Science.gov

Sample records for apoptotic enzymes escape

  1. Evidence for genes associated with the ability of Mycobacterium avium subsp. hominissuis to escape apoptotic macrophages

    PubMed Central

    Bermudez, Luiz E.; Danelishvili, Lia; Babrack, Lmar; Pham, Tuan

    2015-01-01

    Mycobacterium avium subsp. hominissuis (MAH) is an environmental bacteria that infects immunocompromised humans. MAH cases are increasing in incidence, making it crucial to gain knowledge of the pathogenic mechanisms associated with the bacterium. MAH infects macrophages and after several days the infection triggers the phagocyte apoptosis. Many of the intracellular MAH escape the cell undergoing apoptosis leading to infection of neighboring macrophages. We screened a transposon bank of MAH mutants in U937 mononuclear phagocytes for the inability to escape macrophages undergoing apoptosis. Mutations in genes; MAV_2235, MAV_2120, MAV_2410, and MAV_4563 resulted in the inability of the bacteria to exit macrophages upon apoptosis. Complementation of the mutations corrected the phenotype either completely or partially. Testing for the ability of the mutants to survive in macrophages compared to the wild-type bacterium revealed that the mutant clones were not attenuated up to 4 days of infection. Testing in vivo, however, demonstrated that all the MAH clones were attenuated compared with the wild-type MAC 104 in tissues of mice. Although the mechanism associated with the bacterial inability to leave apoptotic macrophages is unknown, the identification of macrophage cytoplasm targets for the MAH proteins suggest that they interfere either with protein degradation machinery or post-translation mechanisms. The identification of tatC as a MAH protein involved in the ability of MAH to leave macrophages, suggests that secreted effector(s) are involved in the process. The study reveals a pathway of escape from macrophages, not shared with Mycobacterium tuberculosis. PMID:26380226

  2. Echinacoside induces apoptotic cancer cell death by inhibiting the nucleotide pool sanitizing enzyme MTH1

    PubMed Central

    Dong, Liwei; Wang, Hongge; Niu, Jiajing; Zou, Mingwei; Wu, Nuoting; Yu, Debin; Wang, Ye; Zou, Zhihua

    2015-01-01

    Inhibition of the nucleotide pool sanitizing enzyme MTH1 causes extensive oxidative DNA damages and apoptosis in cancer cells and hence may be used as an anticancer strategy. As natural products have been a rich source of medicinal chemicals, in the present study, we used the MTH1-catalyzed enzymatic reaction as a high-throughput in vitro screening assay to search for natural compounds capable of inhibiting MTH1. Echinacoside, a compound derived from the medicinal plants Cistanche and Echinacea, effectively inhibited the catalytic activity of MTH1 in an in vitro assay. Treatment of various human cancer cell lines with Echinacoside resulted in a significant increase in the cellular level of oxidized guanine (8-oxoguanine), while cellular reactive oxygen species level remained unchanged, indicating that Echinacoside also inhibited the activity of cellular MTH1. Consequently, Echinacoside treatment induced an immediate and dramatic increase in DNA damage markers and upregulation of the G1/S-CDK inhibitor p21, which were followed by marked apoptotic cell death and cell cycle arrest in cancer but not in noncancer cells. Taken together, these studies identified a natural compound as an MTH1 inhibitor and suggest that natural products can be an important source of anticancer agents. PMID:26677335

  3. Reactive oxygen species are related to ionic fluxes and volume decrease in apoptotic cerebellar granule neurons: role of NOX enzymes.

    PubMed

    Hernández-Enríquez, Berenice; Guemez-Gamboa, Alicia; Morán, Julio

    2011-05-01

    Reactive oxygen species (ROS) are produced early during apoptosis of cerebellar granule neurons induced by low potassium (K5) and staurosporine (Sts). In addition, K5 and Sts activate NADPH oxidases (NOX). Recently, we described that K5 and Sts induce apoptotic volume decrease (AVD) at a time when ROS generation and NOX activity occur. In the present study, we evaluated the relationship between ROS generation and ionic fluxes during AVD. Here, we showed that K5- and Sts-induced AVD was inhibited by antioxidants and that direct ROS production induced AVD. Moreover, NOX inhibitors eliminated AVD induced by both K5 and Sts. Sts, but not K5, failed to induce AVD in cerebellar granule neurons from NOX2 knockout mice. These findings suggest that K5- and Sts-induced AVD is largely mediated by ROS produced by NOX. On the other hand, we also found that the blockage of ionic fluxes involved in AVD inhibited both ROS generation and NOX activity. These findings suggest that ROS generation and NOX activity are involved in ionic fluxes activation, which in turn could maintain ROS generation by activating NOX, leading to a self-amplifying cycle.

  4. Escaping the cut by restriction enzymes through single-strand self-annealing of host-edited 12-bp and longer synthetic palindromes.

    PubMed

    Castro-Chavez, Fernando

    2012-02-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5' CCCGAATTCGGG 3', (2) by a 22-bp related sequence 5' CTCGTGCCGAATTCGGCACGAG 3', and (3) by a longer 44-bp related sequence: 5' CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3'. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (-) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5' G/AATTC 3', its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations.

  5. Escaping the Cut by Restriction Enzymes Through Single-Strand Self-Annealing of Host-Edited 12-bp and Longer Synthetic Palindromes

    PubMed Central

    2012-01-01

    Palindromati, the massive host-edited synthetic palindromic contamination found in GenBank, is illustrated and exemplified. Millions of contaminated sequences with portions or tandems of such portions derived from the ZAP adaptor or related linkers are shown (1) by the 12-bp sequence reported elsewhere, exon Xb, 5′ CCCGAATTCGGG 3′, (2) by a 22-bp related sequence 5′ CTCGTGCCGAATTCGGCACGAG 3′, and (3) by a longer 44-bp related sequence: 5′ CTCGTGCCGAATTCGGCACGAGCTCGTGCCGAATTCGGCACGAG 3′. Possible reasons for why those long contaminating sequences continue in the databases are presented here: (1) the recognition site for the plus strand (+) is single-strand self-annealed; (2) the recognition site for the minus strand (−) is not only single-strand self-annealed but also located far away from the single-strand self-annealed plus strand, rendering impossible the formation of the active EcoRI enzyme dimer to cut on 5′ G/AATTC 3′, its target sequence. As a possible solution, it is suggested to rely on at least two or three independent results, such as sequences obtained by independent laboratories with the use, preferably, of independent sequencing methodologies. This information may help to develop tools for bioinformatics capable to detect/remove these contaminants and to infer why some damaged sequences which cause genetic diseases escape detection by the molecular quality control mechanism of cells and organisms, being undesirably transferred unchecked through the generations. PMID:21895510

  6. In the absence of cellular poly (A) binding protein, the glycolytic enzyme GAPDH translocated to the cell nucleus and activated the GAPDH mediated apoptotic pathway by enhancing acetylation and serine 46 phosphorylation of p53.

    PubMed

    Thangima Zannat, Mst; Bhattacharjee, Rumpa B; Bag, Jnanankur

    2011-06-01

    The cytoplasmic poly (A) binding protein (PABP) interacts with 3' poly (A) tract of eukaryotic mRNA and is important for both translation and stability of mRNA. Previously, we have shown that depletion of PABP by siRNA prevents protein synthesis and consequently leads to cell death through apoptosis. In the present investigation, we studied the mechanism of cell apoptosis. We show that in the absence of PABP, the glycolytic enzyme GAPDH translocated to the cell nucleus and activated the GAPDH mediated apoptotic pathway by enhancing acetylation and serine 46 phosphorylation of p53. As a result, p53 translocated to the mitochondria to initiate Bax mediated apoptosis.

  7. Enzyme

    MedlinePlus

    Enzymes are complex proteins that cause a specific chemical change in all parts of the body. For ... use them. Blood clotting is another example of enzymes at work. Enzymes are needed for all body ...

  8. Inhibition of ROS-induced apoptosis in endothelial cells by nitrone spin traps via induction of phase II enzymes and suppression of mitochondria-dependent pro-apoptotic signaling.

    PubMed

    Das, Amlan; Gopalakrishnan, Bhavani; Voss, Oliver H; Doseff, Andrea I; Villamena, Frederick A

    2012-08-15

    Oxidative stress is the main etiological factor behind the pathogenesis of various diseases including inflammation, cancer, cardiovascular and neurodegenerative disorders. Due to the spin trapping abilities and various pharmacological properties of nitrones, their application as therapeutic agent has been gaining attention. Though the antioxidant properties of the nitrones are well known, the mechanism by which they modulate the cellular defense machinery against oxidative stress is not well investigated and requires further elucidation. Here, we have investigated the mechanisms of cytoprotection of the nitrone spin traps against oxidative stress in bovine aortic endothelial cells (BAEC). Cytoprotective properties of both the cyclic nitrone 5,5-dimethyl-pyrroline N-oxide (DMPO) and linear nitrone α-phenyl N-tert-butyl nitrone (PBN) against H₂O₂-induced cytotoxicity were investigated. Preincubation of BAEC with PBN or DMPO resulted in the inhibition of H₂O₂-mediated cytotoxicity and apoptosis. Nitrone-treatment resulted in the induction and restoration of phase II antioxidant enzymes via nuclear translocation of NF-E2-related factor 2 (Nrf-2) in oxidatively-challenged cells. Furthermore, the nitrones were found to inhibit the mitochondrial depolarization and subsequent activation of caspase-3 induced by H₂O₂. Significant down-regulation of the pro-apoptotic proteins p53 and Bax, and up-regulation of the anti-apoptotic proteins Bcl-2 and p-Bad were observed when the cells were preincubated with the nitrones prior to H₂O₂-treatment. It was also observed that Nrf-2 silencing completely abolished the protective effects of nitrones. Hence, these findings suggest that nitrones confer protection to the endothelial cells against oxidative stress by modulating phase II antioxidant enzymes and subsequently inhibiting mitochondria-dependent apoptotic cascade. PMID:22580046

  9. Inhibition of ROS-induced apoptosis in endothelial cells by nitrone spin traps via induction of phase II enzymes and suppression of mitochondria-dependent pro-apoptotic signaling

    PubMed Central

    Das, Amlan; Gopalakrishnan, Bhavani; Voss, Oliver H.; Doseff, Andrea I.; Villamena, Frederick A.

    2012-01-01

    Oxidative stress is the main etiological factor behind the pathogenesis of various diseases including inflammation, cancer, cardiovascular and neurodegenerative disorders. Due to the spin trapping abilities and various pharmacological properties of nitrones, their application as therapeutic agent has been gaining attention. Though the antioxidant properties of the nitrones are well known, the mechanisms by which they modulate the cellular defense machinery against oxidative stress is not well investigated and requires further elucidation. Here, we have investigated the mechanisms of cytoprotection of the nitrone spin traps against oxidative stress in bovine aortic endothelial cells (BAEC). Cytoprotective properties of both the cyclic nitrone 5,5-dimethyl-pyrroline N-oxide (DMPO) and linear nitrone alpha-phenyl N-tert-butyl nitrone (PBN) against H2O2-induced cytoxicity were investigated. Preincubation of BAEC with PBN or DMPO resulted in the inhibition of H2O2–mediated cytotoxicity and apoptosis. Nitrone-treatment resulted in the induction and restoration of phase II antioxidant enzymes via nuclear translocation of NF-E2-related factor 2 (Nrf-2) in oxidatively-challenged cells. Furthermore, the nitrones were found to inhibit the mitochondrial depolarization and subsequent activation of caspase-3 induced by H2O2. Significant down-regulation of the pro-apoptotic proteins p53 and Bax, and up-regulation of the anti-apoptotic proteins Bcl-2 and p-Bad were observed when the cells were preincubated with the nitrones prior to H2O2–treatment. It was also observed that Nrf-2 silencing completely abolished the protective effects of nitrones. Hence, these findings suggest that nitrones confer protection to the endothelial cells against oxidative stress by modulating phase II antioxidant enzymes and subsequently inhibiting mitochondria-dependent apoptotic cascade. PMID:22580046

  10. Non-erythroid alpha-spectrin breakdown by calpain and interleukin 1 beta-converting-enzyme-like protease(s) in apoptotic cells: contributory roles of both protease families in neuronal apoptosis.

    PubMed Central

    Nath, R; Raser, K J; Stafford, D; Hajimohammadreza, I; Posner, A; Allen, H; Talanian, R V; Yuen, P; Gilbertsen, R B; Wang, K K

    1996-01-01

    The cytoskeletal protein non-erythroid alpha-spectrin is well documented as an endogenous calpain substrate, especially under pathophysiological conditions. In cell necrosis (e.g. maitotoxin-treated neuroblastoma SH-SY5Y cells), alpha-spectrin breakdown products (SBDPs) of 150 kDa and 145 kDa were produced by cellular calpains. In contrast, in neuronal cells undergoing apoptosis (cerebellar granule neurons subjected to low potassium and SH-SY5Y cells treated with staurosporine), an additional SBDP of 120 kDa was also observed. The formation of the 120 kDa SBDP was insensitive to calpain inhibitors but was completely blocked by an interleukin 1 beta-converting-enzyme (ICE)-like protease inhibitor, Z-Asp-CH2OC(O)-2,6-dichlorobenzene. Autolytic activation of both calpain and the ICE homologue CPP32 was also observed in apoptotic cells. alpha-Spectrin can also be cleaved in vitro by purified calpains to produce the SBDP doublet of 150/145 kDa and by ICE and ICE homologues [ICH-1, ICH-2 and CPP32(beta)] to produce a 150 kDa SBDP. In addition, CPP32 and ICE also produced a 120 kDa SBDP. Furthermore inhibition of either ICE-like protease(s) or calpain protects both granule neurons and SH-SY5Y cells against apoptosis. Our results suggest that both protease families participate in the expression of neuronal apoptosis. PMID:8920967

  11. In the absence of cellular poly (A) binding protein, the glycolytic enzyme GAPDH translocated to the cell nucleus and activated the GAPDH mediated apoptotic pathway by enhancing acetylation and serine 46 phosphorylation of p53

    SciTech Connect

    Thangima Zannat, Mst.; Bhattacharjee, Rumpa B.; Bag, Jnanankur

    2011-06-03

    Highlights: {yields} PABP knock down and cell apoptosis. {yields} Nuclear translocation of GAPDH in PABP depleted cells. {yields} Role of p53 in apoptosis of PABP depleted cells. {yields} Bax translocation and cytochrome C release and caspase 3 activation following PABP depletion. {yields} Association of p53 with Bcl2 and Bax. -- Abstract: The cytoplasmic poly (A) binding protein (PABP) interacts with 3' poly (A) tract of eukaryotic mRNA and is important for both translation and stability of mRNA. Previously, we have shown that depletion of PABP by siRNA prevents protein synthesis and consequently leads to cell death through apoptosis. In the present investigation, we studied the mechanism of cell apoptosis. We show that in the absence of PABP, the glycolytic enzyme GAPDH translocated to the cell nucleus and activated the GAPDH mediated apoptotic pathway by enhancing acetylation and serine 46 phosphorylation of p53. As a result, p53 translocated to the mitochondria to initiate Bax mediated apoptosis.

  12. Non-erythroid alpha-spectrin breakdown by calpain and interleukin 1 beta-converting-enzyme-like protease(s) in apoptotic cells: contributory roles of both protease families in neuronal apoptosis.

    PubMed

    Nath, R; Raser, K J; Stafford, D; Hajimohammadreza, I; Posner, A; Allen, H; Talanian, R V; Yuen, P; Gilbertsen, R B; Wang, K K

    1996-11-01

    The cytoskeletal protein non-erythroid alpha-spectrin is well documented as an endogenous calpain substrate, especially under pathophysiological conditions. In cell necrosis (e.g. maitotoxin-treated neuroblastoma SH-SY5Y cells), alpha-spectrin breakdown products (SBDPs) of 150 kDa and 145 kDa were produced by cellular calpains. In contrast, in neuronal cells undergoing apoptosis (cerebellar granule neurons subjected to low potassium and SH-SY5Y cells treated with staurosporine), an additional SBDP of 120 kDa was also observed. The formation of the 120 kDa SBDP was insensitive to calpain inhibitors but was completely blocked by an interleukin 1 beta-converting-enzyme (ICE)-like protease inhibitor, Z-Asp-CH2OC(O)-2,6-dichlorobenzene. Autolytic activation of both calpain and the ICE homologue CPP32 was also observed in apoptotic cells. alpha-Spectrin can also be cleaved in vitro by purified calpains to produce the SBDP doublet of 150/145 kDa and by ICE and ICE homologues [ICH-1, ICH-2 and CPP32(beta)] to produce a 150 kDa SBDP. In addition, CPP32 and ICE also produced a 120 kDa SBDP. Furthermore inhibition of either ICE-like protease(s) or calpain protects both granule neurons and SH-SY5Y cells against apoptosis. Our results suggest that both protease families participate in the expression of neuronal apoptosis. PMID:8920967

  13. Viral apoptotic mimicry.

    PubMed

    Amara, Ali; Mercer, Jason

    2015-08-01

    As opportunistic pathogens, viruses have evolved many elegant strategies to manipulate host cells for infectious entry and replication. Viral apoptotic mimicry, defined by the exposure of phosphatidylserine - a marker for apoptosis - on the pathogen surface, is emerging as a common theme used by enveloped viruses to promote infection. Focusing on the four best described examples (vaccinia virus, dengue virus, Ebola virus and pseudotyped lentivirus), we summarize our current understanding of apoptotic mimicry as a mechanism for virus entry, binding and immune evasion. We also describe recent examples of non-enveloped viruses that use this mimicry strategy, and discuss future directions and how viral apoptotic mimicry could be targeted therapeutically.

  14. THERMALLY DRIVEN ATMOSPHERIC ESCAPE

    SciTech Connect

    Johnson, Robert E.

    2010-06-20

    Accurately determining the escape rate from a planet's atmosphere is critical for determining its evolution. A large amount of Cassini data is now available for Titan's upper atmosphere and a wealth of data is expected within the next decade on escape from Pluto, Mars, and extra-solar planets. Escape can be driven by upward thermal conduction of energy deposited well below the exobase, as well as by nonthermal processes produced by energy deposited in the exobase region. Recent applications of a model for escape driven by upward thermal conduction, called the slow hydrodynamic escape model, have resulted in surprisingly large loss rates for the atmosphere of Titan, Saturn's largest moon. Based on a molecular kinetic simulation of the exobase region, these rates appear to be orders of magnitude too large. Therefore, the slow hydrodynamic model is evaluated here. It is shown that such a model cannot give a reliable description of the atmospheric temperature profile unless it is coupled to a molecular kinetic description of the exobase region. Therefore, the present escape rates for Titan and Pluto must be re-evaluated using the atmospheric model described here.

  15. Spacecraft crew escape

    NASA Astrophysics Data System (ADS)

    Miller, B. A.

    Safe crew escape from spacecraft is extremely difficult to engineer and has large cost and vehicle payload penalties. Because of these factors calculated risks have apparently been taken and only the most rudimentary means of crew protecion have been provided for space programs. Although designed for maximum reliability and safety a calculated risk is taken that on-balance it is more acceptable to risk the loss of possibly some or all occupants than introduce the mass, cost and complexity of an escape system. This philosophy was accepted until the Challenger tragedy. It is now clear that the use of this previously acceptable logic is invalid and that provisions must be made for spacecraft crew escape in the event of a catastrophic accident. This paper reviews the funded studies and subsequent proposals undertaken by Martin-Baker for the use of both encapsullated and open ejection seats for the Hermes Spaceplane. The technical difficulties, special innovations and future applications are also discussed.

  16. Escape and rescue model

    NASA Astrophysics Data System (ADS)

    Alvord, D.; Nelson, H. E.

    The Escape and Rescue model is a discrete-event simulation program written in Simscript. It was developed to simulate the emergency movement involved in escape and/or rescue of people from a Board and Care Home housing a group of persons with varying degrees of physical or mental disabilities along with a small live-in staff. It may, however, be used in a much more general setting. It can reasonably handle a building with up to 100 residents and 100 rooms.

  17. Titan impacts and escape

    NASA Astrophysics Data System (ADS)

    Korycansky, D. G.; Zahnle, Kevin J.

    2011-01-01

    We report on hydrodynamic calculations of impacts of large (multi-kilometer) objects on Saturn's moon Titan. We assess escape from Titan, and evaluate the hypothesis that escaping ejecta blackened the leading hemisphere of Iapetus and peppered the surface of Hyperion. We carried out two- and three-dimensional simulations of impactors ranging in size from 4 to 100 km diameter, impact velocities between 7 and 15 km s -1, and impact angles from 0° to 75° from the vertical. We used the ZEUSMP2 hydrocode for the calculations. Simulations were made using three different geometries: three-dimensional Cartesian, two-dimensional axisymmetric spherical polar, and two-dimensional plane polar. Three-dimensional Cartesian geometry calculations were carried out over a limited domain (e.g. 240 km on a side for an impactor of size di = 10 km), and the results compared to ones with the same parameters done by Artemieva and Lunine (2005); in general the comparison was good. Being computationally less demanding, two-dimensional calculations were possible for much larger domains, covering global regions of the satellite (from 800 km below Titan's surface to the exobase altitude 1700 km above the surface). Axisymmetric spherical polar calculations were carried out for vertical impacts. Two-dimensional plane-polar geometry calculations were made for both vertical and oblique impacts. In general, calculations among all three geometries gave consistent results. Our basic result is that the amount of escaping material is less than or approximately equal to the impactor mass even for the most favorable cases. Amounts of escaping material scaled most strongly as a function of velocity, with high-velocity impacts generating the largest amount, as expected. Dependence of the relative amount of escaping mass fesc = mesc/ Mi on impactor diameter di was weak. Oblique impacts (impact angle θi > 45°) were more effective than vertical or near-vertical impacts; ratios of mesc/ Mi ˜ 1-2 were

  18. Nosema Tolerant Honeybees (Apis mellifera) Escape Parasitic Manipulation of Apoptosis.

    PubMed

    Kurze, Christoph; Le Conte, Yves; Dussaubat, Claudia; Erler, Silvio; Kryger, Per; Lewkowski, Oleg; Müller, Thomas; Widder, Miriam; Moritz, Robin F A

    2015-01-01

    Apoptosis is not only pivotal for development, but also for pathogen defence in multicellular organisms. Although numerous intracellular pathogens are known to interfere with the host's apoptotic machinery to overcome this defence, its importance for host-parasite coevolution has been neglected. We conducted three inoculation experiments to investigate in the apoptotic respond during infection with the intracellular gut pathogen Nosema ceranae, which is considered as potential global threat to the honeybee (Apis mellifera) and other bee pollinators, in sensitive and tolerant honeybees. To explore apoptotic processes in the gut epithelium, we visualised apoptotic cells using TUNEL assays and measured the relative expression levels of subset of candidate genes involved in the apoptotic machinery using qPCR. Our results suggest that N. ceranae reduces apoptosis in sensitive honeybees by enhancing inhibitor of apoptosis protein-(iap)-2 gene transcription. Interestingly, this seems not be the case in Nosema tolerant honeybees. We propose that these tolerant honeybees are able to escape the manipulation of apoptosis by N. ceranae, which may have evolved a mechanism to regulate an anti-apoptotic gene as key adaptation for improved host invasion.

  19. Nosema Tolerant Honeybees (Apis mellifera) Escape Parasitic Manipulation of Apoptosis

    PubMed Central

    Kurze, Christoph; Le Conte, Yves; Dussaubat, Claudia; Erler, Silvio; Kryger, Per; Lewkowski, Oleg; Müller, Thomas; Widder, Miriam; Moritz, Robin F. A.

    2015-01-01

    Apoptosis is not only pivotal for development, but also for pathogen defence in multicellular organisms. Although numerous intracellular pathogens are known to interfere with the host’s apoptotic machinery to overcome this defence, its importance for host-parasite coevolution has been neglected. We conducted three inoculation experiments to investigate in the apoptotic respond during infection with the intracellular gut pathogen Nosema ceranae, which is considered as potential global threat to the honeybee (Apis mellifera) and other bee pollinators, in sensitive and tolerant honeybees. To explore apoptotic processes in the gut epithelium, we visualised apoptotic cells using TUNEL assays and measured the relative expression levels of subset of candidate genes involved in the apoptotic machinery using qPCR. Our results suggest that N. ceranae reduces apoptosis in sensitive honeybees by enhancing inhibitor of apoptosis protein-(iap)-2 gene transcription. Interestingly, this seems not be the case in Nosema tolerant honeybees. We propose that these tolerant honeybees are able to escape the manipulation of apoptosis by N. ceranae, which may have evolved a mechanism to regulate an anti-apoptotic gene as key adaptation for improved host invasion. PMID:26445372

  20. Spacecraft Escape Capsule

    NASA Technical Reports Server (NTRS)

    Robertson, Edward A.; Charles, Dingell W.; Bufkin, Ann L.; Rodriggs, Liana M.; Peterson, Wayne; Cuthbert, Peter; Lee, David E.; Westhelle, Carlos

    2006-01-01

    A report discusses the Gumdrop capsule a conceptual spacecraft that would enable the crew to escape safely in the event of a major equipment failure at any time from launch through atmospheric re-entry. The scaleable Gumdrop capsule would comprise a command module (CM), a service module (SM), and a crew escape system (CES). The CM would contain a pressurized crew environment that would include avionic, life-support, thermal control, propulsive attitude control, and recovery systems. The SM would provide the primary propulsion and would also supply electrical power, life-support resources, and active thermal control to the CM. The CES would include a solid rocket motor, embedded within the SM, for pushing the CM away from the SM in the event of a critical thermal-protection-system failure or loss of control. The CM and SM would normally remain integrated with each other from launch through recovery, but could be separated using the CES, if necessary, to enable the safe recovery of the crew in the CM. The crew escape motor could be used, alternatively, as a redundant means of de-orbit propulsion for the CM in the event of a major system failure in the SM.

  1. Inhibitors of apoptotic proteins: new targets for anticancer therapy.

    PubMed

    Saleem, Mohammad; Qadir, Muhammad Imran; Perveen, Nadia; Ahmad, Bashir; Saleem, Uzma; Irshad, Tehseen; Ahmad, Bashir

    2013-09-01

    Inhibitors of apoptotic proteins (IAPs) can play an important role in inhibiting apoptosis by exerting their negative action on caspases (apoptotic proteins). There are eight proteins in this family: NAIP/BIRC1/NLRB, cellular IAP1 (cIAP1)/human IAP2/BIRC2, cellular IAP2 (cIAP2)/human IAP1/BIRC3, X-linked IAP (XIAP)/BIRC4, survivin/BIRC5, baculoviral IAP repeat (BIR)-containing ubiquitin-conjugating enzyme/apollon/BIRC6, livin/melanoma-IAP (ML-IAP)/BIRC7/KIAP, and testis-specific IAP (Ts-IAP)/hILP-2/BIRC8. Deregulation of these inhibitors of apoptotic proteins (IAPs) may push cell toward cancer and neurodegenerative disorders. Inhibitors of apoptotic proteins (IAPs) may provide new target for anticancer therapy. Drugs may be developed that are inhibiting these IAPs to induce apoptosis in cancerous cells.

  2. Inhibitors of apoptotic proteins: new targets for anticancer therapy.

    PubMed

    Saleem, Mohammad; Qadir, Muhammad Imran; Perveen, Nadia; Ahmad, Bashir; Saleem, Uzma; Irshad, Tehseen; Ahmad, Bashir

    2013-09-01

    Inhibitors of apoptotic proteins (IAPs) can play an important role in inhibiting apoptosis by exerting their negative action on caspases (apoptotic proteins). There are eight proteins in this family: NAIP/BIRC1/NLRB, cellular IAP1 (cIAP1)/human IAP2/BIRC2, cellular IAP2 (cIAP2)/human IAP1/BIRC3, X-linked IAP (XIAP)/BIRC4, survivin/BIRC5, baculoviral IAP repeat (BIR)-containing ubiquitin-conjugating enzyme/apollon/BIRC6, livin/melanoma-IAP (ML-IAP)/BIRC7/KIAP, and testis-specific IAP (Ts-IAP)/hILP-2/BIRC8. Deregulation of these inhibitors of apoptotic proteins (IAPs) may push cell toward cancer and neurodegenerative disorders. Inhibitors of apoptotic proteins (IAPs) may provide new target for anticancer therapy. Drugs may be developed that are inhibiting these IAPs to induce apoptosis in cancerous cells. PMID:23790005

  3. Endosomal escape: a bottleneck in intracellular delivery.

    PubMed

    Shete, Harshad K; Prabhu, Rashmi H; Patravale, Vandana B

    2014-01-01

    With advances in therapeutic science, apart from drugs, newer bioactive moieties like oligonucleotides, proteins, peptides, enzymes and antibodies are constantly being introduced for the betterment of therapeutic efficacy. These moieties have intracellular components of the cells like cytoplasm and nucleus as one of their pharmacological sites for exhibiting therapeutic activity. Despite their promising efficacy, their intracellular bioavailability has been critically hampered leading to failure in the treatment of numerous diseases and disorders. The endosomal uptake pathway is known to be a rate-limiting barrier for such systems. Bioactive molecules get trapped in the endosomal vesicles and degraded in the lysosomal compartment, necessitating the need for effective strategies that facilitate the endosomal escape and enhance the cytosolic bioavailability of bioactives. Microbes like viruses and bacteria have developed their innate mechanistic tactics to translocate their genome and toxins by efficiently penetrating the host cell membrane. Understanding this mechanism and exploring it further for intracellular delivery has opened new avenues to surmount the endosomal barrier. These strategies include membrane fusion, pore formation and proton sponge effects. On the other hand, progress in designing a novel smart polymeric carrier system that triggers endosomal escape by undergoing modulations in the intracellular milieu has further led to an improvement in intracellular delivery. These comprise pH, enzyme and temperature-induced modulators, synthetic cationic lipids and photo-induced physical disruption. Each of the aforementioned strategies has its own unique mechanism to escape the endosome. This review recapitulates the numerous strategies designed to surmount the bottleneck of endosomal escape and thereby achieve successful intracellular uptake of bioactives. PMID:24730275

  4. Novel Cytoprotective Inhibitors for Apoptotic Endonuclease G

    PubMed Central

    Jang, Dae Song; Penthala, Narsimha R.; Apostolov, Eugene O.; Wang, Xiaoying; Crooks, Peter A.

    2015-01-01

    Apoptotic endonuclease G (EndoG) is responsible for DNA fragmentation both during and after cell death. Previous studies demonstrated that genetic inactivation of EndoG is cytoprotective against various pro-apoptotic stimuli; however, specific inhibitors for EndoG are not available. In this study, we have developed a high-throughput screening assay for EndoG and have used it to screen a chemical library. The screening resulted in the identification of two potent EndoG inhibitors, PNR-3-80 and PNR-3-82, which are thiobarbiturate analogs. As determined by their IC50s, the inhibitors are more potent than ZnCl2 or EDTA. They inhibit EndoG at one or two orders of magnitude greater than another apoptotic endonuclease, DNase I, and do not inhibit the other five tested cell death-related enzymes: DNase II, RNase A, proteinase, lactate dehydrogenase, and superoxide dismutase 1. Exposure of natural EndoG-expressing 22Rv1 or EndoG-overexpressing PC3 cells rendered them significantly resistant to Cisplatin and Docetaxel, respectively. These novel EndoG inhibitors have the potential to be utilized for amelioration of cell injuries in which participation of EndoG is essential. PMID:25401220

  5. Reconstructing the Alcatraz escape

    NASA Astrophysics Data System (ADS)

    Baart, F.; Hoes, O.; Hut, R.; Donchyts, G.; van Leeuwen, E.

