Sample records for apicomplexan transcriptional regulons

  1. Comparative genomics and evolution of transcriptional regulons in Proteobacteria

    PubMed Central

    Kazakov, Alexey E.; Ravcheev, Dmitry A.; Stepanova, Vita V.; Novichkov, Pavel S.


    Comparative genomics approaches are broadly used for analysis of transcriptional regulation in bacterial genomes. In this work, we identified binding sites and reconstructed regulons for 33 orthologous groups of transcription factors (TFs) in 196 reference genomes from 21 taxonomic groups of Proteobacteria. Overall, we predict over 10 600 TF binding sites and identified more than 15 600 target genes for 1896 TFs constituting the studied orthologous groups of regulators. These include a set of orthologues for 21 metabolism-associated TFs from Escherichia coli and/or Shewanella that are conserved in five or more taxonomic groups and several additional TFs that represent non-orthologous substitutions of the metabolic regulators in some lineages of Proteobacteria. By comparing gene contents of the reconstructed regulons, we identified the core, taxonomy-specific and genome-specific TF regulon members and classified them by their metabolic functions. Detailed analysis of ArgR, TyrR, TrpR, HutC, HypR and other amino-acid-specific regulons demonstrated remarkable differences in regulatory strategies used by various lineages of Proteobacteria. The obtained genomic collection of in silico reconstructed TF regulons contains a large number of new regulatory interactions that await future experimental validation. The collection provides a framework for future evolutionary studies of transcriptional regulatory networks in Bacteria. It can be also used for functional annotation of putative metabolic transporters and enzymes that are abundant in the reconstructed regulons. PMID:28348857

  2. Novel Transcriptional Regulons for Autotrophic Cycle Genes in Crenarchaeota

    PubMed Central

    Leyn, Semen A.; Rodionova, Irina A.; Li, Xiaoqing


    ABSTRACT Autotrophic microorganisms are able to utilize carbon dioxide as their only carbon source, or, alternatively, many of them can grow heterotrophically on organics. Different variants of autotrophic pathways have been identified in various lineages of the phylum Crenarchaeota. Aerobic members of the order Sulfolobales utilize the hydroxypropionate-hydroxybutyrate cycle (HHC) to fix inorganic carbon, whereas anaerobic Thermoproteales use the dicarboxylate-hydroxybutyrate cycle (DHC). Knowledge of transcriptional regulation of autotrophic pathways in Archaea is limited. We applied a comparative genomics approach to predict novel autotrophic regulons in the Crenarchaeota. We report identification of two novel DNA motifs associated with the autotrophic pathway genes in the Sulfolobales (HHC box) and Thermoproteales (DHC box). Based on genome context evidence, the HHC box regulon was attributed to a novel transcription factor from the TrmB family named HhcR. Orthologs of HhcR are present in all Sulfolobales genomes but were not found in other lineages. A predicted HHC box regulatory motif was confirmed by in vitro binding assays with the recombinant HhcR protein from Metallosphaera yellowstonensis. For the DHC box regulon, we assigned a different potential regulator, named DhcR, which is restricted to the order Thermoproteales. DhcR in Thermoproteus neutrophilus (Tneu_0751) was previously identified as a DNA-binding protein with high affinity for the promoter regions of two autotrophic operons. The global HhcR and DhcR regulons reconstructed by comparative genomics were reconciled with available omics data in Metallosphaera and Thermoproteus spp. The identified regulons constitute two novel mechanisms for transcriptional control of autotrophic pathways in the Crenarchaeota. IMPORTANCE Little is known about transcriptional regulation of carbon dioxide fixation pathways in Archaea. We previously applied the comparative genomics approach for reconstruction of Dtx

  3. Post-transcriptional RNA Regulons Affecting Cell Cycle and Proliferation

    PubMed Central

    Blackinton, Jeff G.


    The cellular growth cycle is initiated and maintained by punctual, yet agile, regulatory events involving modifications of cell cycle proteins as well as coordinated gene expression to support cyclic checkpoint decisions. Recent evidence indicates that post-transcriptional partitioning of messenger RNA subsets by RNA-binding proteins help physically localize, temporally coordinate, and efficiently translate cell cycle proteins. This dynamic organization of mRNAs encoding cell cycle components contributes to the overall economy of the cell cycle consistent with the post-transcriptional RNA regulon model of gene expression. This review examines several recent studies demonstrating the coordination of mRNA subsets encoding cell cycle proteins during nuclear export and subsequent coupling to protein synthesis, and discusses evidence for mRNA coordination of p53 targets and the DNA damage response pathway. We consider how these observations may connect to upstream and downstream post-transcriptional coordination and coupling of splicing, export, localization, and translation. Published examples from yeast, nematode, insect, and mammalian systems are discussed, and we consider genetic evidence supporting the conclusion that dysregulation of RNA regulons may promote pathogenic states of growth such as carcinogenesis. PMID:24882724

  4. Maltose-Dependent Transcriptional Regulation of the mal Regulon by MalR in Streptococcus pneumoniae.


    Afzal, Muhammad; Shafeeq, Sulman; Manzoor, Irfan; Kuipers, Oscar P


    The maltose regulon (mal regulon) has previously been shown to consist of the mal gene cluster (malMP, malXCD and malAR operons) in Streptococcus pneumoniae. In this study, we have further elucidated the complete mal regulon in S. pneumoniae D39 using microarray analyses and β-galactosidase assays. In addition to the mal gene cluster, the complete mal regulon of S. pneumoniae D39 consists of a pullulanase (PulA), a glucosidase (DexB), a glucokinase (RokB), a PTS component (PtsG) and an amylase (AmyA2). Our microarray studies and β-galactosidase assays further showed that the LacI-family transcriptional regulator MalR represses the expression of the mal regulon in the absence of maltose. Furthermore, the role of the pleiotropic transcriptional regulator CcpA in the regulation of the mal regulon in the presence of maltose was explored. Our microarray analysis with a ΔccpA strain showed that CcpA only represses the expression of the malXCD operon and the pulA gene in the presence of maltose. Hence, we extend the mal regulon now consisting of pulA, dexB, rokB, ptsG and amyA2 in addition to malMP, malXCD and malAR operons.

  5. The Streptococcus pneumoniae cia regulon: CiaR target sites and transcription profile analysis.


    Mascher, Thorsten; Zähner, Dorothea; Merai, Michelle; Balmelle, Nadège; de Saizieu, Antoine B; Hakenbeck, Regine


    The ciaR-ciaH system is one of 13 two-component signal-transducing systems of the human pathogen Streptococcus pneumoniae. Mutations in the histidine protein kinase CiaH confer increased resistance to beta-lactam antibiotics and interfere with the development of genetic competence. In order to identify the genes controlled by the cia system, the cia regulon, DNA fragments targeted by the response regulator CiaR were isolated from restricted chromosomal DNA using the solid-phase DNA binding assay and analyzed by hybridization to an oligonucleotide microarray representing the S. pneumoniae genome. A set of 18 chromosomal regions containing 26 CiaR target sites were detected and proposed to represent the minimal cia regulon. The putative CiaR target loci included genes important for the synthesis and modification of cell wall polymers, peptide pheromone and bacteriocin production, and the htrA-spo0J region. In addition, the transcription profile of cia loss-of-function mutants and those with an apparent activated cia system representing the off and on states of the regulatory system were analyzed. The transcript analysis confirmed the cia-dependent expression of seven putative target loci and revealed three additional cia-regulated loci. Five putative target regions were silent under all conditions, and for the remaining three regions, no cia-dependent expression could be detected. Furthermore, the competence regulon, including the comCDE operon required for induction of competence, was completely repressed by the cia system.

  6. Transcriptional and functional analysis of the Neisseria gonorrhoeae fur regulon

    Technology Transfer Automated Retrieval System (TEKTRAN)

    To ensure survival in the host, bacteria have evolved strategies to acquire the essential element iron. In Neisseria gonorrhoeae, the ferric uptake regulator senses intracellular iron stores and acting as a repressor, directly regulates transcription of iron-responsive genes by binding to a conserve...

  7. Identification of the CRP regulon using in vitro and in vivo transcriptional profiling.


    Zheng, Dongling; Constantinidou, Chrystala; Hobman, Jon L; Minchin, Stephen D


    The Escherichia coli cyclic AMP receptor protein (CRP) is a global regulator that controls transcription initiation from more than 100 promoters by binding to a specific DNA sequence within cognate promoters. Many genes in the CRP regulon have been predicted simply based on the presence of DNA-binding sites within gene promoters. In this study, we have exploited a newly developed technique, run-off transcription/microarray analysis (ROMA) to define CRP-regulated promoters. Using ROMA, we identified 176 operons that were activated by CRP in vitro and 16 operons that were repressed. Using positive control mutants in different regions of CRP, we were able to classify the different promoters into class I or class II/III. A total of 104 operons were predicted to contain Class II CRP-binding sites. Sequence analysis of the operons that were repressed by CRP revealed different mechanisms for CRP inhibition. In contrast, the in vivo transcriptional profiles failed to identify most CRP-dependent regulation because of the complexity of the regulatory network. Analysis of these operons supports the hypothesis that CRP is not only a regulator of genes required for catabolism of sugars other than glucose, but also regulates the expression of a large number of other genes in E.coli. ROMA has revealed 152 hitherto unknown CRP regulons.

  8. Comparative genomics of pyridoxal 5′-phosphate-dependent transcription factor regulons in Bacteria

    PubMed Central

    Suvorova, Inna A.


    The MocR-subfamily transcription factors (MocR-TFs) characterized by the GntR-family DNA-binding domain and aminotransferase-like sensory domain are broadly distributed among certain lineages of Bacteria. Characterized MocR-TFs bind pyridoxal 5′-phosphate (PLP) and control transcription of genes involved in PLP, gamma aminobutyric acid (GABA) and taurine metabolism via binding specific DNA operator sites. To identify putative target genes and DNA binding motifs of MocR-TFs, we performed comparative genomics analysis of over 250 bacterial genomes. The reconstructed regulons for 825 MocR-TFs comprise structural genes from over 200 protein families involved in diverse biological processes. Using the genome context and metabolic subsystem analysis we tentatively assigned functional roles for 38 out of 86 orthologous groups of studied regulators. Most of these MocR-TF regulons are involved in PLP metabolism, as well as utilization of GABA, taurine and ectoine. The remaining studied MocR-TF regulators presumably control genes encoding enzymes involved in reduction/oxidation processes, various transporters and PLP-dependent enzymes, for example aminotransferases. Predicted DNA binding motifs of MocR-TFs are generally similar in each orthologous group and are characterized by two to four repeated sequences. Identified motifs were classified according to their structures. Motifs with direct and/or inverted repeat symmetry constitute the majority of inferred DNA motifs, suggesting preferable TF dimerization in head-to-tail or head-to-head configuration. The obtained genomic collection of in silico reconstructed MocR-TF motifs and regulons in Bacteria provides a basis for future experimental characterization of molecular mechanisms for various regulators in this family. PMID:28348826

  9. Quantitative and temporal definition of the Mla transcriptional regulon during barley-powdery mildew interactions.


    Moscou, Matthew J; Lauter, Nick; Caldo, Rico A; Nettleton, Dan; Wise, Roger P


    Barley Mildew resistance locus a (Mla) is a major determinant of immunity to the powdery mildew pathogen, Blumeria graminis f. sp. hordei. Alleles of Mla encode cytoplasmic- and membrane-localized coiled-coil, nucleotide binding site, leucine-rich repeat proteins that mediate resistance when complementary avirulence effectors (AVR(a)) are present in the pathogen. Presence of an appropriate AVR(a) protein triggers nuclear relocalization of MLA, in which MLA binds repressing host transcription factors. Timecourse expression profiles of plants harboring Mla1, Mla6, and Mla12 wild-type alleles versus paired loss-of-function mutants were compared to discover conserved transcriptional targets of MLA and downstream signaling cascades. Pathogen-dependent gene expression was equivalent or stronger in susceptible plants at 20 h after inoculation (HAI) and was attenuated at later timepoints, whereas resistant plants exhibited a time-dependent strengthening of the transcriptional response, increasing in both fold change and the number of genes differentially expressed. Deregulation at 20 HAI implicated 16 HAI as a crucial point in determining the future trajectory of this interaction and was interrogated by quantitative analysis. In total, 28 potential transcriptional targets of the MLA regulon were identified. These candidate targets possess a diverse set of predicted functions, suggesting that multiple pathways are required to mediate the hypersensitive reaction.

  10. Transcriptome analysis of differentiating trypanosomes reveals the existence of multiple post-transcriptional regulons

    PubMed Central

    Queiroz, Rafael; Benz, Corinna; Fellenberg, Kurt; Hoheisel, Jörg D; Clayton, Christine


    Background Trypanosome gene expression is regulated almost exclusively at the post-transcriptional level, with mRNA degradation playing a decisive role. When trypanosomes are transferred from the blood of a mammal to the midgut of a Tsetse fly, they transform to procyclic forms: gene expression is reprogrammed, changing the cell surface and switching the mode of energy metabolism. Within the blood, trypanosomes can pre-adapt for Tsetse transmission, becoming growth-arrested stumpy forms. We describe here the transitions in gene expression that occur during differentiation of in-vitro cultured bloodstream forms to procyclic forms. Results Some mRNAs showed changes within 30 min of cis-aconitate addition, whereas others responded 12-24 hours later. For the first 12 h after addition of cis-aconitate, cells accumulated at the G1 phase of the cell cycle, and showed decreases in mRNAs required for proliferation, mimicking the changes seen in stumpy forms: many mRNAs needed for ribosomal and flagellar biogenesis showed striking co-regulation. Other mRNAs encoding components of signal transduction pathways and potential regulators were specifically induced only during differentiation. Messenger RNAs encoding proteins required for individual metabolic pathways were often co-regulated. Conclusion Trypanosome genes form post-transcriptional regulons in which mRNAs with functions in particular pathways, or encoding components of protein complexes, show almost identical patterns of regulation. PMID:19857263

  11. Onco-Regulon: an integrated database and software suite for site specific targeting of transcription factors of cancer genes

    PubMed Central

    Tomar, Navneet; Mishra, Akhilesh; Mrinal, Nirotpal; Jayaram, B.


    Transcription factors (TFs) bind at multiple sites in the genome and regulate expression of many genes. Regulating TF binding in a gene specific manner remains a formidable challenge in drug discovery because the same binding motif may be present at multiple locations in the genome. Here, we present Onco-Regulon (, an integrated database of regulatory motifs of cancer genes clubbed with Unique Sequence-Predictor (USP) a software suite that identifies unique sequences for each of these regulatory DNA motifs at the specified position in the genome. USP works by extending a given DNA motif, in 5′→3′, 3′ →5′ or both directions by adding one nucleotide at each step, and calculates the frequency of each extended motif in the genome by Frequency Counter programme. This step is iterated till the frequency of the extended motif becomes unity in the genome. Thus, for each given motif, we get three possible unique sequences. Closest Sequence Finder program predicts off-target drug binding in the genome. Inclusion of DNA-Protein structural information further makes Onco-Regulon a highly informative repository for gene specific drug development. We believe that Onco-Regulon will help researchers to design drugs which will bind to an exclusive site in the genome with no off-target effects, theoretically. Database URL: PMID:27515825

  12. Onco-Regulon: an integrated database and software suite for site specific targeting of transcription factors of cancer genes.


    Tomar, Navneet; Mishra, Akhilesh; Mrinal, Nirotpal; Jayaram, B


    Transcription factors (TFs) bind at multiple sites in the genome and regulate expression of many genes. Regulating TF binding in a gene specific manner remains a formidable challenge in drug discovery because the same binding motif may be present at multiple locations in the genome. Here, we present Onco-Regulon (, an integrated database of regulatory motifs of cancer genes clubbed with Unique Sequence-Predictor (USP) a software suite that identifies unique sequences for each of these regulatory DNA motifs at the specified position in the genome. USP works by extending a given DNA motif, in 5'→3', 3' →5' or both directions by adding one nucleotide at each step, and calculates the frequency of each extended motif in the genome by Frequency Counter programme. This step is iterated till the frequency of the extended motif becomes unity in the genome. Thus, for each given motif, we get three possible unique sequences. Closest Sequence Finder program predicts off-target drug binding in the genome. Inclusion of DNA-Protein structural information further makes Onco-Regulon a highly informative repository for gene specific drug development. We believe that Onco-Regulon will help researchers to design drugs which will bind to an exclusive site in the genome with no off-target effects, theoretically.Database URL:

  13. Activation of the Escherichia coli marA/soxS/rob regulon in response to transcriptional activator concentration.


    Martin, Robert G; Bartlett, Emily S; Rosner, Judah L; Wall, Michael E


    The paralogous transcriptional activators MarA, SoxS, and Rob activate a common set of promoters, the marA/soxS/rob regulon of Escherichia coli, by binding a cognate site (marbox) upstream of each promoter. The extent of activation varies from one promoter to another and is only poorly correlated with the in vitro affinity of the activator for the specific marbox. Here, we examine the dependence of promoter activation on the level of activator in vivo by manipulating the steady-state concentrations of MarA and SoxS in Lon protease mutants and by measuring promoter activation using lacZ transcriptional fusions. We found that: (i) the MarA concentrations needed for half-maximal stimulation varied by at least 19-fold among the 10 promoters tested; (ii) most marboxes were not saturated when there were 24,000 molecules of MarA per cell; (iii) the correlation between the MarA concentration needed for half-maximal promoter activity in vivo and marbox binding affinity in vitro was poor; and (iv) the two activators differed in their promoter activation profiles. The marRAB and sodA promoters could both be saturated by MarA and SoxS in vivo. However, saturation by MarA resulted in greater marRAB and lesser sodA transcription than did saturation by SoxS, implying that the two activators interact with RNA polymerase in different ways at the different promoters. Thus, the concentration and nature of activator determine which regulon promoters are activated, as well as the extent of their activation.

  14. Alternative splicing mechanisms orchestrating post-transcriptional gene expression: intron retention and the intron-rich genome of apicomplexan parasites.


    Lunghi, Matteo; Spano, Furio; Magini, Alessandro; Emiliani, Carla; Carruthers, Vern B; Di Cristina, Manlio


    Apicomplexan parasites including Toxoplasma gondii and Plasmodium species have complex life cycles that include multiple hosts and differentiation through several morphologically distinct stages requiring marked changes in gene expression. This review highlights emerging evidence implicating regulation of mRNA splicing as a mechanism to prime these parasites for rapid gene expression upon differentiation. We summarize the most important insights in alternative splicing including its role in regulating gene expression by decreasing mRNA abundance via 'Regulated Unproductive Splicing and Translation'. As a related but less well-understood mechanism, we discuss also our recent work suggesting a role for intron retention for precluding translation of stage specific isoforms of T. gondii glycolytic enzymes. We additionally provide new evidence that intron retention might be a widespread mechanism during parasite differentiation. Supporting this notion, recent genome-wide analysis of Toxoplasma and Plasmodium suggests intron retention is more pervasive than heretofore thought. These findings parallel recent emergence of intron retention being more prevalent in mammals than previously believed, thereby adding to the established roles in plants, fungi and unicellular eukaryotes. Deeper mechanistic studies of intron retention will provide important insight into its role in regulating gene expression in apicomplexan parasites and more general in eukaryotic organisms.

  15. The origins of apicomplexan sequence innovation

    PubMed Central

    Wasmuth, James; Daub, Jennifer; Peregrín-Alvarez, José Manuel; Finney, Constance A.M.; Parkinson, John


    The Apicomplexa are a group of phylogenetically related parasitic protists that include Plasmodium, Cryptosporidium, and Toxoplasma. Together they are a major global burden on human health and economics. To meet this challenge, several international consortia have generated vast amounts of sequence data for many of these parasites. Here, we exploit these data to perform a systematic analysis of protein family and domain incidence across the phylum. A total of 87,736 protein sequences were collected from 15 apicomplexan species. These were compared with three protein databases, including the partial genome database, PartiGeneDB, which increases the breadth of taxonomic coverage. From these searches we constructed taxonomic profiles that reveal the extent of apicomplexan sequence diversity. Sequences without a significant match outside the phylum were denoted as apicomplexan specialized. These were collated into 9134 discrete protein families and placed in the context of the apicomplexan phylogeny, identifying the putative origin of each family. Most apicomplexan families were associated with an individual genus or species. Interestingly, many genera-specific innovations were associated with specialized host cell invasion and/or parasite survival processes. Contrastingly, those families reflecting more ancestral relationships were enriched in generalized housekeeping functions such as translation and transcription, which have diverged within the apicomplexan lineage. Protein domain searches revealed 192 domains not previously reported in apicomplexans together with a number of novel domain combinations. We highlight domains that may be important to parasite survival. PMID:19363216

  16. Transcriptional response of Corynebacterium glutamicum ATCC 13032 to hydrogen peroxide stress and characterization of the OxyR regulon.


    Milse, Johanna; Petri, Kathrin; Rückert, Christian; Kalinowski, Jörn


    The aerobic soil bacterium Corynebacterium glutamicum ATCC 13032 has a remarkable natural resistance to hydrogen peroxide. A major player in hydrogen peroxide defense is the LysR type transcriptional regulator OxyR, homologs of which are present in a wide range of bacteria. In this study, the global transcriptional response of C. glutamicum to oxidative stress induced by hydrogen peroxide was examined using whole genome DNA microarrays, demonstrating the dynamic reaction of the regulatory networks. Deletion of oxyR resulted in an increased resistance of the C. glutamicum mutant to hydrogen peroxide. By performing DNA microarray hybridizations and RT-qPCR, differentially expressed genes were detected in the mutant. The direct control by OxyR was verified by electrophoretic mobility shift assays for 12 target regions. The results demonstrated that OxyR in C. glutamicum acts as a transcriptional repressor under non-stress conditions for a total of 23 genes. The regulated genes encode proteins related to oxidative stress response (e.g. katA), iron homeostasis (e.g. dps) and sulfur metabolism (e.g. suf cluster). Besides the regulator of the suf cluster, SufR, OxyR regulated the gene cg1695 encoding a putative transcriptional regulator, indicating the role of OxyR as a master regulator in defense against oxidative stress. Using a modified DNase footprint approach, the OxyR-binding sites in five target promoter regions, katA, cydA, hemH, dps and cg1292, were localized and in each upstream region at least two overlapping binding sites were found. The DNA regions protected by the OxyR protein are about 56bp in length and do not have evident sequence similarities. Still, by giving an insight in the H2O2 stimulon and extending the OxyR regulon this study considerably contributes to the understanding of the response of C. glutamicum to hydrogen peroxide-mediated oxidative stress.

  17. The signal for glucose repression of the lactose-galactose regulon is amplified through subtle modulation of transcription of the Kluyveromyces lactis Kl-GAL4 activator gene.

    PubMed Central

    Kuzhandaivelu, N; Jones, W K; Martin, A K; Dickson, R C


    Induction of the lactose-galactose regulon is strongly repressed by glucose in some but not all strains of Kluyveromyces lactis. We show here that in strongly repressed strains, two to three times less Kl-GAL4 mRNA is synthesized and that expression of structural genes in the regulon such as LAC4, the structural gene for beta-galactosidase, is down regulated 40-fold or more. Comparative analysis of strains having a strong or weak repression phenotype revealed a two-base difference in the promoter of the Kl-GAL4 (also called LAC9) positive regulatory gene. This two-base difference is responsible for the strong versus the weak repression phenotype. The two base changes are symmetrically located in a DNA sequence having partial twofold rotational symmetry (14 of 21 bases). We hypothesize that this region functions as a sensitive regulatory switch, an upstream repressor sequence (URS). According to our model, the presence of glucose in the culture medium signals, by an unidentified pathway, a repressor protein to bind the URS. Binding reduces transcription of the Kl-GAL4 gene so that the concentration of the Kl-GAL4 protein falls below the level needed for induction of LAC4 and other genes in the regulon. For strains showing weak glucose repression, we hypothesize that the two base changes in the URS reduce repressor binding so that the regulon is not repressed. Our results illustrate an important principle of genetic regulation: a small (2- to 3-fold) change in the concentration of a regulatory protein can produce a large (40-fold or greater) change in expression of structural genes. This mechanism of signal amplification could play a role in many biological phenomena that require regulated transcription. Images PMID:1569929

  18. The Cryptosporidium parvum ApiAP2 gene family: insights into the evolution of apicomplexan AP2 regulatory systems

    PubMed Central

    Oberstaller, Jenna; Pumpalova, Yoanna; Schieler, Ariel; Llinás, Manuel; Kissinger, Jessica C.


    We provide the first comprehensive analysis of any transcription factor family in Cryptosporidium, a basal-branching apicomplexan that is the second leading cause of infant diarrhea globally. AP2 domain-containing proteins have evolved to be the major regulatory family in the phylum to the exclusion of canonical regulators. We show that apicomplexan and perkinsid AP2 domains cluster distinctly from other chromalveolate AP2s. Protein-binding specificity assays of C. parvum AP2 domains combined with motif conservation upstream of co-regulated gene clusters allowed the construction of putative AP2 regulons across the in vitro life cycle. Orthologous Apicomplexan AP2 (ApiAP2) expression has been rearranged relative to the malaria parasite P. falciparum, suggesting ApiAP2 network rewiring during evolution. C. hominis orthologs of putative C. parvum ApiAP2 proteins and target genes show greater than average variation. C. parvum AP2 domains display reduced binding diversity relative to P. falciparum, with multiple domains binding the 5′-TGCAT-3′, 5′-CACACA-3′ and G-box motifs (5′-G[T/C]GGGG-3′). Many overrepresented motifs in C. parvum upstream regions are not AP2 binding motifs. We propose that C. parvum is less reliant on ApiAP2 regulators in part because it utilizes E2F/DP1 transcription factors. C. parvum may provide clues to the ancestral state of apicomplexan transcriptional regulation, pre-AP2 domination. PMID:24957599

  19. Structural basis of the transcriptional regulation of the proline utilization regulon by multifunctional PutA.


    Zhou, Yuzhen; Larson, John D; Bottoms, Christopher A; Arturo, Emilia C; Henzl, Michael T; Jenkins, Jermaine L; Nix, Jay C; Becker, Donald F; Tanner, John J


    The multifunctional Escherichia coli proline utilization A (PutA) flavoprotein functions both as a membrane-associated proline catabolic enzyme and as a transcriptional repressor of the proline utilization genes putA and putP. To better understand the mechanism of transcriptional regulation by PutA, we have mapped the put-regulatory region, determined a crystal structure of the PutA ribbon-helix-helix domain (PutA52, a polypeptide corresponding to residues 1-52 of E. coli PutA) complexed with DNA, and examined the thermodynamics of DNA binding to PutA52. Five operator sites, each containing the sequence motif 5'-GTTGCA-3', were identified using gel-shift analysis. Three of the sites are shown to be critical for repression of putA, whereas the two other sites are important for repression of putP. The 2.25-A-resolution crystal structure of PutA52 bound to one of the operators (operator 2; 21 bp) shows that the protein contacts a 9-bp fragment corresponding to the GTTGCA consensus motif plus three flanking base pairs. Since the operator sequences differ in flanking bases, the structure implies that PutA may have different affinities for the five operators. This hypothesis was explored using isothermal titration calorimetry. The binding of PutA52 to operator 2 is exothermic, with an enthalpy of -1.8 kcal/mol and a dissociation constant of 210 nM. Substitution of the flanking bases of operator 4 into operator 2 results in an unfavorable enthalpy of 0.2 kcal/mol and a 15-fold-lower affinity, showing that base pairs outside of the consensus motif impact binding. Structural and thermodynamic data suggest that hydrogen bonds between Lys9 and bases adjacent to the GTTGCA motif contribute to transcriptional regulation by fine-tuning the affinity of PutA for put control operators.

  20. RegulonDB (version 5.0): Escherichia coli K-12 transcriptional regulatory network, operon organization, and growth conditions

    PubMed Central

    Salgado, Heladia; Gama-Castro, Socorro; Peralta-Gil, Martín; Díaz-Peredo, Edgar; Sánchez-Solano, Fabiola; Santos-Zavaleta, Alberto; Martínez-Flores, Irma; Jiménez-Jacinto, Verónica; Bonavides-Martínez, César; Segura-Salazar, Juan; Martínez-Antonio, Agustino; Collado-Vides, Julio


    RegulonDB is the internationally recognized reference database of Escherichia coli K-12 offering curated knowledge of the regulatory network and operon organization. It is currently the largest electronically-encoded database of the regulatory network of any free-living organism. We present here the recently launched RegulonDB version 5.0 radically different in content, interface design and capabilities. Continuous curation of original scientific literature provides the evidence behind every single object and feature. This knowledge is complemented with comprehensive computational predictions across the complete genome. Literature-based and predicted data are clearly distinguished in the database. Starting with this version, RegulonDB public releases are synchronized with those of EcoCyc since our curation supports both databases. The complex biology of regulation is simplified in a navigation scheme based on three major streams: genes, operons and regulons. Regulatory knowledge is directly available in every navigation step. Displays combine graphic and textual information and are organized allowing different levels of detail and biological context. This knowledge is the backbone of an integrated system for the graphic display of the network, graphic and tabular microarray comparisons with curated and predicted objects, as well as predictions across bacterial genomes, and predicted networks of functionally related gene products. Access RegulonDB at . PMID:16381895

  1. RegulonDB version 7.0: transcriptional regulation of Escherichia coli K-12 integrated within genetic sensory response units (Gensor Units)

    PubMed Central

    Gama-Castro, Socorro; Salgado, Heladia; Peralta-Gil, Martin; Santos-Zavaleta, Alberto; Muñiz-Rascado, Luis; Solano-Lira, Hilda; Jimenez-Jacinto, Verónica; Weiss, Verena; García-Sotelo, Jair S.; López-Fuentes, Alejandra; Porrón-Sotelo, Liliana; Alquicira-Hernández, Shirley; Medina-Rivera, Alejandra; Martínez-Flores, Irma; Alquicira-Hernández, Kevin; Martínez-Adame, Ruth; Bonavides-Martínez, César; Miranda-Ríos, Juan; Huerta, Araceli M.; Mendoza-Vargas, Alfredo; Collado-Torres, Leonardo; Taboada, Blanca; Vega-Alvarado, Leticia; Olvera, Maricela; Olvera, Leticia; Grande, Ricardo; Morett, Enrique; Collado-Vides, Julio


    RegulonDB ( is the primary reference database of the best-known regulatory network of any free-living organism, that of Escherichia coli K-12. The major conceptual change since 3 years ago is an expanded biological context so that transcriptional regulation is now part of a unit that initiates with the signal and continues with the signal transduction to the core of regulation, modifying expression of the affected target genes responsible for the response. We call these genetic sensory response units, or Gensor Units. We have initiated their high-level curation, with graphic maps and superreactions with links to other databases. Additional connectivity uses expandable submaps. RegulonDB has summaries for every transcription factor (TF) and TF-binding sites with internal symmetry. Several DNA-binding motifs and their sizes have been redefined and relocated. In addition to data from the literature, we have incorporated our own information on transcription start sites (TSSs) and transcriptional units (TUs), obtained by using high-throughput whole-genome sequencing technologies. A new portable drawing tool for genomic features is also now available, as well as new ways to download the data, including web services, files for several relational database manager systems and text files including BioPAX format. PMID:21051347

  2. The cellular growth rate controls overall mRNA turnover, and modulates either transcription or degradation rates of particular gene regulons

    PubMed Central

    García-Martínez, José; Delgado-Ramos, Lidia; Ayala, Guillermo; Pelechano, Vicent; Medina, Daniel A.; Carrasco, Fany; González, Ramón; Andrés-León, Eduardo; Steinmetz, Lars; Warringer, Jonas; Chávez, Sebastián; Pérez-Ortín, José E.


    We analyzed 80 different genomic experiments, and found a positive correlation between both RNA polymerase II transcription and mRNA degradation with growth rates in yeast. Thus, in spite of the marked variation in mRNA turnover, the total mRNA concentration remained approximately constant. Some genes, however, regulated their mRNA concentration by uncoupling mRNA stability from the transcription rate. Ribosome-related genes modulated their transcription rates to increase mRNA levels under fast growth. In contrast, mitochondria-related and stress-induced genes lowered mRNA levels by reducing mRNA stability or the transcription rate, respectively. We also detected these regulations within the heterogeneity of a wild-type cell population growing in optimal conditions. The transcriptomic analysis of sorted microcolonies confirmed that the growth rate dictates alternative expression programs by modulating transcription and mRNA decay. The regulation of overall mRNA turnover keeps a constant ratio between mRNA decay and the dilution of [mRNA] caused by cellular growth. This regulation minimizes the indiscriminate transmission of mRNAs from mother to daughter cells, and favors the response capacity of the latter to physiological signals and environmental changes. We also conclude that, by uncoupling mRNA synthesis from decay, cells control the mRNA abundance of those gene regulons that characterize fast and slow growth. PMID:26717982

  3. The cellular growth rate controls overall mRNA turnover, and modulates either transcription or degradation rates of particular gene regulons.


    García-Martínez, José; Delgado-Ramos, Lidia; Ayala, Guillermo; Pelechano, Vicent; Medina, Daniel A; Carrasco, Fany; González, Ramón; Andrés-León, Eduardo; Steinmetz, Lars; Warringer, Jonas; Chávez, Sebastián; Pérez-Ortín, José E


    We analyzed 80 different genomic experiments, and found a positive correlation between both RNA polymerase II transcription and mRNA degradation with growth rates in yeast. Thus, in spite of the marked variation in mRNA turnover, the total mRNA concentration remained approximately constant. Some genes, however, regulated their mRNA concentration by uncoupling mRNA stability from the transcription rate. Ribosome-related genes modulated their transcription rates to increase mRNA levels under fast growth. In contrast, mitochondria-related and stress-induced genes lowered mRNA levels by reducing mRNA stability or the transcription rate, respectively. We also detected these regulations within the heterogeneity of a wild-type cell population growing in optimal conditions. The transcriptomic analysis of sorted microcolonies confirmed that the growth rate dictates alternative expression programs by modulating transcription and mRNA decay.The regulation of overall mRNA turnover keeps a constant ratio between mRNA decay and the dilution of [mRNA] caused by cellular growth. This regulation minimizes the indiscriminate transmission of mRNAs from mother to daughter cells, and favors the response capacity of the latter to physiological signals and environmental changes. We also conclude that, by uncoupling mRNA synthesis from decay, cells control the mRNA abundance of those gene regulons that characterize fast and slow growth.

  4. Characterization of TetD as a transcriptional activator of a subset of genes of the Escherichia coli SoxS/MarA/Rob regulon.


    Griffith, Kevin L; Becker, Stephen M; Wolf, Richard E


    In Escherichia coli, SoxS, MarA and Rob form a closely related subset of the AraC/XylS family of positive regulators, sharing approximately 42% amino acid sequence identity over the length of SoxS and the ability to activate transcription of a common set of target genes that provide resistance to redox-cycling compounds and antibiotics. On the basis of its approximately 43% amino acid sequence identity with SoxS, MarA and Rob, TetD, encoded by transposon Tn10, appears to be a fourth member of the subset. However, although its expression has been shown to be negatively regulated by TetC and not inducible by tetracycline, the physiological function of TetD is unknown. Accordingly, in the work presented here, we initiate a molecular characterization of TetD. We show that expression of TetD activates transcription of a subset of the SoxS/MarA/Rob regulon genes and confers resistance to redox-cycling compounds and antibiotics. We show that mutations in the putative TetD binding site of a TetD-activatable promoter and a mutation in the protein's N-terminal DNA recognition helix interfere with transcription activation, thereby indicating that TetD directly activates target gene transcription. Finally, we show that TetD, like SoxS and MarA, is intrinsically unstable; however, unlike SoxS and MarA, TetD is not degraded by Lon or any of the cell's known cytoplasmic ATP-dependent proteases. Thus, we conclude that TetD is a bona fide member of the SoxS/MarA/Rob subfamily of positive regulators.

  5. Genome-wide profiling of Hfq-binding RNAs uncovers extensive post-transcriptional rewiring of major stress response and symbiotic regulons in Sinorhizobium meliloti.


    Torres-Quesada, Omar; Reinkensmeier, Jan; Schlüter, Jan-Philip; Robledo, Marta; Peregrina, Alexandra; Giegerich, Robert; Toro, Nicolás; Becker, Anke; Jiménez-Zurdo, Jose I


    The RNA chaperone Hfq is a global post-transcriptional regulator in bacteria. Here, we used RNAseq to analyze RNA populations from the legume symbiont Sinorhizobium meliloti that were co-immunoprecipitated (CoIP-RNA) with a FLAG-tagged Hfq in five growth/stress conditions. Hfq-bound transcripts (1315) were largely identified in stressed bacteria and derived from small RNAs (sRNAs), both trans-encoded (6.4%) and antisense (asRNAs; 6.3%), and mRNAs (86%). Pull-down with Hfq recovered a small proportion of annotated S. meliloti sRNAs (14% of trans-sRNAs and 2% of asRNAs) suggesting a discrete impact of this protein in sRNA pathways. Nonetheless, Hfq selectively stabilized CoIP-enriched sRNAs, anticipating that these interactions are functionally significant. Transcription of 26 Hfq-bound sRNAs was predicted to occur from promoters recognized by the major stress σ factors σ(E2) or σ(H1/2). Recovery rates of sRNAs in each of the CoIP-RNA libraries suggest a large impact of Hfq-assisted riboregulation in S. meliloti osmoadaptation. Hfq directly targeted 18% of the predicted S. meliloti mRNAs, which encode functionally diverse proteins involved in transport and metabolism, σ(E2)-dependent stress responses, quorum sensing, flagella biosynthesis, ribosome, and membrane assembly or symbiotic nitrogen fixation. Canonical targeting of the 5' regions of two of the ABC transporter mRNAs by the homologous Hfq-binding AbcR1 and AbcR2 sRNAs leading to inhibition of protein synthesis was confirmed in vivo. We therefore provide a comprehensive resource for the systems-level deciphering of hitherto unexplored S. meliloti stress and symbiotic post-transcriptional regulons and the identification of Hfq-dependent sRNA-mRNA regulatory pairs.

  6. Cytoskeleton-Dependent Transport as a Potential Target for Interfering with Post-transcriptional HuR mRNA Regulons

    PubMed Central

    Eberhardt, Wolfgang; Badawi, Amel; Biyanee, Abhiruchi; Pfeilschifter, Josef


    The ubiquitous mRNA binding protein human antigen R (HuR), a member of the embryonal lethal abnormal vision protein family has a critical impact on the post-transcriptional control of AU-rich element bearing mRNA regulons implied in inflammation, senescence, and carcinogenesis. HuR in addition to mRNA stability can affect many other aspects of mRNA processing including splicing, polyadenylation, translation, modulation of miRNA repression, and intracellular mRNA trafficking. Since many of the identified HuR mRNA targets (“HuR mRNA regulons”) encode tumor-related proteins, HuR is not only discussed as an useful biomarker but also as promising therapeutic target for treatment of various human cancers. HuR which is most abundantly localized in the nucleus is translocated to the cytoplasm which is fundamental for most of the described HuR functions on target mRNAs. Accordingly, an elevation in cytoplasmic HuR was found in many tumors and correlated with a high grade of malignancy and a poor prognosis of patients. Therefore, direct interference with the intracellular trafficking of HuR offers an attractive approach to intervene with pathologically deregulated HuR functions. Data from several laboratories implicate that the integrity of the cytoskeleton is critical for HuR-mediated intracellular mRNA localization and translation. This review will particularly focus on drugs which have proven a direct inhibitory effect on HuR translocation. Based on the results from those studies, we will also discuss on the principle value of targeting cytoskeleton-dependent transport of HuR by natural or synthetic inhibitors as a potential therapeutic avenue for interfering with dysregulated post-transcriptional HuR mRNA regulons and related tumor cell functions. In spite of that, interfering with cytoplasmic HuR transport could highlight a so far underestimated action of microtubule inhibitors clinically used for cancer chemotherapy. PMID:27582706

  7. Comprehensive Definition of the SigH Regulon of Mycobacterium tuberculosis Reveals Transcriptional Control of Diverse Stress Responses

    PubMed Central

    Park, Sang Tae; Lyubetskaya, Anna; Peterson, Matthew W.; Gomes, Antonio L. C.; Potluri, Lakshmi-Prasad; Raman, Sahadevan; Galagan, James E.; Husson, Robert N.


    Expression of SigH, one of 12 Mycobacterium tuberculosis alternative sigma factors, is induced by heat, oxidative and nitric oxide stresses. SigH activation has been shown to increase expression of several genes, including genes involved in maintaining redox equilibrium and in protein degradation. However, few of these are known to be directly regulated by SigH. The goal of this project is to comprehensively define the Mycobacterium tuberculosis genes and operons that are directly controlled by SigH in order to gain insight into the role of SigH in regulating M. tuberculosis physiology. We used ChIP-Seq to identify in vivo SigH binding sites throughout the M. tuberculosis genome, followed by quantification of SigH-dependent expression of genes linked to these sites and identification of SigH-regulated promoters. We identified 69 SigH binding sites, which are located both in intergenic regions and within annotated coding sequences in the annotated M. tuberculosis genome. 41 binding sites were linked to genes that showed greater expression following heat stress in a SigH-dependent manner. We identified several genes not previously known to be regulated by SigH, including genes involved in DNA repair, cysteine biosynthesis, translation, and genes of unknown function. Experimental and computational analysis of SigH-regulated promoter sequences within these binding sites identified strong consensus -35 and -10 promoter sequences, but with tolerance for non-consensus bases at specific positions. This comprehensive identification and validation of SigH-regulated genes demonstrates an extended SigH regulon that controls an unexpectedly broad range of stress response functions. PMID:27003599

  8. Genomics of apicomplexan parasites.


    Swapna, Lakshmipuram Seshadri; Parkinson, John


    The increasing prevalence of infections involving intracellular apicomplexan parasites such as Plasmodium, Toxoplasma, and Cryptosporidium (the causative agents of malaria, toxoplasmosis, and cryptosporidiosis, respectively) represent a significant global healthcare burden. Despite their significance, few treatments are available; a situation that is likely to deteriorate with the emergence of new resistant strains of parasites. To lay the foundation for programs of drug discovery and vaccine development, genome sequences for many of these organisms have been generated, together with large-scale expression and proteomic datasets. Comparative analyses of these datasets are beginning to identify the molecular innovations supporting both conserved processes mediating fundamental roles in parasite survival and persistence, as well as lineage-specific adaptations associated with divergent life-cycle strategies. The challenge is how best to exploit these data to derive insights into parasite virulence and identify those genes representing the most amenable targets. In this review, we outline genomic datasets currently available for apicomplexans and discuss biological insights that have emerged as a consequence of their analysis. Of particular interest are systems-based resources, focusing on areas of metabolism and host invasion that are opening up opportunities for discovering new therapeutic targets.

  9. Cytoskeleton of Apicomplexan Parasites

    PubMed Central

    Morrissette, Naomi S.; Sibley, L. David


    The Apicomplexa are a phylum of diverse obligate intracellular parasites including Plasmodium spp., the cause of malaria; Toxoplasma gondii and Cryptosporidium parvum, opportunistic pathogens of immunocompromised individuals; and Eimeria spp. and Theileria spp., parasites of considerable agricultural importance. These protozoan parasites share distinctive morphological features, cytoskeletal organization, and modes of replication, motility, and invasion. This review summarizes our current understanding of the cytoskeletal elements, the properties of cytoskeletal proteins, and the role of the cytoskeleton in polarity, motility, invasion, and replication. We discuss the unusual properties of actin and myosin in the Apicomplexa, the highly stereotyped microtubule populations in apicomplexans, and a network of recently discovered novel intermediate filament-like elements in these parasites. PMID:11875126

  10. The MazF-regulon: a toolbox for the post-transcriptional stress response in Escherichia coli

    PubMed Central

    Sauert, Martina; Wolfinger, Michael T.; Vesper, Oliver; Müller, Christian; Byrgazov, Konstantin; Moll, Isabella


    Flexible adaptation to environmental stress is vital for bacteria. An energy-efficient post-transcriptional stress response mechanism in Escherichia coli is governed by the toxin MazF. After stress-induced activation the endoribonuclease MazF processes a distinct subset of transcripts as well as the 16S ribosomal RNA in the context of mature ribosomes. As these ‘stress-ribosomes’ are specific for the MazF-processed mRNAs, the translational program is changed. To identify this ‘MazF-regulon’ we employed Poly-seq (polysome fractionation coupled with RNA-seq analysis) and analyzed alterations introduced into the transcriptome and translatome after mazF overexpression. Unexpectedly, our results reveal that the corresponding protein products are involved in all cellular processes and do not particularly contribute to the general stress response. Moreover, our findings suggest that translational reprogramming serves as a fast-track reaction to harsh stress and highlight the so far underestimated significance of selective translation as a global regulatory mechanism in gene expression. Considering the reported implication of toxin-antitoxin (TA) systems in persistence, our results indicate that MazF acts as a prime effector during harsh stress that potentially introduces translational heterogeneity within a bacterial population thereby stimulating persister cell formation. PMID:26908653

  11. Probing key DNA contacts in AraR-mediated transcriptional repression of the Bacillus subtilis arabinose regulon.


    Franco, Irina Saraiva; Mota, Luís Jaime; Soares, Cláudio Manuel; de Sá-Nogueira, Isabel


    In the absence of arabinose, the AraR transcription factor represses the expression of genes involved in the utilization of arabinose, xylose and galactose in Bacillus subtilis. AraR exhibits a chimeric organization: the N-terminal DNA-binding region belongs to the GntR family and the C-terminal effector-binding domain is homologous to the GalR/LacI family. Here, the AraR-DNA-binding interactions were characterized in vivo and in vitro. The effect of residue substitutions in the AraR N-terminal domain and of base-pair exchanges into an AraR-DNA-binding operator site were examined by assaying for AraR-mediated regulatory activity in vivo and DNA-binding activity in vitro. The results showed that residues K4, R45 and Q61, located in or near the winged-helix DNA-binding motif, were the most critical amino acids required for AraR function. In addition, the analysis of the various mutations in an AraR palindromic operator sequence indicated that bases G9, A11 and T16 are crucial for AraR binding. Moreover, an AraR mutant M34T was isolated that partially suppressed the effect of mutations in the regulatory cis-elements. Together, these findings extend the knowledge on the nature of AraR nucleoprotein complexes and provide insight into the mechanism that underlies the mode of action of AraR and its orthologues.

  12. Isoprenoid metabolism in apicomplexan parasites

    PubMed Central

    Imlay, Leah; Odom, Audrey R.


    Apicomplexan parasites include some of the most prevalent and deadly human pathogens. Novel antiparasitic drugs are urgently needed. Synthesis and metabolism of isoprenoids may present multiple targets for therapeutic intervention. The apicoplast-localized methylerythritol phosphate (MEP) pathway for isoprenoid precursor biosynthesis is distinct from the mevalonate (MVA) pathway used by the mammalian host, and this pathway is apparently essential in most Apicomplexa. In this review, we discuss the current field of research on production and metabolic fates of isoprenoids in apicomplexan parasites, including the acquisition of host isoprenoid precursors and downstream products. We describe recent work identifying the first MEP pathway regulator in apicomplexan parasites, and introduce several promising areas for ongoing research into this well-validated antiparasitic target. PMID:25893156

  13. Functional Analysis of 14 Genes That Constitute the Purine Catabolic Pathway in Bacillus subtilis and Evidence for a Novel Regulon Controlled by the PucR Transcription Activator

    PubMed Central

    Schultz, Anna C.; Nygaard, Per; Saxild, Hans H.


    The soil bacterium Bacillus subtilis has developed a highly controlled system for the utilization of a diverse array of low-molecular-weight compounds as a nitrogen source when the preferred nitrogen sources, e.g., glutamate plus ammonia, are exhausted. We have identified such a system for the utilization of purines as nitrogen source in B. subtilis. Based on growth studies of strains with knockout mutations in genes, complemented with enzyme analysis, we could ascribe functions to 14 genes encoding enzymes or proteins of the purine degradation pathway. A functional xanthine dehydrogenase requires expression of five genes (pucA, pucB, pucC, pucD, and pucE). Uricase activity is encoded by the pucL and pucM genes, and a uric acid transport system is encoded by pucJ and pucK. Allantoinase is encoded by the pucH gene, and allantoin permease is encoded by the pucI gene. Allantoate amidohydrolase is encoded by pucF. In a pucR mutant, the level of expression was low for all genes tested, indicating that PucR is a positive regulator of puc gene expression. All 14 genes except pucI are located in a gene cluster at 284 to 285° on the chromosome and are contained in six transcription units, which are expressed when cells are grown with glutamate as the nitrogen source (limiting conditions), but not when grown on glutamate plus ammonia (excess conditions). Our data suggest that the 14 genes and the gde gene, encoding guanine deaminase, constitute a regulon controlled by the pucR gene product. Allantoic acid, allantoin, and uric acid were all found to function as effector molecules for PucR-dependent regulation of puc gene expression. When cells were grown in the presence of glutamate plus allantoin, a 3- to 10-fold increase in expression was seen for most of the genes. However, expression of the pucABCDE unit was decreased 16-fold, while expression of pucR was decreased 4-fold in the presence of allantoin. We have identified genes of the purine degradation pathway in B

  14. Characterization of a cAMP responsive transcription factor, Cmr (Rv1675c), in TB complex mycobacteria reveals overlap with the DosR (DevR) dormancy regulon.


    Ranganathan, Sridevi; Bai, Guangchun; Lyubetskaya, Anna; Knapp, Gwendowlyn S; Peterson, Matthew W; Gazdik, Michaela; C Gomes, Antonio L; Galagan, James E; McDonough, Kathleen A


    Mycobacterium tuberculosis (Mtb) Cmr (Rv1675c) is a CRP/FNR family transcription factor known to be responsive to cAMP levels and during macrophage infections. However, Cmr's DNA binding properties, cellular targets and overall role in tuberculosis (TB) complex bacteria have not been characterized. In this study, we used experimental and computational approaches to characterize Cmr's DNA binding properties and identify a putative regulon. Cmr binds a 16-bp palindromic site that includes four highly conserved nucleotides that are required for DNA binding. A total of 368 binding sites, distributed in clusters among ~200 binding regions throughout the Mycobacterium bovis BCG genome, were identified using ChIP-seq. One of the most enriched Cmr binding sites was located upstream of the cmr promoter, and we demonstrated that expression of cmr is autoregulated. cAMP affected Cmr binding at a subset of DNA loci in vivo and in vitro, including multiple sites adjacent to members of the DosR (DevR) dormancy regulon. Our findings of cooperative binding of Cmr to these DNA regions and the regulation by Cmr of the DosR-regulated virulence gene Rv2623 demonstrate the complexity of Cmr-mediated gene regulation and suggest a role for Cmr in the biology of persistent TB infection.

  15. Evolution of apicomplexan secretory organelles

    PubMed Central

    Gubbels, Marc-Jan; Duraisingh, Manoj T.


    The alveolate superphylum includes many free-living and parasitic organisms, which are united by the presence of alveolar sacs lying proximal to the plasma membrane, providing cell structure. All species comprising the apicomplexan group of alveolates are parasites and have adapted to the unique requirements of the parasitic lifestyle. Here the evolution of apicomplexan secretory organelles that are involved in the critical process of egress from one cell and invasion of another is explored. The variations within the Apicomplexa and how these relate to species-specific biology will be discussed. In addition, recent studies have identified specific calcium-sensitive molecules that coordinate the various events and regulate the release of these secretory organelles within apicomplexan parasites. Some aspects of this machinery are conserved outside the Apicomplexa, and are beginning to elucidate the conserved nature of the machinery. Briefly, the relationship of this secretion machinery within the Apicomplexa will be discussed, compared with free-living and predatory alveolates, and how these might have evolved from a common ancestor. PMID:23068912

  16. Genome-Wide Chromatin Immunoprecipitation Sequencing Analysis Shows that WhiB Is a Transcription Factor That Cocontrols Its Regulon with WhiA To Initiate Developmental Cell Division in Streptomyces

    PubMed Central

    Chandra, Govind; Bibb, Maureen J.; Findlay, Kim C.; Buttner, Mark J.


    ABSTRACT WhiB is the founding member of a family of proteins (the WhiB-like [Wbl] family) that carry a [4Fe-4S] iron-sulfur cluster and play key roles in diverse aspects of the biology of actinomycetes, including pathogenesis, antibiotic resistance, and the control of development. In Streptomyces, WhiB is essential for the process of developmentally controlled cell division that leads to sporulation. The biochemical function of Wbl proteins has been controversial; here, we set out to determine unambiguously if WhiB functions as a transcription factor using chromatin immunoprecipitation sequencing (ChIP-seq) in Streptomyces venezuelae. In the first demonstration of in vivo genome-wide Wbl binding, we showed that WhiB regulates the expression of key genes required for sporulation by binding upstream of ~240 transcription units. Strikingly, the WhiB regulon is identical to the previously characterized WhiA regulon, providing an explanation for the identical phenotypes of whiA and whiB mutants. Using ChIP-seq, we demonstrated that in vivo DNA binding by WhiA depends on WhiB and vice versa, showing that WhiA and WhiB function cooperatively to control expression of a common set of WhiAB target genes. Finally, we show that mutation of the cysteine residues that coordinate the [4Fe-4S] cluster in WhiB prevents DNA binding by both WhiB and WhiA in vivo. PMID:27094333

  17. PePPER: a webserver for prediction of prokaryote promoter elements and regulons

    PubMed Central


    Background Accurate prediction of DNA motifs that are targets of RNA polymerases, sigma factors and transcription factors (TFs) in prokaryotes is a difficult mission mainly due to as yet undiscovered features in DNA sequences or structures in promoter regions. Improved prediction and comparison algorithms are currently available for identifying transcription factor binding sites (TFBSs) and their accompanying TFs and regulon members. Results We here extend the current databases of TFs, TFBSs and regulons with our knowledge on Lactococcus lactis and developed a webserver for prediction, mining and visualization of prokaryote promoter elements and regulons via a novel concept. This new approach includes an all-in-one method of data mining for TFs, TFBSs, promoters, and regulons for any bacterial genome via a user-friendly webserver. We demonstrate the power of this method by mining WalRK regulons in Lactococci and Streptococci and, vice versa, use L. lactis regulon data (CodY) to mine closely related species. Conclusions The PePPER webserver offers, besides the all-in-one analysis method, a toolbox for mining for regulons, promoters and TFBSs and accommodates a new L. lactis regulon database in addition to already existing regulon data. Identification of putative regulons and full annotation of intergenic regions in any bacterial genome on the basis of existing knowledge on a related organism can now be performed by biologists and it can be done for a wide range of regulons. On the basis of the PePPER output, biologist can design experiments to further verify the existence and extent of the proposed regulons. The PePPER webserver is freely accessible at PMID:22747501

  18. The dual transcriptional regulator CysR in Corynebacterium glutamicum ATCC 13032 controls a subset of genes of the McbR regulon in response to the availability of sulphide acceptor molecules

    PubMed Central

    Rückert, Christian; Milse, Johanna; Albersmeier, Andreas; Koch, Daniel J; Pühler, Alfred; Kalinowski, Jörn


    Background Regulation of sulphur metabolism in Corynebacterium glutamicum ATCC 13032 has been studied intensively in the last few years, due to its industrial as well as scientific importance. Previously, the gene cg0156 was shown to belong to the regulon of McbR, a global transcriptional repressor of sulphur metabolism in C. glutamicum. This gene encodes a putative ROK-type regulator, a paralogue of the activator of sulphonate utilisation, SsuR. Therefore, it is an interesting candidate for study to further the understanding of the regulation of sulphur metabolism in C. glutamicum. Results Deletion of cg0156, now designated cysR, results in the inability of the mutant to utilise sulphate and aliphatic sulphonates. DNA microarray hybridisations revealed 49 genes with significantly increased and 48 with decreased transcript levels in presence of the native CysR compared to a cysR deletion mutant. Among the genes positively controlled by CysR were the gene cluster involved in sulphate reduction, fpr2 cysIXHDNYZ, and ssuR. Gel retardation experiments demonstrated that binding of CysR to DNA depends in vitro on the presence of either O-acetyl-L-serine or O-acetyl-L-homoserine. Mapping of the transcription start points of five transcription units helped to identify a 10 bp inverted repeat as the possible CysR binding site. Subsequent in vivo tests proved this motif to be necessary for CysR-dependent transcriptional regulation. Conclusion CysR acts as the functional analogue of the unrelated LysR-type regulator CysB from Escherichia coli, controlling sulphide production in response to acceptor availability. In both bacteria, gene duplication events seem to have taken place which resulted in the evolution of dedicated regulators for the control of sulphonate utilisation. The striking convergent evolution of network topology indicates the strong selective pressure to control the metabolism of the essential but often toxic sulphur-containing (bio-)molecules. PMID:18854009

  19. Quorum sensing transcriptional regulator QseA is essential for the expression of multiple virulence regulons of enterohemorrhagic Escherichia coli O157:H7

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Introduction and Objectives: QseA is one of several transcriptional regulators that regulates the virulence gene expression in enterohemorrhagic Escherichia coli (EHEC) O157:H7 through quorum sensing. QseA has been shown to regulate the expression of the locus of enterocyte effacement (LEE), non-LEE...

  20. Cadmium regulates copper homoeostasis by inhibiting the activity of Mac1, a transcriptional activator of the copper regulon, in Saccharomyces cerevisiae.


    Heo, Dong-Hyuk; Baek, In-Joon; Kang, Hyun-Jun; Kim, Ji-Hyun; Chang, Miwha; Jeong, Mi-Young; Kim, Tae-Hyoung; Choi, Il-Dong; Yun, Cheol-Won


    Cadmium is a toxic metal and the mechanism of its toxicity has been studied in various model systems from bacteria to mammals. We employed Saccharomyces cerevisiae as a model system to study cadmium toxicity at the molecular level because it has been used to identify the molecular mechanisms of toxicity found in higher organisms. cDNA microarray and Northern blot analyses revealed that cadmium salts inhibited the expression of genes related to copper metabolism. Western blotting, Northern blotting and chromatin immunoprecipitation experiments indicated that CTR1 expression was inhibited at the transcriptional level through direct inhibition of the Mac1 transcriptional activator. The decreased expression of CTR1 results in cellular copper deficiency and inhibition of Fet3 activity, which eventually impairs iron uptake. In this way, cadmium exhibits a negative effect on both iron and copper homoeostasis.

  1. Bacterial regulon modeling and prediction based on systematic cis regulatory motif analyses

    NASA Astrophysics Data System (ADS)

    Liu, Bingqiang; Zhou, Chuan; Li, Guojun; Zhang, Hanyuan; Zeng, Erliang; Liu, Qi; Ma, Qin


    Regulons are the basic units of the response system in a bacterial cell, and each consists of a set of transcriptionally co-regulated operons. Regulon elucidation is the basis for studying the bacterial global transcriptional regulation network. In this study, we designed a novel co-regulation score between a pair of operons based on accurate operon identification and cis regulatory motif analyses, which can capture their co-regulation relationship much better than other scores. Taking full advantage of this discovery, we developed a new computational framework and built a novel graph model for regulon prediction. This model integrates the motif comparison and clustering and makes the regulon prediction problem substantially more solvable and accurate. To evaluate our prediction, a regulon coverage score was designed based on the documented regulons and their overlap with our prediction; and a modified Fisher Exact test was implemented to measure how well our predictions match the co-expressed modules derived from E. coli microarray gene-expression datasets collected under 466 conditions. The results indicate that our program consistently performed better than others in terms of the prediction accuracy. This suggests that our algorithms substantially improve the state-of-the-art, leading to a computational capability to reliably predict regulons for any bacteria.

  2. Promoter discrimination at class I MarA regulon promoters mediated by glutamic acid 89 of the MarA transcriptional activator of Escherichia coli.


    Martin, Robert G; Rosner, Judah L


    Three paralogous transcriptional activators MarA, SoxS, and Rob, activate > 40 Escherichia coli promoters. To understand why MarA does not activate certain promoters as strongly as SoxS, we compared MarA, MarA mutants, and SoxS for their abilities to activate 16 promoters and to bind their cognate marbox binding sites. Replacement of the MarA glutamic acid residue 89 with alanine greatly increased the marbox binding and activation of many class I promoters. Like cells constitutive for SoxS, cells expressing the MarA with the E89A mutation were more resistant to superoxides than those harboring WT MarA. The activities of several other E89 substitutions ranked as follows: E89A > E89G > E89V > WT > E89D. Increased binding and activation occurred only at class I promoters when the 12th base of the promoter's marbox (a position at which there is no known interaction between the marbox and MarA) was not a T residue. Furthermore, WT MarA binding to a synthetic marbox in vitro was enhanced when the phosphate group between positions 12 and 13 was eliminated on one strand. The results demonstrate that relatively minor changes in a single amino acid side chain (e.g., alanine to valine or glutamic acid to aspartic acid) can strongly influence activity despite any evidence that the side chain is involved in positive interactions with either DNA or RNA polymerase. We present a model which attributes the differences in binding and activation to the interference between the β- and γ-carbons of the amino acid at position 89 and the phosphate group between positions 12 and 13.

  3. Comparative genomics of the dormancy regulons in mycobacteria.


    Gerasimova, Anna; Kazakov, Alexey E; Arkin, Adam P; Dubchak, Inna; Gelfand, Mikhail S


    In response to stresses, Mycobacterium cells become dormant. This process is regulated by the DosR transcription factor. In Mycobacterium tuberculosis, the dormancy regulon is well characterized and contains the dosR gene itself and dosS and dosT genes encoding DosR kinases, nitroreductases (acg; Rv3131), diacylglycerol acyltransferase (DGAT) (Rv3130c), and many universal stress proteins (USPs). In this study, we apply comparative genomic analysis to characterize the DosR regulons in nine Mycobacterium genomes, Rhodococcus sp. RHA1, Nocardia farcinica, and Saccharopolyspora erythraea. The regulons are highly labile, containing eight core gene groups (regulators, kinases, USPs, DGATs, nitroreductases, ferredoxins, heat shock proteins, and the orthologs of the predicted kinase [Rv2004c] from M. tuberculosis) and 10 additional genes with more restricted taxonomic distribution that are mostly involved in anaerobic respiration. The largest regulon is observed in M. marinum and the smallest in M. abscessus. Analysis of large gene families encoding USPs, nitroreductases, and DGATs demonstrates a mosaic distribution of regulated and nonregulated members, suggesting frequent acquisition and loss of DosR-binding sites.

  4. Functional modules of sigma factor regulons guarantee adaptability and evolvability

    PubMed Central

    Binder, Sebastian C.; Eckweiler, Denitsa; Schulz, Sebastian; Bielecka, Agata; Nicolai, Tanja; Franke, Raimo; Häussler, Susanne; Meyer-Hermann, Michael


    The focus of modern molecular biology turns from assigning functions to individual genes towards understanding the expression and regulation of complex sets of molecules. Here, we provide evidence that alternative sigma factor regulons in the pathogen Pseudomonas aeruginosa largely represent insulated functional modules which provide a critical level of biological organization involved in general adaptation and survival processes. Analysis of the operational state of the sigma factor network revealed that transcription factors functionally couple the sigma factor regulons and significantly modulate the transcription levels in the face of challenging environments. The threshold quality of newly evolved transcription factors was reached faster and more robustly in in silico testing when the structural organization of sigma factor networks was taken into account. These results indicate that the modular structures of alternative sigma factor regulons provide P. aeruginosa with a robust framework to function adequately in its environment and at the same time facilitate evolutionary change. Our data support the view that widespread modularity guarantees robustness of biological networks and is a key driver of evolvability. PMID:26915971

  5. Functional modules of sigma factor regulons guarantee adaptability and evolvability

    NASA Astrophysics Data System (ADS)

    Binder, Sebastian C.; Eckweiler, Denitsa; Schulz, Sebastian; Bielecka, Agata; Nicolai, Tanja; Franke, Raimo; Häussler, Susanne; Meyer-Hermann, Michael


    The focus of modern molecular biology turns from assigning functions to individual genes towards understanding the expression and regulation of complex sets of molecules. Here, we provide evidence that alternative sigma factor regulons in the pathogen Pseudomonas aeruginosa largely represent insulated functional modules which provide a critical level of biological organization involved in general adaptation and survival processes. Analysis of the operational state of the sigma factor network revealed that transcription factors functionally couple the sigma factor regulons and significantly modulate the transcription levels in the face of challenging environments. The threshold quality of newly evolved transcription factors was reached faster and more robustly in in silico testing when the structural organization of sigma factor networks was taken into account. These results indicate that the modular structures of alternative sigma factor regulons provide P. aeruginosa with a robust framework to function adequately in its environment and at the same time facilitate evolutionary change. Our data support the view that widespread modularity guarantees robustness of biological networks and is a key driver of evolvability.

  6. Horizontal gene transfer of epigenetic machinery and evolution of parasitism in the malaria parasite Plasmodium falciparum and other apicomplexans

    PubMed Central


    Background The acquisition of complex transcriptional regulatory abilities and epigenetic machinery facilitated the transition of the ancestor of apicomplexans from a free-living organism to an obligate parasite. The ability to control sophisticated gene expression patterns enabled these ancient organisms to evolve several differentiated forms, invade multiple hosts and evade host immunity. How these abilities were acquired remains an outstanding question in protistan biology. Results In this work, we study SET domain bearing genes that are implicated in mediating immune evasion, invasion and cytoadhesion pathways of modern apicomplexans, including malaria parasites. We provide the first conclusive evidence of a horizontal gene transfer of a Histone H4 Lysine 20 (H4K20) modifier, Set8, from an animal host to the ancestor of apicomplexans. Set8 is known to contribute to the coordinated expression of genes involved in immune evasion in modern apicomplexans. We also show the likely transfer of a H3K36 methyltransferase (Ashr3 from plants), possibly derived from algal endosymbionts. These transfers appear to date to the transition from free-living organisms to parasitism and coincide with the proposed horizontal acquisition of cytoadhesion domains, the O-glycosyltransferase that modifies these domains, and the primary family of transcription factors found in apicomplexan parasites. Notably, phylogenetic support for these conclusions is robust and the genes clearly are dissimilar to SET sequences found in the closely related parasite Perkinsus marinus, and in ciliates, the nearest free-living organisms with complete genome sequences available. Conclusions Animal and plant sources of epigenetic machinery provide new insights into the evolution of parasitism in apicomplexans. Along with the horizontal transfer of cytoadhesive domains, O-linked glycosylation and key transcription factors, the acquisition of SET domain methyltransferases marks a key transitional event in

  7. Components of the SNARE-containing regulon are co-regulated in root cells undergoing defense

    PubMed Central

    Klink, Vincent P.; Sharma, Keshav; Pant, Shankar R.; McNeece, Brant; Niraula, Prakash; Lawrence, Gary W.


    ABSTRACT The term regulon has been coined in the genetic model plant Arabidopsis thaliana, denoting a structural and physiological defense apparatus defined genetically through the identification of the penetration (pen) mutants. The regulon is composed partially by the soluble N-ethylmaleimide-sensitive fusion protein attachment protein receptor (SNARE) syntaxin PEN1. PEN1 has homology to a Saccharomyces cerevisae gene that regulates a Secretion (Sec) protein, Suppressor of Sec 1 (Sso1p). The regulon is also composed of the β-glucosidase (PEN2) and an ATP binding cassette (ABC) transporter (PEN3). While important in inhibiting pathogen infection, limited observations have been made regarding the transcriptional regulation of regulon genes until now. Experiments made using the model agricultural Glycine max (soybean) have identified co-regulated gene expression of regulon components. The results explain the observation of hundreds of genes expressed specifically in the root cells undergoing the natural process of defense. Data regarding additional G. max genes functioning within the context of the regulon are presented here, including Sec 14, Sec 4 and Sec 23. Other examined G. max homologs of membrane fusion genes include an endosomal bromo domain-containing protein1 (Bro1), syntaxin6 (SYP6), SYP131, SYP71, SYP8, Bet1, coatomer epsilon (ε-COP), a coatomer zeta (ζ-COP) paralog and an ER to Golgi component (ERGIC) protein. Furthermore, the effectiveness of biochemical pathways that would function within the context of the regulon ave been examined, including xyloglucan xylosyltransferase (XXT), reticuline oxidase (RO) and galactinol synthase (GS). The experiments have unveiled the importance of the regulon during defense in the root and show how the deposition of callose relates to the process. PMID:28010187

  8. Genome cartography: charting the apicomplexan genome.


    Kissinger, Jessica C; DeBarry, Jeremy


    Genes reside in particular genomic contexts that can be mapped at many levels. Historically, 'genetic maps' were used primarily to locate genes. Recent technological advances in the determination of genome sequences have made the analysis and comparison of whole genomes possible and increasingly tractable. What do we see if we shift our focus from gene content (the 'inventory' of genes contained within a genome) to the composition and organization of a genome? This review examines what has been learned about the evolution of the apicomplexan genome as well as the significance and impact of genomic location on our understanding of the eukaryotic genome and parasite biology.

  9. The response of Bacillus licheniformis to heat and ethanol stress and the role of the SigB regulon.


    Voigt, Birgit; Schroeter, Rebecca; Jürgen, Britta; Albrecht, Dirk; Evers, Stefan; Bongaerts, Johannes; Maurer, Karl-Heinz; Schweder, Thomas; Hecker, Michael


    The heat and ethanol stress response of Bacillus licheniformis DSM13 was analyzed at the transcriptional and/or translational level. During heat shock, regulons known to be heat-induced in Bacillus subtilis 168 are upregulated in B. licheniformis, such as the HrcA, SigB, CtsR, and CssRS regulon. Upregulation of the SigY regulon and of genes controlled by other extracytoplasmic function (ECF) sigma factors indicates a cell-wall stress triggered by the heat shock. Furthermore, tryptophan synthesis enzymes were upregulated in heat stressed cells as well as regulons involved in usage of alternative carbon and nitrogen sources. Ethanol stress led to an induction of the SigB, HrcA, and CtsR regulons. As indicated by the upregulation of a SigM-dependent protein, ethanol also triggered a cell wall stress. To characterize the SigB regulon of B. licheniformis, we analyzed the heat stress response of a sigB mutant. It is shown that the B. licheniformis SigB regulon comprises additional genes, some of which do not exist in B. subtilis, such as BLi03885, encoding a hypothetical protein, the Na/solute symporter gene BLi02212, the arginase homolog-encoding gene BLi00198 and mcrA, encoding a protein with endonuclease activity.

  10. Marine gregarines: evolutionary prelude to the apicomplexan radiation?


    Leander, Brian S


    Gregarine apicomplexans inhabit the intestines, coeloms and reproductive vesicles of invertebrates. An emphasis on specific ancestral characteristics in marine gregarines has given the group a reputation of being 'primitive.' Although some lineages have retained characteristics inferred to be ancestral for the group, and perhaps apicomplexans as a whole, most gregarines represent highly derived parasites with novel ultrastructural and behavioral adaptations. Many marine gregarines have become giants among single-celled organisms and have evolved ornate surface structures. A comparison of gregarine morphology, placed in a modern phylogenetic context, helps clarify the earliest stages of apicomplexan evolution, the origin of Cryptosporidium, and specific cases of convergent evolution within the group and beyond.

  11. Cell cycle RNA regulons coordinating early lymphocyte development.


    Galloway, Alison; Turner, Martin


    Lymphocytes undergo dynamic changes in gene expression as they develop from progenitor cells lacking antigen receptors, to mature cells that are prepared to mount immune responses. While transcription factors have established roles in lymphocyte development, they act in concert with post-transcriptional and post-translational regulators to determine the proteome. Furthermore, the post-transcriptional regulation of RNA regulons consisting of mRNAs whose protein products act cooperatively allows RNA binding proteins to exert their effects at multiple points in a pathway. Here, we review recent evidence demonstrating the importance of RNA binding proteins that control the cell cycle in lymphocyte development and discuss the implications for tumorigenesis. For further resources related to this article, please visit the WIREs website.

  12. DISTILLER: a data integration framework to reveal condition dependency of complex regulons in Escherichia coli

    PubMed Central

    Lemmens, Karen; De Bie, Tijl; Dhollander, Thomas; De Keersmaecker, Sigrid C; Thijs, Inge M; Schoofs, Geert; De Weerdt, Ami; De Moor, Bart; Vanderleyden, Jos; Collado-Vides, Julio; Engelen, Kristof; Marchal, Kathleen


    We present DISTILLER, a data integration framework for the inference of transcriptional module networks. Experimental validation of predicted targets for the well-studied fumarate nitrate reductase regulator showed the effectiveness of our approach in Escherichia coli. In addition, the condition dependency and modularity of the inferred transcriptional network was studied. Surprisingly, the level of regulatory complexity seemed lower than that which would be expected from RegulonDB, indicating that complex regulatory programs tend to decrease the degree of modularity. PMID:19265557

  13. Recent advances in understanding apicomplexan parasites

    PubMed Central

    Seeber, Frank; Steinfelder, Svenja


    Intracellular single-celled parasites belonging to the large phylum Apicomplexa are amongst the most prevalent and morbidity-causing pathogens worldwide. In this review, we highlight a few of the many recent advances in the field that helped to clarify some important aspects of their fascinating biology and interaction with their hosts. Plasmodium falciparum causes malaria, and thus the recent emergence of resistance against the currently used drug combinations based on artemisinin has been of major interest for the scientific community. It resulted in great advances in understanding the resistance mechanisms that can hopefully be translated into altered future drug regimens. Apicomplexa are also experts in host cell manipulation and immune evasion. Toxoplasma gondii and Theileria sp., besides Plasmodium sp., are species that secrete effector molecules into the host cell to reach this aim. The underlying molecular mechanisms for how these proteins are trafficked to the host cytosol ( T. gondii and Plasmodium) and how a secreted protein can immortalize the host cell ( Theileria sp.) have been illuminated recently. Moreover, how such secreted proteins affect the host innate immune responses against T. gondii and the liver stages of Plasmodium has also been unraveled at the genetic and molecular level, leading to unexpected insights. Methodological advances in metabolomics and molecular biology have been instrumental to solving some fundamental puzzles of mitochondrial carbon metabolism in Apicomplexa. Also, for the first time, the generation of stably transfected Cryptosporidium parasites was achieved, which opens up a wide variety of experimental possibilities for this understudied, important apicomplexan pathogen. PMID:27347391

  14. Tracking Transmission of Apicomplexan Symbionts in Diverse Caribbean Corals

    PubMed Central

    Kirk, Nathan L.; Ritson-Williams, Raphael; Coffroth, Mary Alice; Miller, Margaret W.; Fogarty, Nicole D.; Santos, Scott R.


    Symbionts in each generation are transmitted to new host individuals either vertically (parent to offspring), horizontally (from exogenous sources), or a combination of both. Scleractinian corals make an excellent study system for understanding patterns of symbiont transmission since they harbor diverse symbionts and possess distinct reproductive modes of either internal brooding or external broadcast spawning that generally correlate with vertical or horizontal transmission, respectively. Here, we focused on the under-recognized, but apparently widespread, coral-associated apicomplexans (Protista: Alveolata) to determine if symbiont transmission depends on host reproductive mode. Specifically, a PCR-based assay was utilized towards identifying whether planula larvae and reproductive adults from brooding and broadcast spawning scleractinian coral species in Florida and Belize harbored apicomplexan DNA. Nearly all (85.5%; n = 85/89) examined planulae of five brooding species (Porites astreoides, Agaricia tenuifolia, Agaricia agaricites, Favia fragum, Mycetophyllia ferox) and adults of P. astreoides were positive for apicomplexan DNA. In contrast, no (n = 0/10) apicomplexan DNA was detected from planulae of four broadcast spawning species (Acropora cervicornis, Acropora palmata, Pseudodiploria strigosa, and Orbicella faveolata) and rarely in gametes (8.9%; n = 5/56) of these species sampled from the same geographical range as the brooding species. In contrast, tissue samples from nearly all (92.0%; n = 81/88) adults of the broadcast spawning species A. cervicornis, A. palmata and O. faveolata harbored apicomplexan DNA, including colonies whose gametes and planulae tested negative for these symbionts. Taken together, these data suggest apicomplexans are transmitted vertically in these brooding scleractinian coral species while the broadcast spawning scleractinian species examined here acquire these symbionts horizontally. Notably, these transmission patterns are

  15. Characterization of the YdeO regulon in Escherichia coli.


    Yamanaka, Yuki; Oshima, Taku; Ishihama, Akira; Yamamoto, Kaneyoshi


    Enterobacteria are able to survive under stressful conditions within animals, such as acidic conditions in the stomach, bile salts during transfer to the intestine and anaerobic conditions within the intestine. The glutamate-dependent (GAD) system plays a major role in acid resistance in Escherichia coli, and expression of the GAD system is controlled by the regulatory cascade consisting of EvgAS > YdeO > GadE. To understand the YdeO regulon in vivo, we used ChIP-chip to interrogate the E. coli genome for candidate YdeO binding sites. All of the seven operons identified by ChIP-chip as being potentially regulated by YdeO were confirmed as being under the direct control of YdeO using RT-qPCR, EMSA, DNaseI-footprinting and reporter assays. Within this YdeO regulon, we identified four stress-response transcription factors, DctR, NhaR, GadE, and GadW and enzymes for anaerobic respiration. Both GadE and GadW are involved in regulation of the GAD system and NhaR is an activator for the sodium/proton antiporter gene. In conjunction with co-transcribed Slp, DctR is involved in protection against metabolic endoproducts under acidic conditions. Taken all together, we suggest that YdeO is a key regulator of E. coli survival in both acidic and anaerobic conditions.

  16. Anaerobic adaptation in Pseudomonas aeruginosa: definition of the Anr and Dnr regulons.


    Trunk, Katharina; Benkert, Beatrice; Quäck, Nicole; Münch, Richard; Scheer, Maurice; Garbe, Julia; Jänsch, Lothar; Trost, Matthias; Wehland, Jürgen; Buer, Jan; Jahn, Martina; Schobert, Max; Jahn, Dieter


    The anaerobic metabolism of the opportunistic pathogen Pseudomonas aeruginosa is important for growth and biofilm formation during persistent infections. The two Fnr-type transcription factors Anr and Dnr regulate different parts of the underlying network in response to oxygen tension and NO. Little is known about all members of the Anr and Dnr regulons and the mediated immediate response to oxygen depletion. Comprehensive transcriptome and bioinformatics analyses in combination with a limited proteome analyses were used for the investigation of the P. aeruginosa response to an immediate oxygen depletion and for definition of the corresponding Anr and Dnr regulons. We observed at first the activation of fermentative pathways for immediate energy generation followed by induction of alternative respiratory chains. A solid position weight matrix model was deduced from the experimentally identified Anr boxes and used for identification of 170 putative Anr boxes in potential P. aeruginosa promoter regions. The combination with the experimental data unambiguously identified 130 new members for the Anr and Dnr regulons. The basis for the understanding of two regulons of P. aeruginosa central to biofilm formation and infection is now defined.

