Science.gov

Sample records for apoptotic enzymes escape

  1. Evidence for genes associated with the ability of Mycobacterium avium subsp. hominissuis to escape apoptotic macrophages.

    PubMed

    Bermudez, Luiz E; Danelishvili, Lia; Babrack, Lmar; Pham, Tuan

    2015-01-01

    Mycobacterium avium subsp. hominissuis (MAH) is an environmental bacteria that infects immunocompromised humans. MAH cases are increasing in incidence, making it crucial to gain knowledge of the pathogenic mechanisms associated with the bacterium. MAH infects macrophages and after several days the infection triggers the phagocyte apoptosis. Many of the intracellular MAH escape the cell undergoing apoptosis leading to infection of neighboring macrophages. We screened a transposon bank of MAH mutants in U937 mononuclear phagocytes for the inability to escape macrophages undergoing apoptosis. Mutations in genes; MAV_2235, MAV_2120, MAV_2410, and MAV_4563 resulted in the inability of the bacteria to exit macrophages upon apoptosis. Complementation of the mutations corrected the phenotype either completely or partially. Testing for the ability of the mutants to survive in macrophages compared to the wild-type bacterium revealed that the mutant clones were not attenuated up to 4 days of infection. Testing in vivo, however, demonstrated that all the MAH clones were attenuated compared with the wild-type MAC 104 in tissues of mice. Although the mechanism associated with the bacterial inability to leave apoptotic macrophages is unknown, the identification of macrophage cytoplasm targets for the MAH proteins suggest that they interfere either with protein degradation machinery or post-translation mechanisms. The identification of tatC as a MAH protein involved in the ability of MAH to leave macrophages, suggests that secreted effector(s) are involved in the process. The study reveals a pathway of escape from macrophages, not shared with Mycobacterium tuberculosis.

  2. Expression of Apoptotic and Antioxidant Enzyme Genes in Sheep Oocytes and In Vitro Produced Embryos.

    PubMed

    Mishra, Ashish; Reddy, Ippala Janardhan; Gupta, Paluru Subramanyam Parameswara; Mondal, Sukanta

    2017-01-02

    The present study was to find out the expression pattern and relative expression level of apoptotic (Bcl2, Bax, Casp3, and PCNA) and antioxidant enzyme [(GPx, Cu/Zn-SOD (SOD1) and Mn-SOD (SOD2)] genes in sheep oocytes and developing embryos produced in vitro by conventional RT-PCR and real time qPCR, respectively. Different developmental stages of embryos were produced in vitro from oocytes collected from local slaughter house ovaries. RT-PCR amplicons showed expression of Bcl2 and PCNA in all stages except at morula. In contrast Bax and Casp3 were expressed in all stages. GPx and SOD1 were expressed in all stages but SOD2 was not expressed in 8-16 cells, although expressed in the remaining stages. The qPCR analysis reflected that Bcl2 expression was significantly (P < 0.05) downregulated in morula and maximum upregulated expression was observed in in vitro matured oocytes. Higher upregulated expression (P < 0.05) of Bax was in morula and downregulated expression was at 2-4 cells. Casp3 was significantly upregulated at 8-16 cells and downregulated in in vitro matured oocyte. PCNA expression was highest at blastocyst and least expression was at morula. GPx was expressed significantly highest in matured oocytes and least expression was at zygote. SOD1 was expressed significantly highest at 8-16 cells and least expression was at zygote. Expression of SOD2 was least among all the antioxidant enzymes but significantly higher expression of SOD2 was in immature oocyte; however, least expression was at 8-16 cells. It can be concluded from the study that the sheep embryos produced in vitro are highly sensitive to culture condition, which alters the expression level of apoptotic and antioxidant enzyme genes.

  3. Many pathways in laboratory evolution can lead to improved enzymes: how to escape from local minima.

    PubMed

    Gumulya, Yosephine; Sanchis, Joaquin; Reetz, Manfred T

    2012-05-07

    Directed evolution is a method to tune the properties of enzymes for use in organic chemistry and biotechnology, to study enzyme mechanisms, and to shed light on darwinian evolution in nature. In order to enhance its efficacy, iterative saturation mutagenesis (ISM) was implemented. This involves: 1) randomized mutation of appropriate sites of one or more residues; 2) screening of the initial mutant libraries for properties such as enzymatic rate, stereoselectivity, or thermal robustness; 3) use of the best hit in a given library as a template for saturation mutagenesis at the other sites; and 4) continuation of the process until the desired degree of enzyme improvement has been reached. Despite the success of a number of ISM-based studies, the question of the optimal choice of the many different possible pathways remains unanswered. Here we considered a complete 4-site ISM scheme. All 24 pathways were systematically explored, with the epoxide hydrolase from Aspergillus niger as the catalyst in the stereoselective hydrolytic kinetic resolution of a chiral epoxide. All 24 pathways were found to provide improved mutants with notably enhanced stereoselectivity. When a library failed to contain any hits, non-improved or even inferior mutants were used as templates in the continuation of the evolutionary pathway, thereby escaping from the local minimum. These observations have ramifications for directed evolution in general and for evolutionary biological studies in which protein engineering techniques are applied. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Induced resistance enzymes in wild plants-do `early birds' escape from pathogen attack?

    NASA Astrophysics Data System (ADS)

    Heil, Martin; Ploss, Kerstin

    2006-09-01

    Systemic acquired resistance (SAR) of plants to pathogens is a well-defined phenomenon. The underlying signalling pathways and its application in crop protection are intensively studied. However, most studies are conducted on crop plants or on Arabidopsis as a model plant. The taxonomic distribution of this phenomenon and its dependence on life history are thus largely unknown. We quantified activities of three classes of resistance-related enzymes in 18 plant species to investigate whether plants with varying life histories differ in their investment in disease resistance. Enzyme activities were quantified in untreated plants, and in plants induced with BION, a chemical resistance elicitor. All species showed constitutive activities of chitinase, peroxidase, or glucanase. However, constitutive chitinase activities varied by 30 times, and peroxidase by 50 times, among species. Several species did not respond to the induction treatment, while enzyme activities in other species increased more than threefold after BION application. Plant species differ dramatically in the presence and inducibility of resistance enzymes. This variation could be related to life history: While all resistance enzymes were significantly induced in larger perennial plants that flower during summer, spring geophytes hardly showed inducible resistance. These plants grow in an environment that is characterised by a low-pathogen pressure, and thus may simply ‘escape’ from infection. Our study presents the first comparative data set on resistance-related enzymes in noncultivated plants. The current view on SAR—narrowed by the concentration on cultivated crops—is not sufficient to understand the ecological and evolutionary relevance of this widespread plant trait.

  5. Antioxidant enzymes in oligodendroglial brain tumors: association with proliferation, apoptotic activity and survival.

    PubMed

    Järvelä, Sally; Sally, Järvelä; Bragge, Helena; Helena, Bragge; Paunu, Niina; Niina, Paunu; Järvelä, Timo; Timo, Järvelä; Paljärvi, Leo; Leo, Paljärvi; Kalimo, Hannu; Hannu, Kalimo; Helén, Pauli; Pauli, Helén; Kinnula, Vuokko; Vuokko, Kinnula; Soini, Ylermi; Ylermi, Soini; Haapasalo, Hannu; Hannu, Haapasalo

    2006-04-01

    Purpose of the study was to investigate the relationship between antioxidant enzyme expression and clinicopathological features in oligodendroglial tumors. The expression of antioxidant enzymes and related proteins (AOEs), manganese superoxide dismutase (MnSOD), thioredoxin (Trx), thioredoxin reductase (TrxR) and gammaglutamylcysteine synthetase catalytic and regulatory subunits (GLCL-C and GLCL-R), was studied in 85 oligodendroglial tumors. The material included 71 primary (43 grade II and 28 grade III) and 14 recurrent (6 grade II and 8 grade III) tumors. Fifty-seven cases were pure oligodendrogliomas and 28 were mixed oligoastrocytomas. Immunoreactivity for MnSOD was found in 89%, Trx in 29%, TrxR in 76%, GLCL-C in 70% and GLCL-R in 68% of cases. Increased Trx expression was associated with higher tumor grade, cell proliferation and apoptosis (P=0.006, P=0.001 and P=0.003, Mann-Whitney test). Pure oligodendrogliomas showed more intense staining than oligoastrocytomas, especially for MnSOD (P=0.002, Mann-Whitney test). In the total series Trx was associated with poor prognosis in univariate survival analysis (P=0.0343, log-rank test) and furthermore in Cox multivariate analysis (P=0.009) along with age (P=0.002). The results suggest that the expression of Trx has a correlation to patient outcome and that there may be some association between AOEs, like MnSOD and Trx, and clinicopathological features of oligodendrogliomas.

  6. Reactive oxygen species are related to ionic fluxes and volume decrease in apoptotic cerebellar granule neurons: role of NOX enzymes.

    PubMed

    Hernández-Enríquez, Berenice; Guemez-Gamboa, Alicia; Morán, Julio

    2011-05-01

    Reactive oxygen species (ROS) are produced early during apoptosis of cerebellar granule neurons induced by low potassium (K5) and staurosporine (Sts). In addition, K5 and Sts activate NADPH oxidases (NOX). Recently, we described that K5 and Sts induce apoptotic volume decrease (AVD) at a time when ROS generation and NOX activity occur. In the present study, we evaluated the relationship between ROS generation and ionic fluxes during AVD. Here, we showed that K5- and Sts-induced AVD was inhibited by antioxidants and that direct ROS production induced AVD. Moreover, NOX inhibitors eliminated AVD induced by both K5 and Sts. Sts, but not K5, failed to induce AVD in cerebellar granule neurons from NOX2 knockout mice. These findings suggest that K5- and Sts-induced AVD is largely mediated by ROS produced by NOX. On the other hand, we also found that the blockage of ionic fluxes involved in AVD inhibited both ROS generation and NOX activity. These findings suggest that ROS generation and NOX activity are involved in ionic fluxes activation, which in turn could maintain ROS generation by activating NOX, leading to a self-amplifying cycle. © 2011 The Authors. Journal of Neurochemistry © 2011 International Society for Neurochemistry.

  7. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    PubMed

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  8. Escaping the Cut by Restriction Enzymes Through Single-Strand Self-Annealing of Host-Edited 12-bp and Longer Synthetic Palindromes

    PubMed Central

    2012-01-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5′ CCCGAATTCGGG 3′, (2) by a 22-bp related sequence 5′ CTCGTGCCGAATTCGGCACGAG 3′, and (3) by a longer 44-bp related sequence: 5′ CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3′. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (−) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5′ G/AATTC 3′, its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations. PMID:21895510

  9. Enzyme

    MedlinePlus

    Enzymes are complex proteins that cause a specific chemical change in all parts of the body. For ... use them. Blood clotting is another example of enzymes at work. Enzymes are needed for all body ...

  10. Inhibition of ROS-induced apoptosis in endothelial cells by nitrone spin traps via induction of phase II enzymes and suppression of mitochondria-dependent pro-apoptotic signaling

    PubMed Central

    Das, Amlan; Gopalakrishnan, Bhavani; Voss, Oliver H.; Doseff, Andrea I.; Villamena, Frederick A.

    2012-01-01

    Oxidative stress is the main etiological factor behind the pathogenesis of various diseases including inflammation, cancer, cardiovascular and neurodegenerative disorders. Due to the spin trapping abilities and various pharmacological properties of nitrones, their application as therapeutic agent has been gaining attention. Though the antioxidant properties of the nitrones are well known, the mechanisms by which they modulate the cellular defense machinery against oxidative stress is not well investigated and requires further elucidation. Here, we have investigated the mechanisms of cytoprotection of the nitrone spin traps against oxidative stress in bovine aortic endothelial cells (BAEC). Cytoprotective properties of both the cyclic nitrone 5,5-dimethyl-pyrroline N-oxide (DMPO) and linear nitrone alpha-phenyl N-tert-butyl nitrone (PBN) against H2O2-induced cytoxicity were investigated. Preincubation of BAEC with PBN or DMPO resulted in the inhibition of H2O2–mediated cytotoxicity and apoptosis. Nitrone-treatment resulted in the induction and restoration of phase II antioxidant enzymes via nuclear translocation of NF-E2-related factor 2 (Nrf-2) in oxidatively-challenged cells. Furthermore, the nitrones were found to inhibit the mitochondrial depolarization and subsequent activation of caspase-3 induced by H2O2. Significant down-regulation of the pro-apoptotic proteins p53 and Bax, and up-regulation of the anti-apoptotic proteins Bcl-2 and p-Bad were observed when the cells were preincubated with the nitrones prior to H2O2–treatment. It was also observed that Nrf-2 silencing completely abolished the protective effects of nitrones. Hence, these findings suggest that nitrones confer protection to the endothelial cells against oxidative stress by modulating phase II antioxidant enzymes and subsequently inhibiting mitochondria-dependent apoptotic cascade. PMID:22580046

  11. Mediation of endogenous antioxidant enzymes and apoptotic signaling by resveratrol following muscle disuse in the gastrocnemius muscles of young and old rats.

    PubMed

    Jackson, Janna R; Ryan, Michael J; Hao, Yanlei; Alway, Stephen E

    2010-12-01

    Hindlimb suspension (HLS) elicits muscle atrophy, oxidative stress, and apoptosis in skeletal muscle. Increases in oxidative stress can have detrimental effects on muscle mass and function, and it can potentially lead to myonuclear apoptosis. Resveratrol is a naturally occurring polyphenol possessing both antioxidant and antiaging properties. To analyze the capacity of resveratrol to attenuate oxidative stress, apoptosis and muscle force loss were measured following 14 days of HLS. Young (6 mo) and old (34 mo) rats were administered either 12.5 mg·kg(-1)·day(-1) of trans-resveratrol, or 0.1% carboxymethylcellulose for 21 days, including 14 days of HLS. HLS induced a significant decrease in plantarflexor isometric force, but resveratrol blunted this loss in old animals. Resveratrol increased gastrocnemius catalase activity, MnSOD activity, and MnSOD protein content following HLS. Resveratrol reduced hydrogen peroxide and lipid peroxidation levels in muscles from old animals after HLS. Caspase 9 abundance was reduced and Bcl-2 was increased, but other apoptotic markers were not affected by resveratrol in the gastrocnemius muscle after HLS. The data indicate that resveratrol has a protective effect against oxidative stress and muscle force loss in old HLS animals; however, resveratrol was unable to attenuate apoptosis following HLS. These results suggest that resveratrol has the potential to be an effective therapeutic agent to treat muscle functional decrements via improving the redox status associated with disuse.

  12. Dust escape from Io

    NASA Astrophysics Data System (ADS)

    Flandes, Alberto

    2004-08-01

    The Dust ballerina skirt is a set of well defined streams composed of nanometric sized dust particles that escape from the Jovian system and may be accelerated up to >=200 km/s. The source of this dust is Jupiter's moon Io, the most volcanically active body in the Solar system. The escape of dust grains from Jupiter requires first the escape of these grains from Io. This work is basically devoted to explain this escape given that the driving of dust particles to great heights and later injection into the ionosphere of Io may give the particles an equilibrium potential that allow the magnetic field to accelerate them away from Io. The grain sizes obtained through this study match very well to the values required for the particles to escape from the Jovian system.

  13. In the absence of cellular poly (A) binding protein, the glycolytic enzyme GAPDH translocated to the cell nucleus and activated the GAPDH mediated apoptotic pathway by enhancing acetylation and serine 46 phosphorylation of p53

    SciTech Connect

    Thangima Zannat, Mst.; Bhattacharjee, Rumpa B.; Bag, Jnanankur

    2011-06-03

    Highlights: {yields} PABP knock down and cell apoptosis. {yields} Nuclear translocation of GAPDH in PABP depleted cells. {yields} Role of p53 in apoptosis of PABP depleted cells. {yields} Bax translocation and cytochrome C release and caspase 3 activation following PABP depletion. {yields} Association of p53 with Bcl2 and Bax. -- Abstract: The cytoplasmic poly (A) binding protein (PABP) interacts with 3' poly (A) tract of eukaryotic mRNA and is important for both translation and stability of mRNA. Previously, we have shown that depletion of PABP by siRNA prevents protein synthesis and consequently leads to cell death through apoptosis. In the present investigation, we studied the mechanism of cell apoptosis. We show that in the absence of PABP, the glycolytic enzyme GAPDH translocated to the cell nucleus and activated the GAPDH mediated apoptotic pathway by enhancing acetylation and serine 46 phosphorylation of p53. As a result, p53 translocated to the mitochondria to initiate Bax mediated apoptosis.

  14. Non-erythroid alpha-spectrin breakdown by calpain and interleukin 1 beta-converting-enzyme-like protease(s) in apoptotic cells: contributory roles of both protease families in neuronal apoptosis.

    PubMed Central

    Nath, R; Raser, K J; Stafford, D; Hajimohammadreza, I; Posner, A; Allen, H; Talanian, R V; Yuen, P; Gilbertsen, R B; Wang, K K

    1996-01-01

    The cytoskeletal protein non-erythroid alpha-spectrin is well documented as an endogenous calpain substrate, especially under pathophysiological conditions. In cell necrosis (e.g. maitotoxin-treated neuroblastoma SH-SY5Y cells), alpha-spectrin breakdown products (SBDPs) of 150 kDa and 145 kDa were produced by cellular calpains. In contrast, in neuronal cells undergoing apoptosis (cerebellar granule neurons subjected to low potassium and SH-SY5Y cells treated with staurosporine), an additional SBDP of 120 kDa was also observed. The formation of the 120 kDa SBDP was insensitive to calpain inhibitors but was completely blocked by an interleukin 1 beta-converting-enzyme (ICE)-like protease inhibitor, Z-Asp-CH2OC(O)-2,6-dichlorobenzene. Autolytic activation of both calpain and the ICE homologue CPP32 was also observed in apoptotic cells. alpha-Spectrin can also be cleaved in vitro by purified calpains to produce the SBDP doublet of 150/145 kDa and by ICE and ICE homologues [ICH-1, ICH-2 and CPP32(beta)] to produce a 150 kDa SBDP. In addition, CPP32 and ICE also produced a 120 kDa SBDP. Furthermore inhibition of either ICE-like protease(s) or calpain protects both granule neurons and SH-SY5Y cells against apoptosis. Our results suggest that both protease families participate in the expression of neuronal apoptosis. PMID:8920967

  15. THERMALLY DRIVEN ATMOSPHERIC ESCAPE

    SciTech Connect

    Johnson, Robert E.

    2010-06-20

    Accurately determining the escape rate from a planet's atmosphere is critical for determining its evolution. A large amount of Cassini data is now available for Titan's upper atmosphere and a wealth of data is expected within the next decade on escape from Pluto, Mars, and extra-solar planets. Escape can be driven by upward thermal conduction of energy deposited well below the exobase, as well as by nonthermal processes produced by energy deposited in the exobase region. Recent applications of a model for escape driven by upward thermal conduction, called the slow hydrodynamic escape model, have resulted in surprisingly large loss rates for the atmosphere of Titan, Saturn's largest moon. Based on a molecular kinetic simulation of the exobase region, these rates appear to be orders of magnitude too large. Therefore, the slow hydrodynamic model is evaluated here. It is shown that such a model cannot give a reliable description of the atmospheric temperature profile unless it is coupled to a molecular kinetic description of the exobase region. Therefore, the present escape rates for Titan and Pluto must be re-evaluated using the atmospheric model described here.

  16. Viral apoptotic mimicry.

    PubMed

    Amara, Ali; Mercer, Jason

    2015-08-01

    As opportunistic pathogens, viruses have evolved many elegant strategies to manipulate host cells for infectious entry and replication. Viral apoptotic mimicry, defined by the exposure of phosphatidylserine - a marker for apoptosis - on the pathogen surface, is emerging as a common theme used by enveloped viruses to promote infection. Focusing on the four best described examples (vaccinia virus, dengue virus, Ebola virus and pseudotyped lentivirus), we summarize our current understanding of apoptotic mimicry as a mechanism for virus entry, binding and immune evasion. We also describe recent examples of non-enveloped viruses that use this mimicry strategy, and discuss future directions and how viral apoptotic mimicry could be targeted therapeutically.

  17. Bacillus anthracis factors for phagosomal escape.

    PubMed

    Tonello, Fiorella; Zornetta, Irene

    2012-07-01

    The mechanism of phagosome escape by intracellular pathogens is an important step in the infectious cycle. During the establishment of anthrax, Bacillus anthracis undergoes a transient intracellular phase in which spores are engulfed by local phagocytes. Spores germinate inside phagosomes and grow to vegetative bacilli, which emerge from their resident intracellular compartments, replicate and eventually exit from the plasma membrane. During germination, B. anthracis secretes multiple factors that can help its resistance to the phagocytes. Here the possible role of B. anthracis toxins, phospholipases, antioxidant enzymes and capsules in the phagosomal escape and survival, is analyzed and compared with that of factors of other microbial pathogens involved in the same type of process.

  18. Clearance of Apoptotic Photoreceptors

    PubMed Central

    Hisatomi, Toshio; Sakamoto, Taiji; Sonoda, Koh-hei; Tsutsumi, Chikako; Qiao, Hong; Enaida, Hiroshi; Yamanaka, Ichiro; Kubota, Toshiaki; Ishibashi, Tatsuro; Kura, Shinobu; Susin, Santos A.; Kroemer, Guido

    2003-01-01

    The effective phagocytotic clearance of apoptotic debris is fundamental to the maintenance of neural tissues during apoptosis. Retinal photoreceptors undergo apoptosis after retinal detachment. Although their induction phase of apoptosis has been well discussed, their phagocytotic process remains quite unclear. We herein demonstrate that apoptotic photoreceptors are selectively eliminated from their physiological localization, the outer nuclear layer, to the subretinal space, and then phagocytosed by monocyte-derived macrophages. This could be shown by an ultrastructural and immunophenotypic analysis. Moreover, in chimera mice expressing transgenic green fluorescent protein in bone marrow-derived cells, the local infiltration of macrophages could be detected after retinal detachment-induced photoreceptor apoptosis. The local injection of an antibody blocking the phosphatidylserine receptor (PSR) or a peptide (GRGDSP)-blocking integrin αvβ3 revealed that phagocytotic clearance involves the PSR as well as integrin αvβ3 in vivo. Importantly, the level of blockade obtained with these reagents was different. Although anti-PSR increased the frequency of apoptotic cells that fail to bind to macrophages, GRGDSP prevented the engulfment (but not the recognition) of apoptotic photoreceptor cells by macrophages. To our knowledge, this is the first report describing the mechanisms through which apoptotic photoreceptors are selectively eliminated via a directional process in the subretinal space. PMID:12759244

  19. Nosema Tolerant Honeybees (Apis mellifera) Escape Parasitic Manipulation of Apoptosis

    PubMed Central

    Kurze, Christoph; Le Conte, Yves; Dussaubat, Claudia; Erler, Silvio; Kryger, Per; Lewkowski, Oleg; Müller, Thomas; Widder, Miriam; Moritz, Robin F. A.

    2015-01-01

    Apoptosis is not only pivotal for development, but also for pathogen defence in multicellular organisms. Although numerous intracellular pathogens are known to interfere with the host’s apoptotic machinery to overcome this defence, its importance for host-parasite coevolution has been neglected. We conducted three inoculation experiments to investigate in the apoptotic respond during infection with the intracellular gut pathogen Nosema ceranae, which is considered as potential global threat to the honeybee (Apis mellifera) and other bee pollinators, in sensitive and tolerant honeybees. To explore apoptotic processes in the gut epithelium, we visualised apoptotic cells using TUNEL assays and measured the relative expression levels of subset of candidate genes involved in the apoptotic machinery using qPCR. Our results suggest that N. ceranae reduces apoptosis in sensitive honeybees by enhancing inhibitor of apoptosis protein-(iap)-2 gene transcription. Interestingly, this seems not be the case in Nosema tolerant honeybees. We propose that these tolerant honeybees are able to escape the manipulation of apoptosis by N. ceranae, which may have evolved a mechanism to regulate an anti-apoptotic gene as key adaptation for improved host invasion. PMID:26445372

  20. Nosema Tolerant Honeybees (Apis mellifera) Escape Parasitic Manipulation of Apoptosis.

    PubMed

    Kurze, Christoph; Le Conte, Yves; Dussaubat, Claudia; Erler, Silvio; Kryger, Per; Lewkowski, Oleg; Müller, Thomas; Widder, Miriam; Moritz, Robin F A

    2015-01-01

    Apoptosis is not only pivotal for development, but also for pathogen defence in multicellular organisms. Although numerous intracellular pathogens are known to interfere with the host's apoptotic machinery to overcome this defence, its importance for host-parasite coevolution has been neglected. We conducted three inoculation experiments to investigate in the apoptotic respond during infection with the intracellular gut pathogen Nosema ceranae, which is considered as potential global threat to the honeybee (Apis mellifera) and other bee pollinators, in sensitive and tolerant honeybees. To explore apoptotic processes in the gut epithelium, we visualised apoptotic cells using TUNEL assays and measured the relative expression levels of subset of candidate genes involved in the apoptotic machinery using qPCR. Our results suggest that N. ceranae reduces apoptosis in sensitive honeybees by enhancing inhibitor of apoptosis protein-(iap)-2 gene transcription. Interestingly, this seems not be the case in Nosema tolerant honeybees. We propose that these tolerant honeybees are able to escape the manipulation of apoptosis by N. ceranae, which may have evolved a mechanism to regulate an anti-apoptotic gene as key adaptation for improved host invasion.

  1. Escape from Mars

    NASA Image and Video Library

    2017-07-10

    This image from NASA's Mars Reconnaissance Orbiter shows one of millions of small (10s of meters in diameter) craters and their ejecta material that dot the Elysium Planitia region of Mars. The small craters were likely formed when high-speed blocks of rock were thrown out by a much larger impact (about 10-kilometers in diameter) and fell back to the ground. Some of these blocks may actually escape Mars, which is how we get samples in the form of meteorites that fall to Earth. Other ejected blocks have insufficient velocity, or the wrong trajectory, to escape the Red Planet. As such, when one of these high-speed blocks impacts the surface, it makes what is called a "secondary" crater. These secondaries can form dense "chains" or "rays," which are radial to the crater that formed them. https://photojournal.jpl.nasa.gov/catalog/PIA21769

  2. Spacecraft Escape Capsule

    NASA Technical Reports Server (NTRS)

    Robertson, Edward A.; Charles, Dingell W.; Bufkin, Ann L.; Rodriggs, Liana M.; Peterson, Wayne; Cuthbert, Peter; Lee, David E.; Westhelle, Carlos

    2006-01-01

    A report discusses the Gumdrop capsule a conceptual spacecraft that would enable the crew to escape safely in the event of a major equipment failure at any time from launch through atmospheric re-entry. The scaleable Gumdrop capsule would comprise a command module (CM), a service module (SM), and a crew escape system (CES). The CM would contain a pressurized crew environment that would include avionic, life-support, thermal control, propulsive attitude control, and recovery systems. The SM would provide the primary propulsion and would also supply electrical power, life-support resources, and active thermal control to the CM. The CES would include a solid rocket motor, embedded within the SM, for pushing the CM away from the SM in the event of a critical thermal-protection-system failure or loss of control. The CM and SM would normally remain integrated with each other from launch through recovery, but could be separated using the CES, if necessary, to enable the safe recovery of the crew in the CM. The crew escape motor could be used, alternatively, as a redundant means of de-orbit propulsion for the CM in the event of a major system failure in the SM.

  3. Immune escape phenomenon in molluscum contagiosum and the induction of apoptosis.

    PubMed

    Yamauchi-Yamada, Akiko; Yamamoto, Takenobu; Nakayama, Yumi; Ikeda, Kazuko; Miyake, Tomoko; Yamaguchi, Mari; Hirai, Yoji; Shirafuji, Yoshinori; Morizane, Shin; Aoyama, Yumi; Iwatsuki, Keiji

    2014-12-01

    Molluscum contagiosum (MC) may persist for many weeks, evading host immunity. We studied the mechanism of immune escape phenomenon in MC, and the possible inducer of apoptosis. Using tissue samples of MC, we examined the numbers of epidermal Langerhans cells (LC), the expression levels of macrophage inflammatory protein-3α (MIP-3α) and thymic stromal lymphopoietin (TSLP), and the apoptotic signals. After molluscum contagiosum virus (MCV) genotyping, we studied the expression of MCV-encoded MC148 mRNA and MC159 mRNA which correspond to viral antagonist for CCR8 and viral Fas-linked interleukin (IL)-1β converting enzyme (FLICE)-like inhibitor protein (vFLIP), respectively. The nutlin-3-induced apoptosis in MC was observed ex vivo. The numbers of CD1a(+) or Langerin(+) epidermal LC and the expression levels of MIP-3α were markedly decreased in MC. The expression of TSLP was enhanced in the lesional epidermis of atopic dermatitis and human papillomavirus-induced warts, whereas the expression was observed locally in MC. All 14 MC samples examined harbored MCV type 1. The MC148 mRNA was detected in all 14 samples and the MC159 mRNA was detected in 13 samples. Apoptotic cells were absent or at a background level in the living layers of MC, but their numbers were increased in the molluscum bodies by overnight incubation with 5 μmol/L nutlin-3 in culture medium. In conclusion, molluscum bodies are protected from host immune responses and apoptotic signals by being surrounded by LC-depleted epidermal walls and viral immunosuppressive molecules, but could be eradicated by reagents inducing p53-dependent apoptosis. © 2014 Japanese Dermatological Association.

  4. Atmospheric escape from unmagnetized bodies

    NASA Astrophysics Data System (ADS)

    Brain, D. A.; Bagenal, F.; Ma, Y.-J.; Nilsson, H.; Stenberg Wieser, G.

    2016-12-01

    The upper atmospheres of unmagnetized solar system bodies interact more directly with their local plasma environment than their counterparts on magnetized bodies such as Earth. One consequence of this interaction is that atmospheric particles can gain energy from the flowing plasma, as well as solar photons, and escape to space. Escape proceeds through a number of different mechanisms that can remove neutral particles (Jeans escape, photochemical escape, and sputtering) and mechanisms that can remove ions (ion pickup, magnetic shear and tension-related escape, and pressure gradients). Here we discuss the plasma interactions and escape processes and rates from five solar system objects spanning 3 orders of magnitude in size: comets, Pluto, Titan, Mars, and Venus. We describe similarities and differences in escape for the different objects and provide four open questions that should be addressed in the coming years.

  5. Orbiter escape pole

    NASA Technical Reports Server (NTRS)

    Goodrich, Winston D. (Inventor); Wesselski, Clarence J. (Inventor); Pelischek, Timothy E. (Inventor); Becker, Bruce H. (Inventor); Kahn, Jon B. (Inventor); Grimaldi, Margaret E. (Inventor); McManamen, John P. (Inventor); Castro, Edgar O. (Inventor)

    1989-01-01

    A Shuttle type of aircraft (10) with an escape hatch (12) has an arcuately shaped pole housing (16) attachable to an interior wall and ceiling with its open end adjacent to the escape hatch. The pole housing 16 contains a telescopically arranged and arcuately shaped primary pole member (22) and extension pole member (23) which are guided by roller assemblies (30,35). The extension pole member (23) is slidable and extendable relative to the primary pole member (22). For actuation, a spring actuated system includes a spring (52) in the pole housing. A locking member (90) engages both pole members (22,23) through notch portions (85,86) in the pole members. The locking member selectively releases the extension pole member (23) and the primary pole member (22). An internal one-way clutch or anti-return mechanism prevents retraction of the extension pole member from an extended position. Shock absorbers (54)(150,152) are for absoring the energy of the springs. A manual backup deployment system is provided which includes a canted ring (104) biased by a spring member (108). A lever member (100) with a slot and pin connection (102) permits the mechanical manipulation of the canted ring to move the primary pole member. The ring (104) also prevents retraction of the main pole. The crew escape mechanism includes a magazine (60) and a number of lanyards (62), each lanyard being mounted by a roller loop (68) over the primary pole member (22). The strap on the roller loop has stitching for controlled release, a protection sheath (74) to prevent tangling and a hook member (69) for attachment to a crew harness.

  6. Hypervelocity Technology (HVT) crew escape

    NASA Technical Reports Server (NTRS)

    Jines, Lanny A.

    1987-01-01

    Conceptual designs are being investigated for escape systems applicable to hypervelocity technology class aerospace vehicles. The concepts selected for further development will provide survivable escape and recovery throughout all phases of flight. Sixteen conceptual escape systems were identified, of which two were viable. The study vehicles included a horizontally launched vehicle (HLV) and a vertically launched vehicle (VLV). Computer-aided design models of the candidate escape systems were developed. State-of-the-art or near-term enabling technologies were identified in such areas as propulsion, life support, thermal protection, and deceleration.

  7. Ion Escape Rates from Mars

    NASA Astrophysics Data System (ADS)

    Brain, Dave; McFadden, Jim; Halekas, Jasper; Connerney, Jack; Eparvier, Frank; Mitchell, Dave; Andersson, Laila; Jakosky, Bruce; Dong, Yaxue; Egan, Hilary; Weber, Tristan; Ma, Yingjuan; Dong, Chuanfei; Modolo, Ronan; Bougher, Steve; Luhmann, Janet

    2017-04-01

    The Mars Atmosphere and Volatile EvolutioN (MAVEN) mission has been making science measurements of the Martian upper atmosphere and its escape to space since November 2014. A key part of this effort is the measurement of the escape rates of charged particles (ions) at present and over solar system history. The lack of a global dynamo magnetic field at Mars leaves its upper atmosphere more directly exposed to the impinging solar wind than magnetized planets such as Earth. For this reason it is thought that ion escape at Mars may have played a significant role in long term climate change. MAVEN measures escaping planetary ions directly, with high energy, mass, and time resolution. With more than two years of observations in hand, we will report the average ion escape rate and the spatial distribution of escaping ions as measured by MAVEN, including escape as a function of mass and energy. We will then report on the measured variability in ion escape rates with different drivers (e.g. solar EUV, solar wind pressure, etc.). We will use these results to provide an estimate of the total ion escape from Mars over billions of years, and discuss the implications for Mars and unmagnetized planets in general.

  8. Reconstructing the Alcatraz escape

    NASA Astrophysics Data System (ADS)

    Baart, F.; Hoes, O.; Hut, R.; Donchyts, G.; van Leeuwen, E.

    2014-12-01

    In the night of June 12, 1962 three inmates used a raft made of raincoatsto escaped the ultimate maximum security prison island Alcatraz in SanFrancisco, United States. History is unclear about what happened tothe escapees. At what time did they step into the water, did theysurvive, if so, where did they reach land? The fate of the escapees has been the subject of much debate: did theymake landfall on Angel Island, or did the current sweep them out ofthe bay and into the cold pacific ocean? In this presentation, we try to shed light on this historic case using avisualization of a high-resolution hydrodynamic simulation of the San Francisco Bay, combined with historical tidal records. By reconstructing the hydrodynamic conditions and using a particle based simulation of the escapees we show possible scenarios. The interactive model is visualized using both a 3D photorealistic and web based visualization. The "Escape from Alcatraz" scenario demonstrates the capabilities of the 3Di platform. This platform is normally used for overland flooding (1D/2D). The model engine uses a quad tree structure, resulting in an order of magnitude speedup. The subgrid approach takes detailed bathymetry information into account. The inter-model variability is tested by comparing the results with the DFlow Flexible Mesh (DFlowFM) San Francisco Bay model. Interactivity is implemented by converting the models from static programs to interactive libraries, adhering to the Basic ModelInterface (BMI). Interactive models are more suitable for answeringexploratory research questions such as this reconstruction effort. Although these hydrodynamic simulations only provide circumstantialevidence for solving the mystery of what happened during the foggy darknight of June 12, 1962, it can be used as a guidance and provides aninteresting testcase to apply interactive modelling.

  9. THERMALLY DRIVEN ATMOSPHERIC ESCAPE: TRANSITION FROM HYDRODYNAMIC TO JEANS ESCAPE

    SciTech Connect

    Volkov, Alexey N.; Johnson, Robert E.; Tucker, Orenthal J.; Erwin, Justin T.

    2011-03-10

    Thermally driven escape from planetary atmospheres changes in nature from an organized outflow (hydrodynamic escape) to escape on a molecule-by-molecule basis (Jeans escape) with increasing Jeans parameter, {lambda}, the ratio of the gravitational to thermal energy of the atmospheric molecules. This change is described here for the first time using the direct simulation Monte Carlo method. When heating is predominantly below the lower boundary of the simulation region, R{sub 0}, and well below the exobase of a single-component atmosphere, the nature of the escape process changes over a surprisingly narrow range of Jeans parameters, {lambda}{sub 0}, evaluated at R{sub 0}. For an atomic gas, the transition occurs over {lambda}{sub 0} {approx} 2-3, where the lower bound, {lambda}{sub 0} {approx} 2.1, corresponds to the upper limit for isentropic, supersonic outflow. For {lambda}{sub 0} > 3 escape occurs on a molecule-by-molecule basis and we show that, contrary to earlier suggestions, for {lambda}{sub 0} > {approx}6 the escape rate does not deviate significantly from the familiar Jeans rate. In a gas composed of diatomic molecules, the transition shifts to {lambda}{sub 0} {approx} 2.4-3.6 and at {lambda}{sub 0} > {approx}4 the escape rate increases a few tens of percent over that for the monatomic gas. Scaling by the Jeans parameter and the Knudsen number, these results can be applied to thermally induced escape of the major species from solar and extrasolar planets.

  10. Bursty Escape on Mars

    NASA Astrophysics Data System (ADS)

    Dubinin, E.; Fraenz, M.; Woch, J.; Lundin, R.; Wei, J.; Barabash, S.

    2011-10-01

    Bursty or filamentary structuring of plasma flows is a typical feature of the Martian space. This phenomenon is revealed during time periods when MEX-ASPERA- 3 is operating in the high temporal resolution mode. Frequency of oscillations is about 10-50 mHz. Amplitude of flux variations reaches a factor of 10-30. Bursty origin of fluxes of oxygen ions can be the important process for solar wind induced escape on Mars. There are several mechanisms which can be responsible for the observed periodic bursts. Large-amplitude coherent pressure pulses generated by ion beams upstream the bow shock impact the magnetosphere and produce periodic pulses in forces pushing planetary plasma. Pressure pulses can arise downstream the bow shock - in the magnetosheath, which becomes to be decomposed into a sequence of periodic compressive waves. A wavy dynamics can also appear due to a multi-ion origin of the interacting plasmas since such a medium behaves as a specific rotator. At last, not at least, K-H or other types of large-scale MHD instabilities probably excited in the interface region can generate surface waves which will also modulate the tension forces. We present the different observations which can be interpreted in a favor of all the above mechanisms implying a complex and diverse plasma wave environment at Mars.

  11. Escape from Vela X

    SciTech Connect

    Hinton, J.; Funk, S.; Parsons, R.D.; Ohm, S.; /Leicester U. /Leeds U.

    2012-02-15

    While the Vela pulsar and its associated nebula are often considered as the archetype of a system powered by a {approx} 10{sup 4} year old isolated neutron star, many features of the spectral energy distribution of this pulsar wind nebula are both puzzling and unusual. Here we develop a model that for the first time relates the main structures in the system, the extended radio nebula (ERN) and the X-ray cocoon through continuous injection of particles with a fixed spectral shape. We argue that diffusive escape of particles from the ERN can explain the steep Fermi-LAT spectrum. In this scenario Vela X should produce a distinct feature in the locally-measured cosmic ray electron spectrum at very high energies. This prediction can be tested in the future using the Cherenkov Telescope Array (CTA). If particles are indeed released early in the evolution of PWNe and can avoid severe adiabatic losses, PWN provide a natural explanation for the rising positron fraction in the local CR spectrum.

  12. ESCAPE FROM VELA X

    SciTech Connect

    Hinton, J. A.; Ohm, S.; Funk, S.; Parsons, R. D.

    2011-12-10

    While the Vela pulsar and its associated nebula are often considered as the archetype of a system powered by a {approx}10{sup 4} year old isolated neutron star, many features of the spectral energy distribution of this pulsar wind nebula (PWN) are both puzzling and unusual. Here we develop a model that for the first time relates the main structures in the system, the extended radio nebula (ERN) and the X-ray cocoon through continuous injection of particles with a fixed spectral shape. We argue that diffusive escape of particles from the ERN can explain the steep Fermi-LAT spectrum. In this scenario Vela X should produce a distinct feature in the locally measured cosmic ray (CR) electron spectrum at very high energies. This prediction can be tested in the future using the Cherenkov Telescope Array. If particles are indeed released early in the evolution of PWNe and can avoid severe adiabatic losses, PWN provides a natural explanation for the rising positron fraction in the local CR spectrum.

  13. 42 CFR 84.51 - Entry and escape, or escape only; classification.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... during entry into a hazardous atmosphere, and for escape from a hazardous atmosphere; or (b) Escape only. Respirators designed and approved for use only during escape from a hazardous atmosphere. ...

  14. 42 CFR 84.51 - Entry and escape, or escape only; classification.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... during entry into a hazardous atmosphere, and for escape from a hazardous atmosphere; or (b) Escape only. Respirators designed and approved for use only during escape from a hazardous atmosphere. ...

  15. 42 CFR 84.51 - Entry and escape, or escape only; classification.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... during entry into a hazardous atmosphere, and for escape from a hazardous atmosphere; or (b) Escape only. Respirators designed and approved for use only during escape from a hazardous atmosphere. ...

  16. 42 CFR 84.51 - Entry and escape, or escape only; classification.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... during entry into a hazardous atmosphere, and for escape from a hazardous atmosphere; or (b) Escape only. Respirators designed and approved for use only during escape from a hazardous atmosphere. ...

  17. 42 CFR 84.51 - Entry and escape, or escape only; classification.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... during entry into a hazardous atmosphere, and for escape from a hazardous atmosphere; or (b) Escape only. Respirators designed and approved for use only during escape from a hazardous atmosphere. ...

  18. Lise Meitner's escape from Germany

    NASA Astrophysics Data System (ADS)

    Sime, Ruth Lewin

    1990-03-01

    Lise Meitner (1878-1968) achieved prominence as a nuclear physicist in Germany; although of Jewish origin, her Austrian citizenship exempted her from Nazi racial laws until the annexation of Austria in 1938 precipitated her dismissal. Forbidden to emigrate, she narrowly escaped to the Netherlands with the help of concerned friends in the international physics community.

  19. DYNAMICS OF THE ESCAPE RESPONSE.

    DTIC Science & Technology

    requirements. It has been shown that force is a lawful response measure under positive reinforcement (Notterman and Mintz, 1965). Subjects will adjust...concluded that response force in an escape situation is a lawful response measure, and that it operates in a manner similar to force under positive reinforcement .

  20. Mechanisms of Ionospheric Mass Escape

    NASA Technical Reports Server (NTRS)

    Moore, T. E.; Khazanov, G. V.

    2010-01-01

    The dependence of ionospheric O+ escape flux on electromagnetic energy flux and electron precipitation into the ionosphere is derived for a hypothetical ambipolar pick-up process, powered the relative motion of plasmas and neutral upper atmosphere, and by electron precipitation, at heights where the ions are magnetized but influenced by photo-ionization, collisions with gas atoms, ambipolar and centrifugal acceleration. Ion pick-up by the convection electric field produces "ring-beam" or toroidal velocity distributions, as inferred from direct plasma measurements, from observations of the associated waves, and from the spectra of incoherent radar echoes. Ring-beams are unstable to plasma wave growth, resulting in rapid relaxation via transverse velocity diffusion, into transversely accelerated ion populations. Ion escape is substantially facilitated by the ambipolar potential, but is only weakly affected by centrifugal acceleration. If, as cited simulations suggest, ion ring beams relax into non-thermal velocity distributions with characteristic speed equal to the local ion-neutral flow speed, a generalized "Jeans escape" calculation shows that the escape flux of ionospheric O+ increases with Poynting flux and with precipitating electron density in rough agreement with observations.

  1. Immunosuppressive effects of apoptotic cells

    NASA Astrophysics Data System (ADS)

    Voll, Reinhard E.; Herrmann, Martin; Roth, Edith A.; Stach, Christian; Kalden, Joachim R.; Girkontaite, Irute

    1997-11-01

    Apoptotic cell death is important in the development and homeostasis of multicellular organisms and is a highly controlled means of eliminating dangerous, damaged or unnecessary cells without causing an inflammatory response or tissue damage,. We now show that the presence of apoptotic cells during monocyte activation increases their secretion of the anti-inflammatory and immunoregulatory cytokine interleukin 10 (IL-10) and decreases secretion of the proinflammatory cytokines tumour necrosis factor-α (TNF-α), IL-1 and IL-12. This may inhibit inflammation and contribute to impaired cell-mediated immunity in conditions associated with increased apoptosis, such as viral infections, pregnancy, cancer and exposure to radiation.

  2. The anti-apoptotic PON2 protein is Wnt/β-catenin-regulated and correlates with radiotherapy resistance in OSCC patients.

    PubMed

    Krüger, Maximilian; Amort, Julianna; Wilgenbus, Petra; Helmstädter, Johanna P; Grechowa, Irina; Ebert, Julia; Tenzer, Stefan; Moergel, Maximilian; Witte, Ines; Horke, Sven

    2016-08-09

    Aberrant Wnt signaling and control of anti-apoptotic mechanisms are pivotal features in different types of cancer to undergo cell death programs. The intracellular human enzyme Paraoxonase-2 (PON2) is known to have anti-apoptotic properties in leukemia and oral squamous cell cancer (OSCC) cells. However, the distinct regulating pathways are poorly understood. First, we present a so far unknown regulation of PON2 protein expression through the Wnt/GSK3β/β-catenin pathway in leukemia and OSCC cells. This was confirmed via in silico analysis, promoter reporter studies and treatment of multiple cell lines (K562, SCC-4, PCI-13) with different Wnt ligands/inhibitors in vitro. Ex vivo analysis of OSCC patients revealed a correlation between PON2 and β-catenin expression in tumor tissue. Higher PON2 expression in OSCC is associated with relapse independently of treatment (e.g. surgery/radio-/chemotherapy). These results emphasize the clinical impact of the newly described regulation of PON2 through Wnt/GSK3β/β-catenin. More importantly, the study revealed the fundamental finding of an overall Wnt/GSK3β/β-catenin dependent regulation of PON2 in different cancers, which was confirmed by systematic and multimethodological approaches. Thus, the herein presented mechanistic insight contributes to a better understanding of tumor specific escape from cell death strategies and suggests PON2 as a new potential biomarker for therapy resistance or as a prognostic tumor marker.

  3. The anti-apoptotic PON2 protein is Wnt/β-catenin-regulated and correlates with radiotherapy resistance in OSCC patients

    PubMed Central

    Krüger, Maximilian; Amort, Julianna; Wilgenbus, Petra; Helmstädter, Johanna P.; Grechowa, Irina; Ebert, Julia; Tenzer, Stefan; Moergel, Maximilian; Witte, Ines; Horke, Sven

    2016-01-01

    Aberrant Wnt signaling and control of anti-apoptotic mechanisms are pivotal features in different types of cancer to undergo cell death programs. The intracellular human enzyme Paraoxonase-2 (PON2) is known to have anti-apoptotic properties in leukemia and oral squamous cell cancer (OSCC) cells. However, the distinct regulating pathways are poorly understood. First, we present a so far unknown regulation of PON2 protein expression through the Wnt/GSK3β/β-catenin pathway in leukemia and OSCC cells. This was confirmed via in silico analysis, promoter reporter studies and treatment of multiple cell lines (K562, SCC-4, PCI-13) with different Wnt ligands/inhibitors in vitro. Ex vivo analysis of OSCC patients revealed a correlation between PON2 and β-catenin expression in tumor tissue. Higher PON2 expression in OSCC is associated with relapse independently of treatment (e.g. surgery/radio-/chemotherapy). These results emphasize the clinical impact of the newly described regulation of PON2 through Wnt/GSK3β/β-catenin. More importantly, the study revealed the fundamental finding of an overall Wnt/GSK3β/β-catenin dependent regulation of PON2 in different cancers, which was confirmed by systematic and multimethodological approaches. Thus, the herein presented mechanistic insight contributes to a better understanding of tumor specific escape from cell death strategies and suggests PON2 as a new potential biomarker for therapy resistance or as a prognostic tumor marker. PMID:27322774

  4. Blue Origin Conducts Pad Escape Test

    NASA Image and Video Library

    Blue Origin conducted a successful pad escape test Oct. 19 at the company's West Texas launch site, firing its pusher escape motor and launching a full-scale suborbital crew capsule from a simulate...

  5. Escape from Tumor Cell Dormancy

    DTIC Science & Technology

    2012-10-01

    3 ESCAPE FROM TUMOR CELL DORMANCY An Organotypic Liver System to Study Tumor Cell Dormancy Alan Wells and Donna Stolz (UPitt), Linda Griffith (MIT...insights into dormancy and the transition that heralds metastatic emergenceis due mainly to the lack of tractable experimental systems with which to... systems are being optimized in others. The main efforts during the first year of this two-year project have been focused on the establishing the

  6. Cold Ion Escape from Mars

    NASA Astrophysics Data System (ADS)

    Fränz, M.; Dubinin, E.; Wei, Y.; Morgan, D.; Andrews, D.; Barabash, S.; Lundin, R.; Fedorov, A.

    2013-09-01

    It has always been challenging to observe the flux of ions with energies of less than 10eV escaping from the planetary ionospheres. We here report on new measurements of the ionospheric ion flows at Mars by the ASPERA-3 experiment on board Mars Express in combination with the MARSIS radar experiment. We first compare calculations of the mean ion flux observed by ASPERA-3 alone with previously published results. We then combine observations of the cold ion velocity by ASPERA-3 with observations of the cold plasma density by MARSIS since ASPERA-3 misses the cold core of the ion distribution. We show that the mean density of the nightside plasma observed by MARSIS is about two orders higher than observed by ASPERA-3 (Fig.1). Combining both datasets we show that the main escape channel is along the shadow boundary on the tailside of Mars (Fig. 2). At a distance of about 0.5 R_M the flux settles at a constant value (Fig. 3) which indicates that about half of the transterminator ionospheric flow escapes from the planet. Possible mechanism to generate this flux can be the ionospheric pressure gradient between dayside and nightside or momentum transfer from the solar wind via the induced magnetic field since the flow velocity is in the Alfvénic regime.

  7. Senescence may mediate conversion of tau phosphorylation-induced apoptotic escape to neurodegeneration.

    PubMed

    Wang, Jian-Zhi; Wang, Zhi-Hao

    2015-08-01

    Neurodegeneration is the characteristic pathology in the brains of Alzheimer's disease (AD). However, the nature and molecular mechanism leading to the degeneration are not clarified. Given that only the neurons filled with neurofibrillary tangles survive to the end stage of the disease and the major component of the tangles is the hyperphosphorylated tau proteins, it is conceivable that tau hyperphosphorylation must play a crucial role in AD neurodegeneration. We have demonstrated that tau hyperphosphorylation renders the cells more resistant to the acute apoptosis. The molecular mechanisms involve substrate competition of tau and β-catenin for glycogen synthase kinase 3β (GSK-3β); activation of Akt; preservation of Bcl-2 and suppression of Bax, cytosolic cytochrome-c, and caspase-3 activity; and upregulation of unfolded protein response (UPR), i.e., up-regulating phosphorylation of PERK, eIF2 and IRE1 with an increased cleavage of ATF6 and ATF4. On the other hand, tau hyperphosphorylation promotes its intracellular accumulation and disrupts axonal transport; hyperphosphorylated tau also impairs cholinergic function and inhibits proteasome activity. These findings indicate that tau hyperphosphorylation and its intracellular accumulation play dual role in the evolution of AD. We speculate that transient tau phosphorylation helps cells abort from an acute apoptosis, while persistent tau hyperphosphorylation/accumulation may trigger cell senescence that eventually causes a chronic neurodegeneration. Therefore, the nature of "AD neurodegeneration" may represent a new type of tau-regulated chronic neuron death; and the stage of cell senescence may provide a broad window for the intervention of AD.

  8. Apoptotic markers in protozoan parasites

    PubMed Central

    2010-01-01

    The execution of the apoptotic death program in metazoans is characterized by a sequence of morphological and biochemical changes that include cell shrinkage, presentation of phosphatidylserine at the cell surface, mitochondrial alterations, chromatin condensation, nuclear fragmentation, membrane blebbing and the formation of apoptotic bodies. Methodologies for measuring apoptosis are based on these markers. Except for membrane blebbing and formation of apoptotic bodies, all other events have been observed in most protozoan parasites undergoing cell death. However, while techniques exist to detect these markers, they are often optimised for metazoan cells and therefore may not pick up subtle differences between the events occurring in unicellular organisms and multi-cellular organisms. In this review we discuss the markers most frequently used to analyze cell death in protozoan parasites, paying special attention to changes in cell morphology, mitochondrial activity, chromatin structure and plasma membrane structure/permeability. Regarding classical regulators/executors of apoptosis, we have reviewed the present knowledge of caspase-like and nuclease activities. PMID:21062457

  9. On ion escape from Venus

    NASA Astrophysics Data System (ADS)

    Jarvinen, R.

    2011-04-01

    This doctoral thesis is about the solar wind influence on the atmosphere of the planet Venus. A numerical plasma simulation model was developed for the interaction between Venus and the solar wind to study the erosion of charged particles from the Venus upper atmosphere. The developed model is a hybrid simulation where ions are treated as particles and electrons are modelled as a fluid. The simulation was used to study the solar wind induced ion escape from Venus as observed by the European Space Agency's Venus Express and NASA's Pioneer Venus Orbiter spacecraft. Especially, observations made by the ASPERA-4 particle instrument onboard Venus Express were studied. The thesis consists of an introductory part and four peer-reviewed articles published in scientific journals. In the introduction Venus is presented as one of the terrestrial planets in the Solar System and the main findings of the work are discussed within the wider context of planetary physics.Venus is the closest neighbouring planet to the Earth and the most earthlike planet in its size and mass orbiting the Sun. Whereas the atmosphere of the Earth consists mainly of nitrogen and oxygen, Venus has a hot carbon dioxide atmosphere, which is dominated by the greenhouse effect. Venus has all of its water in the atmosphere, which is only a fraction of the Earth's total water supply. Since planets developed presumably in similar conditions in the young Solar System, why Venus and Earth became so different in many respects?One important feature of Venus is that the planet does not have an intrinsic magnetic field. This makes it possible for the solar wind, a continuous stream of charged particles from the Sun, to flow close to Venus and to pick up ions from the planet's upper atmosphere. The strong intrinsic magnetic field of the Earth dominates the terrestrial magnetosphere and deflects the solar wind flow far away from the atmosphere. The region around Venus where the planet's atmosphere interacts with the

  10. On ion escape from Venus

    NASA Astrophysics Data System (ADS)

    Jarvinen, Riku

    2011-04-01

    This doctoral thesis is about the solar wind influence on the atmosphere of the planet Venus. A numerical plasma simulation model was developed for the interaction between Venus and the solar wind to study the erosion of charged particles from the Venus upper atmosphere. The developed model is a hybrid simulation where ions are treated as particles and electrons are modelled as a fluid. The simulation was used to study the solar wind induced ion escape from Venus as observed by the European Space Agency's Venus Express and NASA's Pioneer Venus Orbiter spacecraft. Especially, observations made by the ASPERA-4 particle instrument onboard Venus Express were studied. The thesis consists of an introductory part and four peer-reviewed articles published in scientific journals. In the introduction Venus is presented as one of the terrestrial planets in the Solar System and the main findings of the work are discussed within the wider context of planetary physics. Venus is the closest neighbouring planet to the Earth and the most earthlike planet in its size and mass orbiting the Sun. Whereas the atmosphere of the Earth consists mainly of nitrogen and oxygen, Venus has a hot carbon dioxide atmosphere, which is dominated by the greenhouse effect. Venus has all of its water in the atmosphere, which is only a fraction of the Earth's total water supply. Since planets developed presumably in similar conditions in the young Solar System, why Venus and Earth became so different in many respects? One important feature of Venus is that the planet does not have an intrinsic magnetic field. This makes it possible for the solar wind, a continuous stream of charged particles from the Sun, to flow close to Venus and to pick up ions from the planet's upper atmosphere. The strong intrinsic magnetic field of the Earth dominates the terrestrial magnetosphere and deflects the solar wind flow far away from the atmosphere. The region around Venus where the planet's atmosphere interacts with the

  11. Malaria Parasites: The Great Escape

    PubMed Central

    Rénia, Laurent; Goh, Yun Shan

    2016-01-01

    Parasites of the genus Plasmodium have a complex life cycle. They alternate between their final mosquito host and their intermediate hosts. The parasite can be either extra- or intracellular, depending on the stage of development. By modifying their shape, motility, and metabolic requirements, the parasite adapts to the different environments in their different hosts. The parasite has evolved to escape the multiple immune mechanisms in the host that try to block parasite development at the different stages of their development. In this article, we describe the mechanisms reported thus far that allow the Plasmodium parasite to evade innate and adaptive immune responses. PMID:27872623

  12. Wind-Induced Atmospheric Escape: Titan

    NASA Technical Reports Server (NTRS)

    Hartle, Richard; Johnson, Robert; Sittler, Edward, Jr.; Sarantos, Menelaos; Simpson, David

    2012-01-01

    Rapid thermospheric flows can significantly enhance the estimates of the atmospheric loss rate and the structure of the atmospheric corona of a planetary body. In particular, rapid horizontal flow at the exobase can increase the corresponding constituent escape rate. Here we show that such corrections, for both thermal and non-thermal escape, cannot be ignored when calculating the escape of methane from Titan, for which drastically different rates have been proposed. Such enhancements are also relevant to Pluto and exoplanets.

  13. Electronic Escape Trails for Firefighters

    NASA Technical Reports Server (NTRS)

    Jorgensen, Charles; Schipper, John; Betts, Bradley

    2008-01-01

    A proposed wireless-communication and data-processing system would exploit recent advances in radio-frequency identification devices (RFIDs) and software to establish information lifelines between firefighters in a burning building and a fire chief at a control station near but outside the building. The system would enable identification of trails that firefighters and others could follow to escape from the building, including identification of new trails should previously established trails become blocked. The system would include a transceiver unit and a computer at the control station, portable transceiver units carried by the firefighters in the building, and RFID tags that the firefighters would place at multiple locations as they move into and through the building (see figure). Each RFID tag, having a size of the order of a few centimeters, would include at least standard RFID circuitry and possibly sensors for measuring such other relevant environmental parameters as temperature, levels of light and sound, concentration of oxygen, concentrations of hazardous chemicals in smoke, and/or levels of nuclear radiation. The RFID tags would be activated and interrogated by the firefighters and control-station transceivers. Preferably, RFID tags would be configured to communicate with each other and with the firefighters units and the control station in an ordered sequence, with built-in redundancy. In a typical scenario, as firefighters moved through a building, they would scatter many RFID tags into smoke-obscured areas by use of a compressed-air gun. Alternatively or in addition, they would mark escape trails by dropping RFID tags at such points of interest as mantraps, hot spots, and trail waypoints. The RFID tags could be of different types, operating at different frequencies to identify their functions, and possibly responding by emitting audible beeps when activated by signals transmitted by transceiver units carried by nearby firefighters.

  14. Inhibition of chaotic escape from a potential well by incommensurate escape-suppressing excitations.

    PubMed

    Chacón, R; Martínez, J A

    2002-03-01

    Theoretical results are presented concerning the reduction of chaotic escape from a potential well by means of a harmonic parametric excitation that satisfies an ultrasubharmonic resonance condition with the escape-inducing excitation. The possibility of incommensurate escape-suppressing excitations is demonstrated by studying rational approximations to the irrational escape-suppressing frequency. The analytical predictions for the suitable amplitudes and initial phases of the escape-suppressing excitation are tested against numerical simulations based on a high-resolution grid of initial conditions. These numerical results indicate that the reduction of escape is reliably achieved for small amplitudes and at, and only at, the predicted initial phases. For the case of irrational escape-suppressing frequencies, the effective escape-reducing initial phases are found to lie close to the accumulation points of the set of suitable initial phases that are associated with the complete series of convergents up to the convergent giving the chosen rational approximation.

  15. Apoptotic index for prediction of postmolar gestational trophoblastic neoplasia.

    PubMed

    Braga, Antonio; Maestá, Izildinha; Rocha Soares, Renan; Elias, Kevin M; Custódio Domingues, Maria Aparecida; Barbisan, Luis Fernando; Berkowitz, Ross S

    2016-09-01

    Although 85% of patients with a complete hydatidiform mole achieve spontaneous remission after a few months, 15% of them will experience gestational trophoblastic neoplasia, which requires chemotherapy. To date, there is no biomarker to predict post-molar gestational trophoblastic neoplasia before the initiation of human chorionic gonadotropin surveillance. The purpose of this study was to assess the relationship between the expression of apoptosis markers in the molar villous trophoblasts and the subsequent development of gestational trophoblastic neoplasia after the evacuation of a complete hydatidiform mole. This was a retrospective cohort study of patients with complete hydatidiform mole who were diagnosed, treated, and followed at the Center of Trophoblastic Diseases (Botucatu/São Paulo State and Rio de Janeiro/Rio de Janeiro State, Brazil) from 1995-2014. Patients were divided temporally into derivation (1995-2004) and validation (2005-2014) cohorts. Immunohistochemistry was used to examine tissue expression of the apoptosis inhibitor survivin or the pro-apoptotic enzyme caspase-3. Survivin stains for cytoplasmic and nuclear expression were evaluated independently. Caspase-3 expression was measured as an apoptotic index of positive staining cells over negative staining cells multiplied by 100. Receiver operating characteristic curves were then constructed, and the area under the curve was calculated to test the performance characteristics of the staining to predict the subsequent development of gestational trophoblastic neoplasia. The final study population comprised 780 patients, with 390 patients in each temporal cohort: 590 patients entered spontaneous remission, and 190 patients experienced post-molar gestational trophoblastic neoplasia. Neither nuclear nor cytoplasmic survivin expression performed well as a predictor of subsequent gestational trophoblastic neoplasia. The caspase-3 apoptotic index was a strong risk factor for subsequent gestational

  16. Escape as Reinforcement and Escape Extinction in the Treatment of Feeding Problems

    ERIC Educational Resources Information Center

    LaRue, Robert H.; Stewart, Victoria; Piazza, Cathleen C.; Volkert, Valerie M.; Patel, Meeta R.; Zeleny, Jason

    2011-01-01

    Given the effectiveness of putative escape extinction as treatment for feeding problems, it is surprising that little is known about the effects of escape as reinforcement for appropriate eating during treatment. In the current investigation, we examined the effectiveness of escape as reinforcement for mouth clean (a product measure of…

  17. Submarine 'safe to escape' studies in man.

    PubMed

    Jurd, K M; Seddon, F M; Thacker, J C; Blogg, S L; Stansfield, M R D; White, M G; Loveman, G A M

    2014-01-01

    The Royal Navy requires reliable advice on the safe limits of escape from a distressed submarine (DISSUB). Flooding in a DISSUB may cause a rise in ambient pressure, increasing the risk of decompression sickness (DCS) and decreasing the maximum depth from which it is safe to escape. The aim of this study was to investigate the pressure/depth limits to escape following saturation at raised ambient pressure. Exposure to saturation pressures up to 1.6 bar (a) (160 kPa) (n = 38); escapes from depths down to 120 meters of sea water (msw) (n = 254) and a combination of saturation followed by escape (n = 90) was carried out in the QinetiQ Submarine Escape Simulator, Alverstoke, United Kingdom. Doppler ultrasound monitoring was used to judge the severity of decompression stress. The trials confirmed the previously untested advice, in the Guardbook, that if a DISSUB was lying at a depth of 90 msw, then it was safe to escape when the pressure in the DISSUB was 1.5 bar (a), but also indicated that this advice may be overly conservative. This study demonstrated that the upper DISSUB saturation pressure limit to safe escape from 90 msw was 1.6 bar (a), resulting in two cases of DCS.

  18. Escaping in Literature. Teaching in the Library.

    ERIC Educational Resources Information Center

    Hurst, Carol Otis

    1993-01-01

    Explores the "escape" genre of children's literature, and recommends and describes several books that deal with such topics as escape from prison camps, from slavery, from the Holocaust, from war, and from Utopian societies. These books should provoke meaningful classroom discussions and allow children to view their own world from different…

  19. Learning from escaped prescribed fire reviews [Abstract

    Treesearch

    Anne Black; Dave Thomas; James Saveland

    2011-01-01

    Over the past decade, the wildland fire community has developed a number of innovative methods for conducting a review following escape of a prescribed fire. The stated purpose been to identify methods that not only meet policy requirements, but to reduce future escapes. Implicit is the assumption that a review leads to learning. Yet, as organizational learning expert...

  20. 30 CFR 57.11051 - Escape routes.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Escape routes. 57.11051 Section 57.11051 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... read direction signs that clearly indicate the ways of escape....

  1. 30 CFR 57.11051 - Escape routes.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Escape routes. 57.11051 Section 57.11051 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR METAL AND NONMETAL MINE... read direction signs that clearly indicate the ways of escape....

  2. Atmospheric escape, redox evolution, and planetary habitability

    NASA Astrophysics Data System (ADS)

    Catling, D. C.; Zahnle, K. J.

    2011-12-01

    Through the greenhouse effect, the presence and composition of an atmosphere is critical for defining a (conventional) circumstellar habitable zone in terms of planetary surface temperatures suitable for liquid water. Lack of knowledge of planetary atmospheres is likely to frustrate attempts to say with any certainty whether detected terrestrial-sized exoplanets may or may not be habitable. Perhaps an underappreciated role in such considerations is the evolutionary effect of atmospheric escape for determining atmospheric composition or whether an atmosphere exists in the first place. Whether atmospheres exist at all on planets is demonstrably connected to the effect of integrated atmospheric escape. When we observe our own Solar System and transiting exoplanets, the existence of an atmosphere is clearly delineated by a relative vulnerability to thermal escape and impact erosion. The prevalence of thermal escape as a key evolutionary determinant for the presence of planetary atmosphere is shown by a relationship between the relative solar (or stellar) heating and the escape velocity. Those bodies with too much stellar heating and too smaller escape velocity end up devoid of atmospheres. Impact erosion is evident in the relationship between impact velocity and escape velocity. Escape due to impacts is particularly important for understanding the large differences in the atmospheres of giant planet moons, such as Ganymede versus Titan. It is also significant for Mars-sized planets. The oxidation state of atmospheres is important for some theories of the origin of life (where an early reducing atmosphere is helpful for organic synthesis) and the evolution of advanced life (where free molecular oxygen is the best source of high energy metabolism). Surfaces on some relatively small planets and moons are observed to have evolved to an oxidized state, which theory and observation can explain through atmospheric escape. There are several examples in the Solar System where a

  3. Yessotoxin as an apoptotic inducer.

    PubMed

    Korsnes, Mónica Suárez; Espenes, Arild

    2011-06-01

    This work summarises current knowledge on how the marine toxin yessotoxin (YTX) induces apoptosis in different types of cells. The work also addresses perspectives for future research on this topic. YTX triggers apoptosis in a variety of cellular systems including cancer cells. The actual apoptotic pathways are not fully understood and seem to be cell-specific. YTX can induce the mitochondrial pathway in myoblast cell lines, but its potential to activate other signalling pathways and possible cross-talk between them has not been reported. Improvement in our understanding of death signalling induction by YTX may contribute to identifying novel molecular mechanisms of interest for therapeutic applications. Copyright © 2011 Elsevier Ltd. All rights reserved.

