cultivars. Viruses were detected by DAS-ELISA and their location was determined by immunolocalization. Apex culture did not permit elimination of PFBV and only 15 percent regenerated plants of 'Stellar Artic' cultivar were ELISA PLPV-negative. Plants regenerated from cryotherapy-treated apices were tested by DAS-ELISA after a 3-month in vitro culture period. Viruses were not detected in 25 percent and 50 percent of the plants tested for PFBV and PLPV, respectively. However, immunolocalization carried out on apices originating from cryopreserved shoot tips sampled from DAS-ELISA negative plants showed that they were still virus-infected. Using immunolocalization, PFBV and PLPV could be detected in Pelargonium apices, even in the meristematic dome. However, viral particles were more numerous in basal zone cells than in meristematic cells. Our results demonstrate that PFBV and PLPV are present within meristematic cells and that cryopreservation can partly reduce the quantity of these viruses in Pelargonium plants but not eliminate them totally. Additional knowledge on localization and behaviour of viruses during cryopreservation is essential to optimize cryotherapy and plant genetic resource management.

  10. Apical Organelle Secretion by Toxoplasma Controls Innate and Adaptive Immunity and Mediates Long-Term Protection.

    PubMed

    Sloves, Pierre-Julien; Mouveaux, Thomas; Ait-Yahia, Saliha; Vorng, Han; Everaere, Laetitia; Sangare, Lamba Omar; Tsicopoulos, Anne; Tomavo, Stanislas

    2015-11-01

    Apicomplexan parasites have unique apical rhoptry and microneme secretory organelles that are crucial for host infection, although their role in protection against Toxoplasma gondii infection is not thoroughly understood. Here, we report a novel function of the endolysosomal T. gondii sortilin-like receptor (TgSORTLR), which mediates trafficking to functional apical organelles and their subsequent secretion of virulence factors that are critical to the induction of sterile immunity against parasite reinfection. We further demonstrate that the T. gondii armadillo repeats-only protein (TgARO) mutant, which is deficient only in apical secretion of rhoptries, is also critical in mounting protective immunity. The lack of TgSORTLR and TgARO proteins completely inhibited T-helper 1-dependent adaptive immunity and compromised the function of natural killer T-cell-mediated innate immunity. Our findings reveal an essential role for apical secretion in promoting sterile protection against T. gondii and provide strong evidence for rhoptry-regulated discharge of antigens as a key effector for inducing protective immunity.

  11. Dual roles of Notch in regulation of apically restricted mitosis and apicobasal polarity of neuroepithelial cells.

    PubMed

    Ohata, Shinya; Aoki, Ryo; Kinoshita, Shigeharu; Yamaguchi, Masahiro; Tsuruoka-Kinoshita, Sachiko; Tanaka, Hideomi; Wada, Hironori; Watabe, Shugo; Tsuboi, Takashi; Masai, Ichiro; Okamoto, Hitoshi

    2011-01-27

    How the mitosis of neuroepithelial stem cells is restricted to the apical ventricular area remains unclear. In zebrafish, the mosaic eyes(rw306) (moe/epb41l5(rw306)) mutation disrupts the interaction between the putative adaptor protein Moe and the apicobasal polarity regulator Crumbs (Crb), and impairs the maintenance of neuroepithelial apicobasal polarity. While Crb interacts directly with Notch and inhibits its activity, Moe reverses this inhibition. In the moe(rw306) hindbrain, Notch activity is significantly reduced, and the number of cells that proliferate basally away from the apical area is increased. Surprisingly, activation of Notch in the moe(rw306) mutant rescues not only the basally localized proliferation but also the aberrant neuroepithelial apicobasal polarity. We present evidence that the Crb⋅Moe complex and Notch play key roles in a positive feedback loop to maintain the apicobasal polarity and the apical-high basal-low gradient of Notch activity in neuroepithelial cells, both of which are essential for their apically restricted mitosis. PMID:21262462

  12. Comparative evaluation of total RNA extraction methods in Theobroma cacao using shoot apical meristems.

    PubMed

    Silva, D V; Branco, S M J; Holanda, I S A; Royaert, S; Motamayor, J C; Marelli, J P; Corrêa, R X

    2016-01-01

    Theobroma cacao is a species of great economic importance with its beans used for chocolate production. The tree has been a target of various molecular studies. It contains many polyphenols, which complicate the extraction of nucleic acids with the extraction protocols requiring a large amount of plant material. These issues, therefore, necessitate the optimization of the protocols. The aim of the present study was to evaluate different methods for extraction of total RNA from shoot apical meristems of T. cacao 'CCN 51' and to assess the influence of storage conditions for the meristems on the extraction. The study also aimed to identify the most efficient protocol for RNA extraction using a small amount of plant material. Four different protocols were evaluated for RNA extraction using one shoot apical meristem per sample. Among these protocols, one that was more efficient was then tested to extract RNA using four different numbers of shoot apical meristems, subjected to three different storage conditions. The best protocol was tested for cDNA amplification using reverse transcription-polymerase chain reaction; the cDNA quality was determined to be satisfactory for molecular analyses. The study revealed that with the best RNA extraction protocol, one shoot apical meristem was sufficient for extraction of high-quality total RNA. The results obtained might enable advances in genetic analyses and molecular studies using reduced amount of plant material. PMID:26985935

  13. Apical constriction drives tissue-scale hydrodynamic flow to mediate cell elongation

    PubMed Central

    He, Bing; Doubrovinski, Konstantin; Polyakov, Oleg; Wieschaus, Eric

    2014-01-01

    Epithelial folding mediated by apical constriction converts flat epithelial sheets into multilayered, complex tissue structures and is employed throughout the development in most animals1. Little is known, however, how forces produced near the apical surface of the tissue are transmitted within individual cells to generate the global changes in cell shape that characterize tissue deformation. Here we apply particle tracking velocimetry in gastrulating Drosophila embryos to measure the movement of cytoplasm and plasma membrane during ventral furrow (VF) formation2, 3. We find that cytoplasmic redistribution during the lengthening phase of VF formation can be precisely described by viscous flows that quantitatively match the predictions of hydrodynamics. Cell membranes move with the ambient cytoplasm, with little resistance to or driving force on the flow. Strikingly, apical constriction produces similar flow patterns in mutant embryos that fail to form cells prior to gastrulation (“acellular” embryos), such that the global redistribution of cytoplasm mirrors the summed redistribution occurring in individual cells of wild type embryos. Our results suggest that during the lengthening phase of VF formation, hydrodynamic behavior of the cytoplasm provides the predominant mechanism transmitting apically generated forces deep into the tissue and that cell individualization is dispensable. PMID:24590071

  14. SUPPRESSOR OF APICAL DOMINANCE1 of Sporisorium reilianum Modulates Inflorescence Branching Architecture in Maize and Arabidopsis.

    PubMed

    Ghareeb, Hassan; Drechsler, Frank; Löfke, Christian; Teichmann, Thomas; Schirawski, Jan

    2015-12-01

    The biotrophic fungus Sporisorium reilianum causes head smut of maize (Zea mays) after systemic plant colonization. Symptoms include the formation of multiple female inflorescences at subapical nodes of the stalk because of loss of apical dominance. By deletion analysis of cluster 19-1, the largest genomic divergence cluster in S. reilianum, we identified a secreted fungal effector responsible for S. reilianum-induced loss of apical dominance, which we named SUPPRESSOR OF APICAL DOMINANCE1 (SAD1). SAD1 transcript levels were highly up-regulated during biotrophic fungal growth in all infected plant tissues. SAD1-green fluorescent protein fusion proteins expressed by recombinant S. reilianum localized to the extracellular hyphal space. Transgenic Arabidopsis (Arabidopsis thaliana)-expressing green fluorescent protein-SAD1 displayed an increased number of secondary rosette-leaf branches. This suggests that SAD1 manipulates inflorescence branching architecture in maize and Arabidopsis through a conserved pathway. Using a yeast (Saccharomyces cerevisiae) two-hybrid library of S. reilianum-infected maize tissues, we identified potential plant interaction partners that had a predicted function in ubiquitination, signaling, and nuclear processes. Presence of SAD1 led to an increase of the transcript levels of the auxin transporter PIN-FORMED1 in the root and a reduction of the branching regulator TEOSINTE BRANCHED1 in the stalk. This indicates a role of SAD1 in regulation of apical dominance by modulation of branching through increasing transcript levels of the auxin transporter PIN1 and derepression of bud outgrowth. PMID:26511912

  15. Comparison of Marginal Adaptation of MTA and CEM Cement Apical Plugs in Three Different Media

    PubMed Central

    Ayatollahi, Fatemeh; Tabrizizadeh, Mahdi; Zare Bidoki, Fatemeh; Ayatollahi, Reza; Hazeri Baqdad Abad, Milad

    2016-01-01

    Introduction: The aim of this study was to compare the marginal adaptation of mineral trioxide aggregate (MTA) and calcium-enriched mixture(CEM) cement apical plugs in open apex teeth in dry, blood- and saliva-contaminated canals. Methods and Materials: A total of 120 human extracted single-rooted teeth were used. The teeth were decoronated and canals were cleaned and shaped up to #80 K-Files. After simulating open apex condition, samples were randomly divided into two groups (Group 1: MTA plug and group 2 CEM cement plug) and each group was then further divided into 3 subgroups (dry canal, blood- and saliva-contaminated canals). MTA and CEM cement apical plugs were placed into the canal. After full setting of apical plug, immediate marginal adaptation of the samples was assessed by electronic microscope. The data were analyzed using the two-way analysis of variance. Results: There was no statistically difference between the average marginal gap in MTA and CEM cement groups in three different conditions. The average gap in dry canal was significantly lower than canal contaminated with blood and saliva. Conclusion: It seems that marginal adaptations of MTA and CEM apical plug was not significantly different in various conditions and the two materials can be used successfully in this method.