  17. Comparative Genomics of the Dormancy Regulons in Mycobacteria ▿†

    PubMed Central

    Gerasimova, Anna; Kazakov, Alexey E.; Arkin, Adam P.; Dubchak, Inna; Gelfand, Mikhail S.


    In response to stresses, Mycobacterium cells become dormant. This process is regulated by the DosR transcription factor. In Mycobacterium tuberculosis, the dormancy regulon is well characterized and contains the dosR gene itself and dosS and dosT genes encoding DosR kinases, nitroreductases (acg; Rv3131), diacylglycerol acyltransferase (DGAT) (Rv3130c), and many universal stress proteins (USPs). In this study, we apply comparative genomic analysis to characterize the DosR regulons in nine Mycobacterium genomes, Rhodococcus sp. RHA1, Nocardia farcinica, and Saccharopolyspora erythraea. The regulons are highly labile, containing eight core gene groups (regulators, kinases, USPs, DGATs, nitroreductases, ferredoxins, heat shock proteins, and the orthologs of the predicted kinase [Rv2004c] from M. tuberculosis) and 10 additional genes with more restricted taxonomic distribution that are mostly involved in anaerobic respiration. The largest regulon is observed in M. marinum and the smallest in M. abscessus. Analysis of large gene families encoding USPs, nitroreductases, and DGATs demonstrates a mosaic distribution of regulated and nonregulated members, suggesting frequent acquisition and loss of DosR-binding sites. PMID:21602344

  18. Comparative Genomics of DtxR Family Regulons for Metal Homeostasis in Archaea

    PubMed Central

    Leyn, Semen A.


    The DtxR family consists of metal-dependent transcription factors (DtxR-TFs) that regulate the expression of genes involved in metal homeostasis in the cell. The majority of characterized DtxR-TFs belong to Bacteria. In the current work, we applied a comparative genomics approach to predict DNA-binding sites and reconstruct regulons for DtxR-TFs in Archaea. As a result, we inferred 575 candidate binding sites for 139 DtxR-TFs in 77 genomes from 15 taxonomic orders. Novel DNA motifs of archaeal DtxR-TFs that have a common palindromic structure were classified into 10 distinct groups. By combining functional regulon reconstructions with phylogenetic analysis, we selected 28 DtxR-TF clades and assigned them metal specificities and regulator names. The reconstructed FetR (ferrous iron), MntR (manganese), and ZntR (zinc) regulons largely contain known or putative metal uptake transporters from the FeoAB, NRAMP, ZIP, and TroA families. A novel family of putative iron transporters (named Irt), including multiple FetR-regulated paralogs, was identified in iron-oxidizing Archaea from the Sulfolobales order. The reconstructed DtxR-TF regulons were reconciled with available transcriptomics data in Archaeoglobus, Halobacterium, and Thermococcus spp. PMID:25404694

  19. Phylogeny and evolution of apicoplasts and apicomplexan parasites.


    Arisue, Nobuko; Hashimoto, Tetsuo


    The phylum Apicomplexa includes many parasitic genera of medical and veterinary importance including Plasmodium (causative agent of malaria), Toxoplasma (toxoplasmosis), and Babesia (babesiosis). Most of the apicomplexan parasites possess a unique, essential organelle, the apicoplast, which is a plastid without photosynthetic ability. Although the apicoplast is considered to have evolved through secondary endosymbiosis of a red alga into the common ancestral cell of apicomplexans, its evolutionary history has been under debate until recently. The apicoplast has a genome around 30-40 kb in length. Repertoire and arrangement of the apicoplast genome-encoded genes differ among apicomplexan genera, although within the genus Plasmodium these are almost conserved. Genes in the apicoplast genome may be useful markers for Plasmodium phylogeny, because these are single copy (except for the inverted repeat region) and may have more phylogenetic signal than the mitochondrial genome that have been most commonly used for Plasmodium phylogeny. This review describes recent studies concerning the evolutionary origin of the apicoplast, presents evolutionary comparison of the primary structures of apicoplast genomes from apicomplexan parasites, and summarizes recent findings of malaria phylogeny based on apicoplast genome-encoded genes.

  20. Nephromyces, a beneficial apicomplexan symbiont in marine animals

    PubMed Central

    Saffo, Mary Beth; McCoy, Adam M.; Rieken, Christopher; Slamovits, Claudio H.


    With malaria parasites (Plasmodium spp.), Toxoplasma, and many other species of medical and veterinary importance its iconic representatives, the protistan phylum Apicomplexa has long been defined as a group composed entirely of parasites and pathogens. We present here a report of a beneficial apicomplexan: the mutualistic marine endosymbiont Nephromyces. For more than a century, the peculiar structural and developmental features of Nephromyces, and its unusual habitat, have thwarted characterization of the phylogenetic affinities of this eukaryotic microbe. Using short-subunit ribosomal DNA (SSU rDNA) sequences as key evidence, with sequence identity confirmed by fluorescence in situ hybridization (FISH), we show that Nephromyces, originally classified as a chytrid fungus, is actually an apicomplexan. Inferences from rDNA data are further supported by the several apicomplexan-like structural features in Nephromyces, including especially the strong resemblance of Nephromyces infective stages to apicomplexan sporozoites. The striking emergence of the mutualistic Nephromyces from a quintessentially parasitic clade accentuates the promise of this organism, and the three-partner symbiosis of which it is a part, as a model for probing the factors underlying the evolution of mutualism, pathogenicity, and infectious disease. PMID:20736348

  1. Apicomplexan cell cycle flexibility: centrosome controls the clutch

    PubMed Central

    Chen, Chun-Ti; Gubbels, Marc-Jan


    The centrosome serves as a central hub coordinating multiple cellular events in eukaryotes. A recent study in Toxoplasma gondii revealed a unique bipartite structure of the centrosome, which coordinates the nuclear cycle (S-phase and mitosis) and budding cycle (cytokinesis) of the parasite, and deciphers the principle behind flexible apicomplexan cell division modes. PMID:25899747

  2. Positive control of a global antioxidant defense regulon activated by superoxide-generating agents in Escherichia coli.

    PubMed Central

    Greenberg, J T; Monach, P; Chou, J H; Josephy, P D; Demple, B


    Escherichia coli responds to superoxide-generating agents by inducing approximately 40 proteins. We have identified a genetic locus, soxR (superoxide response), that positively regulates 9 of these proteins during superoxide stress. Induction under soxR control is at the transcriptional level, as shown with lac fusions to five paraquat-inducible promoters. Members of the soxR regulon include at least three proteins with demonstrable antioxidant roles: Mn-containing superoxide dismutase (which destroys superoxide radicals), endonuclease IV (which repairs radical-induced damages in DNA), and glucose-6-phosphate dehydrogenase (which produces NADPH). Induction of the soxR regulon also leads to diminished levels of the major outer membrane protein OmpF and alteration of the small-subunit ribosomal protein S6. These latter changes confer resistance to a variety of antibiotics. The soxR regulon may thus operate as an inducible defense against xenobiotics in general. Images PMID:1696718

  3. The sigma54 global regulon in Salmonella enterica serovar Typhimurium 14028s: an extensive array of intragenic sigma54 regulatory sites revealed

    Technology Transfer Automated Retrieval System (TEKTRAN)

    An essential determinant of a transcriptional regulon is the sigma factor that associates with core RNA polymerase (E) to direct promoter-specific binding and transcription initiation by the holoenzyme (Esigma). In addition to the primary sigma factor, sigma70, S. Typhimurium has five alternative si...

  4. Identification of the CRE-1 Cellulolytic Regulon in Neurospora crassa

    PubMed Central

    Sun, Jianping; Glass, N. Louise


    Background In filamentous ascomycete fungi, the utilization of alternate carbon sources is influenced by the zinc finger transcription factor CreA/CRE-1, which encodes a carbon catabolite repressor protein homologous to Mig1 from Saccharomyces cerevisiae. In Neurospora crassa, deletion of cre-1 results in increased secretion of amylase and β-galactosidase. Methodology/Principal Findings Here we show that a strain carrying a deletion of cre-1 has increased cellulolytic activity and increased expression of cellulolytic genes during growth on crystalline cellulose (Avicel). Constitutive expression of cre-1 complements the phenotype of a N. crassa Δcre-1 strain grown on Avicel, and also results in stronger repression of cellulolytic protein secretion and enzyme activity. We determined the CRE-1 regulon by investigating the secretome and transcriptome of a Δcre-1 strain as compared to wild type when grown on Avicel versus minimal medium. Chromatin immunoprecipitation-PCR of putative target genes showed that CRE-1 binds to only some adjacent 5′-SYGGRG-3′ motifs, consistent with previous findings in other fungi, and suggests that unidentified additional regulatory factors affect CRE-1 binding to promoter regions. Characterization of 30 mutants containing deletions in genes whose expression level increased in a Δcre-1 strain under cellulolytic conditions identified novel genes that affect cellulase activity and protein secretion. Conclusions/Significance Our data provide comprehensive information on the CRE-1 regulon in N. crassa and contribute to deciphering the global role of carbon catabolite repression in filamentous ascomycete fungi during plant cell wall deconstruction. PMID:21980519

  5. A Novel Candidate Vaccine for Cytauxzoonosis Inferred from Comparative Apicomplexan Genomics

    PubMed Central

    Tarigo, Jaime L.; Scholl, Elizabeth H.; Bird, David McK.; Brown, Corrie C.; Cohn, Leah A.; Dean, Gregg A.; Levy, Michael G.; Doolan, Denise L.; Trieu, Angela; Nordone, Shila K.; Felgner, Philip L.; Vigil, Adam; Birkenheuer, Adam J.


    Cytauxzoonosis is an emerging infectious disease of domestic cats (Felis catus) caused by the apicomplexan protozoan parasite Cytauxzoon felis. The growing epidemic, with its high morbidity and mortality points to the need for a protective vaccine against cytauxzoonosis. Unfortunately, the causative agent has yet to be cultured continuously in vitro, rendering traditional vaccine development approaches beyond reach. Here we report the use of comparative genomics to computationally and experimentally interpret the C. felis genome to identify a novel candidate vaccine antigen for cytauxzoonosis. As a starting point we sequenced, assembled, and annotated the C. felis genome and the proteins it encodes. Whole genome alignment revealed considerable conserved synteny with other apicomplexans. In particular, alignments with the bovine parasite Theileria parva revealed that a C. felis gene, cf76, is syntenic to p67 (the leading vaccine candidate for bovine theileriosis), despite a lack of significant sequence similarity. Recombinant subdomains of cf76 were challenged with survivor-cat antiserum and found to be highly seroreactive. Comparison of eleven geographically diverse samples from the south-central and southeastern USA demonstrated 91–100% amino acid sequence identity across cf76, including a high level of conservation in an immunogenic 226 amino acid (24 kDa) carboxyl terminal domain. Using in situ hybridization, transcription of cf76 was documented in the schizogenous stage of parasite replication, the life stage that is believed to be the most important for development of a protective immune response. Collectively, these data point to identification of the first potential vaccine candidate antigen for cytauxzoonosis. Further, our bioinformatic approach emphasizes the use of comparative genomics as an accelerated path to developing vaccines against experimentally intractable pathogens. PMID:23977000

  6. Global analysis of the Bacillus subtilis Fur regulon and the iron starvation stimulon.


    Baichoo, Noel; Wang, Tao; Ye, Rick; Helmann, John D


    The Bacillus subtilis ferric uptake repressor (Fur) protein coordinates a global transcriptional response to iron starvation. We have used DNA microarrays to define the Fur regulon and the iron starvation stimulon. We identify 20 operons (containing 39 genes) that are derepressed both by mutation of fur and by treatment of cells with the iron chelator 2,2'-dipyridyl. These operons are direct targets of Fur regulation as judged by DNase I footprinting. Analyses of lacZ reporter fusions to six Fur-regulated promoter regions reveal that repression is highly selective for iron. In addition to the Fur regulon, iron starvation induces members of the PerR regulon and leads to reduced expression of cytochromes. However, we did not find any evidence for genes that are directly activated by Fur or repressed by Fur under iron-limiting conditions. Although genome searches using the 19 bp Fur box consensus are useful in identifying candidate Fur-regulated genes, some genes associated with Fur boxes are not demonstrably regulated by Fur, whereas other genes are regulated from sites with little apparent similarity to the conventional Fur consensus.

  7. Cohabitation of Two Different lexA Regulons in Pseudomonas putida▿ †

    PubMed Central

    Abella, Marc; Campoy, Susana; Erill, Ivan; Rojo, Fernando; Barbé, Jordi


    In contrast to the vast majority of the members of the domain Bacteria, several Pseudomonas and Xanthomonas species have two lexA genes, whose products have been shown to recognize different LexA binding motifs, making them an interesting target for studying the interplay between cohabiting LexA regulons in a single species. Here we report an analysis of the genetic composition of the two LexA regulons of Pseudomonas putida KT2440 performed with a genomic microarray. The data obtained indicate that one of the two LexA proteins (LexA1) seems to be in control of the conventional Escherichia coli-like SOS response, while the other LexA protein (LexA2) regulates only its own transcriptional unit, which includes the imuA, imuB, and dnaE2 genes, and a gene (PP_3901) from a resident P. putida prophage. Furthermore, PP_3901 is also regulated by LexA1 and is required for DNA damage-mediated induction of several P. putida resident prophage genes. In silico searches suggested that this marked asymmetry in regulon contents also occurs in other Pseudomonas species with two lexA genes, and the implications of this asymmetry in the evolution of the SOS network are discussed. PMID:17933893

  8. Haemophilus influenzae OxyR: Characterization of Its Regulation, Regulon and Role in Fitness

    PubMed Central

    Whitby, Paul W.; Morton, Daniel J.; VanWagoner, Timothy M.; Seale, Thomas W.; Cole, Brett K.; Mussa, Huda J.; McGhee, Phillip A.; Bauer, Chee Yoon S.; Springer, Jennifer M.; Stull, Terrence L.


    To prevent damage by reactive oxygen species, many bacteria have evolved rapid detection and response systems, including the OxyR regulon. The OxyR system detects reactive oxygen and coordinates the expression of numerous defensive antioxidants. In many bacterial species the coordinated OxyR-regulated response is crucial for in vivo survival. Regulation of the OxyR regulon of Haemophilus influenzae was examined in vitro, and significant variation in the regulated genes of the OxyR regulon among strains of H. influenzae was observed. Quantitative PCR studies demonstrated a role for the OxyR-regulated peroxiredoxin/glutaredoxin as a mediator of the OxyR response, and also indicated OxyR self-regulation through a negative feedback loop. Analysis of transcript levels in H. influenzae samples derived from an animal model of otitis media demonstrated that the members of the OxyR regulon were actively upregulated within the chinchilla middle ear. H. influenzae mutants lacking the oxyR gene exhibited increased sensitivity to challenge with various peroxides. The impact of mutations in oxyR was assessed in various animal models of H. influenzae disease. In paired comparisons with the corresponding wild-type strains, the oxyR mutants were unaffected in both the chinchilla model of otitis media and an infant model of bacteremia. However, in weanling rats the oxyR mutant was significantly impaired compared to the wild-type strain. In contrast, in all three animal models when infected with a mixture of equal numbers of both wild-type and mutant strains the mutant strain was significantly out competed by the wild-type strain. These findings clearly establish a crucial role for OxyR in bacterial fitness. PMID:23226321

  9. prhKLM genes of Ralstonia solanacearum encode novel activators of hrp regulon and are required for pathogenesis in tomato.


    Zhang, Yong; Kiba, Akinori; Hikichi, Yasufumi; Ohnishi, Kouhei


    The genes in the hrp regulon encode the proteins composing type III secretion system in Ralstonia solanacearum. The hrp regulon is positively controlled by HrpB, and hrpB expression is activated by both HrpG and PrhG. We have identified three genes, prhK, prhL, and prhM, which positively control the hrp regulon in strain OE1-1. These genes are likely to form an operon, and this operon is well conserved in the genera Ralstonia and Burkholderia. This indicates that the operon is not specific to the plant pathogens. Mutations in each of these three genes abolished hrpB and prhG expression. prhK, prhL, and prhM mutant strains lost pathogenicity toward tomato completely, and they were less virulent toward tobacco. PrhK and PrhL share sequence similarity with allophanate hydrolase and PrhM with LamB. This suggests that the three gene products are not transcriptional regulators in the strict sense, but regulate hrp regulon indirectly. This novel class of virulence-related genes will mark the beginning of new findings regarding the overall infection mode of R. solanacearum.

  10. RegulonDB version 9.0: high-level integration of gene regulation, coexpression, motif clustering and beyond.


    Gama-Castro, Socorro; Salgado, Heladia; Santos-Zavaleta, Alberto; Ledezma-Tejeida, Daniela; Muñiz-Rascado, Luis; García-Sotelo, Jair Santiago; Alquicira-Hernández, Kevin; Martínez-Flores, Irma; Pannier, Lucia; Castro-Mondragón, Jaime Abraham; Medina-Rivera, Alejandra; Solano-Lira, Hilda; Bonavides-Martínez, César; Pérez-Rueda, Ernesto; Alquicira-Hernández, Shirley; Porrón-Sotelo, Liliana; López-Fuentes, Alejandra; Hernández-Koutoucheva, Anastasia; Del Moral-Chávez, Víctor; Rinaldi, Fabio; Collado-Vides, Julio


    RegulonDB ( is one of the most useful and important resources on bacterial gene regulation,as it integrates the scattered scientific knowledge of the best-characterized organism, Escherichia coli K-12, in a database that organizes large amounts of data. Its electronic format enables researchers to compare their results with the legacy of previous knowledge and supports bioinformatics tools and model building. Here, we summarize our progress with RegulonDB since our last Nucleic Acids Research publication describing RegulonDB, in 2013. In addition to maintaining curation up-to-date, we report a collection of 232 interactions with small RNAs affecting 192 genes, and the complete repertoire of 189 Elementary Genetic Sensory-Response units (GENSOR units), integrating the signal, regulatory interactions, and metabolic pathways they govern. These additions represent major progress to a higher level of understanding of regulated processes. We have updated the computationally predicted transcription factors, which total 304 (184 with experimental evidence and 120 from computational predictions); we updated our position-weight matrices and have included tools for clustering them in evolutionary families. We describe our semiautomatic strategy to accelerate curation, including datasets from high-throughput experiments, a novel coexpression distance to search for 'neighborhood' genes to known operons and regulons, and computational developments.

  11. RegulonDB version 9.0: high-level integration of gene regulation, coexpression, motif clustering and beyond

    PubMed Central

    Gama-Castro, Socorro; Salgado, Heladia; Santos-Zavaleta, Alberto; Ledezma-Tejeida, Daniela; Muñiz-Rascado, Luis; García-Sotelo, Jair Santiago; Alquicira-Hernández, Kevin; Martínez-Flores, Irma; Pannier, Lucia; Castro-Mondragón, Jaime Abraham; Medina-Rivera, Alejandra; Solano-Lira, Hilda; Bonavides-Martínez, César; Pérez-Rueda, Ernesto; Alquicira-Hernández, Shirley; Porrón-Sotelo, Liliana; López-Fuentes, Alejandra; Hernández-Koutoucheva, Anastasia; Moral-Chávez, Víctor Del; Rinaldi, Fabio; Collado-Vides, Julio


    RegulonDB ( is one of the most useful and important resources on bacterial gene regulation,as it integrates the scattered scientific knowledge of the best-characterized organism, Escherichia coli K-12, in a database that organizes large amounts of data. Its electronic format enables researchers to compare their results with the legacy of previous knowledge and supports bioinformatics tools and model building. Here, we summarize our progress with RegulonDB since our last Nucleic Acids Research publication describing RegulonDB, in 2013. In addition to maintaining curation up-to-date, we report a collection of 232 interactions with small RNAs affecting 192 genes, and the complete repertoire of 189 Elementary Genetic Sensory-Response units (GENSOR units), integrating the signal, regulatory interactions, and metabolic pathways they govern. These additions represent major progress to a higher level of understanding of regulated processes. We have updated the computationally predicted transcription factors, which total 304 (184 with experimental evidence and 120 from computational predictions); we updated our position-weight matrices and have included tools for clustering them in evolutionary families. We describe our semiautomatic strategy to accelerate curation, including datasets from high-throughput experiments, a novel coexpression distance to search for ‘neighborhood’ genes to known operons and regulons, and computational developments. PMID:26527724

  12. Involvement of phosphotransacetylase, acetate kinase, and acetyl phosphate synthesis in control of the phosphate regulon in Escherichia coli.


    Wanner, B L; Wilmes-Riesenberg, M R


    Two controls of the phosphate (PHO) regulon require sensor proteins that are protein kinases that phosphorylate the regulator, PhoB, which in turn activates transcription only when phosphorylated. Pi control requires the Pi sensor PhoR; the other control is Pi independent and requires the sensor CreC (formerly called PhoM). Here we describe an additional control of the PHO regulon which is Pi independent and requires neither PhoR nor CreC. This control is regulated by a two-step pathway in carbon metabolism in which acetyl coenzyme A, Pi, and ADP are converted into acetate, coenzyme A, and ATP via the enzymes phosphotransacetylase (Pta) and acetate kinase (AckA). It responds to the synthesis of acetyl phosphate, an intermediate in the Pta-AckA pathway. Since the synthesis of acetyl phosphate via this pathway leads to the incorporation of Pi into ATP, the primary phosphoryl donor in metabolism, we propose that a regulatory coupling(s) may exist between the PHO regulon, which encodes genes for Pi uptake, and genes for enzymes in central metabolism for incorporation of Pi into ATP. Regulatory interactions of this sort may be important in global control. Further, it provides a functional basis for the concept of cross-regulation in the PHO regulon. This is also the first evidence that acetyl phosphate may have a role as an effector of gene regulation.

  13. Evidence classification of high-throughput protocols and confidence integration in RegulonDB

    PubMed Central

    Weiss, Verena; Medina-Rivera, Alejandra; Huerta, Araceli M.; Santos-Zavaleta, Alberto; Salgado, Heladia; Morett, Enrique; Collado-Vides, Julio


    RegulonDB provides curated information on the transcriptional regulatory network of Escherichia coli and contains both experimental data and computationally predicted objects. To account for the heterogeneity of these data, we introduced in version 6.0, a two-tier rating system for the strength of evidence, classifying evidence as either ‘weak’ or ‘strong’ (Gama-Castro,S., Jimenez-Jacinto,V., Peralta-Gil,M. et al. RegulonDB (Version 6.0): gene regulation model of Escherichia Coli K-12 beyond transcription, active (experimental) annotated promoters and textpresso navigation. Nucleic Acids Res., 2008;36:D120–D124.). We now add to our classification scheme the classification of high-throughput evidence, including chromatin immunoprecipitation (ChIP) and RNA-seq technologies. To integrate these data into RegulonDB, we present two strategies for the evaluation of confidence, statistical validation and independent cross-validation. Statistical validation involves verification of ChIP data for transcription factor-binding sites, using tools for motif discovery and quality assessment of the discovered matrices. Independent cross-validation combines independent evidence with the intention to mutually exclude false positives. Both statistical validation and cross-validation allow to upgrade subsets of data that are supported by weak evidence to a higher confidence level. Likewise, cross-validation of strong confidence data extends our two-tier rating system to a three-tier system by introducing a third confidence score ‘confirmed’. Database URL: PMID:23327937

  14. The multifaceted RisA regulon of Bordetella pertussis

    PubMed Central

    Coutte, Loïc; Huot, Ludovic; Antoine, Rudy; Slupek, Stephanie; Merkel, Tod J.; Chen, Qing; Stibitz, Scott; Hot, David; Locht, Camille


    The whooping cough agent Bordetella pertussis regulates the production of its virulence factors by the BvgA/S system. Phosphorylated BvgA activates the virulence-activated genes (vags) and represses the expression of the virulence-repressed genes (vrgs) via the activation of the bvgR gene. In modulating conditions, with MgSO4, the BvgA/S system is inactive, and the vrgs are expressed. Here, we show that the expression of almost all vrgs depends on RisA, another transcriptional regulator. We also show that some vags are surprisingly no longer modulated by MgSO4 in the risA− background. RisA also regulates the expression of other genes, including chemotaxis and flagellar operons, iron-regulated genes, and genes of unknown function, which may or may not be controlled by BvgA/S. We identified RisK as the likely cognate RisA kinase and found that it is important for expression of most, but not all RisA-regulated genes. This was confirmed using the phosphoablative RisAD60N and the phosphomimetic RisAD60E analogues. Thus the RisA regulon adds a new layer of complexity to B. pertussis virulence gene regulation. PMID:27620673

  15. An SOS Regulon under Control of a Noncanonical LexA-Binding Motif in the Betaproteobacteria

    PubMed Central

    Sanchez-Alberola, Neus; Campoy, Susana; Emerson, David; Barbé, Jordi


    ABSTRACT The SOS response is a transcriptional regulatory network governed by the LexA repressor that activates in response to DNA damage. In the Betaproteobacteria, LexA is known to target a palindromic sequence with the consensus sequence CTGT-N8-ACAG. We report the characterization of a LexA regulon in the iron-oxidizing betaproteobacterium Sideroxydans lithotrophicus. In silico and in vitro analyses show that LexA targets six genes by recognizing a binding motif with the consensus sequence GAACGaaCGTTC, which is strongly reminiscent of the Bacillus subtilis LexA-binding motif. We confirm that the closely related Gallionella capsiferriformans shares the same LexA-binding motif, and in silico analyses indicate that this motif is also conserved in the Nitrosomonadales and the Methylophilales. Phylogenetic analysis of LexA and the alpha subunit of DNA polymerase III (DnaE) reveal that the organisms harboring this noncanonical LexA form a compact taxonomic cluster within the Betaproteobacteria. However, their lexA gene is unrelated to the standard Betaproteobacteria lexA, and there is evidence of its spread through lateral gene transfer. In contrast to other reported cases of noncanonical LexA-binding motifs, the regulon of S. lithotrophicus is comparable in size and function to that of many other Betaproteobacteria, suggesting that a convergent SOS regulon has reevolved under the control of a new LexA protein. Analysis of the DNA-binding domain of S. lithotrophicus LexA reveals little sequence similarity with that of other LexA proteins targeting similar binding motifs, suggesting that network structure may limit site evolution or that structural constrains make the B. subtilis-type motif an optimal interface for multiple LexA sequences. IMPORTANCE Understanding the evolution of transcriptional systems enables us to address important questions in microbiology, such as the emergence and transfer potential of different regulatory systems to regulate virulence or

  16. Genomic Reconstruction of the Transcriptional Regulatory Network in Bacillus subtilis

    PubMed Central

    Leyn, Semen A.; Kazanov, Marat D.; Sernova, Natalia V.; Ermakova, Ekaterina O.; Novichkov, Pavel S.


    The adaptation of microorganisms to their environment is controlled by complex transcriptional regulatory networks (TRNs), which are still only partially understood even for model species. Genome scale annotation of regulatory features of genes and TRN reconstruction are challenging tasks of microbial genomics. We used the knowledge-driven comparative-genomics approach implemented in the RegPredict Web server to infer TRN in the model Gram-positive bacterium Bacillus subtilis and 10 related Bacillales species. For transcription factor (TF) regulons, we combined the available information from the DBTBS database and the literature with bioinformatics tools, allowing inference of TF binding sites (TFBSs), comparative analysis of the genomic context of predicted TFBSs, functional assignment of target genes, and effector prediction. For RNA regulons, we used known RNA regulatory motifs collected in the Rfam database to scan genomes and analyze the genomic context of new RNA sites. The inferred TRN in B. subtilis comprises regulons for 129 TFs and 24 regulatory RNA families. First, we analyzed 66 TF regulons with previously known TFBSs in B. subtilis and projected them to other Bacillales genomes, resulting in refinement of TFBS motifs and identification of novel regulon members. Second, we inferred motifs and described regulons for 28 experimentally studied TFs with previously unknown TFBSs. Third, we discovered novel motifs and reconstructed regulons for 36 previously uncharacterized TFs. The inferred collection of regulons is available in the RegPrecise database ( and can be used in genetic experiments, metabolic modeling, and evolutionary analysis. PMID:23504016

  17. New roles for perforins and proteases in apicomplexan egress.


    Roiko, Marijo S; Carruthers, Vern B


    Egress is a pivotal step in the life cycle of intracellular pathogens initiating the transition from an expiring host cell to a fresh target cell. While much attention has been focused on understanding cell invasion by intracellular pathogens, recent work is providing a new appreciation of mechanisms and therapeutic potential of microbial egress. This review highlights recent insight into cell egress by apicomplexan parasites and emerging contributions of membranolytic and proteolytic secretory products, along with host proteases. New findings suggest that Toxoplasma gondii secretes a pore-forming protein, TgPLP1, during egress that facilitates parasite escape from the cell by perforating the parasitophorous membrane. Also, in a cascade of proteolytic events, Plasmodium falciparum late-stage schizonts activate and secrete a subtilisin, PfSUB1, which processes enigmatic putative proteases called serine-repeat antigens that contribute to merozoite egress. A new report also suggests that calcium-activated host proteases called calpains aid parasite exit, possibly by acting upon the host cytoskeleton. Together these discoveries reveal important new molecular players involved in the principal steps of egress by apicomplexans.

  18. A novel sigma factor reveals a unique regulon controlling cell-specific recombination in Mycoplasma genitalium.


    Torres-Puig, Sergi; Broto, Alicia; Querol, Enrique; Piñol, Jaume; Pich, Oscar Q


    The Mycoplasma genitalium MG428 protein shows homology to members of the sigma-70 family of sigma factors. Herein, we found that MG428 activates transcription of recA, ruvA and ruvB as well as several genes with unknown function. Deletion of MG_428 or some of the up-regulated unknown genes led to severe recombination defects. Single cell analyses revealed that activation of the MG428-regulon is a rare event under laboratory growth conditions. A conserved sequence with sigma-70 promoter architecture (TTGTCA-N(18/19)-ATTWAT) was identified in the upstream region of all of the MG428-regulated genes or operons. Primer extension analyses demonstrated that transcription initiates immediately downstream of this sigma70-type promoter in a MG428-dependent manner. Furthermore, mutagenesis of the conserved -10 and -35 elements corroborated the requirement of these regions for promoter function. Therefore, a new mycoplasma promoter directs transcription of a unique recombination regulon. Additionally, MG428 was found to interact with the RNAP core enzyme, reinforcing the predicted role of this protein as an alternative sigma factor. Finally, our results indicate that MG428 contributes to the generation of genetic diversity in this model organism. Since recombination is an important mechanism to generate antigenic variation, MG428 emerges as a novel factor contributing to M. genitalium virulence.

  19. Sterol Composition and Biosynthetic Genes of Vitrella brassicaformis, a Recently Discovered Chromerid: Comparison to Chromera velia and Phylogenetic Relationship with Apicomplexan Parasites.


    Khadka, Manoj; Salem, Mohamed; Leblond, Jeffrey D


    Vitrella brassicaformis is the second discovered species in the Chromerida, and first in the family Vitrellaceae. Chromera velia, the first discovered species, forms an independent photosynthetic lineage with V. brassicaformis, and both are closely related to peridinin-containing dinoflagellates and nonphotosynthetic apicomplexans; both also show phylogenetic closeness with red algal plastids. We have utilized gas chromatography/mass spectrometry to identify two free sterols, 24-ethylcholest-5-en-3β-ol, and a minor unknown sterol which appeared to be a C(28:4) compound. We have also used RNA Seq analysis to identify seven genes found in the nonmevalonate/methylerythritol pathway (MEP) for sterol biosynthesis. Subsequent genome analysis of V. brassicaformis showed the presence of two mevalonate (MVA) pathway genes, though the genes were not observed in the transcriptome analysis. Transcripts from four genes (dxr, ispf, ispd, and idi) were selected and translated into proteins to study the phylogenetic relationship of sterol biosynthesis in V. brassicaformis and C. velia to other groups of algae and apicomplexans. On the basis of our genomic and transcriptomic analyses, we hypothesize that the MEP pathway was the primary pathway that apicomplexans used for sterol biosynthesis before they lost their sterol biosynthesis ability, although contribution of the MVA pathway cannot be discounted.

  20. Factors mediating plastid dependency and the origins of parasitism in apicomplexans and their close relatives

    PubMed Central

    Janouškovec, Jan; Tikhonenkov, Denis V.; Burki, Fabien; Howe, Alexis T.; Kolísko, Martin; Mylnikov, Alexander P.; Keeling, Patrick J.


    Apicomplexans are a major lineage of parasites, including causative agents of malaria and toxoplasmosis. How such highly adapted parasites evolved from free-living ancestors is poorly understood, particularly because they contain nonphotosynthetic plastids with which they have a complex metabolic dependency. Here, we examine the origin of apicomplexan parasitism by resolving the evolutionary distribution of several key characteristics in their closest free-living relatives, photosynthetic chromerids and predatory colpodellids. Using environmental sequence data, we describe the diversity of these apicomplexan-related lineages and select five species that represent this diversity for transcriptome sequencing. Phylogenomic analysis recovered a monophyletic lineage of chromerids and colpodellids as the sister group to apicomplexans, and a complex distribution of retention versus loss for photosynthesis, plastid genomes, and plastid organelles. Reconstructing the evolution of all plastid and cytosolic metabolic pathways related to apicomplexan plastid function revealed an ancient dependency on plastid isoprenoid biosynthesis, predating the divergence of apicomplexan and dinoflagellates. Similarly, plastid genome retention is strongly linked to the retention of two genes in the plastid genome, sufB and clpC, altogether suggesting a relatively simple model for plastid retention and loss. Lastly, we examine the broader distribution of a suite of molecular characteristics previously linked to the origins of apicomplexan parasitism and find that virtually all are present in their free-living relatives. The emergence of parasitism may not be driven by acquisition of novel components, but rather by loss and modification of the existing, conserved traits. PMID:25717057

  1. Mechanical loading induces the expression of a Pol I regulon at the onset of skeletal muscle hypertrophy.


    von Walden, Ferdinand; Casagrande, Vandre; Östlund Farrants, Ann-Kristin; Nader, Gustavo A


    The main goal of the present study was to investigate the regulation of ribosomal DNA (rDNA) gene transcription at the onset of skeletal muscle hypertrophy. Mice were subjected to functional overload of the plantaris by bilateral removal of the synergist muscles. Mechanical loading resulted in muscle hypertrophy with an increase in rRNA content. rDNA transcription, as determined by 45S pre-rRNA abundance, paralleled the increase in rRNA content and was consistent with the onset of the hypertrophic response. Increased transcription and protein expression of c-Myc and its downstream polymerase I (Pol I) regulon (POL1RB, TIF-1A, PAF53, TTF1, TAF1C) was also consistent with the increase in rRNA. Similarly, factors involved in rDNA transcription, such as the upstream binding factor and the Williams syndrome transcription factor, were induced by mechanical loading in a corresponding temporal fashion. Chromatin immunoprecipitation revealed that these factors, together with Pol I, were enriched at the rDNA promoter. This, in addition to an increase in histone H3 lysine 9 acetylation, demonstrates that mechanical loading regulates rRNA synthesis by inducing a gene expression program consisting of a Pol I regulon, together with accessory factors involved in transcription and chromatin remodeling at the rDNA promoter. Altogether, these data indicate that transcriptional and epigenetic mechanisms take place in the regulation of ribosome production at the onset of muscle hypertrophy.

  2. Protein trafficking in apicomplexan parasites: crossing the vacuolar Rubicon.


    Haldar, Kasturi


    Although apicomplexans like the blood stages of Plasmodium and the actively replicating 'tachyzoite' stage of Toxoplasma infect very dissimilar host cells, recent studies suggest they share molecular commonalities amongst differences at the parasitophorous vacuolar membrane (PVM) surrounding these intracellular parasites. A protein translocation export (PTEX) complex in the PVM of Plasmodium, is functionally informed by findings in Toxoplasma. Lipids play a role in trafficking to and across the PVM. Toxoplasma exploit an orthologue of a plasmodial secretory aspartyl protease but substrate cleavage yields a signal for targeting to the PVM, rather than directly to the host cell. The studies significantly advance understanding of how trafficking to and across the host-pathogen PVM boundary induces virulence and disease in different host milieu.

  3. How Apicomplexan Parasites Move In and Out of Cells

    PubMed Central

    Sibley, L. David


    Summary Apicomplexan parasites utilize a unique form of “gliding motility” to traverse across substrates, migrate through tissues, and invade into and finally egress from their vertebrate host cells. Parasite gliding relies on the tread milling of surface adhesins linked to short actin filaments that are translocated rearward by a stationary small myosin motor. New details reveal mechanistic insight into the coordinated release and processing of adhesins, the complexity of adhesin-substrate interactions, the regulation of the actin-myosin motor complex, and the formation of a novel junction at the host-parasite interface. These activities are carefully orchestrated to provide an efficient process for motility that is essential for parasite survival. The parasite-specific nature of many of these steps reveals several essential points that may be targeted for intervention. PMID:20580218

  4. Antimicrobial peptides activate the Rcs regulon through the outer membrane lipoprotein RcsF.


    Farris, Carol; Sanowar, Sarah; Bader, Martin W; Pfuetzner, Richard; Miller, Samuel I


    Salmonella enterica species are exposed to envelope stresses due to their environmental and infectious lifestyles. Such stresses include amphipathic cationic antimicrobial peptides (CAMPs), and resistance to these peptides is an important property for microbial virulence for animals. Bacterial mechanisms used to sense and respond to CAMP-induced envelope stress include the RcsFCDB phosphorelay, which contributes to survival from polymyxin B exposure. The Rcs phosphorelay includes two inner membrane (IM) proteins, RcsC and RcsD; the response regulator RcsB; the accessory coregulator RcsA; and an outer membrane bound lipoprotein, RcsF. Transcriptional activation of the Rcs regulon occurred within minutes of exposure to CAMP and during the first detectable signs of CAMP-induced membrane disorder. Rcs transcriptional activation by CAMPs required RcsF and preservation of its two internal disulfide linkages. The rerouting of RcsF to the inner membrane or its synthesis as an unanchored periplasmic protein resulted in constitutive activation of the Rcs regulon and RcsCD-dependent phosphorylation. These findings suggest that RcsFCDB activation in response to CAMP-induced membrane disorder is a result of a change in structure or availability of RcsF to the IM signaling constituents of the Rcs phosphorelay.

  5. Comparative genomics of the KdgR regulon in Erwinia chrysanthemi 3937 and other gamma-proteobacteria.


    Rodionov, Dmitry A; Gelfand, Mikhail S; Hugouvieux-Cotte-Pattat, Nicole


    In the plant-pathogenic enterobacterium Erwinia chrysanthemi, almost all known genes involved in pectin catabolism are controlled by the transcriptional regulator KdgR. In this study, the comparative genomics approach was used to analyse the KdgR regulon in completely sequenced genomes of eight enterobacteria, including Erw. chrysanthemi, and two Vibrio species. Application of a signal recognition procedure complemented by operon structure and protein sequence analysis allowed identification of new candidate genes of the KdgR regulon. Most of these genes were found to be controlled by the cAMP-receptor protein, a global regulator of catabolic genes. At the next step, regulation of these genes in Erw. chrysanthemi was experimentally verified using in vivo transcriptional fusions and an attempt was made to clarify the functional role of the predicted genes in pectin catabolism. Interestingly, it was found that the KdgR protein, previously known as a repressor, positively regulates expression of two new members of the regulon, phosphoenolpyruvate synthase gene ppsA and an adjacent gene, ydiA, of unknown function. Other predicted regulon members, namely chmX, dhfX, gntB, pykF, spiX, sotA, tpfX, yeeO and yjgK, were found to be subject to classical negative regulation by KdgR. Possible roles of newly identified members of the Erw. chrysanthemi KdgR regulon, chmX, dhfX, gntDBMNAC, spiX, tpfX, ydiA, yeeO, ygjV and yjgK, in pectin catabolism are discussed. Finally, complete reconstruction of the KdgR regulons in various gamma-proteobacteria yielded a metabolic map reflecting a globally conserved pathway for the catabolism of pectin and its derivatives with variability in transport and enzymic capabilities among species. In particular, possible non-orthologous substitutes of isomerase KduI and a new oligogalacturonide transporter in the Vibrio species were detected.

  6. Distinct molecular mechanisms involved in carbon catabolite repression of the arabinose regulon in Bacillus subtilis.


    Inácio, José Manuel; Costa, Carla; de Sá-Nogueira, Isabel


    The Bacillus subtilis proteins involved in the utilization of L-arabinose are encoded by the araABDLMNPQ-abfA metabolic operon and by the araE/araR divergent unit. Transcription from the ara operon, araE transport gene and araR regulatory gene is induced by L-arabinose and negatively controlled by AraR. Additionally, expression of both the ara operon and the araE gene is regulated at the transcriptional level by glucose repression. Here, by transcriptional fusion analysis in different mutant backgrounds, it is shown that CcpA most probably complexed with HPr-Ser46-P plays the major role in carbon catabolite repression of the ara regulon by glucose and glycerol. Site-directed mutagenesis and deletion analysis indicate that two catabolite responsive elements (cres) present in the ara operon (cre araA and cre araB) and one cre in the araE gene (cre araE) are implicated in this mechanism. Furthermore, cre araA located between the promoter region of the ara operon and the araA gene, and cre araB placed 2 kb downstream within the araB gene are independently functional and both contribute to glucose repression. In Northern blot analysis, in the presence of glucose, a CcpA-dependent transcript consistent with a message stopping at cre araB was detected, suggesting that transcription 'roadblocking' of RNA polymerase elongation is the most likely mechanism operating in this system. Glucose exerts an additional repression of the ara regulon, which requires a functional araR.

  7. RpfF-dependent regulon of Xylella fastidiosa.


    Wang, Nian; Li, Jian-Liang; Lindow, Steven E


    ABSTRACT Xylella fastidiosa regulates traits important to both virulence of grape as well as colonization of sharpshooter vectors via its production of a fatty acid signal molecule known as DSF whose production is dependent on rpfF. Although X. fastidiosa rpfF mutants exhibit increased virulence to plants, they are unable to be spread from plant to plant by insect vectors. To gain more insight into the traits that contribute to these processes, a whole-genome Agilent DNA microarray for this species was developed and used to determine the RpfF-dependent regulon by transcriptional profiling. In total, 446 protein coding genes whose expression was significantly different between the wild type and an rpfF mutant (false discovery rate < 0.05) were identified when cells were grown in PW liquid medium. Among them, 165 genes were downregulated in the rpfF mutant compared with the wild-type strain whereas 281 genes were over-expressed. RpfF function was required for regulation of 11 regulatory and σ factors, including rpfE, yybA, PD1177, glnB, rpfG, PD0954, PD0199, PD2050, colR, rpoH, and rpoD. In general, RpfF is required for regulation of genes involved in attachment and biofilm formation, enhancing expression of hemagglutinin genes hxfA and hxfB, and suppressing most type IV pili and gum genes. A large number of other RpfF-dependent genes that might contribute to virulence or insect colonization were also identified such as those encoding hemolysin and colicin V, as well as genes with unknown functions.

  8. Divergence of the SigB regulon and pathogenesis of the Bacillus cereus sensu lato group

    PubMed Central


    Background The Bacillus cereus sensu lato group currently includes seven species (B. cereus, B. anthracis, B. mycoides, B. pseudomycoides, B. thuringiensis, B. weihenstephanensis and B. cytotoxicus) that recent phylogenetic and phylogenomic analyses suggest are likely a single species, despite their varied phenotypes. Although horizontal gene transfer and insertion-deletion events are clearly important for promoting divergence among these genomes, recent studies have demonstrated that a major basis for phenotypic diversity in these organisms may be differential regulation of the highly similar gene content shared by these organisms. To explore this hypothesis, we used an in silico approach to evaluate the relationship of pathogenic potential and the divergence of the SigB-dependent general stress response within the B. cereus sensu lato group, since SigB has been demonstrated to support pathogenesis in Bacillus, Listeria and Staphylococcus species. Results During the divergence of these organisms from a common “SigB-less” ancestor, the placement of SigB promoters at varied locations in the B. cereus sensu lato genomes predict alternative structures for the SigB regulon in different organisms. Predicted promoter changes suggesting differential transcriptional control of a common gene pool predominate over evidence of indels or horizontal gene transfer for explaining SigB regulon divergence. Conclusions Four lineages of the SigB regulon have arisen that encompass different gene contents and suggest different strategies for supporting pathogenesis. This is consistent with the hypothesis that divergence within the B. cereus sensu lato group rests in part on alternative strategies for regulation of a common gene pool. PMID:23088190

  9. A comparison of the low temperature transcriptomes and CBF regulons of three plant species that differ in freezing tolerance: Solanum commersonii, Solanum tuberosum, and Arabidopsis thaliana

    PubMed Central

    Pino, María-Teresa; Jeknić, Zoran; Zou, Cheng; Shiu, Shin-Han; Chen, Tony H. H.; Thomashow, Michael F.


    Solanum commersonii and Solanum tuberosum are closely related plant species that differ in their abilities to cold acclimate; whereas S. commersonii increases in freezing tolerance in response to low temperature, S. tuberosum does not. In Arabidopsis thaliana, cold-regulated genes have been shown to contribute to freezing tolerance, including those that comprise the CBF regulon, genes that are controlled by the CBF transcription factors. The low temperature transcriptomes and CBF regulons of S. commersonii and S. tuberosum were therefore compared to determine whether there might be differences that contribute to their differences in ability to cold acclimate. The results indicated that both plants alter gene expression in response to low temperature to similar degrees with similar kinetics and that both plants have CBF regulons composed of hundreds of genes. However, there were considerable differences in the sets of genes that comprised the low temperature transcriptomes and CBF regulons of the two species. Thus differences in cold regulatory programmes may contribute to the differences in freezing tolerance of these two species. However, 53 groups of putative orthologous genes that are cold-regulated in S. commersonii, S. tuberosum, and A. thaliana were identified. Given that the evolutionary distance between the two Solanum species and A. thaliana is 112–156 million years, it seems likely that these conserved cold-regulated genes—many of which encode transcription factors and proteins of unknown function—have fundamental roles in plant growth and development at low temperature. PMID:21511909

  10. A comparison of the low temperature transcriptomes and CBF regulons of three plant species that differ in freezing tolerance: Solanum commersonii, Solanum tuberosum, and Arabidopsis thaliana.


    Carvallo, Marcela A; Pino, María-Teresa; Jeknic, Zoran; Zou, Cheng; Doherty, Colleen J; Shiu, Shin-Han; Chen, Tony H H; Thomashow, Michael F


    Solanum commersonii and Solanum tuberosum are closely related plant species that differ in their abilities to cold acclimate; whereas S. commersonii increases in freezing tolerance in response to low temperature, S. tuberosum does not. In Arabidopsis thaliana, cold-regulated genes have been shown to contribute to freezing tolerance, including those that comprise the CBF regulon, genes that are controlled by the CBF transcription factors. The low temperature transcriptomes and CBF regulons of S. commersonii and S. tuberosum were therefore compared to determine whether there might be differences that contribute to their differences in ability to cold acclimate. The results indicated that both plants alter gene expression in response to low temperature to similar degrees with similar kinetics and that both plants have CBF regulons composed of hundreds of genes. However, there were considerable differences in the sets of genes that comprised the low temperature transcriptomes and CBF regulons of the two species. Thus differences in cold regulatory programmes may contribute to the differences in freezing tolerance of these two species. However, 53 groups of putative orthologous genes that are cold-regulated in S. commersonii, S. tuberosum, and A. thaliana were identified. Given that the evolutionary distance between the two Solanum species and A. thaliana is 112-156 million years, it seems likely that these conserved cold-regulated genes-many of which encode transcription factors and proteins of unknown function-have fundamental roles in plant growth and development at low temperature.

  11. RegulonDB v8.0: omics data sets, evolutionary conservation, regulatory phrases, cross-validated gold standards and more

    PubMed Central

    Salgado, Heladia; Peralta-Gil, Martin; Gama-Castro, Socorro; Santos-Zavaleta, Alberto; Muñiz-Rascado, Luis; García-Sotelo, Jair S.; Weiss, Verena; Solano-Lira, Hilda; Martínez-Flores, Irma; Medina-Rivera, Alejandra; Salgado-Osorio, Gerardo; Alquicira-Hernández, Shirley; Alquicira-Hernández, Kevin; López-Fuentes, Alejandra; Porrón-Sotelo, Liliana; Huerta, Araceli M.; Bonavides-Martínez, César; Balderas-Martínez, Yalbi I.; Pannier, Lucia; Olvera, Maricela; Labastida, Aurora; Jiménez-Jacinto, Verónica; Vega-Alvarado, Leticia; del Moral-Chávez, Victor; Hernández-Alvarez, Alfredo; Morett, Enrique; Collado-Vides, Julio


    This article summarizes our progress with RegulonDB ( during the past 2 years. We have kept up-to-date the knowledge from the published literature regarding transcriptional regulation in Escherichia coli K-12. We have maintained and expanded our curation efforts to improve the breadth and quality of the encoded experimental knowledge, and we have implemented criteria for the quality of our computational predictions. Regulatory phrases now provide high-level descriptions of regulatory regions. We expanded the assignment of quality to various sources of evidence, particularly for knowledge generated through high-throughput (HT) technology. Based on our analysis of most relevant methods, we defined rules for determining the quality of evidence when multiple independent sources support an entry. With this latest release of RegulonDB, we present a new highly reliable larger collection of transcription start sites, a result of our experimental HT genome-wide efforts. These improvements, together with several novel enhancements (the tracks display, uploading format and curational guidelines), address the challenges of incorporating HT-generated knowledge into RegulonDB. Information on the evolutionary conservation of regulatory elements is also available now. Altogether, RegulonDB version 8.0 is a much better home for integrating knowledge on gene regulation from the sources of information currently available. PMID:23203884

  12. In silico discovery of the dormancy regulons in a number of Actinobacteria genomes

    SciTech Connect

    Gerasimova, Anna; Dubchak, Inna; Arkin, Adam; Gelfand, Mikhail


    Mycobacterium tuberculosis is a dangerous Actinobacteria infecting nearly one third of the human population. It becomes dormant and phenotypically drug resistant in response to stresses. An important feature of the M. tuberculosis pathogenesis is the prevalence of latent infection without disease, making understanding of the mechanisms used by the bacteria to exist in this state and to switch to metabolically active infectious form a vital problem to consider. M. tuberculosis dormancy is regulated by the three-component regulatory system of two kinases (DosT and DevS) and transcriprional regulator (DevR). DevR activates transcription of a set of genes, which allow the bacteria to survive long periods of anaerobiosis, and may be important for long-term survival within the host during latent infection. The DevR-regulon is studied experimentally in M. tuberculosis and few other phylogenetically close Mycobacteria spp. As many other two-component systems, the devRS operon is autoregulated. However, the mechanism of the dormancy is not completely clear even for these bacteria and there is no data describing the dormancy regulons in other species.

  13. The apicomplexan glideosome and adhesins -- structures and function

    PubMed Central

    Boucher, Lauren E.; Bosch, Jürgen


    The apicomplexan family of pathogens, which includes Plasmodium spp. and Toxoplasma gondii, are primarily obligate intracellular parasites and invade multiple cell types. These parasites express extracellular membrane protein receptors, adhesins, to form specific pathogen-host cell interaction complexes. Various adhesins are used to invade a variety of cell types. The receptors are linked to an actomyosin motor, which is part of a complex comprised of many proteins known as the invasion machinery or glideosome. To date, reviews on invasion have focused primarily on the molecular pathways and signals of invasion, with little or no structural information presented. Over 75 structures of parasite receptors and glideosome proteins have been deposited with the Protein Data Bank. These structures include adhesins, motor proteins, bridging proteins, inner membrane complex and cytoskeletal proteins, as well as co-crystal structures with peptides and antibodies. These structures provide information regarding key interactions necessary for target receptor engagement, machinery complex formation, how force is transmitted, and the basis of inhibitory antibodies. Additionally, these structures can provide starting points for the development of antibodies and inhibitory molecules targeting protein-protein interactions, with the aim to inhibit invasion. This review provides an overview of the parasite adhesin protein families, the glideosome components, glideosome architecture, and discuss recent work regarding alternative models. PMID:25764948

  14. Eimeripain, a cathepsin B-like cysteine protease, expressed throughout sporulation of the apicomplexan parasite Eimeria tenella.


    Rieux, Anaïs; Gras, Simon; Lecaille, Fabien; Niepceron, Alisson; Katrib, Marilyn; Smith, Nicholas C; Lalmanach, Gilles; Brossier, Fabien


    The invasion and replication of Eimeria tenella in the chicken intestine is responsible for avian coccidiosis, a disease that has major economic impacts on poultry industries worldwide. E. tenella is transmitted to naïve animals via shed unsporulated oocysts that need contact with air and humidity to form the infectious sporulated oocysts, which contain the first invasive form of the parasite, the sporozoite. Cysteine proteases (CPs) are major virulence factors expressed by protozoa. In this study, we show that E. tenella expresses five transcriptionally regulated genes encoding one cathepsin L, one cathepsin B and three cathepsin Cs. Biot-LC-LVG-CHN₂, a cystatin derived probe, tagged eight polypeptides in unsporulated oocysts but only one in sporulated oocysts. CP-dependant activities were found against the fluorescent substrates, Z-FR-AMC and Z-LR-AMC, throughout the sporulation process. These activities corresponded to a cathepsin B-like enzyme since they were inhibited by CA-074, a specific cathepsin B inhibitor. A 3D model of the catalytic domain of the cathepsin B-like protease, based on its sequence homology with human cathepsin B, further confirmed its classification as a papain-like protease with similar characteristics to toxopain-1 from the related apicomplexan parasite, Toxoplasma gondii; we have, therefore, named the E. tenella cathepsin B, eimeripain. Following stable transfection of E. tenella sporozoites with a plasmid allowing the expression of eimeripain fused to the fluorescent protein mCherry, we demonstrated that eimeripain is detected throughout sporulation and has a punctate distribution in the bodies of extra- and intracellular parasites. Furthermore, CA-074 Me, the membrane-permeable derivative of CA-074, impairs invasion of epithelial MDBK cells by E. tenella sporozoites. This study represents the first characterization of CPs expressed by a parasite from the Eimeria genus. Moreover, it emphasizes the role of CPs in transmission and

  15. Genome-wide mapping of TnrA-binding sites provides new insights into the TnrA regulon in Bacillus subtilis.


    Mirouze, Nicolas; Bidnenko, Elena; Noirot, Philippe; Auger, Sandrine


    Under nitrogen limitation conditions, Bacillus subtilis induces a sophisticated network of adaptation responses. More precisely, the B. subtilis TnrA regulator represses or activates directly or indirectly the expression of a hundred genes in response to nitrogen availability. The global TnrA regulon have already been identified among which some directly TnrA-regulated genes have been characterized. However, a genome-wide mapping of in vivo TnrA-binding sites was still needed to clearly define the set of genes directly regulated by TnrA. Using chromatin immunoprecipitation coupled with hybridization to DNA tiling arrays (ChIP-on-chip), we now provide in vivo evidence that TnrA reproducibly binds to 42 regions on the chromosome. Further analysis with real-time in vivo transcriptional profiling, combined with results from previous reports, allowed us to define the TnrA primary regulon. We identified 35 promoter regions fulfilling three criteria necessary to be part of this primary regulon: (i) TnrA binding in ChIP-on-chip experiments and/or in previous in vitro studies; (ii) the presence of a TnrA box; (iii) TnrA-dependent expression regulation. In addition, the TnrA primary regulon delimitation allowed us to improve the TnrA box consensus. Finally, our results reveal new interconnections between the nitrogen regulatory network and other cellular processes.



    Sikkel, Paul; Renoux, Lance P; Dolan, Maureen; Smit, Nico; Cook, Courtney


    Apicomplexan parasites are obligate parasites of many species of vertebrates. To date, there is very limited understanding of these parasites in the most diverse group of vertebrates, actinopterygian fishes. While DNA barcoding targeting the eukaryotic 18S small subunit (SSU) rRNA gene sequence has been useful in identifying apicomplexans in tetrapods, identification of apicomplexans infecting fishes has relied solely on morphological identification by microscopy. In this study, a DNA barcoding method was developed that targets the 18S rRNA gene primers for identification apicomplexans parasitizing certain actinopterygian fishes. A lead primer set was selected showing no cross reactivity to the overwhelming abundant host DNA and successfully confirmed 34 of the 41 (82.9%) microscopically verified parasitized fish blood samples analyzed in this study. Furthermore, this DNA barcoding method identified four additional samples that screened negative for parasitemia suggesting this molecular method may provide improved sensitivity over morphological characterization by microscopy. In addition, this PCR screening method for fish apicomplexans using Whatman FTA preserved DNA was tested in efforts leading to a more simplified field collection, transport and sample storage method as well as a streamlining sample processing important for DNA barcoding large sample sets.

  17. A chemical potentiator of copper-accumulation used to investigate the iron-regulons of Saccharomyces cerevisiae

    PubMed Central

    Foster, Andrew W; Dainty, Samantha J; Patterson, Carl J; Pohl, Ehmke; Blackburn, Hannah; Wilson, Clare; Hess, Corinna R; Rutherford, Julian C; Quaranta, Laura; Corran, Andy; Robinson, Nigel J


    The extreme resistance of Saccharomyces cerevisiae to copper is overcome by 2-(6-benzyl-2-pyridyl)quinazoline (BPQ), providing a chemical-biology tool which has been exploited in two lines of discovery. First, BPQ is shown to form a red (BPQ)2Cu(I) complex and promote Ctr1-independent copper-accumulation in whole cells and in mitochondria isolated from treated cells. Multiple phenotypes, including loss of aconitase activity, are consistent with copper-BPQ mediated damage to mitochondrial iron–sulphur clusters. Thus, a biochemical basis of copper-toxicity in S. cerevisiae is analogous to other organisms. Second, iron regulons controlled by Aft1/2, Cth2 and Yap5 that respond to mitochondrial iron–sulphur cluster status are modulated by copper-BPQ causing iron hyper-accumulation via upregulated iron-import. Comparison of copper-BPQ treated, untreated and copper-only treated wild-type and fra2Δ by RNA-seq has uncovered a new candidate Aft1 target-gene (LSO1) and paralogous non-target (LSO2), plus nine putative Cth2 target-transcripts. Two lines of evidence confirm that Fra2 dominates basal repression of the Aft1/2 regulons in iron-replete cultures. Fra2-independent control of these regulons is also observed but CTH2 itself appears to be atypically Fra2-dependent. However, control of Cth2-target transcripts which is independent of CTH2 transcript abundance or of Fra2, is also quantified. Use of copper-BPQ supports a substantial contribution of metabolite repression to iron-regulation. PMID:24895027

  18. Protococcidian Eleutheroschizon duboscqi, an Unusual Apicomplexan Interconnecting Gregarines and Cryptosporidia.


    Valigurová, Andrea; Paskerova, Gita G; Diakin, Andrei; Kováčiková, Magdaléna; Simdyanov, Timur G


    -evaluation of epicellular development in other apicomplexans and directly compares their niche with that of E. duboscqi.

  19. Protococcidian Eleutheroschizon duboscqi, an Unusual Apicomplexan Interconnecting Gregarines and Cryptosporidia

    PubMed Central

    Valigurová, Andrea; Paskerova, Gita G.; Diakin, Andrei; Kováčiková, Magdaléna; Simdyanov, Timur G.


    -evaluation of epicellular development in other apicomplexans and directly compares their niche with that of E. duboscqi. PMID:25915503

  20. DosR-regulon genes induction in Mycobacterium bovis BCG under aerobic conditions.


    Flores Valdez, Mario Alberto; Schoolnik, Gary K


    In this report we demonstrated that under aerobic conditions, Mycobacterium bovis BCG expressing an hsp60-driven second copy of the hypoxia-related transcriptional regulator DosR increased 2-fold or greater the expression of 38 out of the 48 genes belonging to the DosR regulon, including the latency antigens Rv1733c, Rv2029, Rv2627, and Rv2628. Expression of DosR under these conditions slightly delayed in vitro growth, but did not promote a non-replicating state as opposed to microaerobic and hypoxic adaptation. Our results suggest BCG producing DosR can be cultured under standard in vitro conditions, allowing evaluation of this strain as a latency-specific vaccine candidate.

  1. Cationic amino acid transporters play key roles in the survival and transmission of apicomplexan parasites

    PubMed Central

    Rajendran, Esther; Hapuarachchi, Sanduni V.; Miller, Catherine M.; Fairweather, Stephen J.; Cai, Yeping; Smith, Nicholas C.; Cockburn, Ian A.; Bröer, Stefan; Kirk, Kiaran; van Dooren, Giel G.


    Apicomplexans are obligate intracellular parasites that scavenge essential nutrients from their hosts via transporter proteins on their plasma membrane. The identities of the transporters that mediate amino acid uptake into apicomplexans are unknown. Here we demonstrate that members of an apicomplexan-specific protein family—the Novel Putative Transporters (NPTs)—play key roles in the uptake of cationic amino acids. We show that an NPT from Toxoplasma gondii (TgNPT1) is a selective arginine transporter that is essential for parasite survival and virulence. We also demonstrate that a homologue of TgNPT1 from the malaria parasite Plasmodium berghei (PbNPT1), shown previously to be essential for the sexual gametocyte stage of the parasite, is a cationic amino acid transporter. This reveals a role for cationic amino acid scavenging in gametocyte biology. Our study demonstrates a critical role for amino acid transporters in the survival, virulence and life cycle progression of these parasites. PMID:28205520

  2. Vitamin and co-factor biosynthesis pathways in Plasmodium and other apicomplexan parasites

    PubMed Central

    Müller, Sylke; Kappes, Barbara


    Vitamins are essential components of the human diet. By contrast, the malaria parasite Plasmodium falciparum and related apicomplexan parasites synthesise certain vitamins, de novo, either completely or in parts. The occurrence of the various biosynthesis pathways is specific to different apicomplexan parasites, emphasising their distinct requirements for nutrients and growth factors. The absence of vitamin biosynthesis from the human host implies that inhibition of the parasite pathways may be a way to interfere specifically with parasite development. However, the precise role of biosynthesis and potential uptake of vitamins for the overall regulation of vitamin homeostasis in the parasites needs to be established first. In this review Sylke Müller and Barbara Kappes focus mainly on the procurement of vitamin B1, B5 and B6 by Plasmodium and other apicomplexan parasites. PMID:17276140

  3. Vitamin and cofactor biosynthesis pathways in Plasmodium and other apicomplexan parasites.


    Müller, Sylke; Kappes, Barbara


    Vitamins are essential components of the human diet. By contrast, the malaria parasite Plasmodium falciparum and related apicomplexan parasites synthesize certain vitamins de novo, either completely or in parts. The various biosynthesis pathways are specific to different apicomplexan parasites and emphasize the distinct requirements of these parasites for nutrients and growth factors. The absence of vitamin biosynthesis in humans implies that inhibition of the parasite pathways might be a way to interfere specifically with parasite development. However, the roles of biosynthesis and uptake of vitamins in the regulation of vitamin homeostasis in parasites needs to be established first. In this article, the procurement of vitamins B(1), B(5) and B(6) by Plasmodium and other apicomplexan parasites is discussed.

  4. Cationic amino acid transporters play key roles in the survival and transmission of apicomplexan parasites.


    Rajendran, Esther; Hapuarachchi, Sanduni V; Miller, Catherine M; Fairweather, Stephen J; Cai, Yeping; Smith, Nicholas C; Cockburn, Ian A; Bröer, Stefan; Kirk, Kiaran; van Dooren, Giel G


    Apicomplexans are obligate intracellular parasites that scavenge essential nutrients from their hosts via transporter proteins on their plasma membrane. The identities of the transporters that mediate amino acid uptake into apicomplexans are unknown. Here we demonstrate that members of an apicomplexan-specific protein family-the Novel Putative Transporters (NPTs)-play key roles in the uptake of cationic amino acids. We show that an NPT from Toxoplasma gondii (TgNPT1) is a selective arginine transporter that is essential for parasite survival and virulence. We also demonstrate that a homologue of TgNPT1 from the malaria parasite Plasmodium berghei (PbNPT1), shown previously to be essential for the sexual gametocyte stage of the parasite, is a cationic amino acid transporter. This reveals a role for cationic amino acid scavenging in gametocyte biology. Our study demonstrates a critical role for amino acid transporters in the survival, virulence and life cycle progression of these parasites.

  5. The iron stimulon and fur regulon of Geobacter sulfurreducens and their role in energy metabolism.


    Embree, Mallory; Qiu, Yu; Shieu, Wendy; Nagarajan, Harish; O'Neil, Regina; Lovley, Derek; Zengler, Karsten


    Iron plays a critical role in the physiology of Geobacter species. It serves as both an essential component for proteins and cofactors and an electron acceptor during anaerobic respiration. Here, we investigated the iron stimulon and ferric uptake regulator (Fur) regulon of Geobacter sulfurreducens to examine the coordination between uptake of Fe(II) and the reduction of Fe(III) at the transcriptional level. Gene expression studies across a variety of different iron concentrations in both the wild type and a Δfur mutant strain were used to determine the iron stimulon. The stimulon consists of a broad range of gene products, ranging from iron-utilizing to central metabolism and iron reduction proteins. Integration of gene expression and chromatin immunoprecipitation (ChIP) data sets assisted in the identification of the Fur transcriptional regulatory network and Fur's role as a regulator of the iron stimulon. Additional physiological and transcriptional analyses of G. sulfurreducens grown with various Fe(II) concentrations revealed the depth of Fur's involvement in energy metabolism and the existence of redundancy within the iron-regulatory network represented by IdeR, an alternative iron transcriptional regulator. These characteristics enable G. sulfurreducens to thrive in environments with fluctuating iron concentrations by providing it with a robust mechanism to maintain tight and deliberate control over intracellular iron homeostasis.

  6. The Pho regulon: a huge regulatory network in bacteria

    PubMed Central

    Santos-Beneit, Fernando


    One of the most important achievements of bacteria is its capability to adapt to the changing conditions of the environment. The competition for nutrients with other microorganisms, especially in the soil, where nutritional conditions are more variable, has led bacteria to evolve a plethora of mechanisms to rapidly fine-tune the requirements of the cell. One of the essential nutrients that are normally found in low concentrations in nature is inorganic phosphate (Pi). Bacteria, as well as other organisms, have developed several systems to cope for the scarcity of this nutrient. To date, the unique mechanism responding to Pi starvation known in detail is the Pho regulon, which is normally controlled by a two component system and constitutes one of the most sensible and efficient regulatory mechanisms in bacteria. Many new members of the Pho regulon have emerged in the last years in several bacteria; however, there are still many unknown questions regarding the activation and function of the whole system. This review describes the most important findings of the last three decades in relation to Pi regulation in bacteria, including: the PHO box, the Pi signaling pathway and the Pi starvation response. The role of the Pho regulon in nutritional regulation cross-talk, secondary metabolite production, and pathogenesis is discussed in detail. PMID:25983732

  7. A Genome-wide CRISPR Screen in Toxoplasma Identifies Essential Apicomplexan Genes.


    Sidik, Saima M; Huet, Diego; Ganesan, Suresh M; Huynh, My-Hang; Wang, Tim; Nasamu, Armiyaw S; Thiru, Prathapan; Saeij, Jeroen P J; Carruthers, Vern B; Niles, Jacquin C; Lourido, Sebastian


    Apicomplexan parasites are leading causes of human and livestock diseases such as malaria and toxoplasmosis, yet most of their genes remain uncharacterized. Here, we present the first genome-wide genetic screen of an apicomplexan. We adapted CRISPR/Cas9 to assess the contribution of each gene from the parasite Toxoplasma gondii during infection of human fibroblasts. Our analysis defines ∼200 previously uncharacterized, fitness-conferring genes unique to the phylum, from which 16 were investigated, revealing essential functions during infection of human cells. Secondary screens identify as an invasion factor the claudin-like apicomplexan microneme protein (CLAMP), which resembles mammalian tight-junction proteins and localizes to secretory organelles, making it critical to the initiation of infection. CLAMP is present throughout sequenced apicomplexan genomes and is essential during the asexual stages of the malaria parasite Plasmodium falciparum. These results provide broad-based functional information on T. gondii genes and will facilitate future approaches to expand the horizon of antiparasitic interventions.

  8. Apical membrane antigen 1 mediates apicomplexan parasite attachment but is dispensable for host cell invasion

    PubMed Central

    Bargieri, Daniel Y.; Andenmatten, Nicole; Lagal, Vanessa; Thiberge, Sabine; Whitelaw, Jamie A.; Tardieux, Isabelle; Meissner, Markus; Ménard, Robert


    Apicomplexan parasites invade host cells by forming a ring-like junction with the cell surface and actively sliding through the junction inside an intracellular vacuole. Apical membrane antigen 1 is conserved in apicomplexans and a long-standing malaria vaccine candidate. It is considered to have multiple important roles during host cell penetration, primarily in structuring the junction by interacting with the rhoptry neck 2 protein and transducing the force generated by the parasite motor during internalization. Here, we generate Plasmodium sporozoites and merozoites and Toxoplasma tachyzoites lacking apical membrane antigen 1, and find that the latter two are impaired in host cell attachment but the three display normal host cell penetration through the junction. Therefore, apical membrane antigen 1, rather than an essential invasin, is a dispensable adhesin of apicomplexan zoites. These genetic data have implications on the use of apical membrane antigen 1 or the apical membrane antigen 1–rhoptry neck 2 interaction as targets of intervention strategies against malaria or other diseases caused by apicomplexans. PMID:24108241

  9. Genome Sequence of Babesia bovis and Camparative Analysis of Apicomplexan Hemoprotozoa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Babesia bovis is an apicomplexan tick-transmitted pathogen of cattle imposing a global risk and severe constraints to livestock health and economic development. The complete genome sequence was undertaken to facilitate vaccine antigen discovery, and to allow for comparative analysis with the related...

  10. Effect of database drift on network topology and enrichment analyses: a case study for RegulonDB

    PubMed Central

    Muskhelishvili, Georgi; Hütt, Marc-Thorsten


    RegulonDB is a database storing the biological information behind the transcriptional regulatory network (TRN) of the bacterium Escherichia coli. It is one of the key bioinformatics resources for Systems Biology investigations of bacterial gene regulation. Like most biological databases, the content drifts with time, both due to the accumulation of new information and due to refinements in the underlying biological concepts. Conclusions based on previous database versions may no longer hold. Here, we study the change of some topological properties of the TRN of E. coli, as provided by RegulonDB across 16 versions, as well as a simple index, digital control strength, quantifying the match between gene expression profiles and the transcriptional regulatory networks. While many of network characteristics change dramatically across the different versions, the digital control strength remains rather robust and in tune with previous results for this index. Our study shows that: (i) results derived from network topology should, when possible, be studied across a range of database versions, before detailed biological conclusions are derived, and (ii) resorting to simple indices, when interpreting high-throughput data from a network perspective, may help achieving a robustness of the findings against variation of the underlying biological information. Database URL: PMID:26980514

  11. Effect of database drift on network topology and enrichment analyses: a case study for RegulonDB.


    Beber, Moritz E; Muskhelishvili, Georgi; Hütt, Marc-Thorsten


    RegulonDB is a database storing the biological information behind the transcriptional regulatory network (TRN) of the bacterium Escherichia coli. It is one of the key bioinformatics resources for Systems Biology investigations of bacterial gene regulation. Like most biological databases, the content drifts with time, both due to the accumulation of new information and due to refinements in the underlying biological concepts. Conclusions based on previous database versions may no longer hold. Here, we study the change of some topological properties of the TRN of E. coli, as provided by RegulonDB across 16 versions, as well as a simple index, digital control strength, quantifying the match between gene expression profiles and the transcriptional regulatory networks. While many of network characteristics change dramatically across the different versions, the digital control strength remains rather robust and in tune with previous results for this index. Our study shows that: (i) results derived from network topology should, when possible, be studied across a range of database versions, before detailed biological conclusions are derived, and (ii) resorting to simple indices, when interpreting high-throughput data from a network perspective, may help achieving a robustness of the findings against variation of the underlying biological information. Database URL:

  12. Engineering an Acinetobacter regulon for biosensing and high-throughput enzyme screening in E. coli via flow cytometry

    PubMed Central

    Jha, Ramesh K.; Kern, Theresa L.; Fox, David T.; M. Strauss, Charlie E.


    We created a single cell sorting system to screen for enzyme activity in Escherichia coli producing 3,4 dihydroxy benzoate (34DHB). To do so, we engineered a transcription factor regulon controlling the expression of green fluorescent protein (GFP) for induction by 34DHB. An autoregulated transcription factor, pcaU, was borrowed from Acinetobacter sp ADP1 to E. coli and its promoter region adapted for activity in E. Coli. The engineered pcaU regulon was inducible at >5 μM exogenous 34DHB, making it a sensitive biosensor for this industrially significant nylon precursor. Addition of a second plasmid provided IPTG inducible expression of dehydroshikimate dehydratase enzyme (AsbF), which converts endogenous dehydroshikimate to 34DHB. This system produced GFP fluorescence in an IPTG dose-dependent manner, and was easily detected in single cell on flow cytometer despite a moderate catalytic efficiency of AsbF. Using fluorescence-activated cell sorting (FACS), individual cells carrying the active AsbF could be isolated even when diluted into a decoy population of cells carrying a mutant (inactivated) AsbF variant at one part in a million. The same biosensor was also effective for further optimization of itself. FACS on E. coli carrying randomized loci in the promoter showed several variants with enhanced response to 34DHB. PMID:24861620

  13. The calcium signaling toolkit of the Apicomplexan parasites Toxoplasma gondii and Plasmodium spp.


    Lourido, Sebastian; Moreno, Silvia N J


    Apicomplexan parasites have complex life cycles, frequently split between different hosts and reliant on rapid responses as the parasites react to changing environmental conditions. Calcium ion (Ca(2+)) signaling is consequently essential for the cellular and developmental changes that support Apicomplexan parasitism. Apicomplexan genomes reveal a rich repertoire of genes involved in calcium signaling, although many of the genes responsible for observed physiological changes remain unknown. There is evidence, for example, for the presence of a nifedipine-sensitive calcium entry mechanism in Toxoplasma, but the molecular components involved in Ca(2+) entry in both Toxoplasma and Plasmodium, have not been identified. The major calcium stores are the endoplasmic reticulum (ER), the acidocalcisomes, and the plant-like vacuole in Toxoplasma, or the food vacuole in Plasmodium spp. Pharmacological evidence suggests that Ca(2+) release from intracellular stores may be mediated by inositol 1,4,5-trisphosphate (IP3) or cyclic ADP ribose (cADPR) although there is no molecular evidence for the presence of receptors for these second messengers in the parasites. Several Ca(2+)-ATPases are present in Apicomplexans and a putative mitochondrial Ca(2+)/H(+) exchanger has been identified. Apicomplexan genomes contain numerous genes encoding Ca(2+)-binding proteins, with the notable expansion of calcium-dependent protein kinases (CDPKs), whose study has revealed roles in gliding motility, microneme secretion, host cell invasion and egress, and parasite differentiation. Microneme secretion has also been shown to depend on the C2 domain containing protein DOC2 in both Plasmodium spp. and Toxoplasma, providing further evidence for the complex transduction of Ca(2+) signals in these organisms. The characterization of these pathways could lead to the discovery of novel drug targets and to a better understanding of the role of Ca(2+) in these parasites.

  14. The RegA regulon exhibits variability in response to altered growth conditions and differs markedly between Rhodobacter species

    PubMed Central

    Schindel, Heidi S.


    The RegB/RegA two-component system from Rhodobacter capsulatus regulates global changes in gene expression in response to alterations in oxygen levels. Studies have shown that RegB/RegA controls many energy-generating and energy-utilizing systems such as photosynthesis, nitrogen fixation, carbon fixation, hydrogen utilization, respiration, electron transport and denitrification. In this report, we utilized RNA-seq and ChIP-seq to analyse the breadth of genes indirectly and directly regulated by RegA. A comparison of mRNA transcript levels in wild type cells relative to a RegA deletion strain shows that there are 257 differentially expressed genes under photosynthetic defined minimal growth medium conditions and 591 differentially expressed genes when grown photosynthetically in a complex rich medium. ChIP-seq analysis also identified 61 unique RegA binding sites with a well-conserved recognition sequence, 33 of which exhibit changes in neighbouring gene expression. These transcriptome results define new members of the RegA regulon including genes involved in iron transport and motility. These results also reveal that the set of genes that are regulated by RegA are growth medium specific. Similar analyses under dark aerobic conditions where RegA is thought not to be phosphorylated by RegB reveal 40 genes that are differentially expressed in minimal medium and 20 in rich medium. Finally, a comparison of the R. capsulatus RegA regulon with the orthologous PrrA regulon in Rhodobacter sphaeroides shows that the number of photosystem genes regulated by RegA and PrrA are similar but that the identity of genes regulated by RegA and PrrA beyond those involved in photosynthesis are quite distinct. PMID:28348828

  15. Evolution of a Membrane Protein Regulon in Saccharomyces

    PubMed Central

    Martin, Hilary C.; Roop, Jeremy I.; Schraiber, Joshua G.; Hsu, Tiffany Y.; Brem, Rachel B.


    Expression variation is widespread between species. The ability to distinguish regulatory change driven by natural selection from the consequences of neutral drift remains a major challenge in comparative genomics. In this work, we used observations of mRNA expression and promoter sequence to analyze signatures of selection on groups of functionally related genes in Saccharomycete yeasts. In a survey of gene regulons with expression divergence between Saccharomyces cerevisiae and S. paradoxus, we found that most were subject to variation in trans-regulatory factors that provided no evidence against a neutral model. However, we identified one regulon of membrane protein genes controlled by unlinked cis- and trans-acting determinants with coherent effects on gene expression, consistent with a history of directional, nonneutral evolution. For this membrane protein group, S. paradoxus alleles at regulatory loci were associated with elevated expression and altered stress responsiveness relative to other yeasts. In a phylogenetic comparison of promoter sequences of the membrane protein genes between species, the S. paradoxus lineage was distinguished by a short branch length, indicative of strong selective constraint. Likewise, sequence variants within the S. paradoxus population, but not across strains of other yeasts, were skewed toward low frequencies in promoters of genes in the membrane protein regulon, again reflecting strong purifying selection. Our results support a model in which a distinct expression program for the membrane protein genes in S. paradoxus has been preferentially maintained by negative selection as the result of an increased importance to organismal fitness. These findings illustrate the power of integrating expression- and sequence-based tests of natural selection in the study of evolutionary forces that underlie regulatory change. PMID:22319167

  16. Identification of a DNA-Damage-Inducible Regulon in Acinetobacter baumannii

    PubMed Central

    Aranda, Jesús; Poza, Margarita; Shingu-Vázquez, Miguel; Cortés, Pilar; Boyce, John D.; Adler, Ben; Barbé, Jordi


    The transcriptional response of Acinetobacter baumannii, a major cause of nosocomial infections, to the DNA-damaging agent mitomycin C (MMC) was studied using DNA microarray technology. Most of the 39 genes induced by MMC were related to either prophages or encoded proteins involved in DNA repair. Electrophoretic mobility shift assays demonstrated that the product of the A. baumannii MMC-inducible umuD gene (umuDAb) specifically binds to the palindromic sequence TTGAAAATGTAACTTTTTCAA present in its promoter region. Mutations in this palindromic region abolished UmuDAb protein binding. A comparison of the promoter regions of all MMC-induced genes identified four additional transcriptional units with similar palindromic sequences recognized and specifically bound by UmuDAb. Therefore, the UmuDAb regulon consists of at least eight genes encoding seven predicted error-prone DNA polymerase V components and DddR, a protein of unknown function. Expression of these genes was not induced in the MMC-treated recA mutant. Furthermore, inactivation of the umuDAb gene resulted in the deregulation of all DNA-damage-induced genes containing the described palindromic DNA motif. Together, these findings suggest that UmuDAb is a direct regulator of the DNA damage response in A. baumannii. PMID:24123815

  17. Role of the mar-sox-rob Regulon in Regulating Outer Membrane Porin Expression▿†

    PubMed Central

    Chubiz, Lon M.; Rao, Christopher V.