  4. Apoptotic Signaling in Mouse Odontogenesis

    PubMed Central

    Svandova, Eva; Tucker, Abigail S.

    2012-01-01

    Abstract Apoptosis is an important morphogenetic event in embryogenesis as well as during postnatal life. In the last 2 decades, apoptosis in tooth development (odontogenesis) has been investigated with gradually increasing focus on the mechanisms and signaling pathways involved. The molecular machinery responsible for apoptosis exhibits a high degree of conservation but also organ and tissue specific patterns. This review aims to discuss recent knowledge about apoptotic signaling networks during odontogenesis, concentrating on the mouse, which is often used as a model organism for human dentistry. Apoptosis accompanies the entire development of the tooth and corresponding remodeling of the surrounding bony tissue. It is most evident in its role in the elimination of signaling centers within developing teeth, removal of vestigal tooth germs, and in odontoblast and ameloblast organization during tooth mineralization. Dental apoptosis is caspase dependent and proceeds via mitochondrial mediated cell death with possible amplification by Fas-FasL signaling modulated by Bcl-2 family members. PMID:22204278

  5. Apoptotic signaling in mouse odontogenesis.

    PubMed

    Matalova, Eva; Svandova, Eva; Tucker, Abigail S

    2012-01-01

    Apoptosis is an important morphogenetic event in embryogenesis as well as during postnatal life. In the last 2 decades, apoptosis in tooth development (odontogenesis) has been investigated with gradually increasing focus on the mechanisms and signaling pathways involved. The molecular machinery responsible for apoptosis exhibits a high degree of conservation but also organ and tissue specific patterns. This review aims to discuss recent knowledge about apoptotic signaling networks during odontogenesis, concentrating on the mouse, which is often used as a model organism for human dentistry. Apoptosis accompanies the entire development of the tooth and corresponding remodeling of the surrounding bony tissue. It is most evident in its role in the elimination of signaling centers within developing teeth, removal of vestigal tooth germs, and in odontoblast and ameloblast organization during tooth mineralization. Dental apoptosis is caspase dependent and proceeds via mitochondrial mediated cell death with possible amplification by Fas-FasL signaling modulated by Bcl-2 family members.

  6. Cross Sections for Planetary Escape

    NASA Astrophysics Data System (ADS)

    Tully, C.

    2001-05-01

    Energetic charged-particle bombardment, dissociative recombination and photodissociation processes produce energetic recoil atoms which heat the thermosphere and can lead to escape from a planet affecting the evolution of the atmosphere. In describing these processes by Monte Carlo methods, many of the critical cross sections are not available in the energy range of interest, a few eV to 1 keV. Here we present our recent results for elastic collision and collisional dissociation cross sections relevant to Titan, Triton, Europa and the terrestrial planets [1,2]. Elastic and diffusion cross sections were calculated using both quantum mechanical techniques and the semiclassical JWKB approximation for the collision of ground state oxygen atoms in the energy range 1-10eV [2]. This involved calculation of phase shifts for each of the 18 molecular energy states of O2 which separate to two ground state O atoms. For an O thermosphere the total elastic cross section is close to that typically assumed but the escape depths are shown to be larger than those typically used. Dissociation cross sections of N + N2 were calculated using a semiclassical method, in the energy range 0-30eV. This required treating the vibrational motion quantum mechanically while the rotational and the relative translational motion were treated classically. The evolution of the system was calculated by simultaneous propagation of the classical as well as the quantal degrees of freedom. The solution to the classical part was carried out by solving Hamilton equations of motion using an effective London-Eyring-Polanyi-Sato potential energy surface, calculated by Laganá et al [3]. Propagation of the quantal wavefunction was carried out by solving the time dependent Schrödinger equation using the split operator technique with the help of the fast fourier transform which was used to calculate the second derivatives arising from the kinetic energy operator. This work was supported by NASA's Planetary

  7. CD8 epitope escape and reversion in acute HCV infection.

    PubMed

    Timm, Joerg; Lauer, Georg M; Kavanagh, Daniel G; Sheridan, Isabelle; Kim, Arthur Y; Lucas, Michaela; Pillay, Thillagavathie; Ouchi, Kei; Reyor, Laura L; Schulze zur Wiesch, Julian; Gandhi, Rajesh T; Chung, Raymond T; Bhardwaj, Nina; Klenerman, Paul; Walker, Bruce D; Allen, Todd M

    2004-12-20

    In the setting of acute hepatitis C virus (HCV) infection, robust HCV-specific CD8+ cytotoxic T lymphocyte (CTL) responses are associated with initial control of viremia. Despite these responses, 70-80% of individuals develop persistent infection. Although viral escape from CD8 responses has been illustrated in the chimpanzee model of HCV infection, the effect of CD8 selection pressure on viral evolution and containment in acute HCV infection in humans remains unclear. Here, we examined viral evolution in an immunodominant human histocompatibility leukocyte antigen (HLA)-B8-restricted NS3 epitope in subjects with acute HCV infection. Development of mutations within the epitope coincided with loss of strong ex vivo tetramer and interferon gamma enzyme-linked immunospot responses, and endogenous expression of variant NS3 sequences suggested that the selected mutations altered processing and presentation of the variant epitope. Analysis of NS3 sequences from 30 additional chronic HCV-infected subjects revealed a strong association between sequence variation within this region and expression of HLA-B8, supporting reproducible allele-specific selection pressures at the population level. Interestingly, transmission of an HLA-B8-associated escape mutation to an HLA-B8 negative subject resulted in rapid reversion of the mutation. Together, these data indicate that viral escape from CD8+ T cell responses occurs during human HCV infection and that acute immune selection pressure is of sufficient magnitude to influence HCV evolution.

  8. ESCAP migration study gathers momentum.

    PubMed

    1980-01-01

    A comparative study is being conducted in the ESCAP (Economic and Social Commission for Asia and the Pacific) region on the relationships of migration and urbanization to development. The 1st stage of the study will entail the preparation of country reports on the census analysis of migration, urbanization and development. The 2nd stage will involve preparation of a series of national migration surveys. The 3rd phase will involve assisting member governments to formulate a comprehensive population redistribution policy as part of their national development planning. 1st-phase country reports have been completed in Sri Lanka, South Korea, the Philippines, and Indonesia. Migration in Sri Lanka has largely been rural-to-rural with little urbanization so far. The picture in South Korea has been the opposite, with rapid urbanization in the 1960s and 1970s; the government is hoping to divert some population to smaller cities away from Seoul. The pattern in the Philippines is 1 of urban primacy with the metropolis of Manila accounting for over 1/3 of the country's total population. Indonesia is characterized by a dense heartland in the Java-Bali regions. However, the rate of urbanization here has been slower. Migrants in all the countries studied are preponderantly young. The sex differential varies from country to country. The influence of migration on subsequent fertility is unknown.

  9. Apoptotic cells enhance pathogenesis of Listeria monocytogenes.

    PubMed

    Pattabiraman, Goutham; Palasiewicz, Karol; Visvabharathy, Lavanya; Freitag, Nancy E; Ucker, David S

    2017-04-01

    Infections by pathogenic microorganisms elicit host immune responses, which crucially limit those infections. Pathogens employ various strategies to evade host immunity. We have identified the exploitation of the repertoire of potent immunosuppressive responses elicited normally by apoptotic cells ("Innate Apoptotic Immunity"; IAI) as one of these strategies. In the case of Listeria monocytogenes, an environmentally ubiquitous, foodborne bacterial pathogen capable of causing life-threatening invasive disease in immunocompromised and elderly individuals, the induction of host cell apoptosis appears to play an important role in pathogenesis. Previous studies have documented extensive lymphocyte apoptosis resulting from L. monocytogenes infection and demonstrated paradoxically that lymphocyte-deficient animals exhibit diminished susceptibility to listerial pathogenicity. We speculated that the triggering of IAI following the induction of host cell apoptosis was responsible for enhanced pathogenesis, and that the administration of exogenous apoptotic cells would serve to exert this effect. Importantly, apoptotic cells, which are not susceptible to L. monocytogenes infection, do not provide a niche for bacterial replication. Our experiments confirm that apoptotic cells, including exogenous apoptotic cells induced to die independently of the pathogen, specifically enhance pathogenesis. The recognition of a role of apoptotic cells and Innate Apoptotic Immunity in microbial pathogenesis provides an intriguing and novel insight for therapeutic approaches for the control of pathogenic infections.

  10. Light weight escape capsule for fighter aircraft

    NASA Technical Reports Server (NTRS)

    Robert, James A.

    1988-01-01

    Emergency crew escape capabilities have been less than adequate for fighter aircraft since before WW II. From the over-the-side bailout of those days through the current ejection seat with a rocket catapult, escaping from a disabled aircraft has been risky at best. Current efforts are underway toward developing a high-tech, smart ejection seat that will give fighter pilots more room to live in the sky, but an escape capsule is needed to meet current and future fighter envelopes. Escape capsules have a bad reputation due to past examples of high weight, poor performance and great complexity. However, the advantages available demand that a capsule be developed. This capsule concept will minimize the inherent disavantages and incorporate the benefits while integrating all aspects of crew station design. The resulting design is appropriate for a crew station of the year 2010 and includes improved combat acceleration protection, chemical or biological combat capability, improved aircraft to escape system interaction, and the highest level of escape performance achievable. The capsule is compact, which can allow a reduced aircraft size and weighs only 1200 lb. The escape system weight penalty is only 120 lb higher than that for the next ejection seat and the capsule has a corresponding increase in performance.

  11. Escape of magnetic toroids from the Sun

    NASA Technical Reports Server (NTRS)

    Bieber, John W.; Rust, David M.

    1995-01-01

    Analysis of heliospheric magnetic fields at 1 AU shows that 10(exp 24) Mx of net azimuthal flux escapes from the Sun per solar cycle. This rate is consistent with rates derived from other indicators of flux escape, including coronal mass ejections and filament eruptions. The toroidal flux escape rate is compared with the apparent rate of flux emergence at the solar surface, and it is concluded that escaping toroids will remove at least 20% of the emerging flux, and may remove as much as 100% of emerging flux if multiple eruptions occur on the toroids. The data imply that flux escapes the Sun with an efficiency far exceeding Parker's upper limit estimate of 3%. Toroidal flux escape is almost certainly the source of the observed overwinding of the interplanetary magnetic field spiral. Two mechanisms to facilitate net flux escape are discussed: helicity charging to push open the fields and flux transport with reconnection to close them off. We estimate the Sun will shed approximately 2 x 10(exp 45) of magnetic helicity per solar cycle, leading to a mean helicity density of 100 Mx(exp 2)cm(exp -3) at 1 AU, which agrees well with observations.

  12. Statin escape phenomenon: Fact or fiction?

    PubMed Central

    Barkas, Fotios; Elisaf, Moses; Klouras, Eleftherios; Dimitriou, Theodora; Tentolouris, Nikolaos; Liberopoulos, Evangelos

    2017-01-01

    AIM To evaluate the presence of the so called “statin escape” phenomenon among hyperlipidemic subjects attending a lipid clinic. METHODS This was a retrospective analysis of 1240 hyperlipidemic individuals followed-up for ≥ 3 years. We excluded those individuals meeting one of the following criteria: Use of statin therapy at baseline visit, discontinuation of statin treatment at most recent visit, change in statin treatment during follow-up and poor compliance to treatment. Statin escape phenomenon was defined as an increase in low-density lipoprotein cholesterol (LDL-C) levels at the most recent visit by > 10% compared with the value at 6 mo following initiation of statin treatment. RESULTS Of 181 eligible subjects, 31% exhibited the statin escape phenomenon. No major differences regarding baseline characteristics were found between statin escapers and non-statin escapers. Both escapers and non-escapers had similar baseline LDL-C levels [174 (152-189) and 177 (152-205) mg/dL, respectively]. In comparison with non-escapers, statin escapers demonstrated lower LDL-C levels at 6 mo after treatment initiation [88 (78-97) mg/dL vs 109 (91-129) mg/dL, P < 0.05], but higher levels at the most recent visit [103 (96-118) mg/dL vs 94 (79-114) mg/dL, P < 0.05]. CONCLUSION These data confirm the existence of an escape phenomenon among statin-treated individuals. The clinical significance of this phenomenon remains uncertain. PMID:28261552

  13. The fast escaping set for quasiregular mappings

    NASA Astrophysics Data System (ADS)

    Bergweiler, Walter; Drasin, David; Fletcher, Alastair

    2014-06-01

    The fast escaping set of a transcendental entire function is the set of all points which tend to infinity under iteration as fast as possible compatible with the growth of the function. We study the analogous set for quasiregular mappings in higher dimensions and show, among other things, that various equivalent definitions of the fast escaping set for transcendental entire functions in the plane also coincide for quasiregular mappings. We also exhibit a class of quasiregular mappings for which the fast escaping set has the structure of a spider's web.

  14. Interspecific evaluation of octopus escape behavior.

    PubMed

    Wood, James B; Anderson, Roland C

    2004-01-01

    The well-known ability of octopuses to escape enclosures is a behavior that can be fatal and, therefore, is an animal welfare issue. This study obtained survey data from 38 participants-primarily scientists and public aquarists who work with octopuses-on 25 described species of octopus. The study demonstrates that the likeliness to escape is species specific (p =.001). The study gives husbandry techniques to keep captive octopuses contained. This first interspecific study of octopus escape behavior allows readers to make informed species-specific husbandry choices.

  15. The Neuroethology of C. elegans Escape

    PubMed Central

    Pirri, Jennifer K.; Alkema, Mark J.

    2012-01-01

    Escape behaviors are crucial to survive predator encounters. Touch to the head of C. elegans induces an escape response where the animal rapidly backs away from the stimulus and suppresses foraging head movements. The coordination of head and body movements facilitates escape from predacious fungi that cohabitate with nematodes in organic debris. An appreciation of the natural habitat of laboratory organisms, like C. elegans, enables a comprehensive neuroethological analysis of behavior. In this review we discuss the neuronal mechanisms and the ecological significance of the C. elegans touch response. PMID:22226513

  16. Wind enhanced planetary escape: Collisional modifications

    NASA Technical Reports Server (NTRS)

    Curtis, S. A.; Hartle, R. E.

    1976-01-01

    The problem of thermal escape is considered in which both the effects of thermospheric winds at the exobase and collisions below the exobase are included in a Monte Carlo calculation. The collisions are included by means of a collisional relaxation layer of a background gas which models the transition region between the exosphere and the thermosphere. The wind effects are considered in the limiting cases of vertical and horizontal flows. Two species are considered: terrestrial hydrogen and terrestrial helium. In the cases of terrestrial hydrogen the escape fluxes were found to be strongly filtered or throttled by collisions at high exospheric temperatures. The model is applied to molecular hydrogen diffusing through a methane relaxation layer under conditions possible on Titan. The results are similar to the case of terrestrial hydrogen with wind enhanced escape being strongly suppressed by collisions. It is concluded that wind enhanced escape is not an important process on Titan.

  17. Biogeochemistry: Nocturnal escape route for marsh gas

    NASA Astrophysics Data System (ADS)

    Anthony, Katey Walter; MacIntyre, Sally

    2016-07-01

    A field study of methane emissions from wetlands reveals that more of the gas escapes through diffusive processes than was thought, mostly at night. Because methane is a greenhouse gas, the findings have implications for global warming.

  18. Evolutionary dynamics of escape from biomedical intervention.

    PubMed Central

    Iwasa, Yoh; Michor, Franziska; Nowak, Martin A

    2003-01-01

    Viruses, bacteria, eukaryotic parasites, cancer cells, agricultural pests and other inconvenient animates have an unfortunate tendency to escape from selection pressures that are meant to control them. Chemotherapy, anti-viral drugs or antibiotics fail because their targets do not hold still, but evolve resistance. A major problem in developing vaccines is that microbes evolve and escape from immune responses. The fundamental question is the following: if a genetically diverse population of replicating organisms is challenged with a selection pressure that has the potential to eradicate it, what is the probability that this population will produce escape mutants? Here, we use multi-type branching processes to describe the accumulation of mutants in independent lineages. We calculate escape dynamics for arbitrary mutation networks and fitness landscapes. Our theory shows how to estimate the probability of success or failure of biomedical intervention, such as drug treatment and vaccination, against rapidly evolving organisms. PMID:14728779

  19. Promoter clearance and escape in prokaryotes.

    PubMed

    Hsu, Lilian M

    2002-09-13

    Promoter escape is the last stage of transcription initiation when RNA polymerase, having initiated de novo phosphodiester bond synthesis, must begin to relinquish its hold on promoter DNA and advance to downstream regions (DSRs) of the template. In vitro, this process is marked by the release of high levels of abortive transcripts at most promoters, reflecting the high instability of initial transcribing complexes (ITCs) and indicative of the existence of barriers to the escape process. The high abortive initiation level is the result of the existence of unproductive ITCs that carry out repeated initiation and abortive release without escaping the promoter. The formation of unproductive ITCs is a widespread phenomenon, but it occurs to different extent on different promoters. Quantitative analysis of promoter mutations suggests that the extent and pattern of abortive initiation and promoter escape is determined by the sequence of promoter elements, both in the promoter recognition region (PRR) and the initial transcribed sequence (ITS). A general correlation has been found that the stronger the promoter DNA-polymerase interaction, the poorer the ability of RNA polymerase to escape the promoter. In gene regulation, promoter escape can be the rate-limiting step for transcription initiation. An increasing number of regulatory proteins are known to exert their control at this step. Examples are discussed with an emphasis on the diverse mechanisms involved. At the molecular level, the X-ray crystal structures of RNA polymerase and its various transcription complexes provide the framework for understanding the functional data on abortive initiation and promoter escape. Based on structural and biochemical evidence, a mechanism for abortive initiation and promoter escape is described.

  20. Dynamics of the Pin Pallet Runaway Escapement

    DTIC Science & Technology

    1978-06-01

    pin pallet simulation to a spring- driven timing mechanism. 3. Modification of the present model to accommcdate the simulation of a plate pallet ...NUMULER( Technical Report ARLCD-TFR-77062 4. TITLE (and Sublttle) 5. TYPE OF REPORT & PERIOD COVERED DYNAMICS OF THE PIN PALLET RUNAWAY ESCAPEMENT 6...instantaneous positions of the pallet pin and the escape-wheel form the basis of the controls in the computer program. DO I FJAN 1473AVr1t’I o INOV 6IS

  1. Submarine tower escape decompression sickness risk estimation.

    PubMed

    Loveman, G A M; Seddon, E M; Thacker, J C; Stansfield, M R; Jurd, K M

    2014-01-01

    Actions to enhance survival in a distressed submarine (DISSUB) scenario may be guided in part by knowledge of the likely risk of decompression sickness (DCS) should the crew attempt tower escape. A mathematical model for DCS risk estimation has been calibrated against DCS outcome data from 3,738 exposures of either men or goats to raised pressure. Body mass was used to scale DCS risk. The calibration data included more than 1,000 actual or simulated submarine escape exposures and no exposures with substantial staged decompression. Cases of pulmonary barotrauma were removed from the calibration data. The calibrated model was used to estimate the likelihood of DCS occurrence following submarine escape from the United Kingdom Royal Navy tower escape system. Where internal DISSUB pressure remains at - 0.1 MPa, escape from DISSUB depths < 200 meters is estimated to have DCS risk < 6%. Saturation at raised DISSUB pressure markedly increases risk, with > 60% DCS risk predicted for a 200-meter escape from saturation at 0.21 MPa. Using the calibrated model to predict DCS for direct ascent from saturation gives similar risk estimates to other published models.

  2. [Escape of transgenes and its ecological risks].

    PubMed

    Lu, Baorong; Zhang, Wenju; Li, Bo

    2003-06-01

    The rapid development of biotechnology, particularly the transgenic technology, has brought us with tremendous opportunities to solve the world's starvation problems that have been caused by the continued expanding of the global population. However, the application of transgenic biotechnology and the environmental release of transgenic organisms have evoked a series of extraordinary debates on biosafety issues related to the prosperity and the future of transgenic technology. The public and scientific communities are desperately interested in knowing whether the transgenic products would pose negative influences on plants and animals, human life and health, as well as on genetic resources and environment. These concerns have become universal hot topics over the last decade. Among the most debated biosafety issues caused potentially by transgenic products, transgene escape to the environment and its consequent ecological risks become one of the appealing focal points. In this review, a series of biosafety issues concerned by public, including the possibility of transgene escape and its various paths, as well as the potential ecological risks caused by such escape were discussed, and various approaches for controlling for transgene escape and the factors to consider when designing safety isolation distance between transgenic varieties and other concerned plants were also examined. The objective of this review is to allow readers to understand the potential biosafety problems caused by environmental release of transgenic crops and by the escape of foreign transgenes in particular, and to use the effective tools to control and avoid transgene escape.

  3. Polymer escape from a confining potential

    SciTech Connect

    Mökkönen, Harri; Ikonen, Timo; Jónsson, Hannes; Ala-Nissila, Tapio

    2014-02-07

    The rate of escape of polymers from a two-dimensionally confining potential well has been evaluated using self-avoiding as well as ideal chain representations of varying length, up to 80 beads. Long timescale Langevin trajectories were calculated using the path integral hyperdynamics method to evaluate the escape rate. A minimum is found in the rate for self-avoiding polymers of intermediate length while the escape rate decreases monotonically with polymer length for ideal polymers. The increase in the rate for long, self-avoiding polymers is ascribed to crowding in the potential well which reduces the free energy escape barrier. An effective potential curve obtained using the centroid as an independent variable was evaluated by thermodynamic averaging and Kramers rate theory then applied to estimate the escape rate. While the qualitative features are well reproduced by this approach, it significantly overestimates the rate, especially for the longer polymers. The reason for this is illustrated by constructing a two-dimensional effective energy surface using the radius of gyration as well as the centroid as controlled variables. This shows that the description of a transition state dividing surface using only the centroid fails to confine the system to the region corresponding to the free energy barrier and this problem becomes more pronounced the longer the polymer is. A proper definition of a transition state for polymer escape needs to take into account the shape as well as the location of the polymer.

  4. Gated escaping of ligand out of protein

    NASA Astrophysics Data System (ADS)

    Sheu, Sheh-Yi; Yang, Dah-Yen

    2000-01-01

    We construct a new gating model and develop a new theory to study the escaping process of a ligand out of a spherical cavity with a puncture (or gate) on the surface. The gate undulation can be regulated by any time-dependent function and the motion of the ligand inside the spherical cavity is mapped into a two-dimensional entropy potential surface. Hence the driving force of our model is entropy only. For a static gate, the escaping process corresponds to climbing a two-dimensional entropy barrier. When the gate open angle is small, the escaping rate is proportional to the square of the opening angle. The prefactor of the escaping rate constant depends on the curvature of the entropy potential surface. For coherent gating, the survival time depends not only on the gate undulation frequency but also on how the initial state is defined. On the escaping from protein, our escaping rate shows it is qualitatively consistent with the experimental result of ligand recombination in myoglobin.

  5. Tolerance to apoptotic cells is regulated by indoleamine 2,3-dioxygenase

    PubMed Central

    Ravishankar, Buvana; Liu, Haiyun; Shinde, Rahul; Chandler, Phillip; Baban, Babak; Tanaka, Masato; Munn, David H.; Mellor, Andrew L.; Karlsson, Mikael C. I.; McGaha, Tracy L.

    2012-01-01

    Tolerance to self-antigens present in apoptotic cells is critical to maintain immune-homeostasis and prevent systemic autoimmunity. However, mechanisms that sustain self-tolerance are poorly understood. Here we show that systemic administration of apoptotic cells to mice induced splenic expression of the tryptophan catabolizing enzyme indoleamine 2,3-dioxygenase (IDO). IDO expression was confined to the splenic marginal zone and was abrogated by depletion of CD169+ cells. Pharmacologic inhibition of IDO skewed the immune response to apoptotic cells, resulting in increased proinflammatory cytokine production and increased effector T-cell responses toward apoptotic cell-associated antigens. Presymptomatic lupus-prone MRLlpr/lpr mice exhibited abnormal elevated IDO expression in the marginal zone and red pulp and inhibition of IDO markedly accelerated disease progression. Moreover, chronic exposure of IDO-deficient mice to apoptotic cells induced a lupus-like disease with serum autoreactivity to double-stranded DNA associated with renal pathology and increased mortality. Thus, IDO limits innate and adaptive immunity to apoptotic self-antigens and IDO-mediated regulation inhibits inflammatory pathology caused by systemic autoimmune disease. PMID:22355111

  6. Apoptotic cell death and efferocytosis in atherosclerosis.

    PubMed

    Van Vré, Emily A; Ait-Oufella, Hafid; Tedgui, Alain; Mallat, Ziad

    2012-04-01

    Apoptotic cell death is an important feature of atherosclerotic plaques, and it seems to exert both beneficial and detrimental effects depending on the cell type and plaque stage. Because late apoptotic cells can launch proatherogenic inflammatory responses, adequate engulfment of apoptotic cells (efferocytosis) by macrophages is important to withstand atherosclerosis progression. Several efferocytosis systems, composed of different phagocytic receptors, apoptotic ligands, and bridging molecules, can be distinguished. Because phagocytes in atherosclerotic plaques are very much solicited, a fully operative efferocytosis system seems to be an absolute requisite. Indeed, recent studies demonstrate that deletion of just 1 of the efferocytosis pathways aggravates atherosclerosis. This review discusses the role of apoptosis in atherosclerosis and general mechanisms of efferocytosis, to end with indirect and direct indications of the significance of effective efferocytosis in atherosclerosis.

  7. Intercellular transfer of apoptotic signals via electrofusion

    SciTech Connect

    Park, Jin Suk; Lee, Wilson; McCulloch, Christopher A.

    2012-05-01

    We determined whether cells that are induced to undergo anoikis by matrix detachment can initiate apoptosis in healthy cells following electroporation-induced fusion. Separate populations of MDCK cells undergoing anoikis and stained with FITC-annexin or viable MDCK cells that were labeled with spectrally discrete fluorescent beads were electroporated. Cells were analyzed by flow cytometry for enumeration of viable cells with beads, apoptotic cells or fused cells. Electroporation promoted a 49-fold increase of the percentage of viable cells that had fused with apoptotic cells. Apoptotic cell-viable cell fusions were 8-fold more likely to not attach to cell culture plastic and 2.3-fold less likely to proliferate after 24 hr incubation than viable cell fusion controls. These data demonstrate that apoptotic signals can be transferred between cells by electrofusion, possibly suggesting a novel investigative approach for optimizing targeted cell deletion in cancer treatment.

  8. An Apoptotic 'Eat Me' Signal: Phosphatidylserine Exposure.

    PubMed

    Segawa, Katsumori; Nagata, Shigekazu

    2015-11-01

    Apoptosis and the clearance of apoptotic cells are essential processes in animal development and homeostasis. For apoptotic cells to be cleared, they must display an 'eat me' signal, most likely phosphatidylserine (PtdSer) exposure, which prompts phagocytes to engulf the cells. PtdSer, which is recognized by several different systems, is normally confined to the cytoplasmic leaflet of the plasma membrane by a 'flippase'; apoptosis activates a 'scramblase' that quickly exposes PtdSer on the cell surface. The molecules that flip and scramble phospholipids at the plasma membrane have recently been identified. Here we discuss recent findings regarding the molecular mechanisms of apoptotic PtdSer exposure and the clearance of apoptotic cells.

  9. 46 CFR 177.500 - Means of escape.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 7 2011-10-01 2011-10-01 false Means of escape. 177.500 Section 177.500 Shipping COAST...) CONSTRUCTION AND ARRANGEMENT Escape Requirements § 177.500 Means of escape. (a) Except as otherwise provided in... least two means of escape, one of which must not be a watertight door. (b) The two required means of...

  10. Hydrogen Escape from early Earth and Mars

    NASA Astrophysics Data System (ADS)

    Zugger, M. E.; Ramirez, R. M.; Kasting, J. F.

    2012-12-01

    A controversy regarding hydrodynamic escape rates arose when Tian et al. (2005) published transonic escape rates for an atmosphere composed of pure H2. Tian et al. concluded that the hydrogen escape rate from early Earth would have been a factor of 20 or more slower than the diffusion limit, even if the solar EUV (extreme ultraviolet) flux was enhanced by a factor of 5 relative to today. This conclusion was challenged by Catling (2006), who pointed out that solar EUV fluxes could have been much higher than this so that plenty of energy should have been available to power escape. This controversy has remained unresolved to date. Hydrogen escape from early Mars is also of interest. As discussed in this session in a complementary paper by Ramirez et al., collision-induced absorption by molecular hydrogen could have helped to warm early Mars, perhaps explaining the formation of valleys and valley networks. Ramirez et al. have shown that a mixture of 90% CO2 and 10% H2 is capable raising early Mars' surface temperature above the freezing point of water, for surface pressures exceeding ~3 bar. However, we need to understand whether H2 mixing ratios of 10% are physically plausible. The H2 partial pressure in Mars' early atmosphere would have been determined by the balance between volcanic outgassing and escape to space. The 10% mixing ratio is high compared to the value of ~10-3 typically assumed for early Earth. But Mars' early atmosphere may have been more reduced than Earth's (Wadwha, 2001); if the hydrogen escape rate on Mars was also slower than on Earth, then additional increases in atmospheric hydrogen concentration are possible. To answer these questions about the early atmospheres of Earth and Mars, we have modified an existing model of hydrodynamic escape, developed by F. Tian, J. Kasting, and others, to converge for atmospheres with a wide range of hydrogen mixing ratios. The model finds subsonic solutions to the hydrodynamic equations; these can be shown to

  11. MEMO: Mars Escape and Magnetic Orbiter

    NASA Astrophysics Data System (ADS)

    Chassefiere, E.; Langlais, B.; Leblanc, F.; Sotin, C.; Barabash, S.; Dehant, V.; Dougherty, M.; Lammer, H.; Mandea, M.; Vennerstrom, S.

    There are several reasons to believe that Mars could have become an Earth like planet rather than the present dry and cold planet. In particular, many elements suggest the presence of liquid water at the Martian surface during a relatively short period at an early stage of its history. Since liquid water may have been the birthplace for life on Earth, the fate of Martian water is one of the major key and yet unanswered question to be solved. Mars Escape and Magnetic Orbiter (MEMO) is a low periapsis orbiter of Mars devoted to the measurement of present escape and the characterization of the fossil magnetic field of Mars. The use of a low periapsis altitude orbit (120-150 km) is required to detect and quantify all populations of atoms and molecules involved in escape. It is also required to measure the magnetic field of Mars with an unprecedented spatial resolution that would allow getting a more precise timing of the dynamo and its disappearance. Achieving a full characterization of atmospheric escape, and extrapolating it back to the past requires: (i) to measure escape fluxes of neutral and ion species, and characterize the dynamics and chemistry of the regions of the atmosphere where escape occurs (thermosphere, ionosphere, exosphere), as well as their responses to solar activity, and (ii) to characterize the lateral variations of the magnetic field of lithospheric origin, and by extension, the timing of the Martian dynamo. Of particular interest is the extinction of the dynamo that is thought to have enhanced the atmospheric escape processes still operating today. The proposed low-periapsis orbiter will consist of the following elements: • An "Escape Package" to characterize by both in-situ and remote measurements the thermosphere, ionosphere, exosphere and solar wind interaction regions (from one hundred to several thousand km), including thermal, suprathermal 1 and energetic particles. • A "Magnetic Field Package", to characterize the magnetization of the

  12. Room Escape at Class: Escape Games Activities to Facilitate the Motivation and Learning in Computer Science

    ERIC Educational Resources Information Center

    Borrego, Carlos; Fernández, Cristina; Blanes, Ian; Robles, Sergi

    2017-01-01

    Real-life room-escape games are ludic activities in which participants enter a room in order to get out of it only after solving some riddles. In this paper, we explain a Room Escape teaching experience developed in the Engineering School at Universitat Autònoma de Barcelona. The goal of this activity is to increase student's motivation and to…

  13. Residential smoke alarms and fire escape plans.

    PubMed Central

    Harvey, P A; Sacks, J J; Ryan, G W; Bender, P F

    1998-01-01

    OBJECTIVE: To estimate the proportion of U.S. homes with installed smoke alarms, smoke alarms on the same floor as occupants' bedrooms, and fire escape plans. METHODS: The authors analyzed data on smoke alarm use and fire escape planning from a 1994 stratified random telephone survey of 5238 U.S. households. RESULTS: Respondents from 91% of surveyed households reported the presence of at least one installed smoke alarm, and 94% of respondents reported having an alarm on the same level of the home as their sleeping area. The prevalence of installed smoke alarms varied by highest education level in the household and income level. Sixty percent of all households had designed or discussed a fire escape plan at least once; only 17% of these households had actually practiced one. CONCLUSIONS: Although overall use of smoke alarms was high, certain population subgroups were less likely to have smoke alarms or to have them installed on the same floor as bedrooms. Fire escape planning, another important safety measure, was somewhat less common, and very few respondents reported having practiced a fire escape plan with the members of their household. PMID:9769771

  14. Genes that escape from X inactivation.

    PubMed

    Berletch, Joel B; Yang, Fan; Xu, Jun; Carrel, Laura; Disteche, Christine M

    2011-08-01

    To achieve a balanced gene expression dosage between males (XY) and females (XX), mammals have evolved a compensatory mechanism to randomly inactivate one of the female X chromosomes. Despite this chromosome-wide silencing, a number of genes escape X inactivation: in women about 15% of X-linked genes are bi-allelically expressed and in mice, about 3%. Expression from the inactive X allele varies from a few percent of that from the active allele to near equal expression. While most genes have a stable inactivation pattern, a subset of genes exhibit tissue-specific differences in escape from X inactivation. Escape genes appear to be protected from the repressive chromatin modifications associated with X inactivation. Differences in the identity and distribution of escape genes between species and tissues suggest a role for these genes in the evolution of sex differences in specific phenotypes. The higher expression of escape genes in females than in males implies that they may have female-specific roles and may be responsible for some of the phenotypes observed in X aneuploidy.

  15. Cerebrospinal Fluid HIV Escape from Antiretroviral Therapy.

    PubMed

    Ferretti, Francesca; Gisslen, Magnus; Cinque, Paola; Price, Richard W

    2015-06-01

    CNS infection is a nearly constant facet of systemic CNS infection and is generally well controlled by suppressive systemic antiretroviral therapy (ART). However, there are instances when HIV can be detected in the cerebrospinal fluid (CSF) despite suppression of plasma viruses below the clinical limits of measurement. We review three types of CSF viral escape: asymptomatic, neuro-symptomatic, and secondary. The first, asymptomatic CSF escape, is seemingly benign and characterized by lack of discernable neurological deterioration or subsequent CNS disease progression. Neuro-symptomatic CSF escape is an uncommon, but important, entity characterized by new or progressive CNS disease that is critical to recognize clinically because of its management implications. Finally, secondary CSF escape, which may be even more uncommon, is defined by an increase of CSF HIV replication in association with a concomitant non-HIV infection, as a consequence of the local inflammatory response. Understanding these CSF escape settings not only is important for clinical diagnosis and management but also may provide insight into the CNS HIV reservoir.

  16. Compensatory escape mechanism at low Reynolds number

    PubMed Central

    Gemmell, Brad J.; Sheng, Jian; Buskey, Edward J.

    2013-01-01

    Despite high predation pressure, planktonic copepods remain one of the most abundant groups on the planet. Their escape response provides one of most effective mechanisms to maximize evolutionary fitness. Owing to their small size (100 µm) compared with their predators (>1 mm), increasing viscosity is believed to have detrimental effects on copepods’ fitness at lower temperature. Using high-speed digital holography we acquire 3D kinematics of the nauplius escape including both location and detailed appendage motion. By independently varying temperature and viscosity we demonstrate that at natural thermal extremes, contrary to conventional views, nauplii achieve equivalent escape distance while maintaining optimal velocity. Using experimental results and kinematic simulations from a resistive force theory propulsion model, we demonstrate that a shift in appendage timing creates an increase in power stroke duration relative to recovery stroke duration. This change allows the nauplius to limit losses in velocity and maintain distance during escapes at the lower bound of its natural thermal range. The shift in power stroke duration relative to recovery stroke duration is found to be regulated by the temperature dependence of swimming appendage muscle groups, not a dynamic response to viscosity change. These results show that copepod nauplii have natural adaptive mechanisms to compensate for viscosity variations with temperature but not in situations in which viscosity varies independent of temperature, such as in some phytoplankton blooms. Understanding the robustness of escapes in the wake of environmental changes such as temperature and viscosity has implications in assessing the future health of performance compensation. PMID:23487740

  17. ESCAPE AS REINFORCEMENT AND ESCAPE EXTINCTION IN THE TREATMENT OF FEEDING PROBLEMS

    PubMed Central

    LaRue, Robert H; Stewart, Victoria; Piazza, Cathleen C; Volkert, Valerie M; Patel, Meeta R; Zeleny, Jason

    2011-01-01

    Given the effectiveness of putative escape extinction as treatment for feeding problems, it is surprising that little is known about the effects of escape as reinforcement for appropriate eating during treatment. In the current investigation, we examined the effectiveness of escape as reinforcement for mouth clean (a product measure of swallowing), escape as reinforcement for mouth clean plus escape extinction (EE), and EE alone as treatment for the food refusal of 5 children. Results were similar to those of previous studies, in that reinforcement alone did not result in increases in mouth clean or decreases in inappropriate behavior (e.g., Piazza, Patel, Gulotta, Sevin, & Layer, 2003). Increases in mouth clean and decreases in inappropriate behavior occurred when the therapist implemented EE independent of the presence or absence of reinforcement. Results are discussed in terms of the role of negative reinforcement in the etiology and treatment of feeding problems. PMID:22219525

  18. Escape as reinforcement and escape extinction in the treatment of feeding problems.

    PubMed

    LaRue, Robert H; Stewart, Victoria; Piazza, Cathleen C; Volkert, Valerie M; Patel, Meeta R; Zeleny, Jason

    2011-01-01

    Given the effectiveness of putative escape extinction as treatment for feeding problems, it is surprising that little is known about the effects of escape as reinforcement for appropriate eating during treatment. In the current investigation, we examined the effectiveness of escape as reinforcement for mouth clean (a product measure of swallowing), escape as reinforcement for mouth clean plus escape extinction (EE), and EE alone as treatment for the food refusal of 5 children. Results were similar to those of previous studies, in that reinforcement alone did not result in increases in mouth clean or decreases in inappropriate behavior (e.g., Piazza, Patel, Gulotta, Sevin, & Layer, 2003). Increases in mouth clean and decreases in inappropriate behavior occurred when the therapist implemented EE independent of the presence or absence of reinforcement. Results are discussed in terms of the role of negative reinforcement in the etiology and treatment of feeding problems.

  19. Thermal escape from extrasolar giant planets

    PubMed Central

    Koskinen, Tommi T.; Lavvas, Panayotis; Harris, Matthew J.; Yelle, Roger V.

    2014-01-01

    The detection of hot atomic hydrogen and heavy atoms and ions at high altitudes around close-in extrasolar giant planets (EGPs) such as HD209458b implies that these planets have hot and rapidly escaping atmospheres that extend to several planetary radii. These characteristics, however, cannot be generalized to all close-in EGPs. The thermal escape mechanism and mass loss rate from EGPs depend on a complex interplay between photochemistry and radiative transfer driven by the stellar UV radiation. In this study, we explore how these processes change under different levels of irradiation on giant planets with different characteristics. We confirm that there are two distinct regimes of thermal escape from EGPs, and that the transition between these regimes is relatively sharp. Our results have implications for thermal mass loss rates from different EGPs that we discuss in the context of currently known planets and the detectability of their upper atmospheres. PMID:24664923

  20. Thermal escape from extrasolar giant planets.

    PubMed

    Koskinen, Tommi T; Lavvas, Panayotis; Harris, Matthew J; Yelle, Roger V

    2014-04-28

    The detection of hot atomic hydrogen and heavy atoms and ions at high altitudes around close-in extrasolar giant planets (EGPs) such as HD209458b implies that these planets have hot and rapidly escaping atmospheres that extend to several planetary radii. These characteristics, however, cannot be generalized to all close-in EGPs. The thermal escape mechanism and mass loss rate from EGPs depend on a complex interplay between photochemistry and radiative transfer driven by the stellar UV radiation. In this study, we explore how these processes change under different levels of irradiation on giant planets with different characteristics. We confirm that there are two distinct regimes of thermal escape from EGPs, and that the transition between these regimes is relatively sharp. Our results have implications for thermal mass loss rates from different EGPs that we discuss in the context of currently known planets and the detectability of their upper atmospheres.

  1. Statistical theory of asteroid escape rates.

    PubMed

    Jaffé, Charles; Ross, Shane D; Lo, Martin W; Marsden, Jerrold; Farrelly, David; Uzer, T

    2002-07-01

    Transition states in phase space are identified and shown to regulate the rate of escape of asteroids temporarily captured in circumplanetary orbits. The transition states, similar to those occurring in chemical reaction dynamics, are then used to develop a statistical semianalytical theory for the rate of escape of asteroids temporarily captured by Mars. Theory and numerical simulations are found to agree to better than 1%. These calculations suggest that further development of transition state theory in celestial mechanics, as an alternative to large-scale numerical simulations, will be a fruitful approach to mass transport calculations.

  2. Black holes escaping from domain walls

    SciTech Connect

    Flachi, Antonino; Sasaki, Misao; Pujolas, Oriol; Tanaka, Takahiro

    2006-06-15

    Previous studies concerning the interaction of branes and black holes suggested that a small black hole intersecting a brane may escape via a mechanism of reconnection. Here we consider this problem by studying the interaction of a small black hole and a domain wall composed of a scalar field and simulate the evolution of this system when the black hole acquires an initial recoil velocity. We test and confirm previous results, however, unlike the cases previously studied, in the more general set-up considered here, we are able to follow the evolution of the system also during the separation, and completely illustrate how the escape of the black hole takes place.

  3. Widespread Impact of HLA Restriction on Immune Control and Escape Pathways of HIV-1

    PubMed Central

    Listgarten, Jennifer; Pfeifer, Nico; Tan, Vincent; Kadie, Carl; Walker, Bruce D.; Ndung'u, Thumbi; Shapiro, Roger; Frater, John; Brumme, Zabrina L.; Goulder, Philip J. R.; Heckerman, David

    2012-01-01

    The promiscuous presentation of epitopes by similar HLA class I alleles holds promise for a universal T-cell-based HIV-1 vaccine. However, in some instances, cytotoxic T lymphocytes (CTL) restricted by HLA alleles with similar or identical binding motifs are known to target epitopes at different frequencies, with different functional avidities and with different apparent clinical outcomes. Such differences may be illuminated by the association of similar HLA alleles with distinctive escape pathways. Using a novel computational method featuring phylogenetically corrected odds ratios, we systematically analyzed differential patterns of immune escape across all optimally defined epitopes in Gag, Pol, and Nef in 2,126 HIV-1 clade C-infected adults. Overall, we identified 301 polymorphisms in 90 epitopes associated with HLA alleles belonging to shared supertypes. We detected differential escape in 37 of 38 epitopes restricted by more than one allele, which included 278 instances of differential escape at the polymorphism level. The majority (66 to 97%) of these resulted from the selection of unique HLA-specific polymorphisms rather than differential epitope targeting rates, as confirmed by gamma interferon (IFN-γ) enzyme-linked immunosorbent spot assay (ELISPOT) data. Discordant associations between HLA alleles and viral load were frequently observed between allele pairs that selected for differential escape. Furthermore, the total number of associated polymorphisms strongly correlated with average viral load. These studies confirm that differential escape is a widespread phenomenon and may be the norm when two alleles present the same epitope. Given the clinical correlates of immune escape, such heterogeneity suggests that certain epitopes will lead to discordant outcomes if applied universally in a vaccine. PMID:22379086

  4. Chlorobenzenes, lindane and dieldrin induce apoptotic alterations in human peripheral blood lymphocytes (in vitro study).

    PubMed

    Michałowicz, Jaromir; Mokra, Katarzyna; Rosiak, Karolina; Sicińska, Paulina; Bukowska, Bożena

    2013-11-01

    In this study, we have assessed apoptotic effect of 1,2,4-trichlorobenzene, hexachlorobenzene, lindane and dieldrin on human peripheral blood lymphocytes. We observed an increase in ROS formation and a decrease in mitochondrial transmembrane potential in the cells incubated with low concentrations of all compounds studied, in particular lindane and dieldrin. ROS formation and changes in mitochondrial transmembrane potential may have influenced caspase-3 activation, a crucial enzyme in the apoptotic process. Moreover, chlorobenzenes, and in particular lindane and dieldrin changed cells' membrane permeability and induced phosphatidylserine translocation, which confirmed that they are capable of inducing apoptosis in human lymphocytes. Apoptotic changes in human lymphocytes provoked by biologically relevant concentrations of these substances suggest that they may disturb function of immunological system especially among people occupationally exposed to their action. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Martian Atmospheric and Ionospheric plasma Escape

    NASA Astrophysics Data System (ADS)

    Lundin, Rickard

    2016-04-01

    Solar forcing is responsible for the heating, ionization, photochemistry, and erosion processes in the upper atmosphere throughout the lifetime of the terrestrial planets. Of the four terrestrial planets, the Earth is the only one with a fully developed biosphere, while our kin Venus and Mars have evolved into arid inhabitable planets. As for Mars, there are ample evidences for an early Noachian, water rich period on Mars. The question is, what made Mars evolve so differently compared to the Earth? Various hydrosphere and atmospheric evolution scenarios for Mars have been forwarded based on surface morphology, chemical composition, simulations, semi-empiric (in-situ data) models, and the long-term evolution of the Sun. Progress has been made, but the case is still open regarding the changes that led to the present arid surface and tenuous atmosphere at Mars. This presentation addresses the long-term variability of the Sun, the solar forcing impact on the Martian atmosphere, and its interaction with the space environment - an electromagnetic wave and particle interaction with the upper atmosphere that has implications for its photochemistry, composition, and energization that governs thermal and non-thermal escape. Non-thermal escape implies an electromagnetic upward energization of planetary ions and molecules to velocities above escape velocity, a process governed by a combination of solar EUV radiation (ionization), and energy and momentum transfer by the solar wind. The ion escape issue dates back to the early Soviet and US-missions to Mars, but the first more accurate estimates of escape rates came with the Phobos-2 mission in 1989. Better-quality ion composition measurement results of atmospheric/ionospheric ion escape from Mars, obtained from ESA Mars Express (MEX) instruments, have improved our understanding of the ion escape mechanism. With the NASA MAVEN spacecraft orbiting Mars since Sept. 2014, dual in-situ measurement with plasma instruments are now

  6. On the escape of CH4 from Pluto's atmosphere

    NASA Astrophysics Data System (ADS)

    Koskinen, T. T.; Erwin, J. T.; Yelle, R. V.

    2015-09-01

    We adapted a multispecies escape model, developed for close-in extrasolar planets, to calculate the escape rates of CH4 and N2 from Pluto. In the absence of escape, CH4 should overtake N2 as the dominant species below the exobase. The CH4 profile depends strongly on the escape rate, however, and the typical escape rates predicted for Pluto lead to a nearly constant mixing ratio of less than 1% below the exobase. In this case the CH4 escape rate is only 5-10% of the N2 escape rate. Observations of the CH4 profile by the New Horizons/ALICE spectrograph can constrain the CH4 escape rate and provide a unique test for escape models.

  7. Comparative analysis of dendritic cells transduced with different anti-apoptotic molecules: sensitivity to tumor-induced apoptosis.

    PubMed

    Balkir, Levent; Tourkova, Irina L; Makarenkova, Valeria P; Shurin, Galina V; Robbins, Paul D; Yin, Xiao-Ming; Chatta, Gurkamal; Shurin, Michael R

    2004-05-01

    Tumors develop mechanisms to escape recognition by the immune system. It has recently been demonstrated that tumors cause apoptotic death of key immune cells, including the major antigen-presenting cells, dendritic cells (DC). Elimination of DC from the tumor environment significantly diminishes development of specific immunologic responses. We have recently demonstrated that tumor-induced DC apoptosis could be prevented by overexpression of the anti-apoptotic molecule Bcl-x(L). The aim of this study was to identify extrinsic and intrinsic tumor-induced apoptotic pathways in DC by targeting different anti-apoptotic molecules, including FLIP, XIAP/hILP, dominant-negative procaspase-9 and HSP70. Murine bone marrow derived DC were transduced with adenoviral vectors carrying different anti-apoptotic molecules and co-incubated with tumor cells in a Transwell system. Apoptosis of DC was assessed by Annexin V and PI staining. We have demonstrated that adenoviral infection of DC with genes encoding different anti-apoptotic molecules exhibits different degrees of resistance to melanoma-induced apoptosis. Furthermore, we have shown that anti-apoptotic molecules other than the Bcl-2 family of proteins are able to protect DC and prevent tumor-induced apoptosis in DC. The results show that tumor-induced apoptosis of DC is not limited to the mitochondrial pathway of cell death and open additional possibilities for targeted molecular protection of DC longevity in cancer. Therefore, effective protection of DC from tumor-induced apoptosis may significantly improve the efficacy of DC-based therapies for cancer. Copyright 2004 John Wiley & Sons, Ltd.

  8. Gene polymorphisms, apoptotic capacity and cancer risk.

    PubMed

    Imyanitov, Evgeny N

    2009-04-01

    Programmed cell death has been implicated in various aspects of cancer development. Apoptotic capacity is a subject of significant interindividual variations, which are largely attributed to hereditary traits. Single nucleotide polymorphisms (SNPs) located within cell death genes may influence cancer risk in various ways. Low activity of apoptosis may favor cancer development because of the failure to eliminate cellular clones carrying DNA damage and propensity to inflammation, but may also protect against malignancy due to preservation of antitumor immune cells. Phenotyping studies assessing cell death rate in cancer patients versus healthy controls are limited in number and produced controversial results. TP53 R72P polymorphism is the only SNP whose functional impact on apoptotic response has been replicated in independent investigations. Intriguingly, meta-analysis of TP53 genotyping studies has provided evidence for the association between apoptosis-deficient TP53 genotype and tumor susceptibility. Systematic analysis of cancer-predisposing relevance of other apoptotic gene SNPs remains to be done.

  9. Detection of apoptotic cells using immunohistochemistry.

    PubMed

    Newbold, Andrea; Martin, Ben P; Cullinane, Carleen; Bots, Michael

    2014-11-03

    Immunohistochemistry is commonly used to show the presence of apoptotic cells in situ. In this protocol, B-cell lymphoma cells are injected into recipient mice and, on tumor formation, the mice are treated with the apoptosis inducer vorinostat (a histone deacetylase inhibitor). Tumor samples are fixed and sectioned, and fragmented DNA (a feature of apoptotic cells) is end-labeled by terminal deoxynucleotidyl transferase dUTP nick-end labeling (TUNEL). Immunohistochemical methods are then used to detect the labeled DNA and identify B-cell lymphoma cells in the last stage of apoptosis. Because the assay can lead to false-positive results, it is advisable to carry out an additional assay (e.g., immunohistochemistry for active caspase-3) to confirm the presence of apoptotic cells.

  10. Developing the E-Scape Software System

    ERIC Educational Resources Information Center

    Derrick, Karim

    2012-01-01

    Most innovations have contextual pre-cursors that prompt new ways of thinking and in their turn help to give form to the new reality. This was the case with the e-scape software development process. The origins of the system existed in software components and ideas that we had developed through previous projects, but the ultimate direction we took…

  11. Animal escapology II: escape trajectory case studies

    PubMed Central

    Domenici, Paolo; Blagburn, Jonathan M.; Bacon, Jonathan P.

    2011-01-01

    Summary Escape trajectories (ETs; measured as the angle relative to the direction of the threat) have been studied in many taxa using a variety of methodologies and definitions. Here, we provide a review of methodological issues followed by a survey of ET studies across animal taxa, including insects, crustaceans, molluscs, lizards, fish, amphibians, birds and mammals. Variability in ETs is examined in terms of ecological significance and morpho-physiological constraints. The survey shows that certain escape strategies (single ETs and highly variable ETs within a limited angular sector) are found in most taxa reviewed here, suggesting that at least some of these ET distributions are the result of convergent evolution. High variability in ETs is found to be associated with multiple preferred trajectories in species from all taxa, and is suggested to provide unpredictability in the escape response. Random ETs are relatively rare and may be related to constraints in the manoeuvrability of the prey. Similarly, reports of the effect of refuges in the immediate environment are relatively uncommon, and mainly confined to lizards and mammals. This may be related to the fact that work on ETs carried out in laboratory settings has rarely provided shelters. Although there are a relatively large number of examples in the literature that suggest trends in the distribution of ETs, our understanding of animal escape strategies would benefit from a standardization of the analytical approach in the study of ETs, using circular statistics and related tests, in addition to the generation of large data sets. PMID:21753040

  12. Developing the E-Scape Software System

    ERIC Educational Resources Information Center

    Derrick, Karim

    2012-01-01

    Most innovations have contextual pre-cursors that prompt new ways of thinking and in their turn help to give form to the new reality. This was the case with the e-scape software development process. The origins of the system existed in software components and ideas that we had developed through previous projects, but the ultimate direction we took…

  13. Centrifugally Stimulated Exospheric Ion Escape at Mercury

    NASA Technical Reports Server (NTRS)

    Delcourt, Dominique; Seki, K.; Terada, N.; Moore, Thomas E.

    2012-01-01

    We investigate the transport of ions in the low-altitude magnetosphere magnetosphere of Mercury. We show that, because of small spatial scales, the centrifugal effect due to curvature of the E B drift paths can lead to significant particle energization in the parallel direction. We demonstrate that because of this effect, ions with initial speed smaller than the escape speed such as those produced via thermal desorption can overcome gravity and escape into the magnetosphere. The escape route of this low-energy exosphere originating material is largely controlled by the magnetospheric convection rate. This escape route spreads over a narrower range of altitudes when the convection rate increases. Bulk transport of low-energy planetary material thus occurs within a limited region of space once moderate magnetospheric convection is established. These results suggest that, via release of material otherwise gravitationally trapped, the E B related centrifugal acceleration is an important mechanism for the net supply of plasma to the magnetosphere of Mercury.

  14. Unconventional Interrogation Yields HIV's Escape Plan.

    PubMed

    Kepler, Thomas B

    2017-06-14

    Chasing HIV-1 across the genotype landscape, unequipped to anticipate its maneuvers, the antibody variable-region genes pursue the virus in futility. In this issue of Cell Host & Microbe, Dingens et al. (2017) exhibit a powerful technology that reveals the escape pathways of HIV-1 and may enable its capture. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Escape from Albuquerque: An Apache Memorate.

    ERIC Educational Resources Information Center

    Greenfeld, Philip J.

    2001-01-01

    Clarence Hawkins, a White Mountain Apache, escaped from the Albuquerque Indian School around 1920. His 300-mile trip home, made with two other boys, exemplifies the reaction of many Indian youths to the American government's plans for cultural assimilation. The tale is told in the form of traditional Apache narrative. (TD)

  16. Nociception and escape behavior in planarians

    NASA Astrophysics Data System (ADS)

    Schoetz Collins, Eva-Maria

    2015-03-01

    Planarians are famous and widely studied for their regenerative capabilities. When a moving planarian is cut through the middle, the resulting head and tail pieces instantaneously retract and exhibit a characteristic escape response that differs from normal locomotion. In asexual animals, a similar reaction is observed when the planarian undergoes fission, suggesting that reproduction through self-tearing is a rather traumatic event for the animal. Using a multiscale approach, we unravel the dynamics, mechanics, and functional aspects of the planarian escape response. This musculature-driven gait was found to be a dominating response that supersedes the urge to feed or reproduce and quantitatively differs from other modes of planarian locomotion (gliding, peristalsis). We show that this escape gait constitutes the animal's pain response mediated by TRP like receptors and the neurotransmitter histamine, and that it can be induced through adverse thermal, mechanical, electrical or chemical stimuli. Ultimately, we will examine the neuronal subpopulations involved in mediating escape reflexes in planarians and how they are functionally restored during regeneration, thereby gaining mechanistic insight into the neuronal circuits required for specific behaviors. Supported by BWF CASI and Sloan Foundation.

  17. Learning from escaped prescribed fire reviews

    Treesearch

    Anne E. Black; Dave Thomas; James Saveland; Jennifer D. Ziegler

    2011-01-01

    The U.S. wildland fire community has developed a number of innovative methods for conducting a review following escape of a prescribed fire (expanding on the typical regional or local reviews, to include more of a learning focus - expanded After Action Reviews, reviews that incorporate High Reliability Organizing, Facilitated Learning Analyses, etc). The stated purpose...

  18. Life events and escape in conversion disorder.

    PubMed

    Nicholson, T R; Aybek, S; Craig, T; Harris, T; Wojcik, W; David, A S; Kanaan, R A

    2016-09-01

    Psychological models of conversion disorder (CD) traditionally assume that psychosocial stressors are identifiable around symptom onset. In the face of limited supportive evidence such models are being challenged. Forty-three motor CD patients, 28 depression patients and 28 healthy controls were assessed using the Life Events and Difficulties Schedule in the year before symptom onset. A novel 'escape' rating for events was developed to test the Freudian theory that physical symptoms of CD could provide escape from stressors, a form of 'secondary gain'. CD patients had significantly more severe life events and 'escape' events than controls. In the month before symptom onset at least one severe event was identified in 56% of CD patients - significantly more than 21% of depression patients [odds ratio (OR) 4.63, 95% confidence interval (CI) 1.56-13.70] and healthy controls (OR 5.81, 95% CI 1.86-18.2). In the same time period 53% of CD patients had at least one 'high escape' event - again significantly higher than 14% in depression patients (OR 6.90, 95% CI 2.05-23.6) and 0% in healthy controls. Previous sexual abuse was more commonly reported in CD than controls, and in one third of female patients was contextually relevant to life events at symptom onset. The majority (88%) of life events of potential aetiological relevance were not identified by routine clinical assessments. Nine per cent of CD patients had no identifiable severe life events. Evidence was found supporting the psychological model of CD, the Freudian notion of escape and the potential aetiological relevance of childhood traumas in some patients. Uncovering stressors of potential aetiological relevance requires thorough psychosocial evaluation.

  19. Cold Ion Escape from the Martian Ionosphere

    NASA Astrophysics Data System (ADS)

    Fränz, M.; Dubinin, E.; Wei, Y.; Woch, J.; Morgan, D.; Barabash, S.; Fedorov, A.

    2012-09-01

    It has always been challenging to observe the flux of ions with energies of less than 10eV escaping from the planetary ionospheres. We here report on new measurements of the ionospheric ion flows at Mars by the ASPERA-3 experiment on board Mars Express. We first use support from the MARSIS radar experiment for some orbits with fortunate observation geometry. Here we have observed a transterminator flow of O+ and O+ 2 ions with a super-sonic velocity of around 5km/s and fluxes of 0.8 · 109/cm2s. If we assume a symmetric flux around the terminator this corresponds to an ion flow of 3.1 ± 0.5 × 1025/s half of which is expected to escape from Mars (Fraenz et al, 2010). This escape flux is significantly higher than previously observed on the tailside of Mars, we discuss possible reasons for the difference. Since 2008 the MARSIS radar does nightside local plasma density measurement which often coincide with ASPERA-3 measurements. In a new analysis of the combined nightside datasets (Fig. 1) we show that the main escape channel is along the shadow boundary on the tailside of Mars. At a distance of about 0.5 R_M the flux settles at a constant value (Fig. 2) which indicates that about half of the transterminator ionospheric flow escapes from the planet. Possible mechanism to generate this flux can be the ionospheric pressure gradient between dayside and nightside or momentum transfer from the solar wind via the induced magnetic field since the flow velocity is in the Alfvénic regime.

  20. Cold Ion Escape from the Martian Ionosphere

    NASA Astrophysics Data System (ADS)

    Fränz, Markus; Dubinin, Eduard; Wei, Yong; Morgan, David; Barabash, Stas; Lundin, Rickard; Fedorov, Andrei

    2013-04-01

    It has always been challenging to observe the flux of ions with energies of less than 10eV escaping from the planetary ionospheres. We here report on new measurements of the ionospheric ion flows at Mars by the ASPERA-3 experiment on board Mars Express. We first use support from the MARSIS radar experiment for some orbits with fortunate observation geometry. Here we have observed a transterminator flow of O+ and O2+ ions with a super-sonic velocity of around 5km/s and fluxes of 0.8 ? 109/cm2s. If we assume a symmetric flux around the terminator this corresponds to an ion flow of 3.1 ± 0.5 × 1025-s half of which is expected to escape from Mars (Fraenz et al, Plan.Space Sci., 2010). This escape flux is significantly higher than previously observed on the tailside of Mars, we discuss possible reasons for the difference. Since 2008 the MARSIS radar does nightside local plasma density measurements which often coincide with ASPERA-3 measurements. In a new analysis of the combined nightside datasets we show that the main escape channel is along the shadow boundary on the tailside of Mars. At a distance of half a Martian radius the flux settles at a constant value which indicates that about half of the transterminator ionospheric flow escapes from the planet. Possible mechanism to generate this flux can be the ionospheric pressure gradient between dayside and nightside or momentum transfer from the solar wind via the induced magnetic field since the flow velocity is in the Alfvénic regime.

  1. Escape driven by α -stable white noises

    NASA Astrophysics Data System (ADS)

    Dybiec, B.; Gudowska-Nowak, E.; Hänggi, P.

    2007-02-01

    We explore the archetype problem of an escape dynamics occurring in a symmetric double well potential when the Brownian particle is driven by white Lévy noise in a dynamical regime where inertial effects can safely be neglected. The behavior of escaping trajectories from one well to another is investigated by pointing to the special character that underpins the noise-induced discontinuity which is caused by the generalized Brownian paths that jump beyond the barrier location without actually hitting it. This fact implies that the boundary conditions for the mean first passage time (MFPT) are no longer determined by the well-known local boundary conditions that characterize the case with normal diffusion. By numerically implementing properly the set up boundary conditions, we investigate the survival probability and the average escape time as a function of the corresponding Lévy white noise parameters. Depending on the value of the skewness β of the Lévy noise, the escape can either become enhanced or suppressed: a negative asymmetry parameter β typically yields a decrease for the escape rate while the rate itself depicts a non-monotonic behavior as a function of the stability index α that characterizes the jump length distribution of Lévy noise, exhibiting a marked discontinuity at α=1 . We find that the typical factor of 2 that characterizes for normal diffusion the ratio between the MFPT for well-bottom-to-well-bottom and well-bottom-to-barrier-top no longer holds true. For sufficiently high barriers the survival probabilities assume an exponential behavior versus time. Distinct non-exponential deviations occur, however, for low barrier heights.

  2. Apoptotic cells subjected to cold/warming exposure disorganize apoptotic microtubule network and undergo secondary necrosis.

    PubMed

    Oropesa-Ávila, Manuel; Fernández-Vega, Alejandro; de la Mata, Mario; Garrido-Maraver, Juan; Cotán, David; Paz, Marina Villanueva; Pavón, Ana Delgado; Cordero, Mario D; Alcocer-Gómez, Elizabet; de Lavera, Isabel; Lema, Rafael; Zaderenko, Ana Paula; Sánchez-Alcázar, José A

    2014-09-01

    Apoptotic microtubule network (AMN) is organized during apoptosis, forming a cortical structure beneath the plasma membrane which plays a critical role in preserving cell morphology and plasma membrane integrity. The aim of this study was to examine the effect of cold/warming exposure on apoptotic microtubules and plasma membrane integrity during the execution phase of apoptosis. We demonstrated in camptothecin-induced apoptotic H460 cells that cold/warming exposure disorganized apoptotic microtubules and allowed the access of active caspases to the cellular cortex and the cleavage of essential proteins in the preservation of plasma membrane permeability. Cleavage of cellular cortex and plasma membrane proteins, such as α-spectrin, paxilin, focal adhesion kinase and calcium ATPase pump (PMCA-4) involved in cell calcium extrusion resulted in increased plasma permeability and calcium overload leading apoptotic cells to secondary necrosis. The essential role of caspase-mediated cleavage in this process was demonstrated because the addition of the pan-caspase inhibitor z-VAD during cold/warming exposure that induces AMN depolymerization avoided the cleavage of cortical and plasma membrane proteins and prevented apoptotic cells to undergo secondary necrosis. Likewise, apoptotic microtubules stabilization by taxol during cold/warming exposure also prevented cellular cortex and plasma membrane protein cleavage and secondary necrosis. Furthermore, microtubules stabilization or caspase inhibition during cold/warming exposure was also critical for proper phosphatidylserine externalization and apoptotic cell clearance by macrophages. These results indicate that cold/warming exposure of apoptotic cells induces secondary necrosis which can be prevented by both, microtubule stabilization or caspase inhibition.

  3. Escape from viscosity: the kinematics and hydrodynamics of copepod foraging and escape swimming.

    PubMed

    van Duren, Luca A; Videler, John J

    2003-01-01

    Feeding and escape swimming in adult females of the calanoid copepod Temora longicornis Müller were investigated and compared. Swimming velocities were calculated using a 3-D filming setup. Foraging velocities ranged between 2 and 6 mm s(-1), while maximum velocities of up to 80 mm s(-1) were reached during escape responses. Foraging took place at Reynolds numbers between 2 and 6, indicating that viscous forces are considerable during this swimming mode. Inertial forces are much more important during escape responses, when Reynolds numbers of more than 100 are reached. High-speed film recordings at 500 frames s(-1) of the motion pattern of the feeding appendages and the escape movement of the swimming legs revealed that the two swimming modes are essentially very different. While foraging, the first three mouth appendages (antennae, mandibular palps and maxillules) create a backwards motion of water with a metachronal beating pattern. During escape movements the mouth appendages stop moving and the swimming legs beat in a very fast metachronal rhythm, accelerating a jet of water backwards. The large antennules are folded backwards, resulting in a streamlined body shape. Particle image velocimetry analysis of the flow around foraging and escaping copepods revealed that during foraging an asymmetrical vortex system is created on the ventral side of the animal. The feeding motion is steady over a long period of time. The rate of energy dissipation due to viscous friction relates directly to the energetic cost of the feeding current. During escape responses a vortex ring appears behind the animal, which dissipates over time. Several seconds after cessation of swimming leg movements, energy dissipation can still be measured. During escape responses the rate of energy dissipation due to viscous friction increases by up to two orders of magnitude compared to the rate when foraging.