  16. SUPPRESSOR OF APICAL DOMINANCE1 of Sporisorium reilianum Modulates Inflorescence Branching Architecture in Maize and Arabidopsis.

    PubMed

    Ghareeb, Hassan; Drechsler, Frank; Löfke, Christian; Teichmann, Thomas; Schirawski, Jan

    2015-12-01

    The biotrophic fungus Sporisorium reilianum causes head smut of maize (Zea mays) after systemic plant colonization. Symptoms include the formation of multiple female inflorescences at subapical nodes of the stalk because of loss of apical dominance. By deletion analysis of cluster 19-1, the largest genomic divergence cluster in S. reilianum, we identified a secreted fungal effector responsible for S. reilianum-induced loss of apical dominance, which we named SUPPRESSOR OF APICAL DOMINANCE1 (SAD1). SAD1 transcript levels were highly up-regulated during biotrophic fungal growth in all infected plant tissues. SAD1-green fluorescent protein fusion proteins expressed by recombinant S. reilianum localized to the extracellular hyphal space. Transgenic Arabidopsis (Arabidopsis thaliana)-expressing green fluorescent protein-SAD1 displayed an increased number of secondary rosette-leaf branches. This suggests that SAD1 manipulates inflorescence branching architecture in maize and Arabidopsis through a conserved pathway. Using a yeast (Saccharomyces cerevisiae) two-hybrid library of S. reilianum-infected maize tissues, we identified potential plant interaction partners that had a predicted function in ubiquitination, signaling, and nuclear processes. Presence of SAD1 led to an increase of the transcript levels of the auxin transporter PIN-FORMED1 in the root and a reduction of the branching regulator TEOSINTE BRANCHED1 in the stalk. This indicates a role of SAD1 in regulation of apical dominance by modulation of branching through increasing transcript levels of the auxin transporter PIN1 and derepression of bud outgrowth.

  17. Sugar demand, not auxin, is the initial regulator of apical dominance.

    PubMed

    Mason, Michael G; Ross, John J; Babst, Benjamin A; Wienclaw, Brittany N; Beveridge, Christine A

    2014-04-22

    For almost a century the plant hormone auxin has been central to theories on apical dominance, whereby the growing shoot tip suppresses the growth of the axillary buds below. According to the classic model, the auxin indole-3-acetic acid is produced in the shoot tip and transported down the stem, where it inhibits bud growth. We report here that the initiation of bud growth after shoot tip loss cannot be dependent on apical auxin supply because we observe bud release up to 24 h before changes in auxin content in the adjacent stem. After the loss of the shoot tip, sugars are rapidly redistributed over large distances and accumulate in axillary buds within a timeframe that correlates with bud release. Moreover, artificially increasing sucrose levels in plants represses the expression of BRANCHED1 (BRC1), the key transcriptional regulator responsible for maintaining bud dormancy, and results in rapid bud release. An enhancement in sugar supply is both necessary and sufficient for suppressed buds to be released from apical dominance. Our data support a theory of apical dominance whereby the shoot tip's strong demand for sugars inhibits axillary bud outgrowth by limiting the amount of sugar translocated to those buds. PMID:24711430

  18. Impact of different file systems on the amount of apically extruded debris during endodontic retreatment

    PubMed Central

    Uzunoglu, Emel; Turker, Sevinc Aktemur

    2016-01-01

    Objective: The goal of present study was to determine the effect of different nickel–titanium file systems on the amount of apically extruded debris during endodontic retreatment: D-RaCe retreatment systems, EdgeFile XR retreatment rotary files, and Reciproc R40. Materials and Methods: Thirty-six single-rooted prepared mandibular premolar teeth were filled with Gutta-percha and AH Plus sealer. The teeth were then randomly assigned into three groups (n = 12) for retreatment. The endodontic retreatment was performed as follows: D-RaCe, EdgeFile XR, Reciproc 40. Debris extruded apically during the retreatment was collected into preweighed Eppendorf tubes. An incubator was used to store tubes at 70° C for 5 days. The initial weight was subtracted from final weight of the Eppendorf tubes to calculate the weight of the dry extruded debris for each group. The data obtained were evaluated using Welch analysis of variance and Games-Howell post-hoc tests (P < 0.05). Results: All files resulted in apical extrusion of debris. Reciproc caused significantly less debris extrusion compared to D-RaCe and EdgeFile XR (P < 0.05). Conclusions: The findings revealed that during endodontic retreatment, number, and taper of files might have an influence on the amount of apically extruded debris during endodontic retreatment. PMID:27095898

  19. A systematic analysis of neonatal mouse heart regeneration after apical resection.

    PubMed

    Bryant, Donald Marion; O'Meara, Caitlin Claire; Ho, Nhi Ngoc; Gannon, Joseph; Cai, Lei; Lee, Richard Theodore

    2015-02-01

    The finding that neonatal mice are able to regenerate myocardium after apical resection has recently been questioned. We determined if heart regeneration is influenced by the size of cardiac resection and whether surgical retraction of the ventricular apex results in an increase in cardiomyocyte cell cycle activity. We performed moderate or large apical ventricular resections on neonatal mice and quantified scar infiltration into the left ventricular wall at 21 days post-surgery. Moderately resected hearts had 15±2% of the wall infiltrated by a collagen scar; significantly greater scar infiltration (23±4%) was observed in hearts with large resections. Resected hearts had higher levels of cardiomyocyte cell cycle activity relative to sham hearts. Surgically retracting the ventricle often resulted in fibrosis and induced cardiomyocyte cell cycle activity that were comparable to that of resected hearts. We conclude that apical resection in neonatal mice induces cardiomyocyte cell cycle activity and neomyogenesis, although scarring can occur. Surgical technique and definition of approach to assessing the extent of regeneration are both critical when using the neonatal mouse apical resection model.

  20. Age estimation in children by measurement of open apices in teeth.

    PubMed

    Cameriere, Roberto; Ferrante, Luigi; Cingolani, Mariano

    2006-01-01

    This paper concerns a method for estimating the age of children based on their teeth. The sample consisted of 455 Italian white children (213 boys, 242 girls) aged between 5 and 15 years. The purpose of the present investigation was to present a method for assessing chronological age based on the relationship between age and measurement of the open apices in teeth. Pearson's correlation coefficients between age and these variables showed that the correlations between age and the open apices in teeth were significant and negative. Furthermore, gender and the number of teeth with the apical end of the root canals completely closed (N(0)) showed a significant correlation with chronological age. With the aid of a stepwise multiple regression model, a linear relationship between open apices, N(0), and age was shown. Statistical analysis indicated that these morphological variables explain 83.6% of the variations in estimated chronological age. The median of residual errors between the actual and estimated ages was -0.035 years [interquartile range (IQR)=1.18 years].

  1. A new training set-up for trans-apical aortic valve replacement.

    PubMed

    Abdel-Sayed, Philippe; Kalejs, Martins; von Segesser, Ludwig Karl

    2009-06-01

    Trans-apical aortic valve replacement (AVR) is a new and rapidly growing therapy. However, there are only few training opportunities. The objective of our work is to build an appropriate artificial model of the heart that can replace the use of animals for surgical training in trans-apical AVR procedures. To reduce the necessity for fluoroscopy, we pursued the goal of building a translucent model of the heart that has nature-like dimensions. A simplified 3D model of a human heart with its aortic root was created in silico using the SolidWorks Computer-Aided Design (CAD) program. This heart model was printed using a rapid prototyping system developed by the Fab@Home project and dip-coated two times with dispersion silicone. The translucency of the heart model allows the perception of the deployment area of the valved-stent without using heavy imaging support. The final model was then placed in a human manikin for surgical training on trans-apical AVR procedure. Trans-apical AVR with all the necessary steps (puncture, wiring, catheterization, ballooning etc.) can be realized repeatedly in this setting.

  2. Ethylene-mediated enhancement of apical hook formation in etiolated Arabidopsis thaliana seedlings is gibberellin dependent.

    PubMed

    Vriezen, Wim H; Achard, Patrick; Harberd, Nicholas P; Van Der Straeten, Dominique

    2004-02-01

    Dark-grown Arabidopsis seedlings develop an apical hook by differential elongation and division of hypocotyl cells. This allows the curved hypocotyl to gently drag the apex, which is protected by the cotyledons, upwards through the soil. Several plant hormones are known to be involved in hook development, including ethylene, which causes exaggeration of the hook. We show that gibberellins (GAs) are also involved in this process. Inhibition of GA biosynthesis with paclobutrazol (PAC) prevented hook formation in wild-type (WT) seedlings and in constitutive ethylene response (ctr)1-1, a mutant that exhibits a constitutive ethylene response. In addition, a GA-deficient mutant (ga1-3) did not form an apical hook in the presence of the ethylene precursor 1-aminocyclopropane-1-carboxylate (ACC). Analysis of transgenic Arabidopsis seedlings expressing a green fluorescent protein (GFP)-repressor of ga1-3 (RGA) fusion protein suggested that ACC inhibits cell elongation in the apical hook by inhibition of GA signaling. A decreased feedback of GA possibly causes an induction of GA biosynthesis based upon the expression of genes encoding copalyl diphosphate synthase (CPS; GA1) and GA 2-oxidase (AtGA2ox1). Furthermore, expression of GASA1, a GA-response gene, suggests that differential cell elongation in the apical hook might be a result of differential GA-sensitivity.