    Multiple factors control the expression of the outer membrane porins OmpF and OmpC in Escherichia coli. In this work, we investigated the role of the mar-sox-rob regulon in regulating outer membrane porin expression in response to salicylate. We provide both genetic and physiological evidence that MarA and Rob can independently activate micF transcription in response to salicylate, leading to reduced OmpF expression. MarA was also found to repress OmpF expression through a MicF-independent pathway. In the case of OmpC, we found that its transcription was moderately increased in response to salicylate. However, this increase was independent of MarA and Rob. Finally, we found that the reduction in OmpF expression in a tolC mutant is due primarily to Rob. Collectively, this work further clarifies the coordinated role of MarA and Rob in regulating the expression of the outer membrane porins. PMID:21398557

  18. Effects of Enrichment on Expression of Key Nutrient Regulons in Extremophiles in Hydrothermal Springs at Yellowstone National Park

    NASA Astrophysics Data System (ADS)

    Knowlton, M.; Elser, J. J.; Poret-peterson, A. T.


    To cope with nutrient limitation, micro-organisms have evolved diverse means to increase acquisition of nutrients such as ammonium, nitrate, and phosphate and trace metals when they become limiting. These strategies typically involve production of compound-specific transporters (i.e., ammonium transporters) or extracellular enzymes (i.e., alkaline phosphatase). Genes that encode these proteins are often under the control of shared regulatory proteins called regulons. Regulons of genes for N, P, or Fe metabolism ultimately affect the transport of vital nutrients into and out of cells and thus help organisms deal with nutrient limitation. Regulons for N, P, and Fe have been found and studied ex situ for model organisms under various nutrient-limiting conditions but are relatively unstudied in the field, especially in hydrothermal systems. The aim of this study was to characterize transcription patterns of genes for N, P, and Fe processing under experimental nutrient enrichment in a complex microbial community from an alkaline hot spring located in Yellowstone National Park. Microbial mat samples and hot spring water were placed in bottles, subjected to a fully factorial manipulation of N (125 μM N as ammonium nitrate), phosphorus (7.8 μM P as sodium phosphate), and Fe (7.8 x 10-2 μM Fe as ferric citrate), and incubated overnight at in situ temperatures. Following incubation, hot spring water was filtered and preserved for nutrient analyses and biomass subsamples were snap-frozen for molecular analysis. Chemical analysis showed a total removal of NH4 and PO4 from the water in all treatments. NO3 decreased slightly in most treatments (control, +N, +P, +Fe, +PFe, and +NPFe) but increased in the others (+NFe and +NP). Interestingly, Fe concentrations were lower in amended samples (+Fe, +NFe, +PFe, and +NPFe) than in unamended samples (control, +N, +P, +NP). To assess the transcriptional responses, primers were designed to target genes controlled by the ferric uptake

  19. Structures of apicomplexan calcium-dependent protein kinases reveal mechanism of activation by calcium

    SciTech Connect

    Wernimont, Amy K; Artz, Jennifer D.; Jr, Patrick Finerty; Lin, Yu-Hui; Amani, Mehrnaz; Allali-Hassani, Abdellah; Senisterra, Guillermo; Vedadi, Masoud; Tempel, Wolfram; Mackenzie, Farrell; Chau, Irene; Lourido, Sebastian; Sibley, L. David; Hui, Raymond


    Calcium-dependent protein kinases (CDPKs) have pivotal roles in the calcium-signaling pathway in plants, ciliates and apicomplexan parasites and comprise a calmodulin-dependent kinase (CaMK)-like kinase domain regulated by a calcium-binding domain in the C terminus. To understand this intramolecular mechanism of activation, we solved the structures of the autoinhibited (apo) and activated (calcium-bound) conformations of CDPKs from the apicomplexan parasites Toxoplasma gondii and Cryptosporidium parvum. In the apo form, the C-terminal CDPK activation domain (CAD) resembles a calmodulin protein with an unexpected long helix in the N terminus that inhibits the kinase domain in the same manner as CaMKII. Calcium binding triggers the reorganization of the CAD into a highly intricate fold, leading to its relocation around the base of the kinase domain to a site remote from the substrate binding site. This large conformational change constitutes a distinct mechanism in calcium signal-transduction pathways.

  20. Is an Apicomplexan Parasite Responsible for the Collapse of the Iceland Scallop (Chlamys islandica) Stock?

    PubMed Central

    Kristmundsson, Árni; Erlingsdóttir, Ásthildur; Freeman, Mark A.


    Due to the total and unexpected collapse of the Iceland scallop, Chlamys islandica, stocks around Iceland during the 2000s, a commercial fishing ban has been imposed on this valuable resource since 2003. Following the initial identification of an apicomplexan parasite in the scallops, a long-term surveillance program was established to evaluate the effect of the parasite on the population. The infections were highly prevalent in all shell sizes throughout the study. However, the parasite only impacts mature scallops where they cause severe macroscopic changes, characterized by an extensively diminished and abnormally coloured adductor muscle. A highly significant relationship was observed between infection intensity and gonad and adductor muscle indices. The first four years of the study, were characterized by high infection intensity and very poor condition of the adductor muscle and gonads, whilst during subsequent years, infections gradually decreased and the condition of the scallops improved. Histopathological changes were restricted to the presence of apicomplexan zoites which were widely distributed, causing varying degrees of pathology in all organs. In heavy infections, muscular and connective tissues were totally necrotized, destroying significant parts of numerous organs, especially the adductor muscle, digestive gland and gonads. The progression of the disease was in good synchrony with the mortality rates and the subsequent decline observed in the scallop stock and recruitment indices. Our findings strongly suggest that the apicomplexan parasite played a major role in the collapse of the Iceland scallop stock in Breidafjordur. In addition to causing mortality, the infections significantly impact gonad development which contributes further to the collapse of the stock in the form of lower larval recruitment. Furthermore, compelling evidence exists that this apicomplexan pathogen is causing serious disease outbreaks in other scallop populations. Similar

  1. Genetic mapping identifies novel highly protective antigens for an apicomplexan parasite.


    Blake, Damer P; Billington, Karen J; Copestake, Susan L; Oakes, Richard D; Quail, Michael A; Wan, Kiew-Lian; Shirley, Martin W; Smith, Adrian L


    Apicomplexan parasites are responsible for a myriad of diseases in humans and livestock; yet despite intensive effort, development of effective sub-unit vaccines remains a long-term goal. Antigenic complexity and our inability to identify protective antigens from the pool that induce response are serious challenges in the development of new vaccines. Using a combination of parasite genetics and selective barriers with population-based genetic fingerprinting, we have identified that immunity against the most important apicomplexan parasite of livestock (Eimeria spp.) was targeted against a few discrete regions of the genome. Herein we report the identification of six genomic regions and, within two of those loci, the identification of true protective antigens that confer immunity as sub-unit vaccines. The first of these is an Eimeria maxima homologue of apical membrane antigen-1 (AMA-1) and the second is a previously uncharacterised gene that we have termed 'immune mapped protein-1' (IMP-1). Significantly, homologues of the AMA-1 antigen are protective with a range of apicomplexan parasites including Plasmodium spp., which suggest that there may be some characteristic(s) of protective antigens shared across this diverse group of parasites. Interestingly, homologues of the IMP-1 antigen, which is protective against E. maxima infection, can be identified in Toxoplasma gondii and Neospora caninum. Overall, this study documents the discovery of novel protective antigens using a population-based genetic mapping approach allied with a protection-based screen of candidate genes. The identification of AMA-1 and IMP-1 represents a substantial step towards development of an effective anti-eimerian sub-unit vaccine and raises the possibility of identification of novel antigens for other apicomplexan parasites. Moreover, validation of the parasite genetics approach to identify effective antigens supports its adoption in other parasite systems where legitimate protective antigen

  2. Is an Apicomplexan Parasite Responsible for the Collapse of the Iceland Scallop (Chlamys islandica) Stock?


    Kristmundsson, Árni; Erlingsdóttir, Ásthildur; Freeman, Mark A


    Due to the total and unexpected collapse of the Iceland scallop, Chlamys islandica, stocks around Iceland during the 2000s, a commercial fishing ban has been imposed on this valuable resource since 2003. Following the initial identification of an apicomplexan parasite in the scallops, a long-term surveillance program was established to evaluate the effect of the parasite on the population. The infections were highly prevalent in all shell sizes throughout the study. However, the parasite only impacts mature scallops where they cause severe macroscopic changes, characterized by an extensively diminished and abnormally coloured adductor muscle. A highly significant relationship was observed between infection intensity and gonad and adductor muscle indices. The first four years of the study, were characterized by high infection intensity and very poor condition of the adductor muscle and gonads, whilst during subsequent years, infections gradually decreased and the condition of the scallops improved. Histopathological changes were restricted to the presence of apicomplexan zoites which were widely distributed, causing varying degrees of pathology in all organs. In heavy infections, muscular and connective tissues were totally necrotized, destroying significant parts of numerous organs, especially the adductor muscle, digestive gland and gonads. The progression of the disease was in good synchrony with the mortality rates and the subsequent decline observed in the scallop stock and recruitment indices. Our findings strongly suggest that the apicomplexan parasite played a major role in the collapse of the Iceland scallop stock in Breidafjordur. In addition to causing mortality, the infections significantly impact gonad development which contributes further to the collapse of the stock in the form of lower larval recruitment. Furthermore, compelling evidence exists that this apicomplexan pathogen is causing serious disease outbreaks in other scallop populations. Similar

  3. Evolutionarily divergent, unstable filamentous actin is essential for gliding motility in apicomplexan parasites.


    Skillman, Kristen M; Diraviyam, Karthikeyan; Khan, Asis; Tang, Keliang; Sept, David; Sibley, L David


    Apicomplexan parasites rely on a novel form of actin-based motility called gliding, which depends on parasite actin polymerization, to migrate through their hosts and invade cells. However, parasite actins are divergent both in sequence and function and only form short, unstable filaments in contrast to the stability of conventional actin filaments. The molecular basis for parasite actin filament instability and its relationship to gliding motility remain unresolved. We demonstrate that recombinant Toxoplasma (TgACTI) and Plasmodium (PfACTI and PfACTII) actins polymerized into very short filaments in vitro but were induced to form long, stable filaments by addition of equimolar levels of phalloidin. Parasite actins contain a conserved phalloidin-binding site as determined by molecular modeling and computational docking, yet vary in several residues that are predicted to impact filament stability. In particular, two residues were identified that form intermolecular contacts between different protomers in conventional actin filaments and these residues showed non-conservative differences in apicomplexan parasites. Substitution of divergent residues found in TgACTI with those from mammalian actin resulted in formation of longer, more stable filaments in vitro. Expression of these stabilized actins in T. gondii increased sensitivity to the actin-stabilizing compound jasplakinolide and disrupted normal gliding motility in the absence of treatment. These results identify the molecular basis for short, dynamic filaments in apicomplexan parasites and demonstrate that inherent instability of parasite actin filaments is a critical adaptation for gliding motility.

  4. Two recently sequenced vertebrate genomes are contaminated with apicomplexan species of the Sarcocystidae family.


    Orosz, Ferenc


    This paper highlights a general problem, namely that host genome sequences can easily be contaminated with parasite sequences, thus careful isolation of genetic material and careful bioinformatics analysis are needed in all cases. Two recently published genomes are shown here to be contaminated with sequences of apicomplexan parasites which belong to the Sarcocystidae family. Sequences of the characteristic apicomplexan organelle, the apicoplast, were used as queries in BLASTN searches against nucleotide sequences of various animal groups looking for possible contamination. Draft genomes of a bird, Colinus virginianus (Halley et al., 2014), and a bat, Myotis davidii (Zhang et al., 2013) were found to contain at least six and 17 contigs, respectively, originating from the apicoplast of an apicomplexan species, and other genes specific to this phylum can also be found in the published genomes. Obviously, the sources of the genetic material, the muscle and the kidney of the animals, respectively, contained the parasitic cysts. Phylogenetic analyses using 18S rRNA and internal transcribed spacer 1 genes show that the parasite contaminating C. virginianus is a species of Sarcocystis related to ones known to cycle between avian and mammalian hosts. In the case of M. davidii it belongs to the Nephroisospora genus, the only member of which, Nephroisospora eptesici, has been recently identified from the kidney of big brown bats (Eptesicus fuscus).

  5. Evolutionarily Divergent, Unstable Filamentous Actin Is Essential for Gliding Motility in Apicomplexan Parasites

    PubMed Central

    Skillman, Kristen M.; Diraviyam, Karthikeyan; Khan, Asis; Tang, Keliang; Sept, David; Sibley, L. David


    Apicomplexan parasites rely on a novel form of actin-based motility called gliding, which depends on parasite actin polymerization, to migrate through their hosts and invade cells. However, parasite actins are divergent both in sequence and function and only form short, unstable filaments in contrast to the stability of conventional actin filaments. The molecular basis for parasite actin filament instability and its relationship to gliding motility remain unresolved. We demonstrate that recombinant Toxoplasma (TgACTI) and Plasmodium (PfACTI and PfACTII) actins polymerized into very short filaments in vitro but were induced to form long, stable filaments by addition of equimolar levels of phalloidin. Parasite actins contain a conserved phalloidin-binding site as determined by molecular modeling and computational docking, yet vary in several residues that are predicted to impact filament stability. In particular, two residues were identified that form intermolecular contacts between different protomers in conventional actin filaments and these residues showed non-conservative differences in apicomplexan parasites. Substitution of divergent residues found in TgACTI with those from mammalian actin resulted in formation of longer, more stable filaments in vitro. Expression of these stabilized actins in T. gondii increased sensitivity to the actin-stabilizing compound jasplakinolide and disrupted normal gliding motility in the absence of treatment. These results identify the molecular basis for short, dynamic filaments in apicomplexan parasites and demonstrate that inherent instability of parasite actin filaments is a critical adaptation for gliding motility. PMID:21998582

  6. Comparative Analysis of Apicoplast-Targeted Protein Extension Lengths in Apicomplexan Parasites

    PubMed Central

    Seliverstov, Alexandr V.; Zverkov, Oleg A.; Istomina, Svetlana N.; Pirogov, Sergey A.; Kitsis, Philip S.


    In general, the mechanism of protein translocation through the apicoplast membrane requires a specific extension of a functionally important region of the apicoplast-targeted proteins. The corresponding signal peptides were detected in many apicomplexans but not in the majority of apicoplast-targeted proteins in Toxoplasma gondii. In T. gondii signal peptides are either much diverged or their extension region is processed, which in either case makes the situation different from other studied apicomplexans. We propose a statistic method to compare extensions of the functionally important regions of apicoplast-targeted proteins. More specifically, we provide a comparison of extension lengths of orthologous apicoplast-targeted proteins in apicomplexan parasites. We focus on results obtained for the model species T. gondii, Neospora caninum, and Plasmodium falciparum. With our method, cross species comparisons demonstrate that, in average, apicoplast-targeted protein extensions in T. gondii are 1.5-fold longer than in N. caninum and 2-fold longer than in P. falciparum. Extensions in P. falciparum less than 87 residues in size are longer than the corresponding extensions in N. caninum and, reversely, are shorter if they exceed 88 residues. PMID:26114107

  7. Isoprenoid precursor biosynthesis offers potential targets for drug discovery against diseases caused by apicomplexan parasites.


    Hunter, William N


    Two, simple, C5 compounds, dimethylally diphosphate and isopentenyl diphosphate, are the universal precursors of isoprenoids, a large family of natural products involved in numerous important biological processes. Two distinct biosynthetic pathways have evolved to supply these precursors. Humans use the mevalonate route whilst many species of bacteria including important pathogens, plant chloroplasts and apicomplexan parasites exploit the non-mevalonate pathway. The absence from humans, combined with genetic and chemical validation suggests that the non-mevalonate pathway holds the potential to support new drug discovery programmes targeting Gram-negative bacteria and the apicomplexan parasites responsible for causing serious human diseases, and also infections of veterinary importance. The non-mevalonate pathway relies on eight enzyme-catalyzed stages exploiting a range of cofactors and metal ions. A wealth of structural and mechanistic data, mainly derived from studies of bacterial enzymes, now exists for most components of the pathway and these will be described. Particular attention will be paid to how these data inform on the apicomplexan orthologues concentrating on the enzymes from Plasmodium spp. these cause malaria, one the most important parasitic diseases in the world today.

  8. The Organellar Genomes of Chromera and Vitrella, the Phototrophic Relatives of Apicomplexan Parasites.


    Oborník, Miroslav; Lukeš, Julius


    Apicomplexa are known to contain greatly reduced organellar genomes. Their mitochondrial genome carries only three protein-coding genes, and their plastid genome is reduced to a 35-kb-long circle. The discovery of coral-endosymbiotic algae Chromera velia and Vitrella brassicaformis, which share a common ancestry with Apicomplexa, provided an opportunity to study possibly ancestral forms of organellar genomes, a unique glimpse into the evolutionary history of apicomplexan parasites. The structurally similar mitochondrial genomes of Chromera and Vitrella differ in gene content, which is reflected in the composition of their respiratory chains. Thus, Chromera lacks respiratory complexes I and III, whereas Vitrella and apicomplexan parasites are missing only complex I. Plastid genomes differ substantially between these algae, particularly in structure: The Chromera plastid genome is a linear, 120-kb molecule with large and divergent genes, whereas the plastid genome of Vitrella is a highly compact circle that is only 85 kb long but nonetheless contains more genes than that of Chromera. It appears that organellar genomes have already been reduced in free-living phototrophic ancestors of apicomplexan parasites, and such reduction is not associated with parasitism.

  9. Genetic characterization of the HrpL regulon of the fire blight pathogen Erwinia amylovora reveals novel virulence factors.


    McNally, R Ryan; Toth, Ian K; Cock, Peter J A; Pritchard, Leighton; Hedley, Pete E; Morris, Jenny A; Zhao, Youfu; Sundin, George W


    The bacterial pathogen Erwinia amylovora is the causal agent of fire blight, an economically significant disease of apple and pear. Disease initiation by E. amylovora requires the translocation of effector proteins into host cells via the hypersensitive response and pathogenicity (hrp) type III secretion system (T3SS). The alternative sigma factor HrpL positively regulates the transcription of structural and translocated components of the T3SS via hrp promoter elements. To characterize genome-wide HrpL-dependent gene expression in E. amylovora Ea1189, wild-type and Ea1189ΔhrpL strains were cultured in hrp-inducing minimal medium, and total RNA was compared using a custom microarray designed to represent the annotated genes of E. amylovora ATCC 49946. The results revealed 24 genes differentially regulated in Ea1189ΔhrpL relative to Ea1189 with fold-change expression ratios greater than 1.5; of these, 19 genes exhibited decreased transcript abundance and five genes showed increased transcript abundance relative to Ea1189. To expand our understanding of the HrpL regulon and to elucidate direct versus indirect HrpL-mediated effects on gene expression, the genome of E. amylovora ATCC 49946 was examined in silico using a hidden Markov model assembled from known Erwinia spp. hrp promoters. This technique identified 15 putative type III novel hrp promoters, seven of which were validated with quantitative polymerase chain reaction based on expression analyses. It was found that HrpL-regulated genes encode all known components of the hrp T3SS, as well as five putative type III effectors. Eight genes displayed apparent indirect HrpL regulation, suggesting that the HrpL regulon is connected to downstream signalling networks. The construction of deletion mutants of three novel HrpL-regulated genes resulted in the identification of additional virulence factors as well as mutants displaying abnormal motility and biofilm phenotypes.

  10. Regulon of the N-Acetylglucosamine Utilization Regulator NagR in Bacillus subtilis▿†

    PubMed Central

    Bertram, Ralph; Rigali, Sébastien; Wood, Natalie; Lulko, Andrzej T.; Kuipers, Oscar P.; Titgemeyer, Fritz


    N-Acetylglucosamine (GlcNAc) is the most abundant carbon-nitrogen biocompound on earth and has been shown to be an important source of nutrients for both catabolic and anabolic purposes in Bacillus species. In this work we show that the GntR family regulator YvoA of Bacillus subtilis serves as a negative transcriptional regulator of GlcNAc catabolism gene expression. YvoA represses transcription by binding a 16-bp sequence upstream of nagP encoding the GlcNAc-specific EIIBC component of the sugar phosphotransferase system involved in GlcNAc transport and phosphorylation, as well as another very similar 16-bp sequence upstream of the nagAB-yvoA locus, wherein nagA codes for N-acetylglucosamine-6-phosphate deacetylase and nagB codes for the glucosamine-6-phosphate (GlcN-6-P) deaminase. In vitro experiments demonstrated that GlcN-6-P acts as an inhibitor of YvoA DNA-binding activity, as occurs for its Streptomyces ortholog, DasR. Interestingly, we observed that the expression of nag genes was still activated upon addition of GlcNAc in a ΔyvoA mutant background, suggesting the existence of an auxiliary transcriptional control instance. Initial computational prediction of the YvoA regulon showed a distribution of YvoA binding sites limited to nag genes and therefore suggests renaming YvoA to NagR, for N-acetylglucosamine utilization regulator. Whole-transcriptome studies showed significant repercussions of nagR deletion for several major B. subtilis regulators, probably indirectly due to an excess of the crucial molecules acetate, ammonia, and fructose-6-phosphate, resulting from complete hydrolysis of GlcNAc. We discuss a model deduced from NagR-mediated gene expression, which highlights clear connections with pathways for GlcNAc-containing polymer biosynthesis and adaptation to growth under oxygen limitation. PMID:21602348

  11. Identification and characterization of the PhhR regulon in Pseudomonas putida.


    Herrera, M Carmen; Duque, Estrella; Rodríguez-Herva, José J; Fernández-Escamilla, Ana M; Ramos, Juan L


    Pseudomonas putida is a soil microorganism that utilizes aromatic amino acids present in root exudates as a nitrogen source. We have previously shown that the PhhR transcriptional regulator induces phhAB genes encoding a phenylalanine hydroxylase. In this study we show, using microarray assays and promoter fusions, that PhhR is a global regulator responsible for the activation of genes essential for phenylalanine degradation, phenylalanine homeostasis and other genes of unknown function. Recently, it has been shown that phenylalanine catabolism occurs through more than one pathway. One of these possible pathways involves the metabolism of phenylalanine via tyrosine, p-hydroxyphenylpyruvate, and homogentisate. We identified two genes within this pathway that encode an acyl-CoA transferase involved in the metabolism of acetoacetate. All genes in this pathway were induced in response to phenylalanine in a PhhR-proficient background. The second potential degradative pathway involves the degradation of phenylalanine to produce phenylpyruvate, which seems to be degraded via phenylacetyl-CoA. A number of mutants in the paa genes encoding phenylacetyl-CoA degradation enzymes fail to grow on phenylpyruvate or phenylacetate, further supporting the existence of this second pathway. We found that the PhhR regulon also includes genes involved in the biosynthesis of aromatic amino acids that are repressed in the presence of phenylalanine, suggesting the possibility of feedback at the transcriptional level. In addition, we found that PhhR modulates the level of expression of the broad-substrate-specificity MexEF/OprN efflux pump. Expression from this pump is under the control of mexT gene product because phenylalanine-dependent transcription from the mexE promoter does not occur in a mexT mutant background. These results place PhhR as an important regulator in the control of bacterial responses to aromatic amino acids.

  12. Mycobacterium tuberculosis growth following aerobic expression of the DosR regulon.


    Minch, Kyle; Rustad, Tige; Sherman, David R


    The Mycobacterium tuberculosis regulator DosR is induced by multiple stimuli including hypoxia, nitric oxide and redox stress. Overlap of these stimuli with conditions thought to promote latency in infected patients fuels a model in which DosR regulon expression is correlated with bacteriostasis in vitro and a proxy for latency in vivo. Here, we find that inducing the DosR regulon to wildtype levels in aerobic, replicating M. tuberculosis does not alter bacterial growth kinetics. We conclude that DosR regulon expression alone is insufficient for bacterial latency, but rather is expressed during a range of growth states in a dynamic environment.

  13. Binase-like guanyl-preferring ribonucleases are new members of Bacillus PhoP regulon.


    Ulyanova, Vera; Vershinina, Valentina; Ilinskaya, Olga; Harwood, Colin R


    Extracellular low-molecular weight guanyl-preferring ribonucleases (LMW RNases) of Bacillus sp. comprise a group of hydrolytic enzymes that share highly similar structural and catalytic characteristics with barnase, a ribonuclease from Bacillus amyloliquefaciens, and binase, a ribonuclease from Bacillus intermedius. Although the physical-chemical and catalytic properties of Bacillus guanyl-preferring ribonucleases are very similar, there is considerably more variation in the environmental conditions that lead to the induction of the genes encoding these RNases. Based on structural differences of their genes the guanyl-preferring ribonucleases have been sub-divided into binase-like and barnase-like groups. Here we show the ability of the key regulator of phosphate deficiency response, PhoP, to direct the transcription of the binase-like RNases but not barnase-like RNases. These results, together with our demonstration that binase-like RNases are induced in response to phosphate starvation, allow us to categorise this group of ribonucleases as new members of Bacillus PhoP regulon. In contrast, the barnase-like ribonucleases are relatively insensitive to the phosphate concentration and the environmental conditions that are responsible for their induction, and the regulatory elements involved, are currently unknown.

  14. Overlapping Alternative Sigma Factor Regulons in the Response to Singlet Oxygen in Rhodobacter sphaeroides▿ †

    PubMed Central

    Nuss, Aaron M.; Glaeser, Jens; Berghoff, Bork A.; Klug, Gabriele


    Organisms performing photosynthesis in the presence of oxygen have to cope with the formation of highly reactive singlet oxygen (1O2) and need to mount an adaptive response to photooxidative stress. Here we show that the alternative sigma factors RpoHI and RpoHII are both involved in the 1O2 response and in the heat stress response in Rhodobacter sphaeroides. We propose RpoHII to be the major player in the 1O2 response, whereas RpoHI is more important for the heat stress response. Mapping of the 5′ ends of RpoHII- and also RpoHI/RpoHII-dependent transcripts revealed clear differences in the −10 regions of the putative promoter sequences. By using bioinformatic tools, we extended the RpoHII regulon, which includes genes induced by 1O2 exposure. These genes encode proteins which are, e.g., involved in methionine sulfoxide reduction and in maintaining the quinone pool. Furthermore, we identified small RNAs which depend on RpoHI and RpoHII and are likely to contribute to the defense against photooxidative stress and heat stress. PMID:20304993

  15. OsdR of Streptomyces coelicolor and the Dormancy Regulator DevR of Mycobacterium tuberculosis Control Overlapping Regulons

    PubMed Central

    Urem, Mia; van Rossum, Teunke; Bucca, Giselda; Moolenaar, Geri F.; Laing, Emma; Świątek-Połatyńska, Magda A.; Willemse, Joost; Tenconi, Elodie; Rigali, Sébastien; Goosen, Nora; Smith, Colin P.


    ABSTRACT Two-component regulatory systems allow bacteria to respond adequately to changes in their environment. In response to a given stimulus, a sensory kinase activates its cognate response regulator via reversible phosphorylation. The response regulator DevR activates a state of dormancy under hypoxia in Mycobacterium tuberculosis, allowing this pathogen to escape the host defense system. Here, we show that OsdR (SCO0204) of the soil bacterium Streptomyces coelicolor is a functional orthologue of DevR. OsdR, when activated by the sensory kinase OsdK (SCO0203), binds upstream of the DevR-controlled dormancy genes devR, hspX, and Rv3134c of M. tuberculosis. In silico analysis of the S. coelicolor genome combined with in vitro DNA binding studies identified many binding sites in the genomic region around osdR itself and upstream of stress-related genes. This binding correlated well with transcriptomic responses, with deregulation of developmental genes and genes related to stress and hypoxia in the osdR mutant. A peak in osdR transcription in the wild-type strain at the onset of aerial growth correlated with major changes in global gene expression. Taken together, our data reveal the existence of a dormancy-related regulon in streptomycetes which plays an important role in the transcriptional control of stress- and development-related genes. IMPORTANCE Dormancy is a state of growth cessation that allows bacteria to escape the host defense system and antibiotic challenge. Understanding the mechanisms that control dormancy is of key importance for the treatment of latent infections, such as those from Mycobacterium tuberculosis. In mycobacteria, dormancy is controlled by the response regulator DevR, which responds to conditions of hypoxia. Here, we show that OsdR of Streptomyces coelicolor recognizes the same regulatory element and controls a regulon that consists of genes involved in the control of stress and development. Only the core regulon in the direct

  16. Comparative genomic analysis of dha regulon and related genes for anaerobic glycerol metabolism in bacteria.


    Sun, Jibin; van den Heuvel, Joop; Soucaille, Philippe; Qu, Yinbo; Zeng, An-Ping


    The dihydroxyacetone (dha) regulon of bacteria encodes genes for the anaerobic metabolism of glycerol. In this work, genomic data are used to analyze and compare the dha regulon and related genes in different organisms in silico with respect to gene organization, sequence similarity, and possible functions. Database searches showed that among the organisms, the genomes of which have been sequenced so far, only two, i.e., Klebsiella pneumoniae MGH 78578 and Clostridium perfringens contain a complete dha regulon bearing all known enzymes. The components and their organization in the dha regulon of these two organisms differ considerably from each other and also from the previously partially sequenced dha regulons in Citrobacter freundii, Clostridium pasteurianum, and Clostridium butyricum. Unlike all of the other organisms, genes for the oxidative and reductive pathways of anaerobic glycerol metabolism in C. perfringens are located in two separate organization units on the chromosome. Comparisons of deduced protein sequences of genes with similar functions showed that the dha regulon components in K. pneumoniae and C. freundii have high similarities (80-95%) but lower similarities to those of the Clostridium species (30-80%). Interestingly, the protein sequence similarities among the dha genes of the Clostridium species are in many cases even lower than those between the Clostridium species and K. pneumoniae or C. freundii, suggesting two different types of dha regulon in the Clostridium species studied. The in silico reconstruction and comparison of dha regulons revealed several new genes in the microorganisms studied. In particular, a novel dha kinase that is phosphoenolpyruvate-dependent is identified and experimentally confirmed for K. pneumoniae in addition to the known ATP-dependent dha kinase. This finding gives new insights into the regulation of glycerol metabolism in K. pneumoniae and explains some hitherto not well understood experimental observations.

  17. RegPredict: an integrated system for regulon inference in prokaryotes by comparative genomics approach

    SciTech Connect

    Novichkov, Pavel S.; Rodionov, Dmitry A.; Stavrovskaya, Elena D.; Novichkova, Elena S.; Kazakov, Alexey E.; Gelfand, Mikhail S.; Arkin, Adam P.; Mironov, Andrey A.; Dubchak, Inna


    RegPredict web server is designed to provide comparative genomics tools for reconstruction and analysis of microbial regulons using comparative genomics approach. The server allows the user to rapidly generate reference sets of regulons and regulatory motif profiles in a group of prokaryotic genomes. The new concept of a cluster of co-regulated orthologous operons allows the user to distribute the analysis of large regulons and to perform the comparative analysis of multiple clusters independently. Two major workflows currently implemented in RegPredict are: (i) regulon reconstruction for a known regulatory motif and (ii) ab initio inference of a novel regulon using several scenarios for the generation of starting gene sets. RegPredict provides a comprehensive collection of manually curated positional weight matrices of regulatory motifs. It is based on genomic sequences, ortholog and operon predictions from the MicrobesOnline. An interactive web interface of RegPredict integrates and presents diverse genomic and functional information about the candidate regulon members from several web resources. RegPredict is freely accessible at

  18. Comparative genomic reconstruction of transcriptional networks controlling central metabolism in the Shewanella genus

    PubMed Central


    Background Genome-scale prediction of gene regulation and reconstruction of transcriptional regulatory networks in bacteria is one of the critical tasks of modern genomics. The Shewanella genus is comprised of metabolically versatile gamma-proteobacteria, whose lifestyles and natural environments are substantially different from Escherichia coli and other model bacterial species. The comparative genomics approaches and computational identification of regulatory sites are useful for the in silico reconstruction of transcriptional regulatory networks in bacteria. Results To explore conservation and variations in the Shewanella transcriptional networks we analyzed the repertoire of transcription factors and performed genomics-based reconstruction and comparative analysis of regulons in 16 Shewanella genomes. The inferred regulatory network includes 82 transcription factors and their DNA binding sites, 8 riboswitches and 6 translational attenuators. Forty five regulons were newly inferred from the genome context analysis, whereas others were propagated from previously characterized regulons in the Enterobacteria and Pseudomonas spp.. Multiple variations in regulatory strategies between the Shewanella spp. and E. coli include regulon contraction and expansion (as in the case of PdhR, HexR, FadR), numerous cases of recruiting non-orthologous regulators to control equivalent pathways (e.g. PsrA for fatty acid degradation) and, conversely, orthologous regulators to control distinct pathways (e.g. TyrR, ArgR, Crp). Conclusions We tentatively defined the first reference collection of ~100 transcriptional regulons in 16 Shewanella genomes. The resulting regulatory network contains ~600 regulated genes per genome that are mostly involved in metabolism of carbohydrates, amino acids, fatty acids, vitamins, metals, and stress responses. Several reconstructed regulons including NagR for N-acetylglucosamine catabolism were experimentally validated in S. oneidensis MR-1. Analysis of

  19. Rearrangements of the transcriptional regulatory networks of metabolic pathways in fungi.


    Lavoie, Hugo; Hogues, Hervé; Whiteway, Malcolm


    Growing evidence suggests that transcriptional regulatory networks in many organisms are highly flexible. Here, we discuss the evolution of transcriptional regulatory networks governing the metabolic machinery of sequenced ascomycetes. In particular, recent work has shown that transcriptional rewiring is common in regulons controlling processes such as production of ribosome components and metabolism of carbohydrates and lipids. We note that dramatic rearrangements of the transcriptional regulatory components of metabolic functions have occurred among ascomycetes species.

  20. Autoregulation of GAL4 transcription is essential for rapid growth of Kluyveromyces lactis on lactose and galactose.

    PubMed Central

    Czyz, M; Nagiec, M M; Dickson, R C


    Transcriptional induction of genes in the lactose-galactose regulon of the yeast Kluyveromyces lactis requires the GAL4 transcription activator protein. Previous data indicated that the concentration of GAL4 was tightly regulated under basal, inducing, and glucose repressing conditions but the mechanisms were unknown. In this paper we demonstrate that transcription of the GAL4 gene (KI-GAL4) increases 3- to 4-fold during induction of the regulon. This increase requires a KI-GAL4 binding site, UASG, in front of the KI-GAL4 gene, indicating that the KI-GAL4 protein autoregulates transcription of its own gene. Our data demonstrate that the autoregulatory circuit is essential for full induction of the lactose-galactose regulon and, hence, for rapid growth on lactose or galactose. Other data indicate that basal transcription of the KI-GAL4 gene is governed by unidentified promoter elements. The existence of the autoregulatory circuit reveals an important difference between the lactose-galactose regulon and its homologue in Saccharomyces cerevisiae, the melibiose-galactose regulon. This difference may have evolved in response to different selective pressures encountered by the two organisms. PMID:8414996

  1. Technical Considerations in using DNA Microarrays to Define Regulons

    PubMed Central

    Rhodius, Virgil A.; Wade, Joseph T.


    Transcription is the major regulatory target of gene expression in bacteria, and is controlled by many regulatory proteins and RNAs. Microarrays are a powerful tool to study the regulation of transcription on a genomic scale. Here we describe the use of transcription profiling and ChIP-chip to study transcriptional regulation in bacteria. Transcription profiling determines the outcome of regulatory events whereas ChIP-chip identifies the protein-DNA interactions that determine these events. Together they can provide detailed information on transcriptional regulatory systems. PMID:18955146

  2. The Large Mitochondrial Genome of Symbiodinium minutum Reveals Conserved Noncoding Sequences between Dinoflagellates and Apicomplexans

    PubMed Central

    Shoguchi, Eiichi; Shinzato, Chuya; Hisata, Kanako; Satoh, Nori; Mungpakdee, Sutada


    Even though mitochondrial genomes, which characterize eukaryotic cells, were first discovered more than 50 years ago, mitochondrial genomics remains an important topic in molecular biology and genome sciences. The Phylum Alveolata comprises three major groups (ciliates, apicomplexans, and dinoflagellates), the mitochondrial genomes of which have diverged widely. Even though the gene content of dinoflagellate mitochondrial genomes is reportedly comparable to that of apicomplexans, the highly fragmented and rearranged genome structures of dinoflagellates have frustrated whole genomic analysis. Consequently, noncoding sequences and gene arrangements of dinoflagellate mitochondrial genomes have not been well characterized. Here we report that the continuous assembled genome (∼326 kb) of the dinoflagellate, Symbiodinium minutum, is AT-rich (∼64.3%) and that it contains three protein-coding genes. Based upon in silico analysis, the remaining 99% of the genome comprises transcriptomic noncoding sequences. RNA edited sites and unique, possible start and stop codons clarify conserved regions among dinoflagellates. Our massive transcriptome analysis shows that almost all regions of the genome are transcribed, including 27 possible fragmented ribosomal RNA genes and 12 uncharacterized small RNAs that are similar to mitochondrial RNA genes of the malarial parasite, Plasmodium falciparum. Gene map comparisons show that gene order is only slightly conserved between S. minutum and P. falciparum. However, small RNAs and intergenic sequences share sequence similarities with P. falciparum, suggesting that the function of noncoding sequences has been preserved despite development of very different genome structures. PMID:26199191

  3. A unique hexokinase in Cryptosporidium parvum, an apicomplexan pathogen lacking the Krebs cycle and oxidative phosphorylation.


    Yu, Yonglan; Zhang, Haili; Guo, Fengguang; Sun, Mingfei; Zhu, Guan


    Cryptosporidium parvum may cause virtually untreatable infections in AIDS patients, and is recently identified as one of the top four diarrheal pathogens in children in developing countries. Cryptosporidium differs from other apicomplexans (e.g., Plasmodium and Toxoplasma) by lacking many metabolic pathways including the Krebs cycle and cytochrome-based respiratory chain, thus relying mainly on glycolysis for ATP production. Here we report the molecular and biochemical characterizations of a hexokinase in C. parvum (CpHK). Our phylogenetic reconstructions indicated that apicomplexan hexokinases including CpHK were highly divergent from those of humans and animals (i.e., at the base of the eukaryotic clade). CpHK displays unique kinetic features that differ from those in mammals and Toxoplasma gondii (TgHK) in the preference towards various hexoses and its capacity to use ATP and other NTPs. CpHK also displays substrate inhibition by ATP. Moreover, 2-deoxy-D-glucose (2DG) could not only inhibit the CpHK activity, but also the parasite growth in vitro at concentrations nontoxic to host cells (IC(50) = 0.54 mM). While the exact action of 2-deoxy-D-glucose on the parasite is subject to further verification, our data suggest that CpHK and the glycolytic pathway may be explored for developing anti-cryptosporidial therapeutics.

  4. In Vitro and In Vivo Activities of Sulfur-Containing Linear Bisphosphonates against Apicomplexan Parasites.


    Szajnman, Sergio H; Galaka, Tamila; Li, Zhu-Hong; Li, Catherine; Howell, Nathan M; Chao, María N; Striepen, Boris; Muralidharan, Vasant; Moreno, Silvia N J; Rodriguez, Juan B


    We tested a series of sulfur-containing linear bisphosphonates against Toxoplasma gondii, the etiologic agent of toxoplasmosis. The most potent compound (compound 22; 1-[(n-decylsulfonyl)ethyl]-1,1-bisphosphonic acid) is a sulfone-containing compound, which had a 50% effective concentration (EC50) of 0.11 ± 0.02 μM against intracellular tachyzoites. The compound showed low toxicity when tested in tissue culture with a selectivity index of >2,000. Compound 22 also showed high activity in vivo in a toxoplasmosis mouse model. The compound inhibited the Toxoplasma farnesyl diphosphate synthase (TgFPPS), but the concentration needed to inhibit 50% of the enzymatic activity (IC50) was higher than the concentration that inhibited 50% of growth. We tested compound 22 against two other apicomplexan parasites, Plasmodium falciparum (EC50 of 0.6 ± 0.01 μM), the agent of malaria, and Cryptosporidium parvum (EC50 of ∼65 μM), the agent of cryptosporidiosis. Our results suggest that compound 22 is an excellent novel compound that could lead to the development of potent agents against apicomplexan parasites.

  5. A Conserved Apicomplexan Microneme Protein Contributes to Toxoplasma gondii Invasion and Virulence

    PubMed Central

    Huynh, My-Hang; Boulanger, Martin J.


    The obligate intracellular parasite Toxoplasma gondii critically relies on host cell invasion during infection. Proteins secreted from the apical micronemes are central components for host cell recognition, invasion, egress, and virulence. Although previous work established that the sporozoite protein with an altered thrombospondin repeat (SPATR) is a micronemal protein conserved in other apicomplexan parasites, including Plasmodium, Neospora, and Eimeria, no genetic evidence of its contribution to invasion has been reported. SPATR contains a predicted epidermal growth factor domain and two thrombospondin type 1 repeats, implying a role in host cell recognition. In this study, we assess the contribution of T. gondii SPATR (TgSPATR) to T. gondii invasion by genetically ablating it and restoring its expression by genetic complementation. Δspatr parasites were ∼50% reduced in invasion compared to parental strains, a defect that was reversed in the complemented strain. In mouse virulence assays, Δspatr parasites were significantly attenuated, with ∼20% of mice surviving infection. Given the conservation of this protein among the Apicomplexa, we assessed whether the Plasmodium falciparum SPATR ortholog (PfSPATR) could complement the absence of the TgSPATR. Although PfSPATR showed correct micronemal localization, it did not reverse the invasion deficiency of Δspatr parasites, because of an apparent failure in secretion. Overall, the results suggest that TgSPATR contributes to invasion and virulence, findings that have implications for the many genera and life stages of apicomplexans that express SPATR. PMID:25092910

  6. The identification of a sequence related to apicomplexan enolase from Sarcocystis neurona.


    Wilson, A P; Thelen, J J; Lakritz, J; Brown, C R; Marsh, A E


    Equine protozoal myeloencephalitis (EPM) is a neurological disease caused by Sarcocystis neurona, an apicomplexan parasite. S. neurona is also associated with EPM-like diseases in marine and small mammals. The mechanisms of transmission and ability to infect a wide host range remain obscure; therefore, characterization of essential proteins may provide evolutionary information allowing the development of novel chemotherapeutics that target non-mammalian biochemical pathways. In the current study, two-dimensional electrophoresis and matrix-assisted laser desorption ionization-time of flight (MALDI-ToF) mass spectrometry were combined to characterize and identify an enolase protein from S. neurona based on peptide homology to the Toxoplasma gondii protein. Enolase is thought to be a vestigial, non-photosynthetic protein resulting from an evolutionary endosymbiosis event of an apicomplexan ancestor with green algae. Enolase has also been suggested to play a role in parasite stage conversion for T. gondii. Characterization of this protein in S. neurona and comparison to other protozoans indicate a biochemical similarity of S. neurona enolase to other tissue-cyst forming coccidians that cause encephalitis.

  7. 2,3,7,8-Tetrachlorodibenzo-p-dioxin induces premature activation of the KLF2 regulon during thymocyte development.


    McMillan, Brian J; McMillan, Susanne N; Glover, Ed; Bradfield, Christopher A


    The environmental pollutant 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD, dioxin) causes numerous and diverse toxic events via activation of the aryl hydrocarbon receptor, including atrophy of the thymus. Exposure to TCDD induces acute thymocyte cell loss, which occurs concomitantly with proliferation arrest and premature emigration of triple negative (TN; CD4(-), CD8(-), CD3(-)) T cell progenitors. In this report, we demonstrate that TCDD exposure results in dysregulation of KLF2 (Kruppel-like factor 2) expression in developing thymocytes. The Klf2 gene encodes an Sp1-like zinc finger transcription factor that functions as a central regulator of T lymphocyte proliferation and trafficking. During normal thymocyte development, KLF2 is expressed exclusively in CD4 and CD8 single positive T cells and promotes a nonproliferative, promigratory phenotype. In mice exposed to TCDD, however, the Klf2 gene is prematurely expressed in TN thymocytes. Administration of a 100 microg/kg dose of TCDD results in a approximately 15-fold induction of KLF2 as early as the TN2 (CD44(+), CD25(+)) stage of development and immediately precedes acute cell loss in the TN3, TN4, and double positive (CD4(+), CD8(+)) cell stages. Induction of KLF2 occurs within 12 h of TCDD exposure and is fully dependent on expression of the aryl hydrocarbon receptor. In addition, TCDD exposure alters the expression of several factors comprising the KLF2 regulon, including Edg1/S1P(1), beta(7) integrin, CD52, Cdkn2d (cyclin-dependent kinase inhibitor 2D), s100a4, and IL10R alpha. These findings indicate that the pollutant TCDD interferes with early thymopoeisis via ectopic expression of the KLF2 regulon.

  8. Identified members of the Streptomyces lividans AdpA regulon involved in differentiation and secondary metabolism

    PubMed Central


    Background AdpA is a key transcriptional regulator involved in the complex growth cycle of Streptomyces. Streptomyces are Gram-positive bacteria well-known for their production of secondary metabolites and antibiotics. Most work on AdpA has been in S. griseus, and little is known about the pathways it controls in other Streptomyces spp. We recently discovered interplay between ClpP peptidases and AdpA in S. lividans. Here, we report the identification of genes directly regulated by AdpA in S. lividans. Results Microarray experiments revealed that the expression of hundreds of genes was affected in a S. lividans adpA mutant during early stationary phase cultures in YEME liquid medium. We studied the expression of the S. lividans AdpA-regulated genes by quantitative real-time PCR analysis after various times of growth. In silico analysis revealed the presence of potential AdpA-binding sites upstream from these genes; electrophoretic mobility shift assays indicated that AdpA binds directly to their promoter regions. This work identifies new pathways directly controlled by AdpA and that are involved in S. lividans development (ramR, SLI7885 also known as hyaS and SLI6586), and primary (SLI0755-SLI0754 encoding CYP105D5 and Fdx4) or secondary (cchA, cchB, and hyaS) metabolism. Conclusions We characterised six S. lividans AdpA-dependent genes whose expression is directly activated by this pleiotropic regulator. Several of these genes are orthologous to bldA-dependent genes in S. coelicolor. Furthermore, in silico analysis suggests that over hundred genes may be directly activated or repressed by S. lividans AdpA, although few have been described as being part of any Streptomyces AdpA regulons. This study increases the number of known AdpA-regulated pathways in Streptomyces spp. PMID:24694298

  9. Modulation of hexa-acyl pyrophosphate lipid A population under Escherichia coli phosphate (Pho) regulon activation.


    Lamarche, Martin G; Kim, Sang-Hyun; Crépin, Sébastien; Mourez, Michael; Bertrand, Nicolas; Bishop, Russell E; Dubreuil, J Daniel; Harel, Josée


    Environmental phosphate is an important signal for microorganism gene regulation, and it has recently been shown to trigger some key bacterial virulence mechanisms. In many bacteria, the Pho regulon is the major circuit involved in adaptation to phosphate limitation. The Pho regulon is controlled jointly by the two-component regulatory system PhoR/PhoB and by the phosphate-specific transport (Pst) system, which both belong to the Pho regulon. We showed that a pst mutation results in virulence attenuation in extraintestinal pathogenic Escherichia coli (ExPEC) strains. Our results indicate that the bacterial cell surface of the pst mutants is altered. In this study, we show that pst mutants of ExPEC strains display an increased sensitivity to different cationic antimicrobial peptides and vancomycin. Remarkably, the hexa-acylated 1-pyrophosphate form of lipid A is significantly less abundant in pst mutants. Among differentially expressed genes in the pst mutant, lpxT coding for an enzyme that transfers a phosphoryl group to lipid A, forming the 1-diphosphate species, was found to be downregulated. Our results strongly suggest that the Pho regulon is involved in lipid A modifications, which could contribute to bacterial surface perturbations. Since the Pho regulon and the Pst system are conserved in many bacteria, such a lipid A modification mechanism could be widely distributed among gram-negative bacterial species.

  10. Bacterial Regulon Evolution: Distinct Responses and Roles for the Identical OmpR Proteins of Salmonella Typhimurium and Escherichia coli in the Acid Stress Response

    PubMed Central

    Quinn, Heather J.; Cameron, Andrew D. S.; Dorman, Charles J.


    The evolution of new gene networks is a primary source of genetic innovation that allows bacteria to explore and exploit new niches, including pathogenic interactions with host organisms. For example, the archetypal DNA binding protein, OmpR, is identical between Salmonella Typhimurium serovar Typhimurium and Escherichia coli, but regulatory specialization has resulted in different environmental triggers of OmpR expression and largely divergent OmpR regulons. Specifically, ompR mRNA and OmpR protein levels are elevated by acid pH in S. Typhimurium but not in E. coli. This differential expression pattern is due to differences in the promoter regions of the ompR genes and the E. coli ompR orthologue can be made acid-inducible by introduction of the appropriate sequences from S. Typhimurium. The OmpR regulon in S. Typhimurium overlaps that of E. coli at only 15 genes and includes many horizontally acquired genes (including virulence genes) that E. coli does not have. We found that OmpR binds to its genomic targets in higher abundance when the DNA is relaxed, something that occurs in S. Typhimurium as a result of acid stress and which is a requirement for optimal expression of its virulence genes. The genomic targets of OmpR do not share a strong nucleotide sequence consensus: we propose that the ability of OmpR to recruit additional genes to its regulon arises from its modest requirements for specificity in its DNA targets with its preference for relaxed DNA allowing it to cooperate with DNA-topology-based allostery to modulate transcription in response to acid stress. PMID:24603618

  11. Comparative genomics of transcriptional regulation of methionine metabolism in proteobacteria

    SciTech Connect

    Leyn, Semen A.; Suvorova, Inna A.; Kholina, Tatiana D.; Sherstneva, Sofia S.; Novichkov, Pavel S.; Gelfand, Mikhail S.; Rodionov, Dmitry A.; Kuipers, Oscar P.


    Methionine metabolism and uptake genes in Proteobacteria are controlled by a variety of RNA and DNA regulatory systems. We have applied comparative genomics to reconstruct regulons for three known transcription factors, MetJ, MetR, and SahR, and three known riboswitch motifs, SAH, SAM-SAH, and SAM_alpha, in ~200 genomes from 22 taxonomic groups of Proteobacteria. We also identified two novel regulons: a SahR-like transcription factor SamR controlling various methionine biosynthesis genes in the Xanthomonadales group, and a potential RNA regulatory element with terminator-antiterminator mechanism controlling the metX or metZ genes in beta-proteobacteria. For each analyzed regulator we identified the core, taxon-specific and genome-specific regulon members. By analyzing the distribution of these regulators in bacterial genomes and by comparing their regulon contents we elucidated possible evolutionary scenarios for the regulation of the methionine metabolism genes in Proteobacteria.

  12. Comparative genomics of transcriptional regulation of methionine metabolism in proteobacteria


    Leyn, Semen A.; Suvorova, Inna A.; Kholina, Tatiana D.; ...


    Methionine metabolism and uptake genes in Proteobacteria are controlled by a variety of RNA and DNA regulatory systems. We have applied comparative genomics to reconstruct regulons for three known transcription factors, MetJ, MetR, and SahR, and three known riboswitch motifs, SAH, SAM-SAH, and SAM_alpha, in ~200 genomes from 22 taxonomic groups of Proteobacteria. We also identified two novel regulons: a SahR-like transcription factor SamR controlling various methionine biosynthesis genes in the Xanthomonadales group, and a potential RNA regulatory element with terminator-antiterminator mechanism controlling the metX or metZ genes in beta-proteobacteria. For each analyzed regulator we identified the core, taxon-specific andmore » genome-specific regulon members. By analyzing the distribution of these regulators in bacterial genomes and by comparing their regulon contents we elucidated possible evolutionary scenarios for the regulation of the methionine metabolism genes in Proteobacteria.« less

  13. Control of the arabinose regulon in Bacillus subtilis by AraR in vivo: crucial roles of operators, cooperativity, and DNA looping.


    Mota, L J; Sarmento, L M; de Sá-Nogueira, I


    The proteins involved in the utilization of L-arabinose by Bacillus subtilis are encoded by the araABDLMNPQ-abfA metabolic operon and by the araE/araR divergent unit. Transcription from the ara operon, araE transport gene, and araR regulatory gene is induced by L-arabinose and negatively controlled by AraR. The purified AraR protein binds cooperatively to two in-phase operators within the araABDLMNPQ-abfA (OR(A1) and OR(A2)) and araE (OR(E1) and OR(E2)) promoters and noncooperatively to a single operator in the araR (OR(R3)) promoter region. Here, we have investigated how AraR controls transcription from the ara regulon in vivo. A deletion analysis of the ara promoters region showed that the five AraR binding sites are the key cis-acting regulatory elements of their corresponding genes. Furthermore, OR(E1)-OR(E2) and OR(R3) are auxiliary operators for the autoregulation of araR and the repression of araE, respectively. Analysis of mutations designed to prevent cooperative binding of AraR showed that in vivo repression of the ara operon requires communication between repressor molecules bound to two properly spaced operators. This communication implicates the formation of a small loop by the intervening DNA. In an in vitro transcription system, AraR alone sufficed to abolish transcription from the araABDLMNPQ-abfA operon and araE promoters, strongly suggesting that it is the major protein involved in the repression mechanism of L-arabinose-inducible expression in vivo. The ara regulon is an example of how the architecture of the promoters is adapted to respond to the particular characteristics of the system, resulting in a tight and flexible control.

  14. Characterization of the CpxRA regulon in Haemophilus ducreyi.


    Labandeira-Rey, Maria; Brautigam, Chad A; Hansen, Eric J


    The Haemophilus ducreyi 35000HP genome encodes a homolog of the CpxRA two-component cell envelope stress response system originally characterized in Escherichia coli. CpxR, the cytoplasmic response regulator, was shown previously to be involved in repression of the expression of the lspB-lspA2 operon (M. Labandeira-Rey, J. R. Mock, and E. J. Hansen, Infect. Immun. 77:3402-3411, 2009). In the present study, the H. ducreyi CpxR and CpxA proteins were shown to closely resemble those of other well-studied bacterial species. A cpxA deletion mutant and a CpxR-overexpressing strain were used to explore the extent of the CpxRA regulon. DNA microarray and real-time reverse transcriptase (RT) PCR analyses indicated several potential regulatory targets for the H. ducreyi CpxRA two-component regulatory system. Electrophoretic mobility shift assays (EMSAs) were used to prove that H. ducreyi CpxR interacted with the promoter regions of genes encoding both known and putative virulence factors of H. ducreyi, including the lspB-lspA2 operon, the flp operon, and dsrA. Interestingly, the use of EMSAs also indicated that H. ducreyi CpxR did not bind to the promoter regions of several genes predicted to encode factors involved in the cell envelope stress response. Taken together, these data suggest that the CpxRA system in H. ducreyi, in contrast to that in E. coli, may be involved primarily in controlling expression of genes not involved in the cell envelope stress response.

  15. Transcriptional Regulation of Carbohydrate Utilization Pathways in the Bifidobacterium Genus.


    Khoroshkin, Matvei S; Leyn, Semen A; Van Sinderen, Douwe; Rodionov, Dmitry A


    Bifidobacteria, which represent common commensals of mammalian gut, are believed to have positive effects on human health. The influence of certain non-digestible carbohydrates (and their use as so-called prebiotics) on growth and metabolic activity of bifidobacteria is of increasing interest; however, mechanisms of transcriptional control of carbohydrate metabolism are poorly understood in these species. We used a comparative genomics approach to reconstruct carbohydrate utilization pathways and transcriptional regulons in 10 Bifidobacterium genomes. Analysis of regulatory gene regions revealed candidate DNA motifs and reconstructed regulons for 268 transcription factors from the LacI, ROK, DeoR, AraC, GntR, and TetR families that form 64 orthologous groups of regulators. Most of the reconstructed regulons are local and control specific catabolic pathways for host- and diet-derived glycans and monosaccharides. Mosaic distributions of many of these local regulators across Bifidobacterium species correlate with distribution of corresponding catabolic pathways. In contrast, the maltose, galactose, sucrose, and fructose regulons, as well as a novel global LacI-family regulator that is predicted to control the central carbohydrate metabolism and arabinose catabolism genes, are universally present in all 10 studied bifidobacteria. A novel group of TetR-family regulators presumably controls the glucoside and galactoside utilization pathways. Paralogs of the ribose repressor RbsR control the pyrimidine nucleoside utilization genes. Multiple paralogs of the maltose regulator MalR co-regulate large sets of genes involved in maltodextrin utilization. The inferred metabolic regulons provide new insights on diverse carbohydrate utilization networks in bifidobacteria that can be employed in metabolic modeling, phenotype prediction and the rational development of novel prebiotics.

  16. Transcriptional Regulation of Carbohydrate Utilization Pathways in the Bifidobacterium Genus

    PubMed Central

    Khoroshkin, Matvei S.; Leyn, Semen A.; Van Sinderen, Douwe; Rodionov, Dmitry A.


    Bifidobacteria, which represent common commensals of mammalian gut, are believed to have positive effects on human health. The influence of certain non-digestible carbohydrates (and their use as so-called prebiotics) on growth and metabolic activity of bifidobacteria is of increasing interest; however, mechanisms of transcriptional control of carbohydrate metabolism are poorly understood in these species. We used a comparative genomics approach to reconstruct carbohydrate utilization pathways and transcriptional regulons in 10 Bifidobacterium genomes. Analysis of regulatory gene regions revealed candidate DNA motifs and reconstructed regulons for 268 transcription factors from the LacI, ROK, DeoR, AraC, GntR, and TetR families that form 64 orthologous groups of regulators. Most of the reconstructed regulons are local and control specific catabolic pathways for host- and diet-derived glycans and monosaccharides. Mosaic distributions of many of these local regulators across Bifidobacterium species correlate with distribution of corresponding catabolic pathways. In contrast, the maltose, galactose, sucrose, and fructose regulons, as well as a novel global LacI-family regulator that is predicted to control the central carbohydrate metabolism and arabinose catabolism genes, are universally present in all 10 studied bifidobacteria. A novel group of TetR-family regulators presumably controls the glucoside and galactoside utilization pathways. Paralogs of the ribose repressor RbsR control the pyrimidine nucleoside utilization genes. Multiple paralogs of the maltose regulator MalR co-regulate large sets of genes involved in maltodextrin utilization. The inferred metabolic regulons provide new insights on diverse carbohydrate utilization networks in bifidobacteria that can be employed in metabolic modeling, phenotype prediction and the rational development of novel prebiotics. PMID:26903998

  17. The Listeria monocytogenes σB Regulon and Its Virulence-Associated Functions Are Inhibited by a Small Molecule

    PubMed Central

    Palmer, M. Elizabeth; Chaturongakul, Soraya; Wiedmann, Martin; Boor, Kathryn J.


    ABSTRACT The stress-responsive alternative sigma factor σB is conserved across diverse Gram-positive bacterial genera. In Listeria monocytogenes, σB regulates transcription of >150 genes, including genes contributing to virulence and to bacterial survival under host-associated stress conditions, such as those encountered in the human gastrointestinal lumen. An inhibitor of L. monocytogenes σB activity was identified by screening ~57,000 natural and synthesized small molecules using a high-throughput cell-based assay. The compound fluoro-phenyl-styrene-sulfonamide (FPSS) (IC50 = 3.5 µM) downregulated the majority of genes previously identified as members of the σB regulon in L. monocytogenes 10403S, thus generating a transcriptional profile comparable to that of a 10403S ΔsigB strain. Specifically, of the 208 genes downregulated by FPSS, 75% had been identified previously as positively regulated by σB. Downregulated genes included key virulence and stress response genes, such as inlA, inlB, bsh, hfq, opuC, and bilE. From a functional perspective, FPSS also inhibited L. monocytogenes invasion of human intestinal epithelial cells and bile salt hydrolase activity. The ability of FPSS to inhibit σB activity in both L. monocytogenes and Bacillus subtilis indicates its utility as a specific inhibitor of σB across multiple Gram-positive genera. PMID:22128349

  18. The oxidative stress response in yeast cells involves changes in the stability of Aft1 regulon mRNAs.


    Castells-Roca, Laia; Mühlenhoff, Ulrich; Lill, Roland; Herrero, Enrique; Bellí, Gemma


    Saccharomyces cerevisiae can import iron through a high-affinity system consisting of the Ftr1/Fet3-mediated reductive pathway and the siderophore-mediated non-reductive one. Expression of components of the high-affinity system is controlled by the Aft1 transcriptional factor. In this study we show that, upon oxidative stress, Aft1 is transitorily internalized into the nucleus, followed by transcription activation of components of its regulon. In these conditions, the mRNA levels of the genes of the non-reductive pathway become increased, while those of FTR1 and FET3 remain low because of destabilization of the mRNAs. Consequently, the respective protein levels also remain low. Such mRNA destabilization is mediated by the general 5'-3' mRNA decay pathway and is independent of the RNA binding protein Cth2. Yeast cells are hypersensitive to peroxides in growth conditions where only the high-affinity reductive pathway is functional for iron assimilation. On the contrary, peroxide does not affect growth when iron uptake occurs exclusively through the non-reductive pathway. This reinforces the idea that upon oxidative stress S. cerevisiae cells redirect iron assimilation through the non-reductive pathway to minimize oxidative damage by the ferrous ions, which are formed during iron import through the Ftr1/Fet3 complexes.

  19. Divergent Regulation of CBF Regulon on Cold Tolerance and Plant Phenotype in Cassava Overexpressing Arabidopsis CBF3 Gene

    PubMed Central

    An, Dong; Ma, Qiuxiang; Yan, Wei; Zhou, Wenzhi; Liu, Guanghua; Zhang, Peng


    Cassava is a tropical origin plant that is sensitive to chilling stress. In order to understand the CBF cold response pathway, a well-recognized regulatory mechanism in temperate plants, in cassava, overexpression of an Arabidopsis CBF3 gene is studied. This gene renders cassava increasingly tolerant to cold and drought stresses but is associated with retarded plant growth, leaf curling, reduced storage root yield, and reduced anthocyanin accumulation in a transcript abundance-dependent manner. Physiological analysis revealed that the transgenic cassava increased proline accumulation, reduced malondialdehyde production, and electrolyte leakage under cold stress. These transgenic lines also showed high relative water content when faced with drought. The expression of partial CBF-targeted genes in response to cold displayed temporal and spatial variations in the wild-type and transgenic plants: highly inducible in leaves and less altered in apical buds. In addition, anthocyanin accumulation was inhibited by downregulating the expression of genes involved in its biosynthesis and by interplaying between the CBF3 and the endogenous transcription factors. Thus, the heterologous CBF3 modulates the expression of stress-related genes and carries out a series of physiological adjustments under stressful conditions, showing a varied regulation pattern of CBF regulon from that of cassava CBFs. PMID:27999588

  20. Evaluation of the virulence of Xanthomonas campestris pv. campestris mutant strains lacking functional genes in the OxyR regulon.


    Charoenlap, Nisanart; Buranajitpakorn, Sarinya; Duang-Nkern, Jintana; Namchaiw, Poommaree; Vattanaviboon, Paiboon; Mongkolsuk, Skorn


    Xanthomonas campestris pv. campestris causes black rot in cruciferous crops. Hydrogen peroxide (H(2)O(2)) production and accumulation is an important initial response in plant defense against invading microbes. The role of genes involved in the bacterial H(2)O(2) protection system in pathogenicity was evaluated. Mutants of katA (encoding a monofunctional catalase) and, to a lesser extent, katG (encoding a catalase-peroxidase) and oxyR (encoding a H(2)O(2) sensor and a transcription regulator), are hypersensitive to H(2)O(2) treatments that mimic the plant H(2)O(2) burst. These data correlate with the results of pathogenicity testing that show katA, katG, and oxyR mutants are avirulent on a compatible plant. Moreover, exposure to H(2)O(2) (1, 2, and 4 mM) highly induces the expression of genes in the OxyR regulon, including katA, katG, and ahpC. The avirulent phenotype of the oxyR mutant is partly because of its inability to mount an adaptive response upon exposure to an H(2)O(2) burst. Our data provide insights into important roles of a transcription regulator and other genes involved in peroxide stress protection in the virulence of X. campestris pv. campestris.

  1. Proteomic Analysis of the Quorum-Sensing Regulon in Pantoea stewartii and Identification of Direct Targets of EsaR

    PubMed Central

    Ramachandran, Revathy


    The proteobacterium Pantoea stewartii subsp. stewartii causes Stewart's wilt disease in maize when it colonizes the xylem and secretes large amounts of stewartan, an exopolysaccharide. The success of disease pathogenesis lies in the timing of bacterial virulence factor expression through the different stages of infection. Regulation is achieved through a quorum-sensing (QS) system consisting of the acyl-homoserine lactone (AHL) synthase, EsaI, and the transcription regulator EsaR. At low cell densities, EsaR represses transcription of itself and of rcsA, an activator of the stewartan biosynthesis operon; it also activates esaS, which encodes a small RNA (sRNA). Repression or activation ceases at high cell densities when EsaI synthesizes sufficient levels of the AHL ligand N-3-oxo-hexanoyl-l-homoserine lactone to bind and inactivate EsaR. This study aims to identify other genes activated or repressed by EsaR during the QS response. Proteomic analysis identified a QS regulon of more than 30 proteins. Electrophoretic mobility shift assays of promoters of genes encoding differentially expressed proteins distinguished direct targets of EsaR from indirect targets. Additional quantitative reverse transcription-PCR (qRT-PCR) and DNA footprinting analysis established that EsaR directly regulates the promoters of dkgA, glpF, and lrhA. The proteins encoded by dkgA, glpF, and lrhA are a 2,5-diketogluconate reductase, glycerol facilitator, and transcriptional regulator of chemotaxis and motility, respectively, indicating a more global QS response in P. stewartii than previously recognized. PMID:23913428

  2. Investigation of the malE promoter and MalR, a positive regulator of the maltose regulon, for an improved expression system in Sulfolobus acidocaldarius.


    Wagner, Michaela; Wagner, Alexander; Ma, Xiaoqing; Kort, Julia Christin; Ghosh, Abhrajyoti; Rauch, Bernadette; Siebers, Bettina; Albers, Sonja-Verena


    In this study, the regulator MalR (Saci_1161) of the TrmB family from Sulfolobus acidocaldarius was identified and was shown to be involved in transcriptional control of the maltose regulon (Saci_1660 to Saci_1666), including the ABC transporter (malEFGK), α-amylase (amyA), and α-glycosidase (malA). The ΔmalR deletion mutant exhibited a significantly decreased growth rate on maltose and dextrin but not on sucrose. The expression of the genes organized in the maltose regulon was induced only in the presence of MalR and maltose in the growth medium, indicating that MalR, in contrast to its TrmB and TrmB-like homologues, is an activator of the maltose gene cluster. Electrophoretic mobility shift assays revealed that the binding of MalR to malE was independent of sugars. Here we report the identification of the archaeal maltose regulator protein MalR, which acts as an activator and controls the expression of genes involved in maltose transport and metabolic conversion in S. acidocaldarius, and its use for improvement of the S. acidocaldarius expression system under the control of an optimized maltose binding protein (malE) promoter by promoter mutagenesis.

  3. The proteasome stress regulon is controlled by a pair of NAC transcription factors in arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Proteotoxic stress is mitigated by a variety of mechanisms, including activation of the unfolded protein response and co-ordinated increases in protein chaperones and activities that direct proteolysis such as the 26S proteasome. Using RNA-seq analyses combined with either chemical inhibitors or mut...

  4. The proteasome stress regulon is controlled by a pair of NAC transcription factors in arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Proteotoxic stress is mitigated by a variety of mechanisms, including activation of the unfolded protein response and coordinated increases in protein chaperones and activities that direct proteolysis such as the 26S proteasome. Using RNA-seq analyses combined with either chemical inhibitors or mut...

  5. Quantitative and temporal definition of the Mla transcriptional regulon during barley-powdery mildew interactions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Barley Mildew resistance locus a (Mla) is a major determinant of immunity to the powdery mildew pathogen, Blumeria graminis f. sp. hordei. Alleles of Mla encode cytoplasmic- and membrane-localized coiled-coil, nucleotide binding site, leucine-rich repeat proteins that mediate resistance when complem...

  6. The MetJ regulon in gammaproteobacteria determined by comparative genomics methods

    PubMed Central


    Background Whole-genome sequencing of bacteria has proceeded at an exponential pace but annotation validation has lagged behind. For instance, the MetJ regulon, which controls methionine biosynthesis and transport, has been studied almost exclusively in E. coli and Salmonella, but homologs of MetJ exist in a variety of other species. These include some that are pathogenic (e.g. Yersinia) and some that are important for environmental remediation (e.g. Shewanella) but many of which have not been extensively characterized in the literature. Results We have determined the likely composition of the MetJ regulon in all species which have MetJ homologs using bioinformatics techniques. We show that the core genes known from E. coli are consistently regulated in other species, and we identify previously unknown members of the regulon. These include the cobalamin transporter, btuB; all the genes involved in the methionine salvage pathway; as well as several enzymes and transporters of unknown specificity. Conclusions The MetJ regulon is present and functional in five orders of gammaproteobacteria: Enterobacteriales, Pasteurellales, Vibrionales, Aeromonadales and Alteromonadales. New regulatory activity for MetJ was identified in the genomic data and verified experimentally. This strategy should be applicable for the elucidation of regulatory pathways in other systems by using the extensive sequencing data currently being generated. PMID:22082356

  7. Role of dihydroxyacetone kinases I and II in the dha regulon of Klebsiella pneumoniae.


    Wei, Dong; Wang, Min; Jiang, Biao; Shi, Jiping; Hao, Jian


    Dha regulon is responsible for anaerobic glycerol metabolism and 1,3-propanediol production in Klebsiella pneumoniae. DhaK encodes an ATP-dependent dihydroxyacetone kinase I, whereas dhaK123 encodes a dihydroxyacetone kinase II that uses phosphoenolpyruvate as a phosphate donor. The functions of dihydroxyacetone kinases I and II in K. pneumoniae have not been discriminated. In this study, four individual genes of the two kinases were knocked out, and the metabolic characteristics of these mutants were investigated. DhaK1 or dhaK2 mutation inhibited dha regulon expression. DhaK3 mutation reduced glycerol utilization, and the growth was slower than the wild stain. However, dhaK mutation exerted no significant effects on glycerol metabolism. The metabolic characteristics of these mutants showed that the subunits of dihydroxyacetone kinase II were involved in the regulation of dha regulon expression, similar to the dha regulon of E. coli. Dihydroxyacetone kinase II catalyzed dihydroxyacetone conversion to dihydroxyacetone phosphate, whereas dihydroxyacetone kinase I showed no significant contribution to this reaction.

  8. Transcriptome-based identification of the Sinorhizobium meliloti NodD1 regulon.


    Capela, Delphine; Carrere, Sébastien; Batut, Jacques


    The NodD1 regulon of Sinorhizobium meliloti was determined through the analysis of the S. meliloti transcriptome in response to the plant flavone luteolin and the overexpression of nodD1. Nine new genes regulated by both NodD1 and luteolin were identified, demonstrating that NodD1 controls few functions behind nodulation in S. meliloti.

  9. Global regulatory networks control the hrp regulon of the gall-forming bacterium Pantoea agglomerans pv. gypsophilae.


    Panijel, Mary; Chalupowicz, Laura; Sessa, Guido; Manulis-Sasson, Shulamit; Barash, Isaac


    Gall formation by Pantoea agglomerans pv. gypsophilae is dependent on the hypersensitive response and pathogenicity (hrp) system. Previous studies demonstrated that PagR and PagI, regulators of the quorum-sensing system, induce expression of the hrp regulatory cascade (i.e., hrpXY, hrpS, and hrpL) that activates the HrpL regulon. Here, we isolated the genes of the Gac/Rsm global regulatory pathway (i.e., gacS, gacA, rsmB, and csrD) and of the post-transcriptional regulator rsmA. Our results demonstrate that PagR and PagI also upregulate expression of the Gac/Rsm pathway. PagR acts as a transcriptional activator of each of the hrp regulatory genes and gacA in a N-butanoyl-L-homoserine lactone-dependent manner as shown by gel shift experiments. Mutants of the Gac/Rsm genes or overexpression of rsmA significantly reduced Pantoea agglomerans virulence and colonization of gypsophila. Overexpression of rsmB sRNA abolished gall formation, colonization, and hypersensitive reaction on nonhost plants and prevented transcription of the hrp regulatory cascade, indicating a lack of functional type III secretion system. Expression of rsmB sRNA in the background of the csrD null mutant suggests that CsrD may act as a safeguard for preventing excessive production of rsmB sRNA. Results presented indicate that the hrp regulatory cascade is controlled directly by PagR and indirectly by RsmA, whereas deficiency in RsmA activity is epistatic to PagR induction.

  10. Characterization of the RelBbu Regulon in Borrelia burgdorferi Reveals Modulation of Glycerol Metabolism by (p)ppGpp.


    Bugrysheva, Julia V; Pappas, Christopher J; Terekhova, Darya A; Iyer, Radha; Godfrey, Henry P; Schwartz, Ira; Cabello, Felipe C


    The bacterial stringent response is triggered by deficiencies of available nutrients and other environmental stresses. It is mediated by 5'-triphosphate-guanosine-3'-diphosphate and 5'-diphosphate-guanosine-3'-diphosphate (collectively (p)ppGpp) and generates global changes in gene expression and metabolism that enable bacteria to adapt to and survive these challenges. Borrelia burgdorferi encounters multiple stressors in its cycling between ticks and mammals that could trigger the stringent response. We have previously shown that the B. burgdorferi stringent response is mediated by a single enzyme, RelBbu, with both (p)ppGpp synthase and hydrolase activities, and that a B. burgdorferi 297 relBbu null deletion mutant was defective in adapting to stationary phase, incapable of down-regulating synthesis of rRNA and could not infect mice. We have now used this deletion mutant and microarray analysis to identify genes comprising the rel regulon in B. burgdorferi cultured at 34°C, and found that transcription of genes involved in glycerol metabolism is induced by relBbu. Culture of the wild type parental strain, the relBbu deletion mutant and its complemented derivative at 34°C and 25°C in media containing glucose or glycerol as principal carbon sources revealed a growth defect in the mutant, most evident at the lower temperature. Transcriptional analysis of the glp operon for glycerol uptake and metabolism in these three strains confirmed that relBbu was necessary and sufficient to increase transcription of this operon in the presence of glycerol at both temperatures. These results confirm and extend previous findings regarding the stringent response in B. burgdorferi. They also demonstrate that the stringent response regulates glycerol metabolism in this organism and is likely crucial for its optimal growth in ticks.

  11. Holding back the microfilament--structural insights into actin and the actin-monomer-binding proteins of apicomplexan parasites.


    Olshina, Maya A; Wong, Wilson; Baum, Jake


    Parasites from the phylum Apicomplexa are responsible for several major diseases of man, including malaria and toxoplasmosis. These highly motile protozoa use a conserved actomyosin-based mode of movement to power tissue traversal and host cell invasion. The mode termed as 'gliding motility' relies on the dynamic turnover of actin, whose polymerisation state is controlled by a markedly limited number of identifiable regulators when compared with other eukaryotic cells. Recent studies of apicomplexan actin regulator structure-in particular those of the core triad of monomer-binding proteins, actin-depolymerising factor/cofilin, cyclase-associated protein/Srv2, and profilin-have provided new insights into possible mechanisms of actin regulation in parasite cells, highlighting divergent structural features and functions to regulators from other cellular systems. Furthermore, the unusual nature of apicomplexan actin itself is increasingly coming into the spotlight. Here, we review recent advances in understanding of the structure and function of actin and its regulators in apicomplexan parasites. In particular we explore the paradox between there being an abundance of unpolymerised actin, its having a seemingly increased potential to form filaments relative to vertebrate actin, and the apparent lack of visible, stable filaments in parasite cells.

  12. Towards a molecular understanding of the apicomplexan actin motor: on a road to novel targets for malaria remedies?

    SciTech Connect

    Kumpula, Esa-Pekka; Kursula, Inari


    In this review, current structural understanding of the apicomplexan glideosome and actin regulation is described. Apicomplexan parasites are the causative agents of notorious human and animal diseases that give rise to considerable human suffering and economic losses worldwide. The most prominent parasites of this phylum are the malaria-causing Plasmodium species, which are widespread in tropical and subtropical regions, and Toxoplasma gondii, which infects one third of the world’s population. These parasites share a common form of gliding motility which relies on an actin–myosin motor. The components of this motor and the actin-regulatory proteins in Apicomplexa have unique features compared with all other eukaryotes. This, together with the crucial roles of these proteins, makes them attractive targets for structure-based drug design. In recent years, several structures of glideosome components, in particular of actins and actin regulators from apicomplexan parasites, have been determined, which will hopefully soon allow the creation of a complete molecular picture of the parasite actin–myosin motor and its regulatory machinery. Here, current knowledge of the function of this motor is reviewed from a structural perspective.

  13. The Copper-Responsive RicR Regulon Contributes to Mycobacterium tuberculosis Virulence

    PubMed Central

    Shi, Xiaoshan; Festa, Richard A.; Ioerger, Thomas R.; Butler-Wu, Susan; Sacchettini, James C.; Darwin, K. Heran; Samanovic, Marie I.