  4. Escape of asteroids from the main belt

    NASA Astrophysics Data System (ADS)

    Granvik, Mikael; Morbidelli, Alessandro; Vokrouhlický, David; Bottke, William F.; Nesvorný, David; Jedicke, Robert

    2017-02-01

    Aims: We locate escape routes from the main asteroid belt, particularly into the near-Earth-object (NEO) region, and estimate the relative fluxes for different escape routes as a function of object size under the influence of the Yarkovsky semimajor-axis drift. Methods: We integrated the orbits of 78 355 known and 14 094 cloned main-belt objects and Cybele and Hilda asteroids (hereafter collectively called MBOs) for 100 Myr and recorded the characteristics of the escaping objects. The selected sample of MBOs with perihelion distance q > 1.3 au and semimajor axis a < 4.1 au is essentially complete, with an absolute magnitude limit ranging from HV < 15.9 in the inner belt (a < 2.5 au) to HV < 14.4 in the outer belt (2.5 au < a < 4.1 au). We modeled the semimajor-axis drift caused by the Yarkovsky force and assigned four different sizes (diameters of 0.1, 0.3, 1.0, and 3.0 km) and random spin obliquities (either 0 deg or 180 deg) for each test asteroid. Results: We find more than ten obvious escape routes from the asteroid belt to the NEO region, and they typically coincide with low-order mean-motion resonances with Jupiter and secular resonances. The locations of the escape routes are independent of the semimajor-axis drift rate and thus are also independent of the asteroid diameter. The locations of the escape routes are likewise unaffected when we added a model for Yarkovsky-O'Keefe-Radzievskii-Paddack (YORP) cycles coupled with secular evolution of the rotation pole as a result of the solar gravitational torque. A Yarkovsky-only model predicts a flux of asteroids entering the NEO region that is too high compared to the observationally constrained flux, and the discrepancy grows larger for smaller asteroids. A combined Yarkovsky and YORP model predicts a flux of small NEOs that is approximately a factor of 5 too low compared to an observationally constrained estimate. This suggests that the characteristic timescale of the YORP cycle is longer than our canonical

  5. Launch Pad Escape System Design (Human Spaceflight)

    NASA Technical Reports Server (NTRS)

    Maloney, Kelli

    2011-01-01

    A launch pad escape system for human spaceflight is one of those things that everyone hopes they will never need but is critical for every manned space program. Since men were first put into space in the early 1960s, the need for such an Emergency Escape System (EES) has become apparent. The National Aeronautics and Space Administration (NASA) has made use of various types of these EESs over the past 50 years. Early programs, like Mercury and Gemini, did not have an official launch pad escape system. Rather, they relied on a Launch Escape System (LES) of a separate solid rocket motor attached to the manned capsule that could pull the astronauts to safety in the event of an emergency. This could only occur after hatch closure at the launch pad or during the first stage of flight. A version of a LES, now called a Launch Abort System (LAS) is still used today for all manned capsule type launch vehicles. However, this system is very limited in that it can only be used after hatch closure and it is for flight crew only. In addition, the forces necessary for the LES/LAS to get the capsule away from a rocket during the first stage of flight are quite high and can cause injury to the crew. These shortcomings led to the development of a ground based EES for the flight crew and ground support personnel as well. This way, a much less dangerous mode of egress is available for any flight or ground personnel up to a few seconds before launch. The early EESs were fairly simple, gravity-powered systems to use when thing's go bad. And things can go bad very quickly and catastrophically when dealing with a flight vehicle fueled with millions of pounds of hazardous propellant. With this in mind, early EES designers saw such a passive/unpowered system as a must for last minute escapes. This and other design requirements had to be derived for an EES, and this section will take a look at the safety design requirements had to be derived for an EES, and this section will take a look at

  6. 34. VIEW OF SUBMARINE ESCAPE TRAINING TANK PRIOR TO ADDITION ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    34. VIEW OF SUBMARINE ESCAPE TRAINING TANK PRIOR TO ADDITION OF BLISTERS IN 1959, LOOKING SOUTHEAST - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  7. 23. VIEW OF ESCAPE TRAINING TANK, LOOKING NORTHWEST, SHOWING TWOLOCK ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    23. VIEW OF ESCAPE TRAINING TANK, LOOKING NORTHWEST, SHOWING TWO-LOCK RECOMPRESSION CHAMBER IN PASSAGEWAY FROM ELEVATOR TO CUPOLA - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  8. 14. DETAIL VIEW OF ESCAPE TRAINING TANK, SHOWING HOLDDOWN RODS, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. DETAIL VIEW OF ESCAPE TRAINING TANK, SHOWING HOLD-DOWN RODS, LOOKING SOUTH - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  9. 15. VIEW OF ESCAPE TRAINING TANK, LOOKING EAST ACROSS MEZZANINE, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    15. VIEW OF ESCAPE TRAINING TANK, LOOKING EAST ACROSS MEZZANINE, SHOWING ENTRANCE TO SUBMARINE SECTION AT 110-FOOT LEVEL - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  10. 21. VIEW OF ESCAPE TRAINING TANK, SHOWING INTERIOR OF CUPOLA ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    21. VIEW OF ESCAPE TRAINING TANK, SHOWING INTERIOR OF CUPOLA AND TOP OF THE TANK, LOOKING NORTHEAST - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  11. 18. VIEW OF ESCAPE TRAINING TANK, SHOWING ENCLOSED PASSAGEWAY FROM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    18. VIEW OF ESCAPE TRAINING TANK, SHOWING ENCLOSED PASSAGEWAY FROM 50-FOOT LOCK TO ELEVATOR, LOOKING WEST - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  12. 17. VIEW OF ESCAPE TRAINING TANK, SHOWING ENCLOSED PASSAGEWAY FROM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    17. VIEW OF ESCAPE TRAINING TANK, SHOWING ENCLOSED PASSAGEWAY FROM ELEVATOR TO 18-FOOT LOCK, LOOKING EAST - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  13. 46 CFR 127.240 - Means of escape.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... any interior door giving access to either of the two required means of escape, except that a crash... escape that could cause injury, ensnare clothing, or damage lifejackets. (i) No interior stairway, other...

  14. Enzyme assays.

    PubMed

    Reymond, Jean-Louis; Fluxà, Viviana S; Maillard, Noélie

    2009-01-07

    Enzyme assays are analytical tools to visualize enzyme activities. In recent years a large variety of enzyme assays have been developed to assist the discovery and optimization of industrial enzymes, in particular for "white biotechnology" where selective enzymes are used with great success for economically viable, mild and environmentally benign production processes. The present article highlights the aspects of fluorogenic and chromogenic substrates, sensors, and enzyme fingerprinting, which are our particular areas of interest.

  15. The Escaping Upper Atmospheres of Hot Jupiters

    NASA Astrophysics Data System (ADS)

    Davidson, Eric; Jones, Gabrielle; Uribe, Ana; Carson, Joseph

    2017-01-01

    Hot Jupiters are massive gaseous planets which orbit closely to their parent star. The strong stellar irradiation at these small orbital separations causes the temperature of the upper atmosphere of the planet to rise. This can cause the planet's atmosphere to escape into space, creating an exoplanet outflow. We ascertained which factors determine the presence and structure of these outflows by creating one dimensional simulations of the density, pressure, velocity, optical depth, and neutral fraction of hot Jupiter atmospheres. This was done for planets of masses and radii ranging from 0.5-1.5 Mj and 0.5-1.5 Rj. We found the outflow rate to be highest for a planet of 0.5 Mj and 1.5 Rj at 5.3×10-14 Mj/Yr. We also found that the higher the escape velocity, the lower the chance of the planet having an outflow.

  16. Triton: topside ionosphere and nitrogen escape.

    PubMed

    Yung, Y L; Lyons, J R

    1990-09-01

    The principal ion in the ionosphere of Triton is N+. Energetic electrons of magnetospheric origin are the primary source of ionization, with a smaller contribution due to photoionization. To explain the topside plasma scale height, we postulate that N+ ions escape from Triton. The loss rate is 3.4 x 10(7) cm-2 s-1 or 7.9 x 10(24) ions s-1. Dissociative recombination of N2+ produces neutral exothermic fragments that can escape from Triton. The rate is estimated to be 8.6 x 10(6) N cm-2 s-1 or 2.0 x 10(24) atoms s-1. Implications for the magnetosphere of Neptune and Triton's evolution are discussed.

  17. Escape of atmospheres and loss of water

    NASA Technical Reports Server (NTRS)

    Hunten, D. M.; Donahue, T. M.; Walker, J. C. G.; Kasting, J. F.

    1989-01-01

    The properties and limitations of several loss processes for atmospheric gases are presented and discussed. They include thermal loss (Jeans and hydrodynamic); nonthermal loss (all processes involve charged particles); and impact erosion, including thermal escape from a molten body heated by rapid accretion. Hydrodynamic escape, or 'blowoff', is of particular interest because it offers the prospect of processing large quantities of gas and enriching the remainder in heavy elements and isotopes. In a second part, the water budgets and likely evolutionary histories of Venus, Earth and Mars are assessed. Although it is tempting to associate the great D/H enrichment on Venus with loss of a large initial endowment, a steady state with juvenile water (perhaps from comets) is equally probable.

  18. Escape of atmospheres and loss of water

    NASA Technical Reports Server (NTRS)

    Hunten, D. M.; Donahue, T. M.; Walker, J. C. G.; Kasting, J. F.

    1989-01-01

    The properties and limitations of several loss processes for atmospheric gases are presented and discussed. They include thermal loss (Jeans and hydrodynamic); nonthermal loss (all processes involve charged particles); and impact erosion, including thermal escape from a molten body heated by rapid accretion. Hydrodynamic escape, or 'blowoff', is of particular interest because it offers the prospect of processing large quantities of gas and enriching the remainder in heavy elements and isotopes. In a second part, the water budgets and likely evolutionary histories of Venus, Earth and Mars are assessed. Although it is tempting to associate the great D/H enrichment on Venus with loss of a large initial endowment, a steady state with juvenile water (perhaps from comets) is equally probable.

  19. Fixed-ratio escape reinforcement1

    PubMed Central

    Azrin, N. H.; Holz, W. C.; Hake, D. F.; Ayllon, T.

    1963-01-01

    Escape responses of squirrel monkeys were reinforced according to a fixed-ratio schedule. The reinforcement was a period of safety from a stimulus that signalled the delivery of intermittent pain-shocks. When the frequency of shock was gradually reduced, the performance remained at a high level until the shocks were quite infrequent. Similarly, the duration of the period of safety could be reduced to a few seconds with little loss of behavior. Thus, the responses appeared to be reinforced by even a brief period of safety, the actual degree of shock reduction being fairly slight. The changes in responding during this fixed-ratio escape procedure were comparable to the response changes typically obtained during fixed-ratio food procedures. PMID:13965780

  20. [Escape mutants of hepatitis B virus].

    PubMed

    Jaramillo, Carlos Mario; Navas, María-Cristina

    2015-04-01

    The hepatitis B virus (HBV) infection is a public health problem worldwide. Considering HBV morbidity and mortality and the economic consequences .of this infection, policies and strategies to control it have been implemented, especially in regions where HBV infection is endemic, with high rates of vertical and horizontal infection. One of these strategies is the development of the recombinant vaccine. A 92% of the countries in the world have implemented the vaccine with a global coverage of 69%. The escape variants of HBV correspond to isolates with mutations in the sequence coding for the "a" determinant; these mutations result in changes in the amino acid sequence of the surface antigen (HBsAg) that prevent neutralization of viral particles by antibodies generated in response to vaccination or infection. The escape variants can infect vaccinated individuals and have been identified in the population of countries with different epidemiological patterns.

  1. Dynamic Escape Routes for Naval Ships

    DTIC Science & Technology

    2005-09-01

    3 o Increase the likelihood of successfully salvaging the ship, and o Increase the likelihood that the crew is rescued safely. It will be possible...spans the period before the event that triggers ship abandonment. Escape routes can be configured based on two factors: 6 o “Crew distribution...crewmembers but the guards are resting in cabins and berthing rooms. This is a plausible scenario at night when the ship is in a non-home port. o

  2. Mars Planetary Ion Escape: Assessing Transitional Trajectories

    NASA Astrophysics Data System (ADS)

    Johnson, B. C.

    2016-12-01

    The availability of in situ observations of ions escaping from Mars' atmosphere is vital to descriptions of atmospheric loss, but such point measurements taken by orbiting spacecraft cannot easily differentiate between spatial changes along the spacecraft trajectory and temporal changes, nor can they directly provide information about atmospheric loss rates during Mars' long history. Numerical models are therefore crucial to crystalizing understanding of ion escape processes. One such category are test particle models that release non-interacting ions into background electric and magnetic fields and then calculate ion trajectories and loss rates. To date, such models have focused on the collisionless regime. Another approach is to include collisions between the particles, the Direct Simulation Monte Carlo (DSMC) approach. We present the results of the first fully three dimensional collisional Mars ion DSMC model capable of peering deep into the collionsional atmosphere, beneath the ionospheric peak, i.e., the ion version of the Adaptive Mesh Particle Simulator (AMPS) configured for Mars. Multiple model runs are performed, each with a different cutoff altitude below which collisions are included. Escape rates of O+ are calculated for each run, providing both the asymptotic escape rate as the cutoff altitude extends into the exosphere and also an idea of the altitude range for which collisions must be included for the results to reasonably converge to this value. In other words, how low can a collisionless model go? Furthermore, these results can be used to interpret satellite data of planetary ions, helping to determine if the spacecraft is in the upflow or outflow regime. In other words, how low can observations be used for measuring the loss of planetary ions to deep space? This entire process is repeated a second time, with the first set of runs corresponding to solar minimum input parameters, and the second set of runs corresponding to solar maximum parameters.

  3. Lithium clearance in mineralocorticoid escape in humans

    SciTech Connect

    Boer, W.H.; Koomans, H.A.; Mees, E.J.D.

    1987-03-01

    Lithium clearance (C/sub Li/) has been advanced as an indicator of Na delivery from the proximal tubules. The authors studied C/sub Li/ in eight healthy males before and after mineralocorticoid escape, a maneuver that may induce suppression of fractional proximal Na reabsorption (FPR/sub Na/). FPR/sub Na/ was also estimated from changes in maximal free water clearance (C/sub H/sub 2/O/). Plasma volume was measured as the /sup 131/I-labeled albumin distribution space. Extracellular fluid volume was estimated as the /sup 82/Br vector distribution volume. According to the latter method, FPR/sub Na/ dropped whereas inulin clearance rose. The changes in C/sub Li/ were surprisingly large. If lithium is a valid marker of Na handling in the proximal tubule in humans, this change would imply a fall in FPR/sub Na/, suggesting a much larger shift in tubular Na reabsorption in escape than hitherto suspected. In addition, it would suggest that the inevitable back diffusion of a part of the solute-free water in the distal nephron, and thus overestimation of FPR/sub Na/ by the C/sub H/sub 2/O/ method, increases importantly during escape. Alternately, lithium may not be a good marker of proximal tubular Na handling. For instance, both lithium reabsorption and escape may take place beyond the proximal tubule, or lithium may be excreted in the distal nephron in certain conditions. Present methods do not permit further analysis of these options in the human model.

  4. 46 CFR 177.500 - Means of escape.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... a means of escape must be such as to allow easy movement of persons when wearing life jackets. There must be no protrusions in means of escape that could cause injury, ensnare clothing, or damage life jackets. (f) The minimum clear opening of a door or passageway used as a means of escape must not be less...

  5. 30 CFR 77.1101 - Escape and evacuation; plan.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... event of a fire. (b) All employees shall be instructed on current escape and evacuation plans, fire alarm signals, and applicable procedures to be followed in case of fire. (c) Plans for escape and... Fire Protection § 77.1101 Escape and evacuation; plan. (a) Before September 30, 1971, each operator of...

  6. 30 CFR 77.1101 - Escape and evacuation; plan.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... event of a fire. (b) All employees shall be instructed on current escape and evacuation plans, fire alarm signals, and applicable procedures to be followed in case of fire. (c) Plans for escape and... Fire Protection § 77.1101 Escape and evacuation; plan. (a) Before September 30, 1971, each operator of...

  7. 30 CFR 77.1101 - Escape and evacuation; plan.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... event of a fire. (b) All employees shall be instructed on current escape and evacuation plans, fire alarm signals, and applicable procedures to be followed in case of fire. (c) Plans for escape and... Fire Protection § 77.1101 Escape and evacuation; plan. (a) Before September 30, 1971, each operator of...

  8. 30 CFR 77.1101 - Escape and evacuation; plan.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... event of a fire. (b) All employees shall be instructed on current escape and evacuation plans, fire alarm signals, and applicable procedures to be followed in case of fire. (c) Plans for escape and... Fire Protection § 77.1101 Escape and evacuation; plan. (a) Before September 30, 1971, each operator of...

  9. 30 CFR 77.1101 - Escape and evacuation; plan.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... event of a fire. (b) All employees shall be instructed on current escape and evacuation plans, fire alarm signals, and applicable procedures to be followed in case of fire. (c) Plans for escape and... Fire Protection § 77.1101 Escape and evacuation; plan. (a) Before September 30, 1971, each operator of...

  10. 30 CFR 75.382 - Mechanical escape facilities.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Mechanical escape facilities. 75.382 Section 75... HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Ventilation § 75.382 Mechanical escape facilities. (a) Mechanical escape facilities shall be provided with overspeed, overwind, and automatic stop...

  11. 30 CFR 75.382 - Mechanical escape facilities.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Mechanical escape facilities. 75.382 Section 75... HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Ventilation § 75.382 Mechanical escape facilities. (a) Mechanical escape facilities shall be provided with overspeed, overwind, and automatic stop...

  12. 30 CFR 75.382 - Mechanical escape facilities.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Mechanical escape facilities. 75.382 Section 75... HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Ventilation § 75.382 Mechanical escape facilities. (a) Mechanical escape facilities shall be provided with overspeed, overwind, and automatic stop...

  13. 30 CFR 75.382 - Mechanical escape facilities.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Mechanical escape facilities. 75.382 Section 75... HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Ventilation § 75.382 Mechanical escape facilities. (a) Mechanical escape facilities shall be provided with overspeed, overwind, and automatic...

  14. 46 CFR 108.153 - Location of means of escape.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Location of means of escape. 108.153 Section 108.153 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Construction and Arrangement Means of Escape § 108.153 Location of means of escape....

  15. 46 CFR 108.153 - Location of means of escape.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 4 2011-10-01 2011-10-01 false Location of means of escape. 108.153 Section 108.153 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Construction and Arrangement Means of Escape § 108.153 Location of means of escape....

  16. 30 CFR 75.382 - Mechanical escape facilities.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Ventilation § 75.382 Mechanical escape facilities. (a) Mechanical escape facilities shall be provided with overspeed, overwind, and automatic stop... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Mechanical escape facilities. 75.382 Section...

  17. Xenon Fractionation and Archean Hydrogen Escape

    NASA Technical Reports Server (NTRS)

    Zahnle, K. J.

    2015-01-01

    Xenon is the heaviest gas found in significant quantities in natural planetary atmospheres. It would seem the least likely to escape. Yet there is more evidence for xenon escape from Earth than for any element other than helium and perhaps neon. The most straightforward evidence is that most of the radiogenic Xe from the decay of (129)I (half-life 15.7 Myr) and (244)Pu (half-life 81 Myr) that is Earth's birthright is missing. The missing xenon is often attributed to the impact erosion of early atmospheres of Earth and its ancestors. It is obvious that if most of the radiogenic xenon were driven off by impacts, most of the rest of the atmophiles fared the same fate. The other line of evidence is in the nonradiogenic isotopes of xenon and its silent partner, krypton. Atmospheric xenon is strongly mass fractionated (at about 4% per amu) compared to any known solar system source (Figure 1). This is in stark contrast to krypton, which may not be fractionated at all: atmospheric Kr is slightly heavier than solar Kr (at about 0.5% per amu), but it is the same as in carbonaceous chondrites. Nonradiogenic xenon is also under abundant relative to krypton (the so-called "missing xenon" problem). Together these observations imply that xenon has been subject to fractionating escape and krypton not.

  18. Scrunching: a novel escape gait in planarians.

    PubMed

    Cochet-Escartin, Olivier; Mickolajczyk, Keith J; Collins, Eva-Maria S

    2015-09-10

    The ability to escape a predator or other life-threatening situations is central to animal survival. Different species have evolved unique strategies under anatomical and environmental constraints. In this study, we describe a novel musculature-driven escape gait in planarians, 'scrunching', which is quantitatively different from other planarian gaits, such as gliding and peristalsis. We show that scrunching is a conserved gait among different flatworm species, underlying its importance as an escape mechanism. We further demonstrate that it can be induced by a variety of physical stimuli, including amputation, high temperature, electric shock and low pH. We discuss the functional basis for scrunching as the preferential gait when gliding is impaired due to a disruption of mucus production. Finally, we show that the key mechanical features of scrunching are adequately captured by a simple biomechanical model that is solely based on experimental data from traction force microscopy and tissue rheology without fit parameters. Together, our results form a complete description of this novel form of planarian locomotion. Because scrunching has distinct dynamics, this gait can serve as a robust behavioral readout for studies of motor neuron and muscular functions in planarians and in particular the restoration of these functions during regeneration.

  19. Scrunching: a novel escape gait in planarians

    NASA Astrophysics Data System (ADS)

    Cochet-Escartin, Olivier; Mickolajczyk, Keith J.; Collins, Eva-Maria S.

    2015-10-01

    The ability to escape a predator or other life-threatening situations is central to animal survival. Different species have evolved unique strategies under anatomical and environmental constraints. In this study, we describe a novel musculature-driven escape gait in planarians, ‘scrunching’, which is quantitatively different from other planarian gaits, such as gliding and peristalsis. We show that scrunching is a conserved gait among different flatworm species, underlying its importance as an escape mechanism. We further demonstrate that it can be induced by a variety of physical stimuli, including amputation, high temperature, electric shock and low pH. We discuss the functional basis for scrunching as the preferential gait when gliding is impaired due to a disruption of mucus production. Finally, we show that the key mechanical features of scrunching are adequately captured by a simple biomechanical model that is solely based on experimental data from traction force microscopy and tissue rheology without fit parameters. Together, our results form a complete description of this novel form of planarian locomotion. Because scrunching has distinct dynamics, this gait can serve as a robust behavioral readout for studies of motor neuron and muscular functions in planarians and in particular the restoration of these functions during regeneration.

  20. Escape behavior and escape circuit activation in juvenile crayfish during prey-predator interactions.

    PubMed

    Herberholz, Jens; Sen, Marjorie M; Edwards, Donald H

    2004-05-01

    The neural systems that control escape behavior have been studied intensively in several animals, including mollusks, fish and crayfish. Surprisingly little is known, however, about the activation and the utilization of escape circuits during prey-predator interactions. To complement the physiological and anatomical studies with a necessary behavioral equivalent, we investigated encounters between juvenile crayfish and large dragonfly nymphs in freely behaving animals using a combination of high-speed video-recordings and measurements of electric field potentials. During attacks, dragonfly nymphs rapidly extended their labium, equipped with short, sharp palps, to capture small crayfish. Crayfish responded to the tactile stimulus by activating neural escape circuits to generate tail-flips directed away from the predator. Tail-flips were the sole defense mechanism in response to an attack and every single strike was answered by tail-flip escape behavior. Crayfish used all three known types of escape tail-flips during the interactions with the dragonfly nymphs. Tail-flips generated by activity in the giant neurons were predominantly observed to trigger the initial escape responses to an attack, but non-giant mediated tail-flips were often generated to attempt escape after capture. Attacks to the front of the crayfish triggered tail-flips mediated either by the medial giant neuron or by non-giant circuitry, whereas attacks to the rear always elicited tail-flips mediated by the lateral giant neuron. Overall, tail flipping was found to be a successful behavior in preventing predation, and only a small percentage of crayfish were killed and consumed.

  1. Elevated Levels of Uterine Anti-Apoptotic Signaling May Activate NFKB and Potentially Confer Resistance to Caspase 3-Mediated Apoptotic Cell Death During Pregnancy in Mice1

    PubMed Central

    Jeyasuria, Pancharatnam; Subedi, Kalpana; Suresh, Arvind; Condon, Jennifer C.

    2011-01-01

    Preserving the uterus in a state of relative quiescence is vital to the maintenance of a successful pregnancy. Elevated cytoplasmic levels of uterine caspase 3 during pregnancy have been proposed as a potential regulator of uterine quiescence through direct targeting and disabling of the uterine contractile architecture. However, despite highly elevated levels of uterine caspase 3 during pregnancy, there is minimal evidence of apoptosis. This current study defines the mechanism whereby the pregnant uterine myocyte may harness the tocolytic activity of active caspases while avoiding apoptotic cell death. Using the pregnant mouse model, we have analyzed the uterus for changes in pro- and antiapoptotic signaling patterns associated with the advancing stages of pregnancy. Briefly, we have found that members of the IAP family, such as SURVIVIN and XIAP, and the Bcl2 family members, such as MCL1, are elevated in the uterine myocyte during late gestation. The IAP family members are the only endogenous inhibitors of active caspase 3, and MCL1 limits activation of caspase 3 by suppressing proapoptotic signaling. Elevated XIAP levels partner with SURVIVIN, resulting in increased levels of the antiapoptotic MCL1 via NFKB activation; these together have the potential to limit both the activity and level of active caspase 3 in the pregnant uterus as term approaches. We propose that modification of these antiapoptotic signaling partners allows the pregnant uterus to escape the apoptotic action of elevated active caspase 3 levels but also functions to limit the levels of active uterine caspase 3 near term. PMID:21566000

  2. Elevated levels of uterine anti-apoptotic signaling may activate NFKB and potentially confer resistance to caspase 3-mediated apoptotic cell death during pregnancy in mice.

    PubMed

    Jeyasuria, Pancharatnam; Subedi, Kalpana; Suresh, Arvind; Condon, Jennifer C

    2011-08-01

    Preserving the uterus in a state of relative quiescence is vital to the maintenance of a successful pregnancy. Elevated cytoplasmic levels of uterine caspase 3 during pregnancy have been proposed as a potential regulator of uterine quiescence through direct targeting and disabling of the uterine contractile architecture. However, despite highly elevated levels of uterine caspase 3 during pregnancy, there is minimal evidence of apoptosis. This current study defines the mechanism whereby the pregnant uterine myocyte may harness the tocolytic activity of active caspases while avoiding apoptotic cell death. Using the pregnant mouse model, we have analyzed the uterus for changes in pro- and antiapoptotic signaling patterns associated with the advancing stages of pregnancy. Briefly, we have found that members of the IAP family, such as SURVIVIN and XIAP, and the Bcl2 family members, such as MCL1, are elevated in the uterine myocyte during late gestation. The IAP family members are the only endogenous inhibitors of active caspase 3, and MCL1 limits activation of caspase 3 by suppressing proapoptotic signaling. Elevated XIAP levels partner with SURVIVIN, resulting in increased levels of the antiapoptotic MCL1 via NFKB activation; these together have the potential to limit both the activity and level of active caspase 3 in the pregnant uterus as term approaches. We propose that modification of these antiapoptotic signaling partners allows the pregnant uterus to escape the apoptotic action of elevated active caspase 3 levels but also functions to limit the levels of active uterine caspase 3 near term.

  3. Stabilization of apoptotic cells: generation of zombie cells.

    PubMed

    Oropesa-Ávila, M; Andrade-Talavera, Y; Garrido-Maraver, J; Cordero, M D; de la Mata, M; Cotán, D; Paz, M V; Pavón, A D; Alcocer-Gómez, E; de Lavera, I; Lema, R; Zaderenko, A P; Rodríguez-Moreno, A; Sánchez-Alcázar, J A

    2014-08-14

    Apoptosis is characterized by degradation of cell components but plasma membrane remains intact. Apoptotic microtubule network (AMN) is organized during apoptosis forming a cortical structure beneath plasma membrane that maintains plasma membrane integrity. Apoptotic cells are also characterized by high reactive oxygen species (ROS) production that can be potentially harmful for the cell. The aim of this study was to develop a method that allows stabilizing apoptotic cells for diagnostic and therapeutic applications. By using a cocktail composed of taxol (a microtubule stabilizer), Zn(2+) (a caspase inhibitor) and coenzyme Q10 (a lipid antioxidant), we were able to stabilize H460 apoptotic cells in cell cultures for at least 72 h, preventing secondary necrosis. Stabilized apoptotic cells maintain many apoptotic cell characteristics such as the presence of apoptotic microtubules, plasma membrane integrity, low intracellular calcium levels and mitochondrial polarization. Apoptotic cell stabilization may open new avenues in apoptosis detection and therapy.

  4. Stabilization of apoptotic cells: generation of zombie cells

    PubMed Central

    Oropesa-Ávila, M; Andrade-Talavera, Y; Garrido-Maraver, J; Cordero, M D; de la Mata, M; Cotán, D; Paz, M V; Pavón, A D; Alcocer-Gómez, E; de Lavera, I; Lema, R; Zaderenko, A P; Rodríguez-Moreno, A; Sánchez-Alcázar, J A

    2014-01-01

    Apoptosis is characterized by degradation of cell components but plasma membrane remains intact. Apoptotic microtubule network (AMN) is organized during apoptosis forming a cortical structure beneath plasma membrane that maintains plasma membrane integrity. Apoptotic cells are also characterized by high reactive oxygen species (ROS) production that can be potentially harmful for the cell. The aim of this study was to develop a method that allows stabilizing apoptotic cells for diagnostic and therapeutic applications. By using a cocktail composed of taxol (a microtubule stabilizer), Zn2+ (a caspase inhibitor) and coenzyme Q10 (a lipid antioxidant), we were able to stabilize H460 apoptotic cells in cell cultures for at least 72 h, preventing secondary necrosis. Stabilized apoptotic cells maintain many apoptotic cell characteristics such as the presence of apoptotic microtubules, plasma membrane integrity, low intracellular calcium levels and mitochondrial polarization. Apoptotic cell stabilization may open new avenues in apoptosis detection and therapy. PMID:25118929

  5. Cold Ion Escape from the Martian Ionosphere

    NASA Astrophysics Data System (ADS)

    Fraenz, M.; Dubinin, E.; Wei, Y.; Woch, J. G.; Morgan, D. D.; Barabash, S. V.; Lundin, R. N.; Fedorov, A.

    2012-12-01

    It has always been challenging to observe the flux of ions with energies of less than 10eV escaping from the planetary ionospheres. We here report on new measurements of the ionospheric ion flows at Mars by the ASPERA-3 experiment on board Mars Express. We first use support from the MARSIS radar experiment for some orbits with fortunate observation geometry. Here we have observed a transterminator flow of O+ and O2+ ions with a super-sonic velocity of around 5km/s and fluxes of 0.8x10^9/cm^2s. If we assume a symmetric flux around the terminator this corresponds to an ion flow of 3.1x10^25/s half of which is expected to escape from Mars (Fraenz et al, 2010). This escape flux is significantly higher than previously observed on the tailside of Mars, we discuss possible reasons for the difference. Since 2008 the MARSIS radar does nightside local plasma density measurement which often coincide with ASPERA-3 measurements. In a new analysis of the combined nightside datasets (Fig. 1) we show that the main escape channel is along the shadow boundary on the tailside of Mars. At a distance of about 0.5 R_M the flux settles at a constant value (Fig. 2) which indicates that about half of the transterminator ionospheric flow escapes from the planet. Possible mechanism to generate this flux can be the ionospheric pressure gradient between dayside and nightside or momentum transfer from the solar wind via the induced magnetic field since the flow velocity is in the Alfvenic regime.; Median oxygen ion flux reconstructed by combining ion velocity observations of the Mars Express ASPERA-3 IMA sensor and local plasma density observations by the MARSIS radar. Each bin value is the median from observations on about 3000 orbits between May 2007 and July 2011. Horizontal axis is MSO X-axis (Sun towards the left), vertical axis is vertical distance from MSO X-axis. ; Ring median flux of cylindrical ring regions of all bins shown in previous figure. The different colors show median fluxes

  6. Hydrodynamical Modeling of Hydrogen Escape from Rocky Planets

    NASA Astrophysics Data System (ADS)

    Barringer, Daniel; Zugger, M.; Kasting, J.

    2013-01-01

    Hydrogen escape affects both the composition of primitive atmospheres of terrestrial planets and the planet’s state of oxidation. On Mars, hydrogen escape played a critical role in how long the planet remained in a warm wet state amenable to life. For both solar and extrasolar planets, hydrogen-rich atmospheres are better candidates for originating life by way of Miller-Urey-type prebiotic synthesis. However, calculating the rate of atmospheric hydrogen escape is difficult, for a number of reasons. First, the escape can be controlled either by diffusion through the homopause or by conditions in the upper atmosphere, whichever is slower. Second, both thermal and non-thermal escape mechanisms are typically important. Third, thermal escape itself can be subdivided into Jeans escape (thin upper atmosphere), and hydrodynamic escape, and hydrodynamic escape can be further subdivided into transonic escape and slower subsonic escape, depending on whether the exobase occurs above or below the sonic point. Additionally, the rate of escape for real terrestrial planet atmospheres, which are not 100% hydrogen, depends upon the concentration of infrared coolants, and upon heating and photochemistry driven largely by extreme ultraviolet (EUV) radiation. We have modified an existing 1-D model of hydrodynamic escape (F. Tian et al., JGR, 2008) to work in the high- hydrogen regime. Calculations are underway to determine hydrogen escape rates as a function of atmospheric H2 mixing ratio and the solar EUV flux. We will compare these rates with the estimated upper limit on the escape rate based on diffusion. Initial results for early Earth and Mars will later be extended to rocky exoplanets.

  7. Risks incurred by hydrogen escaping from containers and conduits

    SciTech Connect

    Swain, M.R.; Grilliot, E.S.; Swain, M.N.

    1998-08-01

    This paper is a discussion of a method for hydrogen leak classification. Leaks are classified as; gas escapes into enclosed spaces, gas escapes into partially enclosed spaces (vented), and gas escapes into unenclosed spaces. Each of the three enclosure classifications is further divided into two subclasses; total volume of hydrogen escaped and flow rate of escaping hydrogen. A method to aid in risk assessment determination in partially enclosed spaces is proposed and verified for several enclosure geometries. Examples are discussed for additional enclosure geometries.

  8. Apoptotic death sensor: an organelle's alter ego?

    PubMed

    Bratton, S B; Cohen, G M

    2001-06-01

    Caspases are intracellular cysteine proteases that are primarily responsible for the stereotypic morphological and biochemical changes that are associated with apoptosis. Caspases are often activated by the apoptotic protease-activating factor 1 (APAF-1) apoptosome, a complex that is formed following mitochondrial release of cytochrome c in response to many death-inducing stimuli. Both pro- and anti-apoptotic BCL-2 family members regulate apoptosis, primarily by their effects on mitochondria, whereas many inhibitor of apoptosis proteins (IAPs) regulate apoptosis by directly inhibiting distinct caspases. Exposure of cells to chemicals and radiation, as well as loss of trophic stimuli, perturb cellular homeostasis and, depending on the type of cellular stress, particular or multiple organelles appear to 'sense' the damage and signal the cell to undergo apoptosis by stimulating the formation of unique and/or common caspase-activating complexes.

  9. Cancer therapeutics: Targeting the apoptotic pathway.

    PubMed

    Khan, Khurum H; Blanco-Codesido, Montserrat; Molife, L Rhoda

    2014-06-01

    Apoptosis, a physiological process of programmed cell death, is disrupted in various malignancies. It has been exploited as an anti-cancer strategy traditionally by inducing DNA damage with chemotherapy and radiotherapy. With an increased understanding of the intrinsic and extrinsic pathways of apoptosis in recent years, novel approaches of targeting the apoptotic pathways have been tested in pre-clinical and clinical models. There are several early phase clinical trials investigating the therapeutic role of pro-apoptotic agents, both as single agents and in combination. In this review, we examine such treatment strategies, detailing the various compounds currently under clinical investigation, their potential roles in cancer therapeutics, and discussing approaches to their optimal use in the clinic. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  10. Geometry of escaping dynamics in nonlinear ship motion

    NASA Astrophysics Data System (ADS)

    Naik, Shibabrat; Ross, Shane D.

    2017-06-01

    Escape from a potential well is a paradigm to understand critical events in chemical physics, celestial mechanics, structural mechanics, and ship dynamics, to name but a few. The consequences of escape could be desirable or undesirable depending on the specific problem at hand, however, the general question is how escape occurs and the effects of environmental noise on the escape. In this article, we answer the first question by discovering the phase space structures that lead to escape and the second question by investigating the effects of random forcing on these structures in the context of ship dynamics and capsize. The phase space structures that lead to escape are the tube manifolds associated to the rank-1 saddles in the conservative system. They are also robust in the sense of predicting high probability regions of escape even in the presence of random forcing.

  11. Antiproliferative and apoptotic effects of spanish honeys

    PubMed Central

    Morales, Paloma; Haza, Ana Isabel

    2013-01-01

    Background: Current evidence supports that consumption of polyphenols has beneficial effects against numerous diseases mostly associated with their antioxidant activity. Honey is a good source of antioxidants since it contains a great variety of phenolic compounds. Objective: The main objective of this work was to investigate the antiproliferative and apoptotic effects of three crude commercial honeys of different floral origin (heather, rosemary and polyfloral honey) from Madrid Autonomic Community (Spain) as well as of an artificial honey in human peripheral blood promyelocytic leukemia cells (HL-60). Material and Methods: HL-60 cells were cultured in the presence of honeys at various concentrations for up to 72 hours and the percentage of cell viability was evaluated by MTT assay. Apoptotic cells were identified by chromatin condensation and flow cytometry analysis. ROS production was determined using 2´,7´-dichlorodihydrofluorescein diacetate (H2DCFDA). Results: The three types of crude commercial honey induced apoptosis in a concentration and time dependent-manner. In addition, honeys with the higher phenolic content, heather and polyfloral, were the most effective to induce apoptosis in HL-60 cells. However, honeys did not generate reactive oxygen species (ROS) and N-acetyl-L-cysteine (NAC) could not block honeys-induced apoptosis in HL-60 cells. Conclusion: These data support that honeys induced apoptosis in HL-60 cells through a ROS-independent cell death pathway. Moreover, our findings indicate that the antiproliferative and apoptotic effects of honey varied according to the floral origin and the phenolic content. PMID:23930007

  12. Interaction of low molecular weight group IIA phospholipase A2 with apoptotic human T cells: role of heparan sulfate proteoglycans.

    PubMed

    Boilard, Eric; Bourgoin, Sylvain G; Bernatchez, Chantale; Poubelle, Patrice E; Surette, Marc E

    2003-06-01

    Human group IIA phospholipase A2 (hIIA PLA2) is a 14 kDa secreted enzyme associated with inflammatory diseases. A newly discovered property of hIIA PLA2 is the binding affinity for the heparan sulfate proteoglycan (HSPG) glypican-1. In this study, the binding of hIIA PLA2 to apoptotic human T cells was investigated. Little or no exogenous hIIA PLA2 bound to CD3-activated T cells but significant binding was measured on activated T cells induced to undergo apoptosis by anti-CD95. Binding to early apoptotic T cells was greater than to late apoptotic cells. The addition of heparin and the hydrolysis of HSPG by heparinase III only partially inhibited hIIA PLA2 binding to apoptotic cells, suggesting an interaction with both HSPG and other binding protein(s). Two low molecular weight HSPG were coimmunoprecipitated with hIIA PLA2 from apoptotic T cells, but not from living cells. Treatment of CD95-stimulated T cells with hIIA PLA2 resulted in the release of arachidonic acid but not oleic acid from cells and this release was blocked by heparin and heparinase III. Altogether, these results suggest a role for hIIA PLA2 in the release of arachidonic acid from apoptotic cells through interactions with HSPG and its potential implication in the progression of inflammatory diseases.

  13. Cold Ion Escape from the Martian Ionosphere

    NASA Astrophysics Data System (ADS)

    Fränz, Markus; Dubinin, Eduard; Andrews, David; Nilsson, Hans; Fedorov, Andrei

    2014-05-01

    It has always been challenging to observe the flux of ions with energies of less than 10eV escaping from the planetary ionospheres. We here report on new measurements of the ionospheric ion flows at Mars by the ASPERA-3 experiment on board Mars Express. The ion sensor IMA of this experiment has in principle a low-energy cut-off at 10eV but in negative spacecraft charging cold ions are lifted into the range of measurement but the field of view is restricted to about 4x360 deg. In a recent paper Nilsson et al. (Earth Planets Space, 64, 135, 2012) tried to use the method of long-time averaged distribution functions to overcome these constraints. In this paper we first use the same method to show that we get results consistent with this when using ASPERA-3 observations only. But then we can show that these results are inconsistent with observations of the local plasma density by the MARSIS radar instrument on board Mars Express. We demonstrate that the method of averaged distribution function can deliver the mean flow speed of the plasma but the low-energy cut-off does usually not allow to reconstruct the density. We then combine measurements of the cold ion flow speed with the plasma density observations of MARSIS to derive the cold ion flux. In an analysis of the combined nightside datasets we show that the main escape channel is along the shadow boundary on the tailside of Mars. At a distance of about 0.5 Martian radii the flux settles at a constant value which indicates that about half of the transterminator ionospheric flow escapes from the planet. Possible mechanism to generate this flux can be the ionospheric pressure gradient between dayside and nightside or momentum transfer from the solar wind via the induced magnetic field since the flow velocity is in the Alfvénic regime.

  14. Heating and acceleration of escaping planetary ions

    NASA Astrophysics Data System (ADS)

    Nilsson, Hans

    2010-05-01

    The magnetic field of the Earth acts like a shield against the solar wind, leading to a magnetopause position many planetary radii away from the planet, in contrast to the situation at non- or weakly magnetized planets such as Mars and Venus. Despite this there is significant ion outflow due to solar wind interaction from the cusp and polar cap regions of the Earth's ionosphere. Effective interaction regions form, in particular in the ionospheric projection of the cusp, where ionospheric plasma flows up along the field-lines in response to magnetospheric energy input. Strong wave-particle interaction at altitudes above the ionosphere further accelerates the particles so that gravity is overcome. For the particles to enter a direct escape path they must be accelerated along open magnetic field lines so that they cross the magnetopause or reach a distance beyond the region of return flow in the tail. This return flow may also be either lost to space or returned to the atmosphere. Throughout this transport chain the heating and acceleration experienced by the particles will have an influence on the final fate of the particles. We will present quantitative estimates of centrifugal acceleration and perpendicular heating along the escape path from the cusp, through the high altitude polar cap/mantle, based on Cluster spacecraft data. We will open up for a discussion on the benefits of a ponderomotive force description of the acceleration affecting the ion circulation and escape. Finally we will compare with the situation at the unmagnetized planets Mars and Venus and discuss to what extent a magnetic field protects an atmosphere from loss through solar wind interaction.

  15. X-chromosome inactivation and escape

    PubMed Central

    DISTECHE, CHRISTINE M.; BERLETCH, JOEL B.

    2016-01-01

    X-chromosome inactivation, which was discovered by Mary Lyon in 1961 results in random silencing of one X chromosome in female mammals. This review is dedicated to Mary Lyon, who passed away last year. She predicted many of the features of X inactivation, for e.g., the existence of an X inactivation center, the role of L1 elements in spreading of silencing and the existence of genes that escape X inactivation. Starting from her published work here we summarize advances in the field. PMID:26690513

  16. Suicide as escape from psychotic panic.

    PubMed

    Goldblatt, Mark J; Ronningstam, Elsa; Schechter, Mark; Herbstman, Benjamin; Maltsberger, John T

    2016-01-01

    Suicides of patients in states of acute persecutory panic may be provoked by a subjective experience of helpless terror threatening imminent annihilation or dismemberment. These patients are literally scared to death and try to run away. They imagine suicide is survivable and desperately attempt to escape from imaginary enemies. These states of terror occur in a wide range of psychotic illnesses and are often associated with command hallucinations and delusions. In this article, the authors consider the subjective experience of persecutory panic and the suicide response as an attempt to flee from danger.

  17. Belt fires and mine escape problems

    SciTech Connect

    Kovac, J.G.; Lazzara, C.P.; Kravitz, J.H.

    1996-12-31

    A conveyor belt fire in an underground coal mine is a serious threat to life and property. About 30% of the reportable underground coal mine fires from 1988 through 1992 occurred in belt entries. In one instance, a fire started in the drive area of a belt line, spread rapidly, and resulted in seating of the entire mine. Large-scale studies conducted by the U.S. Bureau of Mines in an aboveground fire gallery at Lake Lynn Laboratory clearly show the hazards of conveyor belt fires. Mine conveyor belt formulations which passed the current Federal acceptance test for fire-resistant betting were completely consumed by propagating fires or propagated flame, with flame spread rates ranging from 0.3 to 9 m/min. High downstream temperatures and large quantities of smoke and toxic gases, such as carbon monoxide, were generated as the belting burned. The smoke and gases can be spread by the mine`s ventilation system and can create significant problems for miners in the process of evacuation, such as reduction in visibility and incapacitation. In the aftermath of a belt fire, the atmosphere inside of the mine can become smoke filled or unbreathable, forcing miners to evacuate while wearing Self-Contained Self-Rescuers (SCSR`s), Sometimes there is confusion about how to regard the rated duration of an MSHA/NIOSH-approved 60-min. SCSR, especially when an SCSR is used in a way which takes it outside of the test conditions under which it was approved. As examples, for a mine escape that takes a miner from the deepest point of penetration in the mine to the surface: How long will a 60-min. SCSR actually last? and How many SCSR`s will a miner need? To answer these kinds of questions, in-mine data being gathered on escape times, distance and heart rates using miners escaping on foot and under oxygen. A model will be developed and validated which predicts how much oxygen is actually needed for a mine escape, and compares oxygen consumption bare faced versus wearing an SCSR.

  18. Evolutionary escape from the prisoner's dilemma.

    PubMed

    Worden, Lee; Levin, Simon A

    2007-04-07

    The classic prisoner's dilemma model of game theory is modified by introducing occasional variations on the options available to players. Mutation and selection of game options reliably change the game matrix, gradually, from a prisoner's dilemma game into a byproduct mutualism one, in which cooperation is stable, and "temptation to defect" is replaced by temptation to cooperate. This result suggests that when there are many different potential ways of interacting, exploring those possibilities may make escape from prisoner's dilemmas a common outcome in the world. A consequence is that persistent prisoner's dilemma structures may be less common than one might otherwise expect.

  19. Modeling Fluorescence Escape from Tissue Phantoms

    NASA Astrophysics Data System (ADS)

    Gardner, Craig Morris

    1995-01-01

    This dissertation represents a contribution to the field of quantitative fluorescence spectroscopy of biological tissue. The absorption and scattering properties of a turbid medium affect the propagation of fluorescence to the medium surface. Optical properties also affect the amount of light reaching a detector placed to monitor fluorescence non-invasively. These facts have in part limited fluorescence spectroscopy of turbid media to a qualitative science. To study the general characteristics of turbid medium fluorescence, a Monte Carlo algorithm of fluorescence light propagation was developed. Modifications to the general algorithm were made to study several specific light distribution quantities associated with optical fiber fluorescent measurement devices. The Monte Carlo-based studies were also used to develop simple, accurate expressions describing the one -dimensional distribution of excitation light within a turbid medium and the escape of fluorescence from the medium. The expressions have accuracy comparable to solutions of the radiative transport equation. The two expressions were combined to derive a simple expression relating the fluorescence power escaping a turbid medium due to surface excitation, to the medium intrinsic fluorescence coefficient, as a function of the medium optical properties. Based on this expression and a description of the fluorescence escape power intercepted by a distant detector, a method was developed to recover the intrinsic fluorescence coefficient from surface measurements of fluorescence and optical properties. Experiments with water-based, turbid media verified the recovery method. The method used to recover the intrinsic fluorescence coefficient was modified for use with a clinical measurement geometry, specifically a small diameter optical fiber probe. Modification required a calibration method to estimate two optical property variables from two unique surface measurements of diffuse reflectance made with the optical

  20. Pro-apoptotic effects of nivalenol and deoxynivalenol trichothecenes in J774A.1 murine macrophages.

    PubMed

    Marzocco, Stefania; Russo, Rosario; Bianco, Giuseppe; Autore, Giuseppina; Severino, Lorella

    2009-08-25

    Nivalenol (NIV) and deoxynivalenol (DON) are trichothecenes mycotoxins produced by Fusarium fungi that occur in cereal grains alone or in combination. Several studies have shown that exposure to high concentrations of these mycotoxins resulted in decreased cell proliferation; however, the molecular mechanism underlying their activities are still partially known. In this study, we evaluated the effects of NIV and DON, alone and in combination, on J7741.A macrophages viability. The results of the current study show that both NIV and DON (10-100 microM) significantly stimulate apoptosis in J774A.1 macrophages in a concentration-dependent manner; in particular, NIV results a stronger pro-apoptotic effect than DON on cultured J774A.1 murine macrophages. No interactive effects were observed by exposing J774A.1 cells to both NIV and DON simultaneously. Pro-apoptotic activity induced by both mycotoxins seems to be essentially mediated by caspase-3 and is associated with a cell cycle blocking in G0/G1 phase. Moreover, our results show that NIV and DON are able to influence apoptotic pathway by ERK, pro-apoptotic protein Bax, caspase-3 and poly-ADP-ribose synthase (PARP), DNA repairing enzyme.

  1. The effects of NAD+ on apoptotic neuronal death and mitochondrial biogenesis and function after glutamate excitotoxicity.

    PubMed

    Wang, Xiaowan; Li, Hailong; Ding, Shinghua

    2014-11-07

    NAD+ is an essential co-enzyme for cellular energy metabolism and is also involved as a substrate for many cellular enzymatic reactions. It has been shown that NAD+ has a beneficial effect on neuronal survival and brain injury in in vitro and in vivo ischemic models. However, the effect of NAD+ on mitochondrial biogenesis and function in ischemia has not been well investigated. In the present study, we used an in vitro glutamate excitotoxicity model of primary cultured cortical neurons to study the effect of NAD+ on apoptotic neuronal death and mitochondrial biogenesis and function. Our results show that supplementation of NAD+ could effectively reduce apoptotic neuronal death, and apoptotic inducing factor translocation after neurons were challenged with excitotoxic glutamate stimulation. Using different approaches including confocal imaging, mitochondrial DNA measurement and Western blot analysis of PGC-1 and NRF-1, we also found that NAD+ could significantly attenuate glutamate-induced mitochondrial fragmentation and the impairment of mitochondrial biogenesis. Furthermore, NAD+ treatment effectively inhibited mitochondrial membrane potential depolarization and NADH redistribution after excitotoxic glutamate stimulation. Taken together, our results demonstrated that NAD+ is capable of inhibiting apoptotic neuronal death after glutamate excitotoxicity via preserving mitochondrial biogenesis and integrity. Our findings provide insights into potential neuroprotective strategies in ischemic stroke.

  2. Stabilization Of Apoptotic Cells: Generation Of Zombie Cells.

    PubMed

    Sánchez Alcázar, José A; Oropesa Ávila, Manuel; Andrade Talavera, Yuniesky; Garrido Maraver, Juan; de Lavera, Isabel; de la Mata, Mario; Cotán, David; Villanueva Paz, Marina; Delgado Pavón, Ana; Alcocer Gómez, Elisabet; Rodríguez Moreno, Antonio

    2015-08-01

    Apoptosis is characterized by degradation of cell components but plasma membrane remains intact. Apoptotic microtubule network (AMN) is organized during apoptosis forming a cortical structure beneath plasma membrane that maintains plasma membrane integrity. Apoptotic cells are also characterized by high reactive oxygen species (ROS) production that can be potentially harmful for the cell. The aim of this study was to develop a method that allows stabilizing apoptotic cells for diagnostic and therapeutic applications. We were able by using a cocktail composed of taxol (a microtubule stabilizer), Zn(2+) (a caspase inhibitor) and coenzyme Q10 (a lipid antioxidant) to stabilize H460 apoptotic cells in cell cultures for at least 72hours preventing secondary necrosis. Stabilized apoptotic cells maintain many apoptotic cells characteristics such as the presence of apoptotic microtubules, plasma membrane integrity, low intracellular calcium levels, plasma membrane potential, PS externalization and ability of being phagocytosed. Stabilized apoptotic cells can be considered as dying cells in which the cellular cortex and plasma membrane are maintained intact or alive. In a metaphorical sense, we can consider them as "living dead" or "zombie cells". Stabilization of apoptotic cells can be used for reliable detection and quantification of apoptosis in cultured cells and may allow a safer administration of apoptotic cells in clinical applications. Furthermore, it opens new avenues in the functional reconstruction of apoptotic cells for longer preservation.

  3. The amino acid sensor GCN2 inhibits inflammatory responses to apoptotic cells promoting tolerance and suppressing systemic autoimmunity

    PubMed Central

    Ravishankar, Buvana; Liu, Haiyun; Shinde, Rahul; Chaudhary, Kapil; Xiao, Wei; Bradley, Jillian; Koritzinsky, Marianne; Madaio, Michael P.; McGaha, Tracy L.

    2015-01-01

    Efficient apoptotic cell clearance and induction of immunologic tolerance is a critical mechanism preventing autoimmunity and associated pathology. Our laboratory has reported that apoptotic cells induce tolerance by a mechanism dependent on the tryptophan catabolizing enzyme indoleamine 2,3 dioxygenase 1 (IDO1) in splenic macrophages (MΦ). The metabolic-stress sensing protein kinase GCN2 is a primary downstream effector of IDO1; thus, we tested its role in apoptotic cell-driven immune suppression. In vitro, expression of IDO1 in MΦs significantly enhanced apoptotic cell-driven IL-10 and suppressed IL-12 production in a GCN2-dependent mechanism. Suppression of IL-12 protein production was due to attenuation of IL-12 mRNA association with polyribosomes inhibiting translation while IL-10 mRNA association with polyribosomes was not affected. In vivo, apoptotic cell challenge drove a rapid, GCN2-dependent stress response in splenic MΦs with increased IL-10 and TGF-β production, whereas myeloid-specific deletion of GCN2 abrogated regulatory cytokine production with provocation of inflammatory T-cell responses to apoptotic cell antigens and failure of long-tolerance induction. Consistent with a role in prevention of apoptotic cell driven autoreactivity, myeloid deletion of GCN2 in lupus-prone mice resulted in increased immune cell activation, humoral autoimmunity, renal pathology, and mortality. In contrast, activation of GCN2 with an agonist significantly reduced anti-DNA autoantibodies and protected mice from disease. Thus, this study implicates a key role for GCN2 signals in regulating the tolerogenic response to apoptotic cells and limiting autoimmunity. PMID:26261340

  4. Non-apoptotic function of BAD and BAX in long-term depression of synaptic transmission

    PubMed Central

    Jiao, Song; Li, Zheng

    2011-01-01

    Summary It has recently been found that caspases not only function in apoptosis, but are also crucial for non-apoptotic processes such as NMDA receptor-dependent long-term depression (LTD) of synaptic transmission. It remains unknown, however, how caspases are activated and how neurons escape death in LTD. Here we show that caspase-3 is activated by the BAD-BAX cascade for LTD induction. This cascade is required specifically for NMDA receptor-dependent LTD but not for mGluR-LTD, and its activation is sufficient to induce synaptic depression. In contrast to apoptosis, however, BAD is activated only moderately and transiently and BAX is not translocated to mitochondria, resulting in only modest caspase-3 activation. We further demonstrate that the intensity and duration of caspase-3 activation determin whether it leads to cell death or LTD, thus fine-tuning of caspase-3 activation is critical in distinguishing between these two pathways. PMID:21609830

  5. The effects of steady swimming on fish escape performance.

    PubMed

    Anwar, Sanam B; Cathcart, Kelsey; Darakananda, Karin; Gaing, Ashley N; Shin, Seo Yim; Vronay, Xena; Wright, Dania N; Ellerby, David J

    2016-06-01

    Escape maneuvers are essential to the survival and fitness of many animals. Escapes are frequently initiated when an animal is already in motion. This may introduce constraints that alter the escape performance. In fish, escape maneuvers and steady, body caudal fin (BCF) swimming are driven by distinct patterns of curvature of the body axis. Pre-existing muscle activity may therefore delay or diminish a response. To quantify the performance consequences of escaping in flow, escape behavior was examined in bluegill sunfish (Lepomis macrochirus) in both still-water and during steady swimming. Escapes executed during swimming were kinematically less variable than those made in still-water. Swimming escapes also had increased response latencies and lower peak velocities and accelerations than those made in still-water. Performance was also lower for escapes made up rather than down-stream, and a preference for down-stream escapes may be associated with maximizing performance. The constraints imposed by pre-existing motion and flow, therefore, have the potential to shape predator-prey interactions under field conditions by shifting the optimal strategies for both predators and prey.

  6. Structured Observations Reveal Slow HIV-1 CTL Escape

    PubMed Central

    Roberts, Hannah E.; Hurst, Jacob; Robinson, Nicola; Brown, Helen; Flanagan, Peter; Vass, Laura; Fidler, Sarah; Weber, Jonathan; Babiker, Abdel; Phillips, Rodney E.; McLean, Angela R.; Frater, John

    2015-01-01

    The existence of viral variants that escape from the selection pressures imposed by cytotoxic T-lymphocytes (CTLs) in HIV-1 infection is well documented, but it is unclear when they arise, with reported measures of the time to escape in individuals ranging from days to years. A study of participants enrolled in the SPARTAC (Short Pulse Anti-Retroviral Therapy at HIV Seroconversion) clinical trial allowed direct observation of the evolution of CTL escape variants in 125 adults with primary HIV-1 infection observed for up to three years. Patient HLA-type, longitudinal CD8+ T-cell responses measured by IFN-γ ELISpot and longitudinal HIV-1 gag, pol, and nef sequence data were used to study the timing and prevalence of CTL escape in the participants whilst untreated. Results showed that sequence variation within CTL epitopes at the first time point (within six months of the estimated date of seroconversion) was consistent with most mutations being transmitted in the infecting viral strain rather than with escape arising within the first few weeks of infection. Escape arose throughout the first three years of infection, but slowly and steadily. Approximately one third of patients did not drive any new escape in an HLA-restricted epitope in just under two years. Patients driving several escape mutations during these two years were rare and the median and modal numbers of new escape events in each patient were one and zero respectively. Survival analysis of time to escape found that possession of a protective HLA type significantly reduced time to first escape in a patient (p = 0.01), and epitopes escaped faster in the face of a measurable CD8+ ELISpot response (p = 0.001). However, even in an HLA matched host who mounted a measurable, specific, CD8+ response the average time before the targeted epitope evolved an escape mutation was longer than two years. PMID:25642847

  7. A New Maneuver for Escape Trajectories

    NASA Technical Reports Server (NTRS)

    Adams, Robert B.

    2008-01-01

    This presentation put forth a new maneuver for escape trajectories and specifically sought to find an analytical approximation for medium thrust trajectories. In most low thrust derivations the idea is that escape velocity is best achieved by accelerating along the velocity vector. The reason for this is that change in specific orbital energy is a function of velocity and acceleration. However, Levin (1952) suggested that while this is a locally optimal solution it might not be a globally optimal one. Turning acceleration inward would drop periapse giving a higher velocity later in the trajectory. Acceleration at that point would be dotted against a higher magnitude V giving a greater rate of change of mechanical energy. The author then hypothesized that decelerating from the initial orbit and then accelerating at periapse would not lead to a gain in greater specific orbital energy--however, the hypothesis was incorrect. After considerable derivation it was determined that this new maneuver outperforms a direct burn when the overall DeltaV budget exceeds the initial orbital velocity (the author has termed this the Heinlein maneuver). The author provides a physical explanation for this maneuver and presents optimization analyses.

  8. Escape mechanisms of dust in Io

    NASA Astrophysics Data System (ADS)

    Flandes, A.

    The injection of material into the jovian magnetosphere through Io's volcanic activity makes possible the formation of structures such as the plasma torus and the dust ballerina skirt. Io's high temperature volcanism produces spectacular plumes, but even the tallest plumes, as those of Pelen Patera, will not produce enough energy to defeat the gravitational attraction of Io. The fact is that dust escapes from Io, which implies that a second mechanism is acting on the grains. Grains brought to the top of the highest plumes by the volcanic forces are still under Io's gravitational pull, but need only a minimum charge (~10-1 4 C) so that the Lorentz force due to the Jovian magnetic field equilibrates this attraction. In the volcanic vents, the escape velocity of the ejected material and its own density produces enough collisions to create charges. On top of the highest plumes (~500km) charged grains are exposed to the plasma torus that co-rotates rigidly with Jupiter and, due to the relative velocity among Io and the torus, the grains will be dragged away from Io. As it is well known, these dust grains will also be dragged away from Jupiter.

  9. The escape problem for mortal walkers

    NASA Astrophysics Data System (ADS)

    Grebenkov, D. S.; Rupprecht, J.-F.

    2017-02-01

    We introduce and investigate the escape problem for random walkers that may eventually die, decay, bleach, or lose activity during their diffusion towards an escape or reactive region on the boundary of a confining domain. In the case of a first-order kinetics (i.e., exponentially distributed lifetimes), we study the effect of the associated death rate onto the survival probability, the exit probability, and the mean first passage time. We derive the upper and lower bounds and some approximations for these quantities. We reveal three asymptotic regimes of small, intermediate, and large death rates. General estimates and asymptotics are compared to several explicit solutions for simple domains and to numerical simulations. These results allow one to account for stochastic photobleaching of fluorescent tracers in bio-imaging, degradation of mRNA molecules in genetic translation mechanisms, or high mortality rates of spermatozoa in the fertilization process. Our findings provide a mathematical ground for optimizing storage containers and materials to reduce the risk of leakage of dangerous chemicals or nuclear wastes.

  10. F111 Crew Escape Module pilot parachute

    SciTech Connect

    Tadios, E.L.

    1991-01-01

    A successfully deployment of a parachute system highly depends on the efficiency of the deployment device and/or method. There are several existing methods and devices that may be considered for a deployment system. For the F111 Crew Escape Module (CEM), the recovery parachute system deployment is initiated by the firing of a catapult that ejects the complete system from the CEM. At first motion of the pack, a drogue gun is fired, which deploys the pilot parachute system. The pilot parachute system then deploys the main parachute system, which consists of a cluster of three 49-ft diameter parachutes. The pilot parachute system which extracts the F111 Crew Escape Module recovery parachute system must provide reasonable bag strip velocities throughout the flight envelope (10 psf to 300 psf). The pilot parachute system must, therefore, have sufficient drag area at the lower dynamic pressures and a reduced drag area at the high end of the flight envelope. The final design that was developed was a dual parachute system which consists of a 5-ft diameter guide surface parachute tethered inside a 10-ft diameter flat circular parachute. The high drag area is sustained at the low dynamic pressures by keeping both parachutes intact. The drag area is reduced at the higher extreme by allowing the 10-ft parachute attachment to fail. The discussions to follow describe in detail how the system was developed. 4 refs., 10 figs., 2 tabs.

  11. Orbital Effects on Mercury's Escaping Sodium Exosphere

    NASA Technical Reports Server (NTRS)

    Schmidt, Carl A.; Wilson, Jody K.; Baumgardner, Jeffrey; Mendillo, Michael

    2009-01-01

    We present results from coronagraphic imaging of Mercury's sodium tail over a 7 deg field of view. Several sets of observations made at the McDonald Observatory since May 2007 show a tail of neutral sodium atoms stretching more than 1000 Mercury radii (R(sub m)) in length, or a full degree of sky. However, no tail was observed extending beyond 120 R(sub m) during the January 2008 MESSENGER Fly-by period, or during a similar orbital phase of Mercury in July 2008. Large changes in Mercury's heliocentric radial velocity cause Doppler shifts about the Fraunhofer absorption features; the resultant change in solar flux and radiation pressure is the primary cause of the observed variation in tail brightness. Smaller fluctuations in brightness may exist due to changing source rates at the surface, but we have no explicit evidence for such changes in this data set. The effects of radiation pressure on Mercury's escaping atmosphere are investigated using seven observations spanning different orbital phases. Total escape rates of atmospheric sodium are estimated to be between 5 and 13 x 10(exp 23) atoms/s and show a correlation to radiation pressure. Candidate sources of Mercury's sodium exosphere include desorption by UV sunlight, thermal desorption, solar wind channeled along Mercury's magnetic field lines, and micro-meteor impacts. Wide-angle observations of the full extent of Mercury's sodium tail offer opportunities to enhance our understanding of the time histories of these source rates.

  12. Orbital Effects on Mercury's Escaping Sodium Exosphere

    NASA Technical Reports Server (NTRS)

    Schmidt, Carl A.; Wilson, Jody K.; Baumgardner, Jeffrey; Mendillo, Michael

    2009-01-01

    We present results from coronagraphic imaging of Mercury's sodium tail over a 7 deg field of view. Several sets of observations made at the McDonald Observatory since May 2007 show a tail of neutral sodium atoms stretching more than 1000 Mercury radii (R(sub m)) in length, or a full degree of sky. However, no tail was observed extending beyond 120 R(sub m) during the January 2008 MESSENGER Fly-by period, or during a similar orbital phase of Mercury in July 2008. Large changes in Mercury's heliocentric radial velocity cause Doppler shifts about the Fraunhofer absorption features; the resultant change in solar flux and radiation pressure is the primary cause of the observed variation in tail brightness. Smaller fluctuations in brightness may exist due to changing source rates at the surface, but we have no explicit evidence for such changes in this data set. The effects of radiation pressure on Mercury's escaping atmosphere are investigated using seven observations spanning different orbital phases. Total escape rates of atmospheric sodium are estimated to be between 5 and 13 x 10(exp 23) atoms/s and show a correlation to radiation pressure. Candidate sources of Mercury's sodium exosphere include desorption by UV sunlight, thermal desorption, solar wind channeled along Mercury's magnetic field lines, and micro-meteor impacts. Wide-angle observations of the full extent of Mercury's sodium tail offer opportunities to enhance our understanding of the time histories of these source rates.

  13. Escape of water molecular from Carbon Nanotubes

    NASA Astrophysics Data System (ADS)

    Li, Jiaxi; Li, Wenfeng; Zhang, Jianwei

    2014-03-01

    Understanding and controlling the transport of water molecules through nanopores have attracted great interest due to potential applications for designing novel nanofluidic devices, machines and sensors. In this work, we theoretically investigate the effects of an external nonuniform electric field on the escape of water molecules through single-walled carbon nanotubes (SWNTs) by using of molecular dynamics (MD) simulations. When polar water molecules are placed in the gradient electric field, the electric force is experienced that can drive the water molecules. Molecular dynamics simulations show that the escape probability of water obeys the Boltzmann distribution. Our results show that energy barrier delta E is independent of temperature which indicates that it is a single-barrier system. From the MD results statistics, the key parameters could be determined such that the relationship between energy barrier delta E and diameter of SWNTs and nozzle distance of the charge r would be revealed that could deepen our current theoretical understanding on transport of water molecular inside SWNTs with the nonuniform electric field.

  14. Effects of escape to alone versus escape to enriched environments on adaptive and aberrant behavior.

    PubMed Central

    Golonka, Z; Wacker, D; Berg, W; Derby, K M; Harding, J; Peck, S

    2000-01-01

    Escape-maintained aberrant behavior may be influenced by two outcomes: (a) a break from the activity and (b) subsequent access to preferred activities. To assess this hypothesis, a treatment was developed that analyzed response allocation across two break options: break alone and break with access to preferred social activities. The break with preferred activities decreased aberrant behavior and increased appropriate behavior. PMID:10885532

  15. Enzyme Kinetics.

    ERIC Educational Resources Information Center

    Moe, Owen; Cornelius, Richard

    1988-01-01

    Conveys an appreciation of enzyme kinetic analysis by using a practical and intuitive approach. Discusses enzyme assays, kinetic models and rate laws, the kinetic constants (V, velocity, and Km, Michaels constant), evaluation of V and Km from experimental data, and enzyme inhibition. (CW)

  16. Enzyme Kinetics.

    ERIC Educational Resources Information Center

    Moe, Owen; Cornelius, Richard

    1988-01-01

    Conveys an appreciation of enzyme kinetic analysis by using a practical and intuitive approach. Discusses enzyme assays, kinetic models and rate laws, the kinetic constants (V, velocity, and Km, Michaels constant), evaluation of V and Km from experimental data, and enzyme inhibition. (CW)

  17. Some Possible Cases of Escape Mimicry in Neotropical Butterflies.

    PubMed

    Pinheiro, C E G; Freitas, A V L

    2014-10-01

    The possibility that escape or evasive mimicry evolved in butterflies and other prey insects in a similar fashion to classical Batesian and Müllerian mimicry has long been advanced in the literature. However, there is a general disagreement among lepidopterists and evolutionary biologists on whether or not escape mimicry exists, as well as in which mimicry rings this form of mimicry has evolved. Here, we review some purported cases of escape mimicry in Neotropical butterflies and suggest new mimicry rings involving several species of Archaeoprepona, Prepona, and Doxocopa (the "bright blue bands" ring) and species of Colobura and Hypna (the "creamy bands" ring) where the palatability of butterflies, their ability to escape predator attacks, geographic distribution, relative abundance, and co-occurrence in the same habitats strongly suggest that escape mimicry is involved. In addition, we also indicate other butterfly taxa whose similarities of coloration patterns could be due to escape mimicry and would constitute important case studies for future investigation.