  3. Cone beam computed tomography study of apical root resorption induced by Herbst appliance

    PubMed Central

    SCHWARTZ, João Paulo; RAVELI, Taísa Boamorte; ALMEIDA, Kélei Cristina de Mathias; SCHWARTZ-FILHO, Humberto Osvaldo; RAVELI, Dirceu Barnabé

    2015-01-01

    Objective This study evaluated the frequency of root resorption during the orthodontic treatment with Herbst appliance by Cone Beam Computed Tomography (CBCT). Material and Methods The sample comprised 23 patients (11 men, 12 women; mean ages 15.76±1.75 years) with Class II division 1 malocclusion, treated with Herbst appliance. CBCT was obtained before treatment (T0) and after Herbst treatment (T1). All the dental roots, except third molars, were evaluated, and apical root resorption was determined using the axial guided navigation method. Paired t-tests and Wilcoxon T Test were used to compare the dependent samples in parametric and nonparametric cases, respectively. Chi-Square Test with Yates’ correction was used to evaluate the relationship between apical root resorption and gender. Results were considered at a significance level of 5%. Results Apical resorption was detected by CBCT in 57.96% of 980 roots that underwent Herbst appliance treatment. All patients had minimal resorption and there was no statistical significance between the genders. Conclusion CBCT three-dimensional evaluation showed association between Herbst appliance and minimal apical root resorption, mostly in the anchoring teeth, without clinical significance. PMID:26537718

  4. [Localization of the apical foramen using the newest electronic instruments: stereomicroscopy and SEM (scanning electron microscopy)].

    PubMed

    Pagavino, G; Diamante, D; Marri, M; Pace, R

    1995-11-01

    Introduction of double impedence as new parameter in root canal length electronic measurement allowed first and second generation electronic apical localizers main problems overcoming: precision failure in presence of conducting fluids. Our study's purpose was an in vitro evaluation of two third generation instruments (Apit-Osada and Root ZX-Morita Corp.) ability in apical foramen localization using sodium hypoclorite as irrigating solution. 40 human monorooted teeth with immature apex were studied. 20 samples were measured by Apit and 20 by Root ZX; measurements were recorded when apical foramen was reached. Samples were fixed for stereomicroscope observation before and after apical 3 mm worn and prepared for SEM observation. Evaluations about each system's precision were made by calculating difference between foramen position determined by electronic localizer and its real anatomical position determined by a computed image analizing system linked to SEM. All measurements were included between a minimum value of -0.45 mm and a maximum value of 0.26 mm. Mann Whithney U test was performed to compare average values of the two sample groups but his was not meaningful (p = 0.18) showing that there is no valuable difference in accuracy between Apit and Root ZX. According to most researchers, who consider a +/- 0.5 mm error range clinically acceptable, and considering that in vitro measurements never exceded this limit value we conclude confirming both instruments' safety.

  5. Sugar demand, not auxin, is the initial regulator of apical dominance.

    PubMed

    Mason, Michael G; Ross, John J; Babst, Benjamin A; Wienclaw, Brittany N; Beveridge, Christine A

    2014-04-22

    For almost a century the plant hormone auxin has been central to theories on apical dominance, whereby the growing shoot tip suppresses the growth of the axillary buds below. According to the classic model, the auxin indole-3-acetic acid is produced in the shoot tip and transported down the stem, where it inhibits bud growth. We report here that the initiation of bud growth after shoot tip loss cannot be dependent on apical auxin supply because we observe bud release up to 24 h before changes in auxin content in the adjacent stem. After the loss of the shoot tip, sugars are rapidly redistributed over large distances and accumulate in axillary buds within a timeframe that correlates with bud release. Moreover, artificially increasing sucrose levels in plants represses the expression of BRANCHED1 (BRC1), the key transcriptional regulator responsible for maintaining bud dormancy, and results in rapid bud release. An enhancement in sugar supply is both necessary and sufficient for suppressed buds to be released from apical dominance. Our data support a theory of apical dominance whereby the shoot tip's strong demand for sugars inhibits axillary bud outgrowth by limiting the amount of sugar translocated to those buds.

  6. Organization and Dynamics of the Aspergillus nidulans Golgi during Apical Extension and Mitosis

    PubMed Central

    Pantazopoulou, Areti

    2009-01-01

    Aspergillus nidulans hyphae grow exclusively by apical extension. Golgi equivalents (GEs) labeled with mRFP-tagged PHOSBP domain form a markedly polarized, dynamic network of ring-shaped and fenestrated cisternae that remains intact during “closed” mitosis. mRFP-PHOSBP GEs advance associated with the growing apex where secretion predominates but do not undergo long-distance movement toward the tip that could account for their polarization. mRFP-PHOSBP GEs overlap with the trans-Golgi resident Sec7 but do not colocalize with also polarized accretions of the early Golgi marker GrhAGrh1-GFP, indicating that early and late Golgi membranes segregate spatially. AnSec23-GFP ER exit sites (ERES) are numerous, relatively static foci localizing across the entire cell. However, their density is greatest near the tip, correlating with predominance of early and trans-Golgi elements in this region. Whereas GrhA-GFP structures and ERES reach the apical dome, mRFP-PHOSBP GEs are excluded from this region, which contains the endosome dynein loading zone. After latrunculin-mediated F-actin disruption, mRFP-PHOSBP GEs fragment and, like AnSec23-GFP ERES, depolarize. Brefeldin A transiently collapses late and early GEs into distinct aggregates containing Sec7/mRFP-PHOSBP and GrhA-GFP, respectively, temporarily arresting apical extension. Rapid growth reinitiates after washout, correlating with reacquisition of the normal Golgi organization that, we conclude, is required for apical extension. PMID:19692566

  7. miR-219 regulates neural progenitors by dampening apical Par protein-dependent Hedgehog signaling.

    PubMed

    Hudish, Laura I; Galati, Domenico F; Ravanelli, Andrew M; Pearson, Chad G; Huang, Peng; Appel, Bruce

    2016-07-01

    The transition of dividing neuroepithelial progenitors to differentiated neurons and glia is essential for the formation of a functional nervous system. Sonic hedgehog (Shh) is a mitogen for spinal cord progenitors, but how cells become insensitive to the proliferative effects of Shh is not well understood. Because Shh reception occurs at primary cilia, which are positioned within the apical membrane of neuroepithelial progenitors, we hypothesized that loss of apical characteristics reduces the Shh signaling response, causing cell cycle exit and differentiation. We tested this hypothesis using genetic and pharmacological manipulation, gene expression analysis and time-lapse imaging of zebrafish embryos. Blocking the function of miR-219, a microRNA that downregulates apical Par polarity proteins and promotes progenitor differentiation, elevated Shh signaling. Inhibition of Shh signaling reversed the effects of miR-219 depletion and forced expression of Shh phenocopied miR-219 deficiency. Time-lapse imaging revealed that knockdown of miR-219 function accelerates the growth of primary cilia, revealing a possible mechanistic link between miR-219-mediated regulation of apical Par proteins and Shh signaling. Thus, miR-219 appears to decrease progenitor cell sensitivity to Shh signaling, thereby driving these cells towards differentiation. PMID:27226318

  8. Regenerative Endodontic Treatment versus Apical Plug in Immature Teeth: Three-Year Follow-Up.

    PubMed

    Asgary, Saeed; Fazlyab, Mahta; Nosrat, Ali

    2016-01-01

    This report compares and evaluates the treatment outcomes of regenerative endodontic treatment and apical plug as two accepted treatment protocols in a pair of necrotic immature maxillary central incisors of a 12-year old female. The patient was referred complaining of a dull pain and swelling in her upper lip area. She had a history of trauma to the anterior maxilla two years earlier. Both teeth were clinically diagnosed with pulp necrosis and periapical radiographs revealed that separate periapical radiolucent lesions surrounded the immature apices of both teeth. The left and right incisors were treated with apical plug and regenerative endodontic treatment, respectively, using calcium-enriched mixture (CEM) cement. The patient was followed-up for three years. During this period, both teeth were clinically asymptomatic and showed complete radiographic healing of the periapical lesions. The right central incisor showed root development. No tooth discoloration was evident. Apexification by apical plug placement and pulp regeneration are both reliable treatments for immature non-vital teeth. In order to choose the right treatment the advantages of either technique should be weighed against its drawbacks. CEM cement can be successfully applied for both purposes. This biomaterial causes less discoloration of the tooth. PMID:27617375

  9. Visual intraoperative estimation of cup and stem position is not reliable in minimally invasive hip arthroplasty

    PubMed Central

    Woerner, Michael; Sendtner, Ernst; Springorum, Robert; Craiovan, Benjamin; Worlicek, Michael; Renkawitz, Tobias; Grifka, Joachim; Weber, Markus

    2016-01-01

    Background and purpose In hip arthroplasty, acetabular inclination and anteversion—and also femoral stem torsion—are generally assessed by eye intraoperatively. We assessed whether visual estimation of cup and stem position is reliable. Patients and methods In the course of a subgroup analysis of a prospective clinical trial, 65 patients underwent cementless hip arthroplasty using a minimally invasive anterolateral approach in lateral decubitus position. Altogether, 4 experienced surgeons assessed cup position intraoperatively according to the operative definition by Murray in the anterior pelvic plane and stem torsion in relation to the femoral condylar plane. Inclination, anteversion, and stem torsion were measured blind postoperatively on 3D-CT and compared to intraoperative results. Results The mean difference between the 3D-CT results and intraoperative estimations by eye was −4.9° (−18 to 8.7) for inclination, 9.7° (−16 to 41) for anteversion, and −7.3° (−34 to 15) for stem torsion. We found an overestimation of > 5° for cup inclination in 32 hips, an overestimation of > 5° for stem torsion in 40 hips, and an underestimation < 5° for cup anteversion in 42 hips. The level of professional experience and patient characteristics had no clinically relevant effect on the accuracy of estimation by eye. Altogether, 46 stems were located outside the native norm of 10–20° as defined by Tönnis, measured on 3D-CT. Interpretation Even an experienced surgeon’s intraoperative estimation of cup and stem position by eye is not reliable compared to 3D-CT in minimally invasive THA. The use of mechanical insertion jigs, intraoperative fluoroscopy, or imageless navigation is recommended for correct implant insertion. PMID:26848628

  10. Stability of Commercially Available Grape and Compounded Cherry Oral Vancomycin Preparations Stored in Syringes and Cups.