    ABSTRACT As with most life on Earth, the transition metal copper (Cu) is essential for the viability of the human pathogen Mycobacterium tuberculosis. However, infected hosts can also use Cu to control microbial growth. Several Cu-responsive pathways are present in M. tuberculosis, including the regulated in copper repressor (RicR) regulon, which is unique to pathogenic mycobacteria. In this work, we describe the contribution of each RicR-regulated gene to Cu resistance in vitro and to virulence in animals. We found that the deletion or disruption of individual RicR-regulated genes had no impact on virulence in mice, although several mutants had Cu hypersensitivity. In contrast, a mutant unable to activate the RicR regulon was not only highly susceptible to Cu but also attenuated in mice. Thus, these data suggest that several genes of the RicR regulon are required simultaneously to combat Cu toxicity in vivo or that this regulon is also important for resistance against Cu-independent mechanisms of host defense. IMPORTANCE Mycobacterium tuberculosis is the causative agent of tuberculosis, killing millions of people every year. Therefore, understanding the biology of M. tuberculosis is crucial for the development of new therapies to treat this devastating disease. Our studies reveal that although host-supplied Cu can suppress bacterial growth, M. tuberculosis has a unique pathway, the RicR regulon, to defend against Cu toxicity. These findings suggest that Cu homeostasis pathways in both the host and the pathogen could be exploited for the treatment of tuberculosis. PMID:24549843

  14. Cell: sporozoite interactions and invasion by apicomplexan parasites of the genus Eimeria.


    Augustine, P C


    The site specificity that avian Eimeria sporozoites and, to a more limited degree, other apicomplexan parasites exhibit for invasion in vivo suggests that specific interactions between the sporozoites and the target host cells may mediate the invasion process. Although sporozoite motility and structural and secreted antigens appear to provide the mechanisms for propelling the sporozoite into the host cell,there is a growing body of evidence that the host cell provides characteristics by which the sporozoites recognise and interact with the host cell as a prelude to invasion. Molecules on the surface of cells in the intestinal epithelium, that act as receptor or recognition sites for sporozoite invasion, may be included among these characteristics. The existence of receptor molecules for invasion by apicomplexan parasites was suggested by in vitro studies in which parasite invasion was inhibited in cultured cells that were treated with a variety of substances designed to selectively alter the host cell membrane. These substance included cationic compounds or molecules, enzymes that cleave specific linkages, protease inhibitors, monoclonal antibodies, etc. More specific evidence for the presence of receptors was provided by the binding of parasite antigens to specific host cell surface molecules. Analyses of host cells have implicated 22, 31, and 37 kDa antigens, surface membrane glycoconjugates,conserved epitopes of host cells and sporozoites, etc., but no treatment that perturbs these putative receptors has completely inhibited invasion of the cells by parasites. Regardless of the mechanism,sporozoites of the avian Eimeria also invade the same specific sites in foreign host birds that they invade in the natural host. Thus, site specificity for invasion may be a response to characteristics of the intestine that are shared by a number of hosts rather than to a unique trait of the natural host. Protective immunity elicited against avian Eimeria species is not

  15. Characterization of the regulon controlled by the leucine-responsive regulatory protein in Escherichia coli.

    PubMed Central

    Ernsting, B R; Atkinson, M R; Ninfa, A J; Matthews, R G


    The leucine-responsive regulatory protein (Lrp) has been shown to regulate, either positively or negatively, the transcription of several Escherichia coli genes in response to leucine. We have used two-dimensional gel electrophoresis to analyze the patterns of polypeptide expression in isogenic lrp+ and lrp mutant strains in the presence or absence of leucine. The absence of a functional Lrp protein alters the expression of at least 30 polypeptides. The expression of the majority of these polypeptides is not affected by the presence or absence of 10 mM exogenous leucine. Outer membrane porins OmpC and OmpF, glutamine synthetase (GlnA), the small subunit of glutamate synthase (GltD), lysyl-tRNA synthetase form II (LysU), a high-affinity periplasmic binding protein specific for branched-chain amino acids (LivJ), W protein, and the enzymes of the pathway converting threonine to glycine, namely, threonine dehydrogenase (Tdh) and 2-amino-3-ketobutyrate coenzyme A ligase (Kbl), were identified as members of the Lrp regulon by electrophoretic analysis. We have shown that Lrp is a positive regulator of glutamate synthase and glutamine synthetase and that exogenous leucine has little or no effect on the expression of these proteins. In strains carrying a glnL deletion and in strains carrying the glnL2302 allele, which directs the synthesis of a GlnL protein that is constitutively active, expression of glutamine synthetase is no longer regulated by Lrp, demonstrating that the effect of Lrp on glutamine synthetase levels is indirect and requires an intact glnL gene. lrp::Tn10 strains grow poorly when arginine or ornithine is present as the sole nitrogen source in the medium. On the bases of present studies and previous research, we propose that Lrp is involved in the adaptation of E. coli cells to major shifts in environment, such as those which occur when E. coli leaves the intestinal tract of its animal host. Several genes required for amino acid and peptide transport and

  16. The pst operon of Bacillus subtilis has a phosphate-regulated promoter and is involved in phosphate transport but not in regulation of the pho regulon.

    PubMed Central

    Qi, Y; Kobayashi, Y; Hulett, F M


    Genes from Bacillus subtilis predicted to encode a phosphate-specific transport (Pst) system were shown by mutation to affect high-affinity Pi uptake but not arsenate resistance or phosphate (Pho) regulation. The transcription start of the promoter upstream of the pstS gene was defined by primer extension. The promoter contains structural features analogous to the Escherichia coli pst promoter but not sequence similarity. Expression from this promoter was induced >5,000-fold upon phosphate starvation and regulated by the PhoP-PhoR two-component regulatory system. These data indicate that the pst operon is involved in phosphate transport and is a member of the Pho regulon but is not involved in Pi regulation. PMID:9098050

  17. Genomic reconstruction of transcriptional regulatory networks in lactic acid bacteria

    PubMed Central


    Background Genome scale annotation of regulatory interactions and reconstruction of regulatory networks are the crucial problems in bacterial genomics. The Lactobacillales order of bacteria collates various microorganisms having a large economic impact, including both human and animal pathogens and strains used in the food industry. Nonetheless, no systematic genome-wide analysis of transcriptional regulation has been previously made for this taxonomic group. Results A comparative genomics approach was used for reconstruction of transcriptional regulatory networks in 30 selected genomes of lactic acid bacteria. The inferred networks comprise regulons for 102 orthologous transcription factors (TFs), including 47 novel regulons for previously uncharacterized TFs. Numerous differences between regulatory networks of the Streptococcaceae and Lactobacillaceae groups were described on several levels. The two groups are characterized by substantially different sets of TFs encoded in their genomes. Content of the inferred regulons and structure of their cognate TF binding motifs differ for many orthologous TFs between the two groups. Multiple cases of non-orthologous displacements of TFs that control specific metabolic pathways were reported. Conclusions The reconstructed regulatory networks substantially expand the existing knowledge of transcriptional regulation in lactic acid bacteria. In each of 30 studied genomes the obtained regulatory network contains on average 36 TFs and 250 target genes that are mostly involved in carbohydrate metabolism, stress response, metal homeostasis and amino acids biosynthesis. The inferred networks can be used for genetic experiments, functional annotations of genes, metabolic reconstruction and evolutionary analysis. All reconstructed regulons are captured within the Streptococcaceae and Lactobacillaceae collections in the RegPrecise database ( PMID:23398941

  18. An apicomplexan ankyrin-repeat histone deacetylase with relatives in photosynthetic eukaryotes.


    Rider, S Dean; Zhu, Guan


    Cryptosporidium parvum is a member of the Apicomplexa that lacks a plastid and associated nuclear-encoded genes, which has hampered its use in evolutionary comparisons with algae and eliminated a pool of potentially useful drug targets. Here we show that apicomplexan parasites possess an unusual family of class II histone deacetylase (HDAC) proteins with orthologues that are present in other chromalveolates and primitive algae. A striking feature of these HDAC proteins is the presence of ankyrin repeats in the amino-terminus that appear to be required for enzyme activity. In vitro and in vivo analyses of the C. parvum orthologue indicate that this subclass of chromatin-remodelling proteins is targeted by the anti-cancer drug suberoylanilide hydroxamic acid and that these proteins are most likely involved in the essential process of H4 histone deacetylation that coincides with DNA replication. We propose that members of this novel class of histone deacetylase can serve as promising new targets for treatments against debilitating diseases such as cryptosporidosis, toxoplasmosis and malaria.

  19. Lipid Synthesis in Protozoan Parasites: a Comparison Between Kinetoplastids and Apicomplexans

    PubMed Central

    Ramakrishnan, Srinivasan; Serricchio, Mauro; Striepen, Boris; Bütikofer, Peter


    Lipid metabolism is of crucial importance for pathogens. Lipids serve as cellular building blocks, signalling molecules, energy stores, posttranslational modifiers, and pathogenesis factors. Parasites rely on a complex system of uptake and synthesis mechanisms to satisfy their lipid needs. The parameters of this system change dramatically as the parasite transits through the various stages of its life cycle. Here we discuss the tremendous recent advances that have been made in the understanding of the synthesis and uptake pathways for fatty acids and phospholipids in apicomplexan and kinetoplastid parasites, including Plasmodium, Toxoplasma, Cryptosporidium, Trypanosoma and Leishmania. Lipid synthesis differs in significant ways between parasites from both phyla and the human host. Parasites have acquired novel pathways through endosymbiosis, as in the case of the apicoplast, have dramatically reshaped substrate and product profiles, and have evolved specialized lipids to interact with or manipulate the host. These differences potentially provide opportunities for drug development. We outline the lipid pathways for key species in detail as they progress through the developmental cycle and highlight those that are of particular importance to the biology of the pathogens and/or are the most promising targets for parasite-specific treatment. PMID:23827884

  20. A large-scale proteogenomics study of apicomplexan pathogens—Toxoplasma gondii and Neospora caninum

    PubMed Central

    Krishna, Ritesh; Xia, Dong; Sanderson, Sanya; Shanmugasundram, Achchuthan; Vermont, Sarah; Bernal, Axel; Daniel-Naguib, Gianluca; Ghali, Fawaz; Brunk, Brian P; Roos, David S; Wastling, Jonathan M; Jones, Andrew R


    Proteomics data can supplement genome annotation efforts, for example being used to confirm gene models or correct gene annotation errors. Here, we present a large-scale proteogenomics study of two important apicomplexan pathogens: Toxoplasma gondii and Neospora caninum. We queried proteomics data against a panel of official and alternate gene models generated directly from RNASeq data, using several newly generated and some previously published MS datasets for this meta-analysis. We identified a total of 201 996 and 39 953 peptide-spectrum matches for T. gondii and N. caninum, respectively, at a 1% peptide FDR threshold. This equated to the identification of 30 494 distinct peptide sequences and 2921 proteins (matches to official gene models) for T. gondii, and 8911 peptides/1273 proteins for N. caninum following stringent protein-level thresholding. We have also identified 289 and 140 loci for T. gondii and N. caninum, respectively, which mapped to RNA-Seq-derived gene models used in our analysis and apparently absent from the official annotation (release 10 from EuPathDB) of these species. We present several examples in our study where the RNA-Seq evidence can help in correction of the current gene model and can help in discovery of potential new genes. The findings of this study have been integrated into the EuPathDB. The data have been deposited to the ProteomeXchange with identifiers PXD000297and PXD000298. PMID:25867681

  1. Canine Neutrophil Extracellular Traps Release Induced by the Apicomplexan Parasite Neospora caninum In Vitro.


    Wei, Zhengkai; Hermosilla, Carlos; Taubert, Anja; He, Xuexiu; Wang, Xiaocen; Gong, Pengtao; Li, Jianhua; Yang, Zhengtao; Zhang, Xichen


    Neosporosis is considered as one of the main causes of abortion and severe economic losses in dairy industry. The Canis genus serving as one of the confirmed definitive hosts of the apicomplexan parasite Neospora caninum (N. caninum) plays a critical role in its life cycle. However, the effects of N. caninum on its definitive hosts of neutrophils extracellular traps (NETs) formation remain unclear. In the present study, N. caninum tachyzoite-induced canine NETs formation was observed by scanning electron microscopy (SEM). Visualization of DNA decorated with H3, neutrophil elastase (NE), and myeloperoxidase (MPO) within N. caninum tachyzoite-induced NETs were examined using fluorescence confocal microscopy analyses. Furthermore, the formation of canine NETs was quantified using Sytox Green staining, and the LDH levels in supernatants were examined by an LDH Cytotoxicity Assay(®) kit. The results clearly showed that NETs-like structures were induced by N. caninum tachyzoites, and the major components within these structures induced by N. caninum tachyzoite were further confirmed by fluorescence confocal microscopy visualization. These results suggest that N. caninum tachyzoites strongly induced NETs formation in canine polymorphonuclear neutrophils (PMN). In functional inhibition assays, the blockings of NADPH oxidase, NE, MPO, SOCE, ERK 1/2, and p38 MAPK signaling pathways significantly inhibited N. caninum tachyzoite-induced NETs formation. To our knowledge, this study is the first to report the formation of NETs in canine PMN against N. caninum infection.

  2. Canine Neutrophil Extracellular Traps Release Induced by the Apicomplexan Parasite Neospora caninum In Vitro

    PubMed Central

    Wei, Zhengkai; Hermosilla, Carlos; Taubert, Anja; He, Xuexiu; Wang, Xiaocen; Gong, Pengtao; Li, Jianhua; Yang, Zhengtao; Zhang, Xichen


    Neosporosis is considered as one of the main causes of abortion and severe economic losses in dairy industry. The Canis genus serving as one of the confirmed definitive hosts of the apicomplexan parasite Neospora caninum (N. caninum) plays a critical role in its life cycle. However, the effects of N. caninum on its definitive hosts of neutrophils extracellular traps (NETs) formation remain unclear. In the present study, N. caninum tachyzoite-induced canine NETs formation was observed by scanning electron microscopy (SEM). Visualization of DNA decorated with H3, neutrophil elastase (NE), and myeloperoxidase (MPO) within N. caninum tachyzoite-induced NETs were examined using fluorescence confocal microscopy analyses. Furthermore, the formation of canine NETs was quantified using Sytox Green staining, and the LDH levels in supernatants were examined by an LDH Cytotoxicity Assay® kit. The results clearly showed that NETs-like structures were induced by N. caninum tachyzoites, and the major components within these structures induced by N. caninum tachyzoite were further confirmed by fluorescence confocal microscopy visualization. These results suggest that N. caninum tachyzoites strongly induced NETs formation in canine polymorphonuclear neutrophils (PMN). In functional inhibition assays, the blockings of NADPH oxidase, NE, MPO, SOCE, ERK 1/2, and p38 MAPK signaling pathways significantly inhibited N. caninum tachyzoite-induced NETs formation. To our knowledge, this study is the first to report the formation of NETs in canine PMN against N. caninum infection. PMID:27843440

  3. The GroE chaperonin machine is a major modulator of the CIRCE heat shock regulon of Bacillus subtilis.

    PubMed Central

    Mogk, A; Homuth, G; Scholz, C; Kim, L; Schmid, F X; Schumann, W


    Class I heat-inducible genes in Bacillus subtilis consist of the heptacistronic dnaK and the bicistronic groE operon and form the CIRCE regulon. Both operons are negatively regulated at the level of transcription by the HrcA repressor interacting with its operator, the CIRCE element. Here, we demonstrate that the DnaK chaperone machine is not involved in the regulation of HrcA and that the GroE chaperonin exerts a negative effect in the post-transcriptional control of HrcA. When expression of the groE operon was turned off, the dnaK operon was significantly activated and large amounts of apparently inactive HrcA repressor were produced. Overproduction of GroEL, on the other hand, resulted in decreased expression of the dnaK operon. Introduction of the hrcA gene and its operator into Escherichia coli was sufficient to elicit a transient heat shock response, indicating that no additional Bacillus-specific gene(s) was needed. As in B. subtilis, the groEL gene of E. coli negatively influenced the activity of HrcA. HrcA could be overproduced in E. coli, but formed inclusion bodies which could be dissolved in 8 M urea. Upon removal of urea, HrcA had a strong tendency to aggregate, but aggregation could be suppressed significantly by the addition of GroEL. Purified HrcA repressor was able specifically to retard a DNA fragment containing the CIRCE element, and the amount of retarded DNA was increased significantly in the presence of GroEL. These results suggest that the GroE chaperonin machine modulates the activity of the HrcA repressor and therefore point to a novel function of GroE as a modulator of the heat shock response. PMID:9303302

  4. Non-canonical CRP sites control competence regulons in Escherichia coli and many other γ-proteobacteria

    PubMed Central

    Cameron, Andrew D. S.; Redfield, Rosemary J.


    Escherichia coli's cAMP receptor protein (CRP), the archetypal bacterial transcription factor, regulates over a hundred promoters by binding 22 bp symmetrical sites with the consensus core half-site TGTGA. However, Haemophilus influenzae has two types of CRP sites, one like E.coli's and one with the core sequence TGCGA that regulates genes required for DNA uptake (natural competence). Only the latter ‘CRP-S’ sites require both CRP and the coregulator Sxy for activation. To our knowledge, the TGTGA and TGCGA motifs are the first example of one transcription factor having two distinct binding-site motifs. Here we show that CRP-S promoters are widespread in the γ-proteobacteria and demonstrate their Sxy-dependence in E.coli. Orthologs of most H.influenzae CRP-S-regulated genes are ubiquitous in the five best-studied γ-proteobacteria families, Enterobacteriaceae, Pasteurellaceae, Pseudomonadaceae, Vibrionaceae and Xanthomonadaceae. Phylogenetic footprinting identified CRP-S sites in the promoter regions of the Enterobacteriaceae, Pasteurellaceae and Vibrionaceae orthologs, and canonical CRP sites in orthologs of genes known to be Sxy-independent in H.influenzae. Bandshift experiments confirmed that E.coli CRP-S sequences are low affinity binding sites for CRP, and mRNA analysis showed that they require CRP, cAMP (CRP's allosteric effector) and Sxy for gene induction. This work suggests not only that the γ-proteobacteria share a common DNA uptake mechanism, but also that, in the three best studied families, their competence regulons share both CRP-S specificity and Sxy dependence. PMID:17068078

  5. Involvement and necessity of the Cpx regulon in the event of aberrant β-barrel outer membrane protein assembly

    PubMed Central

    Gerken, Henri; Leiser, Owen P.; Bennion, Drew; Misra, Rajeev


    Summary The Cpx and σE regulons help maintain outer membrane integrity; the Cpx pathway monitors the biogenesis of cell surface structures, such as pili, while the σE pathway monitors the biogenesis of β-barrel outer membrane proteins (OMPs). In this study we revealed the importance of the Cpx regulon in the event of β-barrel OMP mis-assembly, by utilizing mutants expressing either a defective β-barrel OMP assembly machinery (Bam) or assembly defective β-barrel OMPs. Analysis of specific mRNAs showed that ΔcpxR bam double mutants failed to induce degP expression beyond the wild type level, despite activation of the σE pathway. The synthetic conditional lethal phenotype of ΔcpxR in mutant Bam or β-barrel OMP backgrounds was reversed by wild type DegP expressed from a heterologous plasmid promoter. Consistent with the involvement of the Cpx regulon in the event of aberrant β-barrel OMP assembly, the expression of cpxP, the archetypal member of the cpx regulon, was upregulated in defective Bam backgrounds or in cells expressing a single assembly-defective β-barrel OMP species. Together, these results showed that both the Cpx and σE regulons are required to reduce envelope stress caused by aberrant β-barrel OMP assembly, with the Cpx regulon principally contributing by controlling degP expression. PMID:20487295

  6. Identification of a CO2 responsive regulon in Bordetella.


    Hester, Sara E; Lui, Minghsun; Nicholson, Tracy; Nowacki, Daryl; Harvill, Eric T


    Sensing the environment allows pathogenic bacteria to coordinately regulate gene expression to maximize survival within or outside of a host. Here we show that Bordetella species regulate virulence factor expression in response to carbon dioxide levels that mimic in vivo conditions within the respiratory tract. We found strains of Bordetella bronchiseptica that did not produce adenylate cyclase toxin (ACT) when grown in liquid or solid media with ambient air aeration, but produced ACT and additional antigens when grown in air supplemented to 5% CO(2). Transcriptome analysis and quantitative real time-PCR analysis revealed that strain 761, as well as strain RB50, increased transcription of genes encoding ACT, filamentous hemagglutinin (FHA), pertactin, fimbriae and the type III secretion system in 5% CO(2) conditions, relative to ambient air. Furthermore, transcription of cyaA and fhaB in response to 5% CO(2) was increased even in the absence of BvgS. In vitro analysis also revealed increases in cytotoxicity and adherence when strains were grown in 5% CO(2). The human pathogens B. pertussis and B. parapertussis also increased transcription of several virulence factors when grown in 5% CO(2), indicating that this response is conserved among the classical bordetellae. Together, our data indicate that Bordetella species can sense and respond to physiologically relevant changes in CO(2) concentrations by regulating virulence factors important for colonization, persistence and evasion of the host immune response.

  7. Functional analysis of Ralstonia solanacearum PrhG regulating the hrp regulon in host plants.


    Zhang, Yong; Chen, Li; Yoshimochi, Takeshi; Kiba, Akinori; Hikichi, Yasufumi; Ohnishi, Kouhei


    Genes in the hrp regulon encode component proteins of the type III secretion system and are essential for the pathogenicity of Ralstonia solanacearum. The hrp regulon is controlled by HrpB. We isolated several genes regulating hrpB expression from the Japanese strain OE1-1 using minitransposon mutagenesis. Among them, we mainly focused on two genes, hrpG and prhG, which are the positive regulators of hrpB. Although the global virulence regulator PhcA negatively regulated hrpG expression via prhIR, it positively regulated prhG expression. We further investigated the contrasting regulation of hrpG and prhG by PhcA and speculated that R. solanacearum may switch from HrpG to PrhG for hrpB activation in a cell density-dependent manner. Although the prhG mutant proliferated similarly to the wild-type in leaf intercellular spaces and in xylem vessels of the host plants, it was less virulent than the wild-type. The expression of the popA operon, which belongs to the hrp regulon, was significantly reduced in the prhG mutant by more than half in the leaf intercellular spaces and more than two-thirds in the xylem vessels when compared with the wild-type.

  8. Evolutionary and Functional Relationships of the dha Regulon by Genomic Context Analysis

    PubMed Central

    Martins-Pinheiro, Marinalva; Lima, Wanessa C.; Asif, Huma; Oller, Cláudio A.; Menck, Carlos F. M.


    3-hydroxypropionaldehyde (3-HPA) and 1,3-propanediol (1,3-PD) are subproducts of glycerol degradation and of economical interest as they are used for polymers synthesis, such as polyesters and polyurethanes. Some few characterized bacterial species (mostly from Firmicutes and Gamma-proteobacteria groups) are able to catabolize these monomers from glycerol using the gene products from the dha regulon. To expand our knowledge and direct further experimental studies on the regulon and related genes for the anaerobic glycerol metabolism, an extensive genomic screening was performed to identify the presence of the dha genes in fully sequenced prokaryotic genomes. Interestingly, this work shows that although only few bacteria species are known to produce 3-HPA or 1,3-PD, the incomplete regulon is found in more than 100 prokaryotic genomes. However, the complete pathway is found only in a few dozen species belonging to five different taxonomic groups, including one Archaea species, Halalkalicoccus jeotgali. Phylogenetic analysis and conservation of both gene synteny and primary sequence similarity reinforce the idea that these genes have a common origin and were possibly acquired by lateral gene transfer (LGT). Besides the evolutionary aspect, the identification of homologs from several different organisms may predict potential alternative targets for faster or more efficient biological synthesis of 3-HPA or 1,3-PD. PMID:26938861

  9. The Streptococcus sanguinis competence regulon is not required for infective endocarditis virulence in a rabbit model.


    Callahan, Jill E; Munro, Cindy L; Kitten, Todd


    Streptococcus sanguinis is an important component of dental plaque and a leading cause of infective endocarditis. Genetic competence in S. sanguinis requires a quorum sensing system encoded by the early comCDE genes, as well as late genes controlled by the alternative sigma factor, ComX. Previous studies of Streptococcus pneumoniae and Streptococcus mutans have identified functions for the >100-gene com regulon in addition to DNA uptake, including virulence. We investigated this possibility in S. sanguinis. Strains deleted for the comCDE or comX master regulatory genes were created. Using a rabbit endocarditis model in conjunction with a variety of virulence assays, we determined that both mutants possessed infectivity equivalent to that of a virulent control strain, and that measures of disease were similar in rabbits infected with each strain. These results suggest that the com regulon is not required for S. sanguinis infective endocarditis virulence in this model. We propose that the different roles of the S. sanguinis, S. pneumoniae, and S. mutans com regulons in virulence can be understood in relation to the pathogenic mechanisms employed by each species.

  10. Re-Emergence of the Apicomplexan Theileria equi in the United States: Elimination of Persistent Infection and Transmission Risk

    PubMed Central

    Ueti, Massaro W.; Mealey, Robert H.; Kappmeyer, Lowell S.; White, Stephen N.; Kumpula-McWhirter, Nancy; Pelzel, Angela M.; Grause, Juanita F.; Bunn, Thomas O.; Schwartz, Andy; Traub-Dargatz, Josie L.; Hendrickson, Amy; Espy, Benjamin; Guthrie, Alan J.; Fowler, W. Kent; Knowles, Donald P.


    Arthropod-borne apicomplexan pathogens that cause asymptomatic persistent infections present a significant challenge due to their life-long transmission potential. Although anti-microbials have been used to ameliorate acute disease in animals and humans, chemotherapeutic efficacy for apicomplexan pathogen elimination from a persistently infected host and removal of transmission risk is largely unconfirmed. The recent re-emergence of the apicomplexan Theileria equi in U.S. horses prompted testing whether imidocarb dipropionate was able to eliminate T. equi from naturally infected horses and remove transmission risk. Following imidocarb treatment, levels of T. equi declined from a mean of 104.9 organisms/ml of blood to undetectable by nested PCR in 24 of 25 naturally infected horses. Further, blood transfer from treated horses that became nested PCR negative failed to transmit to naïve splenectomized horses. Although these results were consistent with elimination of infection in 24 of 25 horses, T. equi-specific antibodies persisted in the majority of imidocarb treated horses. Imidocarb treatment was unsuccessful in one horse which remained infected as measured by nested PCR and retained the ability to infect a naïve recipient via intravenous blood transfer. However, a second round of treatment eliminated T. equi infection. These results support the utility of imidocarb chemotherapy for assistance in the control and eradication of this tick-borne pathogen. Successful imidocarb dipropionate treatment of persistently infected horses provides a tool to aid the global equine industry by removing transmission risk associated with infection and facilitating international movement of equids between endemic and non-endemic regions. PMID:22970295

  11. Babesia divergens and Neospora caninum apical membrane antigen 1 structures reveal selectivity and plasticity in apicomplexan parasite host cell invasion

    PubMed Central

    Tonkin, Michelle L; Crawford, Joanna; Lebrun, Maryse L; Boulanger, Martin J


    Host cell invasion by the obligate intracellular apicomplexan parasites, including Plasmodium (malaria) and Toxoplasma (toxoplasmosis), requires a step-wise mechanism unique among known host–pathogen interactions. A key step is the formation of the moving junction (MJ) complex, a circumferential constriction between the apical tip of the parasite and the host cell membrane that traverses in a posterior direction to enclose the parasite in a protective vacuole essential for intracellular survival. The leading model of MJ assembly proposes that Rhoptry Neck Protein 2 (RON2) is secreted into the host cell and integrated into the membrane where it serves as the receptor for apical membrane antigen 1 (AMA1) on the parasite surface. We have previously demonstrated that the AMA1-RON2 interaction is an effective target for inhibiting apicomplexan invasion. To better understand the AMA1-dependant molecular recognition events that promote invasion, including the significant AMA1-RON2 interaction, we present the structural characterization of AMA1 from the apicomplexan parasites Babesia divergens (BdAMA1) and Neospora caninum (NcAMA1) by X-ray crystallography. These studies offer intriguing structural insight into the RON2-binding surface groove in the AMA1 apical domain, which shows clear evidence for receptor–ligand co-evolution, and the hyper variability of the membrane proximal domain, which in Plasmodium is responsible for direct binding to erythrocytes. By incorporating the structural analysis of BdAMA1 and NcAMA1 with existing AMA1 structures and complexes we were able to define conserved pockets in the AMA1 apical groove that could be targeted for the design of broadly reactive therapeutics. PMID:23169033

  12. Primary Structure of 28S rRNA Gene Confirms Monophyly of Free-Living Heterotrophic and Phototrophic Apicomplexans (Alveolata).


    Mikhailov, K V; Tikhonenkov, D V; Janouškovec, J; Diakin, A Y; Ofitserov, M V; Mylnikov, A P; Aleshin, V V


    Phylogenetic analysis of large subunit ribosomal RNA (LSU rRNA or 28S rRNA) gene sequences from free-living predatory flagellates Colpodella angusta, Voromonas pontica, and Alphamonas edax (Apicomplexa) confirms their close relationship with chromerids Chromera velia and Vitrella brassicaformis, which possess a functional photosynthetic plastid. Together these organisms form a sister group to parasitic apicomplexans (coccidians and gregarines, or sporozoans sensu lato). This result agrees with the previous conclusion on monophyly of colpodellids and chromerids (chrompodellids) based on phylogenomic data. The revealed relationships demonstrate a complex pattern of acquisition, loss, or modification of plastids and transition to parasitism during alveolate evolution.

  13. Expression of the gonococcal global regulatory protein Fur and genes encompassing the Fur and iron regulon during in vitro and in vivo infection in women.


    Agarwal, Sarika; Sebastian, Shite; Szmigielski, Borys; Rice, Peter A; Genco, Caroline A


    The ferric uptake regulatory protein, Fur, functions as a global regulatory protein of gene transcription in the mucosal pathogen Neisseria gonorrhoeae. We have shown previously that several N. gonorrhoeae Fur-repressed genes are expressed in vivo during mucosal gonococcal infection in men, which suggests that this organism infects in an iron-limited environment and that Fur is expressed under these conditions. In this study we have demonstrated expression of the gonococcal fur gene in vitro, in human cervical epithelial cells, and in specimens from female subjects with uncomplicated gonococcal infection. In vitro studies confirmed that the expression of the gonococcal fur gene was repressed during growth under iron-replete growth conditions but that a basal level of the protein was maintained. Using GFP transcriptional fusions constructed from specific Fur binding sequences within the fur promoter/operator region, we determined that this operator region was functional during N. gonorrhoeae infection of cervical epithelial cells. Furthermore, reverse transcription-PCR analysis, as well as microarray analysis, using a custom Neisseria Fur and iron regulon microarray revealed that several Fur- and iron-regulated genes were expressed during N. gonorrhoeae infection of cervical epithelial cells. Microarray analysis of specimens obtained from female subjects with uncomplicated gonococcal infection corroborated our in vitro findings and point toward a key role of gonococcal Fur- and iron-regulated genes in gonococcal disease.

  14. Deletion of mtrC in Haemophilus ducreyi increases sensitivity to human antimicrobial peptides and activates the CpxRA regulon.


    Rinker, Sherri D; Trombley, Michael P; Gu, Xiaoping; Fortney, Kate R; Bauer, Margaret E


    Haemophilus ducreyi resists killing by antimicrobial peptides encountered during human infection, including cathelicidin LL-37, α-defensins, and β-defensins. In this study, we examined the role of the proton motive force-dependent multiple transferable resistance (MTR) transporter in antimicrobial peptide resistance in H. ducreyi. We found a proton motive force-dependent effect on H. ducreyi's resistance to LL-37 and β-defensin HBD-3, but not α-defensin HNP-2. Deletion of the membrane fusion protein MtrC rendered H. ducreyi more sensitive to LL-37 and human β-defensins but had relatively little effect on α-defensin resistance. The mtrC mutant 35000HPmtrC exhibited phenotypic changes in outer membrane protein profiles, colony morphology, and serum sensitivity, which were restored to wild type by trans-complementation with mtrC. Similar phenotypes were reported in a cpxA mutant; activation of the two-component CpxRA regulator was confirmed by showing transcriptional effects on CpxRA-regulated genes in 35000HPmtrC. A cpxR mutant had wild-type levels of antimicrobial peptide resistance; a cpxA mutation had little effect on defensin resistance but led to increased sensitivity to LL-37. 35000HPmtrC was more sensitive than the cpxA mutant to LL-37, indicating that MTR contributed to LL-37 resistance independent of the CpxRA regulon. The CpxRA regulon did not affect proton motive force-dependent antimicrobial peptide resistance; however, 35000HPmtrC had lost proton motive force-dependent peptide resistance, suggesting that the MTR transporter promotes proton motive force-dependent resistance to LL-37 and human β-defensins. This is the first report of a β-defensin resistance mechanism in H. ducreyi and shows that LL-37 resistance in H. ducreyi is multifactorial.

  15. Definition of a second Bacillus subtilis pur regulon comprising the pur and xpt-pbuX operons plus pbuG, nupG (yxjA), and pbuE (ydhL).


    Johansen, Lars Engholm; Nygaard, Per; Lassen, Catharina; Agersø, Yvonne; Saxild, Hans H


    In Bacillus subtilis expression of genes or operons encoding enzymes and other proteins involved in purine synthesis is affected by purine bases and nucleosides in the growth medium. The genes belonging to the PurR regulon (purR, purA, glyA, guaC, pbuO, pbuG, and the pur, yqhZ-folD, and xpt-pbuX operons) are controlled by the PurR repressor, which inhibits transcription initiation. Other genes are regulated by a less-well-described transcription termination mechanism that responds to the presence of hypoxanthine and guanine. The pur operon and the xpt-pbuX operon, which were studied here, are regulated by both mechanisms. We isolated two mutants resistant to 2-fluoroadenine in which the pur operon and the xpt-pbuX operon are expressed at increased levels in a PurR-independent manner. The mutations were caused by deletions that disrupted a potential transcription terminator structure located immediately upstream of the ydhL gene. The 5' part of the ydhL leader region contained a 63-nucleotide (nt) sequence very similar to the 5' ends of the leaders of the pur and xpt-pbuX operons. Transcripts of these regions may form a common tandem stem-loop secondary structure. Two additional genes with potential leader regions containing the 63-nt sequence are pbuG, encoding a hypoxanthine-guanine transporter, and yxjA, which was shown to encode a purine nucleoside transporter and is renamed nupG. Transcriptional lacZ fusions and mutations in the 63-nt sequence encoding the possible secondary structures provided evidence that expression of the pur and xpt-pbuX operons and expression of the ydhL, nupG, and pbuG genes are regulated by a common mechanism. The new pur regulon is designated the XptR regulon. Except for ydhL, the operons and genes were negatively regulated by hypoxanthine and guanine. ydhL was positively regulated. The derived amino acid sequence encoded by ydhL (now called pbuE) is similar to the amino acid sequences of metabolite efflux pumps. When overexpressed

  16. The CgHaa1-Regulon Mediates Response and Tolerance to Acetic Acid Stress in the Human Pathogen Candida glabrata

    PubMed Central

    Bernardo, Ruben T.; Cunha, Diana V.; Wang, Can; Pereira, Leonel; Silva, Sónia; Salazar, Sara B.; Schröder, Markus S.; Okamoto, Michiyo; Takahashi-Nakaguchi, Azusa; Chibana, Hiroji; Aoyama, Toshihiro; Sá-Correia, Isabel; Azeredo, Joana; Butler, Geraldine; Mira, Nuno Pereira


    To thrive in the acidic vaginal tract, Candida glabrata has to cope with high concentrations of acetic acid. The mechanisms underlying C. glabrata tolerance to acetic acid at low pH remain largely uncharacterized. In this work, the essential role of the CgHaa1 transcription factor (encoded by ORF CAGL0L09339g) in the response and tolerance of C. glabrata to acetic acid is demonstrated. Transcriptomic analysis showed that CgHaa1 regulates, directly or indirectly, the expression of about 75% of the genes activated under acetic acid stress. CgHaa1-activated targets are involved in multiple physiological functions including membrane transport, metabolism of carbohydrates and amino acids, regulation of the activity of the plasma membrane H+-ATPase, and adhesion. Under acetic acid stress, CgHaa1 increased the activity and the expression of the CgPma1 proton pump and contributed to increased colonization of vaginal epithelial cells by C. glabrata. CgHAA1, and two identified CgHaa1-activated targets, CgTPO3 and CgHSP30, are herein demonstrated to be determinants of C. glabrata tolerance to acetic acid. The protective effect of CgTpo3 and of CgHaa1 was linked to a role of these proteins in reducing the accumulation of acetic acid inside C. glabrata cells. In response to acetic acid stress, marked differences were found in the regulons controlled by CgHaa1 and by its S. cerevisiae ScHaa1 ortholog, demonstrating a clear divergent evolution of the two regulatory networks. The results gathered in this study significantly advance the understanding of the molecular mechanisms underlying the success of C. glabrata as a vaginal colonizer. PMID:27815348

  17. The CgHaa1-Regulon Mediates Response and Tolerance to Acetic Acid Stress in the Human Pathogen Candida glabrata.


    Bernardo, Ruben T; Cunha, Diana V; Wang, Can; Pereira, Leonel; Silva, Sónia; Salazar, Sara B; Schröder, Markus S; Okamoto, Michiyo; Takahashi-Nakaguchi, Azusa; Chibana, Hiroji; Aoyama, Toshihiro; Sá-Correia, Isabel; Azeredo, Joana; Butler, Geraldine; Mira, Nuno Pereira


    To thrive in the acidic vaginal tract, Candida glabrata has to cope with high concentrations of acetic acid. The mechanisms underlying C. glabrata tolerance to acetic acid at low pH remain largely uncharacterized. In this work, the essential role of the CgHaa1 transcription factor (encoded by ORF CAGL0L09339g) in the response and tolerance of C. glabrata to acetic acid is demonstrated. Transcriptomic analysis showed that CgHaa1 regulates, directly or indirectly, the expression of about 75% of the genes activated under acetic acid stress. CgHaa1-activated targets are involved in multiple physiological functions including membrane transport, metabolism of carbohydrates and amino acids, regulation of the activity of the plasma membrane H(+)-ATPase, and adhesion. Under acetic acid stress, CgHaa1 increased the activity and the expression of the CgPma1 proton pump and contributed to increased colonization of vaginal epithelial cells by C. glabrata CgHAA1, and two identified CgHaa1-activated targets, CgTPO3 and CgHSP30, are herein demonstrated to be determinants of C. glabrata tolerance to acetic acid. The protective effect of CgTpo3 and of CgHaa1 was linked to a role of these proteins in reducing the accumulation of acetic acid inside C. glabrata cells. In response to acetic acid stress, marked differences were found in the regulons controlled by CgHaa1 and by its S. cerevisiae ScHaa1 ortholog, demonstrating a clear divergent evolution of the two regulatory networks. The results gathered in this study significantly advance the understanding of the molecular mechanisms underlying the success of C. glabrata as a vaginal colonizer.

  18. Towards a molecular understanding of the apicomplexan actin motor: on a road to novel targets for malaria remedies?

    PubMed Central

    Kumpula, Esa-Pekka; Kursula, Inari


    Apicomplexan parasites are the causative agents of notorious human and animal diseases that give rise to considerable human suffering and economic losses worldwide. The most prominent parasites of this phylum are the malaria-causing Plasmodium species, which are widespread in tropical and subtropical regions, and Toxoplasma gondii, which infects one third of the world’s population. These parasites share a common form of gliding motility which relies on an actin–myosin motor. The components of this motor and the actin-regulatory proteins in Apicomplexa have unique features compared with all other eukaryotes. This, together with the crucial roles of these proteins, makes them attractive targets for structure-based drug design. In recent years, several structures of glideosome components, in particular of actins and actin regulators from apicomplexan parasites, have been determined, which will hopefully soon allow the creation of a complete molecular picture of the parasite actin–myosin motor and its regulatory machinery. Here, current knowledge of the function of this motor is reviewed from a structural perspective. PMID:25945702

  19. Three-dimensional visualisation of developmental stages of an apicomplexan fish blood parasite in its invertebrate host

    PubMed Central


    Background Although widely used in medicine, the application of three-dimensional (3D) imaging to parasitology appears limited to date. In this study, developmental stages of a marine fish haemogregarine, Haemogregarina curvata (Apicomplexa: Adeleorina), were investigated in their leech vector, Zeylanicobdella arugamensis; this involved 3D visualisation of brightfield and confocal microscopy images of histological sections through infected leech salivary gland cells. Findings 3D assessment demonstrated the morphology of the haemogregarine stages, their spatial layout, and their relationship with enlarged host cells showing reduced cellular content. Haemogregarine meronts, located marginally within leech salivary gland cells, had small tail-like connections to the host cell limiting membrane; this parasite-host cell interface was not visible in two-dimensional (2D) light micrographs and no records of a similar connection in apicomplexan development have been traced. Conclusions This is likely the first account of the use of 3D visualisation to study developmental stages of an apicomplexan parasite in its invertebrate vector. Elucidation of the extent of development of the haemogregarine within the leech salivary cells, together with the unusual connections between meronts and the host cell membrane, illustrates the future potential of 3D visualisation in parasite-vector biology. PMID:22107751

  20. Assessing the diversity, host-specificity and infection patterns of apicomplexan parasites in reptiles from Oman, Arabia.


    Maia, João P; Harris, D James; Carranza, Salvador; Goméz-Díaz, Elena


    Understanding the processes that shape parasite diversification, their distribution and abundance provides valuable information on the dynamics and evolution of disease. In this study, we assessed the diversity, distribution, host-specificity and infection patterns of apicomplexan parasites in amphibians and reptiles from Oman, Arabia. Using a quantitative PCR approach we detected three apicomplexan parasites (haemogregarines, lankesterellids and sarcocystids). A total of 13 haemogregarine haplotypes were identified, which fell into four main clades in a phylogenetic framework. Phylogenetic analysis of six new lankesterellid haplotypes revealed that these parasites were distinct from, but phylogenetically related to, known Lankesterella species and might represent new taxa. The percentage of infected hosts (prevalence) and the number of haemogregarines in the blood (parasitaemia) varied significantly between gecko species. We also found significant differences in parasitaemia between haemogregarine parasite lineages (defined by phylogenetic clustering of haplotypes), suggesting differences in host-parasite compatibility between these lineages. For Pristurus rupestris, we found significant differences in haemogregarine prevalence between geographical areas. Our results suggest that host ecology and host relatedness may influence haemogregarine distributions and, more generally, highlight the importance of screening wild hosts from remote regions to provide new insights into parasite diversity.

  1. The Eimeria transcript DB: an integrated resource for annotated transcripts of protozoan parasites of the genus Eimeria.


    Rangel, Luiz Thibério; Novaes, Jeniffer; Durham, Alan M; Madeira, Alda Maria B N; Gruber, Arthur


    Parasites of the genus Eimeria infect a wide range of vertebrate hosts, including chickens. We have recently reported a comparative analysis of the transcriptomes of Eimeria acervulina, Eimeria maxima and Eimeria tenella, integrating ORESTES data produced by our group and publicly available Expressed Sequence Tags (ESTs). All cDNA reads have been assembled, and the reconstructed transcripts have been submitted to a comprehensive functional annotation pipeline. Additional studies included orthology assignment across apicomplexan parasites and clustering analyses of gene expression profiles among different developmental stages of the parasites. To make all this body of information publicly available, we constructed the Eimeria Transcript Database (EimeriaTDB), a web repository that provides access to sequence data, annotation and comparative analyses. Here, we describe the web interface, available sequence data sets and query tools implemented on the site. The main goal of this work is to offer a public repository of sequence and functional annotation data of reconstructed transcripts of parasites of the genus Eimeria. We believe that EimeriaTDB will represent a valuable and complementary resource for the Eimeria scientific community and for those researchers interested in comparative genomics of apicomplexan parasites. Database URL:

  2. Evidence of tRNA cleavage in apicomplexan parasites: half-tRNAs as new potential regulatory molecules of Toxoplasma gondii and Plasmodium berghei

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Several lines of evidence demonstrated that organisms ranging from bacteria to higher animals possess a regulated endonucleolytic cleavage pathway producing half-tRNA fragments. In the present study, we investigated the occurrence of this phenomenon in two distantly related apicomplexan parasites, T...

  3. Transcriptomic Analysis Reveals Evidence for a Cryptic Plastid in the Colpodellid Voromonas pontica, a Close Relative of Chromerids and Apicomplexan Parasites

    PubMed Central

    Gile, Gillian H.; Slamovits, Claudio H.


    Colpodellids are free-living, predatory flagellates, but their close relationship to photosynthetic chromerids and plastid-bearing apicomplexan parasites suggests they were ancestrally photosynthetic. Colpodellids may therefore retain a cryptic plastid, or they may have lost their plastids entirely, like the apicomplexan Cryptosporidium. To find out, we generated transcriptomic data from Voromonas pontica ATCC 50640 and searched for homologs of genes encoding proteins known to function in the apicoplast, the non-photosynthetic plastid of apicomplexans. We found candidate genes from multiple plastid-associated pathways including iron-sulfur cluster assembly, isoprenoid biosynthesis, and tetrapyrrole biosynthesis, along with a plastid-type phosphate transporter gene. Four of these sequences include the 5′ end of the coding region and are predicted to encode a signal peptide and a transit peptide-like region. This is highly suggestive of targeting to a cryptic plastid. We also performed a taxon-rich phylogenetic analysis of small subunit ribosomal RNA sequences from colpodellids and their relatives, which suggests that photosynthesis was lost more than once in colpodellids, and independently in V. pontica and apicomplexans. Colpodellids therefore represent a valuable source of comparative data for understanding the process of plastid reduction in humanity's most deadly parasite. PMID:24797661

  4. Strain-dependent diversity in the Pseudomonas aeruginosa quorum-sensing regulon.


    Chugani, Sudha; Kim, Byoung Sik; Phattarasukol, Somsak; Brittnacher, Mitchell J; Choi, Sang Ho; Harwood, Caroline S; Greenberg, E Peter


    Quorum sensing allows bacteria to sense and respond to changes in population density. Acyl-homoserine lactones serve as quorum-sensing signals for many Proteobacteria, and acyl-homoserine lactone signaling is known to control cooperative activities. Quorum-controlled activities vary from one species to another. Quorum-sensing controls a constellation of genes in the opportunistic pathogen Pseudomonas aeruginosa, which thrives in a number of habitats ranging from soil and water to animal hosts. We hypothesized that there would be significant variation in quorum-sensing regulons among strains of P. aeruginosa isolated from different habitats and that differences in the quorum-sensing regulons might reveal insights about the ecology of P. aeruginosa. As a test of our hypothesis we used RNA-seq to identify quorum-controlled genes in seven P. aeruginosa isolates of diverse origins. Although our approach certainly overlooks some quorum-sensing-regulated genes we found a shared set of genes, i.e., a core quorum-controlled gene set, and we identified distinct, strain-variable sets of quorum-controlled genes, i.e., accessory genes. Some quorum-controlled genes in some strains were not present in the genomes of other strains. We detected a correlation between traits encoded by some genes in the strain-variable subsets of the quorum regulons and the ecology of the isolates. These findings indicate a role for quorum sensing in extension of the range of habitats in which a species can thrive. This study also provides a framework for understanding the molecular mechanisms by which quorum-sensing systems operate, the evolutionary pressures by which they are maintained, and their importance in disparate ecological contexts.

  5. Identification of genes in the VirR regulon of Pectobacterium atrosepticum and characterization of their roles in quorum sensing-dependent virulence.


    Monson, Rita; Burr, Tom; Carlton, Timothy; Liu, Hui; Hedley, Peter; Toth, Ian; Salmond, George P C


    In the economically important phytopathogen, Pectobacterium atrosepticum, expression of plant cell wall degrading enzymes and other virulence determinants is controlled in a cell density-dependent fashion, termed quorum sensing (QS). Canonical QS systems in Gram-negative bacteria contain a LuxI-type protein, synthesizing a signalling molecule, and a LuxR-type regulator, responding to the signalling molecule above threshold concentrations. In P. atrosepticum, the central LuxR-type repressor of virulence, VirR, has been identified and its impacts on virulence characterized. Here we define the broader VirR regulon using chromatin immunoprecipitation (ChIP) and in planta microarrays. Ninety-four direct VirR targets were identified by ChIP microarrays and a consensus VirR binding site was determined. Purified VirR was used in DNA gel shift assays on target promoters and VirR : promoter binding was disrupted by exogenous addition of the signalling molecule, N-(3-oxohexanoyl)-l-homoserine lactone (OHHL). VirR autorepressed, and directly activated the transcription of rsmA in the absence of OHHL. Finally, we showed that VirR directly regulated the production of siderophores and controlled swimming motility. This is the first report characterizing the direct targets of VirR and provides clear evidence that this LuxR-type protein can act in vivo as both an activator and repressor of transcription in the absence of its cognate signalling molecule.

  6. Computing and Applying Atomic Regulons to Understand Gene Expression and Regulation

    PubMed Central

    Faria, José P.; Davis, James J.; Edirisinghe, Janaka N.; Taylor, Ronald C.; Weisenhorn, Pamela; Olson, Robert D.; Stevens, Rick L.; Rocha, Miguel; Rocha, Isabel; Best, Aaron A.; DeJongh, Matthew; Tintle, Nathan L.; Parrello, Bruce; Overbeek, Ross; Henry, Christopher S.


    Understanding gene function and regulation is essential for the interpretation, prediction, and ultimate design of cell responses to changes in the environment. An important step toward meeting the challenge of understanding gene function and regulation is the identification of sets of genes that are always co-expressed. These gene sets, Atomic Regulons (ARs), represent fundamental units of function within a cell and could be used to associate genes of unknown function with cellular processes and to enable rational genetic engineering of cellular systems. Here, we describe an approach for inferring ARs that leverages large-scale expression data sets, gene context, and functional relationships among genes. We computed ARs for Escherichia coli based on 907 gene expression experiments and compared our results with gene clusters produced by two prevalent data-driven methods: Hierarchical clustering and k-means clustering. We compared ARs and purely data-driven gene clusters to the curated set of regulatory interactions for E. coli found in RegulonDB, showing that ARs are more consistent with gold standard regulons than are data-driven gene clusters. We further examined the consistency of ARs and data-driven gene clusters in the context of gene interactions predicted by Context Likelihood of Relatedness (CLR) analysis, finding that the ARs show better agreement with CLR predicted interactions. We determined the impact of increasing amounts of expression data on AR construction and find that while more data improve ARs, it is not necessary to use the full set of gene expression experiments available for E. coli to produce high quality ARs. In order to explore the conservation of co-regulated gene sets across different organisms, we computed ARs for Shewanella oneidensis, Pseudomonas aeruginosa, Thermus thermophilus, and Staphylococcus aureus, each of which represents increasing degrees of phylogenetic distance from E. coli. Comparison of the organism-specific ARs showed

  7. Comparative genomics of VirR regulons in Clostridium perfringens strains

    PubMed Central


    Background Clostridium perfringens is a Gram-positive anaerobic bacterium causing severe diseases such as gas gangrene and pseudomembranosus colitis, that are generally due to the secretion of powerful extracellular toxins. The expression of toxin genes is mainly regulated by VirR, the response regulator of a two-component system. Up to now few targets only are known for this regulator and mainly in one strain (Strain 13). Due to the high genomic and phenotypic variability in toxin production by different strains, the development of effective strategies to counteract C. perfringens infections requires methodologies to reconstruct the VirR regulon from genome sequences. Results We implemented a two step computational strategy allowing to consider available information concerning VirR binding sites in a few species to scan all genomes of the same species, assuming the VirR targets are at least partially conserved across these strains. Results obtained are in agreement with previous works where experimental validation of the promoters have been performed and showed the presence of a core and an accessory regulon of VirR in C. perfringens strains with three target genes also located on plasmids. Moreover, the type E strain JGS1987 has the largest predicted regulon with as many as 10 VirR targets not found in the other genomes. Conclusions In this work we exploited available experimental information concerning the targets of the VirR toxin regulator in one C. perfringens strain to obtain plausible predictions concerning target genes in genomes and plasmids of nearby strains. Our predictions are available for wet-lab researchers working on less characterized C. perfringens strains that can thus design focused experiments reducing the search space of their experiments and increasing the probability of characterizing positive targets with less efforts. Main result was that the VirR regulon is variable in different C. perfringens strains with 4 genes controlled in all but

  8. Computing and Applying Atomic Regulons to Understand Gene Expression and Regulation.


    Faria, José P; Davis, James J; Edirisinghe, Janaka N; Taylor, Ronald C; Weisenhorn, Pamela; Olson, Robert D; Stevens, Rick L; Rocha, Miguel; Rocha, Isabel; Best, Aaron A; DeJongh, Matthew; Tintle, Nathan L; Parrello, Bruce; Overbeek, Ross; Henry, Christopher S


    Understanding gene function and regulation is essential for the interpretation, prediction, and ultimate design of cell responses to changes in the environment. An important step toward meeting the challenge of understanding gene function and regulation is the identification of sets of genes that are always co-expressed. These gene sets, Atomic Regulons (ARs), represent fundamental units of function within a cell and could be used to associate genes of unknown function with cellular processes and to enable rational genetic engineering of cellular systems. Here, we describe an approach for inferring ARs that leverages large-scale expression data sets, gene context, and functional relationships among genes. We computed ARs for Escherichia coli based on 907 gene expression experiments and compared our results with gene clusters produced by two prevalent data-driven methods: Hierarchical clustering and k-means clustering. We compared ARs and purely data-driven gene clusters to the curated set of regulatory interactions for E. coli found in RegulonDB, showing that ARs are more consistent with gold standard regulons than are data-driven gene clusters. We further examined the consistency of ARs and data-driven gene clusters in the context of gene interactions predicted by Context Likelihood of Relatedness (CLR) analysis, finding that the ARs show better agreement with CLR predicted interactions. We determined the impact of increasing amounts of expression data on AR construction and find that while more data improve ARs, it is not necessary to use the full set of gene expression experiments available for E. coli to produce high quality ARs. In order to explore the conservation of co-regulated gene sets across different organisms, we computed ARs for Shewanella oneidensis, Pseudomonas aeruginosa, Thermus thermophilus, and Staphylococcus aureus, each of which represents increasing degrees of phylogenetic distance from E. coli. Comparison of the organism-specific ARs showed

  9. Mechanisms other than activation of the iron regulon account for the hyper-resistance to cobalt of a Saccharomyces cerevisiae strain obtained by evolutionary engineering.


    Alkim, Ceren; Benbadis, Laurent; Yilmaz, Ulku; Cakar, Z Petek; François, Jean Marie


    Cobalt is an important metal ion with magnetic properties that is widely used for several industrial applications. Overexposure to cobalt ions can be highly toxic for the organisms because they usually overwhelm the endogenous physiological system that maintains their homeostasis causing (geno)toxic effects. To gain insight into the mechanism of cobalt toxicity, we characterized at the molecular and genetic levels a cobalt resistant CI25E Saccharomyces cerevisiae strain previously isolated by an in vivo evolutionary engineering strategy, and which was able to grow on 5 to 10 mM CoCl2. This evolved strain showed cross-resistance to other metal ions including iron, manganese, nickel and zinc, but not to copper. Moreover, the cobalt resistant trait was semi-dominant, and linked to more than one gene, as indicated by the absence of 2(+):2(-) segregation of the cobalt resistance. Genome wide transcriptional profiling revealed a constitutive activation of the iron regulon that could be accounted for by a constitutive nuclear localization of the transcriptional activator Aft1. However, the presence of Aft1 in the nucleus was not a prerequisite for hyper-resistance to cobalt, since a mutant defective in nuclear monothiol glutaredoxin encoding GRX3 and GRX4 that also leads to nuclear localization of Aft1 was cobalt hypersensitive. In addition, the loss of AFT1 only partially abolished the cobalt resistance in the evolved strain, and the deletion of COT1 encoding the major vacuolar transporter of cobalt had only a minor effect on this trait. Paradoxically to the activation of iron regulon, the evolved strain was hypersensitive to the iron chelator BPS, and this hypersensitivity was abrogated by cobalt ions. Taken together, this work suggested that cobalt resistance is not merely dependent upon activation of AFT1, but it likely implicates other mechanisms including intracellular reallocation of iron into important compartments whose function is dependent on this metal and

  10. Ribulokinase and transcriptional regulation of arabinose metabolism in Clostridium acetobutylicum.


    Zhang, Lei; Leyn, Semen A; Gu, Yang; Jiang, Weihong; Rodionov, Dmitry A; Yang, Chen


    The transcription factor AraR controls utilization of L-arabinose in Bacillus subtilis. In this study, we combined a comparative genomic reconstruction of AraR regulons in nine Clostridium species with detailed experimental characterization of AraR-mediated regulation in Clostridium acetobutylicum. Based on the reconstructed AraR regulons, a novel ribulokinase, AraK, present in all analyzed Clostridium species was identified, which was a nonorthologous replacement of previously characterized ribulokinases. The predicted function of the araK gene was confirmed by inactivation of the araK gene in C. acetobutylicum and biochemical assays using purified recombinant AraK. In addition to the genes involved in arabinose utilization and arabinoside degradation, extension of the AraR regulon to the pentose phosphate pathway genes in several Clostridium species was revealed. The predicted AraR-binding sites in the C. acetobutylicum genome and the negative effect of L-arabinose on DNA-regulator complex formation were verified by in vitro binding assays. The predicted AraR-controlled genes in C. acetobutylicum were experimentally validated by testing gene expression patterns in both wild-type and araR-inactivated mutant strains during growth in the absence or presence of L-arabinose.

  11. Response of Desulfovibrio vulgaris Hildenborough to hydrogen peroxide: enzymatic and transcriptional analyses.


    Brioukhanov, Andrei L; Durand, Marie-Claire; Dolla, Alain; Aubert, Corinne


    We studied the effect of hydrogen peroxide (H(2)O(2)) stress on the anaerobic sulfate-reducing bacterium Desulfovibrio vulgaris Hildenborough. In a lactate/sulfate medium, growth was affected from 0.1 mM H(2)O(2) and totally inhibited at 0.7 mM. Surprisingly, transcript analyses revealed that the PerR regulon exhibited opposite regulation in the presence of 0.1 and 0.3 mM H(2)O(2). The variations in peroxidase- and superoxide dismutase-specific activities in the cell-free extracts of H(2)O(2)-stressed cultures were related to changes in the corresponding transcript abundance. Our data suggest that sod, sor, ngr and tpx genes, in addition to the PerR regulon, belong to the H(2)O(2) stimulon.

  12. A Boolean Model of the Pseudomonas syringae hrp Regulon Predicts a Tightly Regulated System

    PubMed Central

    MacLean, Daniel; Studholme, David J.


    The Type III secretion system (TTSS) is a protein secretion machinery used by certain gram-negative bacterial pathogens of plants and animals to deliver effector molecules to the host and is at the core of the ability to cause disease. Extensive molecular and biochemical study has revealed the components and their interactions within this system but reductive approaches do not consider the dynamical properties of the system as a whole. In order to gain a better understanding of these dynamical behaviours and to create a basis for the refinement of the experimentally derived knowledge we created a Boolean model of the regulatory interactions within the hrp regulon of Pseudomonas syringae pathovar tomato strain DC3000 Pseudomonas syringae. We compared simulations of the model with experimental data and found them to be largely in accordance, though the hrpV node shows some differences in state changes to that expected. Our simulations also revealed interesting dynamical properties not previously predicted. The model predicts that the hrp regulon is a biologically stable two-state system, with each of the stable states being strongly attractive, a feature indicative of selection for a tightly regulated and responsive system. The model predicts that the state of the GacS/GacA node confers control, a prediction that is consistent with experimental observations that the protein has a role as master regulator. Simulated gene “knock out” experiments with the model predict that HrpL is a central information processing point within the network. PMID:20169167

  13. Dissimilatory Metabolism of Nitrogen Oxides in Bacteria:Comparative Reconstruction of Transcriptional Networks

    SciTech Connect

    Rodionov, Dmitry A.; Dubchak, Inna L.; Arkin, Adam P.; Alm, EricJ.; Gelfand, Mikhail S.


    Bacterial response to nitric oxide (NO) is of major importance since NO is an obligatory intermediate of the nitrogen cycle. Transcriptional regulation of the dissimilatory nitric oxides metabolism in bacteria is diverse and involves FNR-like transcription factors HcpR, DNR and NnrR, two-component systems NarXL and NarQP, NO-responsive activator NorR, and nitrite sensitive repressor NsrR. Using comparative genomics approaches we predict DNA-binding signals for these transcriptional factors and describe corresponding regulons in available bacterial genomes. Within the FNR family of regulators, we observed a correlation of two specificity-determining amino acids and contacting bases in corresponding DNA signal. Highly conserved regulon HcpR for the hybrid cluster protein and some other redox enzymes is present in diverse anaerobic bacteria including Clostridia, Thermotogales and delta-proteobacteria. NnrR and DNR control denitrification in alpha- and beta-proteobacteria, respectively. Sigma-54-dependent NorR regulon found in some gamma- and beta-proteobacteria contains various enzymes involved in the NO detoxification. Repressor NsrR, which was previously known to control only nitrite reductase operon in Nitrosomonas spp., appears to be the master regulator of the nitric oxides metabolism not only in most gamma- and beta-proteobacteria (including well-studied species like Escherichia coli), but also in Gram-positive Bacillus and Streptomyces species. Positional analysis and comparison of regulatory regions of NO detoxification genes allows us to propose the candidate NsrR-binding signal. The most conserved member of the predicted NsrR regulon is the NO-detoxifying flavohemoglobin Hmp. In enterobacteria, the regulon includes also two nitrite-responsive loci, nipAB (hcp-hcr) and nipC(dnrN), thus confirming the identity of the effector, i.e., nitrite. The proposed NsrR regulons in Neisseria and some other species are extended to include denitrification genes. As the

  14. A Multi-Serotype Approach Clarifies the Catabolite Control Protein A Regulon in the Major Human Pathogen Group A Streptococcus

    PubMed Central

    DebRoy, Sruti; Saldaña, Miguel; Travisany, Dante; Montano, Andrew; Galloway-Peña, Jessica; Horstmann, Nicola; Yao, Hui; González, Mauricio; Maass, Alejandro; Latorre, Mauricio; Shelburne, Samuel A.


    Catabolite control protein A (CcpA) is a highly conserved, master regulator of carbon source utilization in gram-positive bacteria, but the CcpA regulon remains ill-defined. In this study we aimed to clarify the CcpA regulon by determining the impact of CcpA-inactivation on the virulence and transcriptome of three distinct serotypes of the major human pathogen Group A Streptococcus (GAS). CcpA-inactivation significantly decreased GAS virulence in a broad array of animal challenge models consistent with the idea that CcpA is critical to gram-positive bacterial pathogenesis. Via comparative transcriptomics, we established that the GAS CcpA core regulon is enriched for highly conserved CcpA binding motifs (i.e. cre sites). Conversely, strain-specific differences in the CcpA transcriptome seems to consist primarily of affected secondary networks. Refinement of cre site composition via analysis of the core regulon facilitated development of a modified cre consensus that shows promise for improved prediction of CcpA targets in other medically relevant gram-positive pathogens. PMID:27580596

  15. Proteomics, DNA arrays and the analysis of still unknown regulons and unknown proteins of Bacillus subtilis and pathogenic gram-positive bacteria.


    Hecker, M; Engelmann, S


    The complete sequence of the bacterial genomes provides new perspectives for the study of gene expression and gene function. By the combination of the highly sensitive 2-dimensional (2D) protein gel electrophoresis with the identification of the protein spots by microsequencing or mass spectrometry we established a 2D protein index of Bacillus subtilis that currently comprises almost 400 protein entries. A computer-aided evaluation of the 2D gels loaded with radioactively-labelled proteins from growing or stressed/starved cells proved to be a powerful tool in the analysis of global regulation of the expression of the entire genome. For the general stress regulon it is demonstrated how the proteomics approach can be used to analyse the regulation, structure and function of still unknown regulons. The application of this approach is illustrated for the sigmaB dependent general stress regulon. For the comprehensive description of proteins/genes belonging to stimulons or regulons it is generally recommended to complement the proteome approach with DNA array techniques in order to identify and allocate still undiscovered members of individual regulons. This approach is also very attractive to uncover the function of still unknown global regulators and regulons and to dissect the entire genome into its basic modules of global regulation. The same strategy can be used to analyse the regulation, structure and function of regulons encoding virulence factors of pathogenic bacteria for a comprehensive understanding of the pathogenicity and for the identification of new antibacterial targets.

  16. Cross-Reactive Immunity to Mycobacterium tuberculosis DosR Regulon-Encoded Antigens in Individuals Infected with Environmental, Nontuberculous Mycobacteria▿ †

    PubMed Central

    Lin, May Young; Reddy, T. B. K.; Arend, Sandra M.; Friggen, Annemieke H.; Franken, Kees L. M. C.; van Meijgaarden, Krista E.; Verduyn, Marleen J. C.; Schoolnik, Gary K.; Klein, Michel R.; Ottenhoff, Tom H. M.


    Mycobacterium tuberculosis DosR regulon-encoded antigens are highly immunogenic in M. tuberculosis-infected humans and are associated with latent tuberculosis infection. We have investigated the hypothesis that infection with or exposure to nontuberculous mycobacteria (NTM) can induce cross-reactive immunity to M. tuberculosis DosR regulon-encoded antigens since responsiveness has been observed in non-M. tuberculosis-exposed but purified protein derivative-responsive individuals. M. tuberculosis DosR regulon-encoded antigen-specific T-cell responses were studied in peripheral blood mononuclear cells (PBMCs) of NTM-infected/exposed individuals. BLASTP was used to determine the presence of M. tuberculosis DosR regulon-encoded protein orthologs among environmental mycobacteria and nonmycobacteria. Significant gamma interferon production was observed in PBMCs from NTM-infected/exposed individuals in response to M. tuberculosis DosR regulon-encoded antigens. DosR regulon-encoded protein orthologs were prominently present in tuberculous and environmental mycobacteria and surprisingly also in nonmycobacteria. The ubiquitous presence of the highly conserved DosR master regulator protein Rv3133c suggests that this is a general adaptive bacterial response regulator. We report a first series of M. tuberculosis antigens to which cross-reactive immunity is induced by NTM infection/exposure. The high conservation of M. tuberculosis DosR regulon-encoded antigens most likely enables them to induce cross-reactive T-cell responses. PMID:19737909

  17. Glucose represses the lactose-galactose regulon in Kluyveromyces lactis through a SNF1 and MIG1- dependent pathway that modulates galactokinase (GAL1) gene expression.

    PubMed Central

    Dong, J; Dickson, R C


    Expression of the lactose-galactose regulon in Kluyveromyces lactis is induced by lactose or galactose and repressed by glucose. Some components of the induction and glucose repression pathways have been identified but many remain unknown. We examined the role of the SNF1 (KlSNF1) and MIG1 (KlMIG1) genes in the induction and repression pathways. Our data show that full induction of the regulon requires SNF1; partial induction occurs in a Klsnf1 -deleted strain, indicating that a KlSNF1 -independent pathway(s) also regulates induction. MIG1 is required for full glucose repression of the regulon, but there must be a KlMIG1 -independent repression pathway also. The KlMig1 protein appears to act downstream of the KlSnf1 protein in the glucose repression pathway. Most importantly, the KlSnf1-KIMig repression pathway operates by modulating KlGAL1 expression. Regulating KlGAL1 expression in this manner enables the cell to switch the regulon off in the presence of glucose. Overall, our data show that, while the Snf1 and Mig1 proteins play similar roles in regulating the galactose regulon in Saccharomyces cerevisiae and K.lactis , the way in which these proteins are integrated into the regulatory circuits are unique to each regulon, as is the degree to which each regulon is controlled by the two proteins. PMID:9278487

  18. Genetic makeup of the Corynebacterium glutamicum LexA regulon deduced from comparative transcriptomics and in vitro DNA band shift assays.


    Jochmann, Nina; Kurze, Anna-Katharina; Czaja, Lisa F; Brinkrolf, Karina; Brune, Iris; Hüser, Andrea T; Hansmeier, Nicole; Pühler, Alfred; Borovok, Ilya; Tauch, Andreas


    The lexA gene of Corynebacterium glutamicum ATCC 13032 was deleted to create the mutant strain C. glutamicum NJ2114, which has an elongated cell morphology and an increased doubling time. To characterize the SOS regulon in C. glutamicum, the transcriptomes of NJ2114 and a DNA-damage-induced wild-type strain were compared with that of a wild-type control using DNA microarray hybridization. The expression data were combined with bioinformatic pattern searches for LexA binding sites, leading to the detection of 46 potential SOS boxes located upstream of differentially expressed transcription units. Binding of a hexahistidyl-tagged LexA protein to 40 double-stranded oligonucleotides containing the potential SOS boxes was demonstrated in vitro by DNA band shift assays. It turned out that LexA binds not only to SOS boxes in the promoter-operator region of upregulated genes, but also to SOS boxes detected upstream of downregulated genes. These results demonstrated that LexA controls directly the expression of at least 48 SOS genes organized in 36 transcription units. The deduced genes encode a variety of physiological functions, many of them involved in DNA repair and survival after DNA damage, but nearly half of them have hitherto unknown functions. Alignment of the LexA binding sites allowed the corynebacterial SOS box consensus sequence TcGAA(a/c)AnnTGTtCGA to be deduced. Furthermore, the common intergenic region of lexA and the differentially expressed divS-nrdR operon, encoding a cell division suppressor and a regulator of deoxyribonucleotide biosynthesis, was characterized in detail. Promoter mapping revealed differences in divS-nrdR expression during SOS response and normal growth conditions. One of the four LexA binding sites detected in the intergenic region is involved in regulating divS-nrdR transcription, whereas the other sites are apparently used for negative autoregulation of lexA expression.

  19. The organization of the fuc regulon specifying L-fucose dissimilation in Escherichia coli K12 as determined by gene cloning.


    Chen, Y M; Zhu, Y; Lin, E C


    In Escherichia coli the six known genes specifying the utilization of L-fucose as carbon and energy source cluster at 60.2 min and constitute a regulon. These genes include fucP (encoding L-fucose permease), fucI (encoding L-fucose isomerase), fucK (encoding L-fuculose kinase), fucA (encoding L-fuculose 1-phosphate aldolase), fucO (encoding L-1,2-propanediol oxidoreductase), and fucR (encoding the regulatory protein). In this study the fuc genes were cloned and their positions on the chromosome were established by restriction endonuclease and complementation analyses. Clockwise, the gene order is: fucO-fucA-fucP-fucI-fucK-fucR. The operons comprising the structural genes and the direction of transcription were determined by complementation analysis and Southern blot hybridization. The fucPIK and fucA operons are transcribed clockwise. The fucO operon is transcribed counterclockwise. The fucR gene product activates the three structural operons in trans.

  20. Cryptosporidium is more closely related to the gregarines than to coccidia as shown by phylogenetic analysis of apicomplexan parasites inferred using small-subunit ribosomal RNA gene sequences.


    Carreno, R A; Martin, D S; Barta, J R


    The phylogenetic placement of gregarine parasites (Apicomplexa: Gregarinasina) within the Apicomplexa was derived by comparison of small-subunit ribosomal RNA gene sequences. Gregarine sequences were obtained from Gregarina niphandrodes Clopton, Percival, and Janovy, 1991, and Monocystis agilis Stein, 1848 (Eugregarinorida Léger 1900), as well as from Ophriocystis elektroscirrha McLaughlin and Myers, 1970 (Neogregarinorida Grassé 1953). The sequences were aligned with several other gregarine and apicomplexan sequences from GenBank and the resulting data matrix analyzed by parsimony and maximum-likelihood methods. The gregarines form a monophyletic clade that is a sister group to Cryptosporidium spp. The gregarine/ Cryptosporidium clade is separate from the other major apicomplexan clade containing the coccidia, adeleids, piroplasms, and haemosporinids. The trees indicate that the genus Cryptosporidium has a closer phylogenetic affinity with the gregarines than with the coccidia. These results do not support the present classification of the Cryptosporidiidae in the suborder Eimerioirina Léger, 1911.

  1. Use of new methods for construction of tightly regulated arabinose and rhamnose promoter fusions in studies of the Escherichia coli phosphate regulon.


    Haldimann, A; Daniels, L L; Wanner, B L


    Escherichia coli genes regulated by environmental inorganic phosphate (Pi) levels form the phosphate (Pho) regulon. This regulation requires seven proteins, whose synthesis is under autogenous control, including response regulator PhoB, its partner, histidine sensor kinase PhoR, all four components of the Pi-specific transport (Pst) system (PstA, PstB, PstC, and PstS), and a protein of unknown function called PhoU. Here we examined the effects of uncoupling PhoB synthesis and PhoR synthesis from their normal controls by placing each under the tight control of the arabinose-regulated P(araB) promoter or the rhamnose-regulated P(rhaB) promoter. To do this, we made allele replacement plasmids that may be generally useful for construction of P(araB) or P(rhaB) fusions and for recombination of them onto the E. coli chromosome at the araCBAD or rhaRSBAD locus, respectively. Using strains carrying such single-copy fusions, we showed that a P(rhaB) fusion is more tightly regulated than a P(araB) fusion in that a P(rhaB)-phoR+ fusion but not a P(araB)-phoR+ fusion shows a null phenotype in the absence of its specific inducer. Yet in the absence of induction, both P(araB)-phoB+ and P(rhaB)-phoB+ fusions exhibit a null phenotype. These data indicate that less PhoR than PhoB is required for transcriptional activation of the Pho regulon, which is consistent with their respective modes of action. We also used these fusions to study PhoU. Previously, we had constructed strains with precise delta phoU mutations. However, we unexpectedly found that such delta phoU mutants have a severe growth defect (P. M. Steed and B. L. Wanner, J. Bacteriol. 175:6797-6809, 1993). They also readily give rise to compensatory mutants with lesions in phoB, phoR, or a pst gene, making their study particularly difficult. Here we found that, by using P(araB)-phoB+, P(rhaB)-phoB+, or P(rhaB)-phoR+ fusions, we were able to overcome the extremely deleterious growth defect of a Pst+ delta phoU mutant. The

  2. Involvement of the Rcs regulon in the persistence of Salmonella Typhimurium in tomatoes.


    Marvasi, Massimiliano; de Moraes, Marcos H; Salas-Gonzalez, Isai; Porwollik, Steffen; Farias, Marcelo; McClelland, Michael; Teplitski, Max


    It is becoming clear that human enteric pathogens, like Salmonella, can efficiently colonize vegetative and reproductive organs of plants. Even though the bacterium's ability to proliferate within plant tissues has been linked to outbreaks of salmonellosis, little is known about regulatory and physiological adaptations of Salmonella, or other human pathogens, to their persistence in plants. A screen of Salmonella deletion mutants in tomatoes identified rcsA and rcsB genes as those under positive selection. In tomato fruits, populations of Salmonella rcsB mutants were as much as 100-fold lower than those of the wild type. In the follow-up experiments, competitive fitness of rcsA and rcsB mutants was strongly reduced in tomatoes. Bioinformatics predictions identified a putative Salmonella RcsAB binding box (TTMGGAWWAABCTYA) and revealed an extensive putative RcsAB regulon, of which many members were differentially fit within tomatoes.

  3. 1,3-Propanediol production by Escherichia coli expressing genes from the Klebsiella pneumoniae dha regulon

    SciTech Connect

    I-Teh Tong; Hans H. Liao; Cameron, D.C. )


    The dha regulon in Klebsiella pneumoniae enables the organism to grown anaerobically on glycerol and produce 1,3-propanediol (1,3-PD). Escherichia coli, which does not have a dha system, is unable to grow anaerobically on glycerol without an exogenous electron acceptor and does not produce 1,3-PD. A genomic library of K. pneumoniae ATCC 25955 constructed in E. coli AG1 was enriched for the ability to grow anaerobically on glycerol and dihydoxyacetone and was screened for the production of 1, 3-PD. The cosmid pTC1 (42.5 kn total with an 18.2-kb major insert) was isolated from a 1,3-PD-producing strain of E. coli and found to possess enzymatic activities associated with four genes of the dha regulon: glycersol dehydratase (dhaB), 1,3-PD oxidoreductase (dhaT), glycerol dehydrogenase (dhaD), and dihydroxyacetone kinase (dhaK). All four activities were inducible by the presence of glycerol. When E. coli AG1/pTC1 was grown on complex medium plus glycerol, the yield of 1, 3-PD from glycerol was 0.46 mol/mol. The major fermentation by-products were formate, acetate, and D-lactate. 1,3-PD is an intermediate in organic synthesis and polymer production. The 1,3-PD fermentation provides a useful model system for studying the interaction of a biochemical pathway in a foreign host and for developing strategies for metabolic pathway engineering.

  4. Mutations affecting catabolite repression of the L-arabinose regulon in Escherichia coli B/r.


    Heffernan, L; Bass, R; Englesberg, E


    Expression of the L-arabinose regulon in Escherichia coli B/r requires, among other things, cyclic adenosine-3', 5'-monophosphate (cAMP) and the cAMP receptor protein (CRP). Mutants deficient in adenyl cyclase (cya-), the enzyme which synthesizes cAMP, or CRP (crp-) are unable to utilize a variety of carbohydrates, including L-arabinose. Ara+ revertants of a cya-crp- strain were isolated on 0.2% minimal L-arabinose plates, conditions which require the entire ara regulon to be activated in the absence of cAMP and CRP. Evidence from genetic and physiological studies is consistent with placing these mutations in the araC regulatory gene. Deletion mapping with one mutant localized the site within either araO or araC, and complementation tests indicated the mutants acted trans to confer the ability to utilize L-arabinose in a cya-crp- genetic background. Since genetic analysis supports the conclusion, that the mutant sites are in the araC regulatory gene, the mutants were designated araCi, indicating a mutation in the regulatory gene affecting the cAMP-CRP requirement. Physiological analysis of one mutant, araCi1, illustrates the trans-acting nature of the mutation. In a cya-crp- genetic background, araCi1 promoted synthesis of both isomerase, a product of the araBAD operon, and permease, a product of the araE operon. Isomerase and permease levels in araCi1 cya+ crp+ were hyperinducible, and the sensitivity of each to cAMP was altered. Two models are presented that show the possible mutational lesion in the araCi strains.

  5. PspG, a new member of the Yersinia enterocolitica phage shock protein regulon.


    Green, Rebecca C; Darwin, Andrew J


    The Yersinia enterocolitica phage shock protein (Psp) system is induced when the Ysc type III secretion system is produced or when only the YscC secretin component is synthesized. Some psp null mutants have a growth defect when YscC is produced and a severe virulence defect in animals. The Y. enterocolitica psp locus is made up of two divergently transcribed cistrons, pspF and pspABCDycjXF. pspA operon expression is dependent on RpoN (sigma(54)) and the enhancer-binding protein PspF. Previous data indicated that PspF also controls at least one gene that is not part of the psp locus. In this study we describe the identification of pspG, a new member of the PspF regulon. Predicted RpoN-binding sites upstream of the pspA genes from different bacteria have a common divergence from the consensus sequence, which may be a signature of PspF-dependent promoters. The Y. enterocolitica pspG gene was identified because its promoter also has this signature. Like the pspA operon, pspG is positively regulated by PspF, negatively regulated by PspA, and induced in response to the production of secretins. Purified His(6)-PspF protein specifically interacts with the pspA and pspG control regions. A pspA operon deletion mutant has a growth defect when the YscC secretin is produced and a virulence defect in a mouse model of infection. These phenotypes were exacerbated by a pspG null mutation. Therefore, PspG is the missing component of the Y. enterocolitica Psp regulon that was previously predicted to exist.