  18. Strong purifying selection at genes escaping X chromosome inactivation.

    PubMed

    Park, Chungoo; Carrel, Laura; Makova, Kateryna D

    2010-11-01

    To achieve dosage balance of X-linked genes between mammalian males and females, one female X chromosome becomes inactivated. However, approximately 15% of genes on this inactivated chromosome escape X chromosome inactivation (XCI). Here, using a chromosome-wide analysis of primate X-linked orthologs, we test a hypothesis that such genes evolve under a unique selective pressure. We find that escape genes are subject to stronger purifying selection than inactivated genes and that positive selection does not significantly affect the evolution of these genes. The strength of selection does not differ between escape genes with similar versus different expression levels in males versus females. Intriguingly, escape genes possessing Y homologs evolve under the strongest purifying selection. We also found evidence of stronger conservation in gene expression levels in escape than inactivated genes. We hypothesize that divergence in function and expression between X and Y gametologs is driving such strong purifying selection for escape genes.

  19. The atmospheric escape at Mars: complementing the scenario

    NASA Astrophysics Data System (ADS)

    Lilensten, Jean; Simon, Cyril; Barthélémy, Mathieu; Thissen, Roland; Ehrenreich, David; Gronoff, Guillaume; Witasse, Olivier

    2013-04-01

    In the recent years, the presence of dications in the atmospheres of Mars, Venus, Earth and Titan has been modeled and assessed. These studies also suggested that these ions could participate to the escape of the planetary atmospheres because a large fraction of them is unstable and highly ener- getic. When they dissociate, their internal energy is transformed into kinetic energy which may be larger than the escape energy. This study assesses the impact of the doubly-charged ions in the escape of CO2-dominated planetary atmospheres and to compare it to the escape of thermal photo-ions.We solve a Boltzmann transport equation at daytime taking into account the dissociative states of CO++ for a simplified single constituent atmosphere of a 2 case-study planet. We compute the escape of fast ions using a Beer-Lambert approach. We study three test-cases. On a Mars-analog planet in today's conditions, we retrieve the measured electron escape flux. When comparing the two mechanisms (i.e. excluding solar wind effects, sputtering ...), the escape due to the fast ions issuing from the dissociation of dications may account for up to 6% of the total and the escape of thermal ions for the remaining. We show that these two mechanisms cannot explain the escape of the atmosphere since the magnetic field vanished but complement the other processes and allow writing the scenario of the Mars escape. We show that the atmosphere of a Mars analog planet would empty in another giga years and a half. At Venus orbit, the contribution of the dications in the escape rate is negligible.When simulating the hot Jupiter HD209458b, the two processes cannot explain the measured escape flux of C+.

  20. Galectin-1 and Galectin-3 induce mitochondrial apoptotic pathway in Jurkat cells

    NASA Astrophysics Data System (ADS)

    Vasil'eva, O. A.; Isaeva, A. V.; Prokhorenko, T. S.; Zima, A. P.; Novitsky, V. V.

    2016-08-01

    Cellular malignant transformation is often accompanied by increased gene expression of low-molecular proteins of lectins family-galectins. But it is unknown how galectins promote tumor growth and malignization. Galectins-1 and galectin-3 are thought to be possible immunoregulators exerting their effects by regulating the balance of CD4+ lymphocytes. In addition it is known that tumor cells overexpressing galectins are capable of escaping immunological control, causing apoptosis of lymphocytes. The aim of the study is to investigate the role of galectin-1 and galectin-3 in the implementation of mitochondrial apoptotic pathway in Jurkat cells. Methods: Jurkat cells were used as a model for the study of T-lymphocytes. Jurkat cells were activated with antibodies to CD3 and CD28 and cultured with recombinant galectin-1 and -3. Apoptosis of Jurkat cells and depolarization of the mitochondrial membrane were assessed by flow cytometry. It was found that galectin-1 and galectin-3 have a dose-dependent pro-apoptotic effect on Jurkat cells in vitro and enlarge the number of cells with decreased mitochondrial membrane potential compared with intact cells.

  1. The Post-Apoptotic Fate of RNAs Identified Through High-Throughput Sequencing of Human Hair

    PubMed Central

    Lefkowitz, Gloria K.; Mukhopadhyay, Anandaroop; Cowing-Zitron, Christopher; Yu, Benjamin D.

    2011-01-01

    The hair of all mammals consists of terminally differentiated cells that undergo a specialized form of apoptosis called cornification. While DNA is destroyed during cornification, the extent to which RNA is lost is unknown. Here we find that multiple types of RNA are incompletely degraded after hair shaft formation in both mouse and human. Notably, mRNAs and short regulatory microRNAs (miRNAs) are stable in the hair as far as 10 cm from the scalp. To better characterize the post-apoptotic RNAs that escape degradation in the hair, we performed sequencing (RNA-seq) on RNA isolated from hair shafts pooled from several individuals. This hair shaft RNA library, which encompasses different hair types, genders, and populations, revealed 7,193 mRNAs, 449 miRNAs and thousands of unannotated transcripts that remain in the post-apoptotic hair. A comparison of the hair shaft RNA library to that of viable keratinocytes revealed surprisingly similar patterns of gene coverage and indicates that degradation of RNA is highly inefficient during apoptosis of hair lineages. The generation of a hair shaft RNA library could be used as months of accumulated transcriptional history useful for retrospective detection of disease, drug response and environmental exposure. PMID:22110684

  2. Genistein suppresses the mitochondrial apoptotic pathway in hippocampal neurons in rats with Alzheimer's disease

    PubMed Central

    Wang, Yan; Cai, Biao; Shao, Jing; Wang, Ting-ting; Cai, Run-ze; Ma, Chang-ju; Han, Tao; Du, Jun

    2016-01-01

    Genistein is effective against amyloid-β toxicity, but the underlying mechanisms are unclear. We hypothesized that genistein may protect neurons by inhibiting the mitochondrial apoptotic pathway, and thereby play a role in the prevention of Alzheimer’s disease. A rat model of Alzheimer’s disease was established by intraperitoneal injection of D-galactose and intracerebral injection of amyloid-β peptide (25–35). In the genistein treatment groups, a 7-day pretreatment with genistein (10, 30, 90 mg/kg) was given prior to establishing Alzheimer’s disease model, for 49 consecutive days. Terminal deoxyribonucleotidyl transferase-mediated dUTP nick end labeling assay demonstrated a reduction in apoptosis in the hippocampus of rats treated with genistein. Western blot analysis showed that expression levels of capase-3, Bax and cytochrome c were decreased compared with the model group. Furthermore, immunohistochemical staining revealed reductions in cytochrome c and Bax immunoreactivity in these rats. Morris water maze revealed a substantial shortening of escape latency by genistein in Alzheimer’s disease rats. These findings suggest that genistein decreases neuronal loss in the hippocampus, and improves learning and memory ability. The neuroprotective effects of genistein are associated with the inhibition of the mitochondrial apoptotic pathway, as shown by its ability to reduce levels of caspase-3, Bax and cytochrome c. PMID:27630702

  3. Escaping hydrogen from HD209458b

    NASA Astrophysics Data System (ADS)

    Erwin, Justin; Yelle, Roger V.; Koskinen, Tommi T.

    2014-11-01

    Recent modeling of the atmosphere of HD209458b has been used to interpret the Lyman-α line and other observations during transits. In this presentation, we model the hydrogen exosphere of the short period, Hot Jupiter planet to investigate the dynamics of the extended hydrogen cloud and to determine the observability of the solar ionization and acceleration on the escaping hydrogen.Koskinen et al (2010) used a hydrostatic density profile in the thermosphere combined with the Voigt profile to estimate the Lyman-α transit depths for an array of model parameters. A detailed photochemical-dynamical model of the thermosphere was developed by Koskinen et al (2013a) and used to again estimate model parameters to fit not only the Lyman-α transits, but also the transits in the O I, C II and Si III lines (Koskinen et al, 2013b).Recently, Bourrier et al (2013) modeled the escape of hydrogen from the extended atmospheres of HD209458b and HD189733b and used the results to interpret Lyman-α observations. They included acceleration of hydrogen by stellar radiation pressure to obtain the high velocity tails in the escaping velocity distribution, arguing that the observations are explained by high velocity gas in the system, while Voigt broadening is negligible.In this work we connect a free molecular flow (FMF) model, similar to Bourrier et al (2013), to the results of Koskinen et al (2013b) to simulate the extended atmosphere of HD209458b. We include ionization and radiation pressure in the extended atmosphere along with self-shielding due to the extended atmosphere and thermosphere. The extended atmosphere and absorption rates are iteratively computed to obtain a consistent solution. In this manner, we can interpret the importance of the various physical processes by comparing the simulated line profiles, consisting of velocity and natural broadening, to observations (Koskinen et al, 2010). Furthermore, the transit depths of this model can be used to re-evaluate the

  4. Cockroaches keep predators guessing by using preferred escape trajectories

    PubMed Central

    Domenici, P.; Booth, D.; Blagburn, J.M.; Bacon, J. P.

    2009-01-01

    Summary Anti-predator behaviour is vital for most animals, and calls for accurate timing and swift motion. While fast reaction times [1] and predictable, context-dependent, escape initiation distances [2] are common features of most escape systems, previous work has highlighted the need for unpredictability in escape directions, in order to prevent predators from learning a repeated, fixed pattern [3–5]. Ultimate unpredictability would result from random escape trajectories. Although this strategy would deny any predictive power to the predator, it would also result in some escape trajectories towards the threat. Previous work has shown that escape trajectories are in fact generally directed away from the threat, although with a high variability [5–8]. However, the rules governing this variability are largely unknown. Here, we demonstrate tha t individual cockroaches (Periplaneta americana, a much studied model prey species [9–14]) keep each escape unpredictable by running along one of a set of preferred trajectories at fixed angles from the direction of the threatening stimulus. These results provide a new paradigm for understanding the behavio ural strategies for escape responses, underscoring the need to revisit the neural mechanisms controlling escape directions in the cockroach and similar animal models, and the evolutionary forces driving unpredictable, or “protean” [3], anti-predator behaviour. PMID:19013065

  5. Managing Pacific salmon escapements: The gaps between theory and reality

    USGS Publications Warehouse

    Knudsen, E. Eric; Knudsen, E. Eric; Steward, Cleveland R.; MacDonald, Donald D.; Williams, Jack E.; Reiser, Dudley W.

    1999-01-01

    There are myriad challenges to estimating intrinsic production capacity for Pacific salmon populations that are heavily exploited and/or suffering from habitat alteration. Likewise, it is difficult to determine whether perceived decreases in production are due to harvest, habitat, or hatchery influences, natural variation, or some combination of all four. There are dramatic gaps between the true nature of the salmon spawner/recruit relationship and the theoretical basis for describing and understanding the relationship. Importantly, there are also extensive practical difficulties associated with gathering and interpreting accurate escapement and run-size information and applying it to population management. Paradoxically, certain aspects of salmon management may well be contributing to losses in abundance and biodiversity, including harvesting salmon in mixed population fisheries, grouping populations into management units subject to a common harvest rate, and fully exploiting all available hatchery fish at the expense of wild fish escapements. Information on U.S. Pacific salmon escapement goal-setting methods, escapement data collection methods and estimation types, and the degree to which stocks are subjected to mixed stock fisheries was summarized and categorized for 1,025 known management units consisting of 9,430 known populations. Using criteria developed in this study, only 1% of U.S. escapement goals are by methods rated as excellent. Escapement goals for 16% of management units were rated as good. Over 60% of escapement goals have been set by methods rated as either fair or poor and 22% of management units have no escapement goals at all. Of the 9,430 populations for which any information was available, 6,614 (70%) had sufficient information to categorize the method by which escapement data are collected. Of those, data collection methods were rated as excellent for 1%, good for 1%, fair for 2%, and poor for 52%. Escapement estimates are not made for 44

  6. Feedback regulated escape of ionising radiation from high redshift galaxies

    NASA Astrophysics Data System (ADS)

    Trebitsch, M.; Blaizot, J.

    2016-12-01

    Small galaxies are thought to provide the bulk of the radiation necessary to reionise the Universe by z ˜ 6. Their ionising efficiency is usually quantified by their escape fraction f_{esc}, but it is extremely hard to constrain from observations. With the goal of studying the physical processes that determine the values of the escape fraction, we have run a series of high resolution, cosmological, radiative hydrodynamics simulations centred on three galaxies. We find that the variability of the escape fraction follows that of the star formation rate, and that local feedback is necessary for radiation to escape.

  7. Experimental self-punishment and superstitious escape behavior.

    PubMed

    MIGLER, B

    1963-07-01

    Rats were trained to escape from shock by pressing a bar. Bar holding was subsequently punished with very brief shocks. This treatment failed to depress bar-holding behavior. In some cases, although the escape shocks were delivered very infrequently, bar holding was maintained and resulted in the delivery of several thousand punishments per session. These and other effects of the punishment treatment were investigated. Finally, some of the possibilities of superstitious escape responding were explored by presenting inescapable shocks to rats that had been trained to escape shock by lever pressing. Although responding during these shocks had no programmed consequences, responding was sustained.

  8. Experimental self-punishment and superstitious escape behavior

    PubMed Central

    Migler, Bernard

    1963-01-01

    Rats were trained to escape from shock by pressing a bar. Bar holding was subsequently punished with very brief shocks. This treatment failed to depress bar-holding behavior. In some cases, although the escape shocks were delivered very infrequently, bar holding was maintained and resulted in the delivery of several thousand punishments per session. These and other effects of the punishment treatment were investigated. Finally, some of the possibilities of superstitious escape responding were explored by presenting inescapable shocks to rats that had been trained to escape shock by lever pressing. Although responding during these shocks had no programmed consequences, responding was sustained. PMID:13935675

  9. Apoptotic rate in patients with myelodisplastic syndrome treated with modulatory compounds of pro-apoptotic cytokines.

    PubMed

    Moldoveanu, Elena; Moicean, Andreea; Vidulescu, Cristina; Marta, Daciana; Colita, Adriana

    2003-01-01

    Excessive apoptosis has a central role in ineffective hematopoiesis in myelodysplastic syndrome (MDS). The aim of the study was to quantify apoptosis and Bcl-2 expression in patients with MDS and to use these parameters in the evaluation of treatment efficacy with compounds modulating proapoptotic cytokines. Bone marrow (BM) samples from eight MDS patients were studied: four with refractory anemia and four with refractory anemia with ringed sideroblasts. Two patients with Hodgkin disease without BM determination were studied for control. Therapy consisted in administration of pentoxyphylline, dexamethasone and ciprofloxacin. Biochemical assay of apoptosis and Bcl-2 was performed using annexin V-biotin conjugate antibody and anti-human Bcl-2 antibody respectively, followed by streptavidine-peroxidase conjugate, and peroxidase substrate. Ultrastructural investigation of BM samples was performed with standard electron microscopy techniques. Most of BM hematopoietic cells in the MDS patients had ultrastructural features of various stages of apoptosis including chromatin condensation and margination, cytoplasm condensation and budding of nuclear and plasma membranes to produce apoptotic bodies. Bcl-2 expression showed an inverse correlation with the rate of the apoptotic process. Periodic evaluation of these two parameters has shown an increase of Bcl-2 expression and a decrease of apoptotic rate in patients who had responded to the treatment. Response to the treatment was appreciated in accordance with their transfusion needs. Treatment efficiency diminished in time. The rate of apoptosis was inversely correlated with the level of Bcl-2 expression. These results confirm the importance of the apoptotic process evaluation in monitoring MDS treatment.

  10. The Modulation of Apoptotic Pathways by Gammaherpesviruses

    PubMed Central

    Banerjee, Shuvomoy; Uppal, Timsy; Strahan, Roxanne; Dabral, Prerna; Verma, Subhash C.

    2016-01-01

    Apoptosis or programmed cell death is a tightly regulated process fundamental for cellular development and elimination of damaged or infected cells during the maintenance of cellular homeostasis. It is also an important cellular defense mechanism against viral invasion. In many instances, abnormal regulation of apoptosis has been associated with a number of diseases, including cancer development. Following infection of host cells, persistent and oncogenic viruses such as the members of the Gammaherpesvirus family employ a number of different mechanisms to avoid the host cell’s “burglar” alarm and to alter the extrinsic and intrinsic apoptotic pathways by either deregulating the expressions of cellular signaling genes or by encoding the viral homologs of cellular genes. In this review, we summarize the recent findings on how gammaherpesviruses inhibit cellular apoptosis via virus-encoded proteins by mediating modification of numerous signal transduction pathways. We also list the key viral anti-apoptotic proteins that could be exploited as effective targets for novel antiviral therapies in order to stimulate apoptosis in different types of cancer cells. PMID:27199919

  11. Gated Narrow Escape Time for Molecular Signaling

    NASA Astrophysics Data System (ADS)

    Reingruber, Jürgen; Holcman, David

    2009-10-01

    The mean time for a diffusing ligand to activate a target protein located on the surface of a microdomain can regulate cellular signaling. When the ligand switches between various states induced by chemical interactions or conformational changes, while target activation occurs in only one state, this activation time is affected. We investigate this dynamics using new equations for the sojourn times spent in each state. For two states, we obtain exact solutions in dimension one, and asymptotic ones confirmed by Brownian simulations in dimension 3. We find that the activation time is quite sensitive to changes of the switching rates, which can be used to modulate signaling. Interestingly, our analysis reveals that activation can be fast although the ligand spends most of the time “hidden” in the nonactivating state. Finally, we obtain a new formula for the narrow escape time in the presence of switching.

  12. Escape dynamics through a continuously growing leak

    NASA Astrophysics Data System (ADS)

    Kovács, Tamás; Vanyó, József

    2017-06-01

    We formulate a model that describes the escape dynamics in a leaky chaotic system in which the size of the leak depends on the number of the in-falling particles. The basic motivation of this work is the astrophysical process, which describes the planetary accretion. In order to study the dynamics generally, the standard map is investigated in two cases when the dynamics is fully hyperbolic and in the presence of Kolmogorov-Arnold-Moser islands. In addition to the numerical calculations, an analytic solution to the temporal behavior of the model is also derived. We show that in the early phase of the leak expansion, as long as there are enough particles in the system, the number of survivors deviates from the well-known exponential decay. Furthermore, the analytic solution returns the classical result in the limiting case when the number of particles does not affect the leak size.

  13. Simulating dynamical features of escape panic

    NASA Astrophysics Data System (ADS)

    Helbing, Dirk; Farkas, Illés; Vicsek, Tamás

    2000-09-01

    One of the most disastrous forms of collective human behaviour is the kind of crowd stampede induced by panic, often leading to fatalities as people are crushed or trampled. Sometimes this behaviour is triggered in life-threatening situations such as fires in crowded buildings; at other times, stampedes can arise during the rush for seats or seemingly without cause. Although engineers are finding ways to alleviate the scale of such disasters, their frequency seems to be increasing with the number and size of mass events. But systematic studies of panic behaviour and quantitative theories capable of predicting such crowd dynamics are rare. Here we use a model of pedestrian behaviour to investigate the mechanisms of (and preconditions for) panic and jamming by uncoordinated motion in crowds. Our simulations suggest practical ways to prevent dangerous crowd pressures. Moreover, we find an optimal strategy for escape from a smoke-filled room, involving a mixture of individualistic behaviour and collective `herding' instinct.

  14. Escape of Black Holes from the Brane

    NASA Astrophysics Data System (ADS)

    Flachi, Antonino; Tanaka, Takahiro

    2005-10-01

    TeV-scale gravity theories allow the possibility of producing small black holes at energies that soon will be explored at the CERN LHC or at the Auger observatory. One of the expected signatures is the detection of Hawking radiation that might eventually terminate if the black hole, once perturbed, leaves the brane. Here, we study how the “black hole plus brane” system evolves once the black hole is given an initial velocity that mimics, for instance, the recoil due to the emission of a graviton. The results of our dynamical analysis show that the brane bends around the black hole, suggesting that the black hole eventually escapes into the extra dimensions once two portions of the brane come in contact and reconnect. This gives a dynamical mechanism for the creation of baby branes.

  15. Enzyme Informatics

    PubMed Central

    Alderson, Rosanna G.; Ferrari, Luna De; Mavridis, Lazaros; McDonagh, James L.; Mitchell, John B. O.; Nath, Neetika

    2012-01-01

    Over the last 50 years, sequencing, structural biology and bioinformatics have completely revolutionised biomolecular science, with millions of sequences and tens of thousands of three dimensional structures becoming available. The bioinformatics of enzymes is well served by, mostly free, online databases. BRENDA describes the chemistry, substrate specificity, kinetics, preparation and biological sources of enzymes, while KEGG is valuable for understanding enzymes and metabolic pathways. EzCatDB, SFLD and MACiE are key repositories for data on the chemical mechanisms by which enzymes operate. At the current rate of genome sequencing and manual annotation, human curation will never finish the functional annotation of the ever-expanding list of known enzymes. Hence there is an increasing need for automated annotation, though it is not yet widespread for enzyme data. In contrast, functional ontologies such as the Gene Ontology already profit from automation. Despite our growing understanding of enzyme structure and dynamics, we are only beginning to be able to design novel enzymes. One can now begin to trace the functional evolution of enzymes using phylogenetics. The ability of enzymes to perform secondary functions, albeit relatively inefficiently, gives clues as to how enzyme function evolves. Substrate promiscuity in enzymes is one example of imperfect specificity in protein-ligand interactions. Similarly, most drugs bind to more than one protein target. This may sometimes result in helpful polypharmacology as a drug modulates plural targets, but also often leads to adverse side-effects. Many cheminformatics approaches can be used to model the interactions between druglike molecules and proteins in silico. We can even use quantum chemical techniques like DFT and QM/MM to compute the structural and energetic course of enzyme catalysed chemical reaction mechanisms, including a full description of bond making and breaking. PMID:23116471

  16. Mediators involved in the immunomodulatory effects of apoptotic cells

    PubMed Central

    Saas, Philippe; Bonnefoy, Francis; Kury-Paulin, Stephanie; Kleinclauss, François M.; Perruche, Sylvain

    2007-01-01

    Immunomodulatory properties are attributed to apoptotic cells. These properties have been used to modulate allogeneic immune responses in experimental transplantation settings. In independent studies, apoptotic cell infusion has been shown to favor hematopoietic cell engraftment, to increase heart graft survival and to delay the lethal onset of graft-versus-host disease (GVHD). The goal of this review was to discuss how apoptotic cell infusion interferes with graft rejection or host rejection (i.e., GVHD) and to focus on the potential mediators or “perpetuators” involved in apoptotic cell-induced immunomodulation. Particular emphasis on apoptotic cell phagocytosis, TGF-β secretion and regulatory T cell induction was performed. Stimulating “naturally” immunosuppressive molecules (i.e., TGF-β) or immunomodulatory cells (“alternatively-activated” macrophages, certain DC subsets or regulatory T cells) in a physiological manner by using apoptotic cell infusion can be a promising way to induce tolerance. PMID:17632410

  17. Mediators involved in the immunomodulatory effects of apoptotic cells.

    PubMed

    Saas, Philippe; Bonnefoy, Francis; Kury-Paulin, Stephanie; Kleinclauss, François; Perruche, Sylvain

    2007-07-15

    Immunomodulatory properties are attributed to apoptotic cells. These properties have been used to modulate allogeneic immune responses in experimental transplantation settings. In independent studies, apoptotic cell infusion has been shown to favor hematopoietic cell engraftment, to increase heart graft survival, and to delay the lethal onset of graft-versus-host disease (GVHD). The goal of this review was to discuss how apoptotic cell infusion interferes with graft rejection or host rejection (i.e., GVHD) and to focus on the potential mediators or "perpetuators" involved in apoptotic cell-induced immunomodulation. Particular emphasis on apoptotic cell phagocytosis, transforming growth factor (TGF)-beta secretion, and regulatory T cell induction was performed. Stimulating "naturally" immunosuppressive molecules (i.e., TGF-beta) or immunomodulatory cells ("alternatively-activated" macrophages, certain dendritic cell subsets, or regulatory T cells) in a physiological manner by using apoptotic cell infusion can be a promising way to induce tolerance.

  18. Apoptotic cell clearance: basic biology and therapeutic potential

    PubMed Central

    Poon, Ivan K. H.; Lucas, Christopher D.

    2014-01-01

    Prompt removal of apoptotic cells by phagocytes is important for maintaining tissue homeostasis. The molecular and cellular events that underpin apoptotic cell recognition and uptake, and the subsequent biological responses are increasingly better defined. The detection and disposal of apoptotic cells generally promote an anti-inflammatory response at the tissue level, as well as immunological tolerance. Consequently, defects in apoptotic cell clearance have been linked with a variety of inflammatory diseases and autoimmunity. Conversely, under certain conditions such as killing tumour cells by specific cell death inducers, the recognition of apoptotic tumour cells can promote an immunogenic response and anti-tumour immunity. Here, we review the current understanding of the complex process of apoptotic cell clearance in physiology and pathology, and discuss how this knowledge could be harnessed for new therapeutic strategies. PMID:24481336

  19. Energy Release, Acceleration, and Escape of Solar Energetic Ions

    NASA Astrophysics Data System (ADS)

    de Nolfo, G. A.; Ireland, J.; Ryan, J. M.; Young, C. A.

    2013-12-01

    Solar flares are prodigious producers of energetic particles, and thus a rich laboratory for studying particle acceleration. The acceleration occurs through the release of magnetic energy, a significant fraction of which can go into the acceleration of particles. Coronal mass ejections (CMEs) certainly produce shocks that both accelerate particles and provide a mechanism for escape into the interplanetary medium (IP). What is less well understood is whether accelerated particles produced from the flare reconnection process escape, and if so, how these same particles are related to solar energetic particles (SEPs) detected in-situ. Energetic electron SEPs have been shown to be correlated with Type III radio bursts, hard X-ray emission, and EUV jets, making a very strong case for the connection between acceleration at the flare and escape along open magnetic field lines. Because there has not been a clear signature of ion escape, as is the case with the Type III radio emission for electrons, sorting out the avenues of escape for accelerated flare ions and the possible origin of the impulsive SEPs continues to be a major challenge. The key to building a clear picture of particle escape relies on the ability to map signatures of escape such as EUV jets at the Sun and to follow the progression of these escape signatures as they evolve in time. Furthermore, nuclear γ-ray emissions provide critical context relating ion acceleration to that of escape. With the advent observations from Fermi as well as RHESSI and the Solar Dynamics Observatory (SDO), the challenge of ion escape from the Sun can now be addressed. We present a preliminary study of the relationship of EUV jets with nuclear γ-ray emission and Type III radio observations and discuss the implications for possible magnetic topologies that allow for ion escape from deep inside the corona to the interplanetary medium.

  20. Phytochemical profile and apoptotic activity of Onopordum cynarocephalum.

    PubMed

    Formisano, Carmen; Rigano, Daniela; Russo, Alessandra; Cardile, Venera; Caggia, Silvia; Apostolides Arnold, Nelly; Mari, Angela; Piacente, Sonia; Rosselli, Sergio; Senatore, Felice; Bruno, Maurizio

    2012-10-01

    A phytochemical investigation of acetone and chloroform extracts of the aerial parts of Onopordum cynarocephalum Boiss. et Blanche was carried out. It led to the isolation of two new sesquiterpenes, the elemane aldehyde (2) and the eudesmane (11), together with 15 known compounds: two lignans (1 and 15) and 13 sesquiterpenes (3-10, 12-14, 16, 17). The structures were elucidated by spectroscopic analyses, especially 1D and 2D NMR spectra. The anti-growth effect against three human melanoma cell lines, M14, A375, and A2058, of the different extracts and compounds of O. cynarocephalum was also investigated. Among them, the chloroform extract exhibited the strongest biological activity, while the most active compounds were the lignan arctigenin (1), and the sesquiterpenes, compounds 3, 5, and 6 belonging to the elemane type, and 7 belonging to the eudesmane type. Our data also demonstrate that acetone and chloroform extracts induce, in the A375 cell line, apoptotic cell death that could be related to an overall action of the compounds present, but in particular to the lignans arctigenin (1) and the sesquiterpenes compounds 3-8 and 16. In fact, these molecules were able to induce a high DNA fragmentation, correlated to a significant increase of the caspase-3 enzyme activity. Furthermore, apoptosis appears to be mediated, at least in part, via PTEN activity and the inhibition of Hsp70 expression.

  1. Ion Channels, Cell Volume, Cell Proliferation and Apoptotic Cell Death

    NASA Astrophysics Data System (ADS)

    Lang, Florian; Gulbins, Erich; Szabo, Ildiko; Vereninov, Alexey; Huber, Stephan M.

    At some stage cell proliferation requires an increase in cell volume and a typical hallmark of apoptotic cell death is cell shrinkage. The respective alterations of cell volume are accomplished by altered regulation of ion transport including ion channels. Thus, cell proliferation and apoptosis are both paralleled by altered activity of ion channels, which play an active part in these fundamental cellular mechanisms. Activation of anion channels allows exit of Cl?, osmolyte and HCO3 ? leading to cell shrinkage and acidification of the cytosol. K+ exit through K+ channels leads to cell shrinkage and a decrease in intracellular K+ concentration. K+ channel activity is further important for maintenance of the cell membrane potential - a critical determinant of Ca2+ entry through Ca2+ channels. Cytosolic Ca2+ may both activate mechanisms required for cell proliferation and stimulate enzymes executing apoptosis. The effect of enhanced cytosolic Ca2+ activity depends on the magnitude and temporal organisation of Ca2+ entry. Moreover, a given ion channel may support both cell proliferation and apoptosis, and specific ion channel blockers may abrogate both fundamental cellular mechanisms, depending on cell type, regulatory environment and condition of the cell. Clearly, further experimental effort is needed to clarify the role of ion channels in the regulation of cell proliferation and apoptosis.

  2. Marine enzymes.

    PubMed

    Debashish, Ghosh; Malay, Saha; Barindra, Sana; Joydeep, Mukherjee

    2005-01-01

    Marine enzyme biotechnology can offer novel biocatalysts with properties like high salt tolerance, hyperthermostability, barophilicity, cold adaptivity, and ease in large-scale cultivation. This review deals with the research and development work done on the occurrence, molecular biology, and bioprocessing of marine enzymes during the last decade. Exotic locations have been accessed for the search of novel enzymes. Scientists have isolated proteases and carbohydrases from deep sea hydrothermal vents. Cold active metabolic enzymes from psychrophilic marine microorganisms have received considerable research attention. Marine symbiont microorganisms growing in association with animals and plants were shown to produce enzymes of commercial interest. Microorganisms isolated from sediment and seawater have been the most widely studied, proteases, carbohydrases, and peroxidases being noteworthy. Enzymes from marine animals and plants were primarily studied for their metabolic roles, though proteases and peroxidases have found industrial applications. Novel techniques in molecular biology applied to assess the diversity of chitinases, nitrate, nitrite, ammonia-metabolizing, and pollutant-degrading enzymes are discussed. Genes encoding chitinases, proteases, and carbohydrases from microbial and animal sources have been cloned and characterized. Research on the bioprocessing of marine-derived enzymes, however, has been scanty, focusing mainly on the application of solid-state fermentation to the production of enzymes from microbial sources.

  3. Escape behaviour in the stomatopod crustacean Squilla mantis, and the evolution of the caridoid escape reaction.

    PubMed

    Heitler, W J; Fraser, K; Ferrero, E A

    2000-01-01

    The mantis shrimp Squilla mantis shows a graded series of avoidance/escape responses to visual and mechanical (vibration and touch) rostral stimuli. A low-threshold response is mediated by the simultaneous protraction of the thoracic walking legs and abdominal swimmerets and telson, producing a backwards 'lurch' or jump that can displace the animal by up to one-third of its body length, but leaves it facing in the same direction. A stronger response starts with similar limb protraction, but is followed by partial abdominal flexion. The maximal response also consists of limb protraction followed by abdominal flexion, but in this case the abdominal flexion is sufficiently vigorous to pull the animal into a tight vertical loop, which leaves it inverted and facing away from the stimulus. The animal then swims forward (away from the stimulus) and rights itself by executing a half-roll. A bilaterally paired, large-diameter, rapidly conducting axon in the dorsal region of the ventral nerve excites swimmeret protractor motoneurons in several ganglia and is likely to be the driver neuron for the limb-protraction response. The same neuron also excites unidentified abdominal trunk motoneurons, but less reliably. The escape response is a key feature of the malacostracan caridoid facies, and we provide the first detailed description of this response in a group that diverged early in malacostracan evolution. We show that the components of the escape response contrast strongly with those of the full caridoid reaction, and we provide physiological and behavioural evidence for the biological plausibility of a limb-before-tail thesis for the evolution of the escape response.

  4. 7. VIEW OF ESCAPE TRAINING TANK, LOOKING UP SOUTH SIDE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    7. VIEW OF ESCAPE TRAINING TANK, LOOKING UP SOUTH SIDE FROM 50-FOOT PASSAGEWAY, SHOWING 25-FOOT BLISTER AT LEFT, 18-FOOT PASSAGEWAY AND PLATFORM AT RIGHT - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  5. 22. VIEW OF ESCAPE TRAINING TANK, LOOKING WEST FROM EAST ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    22. VIEW OF ESCAPE TRAINING TANK, LOOKING WEST FROM EAST SIDE OF CUPOLA TOWARD ELEVATOR. TWO-LOCK RECOMPRESSION CHAMBER AT REAR - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  6. 29. VIEW OF SUBMARINE ESCAPE TRAINING TANK DURING CONSTRUCTION AT ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    29. VIEW OF SUBMARINE ESCAPE TRAINING TANK DURING CONSTRUCTION AT POINT JUST ABOVE THE SUBMARINE SECTION AT THE 110-FOOT LEVEL 1929-1930 - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  7. 36. VIEW OF CUPOLA, SUBMARINE ESCAPE TRAINING TANK, SHOWING ROVING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    36. VIEW OF CUPOLA, SUBMARINE ESCAPE TRAINING TANK, SHOWING ROVING RESCUE BELL SUSPENDED ABOVE TANK, WITH TWO-LOCK RECOMPRESSION CHAMBER AT REAR, LOOKING WEST. Photo taken after installation of recompression chamber in 1956. - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  8. 35. INTERIOR VIEW OF EQUIPMENT HOUSE, SUBMARINE ESCAPE TRAINING TANK, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    35. INTERIOR VIEW OF EQUIPMENT HOUSE, SUBMARINE ESCAPE TRAINING TANK, PRIOR TO ENLARGEMENT OF ROOM AND INSTALLATION OF TRIPLE-LOCK RECOMPRESSION CHAMBER IN 1957 - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  9. 31. VIEW OF SUBMARINE ESCAPE TRAINING TANK DURING CONSTRUCTION OF ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    31. VIEW OF SUBMARINE ESCAPE TRAINING TANK DURING CONSTRUCTION OF THE ELEVATOR AND PASSAGEWAYS TO THE 18- AND 50-FOOT LOCKS AND CUPOLA 1932 - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  10. 46 CFR 116.500 - Means of escape.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... this section, each space accessible to passengers or used by the crew on a regular basis, must have at... escape must be widely separated and, if possible, at opposite ends or sides of the space to minimize the... windows. (d) The number and dimensions of the means of escape from each space must be sufficient for rapid...

  11. 46 CFR 177.500 - Means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... this section, each space accessible to passengers or used by the crew on a regular basis, must have at... escape must be widely separated and, if possible, at opposite ends or sides of the space to minimize the... windows. (d) The number and dimensions of the means of escape from each space must be sufficient for rapid...

  12. 46 CFR 116.500 - Means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... this section, each space accessible to passengers or used by the crew on a regular basis, must have at... escape must be widely separated and, if possible, at opposite ends or sides of the space to minimize the... windows. (d) The number and dimensions of the means of escape from each space must be sufficient for rapid...

  13. 46 CFR 177.500 - Means of escape.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... this section, each space accessible to passengers or used by the crew on a regular basis, must have at... escape must be widely separated and, if possible, at opposite ends or sides of the space to minimize the... windows. (d) The number and dimensions of the means of escape from each space must be sufficient for rapid...

  14. 46 CFR 177.500 - Means of escape.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... this section, each space accessible to passengers or used by the crew on a regular basis, must have at... escape must be widely separated and, if possible, at opposite ends or sides of the space to minimize the... windows. (d) The number and dimensions of the means of escape from each space must be sufficient for rapid...

  15. 46 CFR 116.500 - Means of escape.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... this section, each space accessible to passengers or used by the crew on a regular basis, must have at... escape must be widely separated and, if possible, at opposite ends or sides of the space to minimize the... windows. (d) The number and dimensions of the means of escape from each space must be sufficient for rapid...

  16. The Origins and Underpinning Principles of E-Scape

    ERIC Educational Resources Information Center

    Kimbell, Richard

    2012-01-01

    In this article I describe the context within which we developed project e-scape and the early work that laid the foundations of the project. E-scape (e-solutions for creative assessment in portfolio environments) is centred on two innovations. The first concerns a web-based approach to portfolio building; allowing learners to build their…

  17. 33 CFR 143.101 - Means of escape.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Means of escape. 143.101 Section 143.101 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OUTER CONTINENTAL SHELF ACTIVITIES DESIGN AND EQUIPMENT OCS Facilities § 143.101 Means of escape. (a) “Primary...

  18. Teachers Offering Healthy Escape Options for Teenagers in Pain

    ERIC Educational Resources Information Center

    Kaywell, Joan F.

    2005-01-01

    "[T]wenty-five percent of today's teenagers have inordinate emotional baggage beyond the normal angst of adolescence." This burden can lead to unhealthy escapes, including substance abuse, sexual activity, violence, eating disorders, and suicide. One healthy escape, however, lies in books, where students can read about teenagers living in painful…

  19. Green Pea Galaxies Reveal Secrets of Lyα Escape

    NASA Astrophysics Data System (ADS)

    Yang, Huan; Malhotra, Sangeeta; Gronke, Max; Rhoads, James E.; Dijkstra, Mark; Jaskot, Anne; Zheng, Zhenya; Wang, Junxian

    2016-04-01

    We analyze archival Lyα spectra of 12 “Green Pea” galaxies observed with the Hubble Space Telescope, model their Lyα profiles with radiative transfer models, and explore the dependence of the Lyα escape fraction on various properties. Green Pea galaxies are nearby compact starburst galaxies with [O iii] λ5007 equivalent widths (EWs) of hundreds of Å. All 12 Green Pea galaxies in our sample show Lyα lines in emission, with an Lyα EW distribution similar to high-redshift Lyα emitters. Combining the optical and UV spectra of Green Pea galaxies, we estimate their Lyα escape fractions and find correlations between Lyα escape fraction and kinematic features of Lyα profiles. The escape fraction of Lyα in these galaxies ranges from 1.4% to 67%. We also find that the Lyα escape fraction depends strongly on metallicity and moderately on dust extinction. We compare their high-quality Lyα profiles with single H i shell radiative transfer models and find that the Lyα escape fraction anticorrelates with the derived H i column densities. Single-shell models fit most Lyα profiles well, but not the ones with the highest escape fractions of Lyα. Our results suggest that low H i column density and low metallicity are essential for Lyα escape and make a galaxy an Lyα emitter.

  20. How many ions have escaped the Martian atmosphere?

    NASA Astrophysics Data System (ADS)

    Brain, David; McFadden, James; Halekas, Jasper; Connerney, J. E. P.; Eparvier, Frank; Mitchell, David; Bougher, Stephen W.; Bowers, Charlie; Curry, Shannon; Dong, Chuanfei; Dong, Yaxue; Egan, Hilary; Fang, Xiaohua; Harada, Yuki; Jakosky, Bruce; Lillis, Robert; Luhmann, Janet; Ma, Yingjuan; Modolo, Ronan; Weber, Tristan

    2016-10-01

    The Mars Atmosphere and Volatile EvolutioN (MAVEN) mission has been making science measurements of the Martian upper atmosphere and its escape to space since November 2014. A key part of this effort is the measurement of the escape rates of charged particles (ions) at present and over solar system history. The lack of a global dynamo magnetic field at Mars leaves its upper atmosphere more directly exposed to the impinging solar wind than magnetized planets such as Earth. For this reason it is thought that ion escape at Mars may have played a significant role in long term climate change. MAVEN measures escaping planetary ions directly, with high energy, mass, and time resolution.With nearly two years of observations in hand, we will report the average ion escape rate and the spatial distribution of escaping ions as measured by MAVEN and place them in context with previous measurements of ion loss by other spacecraft (e.g. Phobos 2 and Mars Express). We will then report on the measured variability in ion escape rates with different drivers (e.g. solar EUV, solar wind pressure, etc.). Finally, we will use these results to provide an initial estimate of the total ion escape from Mars over billions of years.

  1. The Origins and Underpinning Principles of E-Scape

    ERIC Educational Resources Information Center

    Kimbell, Richard

    2012-01-01

    In this article I describe the context within which we developed project e-scape and the early work that laid the foundations of the project. E-scape (e-solutions for creative assessment in portfolio environments) is centred on two innovations. The first concerns a web-based approach to portfolio building; allowing learners to build their…

  2. 46 CFR 169.313 - Means of escape.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... a hold-back to hold the scuttle in an open position. (e) The required means of escape must not have... escape is acceptable provided that— (1) There is no source of fire in the space, such as a galley stove... back of the ladder; and (4) Except when unavoidable obstructions are encountered, there must be...

  3. Escape for the Slow Solar Wind

    NASA Astrophysics Data System (ADS)

    Kohler, Susanna

    2017-05-01

    Plasma from the Sun known as the slow solar wind has been observed far away from where scientists thought it was produced. Now new simulations may have resolved the puzzle of where the slow solar wind comes from and how it escapes the Sun to travel through our solar system.An Origin PuzzleA full view of a coronal hole (dark portion) from SDO. The edges of the coronal hole mark the boundary between open and closed magnetic field lines. [SDO; adapted from Higginson et al. 2017]The Suns atmosphere, known as the corona, is divided into two types of regions based on the behavior of magnetic field lines. In closed-field regions, the magnetic field is firmly anchored in the photosphere at both ends of field lines, so traveling plasma is confined to coronal loops and must return to the Suns surface. In open-field regions, only one end of each magnetic field line is anchored in the photosphere, so plasma is able to stream from the Suns surface out into the solar system.This second type of region known as a coronal hole is thought to be the origin of fast-moving plasma measured in our solar system and known as the fast solar wind. But we also observe a slow solar wind: plasma that moves at speeds of less than 500 km/s.The slow solar wind presents a conundrum. Its observational properties strongly suggest it originates in the hot, closed corona rather than the cooler, open regions. But if the slow solar wind plasma originates in closed-field regions of the Suns atmosphere, then how does it escape from the Sun?Slow Wind from Closed FieldsA team of scientists led by Aleida Higginson (University of Michigan) has now used high-resolution, three-dimensional magnetohydrodynamic simulations to show how the slow solar wind can be generated from plasma that starts outin closed-field parts of the Sun.A simulated heliospheric arc, composed of open magnetic field lines. [Higginson et al. 2017]Motions on the Suns surface near the boundary between open and closed-field regions the boundary

  4. Complete mapping of viral escape from neutralizing antibodies

    PubMed Central

    Hensley, Scott E.

    2017-01-01

    Identifying viral mutations that confer escape from antibodies is crucial for understanding the interplay between immunity and viral evolution. We describe a high-throughput approach to quantify the selection that monoclonal antibodies exert on all single amino-acid mutations to a viral protein. This approach, mutational antigenic profiling, involves creating all replication-competent protein variants of a virus, selecting with antibody, and using deep sequencing to identify enriched mutations. We use mutational antigenic profiling to comprehensively identify mutations that enable influenza virus to escape four monoclonal antibodies targeting hemagglutinin, and validate key findings with neutralization assays. We find remarkable mutation-level idiosyncrasy in antibody escape: for instance, at a single residue targeted by two antibodies, some mutations escape both antibodies while other mutations escape only one or the other. Because mutational antigenic profiling rapidly maps all mutations selected by an antibody, it is useful for elucidating immune specificities and interpreting the antigenic consequences of viral genetic variation. PMID:28288189

  5. Split-second escape decisions in blue tits (Parus caeruleus)

    NASA Astrophysics Data System (ADS)

    Lind, Johan; Kaby, Ulrika; Jakobsson, Sven

    2002-07-01

    Bird mortality is heavily affected by birds of prey. Under attack, take-off is crucial for survival and even minor mistakes in initial escape response can have devastating consequences. Birds may respond differently depending on the character of the predator's attack and these split-second decisions were studied using a model merlin (Falco columbarius) that attacked feeding blue tits (Parus caeruleus) from two different attack angles in two different speeds. When attacked from a low attack angle they took off more steeply than when attacked from a high angle. This is the first study to show that escape behaviour also depends on predator attack speed. The blue tits responded to a high-speed attack by dodging sideways more often than when attacked at a low speed. Escape speed was not significantly affected by the different treatments. Although they have only a split-second before escaping an attack, blue tits do adjust their escape strategy to the prevailing attack conditions.

  6. Escape rate scaling in infinite measure preserving systems

    NASA Astrophysics Data System (ADS)

    Munday, Sara; Knight, Georgie

    2016-02-01

    We investigate the scaling of the escape rate from piecewise linear dynamical systems displaying intermittency due to the presence of an indifferent fixed point. Strong intermittent behaviour in the dynamics can result in the system preserving an infinite measure. We define a neighbourhood of the indifferent fixed point to be a hole through which points escape and investigate the scaling of the rate of this escape as the length of the hole decreases, both in the finite measure preserving case and infinite measure preserving case. In the infinite measure preserving systems we observe logarithmic corrections to and polynomial scaling of the escape rate with hole length. Finally we conjecture a relationship between the wandering rate and the observed scaling of the escape rate.

  7. Split-second escape decisions in blue tits (Parus caeruleus).

    PubMed

    Lind, Johan; Kaby, Ulrika; Jakobsson, Sven

    2002-09-01

    Bird mortality is heavily affected by birds of prey. Under attack, take-off is crucial for survival and even minor mistakes in initial escape response can have devastating consequences. Birds may respond differently depending on the character of the predator's attack and these split-second decisions were studied using a model merlin (Falco columbarius) that attacked feeding blue tits (Parus caeruleus) from two different attack angles in two different speeds. When attacked from a low attack angle they took off more steeply than when attacked from a high angle. This is the first study to show that escape behaviour also depends on predator attack speed. The blue tits responded to a high-speed attack by dodging sideways more often than when attacked at a low speed. Escape speed was not significantly affected by the different treatments. Although they have only a split-second before escaping an attack, blue tits do adjust their escape strategy to the prevailing attack conditions.

  8. Innate recognition of apoptotic cells: novel apoptotic cell-associated molecular patterns revealed by crossreactivity of anti-LPS antibodies.

    PubMed

    Tennant, I; Pound, J D; Marr, L A; Willems, J J L P; Petrova, S; Ford, C A; Paterson, M; Devitt, A; Gregory, C D

    2013-05-01

    Cells dying by apoptosis are normally cleared by phagocytes through mechanisms that can suppress inflammation and immunity. Molecules of the innate immune system, the pattern recognition receptors (PRRs), are able to interact not only with conserved structures on microbes (pathogen-associated molecular patterns, PAMPs) but also with ligands displayed by apoptotic cells. We reasoned that PRRs might therefore interact with structures on apoptotic cells - apoptotic cell-associated molecular patterns (ACAMPs) - that are analogous to PAMPs. Here we show that certain monoclonal antibodies raised against the prototypic PAMP, lipopolysaccharide (LPS), can crossreact with apoptotic cells. We demonstrate that one such antibody interacts with a constitutively expressed intracellular protein, laminin-binding protein, which translocates to the cell surface during apoptosis and can interact with cells expressing the prototypic PRR, mCD14 as well as with CD14-negative cells. Anti-LPS cross reactive epitopes on apoptotic cells colocalised with annexin V- and C1q-binding sites on vesicular regions of apoptotic cell surfaces and were released associated with apoptotic cell-derived microvesicles (MVs). These results confirm that apoptotic cells and microbes can interact with the immune system through common elements and suggest that anti-PAMP antibodies could be used strategically to characterise novel ACAMPs associated not only with apoptotic cells but also with derived MVs.

  9. Circulating IgM Requires Plasma Membrane Disruption to Bind Apoptotic and Non-Apoptotic Nucleated Cells and Erythrocytes.

    PubMed

    Hesketh, Emily E; Dransfield, Ian; Kluth, David C; Hughes, Jeremy

    2015-01-01

    Autoimmunity is associated with defective phagocytic clearance of apoptotic cells. IgM deficient mice exhibit an autoimmune phenotype consistent with a role for circulating IgM antibodies in apoptotic cell clearance. We have extensively characterised IgM binding to non-apoptotic and apoptotic mouse thymocytes and human Jurkat cells using flow cytometry, confocal imaging and electron microscopy. We demonstrate strong specific IgM binding to a subset of Annexin-V (AnnV)+PI (Propidium Iodide)+ apoptotic cells with disrupted cell membranes. Electron microscopy studies indicated that IgM+AnnV+PI+ apoptotic cells exhibited morphologically advanced apoptosis with marked plasma membrane disruption compared to IgM-AnnV+PI+ apoptotic cells, suggesting that access to intracellular epitopes is required for IgM to bind. Strong and comparable binding of IgM to permeabilised non-apoptotic and apoptotic cells suggests that IgM bound epitopes are 'apoptosis independent' such that IgM may bind any cell with profound disruption of cell plasma membrane integrity. In addition, permeabilised erythrocytes exhibited significant IgM binding thus supporting the importance of cell membrane epitopes. These data suggest that IgM may recognize and tag damaged nucleated cells or erythrocytes that exhibit significant cell membrane disruption. The role of IgM in vivo in conditions characterized by severe cell damage such as ischemic injury, sepsis and thrombotic microangiopathies merits further exploration.

  10. Understanding Enzymes.

    ERIC Educational Resources Information Center

    Sinnott, M. L.

    1979-01-01

    Describes the way enzymes operate through reaction energetics, and explains that most of the catalytic power of enzymes lies in the strong noncovalent forces responsible for initial binding of substrate, which are only manifested at the transition state of the reaction. (Author/GA)

  11. Enzymes, Industrial

    USDA-ARS?s Scientific Manuscript database

    Enzymes serve key roles in numerous biotechnology processes and products that are commonly encountered in the forms of food and beverages, cleaning supplies, clothing, paper products, transportation fuels, pharmaceuticals, and monitoring devices. Enzymes can display regio- and stereo-specificity, p...

  12. Sensitization of the Tritonia escape swim.

    PubMed

    Frost, W N; Brandon, C L; Mongeluzi, D L

    1998-03-01

    When repeatedly elicited, the oscillatory escape swim of the marine mollusc Tritonia diomedea undergoes habituation of the number of cycles per swim. Previous work has shown that this habituation is accompanied by sensitization of another feature of the behavior: latency to swim onset. Here we focused on the behavioral features of sensitization itself. Test swims elicited 5 min after a strong sensitizing head stimulus differed in several ways from control swims: sensitized animals had shorter latencies for gill and rhinophore withdrawal, a shorter latency for swim onset, a lower threshold for swim initiation, and an increased number of cycles per swim. Sensitized animals did not, however, swim any faster (no change in cycle period). A separate experiment found that swim onset latency also sensitized when Tritonia came into contact with one of their natural predators, the seastar Pycnopodia helianthoides, demonstrating the ecological relevance of this form of nonassociative learning. These results define the set of behavioral changes to be explained by cellular studies of sensitization in Tritonia.

  13. WANDERING STARS: AN ORIGIN OF ESCAPED POPULATIONS

    SciTech Connect

    Teyssier, Maureen; Johnston, Kathryn V.; Shara, Michael M.

    2009-12-10

    We demonstrate that stars beyond the virial radii of galaxies may be generated by the gravitational impulse received by a satellite as it passes through the pericenter of its orbit around its parent. These stars may become energetically unbound (escaped stars), or may travel to further than a few virial radii for longer than a few Gyr, but still remain energetically bound to the system (wandering stars). Larger satellites (10%-100% the mass of the parent), and satellites on more radial orbits are responsible for the majority of this ejected population. Wandering stars could be observable on Mpc scales via classical novae, and on 100 Mpc scales via Type Ia supernova. The existence of such stars would imply a corresponding population of barely bound, old, high-velocity stars orbiting the Milky Way, generated by the same physical mechanism during the Galaxy's formation epoch. Sizes and properties of these combined populations should place some constraints on the orbits and masses of the progenitor objects from which they came, providing insight into the merging histories of galaxies in general and the Milky Way in particular.

  14. Escaping the resource curse in China.

    PubMed

    Cao, Shixiong; Li, Shurong; Ma, Hua; Sun, Yutong

    2015-02-01

    Many societies face an income gap between rich regions with access to advanced technology and regions that are rich in natural resources but poorer in technology. This "resource curse" can lead to a Kuznets trap, in which economic inequalities between the rich and the poor increase during the process of socioeconomic development. This can also lead to depletion of natural resources, environmental degradation, social instability, and declining socioeconomic development. These problems will jeopardize China's achievements if the current path continues to be pursued without intervention by the government to solve the problems. To mitigate the socioeconomic development gap between western and eastern China, the government implemented its Western Development Program in 2000. However, recent data suggest that this program has instead worsened the resource curse. Because each region has its own unique strengths and weaknesses, China must escape the resource curse by accounting for this difference; in western China, this can be done by improving education, promoting high-tech industry, adjusting its economic strategy to balance regional development, and seeking more sustainable approaches to socioeconomic development.

  15. Immune Escape Strategies of Malaria Parasites

    PubMed Central

    Gomes, Pollyanna S.; Bhardwaj, Jyoti; Rivera-Correa, Juan; Freire-De-Lima, Celio G.; Morrot, Alexandre

    2016-01-01

    Malaria is one of the most life-threatening infectious diseases worldwide. Immunity to malaria is slow and short-lived despite the repeated parasite exposure in endemic areas. Malaria parasites have evolved refined machinery to evade the immune system based on a range of genetic changes that include allelic variation, biomolecular exposure of proteins, and intracellular replication. All of these features increase the probability of survival in both mosquitoes and the vertebrate host. Plasmodium species escape from the first immunological trap in its invertebrate vector host, the Anopheles mosquitoes. The parasites have to pass through various immunological barriers within the mosquito such as anti-microbial molecules and the mosquito microbiota in order to achieve successful transmission to the vertebrate host. Within these hosts, Plasmodium species employ various immune evasion strategies during different life cycle stages. Parasite persistence against the vertebrate immune response depends on the balance among virulence factors, pathology, metabolic cost of the host immune response, and the parasites ability to evade the immune response. In this review we discuss the strategies that Plasmodium parasites use to avoid the vertebrate host immune system and how they promote successful infection and transmission. PMID:27799922

  16. Immune Escape Strategies of Malaria Parasites.

    PubMed

    Gomes, Pollyanna S; Bhardwaj, Jyoti; Rivera-Correa, Juan; Freire-De-Lima, Celio G; Morrot, Alexandre

    2016-01-01

    Malaria is one of the most life-threatening infectious diseases worldwide. Immunity to malaria is slow and short-lived despite the repeated parasite exposure in endemic areas. Malaria parasites have evolved refined machinery to evade the immune system based on a range of genetic changes that include allelic variation, biomolecular exposure of proteins, and intracellular replication. All of these features increase the probability of survival in both mosquitoes and the vertebrate host. Plasmodium species escape from the first immunological trap in its invertebrate vector host, the Anopheles mosquitoes. The parasites have to pass through various immunological barriers within the mosquito such as anti-microbial molecules and the mosquito microbiota in order to achieve successful transmission to the vertebrate host. Within these hosts, Plasmodium species employ various immune evasion strategies during different life cycle stages. Parasite persistence against the vertebrate immune response depends on the balance among virulence factors, pathology, metabolic cost of the host immune response, and the parasites ability to evade the immune response. In this review we discuss the strategies that Plasmodium parasites use to avoid the vertebrate host immune system and how they promote successful infection and transmission.

  17. Vascular endothelial growth factor enhances macrophage clearance of apoptotic cells

    PubMed Central

    Dalal, Samay; Horstmann, Sarah A.; Richens, Tiffany R.; Tanaka, Takeshi; Doe, Jenna M.; Boe, Darren M.; Voelkel, Norbert F.; Taraseviciene-Stewart, Laimute; Janssen, William J.; Lee, Chun G.; Elias, Jack A.; Bratton, Donna; Tuder, Rubin M.; Henson, Peter M.; Vandivier, R. William

    2012-01-01

    Efficient clearance of apoptotic cells from the lung by alveolar macrophages is important for the maintenance of tissue structure and function. Lung tissue from humans with emphysema contains increased numbers of apoptotic cells and decreased levels of vascular endothelial growth factor (VEGF). Mice treated with VEGF receptor inhibitors have increased numbers of apoptotic cells and develop emphysema. We hypothesized that VEGF regulates apoptotic cell clearance by alveolar macrophages (AM) via its interaction with VEGF receptor 1 (VEGF R1). Our data show that the uptake of apoptotic cells by murine AMs and human monocyte-derived macrophages is inhibited by depletion of VEGF and that VEGF activates Rac1. Antibody blockade or pharmacological inhibition of VEGF R1 activity also decreased apoptotic cell uptake ex vivo. Conversely, overexpression of VEGF significantly enhanced apoptotic cell uptake by AMs in vivo. These results indicate that VEGF serves a positive regulatory role via its interaction with VEGF R1 to activate Rac1 and enhance AM apoptotic cell clearance. PMID:22307908

  18. Dications and thermal ions in planetary atmospheric escape

    NASA Astrophysics Data System (ADS)

    Lilensten, J.; Simon Wedlund, C.; Barthélémy, M.; Thissen, R.; Ehrenreich, D.; Gronoff, G.; Witasse, O.

    2013-01-01

    In the recent years, the presence of dications in the atmospheres of Mars, Venus, Earth and Titan has been modeled and assessed. These studies also suggested that these ions could participate to the escape of the planetary atmospheres because a large fraction of them is unstable and highly energetic. When they dissociate, their internal energy is transformed into kinetic energy which may be larger than the escape energy. The goal of this study is to assess the impact of the doubly-charged ions in the escape of CO2-dominated planetary atmospheres and to compare it to the escape of thermal photo-ions. We solve a Boltzmann transport equation at daytime taking into account the dissociative states of CO2++ for a simplified single constituent atmosphere of a case-study planet. We compute the escape of fast ions using a Beer-Lambert approach. We study three test-cases. On a Mars-analog planet in today's conditions, we retrieve the measured electron escape flux. When comparing the two mechanisms (i.e. excluding solar wind effects, sputtering, etc.), the escape due to the fast ions issuing from the dissociation of dications may account for up to 6% of the total and the escape of thermal ions for the remaining. We show that these two mechanisms cannot explain the escape of the atmosphere since the magnetic field vanished and even contribute only marginally to this loss. We show that with these two mechanisms, the atmosphere of a Mars analog planet would empty in another giga years and a half. At Venus orbit, the contribution of the dications in the escape rate is negligible. When simulating the hot Jupiter HD 209458 b, the two processes cannot explain the measured escape flux of C+. This study shows that the dications may constitute a source of the escape of planetary atmospheres which had not been taken into account until now. This source, although marginal, is not negligible. The influence of the photoionization is of course large, but cannot explain alone the loss of Mars

  19. Anti-tissue transglutaminase antibody inhibits apoptotic cell clearance by macrophages in pregnant NOD mice.

    PubMed

    Sóñora, Cecilia; Mourglia-Ettlin, Gustavo; Calo, Guillermina; Hauk, Vanesa; Ramhorst, Rosanna; Hernández, Ana; Leirós, Claudia Pérez

    2014-06-01

    Autoimmunity is a feature of celiac disease (CD) with tissue transglutaminase (tTG) as a major autoantigen. A correlation between gynecological-obstetric disorders in CD patients and the presence of circulating antibodies anti-tTG that inhibited tTG activity was reported. Serum anti-tTG antibodies were detected in a non-obese diabetic (NOD) mouse model of type I insulin-dependent diabetes mellitus and Sjögren's syndrome, two comorbid states with CD. Since pregnancy complications have been described in NOD mice, we evaluated the ability of anti-tTG antibodies to affect the functions of tTG relevant to the normal course of an early pregnancy like extracellular matrix assembling and apoptotic cell phagocytosis by macrophages. Circulating IgG antibodies against tTG were detected in NOD mice with titers that decreased at early pregnancy; interestingly, the in vitro transamidating activity of tTG was reduced by NOD serum samples. Particularly, anti-tTG antibody inhibited apoptotic cell phagocytosis by peritoneal macrophages from pregnant NOD mice that express the enzyme on surface. Evidence provided support for a role for anti-tTG antibodies through reduced transamidating activity and reduced apoptotic cell clearance by the macrophages of pregnant NOD mice.

  20. Modelling the evolution and spread of HIV immune escape mutants.

    PubMed

    Fryer, Helen R; Frater, John; Duda, Anna; Roberts, Mick G; Phillips, Rodney E; McLean, Angela R

    2010-11-18

    During infection with human immunodeficiency virus (HIV), immune pressure from cytotoxic T-lymphocytes (CTLs) selects for viral mutants that confer escape from CTL recognition. These escape variants can be transmitted between individuals where, depending upon their cost to viral fitness and the CTL responses made by the recipient, they may revert. The rates of within-host evolution and their concordant impact upon the rate of spread of escape mutants at the population level are uncertain. Here we present a mathematical model of within-host evolution of escape mutants, transmission of these variants between hosts and subsequent reversion in new hosts. The model is an extension of the well-known SI model of disease transmission and includes three further parameters that describe host immunogenetic heterogeneity and rates of within host viral evolution. We use the model to explain why some escape mutants appear to have stable prevalence whilst others are spreading through the population. Further, we use it to compare diverse datasets on CTL escape, highlighting where different sources agree or disagree on within-host evolutionary rates. The several dozen CTL epitopes we survey from HIV-1 gag, RT and nef reveal a relatively sedate rate of evolution with average rates of escape measured in years and reversion in decades. For many epitopes in HIV, occasional rapid within-host evolution is not reflected in fast evolution at the population level.

  1. The Impacts of Orbital Distance on Exoplanetary Atmospheric Escape

    NASA Astrophysics Data System (ADS)

    Yang, M.; Guo, J. H.

    2016-11-01

    Driven by the high energy radiation of host stars, atmospheric escape is very important for planet evolution. While the flux drops dramatically with the increase of orbital distance, it is essential to study the impacts of orbital distance on atmospheric escape. We consider the hydrodynamic escape of exoplanets driven by the XUV (X-ray and extreme-ultraviolet) radiation of their host stars. We aim to study the mass-loss rate, the transition of escape mechanism, the structures of temperature and velocity, based on a one-dimensional hydrodynamic model which includes radiative transfer processes and photochemical reactions. As the stellar XUV emission varies with the stellar evolution, we use XSPEC (X-Ray Spectral Fitting Package) to construct the XUV spectra of solar-type stars at different ages. We find that with the increase of orbital distance, the mass-loss rates drop significantly, and when the stellar XUV flux is too small to preserve the hydrodynamic escape, it will turn to Jeans escape. This transition occurs in larger distance for younger and smaller planets. For young planets, hydrodynamic escape can occur in 1-2 au. For very young and close-in planets, the relation between mass-loss rate and stellar flux is not as significant as planets that are not close to their host stars, and the energy-limited equation can lead to large overestimate.

  2. A new paradigm for evaluating avoidance/escape motivation.

    PubMed

    Tsutsui-Kimura, Iku; Bouchekioua, Youcef; Mimura, Masaru; Tanaka, Kenji F

    2017-05-06

    Organisms have evolved to approach pleasurable opportunities and to avoid or escape from aversive experiences. These two distinct motivations are referred to as approach and avoidance/escape motivations and are both considered vital for survival. Despite several recent advances in understanding the neurobiology of motivation, most studies addressed approach but not avoidance/escape motivation. Here we develop a new experimental paradigm to quantify avoidance/escape motivation and examine the pharmacological validity. We set up an avoidance variable ratio 5 (VR-5) task in which mice were required to press a lever for variable times to avoid an upcoming aversive stimulus (foot shock) or to escape the ongoing aversive event if mice failed to avoid it. We intraperitoneally injected ketamine (0, 1, or 5 mg/kg) or buspirone (0, 5, or 10 mg/kg) 20 or 30 minutes before the behavioral task in order to see if ketamine enhanced avoidance/escape behavior and buspirone diminished it as previously reported. We found that the performance on the avoidance VR-5 task was sensitive to the intensity of the aversive stimulus. Treatment with ketamine increased, while that with buspirone decreased, the probability of avoidance from an aversive stimulus in the VR-5 task, being consistent with previous reports. Our new paradigm will prove usefulness for quantifying avoidance/escape motivation and will contribute to a more comprehensive understanding of motivation.

  3. Evolutionary escape on complex genotype-phenotype networks.

    PubMed

    Ibáñez-Marcelo, Esther; Alarcón, Tomás

    2016-04-07

    We study the problem of evolutionary escape that is the process whereby a population under sudden changes in the selective pressures acting upon it try to evade extinction by evolving from previously well-adapted phenotypes to those that are favoured by the new selective pressure. We perform a comparative analysis between results obtained by modelling genotype space as a regular hypercube (H-graphs), which is the scenario considered in previous work on the subject, to those corresponding to a complex genotype-phenotype network (B-graphs). In order to analyse the properties of the escape process on both these graphs, we apply a general theory based on multi-type branching processes to compute the evolutionary dynamics and probability of escape. We show that the distribution of distances between phenotypes in B-graphs exhibits a much larger degree of heterogeneity than in H-graphs. This property, one of the main structural differences between both types of graphs, causes heterogeneous behaviour in all results associated to the escape problem. We further show that, due to the heterogeneity characterising escape on B-graphs, escape probability can be underestimated by assuming a regular hypercube genotype network, even if we compare phenotypes at the same distance in H-graphs. Similarly, it appears that the complex structure of B-graphs slows down the rate of escape. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Lyman-Werner UV escape fractions from primordial haloes

    NASA Astrophysics Data System (ADS)

    Schauer, Anna T. P.; Whalen, Daniel J.; Glover, Simon C. O.; Klessen, Ralf S.

    2015-12-01

    Population III (Pop III) stars can regulate star formation in the primordial Universe in several ways. They can ionize nearby haloes, and even if their ionizing photons are trapped by their own haloes, their Lyman-Werner (LW) photons can still escape and destroy H2 in other haloes, preventing them from cooling and forming stars. LW escape fractions are thus a key parameter in cosmological simulations of early reionization and star formation but have not yet been parametrized for realistic haloes by halo or stellar mass. To do so, we perform radiation hydrodynamical simulations of LW UV escape from 9-120 M⊙ Pop III stars in 105-107 M⊙ haloes with ZEUS-MP. We find that photons in the LW lines (i.e. those responsible for destroying H2 in nearby systems) have escape fractions ranging from 0 to 85 per cent. No LW photons escape the most massive halo in our sample, even from the most massive star. Escape fractions for photons elsewhere in the 11.18-13.6 eV energy range, which can be redshifted into the LW lines at cosmological distances, are generally much higher, being above 60 per cent for all but the least massive stars in the most massive haloes. We find that shielding of H2 by neutral hydrogen, which has been neglected in most studies to date, produces escape fractions that are up to a factor of 3 smaller than those predicted by H2 self-shielding alone.