    2014-12-01

    In the night of June 12, 1962 three inmates used a raft made of raincoatsto escaped the ultimate maximum security prison island Alcatraz in SanFrancisco, United States. History is unclear about what happened tothe escapees. At what time did they step into the water, did theysurvive, if so, where did they reach land? The fate of the escapees has been the subject of much debate: did theymake landfall on Angel Island, or did the current sweep them out ofthe bay and into the cold pacific ocean? In this presentation, we try to shed light on this historic case using avisualization of a high-resolution hydrodynamic simulation of the San Francisco Bay, combined with historical tidal records. By reconstructing the hydrodynamic conditions and using a particle based simulation of the escapees we show possible scenarios. The interactive model is visualized using both a 3D photorealistic and web based visualization. The "Escape from Alcatraz" scenario demonstrates the capabilities of the 3Di platform. This platform is normally used for overland flooding (1D/2D). The model engine uses a quad tree structure, resulting in an order of magnitude speedup. The subgrid approach takes detailed bathymetry information into account. The inter-model variability is tested by comparing the results with the DFlow Flexible Mesh (DFlowFM) San Francisco Bay model. Interactivity is implemented by converting the models from static programs to interactive libraries, adhering to the Basic ModelInterface (BMI). Interactive models are more suitable for answeringexploratory research questions such as this reconstruction effort. Although these hydrodynamic simulations only provide circumstantialevidence for solving the mystery of what happened during the foggy darknight of June 12, 1962, it can be used as a guidance and provides aninteresting testcase to apply interactive modelling.

  6. Hydrodynamic escape from planetary atmospheres

    NASA Astrophysics Data System (ADS)

    Tian, Feng

    Hydrodynamic escape is an important process in the formation and evolution of planetary atmospheres. Due to the existence of a singularity point near the transonic point, it is difficult to find transonic steady state solutions by solving the time-independent hydrodynamic equations. In addition to that, most previous works assume that all energy driving the escape flow is deposited in one narrow layer. This assumption not only results in less accurate solutions to the hydrodynamic escape problem, but also makes it difficult to include other chemical and physical processes in the hydrodynamic escape models. In this work, a numerical model describing the transonic hydrodynamic escape from planetary atmospheres is developed. A robust solution technique is used to solve the time dependent hydrodynamic equations. The method has been validated in an isothermal atmosphere where an analytical solution is available. The hydrodynamic model is applied to 3 cases: hydrogen escape from small orbit extrasolar planets, hydrogen escape from a hydrogen rich early Earth's atmosphere, and nitrogen/methane escape from Pluto's atmosphere. Results of simulations on extrasolar planets are in good agreement with the observations of the transiting extrasolar planet HD209458b. Hydrodynamic escape of hydrogen from other hypothetical close-in extrasolar planets are simulated and the influence of hydrogen escape on the long-term evolution of these extrasolar planets are discussed. Simulations on early Earth suggest that hydrodynamic escape of hydrogen from a hydrogen rich early Earth's atmosphere is about two orders magnitude slower than the diffusion limited escape rate. A hydrogen rich early Earth's atmosphere could have been maintained by the balance between the hydrogen escape and the supply of hydrogen into the atmosphere by volcanic outgassing. Origin of life may have occurred in the organic soup ocean created by the efficient formation of prebiotic molecules in the hydrogen rich early

  7. THERMALLY DRIVEN ATMOSPHERIC ESCAPE: TRANSITION FROM HYDRODYNAMIC TO JEANS ESCAPE

    SciTech Connect

    Volkov, Alexey N.; Johnson, Robert E.; Tucker, Orenthal J.; Erwin, Justin T.

    2011-03-10

    Thermally driven escape from planetary atmospheres changes in nature from an organized outflow (hydrodynamic escape) to escape on a molecule-by-molecule basis (Jeans escape) with increasing Jeans parameter, {lambda}, the ratio of the gravitational to thermal energy of the atmospheric molecules. This change is described here for the first time using the direct simulation Monte Carlo method. When heating is predominantly below the lower boundary of the simulation region, R{sub 0}, and well below the exobase of a single-component atmosphere, the nature of the escape process changes over a surprisingly narrow range of Jeans parameters, {lambda}{sub 0}, evaluated at R{sub 0}. For an atomic gas, the transition occurs over {lambda}{sub 0} {approx} 2-3, where the lower bound, {lambda}{sub 0} {approx} 2.1, corresponds to the upper limit for isentropic, supersonic outflow. For {lambda}{sub 0} > 3 escape occurs on a molecule-by-molecule basis and we show that, contrary to earlier suggestions, for {lambda}{sub 0} > {approx}6 the escape rate does not deviate significantly from the familiar Jeans rate. In a gas composed of diatomic molecules, the transition shifts to {lambda}{sub 0} {approx} 2.4-3.6 and at {lambda}{sub 0} > {approx}4 the escape rate increases a few tens of percent over that for the monatomic gas. Scaling by the Jeans parameter and the Knudsen number, these results can be applied to thermally induced escape of the major species from solar and extrasolar planets.

  8. Escape from Vela X

    SciTech Connect

    Hinton, J.; Funk, S.; Parsons, R.D.; Ohm, S.; /Leicester U. /Leeds U.

    2012-02-15

    While the Vela pulsar and its associated nebula are often considered as the archetype of a system powered by a {approx} 10{sup 4} year old isolated neutron star, many features of the spectral energy distribution of this pulsar wind nebula are both puzzling and unusual. Here we develop a model that for the first time relates the main structures in the system, the extended radio nebula (ERN) and the X-ray cocoon through continuous injection of particles with a fixed spectral shape. We argue that diffusive escape of particles from the ERN can explain the steep Fermi-LAT spectrum. In this scenario Vela X should produce a distinct feature in the locally-measured cosmic ray electron spectrum at very high energies. This prediction can be tested in the future using the Cherenkov Telescope Array (CTA). If particles are indeed released early in the evolution of PWNe and can avoid severe adiabatic losses, PWN provide a natural explanation for the rising positron fraction in the local CR spectrum.

  9. ESCAPE FROM VELA X

    SciTech Connect

    Hinton, J. A.; Ohm, S.; Funk, S.; Parsons, R. D.

    2011-12-10

    While the Vela pulsar and its associated nebula are often considered as the archetype of a system powered by a {approx}10{sup 4} year old isolated neutron star, many features of the spectral energy distribution of this pulsar wind nebula (PWN) are both puzzling and unusual. Here we develop a model that for the first time relates the main structures in the system, the extended radio nebula (ERN) and the X-ray cocoon through continuous injection of particles with a fixed spectral shape. We argue that diffusive escape of particles from the ERN can explain the steep Fermi-LAT spectrum. In this scenario Vela X should produce a distinct feature in the locally measured cosmic ray (CR) electron spectrum at very high energies. This prediction can be tested in the future using the Cherenkov Telescope Array. If particles are indeed released early in the evolution of PWNe and can avoid severe adiabatic losses, PWN provides a natural explanation for the rising positron fraction in the local CR spectrum.

  10. Apoptotic Cell Clearance in Development.

    PubMed

    Shklover, Jeny; Levy-Adam, Flonia; Kurant, Estee

    2015-01-01

    Programmed cell death and its specific form apoptosis play an important role during development of multicellular organisms. They are crucial for morphogenesis and organ sculpting as well as for adjusting cell number in different systems. Removal of apoptotic cells is the last critical step of apoptosis. Apoptotic cells are properly and efficiently recognized and eliminated through phagocytosis, which is performed by professional and nonprofessional phagocytes. Phagocytosis of apoptotic cells or apoptotic cell clearance is a dynamic multistep process, involving interactions between phagocytic receptors and ligands on apoptotic cells, which are highly conserved in evolution. However, this process is extremely redundant in mammals, containing multiple factors playing similar roles in the process. Using model organisms such as Caenorhabditis elegans, Drosophila melanogaster, zebrafish, and mouse permits addressing fundamental questions in developmental cell clearance by a comprehensive approach including powerful genetics and cell biological tools enriched by live imaging. Recent studies in model organisms have enhanced significantly our understanding of the molecular and cellular basis of apoptotic cell clearance during development. Here, we review the current knowledge and illuminate the great potential of the research performed in genetic models, which opens new directions in developmental biology.

  11. An escape from crowding.

    PubMed

    Freeman, Jeremy; Pelli, Denis G

    2007-10-26

    Crowding occurs when nearby flankers jumble the appearance of a target object, making it hard to identify. Crowding is feature integration over an inappropriately large region. What determines the size of that region? According to bottom-up proposals, the size is that of an anatomically determined isolation field. According to top-down proposals, the size is that of the spotlight of attention. Intriligator and Cavanagh (2001) proposed the latter, but we show that their conclusion rests on an implausible assumption. Here we investigate the role of attention in crowding using the change blindness paradigm. We measure capacity for widely and narrowly spaced letters during a change detection task, both with and without an interstimulus cue. We find that standard crowding manipulations-reducing spacing and adding flankers-severely impair uncued change detection but have no effect on cued change detection. Because crowded letters look less familiar, we must use longer internal descriptions (less compact representations) to remember them. Thus, fewer fit into working memory. The memory limit does not apply to the cued condition because the observer need remember only the cued letter. Cued performance escapes the effects of crowding, as predicted by a top-down account. However, our most parsimonious account of the results is bottom-up: Cued change detection is so easy that the observer can tolerate feature degradation and letter distortion, making the observer immune to crowding. The change detection task enhances the classic partial report paradigm by making the test easier (same/different instead of identifying one of many possible targets), which increases its sensitivity, so it can reveal degraded memory traces.

  12. Viral escape from antisense RNA.

    PubMed

    Bull, J J; Jacobson, A; Badgett, M R; Molineux, I J

    1998-05-01

    RNA coliphage SP was propagated for several generations on a host expressing an inhibitory antisense RNA complementary to bases 31-270 of the positive-stranded genome. Phages evolved that escaped inhibition. Typically, these escape mutants contained 3-4 base substitutions, but different sequences were observed among different isolates. The mutations were located within three different types of structural features within the predicted secondary structure of SP genomic RNA: (i) hairpin loops; (ii) hairpin stems; and (iii) the 5' region of the phage genome complementary to the antisense molecule. Computer modelling of the mutant genomic RNAs showed that all of the substitutions within hairpin stems improved the Watson-Crick pairing of the stem. No major structural rearrangements were predicted for any of the mutant genomes, and most substitutions in coding regions did not alter the amino acid sequence. Although the evolved phage populations were polymorphic for substitutions, many substitutions appeared independently in two selected lines. The creation of a new, perfect, antisense RNA against an escape mutant resulted in the inhibition of that mutant but not of other escape mutants nor of the ancestral, unevolved phage. Thus, at least in this system, a population of viruses that evolved to escape from a single antisense RNA would require a cocktail of several antisense RNAs for inhibition. PMID:9643550

  13. Plasma Escape from Unmagnetized Bodies

    NASA Technical Reports Server (NTRS)

    Hartle, R. E.; Grebowsky, J. M.; Intriligator, D. S.

    1998-01-01

    A considerable fraction of atmospheric loss at Venus and Titan is in the form of plasma escape. This is due in part to the fact that the ionospheres of these unmagnetized bodies interact directly with the high speed plasmas flowing around them. The similarities of the interactions help reinforce interpretations of measurements made at each body, especially when instruments and measurement sites differ. For example, it is well established through this method that ions born in the exospheres above the ionopauses are picked up and carried away by the solar wind at Venus and the rotating plasma in Saturn's magnetosphere. On the other hand, it is more difficult to relate the observations associated with escape of cooler ionospheric plasma down the ionotails of each body. A clear example of ionospheric plasma escaping Titan was observed as it flowed down its ionotail (1). Measurements at Venus have not as yet clearly distinguished between ionospheric and pickup ion escape in the ionotail; however, cold ions detected in the distant wake at 1 AU by the CELIAS/CTOF instrument on SOHO have been interpreted as ionospheric in origin (2). An algorithm to determine ionospheric flow from Pioneer Venus aeronomical measurements is used to show that escape of cold ionospheric plasma is likely to occur. These results along with plasma flow measurements made in the ionotail of Venus are combined and compared to the corresponding flow at Titan.

  14. Lise Meitner's escape from Germany

    NASA Astrophysics Data System (ADS)

    Sime, Ruth Lewin

    1990-03-01

    Lise Meitner (1878-1968) achieved prominence as a nuclear physicist in Germany; although of Jewish origin, her Austrian citizenship exempted her from Nazi racial laws until the annexation of Austria in 1938 precipitated her dismissal. Forbidden to emigrate, she narrowly escaped to the Netherlands with the help of concerned friends in the international physics community.

  15. Mechanisms of Ionospheric Mass Escape

    NASA Technical Reports Server (NTRS)

    Moore, T. E.; Khazanov, G. V.

    2010-01-01

    The dependence of ionospheric O+ escape flux on electromagnetic energy flux and electron precipitation into the ionosphere is derived for a hypothetical ambipolar pick-up process, powered the relative motion of plasmas and neutral upper atmosphere, and by electron precipitation, at heights where the ions are magnetized but influenced by photo-ionization, collisions with gas atoms, ambipolar and centrifugal acceleration. Ion pick-up by the convection electric field produces "ring-beam" or toroidal velocity distributions, as inferred from direct plasma measurements, from observations of the associated waves, and from the spectra of incoherent radar echoes. Ring-beams are unstable to plasma wave growth, resulting in rapid relaxation via transverse velocity diffusion, into transversely accelerated ion populations. Ion escape is substantially facilitated by the ambipolar potential, but is only weakly affected by centrifugal acceleration. If, as cited simulations suggest, ion ring beams relax into non-thermal velocity distributions with characteristic speed equal to the local ion-neutral flow speed, a generalized "Jeans escape" calculation shows that the escape flux of ionospheric O+ increases with Poynting flux and with precipitating electron density in rough agreement with observations.

  16. 42 CFR 84.51 - Entry and escape, or escape only; classification.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... during entry into a hazardous atmosphere, and for escape from a hazardous atmosphere; or (b) Escape only. Respirators designed and approved for use only during escape from a hazardous atmosphere....

  17. 42 CFR 84.51 - Entry and escape, or escape only; classification.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... during entry into a hazardous atmosphere, and for escape from a hazardous atmosphere; or (b) Escape only. Respirators designed and approved for use only during escape from a hazardous atmosphere....

  18. 42 CFR 84.51 - Entry and escape, or escape only; classification.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... during entry into a hazardous atmosphere, and for escape from a hazardous atmosphere; or (b) Escape only. Respirators designed and approved for use only during escape from a hazardous atmosphere....

  19. 42 CFR 84.51 - Entry and escape, or escape only; classification.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... during entry into a hazardous atmosphere, and for escape from a hazardous atmosphere; or (b) Escape only. Respirators designed and approved for use only during escape from a hazardous atmosphere....

  20. 42 CFR 84.51 - Entry and escape, or escape only; classification.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... during entry into a hazardous atmosphere, and for escape from a hazardous atmosphere; or (b) Escape only. Respirators designed and approved for use only during escape from a hazardous atmosphere....

  1. Escape Analysis on the Confinement-Escape Problem of a Defender Against an Evader Escaping From a Circular Region.

    PubMed

    Li, Wei

    2016-09-01

    In this paper, we investigate some mathematical properties of the confinement-escape problem of a defender and an evader with respect to a circular region, which was proposed in the author's previous work. Initially, the evader is located inside the circle, the defender patrols on the circle and tries to seal it to prevent the evader' escape; while the evader attempts to escape with avoidance of the defender. Here, we adopt the same control laws of the agents and consider particularly the successful-escape conditions which ensure a monotone-increasing distance (MID) between the defender and the evader as the system evolves, for abbreviation, we call it the escape with the MID to the defender, or simply the MID escape. Then, we: 1) provide some sufficient conditions for the MID escape under different situations; 2) provide the corresponding upper-limit estimations of the escape time; and 3) discuss the characteristics of the analytical results. PMID:27390195

  2. Blue Origin Conducts Pad Escape Test

    NASA Video Gallery

    Blue Origin conducted a successful pad escape test Oct. 19 at the company's West Texas launch site, firing its pusher escape motor and launching a full-scale suborbital crew capsule from a simulate...

  3. [Escape Behaviors and Its Underlying Neuronal Circuits].

    PubMed

    Oda, Yoichi

    2015-10-01

    Escape behaviors are crucial to survive predator encounters or aversive stimuli. The neural circuits mediating escape behaviors of different animal species have a common framework to trigger extremely fast and robust movement with minimum delay. Thus, the neuronal escape circuits possibly represent functional architectures that perform the most efficient sensory-motor processing in the brain. Here, I review the escape behaviors and underlying neuronal circuits of several invertebrates and fish by focusing on the Mauthner cells, a pair of giant reticulospinal neurons in the hindbrain, that trigger fast escape behavior in goldfish and zebrafish. PMID:26450070

  4. On ion escape from Venus

    NASA Astrophysics Data System (ADS)

    Jarvinen, Riku

    2011-04-01

    This doctoral thesis is about the solar wind influence on the atmosphere of the planet Venus. A numerical plasma simulation model was developed for the interaction between Venus and the solar wind to study the erosion of charged particles from the Venus upper atmosphere. The developed model is a hybrid simulation where ions are treated as particles and electrons are modelled as a fluid. The simulation was used to study the solar wind induced ion escape from Venus as observed by the European Space Agency's Venus Express and NASA's Pioneer Venus Orbiter spacecraft. Especially, observations made by the ASPERA-4 particle instrument onboard Venus Express were studied. The thesis consists of an introductory part and four peer-reviewed articles published in scientific journals. In the introduction Venus is presented as one of the terrestrial planets in the Solar System and the main findings of the work are discussed within the wider context of planetary physics. Venus is the closest neighbouring planet to the Earth and the most earthlike planet in its size and mass orbiting the Sun. Whereas the atmosphere of the Earth consists mainly of nitrogen and oxygen, Venus has a hot carbon dioxide atmosphere, which is dominated by the greenhouse effect. Venus has all of its water in the atmosphere, which is only a fraction of the Earth's total water supply. Since planets developed presumably in similar conditions in the young Solar System, why Venus and Earth became so different in many respects? One important feature of Venus is that the planet does not have an intrinsic magnetic field. This makes it possible for the solar wind, a continuous stream of charged particles from the Sun, to flow close to Venus and to pick up ions from the planet's upper atmosphere. The strong intrinsic magnetic field of the Earth dominates the terrestrial magnetosphere and deflects the solar wind flow far away from the atmosphere. The region around Venus where the planet's atmosphere interacts with the

  5. On ion escape from Venus

    NASA Astrophysics Data System (ADS)

    Jarvinen, R.

    2011-04-01

    This doctoral thesis is about the solar wind influence on the atmosphere of the planet Venus. A numerical plasma simulation model was developed for the interaction between Venus and the solar wind to study the erosion of charged particles from the Venus upper atmosphere. The developed model is a hybrid simulation where ions are treated as particles and electrons are modelled as a fluid. The simulation was used to study the solar wind induced ion escape from Venus as observed by the European Space Agency's Venus Express and NASA's Pioneer Venus Orbiter spacecraft. Especially, observations made by the ASPERA-4 particle instrument onboard Venus Express were studied. The thesis consists of an introductory part and four peer-reviewed articles published in scientific journals. In the introduction Venus is presented as one of the terrestrial planets in the Solar System and the main findings of the work are discussed within the wider context of planetary physics.Venus is the closest neighbouring planet to the Earth and the most earthlike planet in its size and mass orbiting the Sun. Whereas the atmosphere of the Earth consists mainly of nitrogen and oxygen, Venus has a hot carbon dioxide atmosphere, which is dominated by the greenhouse effect. Venus has all of its water in the atmosphere, which is only a fraction of the Earth's total water supply. Since planets developed presumably in similar conditions in the young Solar System, why Venus and Earth became so different in many respects?One important feature of Venus is that the planet does not have an intrinsic magnetic field. This makes it possible for the solar wind, a continuous stream of charged particles from the Sun, to flow close to Venus and to pick up ions from the planet's upper atmosphere. The strong intrinsic magnetic field of the Earth dominates the terrestrial magnetosphere and deflects the solar wind flow far away from the atmosphere. The region around Venus where the planet's atmosphere interacts with the

  6. Apoptotic Signaling in Mouse Odontogenesis

    PubMed Central

    Svandova, Eva; Tucker, Abigail S.

    2012-01-01

    Abstract Apoptosis is an important morphogenetic event in embryogenesis as well as during postnatal life. In the last 2 decades, apoptosis in tooth development (odontogenesis) has been investigated with gradually increasing focus on the mechanisms and signaling pathways involved. The molecular machinery responsible for apoptosis exhibits a high degree of conservation but also organ and tissue specific patterns. This review aims to discuss recent knowledge about apoptotic signaling networks during odontogenesis, concentrating on the mouse, which is often used as a model organism for human dentistry. Apoptosis accompanies the entire development of the tooth and corresponding remodeling of the surrounding bony tissue. It is most evident in its role in the elimination of signaling centers within developing teeth, removal of vestigal tooth germs, and in odontoblast and ameloblast organization during tooth mineralization. Dental apoptosis is caspase dependent and proceeds via mitochondrial mediated cell death with possible amplification by Fas-FasL signaling modulated by Bcl-2 family members. PMID:22204278

  7. Apoptotic signaling in mouse odontogenesis.

    PubMed

    Matalova, Eva; Svandova, Eva; Tucker, Abigail S

    2012-01-01

    Apoptosis is an important morphogenetic event in embryogenesis as well as during postnatal life. In the last 2 decades, apoptosis in tooth development (odontogenesis) has been investigated with gradually increasing focus on the mechanisms and signaling pathways involved. The molecular machinery responsible for apoptosis exhibits a high degree of conservation but also organ and tissue specific patterns. This review aims to discuss recent knowledge about apoptotic signaling networks during odontogenesis, concentrating on the mouse, which is often used as a model organism for human dentistry. Apoptosis accompanies the entire development of the tooth and corresponding remodeling of the surrounding bony tissue. It is most evident in its role in the elimination of signaling centers within developing teeth, removal of vestigal tooth germs, and in odontoblast and ameloblast organization during tooth mineralization. Dental apoptosis is caspase dependent and proceeds via mitochondrial mediated cell death with possible amplification by Fas-FasL signaling modulated by Bcl-2 family members.

  8. Mars atmosphere evolution: Escape to space

    NASA Technical Reports Server (NTRS)

    Luhmann, J. G.

    1992-01-01

    The loss mechanisms and the rates of escape, to space, of Martian atmosphere constituents have changed throughout the history of the solar system. For the first billion years, Mars' atmosphere escape was probably dominated by impact erosion related to the presence of debris left over from the accretionary phase. This loss was further augmented by hydrodynamic outflows related to the presence of an early denser atmosphere and a sun that was brighter in the EUV wavelengths. Following this initial 'catastrophic' phase, during which a large fraction of the original atmosphere was lost but then replaced by volcanism and cometary impact, the 'modern' loss mechanisms which still operate today would have taken over. Those mechanisms that now contribute to escape to space consist of classical thermal or Jeans escape, nonthermal escape due to chemical reaction in the atmosphere, and solar wind-related losses. Both the loss mechanisms and the rates of escape are discussed.

  9. Effect of PDT-treated apoptotic cells on macrophages

    NASA Astrophysics Data System (ADS)

    Song, Sheng; Xing, Da; Zhou, Fei-fan; Chen, Wei R.

    2009-02-01

    Recently, the long-term immunological effects of photodynamic therapy have attracted much attention. PDT induced immune response was mainly initiated through necrotic cells and apoptotic cells, as well as immune cells such as macrophages. Nitric oxide (NO) as an important regulatory factor in signal transfer between cells has been wildly studied for generation, development, and metastasis of tumors. NO synthase is a key enzyme in nitric oxide synthesis. However, inducible nitric oxide synthase (iNOS) is usually activated under pathological conditions, such as stress and cancer, which can produce high levels of nitric oxide and contribute to tumor cytotoxicity. In addition, increased NO production by iNOS has been associated with the host immune response and cell apoptosis, which play an important role in many carcinogenesis and anti-carcinoma mechanisms. This study focuses on the NO production in macrophages, induced by mouse breast carcinoma apoptotic cells treated by PDT in vitro, and on the effects of immune response induced by apoptotic cells in tumor cells growth.

  10. Enhanced apoptotic response to photodynamic therapy after bcl-2 transfection.

    PubMed

    Kim, H R; Luo, Y; Li, G; Kessel, D

    1999-07-15

    Apoptosis is a cellular death process involving the sequential activation of a series of caspases, endonucleases, and other enzymes. The initiation of apoptosis can be inhibited by overexpression of bcl-2 and certain other members of a related family of proteins. We examined the effects of bcl-2 overexpression on the apoptotic response to photodynamic therapy (PDT), using aluminum phthalocyanine as the photosensitizing agent. In this study, we compared the immortalized human breast epithelial cell line MCF10A with a subline (MCF10A/bcl-2) transfected with the human bcl-2 gene. The latter was approximately 2-fold more sensitive to the phototoxic effects of PDT. At a 50 mJ/cm2 light dose, photodamage to MCF-10A/bcl-2 resulted in a greater loss of the mitochondrial membrane potential (delta(psi)m), enhanced release of mitochondrial cytochrome c, a more rapid and greater activation of caspase-3, and a greater apoptotic response. Western blot analysis revealed that the transfected cell line showed overexpression of both bcl-2 and bax, and that PDT caused selective destruction of bcl-2, leaving bax unaffected. The greater apoptotic response by the transfected line is, therefore, attributed to the higher bax:bcl-2 ratio after photodamage.

  11. Model of a mechanical clock escapement

    NASA Astrophysics Data System (ADS)

    Moline, David; Wagner, John; Volk, Eugene

    2012-07-01

    The mechanical tower clock originated in Europe during the 14th century to sound hourly bells and later display hands on a dial. An important innovation was the escapement mechanism, which converts stored energy into oscillatory motion for fixed time intervals through the pendulum swing. Previous work has modeled the escapement mechanism in terms of inelastic and elastic collisions. We derive and experimentally verify a theoretical model in terms of impulsive differential equations for the Graham escapement mechanism in a Seth Thomas tower clock. The model offers insight into the clock's mechanical behavior and the functionality of the deadbeat escapement mechanism.

  12. Electronic Escape Trails for Firefighters

    NASA Technical Reports Server (NTRS)

    Jorgensen, Charles; Schipper, John; Betts, Bradley

    2008-01-01

    A proposed wireless-communication and data-processing system would exploit recent advances in radio-frequency identification devices (RFIDs) and software to establish information lifelines between firefighters in a burning building and a fire chief at a control station near but outside the building. The system would enable identification of trails that firefighters and others could follow to escape from the building, including identification of new trails should previously established trails become blocked. The system would include a transceiver unit and a computer at the control station, portable transceiver units carried by the firefighters in the building, and RFID tags that the firefighters would place at multiple locations as they move into and through the building (see figure). Each RFID tag, having a size of the order of a few centimeters, would include at least standard RFID circuitry and possibly sensors for measuring such other relevant environmental parameters as temperature, levels of light and sound, concentration of oxygen, concentrations of hazardous chemicals in smoke, and/or levels of nuclear radiation. The RFID tags would be activated and interrogated by the firefighters and control-station transceivers. Preferably, RFID tags would be configured to communicate with each other and with the firefighters units and the control station in an ordered sequence, with built-in redundancy. In a typical scenario, as firefighters moved through a building, they would scatter many RFID tags into smoke-obscured areas by use of a compressed-air gun. Alternatively or in addition, they would mark escape trails by dropping RFID tags at such points of interest as mantraps, hot spots, and trail waypoints. The RFID tags could be of different types, operating at different frequencies to identify their functions, and possibly responding by emitting audible beeps when activated by signals transmitted by transceiver units carried by nearby firefighters.

  13. Escape as Reinforcement and Escape Extinction in the Treatment of Feeding Problems

    ERIC Educational Resources Information Center

    LaRue, Robert H.; Stewart, Victoria; Piazza, Cathleen C.; Volkert, Valerie M.; Patel, Meeta R.; Zeleny, Jason

    2011-01-01

    Given the effectiveness of putative escape extinction as treatment for feeding problems, it is surprising that little is known about the effects of escape as reinforcement for appropriate eating during treatment. In the current investigation, we examined the effectiveness of escape as reinforcement for mouth clean (a product measure of…

  14. Submarine 'safe to escape' studies in man.

    PubMed

    Jurd, K M; Seddon, F M; Thacker, J C; Blogg, S L; Stansfield, M R D; White, M G; Loveman, G A M

    2014-01-01

    The Royal Navy requires reliable advice on the safe limits of escape from a distressed submarine (DISSUB). Flooding in a DISSUB may cause a rise in ambient pressure, increasing the risk of decompression sickness (DCS) and decreasing the maximum depth from which it is safe to escape. The aim of this study was to investigate the pressure/depth limits to escape following saturation at raised ambient pressure. Exposure to saturation pressures up to 1.6 bar (a) (160 kPa) (n = 38); escapes from depths down to 120 meters of sea water (msw) (n = 254) and a combination of saturation followed by escape (n = 90) was carried out in the QinetiQ Submarine Escape Simulator, Alverstoke, United Kingdom. Doppler ultrasound monitoring was used to judge the severity of decompression stress. The trials confirmed the previously untested advice, in the Guardbook, that if a DISSUB was lying at a depth of 90 msw, then it was safe to escape when the pressure in the DISSUB was 1.5 bar (a), but also indicated that this advice may be overly conservative. This study demonstrated that the upper DISSUB saturation pressure limit to safe escape from 90 msw was 1.6 bar (a), resulting in two cases of DCS. PMID:25109084

  15. Submarine 'safe to escape' studies in man.

    PubMed

    Jurd, K M; Seddon, F M; Thacker, J C; Blogg, S L; Stansfield, M R D; White, M G; Loveman, G A M

    2014-01-01

    The Royal Navy requires reliable advice on the safe limits of escape from a distressed submarine (DISSUB). Flooding in a DISSUB may cause a rise in ambient pressure, increasing the risk of decompression sickness (DCS) and decreasing the maximum depth from which it is safe to escape. The aim of this study was to investigate the pressure/depth limits to escape following saturation at raised ambient pressure. Exposure to saturation pressures up to 1.6 bar (a) (160 kPa) (n = 38); escapes from depths down to 120 meters of sea water (msw) (n = 254) and a combination of saturation followed by escape (n = 90) was carried out in the QinetiQ Submarine Escape Simulator, Alverstoke, United Kingdom. Doppler ultrasound monitoring was used to judge the severity of decompression stress. The trials confirmed the previously untested advice, in the Guardbook, that if a DISSUB was lying at a depth of 90 msw, then it was safe to escape when the pressure in the DISSUB was 1.5 bar (a), but also indicated that this advice may be overly conservative. This study demonstrated that the upper DISSUB saturation pressure limit to safe escape from 90 msw was 1.6 bar (a), resulting in two cases of DCS.