    PubMed

    Kirk, Loren; Lewis, Paul; Luu, Yao; Brown, Stacy

    2016-01-01

    The purpose of this study was to evaluate the stability of two preparations of vancomycin oral solution in two different storage containers, capped amber oral-dosing syringes and heat-sealed oral-dosing cups, stored under refrigerated conditions. Commercially available grape-flavored vancomycin oral preparation and compounded vancomycin for intravenous use in cherry syrup oral preparation were divided into 5-mL aliquots into heat-sealed plastic dosing cups and capped oral-dosing syringes. All samples were stored under refrigeration (2°C to 8°C) and evaluated at days 0, 3, 7, 14, 30, 60, and 90. For each evaluation, samples were visually inspected and analyzed for potency using a stability-indicating high-performance liquid chromatographic method with ultraviolet detection. Over the study period, at least 90% of the initial concentrations for the preparation and the product in both storage containers were retained at 60 days. The commercially available oral vancomycin further demonstrated stability within 90% out to 90 days in the syringe and the unit-dose cups. Visual inspection revealed no changes in the grape-flavored vancomycin oral preparation, but a detectable red-dye precipitate could be seen in the crevices of the dosing cups from the vancomycin in cherry syrup oral preparation after 60 days. Commercially available grape-flavored vancomycin oral preparation was stable up to 90 days, and com- pounded vancomycin for intravenous use in cherry syrup oral preparation maintained stability for 60 days when dispensed in capped amber polypropylene oral-dosing syringes and heat-sealed plastic dosing cups when stored at refrigerated conditions. PMID:27323427

  11. Dual mobility bearings withstand loading from steeper cup-inclinations without substantial wear.

    PubMed

    Loving, LaQuawn; Herrera, Lizeth; Banerjee, Samik; Heffernan, Christopher; Nevelos, Jim; Markel, David C; Mont, Michael A

    2015-03-01

    Steep cup abduction angles with adverse joint loading may increase traditional polyethylene bearing wear in total hip arthroplasties. However, there have been few reports evaluating the effect of cup inclination on the wear of dual-mobility devices. In a hip joint simulation, we compared the short-term wear of two-sizes of modular highly cross-linked dual-mobility bearings (28 mm femoral head diameter/42 mm polyethylene insert outer diameter/54 mm acetabular shell diameter; 22.2 mm femoral head diameter/36 mm polyethylene insert outer diameter/48 mm acetabular shell diameter) at 50 and 65° of cup inclination with modular 28 mm femoral head on 54 mm cup diameter metal-on-highly cross-linked polyethylene bearings. Increasing inclination from 50-65° had no changes in volumetric wear of 28/42/54 mm (mean, 1.7 vs. 1.2 mm3 /million cycles, respectively; p = 0.50) and 22.2/36/48 mm (mean, 1.7 vs. 1.2 mm3/million cycles, respectively; p = 0.48) dual mobility bearings. At 65°, 22.2/36/48 mm dual-mobility bearings had lower volumetric loss (mean, 2.2 vs. 6.3 mm(3) ; p = 0.03) and wear rates (mean, 1.2 vs. 2.7 mm3/million cycles; p = 0.02) compared to metal-on-highly cross-linked polyethylene bearings. Modern-generation dual-mobility designs with highly cross-linked polyethylenes may potentially withstand edge-loading from steeper cup-inclinations without substantial decreases in wear.

  12. Stability of Commercially Available Grape and Compounded Cherry Oral Vancomycin Preparations Stored in Syringes and Cups.

    PubMed

    Kirk, Loren; Lewis, Paul; Luu, Yao; Brown, Stacy

    2016-01-01

    The purpose of this study was to evaluate the stability of two preparations of vancomycin oral solution in two different storage containers, capped amber oral-dosing syringes and heat-sealed oral-dosing cups, stored under refrigerated conditions. Commercially available grape-flavored vancomycin oral preparation and compounded vancomycin for intravenous use in cherry syrup oral preparation were divided into 5-mL aliquots into heat-sealed plastic dosing cups and capped oral-dosing syringes. All samples were stored under refrigeration (2°C to 8°C) and evaluated at days 0, 3, 7, 14, 30, 60, and 90. For each evaluation, samples were visually inspected and analyzed for potency using a stability-indicating high-performance liquid chromatographic method with ultraviolet detection. Over the study period, at least 90% of the initial concentrations for the preparation and the product in both storage containers were retained at 60 days. The commercially available oral vancomycin further demonstrated stability within 90% out to 90 days in the syringe and the unit-dose cups. Visual inspection revealed no changes in the grape-flavored vancomycin oral preparation, but a detectable red-dye precipitate could be seen in the crevices of the dosing cups from the vancomycin in cherry syrup oral preparation after 60 days. Commercially available grape-flavored vancomycin oral preparation was stable up to 90 days, and com- pounded vancomycin for intravenous use in cherry syrup oral preparation maintained stability for 60 days when dispensed in capped amber polypropylene oral-dosing syringes and heat-sealed plastic dosing cups when stored at refrigerated conditions.

  13. aPKC regulates apical localization of Lgl to restrict elongation of microridges in developing zebrafish epidermis

    PubMed Central

    Raman, Renuka; Damle, Indraneel; Rote, Rahul; Banerjee, Shamik; Dingare, Chaitanya; Sonawane, Mahendra

    2016-01-01

    Epithelial cells exhibit apical membrane protrusions, which confer specific functions to epithelial tissues. Microridges are short actin protrusions that are laterally long and form a maze-like pattern in the apical domain. They are widely found on vertebrate squamous epithelia including epidermis and have functions in mucous retention, membrane storage and abrasion resistance. It is largely unknown how the formation of these laterally long actin projections is regulated. Here, we show that antagonistic interactions between aPKC and Lgl–regulators of apical and basolateral domain identity, respectively,–control the length of microridges in the zebrafish periderm, the outermost layer of the epidermis. aPKC regulates the levels of Lgl and the active form of non-muscle myosinII at the apical cortex to prevent actin polymerization-dependent precocious fusion and elongation of microridges. Our data unravels the functional significance of exclusion of Lgl from the apical domain in epithelial cells. PMID:27249668

  14. The effect of dynamic hip motion on the micromotion of press-fit acetabular cups in six degrees of freedom.

    PubMed

    Crosnier, Emilie A; Keogh, Patrick S; Miles, Anthony W

    2016-08-01

    The hip joint is subjected to cyclic loading and motion during activities of daily living and this can induce micromotions at the bone-implant interface of cementless total hip replacements. Initial stability has been identified as a crucial factor to achieve osseointegration and long-term survival. Whilst fixation of femoral stems achieves good clinical results, the fixation of acetabular components remains a challenge. In vitro methods assessing cup stability keep the hip joint in a fixed position, overlooking the effect of hip motion. The effect of hip motion on cup micromotion using a hip motion simulator replicating hip flexion-extension and a six degrees of freedom measurement system was investigated. The results show an increase in cup micromotion under dynamic hip motion compared to Static Flexion. This highlights the need to incorporate hip motion and measure all degrees of freedom when assessing cup micromotion. In addition, comparison of two press-fit acetabular cups with different surface coatings suggested similar stability between the two cups. This new method provides a basis for a more representative protocol for future pre-clinical evaluation of different cup designs.

  15. The effect of dynamic hip motion on the micromotion of press-fit acetabular cups in six degrees of freedom.

    PubMed

    Crosnier, Emilie A; Keogh, Patrick S; Miles, Anthony W

    2016-08-01

    The hip joint is subjected to cyclic loading and motion during activities of daily living and this can induce micromotions at the bone-implant interface of cementless total hip replacements. Initial stability has been identified as a crucial factor to achieve osseointegration and long-term survival. Whilst fixation of femoral stems achieves good clinical results, the fixation of acetabular components remains a challenge. In vitro methods assessing cup stability keep the hip joint in a fixed position, overlooking the effect of hip motion. The effect of hip motion on cup micromotion using a hip motion simulator replicating hip flexion-extension and a six degrees of freedom measurement system was investigated. The results show an increase in cup micromotion under dynamic hip motion compared to Static Flexion. This highlights the need to incorporate hip motion and measure all degrees of freedom when assessing cup micromotion. In addition, comparison of two press-fit acetabular cups with different surface coatings suggested similar stability between the two cups. This new method provides a basis for a more representative protocol for future pre-clinical evaluation of different cup designs. PMID:27210567

  16. Does apical membrane GLUT2 have a role in intestinal glucose uptake?

    PubMed Central

    Naftalin, Richard J

    2014-01-01

    It has been proposed that the non-saturable component of intestinal glucose absorption, apparent following prolonged exposure to high intraluminal glucose concentrations, is mediated via the low affinity glucose and fructose transporter, GLUT2, upregulated within the small intestinal apical border. The evidence that the non-saturable transport component is mediated via an apical membrane sugar transporter is that it is inhibited by phloretin, after exposure to phloridzin. Since the other apical membrane sugar transporter, GLUT5, is insensitive to inhibition by either cytochalasin B, or phloretin, GLUT2 was deduced to be the low affinity sugar transport route. As in its uninhibited state, polarized intestinal glucose absorption depends both on coupled entry of glucose and sodium across the brush border membrane and on the enterocyte cytosolic glucose concentration exceeding that in both luminal and submucosal interstitial fluids, upregulation of GLUT2 within the intestinal brush border will usually stimulate downhill glucose reflux to the intestinal lumen from the enterocytes; thereby reducing, rather than enhancing net glucose absorption across the luminal surface. These states are simulated with a computer model generating solutions to the differential equations for glucose, Na and water flows between luminal, cell, interstitial and capillary compartments. The model demonstrates that uphill glucose transport via SGLT1 into enterocytes, when short-circuited by any passive glucose carrier in the apical membrane, such as GLUT2, will reduce transcellular glucose absorption and thereby lead to increased paracellular flow. The model also illustrates that apical GLUT2 may usefully act as an osmoregulator to prevent excessive enterocyte volume change with altered luminal glucose concentrations. PMID:25671087