  5. Efficiently estimating salmon escapement uncertainty using systematically sampled data

    USGS Publications Warehouse

    Reynolds, Joel H.; Woody, Carol Ann; Gove, Nancy E.; Fair, Lowell F.

    2007-01-01

    Fish escapement is generally monitored using nonreplicated systematic sampling designs (e.g., via visual counts from towers or hydroacoustic counts). These sampling designs support a variety of methods for estimating the variance of the total escapement. Unfortunately, all the methods give biased results, with the magnitude of the bias being determined by the underlying process patterns. Fish escapement commonly exhibits positive autocorrelation and nonlinear patterns, such as diurnal and seasonal patterns. For these patterns, poor choice of variance estimator can needlessly increase the uncertainty managers have to deal with in sustaining fish populations. We illustrate the effect of sampling design and variance estimator choice on variance estimates of total escapement for anadromous salmonids from systematic samples of fish passage. Using simulated tower counts of sockeye salmon Oncorhynchus nerka escapement on the Kvichak River, Alaska, five variance estimators for nonreplicated systematic samples were compared to determine the least biased. Using the least biased variance estimator, four confidence interval estimators were compared for expected coverage and mean interval width. Finally, five systematic sampling designs were compared to determine the design giving the smallest average variance estimate for total annual escapement. For nonreplicated systematic samples of fish escapement, all variance estimators were positively biased. Compared to the other estimators, the least biased estimator reduced bias by, on average, from 12% to 98%. All confidence intervals gave effectively identical results. Replicated systematic sampling designs consistently provided the smallest average estimated variance among those compared.

  6. High Resolution Observations of Escaping Ions in the Martian Magnetotail

    NASA Astrophysics Data System (ADS)

    Halekas, J. S.; Raman, C.; Brain, D.; DiBraccio, G. A.; Harada, Y.; McFadden, J. P.; Mitchell, D. L.; Connerney, J. E. P.; Jakosky, B. M.

    2016-12-01

    Ions escape from the Martian upper atmosphere via a number of channels, including the central plasmasheet of the magnetotail. Mars Express observations show that the heavy ions O+ and O2+ escaping through the central tail often have approximately the same energy, suggesting acceleration in a quasi-static electric field, which has been interpreted as a Hall electric field. The Solar Wind Ion Analyzer (SWIA) on MAVEN was designed to measure the upstream solar wind. However, during orbit segments with appropriate spacecraft attitude, SWIA can also make high resolution measurements of escaping ions in the tail. During the prime mission, these observations were only returned sporadically, during periods of intense escaping fluxes that fortuitously triggered a mode switch. Now, in the extended mission, we return high resolution observations from SWIA routinely. Some of these high resolution measurements reveal slight differences in both the direction and energy of escaping O+ and O2+ ions, which may help determine the acceleration process(es). We investigate the location and solar wind conditions for which the escaping ions separate in energy and angle and the systematics of their energies and flow vectors, and discuss the implications for ion acceleration and the overall picture of Martian atmospheric escape.

  7. Predictions for the escape of CH4 from Pluto

    NASA Astrophysics Data System (ADS)

    Koskinen, Tommi; Erwin, Justin T.; Yelle, Roger V.

    2015-11-01

    Observations of Pluto’s extended atmosphere by the New Horizons/ALICE instrument have the potential to constrain models of energy-limited escape from planetary atmospheres. Such models have wide applicability, ranging from dwarf planets in the solar system to giant extrasolar planets, but the opportunities to test them in actual atmospheres are limited. We adapted a multi-species escape model from close-in extrasolar planets to calculate the escape rates of CH4 and N2 from Pluto. In the absence of escape, CH4 should overtake N2 as the dominant species below the exobase. Theory suggests, however, that Pluto’s atmosphere undergoes rapid escape that leads to a nearly constant CH4 mixing ratio of about 1 % below the exobase, with CH4 escaping at a rate that is only 5-10 % of the N2 escape rate. Simultaneous observations of the N2 and CH4 profiles in the upper atmosphere, together with our model, can be used to test if this is the case and infer an estimate of the mass loss rate.

  8. Modelling the Evolution and Spread of HIV Immune Escape Mutants

    PubMed Central

    Fryer, Helen R.; Frater, John; Duda, Anna; Roberts, Mick G.; Phillips, Rodney E.; McLean, Angela R.

    2010-01-01

    During infection with human immunodeficiency virus (HIV), immune pressure from cytotoxic T-lymphocytes (CTLs) selects for viral mutants that confer escape from CTL recognition. These escape variants can be transmitted between individuals where, depending upon their cost to viral fitness and the CTL responses made by the recipient, they may revert. The rates of within-host evolution and their concordant impact upon the rate of spread of escape mutants at the population level are uncertain. Here we present a mathematical model of within-host evolution of escape mutants, transmission of these variants between hosts and subsequent reversion in new hosts. The model is an extension of the well-known SI model of disease transmission and includes three further parameters that describe host immunogenetic heterogeneity and rates of within host viral evolution. We use the model to explain why some escape mutants appear to have stable prevalence whilst others are spreading through the population. Further, we use it to compare diverse datasets on CTL escape, highlighting where different sources agree or disagree on within-host evolutionary rates. The several dozen CTL epitopes we survey from HIV-1 gag, RT and nef reveal a relatively sedate rate of evolution with average rates of escape measured in years and reversion in decades. For many epitopes in HIV, occasional rapid within-host evolution is not reflected in fast evolution at the population level. PMID:21124991

  9. Oxygen ion escape from Venus: The acceleration mechanisms and the escape rate under different IMF configurations

    NASA Astrophysics Data System (ADS)

    Masunaga, K.; Futaana, Y.; Yamauchi, M.; Barabash, S.; Zhang, T.; Fedorov, A.; Okano, S.; Terada, N.

    2012-12-01

    Using data obtained from ASPERA-4 (Analyser of Space Plasma and Energetic Atoms) and MAG (magnetometer) experiments onboard Venus Express, we investigate the acceleration mechanisms, the escape rate of the oxygen ions from the Venus upper atmosphere, and the contribution of the upstream condition to them. We first produce spatial distribution maps of O+ fluxes (>100 eV) around Venus for two different convection electric fields, namely the solar wind electric field (SWEF; Esw = -Vsw x Bsw) and the local convection electric field (LCEF; EL = -VL x BL where VL and BL are the local proton velocity and the local magnetic field that obtained over one-scan (192 s)). Comparison between the two distributions, we find that the O+ fluxes are frequently observed in the hemisphere where LCEF orients. Moreover, such structure can be identified regardless of the upstream interplanetary magnetic field (IMF) direction. Thus we conclude that the O+ ions are accelerated more effectively by LCEF rather than SWEF in the Venusian upper atmosphere. In the induced magnetosphere, O+ fluxes are frequently associated with Bx reversals where the IMF curvature is strong. It indicates that a magnetic tension force also contributes to O+ acceleration. We also investigate the dependency of the O+ escape rates on the upstream IMF directions. Here, the IMF condition is classified into two cases: the perpendicular IMF case and the parallel IMF case, where IMF directs nearly perpendicular to the Venus-Sun line (60° < θ < 120°) and nearly parallel to it (0° < θ < 30° or 150° < θ < 180°). During the data period between 20 Jun 2006 and 20 Dec 2009 we have obtained 141 perpendicular IMF cases and 71 parallel IMF cases. Using these data, total O+ escape rates are estimated by integrating the anti-sunward fluxes in the nightside region. We find that the total escape rates between the two IMF cases are of the same order, and thus we conclude that the upstream IMF direction does not significantly

  10. 16. INTERIOR VIEW OF SUBMARINE SECTION AT 110FOOT LEVEL, ESCAPE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    16. INTERIOR VIEW OF SUBMARINE SECTION AT 110-FOOT LEVEL, ESCAPE TRAINING TANK, SHOWING LADDER TO ESCAPE TANK, LOOKING SOUTH - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  11. Mass fractionation in hydrodynamic escape. [of gases from planetary atmospheres

    NASA Technical Reports Server (NTRS)

    Hunten, Donald M.; Pepin, Robert O.; Walker, James C. G.

    1987-01-01

    In mass fractionation during the hydrodynamic escape of gases from an inner planet's atmosphere, the readier escape of light gases generates a linear or concave downward line in a plotting of the log of remaining inventory against atomic mass. Just as such an episode of hydrodynamic escape during Mars' early history could have led to the mass-dependent depletion of the noble gases that has been noted in the Martian atmosphere, in the event that the Martian atmosphere was initially hydrogen-rich, an early earth-history episode may have resulted in a mass-dependent fractionation of the xenon isotopes.

  12. Delayed escape from light by the albino rat1

    PubMed Central

    Keller, John V.

    1966-01-01

    Two albino rats were trained to terminate an aversive light for 1 min by pressing a bar. After 19 hr of conditioning they were exposed to successive delays of 1, 2, 5, and 10 sec imposed between occurrence of the escape response and light termination. No stimulus change accompanied the delay interval, and any additional responses made at this time reset the delay timer. For both rats the relative frequency of escape responses with very long latencies increased as the delay interval increased. The modal escape latency, however, remained essentially unchanged for all delay values of greater than 1 sec. “Superstitious” responding was observed during the delay interval. PMID:5970387

  13. Xenon Fractionation, Hydrogen Escape, and the Oxidation of the Earth

    NASA Astrophysics Data System (ADS)

    Zahnle, K. J.; Catling, D. C.

    2014-12-01

    Xenon in Earth's atmosphere is severely mass fractionated and depleted compared to any plausible solar system source material, yet Kr is unfractionated. These observations seem to imply that Xe has escaped from Earth. Vigorous hydrodynamic hydrogen escape can produce mass fractionation in heavy gases. The required hydrogen flux is very high but within the range permitted by solar EUV heating when Earth was 100 Myrs old or younger. However this model cannot explain why Xe escapes but Kr does not. Recently, what appears to be ancient atmospheric xenon has been recovered from several very ancient (3-3.5 Ga) terrestrial hydrothermal barites and cherts (Pujol 2011, 2013). What is eye-catching about this ancient Xe is that it is less fractionated that Xe in modern air. In other words, it appears that a process was active on Earth some 3 to 3.5 billion years ago that caused xenon to fractionate. By this time the Sun was no longer the EUV source that it used to be. If xenon was being fractionated by escape — currently the only viable hypothesis — it had to be in Earth's Archean atmosphere and under rather modest levels of EUV forcing. It should be possible for Xe, but not Kr, to escape from Earth as an ion. In a hydrodynamically escaping hydrogen wind the hydrogen is partially ionized. The key concepts are that ions are much more strongly coupled to the escaping flow than are neutrals (so that a relatively modest flow of H and H+ to space could carry Xe+ along with it, the flux can be small enough to be consistent with diffusion-limited flux), and that Xe alone among the noble gases is more easily ionized than hydrogen. This sort of escape is possible along the polar field lines, although a weak or absent magnetic field would likely work as well. The extended history of hydrogen escape implicit in Xe escape in the Archean is consistent with other suggestions that hydrogen escape in the Archean was considerable. Hydrogen escape plausibly played the key role in creating

  14. Escape of Hydrogen from HD209458b

    NASA Astrophysics Data System (ADS)

    Erwin, Justin; Yelle, Roger; Koskinen, Tommi

    2017-04-01

    Recent modeling of the atmosphere of HD209458b has been used to interpret the Lyman-α line and other observations during transits. Koskinen et al. (2010) used a hydrostatic density profile in the thermosphere combined with the Voigt profile to estimate the Lyman-alpha transit depths for an array of model parameters. A detailed photochemical-dynamical model of the thermosphere was developed by Koskinen et al. (2013a) and used to again estimate model parameters to fit not only the Lyman-alpha transits, but also the transits in the O I, C II and Si III lines (Koskinen et al., 2013b). Recently, Bourrier and Lecavelier (2013) modeled the escape of hydrogen from the extended atmospheres of HD209458b and HD189733b and used the results to interpret Lyman-alpha observations. They included acceleration of hydrogen by radiation pressure and stellar wind protons to simulate the high velocity tails of the velocity distribution, arguing that the observations are explained by high velocity gas in the system while Voigt broadening is negligible. In this work we connect a free molecular flow (FMF) model similar to Bourrier and Lecavelier (2013) to the results of Koskinen et al. (2013b) and properly include absorption by the extended thermosphere in the transit model. In this manner, we can interpret the necessity of the various physical processes in matching the observed line profiles. Furthermore, the transit depths of this model can be used to re-evaluate the atmospheric model parameters to determine if they need to be adjusted due

  15. In situ apoptosis of adaptive immune cells and the cellular escape of rabies virus in CNS from patients with human rabies transmitted by Desmodus rotundus.

    PubMed

    Fernandes, Elaine Raniero; de Andrade, Heitor Franco; Lancellotti, Carmen Lúcia Penteado; Quaresma, Juarez Antônio Simões; Demachki, Samia; da Costa Vasconcelos, Pedro Fernando; Duarte, Maria Irma Seixas

    2011-03-01

    The aim of the current study was to investigate the apoptosis of neurons, astrocytes and immune cells from human patients that were infected with rabies virus by vampire bats bite. Apoptotic neurons were identified by their morphology and immune cells were identified using double immunostaining. There were very few apoptotic neurons present in infected tissue samples, but there was an increase of apoptotic infiltrating CD4+ and TCD8+ adaptive immune cells in the rabies infected tissue. No apoptosis was present in NK, macrophage and astrocytes. The dissemination of the human rabies virus within an infected host may be mediated by viral escape of the virus from an infected cell and may involve an anti-apoptotic mechanism, which does not kill the neuron or pro-apoptosis of TCD4+ and TCD8+ lymphocytes and which allows for increased proliferation of the virus within the CNS by attenuation of the adaptive immune response. Copyright © 2011 Elsevier B.V. All rights reserved.

  16. The apoptotic effect of apigenin on human gastric carcinoma cells through mitochondrial signal pathway.

    PubMed

    Chen, Jiayu; Chen, Jiaqi; Li, Zhaoyun; Liu, Chibo; Yin, Lihui

    2014-08-01

    This study aims to explore the apoptotic function of apigenin on the gastric cancer cells and the related mechanism. The gastric cancer cell lines HGC-27 and SGC-7901, and normal gastric epithelial cell line GES1 were treated with different concentrations of apigenin. Cell proliferation was tested. Morphological changes of the apoptotic cells were observed after Hoechst33342 staining. The apoptosis rate of the gastric cancer cells were measured with flow cytometry. Changes of the cell cycle were explored. The mitochondrial membrane potential changes were analyzed after JC-1 staining. Bcl-2 family proteins and caspases-3 expression with apigenin treatment was analyzed by real-time PCR. Cell proliferation of HGC-27 and SGC-7901 was inhibited by apigenin, and the inhibition was dose-time-dependent. Gastric carcinoma cells treated by apigenin had no obvious cell cycle arrest, but were observed with the higher apoptosis rate and the typical apoptotic morphological changes of the cell nucleus. JC-1 staining showed that apigenin could reduce mitochondrial membrane potential of gastric carcinoma cells. Real-time PCR results showed that apigenin significantly increased caspase-3 and Bax expression level, and down-regulated Bcl-2 expression in a dose-dependent manner in gastric carcinoma cells. However, the GES1 was almost not affected by apigenin treatment. Apigenin can inhibit cell lines HGC-27 and SGC-7901 proliferation in a time and dose-dependent manner, reduce anti-apoptotic protein Bcl-2 levels, enhance apoptosis-promoting protein Bax level, result in mitochondrial membrane potential decreasing and caspase-3 enzyme activating, then lead to cell apoptosis.

  17. Targeting multiple pro-apoptotic signaling pathways with curcumin in prostate cancer cells

    PubMed Central

    Rivera, Mariela; Ramos, Yanilda; Rodríguez-Valentín, Madeline; López-Acevedo, Sheila; Cubano, Luis A.; Zou, Jin; Zhang, Qiang; Wang, Guangdi

    2017-01-01

    Curcumin, an extract from the turmeric rhizome (Curcuma longa), is known to exhibit anti-inflammatory, antioxidant, chemopreventive and antitumoral activities against aggressive and recurrent cancers. Accumulative data indicate that curcumin may induce cancer cell death. However, the detailed mechanism underlying its pro-apoptotic and anti-cancer effects remains to be elucidated. In the present study, we examined the signaling pathways triggered by curcumin, specifically, the exact molecular mechanisms of curcumin-induced apoptosis in highly metastatic human prostate cancer cells. The effect of curcumin was evaluated using for the first time in prostate cancer, a gel-free shotgun quantitative proteomic analysis coupled with Tandem Mass Tag isobaric labeling-based-signaling networks. Results were confirmed at the gene expression level by qRT-PCR and at the protein expression level by western blot and flow cytometry. Our findings revealed that curcumin induced an Endoplasmic Reticulum stress-mediated apoptosis in PC3. The mechanisms by which curcumin promoted cell death in these cells were associated with cell cycle arrest, increased reactive oxygen species, autophagy and the Unfolded Protein Response. Furthermore, the upregulation of ER stress was measured using key indicators of ER stress: Glucose-Regulated Protein 78, Inositol-Requiring Enzyme 1 alpha, Protein Disulfide isomerase and Calreticulin. Chronic ER stress induction was concomitant with the upregulation of pro-apoptotic markers (caspases 3,9,12) and Poly (ADP-ribose) polymerase. The downregulated proteins include anti-apoptotic and anti-tumor markers, supporting their curcumin-induced pro-apoptotic role in prostate cancer cells. Taken together, these data suggest that curcumin may serve as a promising anticancer agent by inducing a chronic ER stress mediated cell death and activation of cell cycle arrest, UPR, autophagy and oxidative stress responses. PMID:28628644

  18. ARTEMIS nuclease facilitates apoptotic chromatin cleavage.

    PubMed

    Britton, Sébastien; Frit, Philippe; Biard, Denis; Salles, Bernard; Calsou, Patrick

    2009-10-15

    One hallmark of apoptosis is DNA degradation that first appears as high molecular weight fragments followed by extensive internucleosomal fragmentation. During apoptosis, the DNA-dependent protein kinase (DNA-PK) is activated. DNA-PK is involved in the repair of DNA double-strand breaks (DSB) and its catalytic subunit is associated with the nuclease ARTEMIS. Here, we report that, on initiation of apoptosis in human cells by agents causing DNA DSB or by staurosporine or other agents, ARTEMIS binds to apoptotic chromatin together with DNA-PK and other DSB repair proteins. ARTEMIS recruitment to chromatin showed a time and dose dependency. It required DNA-PK protein kinase activity and was blocked by antagonizing the onset of apoptosis with a pan-caspase inhibitor or on overexpression of the antiapoptotic BCL2 protein. In the absence of ARTEMIS, no defect in caspase-3, poly(ADP-ribose) polymerase-1, and XRCC4 cleavage or in H2AX phosphorylation was observed and DNA-PK catalytic subunit was still phosphorylated on S2056 in response to staurosporine. However, DNA fragmentation including high molecular weight fragmentation was delayed in ARTEMIS-deficient cells compared with cells expressing ARTEMIS. In addition, ARTEMIS enhanced the kinetics of MLL gene cleavage at a breakage cluster breakpoint that is frequently translocated in acute or therapy-related leukemias. These results show a facilitating role for ARTEMIS at least in early, site-specific chromosome breakage during apoptosis.

  19. Rapid reuptake of granzyme B leads to emperitosis: an apoptotic cell-in-cell death of immune killer cells inside tumor cells.

    PubMed

    Wang, S; He, M-f; Chen, Y-h; Wang, M-y; Yu, X-M; Bai, J; Zhu, H-y; Wang, Y-y; Zhao, H; Mei, Q; Nie, J; Ma, J; Wang, J-f; Wen, Q; Ma, L; Wang, Y; Wang, X-n

    2013-10-10

    A cell-in-cell process refers to the invasion of one living cell into another homotypic or heterotypic cell. Different from non-apoptotic death processes of internalized cells termed entosis or cannibalism, we previously reported an apoptotic cell-in-cell death occurring during heterotypic cell-in-cell formation. In this study, we further demonstrated that the apoptotic cell-in-cell death occurred only in internalized immune killer cells expressing granzyme B (GzmB). Vacuole wrapping around the internalized cells inside the target cells was the common hallmark during the early stage of all cell-in-cell processes, which resulted in the accumulation of reactive oxygen species and subsequent mitochondrial injury of encapsulated killer or non-cytotoxic immune cells. However, internalized killer cells mediated rapid bubbling of the vacuoles with the subsequent degranulation of GzmB inside the vacuole of the target cells and underwent the reuptake of GzmB by killer cells themselves. The confinement of GzmB inside the vacuole surpassed the lysosome-mediated cell death occurring in heterotypic or homotypic entosis processes, resulting in a GzmB-triggered caspase-dependent apoptotic cell-in-cell death of internalized killer cells. On the contrary, internalized killer cells from GzmB-deficient mice underwent a typical non-apoptotic entotic cell-in-cell death similar to that of non-cytotoxic immune cells or tumor cells. Our results thus demonstrated the critical involvement of immune cells with cytotoxic property in apoptotic cell-in-cell death, which we termed as emperitosis taken from emperipolesis and apoptosis. Whereas entosis or cannibalism may serve as a feed-on mechanism to exacerbate and nourish tumor cells, emperitosis of immune killer cells inside tumor cells may serve as an in-cell danger sensation model to prevent the killing of target cells from inside, implying a unique mechanism for tumor cells to escape from immune surveillance.

  20. The anti-apoptotic properties of APEX1 in the endothelium require the first twenty amino acids and converge on Thioredoxin-1.

    PubMed

    Dyballa-Rukes, Nadine; Jakobs, Philipp; Eckers, Anna; Ale-Agha, Niloofar; Serbulea, Vlad; Aufenvenne, Karin; Zschauer, Tim-Christian; Rabanter, Lothar Ludwig; Jakob, Sascha; von Ameln, Florian; Eckermann, Olaf; Leitinger, Norbert; Goy, Christine; Altschmied, Joachim; Haendeler, Judith

    2016-11-11

    The APEX nuclease (multifunctional DNA repair enzyme) 1 (APEX1) has a disordered N-terminus, a redox and a DNA repair domain. APEX1 has anti-apoptotic properties, which have been linked to both domains depending on cell type and experimental conditions.

  1. Anti-apoptotic effects of decyl gallate on the induction of apoptosis in A549 pneumocytes by Paracoccidioides brasiliensis gp43.

    PubMed

    Bernardi, Thais; da Silva, Julhiany de Fátima; Vicentin, Juliana; de Oliveira, Haroldo Cesar; Assato, Patricia Akemi; Marcos, Caroline Maria; de Paula E Silva, Ana Carolina Alves; da Silva, Rosangela Aparecida Moraes; Regasini, Luis Octávio; Silva, Dulce Helena Siqueira; da Silva Bolzani, Vanderlan; Fusco-Almeida, Ana Marisa; Mendes-Giannini, Maria José Soares

    2017-03-03

    Apoptosis is considered an escape mechanism from the host immune system for the fungus Paracoccidioides spp, and it serves as a vehicle for entry into macrophages without stimulating microbicidal activities. Recently, gp43 of P. brasiliensis was demonstrated to be involved in this process. Therefore, as a new therapeutic alternative, it is very important to study compounds that could reduce the modulation of the induction of apoptosis caused by this fungus. Decyl gallate (G14) is a known antifungal compound, and we decided to investigate its anti-apoptotic properties. Our results demonstrate that G14 was effective against apoptosis induced by gp43, as observed in epithelial cells, and led to a reduction in DNA damage, Bak down-regulation and Bcl-2 up-regulation. Together, these data show that G14 presents promising anti-apoptotic activity.

  2. Non-apoptotic functions of BCL-2 family proteins.

    PubMed

    Gross, Atan; Katz, Samuel G

    2017-02-24

    The BCL-2 family proteins are major regulators of the apoptosis process, but the mechanisms by which they regulate this process are only partially understood. It is now well documented that these proteins play additional non-apoptotic roles that are likely to be related to their apoptotic roles and to provide important clues to cracking their mechanisms of action. It seems that these non-apoptotic roles are largely related to the activation of cellular survival pathways designated to maintain or regain cellular survival, but, if unsuccessful, will switch over into a pro-apoptotic mode. These non-apoptotic roles span a wide range of processes that include the regulation of mitochondrial physiology (metabolism, electron transport chain, morphology, permeability transition), endoplasmic reticulum physiology (calcium homeostasis, unfolded protein response (UPR)), nuclear processes (cell cycle, DNA damage response (DDR)), whole-cell metabolism (glucose and lipid), and autophagy. Here we review all these different non-apoptotic roles, make an attempt to link them to the apoptotic roles, and present many open questions for future research directions in this fascinating field.Cell Death and Differentiation advance online publication, 24 February 2017; doi:10.1038/cdd.2017.22.

  3. Apoptosis and apoptotic mimicry in Leishmania: an evolutionary perspective

    PubMed Central

    El-Hani, Charbel N.; Borges, Valéria M.; Wanderley, João L. M.; Barcinski, Marcello A.

    2012-01-01

    Apoptotic death and apoptotic mimicry are defined respectively as a non-accidental death and as the mimicking of an apoptotic-cell phenotype, usually by phosphatidylserine (PS) exposure. In the case of the murine infection by Leishmania spp, apoptotic death has been described in promastigotes and apoptotic mimicry in amastigotes. In both situations they are important events of the experimental murine infection by this parasite. In the present review we discuss what features we need to consider if we want to establish if a behavior shown by Leishmania is altruistic or not: does the behavior increases the fitness of organisms other than the one showing it? Does this behavior have a cost for the actor? If we manage to show that a given behavior is costly for the actor and beneficial for the recipient of the action, we will be able to establish it as altruistic. From this perspective, we can argue that apoptotic-like death and apoptotic mimicry are both altruistic with the latter representing a weaker altruistic behavior than the former. PMID:22912937

  4. Macrophage recognition of ICAM-3 on apoptotic leukocytes.

    PubMed

    Moffatt, O D; Devitt, A; Bell, E D; Simmons, D L; Gregory, C D

    1999-06-01

    Cells undergoing apoptosis are cleared rapidly by phagocytes, thus preventing tissue damage caused by loss of plasma membrane integrity. In this study, we show that the surface of leukocytes is altered during apoptosis such that the first Ig-like domain of ICAM-3 (CD50) can participate in the recognition and phagocytosis of the apoptotic cells by macrophages. Macrophage recognition of apoptotic cell-associated ICAM-3 was demonstrated both on leukocytes and, following transfection of exogenous ICAM-3, on nonleukocytes. The change in ICAM-3 was a consistent consequence of apoptosis triggered by various stimuli, suggesting that it occurs as part of a final common pathway of apoptosis. Alteration of ICAM-3 on apoptotic cells permitting recognition by macrophages resulted in a switch in ICAM-3-binding preference from the prototypic ICAM-3 counterreceptor, LFA-1, to an alternative macrophage receptor. Using mAbs to block macrophage/apoptotic cell interactions, we were unable to obtain evidence that either the alternative ICAM-3 counterreceptor alpha d beta 2 or the apoptotic cell receptor alpha v beta 3 was involved in the recognition of ICAM-3. By contrast, mAb blockade of macrophage CD14 inhibited ICAM-3-dependent recognition of apoptotic cells. These results show that ICAM-3 can function as a phagocytic marker of apoptotic leukocytes on which it acquires altered macrophage receptor-binding activity.

  5. Generation of Escape Variants of Neutralizing Influenza Virus Monoclonal Antibodies.

    PubMed

    Leon, Paul E; Wohlbold, Teddy John; He, Wenqian; Bailey, Mark J; Henry, Carole J; Wilson, Patrick C; Krammer, Florian; Tan, Gene S

    2017-08-29

    Influenza viruses exhibit a remarkable ability to adapt and evade the host immune response. One way is through antigenic changes that occur on the surface glycoproteins of the virus. The generation of escape variants is a powerful method in elucidating how viruses escape immune detection and in identifying critical residues required for antibody binding. Here, we describe a protocol on how to generate influenza A virus escape variants by utilizing human or murine monoclonal antibodies (mAbs) directed against the viral hemagglutinin (HA). With the use of our technique, we previously characterized critical residues required for the binding of antibodies targeting either the head or stalk of the novel avian H7N9 HA. The protocol can be easily adapted for other virus systems. Analyses of escape variants are important for modeling antigenic drift, determining single nucleotide polymorphisms (SNPs) conferring resistance and virus fitness, and in the designing of vaccines and/or therapeutics.

  6. Oxygen Escape from Venus During High Dynamic Pressure ICMEs

    NASA Astrophysics Data System (ADS)

    McEnulty, Tess; Luhmann, J. G.; Brain, D. A.; Fedorov, A.; Jian, L. K.; Russell, C. T.; Zhang, T.; Möstl, C.; Futaana, Y.; de Pater, I.

    2013-10-01

    Previous studies using data from Pioneer Venus suggested that oxygen ion escape flux may be enhanced by orders of magnitude during Interplanetary Coronal Mass Ejections. However, this large enhancement has been ambiguous in Venus Express ion data - with some analyses showing no flux enhancement or a small enhancement (within 2 times undisturbed cases). One possible explanation is that high escape flux may be due to high dynamic pressure in the solar wind, and the dynamic pressure has been lower during the VEX time period. So, we focus on ICMEs with the largest dynamic pressure and with VEX sampling of the escaping ions during the sheath of the ICMEs (during which the highest dynamic pressures in the solar wind occur). We will show the characteristics of these large events measured by VEX, and compare them to the largest ICMEs measured by PVO. We will then discuss estimates of the oxygen ion escape flux during these events.

  7. Pilot Fullerton dons ejection escape suit (EES) on middeck

    NASA Technical Reports Server (NTRS)

    1982-01-01

    Pilot Fullerton dons ejection escape suit (EES) (high altitude pressure garment) life preserver unit (LPU) on forward port side of middeck above potable water tank. Fullerton also adjusts lapbelt fitting and helmet holddown strap.

  8. Prey escaping wolves, Canis lupus, despite close proximity

    USGS Publications Warehouse

    Nelson, M.E.; Mech, L.D.

    1993-01-01

    We describe attacks by wolf (Canis lupus) packs in Minnesota on a white-tailed deer (Odocoileus virginianus) and a moose (Alces alces) in which wolves were within contact distance of the prey but in which the prey escaped.

  9. Dissociated neural effects of cortisol depending on threat escapability.

    PubMed

    Montoya, Estrella R; van Honk, Jack; Bos, Peter A; Terburg, David

    2015-11-01

    Evolution has provided us with a highly flexible neuroendocrine threat system which, depending on threat imminence, switches between active escape and passive freezing. Cortisol, the "stress-hormone", is thought to play an important role in both fear behaviors, but the exact mechanisms are not understood. Using pharmacological functional magnetic resonance imaging we investigated how cortisol modulates the brain's fear systems when humans are under virtual-predator attack. We show dissociated neural effects of cortisol depending on whether escape from threat is possible. During inescapable threat cortisol reduces fear-related midbrain activity, whereas in anticipation of active escape cortisol boosts activity in the frontal salience network (insula and anterior cingulate cortex), which is involved in autonomic control, visceral perception and motivated action. Our findings suggest that cortisol adjusts the human neural threat system from passive fear to active escape, which illuminates the hormone's crucial role in the adaptive flexibility of fear behaviors.

  10. Experimental Analysis and Extinction of Self-Injurious Escape Behavior.

    ERIC Educational Resources Information Center

    Iwata, Brian A.; And Others

    1990-01-01

    Three studies investigated environmental correlates of self-injurious behavior in seven developmentally disabled children and adolescents which were then later used for treatment. Correlates investigated included positive reinforcement, negative reinforcement, automatic reinforcement, and control. "Escape extinction" was successfully…

  11. 39. VIEW OF HORSE AND ESCAPE STEPS ON ARIZONA CANAL, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    39. VIEW OF HORSE AND ESCAPE STEPS ON ARIZONA CANAL, LOOKING NORTH ON THE SALT RIVER INDIAN RESERVATION Photographer: James Eastwood, June 1990 - Arizona Canal, North of Salt River, Phoenix, Maricopa County, AZ

  12. 14. View inside Building 802, the "Escape Hatch" at the ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. View inside Building 802, the "Escape Hatch" at the rear of the "Sleeping Quarters", facing south. - Naval Air Station Fallon, 100-man Fallout Shelter, 800 Complex, off Carson Road near intersection of Pasture & Berney Roads, Fallon, Churchill County, NV

  13. Electron yields and escape depths from spacecraft materials

    SciTech Connect

    Yang, K.Y.

    1986-01-01

    Secondary electron emission (SEE) characteristics and photoelectron yields were determined for several insulating materials used onboard a space shuttle. These materials are: kapton, teflon, spaceshuttle tiles, and space suit cloth. Secondary electron escape depth and photoelectron escape depth from kapton were calculated from the experimental data. Sternglass' theory and Dionne's method were used in the calculation. Some semi-empirical theories of SEE and three-step theory of photoemission were reviewed. Pulsed beam techniques were used to reduce surface charging problems. Three ..mu..sec pulses of electrons were used in SEE experiments, and 100 msec to 1 sec pulses were used in photoemission experiments. The maximum SEE yields of the materials studied range from 1.75 ro 2.70. The secondary electron escape depth in kapton was calculated to be 55 +/- 5 A. All samples have photoyields lower than 1.0%. The photoelectrons excited by 21-eV photons have 87 +/- 30 A escape depth in kapton.

  14. 46 CFR 116.500 - Means of escape.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... wearing life jackets. There must be no protrusions in means of escape that could cause injury, ensnare clothing, or damage life jackets. (f) The minimum clear opening of a door or passageway used as a means of...

  15. Survey of space escape/rescue/survivability capabilities.

    NASA Technical Reports Server (NTRS)

    Fleisig, R.; Bolger, P. H.; Heath, G. W.

    1971-01-01

    Discussion of preventive or remedial systems to achieve safer space flight operations. Escape, rescue, and survival systems are defined by categories: on board, prepositioned aid, and earth-launched concepts. The survey considers separable escape or survival capsules; standby escape or rescue systems; and earth-launched manned and unmanned rescue systems. Reports covering such systems are listed, and the contents are classified as to scope of investigation, space mission, and design approach. Mission classes considered are earth orbit, lunar, and interplanetary. Results of the space escape, rescue, and survivability investigations are summarized in terms of system features and performance, including apparent voids or limitations in rescue capability. Recovery requirements and resources for space rescue are discussed.

  16. Critical escape velocity of black holes from branes

    SciTech Connect

    Flachi, Antonino; Sasaki, Misao; Pujolas, Oriol; Tanaka, Takahiro

    2006-08-15

    In recent work we have shown that a black hole stacked on a brane escapes once it acquires a recoil velocity. This result was obtained in the probe-brane approximation, i.e., when the tension of the brane is negligibly small. Therefore, it is not clear whether the effect of the brane tension may prevent the black hole from escaping for small recoil velocities. The question is whether a critical escape velocity exists. Here, we analyze this problem by studying the interaction between a Dirac-Nambu-Goto brane and a black hole assuming adiabatic (quasistatic) evolution. By describing the brane in a fixed black hole spacetime, which restricts our conclusions to lowest order effects in the tension, we find that the critical escape velocity does not exist for codimension one branes, while it does for higher codimension branes.

  17. Pioneer Venus Orbiter (PVO) Ionosphere Evidence for Atmospheric Escape

    NASA Astrophysics Data System (ADS)

    Grebowsky, J. M.; Hoegy, W. R.

    2009-12-01

    An early estimate of escape of H2O from Venus [McElroy et al., 1982] using observed hot oxygen densities inferred by Nagy et al. [1981] from PVO OUVS 1304 Å dayglow and using ionization rates from photoionization and electron impact. This resulted in an estimated oxygen ionization rate planet-wide above the plasmapause of 3x1025 atoms/s. Based on the energetic O+ being swept up and removed by solar wind, McElroy et al. [1982] gave an estimate of a loss rate for O of 6x106 atoms/cm2/s. Using a different method of estimating escape based data in the ionotail of Venus, Brace et al. [1987] estimated a total planetary O+ escape rate of 5x1025 ions/s. Their estimate was based on PVO measurements of superthermal O+ (energy range 9-16 eV) in the tail ray plasma between 2000 and 3000 km. Their estimated global mean flux was 107 atoms/cm2/s. The two escape rates are remarkably close considering all the errors involved in such estimates of escape. A study of escape by Luhmann et al. [2008] using VEX observations at low solar activity finds modest escape rates, prompting the authors to reconsider the evidence from both PVO and VEX of the possibility of enhanced escape during extreme interplanetary conditions. We reexamine the variation of escape under different solar wind conditions using ion densities and plasma content in the dayside and nightside of Venus using PVO ionosphere density during times of high solar activity. Citations: Brace, L.H., W. T. Kasprzak, H.A. Taylor, R. F. Theis, C. T. Russess, A. Barnes, J. D. Mihalov, and D. M. Hunten, "The Ionotail of Venus: Its Configuration and Evidence for Ion Escape", J. Geophys. Res. 92, 15-26, 1987. Luhmann, J.G., A. Fedorov, S. Barabash, E. Carlsson, Y. Futaana, T.L. Zhang, C.T. Russell, J.G. Lyon, S.A. Ledvina, and D.A. Brain, “Venus Express observations of atmospheric oxygen escape during the passage of several coronal mass ejections”, J. Geophys. Res., 113, 2008. McElroy, M. B., M. J. Prather, J. M. Rodiquez, " Loss

  18. Methane attenuates retinal ischemia/reperfusion injury via anti-oxidative and anti-apoptotic pathways.

    PubMed

    Liu, Lin; Sun, Qinglei; Wang, Ruobing; Chen, Zeli; Wu, Jiangchun; Xia, Fangzhou; Fan, Xian-Qun

    2016-09-01

    Retinal ischemia/reperfusion injury (IRI) may cause incurable visual impairment due to neural regeneration limits. Methane was shown to exert a protective effect against IRI in many organs. This study aims to explore the possible protective effects of methane-rich saline against retinal IRI in rat. Retinal IRI was performed on the right eyes of male Sprague-Dawley rats, which were immediately injected intraperitoneally with methane-saturated saline (25ml/kg). At one week after surgery, the number of retinal ganglion cells (RGCs), total retinal thickness, visual function were measured by hematoxylin and eosin staining, FluoroGold anterograde labeling and flash visual evoked potentials. The levels of 8-hydroxy-2-deoxyguanosine (8-OHdG), 4-Hydroxy-2-nonenal (4-HNE), malondialdehyde (MDA), superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx), caspase-3, caspase-9, B cell lymphoma/leukemia-2 (Bcl-2) and Bcl-2 associated X protein (Bax) in retinas were assessed by immunofluorescence staining, enzyme-linked immunosorbent assay and quantitative polymerase chain reaction. As expected, methane treatment significantly improved the retinal IRI-induced RGC loss, total retinal layer thinning and visual dysfunction. Moreover, methane treatment significantly reduced the levels of oxidative stress biomarkers (8-OHdG, 4-HNE, MDA) and increased the antioxidant enzyme activities (SOD, CAT, GPx) in the retinas with IRI. Meanwhile, methane treatment significantly increased the anti-apoptotic gene (Bcl-2) expression and decreased the pro-apoptotic gene (Bax) expression, accompanied by the suppression of caspase-3 and caspase-9 activity. Thus, these data demonstrated that methane can exert a neuroprotective role against retinal IRI through anti-oxidative and anti-apoptotic pathways. Copyright © 2016. Published by Elsevier B.V.

  19. Photoelectron escape fluxes over the equatorial and midlatitude regions

    NASA Technical Reports Server (NTRS)

    Narasingarao, B. C.; Singh, R. N.; Maier, E. J.

    1972-01-01

    Satellite measurements of photoelectron escape flux around noontime made by Explorer 31 in 600-800 km altitude range are reported for the equatorial and midlatitude regions. The pitch angle distributions and the spectral distributions are derived from the data. Analyzed data show that the flux for equatorial regions is lower by a factor 2 to 3 in comparison to that of midlatitude regions. Theoretical calculations are also made to compare with observed escape fluxes.

  20. GREEN PEA GALAXIES REVEAL SECRETS OF Lyα ESCAPE

    SciTech Connect

    Yang, Huan; Wang, Junxian; Malhotra, Sangeeta; Rhoads, James E.; Gronke, Max; Dijkstra, Mark; Jaskot, Anne; Zheng, Zhenya E-mail: huan.y@asu.edu E-mail: James.Rhoads@asu.edu

    2016-04-01

    We analyze archival Lyα spectra of 12 “Green Pea” galaxies observed with the Hubble Space Telescope, model their Lyα profiles with radiative transfer models, and explore the dependence of the Lyα escape fraction on various properties. Green Pea galaxies are nearby compact starburst galaxies with [O iii] λ5007 equivalent widths (EWs) of hundreds of Å. All 12 Green Pea galaxies in our sample show Lyα lines in emission, with an Lyα EW distribution similar to high-redshift Lyα emitters. Combining the optical and UV spectra of Green Pea galaxies, we estimate their Lyα escape fractions and find correlations between Lyα escape fraction and kinematic features of Lyα profiles. The escape fraction of Lyα in these galaxies ranges from 1.4% to 67%. We also find that the Lyα escape fraction depends strongly on metallicity and moderately on dust extinction. We compare their high-quality Lyα profiles with single H i shell radiative transfer models and find that the Lyα escape fraction anticorrelates with the derived H i column densities. Single-shell models fit most Lyα profiles well, but not the ones with the highest escape fractions of Lyα. Our results suggest that low H i column density and low metallicity are essential for Lyα escape and make a galaxy an Lyα emitter.

  1. Ion escape from Venus using statistical distribution functions

    NASA Astrophysics Data System (ADS)

    Nordstrom, T.; Stenberg, G.; Nilsson, H.; Barabash, S.; Futaana, Y.

    2012-04-01

    We use more than three years of data from the ASPERA-4 instrument onboard Venus Express to compile statistical distribution functions of ion flux in and around induced magnetosphere of Venus. We present samples of statistical distribution functions, as well average flux patterns in the near Venus space based on the statistical distribution functions. The statistical distribution functions allows for a compensation of biased sampling regarding both position and angular coverage of the instrument. Protons and heavy ions (mass/charge > 16) are the major ion species escaping from Venus. The escape is due to acceleration of planetary ions by energy transfer from the solar wind. The ion escape appears to exclusively take place in the induced magnetotail region and no heavy ions are present in the magnetosheath. Protons of solar wind origin are travelling around the planet and penetrating the tail, resulting in a mix of planetary and solar wind protons inside the induced magnetosphere boundary. The escape rates of ions inside the tail agree with results from recent published studies, where other analysis methods have been used. We also compare our results for Venus with a recent study of ion escape from Mars, where the same analysis method has been applied to data from the ASPERA-3 instrument on Mars Express. Both Mars and Venus are unmagnetized planets and are expected to interact similarly with the solar wind. On Mars the heavy ions are seen escaping in both the magnetosheath and tail regions as opposed to Venus where escape only takes place inside the tail. A possible explanation is that the magnetosphere of Mars is smaller compared to the ion gyroradius, making it easier for the ions to pass through the induced magnetosphere boundary. On both planets the escape rates of heavy ions in the tail are constant with increasing tail distance, verifying that the ions are leaving the planet in this region.

  2. Link between intraphagosomal biotin and rapid phagosomal escape in Francisella

    PubMed Central

    Napier, Brooke A.; Meyer, Lena; Bina, James E.; Miller, Mark A.; Sjöstedt, Anders; Weiss, David S.

    2012-01-01

    Cytosolic bacterial pathogens require extensive metabolic adaptations within the host to replicate intracellularly and cause disease. In phagocytic cells such as macrophages, these pathogens must respond rapidly to nutrient limitation within the harsh environment of the phagosome. Many cytosolic pathogens escape the phagosome quickly (15–60 min) and thereby subvert this host defense, reaching the cytosol where they can replicate. Although a great deal of research has focused on strategies used by bacteria to resist antimicrobial phagosomal defenses and transiently pass through this compartment, the metabolic requirements of bacteria in the phagosome are largely uncharacterized. We previously identified a Francisella protein, FTN_0818, as being essential for intracellular replication and involved in virulence in vivo. We now show that FTN_0818 is involved in biotin biosynthesis and required for rapid escape from the Francisella-containing phagosome (FCP). Addition of biotin complemented the phagosomal escape defect of the FTN_0818 mutant, demonstrating that biotin is critical for promoting rapid escape during the short time that the bacteria are in the phagosome. Biotin also rescued the attenuation of the FTN_0818 mutant during infection in vitro and in vivo, highlighting the importance of this process. The key role of biotin in phagosomal escape implies biotin may be a limiting factor during infection. We demonstrate that a bacterial metabolite is required for phagosomal escape of an intracellular pathogen, providing insight into the link between bacterial metabolism and virulence, likely serving as a paradigm for other cytosolic pathogens. PMID:23071317

  3. Optimal escapement in stage-structured fisheries with environmental stochasticity.

    PubMed

    Holden, Matthew H; Conrad, Jon M

    2015-11-01

    Stage-structured population models are commonly used to understand fish population dynamics and additionally for stock assessment. Unfortunately, there is little theory on the optimal harvest of stage-structured populations, especially in the presence of stochastic fluctuations. In this paper, we find closed form optimal equilibrium escapement policies for a three-dimensional, discrete-time, stage-structured population model with linear growth, post-harvest nonlinear recruitment, and stage-specific pricing and extend the analytic results to structured populations with environmental stochasticity. When only fishing reproductive adults, stochasticity does not affect optimal escapement policies. However, when harvesting immature fish, the addition of stochasticity can increase or decrease optimal escapement depending on the second and third derivative of the recruitment function. For logistic recruitment, stochasticity reduces optimal immature escapement by a multiplicative factor of one over one plus the variance of the environmental noise. Using hard clam, Mercenaria mercenaria, as an example and assuming Beverton-Holt recruitment, we show that optimal fishing of hard clam targets the immature stage class exclusively and that environmental stochasticity increases optimal escapement for low discount rates and decreases optimal escapement for high discount rates. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Extreme hydrodynamic atmospheric loss near the critical thermal escape regime

    NASA Astrophysics Data System (ADS)

    Erkaev, N. V.; Lammer, H.; Odert, P.; Kulikov, Yu. N.; Kislyakova, K. G.

    2015-04-01

    By considering martian-like planetary embryos inside the habitable zone of solar-like stars we study the behaviour of the hydrodynamic atmospheric escape of hydrogen for small values of the Jeans escape parameter β < 3, near the base of the thermosphere, that is defined as a ratio of the gravitational and thermal energy. Our study is based on a 1D hydrodynamic upper atmosphere model that calculates the volume heating rate in a hydrogen-dominated thermosphere due to the absorption of the stellar soft X-ray and extreme ultraviolet (XUV) flux. In case of a monatomic gas, we find that when the β value near the mesopause/homopause level exceeds a critical value of ˜2.5, there exists a steady hydrodynamic solution with a smooth transition from subsonic to supersonic flow. For a fixed XUV flux, the escape rate of the upper atmosphere is an increasing function of the temperature at the lower boundary. Our model results indicate a crucial enhancement of the atmospheric escape rate, when the Jeans escape parameter β decreases to this critical value. When β becomes ≤2.5, there is no stationary hydrodynamic transition from subsonic to supersonic flow. This is the case of a fast non-stationary atmospheric expansion that results in extreme thermal atmospheric escape rates.

  5. Foraging behavior delays mechanically-stimulated escape responses in fish.

    PubMed

    Bohórquez-Herrera, Jimena; Kawano, Sandy M; Domenici, Paolo

    2013-11-01

    Foraging and the evasion of predators are fundamental for the survival of organisms, but they impose contrasting demands that can influence performance in each behavior. Previous studies suggested that foraging organisms may experience decreased vigilance to attacks by predators; however, little is known about the effect of foraging on escape performance with respect to the kinematics and the timing of the response. This study tested the hypothesis that engaging in foraging activities affected escape performance by comparing fast-start escape responses of silver-spotted sculpins Blepsias cirrhosus under three conditions: (1) control (no foraging involved), (2) while targeting prey, and (3) immediately after capture of prey. Escape response variables (non-locomotor and locomotor) were analyzed from high-speed videos. Responsiveness was lower immediately after capturing a prey item compared with the other two treatments, and latency of performance was higher in the control treatment than in the other two. Locomotor variables such as maximum speed, maximum acceleration, and turning rates did not show statistical differences among the three groups. Our results demonstrate that foraging can negatively affect two fundamental components of the escape response: (1) responsiveness and (2) latency of escape, suggesting that engaging in foraging may decrease an individual's ability to successfully evade predators.

  6. Group chase and escape with sight-limited chasers

    NASA Astrophysics Data System (ADS)

    Wang, Huodong; Han, Wenchen; Yang, Junzhong

    2017-01-01

    We study group chase and escape with sight-limited chasers. Two search strategies, random-walk-strategy and relocation-strategy, are introduced for chasers when escapers are out of their fields of vision. There exist two regimes for the group lifetime of escapers. In the narrow sight regime, the group lifetime is a decreasing function of chasers' sight range. In the wide sight regime, the group lifetime stays at a constant when chasers adopting random-walk-strategy while increases with the sight range when chasers adopting relocation-strategy. The impacts of the two search strategies on group chase and escape are studied by investigating the lifetime distribution of all escapers and the dependence of the minimum lifetime on the number of chasers. We also find that, to reach the most efficient and the lowest energy cost chase for chasers, the ratio between the number of chasers and escapers stays at around 6 under random-walk-strategy. However, the optimal number of chasers vanishes and the energy cost monotonically increases with increasing the number of chasers under relocation-strategy.

  7. Cobra venom cytotoxins; apoptotic or necrotic agents?

    PubMed

    Ebrahim, Karim; Shirazi, Farshad H; Mirakabadi, Abbas Zare; Vatanpour, Hossein

    2015-12-15

    Organs homeostasis is controlled by a dynamic balance between cell proliferation and apoptosis. Failure to induction of apoptosis has been implicated in tumor development. Cytotoxin-I (CTX-I) and cytotoxin-II (CTX-II) are two physiologically active polypeptides found in Caspian cobra venom. Anticancer activity and mechanism of cell death induced by these toxins have been studied. The toxins were purified by different chromatographic steps and their cytotoxicity and pattern of cell death were determined by MTT, LDH release, acridine orange/ethidium bromide (AO/EtBr) double staining, flow cytometric analysis, caspase-3 activity and neutral red assays. The IC50 of CTX-II in MCF-7, HepG2, DU-145 and HL-60 was 4.1 ± 1.3, 21.2 ± 4.4, 9.4 ± 1.8 μg/mL and 16.3 ± 1.9 respectively while the IC50 of this toxin in normal MDCK cell line was 54.5 ± 3.9 μg/mL. LDH release suddenly increase after a specific toxins concentrations in all cell lines. AO/EtBr double staining, flow cytometric analysis and caspase-3 activity assay confirm dose and time-dependent induction of apoptosis by both toxins. CTX-I and CTX-II treated cells lost their lysosomal membrane integrity and couldn't uptake neutral red day. CTX-I and CTX-II showed significant anticancer activity with minimum effects on normal cells and better IC50 compared to current anticancer drug; cisplatin. They induce their apoptotic effect via lysosomal pathways and release of cathepsins to cytosol. These effects were seen in limited rage of toxins concentrations and pattern of cell death rapidly changes to necrosis by increase in toxin's concentration. In conclusion, significant apoptogenic effects of these toxins candidate them as a possible anticancer agent.

  8. Porphyromonas gingivalis gingipains cause defective macrophage migration towards apoptotic cells and inhibit phagocytosis of primary apoptotic neutrophils.

    PubMed

    Castro, Sowmya A; Collighan, Russell; Lambert, Peter A; Dias, Irundika Hk; Chauhan, Parbata; Bland, Charlotte E; Milic, Ivana; Milward, Michael R; Cooper, Paul R; Devitt, Andrew

    2017-03-02

    Periodontal disease is a prevalent chronic inflammatory condition characterised by an aberrant host response to a pathogenic plaque biofilm resulting in local tissue damage and frustrated healing that can result in tooth loss. Cysteine proteases (gingipains) from the key periodontal pathogen Porphyromonas gingivalis have been implicated in periodontal disease pathogenesis by inhibiting inflammation resolution and are linked with systemic chronic inflammatory conditions such as rheumatoid arthritis. Efficient clearance of apoptotic cells is essential for the resolution of inflammation and tissue restoration. Here we sought to characterise the innate immune clearance of apoptotic cells and its modulation by gingipains. We examined the capacity of gingipain-treated macrophages to migrate towards and phagocytose apoptotic cells. Lysine gingipain treatment of macrophages impaired macrophage migration towards apoptotic neutrophils. Furthermore, lysine gingipain treatment reduced surface expression levels of CD14, a key macrophage receptor for apoptotic cells, which resulted in reduced macrophage interactions with apoptotic cells. Additionally, while apoptotic cells and their derived secretome were shown to inhibit TNF-α-induced expression by P. gingivalis lipopolysaccharide, we demonstrated that gingipain preparations induced a rapid inflammatory response in macrophages that was resistant to the anti-inflammatory effects of apoptotic cells or their secretome. Taken together, these data indicate that P. gingivalis may promote the chronic inflammation seen in periodontal disease patients by multiple mechanisms, including rapid, potent gingipain-mediated inflammation, coupled with receptor cleavage leading to defective clearance of apoptotic cells and reduced anti-inflammatory responses. Thus, gingipains represent a potential therapeutic target for intervention in the management of chronic periodontal disease.

  9. Trade-offs between performance and variability in the escape responses of bluegill sunfish (Lepomis macrochirus)

    PubMed Central

    Hitchcock, Amanda C.; Chen, Tiffany; Connolly, Erin; Darakananda, Karin; Jeong, Janet; Quist, Arbor; Robbins, Allison; Ellerby, David J.

    2015-01-01

    Successful predator evasion is essential to the fitness of many animals. Variation in escape behaviour may be adaptive as it reduces predictability, enhancing escape success. High escape velocities and accelerations also increase escape success, but biomechanical factors likely constrain the behavioural range over which performance can be maximized. There may therefore be a trade-off between variation and performance during escape responses. We have used bluegill sunfish (Lepomis macrochirus) escape responses to examine this potential trade-off, determining the full repertoire of escape behaviour for individual bluegill sunfish and linking this to performance as indicated by escape velocity and acceleration. Fish escapes involve an initial C-bend of the body axis, followed by variable steering movements. These generate thrust and establish the escape direction. Directional changes during the initial C-bend were less variable than the final escape angle, and the most frequent directions were associated with high escape velocity. Significant inter-individual differences in escape angles magnified the overall variation, maintaining unpredictability from a predator perspective. Steering in the latter stages of the escape to establish the final escape trajectory also affected performance, with turns away from the stimulus associated with reduced velocity. This suggests that modulation of escape behaviour by steering may also have an associated performance cost. This has important implications for understanding the scope and control of intra- and inter-individual variation in escape behaviour and the associated costs and benefits. PMID:25910940

  10. Severe apoptotic enteropathy caused by methotrexate treatment for rheumatoid arthritis.

    PubMed

    Toquet, Ségolène; Nguyen, Yohan; Sabbagh, Adel; Djerada, Zoubir; Boulagnon, Camille; Bani-Sadr, Firouzé

    2016-03-01

    The folic acid antagonist methotrexate is a cornerstone treatment of rheumatoid arthritis. Its use is limited chiefly by gastrointestinal toxicity, which is among the main reasons for methotrexate discontinuation. Here, we report the case of a 40-year-old man on chronic methotrexate therapy in whom life-threatening apoptotic enteropathy with watery diarrhea and hypovolemic shock developed after he was switched from the oral to the intramuscular route, with no change in dosage. Colonic biopsies suggested drug-induced colitis, showing a nonspecific, mildly inflammatory infiltrate of lymphocytes and plasma cells, dilated damaged crypts, and a marked increase in basal crypt apoptosis (>20 apoptotic bodies/100 crypts). Clinicians should be aware that methotrexate can cause life-threatening apoptotic enteropathy. Increased basal crypt apoptosis in colonic biopsies with more than 5 apoptotic bodies/100 crypts should routinely suggest drug-induced enteropathy.

  11. Regulation of mammalian horizontal gene transfer by apoptotic DNA fragmentation

    PubMed Central

    Yan, B; Wang, H; Li, F; Li, C-Y

    2006-01-01

    Previously it was shown that horizontal DNA transfer between mammalian cells can occur through the uptake of apoptotic bodies, where genes from the apoptotic cells were transferred to neighbouring cells phagocytosing the apoptotic bodies. The regulation of this process is poorly understood. It was shown that the ability of cells as recipient of horizontally transferred DNA was enhanced by deficiency of p53 or p21. However, little is known with regard to the regulation of DNA from donor apoptotic cells. Here we report that the DNA fragmentation factor/caspase-activated DNase (DFF/CAD), which is the endonuclease responsible for DNA fragmentation during apoptosis, plays a significant role in regulation of horizontal DNA transfer. Cells with inhibited DFF/CAD function are poor donors for horizontal gene transfer (HGT) while their ability of being recipients of HGT is not affected. PMID:17146478

  12. Topological Transitions in Mitochondrial Membranes controlled by Apoptotic Proteins

    NASA Astrophysics Data System (ADS)

    Hwee Lai, Ghee; Sanders, Lori K.; Mishra, Abhijit; Schmidt, Nathan W.; Wong, Gerard C. L.; Ivashyna, Olena; Schlesinger, Paul H.

    2010-03-01

    The Bcl-2 family comprises pro-apoptotic proteins, capable of permeabilizing the mitochondrial membrane, and anti-apoptotic members interacting in an antagonistic fashion to regulate programmed cell death (apoptosis). They offer potential therapeutic targets to re-engage cellular suicide in tumor cells but the extensive network of implicated protein-protein interactions has impeded full understanding of the decision pathway. We show, using synchrotron x-ray diffraction, that pro-apoptotic proteins interact with mitochondrial-like model membranes to generate saddle-splay (negative Gaussian) curvature topologically required for pore formation, while anti-apoptotic proteins can deactivate curvature generation by molecules drastically different from Bcl-2 family members and offer evidence for membrane-curvature mediated interactions general enough to affect very disparate systems.

  13. Zinc Enzymes.

    ERIC Educational Resources Information Center

    Bertini, I.; And Others

    1985-01-01

    Discusses the role of zinc in various enzymes concerned with hydration, hydrolysis, and redox reactions. The binding of zinc to protein residues, properties of noncatalytic zinc(II) and catalytic zinc, and the reactions catalyzed by zinc are among the topics considered. (JN)

  14. Food Enzymes

    ERIC Educational Resources Information Center

    McBroom, Rachel; Oliver-Hoyo, Maria T.

    2007-01-01

    Many students view biology and chemistry as two unrelated, separate sciences; how these courses are generally taught in high schools may do little to change that impression. The study of enzymes provide a great opportunity for both biology and chemistry teachers to share with students the interdisciplinary nature of science. This article describes…

  15. Zinc Enzymes.

    ERIC Educational Resources Information Center

    Bertini, I.; And Others

    1985-01-01

    Discusses the role of zinc in various enzymes concerned with hydration, hydrolysis, and redox reactions. The binding of zinc to protein residues, properties of noncatalytic zinc(II) and catalytic zinc, and the reactions catalyzed by zinc are among the topics considered. (JN)

  16. Engineering enzymes.

    PubMed

    Dutton, P Leslie; Moser, Christopher C

    2011-01-01

    Fundamental research into bioinorganic catalysis of the kind presented at this Faraday Discussion has the potential to turn inspiration drawn from impressive natural energy and chemical transformations into artificial catalyst constructions useful to mankind. Creating bio-inspired artificial constructions requires a level of understanding well beyond simple description of structures and mechanisms of natural enzymes. To be useful, such description must be augmented by a practical sense of structural and energetic engineering tolerances of the mechanism. Significant barriers to achieving an engineering understanding of enzyme mechanisms arise from natural protein complexity. In certain cases we can surmount these barriers to understanding, such as natural electron tunneling, coupling of electron tunneling to light capture and proton exchange as well as simpler bond breaking redox catalysis. Hope for similar solutions of more complex bioinorganic enzymes is indicated in several papers presented in this Discussion. Armed with an engineering understanding of mechanism, the current serious frustrations to successful creation of functional artificial proteins that are rooted in protein complexity can fall away. Here we discuss the genetic and biological roots of protein complexity and show how to dodge and minimize the effects of complexity. In the best-understood cases, artificial enzymes can be designed from scratch using the simplest of protein scaffolds.

  17. Food Enzymes

    ERIC Educational Resources Information Center

    McBroom, Rachel; Oliver-Hoyo, Maria T.

    2007-01-01

    Many students view biology and chemistry as two unrelated, separate sciences; how these courses are generally taught in high schools may do little to change that impression. The study of enzymes provide a great opportunity for both biology and chemistry teachers to share with students the interdisciplinary nature of science. This article describes…

  18. Signals of apoptotic pathways in several types of meningioma.

    PubMed

    Sabbatini, Maurizio; Comi, Cristoforo; Chiocchetti, Annalisa; Piffanelli, Valentina; Car, Pier Giorgio; Dianzani, Umberto; Monaco, Francesco; Cannas, Mario

    2011-03-01

    Meningiomas are intracranial tumour derived from meningothelial cells, which aggressive behaviour has been frequently associated to cell apoptosis. In this paper activation of several factors involved in apoptosis has been investigated on biopsies of primary, non recurrent meningiomas. Benign (meningotheliomatous, transitional, fibrous, angiomatous), atypical and anaplastic meningiomas were analysed by immunohistochemistry and western blot, to visualize the occurring of different apoptotic pathways and their association with clinical grading. Apoptotic cell have been detected by a double colorimetric staining for TUNEL and caspase-3 active form. Apoptotic signal positive cells have been detected in all type of meningiomas analysed, with exception of meningotheliomatous meningiomas. Differences have been found in the activation of apoptotic pathways between several types of grade I meningiomas and among benign, anaplastic and atypical meningiomas. An intense expression of several apoptotic inhibitor occurred in grade I meningiomas. The correlation among expression of apoptotic and inhibitory factors and cell proliferation index may suggest that in grade I meningiomas apoptosis may be related to mechanisms involved into tumor cells surviving. Instead in grade II and III meningiomas the same correlation seems indicate an high turnover of tumor cells that might be useful as index of cell proliferation and tumor mass growth.

  19. Apoptotic cell death in rat epididymis following epichlorohydrin treatment.

    PubMed

    Lee, I-C; Kim, K-H; Kim, S-H; Baek, H-S; Moon, C; Kim, S-H; Yun, W-K; Nam, K-H; Kim, H-C; Kim, J-C

    2013-06-01

    Epichlorohydrin (ECH) is an antifertility agent that acts both as an epididymal toxicant and an agent capable of directly affecting sperm motility. This study identified the time course of apoptotic cell death in rat epididymides after ECH treatment. Rats were administrated with a single oral dose of ECH (50 mg/kg). ECH-induced apoptotic changes were evaluated by terminal deoxynucleotidyl transferase dUTP nick end labeling (TUNEL) assay and its related mechanism was confirmed by Western blot analysis and colorimetric assay. The TUNEL assay showed that the number of apoptotic cells increased at 8 h, reached a maximum level at 12 h, and then decreased progressively. The Western blot analysis demonstrated no significant changes in proapoptotic Bcl-2-associated X (Bax) and anti-apoptotic Bcl-2 expression during the time course of the study. However, phospho-p38 mitogen-activated protein kinase (p-p38 MAPK) and phospho-c-Jun amino-terminal kinase (p-JNK) expression increased at 8-24 h. Caspase-3 and caspase-8 activities also increased at 8-48 h and 12-48 h, respectively, in the same manner as p-p38 MAPK and p-JNK expression. These results indicate that ECH induced apoptotic changes in rat epididymides and that the apoptotic cell death may be related more to the MAPK pathway than to the mitochondrial pathway.

  20. Signaling pathway for phagocyte priming upon encounter with apoptotic cells.

    PubMed

    Nonaka, Saori; Ando, Yuki; Kanetani, Takuto; Hoshi, Chiharu; Nakai, Yuji; Nainu, Firzan; Nagaosa, Kaz; Shiratsuchi, Akiko; Nakanishi, Yoshinobu

    2017-05-12

    The phagocytic elimination of cells undergoing apoptosis is an evolutionarily conserved innate immune mechanism for eliminating unnecessary cells. Previous studies showed an increase in the level of engulfment receptors in phagocytes after the phagocytosis of apoptotic cells, which leads to the enhancement of their phagocytic activity. However, precise mechanisms underlying this phenomenon require further clarification. We found that the pre-incubation of a Drosophila phagocyte cell line with the fragments of apoptotic cells enhanced the subsequent phagocytosis of apoptotic cells, accompanied by an augmented expression of the engulfment receptors Draper and integrin αPS3. The DNA-binding activity of the transcription repressor Tailless was transiently raised in those phagocytes, depending on two partially overlapping signal-transduction pathways for the induction of phagocytosis as well as the occurrence of engulfment. The RNAi knockdown of tailless in phagocytes abrogated the enhancement of both phagocytosis and engulfment receptor expression. Furthermore, the hemocyte-specific RNAi of tailless reduced apoptotic cell clearance in Drosophila embryos. Taken together, we propose the following mechanism for the activation of Drosophila phagocytes after an encounter with apoptotic cells: two partially overlapping signal-transduction pathways for phagocytosis are initiated; transcription repressor Tailless is activated; expression of engulfment receptors is stimulated; and phagocytic activity is enhanced. This phenomenon most likely ensures the phagocytic elimination of apoptotic cells by stimulated phagocytes and is thus considered as a mechanism to prime phagocytes in innate immunity. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  1. Apoptotic pathways as a therapeutic target for colorectal cancer treatment.

    PubMed

    Abraha, Aman M; Ketema, Ezra B

    2016-08-15

    Colorectal cancer is the second leading cause of death from cancer among adults. The disease begins as a benign adenomatous polyp, which develops into an advanced adenoma with high-grade dysplasia and then progresses to an invasive cancer. Appropriate apoptotic signaling is fundamentally important to preserve a healthy balance between cell death and cell survival and in maintaining genome integrity. Evasion of apoptotic pathway has been established as a prominent hallmark of several cancers. During colorectal cancer development, the balance between the rates of cell growth and apoptosis that maintains intestinal epithelial cell homeostasis gets progressively disturbed. Evidences are increasingly available to support the hypothesis that failure of apoptosis may be an important factor in the evolution of colorectal cancer and its poor response to chemotherapy and radiation. The other reason for targeting apoptotic pathway in the treatment of cancer is based on the observation that this process is deregulated in cancer cells but not in normal cells. As a result, colorectal cancer therapies designed to stimulate apoptosis in target cells would play a critical role in controlling its development and progression. A better understanding of the apoptotic signaling pathways, and the mechanisms by which cancer cells evade apoptotic death might lead to effective therapeutic strategies to inhibit cancer cell proliferation with minimal toxicity and high responses to chemotherapy. In this review, we analyzed the current understanding and future promises of apoptotic pathways as a therapeutic target in colorectal cancer treatment.