  16. Escaping Homelessness: Anticipated and Perceived Facilitators

    ERIC Educational Resources Information Center

    Patterson, Allisha; Tweed, Roger

    2009-01-01

    One study with two distinct sections was conducted to identify factors facilitating escape from homelessness. In Section 1, 58 homeless individuals rated possible facilitators of escape (factors they believed would help them become more independent and self-sufficient). In Section 2, 80 participants who had already exited homelessness rated the…

  17. Cooperation between Apoptotic and Viable Metacyclics Enhances the Pathogenesis of Leishmaniasis

    PubMed Central

    Wanderley, João Luiz Mendes; Pinto da Silva, Lucia Helena; Deolindo, Poliana; Soong, Lynn; Borges, Valéria Matos; Prates, Deboraci Brito; de Souza, Ana Paula Almeida; Barral, Aldina; de Freitas Balanco, José Mario; do Nascimento, Michelle Tanny Cunha; Saraiva, Elvira Maria; Barcinski, Marcello André

    2009-01-01

    Mimicking mammalian apoptotic cells by exposing phosphatidylserine (PS) is a strategy used by virus and parasitic protozoa to escape host protective inflammatory responses. With Leishmania amazonensis (La), apoptotic mimicry is a prerogative of the intramacrophagic amastigote form of the parasite and is modulated by the host. Now we show that differently from what happens with amastigotes, promastigotes exposing PS are non-viable, non-infective cells, undergoing apoptotic death. As part of the normal metacyclogenic process occurring in axenic cultures and in the gut of sand fly vectors, a sub-population of metacyclic promastigotes exposes PS. Apoptotic death of the purified PS-positive (PSPOS) sub-population was confirmed by TUNEL staining and DNA laddering. Transmission electron microscopy revealed morphological alterations in PSPOS metacyclics such as DNA condensation, cytoplasm degradation and mitochondrion and kinetoplast destruction, both in in vitro cultures and in sand fly guts. TUNELPOS promastigotes were detected only in the anterior midgut to foregut boundary of infected sand flies. Interestingly, caspase inhibitors modulated parasite death and PS exposure, when added to parasite cultures in a specific time window. Efficient in vitro macrophage infections and in vivo lesions only occur when PSPOS and PS-negative (PSNEG) parasites were simultaneously added to the cell culture or inoculated in the mammalian host. The viable PSNEG promastigote was the infective form, as shown by following the fate of fluorescently labeled parasites, while the PSPOS apoptotic sub-population inhibited host macrophage inflammatory response. PS exposure and macrophage inhibition by a subpopulation of promastigotes is a different mechanism than the one previously described with amastigotes, where the entire population exposes PS. Both mechanisms co-exist and play a role in the transmission and development of the disease in case of infection by La. Since both processes confer

  18. Atmospheric escape, redox evolution, and planetary habitability

    NASA Astrophysics Data System (ADS)

    Catling, D. C.; Zahnle, K. J.

    2011-12-01

    Through the greenhouse effect, the presence and composition of an atmosphere is critical for defining a (conventional) circumstellar habitable zone in terms of planetary surface temperatures suitable for liquid water. Lack of knowledge of planetary atmospheres is likely to frustrate attempts to say with any certainty whether detected terrestrial-sized exoplanets may or may not be habitable. Perhaps an underappreciated role in such considerations is the evolutionary effect of atmospheric escape for determining atmospheric composition or whether an atmosphere exists in the first place. Whether atmospheres exist at all on planets is demonstrably connected to the effect of integrated atmospheric escape. When we observe our own Solar System and transiting exoplanets, the existence of an atmosphere is clearly delineated by a relative vulnerability to thermal escape and impact erosion. The prevalence of thermal escape as a key evolutionary determinant for the presence of planetary atmosphere is shown by a relationship between the relative solar (or stellar) heating and the escape velocity. Those bodies with too much stellar heating and too smaller escape velocity end up devoid of atmospheres. Impact erosion is evident in the relationship between impact velocity and escape velocity. Escape due to impacts is particularly important for understanding the large differences in the atmospheres of giant planet moons, such as Ganymede versus Titan. It is also significant for Mars-sized planets. The oxidation state of atmospheres is important for some theories of the origin of life (where an early reducing atmosphere is helpful for organic synthesis) and the evolution of advanced life (where free molecular oxygen is the best source of high energy metabolism). Surfaces on some relatively small planets and moons are observed to have evolved to an oxidized state, which theory and observation can explain through atmospheric escape. There are several examples in the Solar System where a

  19. Apoptotic effects of signal transduction inhibitors on human tumor cells with different PTEN expression.

    PubMed

    Pfeiler, Georg; Horn, Felicitas; Lattrich, Claus; Klappenberger, Stefanie; Ortmann, Olaf; Treeck, Oliver

    2007-11-01

    An important mechanism of antitumoral targeted therapies is the induction of apoptosis in tumor cells. Tamoxifen and trastuzumab (Herceptin), respectively, are able to trigger apoptosis in human breast cancer cells. But, frequently altered apoptotic signal cascades, for instance through PTEN mutations, help tumor cells to escape antitumoral therapy. We studied to what extent the apoptotic effect of signal-transduction inhibitors is dependent on PTEN expression. PTEN expression was analysed by Western blot analysis in tumor cell lines of the breast (BT-474, MCF-7, MDA-MB-231), ovary (BG-1, SK-OV-3) and endometrium (Ishikawa, HEC-1A). Apoptotic effects of tamoxifen, trastuzumab, ZD1839 (Iressa) and different mitogen-activated protein kinase (MAP) inhibitors were measured after 24 h of treatment. Cellular apoptosis was determined by the detection of cytoplasmic histone-DNA complexes. The tested tumor cell lines exhibited a different PTEN expression, ranging from a high expression (ovarian cancer cell line BG-1 and BT-474 breast cancer cells) to a total absence of PTEN expression (endometrial Ishikawa cells). The apoptotic effect of receptor-targeting drugs (tamoxifen, trastuzumab, ZD1839) was dependent both on receptor expression and PTEN expression. When cells were treated with MAPK inhibitors, no correlation between PTEN expression and the apoptosis rate was observed. Our data underline the importance of PTEN expression regarding the induction of apoptosis through various targeted therapies.

  20. Intercellular transfer of apoptotic signals via electrofusion

    SciTech Connect

    Park, Jin Suk; Lee, Wilson; McCulloch, Christopher A.

    2012-05-01

    We determined whether cells that are induced to undergo anoikis by matrix detachment can initiate apoptosis in healthy cells following electroporation-induced fusion. Separate populations of MDCK cells undergoing anoikis and stained with FITC-annexin or viable MDCK cells that were labeled with spectrally discrete fluorescent beads were electroporated. Cells were analyzed by flow cytometry for enumeration of viable cells with beads, apoptotic cells or fused cells. Electroporation promoted a 49-fold increase of the percentage of viable cells that had fused with apoptotic cells. Apoptotic cell-viable cell fusions were 8-fold more likely to not attach to cell culture plastic and 2.3-fold less likely to proliferate after 24 hr incubation than viable cell fusion controls. These data demonstrate that apoptotic signals can be transferred between cells by electrofusion, possibly suggesting a novel investigative approach for optimizing targeted cell deletion in cancer treatment.

  1. Escape of magnetic toroids from the Sun

    NASA Technical Reports Server (NTRS)

    Bieber, John W.; Rust, David M.

    1995-01-01

    Analysis of heliospheric magnetic fields at 1 AU shows that 10(exp 24) Mx of net azimuthal flux escapes from the Sun per solar cycle. This rate is consistent with rates derived from other indicators of flux escape, including coronal mass ejections and filament eruptions. The toroidal flux escape rate is compared with the apparent rate of flux emergence at the solar surface, and it is concluded that escaping toroids will remove at least 20% of the emerging flux, and may remove as much as 100% of emerging flux if multiple eruptions occur on the toroids. The data imply that flux escapes the Sun with an efficiency far exceeding Parker's upper limit estimate of 3%. Toroidal flux escape is almost certainly the source of the observed overwinding of the interplanetary magnetic field spiral. Two mechanisms to facilitate net flux escape are discussed: helicity charging to push open the fields and flux transport with reconnection to close them off. We estimate the Sun will shed approximately 2 x 10(exp 45) of magnetic helicity per solar cycle, leading to a mean helicity density of 100 Mx(exp 2)cm(exp -3) at 1 AU, which agrees well with observations.

  2. Light weight escape capsule for fighter aircraft

    NASA Technical Reports Server (NTRS)

    Robert, James A.

    1988-01-01

    Emergency crew escape capabilities have been less than adequate for fighter aircraft since before WW II. From the over-the-side bailout of those days through the current ejection seat with a rocket catapult, escaping from a disabled aircraft has been risky at best. Current efforts are underway toward developing a high-tech, smart ejection seat that will give fighter pilots more room to live in the sky, but an escape capsule is needed to meet current and future fighter envelopes. Escape capsules have a bad reputation due to past examples of high weight, poor performance and great complexity. However, the advantages available demand that a capsule be developed. This capsule concept will minimize the inherent disavantages and incorporate the benefits while integrating all aspects of crew station design. The resulting design is appropriate for a crew station of the year 2010 and includes improved combat acceleration protection, chemical or biological combat capability, improved aircraft to escape system interaction, and the highest level of escape performance achievable. The capsule is compact, which can allow a reduced aircraft size and weighs only 1200 lb. The escape system weight penalty is only 120 lb higher than that for the next ejection seat and the capsule has a corresponding increase in performance.

  3. Clusterin facilitates apoptotic cell clearance and prevents apoptotic cell-induced autoimmune responses

    PubMed Central

    Cunin, P; Beauvillain, C; Miot, C; Augusto, J-F; Preisser, L; Blanchard, S; Pignon, P; Scotet, M; Garo, E; Fremaux, I; Chevailler, A; Subra, J-F; Blanco, P; Wilson, M R; Jeannin, P; Delneste, Y

    2016-01-01

    Clusterin (Clu), an extracellular chaperone, exhibits characteristics of soluble innate immunity receptors, as assessed by its ability to bind some bacteria strains. In this study, we report that Clu also binds specifically to late apoptotic cells but not to live, early apoptotic, or necrotic cells. Histones, which accumulate on blebs during the apoptotic process, represent privileged Clu-binding motifs at the surface of late apoptotic cells. As a consequence, Clu potentiates, both in vitro and in vivo, the phagocytosis of late apoptotic cells by macrophages. Moreover, the increased phagocytosis of late apoptotic cells induced by Clu favors the presentation and cross-presentation of apoptotic cell-associated antigens. Finally, we observed that, in a model of apoptotic cell-induced autoimmunity, and relative to control mice, Clu−/− mice develop symptoms of autoimmunity, including the generation of anti-dsDNA antibodies, deposition of immunoglobulins and complement components within kidneys, and splenomegaly. These results identify Clu as a new molecule partner involved in apoptotic cell efferocytosis and suggest a protective role for Clu in inflammation and autoimmune diseases. PMID:27148688

  4. Interspecific evaluation of octopus escape behavior.

    PubMed

    Wood, James B; Anderson, Roland C

    2004-01-01

    The well-known ability of octopuses to escape enclosures is a behavior that can be fatal and, therefore, is an animal welfare issue. This study obtained survey data from 38 participants-primarily scientists and public aquarists who work with octopuses-on 25 described species of octopus. The study demonstrates that the likeliness to escape is species specific (p =.001). The study gives husbandry techniques to keep captive octopuses contained. This first interspecific study of octopus escape behavior allows readers to make informed species-specific husbandry choices.

  5. In situ apoptosis of adaptive immune cells and the cellular escape of rabies virus in CNS from patients with human rabies transmitted by Desmodus rotundus.

    PubMed

    Fernandes, Elaine Raniero; de Andrade, Heitor Franco; Lancellotti, Carmen Lúcia Penteado; Quaresma, Juarez Antônio Simões; Demachki, Samia; da Costa Vasconcelos, Pedro Fernando; Duarte, Maria Irma Seixas

    2011-03-01

    The aim of the current study was to investigate the apoptosis of neurons, astrocytes and immune cells from human patients that were infected with rabies virus by vampire bats bite. Apoptotic neurons were identified by their morphology and immune cells were identified using double immunostaining. There were very few apoptotic neurons present in infected tissue samples, but there was an increase of apoptotic infiltrating CD4+ and TCD8+ adaptive immune cells in the rabies infected tissue. No apoptosis was present in NK, macrophage and astrocytes. The dissemination of the human rabies virus within an infected host may be mediated by viral escape of the virus from an infected cell and may involve an anti-apoptotic mechanism, which does not kill the neuron or pro-apoptosis of TCD4+ and TCD8+ lymphocytes and which allows for increased proliferation of the virus within the CNS by attenuation of the adaptive immune response. PMID:21255623

  6. Biogeochemistry: Nocturnal escape route for marsh gas

    NASA Astrophysics Data System (ADS)

    Anthony, Katey Walter; MacIntyre, Sally

    2016-07-01

    A field study of methane emissions from wetlands reveals that more of the gas escapes through diffusive processes than was thought, mostly at night. Because methane is a greenhouse gas, the findings have implications for global warming.

  7. Development of X-15 escape system

    NASA Technical Reports Server (NTRS)

    Hegenwald, J F

    1958-01-01

    The content of this paper is concerned primarily with testing and determining the suitability of such factors as cockpit mobility, escape potential, mechanical reliability, post-separation performance, and airframe compatibility. Integrating the results of the various studies led to the conclusion that the pressure suit in combination with the open ejection seat would best satisfy the X-15 emergency-escape requirements by virtue of elimination of capsule-imposed penalties on aircraft performance and significant reduction in development time.

  8. Escape from an effortful situation1

    PubMed Central

    Miller, L. Keith

    1968-01-01

    This experiment investigated the tendency to escape from a situation requiring effortful responding. Five human subjects responded in a situation where the response mechanism required 20-lb force to operate; responses were reinforced according to a variable-interval schedule. A subject escaped from this situation by emitting a vocal response which produced a 60-sec “easy period”. During the easy period the reinforcement contingency was switched to a response mechanism requiring 1 lb to operate. It was found that: (1) Escape responding could be conditioned and maintained by producing the easy period; the easy period did not maintain escape responding when the force requirement in the normal situation was equated with it. (2) The rate of escape responding was a function of the magnitude of the force normally required. (3) When easy periods were scheduled after fixed ratios, pausing from the end of the previous easy period to the first escape response was noted. It was concluded that a situation requiring high-force responding is a negative reinforcer. The pattern of fixed-ratio responding suggests that this reinforcer produces typical schedule control in human subjects. PMID:5749186

  9. Polymer escape from a confining potential

    SciTech Connect

    Mökkönen, Harri; Ikonen, Timo; Jónsson, Hannes; Ala-Nissila, Tapio

    2014-02-07

    The rate of escape of polymers from a two-dimensionally confining potential well has been evaluated using self-avoiding as well as ideal chain representations of varying length, up to 80 beads. Long timescale Langevin trajectories were calculated using the path integral hyperdynamics method to evaluate the escape rate. A minimum is found in the rate for self-avoiding polymers of intermediate length while the escape rate decreases monotonically with polymer length for ideal polymers. The increase in the rate for long, self-avoiding polymers is ascribed to crowding in the potential well which reduces the free energy escape barrier. An effective potential curve obtained using the centroid as an independent variable was evaluated by thermodynamic averaging and Kramers rate theory then applied to estimate the escape rate. While the qualitative features are well reproduced by this approach, it significantly overestimates the rate, especially for the longer polymers. The reason for this is illustrated by constructing a two-dimensional effective energy surface using the radius of gyration as well as the centroid as controlled variables. This shows that the description of a transition state dividing surface using only the centroid fails to confine the system to the region corresponding to the free energy barrier and this problem becomes more pronounced the longer the polymer is. A proper definition of a transition state for polymer escape needs to take into account the shape as well as the location of the polymer.

  10. Polymer escape from a confining potential

    NASA Astrophysics Data System (ADS)

    Mökkönen, Harri; Ikonen, Timo; Jónsson, Hannes; Ala-Nissila, Tapio

    2014-02-01

    The rate of escape of polymers from a two-dimensionally confining potential well has been evaluated using self-avoiding as well as ideal chain representations of varying length, up to 80 beads. Long timescale Langevin trajectories were calculated using the path integral hyperdynamics method to evaluate the escape rate. A minimum is found in the rate for self-avoiding polymers of intermediate length while the escape rate decreases monotonically with polymer length for ideal polymers. The increase in the rate for long, self-avoiding polymers is ascribed to crowding in the potential well which reduces the free energy escape barrier. An effective potential curve obtained using the centroid as an independent variable was evaluated by thermodynamic averaging and Kramers rate theory then applied to estimate the escape rate. While the qualitative features are well reproduced by this approach, it significantly overestimates the rate, especially for the longer polymers. The reason for this is illustrated by constructing a two-dimensional effective energy surface using the radius of gyration as well as the centroid as controlled variables. This shows that the description of a transition state dividing surface using only the centroid fails to confine the system to the region corresponding to the free energy barrier and this problem becomes more pronounced the longer the polymer is. A proper definition of a transition state for polymer escape needs to take into account the shape as well as the location of the polymer.

  11. Changes in apoptotic mechanisms following penetrating ballistic-like brain injury.

    PubMed

    Cartagena, Casandra M; Schmid, Kara E; Phillips, Katie L; Tortella, Frank C; Dave, Jitendra R

    2013-02-01

    We investigated apoptotic pathways in a model of severe traumatic brain injury, penetrating ballistic-like brain injury (PBBI). TUNEL staining identified increasing apoptosis within 24 h. From targeted arrays, 11 genes were identified for temporal mRNA evaluation. In addition, mRNA levels and enzyme activity for caspases 3, 8, and 9 were examined. In the death receptor-mediated apoptosis pathway, the relative quantities (RQs) of mRNA for tnfr1, fas, and tnf were upregulated while trail mRNA was downregulated. In the anti-apoptotic TNF-R2 pathway, tnfr2 and flip were upregulated while xiap was downregulated. These findings indicate that increases in tnf levels following injury are not only pro-apoptotic but may also signal competing anti-apoptotic mechanisms. For the mitochondria-mediated apoptosis pathway, RQs of anti-apoptotic factors bcl2a1d and birc3 were upregulated while both bcl2 and bax were downregulated. RQs for casp 3 and casp 8 increased while casp9 decreased. Enzymatic activity increased for caspases 3, 8, and 9. While multiple mechanisms promoting and inhibiting apoptosis are at play during the first week after a PBBI, the cumulative result remains increased apoptosis. The ability to understand and dissect these events will assist in the development and evaluation of treatments targeting apoptosis following severe brain injury.

  12. 46 CFR 28.390 - Means of escape.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 1 2013-10-01 2013-10-01 false Means of escape. 28.390 Section 28.390 Shipping COAST... Operate With More Than 16 Individuals on Board § 28.390 Means of escape. (a) Each space which is used by... two widely separated means of escape. At least one of the means of escape must be independent...

  13. Hydrogen Escape from early Earth and Mars

    NASA Astrophysics Data System (ADS)

    Zugger, M. E.; Ramirez, R. M.; Kasting, J. F.

    2012-12-01

    A controversy regarding hydrodynamic escape rates arose when Tian et al. (2005) published transonic escape rates for an atmosphere composed of pure H2. Tian et al. concluded that the hydrogen escape rate from early Earth would have been a factor of 20 or more slower than the diffusion limit, even if the solar EUV (extreme ultraviolet) flux was enhanced by a factor of 5 relative to today. This conclusion was challenged by Catling (2006), who pointed out that solar EUV fluxes could have been much higher than this so that plenty of energy should have been available to power escape. This controversy has remained unresolved to date. Hydrogen escape from early Mars is also of interest. As discussed in this session in a complementary paper by Ramirez et al., collision-induced absorption by molecular hydrogen could have helped to warm early Mars, perhaps explaining the formation of valleys and valley networks. Ramirez et al. have shown that a mixture of 90% CO2 and 10% H2 is capable raising early Mars' surface temperature above the freezing point of water, for surface pressures exceeding ~3 bar. However, we need to understand whether H2 mixing ratios of 10% are physically plausible. The H2 partial pressure in Mars' early atmosphere would have been determined by the balance between volcanic outgassing and escape to space. The 10% mixing ratio is high compared to the value of ~10-3 typically assumed for early Earth. But Mars' early atmosphere may have been more reduced than Earth's (Wadwha, 2001); if the hydrogen escape rate on Mars was also slower than on Earth, then additional increases in atmospheric hydrogen concentration are possible. To answer these questions about the early atmospheres of Earth and Mars, we have modified an existing model of hydrodynamic escape, developed by F. Tian, J. Kasting, and others, to converge for atmospheres with a wide range of hydrogen mixing ratios. The model finds subsonic solutions to the hydrodynamic equations; these can be shown to

  14. MEMO: Mars Escape and Magnetic Orbiter

    NASA Astrophysics Data System (ADS)

    Chassefiere, E.; Langlais, B.; Leblanc, F.; Sotin, C.; Barabash, S.; Dehant, V.; Dougherty, M.; Lammer, H.; Mandea, M.; Vennerstrom, S.

    There are several reasons to believe that Mars could have become an Earth like planet rather than the present dry and cold planet. In particular, many elements suggest the presence of liquid water at the Martian surface during a relatively short period at an early stage of its history. Since liquid water may have been the birthplace for life on Earth, the fate of Martian water is one of the major key and yet unanswered question to be solved. Mars Escape and Magnetic Orbiter (MEMO) is a low periapsis orbiter of Mars devoted to the measurement of present escape and the characterization of the fossil magnetic field of Mars. The use of a low periapsis altitude orbit (120-150 km) is required to detect and quantify all populations of atoms and molecules involved in escape. It is also required to measure the magnetic field of Mars with an unprecedented spatial resolution that would allow getting a more precise timing of the dynamo and its disappearance. Achieving a full characterization of atmospheric escape, and extrapolating it back to the past requires: (i) to measure escape fluxes of neutral and ion species, and characterize the dynamics and chemistry of the regions of the atmosphere where escape occurs (thermosphere, ionosphere, exosphere), as well as their responses to solar activity, and (ii) to characterize the lateral variations of the magnetic field of lithospheric origin, and by extension, the timing of the Martian dynamo. Of particular interest is the extinction of the dynamo that is thought to have enhanced the atmospheric escape processes still operating today. The proposed low-periapsis orbiter will consist of the following elements: • An "Escape Package" to characterize by both in-situ and remote measurements the thermosphere, ionosphere, exosphere and solar wind interaction regions (from one hundred to several thousand km), including thermal, suprathermal 1 and energetic particles. • A "Magnetic Field Package", to characterize the magnetization of the

  15. Compensatory escape mechanism at low Reynolds number

    PubMed Central

    Gemmell, Brad J.; Sheng, Jian; Buskey, Edward J.

    2013-01-01

    Despite high predation pressure, planktonic copepods remain one of the most abundant groups on the planet. Their escape response provides one of most effective mechanisms to maximize evolutionary fitness. Owing to their small size (100 µm) compared with their predators (>1 mm), increasing viscosity is believed to have detrimental effects on copepods’ fitness at lower temperature. Using high-speed digital holography we acquire 3D kinematics of the nauplius escape including both location and detailed appendage motion. By independently varying temperature and viscosity we demonstrate that at natural thermal extremes, contrary to conventional views, nauplii achieve equivalent escape distance while maintaining optimal velocity. Using experimental results and kinematic simulations from a resistive force theory propulsion model, we demonstrate that a shift in appendage timing creates an increase in power stroke duration relative to recovery stroke duration. This change allows the nauplius to limit losses in velocity and maintain distance during escapes at the lower bound of its natural thermal range. The shift in power stroke duration relative to recovery stroke duration is found to be regulated by the temperature dependence of swimming appendage muscle groups, not a dynamic response to viscosity change. These results show that copepod nauplii have natural adaptive mechanisms to compensate for viscosity variations with temperature but not in situations in which viscosity varies independent of temperature, such as in some phytoplankton blooms. Understanding the robustness of escapes in the wake of environmental changes such as temperature and viscosity has implications in assessing the future health of performance compensation. PMID:23487740

  16. Conservation of Total Escape from Hydrodynamic Planetary Atmospheres

    NASA Astrophysics Data System (ADS)

    Tian, F.

    2013-12-01

    Atmosphere escape is one key process controlling the evolution of planets. However, estimating the escape rate in any detail is difficult because there are many physical processes contributing to the total escape rate. Here we show that as a result of energy conservation the total escape rate from hydrodynamic planetary atmospheres where the outflow remains subsonic is nearly constant under the same stellar XUV photon flux when increasing the escape efficiency from the exobase level, consistent with the energy limited escape approximation. Thus the estimate of atmospheric escape in a planet's evolution history can be greatly simplified.

  17. Gene therapy for carcinoma of the breast: Pro-apoptotic gene therapy

    PubMed Central

    Gómez-Navarro, Jesús; Arafat , Waleed; Xiang, Jialing

    2000-01-01

    Abstract The dysregulation of apoptosis contributes in a variety of ways to the malignant phenotype. It is increasingly recognized that the alteration of pro-apoptotic and anti-apoptotic molecules determines not only escape from mechanisms that control cell cycle and DNA damage, but also endows the cancer cells with the capacity to survive in the presence of a metabolically adverse milieu, to resist the attack of the immune system, to locally invade and survive despite a lack of tissue anchorage, and to evade the otherwise lethal insults induced by drugs and radiotherapy. A multitude of apoptosis mediators has been identified in the past decade, and the roles of several of them in breast cancer have been delineated by studying the clinical correlates of pathologically documented abnormalities. Using this information, attempts are being made to correct the fundamental anomalies at the genetic level. Fundamental to this end are the design of more efficient and selective gene transfer systems, and the employment of complex interventions that are tailored to breast cancer and that are aimed concomitantly towards different components of the redundant regulatory pathways. The combination of such genetic modifications is most likely to be effective when combined with conventional treatments, thus robustly activating several pro-apoptotic pathways. PMID:11250691

  18. Escape as reinforcement and escape extinction in the treatment of feeding problems.

    PubMed

    LaRue, Robert H; Stewart, Victoria; Piazza, Cathleen C; Volkert, Valerie M; Patel, Meeta R; Zeleny, Jason

    2011-01-01

    Given the effectiveness of putative escape extinction as treatment for feeding problems, it is surprising that little is known about the effects of escape as reinforcement for appropriate eating during treatment. In the current investigation, we examined the effectiveness of escape as reinforcement for mouth clean (a product measure of swallowing), escape as reinforcement for mouth clean plus escape extinction (EE), and EE alone as treatment for the food refusal of 5 children. Results were similar to those of previous studies, in that reinforcement alone did not result in increases in mouth clean or decreases in inappropriate behavior (e.g., Piazza, Patel, Gulotta, Sevin, & Layer, 2003). Increases in mouth clean and decreases in inappropriate behavior occurred when the therapist implemented EE independent of the presence or absence of reinforcement. Results are discussed in terms of the role of negative reinforcement in the etiology and treatment of feeding problems.

  19. Escape as reinforcement and escape extinction in the treatment of feeding problems.

    PubMed

    LaRue, Robert H; Stewart, Victoria; Piazza, Cathleen C; Volkert, Valerie M; Patel, Meeta R; Zeleny, Jason

    2011-01-01

    Given the effectiveness of putative escape extinction as treatment for feeding problems, it is surprising that little is known about the effects of escape as reinforcement for appropriate eating during treatment. In the current investigation, we examined the effectiveness of escape as reinforcement for mouth clean (a product measure of swallowing), escape as reinforcement for mouth clean plus escape extinction (EE), and EE alone as treatment for the food refusal of 5 children. Results were similar to those of previous studies, in that reinforcement alone did not result in increases in mouth clean or decreases in inappropriate behavior (e.g., Piazza, Patel, Gulotta, Sevin, & Layer, 2003). Increases in mouth clean and decreases in inappropriate behavior occurred when the therapist implemented EE independent of the presence or absence of reinforcement. Results are discussed in terms of the role of negative reinforcement in the etiology and treatment of feeding problems. PMID:22219525

  20. ESCAPE AS REINFORCEMENT AND ESCAPE EXTINCTION IN THE TREATMENT OF FEEDING PROBLEMS

    PubMed Central

    LaRue, Robert H; Stewart, Victoria; Piazza, Cathleen C; Volkert, Valerie M; Patel, Meeta R; Zeleny, Jason

    2011-01-01

    Given the effectiveness of putative escape extinction as treatment for feeding problems, it is surprising that little is known about the effects of escape as reinforcement for appropriate eating during treatment. In the current investigation, we examined the effectiveness of escape as reinforcement for mouth clean (a product measure of swallowing), escape as reinforcement for mouth clean plus escape extinction (EE), and EE alone as treatment for the food refusal of 5 children. Results were similar to those of previous studies, in that reinforcement alone did not result in increases in mouth clean or decreases in inappropriate behavior (e.g., Piazza, Patel, Gulotta, Sevin, & Layer, 2003). Increases in mouth clean and decreases in inappropriate behavior occurred when the therapist implemented EE independent of the presence or absence of reinforcement. Results are discussed in terms of the role of negative reinforcement in the etiology and treatment of feeding problems. PMID:22219525

  1. Pyrolaser development for aircrew escape systems

    NASA Astrophysics Data System (ADS)

    Paul, Ben E.; Cobbett, John A.

    A Laser Ordnance Initiation System (LOIS) has been developed for use in military aircraft emergency escape/egress systems. Applying LOIS to a single-seat and a two-seat F-16 aircraft escape system has proven both cost and weight effective. In both cases, system redundancy is supplied. The large weight reduction is attributed to the elimination of certain initiators, the small size of the logic components and the low weight of the fiber-optic lines (0.037 lb/ft). The required components for a laser operated escape systems are described, with emphasis on the mechanically actuated pyrolaser, which supplies the required energy to activate the various seat devices; the optical AND gate, which provides the logic to ensure proper event sequencing; and the optical mode selector, which establishes aircrew control of the ejection sequence in multiseat aircraft only.

  2. Pair production and escape in accretion disks.

    NASA Astrophysics Data System (ADS)

    Meirelles Filho, C.; Liang, E. P.

    It is shown that, in the absence of confining mechanisms, there will be a non-negligible amount of pairs escaping from the inner region of a Comptonized soft photon two-temperature accretion disk, when pair production is not balanced by annihilation. Assuming conditions such that the photons and particles in the disk can be regarded as close to a Wien plasma (Svensson, 1984), the authors calculate the rate of pair escape from the disk for both a situation close to pair balance and a situation with the rate of escape exceeding annihilation. The pairs are assumed to be created by photon-photon processes. Within this model one can account for the 511 keV γ-ray luminosity due to pair annihilation in the ISM, as recently observed in the Einstein source.

  3. Martian magnetic anomalies and ionosphere escape rate.

    NASA Astrophysics Data System (ADS)

    Fedorov, A.; Barabash, S.; Sauvaud, J.-A.

    2012-04-01

    Looking forward to the MAVEN mission, it seems very useful to return to Mars Express data to refresh an important problem of Martian atmosphere escape: what role the crustal magnetic field may play in this process? There are several publications on this topic with completely opposite conclusions. The last hybrid simulations show that the magnetic anomalies significantly reduce the ion loss rate during solar minimum. We are trying to use a new approach to Mars Express IMA data analysis to check how it is possible.On the base of a statistical study of the ion distributions in the Martian magnetotail we show that the characteristic accelerated ions are not associated with the magnetic anomalies but only with interplanetary magnetic field clock angle. Moreover the magnetic anomalies screen and deviate the escaping flow leading to reducing of the total loss rate. Finally the observed heavy ions escaping rate is in a fantastic agreement with simulation results.