  6. Probing regulon of ArcA in Shewanella oneidensis MR-1 by integrated genomic analyses

    SciTech Connect

    Gao, Haichun; Wang, Xiaohu; Yang, Zamin Koo; Palzkill, Timothy; Zhou, Jizhong


    The Arc two-component system is a global regulator controlling many genes involved in aerobic/anaerobic respiration and fermentative metabolism in Escherichia coli. Shewanella oneidensis MR-1 contains a gene encoding a putative ArcA homolog with {approx} 81% amino acid sequence identity to the E. coli ArcA protein but not a full-length arcB gene. To understand the role of ArcA in S. oneidensis, an arcA deletion strain was constructed and subjected to both physiological characterization and microarray analysis. Compared to the wild-type MR-1, the mutant exhibited impaired aerobic growth and a defect in utilizing DMSO in the absence of O{sub 2}. Microarray analyses on cells grown aerobically and anaerobically on fumarate revealed that expression of 1009 genes was significantly affected (p < 0.05) by the mutation. In contrast to E. coli ArcA, the protein appears to be dispensable in regulation of the TCA cycle in S. oneidensis. To further determine genes regulated by the Arc system, an ArcA recognition weight matrix from DNA-binding data and bioinformatics analysis was generated and used to produce an ArcA sequence affinity map. By combining both techniques, we identified an ArcA regulon of at least 50 operons, of which only 6 were found to be directly controlled by ArcA in E. coli. These results indicate that the Arc system in S. oneidensis differs from that in E. coli substantially in terms of its physiological function and regulon while their binding motif are strikingly similar.

  7. Purine salvage in the apicomplexan Sarcocystis neurona, and generation of hypoxanthine-xanthine-guanine phosphoribosyltransferase-deficient clones for positive-negative selection of transgenic parasites.


    Dangoudoubiyam, Sriveny; Zhang, Zijing; Howe, Daniel K


    Sarcocystis neurona is an apicomplexan parasite that causes severe neurological disease in horses and marine mammals. The Apicomplexa are all obligate intracellular parasites that lack purine biosynthesis pathways and rely on the host cell for their purine requirements. Hypoxanthine-xanthine-guanine phosphoribosyltransferase (HXGPRT) and adenosine kinase (AK) are key enzymes that function in two complementary purine salvage pathways in apicomplexans. Bioinformatic searches of the S. neurona genome revealed genes encoding HXGPRT, AK and all of the major purine salvage enzymes except purine nucleoside phosphorylase. Wild-type S. neurona were able to grow in the presence of mycophenolic acid (MPA) but were inhibited by 6-thioxanthine (6-TX), suggesting that the pathways involving either HXGPRT or AK are functional in this parasite. Prior work with Toxoplasma gondii demonstrated the utility of HXGPRT as a positive-negative selection marker. To enable the use of HXGPRT in S. neurona, the SnHXGPRT gene sequence was determined and a gene-targeting plasmid was transfected into S. neurona. SnHXGPRT-deficient mutants were selected with 6-TX, and single-cell clones were obtained. These Sn∆HXG parasites were susceptible to MPA and could be complemented using the heterologous T. gondii HXGPRT gene. In summary, S. neurona possesses both purine salvage pathways described in apicomplexans, thus allowing the use of HXGPRT as a positive-negative drug selection marker in this parasite.

  8. LuxR- and acyl-homoserine-lactone-controlled non-lux genes define a quorum-sensing regulon in Vibrio fischeri.


    Callahan, S M; Dunlap, P V


    The luminescence (lux) operon (luxICDABEG) of the symbiotic bacterium Vibrio fischeri is regulated by the transcriptional activator LuxR and two acyl-homoserine lactone (acyl-HSL) autoinducers (the luxI-dependent 3-oxo-hexanoyl-HSL [3-oxo-C6-HSL] and the ainS-dependent octanoyl-HSL [C8-HSL]) in a population density-responsive manner called quorum sensing. To identify quorum-sensing-regulated (QSR) proteins different from those encoded by lux genes, we examined the protein patterns of V. fischeri quorum-sensing mutants defective in luxI, ainS, and luxR by two-dimensional polyacrylamide gel electrophoresis. Five non-Lux QSR proteins, QsrP, RibB, AcfA, QsrV, and QSR 7, were identified; their production occurred preferentially at high population density, required both LuxR and 3-oxo-C6-HSL, and was inhibited by C8-HSL at low population density. The genes encoding two of the QSR proteins were characterized: qsrP directs cells to synthesize an apparently novel periplasmic protein, and ribB is a homolog of the Escherichia coli gene for 3,4-dihydroxy-2-butanone 4-phosphate synthase, a key enzyme for riboflavin synthesis. The qsrP and ribB promoter regions each contained a sequence similar to the lux operon lux box, a 20-bp region of dyad symmetry necessary for LuxR/3-oxo-C6-HSL-dependent activation of lux operon transcription. V. fischeri qsrP and ribB mutants exhibited no distinct phenotype in culture. However, a qsrP mutant, in competition with its parent strain, was less successful in colonizing Euprymna scolopes, the symbiotic host of V. fischeri. The newly identified QSR genes, together with the lux operon, define a LuxR/acyl-HSL-responsive quorum-sensing regulon in V. fischeri.

  9. Gal80 proteins of Kluyveromyces lactis and Saccharomyces cerevisiae are highly conserved but contribute differently to glucose repression of the galactose regulon.

    PubMed Central

    Zenke, F T; Zachariae, W; Lunkes, A; Breunig, K D


    We cloned the GAL80 gene encoding the negative regulator of the transcriptional activator Gal4 (Lac9) from the yeast Kluyveromyces lactis. The deduced amino acid sequence of K. lactis GAL80 revealed a strong structural conservation between K. lactis Gal80 and the homologous Saccharomyces cerevisiae protein, with an overall identity of 60% and two conserved blocks with over 80% identical residues. K. lactis gal80 disruption mutants show constitutive expression of the lactose/galactose metabolic genes, confirming that K. lactis Gal80 functions in essentially in the same way as does S. cerevisiae Gal80, blocking activation by the transcriptional activator Lac9 (K. lactis Gal4) in the absence of an inducing sugar. However, in contrast to S. cerevisiae, in which Gal4-dependent activation is strongly inhibited by glucose even in a gal80 mutant, glucose repressibility is almost completely lost in gal80 mutants of K. lactis. Indirect evidence suggests that this difference in phenotype is due to a higher activator concentration in K. lactis which is able to overcome glucose repression. Expression of the K. lactis GAL80 gene is controlled by Lac9. Two high-affinity binding sites in the GAL80 promoter mediate a 70-fold induction by galactose and hence negative autoregulation by Gal80. Gal80 in turn not only controls Lac9 activity but also has a moderate influence on its rate of synthesis. Thus, a feedback control mechanism exists between the positive and negative regulators. By mutating the Lac9 binding sites of the GAL80 promoter, we could show that induction of GAL80 is required to prevent activation of the lactose/galactose regulon in glycerol or glucose plus galactose, whereas the noninduced level of Gal80 is sufficient to completely block Lac9 function in glucose. Images PMID:8246973

  10. LuxR- and Acyl-Homoserine-Lactone-Controlled Non-lux Genes Define a Quorum-Sensing Regulon in Vibrio fischeri

    PubMed Central

    Callahan, Sean M.; Dunlap, Paul V.


    The luminescence (lux) operon (luxICDABEG) of the symbiotic bacterium Vibrio fischeri is regulated by the transcriptional activator LuxR and two acyl-homoserine lactone (acyl-HSL) autoinducers (the luxI-dependent 3-oxo-hexanoyl-HSL [3-oxo-C6-HSL] and the ainS-dependent octanoyl-HSL [C8-HSL]) in a population density-responsive manner called quorum sensing. To identify quorum-sensing-regulated (QSR) proteins different from those encoded by lux genes, we examined the protein patterns of V. fischeri quorum-sensing mutants defective in luxI, ainS, and luxR by two-dimensional polyacrylamide gel electrophoresis. Five non-Lux QSR proteins, QsrP, RibB, AcfA, QsrV, and QSR 7, were identified; their production occurred preferentially at high population density, required both LuxR and 3-oxo-C6-HSL, and was inhibited by C8-HSL at low population density. The genes encoding two of the QSR proteins were characterized: qsrP directs cells to synthesize an apparently novel periplasmic protein, and ribB is a homolog of the Escherichia coli gene for 3,4-dihydroxy-2-butanone 4-phosphate synthase, a key enzyme for riboflavin synthesis. The qsrP and ribB promoter regions each contained a sequence similar to the lux operon lux box, a 20-bp region of dyad symmetry necessary for LuxR/3-oxo-C6-HSL-dependent activation of lux operon transcription. V. fischeri qsrP and ribB mutants exhibited no distinct phenotype in culture. However, a qsrP mutant, in competition with its parent strain, was less successful in colonizing Euprymna scolopes, the symbiotic host of V. fischeri. The newly identified QSR genes, together with the lux operon, define a LuxR/acyl-HSL-responsive quorum-sensing regulon in V. fischeri. PMID:10781550

  11. Modulation of activation-associated host cell gene expression by the apicomplexan parasite Theileria annulata

    PubMed Central

    Durrani, Zeeshan; Weir, William; Pillai, Sreerekha; Kinnaird, Jane; Shiels, Brian


    Summary Infection of bovine leucocytes by Theileria annulata results in establishment of transformed, infected cells. Infection of the host cell is known to promote constitutive activation of pro-inflammatory transcription factors that have the potential to be beneficial or detrimental. In this study we have compared the effect of LPS activation on uninfected bovine leucocytes (BL20 cells) and their Theileria-infected counterpart (TBL20). Gene expression profiles representing activated uninfected BL20 relative to TBL20 cells were also compared. The results show that while prolonged stimulation with LPS induces cell death and activation of NF-κB in BL20 cells, the viability of Theileria-infected cells was unaffected. Analysis of gene expression networks provided evidence that the parasite establishes tight control over pathways associated with cellular activation by modulating reception of extrinsic stimuli and by significantly altering the expression outcome of genes targeted by infection-activated transcription factors. Pathway analysis of the data set identified novel candidate genes involved in manipulation of cellular functions associated with the infected transformed cell. The data indicate that the T. annulata parasite can irreversibly reconfigure host cell gene expression networks associated with development of inflammatory disease and cancer to generate an outcome thatis beneficial to survival and propagation of the infected leucocyte. PMID:22533473

  12. Quantitative and qualitative stem rust resistance factors in barley are associated with transcriptional suppression of defense regulons

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Stem rust (Puccinia graminis f. sp. tritici; Pgt) is a devastating fungal disease of wheat and barley. Pgt race TTKSK (isolate Ug99) is a serious threat to these Triticeae grain crops because resistance is rare. In barley, the complex Rpg-TTKSK locus on chromosome 5H is presently the only known so...

  13. Fecundity reduction in the second gonotrophic cycle of Culex pipiens infected with the apicomplexan blood parasite, Hepatozoon sipedon.


    Ferguson, Laura V; Smith, Todd G


    Fecundity reduction is a well-recognized phenomenon of parasite infection in insects. Reduced production of eggs might increase longevity of a host and release nutrients to both host and parasite that would otherwise be used for oogenesis. The objective of this study was to assess effects on fecundity caused by Hepatozoon sipedon, an apicomplexan blood parasite of snakes, in its invertebrate host, the mosquito Culex pipiens. In the first gonotrophic cycle, the mean number of eggs laid by mosquitoes infected with H. sipedon did not differ significantly from those laid by uninfected mosquitoes. However, in the second gonotrophic cycle infected mosquitoes laid significantly fewer eggs than did uninfected mosquitoes, and fecundity was reduced by 100% in mosquitoes with parasite burdens of more than 60 oocysts. There was a significant negative correlation between parasite burden, or the number of oocysts, and the number of eggs produced in the second gonotrophic cycle. Significantly fewer viable larvae hatched from eggs laid by infected compared to uninfected mosquitoes in the second gonotrophic cycle. These data indicate that fecundity reduction occurs in this system, although the physiological mechanisms driving this phenotype are not yet known.

  14. The rpoA341 allele of Escherichia coli specifically impairs the transcription of a group of positively-regulated operons.


    Giffard, P M; Booth, I R


    The specificity of the transcription defect caused by the rpoA341(phs) allele has been investigated. Three apparently unlinked genetic systems have been found to be impaired in their transcription by this mutant allele of the alpha subunit of RNA polymerase. These three systems, the melAB operon, the cysA locus and the ara regulon, are apparently unrelated other than by their requirement for a regulon-specific positive regulator for the initiation of transcription. Expression of the gene for the positive regulator does not appear to be significantly affected in any of the three systems. However, mutations that render expression of the araBAD operon independent of the regulatory protein also confer insensitivity to the rpoA341 allele. The significance of these observations is discussed in the context of models of positive regulation.

  15. Molecular cloning and expression of a gene that controls the high-temperature regulon of Escherichia coli.

    PubMed Central

    Neidhardt, F C; VanBogelen, R A; Lau, E T


    The high-temperature production (HTP) regulon of Escherichia coli consists of a set of operons that are induced coordinately by a shift to a high temperature under the control of a single chromosomal gene called htpR or hin. To identify more components of this regulon, the rates of synthesis of many polypeptides resolved on two-dimensional polyacrylamide gels were measured in various strains by pulse-labeling after a temperature shift-up. A total of 13 polypeptides were found to be heat inducible only in cells bearing a normal htpR gene on the chromosome or on a plasmid; on this basis these polypeptides were designated products of the HTP regulon. Several hybrid plasmids that contain segments of the E. coli chromosome in the 75-min region were found to carry the htpR gene. A restriction map of this region was constructed, and selected fragments were subcloned and tested for the ability to complement an htpR mutant. The polypeptides encoded by these fragments were detected by permitting expression in maxicells, minicells, and chloramphenicol-treated cells. Complementation was accompanied by production of a polypeptide having a molecular weight of approximately 33,000. This polypeptide, designated F33.4, was markedly reduced in amount in an htpR mutant expected to contain very little htpR gene product. Polypeptide F33.4 is postulated to be the product of htpR and to be an effector that controls heat induction of the HTP regulon. Images PMID:6337122

  16. Transcriptome analysis of the Dickeya dadantii PecS regulon during early stages of interaction with Arabidopsis thaliana.


    Pédron, Jacques; Chapelle, Emilie; Alunni, Benoît; Van Gijsegem, Frédérique


    PecS is one of the major global regulators controlling virulence of Dickeya dadantii, a broad host range phytopathogenic bacterium causing soft rot on several plant families. To define the PecS regulon during plant colonisation, we analysed the global transcriptome profiles in wild type and pecS mutant strains during early colonization of the leaf surfaces and in leaf tissue just before the onset of symptoms and found that the PecS regulon consists of more than 600 genes. About one half of these genes are down-regulated in the pecS mutant, therefore PecS has both positive and negative regulatory roles that may be direct or indirect. Indeed, PecS also controls the regulation of a few dozen regulatory genes demonstrating that this global regulator is at or near the top of a major regulatory cascade governing adaptation to growth in planta. Notably PecS acts mainly at the very beginning of the infection, not only for preventing virulence gene induction but also playing an active role in adaptation of the bacterium to the epiphytic habitat. Comparison of the patterns of gene expression inside leaf tissues and during early colonisation of leaf surfaces in the wild type bacterium revealed 637 genes modulated between these two environments. More than 40% of these modulated genes are part of the PecS regulon emphasizing the prominent role of PecS during plant colonisation. This article is protected by copyright. All rights reserved.

  17. Comprehensive Assessment of the Regulons Controlled by the FixLJ-FixK2-FixK1 Cascade in Bradyrhizobium japonicum▿ †

    PubMed Central

    Mesa, Socorro; Hauser, Felix; Friberg, Markus; Malaguti, Emmanuelle; Fischer, Hans-Martin; Hennecke, Hauke


    Symbiotic N2 fixation in Bradyrhizobium japonicum is controlled by a complex transcription factor network. Part of it is a hierarchically arranged cascade in which the two-component regulatory system FixLJ, in response to a moderate decrease in oxygen concentration, activates the fixK2 gene. The FixK2 protein then activates not only a number of genes essential for microoxic respiration in symbiosis (fixNOQP and fixGHIS) but also further regulatory genes (rpoN1, nnrR, and fixK1). The results of transcriptome analyses described here have led to a comprehensive and expanded definition of the FixJ, FixK2, and FixK1 regulons, which, respectively, consist of 26, 204, and 29 genes specifically regulated in microoxically grown cells. Most of these genes are subject to positive control. Particular attention was addressed to the FixK2-dependent genes, which included a bioinformatics search for putative FixK2 binding sites on DNA (FixK2 boxes). Using an in vitro transcription assay with RNA polymerase holoenzyme and purified FixK2 as the activator, we validated as direct targets eight new genes. Interestingly, the adjacent but divergently oriented fixK1 and cycS genes shared the same FixK2 box for the activation of transcription in both directions. This recognition site may also be a direct target for the FixK1 protein, because activation of the cycS promoter required an intact fixK1 gene and either microoxic or anoxic, denitrifying conditions. We present evidence that cycS codes for a c-type cytochrome which is important, but not essential, for nitrate respiration. Two other, unexpected results emerged from this study: (i) specifically FixK1 seemed to exert a negative control on genes that are normally activated by the N2 fixation-specific transcription factor NifA, and (ii) a larger number of genes are expressed in a FixK2-dependent manner in endosymbiotic bacteroids than in culture-grown cells, pointing to a possible symbiosis-specific control. PMID:18689489

  18. Xylan utilization regulon in Xanthomonas citri pv. citri Strain 306: gene expression and utilization of oligoxylosides.


    Chow, V; Shantharaj, D; Guo, Y; Nong, G; Minsavage, G V; Jones, J B; Preston, J F


    Xanthomonas citri pv. citri strain 306 (Xcc306), a causative agent of citrus canker, produces endoxylanases that catalyze the depolymerization of cell wall-associated xylans. In the sequenced genomes of all plant-pathogenic xanthomonads, genes encoding xylanolytic enzymes are clustered in three adjacent operons. In Xcc306, these consecutive operons contain genes encoding the glycoside hydrolase family 10 (GH10) endoxylanases Xyn10A and Xyn10C, the agu67 gene, encoding a GH67 α-glucuronidase (Agu67), the xyn43E gene, encoding a putative GH43 α-l-arabinofuranosidase, and the xyn43F gene, encoding a putative β-xylosidase. Recombinant Xyn10A and Xyn10C convert polymeric 4-O-methylglucuronoxylan (MeGXn) to oligoxylosides methylglucuronoxylotriose (MeGX3), xylotriose (X3), and xylobiose (X2). Xcc306 completely utilizes MeGXn predigested with Xyn10A or Xyn10C but shows little utilization of MeGXn. Xcc306 with a deletion in the gene encoding α-glucuronidase (Xcc306 Δagu67) will not utilize MeGX3 for growth, demonstrating the role of Agu67 in the complete utilization of GH10-digested MeGXn. Preferential growth on oligoxylosides compared to growth on polymeric MeGXn indicates that GH10 xylanases, either secreted by Xcc306 in planta or produced by the plant host, generate oligoxylosides that are processed by Xyn10 xylanases and Agu67 residing in the periplasm. Coordinate induction by oligoxylosides of xyn10, agu67, cirA, the tonB receptor, and other genes within these three operons indicates that they constitute a regulon that is responsive to the oligoxylosides generated by the action of Xcc306 GH10 xylanases on MeGXn. The combined expression of genes in this regulon may allow scavenging of oligoxylosides derived from cell wall deconstruction, thereby contributing to the tissue colonization and/or survival of Xcc306 and, ultimately, to plant disease.

  19. Xylan Utilization Regulon in Xanthomonas citri pv. citri Strain 306: Gene Expression and Utilization of Oligoxylosides

    PubMed Central

    Chow, V.; Shantharaj, D.; Guo, Y.; Nong, G.; Minsavage, G. V.; Jones, J. B.


    Xanthomonas citri pv. citri strain 306 (Xcc306), a causative agent of citrus canker, produces endoxylanases that catalyze the depolymerization of cell wall-associated xylans. In the sequenced genomes of all plant-pathogenic xanthomonads, genes encoding xylanolytic enzymes are clustered in three adjacent operons. In Xcc306, these consecutive operons contain genes encoding the glycoside hydrolase family 10 (GH10) endoxylanases Xyn10A and Xyn10C, the agu67 gene, encoding a GH67 α-glucuronidase (Agu67), the xyn43E gene, encoding a putative GH43 α-l-arabinofuranosidase, and the xyn43F gene, encoding a putative β-xylosidase. Recombinant Xyn10A and Xyn10C convert polymeric 4-O-methylglucuronoxylan (MeGXn) to oligoxylosides methylglucuronoxylotriose (MeGX3), xylotriose (X3), and xylobiose (X2). Xcc306 completely utilizes MeGXn predigested with Xyn10A or Xyn10C but shows little utilization of MeGXn. Xcc306 with a deletion in the gene encoding α-glucuronidase (Xcc306 Δagu67) will not utilize MeGX3 for growth, demonstrating the role of Agu67 in the complete utilization of GH10-digested MeGXn. Preferential growth on oligoxylosides compared to growth on polymeric MeGXn indicates that GH10 xylanases, either secreted by Xcc306 in planta or produced by the plant host, generate oligoxylosides that are processed by Xyn10 xylanases and Agu67 residing in the periplasm. Coordinate induction by oligoxylosides of xyn10, agu67, cirA, the tonB receptor, and other genes within these three operons indicates that they constitute a regulon that is responsive to the oligoxylosides generated by the action of Xcc306 GH10 xylanases on MeGXn. The combined expression of genes in this regulon may allow scavenging of oligoxylosides derived from cell wall deconstruction, thereby contributing to the tissue colonization and/or survival of Xcc306 and, ultimately, to plant disease. PMID:25595763

  20. Identification, Functional Characterization and Regulon Prediction of a Novel Two Component System Comprising BAS0540-BAS0541 of Bacillus anthracis

    PubMed Central

    Gopalani, Monisha; Kandari, Divya; Bhatnagar, Rakesh


    Two component systems (TCSs) can be envisaged as complex molecular devices that help the bacteria to sense its environment and respond aptly. 41 TCSs are predicted in Bacillus anthracis, a potential bioterrorism agent, of which only four have been studied so far. Thus, the intricate signaling network contributed by TCSs remains largely unmapped in B. anthracis and needs comprehensive exploration. In this study, we functionally characterized one such system composed of BAS0540 (Response regulator) and BAS0541 (Histidine kinase). BAS0540-BAS0541, the closest homolog of CiaRH of Streptococcus in B. anthracis, forms a functional TCS with BAS0541 displaying autophosphorylation and subsequent phosphotransfer to BAS0540. BAS0540 was also found to accept phosphate from physiologically relevant small molecule phosphodonors like acetyl phosphate and carbamoyl phosphate. Results of qRT-PCR and immunoblotting demonstrated that BAS0540 exhibits a constitutive expression throughout the growth of B. anthracis. Regulon prediction for BAS0540 in B. anthracis was done in silico using the consensus DNA binding sequence of CiaR of Streptococcus. The predicted regulon of BAS0540 comprised of 23 genes, which could be classified into 8 functionally diverse categories. None of the proven virulence factors were a part of the predicted regulon, an observation contrasting with the regulon of CiaRH in Streptococci. Electrophoretic mobility shift assay was used to show direct binding of purified BAS0540 to the upstream regions of 5 putative regulon candidates- BAS0540 gene itself; a gene predicted to encode cell division protein FtsA; a self–immunity gene; a RND family transporter gene and a gene encoding stress (heat) responsive protein. A significant enhancement in the DNA binding ability of BAS0540 was observed upon phosphorylation. Overexpression of response regulator BAS0540 in B. anthracis led to a prodigious increase of ~6 folds in the cell length, thereby conferring it a filamentous

  1. The RNA-binding protein SFPQ orchestrates an RNA regulon to promote axon viability.


    Cosker, Katharina E; Fenstermacher, Sara J; Pazyra-Murphy, Maria F; Elliott, Hunter L; Segal, Rosalind A


    To achieve accurate spatiotemporal patterns of gene expression, RNA-binding proteins (RBPs) guide nuclear processing, intracellular trafficking and local translation of target mRNAs. In neurons, RBPs direct transport of target mRNAs to sites of translation in remote axons and dendrites. However, it is not known whether an individual RBP coordinately regulates multiple mRNAs within these morphologically complex cells. Here we identify SFPQ (splicing factor, poly-glutamine rich) as an RBP that binds and regulates multiple mRNAs in dorsal root ganglion sensory neurons and thereby promotes neurotrophin-dependent axonal viability. SFPQ acts in nuclei, cytoplasm and axons to regulate functionally related mRNAs essential for axon survival. Notably, SFPQ is required for coassembly of LaminB2 (Lmnb2) and Bclw (Bcl2l2) mRNAs in RNA granules and for axonal trafficking of these mRNAs. Together these data demonstrate that SFPQ orchestrates spatial gene expression of a newly identified RNA regulon essential for axonal viability.

  2. The Rcs regulon in Proteus mirabilis: implications for motility, biofilm formation, and virulence.


    Howery, Kristen E; Clemmer, Katy M; Rather, Philip N


    The overall role of the Rcs phosphorelay in Proteus mirabilis is largely unknown. Previous work had demonstrated that the Rcs phosphorelay represses the flhDC operon and activates the minCDE cell division inhibition system. To identify additional cellular functions regulated by the Rcs phosphorelay, an analysis of RNA-seq data was undertaken. In this report, the results of the RNA-sequencing are discussed with an emphasis on the predicted roles of the Rcs phosphorelay in swarmer cell differentiation, motility, biofilm formation, and virulence. RcsB is shown to activate genes important for differentiation and fimbriae formation, while repressing the expression of genes important for motility and virulence. Additionally, to follow up on the RNA-Seq data, we demonstrate that an rcsB mutant is deficient in its ability to form biofilm and exhibits enhanced virulence in a Galleria mellonella waxworm model. Overall, these results indicate the Rcs regulon in P. mirabilis extends beyond flagellar genes to include those involved in biofilm formation and virulence. Furthermore, the information presented in this study may provide clues to additional roles of the Rcs phosphorelay in other members of the Enterobacteriaceae.

  3. The roles of peroxide protective regulons in protecting Xanthomonas campestris pv. campestris from sodium hypochlorite stress.


    Charoenlap, Nisanart; Sornchuer, Phornphan; Piwkam, Anong; Srijaruskul, Kriangsuk; Mongkolsuk, Skorn; Vattanaviboon, Paiboon


    The exposure of Xanthomonas campestris pv. campestris to sublethal concentrations of a sodium hypochlorite (NaOCl) solution induced the expression of genes that encode peroxide scavenging enzymes within the OxyR and OhrR regulons. Sensitivity testing in various X. campestris mutants indicated that oxyR, katA, katG, ahpC, and ohr contributed to protection against NaOCl killing. The pretreatment of X. campestris cultures with oxidants, such as hydrogen peroxide (H2O2), t-butyl hydroperoxide, and the superoxide generator menadione, protected the bacteria from lethal concentrations of NaOCl in an OxyR-dependent manner. Treating the bacteria with a low concentration of NaOCl resulted in the adaptive protection from NaOCl killing and also provided cross-protection from H2O2 killing. Taken together, the results suggest that the toxicity of NaOCl is partially mediated by the generation of peroxides and other reactive oxygen species that are removed by primary peroxide scavenging enzymes, such as catalases and AhpC, as a part of an overall strategy that protects the bacteria from the lethal effects of NaOCl.

  4. Dissecting the interface between apicomplexan parasite and host cell: Insights from a divergent AMA-RON2 pair.


    Parker, Michelle L; Penarete-Vargas, Diana M; Hamilton, Phineas T; Guérin, Amandine; Dubey, Jitender P; Perlman, Steve J; Spano, Furio; Lebrun, Maryse; Boulanger, Martin J


    Plasmodium falciparum and Toxoplasma gondii are widely studied parasites in phylum Apicomplexa and the etiological agents of severe human malaria and toxoplasmosis, respectively. These intracellular pathogens have evolved a sophisticated invasion strategy that relies on delivery of proteins into the host cell, where parasite-derived rhoptry neck protein 2 (RON2) family members localize to the host outer membrane and serve as ligands for apical membrane antigen (AMA) family surface proteins displayed on the parasite. Recently, we showed that T. gondii harbors a novel AMA designated as TgAMA4 that shows extreme sequence divergence from all characterized AMA family members. Here we show that sporozoite-expressed TgAMA4 clusters in a distinct phylogenetic clade with Plasmodium merozoite apical erythrocyte-binding ligand (MAEBL) proteins and forms a high-affinity, functional complex with its coevolved partner, TgRON2L1. High-resolution crystal structures of TgAMA4 in the apo and TgRON2L1-bound forms complemented with alanine scanning mutagenesis data reveal an unexpected architecture and assembly mechanism relative to previously characterized AMA-RON2 complexes. Principally, TgAMA4 lacks both a deep surface groove and a key surface loop that have been established to govern RON2 ligand binding selectivity in other AMAs. Our study reveals a previously underappreciated level of molecular diversity at the parasite-host-cell interface and offers intriguing insight into the adaptation strategies underlying sporozoite invasion. Moreover, our data offer the potential for improved design of neutralizing therapeutics targeting a broad range of AMA-RON2 pairs and apicomplexan invasive stages.

  5. Molecular systematics of marine gregarine apicomplexans from Pacific tunicates, with descriptions of five novel species of Lankesteria.


    Rueckert, Sonja; Wakeman, Kevin C; Jenke-Kodama, Holger; Leander, Brian S


    The eugregarines are a group of apicomplexan parasites that mostly infect the intestines of invertebrates. The high level of morphological variation found within and among species of eugregarines makes it difficult to find consistent and reliable traits that unite even closely related lineages. Based mostly on traits observed with light microscopy, the majority of described eugregarines from marine invertebrates has been classified into a single group, the Lecudinidae. Our understanding of the overall diversity and phylogenetic relationships of lecudinids is very poor, mainly because only a modest amount of exploratory research has been done on the group and very few species of lecudinids have been characterized at the molecular phylogenetic level. In an attempt to understand the diversity of marine gregarines better, we surveyed lecudinids that infect the intestines of Pacific ascidians (i.e. sea squirts) using ultrastructural and molecular phylogenetic approaches; currently, these species fall within one genus, Lankesteria. We collected lecudinid gregarines from six ascidian host species, and our data demonstrated that each host was infected by a different species of Lankesteria: (i) Lankesteria hesperidiiformis sp. nov., isolated from Distaplia occidentalis, (ii) Lankesteria metandrocarpae sp. nov., isolated from Metandrocarpa taylori, (iii) Lankesteria halocynthiae sp. nov., isolated from Halocynthia aurantium, (iv) Lankesteria herdmaniae sp. nov., isolated from Herdmania momus, (v) Lankesteria cf. ritterellae, isolated from Ritterella rubra, and (vi) Lankesteria didemni sp. nov., isolated from Didemnum vexillum. Visualization of the trophozoites with scanning electron microscopy showed that four of these species were covered with epicytic folds, whereas two of the species were covered with a dense pattern of epicytic knobs. The molecular phylogenetic data suggested that species of Lankesteria with surface knobs form a clade that is nested within a paraphyletic

  6. The conserved apicomplexan Aurora kinase TgArk3 is involved in endodyogeny, duplication rate and parasite virulence.


    Berry, Laurence; Chen, Chun-Ti; Reininger, Luc; Carvalho, Teresa G; El Hajj, Hiba; Morlon-Guyot, Juliette; Bordat, Yann; Lebrun, Maryse; Gubbels, Marc-Jan; Doerig, Christian; Daher, Wassim


    Aurora kinases are eukaryotic serine/threonine protein kinases that regulate key events associated with chromatin condensation, centrosome and spindle function and cytokinesis. Elucidating the roles of Aurora kinases in apicomplexan parasites is crucial to understand the cell cycle control during Plasmodium schizogony or Toxoplasma endodyogeny. Here, we report on the localization of two previously uncharacterized Toxoplasma Aurora-related kinases (Ark2 and Ark3) in tachyzoites and of the uncharacterized Ark3 orthologue in Plasmodium falciparum erythrocytic stages. In Toxoplasma gondii, we show that TgArk2 and TgArk3 concentrate at specific sub-cellular structures linked to parasite division: the mitotic spindle and intranuclear mitotic structures (TgArk2), and the outer core of the centrosome and the budding daughter cells cytoskeleton (TgArk3). By tagging the endogenous PfArk3 gene with the green fluorescent protein in live parasites, we show that PfArk3 protein expression peaks late in schizogony and localizes at the periphery of budding schizonts. Disruption of the TgArk2 gene reveals no essential function for tachyzoite propagation in vitro, which is surprising giving that the P. falciparum and P. berghei orthologues are essential for erythrocyte schizogony. In contrast, knock-down of TgArk3 protein results in pronounced defects in parasite division and a major growth deficiency. TgArk3-depleted parasites display several defects, such as reduced parasite growth rate, delayed egress and parasite duplication, defect in rosette formation, reduced parasite size and invasion efficiency and lack of virulence in mice. Our study provides new insights into cell cycle control in Toxoplasma and malaria parasites and highlights Aurora kinase 3 as potential drug target.

  7. Studying Gene Expression: Database Searches and Promoter Fusions to Investigate Transcriptional Regulation in Bacteria†

    PubMed Central

    Martinez-Vaz, Betsy M.; Makarevitch, Irina; Stensland, Shane


    A laboratory project was designed to illustrate how to search biological databases and utilize the information provided by these resources to investigate transcriptional regulation in Escherichia coli. The students searched several databases (NCBI Genomes, RegulonDB and EcoCyc) to learn about gene function, regulation, and the organization of transcriptional units. A fluorometer and GFP promoter fusions were used to obtain fluorescence data and measure changes in transcriptional activity. The class designed and performed experiments to investigate the regulation of genes necessary for biosynthesis of amino acids and how expression is affected by environmental signals and transcriptional regulators. Assessment data showed that this activity enhanced students’ knowledge of databases, reporter genes and transcriptional regulation. PMID:23653697

  8. Novel vaccine potential of Rv3131, a DosR regulon-encoded putative nitroreductase, against hyper-virulent Mycobacterium tuberculosis strain K.


    Kwon, Kee Woong; Kim, Woo Sik; Kim, Hongmin; Han, Seung Jung; Hahn, Mi-Young; Lee, Jong Seok; Nam, Ki Taek; Cho, Sang-Nae; Shin, Sung Jae


    Accumulating evidence indicates that latency-associated Mycobacterium tuberculosis (Mtb)-specific antigens from the dormancy survival regulator regulon (DosR) may be promising novel vaccine target antigens for the development of an improved tuberculosis vaccine. After transcriptional profiling of DosR-related genes in the hyper-virulent Beijing Mtb strain K and the reference Mtb strain H37Rv, we selected Rv3131, a hypothetical nitroreductase, as a vaccine antigen and evaluated its vaccine efficacy against Mtb K. Mtb K exhibited stable and constitutive up-regulation of rv3131 relative to Mtb H37Rv under three different growth conditions (at least 2-fold induction) including exponential growth in normal culture conditions, hypoxia, and inside macrophages. Mice immunised with Rv3131 formulated in GLA-SE, a well-defined TLR4 adjuvant, displayed enhanced Rv3131-specific IFN-γ and serum IgG2c responses along with effector/memory T cell expansion and remarkable generation of Rv3131-specific multifunctional CD4(+) T cells co-producing TNF-α, IFN-γ and IL-2 in both spleen and lung. Following challenge with Mtb K, the Rv3131/GLA-SE-immunised group exhibited a significant reduction in bacterial number and less extensive lung inflammation accompanied by the obvious persistence of Rv3131-specific multifunctional CD4(+) T cells. These results suggest that Rv3131 could be an excellent candidate for potential use in a multi-antigenic Mtb subunit vaccine, especially against Mtb Beijing strains.

  9. Novel vaccine potential of Rv3131, a DosR regulon-encoded putative nitroreductase, against hyper-virulent Mycobacterium tuberculosis strain K

    PubMed Central

    Kwon, Kee Woong; Kim, Woo Sik; Kim, Hongmin; Han, Seung Jung; Hahn, Mi-Young; Lee, Jong Seok; Nam, Ki Taek; Cho, Sang-Nae; Shin, Sung Jae


    Accumulating evidence indicates that latency-associated Mycobacterium tuberculosis (Mtb)-specific antigens from the dormancy survival regulator regulon (DosR) may be promising novel vaccine target antigens for the development of an improved tuberculosis vaccine. After transcriptional profiling of DosR-related genes in the hyper-virulent Beijing Mtb strain K and the reference Mtb strain H37Rv, we selected Rv3131, a hypothetical nitroreductase, as a vaccine antigen and evaluated its vaccine efficacy against Mtb K. Mtb K exhibited stable and constitutive up-regulation of rv3131 relative to Mtb H37Rv under three different growth conditions (at least 2-fold induction) including exponential growth in normal culture conditions, hypoxia, and inside macrophages. Mice immunised with Rv3131 formulated in GLA-SE, a well-defined TLR4 adjuvant, displayed enhanced Rv3131-specific IFN-γ and serum IgG2c responses along with effector/memory T cell expansion and remarkable generation of Rv3131-specific multifunctional CD4+ T cells co-producing TNF-α, IFN-γ and IL-2 in both spleen and lung. Following challenge with Mtb K, the Rv3131/GLA-SE-immunised group exhibited a significant reduction in bacterial number and less extensive lung inflammation accompanied by the obvious persistence of Rv3131-specific multifunctional CD4+ T cells. These results suggest that Rv3131 could be an excellent candidate for potential use in a multi-antigenic Mtb subunit vaccine, especially against Mtb Beijing strains. PMID:28272457

  10. Characterization of DNA Binding Sites of RokB, a ROK-Family Regulator from Streptomyces coelicolor Reveals the RokB Regulon

    PubMed Central

    Bekiesch, Paulina; Forchhammer, Karl; Apel, Alexander Kristian


    ROK-family proteins have been described to act either as sugar kinases or as transcriptional regulators. Few ROK-family regulators have been characterized so far and most of them are involved in carbon catabolite repression. RokB (Sco6115) has originally been identified in a DNA-affinity capturing approach as a possible regulator of the heterologously expressed novobiocin biosynthetic gene cluster in Streptomyces coelicolor M512. Interestingly, both, the rokB deletion mutants as well as its overexpressing mutants showed significantly reduced novobiocin production in the host strain S.coelicolor M512. We identified the DNA-binding site for RokB in the promoter region of the novobiocin biosynthetic genes novH-novW. It overlaps with the novH start codon which may explain the reduction of novobiocin production caused by overexpression of rokB. Bioinformatic screening coupled with surface plasmon resonance based interaction studies resulted in the discovery of five RokB binding sites within the genome of S. coelicolor. Using the genomic binding sites, a consensus motif for RokB was calculated, which differs slightly from previously determined binding motifs for ROK-family regulators. The annotations of the possible members of the so defined RokB regulon gave hints that RokB might be involved in amino acid metabolism and transport. This hypothesis was supported by feeding experiments with casamino acids and L-tyrosine, which could also explain the reduced novobiocin production in the deletion mutants. PMID:27145180

  11. The complete nucleotide sequence of the lux regulon of Vibrio fischeri and the luxABN region of Photobacterium leiognathi and the mechanism of control of bacterial bioluminescence.


    Baldwin, T O; Devine, J H; Heckel, R C; Lin, J W; Shadel, G S


    We have determined the complete nucleotide sequence of a 7622 base pair fragment of DNA from Vibrio fischeri strain ATCC7744 that contains all the information required to confer plasmid-borne, regulated bioluminescence upon strains of Escherichia coli. The lux regulon from V. fischeri consists of two divergently transcribed operons, L (left) and R (right), and at least seven genes, luxR (L operon) and luxICDABE (R operon) and the intervening control region. The luxA and luxB genes encode respectively the alpha and beta subunits of luciferase. The gene order luxCDABE seen in V. fischeri is the same as for V. harveyi. We have determined the sequence of the luxAB and flanking regions from Photobacterium leiognathi and have found upstream sequences homologous with luxC from the Vibrio species, but between luxB and luxE, there is an open reading frame encoding a protein of 227 amino acids (26,229 molecular weight) that is not found in this location in the Vibrio species. The amino terminal amino acid sequence of the encoded protein is nearly identical to that determined by O'Kane and Lee (University of Georgia) for the non-fluorescent flavoprotein from a closely related Photobacterium species (Dr Dennis O'Kane, personal communication). We have therefore designated this gene luxN. There is a 20-base inverted repeat ACCTGTAGGAxTCGTACAGGT, centred between bases 927 and 928 in the region between the two operons of V. fischeri. This region appears to fulfil two functions: it is critical for the LuxR protein to exert its effect and it is a consensus binding site for the E. coli LexA protein, a negative regulatory protein involved with the SOS response. There are sequences within the luxR coding region that appear to function in a cis-acting fashion to repress transcription from both the leftward and rightward promoters in the absence of the respective transcriptional activator proteins, thereby resulting in low basal levels of transcription. It now appears clear that there

  12. Model of transcriptional activation by MarA in Escherichia coli.


    Wall, Michael E; Markowitz, David A; Rosner, Judah L; Martin, Robert G


    The AraC family transcription factor MarA activates approximately 40 genes (the marA/soxS/rob regulon) of the Escherichia coli chromosome resulting in different levels of resistance to a wide array of antibiotics and to superoxides. Activation of marA/soxS/rob regulon promoters occurs in a well-defined order with respect to the level of MarA; however, the order of activation does not parallel the strength of MarA binding to promoter sequences. To understand this lack of correspondence, we developed a computational model of transcriptional activation in which a transcription factor either increases or decreases RNA polymerase binding, and either accelerates or retards post-binding events associated with transcription initiation. We used the model to analyze data characterizing MarA regulation of promoter activity. The model clearly explains the lack of correspondence between the order of activation and the MarA-DNA affinity and indicates that the order of activation can only be predicted using information about the strength of the full MarA-polymerase-DNA interaction. The analysis further suggests that MarA can activate without increasing polymerase binding and that activation can even involve a decrease in polymerase binding, which is opposite to the textbook model of activation by recruitment. These findings are consistent with published chromatin immunoprecipitation assays of interactions between polymerase and the E. coli chromosome. We find that activation involving decreased polymerase binding yields lower latency in gene regulation and therefore might confer a competitive advantage to cells. Our model yields insights into requirements for predicting the order of activation of a regulon and enables us to suggest that activation might involve a decrease in polymerase binding which we expect to be an important theme of gene regulation in E. coli and beyond.

  13. Model of transcriptional activation by MarA in escherichia coli

    SciTech Connect

    Wall, Michael E; Rosner, Judah L; Martin, Robert G


    The AraC family transcription factor MarA activates approximately 40 genes (the marA/soxS/rob regulon) of the Escherichia coli chromosome resulting in different levels of resistance to a wide array of antibiotics and to superoxides. Activation of marA/soxS/rob regulon promoters occurs in a well-defined order with respect to the level of MarA; however, the order of activation does not parallel the strength of MarA binding to promoter sequences. To understand this lack of correspondence, we developed a computational model of transcriptional activation in which a transcription factor either increases or decreases RNA polymerase binding, and either accelerates or retards post-binding events associated with transcription initiation. We used the model to analyze data characterizing MarA regulation of promoter activity. The model clearly explains the lack of correspondence between the order of activation and the MarA-DNA affinity and indicates that the order of activation can only be predicted using information about the strength of the full MarA-polymerase-DNA interaction. The analysis further suggests that MarA can activate without increasing polymerase binding and that activation can even involve a decrease in polymerase binding, which is opposite to the textbook model of activation by recruitment. These findings are consistent with published chromatin immunoprecipitation assays of interactions between polymerase and the E. coli chromosome. We find that activation involving decreased polymerase binding yields lower latency in gene regulation and therefore might confer a competitive advantage to cells. Our model yields insights into requirements for predicting the order of activation of a regulon and enables us to suggest that activation might involve a decrease in polymerase binding which we expect to be an important theme of gene regulation in E. coli and beyond.

  14. Computing and Applying Atomic Regulons to Understand Gene Expression and Regulation

    SciTech Connect

    Faria, José P.; Davis, James J.; Edirisinghe, Janaka N.; Taylor, Ronald C.; Weisenhorn, Pamela; Olson, Robert D.; Stevens, Rick L.; Rocha, Miguel; Rocha, Isabel; Best, Aaron A.; DeJongh, Matthew; Tintle, Nathan L.; Parrello, Bruce; Overbeek, Ross; Henry, Christopher S.


    Understanding gene function and regulation is essential for the interpretation, prediction, and ultimate design of cell responses to changes in the environment. A multitude of technologies, abstractions, and interpretive frameworks have emerged to answer the challenges presented by genome function and regulatory network inference. Here, we propose a new approach for producing biologically meaningful clusters of coexpressed genes, called Atomic Regulons (ARs), based on expression data, gene context, and functional relationships. We demonstrate this new approach by computing ARs for Escherichia coli, which we compare with the coexpressed gene clusters predicted by two prevalent existing methods: hierarchical clustering and k-means clustering. We test the consistency of ARs predicted by all methods against expected interactions predicted by the Context Likelihood of Relatedness (CLR) mutual information based method, finding that the ARs produced by our approach show better agreement with CLR interactions. We then apply our method to compute ARs for four other genomes: Shewanella oneidensis, Pseudomonas aeruginosa, Thermus thermophilus, and Staphylococcus aureus. We compare the AR clusters from all genomes to study the similarity of coexpression among a phylogenetically diverse set of species, identifying subsystems that show remarkable similarity over wide phylogenetic distances. We also study the sensitivity of our method for computing ARs to the expression data used in the computation, showing that our new approach requires less data than competing approaches to converge to a near final configuration of ARs. We go on to use our sensitivity analysis to identify the specific experiments that lead most rapidly to the final set of ARs for E. coli. As a result, this analysis produces insights into improving the design of gene expression experiments.

  15. A mutant crp allele that differentially activates the operons of the fuc regulon in Escherichia coli.


    Zhu, Y; Lin, E C


    L-Fucose is used by Escherichia coli through an inducible pathway mediated by a fucP-encoded permease, a fucI-encoded isomerase, a fucK-encoded kinase, and a fucA-encoded aldolase. The adolase catalyzes the formation of dihydroxyacetone phosphate and L-lactaldehyde. Anaerobically, lactaldehyde is converted by a fucO-encoded oxidoreductase to L-1,2-propanediol, which is excreted. The fuc genes belong to a regulon comprising four linked operons: fucO, fucA, fucPIK, and fucR. The positive regulator encoded by fucR responds to fuculose 1-phosphate as the effector. Mutants serially selected for aerobic growth on propanediol became constitutive in fucO and fucA [fucO(Con) fucA(Con)], but noninducible in fucPIK [fucPIK(Non)]. An external suppressor mutation that restored growth on fucose caused constitutive expression of fucPIK. Results from this study indicate that this suppressor mutation occurred in crp, which encodes the cyclic AMP-binding (or receptor) protein. When the suppressor allele (crp-201) was transduced into wild-type strains, the recipient became fucose negative and fucose sensitive (with glycerol as the carbon and energy source) because of impaired expression of fucA. The fucPIK operon became hyperinducible. The growth rate on maltose was significantly reduced, but growth on L-rhamnose, D-galactose, L-arabinose, glycerol, or glycerol 3-phosphate was close to normal. Lysogenization of fuc+ crp-201 cells by a lambda bacteriophage bearing crp+ restored normal growth ability on fucose. In contrast, lysogenization of [fucO(Con)fucA(Con)fucPIK(Non)crp-201] cells by the same phage retarded their growth on fucose.

  16. Computing and Applying Atomic Regulons to Understand Gene Expression and Regulation

    SciTech Connect

    Faria, Jose P.; Davis, James J.; Edirisinghe, Janaka N.; Taylor, Ronald C.; Weisenhorn, Pamela; Olson, Robert; Stevens, Rick L.; Rocha, Miguel; Rocha, Isabel; Best, Aaron; DeJongh, Matt; Tintle, Nathan; Parrello, Bruce; Overbeek, Ross; Henry, Christopher S.


    Understanding gene function and regulation is essential for the interpretation, prediction, and ultimate design of cell responses to changes in the environment. A multitude of technologies, abstractions, and interpretive frameworks have emerged to answer the challenges presented by genome function and regulatory network inference. Here, we propose a new approach for producing biologically meaningful clusters of coexpressed genes, called Atomic Regulons (ARs), based on expression data, gene context, and functional relationships. We demonstrate this new approach by computing ARs for Escherichia coli, which we compare with the coexpressed gene clusters predicted by two prevalent existing methods: hierarchical clustering and k-means clustering. We test the consistency of ARs predicted by all methods against expected interactions predicted by the Context Likelihood of Relatedness (CLR) mutual information based method, finding that the ARs produced by our approach show better agreement with CLR interactions. We then apply our method to compute ARs for four other genomes: Shewanella oneidensis, Pseudomonas aeruginosa, Thermus thermophilus, and Staphylococcus aureus. We compare the AR clusters from all genomes to study the similarity of coexpression among a phylogenetically diverse set of species, identifying subsystems that show remarkable similarity over wide phylogenetic distances. We also study the sensitivity of our method for computing ARs to the expression data used in the computation, showing that our new approach requires less data than competing approaches to converge to a near final configuration of ARs. We go on to use our sensitivity analysis to identify the specific experiments that lead most rapidly to the final set of ARs for E. coli. This analysis produces insights into improving the design of gene expression experiments.

  17. Computing and Applying Atomic Regulons to Understand Gene Expression and Regulation


    Faria, José P.; Davis, James J.; Edirisinghe, Janaka N.; ...


    Understanding gene function and regulation is essential for the interpretation, prediction, and ultimate design of cell responses to changes in the environment. A multitude of technologies, abstractions, and interpretive frameworks have emerged to answer the challenges presented by genome function and regulatory network inference. Here, we propose a new approach for producing biologically meaningful clusters of coexpressed genes, called Atomic Regulons (ARs), based on expression data, gene context, and functional relationships. We demonstrate this new approach by computing ARs for Escherichia coli, which we compare with the coexpressed gene clusters predicted by two prevalent existing methods: hierarchical clustering and k-meansmore » clustering. We test the consistency of ARs predicted by all methods against expected interactions predicted by the Context Likelihood of Relatedness (CLR) mutual information based method, finding that the ARs produced by our approach show better agreement with CLR interactions. We then apply our method to compute ARs for four other genomes: Shewanella oneidensis, Pseudomonas aeruginosa, Thermus thermophilus, and Staphylococcus aureus. We compare the AR clusters from all genomes to study the similarity of coexpression among a phylogenetically diverse set of species, identifying subsystems that show remarkable similarity over wide phylogenetic distances. We also study the sensitivity of our method for computing ARs to the expression data used in the computation, showing that our new approach requires less data than competing approaches to converge to a near final configuration of ARs. We go on to use our sensitivity analysis to identify the specific experiments that lead most rapidly to the final set of ARs for E. coli. As a result, this analysis produces insights into improving the design of gene expression experiments.« less

  18. Binding motifs in bacterial gene promoters modulate transcriptional effects of global regulators CRP and ArcA

    SciTech Connect

    Leuze, Mike; Karpinets, Tatiana V.; Syed, Mustafa H.; Beliaev, Alex S.; Uberbacher, Edward


    Bacterial gene regulation involves transcription factors (TF) that bind to DNA recognition sequences in operon promoters. These recognition sequences, many of which are palindromic, are known as regulatory elements or transcription factor binding sites (TFBS). Some TFs are global regulators that can modulate the expression of hundreds of genes. In this study we examine global regulator half-sites, where a half-site, which we shall call a binding motif (BM), is one half of a palindromic TFBS. We explore the hypothesis that the number of BMs plays an important role in transcriptional regulation, examining empirical data from transcriptional profiling of the CRP and ArcA regulons. We compare the power of BM counts and of full TFBS characteristics to predict induced transcriptional activity. We find that CRP BM counts have a nonlinear effect on CRP-dependent transcriptional activity and predict this activity better than full TFBS quality or location.

  19. Multivariate PLS Modeling of Apicomplexan FabD-Ligand Interaction Space for Mapping Target-Specific Chemical Space and Pharmacophore Fingerprints

    PubMed Central

    Surolia, Avadhesha


    Biomolecular recognition underlying drug-target interactions is determined by both binding affinity and specificity. Whilst, quantification of binding efficacy is possible, determining specificity remains a challenge, as it requires affinity data for multiple targets with the same ligand dataset. Thus, understanding the interaction space by mapping the target space to model its complementary chemical space through computational techniques are desirable. In this study, active site architecture of FabD drug target in two apicomplexan parasites viz. Plasmodium falciparum (PfFabD) and Toxoplasma gondii (TgFabD) is explored, followed by consensus docking calculations and identification of fifteen best hit compounds, most of which are found to be derivatives of natural products. Subsequently, machine learning techniques were applied on molecular descriptors of six FabD homologs and sixty ligands to induce distinct multivariate partial-least square models. The biological space of FabD mapped by the various chemical entities explain their interaction space in general. It also highlights the selective variations in FabD of apicomplexan parasites with that of the host. Furthermore, chemometric models revealed the principal chemical scaffolds in PfFabD and TgFabD as pyrrolidines and imidazoles, respectively, which render target specificity and improve binding affinity in combination with other functional descriptors conducive for the design and optimization of the leads. PMID:26535573

  20. Genome-Wide Identification of Transcription Start Sites, Promoters and Transcription Factor Binding Sites in E. coli

    PubMed Central

    Mendoza-Vargas, Alfredo; Olvera, Leticia; Olvera, Maricela; Grande, Ricardo; Vega-Alvarado, Leticia; Taboada, Blanca; Jimenez-Jacinto, Verónica; Salgado, Heladia; Juárez, Katy; Contreras-Moreira, Bruno; Huerta, Araceli M.; Collado-Vides, Julio; Morett, Enrique


    Despite almost 40 years of molecular genetics research in Escherichia coli a major fraction of its Transcription Start Sites (TSSs) are still unknown, limiting therefore our understanding of the regulatory circuits that control gene expression in this model organism. RegulonDB ( is aimed at integrating the genetic regulatory network of E. coli K12 as an entirely bioinformatic project up till now. In this work, we extended its aims by generating experimental data at a genome scale on TSSs, promoters and regulatory regions. We implemented a modified 5′ RACE protocol and an unbiased High Throughput Pyrosequencing Strategy (HTPS) that allowed us to map more than 1700 TSSs with high precision. From this collection, about 230 corresponded to previously reported TSSs, which helped us to benchmark both our methodologies and the accuracy of the previous mapping experiments. The other ca 1500 TSSs mapped belong to about 1000 different genes, many of them with no assigned function. We identified promoter sequences and type of σ factors that control the expression of about 80% of these genes. As expected, the housekeeping σ70 was the most common type of promoter, followed by σ38. The majority of the putative TSSs were located between 20 to 40 nucleotides from the translational start site. Putative regulatory binding sites for transcription factors were detected upstream of many TSSs. For a few transcripts, riboswitches and small RNAs were found. Several genes also had additional TSSs within the coding region. Unexpectedly, the HTPS experiments revealed extensive antisense transcription, probably for regulatory functions. The new information in RegulonDB, now with more than 2400 experimentally determined TSSs, strengthens the accuracy of promoter prediction, operon structure, and regulatory networks and provides valuable new information that will facilitate the understanding from a global perspective the complex and intricate regulatory

  1. Identification of a Salmonella ancillary copper detoxification mechanism by a comparative analysis of the genome-wide transcriptional response to copper and zinc excess.


    Pontel, Lucas B; Scampoli, Nadia L; Porwollik, Steffen; Checa, Susana K; McClelland, Michael; Soncini, Fernando C


    Copper and zinc are essential metal ions, but toxic in excess. Bacteria have evolved different strategies to control their intracellular concentrations, ensuring proper supply while avoiding toxicity, including the induction of metal-specific as well as non-specific mechanisms. We compared the transcriptional profiles of Salmonella Typhimurium after exposure to either copper or zinc ions in both rich and minimal media. Besides metal-specific regulatory networks many global stress-response pathways react to an excess of either of these metal ions. Copper excess affects both zinc and iron homeostasis by inducing transcription of these metal-specific regulons. In addition to the control of zinc-specific regulons, zinc excess affects the Cpx regulon and the σ(E) envelope-stress responses. Finally, novel metal-specific upregulated genes were detected including a new copper-detoxification pathway that involves the siderophore enterobactin and the outer-membrane protein TolC. This work sheds light onto the transcriptional landscape of Salmonella after copper or zinc overload, and discloses a new mechanism of copper detoxification.

  2. Resolvase-In Vivo Expression Technology Analysis of the Salmonella enterica Serovar Typhimurium PhoP and PmrA Regulons in BALB/c Mice†

    PubMed Central

    Merighi, Massimo; Ellermeier, Craig D.; Slauch, James M.; Gunn, John S.


    Salmonella enterica modulates resistance to antimicrobial peptides in part via covalent modifications of the lipopolysaccharide (LPS). The two-component systems PhoP/PhoQ and PmrA/PmrB are activated during infection and regulate several genes involved in LPS modifications by responding to signals such as pH, iron, magnesium, and antimicrobial peptides. A recombination-based in vivo expression technology approach was adopted to analyze the spatial-temporal patterns of in vivo expression of genes of the PhoP and PmrA regulons and to identify the in vivo signals modulating their transcription. In vitro, we showed PhoP- and/or PmrA-dependent induction of pmrH (LPS aminoarabinose modification operon) by acidic pH, low levels of magnesium, or high levels of Fe(III). Upregulation in cultured J774A.1 macrophages was shown for pmrH, pagP (LPS palmitate addition), and ssaB (pathogenicity island II secretion) but not for prgH (pathogenicity island I secretion). Increased levels of pmrH, phoP, and prgH transcription but not ssaB were observed in bacteria isolated from the lumen of the distal ileum. Bacteria isolated from spleens of orally inoculated mice showed no further induction of prgH but had the highest expression of pmrH, pagP, and ssaB. In vivo induction of pmrH was fully dependent on pmrA and phoP, and buffering stomach acidity, iron chelation, or low-iron diets did not affect the expression of pmrH in the intestinal lumen. The observation of pmrH and pagP expression in the intestine refutes the paradigm of PhoP/PhoQ and PmrA/PmrB in vivo expression as solely intracellularly induced and supports previous data demonstrating peroral virulence attenuation of pmrH mutants. PMID:16237024

  3. Genome-wide analysis of the PreA/PreB (QseB/QseC) regulon of Salmonella enterica serovar Typhimurium

    PubMed Central


    Background The Salmonella PreA/PreB two-component system (TCS) is an ortholog of the QseBC TCS of Escherichia coli. In both Salmonella and E. coli, this system has been shown to affect motility and virulence in response to quorum-sensing and hormonal signals, and to affect the transcription of the Salmonella enterica serovar Typhimurium (S. Typhimurium) pmrAB operon, which encodes an important virulence-associated TCS. Results To determine the PreA/PreB regulon in S. Typhimurium, we performed DNA microarrays comparing the wild type strain and various preA and/or preB mutants in the presence of ectopically expressed preA (qseB). These data confirmed our previous findings of the negative effect of PreB on PreA gene regulation and identified candidate PreA-regulated genes. A proportion of the activated loci were previously identified as PmrA-activated genes (yibD, pmrAB, cptA, etc.) or were genes located in the local region around preA, including the preAB operon. The transcriptional units were defined in this local region by RT-PCR, suggesting three PreA activated operons composed of preA-preB, mdaB-ygiN, and ygiW-STM3175. Several putative virulence-related phenotypes were examined for preAB mutants, resulting in the observation of a host cell invasion and slight virulence defect of a preAB mutant. Contrary to previous reports on this TCS, we were unable to show a PreA/PreB-dependent effect of the quorum-sensing signal AI-2 or of epinephrine on S. Typhimurium with regard to bacterial motility. Conclusion This work further characterizes this unorthadox OmpR/EnvZ class TCS and provides novel candidate regulated genes for further study. This first in-depth study of the PreA/PreB regulatory system phenotypes and regulation suggests significant comparative differences to the reported function of the orthologous QseB/QseC in E. coli. PMID:19236707

  4. Sputum is a surrogate for bronchoalveolar lavage for monitoring Mycobacterium tuberculosis transcriptional profiles in TB patients.


    Garcia, Benjamin J; Loxton, Andre G; Dolganov, Gregory M; Van, Tran T; Davis, J Lucian; de Jong, Bouke C; Voskuil, Martin I; Leach, Sonia M; Schoolnik, Gary K; Walzl, Gerhard; Strong, Michael; Walter, Nicholas D


    Pathogen-targeted transcriptional profiling in human sputum may elucidate the physiologic state of Mycobacterium tuberculosis (M. tuberculosis) during infection and treatment. However, whether M. tuberculosis transcription in sputum recapitulates transcription in the lung is uncertain. We therefore compared M. tuberculosis transcription in human sputum and bronchoalveolar lavage (BAL) samples from 11 HIV-negative South African patients with pulmonary tuberculosis. We additionally compared these clinical samples with in vitro log phase aerobic growth and hypoxic non-replicating persistence (NRP-2). Of 2179 M. tuberculosis transcripts assayed in sputum and BAL via multiplex RT-PCR, 194 (8.9%) had a p-value <0.05, but none were significant after correction for multiple testing. Categorical enrichment analysis indicated that expression of the hypoxia-responsive DosR regulon was higher in BAL than in sputum. M. tuberculosis transcription in BAL and sputum was distinct from both aerobic growth and NRP-2, with a range of 396-1020 transcripts significantly differentially expressed after multiple testing correction. Collectively, our results indicate that M. tuberculosis transcription in sputum approximates M. tuberculosis transcription in the lung. Minor differences between M. tuberculosis transcription in BAL and sputum suggested lower oxygen concentrations or higher nitric oxide concentrations in BAL. M. tuberculosis-targeted transcriptional profiling of sputa may be a powerful tool for understanding M. tuberculosis pathogenesis and monitoring treatment responses in vivo.

  5. Control of methionine metabolism by the SahR transcriptional regulator in Proteobacteria.


    Novichkov, Pavel S; Li, Xiaoqing; Kuehl, Jennifer V; Deutschbauer, Adam M; Arkin, Adam P; Price, Morgan N; Rodionov, Dmitry A


    Sulphur is an essential element in the metabolism. The sulphur-containing amino acid methionine is a metabolic precursor for S-adenosylmethionine (SAM), which serves as a coenzyme for ubiquitous methyltrtansferases. Recycling of organic sulphur compounds, e.g. via the SAM cycle, is an important metabolic process that needs to be tightly regulated. Knowledge about transcriptional regulation of these processes is still limited for many free-living bacteria. We identified a novel transcription factor SahR from the ArsR family that controls the SAM cycle genes in diverse microorganisms from soil and aquatic ecosystems. By using comparative genomics, we predicted SahR-binding DNA motifs and reconstructed SahR regulons in the genomes of 62 Proteobacteria. The conserved core of SahR regulons includes all enzymes required for the SAM cycle: the SAH hydrolase AhcY, the methionine biosynthesis enzymes MetE/MetH and MetF, and the SAM synthetase MetK. By using a combination of experimental techniques, we validated the SahR regulon in the sulphate-reducing Deltaproteobacterium Desulfovibrio alaskensis. SahR functions as a negative regulator that responds to the S-adenosylhomocysteine (SAH). The elevated SAH level in the cell dissociates SahR from its DNA operators and induces the expression of SAM cycle genes. The effector-sensing domain in SahR is related to SAM-dependent methylases that are able to tightly bind SAH. SahR represents a novel type of transcriptional regulators for the control of sulphur amino acid metabolism.

  6. Transcriptional and Physiological Changes during Mycobacterium tuberculosis Reactivation from Non-replicating Persistence

    PubMed Central

    Du, Peicheng; Sohaskey, Charles D.; Shi, Lanbo


    Mycobacterium tuberculosis can persist for years in the hostile environment of the host in a non-replicating or slowly replicating state. While active disease predominantly results from reactivation of a latent infection, the molecular mechanisms of M. tuberculosis reactivation are still poorly understood. We characterized the physiology and global transcriptomic profiles of M. tuberculosis during reactivation from hypoxia-induced non-replicating persistence. We found that M. tuberculosis reactivation upon reaeration was associated with a lag phase, in which the recovery of cellular physiological and metabolic functions preceded the resumption of cell replication. Enrichment analysis of the transcriptomic dynamics revealed changes to many metabolic pathways and transcription regulons/subnetworks that orchestrated the metabolic and physiological transformation in preparation for cell division. In particular, we found that M. tuberculosis reaeration lag phase is associated with down-regulation of persistence-associated regulons/subnetworks, including DosR, MprA, SigH, SigE, and ClgR, as well as metabolic pathways including those involved in the uptake of lipids and their catabolism. More importantly, we identified a number of up-regulated transcription regulons and metabolic pathways, including those involved in metal transport and remobilization, second messenger-mediated responses, DNA repair and recombination, and synthesis of major cell wall components. We also found that inactivation of the major alternative sigma factors SigE or SigH disrupted exit from persistence, underscoring the importance of the global transcriptional reprogramming during M. tuberculosis reactivation. Our observations suggest that M. tuberculosis lag phase is associated with a global gene expression reprogramming that defines the initiation of a reactivation process. PMID:27630619

  7. Binding motifs in bacterial gene promoters modulate transcriptional effect of global regulators

    SciTech Connect

    Leuze, Michael Rex; Karpinets, Tatiana V; Syed, Mustafa H; Beliaev, Alexander S; Uberbacher, Edward C


    Bacterial gene regulation involves transcription factors (TFs) that influence the expression of many genes. Global regulators, including CRP (cAMP Receptor Protein), ArcA, and FNR, can modulate the transcriptional activity of multiple operons. The similarity of a regulatory element s sequence to a TF s consensus binding site (BS) and the position of the regulatory element in an operon promoter are considered the most important determinants of this TF s regulatory influence. In this study we explore the hypothesis that the number of TFBS half-sites (where a half-site is one half of the palindromic BS consensus sequence, which we shall refer to as a binding motif or a BM) of a global regulator in an operon s promoter plays an important role in the operon s transcriptional regulation. We examine empirical data from transcriptional profiling of the CRP regulon in Shewanella oneidenses MR 1 and Escherichia coli, and of the ArcA regulon in S. oneidenses MR 1. We compare the power of CRP BM counts and of full, symmetrical CRP TFBS characteristics, namely similarity to consensus and location, to predict CRP-induced transcriptional activity. We find that CRP BM counts have a nonlinear effect on CRP-dependent transcriptional activity and predict this activity better than full-length TFBS quality or location. Regression analysis indicates that IHF (Integration Host Factor) and ArcA have synergistic effects on CRP-induced gene transcription, positive and negative, respectively. Based on these results, we propose that the fine-tuning of bacterial transcriptional activity by CRP may involves not only the bending of the operon promoter, facilitated by CRP in cooperation with the histone-like protein IHF, but also the cumulative binding affinity of multiple weak BMs.

  8. Insights into horizontal acquisition patterns of dormancy and reactivation regulon genes in mycobacterial species using a partitioning-based framework.


    Mehra, Varun; Ghosh, Tarini Shankar; Mande, Sharmila S


    Horizontal Gene Transfer (HGT) events, initially thought to be rare in Mycobacterium tuberculosis, have recently been shown to be involved in the acquisition of virulence operons in M. tuberculosis. We have developed a new partitioning framework based HGT prediction algorithm, called Grid3M, and applied the same for the prediction of HGTs in Mycobacteria. Validation and testing using simulated and real microbial genomes indicated better performance of Grid3M as compared with other widely used HGT prediction methods. Specific analysis of the genes belonging to dormancy/reactivation regulons across 14 mycobacterial genomes indicated that horizontal acquisition is specifically restricted to important accessory proteins. The results also revealed Burkholderia species to be a probable source of HGT genes belonging to these regulons. The current study provides a basis for similar analyses investigating the functional/evolutionary aspects of HGT genes in other pathogens. A database of Grid3M predicted HGTs in completely sequenced genomes is available at

  9. Rcs signalling-activated transcription of rcsA induces strong anti-sense transcription of upstream fliPQR flagellar genes from a weak intergenic promoter: regulatory roles for the anti-sense transcript in virulence and motility.


    Wang, Qingfeng; Harshey, Rasika M


    In Salmonella enterica, an activated Rcs signalling system inhibits initiation of transcription of the flhD master operon. Under these conditions, where motility is shut down, microarray experiments showed an increased RNA signal for three flagellar genes -fliPQR- located upstream of rcsA. We show here that it is the anti-sense (AS) strand of these genes that is transcribed, originating at a weak promoter in the intergenic region between fliR and rcsA. RcsA is an auxiliary regulator for the Rcs system, whose transcription is dependent on the response regulator RcsB. Rcs-activated rightward transcription, but not translation, of rcsA is required for stimulation of leftward AS transcription. Our results implicate a combined action of RcsB and rcsA transcription in activating the AS promoter, likely by modulating DNA superhelicity in the intergenic region. We show that the AS transcript regulates many genes in the Rcs regulon, including SPI-1 and SPI-2 virulence and stress-response genes. In the wild-type strain the AS transcript is present in low amounts, independent of Rcs signalling. Here, AS transcription modulates complementary sense RNA levels and impacts swarming motility. It appears that the flagellar AS transcript has been co-opted by the Rcs system to regulate virulence.

  10. Global analysis of photosynthesis transcriptional regulatory networks.


    Imam, Saheed; Noguera, Daniel R; Donohue, Timothy J


    Photosynthesis is a crucial biological process that depends on the interplay of many components. This work analyzed the gene targets for 4 transcription factors: FnrL, PrrA, CrpK and MppG (RSP_2888), which are known or predicted to control photosynthesis in Rhodobacter sphaeroides. Chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq) identified 52 operons under direct control of FnrL, illustrating its regulatory role in photosynthesis, iron homeostasis, nitrogen metabolism and regulation of sRNA synthesis. Using global gene expression analysis combined with ChIP-seq, we mapped the regulons of PrrA, CrpK and MppG. PrrA regulates ∼34 operons encoding mainly photosynthesis and electron transport functions, while CrpK, a previously uncharacterized Crp-family protein, regulates genes involved in photosynthesis and maintenance of iron homeostasis. Furthermore, CrpK and FnrL share similar DNA binding determinants, possibly explaining our observation of the ability of CrpK to partially compensate for the growth defects of a ΔFnrL mutant. We show that the Rrf2 family protein, MppG, plays an important role in photopigment biosynthesis, as part of an incoherent feed-forward loop with PrrA. Our results reveal a previously unrealized, high degree of combinatorial regulation of photosynthetic genes and significant cross-talk between their transcriptional regulators, while illustrating previously unidentified links between photosynthesis and the maintenance of iron homeostasis.

  11. Use of a promiscuous, constitutively-active bacterial enhancer-binding protein to define the Sigma54 (RpoN) regulon of Salmonella Typhimurium LT2

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Background: Sigma54, or RpoN, is an alternative s factor found widely in eubacteria. A significant complication in analysis of the global sigma54 regulon in a bacterium is that the sigma54 RNA polymerase holoenzyme requires interaction with an active bacterial enhancer-binding protein (bEBP) to init...

  12. Toward understanding transcriptional regulatory networks in abiotic stress responses and tolerance in rice

    PubMed Central


    Abiotic stress causes loss of crop production. Under abiotic stress conditions, expression of many genes is induced, and their products have important roles in stress responses and tolerance. Progress has been made in understanding the biological roles of regulons in abiotic stress responses in rice. A number of transcription factors (TFs) regulate stress-responsive gene expression. OsDREB1s and OsDREB2s were identified as abiotic-stress responsive TFs that belong to the AP2/ERF family. Similar to Arabidopsis, these DREB regulons were most likely not involved in the abscisic acid (ABA) pathway. OsAREBs such as OsAREB1 were identified as key components in ABA-dependent transcriptional networks in rice. OsNAC/SNACs including OsNAC6 were characterized as factors that regulate expression of genes important for abiotic stress responses in rice. Here, we review on the rice abiotic-stress responses mediated by transcriptional networks, with the main focus on TFs that function in abiotic stress responses and confer stress tolerance in rice. PMID:24764506

  13. Comparative studies of transcriptional regulation mechanisms in a group of eight gamma-proteobacterial genomes.


    Espinosa, Vladimir; González, Abel D; Vasconcelos, Ana T; Huerta, Araceli M; Collado-Vides, Julio


    Experimental data on the Escherichia coli transcriptional regulation has enabled the construction of statistical models to predict new regulatory elements within its genome. Far less is known about the transcriptional regulatory elements in other gamma-proteobacteria with sequenced genomes, so it is of great interest to conduct comparative genomic studies oriented to extracting biologically relevant information about transcriptional regulation in these less studied organisms using the knowledge from E. coli. In this work, we use the information stored in the TRACTOR_DB database to conduct a comparative study on the mechanisms of transcriptional regulation in eight gamma-proteobacteria and 38 regulons. We assess the conservation of transcription factors binding specificity across all the eight genomes and show a correlation between the conservation of a regulatory site and the structure of the transcription unit it regulates. We also find a marked conservation of site-promoter distances across the eight organisms and a correspondence of the statistical significance of co-occurrence of pairs of transcription factor binding sites in the regulatory regions, which is probably related to a conserved architecture of higher-order regulatory complexes in the organisms studied. The results obtained in this study using the information on transcriptional regulation in E. coli enable us to conclude that not only transcription factor-binding sites are conserved across related species but also several of the transcriptional regulatory mechanisms previously identified in E. coli.

  14. Constitutive SoxS expression in a fluoroquinolone-resistant strain with a truncated SoxR protein and identification of a new member of the marA-soxS-rob regulon, mdtG.


    Fàbrega, Anna; Martin, Robert G; Rosner, Judah L; Tavio, M Mar; Vila, Jordi


    Elevated levels of fluoroquinolone resistance are frequently found among Escherichia coli clinical isolates. This study investigated the antibiotic resistance mechanisms of strain NorE5, derived in vitro by exposing an E. coli clinical isolate, PS5, to two selection steps with increasing concentrations of norfloxacin. In addition to the amino acid substitution in GyrA (S83L) present in PS5, NorE5 has an amino acid change in ParC (S80R). Furthermore, we now find by Western blotting that NorE5 has a multidrug resistance phenotype resulting from the overexpression of the antibiotic resistance efflux pump AcrAB-TolC. Microarray and gene fusion analyses revealed significantly increased expression in NorE5 of soxS, a transcriptional activator of acrAB and tolC. The high soxS activity is attributable to a frameshift mutation that truncates SoxR, rendering it a constitutive transcriptional activator of soxS. Furthermore, microarray and reverse transcription-PCR analyses showed that mdtG (yceE), encoding a putative efflux pump, is overexpressed in the resistant strain. SoxS, MarA, and Rob activated an mdtG::lacZ fusion, and SoxS was shown to bind to the mdtG promoter, showing that mdtG is a member of the marA-soxS-rob regulon. The mdtG marbox sequence is in the backward or class I orientation within the promoter, and its disruption resulted in a loss of inducibility by MarA, SoxS, and Rob. Thus, chromosomal mutations in parC and soxR are responsible for the increased antibiotic resistance of NorE5.

  15. Identification and characterization of transcription networks in environmentally significant species

    SciTech Connect

    Lawrence, Charles E.; McCue, Lee Ann


    Understanding the regulation of gene expression, transcription regulation in particular, is one of the grand challenges of molecular biology. Transcription regulation is arguably the most important foundation of cellular function, since it exerts the most fundamental control of the abundance of virtually all of a cell's functional macromolecules. Nevertheless, this process, perhaps because of its difficulty, has been the subject of only a limited number of genomic level analyses. We have undertaken bioinformatics projects to address this issue by developing (1) a cross-species comparison method (i.e. phylogenetic footprinting) for the identification of transcription factor binding sites, (2) a Bayesian clustering method to identify regulons, (3) an improved scanning algorithm that uses a position weight matrix and several related species sequence data to locate transcription factor binding sites, and (4) a method to predict cognate binding sites for transcription factors of unknown specificity. These bioinformatics methods were developed using the model proteobacterium Escherichia coli, with further applications to the genomes of environmentally significant microbes (Rhodopseudomonas palustris, Shewanella oneidensis) in later years of the grant.

  16. Immunogenicity of Novel DosR Regulon-Encoded Candidate Antigens of Mycobacterium tuberculosis in Three High-Burden Populations in Africa▿ †

    PubMed Central

    Black, Gillian F.; Thiel, Bonnie A.; Ota, Martin O.; Parida, Shreemanta K.; Adegbola, Richard; Boom, W. Henry; Dockrell, Hazel M.; Franken, Kees L. M. C.; Friggen, Annemiek H.; Hill, Philip C.; Klein, Michel R.; Lalor, Maeve K.; Mayanja, Harriet; Schoolnik, Gary; Stanley, Kim; Weldingh, Karin; Kaufmann, Stefan H. E.; Walzl, Gerhard; Ottenhoff, Tom H. M.


    Increasing knowledge about DosR regulon-encoded proteins has led us to produce novel Mycobacterium tuberculosis antigens for immunogenicity testing in human populations in three countries in Africa to which tuberculosis (TB) is endemic. A total of 131 tuberculin skin test-positive and/or ESAT-6/CFP10-positive, human immunodeficiency virus-negative adult household contacts of active pulmonary TB cases from South Africa (n = 56), The Gambia (n = 26), and Uganda (n = 49) were tested for gamma interferon responses to 7 classical and 51 DosR regulon-encoded M. tuberculosis recombinant protein antigens. ESAT-6/CFP10 fusion protein evoked responses in >75% of study participants in all three countries. Of the DosR regulon-encoded antigens tested, Rv1733c was the most commonly recognized by participants from both South Africa and Uganda and the third most commonly recognized antigen in The Gambia. The four most frequently recognized DosR regulon-encoded antigens in Uganda (Rv1733c, Rv0081, Rv1735c, and Rv1737c) included the three most immunogenic antigens in South Africa. In contrast, Rv3131 induced the highest percentage of responders in Gambian contacts (38%), compared to only 3.4% of Ugandan contacts and no South African contacts. Appreciable percentages of TB contacts with a high likelihood of latent M. tuberculosis infection responded to several novel DosR regulon-encoded M. tuberculosis proteins. In addition to significant similarities in antigen recognition profiles between the three African population groups, there were also disparities, which may stem from genetic differences between both pathogen and host populations. Our findings have implications for the selection of potential TB vaccine candidates and for determining biosignatures of latent M. tuberculosis infection, active TB disease, and protective immunity. PMID:19553548

  17. The Sinorhizobium fredii HH103 MucR1 Global Regulator Is Connected With the nod Regulon and Is Required for Efficient Symbiosis With Lotus burttii and Glycine max cv. Williams.