  17. Wizard CD Plus and ProTaper Universal: analysis of apical transportation using new software

    PubMed Central

    GIANNASTASIO, Daiana; da ROSA, Ricardo Abreu; PERES, Bernardo Urbanetto; BARRETO, Mirela Sangoi; DOTTO, Gustavo Nogara; KUGA, Milton Carlos; PEREIRA, Jefferson Ricardo; SÓ, Marcus Vinícius Reis

    2013-01-01

    Objective This study has two aims: 1) to evaluate the apical transportation of the Wizard CD Plus and ProTaper Universal after preparation of simulated root canals; 2) to compare, with Adobe Photoshop, the ability of a new software (Regeemy) in superposing and subtracting images. Material and Methods Twenty five simulated root canals in acrylic-resin blocks (with 20º curvature) underwent cone beam computed tomography before and after preparation with the rotary systems (70 kVp, 4 mA, 10 s and with the 8×8 cm FoV selection). Canals were prepared up to F2 (ProTaper) and 24.04 (Wizard CD Plus) instruments and the working length was established to 15 mm. The tomographic images were imported into iCAT Vision software and CorelDraw for standardization. The superposition of pre- and post-instrumentation images from both systems was performed using Regeemy and Adobe Photoshop. The apical transportation was measured in millimetres using Image J. Five acrylic resin blocks were used to validate the superposition achieved by the software. Student's t-test for independent samples was used to evaluate the apical transportation achieved by the rotary systems using each software individually. Student's t-test for paired samples was used to compare the ability of each software in superposing and subtracting images from one rotary system per time. Results The values obtained with Regeemy and Adobe Photoshop were similar to rotary systems (P>0.05). ProTaper Universal and Wizard CD Plus promoted similar apical transportation regardless of the software used for image's superposition and subtraction (P>0.05). Conclusion Wizard CD Plus and ProTaper Universal promoted little apical transportation. Regeemy consists in a feasible software to superpose and subtract images and appears to be an alternative to Adobe Photoshop. PMID:24212994

  18. Apical crown technique to model canal roots. A review of the literature.

    PubMed

    Tortini, D; Colombo, M; Gagliani, M

    2007-09-01

    The goals of endodontic therapy are to shape and clean the root canal system in order to receive a three-dimensional and hermetic filling of the entire endodontic space. The aim of this review is to analyze the development of the different canal shaping techniques from the manual stainless-steel instruments to the recently developed rotary Ni-Ti systems. The need to provide instruments of a suitable size to reach the apex of curved root canals drove the development of preparation techniques with a greater focus on the apical part. The Crown-Down technique involves the widening of the canal orifices with Gates-Glidden drills followed by the incremental removal of organic canal contents proceeding from the canal orifice to the apical portion using manual files. Files are used from larger to smaller with no apical pressure. Nevertheless, the term ''Crown-Down'' does not define the technique in the strictest sense, nor does it provide a specific sequence for the use of instruments, but rather defines a way to use the instruments. The preparation of root canals has been revolutionised by the development of Ni-Ti alloys. The features of this alloy give instruments profound flexibility and allow the manufacture of more tapered instruments compared with traditional stainless-steel instruments. In the second part of this review, numerous examples are provided concerning the comparison between different Ni-Ti systems and their techniques for use. A Crown-Down approach provides certain advantages including early organic debris removal, the creation of a large reservoir for irrigating solutions, a straighter access to the apical region of curved canals, and greater precision with regard to the exact working length and apical size.

  19. Influence of apical enlargement in cleaning and extrusion in canals with mild and moderate curvatures.

    PubMed

    Borges, Mauricia Ferreira de Almeida E; Miranda, Carlos Eduardo Saraiva; Silva, Silvio Rocha Corrêa da; Marchesan, Melissa

    2011-01-01

    Optical microscopy and morphometric analysis were used in this study to evaluate, in vitro, the cleaning of the apical region in root canals with mild or moderate curvatures subjected to biomechanical preparation with a rotary system, as well as to assess the amount of extruded material to the periapical area. Lateral incisors (n = 32), 16 with curvature angles smaller or equal to 10º (GI) and 16 between 11º and 25º angles (GII) were submitted to Hero 642 rotary instrumentation with different surgical diameters: (A) 30.02 and (B) 45.02. Irrigation was performed at each change of instrument with 5 mL of ultrapure Milli-Q water and the extruded material through the apical foramen was collected. Root cross-sections were subjected to histological analysis by optical microscopy (×40) and the images were evaluated morphometrically using the Image Tool software. Quantification of the extruded material was performed by weighing after liquid evaporation. ANOVA showed no statistically significant differences (p>0.05) among the groups with respect to the procedures used to clean the apical region. Considering the amount of extruded material, the Tukey's HSD showed that canals with mild curvature prepared with the 45.02 surgical diameter showed significantly higher values (p<0.05) that those of the other groups, which were similar between themselves (p>0.05). In conclusion, the effect of cleaning the apical region did not differ in the groups, considering root curvature and the surgical diameter of instruments used for apical preparation. The amount of extruded material was greater in canals with mild curvature that were prepared with the 45.02 surgical instrument diameter. PMID:21915518

  20. TRP Channels Localize to Subdomains of the Apical Plasma Membrane in Human Fetal Retinal Pigment Epithelium

    PubMed Central

    Zhao, Peter Y.; Gan, Geliang; Peng, Shaomin; Wang, Shao-Bin; Chen, Bo; Adelman, Ron A.; Rizzolo, Lawrence J.

    2015-01-01

    Purpose. Calcium regulates many functions of the RPE. Its concentration in the subretinal space and RPE cytoplasm is closely regulated. Transient receptor potential (TRP) channels are a superfamily of ion channels that are moderately calcium-selective. This study investigates the subcellular localization and potential functions of TRP channels in a first-passage culture model of human fetal RPE (hfRPE). Methods. The RPE isolated from 15- to 16-week gestation fetuses were maintained in serum-free media. Cultures were treated with barium chloride (BaCl2) in the absence and presence of TRP channel inhibitors and monitored by the transepithelial electrical resistance (TER). The expression of TRP channels was determined using quantitative RT-PCR, immunoblotting, and immunofluorescence confocal microscopy. Results. Barium chloride substantially decreased TER and disrupted cell–cell contacts when added to the apical surface of RPE, but not when added to the basolateral surface. The effect could be partially blocked by the general TRP inhibitor, lanthanum chloride (LaCl3, ~75%), or an inhibitor of calpain (~25%). Family member-specific inhibitors, ML204 (TRPC4) and HC-067047 (TRPV4), had no effect on basal channel activity. Expression of TRPC4, TRPM1, TRPM3, TRPM7, and TRPV4 was detected by RT-PCR and immunoblotting. The TRPM3 localized to the base of the primary cilium, and TRPC4 and TRPM3 localized to apical tight junctions. The TRPV4 localized to apical microvilli in a small subset of cells. Conclusions. The TRP channels localized to subdomains of the apical membrane, and BaCl2 was only able to dissociate tight junctions when presented to the apical membrane. The data suggest a potential role for TRP channels as sensors of [Ca2+] in the subretinal space. PMID:25736794

  1. Characterization of apical potassium channels induced in rat distal colon during potassium adaptation.

    PubMed Central

    Butterfield, I; Warhurst, G; Jones, M N; Sandle, G I

    1997-01-01

    1. Chronic dietary K+ loading stimulates an active K+ secretory process in rat distal colon, which involves an increase in the macroscopic apical K+ conductance of surface epithelial cells. In the present study, the abundance and characteristics of K+ channels constituting this enhanced apical K+ conductance were evaluated using patch clamp recording techniques. 2. In isolated non-polarized surface cells, K+ channels were seen in 9 of 90 (10%) cell-attached patches in cells from control animals, and in 247 of 437 (57%) cell-attached patches in cells from K(+)-loaded animals, with a significant (P < 0.001) shift in distribution density. Similarly, recordings from cell-attached patches of the apical membrane of surface cells surrounding the openings of distal colonic crypts revealed identical K+ channels in 1 of 11 (9%) patches in control animals, and in 9 of 13 (69%) patches in K(+)-loaded animals. 3. In isolated surface cells and surface cells in situ, K+ channels had mean slope conductances of 209 +/- 6 and 233 +/- 14 pS, respectively, when inside-out patches were bathed symmetrically in K2SO4 solution. The channels were sensitive to 'cytosolic' Ca2+ concentration, were voltage sensitive at 'cytosolic' Ca2+ concentrations encountered in colonic epithelial cells, and were inhibited by 1 mM quinidine, 20 mM TEA or 5 mM Ba2+ ions. 4. The data show that dietary K+ loading increases the abundance of Ca(2+)- and voltage-sensitive large-conductance K+ channels in the apical membrane of surface cells in rat distal colon. These channels constitute the enhanced macroscopic apical K+ conductance previously identified in these cells, and are likely to play a critical role in the active K+ secretory process that typifies this model of colonic K+ adaptation. PMID:9218214

  2. Transurethral biopsy of the prostatic urethra is associated with final apical margin status at radical cystoprostatectomy

    PubMed Central

    von Rundstedt, Friedrich-Carl; Mata, Douglas A; Shen, Steven; Li, Yi; Godoy, Guilherme; Lerner, Seth P

    2015-01-01

    Purpose Biopsy of the prostatic urethra is an integral part of clinical staging in patients prior to radical cystoprostatectomy (RC) and urinary diversion. We examined whether preoperative transurethral resection (TUR) biopsy was associated with final apical urethral margin status and hypothesized that a negative biopsy could replace intraoperative frozen section for decision making regarding the feasibility of orthotopic neobladder reconstruction. Methods TUR biopsy, frozen section, urethrectomy, and final apical urethral margin pathologic data were extracted from the charts of men who had undergone RC at the Houston Methodist Hospital between 1987 and 2013. TUR biopsies were performed at five and seven o’clock adjacent to the verumontanum. A positive biopsy was defined as the presence of in situ or invasive urothelial carcinoma. Clinical and perioperative variables were analyzed using descriptive and inferential statistics. Results We reviewed the medical records of 272 men. Preoperative TUR biopsies of the prostatic urethra were negative in 74% (200/272) and positive in 26% (72/272) of men. The overall incidence of apical urethral margin positivity on final pathology was 2.2% (six of 272). Four men underwent primary or secondary urethrectomy. TUR biopsy negative and positive predictive values for apical urethral margin positivity were 99.5% (95% confidence interval (CI): 97.2 to 99.9) and 6.9% (95% CI: 2.3 to 15.5), respectively. Conclusions The incidence of a positive apical urethral margin was low in patients undergoing RC. A negative preoperative TUR biopsy of the prostatic urethra was reliably associated with a negative final margin, obviating the need for intraoperative frozen section. Furthermore, a positive biopsy was not reliably associated with final margin status. These data will aid in the counseling of patients regarding the feasibility of neobladder reconstruction.