  4. Escape statistics for parameter sweeps through bifurcations.

    PubMed

    Miller, Nicholas J; Shaw, Steven W

    2012-04-01

    We consider the dynamics of systems undergoing parameter sweeps through bifurcation points in the presence of noise. Of interest here are local codimension-one bifurcations that result in large excursions away from an operating point that is transitioning from stable to unstable during the sweep, since information about these "escape events" can be used for system identification, sensing, and other applications. The analysis is based on stochastic normal forms for the dynamic saddle-node and subcritical pitchfork bifurcations with a time-varying bifurcation parameter and additive noise. The results include formulation and numerical solution for the distribution of escape events in the general case and analytical approximations for delayed bifurcations for which escape occurs well beyond the corresponding quasistatic bifurcation points. These bifurcations result in amplitude jumps encountered during parameter sweeps and are particularly relevant to nano- and microelectromechanical systems, for which noise can play a significant role.

  5. Thermal escape from extrasolar giant planets

    PubMed Central

    Koskinen, Tommi T.; Lavvas, Panayotis; Harris, Matthew J.; Yelle, Roger V.

    2014-01-01

    The detection of hot atomic hydrogen and heavy atoms and ions at high altitudes around close-in extrasolar giant planets (EGPs) such as HD209458b implies that these planets have hot and rapidly escaping atmospheres that extend to several planetary radii. These characteristics, however, cannot be generalized to all close-in EGPs. The thermal escape mechanism and mass loss rate from EGPs depend on a complex interplay between photochemistry and radiative transfer driven by the stellar UV radiation. In this study, we explore how these processes change under different levels of irradiation on giant planets with different characteristics. We confirm that there are two distinct regimes of thermal escape from EGPs, and that the transition between these regimes is relatively sharp. Our results have implications for thermal mass loss rates from different EGPs that we discuss in the context of currently known planets and the detectability of their upper atmospheres. PMID:24664923

  6. Thermal escape from extrasolar giant planets.

    PubMed

    Koskinen, Tommi T; Lavvas, Panayotis; Harris, Matthew J; Yelle, Roger V

    2014-04-28

    The detection of hot atomic hydrogen and heavy atoms and ions at high altitudes around close-in extrasolar giant planets (EGPs) such as HD209458b implies that these planets have hot and rapidly escaping atmospheres that extend to several planetary radii. These characteristics, however, cannot be generalized to all close-in EGPs. The thermal escape mechanism and mass loss rate from EGPs depend on a complex interplay between photochemistry and radiative transfer driven by the stellar UV radiation. In this study, we explore how these processes change under different levels of irradiation on giant planets with different characteristics. We confirm that there are two distinct regimes of thermal escape from EGPs, and that the transition between these regimes is relatively sharp. Our results have implications for thermal mass loss rates from different EGPs that we discuss in the context of currently known planets and the detectability of their upper atmospheres. PMID:24664923

  7. Thermal escape from extrasolar giant planets.

    PubMed

    Koskinen, Tommi T; Lavvas, Panayotis; Harris, Matthew J; Yelle, Roger V

    2014-04-28

    The detection of hot atomic hydrogen and heavy atoms and ions at high altitudes around close-in extrasolar giant planets (EGPs) such as HD209458b implies that these planets have hot and rapidly escaping atmospheres that extend to several planetary radii. These characteristics, however, cannot be generalized to all close-in EGPs. The thermal escape mechanism and mass loss rate from EGPs depend on a complex interplay between photochemistry and radiative transfer driven by the stellar UV radiation. In this study, we explore how these processes change under different levels of irradiation on giant planets with different characteristics. We confirm that there are two distinct regimes of thermal escape from EGPs, and that the transition between these regimes is relatively sharp. Our results have implications for thermal mass loss rates from different EGPs that we discuss in the context of currently known planets and the detectability of their upper atmospheres.

  8. Apoptotic activity in Libyan breast cancer

    PubMed Central

    2012-01-01

    Background We evaluated the relationship of the apoptotic activity index (AI) and the standardized mitotic-apoptotic ratio (SMI/AI) with clinicopathological features and prognosis in Libyan female breast cancer (BC) patients. We then compared our results with corresponding results in Finnish and Nigerian female BC patients. Methods Histological samples of breast carcinoma from 130 patients were retrospectively studied: an estimation of the apoptotic activity per square millimeter (expressed as apoptotic activity index (AI)), and standardized mitotic-apoptotic ratio (SMI/AI) was made, and the results compared with the clinicopathological features and the patient’s survival. Results There was a statistically significant correlation between the AI and most of the clinicopathological features; the strongest association was observed for clinical stage lymph node (LN) status (P = 0.005). There were also correlations between AI and histological grade (P = 0.035), large tumor size (P = 0.011) and the clinical stage (P = 0.009). There were, however, prominent AI differences between Libyan, Nigerian and Finnish populations. The mean values of AI and SMI/AI in Libyan BC patients were 12.8 apoptotic figures per square millimeter and 2.8, respectively. The Libyan AI is slightly higher than in Nigeria, but much higher than in Finland. The differences between countries are seen throughout the samples as well as being present in certain subgroups. The survival analysis indicated that short survival time was associated with high apoptotic indices values and so can identify aggressive tumors and provide significant prognostic support. The cutoff (4 and 18 apoptosis/mm2) of AI might be applied as a quantitative criterion for Libyan BC to separate the patients into good, moderate and bad prognosis groups. Conclusions The results indicated that the differences in AI among the three countries may be due to the known variation in the distribution of genetic markers in

  9. Statistical theory of asteroid escape rates.

    PubMed

    Jaffé, Charles; Ross, Shane D; Lo, Martin W; Marsden, Jerrold; Farrelly, David; Uzer, T

    2002-07-01

    Transition states in phase space are identified and shown to regulate the rate of escape of asteroids temporarily captured in circumplanetary orbits. The transition states, similar to those occurring in chemical reaction dynamics, are then used to develop a statistical semianalytical theory for the rate of escape of asteroids temporarily captured by Mars. Theory and numerical simulations are found to agree to better than 1%. These calculations suggest that further development of transition state theory in celestial mechanics, as an alternative to large-scale numerical simulations, will be a fruitful approach to mass transport calculations. PMID:12097024

  10. Statistical theory of asteroid escape rates.

    PubMed

    Jaffé, Charles; Ross, Shane D; Lo, Martin W; Marsden, Jerrold; Farrelly, David; Uzer, T

    2002-07-01

    Transition states in phase space are identified and shown to regulate the rate of escape of asteroids temporarily captured in circumplanetary orbits. The transition states, similar to those occurring in chemical reaction dynamics, are then used to develop a statistical semianalytical theory for the rate of escape of asteroids temporarily captured by Mars. Theory and numerical simulations are found to agree to better than 1%. These calculations suggest that further development of transition state theory in celestial mechanics, as an alternative to large-scale numerical simulations, will be a fruitful approach to mass transport calculations.

  11. Martian Atmospheric and Ionospheric plasma Escape

    NASA Astrophysics Data System (ADS)

    Lundin, Rickard

    2016-04-01

    Solar forcing is responsible for the heating, ionization, photochemistry, and erosion processes in the upper atmosphere throughout the lifetime of the terrestrial planets. Of the four terrestrial planets, the Earth is the only one with a fully developed biosphere, while our kin Venus and Mars have evolved into arid inhabitable planets. As for Mars, there are ample evidences for an early Noachian, water rich period on Mars. The question is, what made Mars evolve so differently compared to the Earth? Various hydrosphere and atmospheric evolution scenarios for Mars have been forwarded based on surface morphology, chemical composition, simulations, semi-empiric (in-situ data) models, and the long-term evolution of the Sun. Progress has been made, but the case is still open regarding the changes that led to the present arid surface and tenuous atmosphere at Mars. This presentation addresses the long-term variability of the Sun, the solar forcing impact on the Martian atmosphere, and its interaction with the space environment - an electromagnetic wave and particle interaction with the upper atmosphere that has implications for its photochemistry, composition, and energization that governs thermal and non-thermal escape. Non-thermal escape implies an electromagnetic upward energization of planetary ions and molecules to velocities above escape velocity, a process governed by a combination of solar EUV radiation (ionization), and energy and momentum transfer by the solar wind. The ion escape issue dates back to the early Soviet and US-missions to Mars, but the first more accurate estimates of escape rates came with the Phobos-2 mission in 1989. Better-quality ion composition measurement results of atmospheric/ionospheric ion escape from Mars, obtained from ESA Mars Express (MEX) instruments, have improved our understanding of the ion escape mechanism. With the NASA MAVEN spacecraft orbiting Mars since Sept. 2014, dual in-situ measurement with plasma instruments are now

  12. Stabilization of apoptotic cells: generation of zombie cells

    PubMed Central

    Oropesa-Ávila, M; Andrade-Talavera, Y; Garrido-Maraver, J; Cordero, M D; de la Mata, M; Cotán, D; Paz, M V; Pavón, A D; Alcocer-Gómez, E; de Lavera, I; Lema, R; Zaderenko, A P; Rodríguez-Moreno, A; Sánchez-Alcázar, J A

    2014-01-01

    Apoptosis is characterized by degradation of cell components but plasma membrane remains intact. Apoptotic microtubule network (AMN) is organized during apoptosis forming a cortical structure beneath plasma membrane that maintains plasma membrane integrity. Apoptotic cells are also characterized by high reactive oxygen species (ROS) production that can be potentially harmful for the cell. The aim of this study was to develop a method that allows stabilizing apoptotic cells for diagnostic and therapeutic applications. By using a cocktail composed of taxol (a microtubule stabilizer), Zn2+ (a caspase inhibitor) and coenzyme Q10 (a lipid antioxidant), we were able to stabilize H460 apoptotic cells in cell cultures for at least 72 h, preventing secondary necrosis. Stabilized apoptotic cells maintain many apoptotic cell characteristics such as the presence of apoptotic microtubules, plasma membrane integrity, low intracellular calcium levels and mitochondrial polarization. Apoptotic cell stabilization may open new avenues in apoptosis detection and therapy. PMID:25118929

  13. Stabilization of apoptotic cells: generation of zombie cells.

    PubMed

    Oropesa-Ávila, M; Andrade-Talavera, Y; Garrido-Maraver, J; Cordero, M D; de la Mata, M; Cotán, D; Paz, M V; Pavón, A D; Alcocer-Gómez, E; de Lavera, I; Lema, R; Zaderenko, A P; Rodríguez-Moreno, A; Sánchez-Alcázar, J A

    2014-01-01

    Apoptosis is characterized by degradation of cell components but plasma membrane remains intact. Apoptotic microtubule network (AMN) is organized during apoptosis forming a cortical structure beneath plasma membrane that maintains plasma membrane integrity. Apoptotic cells are also characterized by high reactive oxygen species (ROS) production that can be potentially harmful for the cell. The aim of this study was to develop a method that allows stabilizing apoptotic cells for diagnostic and therapeutic applications. By using a cocktail composed of taxol (a microtubule stabilizer), Zn(2+) (a caspase inhibitor) and coenzyme Q10 (a lipid antioxidant), we were able to stabilize H460 apoptotic cells in cell cultures for at least 72 h, preventing secondary necrosis. Stabilized apoptotic cells maintain many apoptotic cell characteristics such as the presence of apoptotic microtubules, plasma membrane integrity, low intracellular calcium levels and mitochondrial polarization. Apoptotic cell stabilization may open new avenues in apoptosis detection and therapy. PMID:25118929

  14. Escape from Albuquerque: An Apache Memorate.

    ERIC Educational Resources Information Center

    Greenfeld, Philip J.

    2001-01-01

    Clarence Hawkins, a White Mountain Apache, escaped from the Albuquerque Indian School around 1920. His 300-mile trip home, made with two other boys, exemplifies the reaction of many Indian youths to the American government's plans for cultural assimilation. The tale is told in the form of traditional Apache narrative. (TD)

  15. Developing the E-Scape Software System

    ERIC Educational Resources Information Center

    Derrick, Karim

    2012-01-01

    Most innovations have contextual pre-cursors that prompt new ways of thinking and in their turn help to give form to the new reality. This was the case with the e-scape software development process. The origins of the system existed in software components and ideas that we had developed through previous projects, but the ultimate direction we took…

  16. Animal escapology II: escape trajectory case studies

    PubMed Central

    Domenici, Paolo; Blagburn, Jonathan M.; Bacon, Jonathan P.

    2011-01-01

    Summary Escape trajectories (ETs; measured as the angle relative to the direction of the threat) have been studied in many taxa using a variety of methodologies and definitions. Here, we provide a review of methodological issues followed by a survey of ET studies across animal taxa, including insects, crustaceans, molluscs, lizards, fish, amphibians, birds and mammals. Variability in ETs is examined in terms of ecological significance and morpho-physiological constraints. The survey shows that certain escape strategies (single ETs and highly variable ETs within a limited angular sector) are found in most taxa reviewed here, suggesting that at least some of these ET distributions are the result of convergent evolution. High variability in ETs is found to be associated with multiple preferred trajectories in species from all taxa, and is suggested to provide unpredictability in the escape response. Random ETs are relatively rare and may be related to constraints in the manoeuvrability of the prey. Similarly, reports of the effect of refuges in the immediate environment are relatively uncommon, and mainly confined to lizards and mammals. This may be related to the fact that work on ETs carried out in laboratory settings has rarely provided shelters. Although there are a relatively large number of examples in the literature that suggest trends in the distribution of ETs, our understanding of animal escape strategies would benefit from a standardization of the analytical approach in the study of ETs, using circular statistics and related tests, in addition to the generation of large data sets. PMID:21753040

  17. Centrifugally Stimulated Exospheric Ion Escape at Mercury

    NASA Technical Reports Server (NTRS)

    Delcourt, Dominique; Seki, K.; Terada, N.; Moore, Thomas E.

    2012-01-01

    We investigate the transport of ions in the low-altitude magnetosphere magnetosphere of Mercury. We show that, because of small spatial scales, the centrifugal effect due to curvature of the E B drift paths can lead to significant particle energization in the parallel direction. We demonstrate that because of this effect, ions with initial speed smaller than the escape speed such as those produced via thermal desorption can overcome gravity and escape into the magnetosphere. The escape route of this low-energy exosphere originating material is largely controlled by the magnetospheric convection rate. This escape route spreads over a narrower range of altitudes when the convection rate increases. Bulk transport of low-energy planetary material thus occurs within a limited region of space once moderate magnetospheric convection is established. These results suggest that, via release of material otherwise gravitationally trapped, the E B related centrifugal acceleration is an important mechanism for the net supply of plasma to the magnetosphere of Mercury.

  18. Nociception and escape behavior in planarians

    NASA Astrophysics Data System (ADS)

    Schoetz Collins, Eva-Maria

    2015-03-01

    Planarians are famous and widely studied for their regenerative capabilities. When a moving planarian is cut through the middle, the resulting head and tail pieces instantaneously retract and exhibit a characteristic escape response that differs from normal locomotion. In asexual animals, a similar reaction is observed when the planarian undergoes fission, suggesting that reproduction through self-tearing is a rather traumatic event for the animal. Using a multiscale approach, we unravel the dynamics, mechanics, and functional aspects of the planarian escape response. This musculature-driven gait was found to be a dominating response that supersedes the urge to feed or reproduce and quantitatively differs from other modes of planarian locomotion (gliding, peristalsis). We show that this escape gait constitutes the animal's pain response mediated by TRP like receptors and the neurotransmitter histamine, and that it can be induced through adverse thermal, mechanical, electrical or chemical stimuli. Ultimately, we will examine the neuronal subpopulations involved in mediating escape reflexes in planarians and how they are functionally restored during regeneration, thereby gaining mechanistic insight into the neuronal circuits required for specific behaviors. Supported by BWF CASI and Sloan Foundation.

  19. Phagocytosis of apoptotic cells in homeostasis.

    PubMed

    Arandjelovic, Sanja; Ravichandran, Kodi S

    2015-09-01

    Human bodies collectively turn over about 200 billion to 300 billion cells every day. Such turnover is an integral part of embryonic and postnatal development, as well as routine tissue homeostasis. This process involves the induction of programmed cell death in specific cells within the tissues and the specific recognition and removal of dying cells by a clearance 'crew' composed of professional, non-professional and specialized phagocytes. In the past few years, considerable progress has been made in identifying many features of apoptotic cell clearance. Some of these new observations challenge the way dying cells themselves are viewed, as well as how healthy cells interact with and respond to dying cells. Here we focus on the homeostatic removal of apoptotic cells in tissues.

  20. Cancer therapeutics: Targeting the apoptotic pathway.

    PubMed

    Khan, Khurum H; Blanco-Codesido, Montserrat; Molife, L Rhoda

    2014-06-01

    Apoptosis, a physiological process of programmed cell death, is disrupted in various malignancies. It has been exploited as an anti-cancer strategy traditionally by inducing DNA damage with chemotherapy and radiotherapy. With an increased understanding of the intrinsic and extrinsic pathways of apoptosis in recent years, novel approaches of targeting the apoptotic pathways have been tested in pre-clinical and clinical models. There are several early phase clinical trials investigating the therapeutic role of pro-apoptotic agents, both as single agents and in combination. In this review, we examine such treatment strategies, detailing the various compounds currently under clinical investigation, their potential roles in cancer therapeutics, and discussing approaches to their optimal use in the clinic.

  1. Plasticity of Escape Responses: Prior Predator Experience Enhances Escape Performance in a Coral Reef Fish

    PubMed Central

    Ramasamy, Ryan A.; Allan, Bridie J. M.; McCormick, Mark I.

    2015-01-01

    Teleost and amphibian prey undertake fast-start escape responses during a predatory attack in an attempt to avoid being captured. Although previously viewed as a reflex reaction controlled by the autonomic nervous system, the escape responses of individuals when repeatedly startled are highly variable in their characteristics, suggesting some behavioural mediation of the response. Previous studies have shown that fishes are able to learn from past experiences, but few studies have assessed how past experience with predators affect the fast-start response. Here we determined whether prior experience with the smell or sight of a predator (the Dottyback, Pseudochromis fuscus) affected the escape response of juveniles of the Spiny Chromis (Acanthochromis polyacanthus). Results show that individuals exposed to any of the predator cues prior to being startled exhibited a stronger escape response (i.e., reduced latency, increased escape distance, mean response speed, maximum response speed and maximum acceleration) when compared with controls. This study demonstrates the plasticity of escape responses and highlights the potential for naïve reef fish to take into account both visual and olfactory threat cues simultaneously to optimise the amplitude of their kinematic responses to perceived risk. PMID:26244861

  2. Launch Pad Escape System Design (Human Spaceflight)

    NASA Technical Reports Server (NTRS)

    Maloney, Kelli

    2011-01-01

    A launch pad escape system for human spaceflight is one of those things that everyone hopes they will never need but is critical for every manned space program. Since men were first put into space in the early 1960s, the need for such an Emergency Escape System (EES) has become apparent. The National Aeronautics and Space Administration (NASA) has made use of various types of these EESs over the past 50 years. Early programs, like Mercury and Gemini, did not have an official launch pad escape system. Rather, they relied on a Launch Escape System (LES) of a separate solid rocket motor attached to the manned capsule that could pull the astronauts to safety in the event of an emergency. This could only occur after hatch closure at the launch pad or during the first stage of flight. A version of a LES, now called a Launch Abort System (LAS) is still used today for all manned capsule type launch vehicles. However, this system is very limited in that it can only be used after hatch closure and it is for flight crew only. In addition, the forces necessary for the LES/LAS to get the capsule away from a rocket during the first stage of flight are quite high and can cause injury to the crew. These shortcomings led to the development of a ground based EES for the flight crew and ground support personnel as well. This way, a much less dangerous mode of egress is available for any flight or ground personnel up to a few seconds before launch. The early EESs were fairly simple, gravity-powered systems to use when thing's go bad. And things can go bad very quickly and catastrophically when dealing with a flight vehicle fueled with millions of pounds of hazardous propellant. With this in mind, early EES designers saw such a passive/unpowered system as a must for last minute escapes. This and other design requirements had to be derived for an EES, and this section will take a look at the safety design requirements had to be derived for an EES, and this section will take a look at

  3. 33 CFR 143.101 - Means of escape.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... Officer in Charge, Marine Inspection, one or more “secondary means of escape.” (d) Unmanned OCS facilities... board, unmanned facilities shall also be provided with one or more “secondary means of escape,” but...

  4. 33 CFR 143.101 - Means of escape.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... Officer in Charge, Marine Inspection, one or more “secondary means of escape.” (d) Unmanned OCS facilities... board, unmanned facilities shall also be provided with one or more “secondary means of escape,” but...

  5. 33 CFR 143.101 - Means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... Officer in Charge, Marine Inspection, one or more “secondary means of escape.” (d) Unmanned OCS facilities... board, unmanned facilities shall also be provided with one or more “secondary means of escape,” but...

  6. 23. VIEW OF ESCAPE TRAINING TANK, LOOKING NORTHWEST, SHOWING TWOLOCK ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    23. VIEW OF ESCAPE TRAINING TANK, LOOKING NORTHWEST, SHOWING TWO-LOCK RECOMPRESSION CHAMBER IN PASSAGEWAY FROM ELEVATOR TO CUPOLA - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  7. 17. VIEW OF ESCAPE TRAINING TANK, SHOWING ENCLOSED PASSAGEWAY FROM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    17. VIEW OF ESCAPE TRAINING TANK, SHOWING ENCLOSED PASSAGEWAY FROM ELEVATOR TO 18-FOOT LOCK, LOOKING EAST - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  8. 21. VIEW OF ESCAPE TRAINING TANK, SHOWING INTERIOR OF CUPOLA ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    21. VIEW OF ESCAPE TRAINING TANK, SHOWING INTERIOR OF CUPOLA AND TOP OF THE TANK, LOOKING NORTHEAST - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  9. 15. VIEW OF ESCAPE TRAINING TANK, LOOKING EAST ACROSS MEZZANINE, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    15. VIEW OF ESCAPE TRAINING TANK, LOOKING EAST ACROSS MEZZANINE, SHOWING ENTRANCE TO SUBMARINE SECTION AT 110-FOOT LEVEL - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  10. 34. VIEW OF SUBMARINE ESCAPE TRAINING TANK PRIOR TO ADDITION ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    34. VIEW OF SUBMARINE ESCAPE TRAINING TANK PRIOR TO ADDITION OF BLISTERS IN 1959, LOOKING SOUTHEAST - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  11. 18. VIEW OF ESCAPE TRAINING TANK, SHOWING ENCLOSED PASSAGEWAY FROM ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    18. VIEW OF ESCAPE TRAINING TANK, SHOWING ENCLOSED PASSAGEWAY FROM 50-FOOT LOCK TO ELEVATOR, LOOKING WEST - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  12. 14. DETAIL VIEW OF ESCAPE TRAINING TANK, SHOWING HOLDDOWN RODS, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. DETAIL VIEW OF ESCAPE TRAINING TANK, SHOWING HOLD-DOWN RODS, LOOKING SOUTH - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  13. 46 CFR 169.313 - Means of escape.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... onboard. At least one means of escape must be independent of watertight doors and lead directly to the... escape is acceptable provided that— (1) There is no source of fire in the space, such as a galley...

  14. 46 CFR 169.313 - Means of escape.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... onboard. At least one means of escape must be independent of watertight doors and lead directly to the... escape is acceptable provided that— (1) There is no source of fire in the space, such as a galley...

  15. Observations of Ionospheric Escape on Venus' Nightside

    NASA Technical Reports Server (NTRS)

    Mihalov, J. D.; Russell, C. T.; Kasprzak, W. T.; Knudsen, W. C.

    1995-01-01

    A population of low-energy (0-250 V E/q) ions with tailward directed velocity vectors and energies above that for escape from Venus is evident in nightside data from the Ames plasma analyzer on the Pioneer Venus Orbiter spacecraft. Good correlations with solar wind parameters were not obtained for the magnitudes of these ion fluxes, but tendencies for occurrence at times of tailward oriented magnetic fields and for alignment of the ion flows with the magnetic field were found. These tendencies seemed to be enhanced for higher-energy ions. In a few cases where comparisons were made, the ion fluxes were consistent with simultaneous O(+) measurements by the neutral mass spectrometer experiment on the spacecraft. The mean flux observed of the escaping nightside ions, averaged over an approximately 10-week-long spacecraft nightside season, was less than 2 x 10(exp 6) cm(exp -2) s(exp -1).

  16. Observations of Ionospheric Escape on Venus' Nightside

    NASA Technical Reports Server (NTRS)

    Mihalov, J. D.; Russell, C. T.; Kasprzak, W. T.; Knudsen, W. C.

    1995-01-01

    A population of low-energy (0-250 V E/q) ions with tailward directed velocity vectors and energies above that for escape from Venus is evident in nightside data from the Ames plasma analyzer on the Pioneer Venus Orbiter spacecraft. Good correlations with solar wind parameters were not obtained for the magnitudes of these ion fluxes, but tendencies for occurrence at times of tailward oriented magnetic fields and for alignment of the ion flows with the magnetic field were found. These tendencies seemed to be enhanced for higher-energy ions. In a few cases where comparisons were made, the ion fluxes were consistent with simultaneous O(+) measurements by the neutral mass spectrometer experiment on the spacecraft. The mean flux observed of the escaping nightside ions, averaged over an approximately 10-week-long spacecraft nightside season, was less than 2 x 10(exp 6)/sq cm/s.

  17. Escape of atmospheres and loss of water

    NASA Technical Reports Server (NTRS)

    Hunten, D. M.; Donahue, T. M.; Walker, J. C. G.; Kasting, J. F.

    1989-01-01

    The properties and limitations of several loss processes for atmospheric gases are presented and discussed. They include thermal loss (Jeans and hydrodynamic); nonthermal loss (all processes involve charged particles); and impact erosion, including thermal escape from a molten body heated by rapid accretion. Hydrodynamic escape, or 'blowoff', is of particular interest because it offers the prospect of processing large quantities of gas and enriching the remainder in heavy elements and isotopes. In a second part, the water budgets and likely evolutionary histories of Venus, Earth and Mars are assessed. Although it is tempting to associate the great D/H enrichment on Venus with loss of a large initial endowment, a steady state with juvenile water (perhaps from comets) is equally probable.

  18. Lithium clearance in mineralocorticoid escape in humans

    SciTech Connect

    Boer, W.H.; Koomans, H.A.; Mees, E.J.D.

    1987-03-01

    Lithium clearance (C/sub Li/) has been advanced as an indicator of Na delivery from the proximal tubules. The authors studied C/sub Li/ in eight healthy males before and after mineralocorticoid escape, a maneuver that may induce suppression of fractional proximal Na reabsorption (FPR/sub Na/). FPR/sub Na/ was also estimated from changes in maximal free water clearance (C/sub H/sub 2/O/). Plasma volume was measured as the /sup 131/I-labeled albumin distribution space. Extracellular fluid volume was estimated as the /sup 82/Br vector distribution volume. According to the latter method, FPR/sub Na/ dropped whereas inulin clearance rose. The changes in C/sub Li/ were surprisingly large. If lithium is a valid marker of Na handling in the proximal tubule in humans, this change would imply a fall in FPR/sub Na/, suggesting a much larger shift in tubular Na reabsorption in escape than hitherto suspected. In addition, it would suggest that the inevitable back diffusion of a part of the solute-free water in the distal nephron, and thus overestimation of FPR/sub Na/ by the C/sub H/sub 2/O/ method, increases importantly during escape. Alternately, lithium may not be a good marker of proximal tubular Na handling. For instance, both lithium reabsorption and escape may take place beyond the proximal tubule, or lithium may be excreted in the distal nephron in certain conditions. Present methods do not permit further analysis of these options in the human model.

  19. Scrunching: a novel escape gait in planarians

    NASA Astrophysics Data System (ADS)

    Cochet-Escartin, Olivier; Mickolajczyk, Keith J.; Collins, Eva-Maria S.

    2015-10-01

    The ability to escape a predator or other life-threatening situations is central to animal survival. Different species have evolved unique strategies under anatomical and environmental constraints. In this study, we describe a novel musculature-driven escape gait in planarians, ‘scrunching’, which is quantitatively different from other planarian gaits, such as gliding and peristalsis. We show that scrunching is a conserved gait among different flatworm species, underlying its importance as an escape mechanism. We further demonstrate that it can be induced by a variety of physical stimuli, including amputation, high temperature, electric shock and low pH. We discuss the functional basis for scrunching as the preferential gait when gliding is impaired due to a disruption of mucus production. Finally, we show that the key mechanical features of scrunching are adequately captured by a simple biomechanical model that is solely based on experimental data from traction force microscopy and tissue rheology without fit parameters. Together, our results form a complete description of this novel form of planarian locomotion. Because scrunching has distinct dynamics, this gait can serve as a robust behavioral readout for studies of motor neuron and muscular functions in planarians and in particular the restoration of these functions during regeneration.

  20. Scrunching: a novel escape gait in planarians.

    PubMed

    Cochet-Escartin, Olivier; Mickolajczyk, Keith J; Collins, Eva-Maria S

    2015-09-10

    The ability to escape a predator or other life-threatening situations is central to animal survival. Different species have evolved unique strategies under anatomical and environmental constraints. In this study, we describe a novel musculature-driven escape gait in planarians, 'scrunching', which is quantitatively different from other planarian gaits, such as gliding and peristalsis. We show that scrunching is a conserved gait among different flatworm species, underlying its importance as an escape mechanism. We further demonstrate that it can be induced by a variety of physical stimuli, including amputation, high temperature, electric shock and low pH. We discuss the functional basis for scrunching as the preferential gait when gliding is impaired due to a disruption of mucus production. Finally, we show that the key mechanical features of scrunching are adequately captured by a simple biomechanical model that is solely based on experimental data from traction force microscopy and tissue rheology without fit parameters. Together, our results form a complete description of this novel form of planarian locomotion. Because scrunching has distinct dynamics, this gait can serve as a robust behavioral readout for studies of motor neuron and muscular functions in planarians and in particular the restoration of these functions during regeneration.

  1. Scrunching: a novel escape gait in planarians.

    PubMed

    Cochet-Escartin, Olivier; Mickolajczyk, Keith J; Collins, Eva-Maria S

    2015-10-01

    The ability to escape a predator or other life-threatening situations is central to animal survival. Different species have evolved unique strategies under anatomical and environmental constraints. In this study, we describe a novel musculature-driven escape gait in planarians, 'scrunching', which is quantitatively different from other planarian gaits, such as gliding and peristalsis. We show that scrunching is a conserved gait among different flatworm species, underlying its importance as an escape mechanism. We further demonstrate that it can be induced by a variety of physical stimuli, including amputation, high temperature, electric shock and low pH. We discuss the functional basis for scrunching as the preferential gait when gliding is impaired due to a disruption of mucus production. Finally, we show that the key mechanical features of scrunching are adequately captured by a simple biomechanical model that is solely based on experimental data from traction force microscopy and tissue rheology without fit parameters. Together, our results form a complete description of this novel form of planarian locomotion. Because scrunching has distinct dynamics, this gait can serve as a robust behavioral readout for studies of motor neuron and muscular functions in planarians and in particular the restoration of these functions during regeneration. PMID:26356147

  2. Xenon Fractionation and Archean Hydrogen Escape

    NASA Technical Reports Server (NTRS)

    Zahnle, K. J.