    Acosta-Jurado, Sebastián; Alias-Villegas, Cynthia; Navarro-Gómez, Pilar; Zehner, Susanne; Murdoch, Piedad Del Socorro; Rodríguez-Carvajal, Miguel A; Soto, María J; Ollero, Francisco-Javier; Ruiz-Sainz, José E; Göttfert, Michael; Vinardell, José-María


    Sinorhizobium fredii HH103 is a rhizobial strain showing a broad host range of nodulation. In addition to the induction of bacterial nodulation genes, transition from a free-living to a symbiotic state requires complex genetic expression changes with the participation of global regulators. We have analyzed the role of the zinc-finger transcriptional regulator MucR1 from S. fredii HH103 under both free-living conditions and symbiosis with two HH103 host plants, Glycine max and Lotus burttii. Inactivation of HH103 mucR1 led to a severe decrease in exopolysaccharide (EPS) biosynthesis but enhanced production of external cyclic glucans (CG). This mutant also showed increased cell aggregation capacity as well as a drastic reduction in nitrogen-fixation capacity with G. max and L. burttii. However, in these two legumes, the number of nodules induced by the mucR1 mutant was significantly increased and decreased, respectively, with respect to the wild-type strain, indicating that MucR1 can differently affect nodulation depending on the host plant. RNA-Seq analysis carried out in the absence and the presence of flavonoids showed that MucR1 controls the expression of hundreds of genes (including some related to EPS production and CG transport), some of them being related to the nod regulon.

  18. Integration of a complex regulatory cascade involving the SirA/BarA and Csr global regulatory systems that controls expression of the Salmonella SPI-1 and SPI-2 virulence regulons through HilD.


    Martínez, Luary C; Yakhnin, Helen; Camacho, Martha I; Georgellis, Dimitris; Babitzke, Paul; Puente, José L; Bustamante, Víctor H


    Salmonella pathogenicity islands 1 and 2 (SPI-1 and SPI-2) play key roles in the pathogenesis of Salmonella enterica. Previously, we showed that when Salmonella grows in Luria-Bertani medium, HilD, encoded in SPI-1, first induces the expression of hilA, located in SPI-1, and subsequently of the ssrAB operon, located in SPI-2. These genes code for HilA and the SsrA/B two-component system, the positive regulators of the SPI-1 and SPI-2 regulons respectively. In this study, we demonstrate that CsrA, a global regulatory RNA binding protein, post-transcriptionally regulates hilD expression by directly binding near the Shine-Dalgarno and translation initiation codon sequences of the hilD mRNA, preventing its translation and leading to its accelerated turnover. Negative regulation is counteracted by the global SirA/BarA two-component system, which directly activates the expression of CsrB and CsrC, two non-coding regulatory RNAs that sequester CsrA, thereby preventing it from binding to its target mRNAs. Our results illustrate the integration of global and specific regulators into a multifactorial regulatory cascade controlling the expression of virulence genes acquired by horizontal transfer events.

  19. The functional landscape bound to the transcription factors of Escherichia coli K-12.


    Pérez-Rueda, Ernesto; Tenorio-Salgado, Silvia; Huerta-Saquero, Alejandro; Balderas-Martínez, Yalbi I; Moreno-Hagelsieb, Gabriel


    Motivated by the experimental evidences accumulated in the last ten years and based on information deposited in RegulonDB, literature look up, and sequence analysis, we analyze the repertoire of 304 DNA-binding Transcription factors (TFs) in Escherichia coli K-12. These regulators were grouped in 78 evolutionary families and are regulating almost half of the total genes in this bacterium. In structural terms, 60% of TFs are composed by two-domains, 30% are monodomain, and 10% three- and four-structural domains. As previously noticed, the most abundant DNA-binding domain corresponds to the winged helix-turn-helix, with few alternative DNA-binding structures, resembling the hypothesis of successful protein structures with the emergence of new ones at low scales. In summary, we identified and described the characteristics associated to the DNA-binding TF in E. coli K-12. We also identified twelve functional modules based on a co-regulated gene matrix. Finally, diverse regulons were predicted based on direct associations between the TFs and potential regulated genes. This analysis should increase our knowledge about the gene regulation in the bacterium E. coli K-12, and provide more additional clues for comprehensive modelling of transcriptional regulatory networks in other bacteria.

  20. What Determines the Assembly of Transcriptional Network Motifs in Escherichia coli?

    PubMed Central

    Camas, Francisco M.; Poyatos, Juan F.


    Transcriptional networks are constituted by a collection of building blocks known as network motifs. Why do motifs appear? An adaptive model of motif emergence was recently questioned in favor of neutralist scenarios. Here, we provide a new picture of motif assembly in Escherichia coli which partially clarifies these contrasting explanations. This is based on characterizing the linkage between motifs and sensing or response specificity of their constituent transcriptional factors (TFs). We find that sensing specificity influences the distribution of autoregulation, while the tendency of a TF to establish feed-forward loops (FFLs) depends on response specificity, i.e., regulon size. Analysis of the latter pattern reveals that coregulation between large regulon-size TFs is common under a network neutral model, leading to the assembly of a great number of FFLs and bifans. In addition, neutral exclusive regulation also leads to a collection of single input modules -the fourth basic motif. On the whole, and even under the conservative neutralist scenario considered, a substantial group of regulatory structures revealed adaptive. These structures visibly function as fully-fledged working units. PMID:18987754

  1. Dehydrogenase GRD1 represents a novel component of the cellulase regulon in Trichoderma reesei (Hypocrea jecorina).


    Schuster, André; Kubicek, Christian P; Schmoll, Monika


    Trichoderma reesei (Hypocrea jecorina) is nowadays the most important industrial producer of cellulase and hemicellulase enzymes, which are used for pretreatment of cellulosic biomass for biofuel production. In this study, we introduce a novel component, GRD1 (glucose-ribitol dehydrogenase 1), which shows enzymatic activity on cellobiose and positively influences cellulase gene transcription, expression, and extracellular endo-1,4-β-D-glucanase activity. grd1 is differentially transcribed upon growth on cellulose and the induction of cellulase gene expression by sophorose. The transcription of grd1 is coregulated with that of cel7a (cbh1) under inducing conditions. GRD1 is further involved in carbon source utilization on several carbon sources, such as those involved in lactose and D-galactose catabolism, in several cases in a light-dependent manner. We conclude that GRD1 represents a novel enhancer of cellulase gene expression, which by coregulation with the major cellulase may act via optimization of inducing mechanisms.

  2. Methionine-mediated gene expression and characterization of the CmhR regulon in Streptococcus pneumoniae

    PubMed Central

    Afzal, Muhammad; Shafeeq, Sulman


    This study investigated the transcriptomic response of Streptococcus pneumoniae D39 to methionine. Transcriptome comparison of the S. pneumoniae D39 wild-type grown in chemically defined medium with 0–10 mM methionine revealed the elevated expression of various genes/operons involved in methionine synthesis and transport (fhs, folD, gshT, metA, metB-csd, metEF, metQ, tcyB, spd-0150, spd-0431 and spd-0618). Furthermore, β-galactosidase assays and quantitative RT-PCR studies demonstrated that the transcriptional regulator, CmhR (SPD-0588), acts as a transcriptional activator of the fhs, folD, metB-csd, metEF, metQ and spd-0431 genes. A putative regulatory site of CmhR was identified in the promoter region of CmhR-regulated genes and this CmhR site was further confirmed by promoter mutational experiments. PMID:28348831

  3. In-phase oscillation of global regulons is orchestrated by a pole-specific organizer.


    Janakiraman, Balaganesh; Mignolet, Johann; Narayanan, Sharath; Viollier, Patrick H; Radhakrishnan, Sunish Kumar


    Cell fate determination in the asymmetric bacterium Caulobacter crescentus (Caulobacter) is triggered by the localization of the developmental regulator SpmX to the old (stalked) cell pole during the G1→S transition. Although SpmX is required to localize and activate the cell fate-determining kinase DivJ at the stalked pole in Caulobacter, in cousins such as Asticcacaulis, SpmX directs organelle (stalk) positioning and possibly other functions. We define the conserved σ(54)-dependent transcriptional activator TacA as a global regulator in Caulobacter whose activation by phosphorylation is indirectly down-regulated by SpmX. Using a combination of forward genetics and cytological screening, we uncover a previously uncharacterized and polarized component (SpmY) of the TacA phosphorylation control system, and we show that SpmY function and localization are conserved. Thus, SpmX organizes a site-specific, ancestral, and multifunctional regulatory hub integrating the in-phase oscillation of two global transcriptional regulators, CtrA (the master cell cycle transcriptional regulator A) and TacA, that perform important cell cycle functions.

  4. In-phase oscillation of global regulons is orchestrated by a pole-specific organizer

    PubMed Central

    Janakiraman, Balaganesh; Mignolet, Johann; Narayanan, Sharath; Viollier, Patrick H.


    Cell fate determination in the asymmetric bacterium Caulobacter crescentus (Caulobacter) is triggered by the localization of the developmental regulator SpmX to the old (stalked) cell pole during the G1→S transition. Although SpmX is required to localize and activate the cell fate-determining kinase DivJ at the stalked pole in Caulobacter, in cousins such as Asticcacaulis, SpmX directs organelle (stalk) positioning and possibly other functions. We define the conserved σ54-dependent transcriptional activator TacA as a global regulator in Caulobacter whose activation by phosphorylation is indirectly down-regulated by SpmX. Using a combination of forward genetics and cytological screening, we uncover a previously uncharacterized and polarized component (SpmY) of the TacA phosphorylation control system, and we show that SpmY function and localization are conserved. Thus, SpmX organizes a site-specific, ancestral, and multifunctional regulatory hub integrating the in-phase oscillation of two global transcriptional regulators, CtrA (the master cell cycle transcriptional regulator A) and TacA, that perform important cell cycle functions. PMID:27791133

  5. Transcriptional autoregulation of the Salmonella typhimurium phoPQ operon.


    Soncini, F C; Véscovi, E G; Groisman, E A


    The Salmonella typhimurium PhoP-PhoQ two-component regulatory system controls the expression of several genes, some of which are necessary for virulence. During a screening for PhoP-regulated genes, we identified the phoPQ operon as a PhoP-activated locus. beta-Galactosidase activity originating from phoPQ-lac transcriptional fusions required the presence of both the transcriptional regulator PhoP and its cognate sensor-kinase PhoQ. At low concentrations, PhoQ stimulated expression of phoPQ-lac transcriptional fusions. However, larger amounts of PhoQ protein without a concomitant increase in PhoP failed to activate phoPQ-lac fusions. Two different transcripts are produced from the phoPQ operon during exponential growth. These transcripts define two promoters: phoPp1, which requires both PhoP and PhoQ for activity and which is environmentally regulated, and phoPp2, which remains active in the absence of PhoP and PhoQ but which is slightly stimulated by these proteins. The pattern of transcriptional autoregulation was also observed at the protein level with anti-PhoP antibodies. In sum, autoregulation of the phoPQ operon provides several levels of control for the PhoP-PhoQ regulon. First, environmental signals would stimulate PhoQ to phosphorylate the PhoP protein that is produced at basal levels from the PhoP-PhoQ-independent promoter. Then, phospho-PhoP would activate transcription of phoPp1, resulting in larger amounts of PhoP and PhoQ and increased expression of PhoP-activated genes. A return to basal levels could be mediated by a posttranscriptional mechanism by which translation of the mRNA produced from phoPp1 is inhibited.

  6. Constitutive expression in gal7 mutants of Kluyveromyces lactis is due to internal production of galactose as an inducer of the Gal/Lac regulon.

    PubMed Central

    Cardinali, G; Vollenbroich, V; Jeon, M S; de Graaf, A A; Hollenberg, C P


    The induction process of the galactose regulon has been intensively studied, but until now the nature of the inducer has remained unknown. We have analyzed a delta gal7 mutant of the yeast Kluyveromyces lactis, which lacks the galactotransferase activity and is able to express the genes of the Gal/Lac regulon also in the absence of galactose. We found that this expression is semiconstitutive and undergoes a strong induction during the stationary phase. The gal1-209 mutant, which has a reduced kinase activity but retains its positive regulatory function, also shows a constitutive expression of beta-galactosidase, suggesting that galactose is the inducer. A gal10 deletion in delta gal7 or gal1-209 mutants reduces the expression to under wild-type levels. The presence of the inducer could be demonstrated in both delta gal7 crude extracts and culture medium by means of a bioassay using the induction in gal1-209 cells. A mutation in the transporter gene LAC12 decreases the level of induction in gal7 cells, indicating that galactose is partly released into the medium and then retransported into the cells. Nuclear magnetic resonance analysis of crude extracts from delta gal7 cells revealed the presence of 50 microM galactose. We conclude that galactose is the inducer of the Gal/Lac regulon and is produced via UDP-galactose through a yet-unknown pathway. PMID:9032299

  7. Cysteine-Mediated Gene Expression and Characterization of the CmbR Regulon in Streptococcus pneumoniae

    PubMed Central

    Afzal, Muhammad; Manzoor, Irfan; Kuipers, Oscar P.; Shafeeq, Sulman


    In this study, we investigated the transcriptomic response of Streptococcus pneumoniae D39 to cysteine. Transcriptome comparison of the D39 wild-type grown at a restricted concentration of cysteine (0.03 mM) to one grown at a high concentration of cysteine (50 mM) in chemically-defined medium (CDM) revealed elevated expression of various genes/operons, i.e., spd-0150, metQ, spd-0431, metEF, gshT, spd-0618, fhs, tcyB, metB-csd, metA, spd-1898, yvdE, and cysK, likely to be involved in the transport and utilization of cysteine and/or methionine. Microarray-based data were further confirmed by quantitative RT-PCR. Promoter lacZ-fusion studies and quantitative RT-PCR data showed that the transcriptional regulator CmbR acts as a transcriptional repressor of spd-0150, metEF, gshT, spd-0618, tcyB, metA, and yvdE, putatively involved in cysteine uptake and utilization. The operator site of CmbR in the promoter regions of CmbR-regulated genes is predicted and confirmed by mutating or deleting CmbR operator sites from the promoter regions of these genes. PMID:27990139

  8. Elucidation of the RamA Regulon in Klebsiella pneumoniae Reveals a Role in LPS Regulation

    PubMed Central

    De Majumdar, Shyamasree; Yu, Jing; Fookes, Maria; McAteer, Sean P.; Llobet, Enrique; Finn, Sarah; Spence, Shaun; Monaghan, Avril; Kissenpfennig, Adrien; Ingram, Rebecca J.; Bengoechea, José; Gally, David L.; Fanning, Séamus; Elborn, Joseph S.; Schneiders, Thamarai


    Klebsiella pneumoniae is a significant human pathogen, in part due to high rates of multidrug resistance. RamA is an intrinsic regulator in K. pneumoniae established to be important for the bacterial response to antimicrobial challenge; however, little is known about its possible wider regulatory role in this organism during infection. In this work, we demonstrate that RamA is a global transcriptional regulator that significantly perturbs the transcriptional landscape of K. pneumoniae, resulting in altered microbe-drug or microbe-host response. This is largely due to the direct regulation of 68 genes associated with a myriad of cellular functions. Importantly, RamA directly binds and activates the lpxC, lpxL-2 and lpxO genes associated with lipid A biosynthesis, thus resulting in modifications within the lipid A moiety of the lipopolysaccharide. RamA-mediated alterations decrease susceptibility to colistin E, polymyxin B and human cationic antimicrobial peptide LL-37. Increased RamA levels reduce K. pneumoniae adhesion and uptake into macrophages, which is supported by in vivo infection studies, that demonstrate increased systemic dissemination of ramA overexpressing K. pneumoniae. These data establish that RamA-mediated regulation directly perturbs microbial surface properties, including lipid A biosynthesis, which facilitate evasion from the innate host response. This highlights RamA as a global regulator that confers pathoadaptive phenotypes with implications for our understanding of the pathogenesis of Enterobacter, Salmonella and Citrobacter spp. that express orthologous RamA proteins. PMID:25633080

  9. Microarray analysis identifies Salmonella genes belonging to the low-shear modeled microgravity regulon

    NASA Technical Reports Server (NTRS)

    Wilson, James W.; Ramamurthy, Rajee; Porwollik, Steffen; McClelland, Michael; Hammond, Timothy; Allen, Pat; Ott, C. Mark; Pierson, Duane L.; Nickerson, Cheryl A.


    The low-shear environment of optimized rotation suspension culture allows both eukaryotic and prokaryotic cells to assume physiologically relevant phenotypes that have led to significant advances in fundamental investigations of medical and biological importance. This culture environment has also been used to model microgravity for ground-based studies regarding the impact of space flight on eukaryotic and prokaryotic physiology. We have previously demonstrated that low-shear modeled microgravity (LSMMG) under optimized rotation suspension culture is a novel environmental signal that regulates the virulence, stress resistance, and protein expression levels of Salmonella enterica serovar Typhimurium. However, the mechanisms used by the cells of any species, including Salmonella, to sense and respond to LSMMG and identities of the genes involved are unknown. In this study, we used DNA microarrays to elucidate the global transcriptional response of Salmonella to LSMMG. When compared with identical growth conditions under normal gravity (1 x g), LSMMG differentially regulated the expression of 163 genes distributed throughout the chromosome, representing functionally diverse groups including transcriptional regulators, virulence factors, lipopolysaccharide biosynthetic enzymes, iron-utilization enzymes, and proteins of unknown function. Many of the LSMMG-regulated genes were organized in clusters or operons. The microarray results were further validated by RT-PCR and phenotypic analyses, and they indicate that the ferric uptake regulator is involved in the LSMMG response. The results provide important insight about the Salmonella LSMMG response and could provide clues for the functioning of known Salmonella virulence systems or the identification of uncharacterized bacterial virulence strategies.

  10. Aminopeptidase N1 (EtAPN1), an M1 metalloprotease of the apicomplexan parasite Eimeria tenella, participates in parasite development.


    Gras, Simon; Byzia, Anna; Gilbert, Florence B; McGowan, Sheena; Drag, Marcin; Silvestre, Anne; Niepceron, Alisson; Lecaille, Fabien; Lalmanach, Gilles; Brossier, Fabien


    Aminopeptidases N are metalloproteases of the M1 family that have been reported in numerous apicomplexan parasites, including Plasmodium, Toxoplasma, Cryptosporidium, and Eimeria. While investigating the potency of aminopeptidases as therapeutic targets against coccidiosis, one of the most important avian diseases caused by the genus Eimeria, we identified and characterized Eimeria tenella aminopeptidase N1 (EtAPN1). Its inhibition by bestatin and amastatin, as well as its reactivation by divalent ions, is typical of zinc-dependent metalloproteases. EtAPN1 shared a similar sequence, three-dimensional structure, and substrate specificity and similar kinetic parameters with A-M1 from Plasmodium falciparum (PfA-M1), a validated target in the treatment of malaria. EtAPN1 is synthesized as a 120-kDa precursor and cleaved into 96-, 68-, and 38-kDa forms during sporulation. Further, immunolocalization assays revealed that, similar to PfA-M1, EtAPN1 is present during the intracellular life cycle stages in both the parasite cytoplasm and the parasite nucleus. The present results support the hypothesis of a conserved role between the two aminopeptidases, and we suggest that EtAPN1 might be a valuable target for anticoccidiosis drugs.

  11. Molecular assessment of apicomplexan parasites in the snake Psammophis from North Africa: do multiple parasite lineages reflect the final vertebrate host diet?


    Tomé, Beatriz; Maia, João P M C; Harris, D James


    The Apicomplexa are intracellular pathogens of animals, with the Coccidia being the largest group. Among these are the hemogregarines, which include some of the most common hemoparasites found in reptiles. Several studies have reported a possible pattern of prey-predator transmission for some of these parasites. Snakes from the Mediterranean region have been found to be parasitized with Hepatozoon spp. similar to those in lacertids and gekkonids, supporting the prey-predator transmission hypothesis. Here we analyzed specimens of the saurophagous genus Psammophis from North Africa, an ecologically different region. Through molecular analysis of tissue samples we detected 3 different apicomplexan parasites: Caryospora, Sarcocystis, and Hepatozoon. Caryospora was detected in a Forskål's sand snake Psammophis schokari from Algeria, constituting the first time these parasites have been detected from a tissue sample through molecular screening. The obtained Sarcocystis phylogeny does not reflect the relationships of their final hosts, with the parasites identified from snakes forming at least 3 unrelated groups, indicating that it is still premature to predict definitive host based on the phylogeny of these parasites. Three unrelated lineages of Hepatozoon parasites were identified in Psammophis, each closely related to lineages previously identified from different lizard groups, on which these snakes feed. This once again indicates that diet might be a key element in transmission, at least for Hepatozoon species of saurophagous snakes.

  12. Survival of enterohemorrhagic Escherichia coli in the presence of Acanthamoeba castellanii and its dependence on Pho regulon.


    Chekabab, Samuel Mohammed; Daigle, France; Charette, Steve J; Dozois, Charles M; Harel, Josée


    Enterohemorrhagic Escherichia coli (EHEC) are involved in outbreaks of food-borne illness and transmitted to humans through bovine products or water contaminated by cattle feces. Microbial interaction is one of the strategies used by pathogenic bacteria to survive in the environment. Among protozoa, the free-living amoebae are known to host and protect several water-borne pathogens. In this study, the interaction between EHEC and the predacious protozoa Acanthamoeba castellanii was investigated. Using monoculture and cocultures, growth of both organisms was estimated for 3 weeks by total and viable cell counts. The numbers of EHEC were significantly higher when cultured with amoebae than without, and less EHEC shifted into a viable but nonculturable state in the presence of amoebae. Using several mutants, we observed that the Pho regulon is required for EHEC growth when cocultured with amoebae. In contrast, the Shiga toxins (Stx) were not involved in this association phenotype. Cocultures monitored by electron microscopy revealed a loss of the regular rod shape of EHEC and the secretion of multilamellar vesicles by the amoebae, which did not contain bacteria. As the interaction between A. castellanii and EHEC appears beneficial for bacterial growth, this supports a potential role for protozoa in promoting the persistence of EHEC in the environment.

  13. Survival of enterohemorrhagic Escherichia coli in the presence of Acanthamoeba castellanii and its dependence on Pho regulon

    PubMed Central

    Chekabab, Samuel Mohammed; Daigle, France; Charette, Steve J; Dozois, Charles M; Harel, Josée


    Enterohemorrhagic Escherichia coli (EHEC) are involved in outbreaks of food-borne illness and transmitted to humans through bovine products or water contaminated by cattle feces. Microbial interaction is one of the strategies used by pathogenic bacteria to survive in the environment. Among protozoa, the free-living amoebae are known to host and protect several water-borne pathogens. In this study, the interaction between EHEC and the predacious protozoa Acanthamoeba castellanii was investigated. Using monoculture and cocultures, growth of both organisms was estimated for 3 weeks by total and viable cell counts. The numbers of EHEC were significantly higher when cultured with amoebae than without, and less EHEC shifted into a viable but nonculturable state in the presence of amoebae. Using several mutants, we observed that the Pho regulon is required for EHEC growth when cocultured with amoebae. In contrast, the Shiga toxins (Stx) were not involved in this association phenotype. Cocultures monitored by electron microscopy revealed a loss of the regular rod shape of EHEC and the secretion of multilamellar vesicles by the amoebae, which did not contain bacteria. As the interaction between A. castellanii and EHEC appears beneficial for bacterial growth, this supports a potential role for protozoa in promoting the persistence of EHEC in the environment. PMID:23233434

  14. Gene function analysis in environmental isolates: The nif regulon of the strict iron oxidizing bacterium Leptospirillum ferrooxidans

    PubMed Central

    Parro, Víctor; Moreno-Paz, Mercedes


    A random genomic library from an environmental isolate of the Gram-negative bacterium Leptospirillum ferrooxidans has been printed on a microarray. Gene expression analysis was carried out with total RNA extracted from L. ferrooxidans cultures in the presence or absence of ammonium as nitrogen source under aerobic conditions. Although practically nothing is known about the genome sequence of this bacterium, this approach allowed us the selection and sequencing of only those clones bearing genes that showed an altered expression pattern. By sequence comparison, we have identified most of the genes of nitrogen fixation regulon in L. ferrooxidans, like the nifHDKENX operon, encoding the structural components of Mo-Fe nitrogenase; nifSU-hesB-hscBA-fdx operon, for Fe-S cluster assembly; the amtB gene (ammonium transporter); modA (molybdenum ABC type transporter); some regulatory genes like ntrC, nifA (the specific activator of nif genes); or two glnB-like genes (encoding the PII regulatory protein). Our results show that shotgun DNA microarrays are very powerful tools to accomplish gene expression studies with environmental bacteria whose genome sequence is still unknown, avoiding the time and effort necessary for whole genome sequencing projects. PMID:12808145

  15. Contribution of the Salmonella enterica KdgR Regulon to Persistence of the Pathogen in Vegetable Soft Rots

    PubMed Central

    George, Andrée S.; Salas González, Isai; Lorca, Graciela L.


    During their colonization of plants, human enteric pathogens, such as Salmonella enterica, are known to benefit from interactions with phytopathogens. At least in part, benefits derived by Salmonella from the association with a soft rot caused by Pectobacterium carotovorum were shown to be dependent on Salmonella KdgR, a regulator of genes involved in the uptake and utilization of carbon sources derived from the degradation of plant polymers. A Salmonella kdgR mutant was more fit in soft rots but not in the lesions caused by Xanthomonas spp. and Pseudomonas spp. Bioinformatic, phenotypic, and gene expression analyses demonstrated that the KdgR regulon included genes involved in uptake and metabolism of molecules resulting from pectin degradation as well as those central to the utilization of a number of other carbon sources. Mutant analyses indicated that the Entner-Doudoroff pathway, in part controlled by KdgR, was critical for the persistence within soft rots and likely was responsible for the kdgR phenotype. PMID:26682862

  16. Energetic consequences of nitrite stress in Desulfovibrio vulgaris Hildenborough, inferred from global transcriptional analysis.


    He, Qiang; Huang, Katherine H; He, Zhili; Alm, Eric J; Fields, Matthew W; Hazen, Terry C; Arkin, Adam P; Wall, Judy D; Zhou, Jizhong


    Many of the proteins that are candidates for bioenergetic pathways involved with sulfate respiration in Desulfovibrio spp. have been studied, but complete pathways and overall cell physiology remain to be resolved for many environmentally relevant conditions. In order to understand the metabolism of these microorganisms under adverse environmental conditions for improved bioremediation efforts, Desulfovibrio vulgaris Hildenborough was used as a model organism to study stress response to nitrite, an important intermediate in the nitrogen cycle. Previous physiological studies demonstrated that growth was inhibited by nitrite and that nitrite reduction was observed to be the primary mechanism of detoxification. Global transcriptional profiling with whole-genome microarrays revealed coordinated cascades of responses to nitrite in pathways of energy metabolism, nitrogen metabolism, oxidative stress response, and iron homeostasis. In agreement with previous observations, nitrite-stressed cells showed a decrease in the expression of genes encoding sulfate reduction functions in addition to respiratory oxidative phosphorylation and ATP synthase activity. Consequently, the stressed cells had decreased expression of the genes encoding ATP-dependent amino acid transporters and proteins involved in translation. Other genes up-regulated in response to nitrite include the genes in the Fur regulon, which is suggested to be involved in iron homeostasis, and genes in the Per regulon, which is predicted to be responsible for oxidative stress response.

  17. Energetic Consequences of nitrite stress in Desulfovibrio vulgarisHildenborough, inferred from global transcriptional analysis

    SciTech Connect

    He, Qiang; Huang, Katherine H.; He, Zhili; Alm, Eric J.; Fields,Matthew W.; Hazen, Terry C.; Arkin, Adam P.; Wall, Judy D.; Zhou, Jizhong


    Many of the proteins that are candidates for bioenergetic pathways involved with sulfate respiration in Desulfovibrio spp. have been studied, but complete pathways and overall cell physiology remain to be resolved for many environmentally relevant conditions. In order to understand the metabolism of these microorganisms under adverse environmental conditions for improved bioremediation efforts, Desulfovibrio vulgaris Hildenborough was used as a model organism to study stress response to nitrite, an important intermediate in the nitrogen cycle. Previous physiological studies demonstrated that growth was inhibited by nitrite and that nitrite reduction was observed to be the primary mechanism of detoxification. Global transcriptional profiling with whole-genome microarrays revealed coordinated cascades of responses to nitrite in pathways of energy metabolism, nitrogen metabolism, oxidative stress response, and iron homeostasis. In agreement with previous observations, nitrite-stressed cells showed a decrease in the expression of genes encoding sulfate reduction functions in addition to respiratory oxidative phosphorylation and ATP synthase activity. Consequently, the stressed cells had decreased expression of the genes encoding ATP-dependent amino acid transporters and proteins involved in translation. Other genes up-regulated in response to nitrite include the genes in the Fur regulon, which is suggested to be involved in iron homeostasis, and genes in the Per regulon, which is predicted to be responsible for oxidative stress response.

  18. The Activity of the Pseudomonas aeruginosa Virulence Regulator σ(VreI) Is Modulated by the Anti-σ Factor VreR and the Transcription Factor PhoB.


    Quesada, Jose M; Otero-Asman, Joaquín R; Bastiaansen, Karlijn C; Civantos, Cristina; Llamas, María A


    Gene regulation in bacteria is primarily controlled at the level of transcription initiation by modifying the affinity of the RNA polymerase (RNAP) for the promoter. This control often occurs through the substitution of the RNAP sigma (σ) subunit. Next to the primary σ factor, most bacteria contain a variable number of alternative σ factors of which the extracytoplasmic function group (σ(ECF)) is predominant. Pseudomonas aeruginosa contains nineteen σ(ECF), including the virulence regulator σ(VreI). σ(VreI) is encoded by the vreAIR operon, which also encodes a receptor-like protein (VreA) and an anti-σ factor (VreR). These three proteins form a signal transduction pathway known as PUMA3, which controls expression of P. aeruginosa virulence functions. Expression of the vreAIR operon occurs under inorganic phosphate (Pi) limitation and requires the PhoB transcription factor. Intriguingly, the genes of the σ(VreI) regulon are also expressed in low Pi despite the fact that the σ(VreI) repressor, the anti-σ factor VreR, is also produced in this condition. Here we show that although σ(VreI) is partially active under Pi starvation, maximal transcription of the σ(VreI) regulon genes requires the removal of VreR. This strongly suggests that an extra signal, probably host-derived, is required in vivo for full σ(VreI) activation. Furthermore, we demonstrate that the activity of σ(VreI) is modulated not only by VreR but also by the transcription factor PhoB. Presence of this regulator is an absolute requirement for σ(VreI) to complex the DNA and initiate transcription of the PUMA3 regulon. The potential DNA binding sites of these two proteins, which include a pho box and -10 and -35 elements, are proposed.

  19. The Activity of the Pseudomonas aeruginosa Virulence Regulator σVreI Is Modulated by the Anti-σ Factor VreR and the Transcription Factor PhoB

    PubMed Central

    Quesada, Jose M.; Otero-Asman, Joaquín R.; Bastiaansen, Karlijn C.; Civantos, Cristina; Llamas, María A.


    Gene regulation in bacteria is primarily controlled at the level of transcription initiation by modifying the affinity of the RNA polymerase (RNAP) for the promoter. This control often occurs through the substitution of the RNAP sigma (σ) subunit. Next to the primary σ factor, most bacteria contain a variable number of alternative σ factors of which the extracytoplasmic function group (σECF) is predominant. Pseudomonas aeruginosa contains nineteen σECF, including the virulence regulator σVreI. σVreI is encoded by the vreAIR operon, which also encodes a receptor-like protein (VreA) and an anti-σ factor (VreR). These three proteins form a signal transduction pathway known as PUMA3, which controls expression of P. aeruginosa virulence functions. Expression of the vreAIR operon occurs under inorganic phosphate (Pi) limitation and requires the PhoB transcription factor. Intriguingly, the genes of the σVreI regulon are also expressed in low Pi despite the fact that the σVreI repressor, the anti-σ factor VreR, is also produced in this condition. Here we show that although σVreI is partially active under Pi starvation, maximal transcription of the σVreI regulon genes requires the removal of VreR. This strongly suggests that an extra signal, probably host-derived, is required in vivo for full σVreI activation. Furthermore, we demonstrate that the activity of σVreI is modulated not only by VreR but also by the transcription factor PhoB. Presence of this regulator is an absolute requirement for σVreI to complex the DNA and initiate transcription of the PUMA3 regulon. The potential DNA binding sites of these two proteins, which include a pho box and −10 and −35 elements, are proposed. PMID:27536271

  20. Species boundaries in gregarine apicomplexan parasites: a case study-comparison of morphometric and molecular variability in Lecudina cf. tuzetae (Eugregarinorida, Lecudinidae).


    Rueckert, Sonja; Villette, Petra M A H; Leander, Brian S


    Trophozoites of gregarine apicomplexans are large feeding cells with diverse morphologies that have played a prominent role in gregarine systematics. The range of variability in trophozoite shapes and sizes can be very high even within a single species depending on developmental stages and host environmental conditions; this makes the delimitation of different species of gregarines based on morphological criteria alone very difficult. Accordingly, comparisons of morphological variability and molecular variability in gregarines are necessary to provide a pragmatic framework for establishing species boundaries within this diverse and poorly understood group of parasites. We investigated the morphological and molecular variability present in the gregarine Lecudina cf. tuzetae from the intestines of Nereis vexillosa (Polychaeta) collected in two different locations in Canada. Three distinct morphotypes of trophozoites were identified and the small subunit (SSU) rDNA was sequenced either from multicell isolates of the same morphotype or from single cells. The aim of this investigation was to determine whether the different morphotypes and localities reflected phylogenetic relatedness as inferred from the SSU rDNA sequence data. Phylogenetic analyses of the SSU rDNA demonstrated that the new sequences did not cluster according to morphotype or locality and instead were intermingled within a strongly supported clade. A comparison of 1,657 bp from 45 new sequences demonstrated divergences between 0% and 3.9%. These data suggest that it is necessary to acquire both morphological and molecular data in order to effectively delimit the "clouds" of variation associated with each gregarine species and to unambiguously reidentify these species in the future.

  1. Members of a Novel Protein Family Containing Microneme Adhesive Repeat Domains Act as Sialic Acid-binding Lectins during Host Cell Invasion by Apicomplexan Parasites*

    PubMed Central

    Friedrich, Nikolas; Santos, Joana M.; Liu, Yan; Palma, Angelina S.; Leon, Ester; Saouros, Savvas; Kiso, Makoto; Blackman, Michael J.; Matthews, Stephen; Feizi, Ten; Soldati-Favre, Dominique


    Numerous intracellular pathogens exploit cell surface glycoconjugates for host cell recognition and entry. Unlike bacteria and viruses, Toxoplasma gondii and other parasites of the phylum Apicomplexa actively invade host cells, and this process critically depends on adhesins (microneme proteins) released onto the parasite surface from intracellular organelles called micronemes (MIC). The microneme adhesive repeat (MAR) domain of T. gondii MIC1 (TgMIC1) recognizes sialic acid (Sia), a key determinant on the host cell surface for invasion by this pathogen. By complementation and invasion assays, we demonstrate that TgMIC1 is one important player in Sia-dependent invasion and that another novel Sia-binding lectin, designated TgMIC13, is also involved. Using BLAST searches, we identify a family of MAR-containing proteins in enteroparasitic coccidians, a subclass of apicomplexans, including T. gondii, suggesting that all these parasites exploit sialylated glycoconjugates on host cells as determinants for enteric invasion. Furthermore, this protein family might provide a basis for the broad host cell range observed for coccidians that form tissue cysts during chronic infection. Carbohydrate microarray analyses, corroborated by structural considerations, show that TgMIC13, TgMIC1, and its homologue Neospora caninum MIC1 (NcMIC1) share a preference for α2–3- over α2–6-linked sialyl-N-acetyllactosamine sequences. However, the three lectins also display differences in binding preferences. Intense binding of TgMIC13 to α2–9-linked disialyl sequence reported on embryonal cells and relatively strong binding to 4-O-acetylated-Sia found on gut epithelium and binding of NcMIC1 to 6′sulfo-sialyl Lewisx might have implications for tissue tropism. PMID:19901027

  2. Pyruvate : NADP+ oxidoreductase from the mitochondrion of Euglena gracilis and from the apicomplexan Cryptosporidium parvum: a biochemical relic linking pyruvate metabolism in mitochondriate and amitochondriate protists.


    Rotte, C; Stejskal, F; Zhu, G; Keithly, J S; Martin, W


    Most eukaryotes perform the oxidative decarboxylation of pyruvate in mitochondria using pyruvate dehydrogenase (PDH). Eukaryotes that lack mitochondria also lack PDH, using instead the O(2)-sensitive enzyme pyruvate : ferredoxin oxidoreductase (PFO), which is localized either in the cytosol or in hydrogenosomes. The facultatively anaerobic mitochondria of the photosynthetic protist Euglena gracilis constitute a hitherto unique exception in that these mitochondria oxidize pyruvate with the O(2)-sensitive enzyme pyruvate : NADP oxidoreductase (PNO). Cloning and analysis of Euglena PNO revealed that the cDNA encodes a mitochondrial transit peptide followed by an N-terminal PFO domain that is fused to a C-terminal NADPH-cytochrome P450 reductase (CPR) domain. Two independent 5.8-kb full-size cDNAs for Euglena mitochondrial PNO were isolated; the gene was expressed in cultures supplied with 2% CO(2) in air and with 2% CO(2) in N(2). The apicomplexan Cryptosporidium parvum was also shown to encode and express the same PFO-CPR fusion, except that, unlike E. gracilis, no mitochondrial transit peptide for C. parvum PNO was found. Recombination-derived remnants of PNO are conserved in the genomes of Saccharomyces cerevisiae and Schizosaccharomyces pombe as proteins involved in sulfite reduction. Notably, Trypanosoma brucei was found to encode homologs of both PFO and all four PDH subunits. Gene organization and phylogeny revealed that eukaryotic nuclear genes for mitochondrial, hydrogenosomal, and cytosolic PFO trace to a single eubacterial acquisition. These findings suggest a common ancestry of PFO in amitochondriate protists with Euglena mitochondrial PNO and Cryptosporidium PNO. They are also consistent with the view that eukaryotic PFO domains are biochemical relics inherited from a facultatively anaerobic, eubacterial ancestor of mitochondria and hydrogenosomes.

  3. Time-Resolved Determination of the CcpA Regulon of Lactococcus lactis subsp. cremoris MG1363▿

    PubMed Central

    Zomer, Aldert L.; Buist, Girbe; Larsen, Rasmus; Kok, Jan; Kuipers, Oscar P.


    Carbon catabolite control protein A (CcpA) is the main regulator involved in carbon catabolite repression in gram-positive bacteria. Time series gene expression analyses of Lactococcus lactis MG1363 and L. lactis MG1363ΔccpA using DNA microarrays were used to define the CcpA regulon of L. lactis. Based on a comparison of the transcriptome data with putative CcpA binding motifs (cre sites) in promoter sequences in the genome of L. lactis, 82 direct targets of CcpA were predicted. The main differences in time-dependent expression of CcpA-regulated genes were differences between the exponential and transition growth phases. Large effects were observed for carbon and nitrogen metabolic genes in the exponential growth phase. Effects on nucleotide metabolism genes were observed primarily in the transition phase. Analysis of the positions of putative cre sites revealed that there is a link between either repression or activation and the location of the cre site within the promoter region. Activation was observed when putative cre sites were located upstream of the hexameric −35 sequence at an average position of −56.5 or further upstream with decrements of 10.5 bp. Repression was observed when the cre site was located in or downstream of putative −35 and −10 sequences. The highest level of repression was observed when the cre site was present at a defined side of the DNA helix relative to the canonical −10 sequence. Gel retardation experiments, Northern blotting, and enzyme assays showed that CcpA represses its own expression and activates the expression of the divergently oriented prolidase-encoding pepQ gene, which constitutes a link between regulation of carbon metabolism and regulation of nitrogen metabolism. PMID:17028270

  4. The new pLAI (lux regulon based auto-inducible) expression system for recombinant protein production in Escherichia coli

    PubMed Central


    Background After many years of intensive research, it is generally assumed that no universal expression system can exist for high-level production of a given recombinant protein. Among the different expression systems, the inducible systems are the most popular for their tight regulation. However, induction is in many cases less favorable due to the high cost and/or toxicity of inducers, incompatibilities with industrial scale-up or detrimental growth conditions. Expression systems using autoinduction (or self-induction) prove to be extremely versatile allowing growth and induction of recombinant proteins without the need to monitor cell density or add inducer. Unfortunately, almost all the actual auto inducible expression systems need endogenous or induced metabolic changes during the growth to trigger induction, both frequently linked to detrimental condition to cell growth. In this context, we use a simple modular approach for a cell density-based genetic regulation in order to assemble an autoinducible recombinant protein expression system in E. coli. Result The newly designed pLAI expression system places the expression of recombinant proteins in Escherichia coli under control of the regulatory genes of the lux regulon of Vibrio fischeri's Quorum Sensing (QS) system. The pLAI system allows a tight regulation of the recombinant gene allowing a negligible basal expression and expression only at high cell density. Sequence optimization of regulative genes of QS of V. fischeri for expression in E. coli upgraded the system to high level expression. Moreover, partition of regulative genes between the plasmid and the host genome and introduction of a molecular safety lock permitted tighter control of gene expression. Conclusion Coupling gene expression to cell density using cell-to-cell communication provides a promising approach for recombinant protein production. The system allows the control of expression of the target recombinant gene independently from external

  5. Induction of the heat shock regulon of Escherichia coli markedly increases production of bacterial viruses at high temperatures

    SciTech Connect

    Wiberg, J.S.; Mowrey-Mckee, M.F.; Stevens, E.J.


    Production of bacteriophages T2, T4, and T6 at 42.8 to 44/sup 0/C was increased from 8- to 260-fold by adapting the Escherichia coli host (grown at 30/sup 0/C) to growth at the high temperature for 8 min before infection; this increase was abolished if the host htpR (rpoH) gene was inactive. Others have shown that the htpR protein increases or activates the synthesis of at least 17 E. coli heat shock proteins upon raising the growth temperature above a certain level. At 43.8 to 44/sup 0/C in T4-infected, unadapted cells, the rates of RNA, DNA, and protein synthesis were about 100, 70 and 70%, respectively, of those in T4-infected, adapted cells. Production of the major processed capsid protein, gp23, was reduced significantly more than that of most other T4 proteins in unadapted cells relative to adapted cells. Only 4.6% of the T4 DNA made in unadapted cells was resistant to micrococcal nuclease, versus 50% in adapted cells. Thus, defective maturation of T4 heads appears to explain the failure of phage production in unadapted cells. Overproduction of the heat shock protein GroEL from plasmids restored T4 production in unadapted cells to about 50% of that seen in adapted cells. T4-infected, adapted E. coli B at around 44/sup 0/C exhibited a partial tryptophan deficiency. Production of bacteriophage T7 at 44/sup 0/C was increased two- to fourfold by adapting the host to 44/sup 0/C before infection; evidence against involvement of the htpR (rpoH) gene is presented. This work and recent work with bacteriophage delta appear to represent the first demonstrations for any virus that expression of the heat shock regulon of a host is necessary for virus production at high temperature.

  6. Proposed megakaryocytic regulon of p53: the genes engaged to control cell cycle and apoptosis during megakaryocytic differentiation.


    Apostolidis, Pani A; Lindsey, Stephan; Miller, William M; Papoutsakis, Eleftherios T


    During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects.

  7. The H-NS-like protein StpA represses the RpoS (sigma 38) regulon during exponential growth of Salmonella Typhimurium.


    Lucchini, Sacha; McDermott, Paul; Thompson, Arthur; Hinton, Jay C D


    StpA is a paralogue of the nucleoid-associated protein H-NS that is conserved in a range of enteric bacteria and had no known function in Salmonella Typhimurium. We show that 5% of the Salmonella genome is regulated by StpA, which contrasts with the situation in Escherichia coli where deletion of stpA only had minor effects on gene expression. The StpA-dependent genes of S. Typhimurium are a specific subset of the H-NS regulon that are predominantly under the positive control of sigma(38) (RpoS), CRP-cAMP and PhoP. Regulation by StpA varied with growth phase; StpA controlled sigma(38) levels at mid-exponential phase by preventing inappropriate activation of sigma(38) during rapid bacterial growth. In contrast, StpA only activated the CRP-cAMP regulon during late exponential phase. ChIP-chip analysis revealed that StpA binds to PhoP-dependent genes but not to most genes of the CRP-cAMP and sigma(38) regulons. In fact, StpA indirectly regulates sigma(38)-dependent genes by enhancing sigma(38) turnover by repressing the anti-adaptor protein rssC. We discovered that StpA is essential for the dynamic regulation of sigma(38) in response to increased glucose levels. Our findings identify StpA as a novel growth phase-specific regulator that plays an important physiological role by linking sigma(38) levels to nutrient availability.

  8. Early activation of quorum sensing in Pseudomonas aeruginosa reveals the architecture of a complex regulon

    PubMed Central

    Schuster, Martin; Greenberg, E Peter


    Background Quorum-sensing regulation of gene expression in Pseudomonas aeruginosa is complex. Two interconnected acyl-homoserine lactone (acyl-HSL) signal-receptor pairs, 3-oxo-dodecanoyl-HSL-LasR and butanoyl-HSL-RhlR, regulate more than 300 genes. The induction of most of the genes is delayed during growth of P. aeruginosa in complex medium, cannot be advanced by addition of exogenous signal, and requires additional regulatory components. Many of these late genes can be induced by addition of signals early by using specific media conditions. While several factors super-regulate the quorum receptors, others may co-regulate target promoters or may affect expression posttranscriptionally. Results To better understand the contributions of super-regulation and co-regulation to quorum-sensing gene expression, and to better understand the general structure of the quorum sensing network, we ectopically expressed the two receptors (in the presence of their cognate signals) and another component that affects quorum sensing, the stationary phase sigma factor RpoS, early in growth. We determined the effect on target gene expression by microarray and real-time PCR analysis. Our results show that many target genes (e.g. lasB and hcnABC) are directly responsive to receptor protein levels. Most genes (e.g. lasA, lecA, and phnAB), however, are not significantly affected, although at least some of these genes are directly regulated by quorum sensing. The majority of promoters advanced by RhlR appeared to be regulated directly, which allowed us to build a RhlR consensus sequence. Conclusion The direct responsiveness of many quorum sensing target genes to receptor protein levels early in growth confirms the role of super-regulation in quorum sensing gene expression. The observation that the induction of most target genes is not affected by signal or receptor protein levels indicates that either target promoters are co-regulated by other transcription factors, or that expression is

  9. Involvement of the phosphate regulon and the psiD locus in carbon-phosphorus lyase activity of Escherichia coli K-12.

    PubMed Central

    Wackett, L P; Wanner, B L; Venditti, C P; Walsh, C T


    Escherichia coli K-12 can readily mutate to use methylphosphonic acid as the sole phosphorus source by a direct carbon-to-phosphorus (C-P) bond cleavage activity that releases methane and Pi. The in vivo C-P lyase activity is both physiologically and genetically regulated as a member of the phosphate regulon. Since psiD::lacZ(Mu d1) mutants cannot metabolize methylphosphonic acid, psiD may be the structural gene(s) for C-P lyase. PMID:3549702

  10. Inference of self-regulated transcriptional networks by comparative genomics.


    Cornish, Joseph P; Matthews, Fialelei; Thomas, Julien R; Erill, Ivan


    The assumption of basic properties, like self-regulation, in simple transcriptional regulatory networks can be exploited to infer regulatory motifs from the growing amounts of genomic and meta-genomic data. These motifs can in principle be used to elucidate the nature and scope of transcriptional networks through comparative genomics. Here we assess the feasibility of this approach using the SOS regulatory network of Gram-positive bacteria as a test case. Using experimentally validated data, we show that the known regulatory motif can be inferred through the assumption of self-regulation. Furthermore, the inferred motif provides a more robust search pattern for comparative genomics than the experimental motifs defined in reference organisms. We take advantage of this robustness to generate a functional map of the SOS response in Gram-positive bacteria. Our results reveal definite differences in the composition of the LexA regulon between Firmicutes and Actinobacteria, and confirm that regulation of cell-division inhibition is a widespread characteristic of this network among Gram-positive bacteria.

  11. Characterization of fhlA mutations resulting in ligand-independent transcriptional activation and ATP hydrolysis.

    PubMed Central

    Korsa, I; Böck, A


    The FhlA protein belongs to the NtrC family of transcriptional regulators. It induces transcription from the -12/-24 promoters of the genes of the formate regulon by sigma54 RNA polymerase. FhlA is activated by binding of the ligand formate and does not require phosphorylation. A mutational analysis of the fhLA gene portion coding for the A and C domains was conducted with the aim of gaining information on the interaction between formate binding and ATP hydrolysis plus transcription activation. Four mutations were identified, all located in the A domain; one of them rendered transcription completely independent from the presence of formate, and the others conferred a semiconstitutive phenotype. The FhlA protein of one of the semiconstitutive variants was purified. Catalytic efficiency of ATP hydrolysis of the mutant FhlA was increased in the absence of formate in the same manner as formate influences the activity of wild-type FhlA. Moreover, in vitro transcription occurred at much lower threshold concentrations of the mutant protein and of nucleoside triphosphates than with the wild-type FhlA. PMID:8981978

  12. Global repositioning of transcription start sites in a plant-fermenting bacterium

    PubMed Central

    Boutard, Magali; Ettwiller, Laurence; Cerisy, Tristan; Alberti, Adriana; Labadie, Karine; Salanoubat, Marcel; Schildkraut, Ira; Tolonen, Andrew C.


    Bacteria respond to their environment by regulating mRNA synthesis, often by altering the genomic sites at which RNA polymerase initiates transcription. Here, we investigate genome-wide changes in transcription start site (TSS) usage by Clostridium phytofermentans, a model bacterium for fermentation of lignocellulosic biomass. We quantify expression of nearly 10,000 TSS at single base resolution by Capp-Switch sequencing, which combines capture of synthetically capped 5′ mRNA fragments with template-switching reverse transcription. We find the locations and expression levels of TSS for hundreds of genes change during metabolism of different plant substrates. We show that TSS reveals riboswitches, non-coding RNA and novel transcription units. We identify sequence motifs associated with carbon source-specific TSS and use them for regulon discovery, implicating a LacI/GalR protein in control of pectin metabolism. We discuss how the high resolution and specificity of Capp-Switch enables study of condition-specific changes in transcription initiation in bacteria. PMID:27982035

  13. A Network of Paralogous Stress Response Transcription Factors in the Human Pathogen Candida glabrata

    PubMed Central

    Merhej, Jawad; Thiebaut, Antonin; Blugeon, Corinne; Pouch, Juliette; Ali Chaouche, Mohammed El Amine; Camadro, Jean-Michel; Le Crom, Stéphane; Lelandais, Gaëlle; Devaux, Frédéric


    The yeast Candida glabrata has become the second cause of systemic candidemia in humans. However, relatively few genome-wide studies have been conducted in this organism and our knowledge of its transcriptional regulatory network is quite limited. In the present work, we combined genome-wide chromatin immunoprecipitation (ChIP-seq), transcriptome analyses, and DNA binding motif predictions to describe the regulatory interactions of the seven Yap (Yeast AP1) transcription factors of C. glabrata. We described a transcriptional network containing 255 regulatory interactions and 309 potential target genes. We predicted with high confidence the preferred DNA binding sites for 5 of the 7 CgYaps and showed a strong conservation of the Yap DNA binding properties between S. cerevisiae and C. glabrata. We provided reliable functional annotation for 3 of the 7 Yaps and identified for Yap1 and Yap5 a core regulon which is conserved in S. cerevisiae, C. glabrata, and C. albicans. We uncovered new roles for CgYap7 in the regulation of iron-sulfur cluster biogenesis, for CgYap1 in the regulation of heme biosynthesis and for CgYap5 in the repression of GRX4 in response to iron starvation. These transcription factors define an interconnected transcriptional network at the cross-roads between redox homeostasis, oxygen consumption, and iron metabolism. PMID:27242683

  14. Pseudomonas syringae Type III Effector HopBB1 Promotes Host Transcriptional Repressor Degradation to Regulate Phytohormone Responses and Virulence.


    Yang, Li; Teixeira, Paulo José Pereira Lima; Biswas, Surojit; Finkel, Omri M; He, Yijian; Salas-Gonzalez, Isai; English, Marie E; Epple, Petra; Mieczkowski, Piotr; Dangl, Jeffery L


    Independently evolved pathogen effectors from three branches of life (ascomycete, eubacteria, and oomycete) converge onto the Arabidopsis TCP14 transcription factor to manipulate host defense. However, the mechanistic basis for defense control via TCP14 regulation is unknown. We demonstrate that TCP14 regulates the plant immune system by transcriptionally repressing a subset of the jasmonic acid (JA) hormone signaling outputs. A previously unstudied Pseudomonas syringae (Psy) type III effector, HopBB1, interacts with TCP14 and targets it to the SCF(COI1) degradation complex by connecting it to the JA signaling repressor JAZ3. Consequently, HopBB1 de-represses the TCP14-regulated subset of JA response genes and promotes pathogen virulence. Thus, HopBB1 fine-tunes host phytohormone crosstalk by precisely manipulating part of the JA regulon to avoid pleiotropic host responses while promoting pathogen proliferation.

  15. Induction of the heat shock regulon of Escherichia coli markedly increases production of bacterial viruses at high temperatures.

    PubMed Central

    Wiberg, J S; Mowrey-McKee, M F; Stevens, E J


    Production of bacteriophages T2, T4, and T6 at 42.8 to 44 degrees C was increased from 8- to 260-fold by adapting the Escherichia coli host (grown at 30 degrees C) to growth at the high temperature for 8 min before infection; this increase was abolished if the host htpR (rpoH) gene was inactive. Others have shown that the htpR protein increases or activates the synthesis of at least 17 E. coli heat shock proteins upon raising the growth temperature above a certain level. At 43.8 to 44 degrees C in T4-infected, unadapted cells, the rates of RNA, DNA, and protein synthesis were about 100, 70, and 70%, respectively, of those in T4-infected, adapted cells. Production of the major processed capsid protein, gp23, was reduced significantly more than that of most other T4 proteins in unadapted cells relative to adapted cells. Only 4.6% of the T4 DNA made in unadapted cells was resistant to micrococcal nuclease, versus 50% in adapted cells. Thus, defective maturation of T4 heads appears to explain the failure of phage production in unadapted cells. Overproduction of the heat shock protein GroEL from plasmids restored T4 production in unadapted cells to about 50% of that seen in adapted cells. T4-infected, adapted E. coli B at around 44 degrees C exhibited a partial tryptophan deficiency; this correlated with reduced uptake of uracil that is probably caused by partial induction of stringency. Production of bacteriophage T7 at 44 degrees C was increased two- to fourfold by adapting the host to 44 degrees C before infection; evidence against involvement of the htpR (rpoH) gene is presented. This work and recent work with bacteriophage lambda (C. Waghorne and C.R. Fuerst, Virology 141:51-64, 1985) appear to represent the first demonstrations for any virus that expression of the heat shock regulon of a host is necessary for virus production at high temperature. Images PMID:2446014

  16. LacI Transcriptional Regulatory Networks in Clostridium thermocellum DSM1313


    Wilson, Charlotte M.; Klingeman, Dawn M.; Schlachter, Caleb; ...


    Organisms regulate gene expression in response to the environment to coordinate metabolic reactions.Clostridium thermocellumexpresses enzymes for both lignocellulose solubilization and its fermentation to produce ethanol. In one LacI regulator termed GlyR3 inC. thermocellumATCC 27405 we identified a repressor of neighboring genes with repression relieved by laminaribiose (a β-1,3 disaccharide). To better understand the threeC. thermocellumLacI regulons, deletion mutants were constructed using the genetically tractable DSM1313 strain. DSM1313lacIgenes Clo1313_2023, Clo1313_0089, and Clo1313_0396 encode homologs of GlyR1, GlyR2, and GlyR3 from strain ATCC 27405, respectively. Furthermore, growth on cellobiose or pretreated switchgrass was unaffected by any of the gene deletions under controlled-pHmore » fermentations. Global gene expression patterns from time course analyses identified glycoside hydrolase genes encoding hemicellulases, including cellulosomal enzymes, that were highly upregulated (5- to 100-fold) in the absence of each LacI regulator, suggesting that these were repressed under wild-type conditions and that relatively few genes were controlled by each regulator under the conditions tested. Clo1313_2022, encoding lichenase enzyme LicB, was derepressed in a ΔglyR1strain. Higher expression of Clo1313_1398, which encodes the Man5A mannanase, was observed in a ΔglyR2strain, and α-mannobiose was identified as a probable inducer for GlyR2-regulated genes. For the ΔglyR3strain, upregulation of the two genes adjacent toglyR3in thecelC-glyR3-licAoperon was consistent with earlier studies. Electrophoretic mobility shift assays have confirmed LacI transcription factor binding to specific regions of gene promoters. IMPORTANCEUnderstandingC. thermocellumgene regulation is of importance for improved fundamental knowledge of this industrially relevant bacterium. Most LacI transcription factors regulate local genomic regions; however, a small number of those

  17. LacI Transcriptional Regulatory Networks in Clostridium thermocellum DSM1313.


    Wilson, Charlotte M; Klingeman, Dawn M; Schlachter, Caleb; Syed, Mustafa H; Wu, Chia-Wei; Guss, Adam M; Brown, Steven D


    Organisms regulate gene expression in response to the environment to coordinate metabolic reactions. Clostridium thermocellum expresses enzymes for both lignocellulose solubilization and its fermentation to produce ethanol. One LacI regulator termed GlyR3 in C. thermocellum ATCC 27405 was previously identified as a repressor of neighboring genes with repression relieved by laminaribiose (a β-1,3 disaccharide). To better understand the three C. thermocellum LacI regulons, deletion mutants were constructed using the genetically tractable DSM1313 strain. DSM1313 lacI genes Clo1313_2023, Clo1313_0089, and Clo1313_0396 encode homologs of GlyR1, GlyR2, and GlyR3 from strain ATCC 27405, respectively. Growth on cellobiose or pretreated switchgrass was unaffected by any of the gene deletions under controlled-pH fermentations. Global gene expression patterns from time course analyses identified glycoside hydrolase genes encoding hemicellulases, including cellulosomal enzymes, that were highly upregulated (5- to 100-fold) in the absence of each LacI regulator, suggesting that these were repressed under wild-type conditions and that relatively few genes were controlled by each regulator under the conditions tested. Clo1313_2022, encoding lichenase enzyme LicB, was derepressed in a ΔglyR1 strain. Higher expression of Clo1313_1398, which encodes the Man5A mannanase, was observed in a ΔglyR2 strain, and α-mannobiose was identified as a probable inducer for GlyR2-regulated genes. For the ΔglyR3 strain, upregulation of the two genes adjacent to glyR3 in the celC-glyR3-licA operon was consistent with earlier studies. Electrophoretic mobility shift assays have confirmed LacI transcription factor binding to specific regions of gene promoters.IMPORTANCE Understanding C. thermocellum gene regulation is of importance for improved fundamental knowledge of this industrially relevant bacterium. Most LacI transcription factors regulate local genomic regions; however, a small number of

  18. A Novel Transcriptional Regulator Related to Thiamine Phosphate Synthase Controls Thiamine Metabolism Genes in Archaea.


    Rodionov, Dmitry A; Leyn, Semen A; Li, Xiaoqing; Rodionova, Irina A


    Thiamine (vitamin B1) is a precursor of thiamine pyrophosphate (TPP), an essential coenzyme in the central metabolism of all living organisms. Bacterial thiamine biosynthesis and salvage genes are controlled at the RNA level by TPP-responsive riboswitches. In Archaea, TPP riboswitches are restricted to the Thermoplasmatales order. Mechanisms of transcriptional control of thiamine genes in other archaeal lineages remain unknown. Using the comparative genomics approach, we identified a novel family of transcriptional regulators (named ThiR) controlling thiamine biosynthesis and transport genes in diverse lineages in the Crenarchaeota phylum as well as in the Halobacteria and Thermococci classes of the Euryarchaeota ThiR regulators are composed of an N-terminal DNA-binding domain and a C-terminal ligand-binding domain, which is similar to the archaeal thiamine phosphate synthase ThiN. By using comparative genomics, we predicted ThiR-binding DNA motifs and reconstructed ThiR regulons in 67 genomes representing all above-mentioned lineages. The predicted ThiR-binding motifs are characterized by palindromic symmetry with several distinct lineage-specific consensus sequences. In addition to thiamine biosynthesis genes, the reconstructed ThiR regulons include various transporters for thiamine and its precursors. Bioinformatics predictions were experimentally validated by in vitro DNA-binding assays with the recombinant ThiR protein from the hyperthermophilic archaeon Metallosphaera yellowstonensis MK1. Thiamine phosphate and, to some extent, TPP and hydroxyethylthiazole phosphate were required for the binding of ThiR to its DNA targets, suggesting that ThiR is derepressed by limitation of thiamine phosphates. The thiamine phosphate-binding residues previously identified in ThiN are highly conserved in ThiR regulators, suggesting a conserved mechanism for effector recognition.

  19. Nitrogen Fixation and Molecular Oxygen: Comparative Genomic Reconstruction of Transcription Regulation in Alphaproteobacteria

    PubMed Central

    Tsoy, Olga V.; Ravcheev, Dmitry A.; Čuklina, Jelena; Gelfand, Mikhail S.


    Biological nitrogen fixation plays a crucial role in the nitrogen cycle. An ability to fix atmospheric nitrogen, reducing it to ammonium, was described for multiple species of Bacteria and Archaea. The transcriptional regulatory network for nitrogen fixation was extensively studied in several representatives of the class Alphaproteobacteria. This regulatory network includes the activator of nitrogen fixation NifA, working in tandem with the alternative sigma-factor RpoN as well as oxygen-responsive regulatory systems, one-component regulators FnrN/FixK and two-component system FixLJ. Here we used a comparative genomics approach for in silico study of the transcriptional regulatory network in 50 genomes of Alphaproteobacteria. We extended the known regulons and proposed the scenario for the evolution of the nitrogen fixation transcriptional network. The reconstructed network substantially expands the existing knowledge of transcriptional regulation in nitrogen-fixing microorganisms and can be used for genetic experiments, metabolic reconstruction, and evolutionary analysis. PMID:27617010

  20. Autogenous transcriptional activation of a thiostrepton-induced gene in Streptomyces lividans.

    PubMed Central

    Holmes, D J; Caso, J L; Thompson, C J


    Although the antibiotic thiostrepton is best known as an inhibitor of protein synthesis, it also, at extremely low concentrations (< 10(-9) M), induces the expression of a regulon of unknown function in certain Streptomyces species. Here, we report the purification of a Streptomyces lividans thiostrepton-induced transcriptional activator protein, TipAL, whose N-terminus is similar to a family of eubacterial regulatory proteins represented by MerR. TipAL was first purified from induced cultures of S.lividans as a factor which bound to and activated transcription from its own promoter. The tipAL gene was overexpressed in Escherichia coli and TipAL protein purified in a single step using a thiostrepton affinity column. Thiostrepton enhanced binding of TipAL to the promoter and catalysed specific transcription in vitro. TipAS, a second gene product of the same open reading frame consisting of the C-terminal domain of TipAL, is apparently translated using its own in-frame initiation site. Since it is produced in large molar excess relative to TipAL after induction and also binds thiostrepton, it may competitively modulate transcriptional activation. Images PMID:7688297

  1. Humoral Responses to Rv1733c, Rv0081, Rv1735c, and Rv1737c DosR Regulon-Encoded Proteins of Mycobacterium tuberculosis in Individuals with Latent Tuberculosis Infection

    PubMed Central

    Nalwoga, Angela; Levin, Jonathan; Ottenhoff, Tom H. M.; Elliott, Alison M.; Cose, Stephen; Andia-Biraro, Irene


    Latent tuberculosis infection (LTBI) is evidence of immunological control of tuberculosis. Dormancy survival regulator (DosR) regulon-encoded proteins may have a role in the maintenance of LTBI. T cell responses to Rv1733c, Rv0081, Rv1735c, and Rv1737c DosR regulon-encoded proteins were found to be most frequent among household contacts of TB cases from Uganda compared to other DosR proteins, but antibody responses were not described. We characterized antibody responses to these proteins in individuals from Uganda. Antibodies to Rv1733c, Rv0081, Rv1735c, and Rv1737c DosR regulon-encoded proteins were measured in 68 uninfected individuals, 62 with LTBI, and 107 with active pulmonary tuberculosis (APTB) cases. There were no differences in the concentrations of antibodies to Rv0081, Rv1735c, and Rv1737c DosR regulon-encoded proteins between individuals with LTBI and APTB and those who were uninfected. LTBI was associated with higher concentrations of antibodies to Rv1733c in female participants [adjusted geometric mean ratio: 1.812, 95% confidence interval (CI): 1.105 2.973, and p = 0.019] but not in males (p value for interaction = 0.060). Antibodies to the four DosR regulon-encoded proteins investigated may not serve as good biomarkers of LTBI in the general population. More of the M.tb proteome needs to be screened to identify proteins that induce strong antibody responses in LTBI. PMID:28255560

  2. Transcriptional enhancers: Transcription, function and flexibility.


    Melamed, Philippa; Yosefzon, Yahav; Rudnizky, Sergei; Pnueli, Lilach


    Active transcriptional enhancers are often transcribed to eRNAs, whose changing levels mirror those of the target gene mRNA. We discuss some of the reported functions of these eRNAs and their likely diversity to allow utilization of distinct cis regulatory regions to enhance transcription in diverse developmental and cellular contexts.

  3. Supra-optimal expression of the cold-regulated OsMyb4 transcription factor in transgenic rice changes the complexity of transcriptional network with major effects on stress tolerance and panicle development.


    Park, Myoung-Ryoul; Yun, Kil-Young; Mohanty, Bijayalaxmi; Herath, Venura; Xu, Fuyu; Wijaya, Edward; Bajic, Vladimir B; Yun, Song-Joong; De Los Reyes, Benildo G


    The R2R3-type OsMyb4 transcription factor of rice has been shown to play a role in the regulation of osmotic adjustment in heterologous overexpression studies. However, the exact composition and organization of its underlying transcriptional network has not been established to be a robust tool for stress tolerance enhancement by regulon engineering. OsMyb4 network was dissected based on commonalities between the global chilling stress transcriptome and the transcriptome configured by OsMyb4 overexpression. OsMyb4 controls a hierarchical network comprised of several regulatory sub-clusters associated with cellular defense and rescue, metabolism and development. It regulates target genes either directly or indirectly through intermediary MYB, ERF, bZIP, NAC, ARF and CCAAT-HAP transcription factors. Regulatory sub-clusters have different combinations of MYB-like, GCC-box-like, ERD1-box-like, ABRE-like, G-box-like, as1/ocs/TGA-like, AuxRE-like, gibberellic acid response element (GARE)-like and JAre-like cis-elements. Cold-dependent network activity enhanced cellular antioxidant capacity through radical scavenging mechanisms and increased activities of phenylpropanoid and isoprenoid metabolic processes involving various abscisic acid (ABA), jasmonic acid (JA), salicylic acid (SA), ethylene and reactive oxygen species (ROS) responsive genes. OsMyb4 network is independent of drought response element binding protein/C-repeat binding factor (DREB/CBF) and its sub-regulons operate with possible co-regulators including nuclear factor-Y. Because of its upstream position in the network hierarchy, OsMyb4 functions quantitatively and pleiotrophically. Supra-optimal expression causes misexpression of alternative targets with costly trade-offs to panicle development.

  4. Transcription factors that defend bacteria against reactive oxygen species

    PubMed Central

    Imlay, James A.


    Bacteria live in a toxic world in which their competitors excrete hydrogen peroxide or superoxide-generating redox-cycling compounds. They protect themselves by activating regulons controlled by the OxyR, PerR, and SoxR transcription factors. OxyR and PerR sense peroxide when it oxidizes key thiolate or iron moieties, respectively; they then induce overlapping sets of proteins that defend their vulnerable metalloenzymes. An additional role for OxyR in detecting electrophilic compounds is possible. In some non-enteric bacteria SoxR appears to control the synthesis and export of redox-cycling compounds, whereas in the enteric bacteria it defends the cell against the same agents. When these compounds oxidize its iron-sulfur cluster, SoxR induces proteins that exclude, excrete, or modify them. It also induces enzymes that defend the cell against the superoxide that such compounds make. Recent work has brought new insight to the biochemistry and physiology of these responses, and comparative studies have clarified their evolutionary histories. PMID:26070785

  5. Transcription in archaea

    NASA Technical Reports Server (NTRS)

    Kyrpides, N. C.; Ouzounis, C. A.; Woese, C. R. (Principal Investigator)


    Using the sequences of all the known transcription-associated proteins from Bacteria and Eucarya (a total of 4,147), we have identified their homologous counterparts in the four complete archaeal genomes. Through extensive sequence comparisons, we establish the presence of 280 predicted transcription factors or transcription-associated proteins in the four archaeal genomes, of which 168 have homologs only in Bacteria, 51 have homologs only in Eucarya, and the remaining 61 have homologs in both phylogenetic domains. Although bacterial and eukaryotic transcription have very few factors in common, each exclusively shares a significantly greater number with the Archaea, especially the Bacteria. This last fact contrasts with the obvious close relationship between the archaeal and eukaryotic transcription mechanisms per se, and in particular, basic transcription initiation. We interpret these results to mean that the archaeal transcription system has retained more ancestral characteristics than have the transcription mechanisms in either of the other two domains.

  6. Regulons of the Pseudomonas syringae pv. tomato DC3000 iron starvation sigma factors PSPTO_0444, PSPTO_1209 and PSPTO_1286

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Pseudomonas syringae is a globally dispersed environmental bacteria that is well known for its ability to cause destructive plant diseases in agricultural and horticultural settings. The ability of bacteria to survive in diverse environments is correlated with a large number of transcription regulat...

  7. The catabolite gene activator protein (CAP) is not required for indole-3-acetic acid to activate transcription of the araBAD operon of Escherichia coli K-12.


    Ebright, R H; Beckwith, J


    Kline et al. (1980) have reported that indole-3-acetic acid (IAA) and four other indole derivatives are able to substitute for cAMP in activating expression of the ara regulon of E. coli. We have examined this phenomenon in detail, utilizing fusions between the structural gene for beta-galactosidase and the promoters for the araBAD, araE, and araFG operons. We confirm that IAA potently stimulates transcription from the araBAD promoter. The effect is highly specific to araBAD, as IAA has no, or only slight, effects on the araE and araFG operons. However, contrary to the results of Kline et al., we find that the action of IAA does not require CAP. Thus, IAA fully stimulates the transcription of araBAD in a strain which bears a complete deletion of the crp gene.

  8. SlyA Is a Transcriptional Regulator Involved in the Virulence of Enterococcus faecalis▿

    PubMed Central

    Michaux, Charlotte; Sanguinetti, Maurizio; Reffuveille, Fany; Auffray, Yanick; Posteraro, Brunella; Gilmore, Michael S.; Hartke, Axel; Giard, Jean-Christophe


    Phylogenetic analysis of the crystal structure of the Enterococcus faecalis SlyA (EF_3002) transcriptional factor places it between the SlyA and MarR regulator subfamilies. Proteins of these families are often involved in the regulation of genes important for bacterial virulence and stress response. To gather evidence for the role of this putative regulator in E. faecalis biology, we dissected the genetic organization of the slyA-EF_3001 locus and constructed a slyA deletion mutant as well as complemented strains. Interestingly, compared to the wild-type parent, the ΔslyA mutant is more virulent in an insect infection model (Galleria mellonella), exhibits increased persistence in mouse kidneys and liver, and survives better inside peritoneal macrophages. In order to identify a possible SlyA regulon, global microarray transcriptional analysis was performed. This study revealed that the slyA-EF_3001 locus appears to be autoregulated and that 117 genes were differentially regulated in the ΔslyA mutant. In the mutant strain, 111 were underexpressed and 6 overexpressed, indicating that SlyA functions mainly as an activator of transcription. PMID:21536798

  9. Physiological and Transcriptional Responses of Saccharomyces cerevisiae to Zinc Limitation in Chemostat Cultures †

    PubMed Central

    De Nicola, Raffaele; Hazelwood, Lucie A.; De Hulster, Erik A. F.; Walsh, Michael C.; Knijnenburg, Theo A.; Reinders, Marcel J. T.; Walker, Graeme M.; Pronk, Jack T.; Daran, Jean-Marc; Daran-Lapujade, Pascale


    Transcriptional responses of the yeast Saccharomyces cerevisiae to Zn availability were investigated at a fixed specific growth rate under limiting and abundant Zn concentrations in chemostat culture. To investigate the context dependency of this transcriptional response and eliminate growth rate-dependent variations in transcription, yeast was grown under several chemostat regimens, resulting in various carbon (glucose), nitrogen (ammonium), zinc, and oxygen supplies. A robust set of genes that responded consistently to Zn limitation was identified, and the set enabled the definition of the Zn-specific Zap1p regulon, comprised of 26 genes and characterized by a broader zinc-responsive element consensus (MHHAACCBYNMRGGT) than so far described. Most surprising was the Zn-dependent regulation of genes involved in storage carbohydrate metabolism. Their concerted down-regulation was physiologically relevant as revealed by a substantial decrease in glycogen and trehalose cellular content under Zn limitation. An unexpectedly large number of genes were synergistically or antagonistically regulated by oxygen and Zn availability. This combinatorial regulation suggested a more prominent involvement of Zn in mitochondrial biogenesis and function than hitherto identified. PMID:17933919

  10. DREB1/CBF transcription factors: their structure, function and role in abiotic stress tolerance in plants.


    Akhtar, M; Jaiswal, A; Taj, G; Jaiswal, J P; Qureshi, M I; Singh, N K


    Drought, high salinity and low temperature are major abiotic stresses that influence survival, productivity and geographical distribution of many important crops across the globe. Plants respond to these environmental challenges via physiological, cellular and molecular processes, which results in adjusted metabolic and structural alterations. The dehydration-responsiveelement-binding (DREB) protein / C-repeat binding factors (CBFs) belong to APETALA2 (AP2) family transcription factors that bind to DRE/CRT cis-element and regulate the expression of stress-responsive genes. DREB1/CBF genes, therefore, play an important role in increasing stress tolerance in plants and their deployment using transgenic technology seems to be a potential alternative in management of abiotic stresses in crop plants. This review is mainly focussed on the structural characteristics as well as transcriptional regulation of gene expression in response to various abiotic stresses, with particular emphasis on the role of DREB1/CBF regulon in stress-responsive gene expression. The recent progress related to genetic engineering of DREB1/CBF transcription factors in various crops and model plants is also summarized.

  11. Comparative physiological and transcriptional analysis of weak organic acid stress in Bacillus subtilis.


    Ter Beek, Alexander; Wijman, Janneke G E; Zakrzewska, Anna; Orij, Rick; Smits, Gertien J; Brul, Stanley


    The advent of 'omics' techniques bears significant potential for the assessment of the microbiological stability of foods. This requires the integration of molecular data with their implication for cellular physiology. Here we performed a comparative physiological and transcriptional analysis of Bacillus subtilis stressed with three different weak organic acids: the commonly used food preservatives sorbic- and acetic-acid, plus the well-known uncoupler carbonyl cyanide-m-chlorophenyl hydrazone (CCCP). The concentration of each compound needed to cause a similar reduction of the growth rate negatively correlated with their membrane solubility, and positively with the concentration of undissociated acid. Intracellular acidification was demonstrated by expressing a pH-sensitive GFP derivative. The largest drop in intracellular pH was observed in CCCP-stressed cells and was accompanied by the transcriptional induction of the general stress response (GSR) and SigM regulon, responses known to be induced by acidification. The GSR was induced by acetate, but not by sorbate in mildly-stressed cells. Microarray analysis further revealed that all three acids activate transcriptional programs normally seen upon nutrient limitation and cause diverse responses indicative of an adaptation of the cell envelope. Based on the responses observed and the utilized pH measurements, the inhibitory effect of sorbic acid seems to be more focused on the cell membrane than that of acetic acid or CCCP.

  12. cse15, cse60, and csk22 are new members of mother-cell-specific sporulation regulons in Bacillus subtilis.

    PubMed Central

    Henriques, A O; Bryan, E M; Beall, B W; Moran, C P


    We report on the characterization of three new transcription units expressed during sporulation in Bacillus subtilis. Two of the units, cse15 and cse60, were mapped at about 123 degrees and 62 degrees on the genetic map, respectively. Their transcription commenced around h 2 of sporulation and showed an absolute requirement for sigmaE. Maximal expression of both cse15 and cse60 further depended on the DNA-binding protein SpoIIID. Primer extension results revealed -10 and -35 sequences upstream of the cse15 and cse60 coding sequences very similar to those utilized by sigmaE-containing RNA polymerase. Alignment of these and other regulatory regions led to a revised consensus sequence for sigmaE-dependent promoters. A third transcriptional unit, designated csk22, was localized at approximately 173 degrees on the chromosome. Transcription of csk22 was activated at h 4 of sporulation, required the late mother-cell regulator sigmaK, and was repressed by the GerE protein. Sequences in the csk22 promoter region were similar to those of other sigmaK-dependent promoters. The cse60 locus was deduced to encode an acidic product of only 60 residues. A 37.6-kDa protein apparently encoded by cse15 was weakly related to the heavy chain of myosins, as well as to other myosin-like proteins, and is predicted to contain a central, 100 residue-long coiled-coil domain. Finally, csk22 is inferred to encode a 18.2-kDa hydrophobic product with five possible membrane-spanning helices, which could function as a transporter. PMID:8990290

  13. Transcriptional dysregulation of coding and non-coding genes in cellular models of Huntington's disease.


    Bithell, Angela; Johnson, Rory; Buckley, Noel J


    HD (Huntington's disease) is a late onset heritable neurodegenerative disorder that is characterized by neuronal dysfunction and death, particularly in the cerebral cortex and medium spiny neurons of the striatum. This is followed by progressive chorea, dementia and emotional dysfunction, eventually resulting in death. HD is caused by an expanded CAG repeat in the first exon of the HD gene that results in an abnormally elongated polyQ (polyglutamine) tract in its protein product, Htt (Huntingtin). Wild-type Htt is largely cytoplasmic; however, in HD, proteolytic N-terminal fragments of Htt form insoluble deposits in both the cytoplasm and nucleus, provoking the idea that mutHtt (mutant Htt) causes transcriptional dysfunction. While a number of specific transcription factors and co-factors have been proposed as mediators of mutHtt toxicity, the causal relationship between these Htt/transcription factor interactions and HD pathology remains unknown. Previous work has highlighted REST [RE1 (repressor element 1)-silencing transcription factor] as one such transcription factor. REST is a master regulator of neuronal genes, repressing their expression. Many of its direct target genes are known or suspected to have a role in HD pathogenesis, including BDNF (brain-derived neurotrophic factor). Recent evidence has also shown that REST regulates transcription of regulatory miRNAs (microRNAs), many of which are known to regulate neuronal gene expression and are dysregulated in HD. Thus repression of miRNAs constitutes a second, indirect mechanism by which REST can alter the neuronal transcriptome in HD. We will describe the evidence that disruption to the REST regulon brought about by a loss of interaction between REST and mutHtt may be a key contributory factor in the widespread dysregulation of gene expression in HD.