  3. Isolation of radio-iodinated apical and basal-lateral plasma membranes of toad bladder epithelium.

    PubMed

    Rodriguez, H J; Edelman, I S

    1979-04-01

    The apical and basal-lateral plasma membranes of toad bladder epithelium were radio-iodinated with the glucose-glucose oxidase-lactoperoxidase system. The covalently bound radio iodine was used as a marker during subcellular fractionation and membrane isolation. Homogenization conditions that ensured rupture of more than 80% of the cells without substantial nuclear damage were defined by Normarski optics. The nuclei were separated by differential centrifugation and the apical and basal-lateral components were resolved by differential and sucrose density gradient centrifugation. The apical components yielded two radioactive bands that were identified as glycocalyx and plasma membrane labeled with 125I. The basal-lateral components yielded a hetero-disperse pattern made up of at least 3 radioactive bands, but the bulk of the activity of ouabain-sensitive ATPase comigrated with only one of these bands. The mitochondia, identified by assays for cytochrome oxidase and NADH cytochrome c reductase activities, were separated from the radio-iodine labeled by centrifugation in sucrose density gradients under isokinetic conditions. The labeled glycocalyx and the slowly migrating components of basal-lateral labeling were separated from the radio-iodinated membranes by centrifugation at 100,000 x g x 1 hr after removal of the mitochrondria by the isokinetic method. The labeled membranes were then subjected to ultracentrifugation in sucrose density gradients under isopycnic conditions; the basal-lateral membranes containing ouabain-sensitive ATP-ase were well resolved from the apical membranes by this method. These results provide a relatively rapid method of attaining partial purification of the apical and basal-lateral plasma membranes of toad bladder epithelium. PMID:222911

  4. Evaluation of the endodontic apical seal after post insertion by synchrotron radiation microtomography

    NASA Astrophysics Data System (ADS)

    Contardo, L.; De Luca, M.; Biasotto, M.; Longo, R.; Olivo, A.; Pani, S.; Di Lenarda, R.

    2005-08-01

    The commonly used methods for evaluating the endodontic apical seal, such as longitudinal and transversal section and diaphanization, show some operative difficulties and intrinsic limitation. This study suggests and describes a new method of analysis using a synchrotron radiation microtomography to analyse the root apex after post insertion, creating a three-dimensional image and analysing sections of the specimen every 5 μm. The study was performed at SYRMEP beam line at the Electra Synchrotron in Trieste using monochromatic X-rays of 32 KeV. Eleven monoradicular teeth were prepared using NiTi GT Rotary files instruments to an apical size 20 with conicity .06 and divided in four groups: in G1 ( n=4) and G2 ( n=2), the specimens were endodontically filled with guttapercha and a zinc-oxide sealer, in G3 ( n=3) and G4 ( n=2) guttapercha and a silicon-based sealer were used. An endodontic post was inserted in specimens of groups 1 and 3 following the manufacturer's instructions. Specimens were analysed using monochromatic X-rays of 32 KeV. A CCD detector with pixel dimension pf 5×5 μm 2 was used for the acquisition process. Seven hundred and twenty projections were performed over 180° range using a high-resolution rotator. The projections were reconstructed using standard algorithms for tomographic reconstruction. The apical infiltration was evaluated by verifying if black spots were detectable on the images. The specimens of groups 3 and 4 showed a better apical seal than the ones of groups 1 and 2. Post insertion, when a ZOE-based sealer is used, increases the apical gap even if it does not seem to be clinically relevant and sufficient to be a cause of endodontic failure. The new method for analysis appeared to be effective to detect small defects in endodontic obturation, analysing guttapercha-sealer and sealer-dentin interfaces.

  5. Apical accumulation of MARCKS in neural plate cells during neurulation in the chick embryo

    PubMed Central

    Zolessi, Flavio R; Arruti, Cristina

    2001-01-01

    Background The neural tube is formed by morphogenetic movements largely dependent on cytoskeletal dynamics. Actin and many of its associated proteins have been proposed as important mediators of neurulation. For instance, mice deficient in MARCKS, an actin cross-linking membrane-associated protein that is regulated by PKC and other kinases, present severe developmental defects, including failure of cranial neural tube closure. Results To determine the distribution of MARCKS, and its possible relationships with actin during neurulation, chick embryos were transversely sectioned and double labeled with an anti-MARCKS polyclonal antibody and phalloidin. In the neural plate, MARCKS was found ubiquitously distributed at the periphery of the cells, being conspicuously accumulated in the apical cell region, in close proximity to the apical actin meshwork. This asymmetric distribution was particularly noticeable during the bending process. After the closure of the neural tube, the apically accumulated MARCKS disappeared, and this cell region became analogous to the other peripheral cell zones in its MARCKS content. Actin did not display analogous variations, remaining highly concentrated at the cell subapical territory. The transient apical accumulation of MARCKS was found throughout the neural tube axis. The analysis of another epithelial bending movement, during the formation of the lens vesicle, revealed an identical phenomenon. Conclusions MARCKS is transiently accumulated at the apical region of neural plate and lens placode cells during processes of bending. This asymmetric subcellular distribution of MARCKS starts before the onset of neural plate bending. These results suggest possible upstream regulatory actions of MARCKS on some functions of the actin subapical meshwork. PMID:11329360

  6. Pak3 regulates apical-basal polarity in migrating border cells during Drosophila oogenesis.

    PubMed

    Felix, Martina; Chayengia, Mrinal; Ghosh, Ritabrata; Sharma, Aditi; Prasad, Mohit

    2015-11-01

    Group cell migration is a highly coordinated process that is involved in a number of physiological events such as morphogenesis, wound healing and tumor metastasis. Unlike single cells, collectively moving cells are physically attached to each other and retain some degree of apical-basal polarity during the migratory phase. Although much is known about direction sensing, how polarity is regulated in multicellular movement remains unclear. Here we report the role of the protein kinase Pak3 in maintaining apical-basal polarity in migrating border cell clusters during Drosophila oogenesis. Pak3 is enriched in border cells and downregulation of its function impedes border cell movement. Time-lapse imaging suggests that Pak3 affects protrusive behavior of the border cell cluster, specifically regulating the stability and directionality of protrusions. Pak3 functions downstream of guidance receptor signaling to regulate the level and distribution of F-actin in migrating border cells. We also provide evidence that Pak3 genetically interacts with the lateral polarity marker Scribble and that it regulates JNK signaling in the moving border cells. Since Pak3 depletion results in mislocalization of several apical-basal polarity markers and overexpression of Jra rescues the polarity of the Pak3-depleted cluster, we propose that Pak3 functions through JNK signaling to modulate apical-basal polarity of the migrating border cell cluster. We also observe loss of apical-basal polarity in Rac1-depleted border cell clusters, suggesting that guidance receptor signaling functions through Rac GTPase and Pak3 to regulate the overall polarity of the cluster and mediate efficient collective movement of the border cells to the oocyte boundary.

  7. Transcriptional profiling of Arabidopsis root hairs and pollen defines an apical cell growth signature

    PubMed Central

    2014-01-01

    Background Current views on the control of cell development are anchored on the notion that phenotypes are defined by networks of transcriptional activity. The large amounts of information brought about by transcriptomics should allow the definition of these networks through the analysis of cell-specific transcriptional signatures. Here we test this principle by applying an analogue to comparative anatomy at the cellular level, searching for conserved transcriptional signatures, or conserved small gene-regulatory networks (GRNs) on root hairs (RH) and pollen tubes (PT), two filamentous apical growing cells that are a striking example of conservation of structure and function in plants. Results We developed a new method for isolation of growing and mature root hair cells, analysed their transcriptome by microarray analysis, and further compared it with pollen and other single cell transcriptomics data. Principal component analysis shows a statistical relation between the datasets of RHs and PTs which is suggestive of a common transcriptional profile pattern for the apical growing cells in a plant, with overlapping profiles and clear similarities at the level of small GTPases, vesicle-mediated transport and various specific metabolic responses. Furthermore, cis-regulatory element analysis of co-regulated genes between RHs and PTs revealed conserved binding sequences that are likely required for the expression of genes comprising the apical signature. This included a significant occurrence of motifs associated to a defined transcriptional response upon anaerobiosis. Conclusions Our results suggest that maintaining apical growth mechanisms synchronized with energy yielding might require a combinatorial network of transcriptional regulation. We propose that this study should constitute the foundation for further genetic and physiological dissection of the mechanisms underlying apical growth of plant cells. PMID:25080170

  8. En face optical coherence tomography investigation of apical microleakage after laser-assisted endodontic treatment.

    PubMed

    Todea, Carmen; Balabuc, Cosmin; Sinescu, Cosmin; Filip, Laura; Kerezsi, Cristina; Calniceanu, Mircea; Negrutiu, Meda; Bradu, Adrian; Hughes, Michael; Podoleanu, Adrian Gh

    2010-09-01

    The aim of our study was to evaluate the potential of en face optical coherence tomography (OCT) for the detection of apical microleakage after 980 nm and 1,064 nm laser-assisted endodontic treatment. Ninety, human, single-rooted teeth with one straight root canal and closed apices were used. All roots were prepared biomechanically to the working length at an apical size 30 and 0.06 taper. The teeth were divided into three equal groups of 30 samples each, according to the treatment to be applied to the root canal. Group I received 980 nm diode laser (3 W, 0.01 s on time, 0.01 s off time, 5 s per procedure, four procedures); group II received neodymium:yttrium-aluminum-garnet (Nd:YAG) laser (1.5 W, 15 Hz, 5 s per procedure, four procedures). In group III the root canals were approached conventionally only. In all groups the root canal filling was performed with AH Plus endodontic sealer and gutta-percha points. An en face OCT prototype was used for the investigation of apical microleakage. According to one-way analysis of variance (ANOVA) and en face OCT, the number of defects in the laser groups was significantly lower (P < 0.005) than in the control group. No statistical differences were noted between the laser groups (P = 0.049). En face OCT imaging proved that laser-assisted endodontic treatment improved the prognosis of root canal filling and led to a reduction in apical microleakage.