    2015-01-01

    Xenon is the heaviest gas found in significant quantities in natural planetary atmospheres. It would seem the least likely to escape. Yet there is more evidence for xenon escape from Earth than for any element other than helium and perhaps neon. The most straightforward evidence is that most of the radiogenic Xe from the decay of (129)I (half-life 15.7 Myr) and (244)Pu (half-life 81 Myr) that is Earth's birthright is missing. The missing xenon is often attributed to the impact erosion of early atmospheres of Earth and its ancestors. It is obvious that if most of the radiogenic xenon were driven off by impacts, most of the rest of the atmophiles fared the same fate. The other line of evidence is in the nonradiogenic isotopes of xenon and its silent partner, krypton. Atmospheric xenon is strongly mass fractionated (at about 4% per amu) compared to any known solar system source (Figure 1). This is in stark contrast to krypton, which may not be fractionated at all: atmospheric Kr is slightly heavier than solar Kr (at about 0.5% per amu), but it is the same as in carbonaceous chondrites. Nonradiogenic xenon is also under abundant relative to krypton (the so-called "missing xenon" problem). Together these observations imply that xenon has been subject to fractionating escape and krypton not.

  3. Cold ion escape from the Martian ionosphere

    NASA Astrophysics Data System (ADS)

    Fränz, M.; Dubinin, E.; Andrews, D.; Barabash, S.; Nilsson, H.; Fedorov, A.

    2015-12-01

    We here report on new measurements of the escape flux of oxygen ions from Mars by combining the observations of the ASPERA-3 and MARSIS experiments on board the European Mars Express spacecraft. We show that in previous estimates of the total heavy ion escape flow the contribution of the cold ionospheric outflow with energies below 10 eV has been underestimated. Both case studies and the derived flow pattern indicate that the cold plasma observed by MARSIS and the superthermal plasma observed by ASPERA-3 move with the same bulk speed in most regions of the Martian tail. We determine maps of the tailside heavy ion flux distribution derived from mean ion velocity distributions sampled over 7 years. If we assume that the superthermal bulk speed derived from these long time averages of the ion distribution function represent the total plasma bulk speed we derive the total tailside plasma flux. Assuming cylindrical symmetry we determine the mean total escape rate for the years 2007-2014 at 2.8 ± 0.4 ×1025 atoms / s which is in good agreement with model estimates. A possible mechanism to generate this flux can be the ionospheric pressure gradient between dayside and nightside.

  4. 30 CFR 75.382 - Mechanical escape facilities.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ... 30 Mineral Resources 1 2014-07-01 2014-07-01 false Mechanical escape facilities. 75.382 Section 75... HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Ventilation § 75.382 Mechanical escape facilities. (a) Mechanical escape facilities shall be provided with overspeed, overwind, and automatic...

  5. 30 CFR 75.382 - Mechanical escape facilities.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Mechanical escape facilities. 75.382 Section 75... HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Ventilation § 75.382 Mechanical escape facilities. (a) Mechanical escape facilities shall be provided with overspeed, overwind, and automatic...

  6. 30 CFR 75.382 - Mechanical escape facilities.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... 30 Mineral Resources 1 2011-07-01 2011-07-01 false Mechanical escape facilities. 75.382 Section 75... HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Ventilation § 75.382 Mechanical escape facilities. (a) Mechanical escape facilities shall be provided with overspeed, overwind, and automatic...

  7. 30 CFR 75.382 - Mechanical escape facilities.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ... 30 Mineral Resources 1 2012-07-01 2012-07-01 false Mechanical escape facilities. 75.382 Section 75... HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Ventilation § 75.382 Mechanical escape facilities. (a) Mechanical escape facilities shall be provided with overspeed, overwind, and automatic...

  8. 30 CFR 75.382 - Mechanical escape facilities.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ... 30 Mineral Resources 1 2013-07-01 2013-07-01 false Mechanical escape facilities. 75.382 Section 75... HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Ventilation § 75.382 Mechanical escape facilities. (a) Mechanical escape facilities shall be provided with overspeed, overwind, and automatic...

  9. BCDO2 acts as a carotenoid scavenger and gatekeeper for the mitochondrial apoptotic pathway

    PubMed Central

    Lobo, Glenn P.; Isken, Andrea; Hoff, Sylvia; Babino, Darwin; von Lintig, Johannes

    2012-01-01

    Carotenoids and their metabolites are widespread and exert key biological functions in living organisms. In vertebrates, the carotenoid oxygenase BCMO1 converts carotenoids such as β,β-carotene to retinoids, which are required for embryonic pattern formation and cell differentiation. Vertebrate genomes encode a structurally related protein named BCDO2 but its physiological function remains undefined. Here, we show that BCDO2 is expressed as an oxidative stress-regulated protein during zebrafish development. Targeted knockdown of this mitochondrial enzyme resulted in anemia at larval stages. Marker gene analysis and staining for hemoglobin revealed that erythropoiesis was not impaired but that erythrocytes underwent apoptosis in BCDO2-deficient larvae. To define the mechanism of this defect, we have analyzed the role of BCDO2 in human cell lines. We found that carotenoids caused oxidative stress in mitochondria that eventually led to cytochrome c release, proteolytic activation of caspase 3 and PARP1, and execution of the apoptotic pathway. Moreover, BCDO2 prevented this induction of the apoptotic pathway by carotenoids. Thus, our study identifying BCDO2 as a crucial protective component against oxidative stress establishes this enzyme as mitochondrial carotenoid scavenger and a gatekeeper of the intrinsic apoptotic pathway. PMID:22764054

  10. Non-apoptotic function of BAD and BAX in long-term depression of synaptic transmission

    PubMed Central

    Jiao, Song; Li, Zheng

    2011-01-01

    Summary It has recently been found that caspases not only function in apoptosis, but are also crucial for non-apoptotic processes such as NMDA receptor-dependent long-term depression (LTD) of synaptic transmission. It remains unknown, however, how caspases are activated and how neurons escape death in LTD. Here we show that caspase-3 is activated by the BAD-BAX cascade for LTD induction. This cascade is required specifically for NMDA receptor-dependent LTD but not for mGluR-LTD, and its activation is sufficient to induce synaptic depression. In contrast to apoptosis, however, BAD is activated only moderately and transiently and BAX is not translocated to mitochondria, resulting in only modest caspase-3 activation. We further demonstrate that the intensity and duration of caspase-3 activation determin whether it leads to cell death or LTD, thus fine-tuning of caspase-3 activation is critical in distinguishing between these two pathways. PMID:21609830

  11. Biophysical investigation of the apoptotic force

    NASA Astrophysics Data System (ADS)

    Toyama, Yusuke; Peralta, Xomalin; Wells, Adrienne; Kiehart, Daniel; Edwards, Glenn

    2009-03-01

    Understanding tissue dynamics during development requires knowledge of how cells produce and respond to forces. We have experimentally shown that apoptosis (programmed cell death, which remodels tissue by eliminating cells) also contributes a significant tissue force that promotes cell sheet fusion during dorsal closure in Drosophila development [Science, 321, 1683 (2008)]. By genetically suppressing (enhancing) apoptosis, we slow (increase) the rate of dorsal closure. These changes correlate with the forces produced by the amnioserosa tissue and the rate of seam formation (zipping) for two advancing sheets of lateral epidermis. This apoptotic force is used to drive cell sheet movements during development, a role not classically attributed to apoptosis.

  12. Risks incurred by hydrogen escaping from containers and conduits

    SciTech Connect

    Swain, M.R.; Grilliot, E.S.; Swain, M.N.

    1998-08-01

    This paper is a discussion of a method for hydrogen leak classification. Leaks are classified as; gas escapes into enclosed spaces, gas escapes into partially enclosed spaces (vented), and gas escapes into unenclosed spaces. Each of the three enclosure classifications is further divided into two subclasses; total volume of hydrogen escaped and flow rate of escaping hydrogen. A method to aid in risk assessment determination in partially enclosed spaces is proposed and verified for several enclosure geometries. Examples are discussed for additional enclosure geometries.

  13. The Modulation of Apoptotic Pathways by Gammaherpesviruses

    PubMed Central

    Banerjee, Shuvomoy; Uppal, Timsy; Strahan, Roxanne; Dabral, Prerna; Verma, Subhash C.

    2016-01-01

    Apoptosis or programmed cell death is a tightly regulated process fundamental for cellular development and elimination of damaged or infected cells during the maintenance of cellular homeostasis. It is also an important cellular defense mechanism against viral invasion. In many instances, abnormal regulation of apoptosis has been associated with a number of diseases, including cancer development. Following infection of host cells, persistent and oncogenic viruses such as the members of the Gammaherpesvirus family employ a number of different mechanisms to avoid the host cell’s “burglar” alarm and to alter the extrinsic and intrinsic apoptotic pathways by either deregulating the expressions of cellular signaling genes or by encoding the viral homologs of cellular genes. In this review, we summarize the recent findings on how gammaherpesviruses inhibit cellular apoptosis via virus-encoded proteins by mediating modification of numerous signal transduction pathways. We also list the key viral anti-apoptotic proteins that could be exploited as effective targets for novel antiviral therapies in order to stimulate apoptosis in different types of cancer cells. PMID:27199919

  14. Organization of the Mitochondrial Apoptotic BAK Pore

    PubMed Central

    Aluvila, Sreevidya; Mandal, Tirtha; Hustedt, Eric; Fajer, Peter; Choe, Jun Yong; Oh, Kyoung Joon

    2014-01-01

    The multidomain pro-apoptotic Bcl-2 family proteins BAK and BAX are believed to form large oligomeric pores in the mitochondrial outer membrane during apoptosis. Formation of these pores results in the release of apoptotic factors including cytochrome c from the intermembrane space into the cytoplasm, where they initiate the cascade of events that lead to cell death. Using the site-directed spin labeling method of electron paramagnetic resonance (EPR) spectroscopy, we have determined the conformational changes that occur in BAK when the protein targets to the membrane and forms pores. The data showed that helices α1 and α6 disengage from the rest of the domain, leaving helices α2-α5 as a folded unit. Helices α2-α5 were shown to form a dimeric structure, which is structurally homologous to the recently reported BAX “BH3-in-groove homodimer.” Furthermore, the EPR data and a chemical cross-linking study demonstrated the existence of a hitherto unknown interface between BAK BH3-in-groove homodimers in the oligomeric BAK. This novel interface involves the C termini of α3 and α5 helices. The results provide further insights into the organization of the BAK oligomeric pores by the BAK homodimers during mitochondrial apoptosis, enabling the proposal of a BAK-induced lipidic pore with the topography of a “worm hole.” PMID:24337568

  15. Complement activation by apoptotic cells occurs predominantly via IgM and is limited to late apoptotic (secondary necrotic) cells.

    PubMed

    Zwart, Bas; Ciurana, Caroline; Rensink, Irma; Manoe, Rishi; Hack, C Erik; Aarden, Lucien A

    2004-03-01

    Apoptotic cells activate complement via various molecular mechanisms. It is not known which of these mechanisms predominate in a physiological environment. Using Jurkat cells as a model, we investigated complement deposition on vital, early and late apoptotic (secondary necrotic) cells in a physiological medium, human plasma, and established the main molecular mechanism involved in this activation. Upon incubation with recalcified plasma, binding of C3 and C4 to early apoptotic cells was similar to background binding on vital cells. In contrast, late apoptotic (secondary necrotic) cells consistently displayed substantial binding of C4 and C3 and low, but detectable, binding of C1q. Binding of C3 and C4 to the apoptotic cells was abolished by EDTA or Mg-EGTA, and also by C1-inhibitor or a monoclonal antibody that inhibits C1q binding, indicating that complement fixation by the apoptotic cells was mainly dependent on the classical pathway. Late apoptotic cells also consistently bound IgM, in which binding significantly correlated with that of C4 and C3. Depletion of plasma for IgM abolished most of the complement fixation by apoptotic cells, which was restored by supplementation with purified IgM. We conclude that complement binding by apoptotic cells in normal human plasma occurs mainly to late apoptotic, secondary necrotic cells, and that the dominant mechanism involves classical pathway activation by IgM.

  16. Apoptotic cell clearance: basic biology and therapeutic potential.

    PubMed

    Poon, Ivan K H; Lucas, Christopher D; Rossi, Adriano G; Ravichandran, Kodi S

    2014-03-01

    The prompt removal of apoptotic cells by phagocytes is important for maintaining tissue homeostasis. The molecular and cellular events that underpin apoptotic cell recognition and uptake, and the subsequent biological responses, are increasingly better defined. The detection and disposal of apoptotic cells generally promote an anti-inflammatory response at the tissue level, as well as immunological tolerance. Consequently, defects in apoptotic cell clearance have been linked with various inflammatory diseases and autoimmunity. Conversely, under certain conditions, such as the killing of tumour cells by specific cell-death inducers, the recognition of apoptotic tumour cells can promote an immunogenic response and antitumour immunity. Here, we review the current understanding of the complex process of apoptotic cell clearance in physiology and pathology, and discuss how this knowledge could be harnessed for new therapeutic strategies.

  17. Genistein suppresses the mitochondrial apoptotic pathway in hippocampal neurons in rats with Alzheimer's disease.

    PubMed

    Wang, Yan; Cai, Biao; Shao, Jing; Wang, Ting-Ting; Cai, Run-Ze; Ma, Chang-Ju; Han, Tao; Du, Jun

    2016-07-01

    Genistein is effective against amyloid-β toxicity, but the underlying mechanisms are unclear. We hypothesized that genistein may protect neurons by inhibiting the mitochondrial apoptotic pathway, and thereby play a role in the prevention of Alzheimer's disease. A rat model of Alzheimer's disease was established by intraperitoneal injection of D-galactose and intracerebral injection of amyloid-β peptide (25-35). In the genistein treatment groups, a 7-day pretreatment with genistein (10, 30, 90 mg/kg) was given prior to establishing Alzheimer's disease model, for 49 consecutive days. Terminal deoxyribonucleotidyl transferase-mediated dUTP nick end labeling assay demonstrated a reduction in apoptosis in the hippocampus of rats treated with genistein. Western blot analysis showed that expression levels of capase-3, Bax and cytochrome c were decreased compared with the model group. Furthermore, immunohistochemical staining revealed reductions in cytochrome c and Bax immunoreactivity in these rats. Morris water maze revealed a substantial shortening of escape latency by genistein in Alzheimer's disease rats. These findings suggest that genistein decreases neuronal loss in the hippocampus, and improves learning and memory ability. The neuroprotective effects of genistein are associated with the inhibition of the mitochondrial apoptotic pathway, as shown by its ability to reduce levels of caspase-3, Bax and cytochrome c. PMID:27630702

  18. Galectin-1 and Galectin-3 induce mitochondrial apoptotic pathway in Jurkat cells

    NASA Astrophysics Data System (ADS)

    Vasil'eva, O. A.; Isaeva, A. V.; Prokhorenko, T. S.; Zima, A. P.; Novitsky, V. V.

    2016-08-01

    Cellular malignant transformation is often accompanied by increased gene expression of low-molecular proteins of lectins family-galectins. But it is unknown how galectins promote tumor growth and malignization. Galectins-1 and galectin-3 are thought to be possible immunoregulators exerting their effects by regulating the balance of CD4+ lymphocytes. In addition it is known that tumor cells overexpressing galectins are capable of escaping immunological control, causing apoptosis of lymphocytes. The aim of the study is to investigate the role of galectin-1 and galectin-3 in the implementation of mitochondrial apoptotic pathway in Jurkat cells. Methods: Jurkat cells were used as a model for the study of T-lymphocytes. Jurkat cells were activated with antibodies to CD3 and CD28 and cultured with recombinant galectin-1 and -3. Apoptosis of Jurkat cells and depolarization of the mitochondrial membrane were assessed by flow cytometry. It was found that galectin-1 and galectin-3 have a dose-dependent pro-apoptotic effect on Jurkat cells in vitro and enlarge the number of cells with decreased mitochondrial membrane potential compared with intact cells.

  19. Genistein suppresses the mitochondrial apoptotic pathway in hippocampal neurons in rats with Alzheimer's disease

    PubMed Central

    Wang, Yan; Cai, Biao; Shao, Jing; Wang, Ting-ting; Cai, Run-ze; Ma, Chang-ju; Han, Tao; Du, Jun

    2016-01-01

    Genistein is effective against amyloid-β toxicity, but the underlying mechanisms are unclear. We hypothesized that genistein may protect neurons by inhibiting the mitochondrial apoptotic pathway, and thereby play a role in the prevention of Alzheimer’s disease. A rat model of Alzheimer’s disease was established by intraperitoneal injection of D-galactose and intracerebral injection of amyloid-β peptide (25–35). In the genistein treatment groups, a 7-day pretreatment with genistein (10, 30, 90 mg/kg) was given prior to establishing Alzheimer’s disease model, for 49 consecutive days. Terminal deoxyribonucleotidyl transferase-mediated dUTP nick end labeling assay demonstrated a reduction in apoptosis in the hippocampus of rats treated with genistein. Western blot analysis showed that expression levels of capase-3, Bax and cytochrome c were decreased compared with the model group. Furthermore, immunohistochemical staining revealed reductions in cytochrome c and Bax immunoreactivity in these rats. Morris water maze revealed a substantial shortening of escape latency by genistein in Alzheimer’s disease rats. These findings suggest that genistein decreases neuronal loss in the hippocampus, and improves learning and memory ability. The neuroprotective effects of genistein are associated with the inhibition of the mitochondrial apoptotic pathway, as shown by its ability to reduce levels of caspase-3, Bax and cytochrome c. PMID:27630702

  20. Relationship of scores on the Escapism Scale of the MMPI to escape from minimum security federal custody.

    PubMed

    White, R B

    1979-04-01

    Investigated the ability of the Escapism (Ec) scale of the MMPI to differentiate between escape and non-escape minimum security federal prisoners. At the .05 level there was no difference between the scores of the two groups on the Ec scale or on comparisons of other correctional data, age, and ethnic composition. It appears that the Ec scale alone or in combination with other data will be a poor predictor of escape. Also, the rate of escape was so low as to make accurate prediction from any criteria extremely unlikely.

  1. Belt fires and mine escape problems

    SciTech Connect

    Kovac, J.G.; Lazzara, C.P.; Kravitz, J.H.

    1996-12-31

    A conveyor belt fire in an underground coal mine is a serious threat to life and property. About 30% of the reportable underground coal mine fires from 1988 through 1992 occurred in belt entries. In one instance, a fire started in the drive area of a belt line, spread rapidly, and resulted in seating of the entire mine. Large-scale studies conducted by the U.S. Bureau of Mines in an aboveground fire gallery at Lake Lynn Laboratory clearly show the hazards of conveyor belt fires. Mine conveyor belt formulations which passed the current Federal acceptance test for fire-resistant betting were completely consumed by propagating fires or propagated flame, with flame spread rates ranging from 0.3 to 9 m/min. High downstream temperatures and large quantities of smoke and toxic gases, such as carbon monoxide, were generated as the belting burned. The smoke and gases can be spread by the mine`s ventilation system and can create significant problems for miners in the process of evacuation, such as reduction in visibility and incapacitation. In the aftermath of a belt fire, the atmosphere inside of the mine can become smoke filled or unbreathable, forcing miners to evacuate while wearing Self-Contained Self-Rescuers (SCSR`s), Sometimes there is confusion about how to regard the rated duration of an MSHA/NIOSH-approved 60-min. SCSR, especially when an SCSR is used in a way which takes it outside of the test conditions under which it was approved. As examples, for a mine escape that takes a miner from the deepest point of penetration in the mine to the surface: How long will a 60-min. SCSR actually last? and How many SCSR`s will a miner need? To answer these kinds of questions, in-mine data being gathered on escape times, distance and heart rates using miners escaping on foot and under oxygen. A model will be developed and validated which predicts how much oxygen is actually needed for a mine escape, and compares oxygen consumption bare faced versus wearing an SCSR.

  2. Suicide as escape from psychotic panic.

    PubMed

    Goldblatt, Mark J; Ronningstam, Elsa; Schechter, Mark; Herbstman, Benjamin; Maltsberger, John T

    2016-01-01

    Suicides of patients in states of acute persecutory panic may be provoked by a subjective experience of helpless terror threatening imminent annihilation or dismemberment. These patients are literally scared to death and try to run away. They imagine suicide is survivable and desperately attempt to escape from imaginary enemies. These states of terror occur in a wide range of psychotic illnesses and are often associated with command hallucinations and delusions. In this article, the authors consider the subjective experience of persecutory panic and the suicide response as an attempt to flee from danger. PMID:27294586

  3. Escape Artists of the X Chromosome.

    PubMed

    Balaton, Bradley P; Brown, Carolyn J

    2016-06-01

    Inactivation of one X chromosome in mammalian females achieves dosage compensation between XX females and XY males; however, over 15% of human X-linked genes continue to be expressed from the inactive X chromosome. New genomic methodologies have improved our identification and characterization of these escape genes, revealing the importance of DNA sequence, chromatin structure, and chromosome ultrastructure in regulating expression from an otherwise inactive chromosome. Study of these exceptions to the rule of silencing highlights the interconnectedness of chromatin and chromosome structure in X-chromosome inactivation (XCI). Recent advances also demonstrate the importance of these genes in sexually dimorphic disease risk, particularly cancer.

  4. Staurosporine induces apoptotic volume decrease (AVD) in ECV304 cells.

    PubMed

    Porcelli, A M; Ghelli, A; Zanna, C; Valente, P; Ferroni, S; Rugolo, M

    2003-12-01

    Incubation of ECV304 cells with 1 micro M staurosporine (STS) causes apoptotic cell death. In the present study, we investigate whether a significant apoptotic volume decrease (AVD) was apparent during the very early times (1 h) of the apoptotic process. Our data suggest that upregulation of Cl(-) (and possibly K(+)) channels by STS may be a very early primary event required for the subsequent onset of AVD, which results in apoptosis.

  5. Plasma membrane aquaporin activity can affect the rate of apoptosis but is inhibited after apoptotic volume decrease.

    PubMed

    Jablonski, Elizabeth M; Webb, Ashley N; McConnell, Nisha A; Riley, Marcus C; Hughes, Francis M

    2004-04-01

    Apoptosis is characterized by a conserved series of morphological events beginning with the apoptotic volume decrease (AVD). This study investigated a role for aquaporins (AQPs) during the AVD. Inhibition of AQPs blocked the AVD in ovarian granulosa cells undergoing growth factor withdrawal and blocked downstream apoptotic events such as cell shrinkage, changes in the mitochondrial membrane potential, DNA degradation, and caspase-3 activation. The effects of AQP inhibition on the AVD and DNA degradation were consistent in thymocytes and with two additional apoptotic signals, thapsigargin and C(6)-ceramide. Overexpression of AQP-1 in Chinese hamster ovary (CHO-AQP-1) cells enhanced their rate of apoptosis. The AVD is driven by loss of K(+) from the cell, and we hypothesize that after the AVD, AQPs become inactive, which halts further water loss and allows K(+) concentrations to decrease to levels necessary for apoptotic enzyme activation. Swelling assays on granulosa cells, thymocytes, and CHO-AQP-1 cells revealed that indeed, the shrunken (apoptotic) subpopulation has very low water permeability compared with the normal-sized (nonapoptotic) subpopulation. In thymocytes, AQP-1 is present and was shown to colocalize with the plasma membrane receptor tumor necrosis factor receptor-1 (TNF-R1) both before and after the AVD, which suggests that this protein is not proteolytically cleaved and remains on the cell membrane. Overall, these data indicate that AQP-mediated water loss is important for the AVD and downstream apoptotic events, that the water permeability of the plasma membrane can control the rate of apoptosis, and that inactivation after the AVD may help create the low K(+) concentration that is essential in apoptotic cells. Furthermore, inactivation of AQPs after the AVD does not appear to be through degradation or removal from the cell membrane.

  6. Intracellular Staphylococcus aureus Escapes the Endosome and Induces Apoptosis in Epithelial Cells

    PubMed Central

    Bayles, Kenneth W.; Wesson, Carla A.; Liou, Linda E.; Fox, Lawrence K.; Bohach, Gregory A.; Trumble, W. R.

    1998-01-01

    We examined the invasion of an established bovine mammary epithelial cell line (MAC-T) by a Staphylococcus aureus mastitis isolate to study the potential role of intracellular survival in the persistence of staphylococcal infections. S. aureus cells displayed dose-dependent invasion of MAC-T cells and intracellular survival. An electron microscopic examination of infected cells indicated that the bacteria induced internalization via a mechanism involving membrane pseudopod formation and then escaped into the cytoplasm following lysis of the endosomal membrane. Two hours after the internalization of S. aureus, MAC-T cells exhibited detachment from the matrix, rounding, a mottled cell membrane, and vacuolization of the cytoplasm, all of which are indicative of cells undergoing programmed cell death (apoptosis). By 18 h, the majority of the MAC-T cell population exhibited an apoptotic morphology. Other evidence for apoptosis was the generation of MAC-T cell DNA fragments differing in size by increments of approximately 180 bp and terminal deoxynucleotidyl transferase-mediated dUTP nick end labeling of the fragmented nuclear DNA of the infected host cells. These results demonstrate that after internalization S. aureus escapes the endosome and induces apoptosis in nonprofessional phagocytes. PMID:9423876

  7. Enzyme Kinetics.

    ERIC Educational Resources Information Center

    Moe, Owen; Cornelius, Richard

    1988-01-01

    Conveys an appreciation of enzyme kinetic analysis by using a practical and intuitive approach. Discusses enzyme assays, kinetic models and rate laws, the kinetic constants (V, velocity, and Km, Michaels constant), evaluation of V and Km from experimental data, and enzyme inhibition. (CW)

  8. Time between onset of apoptosis and release of nucleosomes from apoptotic cells: putative implications for systemic lupus erythematosus

    PubMed Central

    van Nieuwenhuijze, A E M; van Lopik, T; Smeenk, R; Aarden, L

    2003-01-01

    Objective: To investigate the kinetics of nucleosome leakage from apoptotic cells in an in vitro system and extrapolate the results to autoimmune disease, in particular systemic lupus erythematosus. Methods: A sensitive nucleosome enzyme linked immunosorbent assay (ELISA) was developed, using a monoclonal antibody (mAb) against histone 3 and an mAb against nucleosomes. Nucleosome release during apoptotic cell death was studied in Jurkat cells. AnnexinV binding (early apoptosis) and propidium iodide positivity (late apoptosis) of the cells were compared with nucleosome release at different times after apoptosis induction. Results: Nucleosomes appeared in culture supernatant of Jurkat cells 24 to 48 hours after apoptosis induction, when the cells had been late apoptotic for more than 12 hours. Conclusion: Nucleosomes are released from late apoptotic Jurkat cells, with a 12 hour delay from the appearance of AnnexinV binding cells. This result suggests that in vivo scavenger mechanisms have 12 hours to remove apoptotic material from the circulation. PMID:12480662

  9. The effects of steady swimming on fish escape performance.

    PubMed

    Anwar, Sanam B; Cathcart, Kelsey; Darakananda, Karin; Gaing, Ashley N; Shin, Seo Yim; Vronay, Xena; Wright, Dania N; Ellerby, David J

    2016-06-01

    Escape maneuvers are essential to the survival and fitness of many animals. Escapes are frequently initiated when an animal is already in motion. This may introduce constraints that alter the escape performance. In fish, escape maneuvers and steady, body caudal fin (BCF) swimming are driven by distinct patterns of curvature of the body axis. Pre-existing muscle activity may therefore delay or diminish a response. To quantify the performance consequences of escaping in flow, escape behavior was examined in bluegill sunfish (Lepomis macrochirus) in both still-water and during steady swimming. Escapes executed during swimming were kinematically less variable than those made in still-water. Swimming escapes also had increased response latencies and lower peak velocities and accelerations than those made in still-water. Performance was also lower for escapes made up rather than down-stream, and a preference for down-stream escapes may be associated with maximizing performance. The constraints imposed by pre-existing motion and flow, therefore, have the potential to shape predator-prey interactions under field conditions by shifting the optimal strategies for both predators and prey. PMID:27161016

  10. F111 Crew Escape Module pilot parachute

    SciTech Connect

    Tadios, E.L.

    1991-01-01

    A successfully deployment of a parachute system highly depends on the efficiency of the deployment device and/or method. There are several existing methods and devices that may be considered for a deployment system. For the F111 Crew Escape Module (CEM), the recovery parachute system deployment is initiated by the firing of a catapult that ejects the complete system from the CEM. At first motion of the pack, a drogue gun is fired, which deploys the pilot parachute system. The pilot parachute system then deploys the main parachute system, which consists of a cluster of three 49-ft diameter parachutes. The pilot parachute system which extracts the F111 Crew Escape Module recovery parachute system must provide reasonable bag strip velocities throughout the flight envelope (10 psf to 300 psf). The pilot parachute system must, therefore, have sufficient drag area at the lower dynamic pressures and a reduced drag area at the high end of the flight envelope. The final design that was developed was a dual parachute system which consists of a 5-ft diameter guide surface parachute tethered inside a 10-ft diameter flat circular parachute. The high drag area is sustained at the low dynamic pressures by keeping both parachutes intact. The drag area is reduced at the higher extreme by allowing the 10-ft parachute attachment to fail. The discussions to follow describe in detail how the system was developed. 4 refs., 10 figs., 2 tabs.

  11. Orbital Effects on Mercury's Escaping Sodium Exosphere

    NASA Technical Reports Server (NTRS)

    Schmidt, Carl A.; Wilson, Jody K.; Baumgardner, Jeffrey; Mendillo, Michael

    2009-01-01

    We present results from coronagraphic imaging of Mercury's sodium tail over a 7 deg field of view. Several sets of observations made at the McDonald Observatory since May 2007 show a tail of neutral sodium atoms stretching more than 1000 Mercury radii (R(sub m)) in length, or a full degree of sky. However, no tail was observed extending beyond 120 R(sub m) during the January 2008 MESSENGER Fly-by period, or during a similar orbital phase of Mercury in July 2008. Large changes in Mercury's heliocentric radial velocity cause Doppler shifts about the Fraunhofer absorption features; the resultant change in solar flux and radiation pressure is the primary cause of the observed variation in tail brightness. Smaller fluctuations in brightness may exist due to changing source rates at the surface, but we have no explicit evidence for such changes in this data set. The effects of radiation pressure on Mercury's escaping atmosphere are investigated using seven observations spanning different orbital phases. Total escape rates of atmospheric sodium are estimated to be between 5 and 13 x 10(exp 23) atoms/s and show a correlation to radiation pressure. Candidate sources of Mercury's sodium exosphere include desorption by UV sunlight, thermal desorption, solar wind channeled along Mercury's magnetic field lines, and micro-meteor impacts. Wide-angle observations of the full extent of Mercury's sodium tail offer opportunities to enhance our understanding of the time histories of these source rates.

  12. The escape model for Galactic cosmic rays

    NASA Astrophysics Data System (ADS)

    Giacinti, G.; Kachelrieß, M.; Semikoz, D. V.

    2015-08-01

    The escape model explains the cosmic ray (CR) knee by energy-dependent CR leakage from the Milky Way, with an excellent fit to all existing data. We test this model calculating the trajectories of individual CRs in the Galactic magnetic field. We find that the CR escape time τesc(E) exhibits a knee-like structure around E/Z = few × 1015 eV for small coherence lengths and strengths of the turbulent magnetic field. The resulting intensities for different groups of nuclei are consistent with the ones determined by KASCADE and KASCADE-Grande, using simple power-laws as injection spectra. The transition from Galactic to extragalactic CRs happens in this model at low energies and is terminated below ≈ 3 × 1018 eV. The intermediate energy region up to the ankle is populated by CRs accelerated in starburst galaxies. This model provides a good fit to ln(A) data, while the estimated CR dipole anisotropy is close to, or below, upper limits in the energy range 1017 - 1018 eV. The phase of the dipole is expected to change between 1 × 1017 and 3 × 1018 eV.