  14. Transcription Regulation in Archaea

    PubMed Central

    Gehring, Alexandra M.; Walker, Julie E.


    The known diversity of metabolic strategies and physiological adaptations of archaeal species to extreme environments is extraordinary. Accurate and responsive mechanisms to ensure that gene expression patterns match the needs of the cell necessitate regulatory strategies that control the activities and output of the archaeal transcription apparatus. Archaea are reliant on a single RNA polymerase for all transcription, and many of the known regulatory mechanisms employed for archaeal transcription mimic strategies also employed for eukaryotic and bacterial species. Novel mechanisms of transcription regulation have become apparent by increasingly sophisticated in vivo and in vitro investigations of archaeal species. This review emphasizes recent progress in understanding archaeal transcription regulatory mechanisms and highlights insights gained from studies of the influence of archaeal chromatin on transcription. PMID:27137495

  15. Genome-scale co-expression network comparison across Escherichia coli and Salmonella enterica serovar Typhimurium reveals significant conservation at the regulon level of local regulators despite their dissimilar lifestyles.


    Zarrineh, Peyman; Sánchez-Rodríguez, Aminael; Hosseinkhan, Nazanin; Narimani, Zahra; Marchal, Kathleen; Masoudi-Nejad, Ali


    Availability of genome-wide gene expression datasets provides the opportunity to study gene expression across different organisms under a plethora of experimental conditions. In our previous work, we developed an algorithm called COMODO (COnserved MODules across Organisms) that identifies conserved expression modules between two species. In the present study, we expanded COMODO to detect the co-expression conservation across three organisms by adapting the statistics behind it. We applied COMODO to study expression conservation/divergence between Escherichia coli, Salmonella enterica, and Bacillus subtilis. We observed that some parts of the regulatory interaction networks were conserved between E. coli and S. enterica especially in the regulon of local regulators. However, such conservation was not observed between the regulatory interaction networks of B. subtilis and the two other species. We found co-expression conservation on a number of genes involved in quorum sensing, but almost no conservation for genes involved in pathogenicity across E. coli and S. enterica which could partially explain their different lifestyles. We concluded that despite their different lifestyles, no significant rewiring have occurred at the level of local regulons involved for instance, and notable conservation can be detected in signaling pathways and stress sensing in the phylogenetically close species S. enterica and E. coli. Moreover, conservation of local regulons seems to depend on the evolutionary time of divergence across species disappearing at larger distances as shown by the comparison with B. subtilis. Global regulons follow a different trend and show major rewiring even at the limited evolutionary distance that separates E. coli and S. enterica.

  16. Genome-Scale Co-Expression Network Comparison across Escherichia coli and Salmonella enterica Serovar Typhimurium Reveals Significant Conservation at the Regulon Level of Local Regulators Despite Their Dissimilar Lifestyles

    PubMed Central

    Zarrineh, Peyman; Sánchez-Rodríguez, Aminael; Hosseinkhan, Nazanin; Narimani, Zahra; Marchal, Kathleen; Masoudi-Nejad, Ali


    Availability of genome-wide gene expression datasets provides the opportunity to study gene expression across different organisms under a plethora of experimental conditions. In our previous work, we developed an algorithm called COMODO (COnserved MODules across Organisms) that identifies conserved expression modules between two species. In the present study, we expanded COMODO to detect the co-expression conservation across three organisms by adapting the statistics behind it. We applied COMODO to study expression conservation/divergence between Escherichia coli, Salmonella enterica, and Bacillus subtilis. We observed that some parts of the regulatory interaction networks were conserved between E. coli and S. enterica especially in the regulon of local regulators. However, such conservation was not observed between the regulatory interaction networks of B. subtilis and the two other species. We found co-expression conservation on a number of genes involved in quorum sensing, but almost no conservation for genes involved in pathogenicity across E. coli and S. enterica which could partially explain their different lifestyles. We concluded that despite their different lifestyles, no significant rewiring have occurred at the level of local regulons involved for instance, and notable conservation can be detected in signaling pathways and stress sensing in the phylogenetically close species S. enterica and E. coli. Moreover, conservation of local regulons seems to depend on the evolutionary time of divergence across species disappearing at larger distances as shown by the comparison with B. subtilis. Global regulons follow a different trend and show major rewiring even at the limited evolutionary distance that separates E. coli and S. enterica. PMID:25101984

  17. The TyrR Transcription Factor Regulates the Divergent akr-ipdC Operons of Enterobacter cloacae UW5

    PubMed Central

    Coulson, Thomas J. D.; Patten, Cheryl L.


    The TyrR transcription factor regulates genes involved in the uptake and biosynthesis of aromatic amino acids in Enterobacteriaceae. Genes may be positively or negatively regulated depending on the presence or absence of each aromatic amino acid, all three of which function as cofactors for TyrR. In this report we detail the transcriptional control of two divergently transcribed genes, akr and ipdC, by TyrR, elucidated by promoter fusion expression assays and electrophoretic mobility shift assays to assess protein-DNA interactions. Expression of both genes was shown to be controlled by TyrR via interactions with two TyrR boxes located within the akr-ipdC intergenic region. Expression of ipdC required TyrR bound to the proximal strong box, and is strongly induced by phenylalanine, and to a lesser extent by tryptophan and tyrosine. Down-regulation of akr was reliant on interactions with the weak box, and may also require a second, as yet unidentified protein for further repression. Tyrosine enhanced repression of akr. Electrophoretic mobility shift assays demonstrated that TyrR interacts with both the strong and weak boxes, and that binding of the weak box in vitro requires an intact adjacent strong box. While the strong box shows a high degree of conservation with the TyrR binding site consensus sequence, the weak box has atypical spacing of the two half sites comprising the palindromic arms. Site-directed mutagenesis demonstrated sequence-specific interaction between TyrR and the weak box. This is the first report of TyrR-controlled expression of two divergent protein-coding genes, transcribed from independent promoters. Moreover, the identification of a predicted aldo-keto reductase as a member of the TyrR regulon further extends the function of the TyrR regulon. PMID:25811953

  18. A generic approach to identify Transcription Factor-specific operator motifs; Inferences for LacI-family mediated regulation in Lactobacillus plantarum WCFS1

    PubMed Central

    Francke, Christof; Kerkhoven, Robert; Wels, Michiel; Siezen, Roland J


    Background A key problem in the sequence-based reconstruction of regulatory networks in bacteria is the lack of specificity in operator predictions. The problem is especially prominent in the identification of transcription factor (TF) specific binding sites. More in particular, homologous TFs are abundant and, as they are structurally very similar, it proves difficult to distinguish the related operators by automated means. This also holds for the LacI-family, a family of TFs that is well-studied and has many members that fulfill crucial roles in the control of carbohydrate catabolism in bacteria including catabolite repression. To overcome the specificity problem, a comprehensive footprinting approach was formulated to identify TF-specific operator motifs and was applied to the LacI-family of TFs in the model gram positive organism, Lactobacillus plantarum WCFS1. The main premise behind the approach is that only orthologous sequences that share orthologous genomic context will share equivalent regulatory sites. Results When the approach was applied to the 12 LacI-family TFs of the model species, a specific operator motif was identified for each of them. With the TF-specific operator motifs, potential binding sites were found on the genome and putative minimal regulons could be defined. Moreover, specific inducers could in most cases be linked to the TFs through phylogeny, thereby unveiling the biological role of these regulons. The operator predictions indicated that the LacI-family TFs can be separated into two subfamilies with clearly distinct operator motifs. They also established that the operator related to the 'global' regulator CcpA is not inherently distinct from that of other LacI-family members, only more degenerate. Analysis of the chromosomal position of the identified putative binding sites confirmed that the LacI-family TFs are mostly auto-regulatory and relate mainly to carbohydrate uptake and catabolism. Conclusion Our approach to identify

  19. The yeast Aft2 transcription factor determines selenite toxicity by controlling the low affinity phosphate transport system

    PubMed Central

    Pérez-Sampietro, María; Serra-Cardona, Albert; Canadell, David; Casas, Celia; Ariño, Joaquín; Herrero, Enrique


    The yeast Saccharomyces cerevisiae is employed as a model to study the cellular mechanisms of toxicity and defense against selenite, the most frequent environmental selenium form. We show that yeast cells lacking Aft2, a transcription factor that together with Aft1 regulates iron homeostasis, are highly sensitive to selenite but, in contrast to aft1 mutants, this is not rescued by iron supplementation. The absence of Aft2 strongly potentiates the transcriptional responses to selenite, particularly for DNA damage- and oxidative stress-responsive genes, and results in intracellular hyperaccumulation of selenium. Overexpression of PHO4, the transcriptional activator of the PHO regulon under low phosphate conditions, partially reverses sensitivity and hyperaccumulation of selenite in a way that requires the presence of Spl2, a Pho4-controlled protein responsible for post-transcriptional downregulation of the low-affinity phosphate transporters Pho87 and Pho90. SPL2 expression is strongly downregulated in aft2 cells, especially upon selenite treatment. Selenite hypersensitivity of aft2 cells is fully rescued by deletion of PHO90, suggesting a major role for Pho90 in selenite uptake. We propose that the absence of Aft2 leads to enhanced Pho90 function, involving both Spl2-dependent and independent events and resulting in selenite hyperaccumulation and toxicity. PMID:27618952

  20. SigmoID: a user-friendly tool for improving bacterial genome annotation through analysis of transcription control signals

    PubMed Central

    Damienikan, Aliaksandr U.


    The majority of bacterial genome annotations are currently automated and based on a ‘gene by gene’ approach. Regulatory signals and operon structures are rarely taken into account which often results in incomplete and even incorrect gene function assignments. Here we present SigmoID, a cross-platform (OS X, Linux and Windows) open-source application aiming at simplifying the identification of transcription regulatory sites (promoters, transcription factor binding sites and terminators) in bacterial genomes and providing assistance in correcting annotations in accordance with regulatory information. SigmoID combines a user-friendly graphical interface to well known command line tools with a genome browser for visualising regulatory elements in genomic context. Integrated access to online databases with regulatory information (RegPrecise and RegulonDB) and web-based search engines speeds up genome analysis and simplifies correction of genome annotation. We demonstrate some features of SigmoID by constructing a series of regulatory protein binding site profiles for two groups of bacteria: Soft Rot Enterobacteriaceae (Pectobacterium and Dickeya spp.) and Pseudomonas spp. Furthermore, we inferred over 900 transcription factor binding sites and alternative sigma factor promoters in the annotated genome of Pectobacterium atrosepticum. These regulatory signals control putative transcription units covering about 40% of the P. atrosepticum chromosome. Reviewing the annotation in cases where it didn’t fit with regulatory information allowed us to correct product and gene names for over 300 loci. PMID:27257541

  1. SigmoID: a user-friendly tool for improving bacterial genome annotation through analysis of transcription control signals.


    Nikolaichik, Yevgeny; Damienikan, Aliaksandr U


    The majority of bacterial genome annotations are currently automated and based on a 'gene by gene' approach. Regulatory signals and operon structures are rarely taken into account which often results in incomplete and even incorrect gene function assignments. Here we present SigmoID, a cross-platform (OS X, Linux and Windows) open-source application aiming at simplifying the identification of transcription regulatory sites (promoters, transcription factor binding sites and terminators) in bacterial genomes and providing assistance in correcting annotations in accordance with regulatory information. SigmoID combines a user-friendly graphical interface to well known command line tools with a genome browser for visualising regulatory elements in genomic context. Integrated access to online databases with regulatory information (RegPrecise and RegulonDB) and web-based search engines speeds up genome analysis and simplifies correction of genome annotation. We demonstrate some features of SigmoID by constructing a series of regulatory protein binding site profiles for two groups of bacteria: Soft Rot Enterobacteriaceae (Pectobacterium and Dickeya spp.) and Pseudomonas spp. Furthermore, we inferred over 900 transcription factor binding sites and alternative sigma factor promoters in the annotated genome of Pectobacterium atrosepticum. These regulatory signals control putative transcription units covering about 40% of the P. atrosepticum chromosome. Reviewing the annotation in cases where it didn't fit with regulatory information allowed us to correct product and gene names for over 300 loci.

  2. Deciphering Transcriptional Regulatory Mechanisms Associated with Hemicellulose Degradation in Neurospora crassa

    PubMed Central

    Sun, Jianping; Tian, Chaoguang; Diamond, Spencer


    Hemicellulose, the second most abundant plant biomass fraction after cellulose, is widely viewed as a potential substrate for the production of liquid fuels and other value-added materials. Degradation of hemicellulose by filamentous fungi requires production of many different enzymes, which are induced by biopolymers or its derivatives and regulated mainly at the transcriptional level through transcription factors (TFs). Neurospora crassa, a model filamentous fungus, expresses and secretes enzymes required for plant cell wall deconstruction. To better understand genes specifically associated with degradation of hemicellulose, we applied secretome and transcriptome analysis to N. crassa grown on beechwood xylan. We identified 34 secreted proteins and 353 genes with elevated transcription on xylan. The xylanolytic phenotype of strains with deletions in genes identified from the secretome and transcriptome analysis of the wild type was assessed, revealing functions for known and unknown proteins associated with hemicellulose degradation. By evaluating phenotypes of strains containing deletions of predicted TF genes in N. crassa, we identified a TF (XLR-1; xylan degradation regulator 1) essential for hemicellulose degradation that is an ortholog to XlnR/XYR1 in Aspergillus and Trichoderma species, respectively, a major transcriptional regulator of genes encoding both cellulases and hemicellulases. Deletion of xlr-1 in N. crassa abolished growth on xylan and xylose, but growth on cellulose and cellulolytic activity were only slightly affected. To determine the regulatory mechanisms for hemicellulose degradation, we explored the transcriptional regulon of XLR-1 under xylose, xylanolytic, and cellulolytic conditions. XLR-1 regulated only some predicted hemicellulase genes in N. crassa and was required for a full induction of several cellulase genes. Hemicellulase gene expression was induced by a combination of release from carbon catabolite repression (CCR) and induction

  3. Comprehensive mapping of the Helicobacter pylori NikR regulon provides new insights in bacterial nickel responses

    PubMed Central

    Vannini, Andrea; Pinatel, Eva; Costantini, Paolo Emidio; Pelliciari, Simone; Roncarati, Davide; Puccio, Simone; De Bellis, Gianluca; Peano, Clelia; Danielli, Alberto


    Nickel homeostasis is important for pathogenic and ureolytic bacteria, which use this metal ion as enzymatic cofactor. For example, in the human pathogen Helicobacter pylori an optimal balance between nickel uptake and incorporation in metallo-enzymes is fundamental for colonization of the host. Nickel is also used as cofactor to modulate DNA binding of the NikR regulator, which controls transcription of genes involved in nickel trafficking or infection in many bacteria. Accordingly, there is much interest in a systematic characterization of NikR regulation. Herein we use H. pylori as a model to integrate RNA-seq and ChIP-seq data demonstrating that NikR not only regulates metal-ion transporters but also virulence factors, non-coding RNAs, as well as toxin-antitoxin systems in response to nickel stimulation. Altogether, results provide new insights into the pathobiology of H. pylori and contribute to understand the responses to nickel in other bacteria. PMID:28393877

  4. Betulin inhibits virulence and biofilm of Streptococcus pyogenes by suppressing ropB core regulon, sagA and dltA.


    Viszwapriya, Dharmaprakash; Subramenium, Ganapathy Ashwinkumar; Prithika, Udayakumar; Balamurugan, Krishnaswamy; Pandian, Shunmugiah Karutha


    The present study demonstrates the antivirulence potential of betulin, an abundantly available triterpenoid against Streptococcus pyogenes, a multivirulent and exclusive human pathogen. Crystal violet assay and microscopic examination revealed that betulin (100 μg mL(-1)) exhibits surface-independent antibiofilm activity and mitigates extracellular polymeric substance production. Betulin treatment enhanced the rate of auto-aggregation in liquid medium. Results of real-time PCR and biochemical assays demonstrated that betulin suppresses the expression of ropB core regulon, sagA and dltA, which correspondingly affects SpeB production, hemolysis and cell surface hydrophobicity for the observed impairment in virulence and biofilm formation. dltA downregulation also affected the production of M protein, making betulin-treated cells more susceptible to phagocytosis. The non-toxic nature of betulin and its antivirulence potential against S. pyogenes were manifested in vivo in Caenorhabditis elegans This study reveals the prospective role of betulin as therapeutic agent for the prevention and treatment of streptococcal infections.

  5. PtrBAM1, a β-amylase-coding gene of Poncirus trifoliata, is a CBF regulon member with function in cold tolerance by modulating soluble sugar levels.


    Peng, Ting; Zhu, Xiaofang; Duan, Nian; Liu, Ji-Hong


    β-Amylase (BAM) catalyses starch breakdown to generate maltose, which can be incorporated into sugar metabolism. However, the role of BAM genes in cold tolerance is less characterized. In this study, we report the isolation and functional characterization of a chloroplast-localizing BAM-encoding gene PtrBAM1 from Poncirus trifoliata. PtrBAM1 was induced by cold, dehydration and salt, but repressed by maltose. Overexpression of PtrBAM1 in tobacco (Nicotiana nudicaulis) increased BAM activity, promoted starch degradation and enhanced the contents of maltose and soluble sugars, whereas opposite changes were observed when PtrBAM1 homolog in lemon (Citrus lemon) was knocked down. The tobacco overexpressing lines exhibited enhanced tolerance to cold at chilling or freezing temperatures. Under cold stress, higher BAM activity and greater accumulation of maltose and soluble sugars were observed in the overexpressing lines when compared with the wild-type or empty vector transformants. Bioinformatics analysis demonstrated that PtrBAM1 promoter contained a CBF-recognizing element. Yeast one-hybrid assay demonstrated that PtrCBF could interact with the promoter fragment containing the element. Taken together, these results demonstrate that PtrBAM1 is a member of CBF regulon and plays an important role in cold tolerance by modulating the levels of soluble sugars acting as osmolytes or antioxidants.

  6. Malaria parasites possess a telomere repeat-binding protein that shares ancestry with transcription factor IIIA.


    Bertschi, Nicole L; Toenhake, Christa G; Zou, Angela; Niederwieser, Igor; Henderson, Rob; Moes, Suzette; Jenoe, Paul; Parkinson, John; Bartfai, Richard; Voss, Till S


    Telomere repeat-binding factors (TRFs) are essential components of the molecular machinery that regulates telomere function. TRFs are widely conserved across eukaryotes and bind duplex telomere repeats via a characteristic MYB-type domain. Here, we identified the telomere repeat-binding protein PfTRZ in the malaria parasite Plasmodium falciparum, a member of the Alveolate phylum for which TRFs have not been described so far. PfTRZ lacks an MYB domain and binds telomere repeats via a C2H2-type zinc finger domain instead. In vivo, PfTRZ binds with high specificity to the telomeric tract and to interstitial telomere repeats upstream of subtelomeric virulence genes. Conditional depletion experiments revealed that PfTRZ regulates telomere length homeostasis and is required for efficient cell cycle progression. Intriguingly, we found that PfTRZ also binds to and regulates the expression of 5S rDNA genes. Combined with detailed phylogenetic analyses, our findings identified PfTRZ as a remote functional homologue of the basic transcription factor TFIIIA, which acquired a new function in telomere maintenance early in the apicomplexan lineage. Our work sheds unexpected new light on the evolution of telomere repeat-binding proteins and paves the way for dissecting the presumably divergent mechanisms regulating telomere functionality in one of the most deadly human pathogens.

  7. FlrA, a sigma54-dependent transcriptional activator in Vibrio fischeri, is required for motility and symbiotic light-organ colonization.


    Millikan, Deborah S; Ruby, Edward G


    Flagellum-mediated motility of Vibrio fischeri is an essential factor in the bacterium's ability to colonize its host, the Hawaiian squid Euprymna scolopes. To begin characterizing the nature of the flagellar regulon, we have cloned a gene, designated flrA, from V. fischeri that encodes a putative sigma(54)-dependent transcriptional activator. Genetic arrangement of the flrA locus in V. fischeri is similar to motility master-regulator operons of Vibrio cholerae and Vibrio parahaemolyticus. In addition, examination of regulatory regions of a number of flagellar operons in V. fischeri revealed apparent sigma(54) recognition motifs, suggesting that the flagellar regulatory hierarchy is controlled by a similar mechanism to that described in V. cholerae. However, in contrast to its closest known relatives, flrA mutant strains of V. fischeri ES114 were completely abolished in swimming capability. Although flrA provided in trans restored motility to the flrA mutant, the complemented strain was unable to reach wild-type levels of symbiotic colonization in juvenile squid, suggesting a possible role for the proper expression of FlrA in regulating symbiotic colonization factors in addition to those required for motility. Comparative RNA arbitrarily primed PCR analysis of the flrA mutant and its wild-type parent revealed several differentially expressed transcripts. These results define a regulon that includes both flagellar structural genes and other genes apparently not involved in flagellum elaboration or function. Thus, the transcriptional activator FlrA plays an essential role in regulating motility, and apparently in modulating other symbiotic functions, in V. fischeri.

  8. A dual-signal regulatory circuit activates transcription of a set of divergent operons in Salmonella typhimurium

    PubMed Central

    Zhao, Guang; Weatherspoon, Natasha; Kong, Wei; Curtiss, Roy; Shi, Yixin


    We present a molecular mechanism for signal transduction that activates transcription of the SlyA regulon in Salmonella typhimurium. We demonstrate that SlyA mediates transcriptional activation in response to guanosine tetraphosphate, ppGpp, according to the following observations: (i) in vivo transcription of SlyA-dependent genes is repressed when ppGpp is absent; this transcription can be restored by overproducing SlyA; (ii) in vivo dimerization and binding of SlyA to the target promoter are facilitated in the presence of ppGpp; and (iii) in vitro SlyA binding to the target promoter is enhanced when ppGpp is supplemented. Thus, ppGpp must be the cytoplasmic component that stimulates SlyA regulatory function by interacting directly with this regulator in Salmonella. This signaling domain, integrated by the PhoP/PhoQ 2-component system that activates slyA transcription by sensing Mg2+, forms feedforward loops that regulate chromosomal loci identified through a motif search over the S. typhimurium genome. Many such loci are divergent operons, each formed by 2 neighboring genes in which transcription of these 2 loci proceeds in opposite directions. Both genes, however, are controlled by PhoP and SlyA through a single shared PhoP box and SlyA box present in their intergenic regions. A substitution in either box sequence causes a simultaneous cessation of transcription of a divergent operon, pagD-pagC, equivalent to the phenotype in a phoP or slyA mutant. We also identified several chromosomal loci that possess pagC-type genes without the cognate pagD-type genes. Therefore, our results provide a molecular basis for the understanding of SlyA-dependent phenotypes associated with Salmonella virulence. PMID:19091955

  9. Global Transcriptional Responses of the Toxic Cyanobacterium, Microcystis aeruginosa, to Nitrogen Stress, Phosphorus Stress, and Growth on Organic Matter

    PubMed Central

    Harke, Matthew J.; Gobler, Christopher J.


    Whole transcriptome shotgun sequencing (RNA-seq) was used to assess the transcriptomic response of the toxic cyanobacterium Microcystis aeruginosa during growth with low levels of dissolved inorganic nitrogen (low N), low levels of dissolved inorganic phosphorus (low P), and in the presence of high levels of high molecular weight dissolved organic matter (HMWDOM). Under low N, one third of the genome was differentially expressed, with significant increases in transcripts observed among genes within the nir operon, urea transport genes (urtBCDE), and amino acid transporters while significant decreases in transcripts were observed in genes related to photosynthesis. There was also a significant decrease in the transcription of the microcystin synthetase gene set under low N and a significant decrease in microcystin content per Microcystis cell demonstrating that N supply influences cellular toxicity. Under low P, 27% of the genome was differentially expressed. The Pho regulon was induced leading to large increases in transcript levels of the alkaline phosphatase phoX, the Pst transport system (pstABC), and the sphX gene, and transcripts of multiple sulfate transporter were also significantly more abundant. While the transcriptional response to growth on HMWDOM was smaller (5–22% of genes differentially expressed), transcripts of multiple genes specifically associated with the transport and degradation of organic compounds were significantly more abundant within HMWDOM treatments and thus may be recruited by Microcystis to utilize these substrates. Collectively, these findings provide a comprehensive understanding of the nutritional physiology of this toxic, bloom-forming cyanobacterium and the role of N in controlling microcystin synthesis. PMID:23894552

  10. Infection by Toxoplasma gondii Specifically Induces Host c-Myc and the Genes This Pivotal Transcription Factor Regulates

    PubMed Central

    Franco, Magdalena; Shastri, Anjali J.


    Toxoplasma gondii infection has previously been described to cause dramatic changes in the host transcriptome by manipulating key regulators, including STATs, NF-κB, and microRNAs. Here, we report that Toxoplasma tachyzoites also mediate rapid and sustained induction of another pivotal regulator of host cell transcription, c-Myc. This induction is seen in cells infected with all three canonical types of Toxoplasma but not the closely related apicomplexan parasite Neospora caninum. Coinfection of cells with both Toxoplasma and Neospora still results in an increase in the level of host c-Myc, showing that c-Myc is actively upregulated by Toxoplasma infection (rather than repressed by Neospora). We further demonstrate that this upregulation may be mediated through c-Jun N-terminal protein kinase (JNK) and is unlikely to be a nonspecific host response, as heat-killed Toxoplasma parasites do not induce this increase and neither do nonviable parasites inside the host cell. Finally, we show that the induced c-Myc is active and that transcripts dependent on its function are upregulated, as predicted. Hence, c-Myc represents an additional way in which Toxoplasma tachyzoites have evolved to specifically alter host cell functions during intracellular growth. PMID:24532536

  11. Infection by Toxoplasma gondii specifically induces host c-Myc and the genes this pivotal transcription factor regulates.


    Franco, Magdalena; Shastri, Anjali J; Boothroyd, John C


    Toxoplasma gondii infection has previously been described to cause dramatic changes in the host transcriptome by manipulating key regulators, including STATs, NF-κB, and microRNAs. Here, we report that Toxoplasma tachyzoites also mediate rapid and sustained induction of another pivotal regulator of host cell transcription, c-Myc. This induction is seen in cells infected with all three canonical types of Toxoplasma but not the closely related apicomplexan parasite Neospora caninum. Coinfection of cells with both Toxoplasma and Neospora still results in an increase in the level of host c-Myc, showing that c-Myc is actively upregulated by Toxoplasma infection (rather than repressed by Neospora). We further demonstrate that this upregulation may be mediated through c-Jun N-terminal protein kinase (JNK) and is unlikely to be a nonspecific host response, as heat-killed Toxoplasma parasites do not induce this increase and neither do nonviable parasites inside the host cell. Finally, we show that the induced c-Myc is active and that transcripts dependent on its function are upregulated, as predicted. Hence, c-Myc represents an additional way in which Toxoplasma tachyzoites have evolved to specifically alter host cell functions during intracellular growth.

  12. The Program of Gene Transcription for a Single Differentiating Cell Type during Sporulation in Bacillus subtilis

    PubMed Central

    Eichenberger, Patrick; Fujita, Masaya; Jensen, Shane T; Conlon, Erin M; Rudner, David Z; Wang, Stephanie T; Ferguson, Caitlin; Haga, Koki; Sato, Tsutomu; Liu, Jun S


    Asymmetric division during sporulation by Bacillus subtilis generates a mother cell that undergoes a 5-h program of differentiation. The program is governed by a hierarchical cascade consisting of the transcription factors: σE, σK, GerE, GerR, and SpoIIID. The program consists of the activation and repression of 383 genes. The σE factor turns on 262 genes, including those for GerR and SpoIIID. These DNA-binding proteins downregulate almost half of the genes in the σE regulon. In addition, SpoIIID turns on ten genes, including genes involved in the appearance of σK . Next, σK activates 75 additional genes, including that for GerE. This DNA-binding protein, in turn, represses half of the genes that had been activated by σK while switching on a final set of 36 genes. Evidence is presented that repression and activation contribute to proper morphogenesis. The program of gene expression is driven forward by its hierarchical organization and by the repressive effects of the DNA-binding proteins. The logic of the program is that of a linked series of feed-forward loops, which generate successive pulses of gene transcription. Similar regulatory circuits could be a common feature of other systems of cellular differentiation. PMID:15383836

  13. FOS-1 functions as a transcriptional activator downstream of the C. elegans JNK homolog KGB-1.


    Zhang, Zhe; Liu, Limeng; Twumasi-Boateng, Kwame; Block, Dena H S; Shapira, Michael


    JNK proteins are conserved stress-activated MAP kinases. In C. elegans, the JNK-homolog KGB-1 plays essential roles in protection from heavy metals and protein folding stress. However, the contributions of KGB-1 are age-dependent, providing protection in larvae, but reducing stress resistance and shortening lifespan in adults. Attenuation of DAF-16 was linked to the detrimental contributions of KGB-1 in adults, but its involvement in KGB-1-dependent protection in larvae remains unclear. To characterize age-dependent contributions of KGB-1, we used microarray analysis to measure gene expression following KGB-1 activation either in developing larvae or in adults, achieved by knocking down its negative phosphatase regulator vhp-1. This revealed a robust KGB-1 regulon, most of which consisting of genes induced following KGB-1 activation regardless of age; a smaller number of genes was regulated in an age-dependent manner. We found that the bZIP transcription factor FOS-1 was essential for age-invariant KGB-1-dependent gene induction, but not for age-dependent expression. The latter was more affected by DAF-16, which was further found to be required for KGB-1-dependent cadmium resistance in larvae. Our results identify FOS-1 as a transcriptional activator mediating age-invariant contributions of KGB-1, including a regulatory loop of KGB-1 signaling, but also stress the importance of DAF-16 as a mediator of age-dependent contributions.

  14. The RclR protein is a reactive chlorine-specific transcription factor in Escherichia coli.


    Parker, Benjamin W; Schwessinger, Emily A; Jakob, Ursula; Gray, Michael J


    Reactive chlorine species (RCS) such as hypochlorous acid are powerful antimicrobial oxidants. Used extensively for disinfection in household and industrial settings (i.e. as bleach), RCS are also naturally generated in high quantities during the innate immune response. Bacterial responses to RCS are complex and differ substantially from the well characterized responses to other physiologically relevant oxidants, like peroxide or superoxide. Several RCS-sensitive transcription factors have been identified in bacteria, but most of them respond to multiple stressors whose damaging effects overlap with those of RCS, including reactive oxygen species and electrophiles. We have now used in vivo genetic and in vitro biochemical methods to identify and demonstrate that Escherichia coli RclR (formerly YkgD) is a redox-regulated transcriptional activator of the AraC family, whose highly conserved cysteine residues are specifically sensitive to oxidation by RCS. Oxidation of these cysteines leads to strong, highly specific activation of expression of genes required for survival of RCS stress. These results demonstrate the existence of a widely conserved bacterial regulon devoted specifically to RCS resistance.

  15. Functional diversification of ROK-family transcriptional regulators of sugar catabolism in the Thermotogae phylum

    PubMed Central

    Kazanov, Marat D.; Li, Xiaoqing; Gelfand, Mikhail S.; Osterman, Andrei L.; Rodionov, Dmitry A.


    Large and functionally heterogeneous families of transcription factors have complex evolutionary histories. What shapes specificities toward effectors and DNA sites in paralogous regulators is a fundamental question in biology. Bacteria from the deep-branching lineage Thermotogae possess multiple paralogs of the repressor, open reading frame, kinase (ROK) family regulators that are characterized by carbohydrate-sensing domains shared with sugar kinases. We applied an integrated genomic approach to study functions and specificities of regulators from this family. A comparative analysis of 11 Thermotogae genomes revealed novel mechanisms of transcriptional regulation of the sugar utilization networks, DNA-binding motifs and specific functions. Reconstructed regulons for seven groups of ROK regulators were validated by DNA-binding assays using purified recombinant proteins from the model bacterium Thermotoga maritima. All tested regulators demonstrated specific binding to their predicted cognate DNA sites, and this binding was inhibited by specific effectors, mono- or disaccharides from their respective sugar catabolic pathways. By comparing ligand-binding domains of regulators with structurally characterized kinases from the ROK family, we elucidated signature amino acid residues determining sugar-ligand regulator specificity. Observed correlations between signature residues and the sugar-ligand specificities provide the framework for structure functional classification of the entire ROK family. PMID:23209028

  16. ASTP Onboard Voice Transcription

    NASA Technical Reports Server (NTRS)


    The transcription is presented of the Apollo-Soyuz Test Project voice communications as recorded on the command module data storage equipment. Data from this recorder are telemetered (dumped) to Space Tracking and Data Network sites for retransmission to the Johnson Space Center. The transcript is divided into three columns -- time, speaker, and text. The Greenwich mean time column consists of three two-digit numbers representing hours, minutes, and seconds (e.g., 22 34 14) for the Julian dates shown at the top of the page on which a new day begins. The speaker column indicates the source of a transmission; the text column contains the verbatim transcript of the communications.

  17. DNA supercoiling during transcription

    PubMed Central

    Ma, Jie; Wang, Michelle D.


    The twin-supercoiled-domain model describes how transcription can drive DNA supercoiling, and how DNA supercoiling, in turn plays an important role in regulating gene transcription. In vivo and in vitro experiments have disclosed many details of the complex interactions in this relationship, and recently new insights have been gained with the help of genome-wide DNA supercoiling mapping techniques and single molecule methods. This review summarizes the general mechanisms of the interplay between DNA supercoiling and transcription, considers the biological implications, and focuses on recent important discoveries and technical advances in this field. We highlight the significant impact of DNA supercoiling in transcription, but also more broadly in all processes operating on DNA.

  18. Discovery of a diverse clade of gregarine apicomplexans (Apicomplexa: Eugregarinorida) from Pacific eunicid and onuphid polychaetes, including descriptions of Paralecudina n. gen., Trichotokara japonica n. sp., and T. eunicae n. sp.


    Rueckert, Sonja; Wakeman, Kevin C; Leander, Brian S


    Marine gregarines are poorly understood apicomplexan parasites with large trophozoites that inhabit the body cavities of marine invertebrates. Two novel species of gregarines were discovered in polychaete hosts collected in Canada and Japan. The trophozoites of Trichotokara japonica n. sp. were oval to rhomboidal shaped, and covered with longitudinal epicytic folds with a density of six to eight folds/micron. The nucleus was situated in the middle of the cell, and the mucron was elongated and covered with hair-like projections; antler-like projections also extended from the anterior tip of the mucron. The distinctively large trophozoites of Trichotokara eunicae n. sp. lacked an elongated mucron and had a tadpole-like cell shape consisting of a bulbous anterior region and a tapered tail-like posterior region. The cell surface was covered with longitudinal epicytic folds with a density of three to five folds/micron. Small subunit (SSU) rDNA sequences of both species were very divergent and formed a strongly supported clade with the recently described species Trichotokara nothriae and an environmental sequence (AB275074). This phylogenetic context combined with the morphological features of T. eunicae n. sp. required us to amend the description for Trichotokara. The sister clade to the Trichotokara clade consisted of environmental sequences and Lecudina polymorpha, which also possesses densely packed epicyctic folds (3-5 folds/micron) and a prominently elongated mucron. This improved morphological and molecular phylogenetic context justified the establishment of Paralecudina (ex. Lecudina) polymorpha n. gen. et comb.

  19. Transcription and cancer.

    PubMed Central

    Cox, P. M.; Goding, C. R.


    The normal growth, development and function of an organism requires precise and co-ordinated control of gene expression. A major part of this control is exerted by regulating messenger RNA (mRNA) production and involves complex interactions between an array of transcriptionally active proteins and specific regulatory DNA sequences. The combination of such proteins and DNA sequences is specific for given gene or group of genes in a particular cell type and the proteins regulating the same gene may vary between cell types. In addition the expression or activity of these regulatory proteins may be modified depending on the state of differentiation of a cell or in response to an external stimulus. Thus, the differentiation of embryonic cells into diverse tissues is achieved and the mature structure and function of the organism is maintained. This review focusses on the role of perturbations of these transcriptional controls in neoplasia. Deregulation of transcription may result in the failure to express genes responsible for cellular differentiation, or alternatively, in the transcription of genes involved in cell division, through the inappropriate expression or activation of positively acting transcription factors and nuclear oncogenes. Whether the biochemical abnormalities that lead to the disordered growth and differentiation of a malignant tumour affect cell surface receptors, membrane or cytoplasmic signalling proteins or nuclear transcription factors, the end result is the inappropriate expression of some genes and failure to express others. Current research is starting to elucidate which of the elements of this complicated system are important in neoplasia. PMID:1645561

  20. Robust optimization for nonlinear time-delay dynamical system of dha regulon with cost sensitivity constraint in batch culture

    NASA Astrophysics Data System (ADS)

    Yuan, Jinlong; Zhang, Xu; Liu, Chongyang; Chang, Liang; Xie, Jun; Feng, Enmin; Yin, Hongchao; Xiu, Zhilong


    Time-delay dynamical systems, which depend on both the current state of the system and the state at delayed times, have been an active area of research in many real-world applications. In this paper, we consider a nonlinear time-delay dynamical system of dha-regulonwith unknown time-delays in batch culture of glycerol bioconversion to 1,3-propanediol induced by Klebsiella pneumonia. Some important properties and strong positive invariance are discussed. Because of the difficulty in accurately measuring the concentrations of intracellular substances and the absence of equilibrium points for the time-delay system, a quantitative biological robustness for the concentrations of intracellular substances is defined by penalizing a weighted sum of the expectation and variance of the relative deviation between system outputs before and after the time-delays are perturbed. Our goal is to determine optimal values of the time-delays. To this end, we formulate an optimization problem in which the time delays are decision variables and the cost function is to minimize the biological robustness. This optimization problem is subject to the time-delay system, parameter constraints, continuous state inequality constraints for ensuring that the concentrations of extracellular and intracellular substances lie within specified limits, a quality constraint to reflect operational requirements and a cost sensitivity constraint for ensuring that an acceptable level of the system performance is achieved. It is approximated as a sequence of nonlinear programming sub-problems through the application of constraint transcription and local smoothing approximation techniques. Due to the highly complex nature of this optimization problem, the computational cost is high. Thus, a parallel algorithm is proposed to solve these nonlinear programming sub-problems based on the filled function method. Finally, it is observed that the obtained optimal estimates for the time-delays are highly satisfactory

  1. Regulon studies and in planta role of the BraI/R quorum-sensing system in the plant-beneficial Burkholderia cluster.


    Coutinho, Bruna G; Mitter, Birgit; Talbi, Chouhra; Sessitsch, Angela; Bedmar, Eulogio J; Halliday, Nigel; James, Euan K; Cámara, Miguel; Venturi, Vittorio


    The genus Burkholderia is composed of functionally diverse species, and it can be divided into several clusters. One of these, designated the plant-beneficial-environmental (PBE) Burkholderia cluster, is formed by nonpathogenic species, which in most cases have been found to be associated with plants. It was previously established that members of the PBE group share an N-acyl-homoserine lactone (AHL) quorum-sensing (QS) system, designated BraI/R, that produces and responds to 3-oxo-C14-HSL (OC14-HSL). Moreover, some of them also possess a second AHL QS system, designated XenI2/R2, producing and responding to 3-hydroxy-C8-HSL (OHC8-HSL). In the present study, we performed liquid chromatography-electrospray ionization-tandem mass spectrometry (LC-ESI-MS/MS) analysis to determine which AHL molecules are produced by each QS system of this group of bacteria. The results showed that XenI2/R2 is mainly responsible for the production of OHC8-HSL and that the BraI/R system is involved in the production of several different AHLs. This analysis also revealed that Burkholderia phymatum STM815 produces greater amounts of AHLs than the other species tested. Further studies showed that the BraR protein of B. phymatum is more promiscuous than other BraR proteins, responding equally well to several different AHL molecules, even at low concentrations. Transcriptome studies with Burkholderia xenovorans LB400 and B. phymatum STM815 revealed that the BraI/R regulon is species specific, with exopolysaccharide production being the only common phenotype regulated by this system in the PBE cluster. In addition, BraI/R was shown not to be important for plant nodulation by B. phymatum strains or for endophytic colonization and growth promotion of maize by B. phytofirmans PsJN.

  2. Regulon Studies and In Planta Role of the BraI/R Quorum-Sensing System in the Plant-Beneficial Burkholderia Cluster

    PubMed Central

    Coutinho, Bruna G.; Mitter, Birgit; Talbi, Chouhra; Sessitsch, Angela; Bedmar, Eulogio J.; Halliday, Nigel; James, Euan K.; Cámara, Miguel


    The genus Burkholderia is composed of functionally diverse species, and it can be divided into several clusters. One of these, designated the plant-beneficial-environmental (PBE) Burkholderia cluster, is formed by nonpathogenic species, which in most cases have been found to be associated with plants. It was previously established that members of the PBE group share an N-acyl-homoserine lactone (AHL) quorum-sensing (QS) system, designated BraI/R, that produces and responds to 3-oxo-C14-HSL (OC14-HSL). Moreover, some of them also possess a second AHL QS system, designated XenI2/R2, producing and responding to 3-hydroxy-C8-HSL (OHC8-HSL). In the present study, we performed liquid chromatography-electrospray ionization-tandem mass spectrometry (LC-ESI-MS/MS) analysis to determine which AHL molecules are produced by each QS system of this group of bacteria. The results showed that XenI2/R2 is mainly responsible for the production of OHC8-HSL and that the BraI/R system is involved in the production of several different AHLs. This analysis also revealed that Burkholderia phymatum STM815 produces greater amounts of AHLs than the other species tested. Further studies showed that the BraR protein of B. phymatum is more promiscuous than other BraR proteins, responding equally well to several different AHL molecules, even at low concentrations. Transcriptome studies with Burkholderia xenovorans LB400 and B. phymatum STM815 revealed that the BraI/R regulon is species specific, with exopolysaccharide production being the only common phenotype regulated by this system in the PBE cluster. In addition, BraI/R was shown not to be important for plant nodulation by B. phymatum strains or for endophytic colonization and growth promotion of maize by B. phytofirmans PsJN. PMID:23686262

  3. Intracellular Zn(II) Intoxication Leads to Dysregulation of the PerR Regulon Resulting in Heme Toxicity in Bacillus subtilis

    PubMed Central


    Transition metal ions (Zn(II), Cu(II)/(I), Fe(III)/(II), Mn(II)) are essential for life and participate in a wide range of biological functions. Cellular Zn(II) levels must be high enough to ensure that it can perform its essential roles. Yet, since Zn(II) binds to ligands with high avidity, excess Zn(II) can lead to protein mismetallation. The major targets of mismetallation, and the underlying causes of Zn(II) intoxication, are not well understood. Here, we use a forward genetic selection to identify targets of Zn(II) toxicity. In wild-type cells, in which Zn(II) efflux prevents intoxication of the cytoplasm, extracellular Zn(II) inhibits the electron transport chain due to the inactivation of the major aerobic cytochrome oxidase. This toxicity can be ameliorated by depression of an alternate oxidase or by mutations that restrict access of Zn(II) to the cell surface. Conversely, efflux deficient cells are sensitive to low levels of Zn(II) that do not inhibit the respiratory chain. Under these conditions, intracellular Zn(II) accumulates and leads to heme toxicity. Heme accumulation results from dysregulation of the regulon controlled by PerR, a metal-dependent repressor of peroxide stress genes. When metallated with Fe(II) or Mn(II), PerR represses both heme biosynthesis (hemAXCDBL operon) and the abundant heme protein catalase (katA). Metallation of PerR with Zn(II) disrupts this coordination, resulting in depression of heme biosynthesis but continued repression of catalase. Our results support a model in which excess heme partitions to the membrane and undergoes redox cycling catalyzed by reduced menaquinone thereby resulting in oxidative stress. PMID:27935957

  4. Computational Analysis and In silico Predictive Modeling for Inhibitors of PhoP Regulon in S. typhi on High-Throughput Screening Bioassay Dataset.


    Kaur, Harleen; Ahmad, Mohd; Scaria, Vinod


    There is emergence of multidrug-resistant Salmonella enterica serotype typhi in pandemic proportions throughout the world, and therefore, there is a necessity to speed up the discovery of novel molecules having different modes of action and also less influenced by the resistance formation that would be used as drug for the treatment of salmonellosis particularly typhoid fever. The PhoP regulon is well studied and has now been shown to be a critical regulator of number of gene expressions which are required for intracellular survival of S. enterica and pathophysiology of disease like typhoid. The evident roles of two-component PhoP-/PhoQ-regulated products in salmonella virulence have motivated attempts to target them therapeutically. Although the discovery process of biologically active compounds for the treatment of typhoid relies on hit-finding procedure, using high-throughput screening technology alone is very expensive, as well as time consuming when performed on large scales. With the recent advancement in combinatorial chemistry and contemporary technique for compounds synthesis, there are more and more compounds available which give ample growth of diverse compound library, but the time and endeavor required to screen these unfocused massive and diverse library have been slightly reduced in the past years. Hence, there is demand to improve the high-quality hits and success rate for high-throughput screening that required focused and biased compound library toward the particular target. Therefore, we still need an advantageous and expedient method to prioritize the molecules that will be utilized for biological screens, which saves time and is also inexpensive. In this concept, in silico methods like machine learning are widely applicable technique used to build computational model for high-throughput virtual screens to prioritize molecules for advance study. Furthermore, in computational analysis, we extended our study to identify the common enriched

  5. Intracellular Zn(II) Intoxication Leads to Dysregulation of the PerR Regulon Resulting in Heme Toxicity in Bacillus subtilis.


    Chandrangsu, Pete; Helmann, John D


    Transition metal ions (Zn(II), Cu(II)/(I), Fe(III)/(II), Mn(II)) are essential for life and participate in a wide range of biological functions. Cellular Zn(II) levels must be high enough to ensure that it can perform its essential roles. Yet, since Zn(II) binds to ligands with high avidity, excess Zn(II) can lead to protein mismetallation. The major targets of mismetallation, and the underlying causes of Zn(II) intoxication, are not well understood. Here, we use a forward genetic selection to identify targets of Zn(II) toxicity. In wild-type cells, in which Zn(II) efflux prevents intoxication of the cytoplasm, extracellular Zn(II) inhibits the electron transport chain due to the inactivation of the major aerobic cytochrome oxidase. This toxicity can be ameliorated by depression of an alternate oxidase or by mutations that restrict access of Zn(II) to the cell surface. Conversely, efflux deficient cells are sensitive to low levels of Zn(II) that do not inhibit the respiratory chain. Under these conditions, intracellular Zn(II) accumulates and leads to heme toxicity. Heme accumulation results from dysregulation of the regulon controlled by PerR, a metal-dependent repressor of peroxide stress genes. When metallated with Fe(II) or Mn(II), PerR represses both heme biosynthesis (hemAXCDBL operon) and the abundant heme protein catalase (katA). Metallation of PerR with Zn(II) disrupts this coordination, resulting in depression of heme biosynthesis but continued repression of catalase. Our results support a model in which excess heme partitions to the membrane and undergoes redox cycling catalyzed by reduced menaquinone thereby resulting in oxidative stress.

  6. Regulation of Transcript Elongation

    PubMed Central

    Belogurov, Georgiy A.; Artsimovitch, Irina


    Bacteria lack subcellular compartments and harbor a single RNA polymerase that synthesizes both structural and protein-coding RNAs, which are cotranscriptionally processed by distinct pathways. Nascent rRNAs fold into elaborate secondary structures and associate with ribosomal proteins, whereas nascent mRNAs are translated by ribosomes. During elongation, nucleic acid signals and regulatory proteins modulate concurrent RNA-processing events, instruct RNA polymerase where to pause and terminate transcription, or act as roadblocks to the moving enzyme. Communications among complexes that carry out transcription, translation, repair, and other cellular processes ensure timely execution of the gene expression program and survival under conditions of stress. This network is maintained by auxiliary proteins that act as bridges between RNA polymerase, ribosome, and repair enzymes, blurring boundaries between separate information-processing steps and making assignments of unique regulatory functions meaningless. Understanding the regulation of transcript elongation thus requires genome-wide approaches, which confirm known and reveal new regulatory connections. PMID:26132790

  7. LacI Transcriptional Regulatory Networks in Clostridium thermocellum DSM1313

    SciTech Connect

    Wilson, Charlotte M.; Klingeman, Dawn M.; Schlachter, Caleb; Syed, Mustafa H.; Wu, Chia-wei; Guss, Adam M.; Brown, Steven D.; Parales, Rebecca E.


    Organisms regulate gene expression in response to the environment to coordinate metabolic reactions.Clostridium thermocellumexpresses enzymes for both lignocellulose solubilization and its fermentation to produce ethanol. In one LacI regulator termed GlyR3 inC. thermocellumATCC 27405 we identified a repressor of neighboring genes with repression relieved by laminaribiose (a β-1,3 disaccharide). To better understand the threeC. thermocellumLacI regulons, deletion mutants were constructed using the genetically tractable DSM1313 strain. DSM1313lacIgenes Clo1313_2023, Clo1313_0089, and Clo1313_0396 encode homologs of GlyR1, GlyR2, and GlyR3 from strain ATCC 27405, respectively. Furthermore, growth on cellobiose or pretreated switchgrass was unaffected by any of the gene deletions under controlled-pH fermentations. Global gene expression patterns from time course analyses identified glycoside hydrolase genes encoding hemicellulases, including cellulosomal enzymes, that were highly upregulated (5- to 100-fold) in the absence of each LacI regulator, suggesting that these were repressed under wild-type conditions and that relatively few genes were controlled by each regulator under the conditions tested. Clo1313_2022, encoding lichenase enzyme LicB, was derepressed in a ΔglyR1strain. Higher expression of Clo1313_1398, which encodes the Man5A mannanase, was observed in a ΔglyR2strain, and α-mannobiose was identified as a probable inducer for GlyR2-regulated genes. For the ΔglyR3strain, upregulation of the two genes adjacent toglyR3in thecelC-glyR3-licAoperon was consistent with earlier studies. Electrophoretic mobility shift assays have confirmed LacI transcription factor binding to specific

  8. The transcription factor encyclopedia.


    Yusuf, Dimas; Butland, Stefanie L; Swanson, Magdalena I; Bolotin, Eugene; Ticoll, Amy; Cheung, Warren A; Zhang, Xiao Yu Cindy; Dickman, Christopher T D; Fulton, Debra L; Lim, Jonathan S; Schnabl, Jake M; Ramos, Oscar H P; Vasseur-Cognet, Mireille; de Leeuw, Charles N; Simpson, Elizabeth M; Ryffel, Gerhart U; Lam, Eric W-F; Kist, Ralf; Wilson, Miranda S C; Marco-Ferreres, Raquel; Brosens, Jan J; Beccari, Leonardo L; Bovolenta, Paola; Benayoun, Bérénice A; Monteiro, Lara J; Schwenen, Helma D C; Grontved, Lars; Wederell, Elizabeth; Mandrup, Susanne; Veitia, Reiner A; Chakravarthy, Harini; Hoodless, Pamela A; Mancarelli, M Michela; Torbett, Bruce E; Banham, Alison H; Reddy, Sekhar P; Cullum, Rebecca L; Liedtke, Michaela; Tschan, Mario P; Vaz, Michelle; Rizzino, Angie; Zannini, Mariastella; Frietze, Seth; Farnham, Peggy J; Eijkelenboom, Astrid; Brown, Philip J; Laperrière, David; Leprince, Dominique; de Cristofaro, Tiziana; Prince, Kelly L; Putker, Marrit; del Peso, Luis; Camenisch, Gieri; Wenger, Roland H; Mikula, Michal; Rozendaal, Marieke; Mader, Sylvie; Ostrowski, Jerzy; Rhodes, Simon J; Van Rechem, Capucine; Boulay, Gaylor; Olechnowicz, Sam W Z; Breslin, Mary B; Lan, Michael S; Nanan, Kyster K; Wegner, Michael; Hou, Juan; Mullen, Rachel D; Colvin, Stephanie C; Noy, Peter John; Webb, Carol F; Witek, Matthew E; Ferrell, Scott; Daniel, Juliet M; Park, Jason; Waldman, Scott A; Peet, Daniel J; Taggart, Michael; Jayaraman, Padma-Sheela; Karrich, Julien J; Blom, Bianca; Vesuna, Farhad; O'Geen, Henriette; Sun, Yunfu; Gronostajski, Richard M; Woodcroft, Mark W; Hough, Margaret R; Chen, Edwin; Europe-Finner, G Nicholas; Karolczak-Bayatti, Magdalena; Bailey, Jarrod; Hankinson, Oliver; Raman, Venu; LeBrun, David P; Biswal, Shyam; Harvey, Christopher J; DeBruyne, Jason P; Hogenesch, John B; Hevner, Robert F; Héligon, Christophe; Luo, Xin M; Blank, Marissa Cathleen; Millen, Kathleen Joyce; Sharlin, David S; Forrest, Douglas; Dahlman-Wright, Karin; Zhao, Chunyan; Mishima, Yuriko; Sinha, Satrajit; Chakrabarti, Rumela; Portales-Casamar, Elodie; Sladek, Frances M; Bradley, Philip H; Wasserman, Wyeth W


    Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130 mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written and vetted by experts in the field. TFe is available at

  9. The Transcription Factor Encyclopedia

    PubMed Central


    Here we present the Transcription Factor Encyclopedia (TFe), a new web-based compendium of mini review articles on transcription factors (TFs) that is founded on the principles of open access and collaboration. Our consortium of over 100 researchers has collectively contributed over 130 mini review articles on pertinent human, mouse and rat TFs. Notable features of the TFe website include a high-quality PDF generator and web API for programmatic data retrieval. TFe aims to rapidly educate scientists about the TFs they encounter through the delivery of succinct summaries written and vetted by experts in the field. TFe is available at PMID:22458515

  10. Mapping yeast transcriptional networks.


    Hughes, Timothy R; de Boer, Carl G


    The term "transcriptional network" refers to the mechanism(s) that underlies coordinated expression of genes, typically involving transcription factors (TFs) binding to the promoters of multiple genes, and individual genes controlled by multiple TFs. A multitude of studies in the last two decades have aimed to map and characterize transcriptional networks in the yeast Saccharomyces cerevisiae. We review the methodologies and accomplishments of these studies, as well as challenges we now face. For most yeast TFs, data have been collected on their sequence preferences, in vivo promoter occupancy, and gene expression profiles in deletion mutants. These systematic studies have led to the identification of new regulators of numerous cellular functions and shed light on the overall organization of yeast gene regulation. However, many yeast TFs appear to be inactive under standard laboratory growth conditions, and many of the available data were collected using techniques that have since been improved. Perhaps as a consequence, comprehensive and accurate mapping among TF sequence preferences, promoter binding, and gene expression remains an open challenge. We propose that the time is ripe for renewed systematic efforts toward a complete mapping of yeast transcriptional regulatory mechanisms.

  11. Transcription of mitochondrial DNA.


    Tabak, H F; Grivell, L A; Borst, P


    While mitochondrial DNA (mtDNA) is the simplest DNA in nature, coding for rRNAs and tRNAs, results of DNA sequence, and transcript analysis have demonstrated that both the synthesis and processing of mitochondrial RNAs involve remarkably intricate events. At one extreme, genes in animal mtDNAs are tightly packed, both DNA strands are completely transcribed (symmetric transcription), and the appearance of specific mRNAs is entirely dependent on processing at sites signalled by the sequences of the tRNAs, which abut virtually every gene. At the other extreme, gene organization in yeast (Saccharomyces) is anything but compact, with long stretches of AT-rich DNA interspaced between coding sequences and no obvious logic to the order of genes. Transcription is asymmetric and several RNAs are initiated de novo. Nevertheless, extensive RNA processing occurs due largely to the presence of split genes. RNA splicing is complex, is controlled by both mitochondrial and nuclear genes, and in some cases is accompanied by the formation of RNAs that behave as covalently closed circles. The present article reviews current knowledge of mitochondrial transcription and RNA processing in relation to possible mechanisms for the regulation of mitochondrial gene expression.

  12. Fungal CSL transcription factors

    PubMed Central

    Převorovský, Martin; Půta, František; Folk, Petr


    Background The CSL (CBF1/RBP-Jκ/Suppressor of Hairless/LAG-1) transcription factor family members are well-known components of the transmembrane receptor Notch signaling pathway, which plays a critical role in metazoan development. They function as context-dependent activators or repressors of transcription of their responsive genes, the promoters of which harbor the GTG(G/A)GAA consensus elements. Recently, several studies described Notch-independent activities of the CSL proteins. Results We have identified putative CSL genes in several fungal species, showing that this family is not confined to metazoans. We have analyzed their sequence conservation and identified the presence of well-defined domains typical of genuine CSL proteins. Furthermore, we have shown that the candidate fungal protein sequences contain highly conserved regions known to be required for sequence-specific DNA binding in their metazoan counterparts. The phylogenetic analysis of the newly identified fungal CSL proteins revealed the existence of two distinct classes, both of which are present in all the species studied. Conclusion Our findings support the evolutionary origin of the CSL transcription factor family in the last common ancestor of fungi and metazoans. We hypothesize that the ancestral CSL function involved DNA binding and Notch-independent regulation of transcription and that this function may still be shared, to a certain degree, by the present CSL family members from both fungi and metazoans. PMID:17629904

  13. Focus on Refugees. Transcript.

    ERIC Educational Resources Information Center

    Brandel, Sarah; And Others

    This is the transcript of the "Focus on Refugees," proqram conducted by the Overseas Development Council. Remarks from the following participants are included: (1) Sarah Brandel, Associate Fellow at the Overseas Development Council; (2) Gary Perkins, Chief of Mission of the Washington Office of the United Nations High Commissioner for Refugees…

  14. OpaR Controls a Network of Downstream Transcription Factors in Vibrio parahaemolyticus BB22OP

    PubMed Central

    Kernell Burke, Alison; Guthrie, Leah T. C.; Modise, Thero; Cormier, Guy; Jensen, Roderick V.; McCarter, Linda L.; Stevens, Ann M.


    Vibrio parahaemolyticus is an emerging world-wide human pathogen that is associated with food-borne gastroenteritis when raw or undercooked seafood is consumed. Expression of virulence factors in this organism is modulated by the phenomenon known as quorum sensing, which permits differential gene regulation at low versus high cell density. The master regulator of quorum sensing in V. parahaemolyticus is OpaR. OpaR not only controls virulence factor gene expression, but also the colony and cellular morphology associated with growth on a surface and biofilm formation. Whole transcriptome Next Generation sequencing (RNA-Seq) was utilized to determine the OpaR regulon by comparing strains BB22OP (opaR+, LM5312) and BB22TR (∆opaR1, LM5674). This work, using the published V. parahaemolyticus BB22OP genome sequence, confirms and expands upon a previous microarray analysis for these two strains that used an Affymetrix GeneChip designed from the closely related V. parahaemolyticus RIMD2210633 genome sequence. Overall there was excellent correlation between the microarray and RNA-Seq data. Eleven transcription factors under OpaR control were identified by both methods and further confirmed by quantitative reverse transcription PCR (qRT-PCR) analysis. Nine of these transcription factors were demonstrated to be direct OpaR targets via in vitro electrophoretic mobility shift assays with purified hexahistidine-tagged OpaR. Identification of the direct and indirect targets of OpaR, including small RNAs, will enable the construction of a network map of regulatory interactions important for the switch between the nonpathogenic and pathogenic states. PMID:25901572

  15. The NifA-RpoN regulon of Mesorhizobium loti strain R7A and its symbiotic activation by a novel LacI/GalR-family regulator.


    Sullivan, John T; Brown, Steven D; Ronson, Clive W


    Mesorhizobium loti is the microsymbiont of Lotus species, including the model legume L. japonicus. M. loti differs from other rhizobia in that it contains two copies of the key nitrogen fixation regulatory gene nifA, nifA1 and nifA2, both of which are located on the symbiosis island ICEMlSym(R7A). M. loti R7A also contains two rpoN genes, rpoN1 located on the chromosome outside of ICEMlSym(R7A) and rpoN2 that is located on ICEMlSym(R7A). The aims of the current work were to establish how nifA expression was activated in M. loti and to characterise the NifA-RpoN regulon. The nifA2 and rpoN2 genes were essential for nitrogen fixation whereas nifA1 and rpoN1 were dispensable. Expression of nifA2 was activated, possibly in response to an inositol derivative, by a novel regulator of the LacI/GalR family encoded by the fixV gene located upstream of nifA2. Other than the well-characterized nif/fix genes, most NifA2-regulated genes were not required for nitrogen fixation although they were strongly expressed in nodules. The NifA-regulated nifZ and fixU genes, along with nifQ which was not NifA-regulated, were required in M. loti for a fully effective symbiosis although they are not present in some other rhizobia. The NifA-regulated gene msi158 that encodes a porin was also required for a fully effective symbiosis. Several metabolic genes that lacked NifA-regulated promoters were strongly expressed in nodules in a NifA2-dependent manner but again mutants did not have an overt symbiotic phenotype. In summary, many genes encoded on ICEMlSym(R7A) were strongly expressed in nodules but not free-living rhizobia, but were not essential for symbiotic nitrogen fixation. It seems likely that some of these genes have functional homologues elsewhere in the genome and that bacteroid metabolism may be sufficiently plastic to adapt to loss of certain enzymatic functions.

  16. A Combination of Two Antioxidants (An SOD Mimic and Ascorbate) Produces a Pro-Oxidative Effect Forcing Escherichia coli to Adapt Via Induction of oxyR Regulon

    PubMed Central

    Batinić-Haberle, Ines; Rajić, Zrinka; Benov, Ludmil


    Cationic Mn(III) N-alkylpyridyl (MnTalkyl-2(or 3)-PyP5+) and N, N′-dialkylimidazolylporphyrins (MnTDalkyl-2-ImP5+) have been regarded as the most powerful SOD mimics/peroxynitrite scavengers – i. e. antioxidants. The ethyl-, MnTE-2-PyP5+ (AEOL10113), and hexylpyridyl-, MnTnHex-2-PyP5+ and diethylimidazolylporphyrin, MnTDE-2-ImP5+ (AEOL10150) have been mostly studied in vitro and in vivo. Given the in vivo abundance of cellular reductants, MnPs can couple with them in removing superoxide. Thus, they could be readily reduced from MnIIIP to MnIIP with ascorbate and glutathione, and in a subsequent step reduce either O2·− (while acting as superoxide reductase) or oxygen (while exerting pro-oxidative action). Moreover, MnPs can catalyze ascorbate oxidation and in turn hydrogen peroxide production. The in vivo type of MnP action (anti- or pro-oxidative) will depend upon the cellular levels of reactive species, endogenous antioxidants, availability of oxygen, ratio of O2·−- to peroxide-removing systems, redox ability of MnPs and their cellular localization/bioavailibility. To exemplify the switch from an anti- to pro-oxidative action we have explored a very simple and straightforward system – the superoxide-specific aerobic growth of SOD-deficient E. coli. In such a system, cationic MnPs, ortho and meta MnTE-2-(or 3)-PyP5+ act as powerful SOD mimics. Yet, in the presence of exogenous ascorbate, the SOD mimics catalyze the H2O2 production, causing oxidative damage to both wild and SOD-deficient strains and inhibiting their growth. Catalase added to the medium reversed the effect indicating that H2O2 is a major damaging/signaling species involved in cell growth suppression. The experiments with oxyR- and soxRS-deficient E. coli were conducted to show that E. coli responds to increased oxidative stress exerted by MnP/ascorbate system by induction of oxyR regulon and thus upregulation of antioxidative defenses such as catalases and peroxidases. As anticipated

  17. Transcription-coupled DNA supercoiling dictates the chromosomal arrangement of bacterial genes

    PubMed Central

    Sobetzko, Patrick


    Over the recent decade, the central importance of DNA supercoiling in chromosome organization and global gene regulation of bacteria became more and more visible. With a regulon comprising more than 2000 genes in Escherichia coli, DNA supercoiling is among the most influential regulators of gene expression found in bacteria so far. However, the mechanism creating thousands of diverse temporal gene expression patterns coordinated by DNA supercoiling remains unclear. In this study we show that a specific chromosomal arrangement of genes modulates the local levels of DNA supercoiling at gene promoters via transcription-coupled DNA supercoiling (TCDS) in the model organism E. coli. Our findings provide a consistent explanation for the strong positive coupling of temporal gene expression patterns of neighboring genes. Using comparative genomics we are furthermore able to provide evidence that TCDS is a driving force for the evolution of chromosomal gene arrangement patterns in other Enterobacteriaceae. With the currently available data of promoter supercoiling sensitivity we prove that the same principle is applicable also for the evolutionary distant gram-positive pathogenic bacterium Streptococcus pneumoniae. Moreover, our findings are fully consistent with recent investigations concerning the regulatory impact of TCDS on gene pairs in eukaryots underpinning the broad applicability of our analysis. PMID:26783203

  18. Transcriptional profiling of CRP-regulated genes in deep-sea bacterium Shewanella piezotolerans WP3.


    Jian, Huahua; Hu, Jing; Xiao, Xiang


    The cAMP receptor protein (CRP) is a conserved regulator in bacteria and involved in regulation of energy metabolism, such as glucose, galactose, and citrate (Green et al., 2014 [1]). As an important catabolite activator protein, it has been well characterized in model microorganism such as Escherichia coli. However, our understanding of the roles of CRP in deep-sea bacteria is rather limited. To indentify the function of CRP, we performed whole genome transcriptional profiling using a custom designed microarray which contains 95% open reading frames of Shewanella piezotolerans WP3, which was isolated from West Pacific sediment at a depth of 1914 m (Xiao et al., 2007 [2]; Wang et al., 2008 [3]). Here we describe the experimental procedures and methods in detail to reproduce the results (available at Gene Expression Omnibus database under GSE67731 and GSE67732) and provide resource to be employed for comparative analyses of CRP regulon and the regulatory network of anaerobic respiration in microorganisms which inhabited in different environments, and thus broaden our understanding of mechanism of bacteria against various environment stresses.

  19. Transcriptional profiling of CRP-regulated genes in deep-sea bacterium Shewanella piezotolerans WP3

    PubMed Central

    Jian, Huahua; Hu, Jing; Xiao, Xiang


    The cAMP receptor protein (CRP) is a conserved regulator in bacteria and involved in regulation of energy metabolism, such as glucose, galactose, and citrate (Green et al., 2014 [1]). As an important catabolite activator protein, it has been well characterized in model microorganism such as Escherichia coli. However, our understanding of the roles of CRP in deep-sea bacteria is rather limited. To indentify the function of CRP, we performed whole genome transcriptional profiling using a custom designed microarray which contains 95% open reading frames of Shewanella piezotolerans WP3, which was isolated from West Pacific sediment at a depth of 1914 m (Xiao et al., 2007 [2]; Wang et al., 2008 [3]). Here we describe the experimental procedures and methods in detail to reproduce the results (available at Gene Expression Omnibus database under GSE67731 and GSE67732) and provide resource to be employed for comparative analyses of CRP regulon and the regulatory network of anaerobic respiration in microorganisms which inhabited in different environments, and thus broaden our understanding of mechanism of bacteria against various environment stresses. PMID:26484223

  20. Using sequence-specific chemical and structural properties of DNA to predict transcription factor binding sites.


    Bauer, Amy L; Hlavacek, William S; Unkefer, Pat J; Mu, Fangping


    An important step in understanding gene regulation is to identify the DNA binding sites recognized by each transcription factor (TF). Conventional approaches to prediction of TF binding sites involve the definition of consensus sequences or position-specific weight matrices and rely on statistical analysis of DNA sequences of known binding sites. Here, we present a method called SiteSleuth in which DNA structure prediction, computational chemistry, and machine learning are applied to develop models for TF binding sites. In this approach, binary classifiers are trained to discriminate between true and false binding sites based on the sequence-specific chemical and structural features of DNA. These features are determined via molecular dynamics calculations in which we consider each base in different local neighborhoods. For each of 54 TFs in Escherichia coli, for which at least five DNA binding sites are documented in RegulonDB, the TF binding sites and portions of the non-coding genome sequence are mapped to feature vectors and used in training. According to cross-validation analysis and a comparison of computational predictions against ChIP-chip data available for the TF Fis, SiteSleuth outperforms three conventional approaches: Match, MATRIX SEARCH, and the method of Berg and von Hippel. SiteSleuth also outperforms QPMEME, a method similar to SiteSleuth in that it involves a learning algorithm. The main advantage of SiteSleuth is a lower false positive rate.

  1. Transcriptional Adaptation of Mycobacterium tuberculosis within Macrophages: Insights into the Phagosomal Environment.


    Schnappinger, Dirk; Ehrt, Sabine; Voskuil, Martin I; Liu, Yang; Mangan, Joseph A; Monahan, Irene M; Dolganov, Gregory; Efron, Brad; Butcher, Philip D; Nathan, Carl; Schoolnik, Gary K


    Little is known about the biochemical environment in phagosomes harboring an infectious agent. To assess the state of this organelle we captured the transcriptional responses of Mycobacterium tuberculosis (MTB) in macrophages from wild-type and nitric oxide (NO) synthase 2-deficient mice before and after immunologic activation. The intraphagosomal transcriptome was compared with the transcriptome of MTB in standard broth culture and during growth in diverse conditions designed to simulate features of the phagosomal environment. Genes expressed differentially as a consequence of intraphagosomal residence included an interferon gamma- and NO-induced response that intensifies an iron-scavenging program, converts the microbe from aerobic to anaerobic respiration, and induces a dormancy regulon. Induction of genes involved in the activation and beta-oxidation of fatty acids indicated that fatty acids furnish carbon and energy. Induction of sigmaE-dependent, sodium dodecyl sulfate-regulated genes and genes involved in mycolic acid modification pointed to damage and repair of the cell envelope. Sentinel genes within the intraphagosomal transcriptome were induced similarly by MTB in the lungs of mice. The microbial transcriptome thus served as a bioprobe of the MTB phagosomal environment, showing it to be nitrosative, oxidative, functionally hypoxic, carbohydrate poor, and capable of perturbing the pathogen's cell envelope.

  2. Global transcriptional control by glucose and carbon regulator CcpA in Clostridium difficile

    PubMed Central

    Antunes, Ana; Camiade, Emilie; Monot, Marc; Courtois, Emmanuelle; Barbut, Frédéric; Sernova, Natalia V.; Rodionov, Dmitry A.; Martin-Verstraete, Isabelle; Dupuy, Bruno


    The catabolite control protein CcpA is a pleiotropic regulator that mediates the global transcriptional response to rapidly catabolizable carbohydrates, like glucose in Gram-positive bacteria. By whole transcriptome analyses, we characterized glucose-dependent and CcpA-dependent gene regulation in Clostridium difficile. About 18% of all C. difficile genes are regulated by glucose, for which 50% depend on CcpA for regulation. The CcpA regulon comprises genes involved in sugar uptake, fermentation and amino acids metabolism, confirming the role of CcpA as a link between carbon and nitrogen pathways. Using combination of chromatin immunoprecipitation and genome sequence analysis, we detected 55 CcpA binding sites corresponding to ∼140 genes directly controlled by CcpA. We defined the C. difficile CcpA consensus binding site (creCD motif), that is, ‘RRGAAAANGTTTTCWW’. Binding of purified CcpA protein to 19 target creCD sites was demonstrated by electrophoretic mobility shift assay. CcpA also directly represses key factors in early steps of sporulation (Spo0A and SigF). Furthermore, the C. difficile toxin genes (tcdA and tcdB) and their regulators (tcdR and tcdC) are direct CcpA targets. Finally, CcpA controls a complex and extended regulatory network through the modulation of a large set of regulators. PMID:22989714

  3. Identification of a Transcription Factor That Regulates Host Cell Exit and Virulence of Mycobacterium tuberculosis

    PubMed Central

    Srinivasan, Lalitha; Gurses, Serdar A.; Hurley, Benjamin E.; Miller, Jessica L.; Karakousis, Petros C.; Briken, Volker


    The interaction of Mycobacterium tuberculosis (Mtb) with host cell death signaling pathways is characterized by an initial anti-apoptotic phase followed by a pro-necrotic phase to allow for host cell exit of the bacteria. The bacterial modulators regulating necrosis induction are poorly understood. Here we describe the identification of a transcriptional repressor, Rv3167c responsible for regulating the escape of Mtb from the phagosome. Increased cytosolic localization of MtbΔRv3167c was accompanied by elevated levels of mitochondrial reactive oxygen species and reduced activation of the protein kinase Akt, and these events were critical for the induction of host cell necrosis and macroautophagy. The increase in necrosis led to an increase in bacterial virulence as reflected in higher bacterial burden and reduced survival of mice infected with MtbΔRv3167c. The regulon of Rv3167c thus contains the bacterial mediators involved in escape from the phagosome and host cell necrosis induction, both of which are crucial steps in the intracellular lifecycle and virulence of Mtb. PMID:27191591

  4. Characterisation of a putative AraC transcriptional regulator from Mycobacterium smegmatis

    PubMed Central

    Evangelopoulos, Dimitrios; Gupta, Antima; Lack, Nathan A.; Maitra, Arundhati; ten Bokum, Annemieke M.C.; Kendall, Sharon; Sim, Edith; Bhakta, Sanjib


    Summary MSMEG_0307 is annotated as a transcriptional regulator belonging to the AraC protein family and is located adjacent to the arylamine N-acetyltransferase (nat) gene in Mycobacterium smegmatis, in a gene cluster, conserved in most environmental mycobacterial species. In order to elucidate the function of the AraC protein from the nat operon in M. smegmatis, two conserved palindromic DNA motifs were identified using bioinformatics and tested for protein binding using electrophoretic mobility shift assays with a recombinant form of the AraC protein. We identified the formation of a DNA:AraC protein complex with one of the motifs as well as the presence of this motif in 20 loci across the whole genome of M. smegmatis, supporting the existence of an AraC controlled regulon. To characterise the effects of AraC in the regulation of the nat operon genes, as well as to gain further insight into its function, we generated a ΔaraC mutant strain where the araC gene was replaced by a hygromycin resistance marker. The level of expression of the nat and MSMEG_0308 genes was down-regulated in the ΔaraC strain when compared to the wild type strain indicating an activator effect of the AraC protein on the expression of the nat operon genes. PMID:25443504

  5. Compartment and signal-specific codependence in the transcriptional control of Salmonella periplasmic copper homeostasis

    PubMed Central

    Pezza, Alejandro; Pontel, Lucas B.; López, Carolina; Soncini, Fernando C.


    Copper homeostasis is essential for bacterial pathogen fitness and infection, and has been the focus of a number of recent studies. In Salmonella, envelope protection against copper overload and macrophage survival depends on CueP, a major copper-binding protein in the periplasm. This protein is also required to deliver the metal ion to the Cu/Zn superoxide dismutase SodCII. The Salmonella-specific CueP-coding gene was originally identified as part of the Cue regulon under the transcriptional control of the cytoplasmic copper sensor CueR, but its expression differs from the rest of CueR-regulated genes. Here we show that cueP expression is controlled by the concerted action of CueR, which detects the presence of copper in the cytoplasm, and by CpxR/CpxA, which monitors envelope stress. Copper-activated CueR is necessary for the appropriate spatial arrangement of the −10 and −35 elements of the cueP promoter, and CpxR is essential to recruit the RNA polymerase. The integration of two ancestral sensory systems—CueR, which provides signal specificity, and CpxR/CpxA, which detects stress in the bacterial envelope—restricts the expression of this periplasmic copper resistance protein solely to cells encountering surplus copper that disturbs envelope homeostasis, emulating the role of the CusR/CusS regulatory system present in other enteric bacteria. PMID:27679850

  6. AraR, an l-Arabinose-Responsive Transcriptional Regulator in Corynebacterium glutamicum ATCC 31831, Exerts Different Degrees of Repression Depending on the Location of Its Binding Sites within the Three Target Promoter Regions

    PubMed Central

    Kuge, Takayuki; Teramoto, Haruhiko


    ABSTRACT In Corynebacterium glutamicum ATCC 31831, a LacI-type transcriptional regulator AraR, represses the expression of l-arabinose catabolism (araBDA), uptake (araE), and the regulator (araR) genes clustered on the chromosome. AraR binds to three sites: one (BSB) between the divergent operons (araBDA and galM-araR) and two (BSE1 and BSE2) upstream of araE. l-Arabinose acts as an inducer of the AraR-mediated regulation. Here, we examined the roles of these AraR-binding sites in the expression of the AraR regulon. BSB mutation resulted in derepression of both araBDA and galM-araR operons. The effects of BSE1 and/or BSE2 mutation on araE expression revealed that the two sites independently function as the cis elements, but BSE1 plays the primary role. However, AraR was shown to bind to these sites with almost the same affinity in vitro. Taken together, the expression of araBDA and araE is strongly repressed by binding of AraR to a single site immediately downstream of the respective transcriptional start sites, whereas the binding site overlapping the −10 or −35 region of the galM-araR and araE promoters is less effective in repression. Furthermore, downregulation of araBDA and araE dependent on l-arabinose catabolism observed in the BSB mutant and the AraR-independent araR promoter identified within galM-araR add complexity to regulation of the AraR regulon derepressed by l-arabinose. IMPORTANCE Corynebacterium glutamicum has a long history as an industrial workhorse for large-scale production of amino acids. An important aspect of industrial microorganisms is the utilization of the broad range of sugars for cell growth and production process. Most C. glutamicum strains are unable to use a pentose sugar l-arabinose as a carbon source. However, genes for l-arabinose utilization and its regulation have been recently identified in C. glutamicum ATCC 31831. This study elucidates the roles of the multiple binding sites of the transcriptional repressor AraR in the

  7. Transcriptional Profiling of Nitrogen Fixation and the Role of NifA in the Diazotrophic Endophyte Azoarcus sp. Strain BH72

    PubMed Central

    Sarkar, Abhijit; Reinhold-Hurek, Barbara


    Background The model endophyte Azoarcus sp. strain BH72 is known to contribute fixed nitrogen to its host Kallar grass and also expresses nitrogenase genes endophytically in rice seedlings. Availability of nitrogen is a signal regulating the transcription of nitrogenase genes. Therefore, we analysed global transcription in response to differences in the nitrogen source. Methodology/Principal Findings A DNA microarray, comprising 70-mer oligonucleotides representing 3989 open reading frames of the genome of strain BH72, was used for transcriptome studies. Transcription profiles of cells grown microaerobically on N2 versus ammonium were compared. Expression of 7.2% of the genes was significantly up-regulated, and 5.8% down-regulated upon N2 fixation, respectively. A parallel genome-wide prediction of σ54-type promoter elements mapped to the upstream region of 38 sequences of which 36 were modulated under the N2 response. In addition to modulation of genes related to N2 fixation, the expressions of gene clusters that might be related to plant-microbe interaction and of several transcription factors were significantly enhanced. While comparing under N2-fixation conditions the transcriptome of wild type with a nifLA− insertion mutant, NifA being the essential transcriptional activator for nif genes, 24.5% of the genome was found to be affected in expression. A genome-wide prediction of 29 NifA binding sequences matched to 25 of the target genes whose expression was differential during microarray analysis, some of which were putatively negatively regulated by NifA. For selected genes, differential expression was corroborated by real time RT-PCR studies. Conclusion/Significance Our data suggest that life under conditions of nitrogen fixation is an important part of the lifestyle of strain BH72 in roots, as a wide range of genes far beyond the nif regulon is modulated. Moreover, the NifA regulon in strain BH72 appears to encompass a wider range of cellular functions

  8. Machine Transcription--Practically Speaking.

    ERIC Educational Resources Information Center

    Clippinger, Dorinda A.