  9. Apical uptake of radiolabelled ochratoxin A into Madin-Darby canine kidney cells.

    PubMed

    Schwerdt, G; Freudinger, R; Silbernagl, S; Gekle, M

    1998-11-16

    Uptake of ochratoxin A (OTA) across the apical cell membrane of collecting duct cells is the first step in reabsorption and partly mediated by proton-dipeptide cotransport. As the remaining part of apical OTA uptake remained unclear, we studied the characteristics of apical uptake of tritium-labelled OTA (3H-OTA) in MDCK-C11 cells in detail. Uptake of 3H-OTA was pH- and temperature-dependent and led to intracellular accumulation of OTA. Lowering pH led to an increase and lowering temperature (4 degrees C) to a decrease of OTA uptake. Besides dipeptides, the beta-lactam antibiotics cephalexin and ceftibuten inhibited the 3H-OTA uptake also confirming the role of the proton dipeptide cotransporter. In addition, substrates of organic anion transporter, taurocholate and methotrexate, inhibited 3H-OTA uptake in part. Aspartylphenylalanine methyl ester (aspartame) had no inhibitory effect on 3H-OTA uptake. Uptake of OTA was not dependent on sodium. Sixty minutes of preincubation with phorbol 12-myristate 13-acetate (PMA) led to increased apical uptake of OTA. The PMA effects were inhibited by ethylisopropylamilorid (EIPA). We conclude that apical uptake of OTA occurs by Na+-independent transport. One part of the uptake is mediated by proton-dipeptide cotransport (30%, dipeptide-inhibitable), by organic anion transporter (20%, taurocholate-inhibitable) and by diffusion (20%, responsible for uptake at 4 degrees C). The remaining part occurs by as yet unidentified but pH-dependent transport mechanisms. An acidic urine in distal parts of the nephron provides thus the main risk for OTA uptake leading to its reabsorption and consequently alkalinisation of the urine should help to prevent this reabsorption.

  10. Temporal and spatial regulation of symplastic trafficking during development in Arabidopsis thaliana apices.

    PubMed

    Gisel, A; Barella, S; Hempel, F D; Zambryski, P C

    1999-05-01

    Plasmodesmata provide symplastic continuity linking individual plant cells. However, specialized cells may be isolated, either by the absence of plasmodesmata or by down regulation of the cytoplasmic flux through these channels, resulting in the formation of symplastic domains. Maintenance of these domains may be essential for the co-ordination of growth and development. While cells in the center of the meristem divide slowly and remain undifferentiated, cells on the meristem periphery divide more frequently and respond to signals determining organ fate. Such symplastic domains were visualized within shoot apices of Arabidopsis, by monitoring fluorescent symplastic tracers (HPTS: 8-hydroxypyrene 1,3,6 trisulfonic acid and CF: carboxy fluorescein). Tracers were loaded through cut leaves and distributed throughout the whole plant. Confocal laser scanning microscopy on living Arabidopsis plants indicates that HPTS moves via the vascular tissue from leaves to the apex where the tracer exits the phloem and moves symplastically into surrounding cells. The distribution of HPTS was monitored in vegetative apices, and just prior to, during, and after the switch to production of flowers. The apices of vegetative plants loaded with HPTS had detectable amounts of tracer in the tunica layer of the meristem and in very young primordia, whereas the corpus of the meristem excluded tracer uptake. Fluorescence signal intensity decreased prior to the onset of flowering. Moreover, at approximately the time the plants were committed to flowering, HPTS was undetectable in the inflorescence meristem or young primordia. Later in development, after several secondary inflorescences and mature siliques appeared, inflorescence apices again showed tracer loading at levels comparable to that of vegetative apices. Thus, analysis of fluorescent tracer movement via plasmodesmata reveals there is distinct temporal and spatial regulation of symplastic domains at the apex, dependent on the

  11. Sorting of Membrane and Fluid at the Apical Pole of Polarized Madin-Darby Canine Kidney Cells

    PubMed Central

    Leung, Som-Ming; Ruiz, Wily G.; Apodaca, Gerard

    2000-01-01

    When fluid-phase markers are internalized from opposite poles of polarized Madin-Darby canine kidney cells, they accumulate in distinct apical and basolateral early endosomes before meeting in late endosomes. Recent evidence suggests that significant mixing of apically and basolaterally internalized membrane proteins occurs in specialized apical endosomal compartments, including the common recycling endosome and the apical recycling endosome (ARE). The relationship between these latter compartments and the fluid-labeled apical early endosome is unknown at present. We report that when the apical recycling marker, membrane-bound immunoglobulin A (a ligand for the polymeric immunoglobulin receptor), and fluid-phase dextran are cointernalized from the apical poles of Madin-Darby canine kidney cells, they enter a shared apical early endosome (≤2.5 min at 37°C) and are then rapidly segregated from one another. The dextran remains in the large supranuclear EEA1-positive early endosomes while recycling polymeric immunoglobulin receptor–bound immunoglobulin A is delivered to a Rab11-positive subapical recycling compartment. This latter step requires an intact microtubule cytoskeleton. Receptor-bound transferrin, a marker of the basolateral recycling pathway, has limited access to the fluid-rich apical early endosome but is excluded from the subapical elements of the Rab11-positive recycling compartment. We propose that the term ARE be used to describe the subapical Rab11-positive compartment and that the ARE is distinct from both the transferrin-rich common recycling endosome and the fluid-rich apical early endosome. PMID:10848634

  12. The S2 Cu(I) site in CupA from Streptococcus pneumoniae is required for cellular copper resistance†

    PubMed Central

    Fu, Yue; Bruce, Kevin E.; Wu, Hongwei; Giedroc, David P.

    2015-01-01

    Pathogenic bacteria have evolved copper homeostasis and resistance systems for fighting copper toxicity imposed by the human immune system. Streptococcus pneumoniae is a respiratory pathogen that encodes an obligatorily membrane-anchored Cu(I) binding protein, CupA, and a P1B-type ATPase efflux transporter, CopA. The soluble, cytoplasmic domain of CupA (sCupA) contains a binuclear Cu(I) cluster consisting of S1 and S2 Cu(I) ions. The NMR solution structure of apo-sCupA reveals the same cupredoxin fold of Cu2-sCupA, except that the Cu(I) binding loop (residues 112–116, harboring S2 Cu ligands M113 and M115) is highly dynamic as documented by both backbone and side chain methionine methyl order parameters. In contrast to the more solvent exposed, lower affinity S2 Cu site, the high affinity S1 Cu-coordinating cysteines (C74, C111) are pre-organized in the apo-sCupA structure. Biological experiments reveal that the S1 site is largely dispensable for cellular Cu resistance and may be involved in buffering low cytoplasmic Cu(I). In contrast, the S2 site is essential for Cu resistance. Expression of a chimeric CopZ chaperone fused to the CupA transmembrane helix does not protect S. pneumoniae from copper toxicity and substitution of a predicted cytoplasm-facing Cu(I) entry metal-binding site (MBS) on CopA also gives rise to a Cu-sensitivity phenotype. These findings suggest that CupA and CopA may interact and filling of the CupA S2 site with Cu(I) results in stimulation of cellular copper efflux by CopA. PMID:26346139

  13. The S2 Cu(i) site in CupA from Streptococcus pneumoniae is required for cellular copper resistance.

    PubMed

    Fu, Yue; Bruce, Kevin E; Wu, Hongwei; Giedroc, David P

    2016-01-01

    Pathogenic bacteria have evolved copper homeostasis and resistance systems for fighting copper toxicity imposed by the human immune system. Streptococcus pneumoniae is a respiratory pathogen that encodes an obligatorily membrane-anchored Cu(i) binding protein, CupA, and a P1B-type ATPase efflux transporter, CopA. The soluble, cytoplasmic domain of CupA (sCupA) contains a binuclear Cu(i) cluster consisting of S1 and S2 Cu(i) ions. The NMR solution structure of apo-sCupA reveals the same cupredoxin fold of Cu2-sCupA, except that the Cu(i) binding loop (residues 112-116, harboring S2 Cu ligands M113 and M115) is highly dynamic as documented by both backbone and side chain methionine methyl order parameters. In contrast to the more solvent exposed, lower affinity S2 Cu site, the high affinity S1 Cu-coordinating cysteines (C74, C111) are pre-organized in the apo-sCupA structure. Biological experiments reveal that the S1 site is largely dispensable for cellular Cu resistance and may be involved in buffering low cytoplasmic Cu(i). In contrast, the S2 site is essential for Cu resistance. Expression of a chimeric CopZ chaperone fused to the CupA transmembrane helix does not protect S. pneumoniae from copper toxicity and substitution of a predicted cytoplasm-facing Cu(i) entry metal-binding site (MBS) on CopA also gives rise to a Cu-sensitivity phenotype. These findings suggest that CupA and CopA may interact and filling of the CupA S2 site with Cu(i) results in stimulation of cellular copper efflux by CopA.