  13. Escape dynamics of many hard disks.

    PubMed

    Taniguchi, Tooru; Murata, Hiroki; Sawada, Shin-Ichi

    2014-11-01

    Many-particle effects in escapes of hard disks from a square box via a hole are discussed in a viewpoint of dynamical systems. Starting from N disks in the box at the initial time, we calculate the probability P_{n}(t) for at least n disks to remain inside the box at time t for n=1,2,...,N. At early times, the probabilities P_{n}(t),n=2,3,...,N-1, are described by superpositions of exponential decay functions. On the other hand, after a long time the probability P_{n}(t) shows a power-law decay ∼t^{-2n} for n≠1, in contrast to the fact that it decays with a different power law ∼t^{-n} for cases without any disk-disk collision. Chaotic or nonchaotic properties of the escape systems are discussed by the dynamics of a finite-time largest Lyapunov exponent, whose decay properties are related with those of the probability P_{n}(t). PMID:25493874

  14. Structured Observations Reveal Slow HIV-1 CTL Escape

    PubMed Central

    Roberts, Hannah E.; Hurst, Jacob; Robinson, Nicola; Brown, Helen; Flanagan, Peter; Vass, Laura; Fidler, Sarah; Weber, Jonathan; Babiker, Abdel; Phillips, Rodney E.; McLean, Angela R.; Frater, John

    2015-01-01

    The existence of viral variants that escape from the selection pressures imposed by cytotoxic T-lymphocytes (CTLs) in HIV-1 infection is well documented, but it is unclear when they arise, with reported measures of the time to escape in individuals ranging from days to years. A study of participants enrolled in the SPARTAC (Short Pulse Anti-Retroviral Therapy at HIV Seroconversion) clinical trial allowed direct observation of the evolution of CTL escape variants in 125 adults with primary HIV-1 infection observed for up to three years. Patient HLA-type, longitudinal CD8+ T-cell responses measured by IFN-γ ELISpot and longitudinal HIV-1 gag, pol, and nef sequence data were used to study the timing and prevalence of CTL escape in the participants whilst untreated. Results showed that sequence variation within CTL epitopes at the first time point (within six months of the estimated date of seroconversion) was consistent with most mutations being transmitted in the infecting viral strain rather than with escape arising within the first few weeks of infection. Escape arose throughout the first three years of infection, but slowly and steadily. Approximately one third of patients did not drive any new escape in an HLA-restricted epitope in just under two years. Patients driving several escape mutations during these two years were rare and the median and modal numbers of new escape events in each patient were one and zero respectively. Survival analysis of time to escape found that possession of a protective HLA type significantly reduced time to first escape in a patient (p = 0.01), and epitopes escaped faster in the face of a measurable CD8+ ELISpot response (p = 0.001). However, even in an HLA matched host who mounted a measurable, specific, CD8+ response the average time before the targeted epitope evolved an escape mutation was longer than two years. PMID:25642847

  15. Structured observations reveal slow HIV-1 CTL escape.

    PubMed

    Roberts, Hannah E; Hurst, Jacob; Robinson, Nicola; Brown, Helen; Flanagan, Peter; Vass, Laura; Fidler, Sarah; Weber, Jonathan; Babiker, Abdel; Phillips, Rodney E; McLean, Angela R; Frater, John

    2015-02-01

    The existence of viral variants that escape from the selection pressures imposed by cytotoxic T-lymphocytes (CTLs) in HIV-1 infection is well documented, but it is unclear when they arise, with reported measures of the time to escape in individuals ranging from days to years. A study of participants enrolled in the SPARTAC (Short Pulse Anti-Retroviral Therapy at HIV Seroconversion) clinical trial allowed direct observation of the evolution of CTL escape variants in 125 adults with primary HIV-1 infection observed for up to three years. Patient HLA-type, longitudinal CD8+ T-cell responses measured by IFN-γ ELISpot and longitudinal HIV-1 gag, pol, and nef sequence data were used to study the timing and prevalence of CTL escape in the participants whilst untreated. Results showed that sequence variation within CTL epitopes at the first time point (within six months of the estimated date of seroconversion) was consistent with most mutations being transmitted in the infecting viral strain rather than with escape arising within the first few weeks of infection. Escape arose throughout the first three years of infection, but slowly and steadily. Approximately one third of patients did not drive any new escape in an HLA-restricted epitope in just under two years. Patients driving several escape mutations during these two years were rare and the median and modal numbers of new escape events in each patient were one and zero respectively. Survival analysis of time to escape found that possession of a protective HLA type significantly reduced time to first escape in a patient (p = 0.01), and epitopes escaped faster in the face of a measurable CD8+ ELISpot response (p = 0.001). However, even in an HLA matched host who mounted a measurable, specific, CD8+ response the average time before the targeted epitope evolved an escape mutation was longer than two years.

  16. Escape from X Inactivation Varies in Mouse Tissues

    PubMed Central

    Yang, Fan; Shendure, Jay; Noble, William S.; Disteche, Christine M.; Deng, Xinxian

    2015-01-01

    X chromosome inactivation (XCI) silences most genes on one X chromosome in female mammals, but some genes escape XCI. To identify escape genes in vivo and to explore molecular mechanisms that regulate this process we analyzed the allele-specific expression and chromatin structure of X-linked genes in mouse tissues and cells with skewed XCI and distinguishable alleles based on single nucleotide polymorphisms. Using a binomial model to assess allelic expression, we demonstrate a continuum between complete silencing and expression from the inactive X (Xi). The validity of the RNA-seq approach was verified using RT-PCR with species-specific primers or Sanger sequencing. Both common escape genes and genes with significant differences in XCI status between tissues were identified. Such genes may be candidates for tissue-specific sex differences. Overall, few genes (3–7%) escape XCI in any of the mouse tissues examined, suggesting stringent silencing and escape controls. In contrast, an in vitro system represented by the embryonic-kidney-derived Patski cell line showed a higher density of escape genes (21%), representing both kidney-specific escape genes and cell-line specific escape genes. Allele-specific RNA polymerase II occupancy and DNase I hypersensitivity at the promoter of genes on the Xi correlated well with levels of escape, consistent with an open chromatin structure at escape genes. Allele-specific CTCF binding on the Xi clustered at escape genes and was denser in brain compared to the Patski cell line, possibly contributing to a more compartmentalized structure of the Xi and fewer escape genes in brain compared to the cell line where larger domains of escape were observed. PMID:25785854

  17. Circulating IgM Requires Plasma Membrane Disruption to Bind Apoptotic and Non-Apoptotic Nucleated Cells and Erythrocytes

    PubMed Central

    Hesketh, Emily E.; Dransfield, Ian; Kluth, David C.; Hughes, Jeremy

    2015-01-01

    Autoimmunity is associated with defective phagocytic clearance of apoptotic cells. IgM deficient mice exhibit an autoimmune phenotype consistent with a role for circulating IgM antibodies in apoptotic cell clearance. We have extensively characterised IgM binding to non-apoptotic and apoptotic mouse thymocytes and human Jurkat cells using flow cytometry, confocal imaging and electron microscopy. We demonstrate strong specific IgM binding to a subset of Annexin-V (AnnV)+PI (Propidium Iodide)+ apoptotic cells with disrupted cell membranes. Electron microscopy studies indicated that IgM+AnnV+PI+ apoptotic cells exhibited morphologically advanced apoptosis with marked plasma membrane disruption compared to IgM-AnnV+PI+ apoptotic cells, suggesting that access to intracellular epitopes is required for IgM to bind. Strong and comparable binding of IgM to permeabilised non-apoptotic and apoptotic cells suggests that IgM bound epitopes are 'apoptosis independent' such that IgM may bind any cell with profound disruption of cell plasma membrane integrity. In addition, permeabilised erythrocytes exhibited significant IgM binding thus supporting the importance of cell membrane epitopes. These data suggest that IgM may recognize and tag damaged nucleated cells or erythrocytes that exhibit significant cell membrane disruption. The role of IgM in vivo in conditions characterized by severe cell damage such as ischemic injury, sepsis and thrombotic microangiopathies merits further exploration. PMID:26121639

  18. Circulating IgM Requires Plasma Membrane Disruption to Bind Apoptotic and Non-Apoptotic Nucleated Cells and Erythrocytes.

    PubMed

    Hesketh, Emily E; Dransfield, Ian; Kluth, David C; Hughes, Jeremy

    2015-01-01

    Autoimmunity is associated with defective phagocytic clearance of apoptotic cells. IgM deficient mice exhibit an autoimmune phenotype consistent with a role for circulating IgM antibodies in apoptotic cell clearance. We have extensively characterised IgM binding to non-apoptotic and apoptotic mouse thymocytes and human Jurkat cells using flow cytometry, confocal imaging and electron microscopy. We demonstrate strong specific IgM binding to a subset of Annexin-V (AnnV)+PI (Propidium Iodide)+ apoptotic cells with disrupted cell membranes. Electron microscopy studies indicated that IgM+AnnV+PI+ apoptotic cells exhibited morphologically advanced apoptosis with marked plasma membrane disruption compared to IgM-AnnV+PI+ apoptotic cells, suggesting that access to intracellular epitopes is required for IgM to bind. Strong and comparable binding of IgM to permeabilised non-apoptotic and apoptotic cells suggests that IgM bound epitopes are 'apoptosis independent' such that IgM may bind any cell with profound disruption of cell plasma membrane integrity. In addition, permeabilised erythrocytes exhibited significant IgM binding thus supporting the importance of cell membrane epitopes. These data suggest that IgM may recognize and tag damaged nucleated cells or erythrocytes that exhibit significant cell membrane disruption. The role of IgM in vivo in conditions characterized by severe cell damage such as ischemic injury, sepsis and thrombotic microangiopathies merits further exploration.

  19. Some Possible Cases of Escape Mimicry in Neotropical Butterflies.

    PubMed

    Pinheiro, C E G; Freitas, A V L

    2014-10-01

    The possibility that escape or evasive mimicry evolved in butterflies and other prey insects in a similar fashion to classical Batesian and Müllerian mimicry has long been advanced in the literature. However, there is a general disagreement among lepidopterists and evolutionary biologists on whether or not escape mimicry exists, as well as in which mimicry rings this form of mimicry has evolved. Here, we review some purported cases of escape mimicry in Neotropical butterflies and suggest new mimicry rings involving several species of Archaeoprepona, Prepona, and Doxocopa (the "bright blue bands" ring) and species of Colobura and Hypna (the "creamy bands" ring) where the palatability of butterflies, their ability to escape predator attacks, geographic distribution, relative abundance, and co-occurrence in the same habitats strongly suggest that escape mimicry is involved. In addition, we also indicate other butterfly taxa whose similarities of coloration patterns could be due to escape mimicry and would constitute important case studies for future investigation.

  20. Effects of zinc and cadmium on apoptotic DNA fragmentation in isolated bovine liver nuclei.

    PubMed Central

    Lohmann, R D; Beyersmann, D

    1994-01-01

    Isolated nuclei from mammalian cells contain a calcium-dependent endonuclease. The produced DNA fragmentation is a necessary step in the sequence of events resulting in apoptosis (programmed cell death). We report here that zinc and cadmium inhibit the calcium-dependent endonuclease. The essential metal ion zinc may counterbalance the calcium-mediated apoptosis. In contrast to zinc, cadmium alone stimulates the endonuclease by replacing calcium. Thus cadmium exerts a dual effect: micromolar concentrations inhibit the apoptotic endonuclease in the presence but activate the enzyme in the absence of calcium. Images Figure 2. PMID:7843111

  1. Anti-tissue transglutaminase antibody inhibits apoptotic cell clearance by macrophages in pregnant NOD mice.

    PubMed

    Sóñora, Cecilia; Mourglia-Ettlin, Gustavo; Calo, Guillermina; Hauk, Vanesa; Ramhorst, Rosanna; Hernández, Ana; Leirós, Claudia Pérez

    2014-06-01

    Autoimmunity is a feature of celiac disease (CD) with tissue transglutaminase (tTG) as a major autoantigen. A correlation between gynecological-obstetric disorders in CD patients and the presence of circulating antibodies anti-tTG that inhibited tTG activity was reported. Serum anti-tTG antibodies were detected in a non-obese diabetic (NOD) mouse model of type I insulin-dependent diabetes mellitus and Sjögren's syndrome, two comorbid states with CD. Since pregnancy complications have been described in NOD mice, we evaluated the ability of anti-tTG antibodies to affect the functions of tTG relevant to the normal course of an early pregnancy like extracellular matrix assembling and apoptotic cell phagocytosis by macrophages. Circulating IgG antibodies against tTG were detected in NOD mice with titers that decreased at early pregnancy; interestingly, the in vitro transamidating activity of tTG was reduced by NOD serum samples. Particularly, anti-tTG antibody inhibited apoptotic cell phagocytosis by peritoneal macrophages from pregnant NOD mice that express the enzyme on surface. Evidence provided support for a role for anti-tTG antibodies through reduced transamidating activity and reduced apoptotic cell clearance by the macrophages of pregnant NOD mice. PMID:24377394

  2. Enhanced Apoptotic Response to Photodynamic Therapy after bcl-2 Transfection1

    PubMed Central

    Kim, Hyeong-Reh Choi; Luo, Yu; Li, Gangyong; Kessel, David

    2015-01-01

    Apoptosis is a cellular death process involving the sequential activation of a series of caspases, endonucleases, and other enzymes. The initiation of apoptosis can be inhibited by overexpression of bcl-2 and certain other members of a related family of proteins. We examined the effects of bcl-2 overexpression on the apoptotic response to photodynamic therapy (PDT), using aluminum phthalocyanine as the photosensitizing agent. In this study, we compared the immortalized human breast epithelial cell line MCF10A with a subline (MCF10A/bcl-2) transfected with the human bcl-2 gene. The latter was ~2-fold more sensitive to the phototoxic effects of PDT. At a 50 mJ/cm2 light dose, photodamage to MCF-10A/bcl-2 resulted in a greater loss of the mitochondrial membrane potential (ΔΨm), enhanced release of mitochondrial cytochrome c, a more rapid and greater activation of caspase-3, and a greater apoptotic response. Western blot analysis revealed that the transfected cell line showed overexpression of both bcl-2 and bax, and that PDT caused selective destruction of bcl-2, leaving bax unaffected. The greater apoptotic response by the transfected line is, therefore, attributed to the higher bax:bcl-2 ratio after photodamage. PMID:10416606

  3. Submarine escape trials 1999-2001--provision of medical support.

    PubMed

    Benton, Peter

    2002-01-01

    Since the early 1960s all Royal Navy submarines have been fitted with an escape system comprising a single escape tower (SET) and submarine escape immersion suit (SEIS). This system enables escape from a submarine at a depth of 180 metres (1.9 MPa) provided that the submarine compartment is at a pressure of no greater than 1 bar (0.1 MPa). Due to a variety of causes which may include flooding and leakage of high pressure air systems it is the highly probable that the submarine compartment will be at a pressure in excess of 1 bar (0.1 MPa) at the time of the escape. To investigate and determine what constitutes a 'safe' maximum escape depth from any given compartment pressure (the safe to escape curve), a purpose built chamber complex, the Submarine Escape Simulator (SES) has been constructed at the QinetiQ, formerly the Defence Evaluation and Research Agency (DERA), Alverstoke site. Unlike escapes from a submarine where once released from the submarine the escapee's ascent can not be halted, within the SES it is possible to halt the ascent phase. This article describes the systems and procedures developed to enable medical support to be provided rapidly to a subject at any stage of the compression decompression profile. The article also provides details of the results to date that have been obtained from this work. PMID:12838773

  4. Wind and Rotation Enhanced Escape from the Early Terrestrial Atmospheres

    NASA Technical Reports Server (NTRS)

    Hartle, Richard E.; Einaudi, Franco (Technical Monitor)

    2001-01-01

    The earliest atmospheres of the terrestrial planets are thought to have been hotter, have stronger winds and rotate faster than atmospheres of today. Since these primitive atmospheres were weakly bound, they evolved rapidly because atmospheric escape was very strong, often referred to as "blowoff." Such escape has been treated as hydrodynamic, transonic flow; similar to solar wind flow dynamics. However, in many cases, although the outward flow is hydrodynamic at low altitudes, it becomes collisionless at higher altitudes, before sonic speeds are ever attained. Recent models dealing with the transition from fluid to kinetic flow have applied the Jeans escape flux at the exobase. This approach leads to escape rates that are too low, because thermospheric winds and planetary rotation are known to increase the escape flux above the corresponding Jeans flux. In particular, for a given density and temperature at the exobase, the escape flux increases as the wind speed and/or the rotation rate increase. Also, for a given wind speed and rotation rate, the escape flux enhancement over the Jeans flux increases as the mass of an escaping constituent increases, an important factor in isotope fractionation, especially the enrichment of deuterium on Mars. Accounting for a range of possible temperatures, thermospheric wind speeds and planetary rotation rates in the primitive atmospheres of the terrestrial planets, estimates are made of light constituent escape flux increases over the corresponding Jeans fluxes.

  5. Critical escape velocity for a charged particle in Ernst spacetime

    NASA Astrophysics Data System (ADS)

    Huang, Qihong; Chen, Juhua; Wang, Yongjiu

    2015-05-01

    Motion of a charged particle in Ernst spacetime is discussed. We study the conditions that a charged particle, originally revolving around this black hole in the innermost stable circular orbit (ISCO), will escape to infinity after being kicked by another particle or photon. The motion of the kicked particle is chaotic. The critical escape energy and velocity of the charged particle are obtained in the present paper. Comparing to the Schwarzschild case, the kicked charged particle without the radial velocity needs more energy to escape in Ernst case for l > 0 and less energy to escape for l < 0.

  6. Human Cells Display Reduced Apoptotic Function Relative to Chimpanzee Cells

    PubMed Central

    McDonald, John F.

    2012-01-01

    Previously published gene expression analyses suggested that apoptotic function may be reduced in humans relative to chimpanzees and led to the hypothesis that this difference may contribute to the relatively larger size of the human brain and the increased propensity of humans to develop cancer. In this study, we sought to further test the hypothesis that humans maintain a reduced apoptotic function relative to chimpanzees by conducting a series of apoptotic function assays on human, chimpanzee and macaque primary fibroblastic cells. Human cells consistently displayed significantly reduced apoptotic function relative to the chimpanzee and macaque cells. These results are consistent with earlier findings indicating that apoptotic function is reduced in humans relative to chimpanzees. PMID:23029431

  7. Escape of black holes from the brane.

    PubMed

    Flachi, Antonino; Tanaka, Takahiro

    2005-10-14

    TeV-scale gravity theories allow the possibility of producing small black holes at energies that soon will be explored at the CERN LHC or at the Auger observatory. One of the expected signatures is the detection of Hawking radiation that might eventually terminate if the black hole, once perturbed, leaves the brane. Here, we study how the "black hole plus brane" system evolves once the black hole is given an initial velocity that mimics, for instance, the recoil due to the emission of a graviton. The results of our dynamical analysis show that the brane bends around the black hole, suggesting that the black hole eventually escapes into the extra dimensions once two portions of the brane come in contact and reconnect. This gives a dynamical mechanism for the creation of baby branes.

  8. The humanitarians' tragedy: escapable and inescapable cruelties.

    PubMed

    de Waal, Alex

    2010-04-01

    Paradoxically, elements of cruelty are intrinsic to the humanitarian enterprise.(1) This paper focuses on some of these. Escapable cruelties arise from technical failings, but the gradual professionalisation of the field and improvements in relief technologies mean that they have been significantly reduced in comparison to earlier eras. Other cruelties arise from clashes among rights, and the tensions inherent in trying to promote humanity amid the horrors of war. These are inescapable and constitute the 'humanitarians' tragedy'. Among them is the individual cruelty of failing to do good at the margin: a clash between the individual's impulses and ideals and the constraints of operating in constrained circumstances. This is a version of triage. In addition, there is the cruelty of compromising dearly-held principles when faced with other competing or overriding demands. There is also the cruelty whereby humanitarians feed victims' dreams that there is an alternative reality, which in fact cannot be attained.

  9. Metamodulation of the crayfish escape circuit.

    PubMed

    Edwards, Donald H; Yeh, Shih-Rung; Musolf, Barbara E; Antonsen, Brian L; Krasne, Franklin B

    2002-01-01

    Neuromodulation provides a means of changing the excitability of neurons or the effect of synapses, and so extends the performance range of neural circuits. Metamodulation occurs when the neuromodulatory effect is itself modulated, often in response to a change in the behavioral state of the animal. The well-studied neural circuit that mediates escape in the crayfish is modulated by serotonin, and this modulation is subject to two forms of metamodulation. First, the serotonergic modulation of the Lateral Giant (LG) command neuron for escape depends on the pattern of exposure of the cell to serotonin. High and low concentrations, and rapid and slow exposures each produce opposite modulatory effects on sensory-evoked EPSPs in LG. In addition, brief exposures produce transient modulatory effects, whereas longer exposures produce long-term facilitation. These different patterns of exposure may result from serotonin neurotransmission, paracrine transmission, and hormonal release, all of which occur in the vicinity of LG. The second form of metamodulation enables serotonergic modulation to track slow changes in the social status of the crayfish. Slowly applied serotonin facilitates LG's response in socially isolated crayfish and in new dominant and subordinate animals. Facilitation is retained in the dominant animal during two weeks of continuous pairing of the animals, but facilitation gradually changes to inhibition in the subordinate crayfish. These and related changes in serotonin modulation appear to result from changes in the population of serotonin receptors that mediate the modulatory effects in LG. Whereas the exposure-dependent metamodulation enables rapid changes in serotonergic modulation of LG to occur, the status-dependent metamodulation enables serotonergic modulation of LG to track the slow maturation of social relationships. PMID:12563168

  10. Energy Release, Acceleration, and Escape of Solar Energetic Ions

    NASA Astrophysics Data System (ADS)

    de Nolfo, G. A.; Ireland, J.; Ryan, J. M.; Young, C. A.

    2013-12-01

    Solar flares are prodigious producers of energetic particles, and thus a rich laboratory for studying particle acceleration. The acceleration occurs through the release of magnetic energy, a significant fraction of which can go into the acceleration of particles. Coronal mass ejections (CMEs) certainly produce shocks that both accelerate particles and provide a mechanism for escape into the interplanetary medium (IP). What is less well understood is whether accelerated particles produced from the flare reconnection process escape, and if so, how these same particles are related to solar energetic particles (SEPs) detected in-situ. Energetic electron SEPs have been shown to be correlated with Type III radio bursts, hard X-ray emission, and EUV jets, making a very strong case for the connection between acceleration at the flare and escape along open magnetic field lines. Because there has not been a clear signature of ion escape, as is the case with the Type III radio emission for electrons, sorting out the avenues of escape for accelerated flare ions and the possible origin of the impulsive SEPs continues to be a major challenge. The key to building a clear picture of particle escape relies on the ability to map signatures of escape such as EUV jets at the Sun and to follow the progression of these escape signatures as they evolve in time. Furthermore, nuclear γ-ray emissions provide critical context relating ion acceleration to that of escape. With the advent observations from Fermi as well as RHESSI and the Solar Dynamics Observatory (SDO), the challenge of ion escape from the Sun can now be addressed. We present a preliminary study of the relationship of EUV jets with nuclear γ-ray emission and Type III radio observations and discuss the implications for possible magnetic topologies that allow for ion escape from deep inside the corona to the interplanetary medium.

  11. Escape behaviour in the stomatopod crustacean Squilla mantis, and the evolution of the caridoid escape reaction.

    PubMed

    Heitler, W J; Fraser, K; Ferrero, E A

    2000-01-01

    The mantis shrimp Squilla mantis shows a graded series of avoidance/escape responses to visual and mechanical (vibration and touch) rostral stimuli. A low-threshold response is mediated by the simultaneous protraction of the thoracic walking legs and abdominal swimmerets and telson, producing a backwards 'lurch' or jump that can displace the animal by up to one-third of its body length, but leaves it facing in the same direction. A stronger response starts with similar limb protraction, but is followed by partial abdominal flexion. The maximal response also consists of limb protraction followed by abdominal flexion, but in this case the abdominal flexion is sufficiently vigorous to pull the animal into a tight vertical loop, which leaves it inverted and facing away from the stimulus. The animal then swims forward (away from the stimulus) and rights itself by executing a half-roll. A bilaterally paired, large-diameter, rapidly conducting axon in the dorsal region of the ventral nerve excites swimmeret protractor motoneurons in several ganglia and is likely to be the driver neuron for the limb-protraction response. The same neuron also excites unidentified abdominal trunk motoneurons, but less reliably. The escape response is a key feature of the malacostracan caridoid facies, and we provide the first detailed description of this response in a group that diverged early in malacostracan evolution. We show that the components of the escape response contrast strongly with those of the full caridoid reaction, and we provide physiological and behavioural evidence for the biological plausibility of a limb-before-tail thesis for the evolution of the escape response. PMID:10607528

  12. 46 CFR 177.500 - Means of escape.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... this section, each space accessible to passengers or used by the crew on a regular basis, must have at... escape must be widely separated and, if possible, at opposite ends or sides of the space to minimize the... windows. (d) The number and dimensions of the means of escape from each space must be sufficient for...

  13. 46 CFR 116.500 - Means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... this section, each space accessible to passengers or used by the crew on a regular basis, must have at... escape must be widely separated and, if possible, at opposite ends or sides of the space to minimize the... windows. (d) The number and dimensions of the means of escape from each space must be sufficient for...

  14. 46 CFR 177.500 - Means of escape.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... this section, each space accessible to passengers or used by the crew on a regular basis, must have at... escape must be widely separated and, if possible, at opposite ends or sides of the space to minimize the... windows. (d) The number and dimensions of the means of escape from each space must be sufficient for...

  15. 46 CFR 177.500 - Means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... the ladder. Rungs must be: (1) At least 405 millimeters (16 inches) in width; and (2) Not more than... millimeters (4.5 inches) clearance above each rung. (l) When a deck scuttle serves as a means of escape, it... designed to be kicked or pushed out; and (3) Is suitably marked. (o) Only one means of escape is...

  16. 33 CFR 143.101 - Means of escape.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... 33 Navigation and Navigable Waters 2 2010-07-01 2010-07-01 false Means of escape. 143.101 Section 143.101 Navigation and Navigable Waters COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OUTER CONTINENTAL SHELF ACTIVITIES DESIGN AND EQUIPMENT OCS Facilities § 143.101 Means of escape. (a) “Primary...

  17. 46 CFR 177.500 - Means of escape.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... the ladder. Rungs must be: (1) At least 405 millimeters (16 inches) in width; and (2) Not more than... millimeters (4.5 inches) clearance above each rung. (l) When a deck scuttle serves as a means of escape, it... designed to be kicked or pushed out; and (3) Is suitably marked. (o) Only one means of escape is...

  18. 46 CFR 127.240 - Means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 4 2012-10-01 2012-10-01 false Means of escape. 127.240 Section 127.240 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS CONSTRUCTION AND ARRANGEMENTS...) and (m) of this section, there must be at least two means of escape, exclusive of windows...

  19. 46 CFR 127.240 - Means of escape.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 4 2011-10-01 2011-10-01 false Means of escape. 127.240 Section 127.240 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) OFFSHORE SUPPLY VESSELS CONSTRUCTION AND ARRANGEMENTS Particular Construction and Arrangements § 127.240 Means of escape. (a) Except as provided by paragraphs (l) and (m) of this section, there...

  20. 46 CFR 169.313 - Means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 7 2012-10-01 2012-10-01 false Means of escape. 169.313 Section 169.313 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS SAILING SCHOOL VESSELS Construction and Arrangement Hull Structure § 169.313 Means of escape. (a) Except as provided by paragraph (f)...

  1. 46 CFR 169.313 - Means of escape.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 7 2011-10-01 2011-10-01 false Means of escape. 169.313 Section 169.313 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS SAILING SCHOOL VESSELS Construction and Arrangement Hull Structure § 169.313 Means of escape. (a) Except as provided by paragraph (f)...

  2. 29. VIEW OF SUBMARINE ESCAPE TRAINING TANK DURING CONSTRUCTION AT ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    29. VIEW OF SUBMARINE ESCAPE TRAINING TANK DURING CONSTRUCTION AT POINT JUST ABOVE THE SUBMARINE SECTION AT THE 110-FOOT LEVEL 1929-1930 - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  3. 35. INTERIOR VIEW OF EQUIPMENT HOUSE, SUBMARINE ESCAPE TRAINING TANK, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    35. INTERIOR VIEW OF EQUIPMENT HOUSE, SUBMARINE ESCAPE TRAINING TANK, PRIOR TO ENLARGEMENT OF ROOM AND INSTALLATION OF TRIPLE-LOCK RECOMPRESSION CHAMBER IN 1957 - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  4. 22. VIEW OF ESCAPE TRAINING TANK, LOOKING WEST FROM EAST ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    22. VIEW OF ESCAPE TRAINING TANK, LOOKING WEST FROM EAST SIDE OF CUPOLA TOWARD ELEVATOR. TWO-LOCK RECOMPRESSION CHAMBER AT REAR - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  5. 31. VIEW OF SUBMARINE ESCAPE TRAINING TANK DURING CONSTRUCTION OF ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    31. VIEW OF SUBMARINE ESCAPE TRAINING TANK DURING CONSTRUCTION OF THE ELEVATOR AND PASSAGEWAYS TO THE 18- AND 50-FOOT LOCKS AND CUPOLA 1932 - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  6. 36. VIEW OF CUPOLA, SUBMARINE ESCAPE TRAINING TANK, SHOWING ROVING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    36. VIEW OF CUPOLA, SUBMARINE ESCAPE TRAINING TANK, SHOWING ROVING RESCUE BELL SUSPENDED ABOVE TANK, WITH TWO-LOCK RECOMPRESSION CHAMBER AT REAR, LOOKING WEST. Photo taken after installation of recompression chamber in 1956. - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  7. Green Pea Galaxies Reveal Secrets of Lyα Escape

    NASA Astrophysics Data System (ADS)

    Yang, Huan; Malhotra, Sangeeta; Gronke, Max; Rhoads, James E.; Dijkstra, Mark; Jaskot, Anne; Zheng, Zhenya; Wang, Junxian

    2016-04-01

    We analyze archival Lyα spectra of 12 “Green Pea” galaxies observed with the Hubble Space Telescope, model their Lyα profiles with radiative transfer models, and explore the dependence of the Lyα escape fraction on various properties. Green Pea galaxies are nearby compact starburst galaxies with [O iii] λ5007 equivalent widths (EWs) of hundreds of Å. All 12 Green Pea galaxies in our sample show Lyα lines in emission, with an Lyα EW distribution similar to high-redshift Lyα emitters. Combining the optical and UV spectra of Green Pea galaxies, we estimate their Lyα escape fractions and find correlations between Lyα escape fraction and kinematic features of Lyα profiles. The escape fraction of Lyα in these galaxies ranges from 1.4% to 67%. We also find that the Lyα escape fraction depends strongly on metallicity and moderately on dust extinction. We compare their high-quality Lyα profiles with single H i shell radiative transfer models and find that the Lyα escape fraction anticorrelates with the derived H i column densities. Single-shell models fit most Lyα profiles well, but not the ones with the highest escape fractions of Lyα. Our results suggest that low H i column density and low metallicity are essential for Lyα escape and make a galaxy an Lyα emitter.