    Draws transcription teaching principles from Gagne's theories about learning. Recommends 12-16 weeks of instruction, pre-transcription development of related skills, frequent feedback, and use of teaching materials that are arranged to take advantage of learning cycles. (SK)

  9. The APSES transcription factor Efg1 is a global regulator that controls morphogenesis and biofilm formation in Candida parapsilosis

    PubMed Central

    Connolly, Leona A; Riccombeni, Alessandro; Grózer, Zsuzsana; Holland, Linda M; Lynch, Denise B; Andes, David R; Gácser, Attila; Butler, Geraldine


    Efg1 (a member of the APSES family) is an important regulator of hyphal growth and of the white-to-opaque transition in Candida albicans and very closely related species. We show that in Candida parapsilosis Efg1 is a major regulator of a different morphological switch at the colony level, from a concentric to smooth morphology. The rate of switching is at least 20-fold increased in an efg1 knockout relative to wild type. Efg1 deletion strains also have reduced biofilm formation, attenuated virulence in an insect model, and increased sensitivity to SDS and caspofungin. Biofilm reduction is more dramatic in in vitro than in in vivo models. An Efg1 paralogue (Efh1) is restricted to Candida species, and does not regulate concentric-smooth phenotype switching, biofilm formation or stress response. We used ChIP-seq to identify the Efg1 regulon. A total of 931 promoter regions bound by Efg1 are highly enriched for transcription factors and regulatory proteins. Efg1 also binds to its own promoter, and negatively regulates its expression. Efg1 targets are enriched in binding sites for 93 additional transcription factors, including Ndt80. Our analysis suggests that Efg1 has an ancient role as regulator of development in fungi, and is central to several regulatory networks. PMID:23895281

  10. Expression of the transcriptional activator LAC9 (KlGAL4) in Kluyveromyces lactis is controlled by autoregulation.

    PubMed Central

    Zachariae, W; Breunig, K D


    The concentration of the transcriptional activator LAC9 (KlGAL4) of Kluyveromyces lactis is moderately regulated by the carbon source as is the case for GAL4, its homolog in Saccharomyces cerevisiae. Expression of the LAC9 gene is induced about twofold in galactose. This induction is due to autoregulation. The LAC9 gene product binds to a low-affinity binding site in the LAC9 promoter and moderately activates transcription in response to galactose above a basal level. As for the LAC9-controlled metabolic genes, induction of LAC9 is inhibited in the presence of glucose. This inhibition of induction is a prerequisite for glucose repression of the lactose-galactose metabolic pathway. On the other hand, induced LAC9 levels are required for optimal growth on galactose, since mutating the LAC9 binding site in the LAC9 promoter resulted in poor growth and reduced expression of LAC9-controlled genes. Thus, in addition to the GAL80-dependent regulation by protein-protein interaction, the regulation of LAC9 gene expression is an important parameter in determining carbon source control of the LAC-GAL regulon. Although the mode of control is different, the pattern of LAC9 gene regulation resembles that of the S. cerevisiae GAL4 gene, being lower in glucose and glucose-galactose than in galactose. Images PMID:8474461

  11. Epigenetic Control of Virulence Gene Expression in Pseudomonas aeruginosa by a LysR-Type Transcription Regulator

    PubMed Central

    Turner, Keith H.; Vallet-Gely, Isabelle; Dove, Simon L.


    Phenotypic variation within an isogenic bacterial population is thought to ensure the survival of a subset of cells in adverse conditions. The opportunistic pathogen Pseudomonas aeruginosa variably expresses several phenotypes, including antibiotic resistance, biofilm formation, and the production of CupA fimbriae. Here we describe a previously unidentified bistable switch in P. aeruginosa. This switch controls the expression of a diverse set of genes, including aprA, which encodes the secreted virulence factor alkaline protease. We present evidence that bistable expression of PA2432, herein named bexR (bistable expression regulator), which encodes a LysR-type transcription regulator, controls this switch. In particular, using DNA microarrays, quantitative RT–PCR analysis, chromatin immunoprecipitation, and reporter gene fusions, we identify genes directly under the control of BexR and show that these genes are bistably expressed. Furthermore, we show that bexR is itself bistably expressed and positively autoregulated. Finally, using single-cell analyses of a GFP reporter fusion, we present evidence that positive autoregulation of bexR is necessary for bistable expression of the BexR regulon. Our findings suggest that a positive feedback loop involving a LysR-type transcription regulator serves as the basis for an epigenetic switch that controls virulence gene expression in P. aeruginosa. PMID:20041030

  12. Non-transcriptional regulatory processes shape transcriptional network dynamics.


    Ray, J Christian J; Tabor, Jeffrey J; Igoshin, Oleg A


    Information about the extra- or intracellular environment is often captured as biochemical signals that propagate through regulatory networks. These signals eventually drive phenotypic changes, typically by altering gene expression programmes in the cell. Reconstruction of transcriptional regulatory networks has given a compelling picture of bacterial physiology, but transcriptional network maps alone often fail to describe phenotypes. Cellular response dynamics are ultimately determined by interactions between transcriptional and non-transcriptional networks, with dramatic implications for physiology and evolution. Here, we provide an overview of non-transcriptional interactions that can affect the performance of natural and synthetic bacterial regulatory networks.

  13. Transcriptional responses to sucrose mimic the plant-associated life style of the plant growth promoting endophyte Enterobacter sp. 638.


    Taghavi, Safiyh; Wu, Xiao; Ouyang, Liming; Zhang, Yian Biao; Stadler, Andrea; McCorkle, Sean; Zhu, Wei; Maslov, Sergei; van der Lelie, Daniel


    Growth in sucrose medium was previously found to trigger the expression of functions involved in the plant associated life style of the endophytic bacterium Enterobacter sp. 638. Therefore, comparative transcriptome analysis between cultures grown in sucrose or lactate medium was used to gain insights in the expression levels of bacterial functions involved in the endophytic life style of strain 638. Growth on sucrose as a carbon source resulted in major changes in cell physiology, including a shift from a planktonic life style to the formation of bacterial aggregates. This shift was accompanied by a decrease in transcription of genes involved in motility (e.g., flagella biosynthesis) and an increase in the transcription of genes involved in colonization, adhesion and biofilm formation. The transcription levels of functions previously suggested as being involved in endophytic behavior and functions responsible for plant growth promoting properties, including the synthesis of indole-acetic acid, acetoin and 2,3-butanediol, also increased significantly for cultures grown in sucrose medium. Interestingly, despite an abundance of essential nutrients transcription levels of functions related to uptake and processing of nitrogen and iron became increased for cultures grown on sucrose as sole carbon source. Transcriptome data were also used to analyze putative regulatory relationships. In addition to the small RNA csrABCD regulon, which seems to play a role in the physiological adaptation and possibly the shift between free-living and plant-associated endophytic life style of Enterobacter sp. 638, our results also pointed to the involvement of rcsAB in controlling responses by Enterobacter sp. 638 to a plant-associated life style. Targeted mutagenesis was used to confirm this role and showed that compared to wild-type Enterobacter sp. 638 a ΔrcsB mutant was affected in its plant growth promoting ability.

  14. Transcriptional Responses to Sucrose Mimic the Plant-Associated Life Style of the Plant Growth Promoting Endophyte Enterobacter sp. 638


    Taghavi, Safiyh; Wu, Xiao; Ouyang, Liming; ...


    Growth in sucrose medium was previously found to trigger the expression of functions involved in the plant associated life style of the endophytic bacterium Enterobacter sp. 638. Therefore, comparative transcriptome analysis between cultures grown in sucrose or lactate medium was used to gain insights in the expression levels of bacterial functions involved in the endophytic life style of strain 638. Growth on sucrose as a carbon source resulted in major changes in cell physiology, including a shift from a planktonic life style to the formation of bacterial aggregates. This shift was accompanied by a decrease in transcription of genes involvedmore » in motility (e.g. flagella biosynthesis) and an increase in the transcription of genes involved in colonization, adhesion and biofilm formation. The transcription levels of functions previously suggested as being involved in endophytic behavior and functions responsible for plant growth promoting properties, including the synthesis of indole-acetic acid, acetoin and 2,3-butanediol, also increased significantly for cultures grown in sucrose medium. Interestingly, despite an abundance of essential nutrients transcription levels of functions related to uptake and processing of nitrogen and iron became increased for cultures grown on sucrose as sole carbon source. Transcriptome data were also used to analyze putative regulatory relationships. In addition to the small RNA csrABCD regulon, which seems to play a role in the physiological adaptation and possibly the shift between free-living and plant-associated endophytic life style of Enterobacter sp. 638, our results also pointed to the involvement of rcsAB in controlling responses by Enterobacter sp. 638 to a plant-associated life style. Lastly, targeted mutagenesis was used to confirm this role and showed that compared to wild-type Enterobacter sp. 638 a ΔrcsB mutant was affected in its plant growth promoting ability.« less

  15. Transcriptional Responses to Sucrose Mimic the Plant-Associated Life Style of the Plant Growth Promoting Endophyte Enterobacter sp. 638

    SciTech Connect

    Taghavi, Safiyh; Wu, Xiao; Ouyang, Liming; Zhang, Yian Biao; Stadler, Andrea; McCorkle, Sean; Zhu, Wei; Maslov, Sergei; van der Lelie, Daniel


    Growth in sucrose medium was previously found to trigger the expression of functions involved in the plant associated life style of the endophytic bacterium Enterobacter sp. 638. Therefore, comparative transcriptome analysis between cultures grown in sucrose or lactate medium was used to gain insights in the expression levels of bacterial functions involved in the endophytic life style of strain 638. Growth on sucrose as a carbon source resulted in major changes in cell physiology, including a shift from a planktonic life style to the formation of bacterial aggregates. This shift was accompanied by a decrease in transcription of genes involved in motility (e.g. flagella biosynthesis) and an increase in the transcription of genes involved in colonization, adhesion and biofilm formation. The transcription levels of functions previously suggested as being involved in endophytic behavior and functions responsible for plant growth promoting properties, including the synthesis of indole-acetic acid, acetoin and 2,3-butanediol, also increased significantly for cultures grown in sucrose medium. Interestingly, despite an abundance of essential nutrients transcription levels of functions related to uptake and processing of nitrogen and iron became increased for cultures grown on sucrose as sole carbon source. Transcriptome data were also used to analyze putative regulatory relationships. In addition to the small RNA csrABCD regulon, which seems to play a role in the physiological adaptation and possibly the shift between free-living and plant-associated endophytic life style of Enterobacter sp. 638, our results also pointed to the involvement of rcsAB in controlling responses by Enterobacter sp. 638 to a plant-associated life style. Lastly, targeted mutagenesis was used to confirm this role and showed that compared to wild-type Enterobacter sp. 638 a ΔrcsB mutant was affected in its plant growth promoting ability.

  16. Transcriptional Responses to Sucrose Mimic the Plant-Associated Life Style of the Plant Growth Promoting Endophyte Enterobacter sp. 638

    PubMed Central

    Taghavi, Safiyh; Wu, Xiao; Ouyang, Liming; Stadler, Andrea; McCorkle, Sean; Zhu, Wei; Maslov, Sergei; van der Lelie, Daniel


    Growth in sucrose medium was previously found to trigger the expression of functions involved in the plant associated life style of the endophytic bacterium Enterobacter sp. 638. Therefore, comparative transcriptome analysis between cultures grown in sucrose or lactate medium was used to gain insights in the expression levels of bacterial functions involved in the endophytic life style of strain 638. Growth on sucrose as a carbon source resulted in major changes in cell physiology, including a shift from a planktonic life style to the formation of bacterial aggregates. This shift was accompanied by a decrease in transcription of genes involved in motility (e.g. flagella biosynthesis) and an increase in the transcription of genes involved in colonization, adhesion and biofilm formation. The transcription levels of functions previously suggested as being involved in endophytic behavior and functions responsible for plant growth promoting properties, including the synthesis of indole-acetic acid, acetoin and 2,3-butanediol, also increased significantly for cultures grown in sucrose medium. Interestingly, despite an abundance of essential nutrients transcription levels of functions related to uptake and processing of nitrogen and iron became increased for cultures grown on sucrose as sole carbon source. Transcriptome data were also used to analyze putative regulatory relationships. In addition to the small RNA csrABCD regulon, which seems to play a role in the physiological adaptation and possibly the shift between free-living and plant-associated endophytic life style of Enterobacter sp. 638, our results also pointed to the involvement of rcsAB in controlling responses by Enterobacter sp. 638 to a plant-associated life style. Targeted mutagenesis was used to confirm this role and showed that compared to wild-type Enterobacter sp. 638 a ΔrcsB mutant was affected in its plant growth promoting ability. PMID:25607953

  17. Toxicogenomic analysis incorporating operon-transcriptional coupling and toxicant concentration-expression response: analysis of MX-treated Salmonella

    PubMed Central

    Ward, William O; Swartz, Carol D; Porwollik, Steffen; Warren, Sarah H; Hanley, Nancy M; Knapp, Geremy W; McClelland, Michael; DeMarini, David M


    Background Deficiencies in microarray technology cause unwanted variation in the hybridization signal, obscuring the true measurements of intracellular transcript levels. Here we describe a general method that can improve microarray analysis of toxicant-exposed cells that uses the intrinsic power of transcriptional coupling and toxicant concentration-expression response data. To illustrate this approach, we characterized changes in global gene expression induced in Salmonella typhimurium TA100 by 3-chloro-4-(dichloromethyl)-5-hydroxy-2(5H)-furanone (MX), the primary mutagen in chlorinated drinking water. We used the co-expression of genes within an operon and the monotonic increases or decreases in gene expression relative to increasing toxicant concentration to augment our identification of differentially expressed genes beyond Bayesian-t analysis. Results Operon analysis increased the number of altered genes by 95% from the list identified by a Bayesian t-test of control to the highest concentration of MX. Monotonic analysis added 46% more genes. A functional analysis of the resulting 448 differentially expressed genes yielded functional changes beyond what would be expected from only the mutagenic properties of MX. In addition to gene-expression changes in DNA-damage response, MX induced changes in expression of genes involved in membrane transport and porphyrin metabolism, among other biological processes. The disruption of porphyrin metabolism might be attributable to the structural similarity of MX, which is a chlorinated furanone, to ligands indigenous to the porphyrin metabolism pathway. Interestingly, our results indicate that the lexA regulon in Salmonella, which partially mediates the response to DNA damage, may contain only 60% of the genes present in this regulon in E. coli. In addition, nanH was found to be highly induced by MX and contains a putative lexA regulatory motif in its regulatory region, suggesting that it may be regulated by lex

  18. The DeoR-type transcriptional regulator SugR acts as a repressor for genes encoding the phosphoenolpyruvate:sugar phosphotransferase system (PTS) in Corynebacterium glutamicum

    PubMed Central

    Gaigalat, Lars; Schlüter, Jan-Philip; Hartmann, Michelle; Mormann, Sascha; Tauch, Andreas; Pühler, Alfred; Kalinowski, Jörn


    Background The major uptake system responsible for the transport of fructose, glucose, and sucrose in Corynebacterium glutamicum ATCC 13032 is the phosphoenolpyruvate:sugar phosphotransferase system (PTS). The genes encoding PTS components, namely ptsI, ptsH, and ptsF belong to the fructose-PTS gene cluster, whereas ptsG and ptsS are located in two separate regions of the C. glutamicum genome. Due to the localization within and adjacent to the fructose-PTS gene cluster, two genes coding for DeoR-type transcriptional regulators, cg2118 and sugR, are putative candidates involved in the transcriptional regulation of the fructose-PTS cluster genes. Results Four transcripts of the extended fructose-PTS gene cluster that comprise the genes sugR-cg2116, ptsI, cg2118-fruK-ptsF, and ptsH, respectively, were characterized. In addition, it was shown that transcription of the fructose-PTS gene cluster is enhanced during growth on glucose or fructose when compared to acetate. Subsequently, the two genes sugR and cg2118 encoding for DeoR-type regulators were mutated and PTS gene transcription was found to be strongly enhanced in the presence of acetate only in the sugR deletion mutant. The SugR regulon was further characterized by microarray hybridizations using the sugR mutant and its parental strain, revealing that also the PTS genes ptsG and ptsS belong to this regulon. Binding of purified SugR repressor protein to a 21 bp sequence identified the SugR binding site as an AC-rich motif. The two experimentally identified SugR binding sites in the fructose-PTS gene cluster are located within or downstream of the mapped promoters, typical for transcriptional repressors. Effector studies using electrophoretic mobility shift assays (EMSA) revealed the fructose PTS-specific metabolite fructose-1-phosphate (F-1-P) as a highly efficient, negative effector of the SugR repressor, acting in the micromolar range. Beside F-1-P, other sugar-phosphates like fructose-1,6-bisphosphate (F-1,6-P

  19. Regulation of Expression and Evolution of Genes in Plastids of Rhodophytic Branch

    PubMed Central

    Zverkov, Oleg Anatolyevich; Seliverstov, Alexandr Vladislavovich; Lyubetsky, Vassily Alexandrovich


    A novel algorithm and original software were used to cluster all proteins encoded in plastids of 72 species of the rhodophytic branch. The results are publicly available at in a database that allows fast identification of clusters (protein families) both by a fragment of an amino acid sequence and by a phylogenetic profile of a protein. No such integral clustering with the corresponding functions can be found in the public domain. The putative regulons of the transcription factors Ycf28 and Ycf29 encoded in the plastids were identified using the clustering and the database. A regulation of translation initiation was proposed for the ycf24 gene in plastids of certain red algae and apicomplexans as well as a regulation of a putative gene in apicoplasts of Babesia spp. and Theileria parva. The conserved regulation of the ycf24 gene expression and specificity alternation of the transcription factor Ycf28 were shown in the plastids. A phylogenetic tree of plastids was generated for the rhodophytic branch. The hypothesis of the origin of apicoplasts from the common ancestor of all apicomplexans from plastids of red algae was confirmed. PMID:26840333

  20. Involvement of outer membrane protein TolC, a possible member of the mar-sox regulon, in maintenance and improvement of organic solvent tolerance of Escherichia coli K-12.


    Aono, R; Tsukagoshi, N; Yamamoto, M


    Escherichia coli mutants with improved organic solvent tolerance levels showed high levels of outer membrane protein TolC and inner membrane protein AcrA. The TolC level was regulated positively by MarA, Rob, or SoxS. A possible mar-rob-sox box sequence was found upstream of the tolC gene. These findings suggest that tolC is a member of the mar-sox regulon responsive to stress conditions. When a defective tolC gene was transferred to n-hexane- or cyclohexane-tolerant strains by P1 transduction, the organic solvent tolerance level was lowered dramatically to the decane-tolerant and nonane-sensitive level. The tolerance level was restored by transformation of the transductants with a wild-type tolC gene. Therefore, it is evident that TolC is essential for E. coli to maintain organic solvent tolerance.

  1. The acid-inducible asr gene in Escherichia coli: transcriptional control by the phoBR operon.


    Suziedeliené, E; Suziedélis, K; Garbenciūté, V; Normark, S


    Escherichia coli responds to external acidification (pH 4.0 to 5.0) by synthesizing a newly identified, approximately 450-nucleotide RNA component. At maximal levels of induction it is one of the most abundant small RNAs in the cell and is relatively stable bacterial RNA. The acid-inducible RNA was purified, and the gene encoding it, designated asr (for acid shock RNA), mapped at 35.98 min on the E. coli chromosome. Analysis of the asr DNA sequence revealed an open reading frame coding for a 111-amino-acid polypeptide with a deduced molecular mass of approximately 11.6 kDa. According to computer-assisted analysis, the predicted polypeptide contains a typical signal sequence of 30 amino acids and might represent either a periplasmic or an outer membrane protein. The asr gene cloned downstream from a T7 promoter was translated in vivo after transcription using a T7 RNA polymerase transcription system. Expression of a plasmid-encoded asr::lacZ fusion under a native asr promoter was reduced approximately 15-fold in a complex medium, such as Luria-Bertani medium, versus the minimal medium. Transcription of the chromosomal asr was abolished in the presence of a phoB-phoR (a two-component regulatory system, controlling the pho regulon inducible by phosphate starvation) deletion mutant. Acid-mediated induction of the asr gene in the Delta(phoB-phoR) mutant strain was restored by introduction of the plasmid with cloned phoB-phoR genes. Primer extension analysis of the asr transcript revealed a region similar to the Pho box (the consensus sequence found in promoters transcriptionally activated by the PhoB protein) upstream from the determined transcription start. The asr promoter DNA region was demonstrated to bind PhoB protein in vitro. We discuss our results in terms of how bacteria might employ the phoB-phoR regulatory system to sense an external acidity and regulate transcription of the asr gene.

  2. The heat-inducible essential response regulator WalR positively regulates transcription of sigI, mreBH and lytE in Bacillus subtilis under heat stress.


    Huang, Wan-Zhen; Wang, Jyun-Jhih; Chen, Hui-Ju; Chen, Jung-Tze; Shaw, Gwo-Chyuan


    The actin homolog MreBH governs cell morphogenesis of Bacillus subtilis through localization of the cell wall hydrolase LytE. The alternative sigma factor SigI of B. subtilis coordinately regulates transcription of mreBH and lytE. Transcription of sigI, mreBH and lytE is heat-inducible. The essential response regulator WalR (YycF) plays a key role in coordinating cell wall metabolism with cell proliferation. We now demonstrate that mreBH is a new member of the WalR regulon. We also found that WalR can positively and directly regulate sigI transcription under heat stress through a binding site located upstream of the σ(I) promoter of sigI. In addition, we found that a WalR binding site located upstream of the SigI binding site in the regulatory region of lytE is important for lytE expression under heat stress. Moreover, we found that walR is a new member of the heat shock stimulon of B. subtilis. WalR appears to coordinately and positively regulate transcription of sigI, mreBH and lytE under heat stress. Finally, our work shows for the first time that WalR can stimulate activities of σ(I) promoters under heat stress.

  3. Output targets and transcriptional regulation by a cyclic dimeric GMP-responsive circuit in the Vibrio parahaemolyticus Scr network.


    Ferreira, Rosana B R; Chodur, Daniel M; Antunes, Luis Caetano M; Trimble, Michael J; McCarter, Linda L


    The Vibrio parahaemolyticus Scr system modulates decisions pertinent to surface colonization by affecting the cellular level of cyclic dimeric GMP (c-di-GMP). In this work, we explore the scope and mechanism of this regulation. Transcriptome comparison of ΔscrABC and wild-type strains revealed expression differences with respect to ∼100 genes. Elevated c-di-GMP repressed genes in the surface-sensing regulon, including those encoding the lateral flagellar and type III secretion systems and N-acetylglucosamine-binding protein GpbA while inducing genes encoding other cell surface molecules and capsular polysaccharide. The transcription of a few regulatory genes was also affected, and the role of one was characterized. Mutations in cpsQ suppressed the sticky phenotype of scr mutants. cpsQ encodes one of four V. parahaemolyticus homologs in the CsgD/VpsT family, members of which have been implicated in c-di-GMP signaling. Here, we demonstrate that CpsQ is a c-di-GMP-binding protein. By using a combination of mutant and reporter analyses, CpsQ was found to be the direct, positive regulator of cpsA transcription. This c-di-GMP-responsive regulatory circuit could be reconstituted in Escherichia coli, where a low level of this nucleotide diminished the stability of CpsQ. The molecular interplay of additional known cps regulators was defined by establishing that CpsS, another CsgD family member, repressed cpsR, and the transcription factor CpsR activated cpsQ. Thus, we are developing a connectivity map of the Scr decision-making network with respect to its wiring and output strategies for colonizing surfaces and interaction with hosts; in doing so, we have isolated and reproduced a c-di-GMP-sensitive regulatory module in the circuit.

  4. Adaptation with transcriptional regulation

    NASA Astrophysics Data System (ADS)

    Shi, Wenjia; Ma, Wenzhe; Xiong, Liyang; Zhang, Mingyue; Tang, Chao


    Biochemical adaptation is one of the basic functions that are widely implemented in biological systems for a variety of purposes such as signal sensing, stress response and homeostasis. The adaptation time scales span from milliseconds to days, involving different regulatory machineries in different processes. The adaptive networks with enzymatic regulation (ERNs) have been investigated in detail. But it remains unclear if and how other forms of regulation will impact the network topology and other features of the function. Here, we systematically studied three-node transcriptional regulatory networks (TRNs), with three different types of gene regulation logics. We found that the topologies of adaptive gene regulatory networks can still be grouped into two general classes: negative feedback loop (NFBL) and incoherent feed-forward loop (IFFL), but with some distinct topological features comparing to the enzymatic networks. Specifically, an auto-activation loop on the buffer node is necessary for the NFBL class. For IFFL class, the control node can be either a proportional node or an inversely-proportional node. Furthermore, the tunability of adaptive behavior differs between TRNs and ERNs. Our findings highlight the role of regulation forms in network topology, implementation and dynamics.

  5. Adaptation with transcriptional regulation.


    Shi, Wenjia; Ma, Wenzhe; Xiong, Liyang; Zhang, Mingyue; Tang, Chao


    Biochemical adaptation is one of the basic functions that are widely implemented in biological systems for a variety of purposes such as signal sensing, stress response and homeostasis. The adaptation time scales span from milliseconds to days, involving different regulatory machineries in different processes. The adaptive networks with enzymatic regulation (ERNs) have been investigated in detail. But it remains unclear if and how other forms of regulation will impact the network topology and other features of the function. Here, we systematically studied three-node transcriptional regulatory networks (TRNs), with three different types of gene regulation logics. We found that the topologies of adaptive gene regulatory networks can still be grouped into two general classes: negative feedback loop (NFBL) and incoherent feed-forward loop (IFFL), but with some distinct topological features comparing to the enzymatic networks. Specifically, an auto-activation loop on the buffer node is necessary for the NFBL class. For IFFL class, the control node can be either a proportional node or an inversely-proportional node. Furthermore, the tunability of adaptive behavior differs between TRNs and ERNs. Our findings highlight the role of regulation forms in network topology, implementation and dynamics.

  6. Adaptation with transcriptional regulation

    PubMed Central

    Shi, Wenjia; Ma, Wenzhe; Xiong, Liyang; Zhang, Mingyue; Tang, Chao


    Biochemical adaptation is one of the basic functions that are widely implemented in biological systems for a variety of purposes such as signal sensing, stress response and homeostasis. The adaptation time scales span from milliseconds to days, involving different regulatory machineries in different processes. The adaptive networks with enzymatic regulation (ERNs) have been investigated in detail. But it remains unclear if and how other forms of regulation will impact the network topology and other features of the function. Here, we systematically studied three-node transcriptional regulatory networks (TRNs), with three different types of gene regulation logics. We found that the topologies of adaptive gene regulatory networks can still be grouped into two general classes: negative feedback loop (NFBL) and incoherent feed-forward loop (IFFL), but with some distinct topological features comparing to the enzymatic networks. Specifically, an auto-activation loop on the buffer node is necessary for the NFBL class. For IFFL class, the control node can be either a proportional node or an inversely-proportional node. Furthermore, the tunability of adaptive behavior differs between TRNs and ERNs. Our findings highlight the role of regulation forms in network topology, implementation and dynamics. PMID:28233824

  7. A direct link between the global regulator PhoP and the Csr regulon in Y. pseudotuberculosis through the small regulatory RNA CsrC.


    Nuss, Aaron M; Schuster, Franziska; Kathrin Heroven, Ann; Heine, Wiebke; Pisano, Fabio; Dersch, Petra


    In this study we investigated the influence of the global response regulator PhoP on the complex regulatory cascade controlling expression of early stage virulence genes of Yersinia pseudotuberculosis via the virulence regulator RovA. Our analysis revealed the following novel features: (1) PhoP activates expression of the CsrC RNA in Y. pseudotuberculosis, leading to activation of RovA synthesis through the CsrABC-RovM cascade, (2) activation of csrC transcription is direct and PhoP is shown to bind to two separate PhoP box-like sites, (3) PhoP-mediated activation results in transcription from two different promoters closely downstream of the PhoP binding sites, leading to two distinct CsrC RNAs, and (4) the stability of the CsrC RNAs differs significantly between the Y. pseudotuberculosis strains YPIII and IP32953 due to a 20 nucleotides insertion in CsrC(IP32953), which renders the transcript more susceptible to degradation. In summary, our study showed that PhoP-mediated influence on the regulatory cascade controlling the Csr system and RovA in Y. pseudotuberculosis varies within the species, suggesting that the Csr system is a focal point to readjust and adapt the genus to different hosts and reservoirs.

  8. Action of multiple intra-QTL genes concerted around a co-localized transcription factor underpins a large effect QTL

    PubMed Central

    Dixit, Shalabh; Kumar Biswal, Akshaya; Min, Aye; Henry, Amelia; Oane, Rowena H.; Raorane, Manish L.; Longkumer, Toshisangba; Pabuayon, Isaiah M.; Mutte, Sumanth K.; Vardarajan, Adithi R.; Miro, Berta; Govindan, Ganesan; Albano-Enriquez, Blesilda; Pueffeld, Mandy; Sreenivasulu, Nese; Slamet-Loedin, Inez; Sundarvelpandian, Kalaipandian; Tsai, Yuan-Ching; Raghuvanshi, Saurabh; Hsing, Yue-Ie C.; Kumar, Arvind; Kohli, Ajay


    Sub-QTLs and multiple intra-QTL genes are hypothesized to underpin large-effect QTLs. Known QTLs over gene families, biosynthetic pathways or certain traits represent functional gene-clusters of genes of the same gene ontology (GO). Gene-clusters containing genes of different GO have not been elaborated, except in silico as coexpressed genes within QTLs. Here we demonstrate the requirement of multiple intra-QTL genes for the full impact of QTL qDTY12.1 on rice yield under drought. Multiple evidences are presented for the need of the transcription factor ‘no apical meristem’ (OsNAM12.1) and its co-localized target genes of separate GO categories for qDTY12.1 function, raising a regulon-like model of genetic architecture. The molecular underpinnings of qDTY12.1 support its effectiveness in further improving a drought tolerant genotype and for its validity in multiple genotypes/ecosystems/environments. Resolving the combinatorial value of OsNAM12.1 with individual intra-QTL genes notwithstanding, identification and analyses of qDTY12.1has fast-tracked rice improvement towards food security. PMID:26507552

  9. Mutation in the transcriptional regulator PhoP contributes to avirulence of Mycobacterium tuberculosis H37Ra strain.


    Lee, Jong Seok; Krause, Roland; Schreiber, Jörg; Mollenkopf, Hans-Joachim; Kowall, Jane; Stein, Robert; Jeon, Bo-Young; Kwak, Jeong-Yeon; Song, Min-Kyong; Patron, Juan Pablo; Jorg, Sabine; Roh, Kyoungmin; Cho, Sang-Nae; Kaufmann, Stefan H E


    Attenuated strains of mycobacteria can be exploited to determine genes essential for their pathogenesis and persistence. To this goal, we sequenced the genome of H37Ra, an attenuated variant of Mycobacterium tuberculosis H37Rv strain. Comparison with H37Rv revealed three unique coding region polymorphisms. One polymorphism was located in the DNA-binding domain of the transcriptional regulator PhoP, causing the protein's diminished DNA-binding capacity. Temporal gene expression profiles showed that several genes with reduced expression in H37Ra were also repressed in an H37Rv phoP knockout strain. At later time points, genes of the dormancy regulon, typically expressed in a state of nonreplicating persistence, were upregulated in H37Ra. Complementation of H37Ra with H37Rv phoP partially restored its persistence in a murine macrophage infection model. Our approach demonstrates the feasibility of identifying minute but distinct differences between isogenic strains and illustrates the consequences of single point mutations on the survival stratagem of M. tuberculosis.

  10. Transcriptional profiling of Bordetella pertussis reveals requirement of RNA chaperone Hfq for Type III secretion system functionality.


    Bibova, Ilona; Hot, David; Keidel, Kristina; Amman, Fabian; Slupek, Stephanie; Cerny, Ondrej; Gross, Roy; Vecerek, Branislav


    Bordetella pertussis, the causative agent of human whooping cough (pertussis) produces a complex array of virulence factors in order to establish efficient infection in the host. The RNA chaperone Hfq and small regulatory RNAs are key players in posttranscriptional regulation in bacteria and have been shown to play an essential role in virulence of a broad spectrum of bacterial pathogens. This study represents the first attempt to characterize the Hfq regulon of the human pathogen B. pertussis under laboratory conditions as well as upon passage in the host and indicates that loss of Hfq has a profound effect on gene expression in B. pertussis. Comparative transcriptional profiling revealed that Hfq is required for expression of several virulence factors in B. pertussis cells including the Type III secretion system (T3SS). In striking contrast to the wt strain, T3SS did not become operational in the hfq mutant passaged either through mice or macrophages thereby proving that Hfq is required for the functionality of the B. pertussis T3SS. Likewise, expression of virulence factors vag8 and tcfA encoding autotransporter and tracheal colonization factor, respectively, was strongly reduced in the hfq mutant. Importantly, for the first time we demonstrate that B. pertussis T3SS can be activated upon contact with macrophage cells in vitro.

  11. The unified ICE-CBF pathway provides a transcriptional feedback control of freezing tolerance during cold acclimation in Arabidopsis.


    Kim, Ye Seul; Lee, Minyoung; Lee, Jae-Hyung; Lee, Hyo-Jun; Park, Chung-Mo


    During cold acclimation, C-repeat binding factors (CBFs) activate downstream targets, such as cold-regulated genes, leading to the acquisition of freezing tolerance in plants. Inducer of CBF expression 1 (ICE1) plays a key role by activating CBF3 expression in shaping the cold-induced transcriptome. While the ICE1-CBF3 regulon constitutes a major cold acclimation pathway, gene regulatory networks governing the CBF signaling are poorly understood. Here, we demonstrated that ICE1 and its paralog ICE2 induce CBF1, CBF2, and CBF3 by binding to the gene promoters. ICE2, like ICE1, was ubiquitinated by the high expression of osmotically responsive gene 1 (HOS1) E3 ubiquitin ligase. Whereas ICE2-defective ice2-2 mutant did not exhibit any discernible freezing-sensitive phenotypes, ice1-2 ice2-2/+ plant, which is defective in ICE1 and has a heterozygotic ice2 mutation, exhibited significantly reduced freezing tolerance. Accordingly, all three CBF genes were markedly down-regulated in the ice1-2 ice2-2/+ plant, indicating that ICE1 and ICE2 are functionally redundant with different implementations in inducing CBF genes. Together with the negative regulation of CBF3 by CBF2, we propose that the unified ICE-CBF pathway provides a transcriptional feedback of freezing tolerance to sustain plant development and survival during cold acclimation.

  12. Transcription of Trypanosoma brucei maxicircles

    SciTech Connect

    Michelotti, E.F.; Hajduk, S.L.


    Trypanosoma brucei is a protozoan parasite which developmentally regulates mitochondrial activity. In the mammal T. brucei produces ATP entirely by glycolysis while cytochrome mediated respiration resumes in the life-stage in the midgut of the insect vector. Using quantitative S1 nuclease protection assays two types of regulation of the steady state levels of the mitochondrial transcripts were found. Transcription of cytochrome b, cytochrome oxidase, and the rRNA genes is repressed in early bloodstream developmental stages, undergoes dramatic activation in later bloodstream stages, and finally a lesser activation in the insect developmental stage. Transcription of NADH dehydrogenase genes, however, is unregulated. Mitochondrial transcripts with a 5' triphosphate terminus, representing the site of transcription initiation, were capped using guanylyl transferase. The in vitro capped RNA hybridized to only one of eight mitochondrial restriction fragments on a Southern blot, however, hybridization of Southern blots with RNA from ..cap alpha..-/sup 32/P-UTP pulsed mitochondria labelled all restriction fragments equally. These results suggest that each DNA strand has a single promoter which directs the transcription of a full-length RNA which is subsequently processed. Different mitochondrial genes, despite being expressed on the same precursor RNA molecule, are independently regulated by both transcription initiation and RNA processing.

  13. AthaMap, integrating transcriptional and post-transcriptional data

    PubMed Central

    Bülow, Lorenz; Engelmann, Stefan; Schindler, Martin; Hehl, Reinhard


    The AthaMap database generates a map of predicted transcription factor binding sites (TFBS) for the whole Arabidopsis thaliana genome. AthaMap has now been extended to include data on post-transcriptional regulation. A total of 403 173 genomic positions of small RNAs have been mapped in the A. thaliana genome. These identify 5772 putative post-transcriptionally regulated target genes. AthaMap tools have been modified to improve the identification of common TFBS in co-regulated genes by subtracting post-transcriptionally regulated genes from such analyses. Furthermore, AthaMap was updated to the TAIR7 genome annotation, a graphic display of gene analysis results was implemented, and the TFBS data content was increased. AthaMap is freely available at PMID:18842622

  14. Identification of host transcriptional networks showing concentration-dependent regulation by HPV16 E6 and E7 proteins in basal cervical squamous epithelial cells.


    Smith, Stephen P; Scarpini, Cinzia G; Groves, Ian J; Odle, Richard I; Coleman, Nicholas


    Development of cervical squamous cell carcinoma requires increased expression of the major high-risk human-papillomavirus (HPV) oncogenes E6 and E7 in basal cervical epithelial cells. We used a systems biology approach to identify host transcriptional networks in such cells and study the concentration-dependent changes produced by HPV16-E6 and -E7 oncoproteins. We investigated sample sets derived from the W12 model of cervical neoplastic progression, for which high quality phenotype/genotype data were available. We defined a gene co-expression matrix containing a small number of highly-connected hub nodes that controlled large numbers of downstream genes (regulons), indicating the scale-free nature of host gene co-expression in W12. We identified a small number of 'master regulators' for which downstream effector genes were significantly associated with protein levels of HPV16 E6 (n = 7) or HPV16 E7 (n = 5). We validated our data by depleting E6/E7 in relevant cells and by functional analysis of selected genes in vitro. We conclude that the network of transcriptional interactions in HPV16-infected basal-type cervical epithelium is regulated in a concentration-dependent manner by E6/E7, via a limited number of central master-regulators. These effects are likely to be significant in cervical carcinogenesis, where there is competitive selection of cells with elevated expression of virus oncoproteins.

  15. Identification of host transcriptional networks showing concentration-dependent regulation by HPV16 E6 and E7 proteins in basal cervical squamous epithelial cells

    PubMed Central

    Smith, Stephen P.; Scarpini, Cinzia G.; Groves, Ian J.; Odle, Richard I.; Coleman, Nicholas


    Development of cervical squamous cell carcinoma requires increased expression of the major high-risk human-papillomavirus (HPV) oncogenes E6 and E7 in basal cervical epithelial cells. We used a systems biology approach to identify host transcriptional networks in such cells and study the concentration-dependent changes produced by HPV16-E6 and -E7 oncoproteins. We investigated sample sets derived from the W12 model of cervical neoplastic progression, for which high quality phenotype/genotype data were available. We defined a gene co-expression matrix containing a small number of highly-connected hub nodes that controlled large numbers of downstream genes (regulons), indicating the scale-free nature of host gene co-expression in W12. We identified a small number of ‘master regulators’ for which downstream effector genes were significantly associated with protein levels of HPV16 E6 (n = 7) or HPV16 E7 (n = 5). We validated our data by depleting E6/E7 in relevant cells and by functional analysis of selected genes in vitro. We conclude that the network of transcriptional interactions in HPV16-infected basal-type cervical epithelium is regulated in a concentration-dependent manner by E6/E7, via a limited number of central master-regulators. These effects are likely to be significant in cervical carcinogenesis, where there is competitive selection of cells with elevated expression of virus oncoproteins. PMID:27457222

  16. XbmR, a new transcription factor involved in the regulation of chemotaxis, biofilm formation and virulence in Xanthomonas citri subsp. citri.


    Yaryura, Pablo M; Conforte, Valeria P; Malamud, Florencia; Roeschlin, Roxana; de Pino, Verónica; Castagnaro, Atilio P; McCarthy, Yvonne; Dow, J Maxwell; Marano, María R; Vojnov, Adrián A


    Xanthomonas citri subsp. citri (Xcc) is the causal agent of citrus canker. Biofilm formation on citrus leaves plays an important role in epiphytic survival of Xcc. Biofilm formation is affected by transposon insertion in XAC3733, which encodes a transcriptional activator of the NtrC family, not linked to a gene encoding a sensor protein, thus could be considered as an 'orphan' regulator whose function is poorly understood in Xanthomonas spp. Here we show that mutation of XAC3733 (named xbmR) resulted in impaired structural development of the Xcc biofilm, loss of chemotaxis and reduced virulence in grapefruit plants. All defective phenotypes were restored to wild-type levels by the introduction of PA2567 from Pseudomonas aeruginosa, which encodes a phosphodiesterase active in the degradation of cyclic diguanosine monophosphate (c-di-GMP). A knockout of xbmR led to a substantial downregulation of fliA that encodes a σ(28) transcription factor, as well as fliC and XAC0350 which are potential member of the σ(28) regulon. XAC0350 encodes an HD-GYP domain c-di-GMP phosphodiesterase. These findings suggest that XbmR is a key regulator of flagellar-dependent motility and chemotaxis exerting its action through a regulatory pathway that involves FliA and c-di-GMP.

  17. Identification of base and backbone contacts used for DNA sequence recognition and high-affinity binding by LAC9, a transcription activator containing a C6 zinc finger

    SciTech Connect

    Halvorsen, Yuan-Di C.; Nandabalan, K.; Dickson, R.C. )


    The LAC9 protein of Kluyveromyces lactis is a transcriptional regulator of genes in the lactose-galactose regulon. To regulate transcription, LAC9 must bind to 17-bp upstream activator sequences (UASs) located in front of each target gene. LAC9 is homologous to the GAL4 protein of Saccharomyces cerevisiae, and the two proteins must bind DNA in a very similar manner. In this paper the authors show that high-affinity, sequence-specific binding by LAC9 dimers is mediated primarily by 3 bp at each end of the UAS. In addition, at least one half of the UAS must have a GC or CG base pair at position 1 for high-affinity binding; LAC9k binds preferentially to the half containing the GC base pair. Hydroxyl radical footprinting shows that a LAC9 dimer binds an unusually broad region on one face of the DNA helix. Because of the data, they suggest that LAC9 contacts positions 6, 7, and 8, both plus and minus, of the UAS, which are separated by more than one turn of the DNA helix, and twists part way around the DNA, thus protecting the broad region of the minor groove between the major-groove contacts.

  18. Transcription regulation mechanisms of bacteriophages

    PubMed Central

    Yang, Haiquan; Ma, Yingfang; Wang, Yitian; Yang, Haixia; Shen, Wei; Chen, Xianzhong


    Phage diversity significantly contributes to ecology and evolution of new bacterial species through horizontal gene transfer. Therefore, it is essential to understand the mechanisms underlying phage-host interactions. After initial infection, the phage utilizes the transcriptional machinery of the host to direct the expression of its own genes. This review presents a view on the transcriptional regulation mechanisms of bacteriophages, and its contribution to phage diversity and classification. Through this review, we aim to broaden the understanding of phage-host interactions while providing a reference source for researchers studying the regulation of phage transcription. PMID:25482231

  19. The NsrR Regulon of Escherichia coli K-12 Includes Genes Encoding the Hybrid Cluster Protein and the Periplasmic, Respiratory Nitrite Reductase▿

    PubMed Central

    Filenko, Nina; Spiro, Stephen; Browning, Douglas F.; Squire, Derrick; Overton, Tim W.; Cole, Jeff; Constantinidou, Chrystala


    Successful pathogens must be able to protect themselves against reactive nitrogen species generated either as part of host defense mechanisms or as products of their own metabolism. The regulatory protein NsrR (a member of the Rrf2 family of transcription factors) plays key roles in this stress response. Microarray analysis revealed that NsrR represses nine operons encoding 20 genes in Escherichia coli MG1655, including the hmpA, ytfE, and ygbA genes that were previously shown to be regulated by NsrR. Novel NsrR targets revealed by this study include hcp-hcr (which were predicted in a recent bioinformatic study to be NsrR regulated) and the well-studied nrfA promoter that directs the expression of the periplasmic respiratory nitrite reductase. Conversely, transcription from the ydbC promoter is strongly activated by NsrR. Regulation of the nrf operon by NsrR is consistent with the ability of the periplasmic nitrite reductase to reduce nitric oxide and hence protect against reactive nitrogen species. Gel retardation assays were used to show that both FNR and NarL bind to the hcp promoter. The expression of hcp and the contiguous gene hcr is not induced by hydroxylamine. As hmpA and ytfE encode a nitric oxide reductase and a mechanism to repair iron-sulfur centers damaged by nitric oxide, the demonstration that hcp-hcr, hmpA, and ytfE are the three transcripts most tightly regulated by NsrR highlights the possibility that the hybrid cluster protein, HCP, might also be part of a defense mechanism against reactive nitrogen stress. PMID:17449618

  20. Coupling transcription and alternative splicing.


    Kornblihtt, Alberto R


    Alternative splicing regulation not only depends on the interaction of splicing factors with splicing enhancers and silencers in the pre-mRNA, but also on the coupling between transcription and splicing. This coupling is possible because splicing is often cotranscriptional and promoter identity and occupation may affect alternative splicing. We discuss here the different mechanisms by which transcription regulates alternative splicing. These include the recruitment of splicing factors to the transcribing polymerase and "kinetic coupling", which involves changes in the rate of transcriptional elongation that in turn affect the timing in which splice sites are presented to the splicing machinery. The recruitment mechanism may depend on the particular features of the carboxyl terminal domain of RNA polymerase II, whereas kinetic coupling seems to be linked to how changes in chromatin structure and other factors affect transcription elongation.

  1. RNA-guided transcriptional regulation


    Church, George M.; Mali, Prashant G.; Esvelt, Kevin M.


    Methods of modulating expression of a target nucleic acid in a cell are provided including introducing into the cell a first foreign nucleic acid encoding one or more RNAs complementary to DNA, wherein the DNA includes the target nucleic acid, introducing into the cell a second foreign nucleic acid encoding a nuclease-null Cas9 protein that binds to the DNA and is guided by the one or more RNAs, introducing into the cell a third foreign nucleic acid encoding a transcriptional regulator protein or domain, wherein the one or more RNAs, the nuclease-null Cas9 protein, and the transcriptional regulator protein or domain are expressed, wherein the one or more RNAs, the nuclease-null Cas9 protein and the transcriptional regulator protein or domain co-localize to the DNA and wherein the transcriptional regulator protein or domain regulates expression of the target nucleic acid.

  2. Nucleolar localization of myc transcripts.

    PubMed Central

    Bond, V C; Wold, B


    In situ hybridization has revealed a striking subnuclear distribution of c-myc RNA transcripts. A major fraction of the sense-strand nuclear c-myc transcripts was localized to the nucleoli. myc intron 1-containing RNAs were noticeably absent from nucleoli, accumulating instead in the nucleoplasm. The localization of myc RNA to nucleoli was shown to be common to a number of diverse cell types, including primary Sertoli cells and several cell lines. Furthermore, nucleolar localization was not restricted to c-myc and N-myc and myoD transcripts also displayed this phenomenon. In contrast, gamma-actin or lactate dehydrogenase transcripts did not display nucleolar localization. These observations suggest a new role for the nucleolus in transport and/or turnover of potential mRNAs. Images PMID:7684491

  3. A Conserved Transcriptional Regulator Governs Fungal Morphology in Widely Diverged Species

    PubMed Central

    Cain, Christopher W.; Lohse, Matthew B.; Homann, Oliver R.; Sil, Anita; Johnson, Alexander D.


    Fungi exhibit a large variety of morphological forms. Here, we examine the functions of a deeply conserved regulator of morphology in three fungal species: Saccharomyces cerevisiae, Candida albicans, and Histoplasma capsulatum. We show that, despite an estimated 600 million years since those species diverged from a common ancestor, Wor1 in C. albicans, Ryp1 in H. capsulatum, and Mit1 in S. cerevisiae are transcriptional regulators that recognize the same DNA sequence. Previous work established that Wor1 regulates white–opaque switching in C. albicans and that its ortholog Ryp1 regulates the yeast to mycelial transition in H. capsulatum. Here we show that the ortholog Mit1 in S. cerevisiae is also a master regulator of a morphological transition, in this case pseudohyphal growth. Full-genome chromatin immunoprecipitation experiments show that Mit1 binds to the control regions of the previously known regulators of pseudohyphal growth as well as those of many additional genes. Through a comparison of binding sites for Mit1 in S. cerevisiae, Wor1 in C. albicans, and Wor1 ectopically expressed in S. cerevisiae, we conclude that the genes controlled by the orthologous regulators overlap only slightly between these two species despite the fact that the DNA binding specificity of the regulators has remained largely unchanged. We suggest that the ancestral Wor1/Mit1/Ryp1 protein controlled aspects of cell morphology and that movement of genes in and out of the Wor1/Mit1/Ryp1 regulon is responsible, in part, for the differences of morphological forms among these species. PMID:22095082

  4. Contrasting Transcriptional Responses of a Virulent and an Attenuated Strain of Mycobacterium tuberculosis Infecting Macrophages

    PubMed Central

    Hinds, Jason; Malloff, Chad A.; Bains, Manjeet; Hancock, Robert E.; Lam, Wan L.


    Background H37Rv and H37Ra are well-described laboratory strains of Mycobacterium tuberculosis derived from the same parental strain, H37, that show dramatically different pathogenic phenotypes. Methodology/Principal Findings In this study, the transcriptomes of the two strains during axenic growth in broth and during intracellular growth within murine bone-marrow macrophages were compared by whole genome expression profiling. We identified and compared adaptations of either strain upon encountering an intracellular environment, and also contrasted the transcriptomes of the two strains while inside macrophages. In the former comparison, both strains induced genes that would facilitate intracellular survival including those involved in mycobactin synthesis and fatty acid metabolism. However, this response was stronger and more extensive for H37Rv than for H37Ra. This was manifested as the differential expression of a greater number of genes and an increased magnitude of expression for these genes in H37Rv. In comparing intracellular transcriptional signatures, fifty genes were found to be differentially expressed between the strains. Of these fifty, twelve were under control of the PhoPR regulon. Further differences between strains included genes whose products were members of the ESAT-6 family of proteins, or were associated with their secretion. Conclusions/Significance Along with the recent identification of single nucleotide polymorphisms in H37Ra when compared to H37Rv, our demonstration of differential expression of PhoP-regulated and ESX-1 region-related genes during macrophage infection further highlights the significance of these genes in the attenuation of H37Ra. PMID:20548782

  5. Transcriptional response of Saccharomyces cerevisiae to different nitrogen concentrations during alcoholic fermentation.


    Mendes-Ferreira, A; del Olmo, M; García-Martínez, J; Jiménez-Martí, E; Mendes-Faia, A; Pérez-Ortín, J E; Leão, C


    Gene expression profiles of a wine strain of Saccharomyces cerevisiae PYCC4072 were monitored during alcoholic fermentations with three different nitrogen supplies: (i) control fermentation (with enough nitrogen to complete sugar fermentation), (ii) nitrogen-limiting fermentation, and (iii) the addition of nitrogen to the nitrogen-limiting fermentation (refed fermentation). Approximately 70% of the yeast transcriptome was altered in at least one of the fermentation stages studied, revealing the continuous adjustment of yeast cells to stressful conditions. Nitrogen concentration had a decisive effect on gene expression during fermentation. The largest changes in transcription profiles were observed when the early time points of the N-limiting and control fermentations were compared. Despite the high levels of glucose present in the media, the early responses of yeast cells to low nitrogen were characterized by the induction of genes involved in oxidative glucose metabolism, including a significant number of mitochondrial associated genes resembling the yeast cell response to glucose starvation. As the N-limiting fermentation progressed, a general downregulation of genes associated with catabolism was observed. Surprisingly, genes encoding ribosomal proteins and involved in ribosome biogenesis showed a slight increase during N starvation; besides, genes that comprise the RiBi regulon behaved distinctively under the different experimental conditions. Here, for the first time, the global response of nitrogen-depleted cells to nitrogen addition under enological conditions is described. An important gene expression reprogramming occurred after nitrogen addition; this reprogramming affected genes involved in glycolysis, thiamine metabolism, and energy pathways, which enabled the yeast strain to overcome the previous nitrogen starvation stress and restart alcoholic fermentation.

  6. The Transcriptional Activator LdtR from ‘Candidatus Liberibacter asiaticus’ Mediates Osmotic Stress Tolerance

    PubMed Central

    Bojilova, Lora; Sarnegrim, Amanda; Tamayo, Cheila; Potts, Anastasia H.; Teplitski, Max; Folimonova, Svetlana Y.; Gonzalez, Claudio F.; Lorca, Graciela L.


    The causal agent of Huanglongbing disease, ‘Candidatus Liberibacter asiaticus’, is a non-culturable, gram negative, phloem-limited α-proteobacterium. Current methods to control the spread of this disease are still limited to the removal and destruction of infected trees. In this study, we identified and characterized a regulon from ‘Ca. L. asiaticus’ involved in cell wall remodeling, that contains a member of the MarR family of transcriptional regulators (ldtR), and a predicted L,D-transpeptidase (ldtP). In Sinorhizobium meliloti, mutation of ldtR resulted in morphological changes (shortened rod-type phenotype) and reduced tolerance to osmotic stress. A biochemical approach was taken to identify small molecules that modulate LdtR activity. The LdtR ligands identified by thermal shift assays were validated using DNA binding methods. The biological impact of LdtR inactivation by the small molecules was then examined in Sinorhizobium meliloti and Liberibacter crescens, where a shortened-rod phenotype was induced by growth in presence of the ligands. A new method was also developed to examine the effects of small molecules on the viability of ‘Ca. Liberibacter asiaticus’, using shoots from HLB-infected orange trees. Decreased expression of ldtRLas and ldtPLas was observed in samples taken from HLB-infected shoots after 6 h of incubation with the LdtR ligands. These results provide strong proof of concept for the use of small molecules that target LdtR, as a potential treatment option for Huanglongbing disease. PMID:24763829

  7. The transcriptional landscape of the mammalian genome.


    Carninci, P; Kasukawa, T; Katayama, S; Gough, J; Frith, M C; Maeda, N; Oyama, R; Ravasi, T; Lenhard, B; Wells, C; Kodzius, R; Shimokawa, K; Bajic, V B; Brenner, S E; Batalov, S; Forrest, A R R; Zavolan, M; Davis, M J; Wilming, L G; Aidinis, V; Allen, J E; Ambesi-Impiombato, A; Apweiler, R; Aturaliya, R N; Bailey, T L; Bansal, M; Baxter, L; Beisel, K W; Bersano, T; Bono, H; Chalk, A M; Chiu, K P; Choudhary, V; Christoffels, A; Clutterbuck, D R; Crowe, M L; Dalla, E; Dalrymple, B P; de Bono, B; Della Gatta, G; di Bernardo, D; Down, T; Engstrom, P; Fagiolini, M; Faulkner, G; Fletcher, C F; Fukushima, T; Furuno, M; Futaki, S; Gariboldi, M; Georgii-Hemming, P; Gingeras, T R; Gojobori, T; Green, R E; Gustincich, S; Harbers, M; Hayashi, Y; Hensch, T K; Hirokawa, N; Hill, D; Huminiecki, L; Iacono, M; Ikeo, K; Iwama, A; Ishikawa, T; Jakt, M; Kanapin, A; Katoh, M; Kawasawa, Y; Kelso, J; Kitamura, H; Kitano, H; Kollias, G; Krishnan, S P T; Kruger, A; Kummerfeld, S K; Kurochkin, I V; Lareau, L F; Lazarevic, D; Lipovich, L; Liu, J; Liuni, S; McWilliam, S; Madan Babu, M; Madera, M; Marchionni, L; Matsuda, H; Matsuzawa, S; Miki, H; Mignone, F; Miyake, S; Morris, K; Mottagui-Tabar, S; Mulder, N; Nakano, N; Nakauchi, H; Ng, P; Nilsson, R; Nishiguchi, S; Nishikawa, S; Nori, F; Ohara, O; Okazaki, Y; Orlando, V; Pang, K C; Pavan, W J; Pavesi, G; Pesole, G; Petrovsky, N; Piazza, S; Reed, J; Reid, J F; Ring, B Z; Ringwald, M; Rost, B; Ruan, Y; Salzberg, S L; Sandelin, A; Schneider, C; Schönbach, C; Sekiguchi, K; Semple, C A M; Seno, S; Sessa, L; Sheng, Y; Shibata, Y; Shimada, H; Shimada, K; Silva, D; Sinclair, B; Sperling, S; Stupka, E; Sugiura, K; Sultana, R; Takenaka, Y; Taki, K; Tammoja, K; Tan, S L; Tang, S; Taylor, M S; Tegner, J; Teichmann, S A; Ueda, H R; van Nimwegen, E; Verardo, R; Wei, C L; Yagi, K; Yamanishi, H; Zabarovsky, E; Zhu, S; Zimmer, A; Hide, W; Bult, C; Grimmond, S M; Teasdale, R D; Liu, E T; Brusic, V; Quackenbush, J; Wahlestedt, C; Mattick, J S; Hume, D A; Kai, C; Sasaki, D; Tomaru, Y; Fukuda, S; Kanamori-Katayama, M; Suzuki, M; Aoki, J; Arakawa, T; Iida, J; Imamura, K; Itoh, M; Kato, T; Kawaji, H; Kawagashira, N; Kawashima, T; Kojima, M; Kondo, S; Konno, H; Nakano, K; Ninomiya, N; Nishio, T; Okada, M; Plessy, C; Shibata, K; Shiraki, T; Suzuki, S; Tagami, M; Waki, K; Watahiki, A; Okamura-Oho, Y; Suzuki, H; Kawai, J; Hayashizaki, Y


    This study describes comprehensive polling of transcription start and termination sites and analysis of previously unidentified full-length complementary DNAs derived from the mouse genome. We identify the 5' and 3' boundaries of 181,047 transcripts with extensive variation in transcripts arising from alternative promoter usage, splicing, and polyadenylation. There are 16,247 new mouse protein-coding transcripts, including 5154 encoding previously unidentified proteins. Genomic mapping of the transcriptome reveals transcriptional forests, with overlapping transcription on both strands, separated by deserts in which few transcripts are observed. The data provide a comprehensive platform for the comparative analysis of mammalian transcriptional regulation in differentiation and development.

  8. ChIP-seq analysis of the σE regulon of Salmonella enterica serovar typhimurium reveals new genes implicated in heat shock and oxidative stress response


    Li, Jie; Overall, Christopher C.; Johnson, Rudd C.; ...


    The alternative sigma factor σE functions to maintain bacterial homeostasis and membrane integrity in response to extracytoplasmic stress by regulating thousands of genes both directly and indirectly. The transcriptional regulatory network governed by σE in Salmonella and E. coli has been examined using microarray, however a genome-wide analysis of σE–binding sites inSalmonella has not yet been reported. We infected macrophages with Salmonella Typhimurium over a select time course. Using chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq), 31 σE–binding sites were identified. Seventeen sites were new, which included outer membrane proteins, a quorum-sensing protein, a cell division factor, and amore » signal transduction modulator. The consensus sequence identified for σE in vivo binding was similar to the one previously reported, except for a conserved G and A between the -35 and -10 regions. One third of the σE–binding sites did not contain the consensus sequence, suggesting there may be alternative mechanisms by which σE modulates transcription. By dissecting direct and indirect modes of σE-mediated regulation, we found that σE activates gene expression through recognition of both canonical and reversed consensus sequence. Lastly, new σE regulated genes (greA, luxS, ompA and ompX) are shown to be involved in heat shock and oxidative stress responses.« less

  9. ChIP-Seq Analysis of the σE Regulon of Salmonella enterica Serovar Typhimurium Reveals New Genes Implicated in Heat Shock and Oxidative Stress Response

    SciTech Connect

    Li, Jie; Overall, Christopher C.; Johnson, Rudd C.; Jones, Marcus B.; McDermott, Jason E.; Heffron, Fred; Adkins, Joshua N.; Cambronne, Eric D.; Hensel, Michael


    The alternative sigma factor σE functions to maintain bacterial homeostasis and membrane integrity in response to extracytoplasmic stress by regulating thousands of genes both directly and indirectly. The transcriptional regulatory network governed by σE in Salmonella and E. colihas been examined using microarray, however a genome-wide analysis of σE–binding sites inSalmonella has not yet been reported. We infected macrophages with Salmonella Typhimurium over a select time course. Using chromatin immunoprecipitation followed by high-throughput DNA sequencing (ChIP-seq), 31 σE–binding sites were identified. Seventeen sites were new, which included outer membrane proteins, a quorum-sensing protein, a cell division factor, and a signal transduction modulator. The consensus sequence identified for σE in vivo binding was similar to the one previously reported, except for a conserved G and A between the -35 and -10 regions. One third of the σE–binding sites did not contain the consensus sequence, suggesting there may be alternative mechanisms by which σE modulates transcription. By dissecting direct and indirect modes of σE-mediated regulation, we found that σE activates gene expression through recognition of both canonical and reversed consensus sequence. New σEregulated genes (greA, luxS, ompA and ompX) are shown to be involved in heat shock and oxidative stress responses.

  10. Structures of the Porphyromonas gingivalis OxyR regulatory domain explain differences in expression of the OxyR regulon in Escherichia coli and P. gingivalis

    SciTech Connect

    Svintradze, David V.; Peterson, Darrell L.; Collazo-Santiago, Evys A.; Lewis, Janina P.; Wright, H. Tonie


    Differences in OxyR regulated expression of oxidative stress genes between Escherichia coli and Porphyromonas gingivalis are explained by very minor differences in structure and amino-acid sequence of the respective oxidized and reduced OxyR regulatory domains. These differences affect OxyR quaternary structures and are predicted from model building of full length OxyR–DNA complexes to confer distinct modes of DNA binding on this transcriptional regulator. OxyR transcriptionally regulates Escherichia coli oxidative stress response genes through a reversibly reducible cysteine disulfide biosensor of cellular redox status. Structural changes induced by redox changes in these cysteines are conformationally transmitted to the dimer subunit interfaces, which alters dimer and tetramer interactions with DNA. In contrast to E. coli OxyR regulatory-domain structures, crystal structures of Porphyromonas gingivalis OxyR regulatory domains show minimal differences in dimer configuration on changes in cysteine disulfide redox status. This locked configuration of the P. gingivalis OxyR regulatory-domain dimer closely resembles the oxidized (activating) form of the E. coli OxyR regulatory-domain dimer. It correlates with the observed constitutive activation of some oxidative stress genes in P. gingivalis and is attributable to a single amino-acid insertion in P. gingivalis OxyR relative to E. coli OxyR. Modelling of full-length P. gingivalis, E. coli and Neisseria meningitidis OxyR–DNA complexes predicts different modes of DNA binding for the reduced and oxidized forms of each.

  11. The ornibactin biosynthesis and transport genes of Burkholderia cenocepacia are regulated by an extracytoplasmic function sigma factor which is a part of the Fur regulon.


    Agnoli, Kirsty; Lowe, Carolyn A; Farmer, Kate L; Husnain, Seyyed I; Thomas, Mark S


    Burkholderia cenocepacia mutants that fail to produce the siderophore ornibactin were obtained following mutagenesis with mini-Tn5Tp. These mutants were shown to be growth restricted under conditions of iron depletion. In eight of the mutants, the transposon had integrated into one of two genes, orbI and orbJ, encoding nonribosomal peptide synthetases. In the other mutant, the transposon had inserted into an open reading frame, orbS, located upstream from orbI. The polypeptide product of orbS exhibits a high degree of similarity to the Pseudomonas aeruginosa extracytoplasmic function (ECF) sigma factor PvdS but possesses an N-terminal extension of approximately 29 amino acids that is not present in PvdS. Three predicted OrbS-dependent promoters were identified within the ornibactin gene cluster, based on their similarity to PvdS-dependent promoters. The iron-regulated activity of these promoters was shown to require OrbS. Transcription of the orbS gene was found to be under the control of an iron-regulated sigma(70)-dependent promoter. This promoter, but not the OrbS-dependent promoters, was shown to be a target for repression by the global regulator Fur. Our results demonstrate that production of ornibactin by B. cenocepacia in response to iron starvation requires transcription of an operon that is dependent on the Fur-regulated ECF sigma factor gene orbS. A mechanism is also proposed for the biosynthesis of ornibactin.

  12. Genome-Wide Transcriptional Analysis of the Phosphate Starvation Stimulon of Bacillus subtilis†

    PubMed Central

    Allenby, Nicholas E. E.; O'Connor, Nicola; Prágai, Zoltán; Ward, Alan C.; Wipat, Anil; Harwood, Colin R.


    Bacillus subtilis responds to phosphate starvation stress by inducing the PhoP and SigB regulons. While the PhoP regulon provides a specific response to phosphate starvation stress, maximizing the acquisition of phosphate (Pi) from the environment and reducing the cellular requirement for this essential nutrient, the SigB regulon provides nonspecific resistance to stress by protecting essential cellular components, such as DNA and membranes. We have characterized the phosphate starvation stress response of B. subtilis at a genome-wide level using DNA macroarrays. A combination of outlier and cluster analyses identified putative new members of the PhoP regulon, namely, yfkN (2′,3′ cyclic nucleotide 2′-phosphodiesterase), yurI (RNase), yjdB (unknown), and vpr (extracellular serine protease). YurI is thought to be responsible for the nonspecific degradation of RNA, while the activity of YfkN on various nucleotide phosphates suggests that it could act on substrates liberated by YurI, which produces 3′ or 5′ phosphoribonucleotides. The putative new PhoP regulon members are either known or predicted to be secreted and are likely to be important for the recovery of inorganic phosphate from a variety of organic sources of phosphate in the environment. PMID:16291680

  13. Transcriptional regulation by post-transcriptional modification--role of phosphorylation in Sp1 transcriptional activity.


    Chu, Shijian


    Sp1 is a ubiquitously expressed transcription factor involved in the regulation of a large number of genes including housekeeping genes as well as actively regulated genes. Although Sp1 was discovered nearly three decades ago, its functional diversity is still not completely understood. One of the ways that make Sp1 versatile in transcriptional regulation is its post-transcriptional modification, which alters Sp1 structure in different cells and at different times. Compared to other types of modifications of the Sp1 protein, phosphorylation has been studied far more extensively. This review focuses on the inducers, pathways, enzymes, and biological effects of Sp1 phosphorylation. Recent data are beginning to reveal the biological significance and universal presence of Sp1 phosphorylation-related cell/molecular responses. Studies in this field provide a quick glance at how a simple chemical modification of a transcription factor could produce significant functional diversity of the protein.

  14. Two functions of the C-terminal domain of Escherichia coli Rob: mediating "sequestration-dispersal" as a novel off-on switch for regulating Rob's activity as a transcription activator and preventing degradation of Rob by Lon protease.


    Griffith, Kevin L; Fitzpatrick, M Megan; Keen, Edward F; Wolf, Richard E


    In Escherichia coli, Rob activates transcription of the SoxRS/MarA/Rob regulon. Previous work revealed that Rob resides in three to four immunostainable foci, that dipyridyl and bile salts are inducers of its activity, and that inducers bind to Rob's C-terminal domain (CTD). We propose that sequestration inactivates Rob by blocking its access to the transcriptional machinery and that inducers activate Rob by mediating its dispersal, allowing interaction with RNA polymerase. To test "sequestration-dispersal" as a new mechanism for regulating the activity of transcriptional activators, we fused Rob's CTD to SoxS and used indirect immunofluorescence microscopy to determine the effect of inducers on SoxS-Rob's cellular localization. Unlike native SoxS, which is uniformly distributed throughout the cell, SoxS-Rob is sequestered without an inducer, but is rapidly dispersed when cells are treated with an inducer. In this manner, Rob's CTD serves as an anti-sigma factor in regulating the co-sigma-factor-like activity of SoxS when fused to it. Rob's CTD also protects its N-terminus from Lon protease, since Lon's normally rapid degradation of SoxS is blocked in the chimera. Accordingly, Rob's CTD has novel regulatory properties that can be bestowed on another E. coli protein.

  15. An excretory function for the Escherichia coli outer membrane pore TolC: upregulation of marA and soxS transcription and Rob activity due to metabolites accumulated in tolC mutants.


    Rosner, Judah L; Martin, Robert G


    Efflux pumps function to rid bacteria of xenobiotics, including antibiotics, bile salts, and organic solvents. TolC, which forms an outer membrane channel, is an essential component of several efflux pumps in Escherichia coli. We asked whether TolC has a role during growth in the absence of xenobiotics. Because tolC transcription is activated by three paralogous activators, MarA, SoxS, and Rob, we examined the regulation of these activators in tolC mutants. Using transcriptional fusions, we detected significant upregulation of marRAB and soxS transcription and Rob protein activity in tolC mutants. Three mechanisms could be distinguished: (i) activation of marRAB transcription was independent of marRAB, soxR, and rob functions; (ii) activation of soxS transcription required SoxR, a sensor of oxidants; and (iii) Rob protein was activated posttranscriptionally. This mechanism is similar to the mechanisms of upregulation of marRAB, soxS, and Rob by treatment with certain phenolics, superoxides, and bile salts, respectively. The transcription of other marA/soxS/rob regulon promoters, including tolC itself, was also elevated in tolC mutants. We propose that TolC is involved in the efflux of certain cellular metabolites, not only xenobiotics. As these metabolites accumulate during growth, they trigger the upregulation of MarA, SoxS, and Rob, which in turn upregulate tolC and help rid the bacteria of these metabolites, thereby restoring homeostasis.

  16. Physiological and transcriptional responses to high concentrations of lactic acid in anaerobic chemostat cultures of Saccharomyces cerevisiae.


    Abbott, Derek A; Suir, Erwin; van Maris, Antonius J A; Pronk, Jack T


    Based on the high acid tolerance and the simple nutritional requirements of Saccharomyces cerevisiae, engineered strains of this yeast are considered biocatalysts for industrial production of high-purity undissociated lactic acid. However, high concentrations of lactic acid are toxic to S. cerevisiae, thus limiting its growth and product formation. Physiological and transcriptional responses to high concentrations of lactic acid were studied in anaerobic, glucose-limited chemostat cultures grown at different pH values and lactic acid concentrations, resulting in a 50% decrease in the biomass yield. At pH 5, the yield decrease was caused mostly by osmotically induced glycerol production and not by the classic weak-acid action, as was observed at pH 3. Cultures grown at pH 5 with 900 mM lactic acid revealed an upregulation of many genes involved in iron homeostasis, indicating that iron chelation occurred at high concentrations of dissociated lactic acid. Chemostat cultivation at pH 3 with 500 mM lactate, resulting in lower anion concentrations, showed an alleviation of this iron homeostasis response. Six of the 10 known targets of the transcriptional regulator Haa1p were strongly upregulated in lactate-challenged cultures at pH 3 but showed only moderate induction by high lactate concentrations at pH 5. Moreover, the haa1Delta mutant exhibited a growth defect at high lactic acid concentrations at pH 3. These results indicate that iron homeostasis plays a major role in the response of S. cerevisiae to high lactate concentrations, whereas the Haa1p regulon is involved primarily in the response to high concentrations of undissociated lactic acid.

  17. Regulatory interactions between quorum-sensing, auxin, cytokinin, and the Hrp regulon in relation to gall formation and epiphytic fitness of Pantoea agglomerans pv. gypsophilae.


    Chalupowicz, Laura; Barash, Isaac; Panijel, Mary; Sessa, Guido; Manulis-Sasson, Shulamit


    Gall formation by Pantoea agglomerans pv. gypsophilae is controlled by hrp/hrc genes, phytohormones, and the quorum-sensing (QS) regulatory system. The interactions between these three components were investigated. Disruption of the QS genes pagI and pagR and deletion of both substantially reduced the transcription levels of the hrp regulatory genes hrpXY, hrpS, and hrpL, as determined by quantitative reverse-transcriptase polymerase chain reaction. Expression of hrpL in planta was inhibited by addition of 20 microM or higher concentrations of the QS signal C(4)-HSL. The pagR and hrpL mutants caused an equivalent reduction of 1.3 orders in bacterial multiplication on bean leaves, suggesting possible mediation of the QS effect on epiphytic fitness of P. agglomerans pv. gypsophilae by the hrp regulatory system. indole-3-acetic acid (IAA) and cytokinin significantly affected the expression of the QS and hrp regulatory genes. Transcription of pagI, pagR, hrpL, and hrpS in planta was substantially reduced in iaaH mutant (disrupted in IAA biosynthesis via the indole-3-acetamide pathway) and etz mutant (disrupted in cytokinin biosynthesis). In contrast, the ipdC mutant (disrupted in IAA biosynthesis via the indole-3-pyruvate pathway) substantially increased expression of pagI, pagR, hrpL, and hrpS. Results presented suggest the involvement of IAA and cytokinins in regulation of the QS system and hrp regulatory genes.

  18. Transcriptional Signatures in Huntington's Disease

    PubMed Central


    While selective neuronal death has been an influential theme in Huntington's disease (HD), there is now a preponderance of evidence that significant neuronal dysfunction precedes frank neuronal death. The best evidence for neuronal dysfunction is the observation that gene expression is altered in HD brain, suggesting that transcriptional dysregulation is a central mechanism. Studies of altered gene expression began with careful observations of post-mortem human HD brain and subsequently were accelerated by the development of transgenic mouse models. The application of DNA microarray technology has spurred tremendous progress with respect to the altered transcriptional processes that occur in HD, through gene expression studies of both transgenic mouse models as well as cellular models of HD. Gene expression profiles are remarkably comparable across these models, bolstering the idea that transcriptional signatures reflect an essential feature of disease pathogenesis. Finally, gene expression studies have been applied to human HD, thus not only validating the approach of using model systems, but also solidifying the idea that altered transcription is a key mechanism in HD pathogenesis. In the future, gene expression profiling will be used as a readout in clinical trials aimed at correcting transcriptional dysregulation in Huntington's disease. PMID:17467140

  19. Kinetic Modelling of Transcription Elongation

    NASA Astrophysics Data System (ADS)

    O'Maoileidigh, Daibhid; Tadigotla, Vasisht; Sengupta, Anirvan; Epshtein, Vitaly; Ebright, Richard; Nudler, Evgeny; Ruckenstein, Andrei


    Transcription is the first step in gene expression and it is at this stage that most of genetic regulation occurs. The enzyme RNA polymerase (RNAP) walks along DNA creating an RNA transcript at a highly non-uniform rate. We discuss how many non-intuitive features of the system may be experimentally and physically motivated and present first a model, which agrees qualitatively with a host of experimental evidence. We also examine intrinsic pauses where it is thought that the RNAP will move backwards along the DNA template without changing the length of the RNA transcript. We describe a simplified kinetic scheme for the recovery of intrinsic pauses with the same degree of predictive power as our thermodynamic model (presented separately). The separation of timescales between the movement of the RNAP and global changes in the RNA secondary structure is seen to be crucial for the function of RNAP. This is essentially a model of a Brownian ratchet where RNAP executes a 1D random walk in a sequence dependent potential over a range determined by the co-transcriptional RNA fold for each transcript length

  20. Transcriptional gene silencing in humans

    PubMed Central

    Weinberg, Marc S.; Morris, Kevin V.


    It has been over a decade since the first observation that small non-coding RNAs can functionally modulate epigenetic states in human cells to achieve functional transcriptional gene silencing (TGS). TGS is mechanistically distinct from the RNA interference (RNAi) gene-silencing pathway. TGS can result in long-term stable epigenetic modifications to gene expression that can be passed on to daughter cells during cell division, whereas RNAi does not. Early studies of TGS have been largely overlooked, overshadowed by subsequent discoveries of small RNA-directed post-TGS and RNAi. A reappraisal of early work has been brought about by recent findings in human cells where endogenous long non-coding RNAs function to regulate the epigenome. There are distinct and common overlaps between the proteins involved in small and long non-coding RNA transcriptional regulatory mechanisms, suggesting that the early studies using small non-coding RNAs to modulate transcription were making use of a previously unrecognized endogenous mechanism of RNA-directed gene regulation. Here we review how non-coding RNA plays a role in regulation of transcription and epigenetic gene silencing in human cells by revisiting these earlier studies and the mechanistic insights gained to date. We also provide a list of mammalian genes that have been shown to be transcriptionally regulated by non-coding RNAs. Lastly, we explore how TGS may serve as the basis for development of future therapeutic agents. PMID:27060137

  1. 46 CFR 502.165 - Official transcript.

    Code of Federal Regulations, 2010 CFR


    ... incremental cost of transcription above the regular copy transcription cost borne by the Commission, in... full cost of transcription being borne by the Commission. (B) In the event a request for daily copy is... of transcription over and above that borne by the Commission, i.e., the incremental cost between...

  2. 46 CFR 502.165 - Official transcript.

    Code of Federal Regulations, 2014 CFR


    ... incremental cost of transcription above the regular copy transcription cost borne by the Commission, in... full cost of transcription being borne by the Commission. (B) In the event a request for daily copy is... of transcription over and above that borne by the Commission, i.e., the incremental cost between...

  3. 46 CFR 502.165 - Official transcript.

    Code of Federal Regulations, 2011 CFR


    ... incremental cost of transcription above the regular copy transcription cost borne by the Commission, in... full cost of transcription being borne by the Commission. (B) In the event a request for daily copy is... of transcription over and above that borne by the Commission, i.e., t