  2. Human CD14 mediates recognition and phagocytosis of apoptotic cells.

    PubMed

    Devitt, A; Moffatt, O D; Raykundalia, C; Capra, J D; Simmons, D L; Gregory, C D

    1998-04-02

    Cells undergoing programmed cell death (apoptosis) are cleared rapidly in vivo by phagocytes without inducing inflammation. Here we show that the glycosylphosphatidylinositol-linked plasma-membrane glycoprotein CD14 on the surface of human macrophages is important for the recognition and clearance of apoptotic cells. CD14 can also act as a receptor that binds bacterial lipopolysaccharide (LPS), triggering inflammatory responses. Overstimulation of CD14 by LPS can cause the often fatal toxic-shock syndrome. Here we show that apoptotic cells interact with CD14, triggering phagocytosis of the apoptotic cells. This interaction depends on a region of CD14 that is identical to, or at least closely associated with, a region known to bind LPS. However, apoptotic cells, unlike LPS, do not provoke the release of pro-inflammatory cytokines from macrophages. These results indicate that clearance of apoptotic cells is mediated by a receptor whose interactions with 'non-self' components (LPS) and 'self' components (apoptotic cells) produce distinct macrophage responses.

  3. Cytosolic pro-apoptotic SPIKE induces mitochondrial apoptosis in cancer.

    PubMed

    Nikolic, Ivana; Kastratovic, Tatjana; Zelen, Ivanka; Zivanovic, Aleksandar; Arsenijevic, Slobodan; Mitrovic, Marina

    2010-04-30

    Proteins of the BCL-2 family are important regulators of apoptosis. The BCL-2 family includes three main subgroups: the anti-apoptotic group, such as BCL-2, BCL-XL, BCL-W, and MCL-1; multi-domain pro-apoptotic BAX, BAK; and pro-apoptotic "BH3-only" BIK, PUMA, NOXA, BID, BAD, and SPIKE. SPIKE, a rare pro-apoptotic protein, is highly conserved throughout the evolution, including Caenorhabditis elegans, whose expression is downregulated in certain tumors, including kidney, lung, and breast. In the literature, SPIKE was proposed to interact with BAP31 and prevent BCL-XL from binding to BAP31. Here, we utilized the Position Weight Matrix method to identify SPIKE to be a BH3-only pro-apoptotic protein mainly localized in the cytosol of all cancer cell lines tested. Overexpression of SPIKE weakly induced apoptosis in comparison to the known BH3-only pro-apoptotic protein BIK. SPIKE promoted mitochondrial cytochrome c release, the activation of caspase 3, and the caspase cleavage of caspase's downstream substrates BAP31 and p130CAS. Although the informatics analysis of SPIKE implicates this protein as a member of the BH3-only BCL-2 subfamily, its role in apoptosis remains to be elucidated.

  4. Oxygen or carbogen breathing before simulated submarine escape.

    PubMed

    Gennser, M; Blogg, S L

    2008-01-01

    Raised internal pressure in a distressed submarine increases the risk of bubble formation and decompression illness after submarine escape. The hypothesis that short periods of oxygen breathing before submarine escape would reduce decompression stress was tested, using Doppler-detectable venous gas emboli as a measure. Twelve goats breathed oxygen for 15 min at 0.1 MPa before exposure to a simulated submarine escape profile to and from 2.5 MPa (240 m/seawater), whereas 28 control animals underwent the same dive without oxygen prebreathe. No decompression sickness (DCS) occurred in either of these two groups. Time with high bubble scores (Kisman-Masurel >or=3) was significantly (P < 0.001) shorter in the prebreathe group. In a second series, 30 goats breathed air at 0.2 MPa for 6 h. Fifteen minutes before escape from 2.5 MPa, animals were provided with either air (n = 10), oxygen (n = 12), or carbogen (97.5% O(2) and 2.5% CO(2)) gas (n = 8) as breathing gas. Animals breathed a hyperoxic gas (60% O(2)-40% N(2)) during the escape. Two animals (carbogen group) suffered oxygen convulsions during the escape but recovered on surfacing. Only one case of DCS occurred (carbogen group). The initial bubble score was reduced in the oxygen group (P < 0.001). The period with bubble score of Kisman-Masurel >or=3 was also significantly reduced in the oxygen group (P < 0.001). Oxygen breathing before submarine escape reduces initial bubble scores, although its significance in reducing central nervous system DCS needs to be investigated further.

  5. Green Pea Galaxies Reveal Secrets of Lyα Escape

    NASA Astrophysics Data System (ADS)

    Yang, Huan; Malhotra, Sangeeta; Gronke, Max; Rhoads, James E.; Jaskot, Anne; Zheng, Zhenya; Dijkstra, Mark; Wang, JunXian

    2016-01-01

    In star-forming galaxies, a lot of Lyα photons were generated in HII regions surrounding massive stars. The escape of Lyα photons from galaxies is a key issue in studying high redshift galaxies and probing cosmic reionization with Lyα. To understand Lyα escape, it is valuable to study high quality Lyα profiles in Lyα emitters. However, such studies are rare due to the faintness of high-z Lyα emitters and the lack of local analogs with high Lyα equivalent width. Here we show that "Green Pea" galaxies are the best local analogs of high-z Lyα emitters and their high quality Lyα profiles demonstrate low HI column density is the key to Lyα escape. The Lyα escape fraction shows correlations with the ratio of Lyα blue peak velocity to Hα line width, the normalized flux density at valley of Lyα profile, and a few other features of Lyα profiles. We compared the Lyα profiles with outflowing HI shell radiative transfer model and found that the best-fit HI column density is anti-correlated with the Lyα escape fraction. We also found an anti-correlation between Lyα escape fraction and galactic metallicity. Our results support that LAEs with high Lyα escape fraction have low metallicity, low HI column density, and mild HI gas outflow.

  6. 42 CFR 84.300 - Closed-circuit escape respirator; description.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 42 Public Health 1 2014-10-01 2014-10-01 false Closed-circuit escape respirator; description. 84... Closed-Circuit Escape Respirators § 84.300 Closed-circuit escape respirator; description. The closed-circuit escape respirator (CCER), technically a subset of self-contained breathing apparatus (SCBAs) which...

  7. 42 CFR 84.300 - Closed-circuit escape respirator; description.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 42 Public Health 1 2013-10-01 2013-10-01 false Closed-circuit escape respirator; description. 84... Closed-Circuit Escape Respirators § 84.300 Closed-circuit escape respirator; description. The closed-circuit escape respirator (CCER), technically a subset of self-contained breathing apparatus (SCBAs) which...

  8. Alterations in oxidative, inflammatory and apoptotic events in short-lived and long-lived mice testes

    PubMed Central

    Matzkin, María Eugenia; Miquet, Johanna Gabriela; Fang, Yimin; Hill, Cristal Monique; Turyn, Daniel; Calandra, Ricardo Saúl; Bartke, Andrzej; Frungieri, Mónica Beatriz

    2016-01-01

    Aged testes undergo profound histological and morphological alterations leading to a reduced functionality. Here, we investigated whether variations in longevity affect the development of local inflammatory processes, the oxidative state and the occurrence of apoptotic events in the testis. To this aim, well-established mouse models with delayed (growth hormone releasing hormone-knockout and Ames dwarf mice) or accelerated (growth hormone-transgenic mice) aging were used. We hereby show that the testes of short-lived mice show a significant increase in cyclooxygenase 2 expression, PGD2 production, lipid peroxidation, antioxidant enzymes expression, local macrophages and TUNEL-positive germ cells numbers, and the levels of both pro-caspase-3 and cleaved caspase-3. In contrast, although the expression of antioxidant enzymes remained unchanged in testes of long-lived mice, the remainder of the parameters assessed showed a significant reduction. This study provides novel evidence that longevity confers anti-inflammatory, anti-oxidant and anti-apoptotic capacities to the adult testis. Oppositely, short-lived mice suffer testicular inflammatory, oxidative and apoptotic processes. PMID:26805572

  9. An inhibitory mono-ubiquitylation of the Drosophila initiator caspase Dronc functions in both apoptotic and non-apoptotic pathways

    PubMed Central

    Ditzel, Mark; Meier, Pascal

    2017-01-01

    Apoptosis is an evolutionary conserved cell death mechanism, which requires activation of initiator and effector caspases. The Drosophila initiator caspase Dronc, the ortholog of mammalian Caspase-2 and Caspase-9, has an N-terminal CARD domain that recruits Dronc into the apoptosome for activation. In addition to its role in apoptosis, Dronc also has non-apoptotic functions such as compensatory proliferation. One mechanism to control the activation of Dronc is ubiquitylation. However, the mechanistic details of ubiquitylation of Dronc are less clear. For example, monomeric inactive Dronc is subject to non-degradative ubiquitylation in living cells, while ubiquitylation of active apoptosome-bound Dronc triggers its proteolytic degradation in apoptotic cells. Here, we examined the role of non-degradative ubiquitylation of Dronc in living cells in vivo, i.e. in the context of a multi-cellular organism. Our in vivo data suggest that in living cells Dronc is mono-ubiquitylated on Lys78 (K78) in its CARD domain. This ubiquitylation prevents activation of Dronc in the apoptosome and protects cells from apoptosis. Furthermore, K78 ubiquitylation plays an inhibitory role for non-apoptotic functions of Dronc. We provide evidence that not all of the non-apoptotic functions of Dronc require its catalytic activity. In conclusion, we demonstrate a mechanism whereby Dronc’s apoptotic and non-apoptotic activities can be kept silenced in a non-degradative manner through a single ubiquitylation event in living cells. PMID:28207763

  10. MAVEN measurements of photochemical escape of oxygen from the Martian atmosphere

    NASA Astrophysics Data System (ADS)

    Lillis, R. J.; Deighan, J.; Fox, J. L.; Bougher, S. W.; Cravens, T. E.; Lee, Y.; Mahaffy, P. R.; Benna, M.; Elrod, M. K.; Andersson, L.; McFadden, J.

    2015-10-01

    One of the primary goals of the Mars Atmosphere and Volatile Evolution Mission (MAVEN) mission is to characterize rates of atmospheric escape at the present epoch and relate those escape rates to solar drivers [1]. One of the major escape processes is known as photochemical escape, which is broadly defined as a process by which a) an exothermic reaction in the atmosphere/ionosphere results in an upward-traveling neutral particle whose velocity exceeds planetary escape velocity and b) the particle is not prevented from escaping through any subsequent collisions[2].At Mars, photochemical escape of oxygen is expected to be a significant channel for atmospheric escape, particularly in the early solar system when extreme ultraviolet (EUV) fluxes were much higher[3]. Thus characterizing this escape process is central to understanding the role escape to space has played in Mars' climate evolution.

  11. Structural controls on fluid escape from the subduction interface

    NASA Astrophysics Data System (ADS)

    Reynard, Bruno; Tauzin, Benoit; Bodin, Thomas; Perrillat, Jean-Philippe; Debayle, Eric

    2017-04-01

    Seismic activity and non-volcanic tremors are often associated with fluid circulation resulting from the dehydration of subducting plates. Tremors in the overriding continental crust of several subduction zones suggest fluid circulation at shallower depths, but potential fluid pathways are still poorly documented. Fluids are also released at different depths in hot and cold subduction zones, which may result in different schemes of fluid escape. We document potential fluid pathways in Cascadia, one of the hottest subduction zone, using receiver function analysis. We provide evidence for a seismic discontinuity near 15 km depth in the crust of the overriding North American plate. This interface is segmented, and its interruptions are spatially correlated with conductive regions of the forearc and shallow swarms of seismicity and non-volcanic tremors. The comparison of seismological and electrical conductivity profiles suggests that fluid escape is controlled by fault zones between blocks of accreted terranes in the overriding plate. These zones constitute fluid escape routes that may influence the seismic cycle by releasing fluid pressure from the megathrust. Results on Cascadia are compared to fluid escape routes suggested by former geophysical observations in NE Japan, one of the coldest subduction zones. Links between fluid escape, permeability and fluid-rock reactions at or above the plate interface are discussed.

  12. History of oxygen and carbon escape from the Martian atmosphere

    NASA Technical Reports Server (NTRS)

    Luhmann, J. G.; Zhang, M. H. G.; Johnson, R. E.; Bougher, S. W.; Nagy, A. F.

    1992-01-01

    A fraction of the oxygen in the Martian atmosphere continually escapes to space because dissociative recombination of the O2(+) ions in the ionosphere can impart sufficient energy to the product O atoms. In addition, ionization of the extended atomic oxygen corona resulting from the above process adds to escape since the solar wind can carry away O(+) ions born above a few hundred km altitude. A further by-product of this ion-pickup by the solar wind is an additional population of escaping oxygen atoms that are sputtered from the atmosphere near the exobase by pickup ions that are on reentry rather than escaping trajectories. This sputtering process can also remove carbon in the form of intact or dissociated CO2 since all atoms and molecules in the 'target' gas are subject to the collisional energy transfer that characterizes sputtering. We have estimated the present rates of escape of oxygen and carbon due to these mechanisms, as well as the rates at several epochs in the history of the solar system.

  13. Inferring HIV Escape Rates from Multi-Locus Genotype Data

    SciTech Connect

    Kessinger, Taylor A.; Perelson, Alan S.; Neher, Richard A.

    2013-09-03

    Cytotoxic T-lymphocytes (CTLs) recognize viral protein fragments displayed by major histocompatibility complex molecules on the surface of virally infected cells and generate an anti-viral response that can kill the infected cells. Virus variants whose protein fragments are not efficiently presented on infected cells or whose fragments are presented but not recognized by CTLs therefore have a competitive advantage and spread rapidly through the population. We present a method that allows a more robust estimation of these escape rates from serially sampled sequence data. The proposed method accounts for competition between multiple escapes by explicitly modeling the accumulation of escape mutations and the stochastic effects of rare multiple mutants. Applying our method to serially sampled HIV sequence data, we estimate rates of HIV escape that are substantially larger than those previously reported. The method can be extended to complex escapes that require compensatory mutations. We expect our method to be applicable in other contexts such as cancer evolution where time series data is also available.

  14. Enhancing Endosomal Escape for Intracellular Delivery of Macromolecular Biologic Therapeutics

    PubMed Central

    Lönn, Peter; Kacsinta, Apollo D.; Cui, Xian-Shu; Hamil, Alexander S.; Kaulich, Manuel; Gogoi, Khirud; Dowdy, Steven F.

    2016-01-01

    Bioactive macromolecular peptides and oligonucleotides have significant therapeutic potential. However, due to their size, they have no ability to enter the cytoplasm of cells. Peptide/Protein transduction domains (PTDs), also called cell-penetrating peptides (CPPs), can promote uptake of macromolecules via endocytosis. However, overcoming the rate-limiting step of endosomal escape into the cytoplasm remains a major challenge. Hydrophobic amino acid R groups are known to play a vital role in viral escape from endosomes. Here we utilize a real-time, quantitative live cell split-GFP fluorescence complementation phenotypic assay to systematically analyze and optimize a series of synthetic endosomal escape domains (EEDs). By conjugating EEDs to a TAT-PTD/CPP spilt-GFP peptide complementation assay, we were able to quantitatively measure endosomal escape into the cytoplasm of live cells via restoration of GFP fluorescence by intracellular molecular complementation. We found that EEDs containing two aromatic indole rings or one indole ring and two aromatic phenyl groups at a fixed distance of six polyethylene glycol (PEG) units from the TAT-PTD-cargo significantly enhanced cytoplasmic delivery in the absence of cytotoxicity. EEDs address the critical rate-limiting step of endosomal escape in delivery of macromolecular biologic peptide, protein and siRNA therapeutics into cells. PMID:27604151

  15. Enhancing Endosomal Escape for Intracellular Delivery of Macromolecular Biologic Therapeutics.

    PubMed

    Lönn, Peter; Kacsinta, Apollo D; Cui, Xian-Shu; Hamil, Alexander S; Kaulich, Manuel; Gogoi, Khirud; Dowdy, Steven F

    2016-09-08

    Bioactive macromolecular peptides and oligonucleotides have significant therapeutic potential. However, due to their size, they have no ability to enter the cytoplasm of cells. Peptide/Protein transduction domains (PTDs), also called cell-penetrating peptides (CPPs), can promote uptake of macromolecules via endocytosis. However, overcoming the rate-limiting step of endosomal escape into the cytoplasm remains a major challenge. Hydrophobic amino acid R groups are known to play a vital role in viral escape from endosomes. Here we utilize a real-time, quantitative live cell split-GFP fluorescence complementation phenotypic assay to systematically analyze and optimize a series of synthetic endosomal escape domains (EEDs). By conjugating EEDs to a TAT-PTD/CPP spilt-GFP peptide complementation assay, we were able to quantitatively measure endosomal escape into the cytoplasm of live cells via restoration of GFP fluorescence by intracellular molecular complementation. We found that EEDs containing two aromatic indole rings or one indole ring and two aromatic phenyl groups at a fixed distance of six polyethylene glycol (PEG) units from the TAT-PTD-cargo significantly enhanced cytoplasmic delivery in the absence of cytotoxicity. EEDs address the critical rate-limiting step of endosomal escape in delivery of macromolecular biologic peptide, protein and siRNA therapeutics into cells.

  16. History of oxygen and carbon escape from the Martian atmosphere

    NASA Technical Reports Server (NTRS)

    Luhmann, J. G.; Zhang, M. H. G.; Johnson, R. E.; Bougher, S. W.; Nagy, A. F.

    1992-01-01

    A fraction of the oxygen in the Martian atmosphere continually escapes to space because dissociative recombination of the O2(+) ions in the ionosphere can impart sufficient energy to the product O atoms. In addition, ionization of the extended atomic oxygen corona resulting from the above process adds to escape since the solar wind can carry away O(+) ions born above a few hundred km altitude. A further by-product of this ion-pickup by the solar wind is an additional population of escaping oxygen atoms that are sputtered from the atmosphere near the exobase by pickup ions that are on reentry rather than escaping trajectories. This sputtering process can also remove carbon in the form of intact or dissociated CO2 since all atoms and molecules in the 'target' gas are subject to the collisional energy transfer that characterizes sputtering. We have estimated the present rates of escape of oxygen and carbon due to these mechanisms, as well as the rates at several epochs in the history of the solar system.

  17. Inferring HIV Escape Rates from Multi-Locus Genotype Data

    DOE PAGES

    Kessinger, Taylor A.; Perelson, Alan S.; Neher, Richard A.

    2013-09-03

    Cytotoxic T-lymphocytes (CTLs) recognize viral protein fragments displayed by major histocompatibility complex molecules on the surface of virally infected cells and generate an anti-viral response that can kill the infected cells. Virus variants whose protein fragments are not efficiently presented on infected cells or whose fragments are presented but not recognized by CTLs therefore have a competitive advantage and spread rapidly through the population. We present a method that allows a more robust estimation of these escape rates from serially sampled sequence data. The proposed method accounts for competition between multiple escapes by explicitly modeling the accumulation of escape mutationsmore » and the stochastic effects of rare multiple mutants. Applying our method to serially sampled HIV sequence data, we estimate rates of HIV escape that are substantially larger than those previously reported. The method can be extended to complex escapes that require compensatory mutations. We expect our method to be applicable in other contexts such as cancer evolution where time series data is also available.« less

  18. Single-File Escape of Colloidal Particles from Microfluidic Channels

    NASA Astrophysics Data System (ADS)

    Locatelli, Emanuele; Pierno, Matteo; Baldovin, Fulvio; Orlandini, Enzo; Tan, Yizhou; Pagliara, Stefano

    2016-07-01

    Single-file diffusion is a ubiquitous physical process exploited by living and synthetic systems to exchange molecules with their environment. It is paramount to quantify the escape time needed for single files of particles to exit from constraining synthetic channels and biological pores. This quantity depends on complex cooperative effects, whose predominance can only be established through a strict comparison between theory and experiments. By using colloidal particles, optical manipulation, microfluidics, digital microscopy, and theoretical analysis we uncover the self-similar character of the escape process and provide closed-formula evaluations of the escape time. We find that the escape time scales inversely with the diffusion coefficient of the last particle to leave the channel. Importantly, we find that at the investigated microscale, bias forces as tiny as 10-15 N determine the magnitude of the escape time by drastically reducing interparticle collisions. Our findings provide crucial guidelines to optimize the design of micro- and nanodevices for a variety of applications including drug delivery, particle filtering, and transport in geometrical constrictions.

  19. THE ESCAPE FRACTION OF IONIZING RADIATION FROM GALAXIES

    SciTech Connect

    Benson, Andrew; Venkatesan, Aparna; Shull, J. Michael E-mail: avenkatesan@usfca.edu

    2013-06-10

    The escape of ionizing radiation from galaxies plays a critical role in the evolution of gas in galaxies, and the heating and ionization history of the intergalactic medium. We present semi-analytic calculations of the escape fraction of ionizing radiation for both hydrogen and helium from galaxies ranging from primordial systems to disk-type galaxies that are not heavily dust-obscured. We consider variations in the galaxy density profile, source type, location, and spectrum, and gas overdensity/distribution factors. For sufficiently hard first-light sources, the helium ionization fronts closely track or advance beyond that of hydrogen. Key new results in this work include calculations of the escape fractions for He I and He II ionizing radiation, and the impact of partial ionization from X-rays from early active galactic nuclei or stellar clusters on the escape fractions from galaxy halos. When factoring in frequency-dependent effects, we find that X-rays play an important role in boosting the escape fractions for both hydrogen and helium, but especially for He II. We briefly discuss the implications of these results for recent observations of the He II reionization epoch at low redshifts, as well as the UV data and emission-line signatures from early galaxies anticipated from future satellite missions.

  20. Loss of water from Venus. I - Hydrodynamic escape of hydrogen

    NASA Technical Reports Server (NTRS)

    Kasting, J. F.; Pollack, J. B.

    1983-01-01

    A one-dimensional photochemical-dynamic model is used to study hydrodynamic loss of hydrogen from a primitive, water-rich atmosphere on Venus. The escape flux is calculated as a function of the H2O mixing ratio at the atmospheric cold trap. The cold trap mixing ratio is then related in an approximate fashion to the H2O concentration in the lower atmosphere. Hydrodynamic escape should have been the dominant loss process for hydroogen when the H2O mass mixing ratio in the lower atmosphere exceeded approximately 0.1. The escape rate would have depended upon the magnitude of the solar ultraviolet flux and the atmospheric EUV heating efficiency and, to a lesser extent, on the O2 content of the atmosphere. The time required for Venus to have lost the bulk of a terrestrial ocean of water is on the order of a billion years. Deuterium would have been swept away along with hydrogen if the escape rate was high enough, but some D/H enrichment should have occurred as the escape rate slowed down.

  1. Single-File Escape of Colloidal Particles from Microfluidic Channels.

    PubMed

    Locatelli, Emanuele; Pierno, Matteo; Baldovin, Fulvio; Orlandini, Enzo; Tan, Yizhou; Pagliara, Stefano

    2016-07-15

    Single-file diffusion is a ubiquitous physical process exploited by living and synthetic systems to exchange molecules with their environment. It is paramount to quantify the escape time needed for single files of particles to exit from constraining synthetic channels and biological pores. This quantity depends on complex cooperative effects, whose predominance can only be established through a strict comparison between theory and experiments. By using colloidal particles, optical manipulation, microfluidics, digital microscopy, and theoretical analysis we uncover the self-similar character of the escape process and provide closed-formula evaluations of the escape time. We find that the escape time scales inversely with the diffusion coefficient of the last particle to leave the channel. Importantly, we find that at the investigated microscale, bias forces as tiny as 10^{-15}  N determine the magnitude of the escape time by drastically reducing interparticle collisions. Our findings provide crucial guidelines to optimize the design of micro- and nanodevices for a variety of applications including drug delivery, particle filtering, and transport in geometrical constrictions.

  2. Enhancing endosomal escape for nanoparticle mediated siRNA delivery

    NASA Astrophysics Data System (ADS)

    Ma, Da

    2014-05-01

    Gene therapy with siRNA is a promising biotechnology to treat cancer and other diseases. To realize siRNA-based gene therapy, a safe and efficient delivery method is essential. Nanoparticle mediated siRNA delivery is of great importance to overcome biological barriers for systemic delivery in vivo. Based on recent discoveries, endosomal escape is a critical biological barrier to be overcome for siRNA delivery. This feature article focuses on endosomal escape strategies used for nanoparticle mediated siRNA delivery, including cationic polymers, pH sensitive polymers, calcium phosphate, and cell penetrating peptides. Work has been done to develop different endosomal escape strategies based on nanoparticle types, administration routes, and target organ/cell types. Also, enhancement of endosomal escape has been considered along with other aspects of siRNA delivery to ensure target specific accumulation, high cell uptake, and low toxicity. By enhancing endosomal escape and overcoming other biological barriers, great progress has been achieved in nanoparticle mediated siRNA delivery.

  3. The DAP kinase family of pro-apoptotic proteins: novel players in the apoptotic game.

    PubMed

    Kögel, D; Prehn, J H; Scheidtmann, K H

    2001-04-01

    The DAP (Death Associated Protein) kinase family is a novel subfamily of pro-apoptotic serine/threonine kinases. All five DAP kinase family members identified to date are ubiquitously expressed in various tissues and are capable of inducing apoptosis. The sequence homology of the five kinases is largely restricted to the N-terminal kinase domain. In contrast, the adjacent C-terminal regions are very diverse and link individual family members to specific signal transduction pathways. There is increasing evidence that DAP kinase family members are involved in both extrinsic and intrinsic pathways of apoptosis and may play a role in tumor progression. This review will focus on structural composition and subcellular localization of DAP kinase family members and on signal transduction pathways leading to their activation. Potential mechanisms of DAP kinase family-mediated apoptosis will be discussed. BioEssays 23:352-358, 2001. Copyright 2001 John Wiley & Sons, Inc.

  4. Surface code—biophysical signals for apoptotic cell clearance

    NASA Astrophysics Data System (ADS)

    Biermann, Mona; Maueröder, Christian; Brauner, Jan M.; Chaurio, Ricardo; Janko, Christina; Herrmann, Martin; Muñoz, Luis E.

    2013-12-01

    Apoptotic cell death and the clearance of dying cells play an important and physiological role in embryonic development and normal tissue turnover. In contrast to necrosis, apoptosis proceeds in an anti-inflammatory manner. It is orchestrated by the timed release and/or exposure of so-called ‘find-me’, ‘eat me’ and ‘tolerate me’ signals. Mononuclear phagocytes are attracted by various ‘find-me’ signals, including proteins, nucleotides, and phospholipids released by the dying cell, whereas the involvement of granulocytes is prevented via ‘stay away’ signals. The exposure of anionic phospholipids like phosphatidylserine (PS) by apoptotic cells on the outer leaflet of the plasma membrane is one of the main ‘eat me’ signals. PS is recognized by a number of innate receptors as well as by soluble bridging molecules on the surface of phagocytes. Importantly, phagocytes are able to discriminate between viable and apoptotic cells both exposing PS. Due to cytoskeleton remodeling PS has a higher lateral mobility on the surfaces of apoptotic cells thereby promoting receptor clustering on the phagocyte. PS not only plays an important role in the engulfment process, but also acts as ‘tolerate me’ signal inducing the release of anti-inflammatory cytokines by phagocytes. An efficient and fast clearance of apoptotic cells is required to prevent secondary necrosis and leakage of intracellular danger signals into the surrounding tissue. Failure or prolongation of the clearance process leads to the release of intracellular antigens into the periphery provoking inflammation and development of systemic inflammatory autoimmune disease like systemic lupus erythematosus. Here we review the current findings concerning apoptosis-inducing pathways, important players of apoptotic cell recognition and clearance as well as the role of membrane remodeling in the engulfment of apoptotic cells by phagocytes.

  5. Potential of apoptotic pathway-targeted cancer therapeutic research: Where do we stand?

    PubMed

    Baig, S; Seevasant, I; Mohamad, J; Mukheem, A; Huri, H Z; Kamarul, T

    2016-01-14

    Underneath the intricacy of every cancer lies mysterious events that impel the tumour cell and its posterity into abnormal growth and tissue invasion. Oncogenic mutations disturb the regulatory circuits responsible for the governance of versatile cellular functions, permitting tumour cells to endure deregulated proliferation, resist to proapoptotic insults, invade and erode normal tissues and above all escape apoptosis. This disruption of apoptosis has been highly implicated in various malignancies and has been exploited as an anticancer strategy. Owing to the fact that apoptosis causes minimal inflammation and damage to the tissue, apoptotic cell death-based therapy has been the centre of attraction for the development of anticancer drugs. Increased understanding of the molecular pathways underlying apoptosis has enabled scientists to establish unique approaches targeting apoptosis pathways in cancer therapeutics. In this review, we reconnoitre the two major pathways (intrinsic and extrinsic) targeted cancer therapeutics, steering toward chief modulators of these pathways, such as B-cell lymphoma 2 protein family members (pro- and antiapoptotic), inhibitor of apoptosis proteins, and the foremost thespian of extrinsic pathway regulator, tumour necrosis factor-related apoptosis-inducing agent. Together, we also will have a look from clinical perspective to address the agents (drugs) and therapeutic strategies adopted to target these specific proteins/pathways that have entered clinical trials.

  6. Mean escape time in a system with stochastic volatility

    NASA Astrophysics Data System (ADS)

    Bonanno, Giovanni; Valenti, Davide; Spagnolo, Bernardo

    2007-01-01

    We study the mean escape time in a market model with stochastic volatility. The process followed by the volatility is the Cox, Ingersoll, and Ross process which is widely used to model stock price fluctuations. The market model can be considered as a generalization of the Heston model, where the geometric Brownian motion is replaced by a random walk in the presence of a cubic nonlinearity. We investigate the statistical properties of the escape time of the returns, from a given interval, as a function of the three parameters of the model. We find that the noise can have a stabilizing effect on the system, as long as the global noise is not too high with respect to the effective potential barrier experienced by a fictitious Brownian particle. We compare the probability density function of the return escape times of the model with those obtained from real market data. We find that they fit very well.

  7. Coexisting chaotic and periodic dynamics in clock escapements.

    PubMed

    Moon, Francis C; Stiefel, Preston D

    2006-09-15

    This paper addresses the nature of noise in machines. As a concrete example, we examine the dynamics of clock escapements from experimental, historical and analytical points of view. Experiments on two escapement mechanisms from the Reuleaux kinematic collection at Cornell University are used to illustrate chaotic-like noise in clocks. These vibrations coexist with the periodic dynamics of the balance wheel or pendulum. A mathematical model is presented that shows how self-generated chaos in clocks can break the dry friction in the gear train. This model is shown to exhibit a strange attractor in the structural vibration of the clock. The internal feedback between the oscillator and the escapement structure is similar to anti-control of chaos models.

  8. Social escape behaviors in children with fragile X syndrome.

    PubMed

    Hall, Scott; DeBernardis, Marie; Reiss, Allan

    2006-10-01

    Social escape behavior is a common behavioral feature of individuals with fragile X syndrome (fraX). In this observational study, we examined the effect of antecedent social and performance demands on problem behaviors in four conditions: face-to-face interview, silent reading, oral reading and a singing task. Results showed that problem behaviors were significantly more likely to occur during the interview and singing conditions. Higher levels of salivary cortisol were predictive of higher levels of fidgeting behavior and lower levels of eye contact in male participants. There were no associations between level of FMRP expression and social escape behaviors. These data suggest that specific antecedent biological and environmental factors evoke social escape behaviors in fragile X syndrome.

  9. Kramers escape of a self-propelled particle

    NASA Astrophysics Data System (ADS)

    Geiseler, Alexander; Hänggi, Peter; Schmid, Gerhard

    2016-08-01

    We investigate the escape rate of an overdamped, self-propelled spherical Brownian particle on a surface from a metastable potential well. Within a modeling in terms of a 1D constant speed of the particle's active dynamics we consider the associated rate using both numerical and analytical approaches. Regarding the properties of the stationary state in the potential well, two major timescales exist, each governing the translational and the rotational dynamics of the particle, respectively. The particle radius is identified to present the essential quantity in charge of regulating the ratio between those timescales. For very small and very large particle radii, approximate analytic expressions for the particle's escape rate can be derived, which, within their respective range of validity, compare favorably with the precise escape numerics of the underlying full two-dimensional Fokker-Planck description.

  10. Behavior of Ants Escaping from a Single-Exit Room

    PubMed Central

    Wang, Shujie; Lv, Wei; Song, Weiguo

    2015-01-01

    To study the rules of ant behavior and group-formation phenomena, we examined the behaviors of Camponotus japonicus, a species of large ant, in a range of situations. For these experiments, ants were placed inside a rectangular chamber with a single exit that also contained a filter paper soaked in citronella oil, a powerful repellent. The ants formed several groups as they moved toward the exit to escape. We measured the time intervals between individual escapes in six versions of the experiment, each containing an exit of a different width, to quantify the movement of the groups. As the ants exited the chamber, the time intervals between individual escapes changed and the frequency distribution of the time intervals exhibited exponential decay. We also investigated the relationship between the number of ants in a group and the group flow rate. PMID:26125191

  11. Escape probability of the super-Penrose process

    NASA Astrophysics Data System (ADS)

    Ogasawara, Kota; Harada, Tomohiro; Miyamoto, Umpei; Igata, Takahisa

    2017-06-01

    We consider a head-on collision of two massive particles that move in the equatorial plane of an extremal Kerr black hole, which results in the production of two massless particles. Focusing on a typical case, where both of the colliding particles have zero angular momenta, we show that a massless particle produced in such a collision can escape to infinity with arbitrarily large energy in the near-horizon limit of the collision point. Furthermore, if we assume that the emission of the produced massless particles is isotropic in the center-of-mass frame but confined to the equatorial plane, the escape probability of the produced massless particle approaches 5 /12 , and almost all escaping massless particles have arbitrarily large energy at infinity and an impact parameter approaching 2 G M /c2, where M is the mass of the black hole.

  12. Escape of coupled Brownian particles across a fluctuating barrier

    NASA Astrophysics Data System (ADS)

    Singh, R. K.

    2017-09-01

    The escape of two harmonically coupled Brownian particles across the fluctuating barrier of a bistable potential is investigated with correlated additive and multiplicative fluctuations. Positive correlations enhance the rate of escape across the barrier when the coupling is effective, whereas for weakly coupled particles, escape becomes difficult. It is found that the system exhibits the phenomenon of resonant activation when the rate of barrier fluctuations is comparable to the relaxation time in the bistable potential. Using a decoupling ansatz, we derive the Markovian limit of the problem in the steady state, under the constraint that the barriers fluctuate on a time scale faster than the relative oscillation of the two particles. Adiabatic elimination of the fast variable of the dynamical system is discussed in appropriate limits.

  13. Escape rate and diffusion of a Stochastically Driven particle

    PubMed Central

    Piscitelli, Antonio; Pica Ciamarra, Massimo

    2017-01-01

    The dynamical properties of a tracer repeatedly colliding with heat bath particles can be described within a Langevin framework provided that the tracer is more massive than the bath particles, and that the collisions are frequent. Here we consider the escape of a particle from a potential well, and the diffusion coefficient in a periodic potential, without making these assumptions. We have thus investigated the dynamical properties of a Stochastically Driven particle that moves under the influence of the confining potential in between successive collisions with the heat bath. In the overdamped limit, both the escape rate and the diffusion coefficient coincide with those of a Langevin particle. Conversely, in the underdamped limit the two dynamics have a different temperature dependence. In particular, at low temperature the Stochastically Driven particle has a smaller escape rate, but a larger diffusion coefficient. PMID:28120904

  14. An anticipative escape system for vehicles in water crashes

    NASA Astrophysics Data System (ADS)

    Shen, Chuanliang; Wang, Jiawei; Yin, Qi; Zhu, Yantao; Yang, Jiawei; Liao, Mengdi; Yang, Liming

    2017-07-01

    In this article, it designs an escape system for vehicles in water crashes. The structure mainly contains sensors, control organs and actuating mechanism for both doors and windows. Sensors judge whether the vehicle falls into water or is in the falling process. The actuating mechanism accepts the signal delivered by the control organs, then open the electronic central lock on doors and meanwhile lower the window. The water escape system is able to anticipate drowning situations for vehicles and controls both doors and windows in such an emergency. Under the premise of doors staying in an undamaged state, it is for sure that people in the vehicle can open the door while drowning in the water and safely escape.

  15. Detection and Quantification of Nuclear Morphology Changes in Apoptotic Cells by Fluorescence Microscopy and Subsequent Analysis of Visualized Fluorescent Signals.

    PubMed

    Mandelkow, Robert; Gümbel, Denis; Ahrend, Hannes; Kaul, Anne; Zimmermann, Uwe; Burchardt, Martin; Stope, Matthias B

    2017-05-01

    Apoptosis results in specific and stage-dependent morphological alterations of the cell nucleus, including pyknosis and cell shrinking. The experimental investigation of apoptotic processes is still challenging and routinely based on the assessment of molecular events like chromatin fragmentation and caspase enzyme activity. Alternatively, the establishment of a fluorescence microscopy nuclear morphology assay would provide a simple and robust low-cost method for detection and quantification of apoptotic cascades. Model cell lines LNCaP and MDA-MB-231 were incubated in the presence of the apoptosis-inducer cycloheximide (CHX). After evaluation of apoptotic cascades by terminal deoxynucleotidyl transferase-dUTP nick-end labeling (TUNEL) assay, stained cell nuclei were analyzed regarding area, perimeter, major and minor axis, as well as brightness of nuclear fluorescence signal. When compared to vehicle-treated control cells, administration of CHX led to significantly reduced cell growth and elevated rates of chromatin fragmentation of both cell lines as shown by cell counting and TUNEL assay, respectively. These apoptotic effects were accompanied by apoptosis-specific modulations of the nuclei demonstrated by diminished nuclear morphology parameters, such as area, perimeter, major and minor axis, as well as elevated levels of nuclear staining intensity. We present a computerized method for apoptosis detection and quantification using images of fluorescent dye-stained cell nuclei. The advantages of this nuclear morphology assay include the (i) ability to routinely assess apoptosis by a fast, highly reproducible low-cost technique, (ii) applicability of an experimental approach analyzing high numbers of single nuclei and (iii) detection of apoptosis in early, as well as late, stages of the apoptotic cascade. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  16. Lyman-Werner escape fractions from the first galaxies

    NASA Astrophysics Data System (ADS)

    Schauer, Anna T. P.; Agarwal, Bhaskar; Glover, Simon C. O.; Klessen, Ralf S.; Latif, Muhammad A.; Mas-Ribas, Lluís; Rydberg, Claes-Erik; Whalen, Daniel J.; Zackrisson, Erik

    2017-05-01

    Direct collapse black holes forming in pristine, atomically cooling haloes at z ≈ 10-20 may act as the seeds of supermassive black holes (BHs) at high redshifts. In order to create a massive BH seed, the host halo needs to be prevented from forming stars. H2 therefore needs to be irradiated by a large flux of Lyman-Werner (LW) UV photons in order to suppress H2 cooling. A key uncertainty in this scenario is the escape fraction of LW radiation from first galaxies, which is the dominant source of UV photons at this epoch. To better constrain this escape fraction, we have performed radiation-hydrodynamical simulations of the growth of H ii regions and their associated photodissociation regions in the first galaxies using the zeus-mp code. We find that the LW escape fraction crucially depends on the propagation of the ionization front (I-front). For an R-type I-front overrunning the halo, the LW escape fraction is always larger than 95 per cent. If the halo recombines later from the outside-in, due to a softened and weakened spectrum, the LW escape fraction in the rest frame of the halo (the near-field) drops to zero. A detailed and careful analysis is required to analyse slowly moving, D-type I-fronts, where the escape fraction depends on the microphysics and can be as small as 3 per cent in the near-field and 61 per cent in the far-field or as large as 100 per cent in both the near-field and the far-field.

  17. Exploring the Escape of Hydrogen Ionizing Photons from Local Galaxies

    NASA Astrophysics Data System (ADS)

    Davis, Jesse A.; Rosenberg, Jessica L.; Venkatesan, Aparna; Cannon, John M.; Salzer, John Joseph

    2016-01-01

    Low-mass galaxies dominate the universe by number and many of these systems have large star formation rates per unit mass. Measurements of the escape fraction of ionizing radiation from dwarf galaxies are an important input to cosmological simulations and theoretical studies but are largely unconstrained by observations. As a result, the role of low-mass galaxies in cosmological reionization and the ionization state of the intergalactic medium (IGM) at high and low redshifts remains poorly understood. Here we study a sample of 18 star-forming galaxies (12 from the Lyman-Alpha Reference Sample, Rivera-Thorsen et al. 2015; 6 from the KISS sample, Salzer et al. 2001), some of which are low-mass systems (10 with M_star < 5 x 10^9 M_sun). All of the sample galaxies were observed in the FUV with the HST/COS spectrograph and these measurements were used to derive limits on their escaping Lyman-alpha radiation (Rivera-Thorsen et al. 2015, Wofford et al. 2013). Using the numerical radiative transfer simulations of Yajima et al. 2014, we relate the escape of Lyman-alpha radiation to limits on the fraction of escaping H-ionizing radiation from these galaxies. This correlation is stronger for low-redshift galaxies (Yajima et al. 2014) and these galaxies are more accessible observationally for these studies. Although the Yajima et al. (2014) study focuses on high-mass galaxies, we derive tentative limits on the escape fraction for H-ionizing radiation for all of the galaxies in this sample. From our analysis, we find escape fractions of less than 5% in all but two extreme cases where the escape fractions are greater than 14%. Our sample averaged escape fraction is insufficient for what reionization requires, although our values are likely to be lower limits and the two outliers are two of the lowest mass systems from the LARS sample. We discuss future directions, including further modeling of the radiative transfer and the galaxy's physical conditions, to better understand the

  18. Rapid endosomal escape of prickly nanodiamonds: implications for gene delivery

    NASA Astrophysics Data System (ADS)

    Chu, Zhiqin; Miu, Kaikei; Lung, Pingsai; Zhang, Silu; Zhao, Saisai; Chang, Huan-Cheng; Lin, Ge; Li, Quan

    2015-06-01

    The prickly nanodiamonds easily entered cells via endocytosis followed by unique intracellular translocation characteristics—quick endosomal escape followed by stable residence in cytoplasm. Endosomal membrane rupturing is identified as the major route of nanodiamonds’ escaping the vesicle confinement and to the cytoplasm. Little cytotoxicity is observed to associate with the nanodiamonds’ cytosolic release. Such features enable its application for gene delivery, which requires both effective cellular uptake and cytosolic release of the gene. Taking green fluorescent protein gene as an example, we demonstrate the successful cytosolic delivery and expression of such a gene using the prickly nanodiamonds as carrier.

  19. SOYUZ escape trajectory analysis from Space Station Freedom

    NASA Technical Reports Server (NTRS)

    Heck, Michael L.

    1993-01-01

    It has been proposed to utilize the Russian built SOYUZ as an assured crew return vehicle (ACRV) for Space Station Freedom. Three departure directions (nadir, zenith, minus velocity) are evaluated to determine escape path clearances. In addition, the effects of the following parameters were also evaluated: delta-V magnitude, configuration dependent ballistic coefficients, atmospheric density, Freedom attitude control, and canted docking adaptors. The primary factor influencing the escape trajectory was station contingency attitude rate. The nadir and zenith departures were preferable to minus velocity. The impact of atmospheric density and relative ballistic coefficients was minimal.

  20. Case of escape in cassava, Manihot esculenta Crantz.

    PubMed

    Nassar, N M A; Mendonza, M

    2017-02-08

    Two cassava escapes where collected from cultivated fields near natural habitat in Bolivia. They are described morphologically and analyzed cytogenetically in this study. It is suggested that they are the product of backcrosses of cassava interspecific hybrids with the cultigen itself, and that selective conditions have developed in which certain forms of cassava segregates have adapted to grow wildly in natural habitats near cassava fields. These segregates may hybridize with cultivated cassava upon coming in contact with such varieties. Because these escapes have incorporated useful genes from the wild into their genetic structure, they could be used for cassava improvement since their genetic barriers with other forms of cassava are very weak.

  1. Carbocisteine promotes phagocytosis of apoptotic cells by alveolar macrophages.

    PubMed

    Inoue, Masako; Ishibashi, Yuji; Nogawa, Hisashi; Yasue, Tokutaro

    2012-02-29

    Clearance of apoptotic cells, so-called efferocytosis, by alveolar macrophages (AMs) is important for lung homeostasis and is impaired in pulmonary inflammatory diseases, such as chronic obstructive pulmonary disease and asthma. Carbocisteine, a mucoregulatory drug, corrects the contents of fucose in airway mucus and has anti-inflammatory properties in airway inflammation. Thus, we conducted the present study to better understand the anti-inflammatory properties of carbocisteine. First, we induced airway inflammation in mice with lipopolysaccharide intratracheally. Carbocisteine significantly decreased neutrophil numbers in bronchoalveolar lavage fluid at the resolution phase of inflammation, implying the promotion of neutrophil clearance. Then, we investigated whether carbocisteine would enhance the efferocytosis by AMs isolated from mice and found that this drug promoted not only the phagocytosis but also the binding of apoptotic cells to AMs in vitro. Furthermore, carbocisteine decreased the fucose residues stained with fluorescent fucose-binding lectin, Lens culinaris agglutinin, on the cell surface of AMs. We found here that removing fucose residues from cell surfaces of AMs by fucosidase markedly enhanced both the binding and phagocytosis of apoptotic cells. Finally, AMs from mice orally given carbocisteine also promoted both the binding and phagocytosis ex vivo similarly to in vitro. These results suggest that carbocisteine could promote the clearance of apoptotic cells by AMs in airway. In addition, the present findings suggest that the binding and phagocytosis of apoptotic cells may be modulated by fucose residues on the cell surface of AMs.

  2. Phagocytosis Assay for Apoptotic Cells in Drosophila Embryos.

    PubMed

    Nonaka, Saori; Hori, Aki; Nakanishi, Yoshinobu; Kuraishi, Takayuki

    2017-08-03

    The molecular mechanisms underlying the phagocytosis of apoptotic cells need to be elucidated in more detail because of its role in immune and inflammatory intractable diseases. We herein developed an experimental method to investigate phagocytosis quantitatively using the fruit fly Drosophila, in which the gene network controlling engulfment reactions is evolutionally conserved from mammals. In order to accurately detect and count engulfing and un-engulfing phagocytes using whole animals, Drosophila embryos were homogenized to obtain dispersed cells including phagocytes and apoptotic cells. The use of dispersed embryonic cells enables us to measure in vivo phagocytosis levels as if we performed an in vitro phagocytosis assay in which it is possible to observe all phagocytes and apoptotic cells in whole embryos and precisely quantify the level of phagocytosis. We confirmed that this method reproduces those of previous studies that identified the genes required for the phagocytosis of apoptotic cells. This method allows the engulfment of dead cells to be analyzed, and when combined with the powerful genetics of Drosophila, will reveal the complex phagocytic reactions comprised of the migration, recognition, engulfment, and degradation of apoptotic cells by phagocytes.

  3. Rho kinase regulates fragmentation and phagocytosis of apoptotic cells

    SciTech Connect

    Orlando, Kelly A.; Stone, Nicole L.; Pittman, Randall N. . E-mail: pittman@pharm.med.upenn.edu

    2006-01-01

    During the execution phase of apoptosis, a cell undergoes cytoplasmic and nuclear changes that prepare it for death and phagocytosis. The end-point of the execution phase is condensation into a single apoptotic body or fragmentation into multiple apoptotic bodies. Fragmentation is thought to facilitate phagocytosis; however, mechanisms regulating fragmentation are unknown. An isoform of Rho kinase, ROCK-I, drives membrane blebbing through its activation of actin-myosin contraction; this raises the possibility that ROCK-I may regulate other execution phase events, such as cellular fragmentation. Here, we show that COS-7 cells fragment into a number of small apoptotic bodies during apoptosis; treating with ROCK inhibitors (Y-27632 or H-1152) prevents fragmentation. Latrunculin B and blebbistatin, drugs that interfere with actin-myosin contraction, also inhibit fragmentation. During apoptosis, ROCK-I is cleaved and activated by caspases, while ROCK-II is not activated, but rather translocates to a cytoskeletal fraction. siRNA knock-down of ROCK-I but not ROCK-II inhibits fragmentation of dying cells, consistent with ROCK-I being required for apoptotic fragmentation. Finally, cells dying in the presence of the ROCK inhibitor Y-27632 are not efficiently phagocytized. These data show that ROCK plays an essential role in fragmentation and phagocytosis of apoptotic cells.

  4. Chronic treatment with lisinopril decreases proliferative and apoptotic pathways in autosomal recessive polycystic kidney disease.

    PubMed

    Jia, Guangfu; Kwon, Michelle; Liang, Huan Ling; Mortensen, Jordan; Nilakantan, Vani; Sweeney, William E; Park, Frank

    2010-06-01

    Angiotensin converting enzyme (ACE) inhibition is a common therapeutic modality in the treatment of autosomal recessive polycystic kidney disease (ARPKD). This study was designed to investigate whether chronic inhibition of ACE would have a therapeutic effect in attenuating the progression of renal cystogenesis in an orthologous rat model of ARPKD, the polycystic kidney (PCK) rat. Lisinopril (3 mg/kg per day) was administered orally for a period of 12 weeks, beginning at post-natal week 4. Lisinopril treatment resulted in an approximately 30% improvement in the collecting duct cystic indices (CT CI) of PCK animals. Activation of extracellular signal-regulated kinase 1 (ERK1) and 2 (ERK2), proliferative signaling markers, and proliferating cell nuclear antigen (PCNA), an end-point marker for proliferation, was reduced following chronic treatment with lisinopril compared to that in vehicle-treated PCK rats. To assess whether apoptotic pathways were altered due to chronic ACE inhibition, we examined p38 mitogen activated protein kinase (MAPK) and stress-activated protein kinase/c-Jun N-terminal kinase (SAPK/JNK), which are markers of apoptotic signaling cascades. p38 MAPK was significantly reduced (P < 0.0001) following chronic treatment with lisinopril, but no change in the activation of SAPK/JNK could be detected by immunoblot analysis. Lisinopril treatment resulted in a significant reduction (P < 0.01) in cleaved caspase-7 levels, but not caspase-3 activity, in PCK rat kidneys compared to the vehicle-treated PCK rat kidneys. Proteinuria was completely ameliorated in the presence of chronic ACE inhibition in the lisinopril-treated rats compared with the vehicle-treated PCK rats. In all, these findings demonstrated that chronic ACE inhibition can beneficially alter proliferative and apoptotic pathways to promote therapeutic reductions in renal cyst development in ARPKD.

  5. The Sound of Silence: Signaling by Apoptotic Cells

    PubMed Central

    Fogarty, Caitlin E.; Bergmann, Andreas

    2016-01-01

    Apoptosis is a carefully choreographed process of cellular self-destruction in the absence of inflammation. During the death process, apoptotic cells actively communicate with their environment, signaling to both their immediate neighbors as well as distant sentinels. Some of these signals direct the anti-inflammatory immune response, instructing specific subsets of phagocytes to participate in the limited and careful clearance of dying cellular debris. These immunomodulatory signals can also regulate the activation state of the engulfing phagocytes. Other signals derived from apoptotic cells contribute to tissue growth control with the common goal of maintaining tissue integrity. Derangements in these growth control signals during prolonged apoptosis can lead to excessive cell loss or proliferation. Here, we highlight some of the most intriguing signals produced by apoptotic cells during the course of normal development as well as during physiological disturbances such as atherosclerosis and cancer. PMID:26431570

  6. Primary enzyme quantitation

    DOEpatents

    Saunders, G.C.

    1982-03-04

    The disclosure relates to the quantitation of a primary enzyme concentration by utilizing a substrate for the primary enzyme labeled with a second enzyme which is an indicator enzyme. Enzyme catalysis of the substrate occurs and results in release of the indicator enzyme in an amount directly proportional to the amount of primary enzyme present. By quantifying the free indicator enzyme one determines the amount of primary enzyme present.

  7. Macrophages programmed by apoptotic cells promote angiogenesis via prostaglandin E2.

    PubMed

    Brecht, Kerstin; Weigert, Andreas; Hu, Jiong; Popp, Rüdiger; Fisslthaler, Beate; Korff, Thomas; Fleming, Ingrid; Geisslinger, Gerd; Brüne, Bernhard

    2011-07-01

    Macrophages contribute to tissue homeostasis in the developing as well as the adult organism. They promote tissue regeneration and remodeling after injury, which requires efficient neoangiogenesis. Signaling pathways activating an angiogenic program in macrophages are still poorly defined. We report that apoptotic cells (ACs), which originate from stressed or damaged tissues, can induce angiogenic properties in primary human macrophages. The signal originating from ACs is the lipid mediator sphingosine-1-phosphate (S1P), which activates S1P1/3 on macrophages to up-regulate cyclooxygenase-2. The formation and liberation of prostaglandin E(2) (PGE(2)) then stimulates migration of endothelial cells. This is demonstrated by using PGE(2) receptor antagonists or a neutralizing PGE(2) antibody in vitro, thereby attenuating endothelial cell migration using a Boyden chamber assay. In vivo, neutralization of PGE(2) from proangiogenic macrophage supernatants blocked vessel formation into Matrigel plugs. In particular, apoptotic cancer cells shifted prostanoid formation in macrophages selectively toward PGE(2) by up-regulating cyclooxygenase-2 and microsomal prostaglandin E synthase-1 (mPGES1), while down-regulating the PGE(2)-degrading enzyme 15-hydroxyprostaglandin dehydrogenase (15-PGDH) or prostaglandin-D synthase (PGDS). Angiogenic programming of macrophages by ACs, therefore, may control responses to tissue stress such as in tumors, where macrophages support cancer progression.

  8. Exocytosis of macrophage lysosomes leads to digestion of apoptotic adipocytes and foam cell formation[S

    PubMed Central

    Haka, Abigail S.; Barbosa-Lorenzi, Valéria C.; Lee, Hyuek Jong; Falcone, Domenick J.; Hudis, Clifford A.; Dannenberg, Andrew J.

    2016-01-01

    Many types of apoptotic cells are phagocytosed and digested by macrophages. Adipocytes can be hundreds of times larger than macrophages, so they are too large to be digested by conventional phagocytic processes. The nature of the interaction between macrophages and apoptotic adipocytes has not been studied in detail. We describe a cellular process, termed exophagy, that is important for macrophage clearance of dead adipocytes and adipose tissue homeostasis. Using mouse models of obesity, human tissue, and a cell culture model, we show that macrophages form hydrolytic extracellular compartments at points of contact with dead adipocytes using local actin polymerization. These compartments are acidic and contain lysosomal enzymes delivered by exocytosis. Uptake and complete degradation of adipocyte fragments, which are released by extracellular hydrolysis, leads to macrophage foam cell formation. Exophagy-mediated foam cell formation is a highly efficient means by which macrophages internalize large amounts of lipid, which may ultimately overwhelm the metabolic capacity of the macrophage. This process provides a mechanism for degradation of objects, such as dead adipocytes, that are too large to be phagocytosed by macrophages. PMID:27044658

  9. Biphasic regulation of chondrocytes by Rela through induction of anti-apoptotic and catabolic target genes

    PubMed Central

    Kobayashi, Hiroshi; Chang, Song Ho; Mori, Daisuke; Itoh, Shozo; Hirata, Makoto; Hosaka, Yoko; Taniguchi, Yuki; Okada, Keita; Mori, Yoshifumi; Yano, Fumiko; Chung, Ung-il; Akiyama, Haruhiko; Kawaguchi, Hiroshi; Tanaka, Sakae; Saito, Taku

    2016-01-01

    In vitro studies have shown that Rela/p65, a key subunit mediating NF-κB signalling, is involved in chondrogenic differentiation, cell survival and catabolic enzyme production. Here, we analyse in vivo functions of Rela in embryonic limbs and adult articular cartilage, and find that Rela protects chondrocytes from apoptosis through induction of anti-apoptotic genes including Pik3r1. During skeletal development, homozygous knockout of Rela leads to impaired growth through enhanced chondrocyte apoptosis, whereas heterozygous knockout of Rela does not alter growth. In articular cartilage, homozygous knockout of Rela at 7 weeks leads to marked acceleration of osteoarthritis through enhanced chondrocyte apoptosis, whereas heterozygous knockout of Rela results in suppression of osteoarthritis development through inhibition of catabolic gene expression. Haploinsufficiency or a low dose of an IKK inhibitor suppresses catabolic gene expression, but does not alter anti-apoptotic gene expression. The biphasic regulation of chondrocytes by Rela contributes to understanding the pathophysiology of osteoarthritis. PMID:27830706

  10. Phosphatidylserine recognition and induction of apoptotic cell clearance by Drosophila engulfment receptor Draper.

    PubMed

    Tung, Tran Thanh; Nagaosa, Kaz; Fujita, Yu; Kita, Asana; Mori, Hiroki; Okada, Ryo; Nonaka, Saori; Nakanishi, Yoshinobu

    2013-05-01

    The membrane phospholipid phosphatidylserine is exposed on the cell surface during apoptosis and acts as an eat-me signal in the phagocytosis of apoptotic cells in mammals and nematodes. However, whether this is also true in insects was unclear. When milk fat globule-epidermal growth factor 8, a phosphatidylserine-binding protein of mammals, was ectopically expressed in Drosophila, the level of phagocytosis was reduced, whereas this was not the case for the same protein lacking a domain responsible for the binding to phosphatidylserine. We found that the extracellular region of Draper, an engulfment receptor of Drosophila, binds to phosphatidylserine in an enzyme-linked immunosorbent assay-like solid-phase assay and in an assay for surface plasmon resonance. A portion of Draper containing domains EMI and NIM located close to the N-terminus was required for binding to phosphatidylserine, and a Draper protein lacking this region was not active in Drosophila. Finally, the level of tyrosine-phosphorylated Draper, indicative of the activation of Draper, in a hemocyte-derived cell line was increased after treatment with phosphatidylserine-containing liposome. These results indicated that phosphatidylserine serves as an eat-me signal in the phagocytic removal of apoptotic cells in Drosophila and that Draper is a phosphatidylserine-binding receptor for phagocytosis.

  11. Positioning atypical protein kinase C isoforms in the UV-induced apoptotic signaling cascade.

    PubMed Central

    Berra, E; Municio, M M; Sanz, L; Frutos, S; Diaz-Meco, M T; Moscat, J

    1997-01-01

    Recent studies have documented the involvement of the atypical protein kinase C (aPKC) isoforms in important cellular functions such as cell proliferation and survival. Exposure of cells to a genotoxic stimulus that induces apoptosis, such as UV irradiation, leads to a profound inhibition of the atypical PKC activity in vivo. In this study, we addressed the relationship between this phenomenon and different proteins involved in the apoptotic response. We show that (i) the inhibition of the aPKC activity precedes UV-induced apoptosis; (ii) UV-induced aPKC inhibition and apoptosis are independent of p53; (iii) Bcl-2 proteins are potent modulators of aPKC activity; and (iv) the aPKCs are located upstream of the interleukin-converting enzyme-like protease system, which is required for the induction of apoptosis by both Par-4 (a selective aPKC inhibitor) and UV irradiation. We also demonstrate here that inhibition of aPKC activity leads to a decrease in mitogen-activated protein (MAP) kinase activity and simultaneously an increase in p38 activity. Both effects are critical for the induction of apoptosis in response to Par-4 expression and UV irradiation. Collectively, these results clarify the position of the aPKCs in the UV-induced apoptotic pathway and strongly suggest that MAP kinases play a role in this signaling cascade. PMID:9234692

  12. Ilexsaponin A attenuates ischemia-reperfusion-induced myocardial injury through anti-apoptotic pathway

    PubMed Central

    Wang, Fang; Qiang, Jiao; Liu, Pan; Zhang, Jun; Xu, Jin-Wen

    2017-01-01

    The protective effects of ilexsaponin A on ischemia-reperfusion-induced myocardial injury were investigated. Myocardial ischemia/reperfusion model was established in male Sprague–Dawley rats. Myocardial injury was evaluated by TTC staining and myocardial marker enzyme leakage. The in vitro protective potential of Ilexsaponin A was assessed on hypoxia/reoxygenation cellular model in neonatal rat cardiomyocytes. Cellular viability and apoptosis were evaluated by MTT and TUNEL assay. Caspase-3, cleaved caspase-3, bax, bcl-2, p-Akt and Akt protein expression levels were detected by western-blot. Ilexsaponin A treatment was able to attenuate the myocardial injury in ischemia/reperfusion model by reducing myocardial infarct size and lower the serum levels of LDH, AST and CK-MB. The in vitro study also showed that ilexsaponin A treatment could increase cellular viability and inhibit apoptosis in hypoxia/reoxygenation cardiomyocytes. Proapoptotic proteins including caspase-3, cleaved caspase-3 and bax were significantly reduced and anti-apoptotic protein bcl-2 was significantly increased by ilexsaponin A treatment in hypoxia/reoxygenation cardiomyocytes. Moreover, Ilexsaponin A treatment was able to increase the expression levels of p-Akt in hypoxia/reoxygenation cellular model and myocardial ischemia/reperfusion animal model. Coupled results from both in vivo and in vitro experiments indicate that Ilexsaponin A attenuates ischemia-reperfusion-induced myocardial injury through anti-apoptotic pathway. PMID:28182689

  13. An antibody tag-team: driving neutralization through escape.

    PubMed

    Alter, Galit; Ackerman, Margaret E

    2014-09-01

    HIV rapidly mutates to escape antibody detection, and B cells counter this mutation by continual evolution to restore recognition, serendipitously resulting in the evolution of neutralizing activity in a fraction of infected individuals. A recent Cell paper describes how antibody repertoires stochastically collaborated, shaping the viral swarm and utilizing viral immune evasion to their advantage. Copyright © 2014. Published by Elsevier Ltd.

  14. Purinergic Inhibition of ENaC Produces Aldosterone Escape

    PubMed Central

    Mironova, Elena; Bugaj, Vladislav; Rieg, Timo; Insel, Paul A.; Vallon, Volker; Peti-Peterdi, Janos

    2010-01-01

    The mechanisms underlying “aldosterone escape,” which refers to the excretion of sodium (Na+) during high Na+ intake despite inappropriately increased levels of mineralocorticoids, are incompletely understood. Because local purinergic tone in the aldosterone-sensitive distal nephron downregulates epithelial Na+ channel (ENaC) activity, we tested whether this mechanism mediates aldosterone escape. Here, urinary ATP concentration increased with dietary Na+ intake in mice. Physiologic concentrations of ATP decreased ENaC activity in a dosage-dependent manner. P2Y2−/− mice, which lack the purinergic receptor, had significantly less increased Na+ excretion than wild-type mice in response to high-Na+ intake. Exogenous deoxycorticosterone acetate and deletion of the P2Y2 receptor each modestly increased the resistance of ENaC to changes in Na+ intake; together, they markedly increased resistance. Under the latter condition, ENaC could not respond to changes in Na+ intake. In contrast, as a result of aldosterone escape, wild-type mice had increased Na+ excretion in response to high-Na+ intake regardless of the presence of high deoxycorticosterone acetate. These data suggest that control of ENaC by purinergic signaling is necessary for aldosterone escape. PMID:20813869

  15. Development of three-layered rumen escapable capsules for cattle

    PubMed Central

    SEYAMA, Tomohiro; HIRAYASU, Hirofumi; YAMAWAKI, Kenji; ADACHI, Takuhiko; SUGIMOTO, Takayuki; KASAI, Koji

    2016-01-01

    A new rumen escapable tool is presented for cattle in prospect of developing medical treatment or supplementing trace elements for disease prevention. This tool consists of a three-layered capsule that dissolves in the lower digestive tract, but not in the rumen. The capsule was manufactured by capsule-forming techniques through the use of liquid surface tension. This method does not involve high-temperature treatment, so the capsule can contain not only lipophilic substances but also hydrophilic or heat-sensitive substances. Furthermore, the capsule has a specific gravity of 1.3 and diameter of 6.0 mm, which were previously shown to be appropriate to avoid rumination. The objective of this study was to confirm the effectiveness of the capsule pertinent to rumen escaping. In order to validate rumen escape, capsules containing 30 g of water-soluble vitamin (thiamine hydrochloride) per head were administered to four lactating cows assigned in a crossover trial. In the group administered encapsulated thiamine hydrochloride, blood thiamine levels increased from 12.4 ± 1.03 ng/ml before administration to 54.8 ± 2.21 ng/ml at 6 hr following administration, whereas the level remained at 13.3 ± 2.05 ng/ml in the control group administered via aqueous solution. This indicates that the three-layered capsules passed through the rumen and dissolved in the lower digestive tract, thus functioning as a rumen escapable tool. PMID:27546371

  16. 46 CFR 108.445 - Alarm and means of escape.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 4 2011-10-01 2011-10-01 false Alarm and means of escape. 108.445 Section 108.445 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Fire Extinguishing Systems Fixed Carbon Dioxide Fire Extinguishing Systems § 108.445...

  17. 46 CFR 108.445 - Alarm and means of escape.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Alarm and means of escape. 108.445 Section 108.445 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Fire Extinguishing Systems Fixed Carbon Dioxide Fire Extinguishing Systems § 108.445...

  18. Escaping Embarrassment: Face-Work in the Rap Cipher

    ERIC Educational Resources Information Center

    Lee, Jooyoung

    2009-01-01

    How do individuals escape embarrassing moments in interaction? Drawing from ethnographic fieldwork, in-depth interviews, and video recordings of weekly street corner ciphers (impromptu rap sessions), this paper expands Goffman's theory of defensive and protective face-work. The findings reveal formulaic and indirect dimensions of face-work. First,…

  19. Plasma amino acid response to graded levels of escape protein.

    PubMed

    Gibb, D J; Klopfenstein, T J; Britton, R A; Lewis, A J

    1992-09-01

    A trial was conducted to examine the potential of using plasma amino acid responses to graded levels of escape protein to determine limiting amino acids in cattle. Growing calves (n = 120; mean BW = 220 +/- 21 kg) were fed a basal diet of corncob:sorghum silage (61:39) and were individually supplemented with distillers' dried grains (DDG), heat-damaged DDG (H-DDG), feather meal (FTH), or urea. The urea supplement was mixed with DDG and H-DDG to allow 0, 20, 35, 50, 65, or 80% of the supplemental CP to come from distillers' protein and maintain an 11.5% CP diet. Urea supplement was mixed with FTH to allow 0, 22, 39, 56, 73, or 90% of the supplemental CP to come from FTH. Dietary CP ranged from 11.5% at the 0% level to 17.3% at the 90% level. Plasma concentration of most essential plasma amino acids responded (P less than .10) linearly and(or) quadratically to increased escape protein. The broken-line response of plasma methionine at low DDG intake suggested that methionine was limiting at low levels of escape protein. An initial decrease followed by a plateau fit by a broken line indicated that histidine became limiting in FTH diets, and lysine eventually became limiting for DDG, H-DDG, and FTH diets before maximum BW gain was reached. Results indicate that plasma amino acid responses may identify amino acids that become limiting with increasing escape protein.

  20. Hepatitis B escape mutants in Scottish blood donors.

    PubMed

    Larralde, Osmany; Dow, Brian; Jarvis, Lisa; Davidson, Fiona; Petrik, Juraj

    2013-06-01

    Hepatitis B virus (HBV) remains as the viral infection with the highest risk of transmission by transfusion. This risk is associated with window period donations, occult HBV infection (OBI) and the emergence of escape mutants, which render blood donations false negative for hepatitis B surface antigen (HBsAg) serological testing. A retrospective study was conducted to gain insights into the molecular epidemiology of HBV escape mutants in Scottish blood donors. The criterion for selection was HBV positivity either by serology or nucleic acid testing (NAT). HBsAg detection was compared across several commercial immunoassays. The full length S gene from plasma samples was PCR amplified, cloned and expressed in HepG2 cells. Eight samples showed HBsAg discordant results, while 5 OBI samples were found. Four escape mutants, containing missense mutations in the S gene, are described here. These mutations impaired HBsAg detection both from HBV infected plasma samples and from recombinant proteins derived from its infected donors. Phylogenetic analysis showed that most of the mutants were clustered in the genotype D and were closely related to strains from Asia and the Middle East. We report here a proline substitution, outside the major hydrophilic region, that impaired HBsAg detection in vivo and in vitro, warning about the risk for the emergence of vaccine escape mutants with mutations outside the major neutralisation site.