  8. 7. VIEW OF ESCAPE TRAINING TANK, LOOKING UP SOUTH SIDE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    7. VIEW OF ESCAPE TRAINING TANK, LOOKING UP SOUTH SIDE FROM 50-FOOT PASSAGEWAY, SHOWING 25-FOOT BLISTER AT LEFT, 18-FOOT PASSAGEWAY AND PLATFORM AT RIGHT - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  9. The Origins and Underpinning Principles of E-Scape

    ERIC Educational Resources Information Center

    Kimbell, Richard

    2012-01-01

    In this article I describe the context within which we developed project e-scape and the early work that laid the foundations of the project. E-scape (e-solutions for creative assessment in portfolio environments) is centred on two innovations. The first concerns a web-based approach to portfolio building; allowing learners to build their…

  10. Fire Won't Wait--Plan Your Escape!

    ERIC Educational Resources Information Center

    PTA Today, 1991

    1991-01-01

    Discusses the importance of home fire escape drills, detailing fire safety plans. Early detection and warning (smoke detectors) coupled with well-rehearsed escape plans help prevent serious injury. Children need to be taught about fire safety beginning at a very early age. (SM)

  11. How many ions have escaped the Martian atmosphere?

    NASA Astrophysics Data System (ADS)

    Brain, David; McFadden, James; Halekas, Jasper; Connerney, J. E. P.; Eparvier, Frank; Mitchell, David; Bougher, Stephen W.; Bowers, Charlie; Curry, Shannon; Dong, Chuanfei; Dong, Yaxue; Egan, Hilary; Fang, Xiaohua; Harada, Yuki; Jakosky, Bruce; Lillis, Robert; Luhmann, Janet; Ma, Yingjuan; Modolo, Ronan; Weber, Tristan

    2016-10-01

    The Mars Atmosphere and Volatile EvolutioN (MAVEN) mission has been making science measurements of the Martian upper atmosphere and its escape to space since November 2014. A key part of this effort is the measurement of the escape rates of charged particles (ions) at present and over solar system history. The lack of a global dynamo magnetic field at Mars leaves its upper atmosphere more directly exposed to the impinging solar wind than magnetized planets such as Earth. For this reason it is thought that ion escape at Mars may have played a significant role in long term climate change. MAVEN measures escaping planetary ions directly, with high energy, mass, and time resolution.With nearly two years of observations in hand, we will report the average ion escape rate and the spatial distribution of escaping ions as measured by MAVEN and place them in context with previous measurements of ion loss by other spacecraft (e.g. Phobos 2 and Mars Express). We will then report on the measured variability in ion escape rates with different drivers (e.g. solar EUV, solar wind pressure, etc.). Finally, we will use these results to provide an initial estimate of the total ion escape from Mars over billions of years.

  12. Rapid reuptake of granzyme B leads to emperitosis: an apoptotic cell-in-cell death of immune killer cells inside tumor cells.

    PubMed

    Wang, S; He, M-f; Chen, Y-h; Wang, M-y; Yu, X-M; Bai, J; Zhu, H-y; Wang, Y-y; Zhao, H; Mei, Q; Nie, J; Ma, J; Wang, J-f; Wen, Q; Ma, L; Wang, Y; Wang, X-n

    2013-01-01

    A cell-in-cell process refers to the invasion of one living cell into another homotypic or heterotypic cell. Different from non-apoptotic death processes of internalized cells termed entosis or cannibalism, we previously reported an apoptotic cell-in-cell death occurring during heterotypic cell-in-cell formation. In this study, we further demonstrated that the apoptotic cell-in-cell death occurred only in internalized immune killer cells expressing granzyme B (GzmB). Vacuole wrapping around the internalized cells inside the target cells was the common hallmark during the early stage of all cell-in-cell processes, which resulted in the accumulation of reactive oxygen species and subsequent mitochondrial injury of encapsulated killer or non-cytotoxic immune cells. However, internalized killer cells mediated rapid bubbling of the vacuoles with the subsequent degranulation of GzmB inside the vacuole of the target cells and underwent the reuptake of GzmB by killer cells themselves. The confinement of GzmB inside the vacuole surpassed the lysosome-mediated cell death occurring in heterotypic or homotypic entosis processes, resulting in a GzmB-triggered caspase-dependent apoptotic cell-in-cell death of internalized killer cells. On the contrary, internalized killer cells from GzmB-deficient mice underwent a typical non-apoptotic entotic cell-in-cell death similar to that of non-cytotoxic immune cells or tumor cells. Our results thus demonstrated the critical involvement of immune cells with cytotoxic property in apoptotic cell-in-cell death, which we termed as emperitosis taken from emperipolesis and apoptosis. Whereas entosis or cannibalism may serve as a feed-on mechanism to exacerbate and nourish tumor cells, emperitosis of immune killer cells inside tumor cells may serve as an in-cell danger sensation model to prevent the killing of target cells from inside, implying a unique mechanism for tumor cells to escape from immune surveillance. PMID:24113190

  13. Split-second escape decisions in blue tits (Parus caeruleus)

    NASA Astrophysics Data System (ADS)

    Lind, Johan; Kaby, Ulrika; Jakobsson, Sven

    2002-07-01

    Bird mortality is heavily affected by birds of prey. Under attack, take-off is crucial for survival and even minor mistakes in initial escape response can have devastating consequences. Birds may respond differently depending on the character of the predator's attack and these split-second decisions were studied using a model merlin (Falco columbarius) that attacked feeding blue tits (Parus caeruleus) from two different attack angles in two different speeds. When attacked from a low attack angle they took off more steeply than when attacked from a high angle. This is the first study to show that escape behaviour also depends on predator attack speed. The blue tits responded to a high-speed attack by dodging sideways more often than when attacked at a low speed. Escape speed was not significantly affected by the different treatments. Although they have only a split-second before escaping an attack, blue tits do adjust their escape strategy to the prevailing attack conditions.

  14. Hydrodynamics of the escape response in bluegill sunfish, Lepomis macrochirus

    PubMed Central

    Tytell, Eric D.; Lauder, George V.

    2009-01-01

    SUMMARY Escape responses of fishes are one of the best characterized vertebrate behaviors, with extensive previous research on both the neural control and biomechanics of startle response performance. However, very little is known about the hydrodynamics of escape responses, despite the fact that understanding fluid flow patterns during the escape is critical for evaluating how body movement transfers power to the fluid, for defining the time course of power generation, and for characterizing the wake signature left by escaping fishes, which may provide information to predators. In this paper we present an experimental hydrodynamic analysis of the C-start escape response in bluegill sunfish (Lepomis macrochirus). We used time-resolved digital particle image velocimetry at 1000 fps to image flow patterns during the escape response. We analyzed flow patterns generated by the body separately from those generated by the dorsal and anal fins, to assess the contribution of these median fins to escape momentum. Each escape response produced three distinct jets of fluid. Summing the components of fluid momentum in the jets provided an estimate of fish momentum that did not differ significantly from momentum measured from the escaping fish body. In contrast to conclusions drawn from previous kinematic analyses and theoretical models, the caudal fin generated momentum that opposes the escape during stage one, while the body bending during stage one contributed substantial propulsive momentum. Additionally, the dorsal and anal fins each contributed substantial momentum. The results underscore the importance of the dorsal and anal fins as propulsors and suggest that the size and placement of these fins may be a key determinant of fast start performance. PMID:18931309

  15. Ion Escape from the Ionosphere of Titan

    NASA Technical Reports Server (NTRS)

    Hartle, R.; Sittler, E.; Lipatov, A.

    2008-01-01

    Ions have been observed to flow away from Titan along its induced magnetic tail by the Plasma Science Instrument (PLS) on Voyager 1 and the Cassini Plasma Spectrometer (CAPS) on Cassini. In both cases, the ions have been inferred to be of ionospheric origin. Recent plasma measurements made at another unmagnetized body, Venus, have also observed similar flow in its magnetic tail. Much earlier, the possibility of such flow was inferred when ionospheric measurements made from the Pioneer Venus Orbiter (PVO) were used to derive upward flow and acceleration of H(+), D(+) and O(+) within the nightside ionosphere of Venus. The measurements revealed that the polarization electric field in the ionosphere produced the principal upward force on these light ions. The resulting vertical flow of H(+) and D(+) was found to be the dominant escape mechanism of hydrogen and deuterium, corresponding to loss rates consistent with large oceans in early Venus. Other electrodynamic forces were unimportant because the plasma beta in the nightside ionosphere of Venus is much greater than one. Although the plasma beta is also greater than one on Titan, ion acceleration is expected to be more complex, especially because the subsolar point and the subflow points can be 180 degrees apart. Following what we learned at Venus, upward acceleration of light ions by the polarization electric field opposing gravity in the ionosphere of Titan will be described. Additional electrodynamic forces resulting from the interaction of Saturn's magnetosphere with Titan's ionosphere will be examined using a recent hybrid model.

  16. WANDERING STARS: AN ORIGIN OF ESCAPED POPULATIONS

    SciTech Connect

    Teyssier, Maureen; Johnston, Kathryn V.; Shara, Michael M.

    2009-12-10

    We demonstrate that stars beyond the virial radii of galaxies may be generated by the gravitational impulse received by a satellite as it passes through the pericenter of its orbit around its parent. These stars may become energetically unbound (escaped stars), or may travel to further than a few virial radii for longer than a few Gyr, but still remain energetically bound to the system (wandering stars). Larger satellites (10%-100% the mass of the parent), and satellites on more radial orbits are responsible for the majority of this ejected population. Wandering stars could be observable on Mpc scales via classical novae, and on 100 Mpc scales via Type Ia supernova. The existence of such stars would imply a corresponding population of barely bound, old, high-velocity stars orbiting the Milky Way, generated by the same physical mechanism during the Galaxy's formation epoch. Sizes and properties of these combined populations should place some constraints on the orbits and masses of the progenitor objects from which they came, providing insight into the merging histories of galaxies in general and the Milky Way in particular.

  17. Immune Escape Strategies of Malaria Parasites

    PubMed Central

    Gomes, Pollyanna S.; Bhardwaj, Jyoti; Rivera-Correa, Juan; Freire-De-Lima, Celio G.; Morrot, Alexandre

    2016-01-01

    Malaria is one of the most life-threatening infectious diseases worldwide. Immunity to malaria is slow and short-lived despite the repeated parasite exposure in endemic areas. Malaria parasites have evolved refined machinery to evade the immune system based on a range of genetic changes that include allelic variation, biomolecular exposure of proteins, and intracellular replication. All of these features increase the probability of survival in both mosquitoes and the vertebrate host. Plasmodium species escape from the first immunological trap in its invertebrate vector host, the Anopheles mosquitoes. The parasites have to pass through various immunological barriers within the mosquito such as anti-microbial molecules and the mosquito microbiota in order to achieve successful transmission to the vertebrate host. Within these hosts, Plasmodium species employ various immune evasion strategies during different life cycle stages. Parasite persistence against the vertebrate immune response depends on the balance among virulence factors, pathology, metabolic cost of the host immune response, and the parasites ability to evade the immune response. In this review we discuss the strategies that Plasmodium parasites use to avoid the vertebrate host immune system and how they promote successful infection and transmission. PMID:27799922

  18. Nonthermal atmospheric escape from Mars and Titan

    NASA Astrophysics Data System (ADS)

    Lammer, H.; Bauer, S. J.

    1991-02-01

    Energy flux spectra and particle concentrations of the hot O and N coronae from Mars and Titan, respectively, resulting primarily from dissociative recombination of molecular ions, have been calculated by means of a Monte Carlo method. The calculated energy flux spectra lead to an escape flux phi(esc) about 6 x 10 to the 6th/sq cm per sec for Mars and phi(esc) about 2 x 10 to 6th/sq cm per sec for Titan, corresponding to a mass loss of about 0.14 kg/s for Mars and about 0.3 kg/s for Titan. (The contribution of electron impact ionization on N2 amounts to only about 25 percent of Titan's mass loss). Mass loss via solar and magnetospheric wind is also estimated using newly calculated mass loading limits. The mass loss via ion pickup from the extended hot atom corona for Mars amounts to about 0.25 kg/s (O/+/) and for Titan to about 50 g/s (N2/+/or H2CN/+/). Thus, the total mass loss rate from Mars and Titan is about the same (i.e., 0.4 kg/s).

  19. [Interferon : antiviral mechanisms and viral escape].

    PubMed

    Espert, Lucile; Gongora, Céline; Mechti, Nadir

    2003-02-01

    15 % of human cancers have virus origin, meaning that viruses are the second cause of cancers after tabagism. The knowledge of antiviral mechanisms is essential for treatment and prevention of infection evolution towards cancers. Interferons (IFNs) are a large family of multifunctional cytokines. They are involved in regulation of cell growth and modulation of immune response. But, all these functions seem to converge toward the most important of them : the antiviral activity. IFN secretion is the first event induced by viral infection, and will act on specific receptors on neighbour cells and prevent their infection by inducing numbers of antiviral genes. Although few of them are well known like the PKR, the 2-5OAS/RNase L pathway and the Mx proteins, many others need extensive studies to understand the wide range of IFN effect. Viruses have evolved to circumvent the IFN antiviral activity, and are able not only to divert the cellular machinery but also to lure the antiviral mechanisms of the host cell. The purpose of this review is to describe the many antiviral pathways and proteins induced by IFNs and to summarize the strategies of viral escape. PMID:12660132

  20. Escaping the resource curse in China.

    PubMed

    Cao, Shixiong; Li, Shurong; Ma, Hua; Sun, Yutong

    2015-02-01

    Many societies face an income gap between rich regions with access to advanced technology and regions that are rich in natural resources but poorer in technology. This "resource curse" can lead to a Kuznets trap, in which economic inequalities between the rich and the poor increase during the process of socioeconomic development. This can also lead to depletion of natural resources, environmental degradation, social instability, and declining socioeconomic development. These problems will jeopardize China's achievements if the current path continues to be pursued without intervention by the government to solve the problems. To mitigate the socioeconomic development gap between western and eastern China, the government implemented its Western Development Program in 2000. However, recent data suggest that this program has instead worsened the resource curse. Because each region has its own unique strengths and weaknesses, China must escape the resource curse by accounting for this difference; in western China, this can be done by improving education, promoting high-tech industry, adjusting its economic strategy to balance regional development, and seeking more sustainable approaches to socioeconomic development.

  1. Candida albicans escapes from mouse neutrophils.

    PubMed

    Ermert, David; Niemiec, Maria J; Röhm, Marc; Glenthøj, Andreas; Borregaard, Niels; Urban, Constantin F

    2013-08-01

    Candida albicans, the most commonly isolated human fungal pathogen, is able to grow as budding yeasts or filamentous forms, such as hyphae. The ability to switch morphology has been attributed a crucial role for the pathogenesis of C. albicans. To mimic disseminated candidiasis in humans, the mouse is the most widely used model organism. Neutrophils are essential immune cells to prevent opportunistic mycoses. To explore potential differences between the rodent infection model and the human host, we compared the interactions of C. albicans with neutrophil granulocytes from mice and humans. We revealed that murine neutrophils exhibited a significantly lower ability to kill C. albicans than their human counterparts. Strikingly, C. albicans yeast cells formed germ tubes upon internalization by murine neutrophils, eventually rupturing the neutrophil membrane and thereby, killing the phagocyte. On the contrary, growth and subsequent escape of C. albicans are blocked inside human neutrophils. According to our findings, this blockage in human neutrophils might be a result of higher levels of MPO activity and the presence of α-defensins. We therefore outline differences in antifungal immune defense between humans and mouse strains, which facilitates a more accurate interpretation of in vivo results.

  2. Dications and thermal ions in planetary atmospheric escape

    NASA Astrophysics Data System (ADS)

    Lilensten, J.; Simon Wedlund, C.; Barthélémy, M.; Thissen, R.; Ehrenreich, D.; Gronoff, G.; Witasse, O.

    2013-01-01

    In the recent years, the presence of dications in the atmospheres of Mars, Venus, Earth and Titan has been modeled and assessed. These studies also suggested that these ions could participate to the escape of the planetary atmospheres because a large fraction of them is unstable and highly energetic. When they dissociate, their internal energy is transformed into kinetic energy which may be larger than the escape energy. The goal of this study is to assess the impact of the doubly-charged ions in the escape of CO2-dominated planetary atmospheres and to compare it to the escape of thermal photo-ions. We solve a Boltzmann transport equation at daytime taking into account the dissociative states of CO2++ for a simplified single constituent atmosphere of a case-study planet. We compute the escape of fast ions using a Beer-Lambert approach. We study three test-cases. On a Mars-analog planet in today's conditions, we retrieve the measured electron escape flux. When comparing the two mechanisms (i.e. excluding solar wind effects, sputtering, etc.), the escape due to the fast ions issuing from the dissociation of dications may account for up to 6% of the total and the escape of thermal ions for the remaining. We show that these two mechanisms cannot explain the escape of the atmosphere since the magnetic field vanished and even contribute only marginally to this loss. We show that with these two mechanisms, the atmosphere of a Mars analog planet would empty in another giga years and a half. At Venus orbit, the contribution of the dications in the escape rate is negligible. When simulating the hot Jupiter HD 209458 b, the two processes cannot explain the measured escape flux of C+. This study shows that the dications may constitute a source of the escape of planetary atmospheres which had not been taken into account until now. This source, although marginal, is not negligible. The influence of the photoionization is of course large, but cannot explain alone the loss of Mars

  3. Virological and immunological connotations of apoptotic and anti-apoptotic forces in neoplasia.

    PubMed

    Sinkovics, J G; Horvath, J C

    2001-09-01

    Against the background of its earliest recognition, programmed cell death (PCD) or apoptosis (A) is presented in its fundamental biological contexts. Techniques of its demonstration are listed. Former original works of the authors encompass designs for genetically engineered oncolytic viruses. Presented here are observations on mesenchymal stromal cells of the bone marrow serving as feeder layers to chronic lymphocytic leukemia (CLL) cells (recently rediscovered elsewhere as subverted "nurse cells" protecting CLL cells from A). A-resistant human melanoma cells are shown to expropriate the Fas ligand to Fas receptor (CD95; APO-1) (FasL-->FasR) system for their autocrine growth loop not only in melanoma cells coexpressing CD95 and its ligand but also in CD95-positive melanoma cells undergoing divisions when exposed to CD95 ligand. Bi-directional A-induction is demonstrated upon the encounter of cytotoxic lymphocytes and targeted tumor cells as exemplified with lymphomas; and chemotherapy-induced A of malignant cells as exemplified by paclitaxel-induced PCD of Reed-Sternberg (RS) cells in a case of chemotherapy-resistant Hodgkin's disease (HD). A list of interventions capable of inducing A in tumor cells is provided. These interventions are of potential therapeutic value. The balance of apoptotic and anti-apoptotic forces in virally infected normal and malignant cells is discussed.

  4. Topological Transitions in Mitochondrial Membranes controlled by Apoptotic Proteins

    NASA Astrophysics Data System (ADS)

    Hwee Lai, Ghee; Sanders, Lori K.; Mishra, Abhijit; Schmidt, Nathan W.; Wong, Gerard C. L.; Ivashyna, Olena; Schlesinger, Paul H.

    2010-03-01

    The Bcl-2 family comprises pro-apoptotic proteins, capable of permeabilizing the mitochondrial membrane, and anti-apoptotic members interacting in an antagonistic fashion to regulate programmed cell death (apoptosis). They offer potential therapeutic targets to re-engage cellular suicide in tumor cells but the extensive network of implicated protein-protein interactions has impeded full understanding of the decision pathway. We show, using synchrotron x-ray diffraction, that pro-apoptotic proteins interact with mitochondrial-like model membranes to generate saddle-splay (negative Gaussian) curvature topologically required for pore formation, while anti-apoptotic proteins can deactivate curvature generation by molecules drastically different from Bcl-2 family members and offer evidence for membrane-curvature mediated interactions general enough to affect very disparate systems.

  5. Optical determination of intracellular water in apoptotic cells.

    PubMed

    Model, Michael A; Schonbrun, Ethan

    2013-12-01

    Intracellular water plays a critical role in apoptotic and necrotic cell death. We describe a method for quantifying cell water by application of two previously described variants of transmission microscopy. By taking two axially displaced brightfield images, the phase shift of the transmitted wave was computed using the transport-of-intensity equation. At the same time, cell thickness was determined by transmission through an externally applied dye ('transmission-through-dye' microscopy); switching between these two imaging modalities was accomplished by simply changing the illumination wavelength. The sets of data thus obtained allow computation of the refractive index and cell water content within individual cells. The method was illustrated using cells treated with apoptotic agents staurosporine and actinomycin D and with necrosis inducer ionomycin. Water imaging allows discrimination between apoptotic volume decrease due to dehydration from that due to detachment of apoptotic bodies and can be used on samples where cell volume determination alone would be difficult or insufficient.

  6. Multi-site Phosphorylation Regulates Bim Stability and Apoptotic Activity

    PubMed Central

    Hübner, Anette; Barrett, Tamera; Flavell, Richard A.; Davis, Roger J.

    2008-01-01

    The pro-apoptotic BH3-only protein Bim is established to be an important mediator of signaling pathways that induce cell death. Multi-site phosphorylation of Bim by several members of the MAP kinase group is implicated as a regulatory mechanism that controls the apoptotic activity of Bim. To test the role of Bim phosphorylation in vivo, we constructed mice with a series of mutant alleles that express phosphorylation-defective Bim proteins. We show that mutation of the phosphorylation site Thr-112 causes decreased binding of Bim to the anti-apoptotic protein Bcl2 and can increase cell survival. In contrast, mutation of the phosphorylation sites Ser-55, Ser-65, and Ser-73 can cause increased apoptosis because of reduced proteasomal degradation of Bim. Together, these data indicate that phosphorylation can regulate Bim by multiple mechanisms and that the phosphorylation of Bim on different sites can contribute to the sensitivity of cellular apoptotic responses. PMID:18498746

  7. In vitro study of immunosuppressive effect of apoptotic cells*

    PubMed Central

    Zhang, Wen-jin; Zheng, Shu-sen

    2005-01-01

    Recent studies revealed that apoptotic cells are actively involved in immunosuppression and anti-inflammation. After being phagocytosed by macrophages, apoptotic cells can actively regulate cytokines secretion from lipopolysaccharide (LPS)-stimulated macrophages, in which the secretion of immunosuppressive cytokines such as interleukin-10 (IL-10) is increased while the pro-inflammatory cytokines such as tumor necrosis factor-alpha (TNFα), interleukin-1beta (IL-1β) and leukin-8 (IL-8) are suppressed. In this paper, we first present evidence that phagocytosed apoptotic cells regulate cytokine secretion of LPS-stimulated macrophages, but also inhibit the activation of T lymphocytes stimulated by ConA. These data suggest that apoptotic cells can alter the biological behavior of macrophages which gain immunosuppressive property. PMID:16130196

  8. Evolutionary escape on complex genotype-phenotype networks.

    PubMed

    Ibáñez-Marcelo, Esther; Alarcón, Tomás

    2016-04-01

    We study the problem of evolutionary escape that is the process whereby a population under sudden changes in the selective pressures acting upon it try to evade extinction by evolving from previously well-adapted phenotypes to those that are favoured by the new selective pressure. We perform a comparative analysis between results obtained by modelling genotype space as a regular hypercube (H-graphs), which is the scenario considered in previous work on the subject, to those corresponding to a complex genotype-phenotype network (B-graphs). In order to analyse the properties of the escape process on both these graphs, we apply a general theory based on multi-type branching processes to compute the evolutionary dynamics and probability of escape. We show that the distribution of distances between phenotypes in B-graphs exhibits a much larger degree of heterogeneity than in H-graphs. This property, one of the main structural differences between both types of graphs, causes heterogeneous behaviour in all results associated to the escape problem. We further show that, due to the heterogeneity characterising escape on B-graphs, escape probability can be underestimated by assuming a regular hypercube genotype network, even if we compare phenotypes at the same distance in H-graphs. Similarly, it appears that the complex structure of B-graphs slows down the rate of escape.

  9. Efficiently estimating salmon escapement uncertainty using systematically sampled data

    USGS Publications Warehouse

    Reynolds, Joel H.; Woody, Carol Ann; Gove, Nancy E.; Fair, Lowell F.

    2007-01-01

    Fish escapement is generally monitored using nonreplicated systematic sampling designs (e.g., via visual counts from towers or hydroacoustic counts). These sampling designs support a variety of methods for estimating the variance of the total escapement. Unfortunately, all the methods give biased results, with the magnitude of the bias being determined by the underlying process patterns. Fish escapement commonly exhibits positive autocorrelation and nonlinear patterns, such as diurnal and seasonal patterns. For these patterns, poor choice of variance estimator can needlessly increase the uncertainty managers have to deal with in sustaining fish populations. We illustrate the effect of sampling design and variance estimator choice on variance estimates of total escapement for anadromous salmonids from systematic samples of fish passage. Using simulated tower counts of sockeye salmon Oncorhynchus nerka escapement on the Kvichak River, Alaska, five variance estimators for nonreplicated systematic samples were compared to determine the least biased. Using the least biased variance estimator, four confidence interval estimators were compared for expected coverage and mean interval width. Finally, five systematic sampling designs were compared to determine the design giving the smallest average variance estimate for total annual escapement. For nonreplicated systematic samples of fish escapement, all variance estimators were positively biased. Compared to the other estimators, the least biased estimator reduced bias by, on average, from 12% to 98%. All confidence intervals gave effectively identical results. Replicated systematic sampling designs consistently provided the smallest average estimated variance among those compared.

  10. Apoptotic pathways as a therapeutic target for colorectal cancer treatment.

    PubMed

    Abraha, Aman M; Ketema, Ezra B

    2016-08-15

    Colorectal cancer is the second leading cause of death from cancer among adults. The disease begins as a benign adenomatous polyp, which develops into an advanced adenoma with high-grade dysplasia and then progresses to an invasive cancer. Appropriate apoptotic signaling is fundamentally important to preserve a healthy balance between cell death and cell survival and in maintaining genome integrity. Evasion of apoptotic pathway has been established as a prominent hallmark of several cancers. During colorectal cancer development, the balance between the rates of cell growth and apoptosis that maintains intestinal epithelial cell homeostasis gets progressively disturbed. Evidences are increasingly available to support the hypothesis that failure of apoptosis may be an important factor in the evolution of colorectal cancer and its poor response to chemotherapy and radiation. The other reason for targeting apoptotic pathway in the treatment of cancer is based on the observation that this process is deregulated in cancer cells but not in normal cells. As a result, colorectal cancer therapies designed to stimulate apoptosis in target cells would play a critical role in controlling its development and progression. A better understanding of the apoptotic signaling pathways, and the mechanisms by which cancer cells evade apoptotic death might lead to effective therapeutic strategies to inhibit cancer cell proliferation with minimal toxicity and high responses to chemotherapy. In this review, we analyzed the current understanding and future promises of apoptotic pathways as a therapeutic target in colorectal cancer treatment. PMID:27574550

  11. Apoptotic pathways as a therapeutic target for colorectal cancer treatment

    PubMed Central

    Abraha, Aman M; Ketema, Ezra B

    2016-01-01

    Colorectal cancer is the second leading cause of death from cancer among adults. The disease begins as a benign adenomatous polyp, which develops into an advanced adenoma with high-grade dysplasia and then progresses to an invasive cancer. Appropriate apoptotic signaling is fundamentally important to preserve a healthy balance between cell death and cell survival and in maintaining genome integrity. Evasion of apoptotic pathway has been established as a prominent hallmark of several cancers. During colorectal cancer development, the balance between the rates of cell growth and apoptosis that maintains intestinal epithelial cell homeostasis gets progressively disturbed. Evidences are increasingly available to support the hypothesis that failure of apoptosis may be an important factor in the evolution of colorectal cancer and its poor response to chemotherapy and radiation. The other reason for targeting apoptotic pathway in the treatment of cancer is based on the observation that this process is deregulated in cancer cells but not in normal cells. As a result, colorectal cancer therapies designed to stimulate apoptosis in target cells would play a critical role in controlling its development and progression. A better understanding of the apoptotic signaling pathways, and the mechanisms by which cancer cells evade apoptotic death might lead to effective therapeutic strategies to inhibit cancer cell proliferation with minimal toxicity and high responses to chemotherapy. In this review, we analyzed the current understanding and future promises of apoptotic pathways as a therapeutic target in colorectal cancer treatment. PMID:27574550

  12. 46 CFR 108.155 - Restrictions on means of escape utilized.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... means of escape utilized. A required means of escape may not be a vertical ladder or deck scuttle, except that one of the means of escape may be a vertical ladder or deck scuttle if a stairway would...