  14. The Cup Anemometer, a Fundamental Meteorological Instrument for the Wind Energy Industry. Research at the IDR/UPM Institute

    PubMed Central

    Pindado, Santiago; Cubas, Javier; Sorribes-Palmer, Félix

    2014-01-01

    The results of several research campaigns investigating cup anemometer performance carried out since 2008 at the IDR/UPM Institute are included in the present paper. Several analysis of large series of calibrations were done by studying the effect of the rotor's geometry, climatic conditions during calibration, and anemometers' ageing. More specific testing campaigns were done regarding the cup anemometer rotor aerodynamics, and the anemometer signals. The effect of the rotor's geometry on the cup anemometer transfer function has been investigated experimentally and analytically. The analysis of the anemometer's output signal as a way of monitoring the anemometer status is revealed as a promising procedure for detecting anomalies. PMID:25397921

  15. The cup anemometer, a fundamental meteorological instrument for the wind energy industry. Research at the IDR/UPM Institute.

    PubMed

    Pindado, Santiago; Cubas, Javier; Sorribes-Palmer, Félix

    2014-11-12

    The results of several research campaigns investigating cup anemometer performance carried out since 2008 at the IDR/UPM Institute are included in the present paper. Several analysis of large series of calibrations were done by studying the effect of the rotor's geometry, climatic conditions during calibration, and anemometers' ageing. More specific testing campaigns were done regarding the cup anemometer rotor aerodynamics, and the anemometer signals. The effect of the rotor's geometry on the cup anemometer transfer function has been investigated experimentally and analytically. The analysis of the anemometer's output signal as a way of monitoring the anemometer status is revealed as a promising procedure for detecting anomalies.

  16. Use and abuse of medication during 2014 FIFA World Cup Brazil: a retrospective survey

    PubMed Central

    Vaso, Martin; Weber, Alexis; Tscholl, Philippe M; Junge, Astrid; Dvorak, Jiri

    2015-01-01

    Objective To examine the use of medication of top-level male players during the 2014 FIFA World Cup Brazil. Design Retrospective survey. Participants/information 736 top level players. Setting The teams’ physicians disclosed a list of the medications used by each player within 72 h before each match of the 2014 FIFA World Cup Brazil. Outcome measures Average number of medications used per player per match or during the tournament; average number and percentage of players using at least one medication per match or during the tournament. Results 67.0% of all players took various types of medication during the tournament. The most used medications during the tournament were non-steroidal anti-inflammatory drugs (NSAIDs), by 54.2% of all players, followed by analgaesics (12.6%); β-2 agonists were only used by 0.5%. On average, 0.8 medications per player were used before each match. More players were reported taking medications during the knockout round than during the qualification round (0.36±0.48 vs 0.49±0.50, p<0.001). Players from the South American and Asian Confederations took twice as many medications per match as players from the African Confederation (1.17±1.55 and 1.01±1.26 vs 0.48±0.69, both p<0.001). Conclusions There was high use of NSAIDs during the 2014 FIFA World Cup. Although the intake of NSAIDs per match (0.35±0.46 vs 0.31±0.48, p<0.01) in the 2014 FIFA World Cup decreased compared to the 2010 FIFA World Cup, the average use was still higher than in the 2006 FIFA World Cup, and the average number of all used medications per player remained the same level as 4 years prior, with all its implications for the player's health. More efforts need to be undertaken worldwide in order to reduce the administration of medications in sports, through continuous education for players, starting from a young age, as well as for doctors and paramedics. PMID:26359283

  17. Comparison of Head Center Position and Screw Fixation Options Between a Jumbo Cup and an Offset Center of Rotation Cup in Revision Total Hip Arthroplasty: A Computer Simulation Study.

    PubMed

    Faizan, Ahmad; Black, Brandon J; Fay, Brian D; Heffernan, Christopher D; Ries, Michael D

    2016-01-01

    Jumbo acetabular cups are commonly used in revision total hip arthroplasty (THA). A straightforward reaming technique is used which is similar to primary THA. However, jumbo cups may also be associated with hip center elevation, limited screw fixation options, and anterior soft tissue impingement. A partially truncated hemispherical shell was designed with an offset center of rotation, thick superior rim, and beveled anterior and superior rims as an alternative to a conventional jumbo cup. A three dimensional computer simulation was used to assess head center position and safe screw trajectories. Results of this in vitro study indicate that a modified hemispherical implant geometry can reduce head center elevation while permitting favorable screw fixation trajectories into the pelvis in comparison to a conventional jumbo cup.

  18. Measuring splash erosion potential under vegetation using sand-filled splash cups

    NASA Astrophysics Data System (ADS)

    Geißler, C.; Scholten, T.; Kühn, P.

    2009-04-01

    In soil erosion research it is widely accepted that vegetation is not only protecting the soil from the erosive power of rainfall. Under specific circumstances (like they occur e.g. in forests) vegetation can enhance the erosive power of rainfall by modifying its properties (esp. drop size distribution, kinetic energy). The adjacent processes are very complex and variable in time and space and depend on numerous variables (e.g. rainfall intensity, drop size distribution, drop fall velocity, height of the canopy, density of the canopy, crown and leaf traits, LAI). In the last decades a large number of studies focused this process-system using different methods and came to often different results (Brandt 1989; Calder 2001; Foot & Morgan 2005; Hall & Calder 1993; Mosley 1982; Nanko et al. 2006; Park & Cameron 2008; Vis 1986). The main objective of our field experiments in subtropical China is to quantify the modification of precipitation by its pass through the canopy layer for six different tree species, three different successional stages and three different biodiversity classes. For this, new splash cups were developed based on the archetype of Ellison (1947). In contrast to previous studies with splash cups (Vis 1986) or other forms of splash cups (Kinnell 1974; Morgan 1981) we measured the unit sand remaining inside the cup after single natural rainfall events. The new splash cups contain of a PE-flask to which a carrier system has been attached. In this carrier system a cup filled with unit sand of 125-200 µm particle size is inserted. At the bottom of the cup a silk cover is attached to avoid the loss of sand and to guarantee free drainage of water from the cup to the carrier and vice versa. Cup and PE-flask are hydraulically connected by a cotton wick to assure constant moisture content throughout the time of measuring. Additionally, vents in the carrier system ensure that the pressure arising from the insertion of the cup doesn't lead to a loss of sand. The

  19. Glutathione transferase theta in apical ciliary tuft regulates mechanical reception and swimming behavior of Sea Urchin Embryos

    PubMed Central

    Jin, Yinhua; Yaguchi, Shunsuke; Shiba, Kogiku; Yamada, Lixy; Yaguchi, Junko; Shibata, Daisuke; Sawada, Hitoshi; Inaba, Kazuo

    2013-01-01

    An apical tuft, which is observed in a wide range of embryos/larvae of marine invertebrates, is composed of a group of cilia that are longer and less motile than the abundant lateral cilia covering the rest of the embryonic surface. Although the apical tuft has been thought to function as a sensory organ, its molecular composition and roles are poorly understood. Here, we identified a glutathione transferase theta (GSTT) as an abundant and specific component of the apical tuft in sea urchin embryos. The expression of GSTT mRNA increases and becomes limited to the animal plate of the mesenchyme blastula, gastrula, and prism larva. Electron microscopy and tandem mass spectrometry demonstrated that the apical tuft contains almost every axonemal component for ciliary motility. Low concentrations of an inhibitor of glutathione transferase bromosulphophthalein (BSP) induce bending of apical tuft, suggesting that GSTT regulates motility of apical tuft cilia. Embryos treated with BSP swim with normal velocity and trajectories but show less efficiency of changing direction when they collide with an object. These results suggest that GSTT in the apical tuft plays an important role in the mechanical reception for the motility regulation of lateral motile cilia in sea urchin embryos. PMID:23907936

  20. Adenovirus entry from the apical surface of polarized epithelia is facilitated by the host innate immune response.

    PubMed

    Kotha, Poornima L N; Sharma, Priyanka; Kolawole, Abimbola O; Yan, Ran; Alghamri, Mahmoud S; Brockman, Trisha L; Gomez-Cambronero, Julian; Excoffon, Katherine J D A

    2015-03-01

    Prevention of viral-induced respiratory disease begins with an understanding of the factors that increase or decrease susceptibility to viral infection. The primary receptor for most adenoviruses is the coxsackievirus and adenovirus receptor (CAR), a cell-cell adhesion protein normally localized at the basolateral surface of polarized epithelia and involved in neutrophil transepithelial migration. Recently, an alternate isoform of CAR, CAREx8, has been identified at the apical surface of polarized airway epithelia and is implicated in viral infection from the apical surface. We hypothesized that the endogenous role of CAREx8 may be to facilitate host innate immunity. We show that IL-8, a proinflammatory cytokine and a neutrophil chemoattractant, stimulates the protein expression and apical localization of CAREx8 via activation of AKT/S6K and inhibition of GSK3β. Apical CAREx8 tethers infiltrating neutrophils at the apical surface of a polarized epithelium. Moreover, neutrophils present on the apical-epithelial surface enhance adenovirus entry into the epithelium. These findings suggest that adenovirus evolved to co-opt an innate immune response pathway that stimulates the expression of its primary receptor, apical CAREx8, to allow the initial infection the intact epithelium. In addition, CAREx8 is a new target for the development of novel therapeutics for both respiratory inflammatory disease and adenoviral infection.