  1. Escaping Embarrassment: Face-Work in the Rap Cipher

    ERIC Educational Resources Information Center

    Lee, Jooyoung

    2009-01-01

    How do individuals escape embarrassing moments in interaction? Drawing from ethnographic fieldwork, in-depth interviews, and video recordings of weekly street corner ciphers (impromptu rap sessions), this paper expands Goffman's theory of defensive and protective face-work. The findings reveal formulaic and indirect dimensions of face-work. First,…

  2. Social Escape Behaviors in Children with Fragile X Syndrome

    ERIC Educational Resources Information Center

    Hall, Scott; DeBernardis, Marie; Reiss, Allan

    2006-01-01

    Social escape behavior is a common behavioral feature of individuals with fragile X syndrome (fraX). In this observational study, we examined the effect of antecedent social and performance demands on problem behaviors in four conditions: face-to-face interview, silent reading, oral reading and a singing task. Results showed that problem behaviors…

  3. Purinergic inhibition of ENaC produces aldosterone escape.

    PubMed

    Stockand, James D; Mironova, Elena; Bugaj, Vladislav; Rieg, Timo; Insel, Paul A; Vallon, Volker; Peti-Peterdi, Janos; Pochynyuk, Oleh

    2010-11-01

    The mechanisms underlying "aldosterone escape," which refers to the excretion of sodium (Na(+)) during high Na(+) intake despite inappropriately increased levels of mineralocorticoids, are incompletely understood. Because local purinergic tone in the aldosterone-sensitive distal nephron downregulates epithelial Na(+) channel (ENaC) activity, we tested whether this mechanism mediates aldosterone escape. Here, urinary ATP concentration increased with dietary Na(+) intake in mice. Physiologic concentrations of ATP decreased ENaC activity in a dosage-dependent manner. P2Y(2)(-/-) mice, which lack the purinergic receptor, had significantly less increased Na(+) excretion than wild-type mice in response to high-Na(+) intake. Exogenous deoxycorticosterone acetate and deletion of the P2Y(2) receptor each modestly increased the resistance of ENaC to changes in Na(+) intake; together, they markedly increased resistance. Under the latter condition, ENaC could not respond to changes in Na(+) intake. In contrast, as a result of aldosterone escape, wild-type mice had increased Na(+) excretion in response to high-Na(+) intake regardless of the presence of high deoxycorticosterone acetate. These data suggest that control of ENaC by purinergic signaling is necessary for aldosterone escape.

  4. 46 CFR 108.445 - Alarm and means of escape.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 4 2014-10-01 2014-10-01 false Alarm and means of escape. 108.445 Section 108.445 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Fire Extinguishing Systems Fixed Carbon Dioxide Fire Extinguishing Systems § 108.445...

  5. 46 CFR 108.445 - Alarm and means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... Alarm and means of escape. (a) Each CO2 system that has a supply of more than 136 kilograms (300 pounds) of CO2, except a system that protects a tank, must have an alarm that sounds for at least 20 seconds before the CO2 is released into the space. (b) Each audible alarm for a CO2 system must have the...

  6. 46 CFR 108.445 - Alarm and means of escape.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... Alarm and means of escape. (a) Each CO2 system that has a supply of more than 136 kilograms (300 pounds) of CO2, except a system that protects a tank, must have an alarm that sounds for at least 20 seconds before the CO2 is released into the space. (b) Each audible alarm for a CO2 system must have the...

  7. Speed kills: ineffective avian escape responses to oncoming vehicles

    PubMed Central

    DeVault, Travis L.; Blackwell, Bradley F.; Seamans, Thomas W.; Lima, Steven L.; Fernández-Juricic, Esteban

    2015-01-01

    Animal–vehicle collisions cause high levels of vertebrate mortality worldwide, and what goes wrong when animals fail to escape and ultimately collide with vehicles is not well understood. We investigated alert and escape behaviours of captive brown-headed cowbirds (Molothrus ater) in response to virtual vehicle approaches of different sizes and at speeds ranging from 60 to 360 km h−1. Alert and flight initiation distances remained similar across vehicle speeds, and accordingly, alert and flight initiation times decreased at higher vehicle speeds. Thus, avoidance behaviours in cowbirds appeared to be based on distance rather than time available for escape, particularly at 60–150 km h−1; however, at higher speeds (more than or equal to 180 km h−1) no trend in response behaviour was discernible. As vehicle speed increased, cowbirds did not have enough time to assess the approaching vehicle, and cowbirds generally did not initiate flight with enough time to avoid collision when vehicle speed exceeded 120 km h−1. Although potentially effective for evading predators, the decision-making process used by cowbirds in our study appears maladaptive in the context of avoiding fast-moving vehicles. Our methodological approach and findings provide a framework to assess how novel management strategies could affect escape rules, and the sensory and cognitive abilities animals use to avoid vehicle collisions. PMID:25567648

  8. Seasonal Dependence of the Escape of Martian Water

    NASA Astrophysics Data System (ADS)

    Clarke, John

    2013-10-01

    This proposal is to obtain ACS/SBC images and STIS spectra of the extended H Ly alpha and O 1304 emissions from H and O atoms in the atmosphere of Mars to study seasonal changes in the escape rate of H and O atoms, and thereby water. Prior HST observations have revealed a surprising rapid change in the H escape rate in late martian summer following a global dust storm, and have shown that STIS spectra can easily detect superthermal O atoms. The relative degree of influence of seasons and dust storms on the H density and escape flux are not known, and little is known about variations in the hot O density and escape rate. The timing of these observations is key to these scientific goals. Mars is now approaching the Sun, HST can observe Mars over a wide range of seasons from April - Nov 2014, and HST will not be able to observe Mars again until after the prime mission of MAVEN. These observations will provide strong support for the NASA MAVEN mission, scheduled to arrive at Mars in Sept. 2014. This proposal is for a single visit of 3 HST orbits in late sprign 2014 to establish the baseline conditions when Mars is far from the Sun.

  9. Learning from escaped prescribed fires - lessons for high reliability

    Treesearch

    Deirdre Dether; Anne Black

    2006-01-01

    Meeting national goals for hazardous fuels reduction and ecosystem restoration would be difficult - if not impossible - without utilizing prescribed fire. Suspension of prescribed fire programs, as often happens following an escape, limits Federal capacity to meet programmatic, social, and ecological goals.

  10. The Effect of Laziness in Group Chase and Escape

    NASA Astrophysics Data System (ADS)

    Masuko, Makoto; Hiraoka, Takayuki; Ito, Nobuyasu; Shimada, Takashi

    2017-08-01

    The effect of laziness in the group chase and escape problem is studied using a simple model. Laziness is introduced as random walks in two ways: uniformly and in a "division of labor" way. It is shown that while the former is always ineffective, the latter can improve the efficiency of catching, through the formation of pincer attack configuration by diligent and lazy chasers.

  11. 6. UNDERGROUND FIRING CONTROL ROOM, INTERIOR. Looking southeast to escape ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. UNDERGROUND FIRING CONTROL ROOM, INTERIOR. Looking southeast to escape tunnel. - Edwards Air Force Base, Air Force Rocket Propulsion Laboratory, Firing Control Building, Test Area 1-100, northeast end of Test Area 1-100 Road, Boron, Kern County, CA

  12. Spatial and Nonspatial Escape Strategies in the Barnes Maze

    ERIC Educational Resources Information Center

    Harrison, Fiona E.; Reiserer, Randall S.; Tomarken, Andrew J.; McDonald, Michael P.

    2006-01-01

    The Barnes maze is a spatial memory task that requires subjects to learn the position of a hole that can be used to escape the brightly lit, open surface of the maze. Two experiments assessed the relative importance of spatial (extra-maze) versus proximal visible cues in solving the maze. In Experiment 1, four groups of mice were trained either…

  13. Magnetic buoyancy and the escape of magnetic fields from stars

    NASA Astrophysics Data System (ADS)

    Parker, E. N.

    1984-06-01

    Magnetic buoyancy causes the azimuthal magnetic fields of stars to rise rapidly to the surface, from where they are generally assumed to escape freely into space. However, a closer look at the problem reveals the simple fact that disengagement of the field from the gas, and escape into space, require a convoluted field configuration, producing neutral point reconnection of the flux in the tenuous gas above the surface of the star. Only that flux which reconnects can escape. Recent observations of the magnetic fields emerging through the surface of the Sun show that even at sunspot maximum the gaps in longitude between bipolar magnetic regions are so wide as to limit severely the reconnection between regions. We suggest from the observations that no more than perhaps 3% of the flux that is observed to emerge through the surface is able to reconnect and escape. Hence the surface of the Sun approximates to an impenetrable barrier rather than an open surface, with quantitative consequences for theoretical dynamo models. Recent observations of the retraction of bipolar fields at the end of their appearance at the surface suggest active dynamical control by the convection beneath the surface.

  14. Solar forcing and planetary ion escape from Mars

    NASA Astrophysics Data System (ADS)

    Lundin, R.; Barabash, S.; Fedorov, A.; Holmström, M.; Nilsson, H.; Sauvaud, J.-A.; Yamauchi, M.

    2008-05-01

    The variability of planetary ion escape from Mars is studied using data from the Ion Mass Analyzer, IMA, on Mars Express (MEX). 42 orbits were selected during 17 months for different solar wind conditions, focusing on the low energy (~30 - 800 eV) heavy ion (e.g. O+, O2 + and CO2 +) outflow. A strong correlation is found between solar wind forcing of the obstacle, the cross-sectional area enclosing the ion outflow from Mars and the total heavy ion escape flux. The at least one order of magnitude changes of the ion outflow on the short term (hours, days), is directly connected with the variability of solar wind, solar soft x-ray and solar EUV (XEUV). The latter was first inferred from an analysis of how the obstacle size changes with changing solar wind and solar XEUV forcing. The 17-month trend of decreasing ion outflow with EUV during a declining phase of solar cycle 23, the EUV determined from the Neutral Particle Imager (NPI) on MEX, illustrates the influence of solar EUV forcing. On the basis of this we conclude that changes in solar wind- and solar XEUV forcing governs the variable ion escape from Mars. Both forcing terms appear to be equally important for the escape rate. Considering the difference in travel time for XEUV and the solar wind to Mars, the XEUV effect will precede the solar wind effect by several (3-9) days.

  15. Action of cocaine and chronic sympathetic denervation on vagal escape

    PubMed Central

    Campos, H. A.; Urquilla, P. R.

    1969-01-01

    1. The effect of cocaine has been studied on vagal escape and on the tachycardia due to vagal stimulation in the atropinized dog. All the dogs were submitted to acute cervical section of the spinal cord and acute or chronic sympathetic denervation. 2. Cocaine, 5 mg/kg or 40 μg/kg/min, I.V., induces a significant enhancement of the ventricular escape. The effects of a continuous infusion of cocaine are more reproducible than those of a single injection of the drug. 3. Cocaine, 40 μg/kg/min, I.V., potentiates the tachycardia due to vagal stimulation in the atropinized dog. 4. Chronic thoracic sympathectomy markedly retards the recovery of the ventricular rate from the inhibitory action of the vagus. Under this condition, the infusion of cocaine does not significantly enhance the ventricular escape. 5. These findings suggest that an adrenergic mechanism located at the sympathetic nerves supplying the heart is substantially involved in the phenomenon of vagal escape. PMID:5249864

  16. Spatial and Nonspatial Escape Strategies in the Barnes Maze

    ERIC Educational Resources Information Center

    Harrison, Fiona E.; Reiserer, Randall S.; Tomarken, Andrew J.; McDonald, Michael P.

    2006-01-01

    The Barnes maze is a spatial memory task that requires subjects to learn the position of a hole that can be used to escape the brightly lit, open surface of the maze. Two experiments assessed the relative importance of spatial (extra-maze) versus proximal visible cues in solving the maze. In Experiment 1, four groups of mice were trained either…

  17. 46 CFR 169.313 - Means of escape.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 7 2014-10-01 2014-10-01 false Means of escape. 169.313 Section 169.313 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS SAILING SCHOOL VESSELS Construction... apart, uniform for the length of the ladder; (3) At least 3 inches from the nearest permanent object...

  18. 46 CFR 169.313 - Means of escape.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 7 2013-10-01 2013-10-01 false Means of escape. 169.313 Section 169.313 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS SAILING SCHOOL VESSELS Construction... apart, uniform for the length of the ladder; (3) At least 3 inches from the nearest permanent object...

  19. Emergency escape system protects personnel from explosion and fire

    NASA Technical Reports Server (NTRS)

    Offik, W. G.

    1966-01-01

    Elevator-type emergency escape system evacuates personnel from tall structures, especially when the possibility of explosion or fire exists. The system consists of a spike shaped rescue cabin which descends along a vertical guide cable, penetrates the dome shaped roof of an underground blast shelter and stops in a deceleration bed of granular material.

  20. Social Escape Behaviors in Children with Fragile X Syndrome

    ERIC Educational Resources Information Center

    Hall, Scott; DeBernardis, Marie; Reiss, Allan

    2006-01-01

    Social escape behavior is a common behavioral feature of individuals with fragile X syndrome (fraX). In this observational study, we examined the effect of antecedent social and performance demands on problem behaviors in four conditions: face-to-face interview, silent reading, oral reading and a singing task. Results showed that problem behaviors…

  1. Pilot Fullerton dons ejection escape suit (EES) on middeck

    NASA Image and Video Library

    1982-03-30

    STS003-23-165 (22-30 March 1982) --- Astronaut Gordon Fullerton, STS-3 pilot, dons ejection escape suit (EES) (high altitude pressure garment) life preserver unit (LPU) on forward port side of middeck above potable water tank. Fullerton also adjusts lapbelt fitting and helmet holddown strap. Photo credit: NASA

  2. Enuresis Control through Fading, Escape, and Avoidance Training.

    ERIC Educational Resources Information Center

    Hansen, Gordon D.

    1979-01-01

    A twin signal device that provides both escape and avoidance conditioning in enuresis control was documented with case studies of two enuretic children (eight and nine years old). In addition, a technique of fading as an adjunct to the process was utilized with one subject. (Author/SBH)

  3. Thermally activated escape from a Lennard-Jones potential well

    NASA Astrophysics Data System (ADS)

    Larson, Richard S.; Lightfoot, Edwin J.

    1988-03-01

    The Kramers theory of chemical kinetics is modified in order to describe the escape of particles from a potential well of the Lennard-Jones type, for which there is no well-defined barrier position or curvature. Approximate analytical methods are used to derive from the Fokker-Planck equation two distinct formulas for the escape rate, each valid in a different regime of the friction constant β. The large-β result is seen to be consistent with that obtained from the Smoluchoeski equation, and it shows that the resistance to escape is dominated by a purely diffusive component that causes nonequilibrium effects to be felt well down into the reactant region. On the other hand, the small-β result describes a situation in which diffusional resistance is of minor importance, and the escape rate is determined largely by the characteristics of the well itself. The approximate formulas give a reasonably good picture of the transition between the two kinds of limiting behavior.

  4. Evolving Project E-Scape for National Assessment

    ERIC Educational Resources Information Center

    Kimbell, Richard

    2012-01-01

    In the opening paper in this Special Edition I outlined the major issues that led to the establishment of "project e-scape". The project was intended to develop systems and approaches that enabled learners to build real-time web-based portfolios of their performance (initially) in design & technology and additionally to build systems…

  5. Brain size as a driver of avian escape strategy.

    PubMed

    Samia, Diogo S M; Pape Møller, Anders; Blumstein, Daniel T

    2015-07-03

    After detecting an approaching predator, animals make a decision when to flee. Prey will initiate flight soon after detecting a predator so as to minimize attentional costs related to on-going monitoring of the whereabouts of the predator. Such costs may compete with foraging and other maintenance activities and hence be larger than the costs of immediate flight. The drivers of interspecific variation in escape strategy are poorly known. Here we investigated the morphological, life history and natural history traits that correlate with variation in avian escape strategy across a sample of 96 species of birds. Brain mass, body size, habitat structure and group size were the main predictors of escape strategy. The direction of the effect of these traits was consistent with selection for a reduction of monitoring costs. Therefore, attentional costs depend on relative brain size, which determines the ability to monitor the whereabouts of potential predators and the difficulty of this task as reflected by habitat and social complexity. Thus brain size, and the cognitive functions associated with it, constitute a general framework for explaining the effects of body size, habitat structure and sociality identified as determinants of avian escape strategy.

  6. 12. CLOSEUP VIEW FROM NORTHWEST, SHOWING DETAILS OF FIRE ESCAPE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. CLOSE-UP VIEW FROM NORTHWEST, SHOWING DETAILS OF FIRE ESCAPE NEAR CORNER OF MILLS HALL MAIN WING NORTH WALL, AND MILLS HALL NORTH WING WEST WALL. - Mills Hall, Mills College, 5000 MacArthur Boulevard, Oakland, Alameda County, CA

  7. 2. WEST REAR, WITH PORTHOLE ESCAPE HATCH ABOVE ENTRY DOOR. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. WEST REAR, WITH PORTHOLE ESCAPE HATCH ABOVE ENTRY DOOR. - Edwards Air Force Base, South Base Sled Track, Firing & Control Blockhouse for 10,000-foot Track, South of Sled Track at midpoint of 20,000-foot track, Lancaster, Los Angeles County, CA

  8. Danger detection and escape behaviour in wood crickets.

    PubMed

    Dupuy, Fabienne; Casas, Jérôme; Body, Mélanie; Lazzari, Claudio R

    2011-07-01

    The wind-sensitive cercal system of Orthopteroid insects that mediates the detection of the approach of a predator is a very sensitive sensory system. It has been intensively analysed from a behavioural and neurobiological point of view, and constitutes a classical model system in neuroethology. The escape behaviour is triggered in orthopteroids by the detection of air-currents produced by approaching objects, allowing these insects to keep away from potential dangers. Nevertheless, escape behaviour has not been studied in terms of success. Moreover, an attacking predator is more than "air movement", it is also a visible moving entity. The sensory basis of predator detection is thus probably more complex than the perception of air movement by the cerci. We have used a piston mimicking an attacking running predator for a quantitative evaluation of the escape behaviour of wood crickets Nemobius sylvestris. The movement of the piston not only generates air movement, but it can be seen by the insect and can touch it as a natural predator. This procedure allowed us to study the escape behaviour in terms of detection and also in terms of success. Our results showed that 5-52% of crickets that detected the piston thrust were indeed touched. Crickets escaped to stimulation from behind better than to a stimulation from the front, even though they detected the approaching object similarly in both cases. After cerci ablation, 48% crickets were still able to detect a piston approaching from behind (compared with 79% of detection in intact insects) and 24% crickets escaped successfully (compared with 62% in the case of intact insects). So, cerci play a major role in the detection of an approaching object but other mechanoreceptors or sensory modalities are implicated in this detection. It is not possible to assure that other sensory modalities participate (in the case of intact animals) in the behaviour; rather, than in the absence of cerci other sensory modalities can

  9. Plasma-induced Escape and Alterations of Planetary Atmospheres

    NASA Astrophysics Data System (ADS)

    Johnson, R. E.; Tucker, O. J.; Ewrin, J.; Cassidy, T. A.; Leblanc, F.

    2009-12-01

    The atmospheres of planets and planetary satellites are typically imbedded in space plasmas. Depending on the interaction with the induced or intrinsic fields energetic ions can have access to the thermosphere and the corona affecting their composition and thermal structure and causing loss to space. These processes are often lumped together as ‘atmospheric sputtering’ (Johnson 1994). In this talk I will review the results of simulations of the plasma bombardment at a number of solar system bodies and use those data to describe the effect on the upper atmosphere and on escape. Of considerable recent interest is the modeling of escape from Titan. Prior to Cassini’s tour of the Saturnian system, plasma-induced escape was suggested to be the dominant loss process, but recent models of enhanced thermal escape, often referred to as ‘slow hydrodynamic’ escape, have been suggested to lead to much larger Titan atmospheric loss rates (Strobel 2008; Cui et al. 2008). Such a process has been suggested to be active at some point in time on a number of solar system bodies. I will present hybrid fluid/ kinetic models of the upper atmosphere of certain bodies in order to test both the plasma-induced and thermal escape processes. Preliminary results suggest that the loss rates estimated using the ‘slow hydrodynamic’ escape process can be orders of magnitude too large. The implications for Mars, Titan and Pluto will be discussed. Background for this talk is contained in the following papers (Johnson 2004; 2009; Chaufray et al. 2007; Johnson et al. 2008; 2009; Tucker and Johnson 2009). References: Chaufray, J.Y., R. Modolo, F. Leblanc, G. Chanteur, R.E. Johnson, and J.G. Luhmann, Mars Solar Wind interaction: formation of the Martian corona and atmosphric loss to space, JGR 112, E09009, doi:10.1029/2007JE002915 (2007) Cui, J., Yelle, R. V., Volk, K. Distribution and escape of molecular hydrogen in Titan's thermosphere and exosphere. J. Geophys. Res. 113, doi:10

  10. New insights into the antioxidant and apoptotic potential of Glycyrrhiza glabra L. during hydrogen peroxide mediated oxidative stress: An in vitro and in silico evaluation.

    PubMed

    Hejazi, Iram Iqbal; Khanam, Rashmin; Mehdi, Syed Hassan; Bhat, Abdul Roouf; Moshahid Alam Rizvi, M; Islam, Asimul; Thakur, Sonu Chand; Athar, Fareeda

    2017-10-01

    Plant-derived substances (phytochemicals) are well recognized as sources of pharmacologically potent drugs in the treatment of several oxidative stress related disorders. Our study aims to evaluate the antioxidant and apoptotic effects of Glycyrrhiza glabra L. in both cell free and cell culture system. Plant fractions have been prepared with hexane, chloroform, ethyl acetate, methanol and water and their antioxidant properties are reviewed. Potent antioxidant activity has been well established in both in vitro and in silico studies which is believed to be responsible for the anticancerous nature of the plant. Results obtained indicate that methanol fraction of G. glabra L. exhibited maximum scavenging activity against DPPH and nitric oxide free radicals comparable to standard antioxidant L-AA. Administration of methanol fraction also considerably reduced the malondialdehyde produced due to lipid peroxidation in mammalian liver tissues. Moreover, the levels of antioxidant enzymes SOD, CAT, GST, GPx and GR in the oxidative stress induced tissues were refurbished significantly after treatment with plant's methanol fraction. Moreover, methanol fraction was found to be nontoxic to normal human cell line whereas it inhibited cancer cells HeLa and HepG2 considerably. Apoptosis was established by DAPI fluorescent staining and western blot analysis of pro apoptotic protein caspase-8, caspase-3 and anti-apoptotic protein Bcl-2.There is an up regulation in the levels of pro apoptotic caspase-8 and caspase-3 and down regulation of anti-apoptotic Bcl-2. Furthermore, GC-MS analysis of the methanol fraction revealed the presence of many compounds. In silico experiments using Autodock 4.2 tools showed strong affinity of plant compounds towards antioxidant enzymes (proteins) thus validating with the conclusions of antioxidant enzyme assays and establishing a role in cancer pathogenesis. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  11. Escape manoeuvres in the spiny dogfish (Squalus acanthias).

    PubMed

    Domenici, Paolo; Standen, Emily M; Levine, Robert P

    2004-06-01

    The locomotor performance of dogfish during escape responses was observed by means of high-speed video. Dogfish show C-type escape responses that are comparable with those shown previously in teleosts. Dogfish show high variability of turning rates of the anterior part of the body (head to centre of mass), i.e. with peak values from 434 to 1023 deg. s(-1). We suggest that this variability may be due to the presence of two types of escape manoeuvres, i.e. responses with high and low turning rates, as previously found in a teleost species. Fast responses (i.e. with high maximum turning rates, ranging between 766 and 1023 deg. s(-1)) showed significantly higher locomotor performance than slow responses (i.e. with low maximum turning rates, ranging between 434 and 593 deg. s(-1)) in terms of distance covered, speed and acceleration, although no differences were found in the turning radius of the centre of mass during the escape manoeuvres. The existence of two types of escape responses would have implications in terms of both neural control and muscular activation patterns. When compared with literature data for the locomotor performance of bony fishes, dogfish showed relatively low speed and acceleration, comparable turning rates and a turning radius that is in the low part of the range when compared with teleosts, indicating relatively high manoeuvrability. The locomotor performance observed in dogfish is consistent with their morphological characteristics: (1) low locomotor performance associated with low thrust developed by their relatively small posterior depth of section and (2) relatively high manoeuvrability associated with their high flexibility.

  12. Spatial and nonspatial escape strategies in the Barnes maze.

    PubMed

    Harrison, Fiona E; Reiserer, Randall S; Tomarken, Andrew J; McDonald, Michael P

    2006-01-01

    The Barnes maze is a spatial memory task that requires subjects to learn the position of a hole that can be used to escape the brightly lit, open surface of the maze. Two experiments assessed the relative importance of spatial (extra-maze) versus proximal visible cues in solving the maze. In Experiment 1, four groups of mice were trained either with or without a discrete visible cue marking the location of the escape hole, which was either in a fixed or variable location across trials. In Experiment 2, all mice were trained with the discrete visible cue marking the target hole location. Two groups were identical to the cued-target groups from Experiment 1, with either fixed or variable escape locations. For these mice, the discrete cue either was the sole predictor of the target location or was perfectly confounded with the spatial extra-maze cues. The third group also used a cued variable target, but a curtain was drawn around the maze to prevent the use of spatial cues to guide navigation. Probe trials with all escape holes blocked were conducted to dissociate the use of spatial and discrete proximal cues. We conclude that the Barnes maze can be solved efficiently using spatial, visual cue, or serial-search strategies. However, mice showed a strong preference for using the distal room cues, even when a discrete visible cue clearly marked the escape location. Importantly, these data show that the cued-target control version of the Barnes maze as typically conducted does not dissociate spatial from nonspatial abilities.

  13. Spatial and nonspatial escape strategies in the Barnes maze

    PubMed Central

    Harrison, Fiona E.; Reiserer, Randall S.; Tomarken, Andrew J.; McDonald, Michael P.

    2006-01-01

    The Barnes maze is a spatial memory task that requires subjects to learn the position of a hole that can be used to escape the brightly lit, open surface of the maze. Two experiments assessed the relative importance of spatial (extra-maze) versus proximal visible cues in solving the maze. In Experiment 1, four groups of mice were trained either with or without a discrete visible cue marking the location of the escape hole, which was either in a fixed or variable location across trials. In Experiment 2, all mice were trained with the discrete visible cue marking the target hole location. Two groups were identical to the cued-target groups from Experiment 1, with either fixed or variable escape locations. For these mice, the discrete cue either was the sole predictor of the target location or was perfectly confounded with the spatial extra-maze cues. The third group also used a cued variable target, but a curtain was drawn around the maze to prevent the use of spatial cues to guide navigation. Probe trials with all escape holes blocked were conducted to dissociate the use of spatial and discrete proximal cues. We conclude that the Barnes maze can be solved efficiently using spatial, visual cue, or serial-search strategies. However, mice showed a strong preference for using the distal room cues, even when a discrete visible cue clearly marked the escape location. Importantly, these data show that the cued-target control version of the Barnes maze as typically conducted does not dissociate spatial from nonspatial abilities. PMID:17101874

  14. In situ and remote measurements of ions escaping from Venus

    NASA Astrophysics Data System (ADS)

    Kollmann, P.; Brandt, P. C.

    2013-12-01

    Venus is thought to lose a large fraction of its atmosphere in the form ions, mainly via pickup. The relative loss rate of the exosphere as neutrals or ions is not known, nor is the flux of escaping ions well constrained. Knowledge of these processes will shed light on the role an intrinsic magnetic field has in atmospheric erosion. We use the complementary in-situ plasma and energetic neutral atom (ENA) measurements from the Venus Express (VEx) spacecraft in order to constrain the ion escape. VEx completed about 2500 orbits to date and reached altitudes as low as 200km. The ASPERA/IMA instrument measured directional proton and oxygen ion spectra in the 10eV to 40keV range. We bin the data accumulated over the mission in space and bulk flow direction, yielding a direct measure of the local ion escape flux. While such in-situ measurements provide data without ambiguity, they are limited by the orbital coverage. This is why we include remote ENA measurements from the ASPERA/NPD (100eV to 10keV) instrument to our study. ENAs are created when escaping ions charge exchange with the high atmosphere atoms or molecules. We have done an exhaustive analysis of the data, excluding time periods of instrument contamination. Most ENA emission originates from low altitudes above Venus' limb. These measurements will be compared with the in-situ data, which allows constraining the atmospheric density at high altitudes. Interestingly, there are also ENA emissions from other directions, which were not sampled in-situ. This allows us to put a lower limit to the escape from these regions.

  15. Erratum: The Escape of Ionizing Photons from the Galaxy

    NASA Astrophysics Data System (ADS)

    Bland-Hawthorn, J.; Maloney, P. R.

    2001-04-01

    In the Letter ``The Escape of Ionizing Photons from the Galaxy'' by J. Bland-Hawthorn & P. R. Maloney (ApJ, 510, L33 [1999]), there is an error in Figure 4 that bears on the derived escape fraction of ionizing photons from star-forming regions in the Galaxy's disk. For the quoted distance (55 kpc) of the Magellanic Stream, the predicted emission measures should be reduced by a factor of (20/55)2. Our derived value of fesc~6%, the escape fraction normal to the disk, must be raised by the inverse of this factor, which makes it unlikely that the Stream Hα arises from UV produced by the Galaxy's young stellar disk. This is exacerbated by new Hα observations that show that the Stream is even brighter than originally thought (Weiner, Vogel, & Williams 2001). Bland-Hawthorn & Putman (2001) discuss possible sources of ionization for the Magellanic Stream. We note with interest that high-velocity clouds have now been detected in Hα (e.g., Tufte, Reynolds, & Haffner 1998). Some of these have well-established distance bounds. Bland-Hawthorn & Putman (2001) and Weiner et al. (2001) find that the observed Hα is roughly consistent with fesc~5%, although the present uncertainties are about a factor of 2. It should be noted that fesc refers to the escape fraction normal to the disk. The escape fraction averaged over 4π sr, fesc, is about a factor of 3 smaller and depends on the details of the opacity model (Bland-Hawthorn 1998, Appendix 1). The present uncertainties on fesc for the Galaxy mean that we cannot determine whether star-forming regions dominate the extragalactic UV background (cf. Shull et al. 1999).

  16. Recording Field Potentials From Zebrafish Larvae During Escape Responses

    PubMed Central

    Monesson-Olson, Bryan D.; Troconis, Eileen L.; Trapani, Josef G.

    2014-01-01

    Among vertebrates, startle responses are a ubiquitous method for alerting, and avoiding or escaping from alarming or dangerous stimuli. In zebrafish larvae, fast escape behavior is easily evoked through either acoustic or tactile stimuli. For example, a light touch to the head will excite trigeminal neurons that in turn excite a large reticulospinal neuron in the hindbrain called the Mauthner cell (M-cell). The M-cell action potential then travels down the contralateral trunk of the larva exciting motoneurons, which subsequently excite the entire axial musculature, producing a large amplitude body bend away from the source of the stimulus. This body conformation is known as the “C-bend” due to the shape of the larva during the behavior. As a result of the semi-synchronized activation of the M-cell, the population of motor neurons, and the axial trunk muscles, a large field potential is generated and can be recorded from free-swimming or fixed-position larvae. Undergraduate laboratories that record field potentials during escape responses in larval zebrafish are relatively simple to setup and allow students to observe and study the escape reflex circuit. Furthermore, by testing hypotheses, analyzing data and writing journal-style laboratory reports, students have multiple opportunities to learn about many neuroscience topics including vertebrate reflexes; sensory transduction; synaptic-, neuro-, and muscle-physiology; the M-cell mediated escape response; and the zebrafish as a model organism. Here, we detail the equipment, software, and recording setup necessary to observe field potentials in an undergraduate teaching lab. Additionally, we discuss potential advanced laboratory exercises and pedagogical outcomes. Finally, we note possible low-cost alternatives for recording field potentials. PMID:25565920

  17. Challenging zebrafish escape responses by increasing water viscosity.

    PubMed

    Danos, Nicole; Lauder, George V

    2012-06-01

    Escape responses of fishes have long been studied as a model locomotor behavior in which hypothesized maximal or near-maximal muscle power output is used to generate rapid body bending. In this paper we present the results of experiments that challenged zebrafish (Danio rerio) to perform escape responses in water of altered viscosity, to better understand the effects that the fluid mechanical environment exerts on kinematics. We quantified escape kinematics using 1000 frames s(-1) high-speed video, and compared escape response kinematics of fish in three media that differed in viscosity: 1 mPa s (normal water), 10 mPa s and 20 mPa s (20 times normal water viscosity). We hypothesized that because viscosity is increased but not density there will be a different effect on kinematic variables resulting from unsteady (acceleration-dependent) hydrodynamic forces and steady (velocity-dependent) ones. Similarly, we hypothesized that the kinematics of stage 1 will be less affected by viscosity than those of stage 2, as higher angular velocities are reached during stage 1 resulting in higher Reynolds numbers. Our results showed a significant overall effect of viscosity on escape response kinematics but the effect was not in accordance with our predictions. Statistical tests showed that increasing viscosity significantly decreased displacement of the center of mass during stage 1 and after 30 ms, and decreased maximum velocity of the center of mass, maximum angular velocity and acceleration during stage 1, but increased time to maximum angular acceleration and time to maximum linear velocity of the center of mass. Remarkably, increasing water viscosity 20 times did not significantly affect the duration of stage 1 or stage 2.

  18. Levels of pro-apoptotic regulator Bad and anti-apoptotic regulator Bcl-xL determine the type of the apoptotic logic gate.

    PubMed

    Bogdał, Marta N; Hat, Beata; Kochańczyk, Marek; Lipniacki, Tomasz

    2013-07-24

    Apoptosis is a tightly regulated process: cellular survive-or-die decisions cannot be accidental and must be unambiguous. Since the suicide program may be initiated in response to numerous stress stimuli, signals transmitted through a number of checkpoints have to be eventually integrated. In order to analyze possible mechanisms of the integration of multiple pro-apoptotic signals, we constructed a simple model of the Bcl-2 family regulatory module. The module collects upstream signals and processes them into life-or-death decisions by employing interactions between proteins from three subgroups of the Bcl-2 family: pro-apoptotic multidomain effectors, pro-survival multidomain restrainers, and pro-apoptotic single domain BH3-only proteins. Although the model is based on ordinary differential equations (ODEs), it demonstrates that the Bcl-2 family module behaves akin to a Boolean logic gate of the type dependent on levels of BH3-only proteins (represented by Bad) and restrainers (represented by Bcl-xL). A low level of pro-apoptotic Bad or a high level of pro-survival Bcl-xL implies gate AND, which allows for the initiation of apoptosis only when two stress stimuli are simultaneously present: the rise of the p53 killer level and dephosphorylation of kinase Akt. In turn, a high level of Bad or a low level of Bcl-xL implies gate OR, for which any of these stimuli suffices for apoptosis. Our study sheds light on possible signal integration mechanisms in cells, and spans a bridge between modeling approaches based on ODEs and on Boolean logic. In the proposed scheme, logic gates switching results from the change of relative abundances of interacting proteins in response to signals and involves system bistability. Consequently, the regulatory system may process two analogous inputs into a digital survive-or-die decision.

  19. The apoptotic effect and the plausible mechanism of microwave radiation on rat myocardial cells.

    PubMed

    Zhu, Wenhe; Cui, Yan; Feng, Xianmin; Li, Yan; Zhang, Wei; Xu, Junjie; Wang, Huiyan; Lv, Shijie

    2016-08-01

    Microwaves may exert adverse biological effects on the cardiovascular system at the integrated system and cellular levels. However, the mechanism underlying such effects remains poorly understood. Here, we report a previously uncharacterized mechanism through which microwaves damage myocardial cells. Rats were treated with 2450 MHz microwave radiation at 50, 100, 150, or 200 mW/cm(2) for 6 min. Microwave treatment significantly enhanced the levels of various enzymes in serum. In addition, it increased the malondialdehyde content while decreasing the levels of antioxidative stress enzymes, activities of enzyme complexes I-IV, and ATP in myocardial tissues. Notably, irradiated myocardial cells exhibited structural damage and underwent apoptosis. Furthermore, Western blot analysis revealed significant changes in expression levels of proteins involved in oxidative stress regulation and apoptotic signaling pathways, indicating that microwave irradiation could induce myocardial cell apoptosis by interfering with oxidative stress and cardiac energy metabolism. Our findings provide useful insights into the mechanism of microwave-induced damage to the cardiovascular system.

  20. The Protective Properties of the Strawberry (Fragaria ananassa) against Carbon Tetrachloride-Induced Hepatotoxicity in Rats Mediated by Anti-Apoptotic and Upregulation of Antioxidant Genes Expression Effects.

    PubMed

    Hamed, Sherifa S; Al-Yhya, Nouf A; El-Khadragy, Manal F; Al-Olayan, Ebtesam M; Alajmi, Reem A; Hassan, Zeinab K; Hassan, Salwa B; Abdel Moneim, Ahmed E

    2016-01-01

    The strawberry (Fragaria ananassa) has been extensively used to treat a wide range of ailments in many cultures. The present study was aimed at evaluating the hepatoprotective effect of strawberry juice on experimentally induced liver injury in rats. To this end, rats were introperitoneally injected with carbon tetrachloride (CCl4) with or without strawberry juice supplementation for 12 weeks and the hepatoprotective effect of strawberry was assessed by measuring serum liver enzyme markers, hepatic tissue redox status and apoptotic markers with various techniques including biochemistry, ELISA, quantitative PCR assays and histochemistry. The hepatoprotective effect of the strawberry was evident by preventing CCl4-induced increase in liver enzymes levels. Determination of oxidative balance showed that strawberry treatment significantly blunted CCl4-induced increase in oxidative stress markers and decrease in enzymatic and non-enzymatic molecules in hepatic tissue. Furthermore, strawberry supplementation enhanced the anti-apoptotic protein, Bcl-2, and restrained the pro-apoptotic proteins Bax and caspase-3 with a marked reduction in collagen areas in hepatic tissue. These findings demonstrated that strawberry (F. ananassa) juice possessed antioxidant, anti-apoptotic and anti-fibrotic properties, probably mediated by the presence of polyphenols and flavonoids compounds.

  1. The Protective Properties of the Strawberry (Fragaria ananassa) against Carbon Tetrachloride-Induced Hepatotoxicity in Rats Mediated by Anti-Apoptotic and Upregulation of Antioxidant Genes Expression Effects

    PubMed Central

    Hamed, Sherifa S.; AL-Yhya, Nouf A.; El-Khadragy, Manal F.; Al-Olayan, Ebtesam M.; Alajmi, Reem A.; Hassan, Zeinab K.; Hassan, Salwa B.; Abdel Moneim, Ahmed E.

    2016-01-01

    The strawberry (Fragaria ananassa) has been extensively used to treat a wide range of ailments in many cultures. The present study was aimed at evaluating the hepatoprotective effect of strawberry juice on experimentally induced liver injury in rats. To this end, rats were introperitoneally injected with carbon tetrachloride (CCl4) with or without strawberry juice supplementation for 12 weeks and the hepatoprotective effect of strawberry was assessed by measuring serum liver enzyme markers, hepatic tissue redox status and apoptotic markers with various techniques including biochemistry, ELISA, quantitative PCR assays and histochemistry. The hepatoprotective effect of the strawberry was evident by preventing CCl4-induced increase in liver enzymes levels. Determination of oxidative balance showed that strawberry treatment significantly blunted CCl4-induced increase in oxidative stress markers and decrease in enzymatic and non-enzymatic molecules in hepatic tissue. Furthermore, strawberry supplementation enhanced the anti-apoptotic protein, Bcl-2, and restrained the pro-apoptotic proteins Bax and caspase-3 with a marked reduction in collagen areas in hepatic tissue. These findings demonstrated that strawberry (F. ananassa) juice possessed antioxidant, anti-apoptotic and anti-fibrotic properties, probably mediated by the presence of polyphenols and flavonoids compounds. PMID:27547187

  2. Formulation of a Cooperative-Confinement-Escape problem of multiple cooperative defenders against an evader escaping from a circular region

    NASA Astrophysics Data System (ADS)

    Li, Wei

    2016-10-01

    In this paper, we propose and formulate the Cooperative-Confinement-Escape (CCE) problem of multiple cooperative defenders against an evader escaping from a circular region, in which the defenders are moving on the circle with attempt to prevent possible escape of a single evader who is initially located inside the circle. The main contributions are summarized as follows: (1) we first provide an effective formulation of the CCE problem, which is an emphasis of this paper, with design of two nonlinear control strategies for the cooperative defenders and the adversarial evader, respectively. Particularly, we consider to include a proper interaction between each pair of the nearest-neighbor defenders, and an adaptive trajectory prediction mechanism in the strategies of the defenders to increase the chance of successful confinement. (2) For the first attempt on analyzing the CCE dynamics which is unavoidably strongly nonlinear, we analyze the minimum energy of the evader for possible escape. (3) For understanding of the behaviors of the system under different parameters, (i) we illustrate the effectiveness of the confinement strategy using the adaptive trajectory prediction mechanism, and (ii) the physical roles of the system parameters with respect to the system dynamics, some of which may be unexpected or not straightforward. A separate paper will be presented for systematic analysis of the agents' behaviors with respect to the large intervals of the parameter settings.

  3. An Empirical Investigation of Time-Out with and without Escape Extinction to Treat Escape-Maintained Noncompliance

    ERIC Educational Resources Information Center

    Everett, Gregory E.; Olmi, D. Joe; Edwards, Ron P.; Tingstrom, Daniel H.; Sterling-Turner, Heather E.; Christ, Theodore J.

    2007-01-01

    The present study evaluates the effectiveness of two time-out (TO) procedures in reducing escape-maintained noncompliance of 4 children. Noncompliant behavioral function was established via a functional assessment (FA), including indirect and direct descriptive procedures and brief confirmatory experimental analyses. Following FA, parents were…

  4. Action and mechanism of Fas and Fas ligand in immune escape of gallbladder carcinoma

    PubMed Central

    Xu, Li-Ning; Zou, Sheng-Quan; Wang, Jian-Ming

    2005-01-01

    AIM: To study the role of Fas and Fas ligand (FasL) in biological behaviors of gallbladder carcinoma, and their correlated action and mechanism in tumor escape. METHODS: Streptavidin-biotin-peroxidase immunohisto-chemistry technique was used to study the expression of Fas and FasL protein in 26 gallbladder carcinoma tissues, 18 gallbladder adenoma tissues, 3 gallbladder dysplasia tissues and 20 chronic cholecystitis tissues. Apoptosis of the infiltrating lymphocytes in these tissues was studied by terminal deoxynucleotidyl transferase (TdT)-mediated dUTP nick-end labeling (TUNEL) method. Expression of both proteins and apoptosis of the tumor infiltrating lymphocytes in cancer tissues of primary foci was compared with clinicopathological features of gallbladder carcinoma. RESULTS: The positive rates of Fas were not significantly different among carcinoma, adenoma, dysplasia and chronic cholecystitis. The positive rate of FasL in carcinoma was significantly higher than that in chronic cholecystitis (χ2 = 4.89, P<0.05). The apoptotic index (AI) in carcinoma was significantly higher than that in adenoma (t’ = 4.19, P<0.01) and chronic cholecystitis (t’ = 8.06, P<0.01). The AI was significantly lower in well-differentiated carcinoma and Nevin I-III carcinoma than that in poorly-differentiated carcinoma (t’ = 2.63, P<0.05) and Nevin IV-V carcinoma (t’ = 3.33, P<0.01). The confidence interval (CI) of infiltrating lymphocytes in adenoma, chronic cholecystitis, well-differentiated carcinoma and Nevin I-III carcinoma was very significantly lower than that in carcinoma (t’ = 6.99, P<0.01), adenoma (t’ = 3.66, P<0.01), poorly-differentiated carcinoma (t’ = 5.31, P<0.01) and Nevin IV-V carcinoma (t’ = 3.76, P<0.01), respectively. The CI of apoptosis of infiltrating lymphocytes in well-differentiated carcinoma was significantly lower than that in poorly-differentiated carcinoma (t = 2.52, P<0.05), and was not significantly lower in Nevin I-III carcinoma than in

  5. Abnormalities in Alternative Splicing of Apoptotic Genes and Cardiovascular Diseases

    PubMed Central

    Dlamini, Zodwa; Tshidino, Shonisani C.; Hull, Rodney

    2015-01-01

    Apoptosis is required for normal heart development in the embryo, but has also been shown to be an important factor in the occurrence of heart disease. Alternative splicing of apoptotic genes is currently emerging as a diagnostic and therapeutic target for heart disease. This review addresses the involvement of abnormalities in alternative splicing of apoptotic genes in cardiac disorders including cardiomyopathy, myocardial ischemia and heart failure. Many pro-apoptotic members of the Bcl-2 family have alternatively spliced isoforms that lack important active domains. These isoforms can play a negative regulatory role by binding to and inhibiting the pro-apoptotic forms. Alternative splicing is observed to be increased in various cardiovascular diseases with the level of alternate transcripts increasing elevated in diseased hearts compared to healthy subjects. In many cases these isoforms appear to be the underlying cause of the disease, while in others they may be induced in response to cardiovascular pathologies. Regardless of this, the detection of alternate splicing events in the heart can serve as useful diagnostic or prognostic tools, while those splicing events that seem to play a causative role in cardiovascular disease make attractive future drug targets. PMID:26580598

  6. Innate and Adaptive Immune Response to Apoptotic Cells

    PubMed Central

    Peng, YuFeng; Martin, David A; Kenkel, Justin; Zhang, Kang; Ogden, Carol Anne; Elkon, Keith B.

    2007-01-01

    The immune system is constantly exposed to dying cells, most of which arise during central tolerance and from effete circulating immune cells. Under homeostatic conditions, phagocytes (predominantly macrophages and dendritic cells) belonging to the innate immune system, rapidly ingest cells and their debris. Apoptotic cell removal requires recognition of altered self on the apoptotic membrane, a process which is facilitated by natural antibodies and serum opsonins. Recognition, may be site and context specific. Uptake and ingestion of apoptotic cells promotes an immunosuppressive environment that avoids inflammatory responses to self antigens. However, it does not preclude a T cell response and it is likely that constant exposure to self antigen, particularly by immature dendritic cells, leads to T cell tolerance. Tolerance occurs by several different mechanisms including anergy and deletion (for CD8+ T cells) and induction of T regulatory cells (for CD4+ T cells). Failed apoptotic cell clearance promotes immune responses to self antigens, especially when the cellular contents are leaked from the cell (necrosis). Inflammatory responses may be induced by nucleic acid stimulation of toll like receptors and other immune sensors, specific intracellular proteins and non protein (uric acid) stimulation of inflammasomes. PMID:17888627

  7. Allosteric Inhibition of Anti-Apoptotic MCL-1

    PubMed Central

    Lee, Susan; Wales, Thomas E.; Escudero, Silvia; Cohen, Daniel T.; Luccarelli, James; Gallagher, Catherine; Cohen, Nicole A.; Huhn, Annissa J.; Bird, Gregory H.; Engen, John R.; Walensky, Loren D.

    2016-01-01

    MCL-1 is an anti-apoptotic BCL-2 family protein that has emerged as a major pathogenic factor in human cancer. Like BCL-2, MCL-1 bears a surface groove whose function is to sequester the BH3 killer domains of pro-apoptotic BCL-2 family members, a mechanism harnessed by cancer cells to establish formidable apoptotic blockades. Whereas drugging the BH3-binding groove has been achieved for BCL-2, translating this approach to MCL-1 has been challenging. Here, we report an alternative mechanism for MCL-1 inhibition by small molecule covalent modification of C286 at a novel interaction site distant from the BH3-binding groove. Our structure-function analyses revealed that the BH3-binding capacity of MCL-1 and its suppression of BAX are impaired by molecular engagement, a phenomenon recapitulated by C286W mutagenic mimicry in vitro and in cells. Thus, we characterize an allosteric mechanism for disrupting the anti-apoptotic, BH3-binding activity of MCL-1, informing a new strategy for disarming MCL-1 in cancer. PMID:27159560

  8. Monitoring circulating apoptotic cells by in-vivo flow cytometry

    NASA Astrophysics Data System (ADS)

    Wei, Xunbin; Tan, Yuan; Chen, Yun; Zhang, Li; Li, Yan; Liu, Guangda; Wu, Bin; Wang, Chen

    2008-02-01

    Chemotherapies currently constitute one main venue of cancer treatment. For a large number of adult and elderly patients, however, treatment options are poor. These patients may suffer from disease that is resistant to conventional chemotherapy or may not be candidates for curative therapies because of advanced age or poor medical conditions. To control disease in these patients, new therapies must be developed that are selectively targeted to unique characteristics of tumor cell growth and metastasis. A reliable early evaluation and prediction of response to the chemotherapy is critical to its success. Chemotherapies induce apoptosis in tumor cells and a portion of such apoptotic cancer cells may be present in the circulation. However, the fate of circulating tumor cells is difficult to assess with conventional methods that require blood sampling. We report the in situ measurement of circulating apoptotic cells in live animals using in vivo flow cytometry, a novel method that enables real-time detection and quantification of circulating cells without blood extraction. Apoptotic cells are rapidly cleared from the circulation with a half-life of ~10 minutes. Real-time monitoring of circulating apoptotic cells can be useful for detecting early changes in disease processes, as well as for monitoring response to therapeutic intervention.

  9. Apoptotic gene analysis in idiopathic talipes equinovarus (clubfoot).

    PubMed

    Ester, Audrey R; Tyerman, Gayle; Wise, Carol A; Blanton, Susan H; Hecht, Jacqueline T

    2007-09-01

    Idiopathic talipes equinovarus, also known as clubfoot, is a common birth defect occurring in one of 1000 live births. It is a complex disorder in which multiple genes and environmental factors may play an etiologic role. Several chromosomal deletion regions, including 2q31-33, are associated with talipes equinovarus and may harbor genes that contribute to the idiopathic talipes equinovarus phenotype. Previously, two STRs in the 2q31-33, GATA149B10 and D2S1371, showed linkage with association to idiopathic talipes equinovarus. Single nucleotide polymorphisms (SNPs) in three apoptotic genes (Casp8, Casp10, and CFLAR) near GATA149B10 were genotyped in idiopathic talipes equinovarus families. rs3731714 in Casp10 showed linkage with association, suggesting variation in the apoptotic gene pathway, which is important in limb morphogenesis, and may play a role in the development of idiopathic talipes equinovarus. We genotyped SNPs spanning seven apoptotic genes-Casp3, Casp8, Casp9, Casp10, Bid, Bcl-2 and Apaf1-in 210 simplex trios and 139 multiplex families and tested for link-age and association to idiopathic talipes equinovarus. One SNP in each of the genes provided suggestive evidence of association with idiopathic talipes equinovarus. Several haplotypes constructed from these SNPs displayed altered transmission. These data suggest genetic variation in apoptotic genes may play a role in development of idiopathic talipes equinovarus.

  10. Apoptotic Cell Death of Human Interstitial Cells of Cajal

    PubMed Central

    De Giorgio, Roberto; Faussone Pellegrini, Maria Simonetta; Garrity-Park, Megan M.; Miller, Steven M.; Schmalz, Philip F.; Young-Fadok, Tonia M.; Larson, David W.; Dozois, Eric J.; Camilleri, Michael; Stanghellini, Vincenzo; Szurszewski, Joseph H.; Farrugia, Gianrico

    2008-01-01

    Interstitial cells of Cajal (ICC) are specialized mesenchyme-derived cells that regulate contractility and excitability of many smooth muscles with loss of ICC seen in a variety of gut motility disorders. Maintenance of ICC numbers is tightly regulated, with several factors known to regulate proliferation. In contrast, the fate of ICC is not established. The aim of this study was to investigate whether apoptosis plays a role in the regulation of ICC numbers in the normal colon. ICC were identified by immunolabeling for the c-Kit receptor tyrosine kinase and by electron microscopy. Apoptosis was detected in colon tissue by immunolabeling for activated caspase-3, terminal dUTP nucleotide end labeling, and ultrastructural changes in the cells. Apoptotic ICC were identified and counted in double labeled tissue sections. Apoptotic ICC were identified in all layers of the colonic muscle. In the muscularis propria 1.5 ± 0.2% of ICC were positive for activated caspase-3 and in the circular muscle layer 2.1 ± 0.9% of ICC were positive for TUNEL. Apoptotic ICC were identified by electron microscopy. Apoptotic cell death is ongoing in ICC. The level of apoptosis in ICC in healthy colon indicates that these cells must be continually regenerated to maintain intact networks. PMID:18798796

  11. A novel role for synaptic acetylcholinesterase as an apoptotic deoxyribonuclease

    PubMed Central

    Du, Aiying; Xie, Jing; Guo, Kaijie; Yang, Lei; Wan, Yihan; OuYang, Qi; Zhang, Xuejin; Niu, Xin; Lu, Lu; Wu, Jun; Zhang, Xuejun

    2015-01-01

    In addition to terminating neurotransmission by hydrolyzing acetylcholine, synaptic acetylcholinesterase (AChES) has been found to have a pro-apoptotic role. However, the underlying mechanism has rarely been investigated. Here, we report a nuclear translocation-dependent role for AChES as an apoptotic deoxyribonuclease (DNase). AChES polypeptide binds to and cleaves naked DNA at physiological pH in a Ca2+–Mg2+-dependent manner. It also cleaves chromosomal DNA both in pre-fixed and in apoptotic cells. In the presence of a pan-caspase inhibitor, the cleavage still occurred after nuclear translocation of AChES, implying that AChES-DNase acts in a CAD- and EndoG-independent manner. AChE gene knockout impairs apoptotic DNA cleavage; this impairment is rescued by overexpression of the wild-type but not (aa 32–138)-deleted AChES. Furthermore, in comparison with the nuclear-localized wild-type AChES, (aa 32–138)-deleted AChES loses the capacity to initiate apoptosis. These observations confirm that AChES mediates apoptosis via its DNase activity. PMID:27462404

  12. The inflammatory role of phagocyte apoptotic pathways in rheumatic diseases

    PubMed Central

    Cuda, Carla M.; Pope, Richard M.; Perlman, Harris

    2017-01-01

    Rheumatoid arthritis affects nearly 1% of the world's population and is a debilitating autoimmune condition that can result in joint destruction. During the past decade, inflammatory functions have been described for signalling molecules classically involved in apoptotic and non-apoptotic death pathways, including but not limited to toll-like receptor signalling, inflammasome activation, cytokine production, macrophage polarization and antigen citrullination. In light of these remarkable advances in the understanding of inflammatory mechanisms of the death machinery, this review provides a snapshot of the available evidence implicating death pathways, especially within the phagocyte populations of the innate immune system, in the perpetuation of rheumatoid arthritis. Elevated levels of signalling mediators of both the extrinsic and intrinsic apoptotic as well as the autophagy death pathways are observed in the joints of patients with rheumatoid arthritis. Furthermore, in rheumatoid arthritis patients, risk polymorphisms are present in signalling molecules of the extrinsic apoptotic and autophagy death pathways. Although research into the mechanisms underlying these death pathways has made considerable progress, this review highlights areas where further investigation is particularly needed. This exploration is critical, as new discoveries in this field could lead to the development of novel therapeutic targets for rheumatoid arthritis and other rheumatic diseases. PMID:27549026

  13. Transmitted/Founder Viruses Rapidly Escape from CD8+ T Cell Responses in Acute Hepatitis C Virus Infection.

    PubMed

    Bull, Rowena A; Leung, Preston; Gaudieri, Silvana; Deshpande, Pooja; Cameron, Barbara; Walker, Melanie; Chopra, Abha; Lloyd, Andrew R; Luciani, Fabio

    2015-05-01

    The interaction between hepatitis C virus (HCV) and cellular immune responses during very early infection is critical for disease outcome. To date, the impact of antigen-specific cellular immune responses on the evolution of the viral population establishing infection and on potential escape has not been studied. Understanding these early host-virus dynamics is important for the development of a preventative vaccine. Three subjects who were followed longitudinally from the detection of viremia preseroconversion until disease outcome were analyzed. The evolution of transmitted/founder (T/F) viruses was undertaken using deep sequencing. CD8(+) T cell responses were measured via enzyme-linked immunosorbent spot (ELISpot) assay using HLA class I-restricted T/F epitopes. T/F viruses were rapidly extinguished in all subjects associated with either viral clearance (n = 1) or replacement with viral variants leading to establishment of chronic infection (n = 2). CD8(+) T cell responses against 11 T/F epitopes were detectable by 33 to 44 days postinfection, and 5 of these epitopes had not previously been reported. These responses declined rapidly in those who became chronically infected and were maintained in the subject who cleared infection. Higher-magnitude CD8(+) T cell responses were associated with rapid development of immune escape variants at a rate of up to 0.1 per day. Rapid escape from CD8(+) T cell responses has been quantified for the first time in the early phase of primary HCV infection. These rapid escape dynamics were associated with higher-magnitude CD8(+) T cell responses. These findings raise questions regarding optimal selection of immunogens for HCV vaccine development and suggest that detailed analysis of individual epitopes may be required. A major limitation in our detailed understanding of the role of immune response in HCV clearance has been the lack of data on very early primary infection when the transmitted viral variants successfully establish

  14. Differential nitric oxide synthesis and host apoptotic events correlate with bleaching susceptibility in reef corals

    NASA Astrophysics Data System (ADS)

    Hawkins, T. D.; Krueger, T.; Becker, S.; Fisher, P. L.; Davy, S. K.

    2014-03-01

    Coral bleaching poses a threat to coral reefs worldwide. As a consequence of the temperature-induced breakdown in coral-dinoflagellate symbiosis, bleaching can have extensive effects on reef communities. However, our understanding of bleaching at a cellular level is limited, and this is particularly true regarding differential susceptibility among coral species. Recent work suggests that bleaching may represent a host innate immune-like response to symbiont dysfunction that involves synthesis of the signalling compound nitric oxide (NO) and the induction of host apoptotic-like cell death. In this study, we examined the activity of apoptosis-regulating enzymes alongside oxidised NO accumulation (a proxy for NO synthesis) in the reef corals Acropora millepora, Montipora digitata, and Pocillopora damicornis during experimental thermal stress. P. damicornis was the most sensitive species, suffering mortality (tissue sloughing) after 5 days at 33 °C but non-lethal bleaching after 9 days at 31.5 °C. A. millepora bleached at 33 °C but remained structurally intact, while M. digitata showed little evidence of bleaching. P. damicornis and A. millepora both exhibited evidence of temperature-induced NO synthesis and, after 5 days of heating, levels of oxidised NO in both species were fivefold higher than in controls maintained at 28.5 °C. These responses preceded bleaching by a number of days and may have occurred before symbiont dysfunction (measured as chlorophyll a degradation and oxidised NO accumulation). In A. millepora, apparent NO synthesis correlated with the induction of host apoptotic-like pathways, while in P. damicornis, the upregulation of apoptotic pathways occurred later. No evidence of elevated NO production or apoptosis was observed in M. digitata at 33 °C and baseline activity of apoptosis-regulating enzymes was negligible in this species. These findings provide important physiological data in the context of the responses of corals to global change and

  15. Modulation of macrophage antitumor potential by apoptotic lymphoma cells.

    PubMed

    Voss, Jorine J L P; Ford, Catriona A; Petrova, Sofia; Melville, Lynsey; Paterson, Margaret; Pound, John D; Holland, Pam; Giotti, Bruno; Freeman, Tom C; Gregory, Christopher D

    2017-06-01

    In aggressive non-Hodgkin's lymphoma (NHL), constitutive apoptosis of a proportion of the tumor cell population can promote net tumor growth. This is associated with the accumulation of tumor-associated macrophages (TAMs) that clear apoptotic cells and exhibit pro-oncogenic transcriptional activation profiles characteristic of reparatory, anti-inflammatory and angiogenic programs. Here we consider further the activation status of these TAMs. We compare their transcriptomic profile with that of a range of other macrophage types from various tissues noting especially their expression of classically activated (IFN-γ and LPS) gene clusters - typically antitumor - in addition to their previously described protumor phenotype. To understand the impact of apoptotic cells on the macrophage activation state, we cocultured apoptotic lymphoma cells with classically activated macrophages (M(IFN-γ/LPS), also known as M1, macrophages). Although untreated and M(IFN-γ/LPS) macrophages were able to bind apoptotic lymphoma cells equally well, M(IFN-γ/LPS) macrophages displayed enhanced ability to phagocytose them. We found that direct exposure of M(IFN-γ/LPS) macrophages to apoptotic lymphoma cells caused switching towards a protumor activation state (often referred to as M2-like) with concomitant inhibition of antitumor activity that was a characteristic feature of M(IFN-γ/LPS) macrophages. Indeed, M(IFN-γ/LPS) macrophages exposed to apoptotic lymphoma cells displayed increased lymphoma growth-promoting activities. Antilymphoma activity by M(IFN-γ/LPS) macrophages was mediated, in part, by galectin-3, a pleiotropic glycoprotein involved in apoptotic cell clearance that is strongly expressed by lymphoma TAMs but not lymphoma cells. Intriguingly, aggressive lymphoma growth was markedly impaired in mice deficient in galectin-3, suggesting either that host galectin-3-mediated antilymphoma activity is required to sustain net tumor growth or that additional functions of galectin-3

  16. Modulation of macrophage antitumor potential by apoptotic lymphoma cells

    PubMed Central

    Voss, Jorine J L P; Ford, Catriona A; Petrova, Sofia; Melville, Lynsey; Paterson, Margaret; Pound, John D; Holland, Pam; Giotti, Bruno; Freeman, Tom C; Gregory, Christopher D

    2017-01-01

    In aggressive non-Hodgkin's lymphoma (NHL), constitutive apoptosis of a proportion of the tumor cell population can promote net tumor growth. This is associated with the accumulation of tumor-associated macrophages (TAMs) that clear apoptotic cells and exhibit pro-oncogenic transcriptional activation profiles characteristic of reparatory, anti-inflammatory and angiogenic programs. Here we consider further the activation status of these TAMs. We compare their transcriptomic profile with that of a range of other macrophage types from various tissues noting especially their expression of classically activated (IFN-γ and LPS) gene clusters – typically antitumor – in addition to their previously described protumor phenotype. To understand the impact of apoptotic cells on the macrophage activation state, we cocultured apoptotic lymphoma cells with classically activated macrophages (M(IFN-γ/LPS), also known as M1, macrophages). Although untreated and M(IFN-γ/LPS) macrophages were able to bind apoptotic lymphoma cells equally well, M(IFN-γ/LPS) macrophages displayed enhanced ability to phagocytose them. We found that direct exposure of M(IFN-γ/LPS) macrophages to apoptotic lymphoma cells caused switching towards a protumor activation state (often referred to as M2-like) with concomitant inhibition of antitumor activity that was a characteristic feature of M(IFN-γ/LPS) macrophages. Indeed, M(IFN-γ/LPS) macrophages exposed to apoptotic lymphoma cells displayed increased lymphoma growth-promoting activities. Antilymphoma activity by M(IFN-γ/LPS) macrophages was mediated, in part, by galectin-3, a pleiotropic glycoprotein involved in apoptotic cell clearance that is strongly expressed by lymphoma TAMs but not lymphoma cells. Intriguingly, aggressive lymphoma growth was markedly impaired in mice deficient in galectin-3, suggesting either that host galectin-3-mediated antilymphoma activity is required to sustain net tumor growth or that additional functions of

  17. Expression of pro-apoptotic Bax and anti-apoptotic Bcl-2 proteins in human retinoblastoma.

    PubMed

    Singh, Lata; Pushker, Neelam; Saini, Neeru; Sen, Seema; Sharma, Anjana; Bakhshi, Sameer; Chawla, Bhavna; Kashyap, Seema

    2015-04-01

    Regulation of apoptosis is a complex process that involves a number of genes, including Bcl-2, Bcl-x, Bax and other Bcl-2 family members. The aim of the present study is to assess the expression of Bcl- 2 and Bax in retinoblastoma, and correlate them with clinical and histopathological parameters. The expression of Bcl-2 and Bax proteins were examined using immunohistochemistry, Western blotting and reverse transcriptase-polymerase chain reaction in a series of 60 prospective cases of primary retinoblastoma tissues. Immunohistochemistry showed expression of Bcl-2 in 40/60 (66.6%), whereas Bax expression was found only in 18/60 (30%) cases, and these correlated with mRNA expression. The Western blotting results also correlated well with the immunohistochemical expression of Bcl-2 (25 kDa) and Bax (21 kDa) proteins. Bcl-2 was expressed in 96% (24/25) of invasive tumours and in 45.7% (16/35) of non-invasive tumours. Expression of Bcl-2 significantly correlated with tumour invasiveness (P = 0.0274) and poor differentiation (P = 0.0163), whereas loss of Bax correlated with massive choroidal invasion and Pathological Tumor-Node-Metastasis (pTNM) (P = 0.0341). However, no correlation was found between Bax and Bcl-2 expression. Our findings suggest that these apoptotic regulatory proteins may serve as poor prognostic markers and can be used as a therapeutic target for the treatment of invasive retinoblastoma. Further functional studies are required to explore the role of Bax and Bcl-2 in retinoblastoma. © 2014 Royal Australian and New Zealand College of Ophthalmologists.

  18. Anatomy of an escape tectonic zone: Western Irian Jaya (Indonesia)

    NASA Astrophysics Data System (ADS)

    Pubellier, Manuel; Ego, Frédéric

    2002-07-01

    The western fold-and-thrust belt of New Guinea in Irian Jaya is presently a complex boundary, dominated by the Bird's Head block escape from the collision between the Australian plate and the remnants of volcanic belts carried by the Pacific plate. The escape rate given by geodetic measurements is of the order of 7 cm/yr, and movement is accommodated by a broad shear zone. We analyze this shear pattern using fault slip analyses performed in the field from 1992 to 1996, combined with focal mechanism inversions, moment tensors summations, and surface trace of structures inferred from radar and multispectral satellite images. Time control of the deformation is attained by isotope dating of the recent syntectonic intrusives. The geometry of the macro and microstructures occurred in two stages from the early Pliocene to the Present. The first stage (5 to 2 Ma) is marked by flat-and-ramps structures guided by N60°E lateral ramps associated with a N60°E cleavage, affecting the whole of western Irian Jaya. The second stage (2 Ma to Present) shows the collapse of the western fold-and-thrust belt and the escape of the Bird's Head and the Lengguru belts along N60°E transtensile faults. In the latter stage, the strike-slip offset is distributed on the N60°E schistosity zone along which some fracture planes are reactivated as left-lateral transtensile faults. Shallow earthquakes moment tensors have been inverted for stress and summed to get strain rates to define contrasting structural provinces. The spatial variations in both stress and strain fields from earthquakes and microtectonics show that (1) they are consistent and are assumed to be coeval, (2) they reveal that oblique convergence is partitioned, and (3) they are influenced by the existence of a free boundary. We see no significant rotation of stress axes laterally along the escape zone. Instead, stresses change according to the different orientations of basement structures and thus undergo rapid spatial variations

  19. Apoptotic pathways in degenerative disk lesions in the wrist.

    PubMed

    Unglaub, Frank; Thomas, Susanne B; Kroeber, Markus W; Dragu, Adrian; Fellenberg, Jörg; Wolf, Maya B; Horch, Raymund E

    2009-12-01

    Degenerative articular disk perforations of the triangular fibrocartilage (TFC) of the wrist could result from chronic loading of the ulnocarpal joint. Apoptosis played a crucial role in fibrocartilage cell loss, and the purpose of this study was to clarify which apoptotic pathway was involved in the development of degenerative disk lesions. We also investigated whether ulna length played an etiologic role in the occurrence of fibrocartilage cell loss. Included in the study were 17 patients with degenerative articular disk tears of the TFC (Palmer type 2C). After arthroscopic debridement of the TFC, histologic sections were examined to assess the presence of apoptosis. Apoptosis was determined by use of caspase 3, caspase 8, and caspase 9 immunohistochemistry. Furthermore, Fas ligand and BID (BH3 interacting domain death) agonist were applied for immunohistochemical analysis. Cells positive for caspase 3, caspase 8, caspase 9, Fas ligand, and BID were found in all specimens. The number of cells positive for caspase 3 and BID was significantly increased in specimens from patients with an ulna-positive variance. In contrast, for cells positive for caspase 8, caspase 9, and Fas ligand, no significant difference was found between specimens from patients with an ulna-positive variance and those from patients with an ulna-neutral/ulna-negative variance. The extrinsic and intrinsic apoptotic pathways are involved in the development of degenerative disk lesions. Fibrocartilage cell loss occurs mainly through the intrinsic apoptotic pathway. The accumulation of apoptotic cells is not significantly different between the 3 zones of the TFC. It could be verified that ulna length is correlated with fibrocartilage cell loss. Ulnar shortening is a valuable treatment option for degenerative TFC lesions. Knowledge of the specific apoptotic pathway that is causing degenerative disk lesions is critical in selecting the appropriate and most beneficial therapeutic treatment to halt

  20. Mitochondria-associated apoptotic signalling in denervated rat skeletal muscle

    PubMed Central

    Siu, Parco M; Alway, Stephen E

    2005-01-01

    Apoptosis has been implicated in the regulation of denervation-induced muscle atrophy. However, the activation of apoptotic signal transduction during muscle denervation has not been fully elucidated. The present study examined the apoptotic responses to denervation in rat gastrocnemius muscle. Following 14 days of denervation, the extent of apoptotic DNA fragmentation as determined by a cytosolic nucleosome ELISA was increased by 100% in the gastrocnemius muscle. RT-PCR and immunoblot analyses indicated that Bax was dramatically upregulated while Bcl-2 was modestly increased; however, the Bax/Bcl-2 ratio was significantly increased in denervated muscles relative to control muscles. Analyses of ELISA and immunoblots from mitochondria-free cytosol extracts showed a significant increase in mitochondria-associated apoptotic factors, including cytochrome c, Smac/DIABLO and apoptosis-inducing factor (AIF). In addition to the upregulation of caspase-3 and -9 mRNA, pro-/cleaved caspase protein and proteolytic activity levels, the X-linked inhibitor of apoptosis (XIAP) protein level was downregulated. The cleaved product of poly(ADP-ribose) polymerase (PARP) was detected in muscle samples following denervation. Although we did not find a difference in the inhibitor of DNA binding/ differentiation-2 (Id2) and c-Myc protein contents between the denervated and control muscles, the protein content of tumour suppressor p53 was significantly increased in both the nuclear and the cytosolic fractions with denervation. Moreover, denervation increased the protein content of HSP70, whereas the MnSOD (a mitochondrial isoform of superoxide dismutase) protein content was diminished, which indicated that denervation might have induced cellular and/or oxidative stress. Our data show that mitochondria-associated apoptotic signalling is upregulated during muscle denervation. We interpret these findings to indicate that apoptosis has a physiologically important role in regulating denervation

  1. Cyclic regulation of apoptotic gene expression in the mouse oviduct

    PubMed Central

    Jeoung, Myoungkun; Bridges, Phillip J.

    2011-01-01

    The oviduct is a dynamic structure whose function relies upon cyclic changes in the morphology of both ciliated and secretory luminal epithelial cells. Unfortunately, infection of these epithelial cells by sexually transmitted pathogens can lead to pelvic inflammatory disease, ectopic pregnancies and infertility. The disruption of normal, cyclic apoptosis in the oviductal epithelium appears to be a causal factor of sexually-transmitted oviductal pathology and therefore, these pathways represent a potential target for diagnosis and/or therapeutic intervention. The objective of this study was to determine the normal, cyclic pattern of expression for apoptotic genes in the oviduct of the naturally cycling mouse, generating fundamental information that can be applied to the development of animal models for research and/or the identification of targets for disease intervention. Whole oviducts were collected from regular cycling mice killed at 1 pm on each day of the estrous cycle and the expression of 84 key apoptotic genes determined by targeted PCR super-array. Intact and cleaved caspases were then evaluated by western blotting. The expression of mRNA for genes classified as pro-apoptotic (Bad, Bak1 and Bok) and anti-apoptotic (Bag3, Bnip2 and Xiap) was regulated by day of the estrous cycle (P < 0.05). Differences in the temporal expression of several p53-related genes (Trp53bp2, Trp53inp1 and Trp73), those specific to the TNF superfamily (Tnfrsf10 and Tnfsf10b) and one caspase (Casp14) were also observed (P < 0.05). The cleaved forms of Capases-3, −6 and −12 were all detected throughout the estrous cycle. These results represent the first pathway wide analysis of apoptotic gene expression in the murine oviduct. PMID:21635812

  2. Cyclic regulation of apoptotic gene expression in the mouse oviduct.

    PubMed

    Jeoung, Myoungkun; Bridges, Phillip J

    2011-01-01

    The oviduct is a dynamic structure whose function relies upon cyclic changes in the morphology of both ciliated and secretory luminal epithelial cells. Unfortunately, infection of these epithelial cells by sexually transmitted pathogens can lead to pelvic inflammatory disease, ectopic pregnancies and infertility. The disruption of normal, cyclic apoptosis in the oviducal epithelium appears to be a causal factor of oviducal pathology and therefore, these pathways represent a potential target for diagnosis and therapeutic intervention. The objective of this study was to determine the pattern of expression for apoptotic genes in the oviduct of the naturally cycling mouse, generating fundamental information that can be applied to the development of animal models for research and the identification of targets for disease intervention. Whole oviducts were collected from regular cycling mice killed at 1p.m. on each day of the oestrous cycle and the expression of 84 apoptotic genes determined by targeted PCR super-array. Intact and cleaved caspases were then evaluated by western blotting. The expression of mRNA for genes classified as pro-apoptotic (Bad, Bak1 and Bok) and anti-apoptotic (Bag3, Bnip2 and Xiap) was regulated by day (P < 0.05). Differences in the temporal expression of several p53-related genes (Trp53bp2, Trp53inp1 and Trp73), those specific to the TNF superfamily (Tnfrsf10 and Tnfsf10b) and one caspase (Casp14) were also observed (P < 0.05). The cleaved forms of Caspases-3, -6 and -12 were all detected throughout the oestrous cycle. These results represent the first pathway-wide analysis of apoptotic gene expression in the murine oviduct.

  3. Celastrus paniculatus Willd. mitigates t-BHP induced oxidative and apoptotic damage in C2C12 murine muscle cells.

    PubMed

    Kumar, Kandikattu Hemanth; Venuprasad, M P; Jayashree, G V; Rachitha, P; Krupashree, K; Pal, Ajay; Khanum, Farhath

    2015-12-01

    Identification, exploration and scientific validation of antioxidant rich herbal extracts to mitigate the radical induced cell damage provide new insights in the field of ayurvedic research/therapies. In the present study, we evaluated the anti-oxidant and anti-apoptotic potential of Celastrus paniculatus seed extract (CPSE) against tertiary butyl hydroperoxide (t-BHP) induced mice muscle cell damage. The extract at a dose of 50 µg/ml protected the cells up to 70 % as evidenced by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide cell survival assay and also prevented LDH leakage against t-BHP induced cytotoxicity. CPSE showed potential antioxidant activity by restoring mitochondrial membrane potential and inhibited reactive oxygen species generation and lipid peroxidation. CPSE pretreatment also regulated the antioxidant markers such as superoxide dismutase and catalase enzymes content and proteins expression. Further CPSE showed anti-apoptotic effects by regulating cytochrome-C and heat shock protein-70 expression and also showed 43 % muscle cell DNA damage inhibitory activity against t-BHP challenge as observed by single cell gel electrophoresis assay. Overall the extract inhibits the muscle cell damage, thus explaining the possible anti-oxidant/anti-apoptotic defense status of the C. paniculatus seed extract.

  4. Unequal nuclear Sp1/GC box DNA binding activity distinguishes proliferating from differentiated senescent or apoptotic cells.

    PubMed

    Rieber, M; Strasberg Rieber, M

    1999-10-29

    Terminal differentiation can result in either viable, non-proliferating or apoptotic cells. In B16 melanoma, millimolar L-tyrosine induces tyrosinase, a key enzyme for terminal pigmentation concurrent with either irreversible growth arrest at low cell density, or apoptosis at high cell density. Since the promoter for melanocyte-specific tyrosinase expression contains sites for the Sp1 transcription factor, we have investigated the relationship of Sp1-mediated GC-box DNA binding activity to growth control in undifferentiated and in terminally differentiated viable or apoptotic cells. Nuclear extracts from viable, differentiated cells showed increased retardation of GC box DNA sequence compared with that seen in proliferating cells or those reversibly arrested in early G(1) or late G(1) / S. In contrast, nuclear proteins from dying, differentiated cells showed loss of nuclear GC box DNA binding activity without decrease in binding to TTTGCGCG sequences recognized by the E2F transcription factor, which is known to interact with Sp1. However, cyto-plasmic fractions from apoptotic cells revealed phos-phatase-activated retardation of GC box DNA, which was not evident in similarly treated fractions from undifferentiated cells or sparse differentiated cells. Terminal differentiation also correlated with increase in a slow-migrating phosphorylated Sp1 isoform. Our data suggests that lack of nuclear Sp1/GC box DNA binding activity, may promote apoptosis by diminishing expression of survival-associated genes regulated by GC box DNA promoter sequences in dense terminally differentiated melanoma cells. Copyright 1999 Wiley-Liss, Inc.

  5. 20. DETAIL VIEW IN 18FOOT LOCK, ESCAPE TRAINING TANK, SHOWING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    20. DETAIL VIEW IN 18-FOOT LOCK, ESCAPE TRAINING TANK, SHOWING DOOR INTO TANK AT RIGHT - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  6. Ion Escape Processes of Mars with a Weak Intrinsic Magnetic Field

    NASA Astrophysics Data System (ADS)

    Sakai, S.; Seki, K.; Terada, N.; Shinagawa, H.; Tanaka, T.; Ebihara, Y.

    2017-10-01

    The ion tailward flux increases by the magnetization of Mars. Ions escape through four channels in the magnetotail, which are related to the cusp region and the reconnection. This could result in the escape rate from the upper atmosphere enhanced.

  7. Antibody Escape Kinetics of Equine Infectious Anemia Virus Infection of Horses

    PubMed Central

    Mealey, Robert H.

    2015-01-01

    Lentivirus escape from neutralizing antibodies (NAbs) is not well understood. In this work, we quantified antibody escape of a lentivirus, using antibody escape data from horses infected with equine infectious anemia virus. We calculated antibody blocking rates of wild-type virus, fitness costs of mutant virus, and growth rates of both viruses. These quantitative kinetic estimates of antibody escape are important for understanding lentiviral control by antibody neutralization and in developing NAb-eliciting vaccine strategies. PMID:25878104

  8. Chasing and escaping by three groups of species.

    PubMed

    Sato, Masahide

    2012-06-01

    We study group chasing and escaping between three species. In our model, one species acts as a group of chasers for another species and acts as a group of targets for the third species. When a particle is caught by a target, the particle becomes a new chaser. Although the ratio of three species is changed, the total number of particles is conserved. When particles move randomly, the numbers of the three species change periodically but no species seems to become extinct. If particles escape from the nearest chaser and chase the nearest target, the extinction of a species occurs. The extinction induces that of the second species and finally only one species survives.

  9. The production and escape of nitrogen atoms on Mars

    NASA Technical Reports Server (NTRS)

    Fox, J. L.

    1993-01-01

    Updated rate coefficients and a revised ionosphere-thermosphere model are used to compute the production rates and densities of odd nitrogen species in the Martian atmosphere. Computed density profiles for N(4S), N(2D), N(2P), and NO are presented. The model NO densities are found to be about a factor of 2-3 less than those measured by the Viking 1 mass spectrometer. Revised values for the escape rates of N atoms from dissociative recombination and ionospheric reactions are also computed. Dissociative recombination is found to be comparable in importance to photodissociation at low solar activity, but it is still the most important escape mechanism for N-14 at high solar activity.

  10. Escape rate of active particles in the effective equilibrium approach

    NASA Astrophysics Data System (ADS)

    Sharma, A.; Wittmann, R.; Brader, J. M.

    2017-01-01

    The escape rate of a Brownian particle over a potential barrier is accurately described by the Kramers theory. A quantitative theory explicitly taking the activity of Brownian particles into account has been lacking due to the inherently out-of-equilibrium nature of these particles. Using an effective equilibrium approach [Farage et al., Phys. Rev. E 91, 042310 (2015), 10.1103/PhysRevE.91.042310] we study the escape rate of active particles over a potential barrier and compare our analytical results with data from direct numerical simulation of the colored noise Langevin equation. The effective equilibrium approach generates an effective potential that, when used as input to Kramers rate theory, provides results in excellent agreement with the simulation data.

  11. Fractionation of noble gases by thermal escape from accreting planetesimals

    NASA Technical Reports Server (NTRS)

    Donahue, T. M.

    1986-01-01

    Assuming solar initial elemental and isotopic ratios and a determination of the degree of fractionation occurring by competition between gravitational binding and escape, a model is developed for selective noble gas loss through escape during the growth of planetesimals to form the terrestrial planets. Of the two classes of planetesimals that can form on a time scale that is consistent with modern accretion models, one is depleted in neon while the other is neon-rich. The mechanism is noted to be capable of accounting for all known properties of the noble gas volatiles on the terrestrial planets, with only one exception, namely the Ar-36/Ar-38 ratios for Mars and the earth, which are much lower than observed.

  12. Ionospheric Flow and Escape of Ions from Titan and Venus

    NASA Technical Reports Server (NTRS)

    Hartle, R. E.; Intriligator, D. S.; Grebowsky, Joseph M.; Vondrak, Richard R. (Technical Monitor)

    2001-01-01

    Knowledge gained from measurements and models is used to study the high-speed plasmas interacting with the atmospheres and ionospheres of Titan and Venus. Considering the similarities of the interactions, comparative analysis is used to support the interpretations of observations made at each body. Ionospheric flow inferred to exist by analysis of measurements made from the Pioneer Venus Orbiter supports the interpretation of similar flow in the ionosphere of Titan. The concept that cold ions escape from the ionosphere of Venus is supported by the Voyager I observation that cold ions escape down the magnetic tail of Titan. Pickup O+ ion energy distributions observed at their source in the ionosheath of Venus are shown to be influenced by finite gyroradius effects. The signatures of such effects are expected to be retained as the ions move into the wakes of Titan and Venus.

  13. Facilities and capabilities catalog for landing and escape systems

    NASA Technical Reports Server (NTRS)

    Meyerson, Robert E. (Editor)

    1992-01-01

    This catalog serves as a single source reference for designers of landing and escape systems for spacecraft, aircraft, weapons, and airdrop system. It includes those facilities which may be required by a system designer in planning a development test program for many applications. The primary objective of this catalog is to provide a means for identifying critical facilities with the U.S. which can be used for the development of landing and escape systems. A secondary objective is to provide a useful tool to the system designer for picking and choosing facilities and capabilities. The six chapters in this volume include wind tunnels, drop zones, test aircraft, fabrication facilities, design tools, and other miscellaneous facilities. A different data sheet format is used for each of the chapters which provides information on performance, location, special capabilities, and a local point of contact. All inputs were solicited from the individual facilities and have not been independently verified for accuracy.

  14. The production and escape of nitrogen atoms on Mars

    NASA Astrophysics Data System (ADS)

    Fox, J. L.

    1993-02-01

    Updated rate coefficients and a revised ionosphere-thermosphere model are used to compute the production rates and densities of odd nitrogen species in the Martian atmosphere. Computed density profiles for N(4S), N(2D), N(2P), and NO are presented. The model NO densities are found to be about a factor of 2-3 less than those measured by the Viking 1 mass spectrometer. Revised values for the escape rates of N atoms from dissociative recombination and ionospheric reactions are also computed. Dissociative recombination is found to be comparable in importance to photodissociation at low solar activity, but it is still the most important escape mechanism for N-14 at high solar activity.

  15. Behavioral analysis of the escape response in larval zebrafish

    NASA Astrophysics Data System (ADS)

    Feng, Ruopei; Girdhar, Kiran; Chemla, Yann; Gruebele, Martin

    The behavior of larval zebrafish is of great interest because the limited number of locomotor neurons in larval zebrafish couples with its rich repertoire of movements as a vertebrate animal. Current research uses a priori-selected parameters to describe their swimming behavior while our lab has built a parameter-free model based on singular value decomposition analysis to characterize it. Our previous work has analyzed the free swimming of larval zebrafish and presented a different picture from the current classification of larval zebrafish locomotion. Now we are extending this work to the studies of their escape response to acoustic stimulus. Analysis has shown intrinsic difference in the locomotion between escape response and free swimming.

  16. Implications of Advanced Technologies for Air and Spacecraft Escape

    DTIC Science & Technology

    1990-02-01

    when joint strength is exceeded or when the long bones are fractured by contact with the seat structure. Injury of the cervical spine is caused by...accelerations with the operational injury rates asPaciated with the specific escape systems (12.13). After operational verification and use of the model in...York,309-342, 1974. 4. Ewing C.L. : Injury criteriaand human tolerance for the neck . Aircraft crashworthiness, University press of Virginia

  17. Escape Strategies for Turboprop Aircraft in a Microburst Windshear

    DTIC Science & Technology

    1991-03-01

    embodied theser echarcerisics ofthemicobursencountered by Delta Flight 191 during an q~oc olnin tDla /t Worth, 2 August, 1985. Different escape strategies...miles) or less. In spite of its small horizontal scale, an intense microburst could induce damaging winds as high as 75 m/sec (168 mph). Conclusions...resulted in a loss of airspeed accompanied by a sharp nose down pitch. A very high sink rate resulted. The aircraft exited the bottom of the thunderstorm

  18. Tumor escape from immune response: mechanisms and targets of activity.

    PubMed

    Gabrilovich, Dmitry; Pisarev, Vladimir

    2003-10-01

    Immune system plays an important role in control of tumor progression. Effective antitumor immune response depends on close interaction of several elements of immune system. They include antigen-presenting cells, different subsets of T cells, B cells and NK cells. However, tumor cells developed a number of mechanisms to escape recognition and elimination by immune system. In this review we will discuss these mechanisms and address possible approaches to correct them.

  19. Escaping radio emission from pulsars: Possible role of velocity shear

    SciTech Connect

    Mahajan, S.M. |; Machabeli, G.Z.; Rogava, A.D. |

    1997-01-01

    It is demonstrated that the velocity shear, intrinsic to the e{sup +}e{sup {minus}} plasma present in the pulsar magnetosphere, can efficiently convert the nonescaping longitudinal Langmuir waves (produced by some kind of a beam or stream instability) into propagating (escaping) electromagnetic waves. It is suggested that this shear induced transformation may be the basic mechanism needed for the eventual generation of the observed pulsar radio emission.

  20. Helicopter crash in water: effects of simulator escape training.

    PubMed

    Hytten, K

    1989-01-01

    Findings are presented from an interview study of five crew members who survived a helicopter crash. Four of the five surviving men had received simulated helicopter accident training prior to the crash. One untrained crew member died. The four previously trained survivors claimed that the training was of decisive moment in their escape and survival. Contributions from training appeared to be provision of confidence and thought control. The author discusses these as the development of a positive response-outcome expectancy.

  1. Escape factors in zero-dimensional radiation-transfer codes

    NASA Astrophysics Data System (ADS)

    Phillips, G. J.; Wark, J. S.; Kerr, F. M.; Rose, S. J.; Lee, R. W.

    2008-04-01

    Several zero-dimensional non-LTE radiation-transfer codes are in common use within the laser-plasma community (for example, RATION, FLY, FLYCHK and GALAXY). These codes are capable of generating calculated emission spectra for a plasma of given density and temperature in the presence of a radiation field. Although dimensionless in nature, these codes can take into account the coupling of radiation and populations by use of the escape factor method, and in this sense the codes incorporate the finite size of the plasma of interest in two ways - firstly in the calculation of the effect of the radiation on the populations and secondly when using these populations to generate a spectrum. Different lengths can be used within these two distinct operations, though it has not been made clear what these lengths should be. We submit that the appropriate length to use for the calculation of populations in such zero-dimensional codes is the mean chord of the system, whilst when calculating the spectrum the appropriate length is the size of the plasma along the line of sight. Indeed, for specific plasma shapes using the appropriate escape factors it can be shown that this interpretation agrees with analytic results. However, this is only the case if the correct escape factor is employed: use of the Holstein escape factor (which is in widely distributed versions of the codes mentioned above) is found to be significantly in error under most conditions. We also note that for the case where a plasma is close to coronal equilibrium, some limited information concerning the shape of the plasma can be extracted merely from the ratio of optically thick to optically thin lines, without the need for any explicit spatial resolution.

  2. Self-Organizing Reactive Fluid Escape from Dehydrating Rocks

    NASA Astrophysics Data System (ADS)

    John, T.; Pluemper, O.; Podladchikov, Y.; Vrijmoed, J. C.; Scambelluri, M.

    2014-12-01

    Water escape from dehydrating rocks within the Earth's interior is a key process for long-term global water and element cycles, eg. at subduction zones a fluid escape mechanism must exist that prevents ocean water to be drained into the mantle. Existing fluid flow models require a priori physical assumptions (eg. preexisting porosity) and cannot resolve the evolution from initial fluid production to flow channelization. In order to develop a model of this evolution, we need to unravel natural laboratories that display the incipient dehydration stages and the micro- to macro-scale fluid escape route evolution. The Erro-Tobbio meta-serpentinites (Italy) provide a unique snapshot into these early dehydration stages, recording the breakdown of hydrous antigorite to anhydrous olivine plus fluid and the formation of an olivine-vein network. We find that dehydration, fluid pooling, and flow initiation are controlled by micro-scale compositional rock differences. Our model starts with a rock in which all water is stored in solid and any preexisting porosity is negligible (zero-porosity case). As the rock descents into the mantle increasing T will initiate dehydration reactions, dividing the rock continuously into a dry solid and a fluid-filled porosity. Spatially variable reaction progress results in dynamically evolving porosity/permeability and heterogeneous fluid-pore pressure distributions. Fluid-pressure gradient relaxation causes fluid flow and its thermodynamic feedback triggers reactions to progress, resulting in a self-amplifying process. Our new thermodynamic-mechanical model for reaction-porosity waves shows that fluid flow occurs solely in the reaction products and self-organizes into channelized fluid escape networks. This holds the key to formulating future quantitative models that address spatiotemporal processes such as the coupling between fluid release at depth and volcanic eruptions and the amounts of structurally bound water transferred into deep Earth.

  3. 46 CFR 56.50-25 - Safety and relief valve escape piping.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 2 2010-10-01 2010-10-01 false Safety and relief valve escape piping. 56.50-25 Section 56.50-25 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) MARINE ENGINEERING PIPING... valve escape piping. (a) Escape piping from unfired steam generator, boiler, and superheater safety...

  4. Escape Performance Following Exposure to Inescapable Shock: Deficits in Motor Response Maintenance

    ERIC Educational Resources Information Center

    Anisman, Hymie; And Others

    1978-01-01

    A series of 13 experiments employing mice systematically investigated shock-elicited activity in a circular field and escape performance in a shuttle box following exposure to either escapable or inescapable shock. Results show that escape interference induced by inescapable shock may be comfortably interpreted in terms of a decreased tendency for…

  5. On the Relative Contributions of Noncontingent Reinforcement and Escape Extinction in the Treatment of Food Refusal

    ERIC Educational Resources Information Center

    Reed, Gregory K.; Piazza, Cathleen C.; Patel, Meeta R.; Layer, Stacy A.; Bachmeyer, Melanie H.; Bethke, Stephanie D.; Gutshall, Katharine A.

    2004-01-01

    In the current investigation, we evaluated the relative effects of noncontingent reinforcement (NCR), escape extinction, and a combination of NCR and escape extinction as treatment for the feeding problems exhibited by 4 children. For each participant, consumption increased only when escape extinction was implemented, independent of whether NCR…

  6. Escape Geography--Developing Middle-School Students' Sense of Place.

    ERIC Educational Resources Information Center

    Allen, Rodney F.; Molina, Laurie E. S.

    1992-01-01

    Suggests a social studies unit on escaping geography. Examines escape from dangerous places including an airliner, hotel fire, or war zone or from a social situation such as a boring speech or party. Describes historic escapes such as the Underground Railroad and the Berlin Wall. Lists learning strategies such as awareness of space and cognitive…

  7. Escape Geography--Developing Middle-School Students' Sense of Place.

    ERIC Educational Resources Information Center

    Allen, Rodney F.; Molina, Laurie E. S.

    1992-01-01

    Suggests a social studies unit on escaping geography. Examines escape from dangerous places including an airliner, hotel fire, or war zone or from a social situation such as a boring speech or party. Describes historic escapes such as the Underground Railroad and the Berlin Wall. Lists learning strategies such as awareness of space and cognitive…

  8. Autocrine secretion of 15d-PGJ2 mediates simvastatin-induced apoptotic burst in human metastatic melanoma cells

    PubMed Central

    Wasinger, Christine; Künzl, Martin; Minichsdorfer, Christoph; Höller, Christoph; Zellner, Maria; Hohenegger, Martin

    2014-01-01

    Background and Purpose Despite new therapeutic approaches, metastatic melanomas still have a poor prognosis. Statins reduce low-density lipoprotein cholesterol and exert anti-inflammatory and anti-proliferative actions. We have recently shown that simvastatin triggers an apoptotic burst in human metastatic melanoma cells by the synthesis of an autocrine factor. Experimental Approach The current in vitro study was performed in human metastatic melanoma cell lines (A375, 518a2) and primary human melanocytes and melanoma cells. The secretome of simvastatin-stressed cells was analysed with two-dimensional difference gel electrophoresis and MS. The signalling pathways involved were analysed at the protein and mRNA level using pharmacological approaches and siRNA technology. Key Results Simvastatin was shown to activate a stress cascade, leading to the synthesis of 15-deoxy-12,14-PGJ2 (15d-PGJ2), in a p38- and COX-2-dependent manner. Significant concentrations of 15d-PGJ2 were reached in the medium of melanoma cells, which were sufficient to activate caspase 8 and the mitochondrial pathway of apoptosis. Inhibition of lipocalin-type PGD synthase, a key enzyme for 15d-PGJ2 synthesis, abolished the apoptotic effect of simvastatin. Moreover, 15d-PGJ2 was shown to bind to the fatty acid-binding protein 5 (FABP5), which was up-regulated and predominantly detected in the secretome of simvastatin-stressed cells. Knockdown of FABP5 abolished simvastatin-induced activation of PPAR-γ and amplified the apoptotic response. Conclusions and Implications We characterized simvastatin-induced activation of the 15d-PGJ2/FABP5 signalling cascades, which triggered an apoptotic burst in melanoma cells but did not affect primary human melanocytes. These data support the rationale for the pharmacological targeting of 15d-PGJ2 in metastatic melanoma. PMID:25091578

  9. Chronic MDMA induces neurochemical changes in the hippocampus of adolescent and young adult rats: Down-regulation of apoptotic markers.

    PubMed

    García-Cabrerizo, Rubén; García-Fuster, M Julia

    2015-07-01

    While hippocampus is a brain region particularly susceptible to the effects of MDMA, the cellular and molecular changes induced by MDMA are still to be fully elucidated, being the dosage regimen, the species and the developmental stage under study great variables. This study compared the effects of one and four days of MDMA administration following a binge paradigm (3×5 mg/kg, i.p., every 2 h) on inducing hippocampal neurochemical changes in adolescent (PND 37) and young adult (PND 58) rats. The results showed that chronic MDMA caused hippocampal protein deficits in adolescent and young adult rats at different levels: (1) impaired serotonergic (5-HT2A and 5-HT2C post-synaptic receptors) and GABAergic (GAD2 enzyme) signaling, and (2) decreased structural cytoskeletal neurofilament proteins (NF-H, NF-M and NF-L). Interestingly, these effects were not accompanied by an increase in apoptotic markers. In fact, chronic MDMA inhibited proteins of the apoptotic pathway (i.e., pro-apoptotic FADD, Bax and cytochrome c) leading to an inhibition of cell death markers (i.e., p-JNK1/2, cleavage of PARP-1) and suggesting regulatory mechanisms in response to the neurochemical changes caused by the drug. The data, together with the observed lack of GFAP activation, support the view that chronic MDMA effects, regardless of the rat developmental age, extends beyond neurotransmitter systems to impair other hippocampal structural cell markers. Interestingly, inhibitory changes in proteins from the apoptotic pathway might be taking place to overcome the protein deficits caused by MDMA. Copyright © 2015 Elsevier Inc. All rights reserved.

  10. Oxygen and carbogen breathing following simulated submarine escape.

    PubMed

    Gennser, Mikael; Loveman, Geoff; Seddon, Fiona; Thacker, Julian; Blogg, S Lesley

    2014-01-01

    Escape from a disabled submarine exposes escapers to a high risk of decompression sickness (DCS). The initial bubble load is thought to emanate from the fast tissues; it is this load that should be lowered to reduce risk of serious neurological DCS. The breathing of oxygen or carbogen (5% CO2, 95% O2) post-surfacing was investigated with regard to its ability to reduce the initial bubble load in comparison to air breathing. Thirty-two goats were subject to a dry simulated submarine escape profile to and from 240 meters (2.5 MPa). On surfacing, they breathed air (control), oxygen or carbogen for 30 minutes. Regular Doppler audio bubble grading was carried out, using the Kisman Masurel (KM) scale. One suspected case of DCS was noted. No oxygen toxicity or arterial gas embolism occurred. No significant difference was found between the groups in terms of the median peak KM grade or the period before the KM grade dropped below III. Time to disappearance of bubbles was significantly different between groups; oxygen showed faster bubble resolution than carbogen and air. This reduction in time to bubble resolution may be beneficial in reducing decompression stress, but probably does not affect the risk of fast-tissue DCS.

  11. Fleeing to refuge: Escape decisions in the race for life.

    PubMed

    Cooper, William E

    2016-10-07

    Economic escape theory that predicts that flight initiation distance (FID=predator-prey distance when a prey begins to flee from an approaching predator) increases as predation risk increases has been overwhelmingly supported. However, the vast majority of empirical tests have focused on effects of single predation risk factors. Even studies that have included multiple risk factors have not predicted how they jointly affect FID. I present a model that predicts joint effects of several predation risk factors that affect the outcome of a race between predator and prey to the prey's refuge. As a prey's distance to refuge and predator attack speed increase, and as the prey's location forces it to flee more toward a predator to reach refuge, FID increases. A published model proposed and experiment showed that FID is longer when prey flee directly toward than directly away from a predator to a refuge. We present a new geometric model that predicts FID for all angles between the prey's and predator's paths to refuge, distance of the prey from refuge when escape begins, predator and prey speeds, and a margin of safety allowing the prey to reach refuge before the predator. The model provides many new, testable predictions about relationships among its variables and FID. Most notably, it predicts that FID increases sigmoidally as the angle between predator and prey paths to refuge increases. Although the model is not economic (cost-benefit), we discuss its relationship to economic escape theory.

  12. A Treatment Package without Escape Extinction to Address Food Selectivity.

    PubMed

    Weber, Jessica; Gutierrez, Anibal

    2015-08-21

    Feeding difficulties and feeding disorders are a commonly occurring problem for young children, particularly children with developmental delays including autism. Behavior analytic interventions for the treatment of feeding difficulties oftentimes include escape extinction as a primary component of treatment. The use of escape extinction, while effective, may be problematic as it is also associated with the emergence of challenging behavior (e.g., extinction burst). Such challenging behavior may be an acceptable side effect in treatment cases where feeding problems are severe and chronic (e.g., failure to thrive). However, in more acute cases (e.g., selective eating), the negative side effect may be unwarranted and undesired. More recent research on the behavioral treatment of food selectivity has begun to evaluate treatments for feeding difficulties that do not include escape extinction (e.g., demand fading, behavioral momentum), with some success. However, research to date reveals individual differences in responsiveness to such treatments and no clear preferable treatment has emerged. This manuscript describes a multi-component treatment package that includes shaping, sequential presentation and simultaneous presentation, for the treatment of food selectivity in four young children with developmental delays. This treatment package extends the literature on the behavioral treatment for food selectivity and offers a multi-component treatment protocol that may be clinically applicable across a range of treatment scenarios and settings.

  13. Comparison of operant escape and reflex tests of nociceptive sensitivity.

    PubMed

    Vierck, Charles J; Yezierski, Robert P

    2015-04-01

    Testing of reflexes such as flexion/withdrawal or licking/guarding is well established as the standard for evaluating nociceptive sensitivity and its modulation in preclinical investigations of laboratory animals. Concerns about this approach have been dismissed for practical reasons - reflex testing requires no training of the animals; it is simple to instrument; and responses are characterized by observers as latencies or thresholds for evocation. In order to evaluate this method, the present review summarizes a series of experiments in which reflex and operant escape responding are compared in normal animals and following surgical models of neuropathic pain or pharmacological intervention for pain. Particular attention is paid to relationships between reflex and escape responding and information on the pain sensitivity of normal human subjects or patients with pain. Numerous disparities between results for reflex and operant escape measures are described, but the results of operant testing are consistent with evidence from humans. Objective reasons are given for experimenters to choose between these and other methods of evaluating the nociceptive sensitivity of laboratory animals. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Escape problem under stochastic volatility: The Heston model

    NASA Astrophysics Data System (ADS)

    Masoliver, Jaume; Perelló, Josep

    2008-11-01

    We solve the escape problem for the Heston random diffusion model from a finite interval of span L . We obtain exact expressions for the survival probability (which amounts to solving the complete escape problem) as well as for the mean exit time. We also average the volatility in order to work out the problem for the return alone regardless of volatility. We consider these results in terms of the dimensionless normal level of volatility—a ratio of the three parameters that appear in the Heston model—and analyze their form in several asymptotic limits. Thus, for instance, we show that the mean exit time grows quadratically with large spans while for small spans the growth is systematically slower, depending on the value of the normal level. We compare our results with those of the Wiener process and show that the assumption of stochastic volatility, in an apparently paradoxical way, increases survival and prolongs the escape time. We finally observe that the model is able to describe the main exit-time statistics of the Dow-Jones daily index.

  15. Transitions between three swimming gaits in Paramecium escape.

    PubMed

    Hamel, Amandine; Fisch, Cathy; Combettes, Laurent; Dupuis-Williams, Pascale; Baroud, Charles N

    2011-05-03

    Paramecium and other protists are able to swim at velocities reaching several times their body size per second by beating their cilia in an organized fashion. The cilia beat in an asymmetric stroke, which breaks the time reversal symmetry of small scale flows. Here we show that Paramecium uses three different swimming gaits to escape from an aggression, applied in the form of a focused laser heating. For a weak aggression, normal swimming is sufficient and produces a steady swimming velocity. As the heating amplitude is increased, a higher acceleration and faster swimming are achieved through synchronized beating of the cilia, which begin by producing oscillating swimming velocities and later give way to the usual gait. Finally, escape from a life-threatening aggression is achieved by a "jumping" gait, which does not rely on the cilia but is achieved through the explosive release of a group of trichocysts in the direction of the hot spot. Measurements through high-speed video explain the role of trichocysts in defending against aggressions while showing unexpected transitions in the swimming of microorganisms. These measurements also demonstrate that Paramecium optimizes its escape pattern by taking advantage of its inertia.

  16. Transitions between three swimming gaits in Paramecium escape

    PubMed Central

    Hamel, Amandine; Fisch, Cathy; Combettes, Laurent; Dupuis-Williams, Pascale; Baroud, Charles N.

    2011-01-01

    Paramecium and other protists are able to swim at velocities reaching several times their body size per second by beating their cilia in an organized fashion. The cilia beat in an asymmetric stroke, which breaks the time reversal symmetry of small scale flows. Here we show that Paramecium uses three different swimming gaits to escape from an aggression, applied in the form of a focused laser heating. For a weak aggression, normal swimming is sufficient and produces a steady swimming velocity. As the heating amplitude is increased, a higher acceleration and faster swimming are achieved through synchronized beating of the cilia, which begin by producing oscillating swimming velocities and later give way to the usual gait. Finally, escape from a life-threatening aggression is achieved by a “jumping” gait, which does not rely on the cilia but is achieved through the explosive release of a group of trichocysts in the direction of the hot spot. Measurements through high-speed video explain the role of trichocysts in defending against aggressions while showing unexpected transitions in the swimming of microorganisms. These measurements also demonstrate that Paramecium optimizes its escape pattern by taking advantage of its inertia. PMID:21464291

  17. The C. elegans touch response facilitates escape from predacious fungi

    PubMed Central

    Maguire, Sean M.; Clark, Christopher M.; Nunnari, John; Pirri, Jennifer K.; Alkema, Mark J.

    2012-01-01

    Summary Predator-prey interactions are vital determinants in the natural selection of behavioral traits. However, we have few insights into both the neural mechanisms and the selective advantage of specific behavioral traits. Gentle touch to the anterior half of the body of Caenorhabditis elegans elicits an escape response in which the animal quickly reverses and suppresses exploratory head movements [1]. Even though the C. elegans touch response has provided one of the rare examples of how neural networks translate sensory input to a coordinated motor output [2], the ecological significance of the escape response is unclear. We investigate predator-prey relationships between C. elegans and predacious fungi that catch nematodes using constricting rings as trapping devices. We show that the constricting rings of Drechslerella doedycoides catch early larval stages with a diameter similar to the trap opening. There is a delay between the ring entry and ring closure, which allows the animal to withdraw from the trap before getting caught. Mutants that fail to suppress head movements in response to touch are caught more efficiently than the wild type in constricting fungal rings. Direct competition experiments show that the suppression of head movements in response to touch is an ecologically relevant behavior that allows the C. elegans to smoothly retract from a fungal noose and evade capture. These results suggest that selective pressures imposed by predacious fungi have shaped the evolution of C. elegans escape behavior. PMID:21802299

  18. Anomalous barrier escape: The roles of noise distribution and correlation

    NASA Astrophysics Data System (ADS)

    Hu, Meng; Zhang, Jia-Ming; Bao, Jing-Dong

    2017-05-01

    We study numerically and analytically the barrier escape dynamics of a particle driven by an underlying correlated Lévy noise for a smooth metastable potential. A "quasi-monochrome-color" Lévy noise, i.e., the first-order derivative variable of a linear second-order differential equation subjected to a symmetric α-stable white Lévy noise, also called the harmonic velocity Lévy noise, is proposed. Note that the time-integral of the noise Green function of this kind is equal to zero. This leads to the existence of underlying negative time correlation and implies that a step in one direction is likely followed by a step in the other direction. By using the noise of this kind as a driving source, we discuss the competition between long flights and underlying negative correlations in the metastable dynamics. The quite rich behaviors in the parameter space including an optimum α for the stationary escape rate have been found. Remarkably, slow diffusion does not decrease the stationary rate while a negative correlation increases net escape. An approximate expression for the Lévy-Kramers rate is obtained to support the numerically observed dependencies.

  19. A Functional Yeast Survival Screen of Tumor-Derived cDNA Libraries Designed to Identify Anti-Apoptotic Mammalian Oncogenes

    PubMed Central

    Melzer, Inga Maria; Moser, Julia; Siele, Dagmar; Köhl, Ulrike; Rieker, Ralf Joachim; Wachter, David Lukas; Agaimy, Abbas; Herpel, Esther; Baumgarten, Peter; Mittelbronn, Michel; Rakel, Stefanie; Kögel, Donat; Böhm, Stefanie; Gutschner, Tony; Diederichs, Sven; Zörnig, Martin

    2013-01-01

    Yeast cells can be killed upon expression of pro-apoptotic mammalian proteins. We have established a functional yeast survival screen that was used to isolate novel human anti-apoptotic genes overexpressed in treatment-resistant tumors. The screening of three different cDNA libraries prepared from metastatic melanoma, glioblastomas and leukemic blasts allowed for the identification of many yeast cell death-repressing cDNAs, including 28% of genes that are already known to inhibit apoptosis, 35% of genes upregulated in at least one tumor entity and 16% of genes described as both anti-apoptotic in function and upregulated in tumors. These results confirm the great potential of this screening tool to identify novel anti-apoptotic and tumor-relevant molecules. Three of the isolated candidate genes were further analyzed regarding their anti-apoptotic function in cell culture and their potential as a therapeutic target for molecular therapy. PAICS, an enzyme required for de novo purine biosynthesis, the long non-coding RNA MALAT1 and the MAST2 kinase are overexpressed in certain tumor entities and capable of suppressing apoptosis in human cells. Using a subcutaneous xenograft mouse model, we also demonstrated that glioblastoma tumor growth requires MAST2 expression. An additional advantage of the yeast survival screen is its universal applicability. By using various inducible pro-apoptotic killer proteins and screening the appropriate cDNA library prepared from normal or pathologic tissue of interest, the survival screen can be used to identify apoptosis inhibitors in many different systems. PMID:23717670

  20. Ultrastructural apoptotic lesions induced in rat thymocytes after borax ingestion.

    PubMed

    Sylvain, I C; Berry, J P; Galle, P

    1998-01-01

    Apoptosis has gained increasing attention in recent years. Several chemical compounds induce apoptotic lesions in the thymus. Male Wistar rats received 2000 ppm of borax (Na2B4O7.10H2O) in their food for 16 days. The rats were sacrificed 2, 5, 9, 12, 19, 21, 26 and 28 days after the beginning of treatment. Thymus samples of all rats were taken. A Philips EM 300 electron microscopy was used to study the ultrastructural morphology. Serious nuclear and cytoplasmic lesions were observed. Moreover, numerous macrophages containing apoptotic cells were present in the thymus. The alterations were observed from the 2nd to the 28th day. The extent of damage was much more important in the rats sacrificed 21, 26 and 28 days after borax ingestion.

  1. Lunar mission safety and rescue: Escape/rescue analysis and plan

    NASA Technical Reports Server (NTRS)

    1971-01-01

    The results are presented of the technical analysis of escape/rescue/survival situations, crew survival techniques, alternate escape/rescue approaches and vehicles, and the advantages and disadvantages of each for advanced lunar exploration. Candidate escape/rescue guidelines are proposed and elements of a rescue plan developed. The areas of discussions include the following: lunar arrival/departure operations, lunar orbiter operations, lunar surface operations, lunar surface base escape/rescue analysis, lander tug location operations, portable airlock, emergency pressure suit, and the effects of no orbiting lunar station, no lunar surface base, and no foreign lunar orbit/surface operations on the escape/rescue plan.

  2. Synergistic effect of aluminum and ionizing radiation upon ultrastructure, oxidative stress and apoptotic alterations in Paneth cells of rat intestine.

    PubMed

    Eltahawy, N A; Elsonbaty, S M; Abunour, S; Zahran, W E

    2017-03-01

    Environmental and occupational exposure to aluminum along with ionizing radiation results in serious health problems. This study was planned to investigate the impact of oxidative stress provoked by exposure to ionizing radiation with aluminum administration upon cellular ultra structure and apoptotic changes in Paneth cells of rat small intestine . Animals received daily aluminum chloride by gastric gavage at a dose 0.5 mg/Kg BW for 4 weeks. Whole body gamma irradiation was applied at a dose 2 Gy/week up to 8 Gy. Ileum malondialdehyde, advanced oxidation protein products, and protein carbonyl were assessed as biomarkers of lipid peroxidation along with superoxide dismutase, catalase, and glutathione peroxidase activities as enzyme antioxidants. Moreover, analyses of cell cycle division and apoptotic changes were evaluated by flow cytometry. Intestinal cellular ultra structure was investigated using transmission electron microscope. Oxidative stress assessment in the ileum of rats revealed that aluminum and ionizing radiation exposure either alone or in combination exhibits a significant effect upon the increase in biomarkers of lipid peroxidation along with tumor necrosis factor-α with concomitant significant decrease of the antioxidant enzyme activities. Flow cytometric analyses showed significant alterations in the percentage of cells during cell cycle division phases along with significant increase in apoptotic cells. Ultra structurally, intestinal cellular alterations with marked injury in Paneth cells at the sites of bacterial translocation in the crypt of lumens were recorded. The results of this study have clearly suggested that aluminum exposure and ionizing either alone or in combination induced apoptosis and oxidative stress in the Paneth cells of rat intestine, which appeared to play a major role in the pathogenesis of cellular damage. Furthermore, the interaction of these two intestinal toxic routes was found to be synergistic.

  3. Caspase 3 Targeted Cargo Delivery in Apoptotic Cells Using Capped Mesoporous Silica Nanoparticles.

    PubMed

    de la Torre, Cristina; Mondragón, Laura; Coll, Carmen; García-Fernández, Alba; Sancenón, Félix; Martínez-Máñez, Ramón; Amorós, Pedro; Pérez-Payá, Enrique; Orzáez, Mar

    2015-10-26

    Excessive apoptotic cell death is at the origin of several pathologies, such as degenerative disorders, stroke or ischemia-reperfusion damage. In this context, strategies to improve inhibition of apoptosis and other types of cell death are of interest and may represent a pharmacological opportunity for the treatment of cell-death-related disorders. In this scenario new peptide-containing delivery systems (solids S1 -P1 and S1 -P2 ) are described based on mesoporous silica nanoparticles (MSNs) loaded with a dye and capped with the KKGDEVDKKARDEVDK (P1 ) peptide that contains two repeats of the DEVD target sequence that are selectively hydrolyzed by caspase 3 (C3). This enzyme plays a central role in the execution-phase of apoptosis. HeLa cells electroporated with S1 -P1 are able to deliver the cargo in the presence of staurosporin (STS), which induces apoptosis with the consequent activation of the cytoplasmic C3 enzyme. Moreover, the nanoparticles S1 -P2 , containing both a cell-penetrating TAT peptide and P1 also entered in HeLa cells and delivered the cargo preferentially in cells treated with the apoptosis inducer cisplatin. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. A mathematical model for apoptotic switch in Drosophila

    NASA Astrophysics Data System (ADS)

    Ziraldo, Riccardo; Ma, Lan

    2015-10-01

    Apoptosis is an evolutionarily-conserved process of autonomous cell death. The molecular switch mechanism underlying the fate decision of apoptosis in mammalian cells has been intensively studied by mathematical modeling. In contrast, the apoptotic switch in invertebrates, with highly conserved signaling proteins and pathway, remains poorly understood mechanistically and calls for theoretical elucidation. In this study, we develop a mathematical model of the apoptosis pathway in Drosophila and compare the switch mechanism to that in mammals. Enumeration of the elementary reactions for the model demonstrates that the molecular interactions among the signaling components are considerably different from their mammalian counterparts. A notable distinction in network organization is that the direct positive feedback from the effector caspase (EC) to the initiator caspase in mammalian pathway is replaced by a double-negative regulation in Drosophila. The model is calibrated by experimental input-output relationship and the simulated trajectories exhibit all-or-none bimodal behavior. Bifurcation diagrams confirm that the model of Drosophila apoptotic switch possesses bistability, a well-recognized feature for an apoptosis system. Since the apoptotic protease activating factor-1 (APAF1) induced irreversible activation of caspase is an essential and beneficial property for the mammalian apoptotic switch, we perform analysis of the bistable caspase activation with respect to the input of DARK protein, the Drosophila homolog of APAF1. Interestingly, this bistable behavior in Drosophila is predicted to be reversible. Further analysis suggests that the mechanism underlying the systems property of reversibility is the double-negative feedback from the EC to the initiator caspase. Using theoretical modeling, our study proposes plausible evolution of the switch mechanism for apoptosis between organisms.

  5. Apoptotic lymphocytes induce progenitor cell mobilization after exercise.

    PubMed

    Mooren, Frank C; Krüger, Karsten

    2015-07-15

    There is evidence that apoptotic cells and their components have immunmodulatory properties and signaling function. The present study investigated first whether exercise-induced apoptosis and exercise-induced mobilization of progenitor cells are similarly affected by subjects' training status and, second, whether the appearance of dying cells in the circulation might mobilize progenitor cells. CD1 SWISS mice were subjected to a 10-wk endurance training using free wheel running or served as untrained controls. Mice of both groups performed an intensive exercise test after the training period at a velocity corresponding to 80% maximal oxygen uptake for 30 min. Cells from blood and bone marrow were analyzed, and apoptosis and number of progenitor cells determined via flow cytometry. In a second experiment, apoptotic cells were transferred into recipient mice, and mobilization of progenitor cells was analyzed while vital cells served as controls. In untrained animals, the exhaustive exercise was followed by an enhanced rate of annexin V positive CD3(+) cells in blood and bone marrow (P < 0.05), whereas no increase was found in trained mice. Similarly, exercise mobilized Sca-1(+)/c-kit(+) and Sca-1(+)/Flk(+) cells in untrained (P < 0.05) but not trained mice. Furthermore, application of apoptotic cells and their supernatant mobilized Sca-1(+)/c-kit(+) cells into the blood (P < 0.05), whereas Sca-1(+)/Flk(+) cells were not affected. The present study demonstrated that both lymphocyte apoptosis, as well as mobilization of progenitor cells are similarly related to training status. Furthermore, apoptotic cells seem to induce signals that effectively mobilize hematopoietic progenitor cells. The relevance of this effect for the adaptation to exercise stimuli remains to be shown. Copyright © 2015 the American Physiological Society.

  6. Ribonuclease binase apoptotic signature in leukemic Kasumi-1 cells.

    PubMed

    Mitkevich, Vladimir A; Kretova, Olga V; Petrushanko, Irina Yu; Burnysheva, Ksenia M; Sosin, Dmitry V; Simonenko, Olga V; Ilinskaya, Olga N; Tchurikov, Nickolai A; Makarov, Alexander A

    2013-06-01

    Cytotoxic exogenous RNases triggering apoptotic response in malignant cells have potential as anticancer drugs; surprisingly, detailed characterization of the RNase-induced apoptosis has not been conducted so far. Here we show that a cytotoxic RNase from Bacillus intermedius (binase) induces extrinsic and intrinsic apoptotic pathways in leukemic Kasumi-1 cells. The experiments were performed using TaqMan Array Human Apoptosis 96-well Plate for gene expression analysis, and flow cytometry. Cytometric studies demonstrated dissipation of the mitochondrial membrane potential, opening of mitochondrial permeability transition pores, activation of caspases, increase of intracellular Ca(2+) and decrease of reactive oxygen species levels. We found that expression of 62 apoptotic genes is up-regulated, including 16 genes that are highly up-regulated, and only one gene was found to be down-regulated. The highest, 16 fold increase of the expression level was observed for TNF gene. Highly up-regulated genes also include the non-canonical NF-κB signaling pathway and inflammatory caspases 1,4. The obtained results suggest that binase induces evolutionary acquired cellular response to a microbial agent and triggers unusual apoptosis pathway. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  7. Evidence for apoptotic cell death in Alzheimer's disease.

    PubMed

    Smale, G; Nichols, N R; Brady, D R; Finch, C E; Horton, W E

    1995-06-01

    We provide evidence for apoptosis in Alzheimer's disease using the in situ labeling technique TUNEL (terminal transferase-mediated dUTP-biotin nick end labeling). The technique specifically detects apoptotic cells by utilizing terminal transferase to incorporate biotinylated nucleotides into the fragmented DNA of apoptotic cells. The labeled cells are visualized by reaction with avidin peroxidase and a suitable substrate. Sections from the hippocampus of Alzheimer-diseased (AD) brains and non-AD brains were examined for apoptosis. While considerable variation in the quantity of apoptotic cells was observed among individual samples, the incidence of apoptosis in AD brains was elevated in comparison to age-matched, non-AD brains in specific regions of the hippocampal formation. Immunostaining indicated that both neurons and astrocytes were undergoing apoptosis, although the majority of the TUNEL-positive cells appeared to be glial, based on the location of the stained cells. These data suggest that apoptosis may be involved in both the primary neuronal cell loss and in the glial response that is a component of AD.

  8. PDT-apoptotic tumor cells induce macrophage immune response

    NASA Astrophysics Data System (ADS)

    Zhou, Fei-fan; Xing, Da; Chen, Wei R.

    2008-02-01

    Photodynamic therapy (PDT) functions as a cancer therapy through two major cell death mechanisms: apoptosis and necrosis. Immunological responses induced by PDT has been mainly associated with necrosis while apoptosis associated immune responses have not fully investigated. Heat shock proteins (HSPs) play an important role in regulating immune responses. In present study, we studied whether apoptotic tumor cells could induce immune response and how the HSP70 regulates immune response. The endocytosis of tumor cells by the activated macrophages was observed at single cell level by LSM. The TNF-α release of macrophages induced by co-incubated with PDT-apoptotic tumor cells was detected by ELISA. We found that apoptotic tumor cells treated by PDT could activate the macrophages, and the immune effect decreased evidently when HSP70 was blocked. These findings not only show that apoptosis can induce immunological responses, but also show HSP70 may serves as a danger signal for immune cells and induce immune responses to regulate the efficacy of PDT.

  9. The inflammatory role of phagocyte apoptotic pathways in rheumatic diseases.

    PubMed

    Cuda, Carla M; Pope, Richard M; Perlman, Harris

    2016-08-23

    Rheumatoid arthritis affects nearly 1% of the world's population and is a debilitating autoimmune condition that can result in joint destruction. During the past decade, inflammatory functions have been described for signalling molecules classically involved in apoptotic and non-apoptotic death pathways, including, but not limited to, Toll-like receptor signalling, inflammasome activation, cytokine production, macrophage polarization and antigen citrullination. In light of these remarkable advances in the understanding of inflammatory mechanisms of the death machinery, this Review provides a snapshot of the available evidence implicating death pathways, especially within the phagocyte populations of the innate immune system, in the perpetuation of rheumatoid arthritis and other rheumatic diseases. Elevated levels of signalling mediators of both extrinsic and intrinsic apoptosis, as well as the autophagy, are observed in the joints of patients with rheumatoid arthritis. Furthermore, risk polymorphisms are present in signalling molecules of the extrinsic apoptotic and autophagy death pathways. Although research into the mechanisms underlying these pathways has made considerable progress, this Review highlights areas where further investigation is particularly needed. This exploration is critical, as new discoveries in this field could lead to the development of novel therapies for rheumatoid arthritis and other rheumatic diseases.

  10. An auxiliary mode of apoptotic DNA fragmentation provided by phagocytes

    PubMed Central

    McIlroy, Dorian; Tanaka, Masato; Sakahira, Hideki; Fukuyama, Hidehiro; Suzuki, Misao; Yamamura, Ken-ichi; Ohsawa, Yoshiyuki; Uchiyama, Yasuo; Nagata, Shigekazu

    2000-01-01

    CAD (caspase-activated DNase) can cause DNA fragmentation in apoptotic cells. Transgenic mice that ubiquitously express a caspase-resistant form of the CAD inhibitor (ICAD) were generated. Thymocytes prepared from the mice were resistant to DNA fragmentation induced by a variety of stimuli. However, similar numbers of TUNEL-positive cells were present in adult tissues of transgenic and wild-type mice. Exposure to γ-irradiation caused a striking increase in the number of TUNEL-positive cells in the thymus of wild-type, but not transgenic, mice. TUNEL-positive nuclei in transgenic mice were confined to thymic macrophages. When apoptotic thymocytes from the transgenic mice were cocultured with macrophages, the thymocytes underwent phagocytosis and their chromosomal DNA underwent fragmentation. This DNA fragmentation was sensitive to inhibitors that block the acidification of lysosomes. Hence, we conclude that the DNA fragmentation that occurs during apoptosis not only can result cell-autonomously from CAD activity but can also be attributed to a lysosomal acid DNase(s), most likely DNase II, after the apoptotic cells are engulfed. PMID:10716943

  11. Apoptotic death of olfactory sensory neurons in the adult rat.

    PubMed

    Deckner, M L; Risling, M; Frisén, J

    1997-01-01

    Olfactory sensory neurons only live for about 1 month in most mammals. It is not fully understood whether the short life span of these neurons is due to necrotic death, or if these cells die by apoptosis. One characteristic of cells undergoing apoptotic cell death is internucleosomal DNA-fragmentation. We have used TdT-mediated dUTP-digoxigenin nick end labeling (TUNEL) to detect cells undergoing DNA-fragmentation in situ. In the intact olfactory epithelium of adult rats a subpopulation of basal immature neuronal progenitor cells, as well as mature olfactory sensory neurons, showed DNA-fragmentation. The number of TUNEL-labeled neurons increased dramatically 1.5 days after transection of the fila olfactoria and declined to control levels by Day 4 after the injury. In order to relate DNA-fragmentation to ultrastructural characteristics of apoptosis we modified the TUNEL-labeling protocol to enable studies of TUNEL-labeled cells in the electron microscope. This confirmed that TUNEL-labeled neurons showed morphological characteristics of apoptosis. The data provide evidence for apoptotic death of neurons in the adult mammalian nervous system. The turnover of olfactory sensory neurons is, at least in part, regulated by apoptosis and disruption of the contact with the olfactory bulb results in massive apoptotic death of neurons in the olfactory epithelium.

  12. The complexity of apoptotic cell death in mollusks: An update.

    PubMed

    Romero, A; Novoa, B; Figueras, A

    2015-09-01

    Apoptosis is a type of programmed cell death that produces changes in cell morphology and in biochemical intracellular processes without inflammatory reactions. The components of the apoptotic pathways are conserved throughout evolution. Caspases are key molecules involved in the transduction of the death signal and are responsible for many of the biochemical and morphological changes associated with apoptosis. Nowadays, It is known that caspases are activated through two major apoptotic pathways (the extrinsic or death receptor pathway and the intrinsic or mitochondrial pathway), but there are also evidences of at least other alternative pathway (the perforin/granzyme pathway). Apoptosis in mollusks seems to be similar in complexity to apoptosis in vertebrates but also has unique features maybe related to their recurrent exposure to environmental changes, pollutants, pathogens and also related to the sedentary nature of some stages in the life cycle of mollusks bivalves and gastropods. As in other animals, apoptotic process is involved in the maintenance of tissue homeostasis and also constitutes an important immune response that can be triggered by a variety of stimuli, including cytokines, hormones, toxic insults, viruses, and protozoan parasites. The main goal of this work is to present the current knowledge of the molecular mechanisms of apoptosis in mollusks and to highlight those steps that need further study.

  13. Hyperosmotic stress-induced apoptotic signaling pathways in chondrocytes.

    PubMed

    Racz, Boglarka; Reglodi, Dora; Fodor, Barnabas; Gasz, Balazs; Lubics, Andrea; Gallyas, Ferenc; Roth, Erzsebet; Borsiczky, Balazs

    2007-06-01

    Articular chondrocytes have a well-developed osmoregulatory system that enables cells to survive in a constantly changing osmotic environment. However, osmotic loading exceeding that occurring under physiological conditions severely compromises chondrocyte function and leads to degenerative changes. The aim of the present study was to investigate the form of cell death and changes in apoptotic signaling pathways under hyperosmotic stress using a primary chondrocyte culture. Cell viability and apoptosis assays performed with annexin V and propidium iodide staining showed that a highly hyperosmotic medium (600 mOsm) severely reduced chondrocyte viability and led mainly to apoptotic cell death, while elevating osmotic pressure within the physiological range caused no changes compared to isosmotic conditions. Western blot analysis revealed that a 600 mOsm hyperosmotic environment induced the activation of proapoptotic members of the mitogen-activated protein kinase family such as c-Jun N-terminal kinase (JNK) and p38, and led to an increased level of extracellular signal regulated kinase (ERK1/2). Hyperosmotic stress also induced the activation of caspase-3. In summary, our results show that hyperosmotic stress leads to mainly apoptotic cell death via the involvement of proapoptotic signaling pathways in a primary chondrocyte culture.

  14. Apoptotic cell signaling in cancer progression and therapy†

    PubMed Central

    Plati, Jessica; Bucur, Octavian; Khosravi-Far, Roya

    2011-01-01

    Apoptosis is a tightly regulated cell suicide program that plays an essential role in the development and maintenance of tissue homeostasis by eliminating unnecessary or harmful cells. Impairment of this native defense mechanism promotes aberrant cellular proliferation and the accumulation of genetic defects, ultimately resulting in tumorigenesis, and frequently confers drug resistance to cancer cells. The regulation of apoptosis at several levels is essential to maintain the delicate balance between cellular survival and death signaling that is required to prevent disease. Complex networks of signaling pathways act to promote or inhibit apoptosis in response to various cues. Apoptosis can be triggered by signals from within the cell, such as genotoxic stress, or by extrinsic signals, such as the binding of ligands to cell surface death receptors. Various upstream signaling pathways can modulate apoptosis by converging on, and thereby altering the activity of, common central control points within the apoptotic signaling pathways, which involve the BCL-2 family proteins, inhibitor of apoptosis (IAP) proteins, and FLICE-inhibitory protein (c-FLIP). This review highlights the role of these fundamental regulators of apoptosis in the context of both normal apoptotic signaling mechanisms and dysregulated apoptotic pathways that can render cancer cells resistant to cell death. In addition, therapeutic strategies aimed at modulating the activity of BCL-2 family proteins, IAPs, and c-FLIP for the targeted induction of apoptosis are briefly discussed. PMID:21340093

  15. Apoptotic cell signaling in cancer progression and therapy.

    PubMed

    Plati, Jessica; Bucur, Octavian; Khosravi-Far, Roya

    2011-04-01

    Apoptosis is a tightly regulated cell suicide program that plays an essential role in the development and maintenance of tissue homeostasis by eliminating unnecessary or harmful cells. Impairment of this native defense mechanism promotes aberrant cellular proliferation and the accumulation of genetic defects, ultimately resulting in tumorigenesis, and frequently confers drug resistance to cancer cells. The regulation of apoptosis at several levels is essential to maintain the delicate balance between cellular survival and death signaling that is required to prevent disease. Complex networks of signaling pathways act to promote or inhibit apoptosis in response to various cues. Apoptosis can be triggered by signals from within the cell, such as genotoxic stress, or by extrinsic signals, such as the binding of ligands to cell surface death receptors. Various upstream signaling pathways can modulate apoptosis by converging on, and thereby altering the activity of, common central control points within the apoptotic signaling pathways, which involve the BCL-2 family proteins, inhibitor of apoptosis (IAP) proteins, and FLICE-inhibitory protein (c-FLIP). This review highlights the role of these fundamental regulators of apoptosis in the context of both normal apoptotic signaling mechanisms and dysregulated apoptotic pathways that can render cancer cells resistant to cell death. In addition, therapeutic strategies aimed at modulating the activity of BCL-2 family proteins, IAPs, and c-FLIP for the targeted induction of apoptosis are briefly discussed.

  16. Broad CTL Response in Early HIV Infection Drives Multiple Concurrent CTL Escapes.

    PubMed

    Leviyang, Sivan; Ganusov, Vitaly V

    2015-10-01

    Recent studies have highlighted the ability of HIV to escape from cytotoxic T lymphocyte (CTL) responses that concurrently target multiple viral epitopes. Yet, the viral dynamics involved in such escape are incompletely understood. Previous analyses have made several strong assumptions regarding HIV escape from CTL responses such as independent or non-concurrent escape from individual CTL responses. Using experimental data from evolution of HIV half genomes in four patients we observe concurrent viral escape from multiple CTL responses during early infection (first 100 days of infection), providing confirmation of a recent result found in a study of one HIV-infected patient. We show that current methods of estimating CTL escape rates, based on the assumption of independent escapes, are biased and perform poorly when CTL escape proceeds concurrently at multiple epitopes. We propose a new method for analyzing longitudinal sequence data to estimate the rate of CTL escape across multiple epitopes; this method involves few parameters and performs well in simulation studies. By applying our novel method to experimental data, we find that concurrent multiple escapes occur at rates between 0.03 and 0.4 day(-1), a relatively broad range that reflects uncertainty due to sparse sampling and wide ranges of parameter values. However, we show that concurrent escape at rates 0.1-0.2 day(-1) across multiple epitopes is consistent with our patient datasets.

  17. A comparison of positive and negative reinforcement for compliance to treat problem behavior maintained by escape.

    PubMed

    Slocum, Sarah K; Vollmer, Timothy R

    2015-09-01

    Previous research has shown that problem behavior maintained by escape can be treated using positive reinforcement. In the current study, we directly compared functional (escape) and nonfunctional (edible) reinforcers in the treatment of escape-maintained problem behavior for 5 subjects. In the first treatment, compliance produced a break from instructions. In the second treatment, compliance produced a small edible item. Neither treatment included escape extinction. Results suggested that the delivery of a positive reinforcer for compliance was effective for treating escape-maintained problem behavior for all 5 subjects, and the delivery of escape for compliance was ineffective for 3 of the 5 subjects. Implications and future directions related to the use of positive reinforcers in the treatment of escape behavior are discussed.

  18. The effects of escape from self and interpersonal relationship on the pathological use of Internet games.

    PubMed

    Kwon, Jung-Hye; Chung, Chung-Suk; Lee, Jung

    2011-02-01

    The purpose of the present study was to examine whether Baumeister's escape from self theory may account for the pathological use of Internet games among Korean adolescents. A sample of 1,136 junior high school students completed measures assessing Internet game addiction (IGA), real-ideal self discrepancy, escape from self, current mood, peer relationships, perceived parent-child relationship, and parental supervision. IGA was significantly correlated with all of these variables. Multiple regression analysis showed that escape from self best explained the adolescents' IGA. A path model yielded significant paths from self-discrepancy to negative mood, from negative mood to escape from self, and from escape from self to IGA. These results support the validity of using the escape from self theory to explain the adolescents' IGA, thereby suggesting that adolescents become addicted to Internet games in an attempt to escape from self and reality.

  19. The effects of escape conditioning and shock intensity on responding during inescapable shock1

    PubMed Central

    Domjan, Michael P.; Rowell, John W.

    1969-01-01

    Eight albino rats, conditioned to press a lever to escape shock, continued to lever press during short inescapable shocks presented subsequently. The rate of this behavior was found to be higher for higher shock intensities regardless of the order in which shock values were presented. Relative to the immediately preceding escape rate, responding during inescapable shock was higher following conditioning at higher fixed-ratio escape requirements. Four subjects not conditioned to escape shock pressed the lever very infrequently during inescapable shock and showed little change with changes in shock intensity. The escape conditioning effects suggest that responding during inescapable shock is superstitious escape behavior. The effects of shock intensity on this behavior appear to be similar to reported effects of shock intensity on escape behavior. PMID:16811410

  20. Elevated Liver Enzymes

    MedlinePlus

    Symptoms Elevated liver enzymes By Mayo Clinic Staff Elevated liver enzymes may indicate inflammation or damage to cells in the liver. Inflamed or ... than normal amounts of certain chemicals, including liver enzymes, into the bloodstream, which can result in elevated ...