  13. 16. INTERIOR VIEW OF SUBMARINE SECTION AT 110FOOT LEVEL, ESCAPE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    16. INTERIOR VIEW OF SUBMARINE SECTION AT 110-FOOT LEVEL, ESCAPE TRAINING TANK, SHOWING LADDER TO ESCAPE TANK, LOOKING SOUTH - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  14. Alterations in oxidative, inflammatory and apoptotic events in short-lived and long-lived mice testes

    PubMed Central

    Matzkin, María Eugenia; Miquet, Johanna Gabriela; Fang, Yimin; Hill, Cristal Monique; Turyn, Daniel; Calandra, Ricardo Saúl; Bartke, Andrzej; Frungieri, Mónica Beatriz

    2016-01-01

    Aged testes undergo profound histological and morphological alterations leading to a reduced functionality. Here, we investigated whether variations in longevity affect the development of local inflammatory processes, the oxidative state and the occurrence of apoptotic events in the testis. To this aim, well-established mouse models with delayed (growth hormone releasing hormone-knockout and Ames dwarf mice) or accelerated (growth hormone-transgenic mice) aging were used. We hereby show that the testes of short-lived mice show a significant increase in cyclooxygenase 2 expression, PGD2 production, lipid peroxidation, antioxidant enzymes expression, local macrophages and TUNEL-positive germ cells numbers, and the levels of both pro-caspase-3 and cleaved caspase-3. In contrast, although the expression of antioxidant enzymes remained unchanged in testes of long-lived mice, the remainder of the parameters assessed showed a significant reduction. This study provides novel evidence that longevity confers anti-inflammatory, anti-oxidant and anti-apoptotic capacities to the adult testis. Oppositely, short-lived mice suffer testicular inflammatory, oxidative and apoptotic processes. PMID:26805572

  15. JunD-mediated repression of GADD45α and γ regulates escape from cell death in prostate cancer

    PubMed Central

    de Vasconcellos, Jaíra Ferreira; Czibere, Akos; Wang, Yihong; Paccez, Juliano D; Gu, Xuesong; Zhou, Jin-Rong; Libermann, Towia A

    2011-01-01

    The AP-1 transcription factor complex has been implicated in a variety of biological processes including cell differentiation, proliferation, apoptosis and oncogenic transformation. We previously established that activation of the AP-1 family member JunD contributes to deregulated expression of the anti-apoptotic IL-6 gene in prostate cancer cells. We now show that inhibition of JunD in prostate cancer cells results in GADD45α and γ dependent induction of cell death and inhibition of tumor growth that is mediated at least partially via c-Jun N-terminal kinase (JNK) and p38 kinase activation. Apoptosis induction by dominant negative JunD and JNK and p38 kinase activation are impeded upon knock down of GADD45α and γ expression by small interfering RNA, most vividly demonstrating the central role of GADD45α and γ in JunD-mediated escape of prostate cancer cells from programmed cell death. PMID:21734453

  16. 42. Launch Area, Underground Missile Storage Structure, detail of escape ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    42. Launch Area, Underground Missile Storage Structure, detail of escape hatch, elevator and air vent VIEW SOUTH - NIKE Missile Battery PR-79, Launch Area, East Windsor Road south of State Route 101, Foster, Providence County, RI

  17. 40. Launch Area, Underground Missile Storage Structure, detail of escape ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    40. Launch Area, Underground Missile Storage Structure, detail of escape hatch and decontamination shower VIEW WEST - NIKE Missile Battery PR-79, Launch Area, East Windsor Road south of State Route 101, Foster, Providence County, RI

  18. Is tube-escape learning by protozoa associative learning?

    PubMed

    Hinkle, D J; Wood, D C

    1994-02-01

    The ciliate protozoa, Stentor and Paramecium, have been reported to escape from the bottom end of narrow capillary tubes into a larger volume of medium with increasing rapidity over the course of trials. This change in behavior has been considered an apparent example of associative learning. This decrease in escape time is not due to a change in the protozoa's environment, their swimming speed, frequency of ciliary reversals, or the proportion of time spent forward or backward swimming. Instead, most of the decrease results from a decrease in the proportion of time spent in upward swimming. However, a similar decrease in upward swimming occurs when the task is altered to require escape from the upper end of the capillary tubes. Because the protozoa exhibit the same change in behavior regardless of the reinforcing stimulus, tube-escape learning is not associative learning. PMID:8192854

  19. 10. VIEW OF SILO DOORS, AIR VENTS, AND ESCAPE HATCH, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    10. VIEW OF SILO DOORS, AIR VENTS, AND ESCAPE HATCH, LOOKING EAST. WHITE STRUCTURES BELONG TO CURRENT OCCUPANTS Everett Weinreb, photographer, April 1988 - Los Pinetos Nike Missile Site, Santa Clara Road, Los Angeles National Forest, Sylmar, Los Angeles County, CA

  20. 14. View inside Building 802, the "Escape Hatch" at the ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    14. View inside Building 802, the "Escape Hatch" at the rear of the "Sleeping Quarters", facing south. - Naval Air Station Fallon, 100-man Fallout Shelter, 800 Complex, off Carson Road near intersection of Pasture & Berney Roads, Fallon, Churchill County, NV

  1. 39. VIEW OF HORSE AND ESCAPE STEPS ON ARIZONA CANAL, ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    39. VIEW OF HORSE AND ESCAPE STEPS ON ARIZONA CANAL, LOOKING NORTH ON THE SALT RIVER INDIAN RESERVATION Photographer: James Eastwood, June 1990 - Arizona Canal, North of Salt River, Phoenix, Maricopa County, AZ

  2. 46 CFR 169.313 - Means of escape.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... escape is acceptable provided that— (1) There is no source of fire in the space, such as a galley stove... vessel or those on board. (g) Dead end corridors or the equivalent, more than 40 feet in length...

  3. Prey escaping wolves, Canis lupus, despite close proximity

    USGS Publications Warehouse

    Nelson, M.E.; Mech, L.D.

    1993-01-01

    We describe attacks by wolf (Canis lupus) packs in Minnesota on a white-tailed deer (Odocoileus virginianus) and a moose (Alces alces) in which wolves were within contact distance of the prey but in which the prey escaped.

  4. Experimental Analysis and Extinction of Self-Injurious Escape Behavior.

    ERIC Educational Resources Information Center

    Iwata, Brian A.; And Others

    1990-01-01

    Three studies investigated environmental correlates of self-injurious behavior in seven developmentally disabled children and adolescents which were then later used for treatment. Correlates investigated included positive reinforcement, negative reinforcement, automatic reinforcement, and control. "Escape extinction" was successfully applied…

  5. Dissociated neural effects of cortisol depending on threat escapability.

    PubMed

    Montoya, Estrella R; van Honk, Jack; Bos, Peter A; Terburg, David

    2015-11-01

    Evolution has provided us with a highly flexible neuroendocrine threat system which, depending on threat imminence, switches between active escape and passive freezing. Cortisol, the "stress-hormone", is thought to play an important role in both fear behaviors, but the exact mechanisms are not understood. Using pharmacological functional magnetic resonance imaging we investigated how cortisol modulates the brain's fear systems when humans are under virtual-predator attack. We show dissociated neural effects of cortisol depending on whether escape from threat is possible. During inescapable threat cortisol reduces fear-related midbrain activity, whereas in anticipation of active escape cortisol boosts activity in the frontal salience network (insula and anterior cingulate cortex), which is involved in autonomic control, visceral perception and motivated action. Our findings suggest that cortisol adjusts the human neural threat system from passive fear to active escape, which illuminates the hormone's crucial role in the adaptive flexibility of fear behaviors.

  6. Escaping the trap of allergic rhinitis.

    PubMed

    Rossi, Oliviero; Massaro, Ilaria; Caminati, Marco; Quecchia, Cristina; Fassio, Filippo; Heffler, Enrico; Canonica, Giorgio Walter

    2015-01-01

    allergic rhinitis or non-allergic rhinitis, with statistical significance noted from the first day of treatment, with treatment difference maintained for a full year. Taken together, these data suggest that MP29-02 may improve the lives of many of our patients, enabling them to finally escape the allergic rhinitis trap. PMID:26244040

  7. Surface code—biophysical signals for apoptotic cell clearance

    NASA Astrophysics Data System (ADS)

    Biermann, Mona; Maueröder, Christian; Brauner, Jan M.; Chaurio, Ricardo; Janko, Christina; Herrmann, Martin; Muñoz, Luis E.

    2013-12-01

    Apoptotic cell death and the clearance of dying cells play an important and physiological role in embryonic development and normal tissue turnover. In contrast to necrosis, apoptosis proceeds in an anti-inflammatory manner. It is orchestrated by the timed release and/or exposure of so-called ‘find-me’, ‘eat me’ and ‘tolerate me’ signals. Mononuclear phagocytes are attracted by various ‘find-me’ signals, including proteins, nucleotides, and phospholipids released by the dying cell, whereas the involvement of granulocytes is prevented via ‘stay away’ signals. The exposure of anionic phospholipids like phosphatidylserine (PS) by apoptotic cells on the outer leaflet of the plasma membrane is one of the main ‘eat me’ signals. PS is recognized by a number of innate receptors as well as by soluble bridging molecules on the surface of phagocytes. Importantly, phagocytes are able to discriminate between viable and apoptotic cells both exposing PS. Due to cytoskeleton remodeling PS has a higher lateral mobility on the surfaces of apoptotic cells thereby promoting receptor clustering on the phagocyte. PS not only plays an important role in the engulfment process, but also acts as ‘tolerate me’ signal inducing the release of anti-inflammatory cytokines by phagocytes. An efficient and fast clearance of apoptotic cells is required to prevent secondary necrosis and leakage of intracellular danger signals into the surrounding tissue. Failure or prolongation of the clearance process leads to the release of intracellular antigens into the periphery provoking inflammation and development of systemic inflammatory autoimmune disease like systemic lupus erythematosus. Here we review the current findings concerning apoptosis-inducing pathways, important players of apoptotic cell recognition and clearance as well as the role of membrane remodeling in the engulfment of apoptotic cells by phagocytes.

  8. Pioneer Venus Orbiter (PVO) Ionosphere Evidence for Atmospheric Escape

    NASA Astrophysics Data System (ADS)

    Grebowsky, J. M.; Hoegy, W. R.

    2009-12-01

    An early estimate of escape of H2O from Venus [McElroy et al., 1982] using observed hot oxygen densities inferred by Nagy et al. [1981] from PVO OUVS 1304 Å dayglow and using ionization rates from photoionization and electron impact. This resulted in an estimated oxygen ionization rate planet-wide above the plasmapause of 3x1025 atoms/s. Based on the energetic O+ being swept up and removed by solar wind, McElroy et al. [1982] gave an estimate of a loss rate for O of 6x106 atoms/cm2/s. Using a different method of estimating escape based data in the ionotail of Venus, Brace et al. [1987] estimated a total planetary O+ escape rate of 5x1025 ions/s. Their estimate was based on PVO measurements of superthermal O+ (energy range 9-16 eV) in the tail ray plasma between 2000 and 3000 km. Their estimated global mean flux was 107 atoms/cm2/s. The two escape rates are remarkably close considering all the errors involved in such estimates of escape. A study of escape by Luhmann et al. [2008] using VEX observations at low solar activity finds modest escape rates, prompting the authors to reconsider the evidence from both PVO and VEX of the possibility of enhanced escape during extreme interplanetary conditions. We reexamine the variation of escape under different solar wind conditions using ion densities and plasma content in the dayside and nightside of Venus using PVO ionosphere density during times of high solar activity. Citations: Brace, L.H., W. T. Kasprzak, H.A. Taylor, R. F. Theis, C. T. Russess, A. Barnes, J. D. Mihalov, and D. M. Hunten, "The Ionotail of Venus: Its Configuration and Evidence for Ion Escape", J. Geophys. Res. 92, 15-26, 1987. Luhmann, J.G., A. Fedorov, S. Barabash, E. Carlsson, Y. Futaana, T.L. Zhang, C.T. Russell, J.G. Lyon, S.A. Ledvina, and D.A. Brain, “Venus Express observations of atmospheric oxygen escape during the passage of several coronal mass ejections”, J. Geophys. Res., 113, 2008. McElroy, M. B., M. J. Prather, J. M. Rodiquez, " Loss

  9. Quantifying Distributions of the Lyman Continuum Escape Fraction

    NASA Astrophysics Data System (ADS)

    Cen, Renyue; Kimm, Taysun

    2015-03-01

    Simulations have indicated that most of the escaped Lyman continuum (LyC) photons escape through a minority of solid angles with near complete transparency, with the remaining majority of the solid angles largely opaque, resulting in a very broad and skewed probability distribution function (PDF) of the escape fraction when viewed at different angles. Thus, the escape fraction of LyC photons of a galaxy observed along a line of sight merely represents the properties of the interstellar medium along that line of sight, which may be an ill-representation of the true escape fraction of the galaxy averaged over its full sky. Here we study how LyC photons escape from galaxies at z=4-6, utilizing high-resolution large-scale cosmological radiation-hydrodynamic simulations. We compute the PDF of the mean escape fraction (< {{f}esc,1D}> ) averaged over mock observational samples, as a function of the sample size, compared to the true mean (if an infinite sample size is used). We find that, when the sample size is small, the apparent mean skews to the low end. For example, for a true mean of 6.7%, an observational sample of (2,10,50) galaxies at z = 4 would have have a 2.5% probability of obtaining the sample mean lower than ≤ft< {{f}esc,1D} \\right> = (0.007%, 1.8%, 4.1%) and a 2.5% probability of obtaining the sample mean greater than (43%, 18%, 11%). Our simulations suggest that at least ∼100 galaxies should be stacked in order to constrain the true escape fraction within 20% uncertainty.

  10. Ion escape from Venus using statistical distribution functions

    NASA Astrophysics Data System (ADS)

    Nordstrom, T.; Stenberg, G.; Nilsson, H.; Barabash, S.; Futaana, Y.

    2012-04-01

    We use more than three years of data from the ASPERA-4 instrument onboard Venus Express to compile statistical distribution functions of ion flux in and around induced magnetosphere of Venus. We present samples of statistical distribution functions, as well average flux patterns in the near Venus space based on the statistical distribution functions. The statistical distribution functions allows for a compensation of biased sampling regarding both position and angular coverage of the instrument. Protons and heavy ions (mass/charge > 16) are the major ion species escaping from Venus. The escape is due to acceleration of planetary ions by energy transfer from the solar wind. The ion escape appears to exclusively take place in the induced magnetotail region and no heavy ions are present in the magnetosheath. Protons of solar wind origin are travelling around the planet and penetrating the tail, resulting in a mix of planetary and solar wind protons inside the induced magnetosphere boundary. The escape rates of ions inside the tail agree with results from recent published studies, where other analysis methods have been used. We also compare our results for Venus with a recent study of ion escape from Mars, where the same analysis method has been applied to data from the ASPERA-3 instrument on Mars Express. Both Mars and Venus are unmagnetized planets and are expected to interact similarly with the solar wind. On Mars the heavy ions are seen escaping in both the magnetosheath and tail regions as opposed to Venus where escape only takes place inside the tail. A possible explanation is that the magnetosphere of Mars is smaller compared to the ion gyroradius, making it easier for the ions to pass through the induced magnetosphere boundary. On both planets the escape rates of heavy ions in the tail are constant with increasing tail distance, verifying that the ions are leaving the planet in this region.

  11. Pivotal role of a DEVD-sensitive step in etoposide-induced and Fas-mediated apoptotic pathways.

    PubMed Central

    Dubrez, L; Savoy, I; Hamman, A; Solary, E

    1996-01-01

    We investigated the role of proteases in the pathway that leads from specific DNA damage induced by etoposide (VP-16), a topoisomerase II inhibitor, to apoptotic DNA fragmentation in the U937 human leukemic cell line. In a reconstituted cell-free system, Triton-soluble extracts from VP-16-treated cells induced internucleosomal DNA fragmentation in nuclei from untreated cells. This effect was inhibited by the tetrapeptide Ac-DEVD-CHO, a competitive inhibitor of the interleukin-1 beta-converting enzyme (ICE)-related protease CPP32, but was not influenced by Ac-YVAD-CHO and Ac-YVAD-CMK, two specific inhibitors of ICE. The three tetrapeptides inhibited Fas-mediated apoptotic DNA fragmentation in the cell-free system. Internucleosomal DNA fragmentation, triggered by either VP-16 or an anti-Fas antibody, was associated with proteolytic cleavage of the poly(ADP-ribose)polymerase (PARP), a decrease in the level of 32 kDa CPP32 proenzyme and the appearance of the CPP32 p17 active subunit. Conversely, the expression of Ich-1L, another ICE-like protease, remained stable in apoptotic U937 cells. Several cysteine and serine protease inhibitors prevented apoptotic DNA fragmentation by acting either upstream or downstream of the DEVD-sensitive protease(s) activation and PARP cleavage. We conclude that a DEVD-sensitive step, which could involve CPP32, plays a central role in the proteolytic pathway that mediates apoptotic DNA fragmentation in VP-16-treated leukemic cells at the crossing with Fas-mediated pathway. Images PMID:8896444

  12. p53 Protein-mediated regulation of phosphoglycerate dehydrogenase (PHGDH) is crucial for the apoptotic response upon serine starvation.

    PubMed

    Ou, Yang; Wang, Shang-Jui; Jiang, Le; Zheng, Bin; Gu, Wei

    2015-01-01

    Although p53 is frequently mutated in human cancers, about 80% of human melanomas retain wild-type p53. Here we report that PHGDH, the key metabolic enzyme that catalyzes the rate-limiting step of the serine biosynthesis pathway, is a target of p53 in human melanoma cells. p53 suppresses PHGDH expression and inhibits de novo serine biosynthesis. Notably, upon serine starvation, p53-mediated cell death is enhanced dramatically in response to Nutlin-3 treatment. Moreover, PHGDH has been found recently to be amplified frequently in human melanomas. We found that PHGDH overexpression significantly suppresses the apoptotic response, whereas RNAi-mediated knockdown of endogenous PHGDH promotes apoptosis under the same treatment. These results demonstrate an important role of p53 in regulating the serine biosynthesis pathway through suppressing PHGDH expression and reveal serine deprivation as a novel approach to sensitize p53-mediated apoptotic responses in human melanoma cells. PMID:25404730

  13. Initiation and spread of escape waves within animal groups

    PubMed Central

    Herbert-Read, James E.; Buhl, Jerome; Hu, Feng; Ward, Ashley J. W.; Sumpter, David J. T.

    2015-01-01

    The exceptional reactivity of animal collectives to predatory attacks is thought to be owing to rapid, but local, transfer of information between group members. These groups turn together in unison and produce escape waves. However, it is not clear how escape waves are created from local interactions, nor is it understood how these patterns are shaped by natural selection. By startling schools of fish with a simulated attack in an experimental arena, we demonstrate that changes in the direction and speed by a small percentage of individuals that detect the danger initiate an escape wave. This escape wave consists of a densely packed band of individuals that causes other school members to change direction. In the majority of cases, this wave passes through the entire group. We use a simulation model to demonstrate that this mechanism can, through local interactions alone, produce arbitrarily large escape waves. In the model, when we set the group density to that seen in real fish schools, we find that the risk to the members at the edge of the group is roughly equal to the risk of those within the group. Our experiments and modelling results provide a plausible explanation for how escape waves propagate in nature without centralized control. PMID:26064630

  14. Escaping From Predation At Low Reynolds Number: A Compensatory Mechanism

    NASA Astrophysics Data System (ADS)

    Gemmell, Brad; Sheng, Jian; Buskey, Ed

    2010-11-01

    Small planktonic organisms such as copepods are often the first foods for many species of fish and thus, subject to high predation rates. They have developed strong escape responses to attacks from visual predators and this behavior is found even in the youngest development stage. Because of their small size (approx. 100 μm), these juvenile copepods must contend with greater viscous forces than their predators during encounters. In this study, we investigate the role of viscosity on escape swimming performance of young copepods within the context of the environmental temperatures (10C-30C) these animals experience along the Texas coast. 3-Dimensional high speed (3000 frames per second) digital holographic techniques were used to elucidate kinematics and kinetics of swimming. Here we show that although escape velocity and acceleration are reduced as a function of both increasing viscosity and decreasing temperature, total escape distance is conserved. Interestingly, we observed no difference in the number swimming strokes per escape. Instead, the animals exhibit a compensatory mechanism based on increasing power stroke duration to recovery stroke duration to counter act the increasing viscosity at lower temperature. Flow analysis shows this results in the conservation of energy expenditure, and consequently escape distance.

  15. Optimal escapement in stage-structured fisheries with environmental stochasticity.

    PubMed

    Holden, Matthew H; Conrad, Jon M

    2015-11-01

    Stage-structured population models are commonly used to understand fish population dynamics and additionally for stock assessment. Unfortunately, there is little theory on the optimal harvest of stage-structured populations, especially in the presence of stochastic fluctuations. In this paper, we find closed form optimal equilibrium escapement policies for a three-dimensional, discrete-time, stage-structured population model with linear growth, post-harvest nonlinear recruitment, and stage-specific pricing and extend the analytic results to structured populations with environmental stochasticity. When only fishing reproductive adults, stochasticity does not affect optimal escapement policies. However, when harvesting immature fish, the addition of stochasticity can increase or decrease optimal escapement depending on the second and third derivative of the recruitment function. For logistic recruitment, stochasticity reduces optimal immature escapement by a multiplicative factor of one over one plus the variance of the environmental noise. Using hard clam, Mercenaria mercenaria, as an example and assuming Beverton-Holt recruitment, we show that optimal fishing of hard clam targets the immature stage class exclusively and that environmental stochasticity increases optimal escapement for low discount rates and decreases optimal escapement for high discount rates.

  16. Food Enzymes

    ERIC Educational Resources Information Center

    McBroom, Rachel; Oliver-Hoyo, Maria T.

    2007-01-01

    Many students view biology and chemistry as two unrelated, separate sciences; how these courses are generally taught in high schools may do little to change that impression. The study of enzymes provide a great opportunity for both biology and chemistry teachers to share with students the interdisciplinary nature of science. This article describes…

  17. Zinc Enzymes.

    ERIC Educational Resources Information Center

    Bertini, I.; And Others

    1985-01-01

    Discusses the role of zinc in various enzymes concerned with hydration, hydrolysis, and redox reactions. The binding of zinc to protein residues, properties of noncatalytic zinc(II) and catalytic zinc, and the reactions catalyzed by zinc are among the topics considered. (JN)

  18. Apoptotic photoreceptor cell death in mouse models of retinitis pigmentosa.

    PubMed Central

    Portera-Cailliau, C; Sung, C H; Nathans, J; Adler, R

    1994-01-01

    Retinitis pigmentosa (RP) is a group of inherited human diseases in which photoreceptor degeneration leads to visual loss and eventually to blindness. Although mutations in the rhodopsin, peripherin, and cGMP phosphodiesterase genes have been identified in some forms of RP, it remains to be determined whether these mutations lead to photoreceptor cell death through necrotic or apoptotic mechanisms. In this paper, we report a test of the hypothesis that photoreceptor cell death occurs by an apoptotic mechanism in three mouse models of RP: retinal degeneration slow (rds) caused by a peripherin mutation, retinal degeneration (rd) caused by a defect in cGMP phosphodiesterase, and transgenic mice carrying a rhodopsin Q344ter mutation responsible for autosomal dominant RP. Two complementary techniques were used to detect apoptosis-specific internucleosomal DNA fragmentation: agarose gel electrophoresis and in situ labeling of apoptotic cells by terminal dUTP nick end labeling. Both methods showed extensive apoptosis of photoreceptors in all three mouse models of retinal degeneration. We also show that apoptotic death occurs in the retina during normal development, suggesting that different mechanisms can cause photoreceptor death by activating an intrinsic death program in these cells. These findings raise the possibility that retinal degenerations may be slowed by interfering with the apoptotic mechanism itself. Images PMID:8302876

  19. Rho kinase regulates fragmentation and phagocytosis of apoptotic cells

    SciTech Connect

    Orlando, Kelly A.; Stone, Nicole L.; Pittman, Randall N. . E-mail: pittman@pharm.med.upenn.edu

    2006-01-01

    During the execution phase of apoptosis, a cell undergoes cytoplasmic and nuclear changes that prepare it for death and phagocytosis. The end-point of the execution phase is condensation into a single apoptotic body or fragmentation into multiple apoptotic bodies. Fragmentation is thought to facilitate phagocytosis; however, mechanisms regulating fragmentation are unknown. An isoform of Rho kinase, ROCK-I, drives membrane blebbing through its activation of actin-myosin contraction; this raises the possibility that ROCK-I may regulate other execution phase events, such as cellular fragmentation. Here, we show that COS-7 cells fragment into a number of small apoptotic bodies during apoptosis; treating with ROCK inhibitors (Y-27632 or H-1152) prevents fragmentation. Latrunculin B and blebbistatin, drugs that interfere with actin-myosin contraction, also inhibit fragmentation. During apoptosis, ROCK-I is cleaved and activated by caspases, while ROCK-II is not activated, but rather translocates to a cytoskeletal fraction. siRNA knock-down of ROCK-I but not ROCK-II inhibits fragmentation of dying cells, consistent with ROCK-I being required for apoptotic fragmentation. Finally, cells dying in the presence of the ROCK inhibitor Y-27632 are not efficiently phagocytized. These data show that ROCK plays an essential role in fragmentation and phagocytosis of apoptotic cells.

  20. Potential of apoptotic pathway-targeted cancer therapeutic research: Where do we stand?

    PubMed Central

    Baig, S; Seevasant, I; Mohamad, J; Mukheem, A; Huri, H Z; Kamarul, T

    2016-01-01

    Underneath the intricacy of every cancer lies mysterious events that impel the tumour cell and its posterity into abnormal growth and tissue invasion. Oncogenic mutations disturb the regulatory circuits responsible for the governance of versatile cellular functions, permitting tumour cells to endure deregulated proliferation, resist to proapoptotic insults, invade and erode normal tissues and above all escape apoptosis. This disruption of apoptosis has been highly implicated in various malignancies and has been exploited as an anticancer strategy. Owing to the fact that apoptosis causes minimal inflammation and damage to the tissue, apoptotic cell death-based therapy has been the centre of attraction for the development of anticancer drugs. Increased understanding of the molecular pathways underlying apoptosis has enabled scientists to establish unique approaches targeting apoptosis pathways in cancer therapeutics. In this review, we reconnoitre the two major pathways (intrinsic and extrinsic) targeted cancer therapeutics, steering toward chief modulators of these pathways, such as B-cell lymphoma 2 protein family members (pro- and antiapoptotic), inhibitor of apoptosis proteins, and the foremost thespian of extrinsic pathway regulator, tumour necrosis factor-related apoptosis-inducing agent. Together, we also will have a look from clinical perspective to address the agents (drugs) and therapeutic strategies adopted to target these specific proteins/pathways that have entered clinical trials. PMID:26775709

  1. Trade-offs between performance and variability in the escape responses of bluegill sunfish (Lepomis macrochirus)

    PubMed Central

    Hitchcock, Amanda C.; Chen, Tiffany; Connolly, Erin; Darakananda, Karin; Jeong, Janet; Quist, Arbor; Robbins, Allison; Ellerby, David J.

    2015-01-01

    Successful predator evasion is essential to the fitness of many animals. Variation in escape behaviour may be adaptive as it reduces predictability, enhancing escape success. High escape velocities and accelerations also increase escape success, but biomechanical factors likely constrain the behavioural range over which performance can be maximized. There may therefore be a trade-off between variation and performance during escape responses. We have used bluegill sunfish (Lepomis macrochirus) escape responses to examine this potential trade-off, determining the full repertoire of escape behaviour for individual bluegill sunfish and linking this to performance as indicated by escape velocity and acceleration. Fish escapes involve an initial C-bend of the body axis, followed by variable steering movements. These generate thrust and establish the escape direction. Directional changes during the initial C-bend were less variable than the final escape angle, and the most frequent directions were associated with high escape velocity. Significant inter-individual differences in escape angles magnified the overall variation, maintaining unpredictability from a predator perspective. Steering in the latter stages of the escape to establish the final escape trajectory also affected performance, with turns away from the stimulus associated with reduced velocity. This suggests that modulation of escape behaviour by steering may also have an associated performance cost. This has important implications for understanding the scope and control of intra- and inter-individual variation in escape behaviour and the associated costs and benefits. PMID:25910940

  2. BAD, a Proapoptotic Protein, Escapes ERK/RSK Phosphorylation in Deguelin and siRNA-Treated HeLa Cells.

    PubMed

    Hafeez, Samra; Urooj, Mahwish; Saleem, Shamiala; Gillani, Zeeshan; Shaheen, Sumaira; Qazi, Mahmood Husain; Naseer, Muhammad Imran; Iqbal, Zafar; Ansari, Shakeel Ahmed; Haque, Absarul; Asif, Muhammad; Mir, Manzoor Ahmad; Ali, Ashraf; Pushparaj, Peter Natesan; Jamal, Mohammad Sarwar; Rasool, Mahmood

    2016-01-01

    This study has been undertaken to explore the therapeutic effects of deguelin and specific siRNAs in HeLa cells. The data provided clearly show the silencing of ERK 1/2 with siRNAs and inhibition of ERK1/2 with deguelin treatment in HeLa cells. Additionally, we are providing information that deguelin binds directly to anti-apoptotic Bcl-2, Bcl-xl and Mcl-1 in the hydrophobic grooves, thereby releasing BAD and BAX from dimerization with these proteins. This results in increased apoptotic activity through the intrinsic pathway involved in rupture of mitochondrial membrane and release of cytochrome C. Evidence for inhibition of ERK1/2 by deguelin and escape of BAD phosphorylation at serine 112 through ERK/RSK pathway has been further fortified by obtaining similar results by silencing ERK 1/2 each with specific siRNAs. Increase in BAD after treatment with deguelin or siRNAs has been interpreted to mean that deguelin acts through several alternative pathways and therefore can be used as effective therapeutic agent.

  3. Exocytosis of macrophage lysosomes leads to digestion of apoptotic adipocytes and foam cell formation.

    PubMed

    Haka, Abigail S; Barbosa-Lorenzi, Valéria C; Lee, Hyuek Jong; Falcone, Domenick J; Hudis, Clifford A; Dannenberg, Andrew J; Maxfield, Frederick R

    2016-06-01

    Many types of apoptotic cells are phagocytosed and digested by macrophages. Adipocytes can be hundreds of times larger than macrophages, so they are too large to be digested by conventional phagocytic processes. The nature of the interaction between macrophages and apoptotic adipocytes has not been studied in detail. We describe a cellular process, termed exophagy, that is important for macrophage clearance of dead adipocytes and adipose tissue homeostasis. Using mouse models of obesity, human tissue, and a cell culture model, we show that macrophages form hydrolytic extracellular compartments at points of contact with dead adipocytes using local actin polymerization. These compartments are acidic and contain lysosomal enzymes delivered by exocytosis. Uptake and complete degradation of adipocyte fragments, which are released by extracellular hydrolysis, leads to macrophage foam cell formation. Exophagy-mediated foam cell formation is a highly efficient means by which macrophages internalize large amounts of lipid, which may ultimately overwhelm the metabolic capacity of the macrophage. This process provides a mechanism for degradation of objects, such as dead adipocytes, that are too large to be phagocytosed by macrophages. PMID:27044658

  4. Exocytosis of macrophage lysosomes leads to digestion of apoptotic adipocytes and foam cell formation[S

    PubMed Central

    Haka, Abigail S.; Barbosa-Lorenzi, Valéria C.; Lee, Hyuek Jong; Falcone, Domenick J.; Hudis, Clifford A.; Dannenberg, Andrew J.

    2016-01-01

    Many types of apoptotic cells are phagocytosed and digested by macrophages. Adipocytes can be hundreds of times larger than macrophages, so they are too large to be digested by conventional phagocytic processes. The nature of the interaction between macrophages and apoptotic adipocytes has not been studied in detail. We describe a cellular process, termed exophagy, that is important for macrophage clearance of dead adipocytes and adipose tissue homeostasis. Using mouse models of obesity, human tissue, and a cell culture model, we show that macrophages form hydrolytic extracellular compartments at points of contact with dead adipocytes using local actin polymerization. These compartments are acidic and contain lysosomal enzymes delivered by exocytosis. Uptake and complete degradation of adipocyte fragments, which are released by extracellular hydrolysis, leads to macrophage foam cell formation. Exophagy-mediated foam cell formation is a highly efficient means by which macrophages internalize large amounts of lipid, which may ultimately overwhelm the metabolic capacity of the macrophage. This process provides a mechanism for degradation of objects, such as dead adipocytes, that are too large to be phagocytosed by macrophages. PMID:27044658

  5. Cytotoxic and apoptotic effects of Ebenus boissieri Barbey on human lung cancer cell line A549

    PubMed Central

    Aydemir, Esra Arslan; Simsek, Ece; Imir, Nilüfer; Göktürk, Ramazan Süleyman; Yesilada, Erdem; Fiskin, Kayahan

    2015-01-01

    Background: Fabaceae family members are known to possess preventive and therapeutic potentials against various types of cancers. Objective: The aim of this study was to investigate the cytotoxic and apoptotic effects of hydroalcoholic extracts from the aerial parts and roots of an endemic Ebenus species; Ebenus boissieri Barbey in human lung cancer cell line. Materials and Methods: After treatment with hydroalcoholic extracts cytotoxic activities of both extracts were measured by 3-(4,5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide assay, whereas caspase-3 activity, tumor necrosis factor-a lpha (TNF-α) and interferon gamma (IFN-γ) releasewere measured by enzyme linked immunosorbent assay. Results: According to in vitro assay results, the increase in all caspases activity suggested that extracts induce cells to undergo apoptosis. Especially, induction in caspase-3 activity was the most remarkable result of this study. Both aerial part and root extracts induced apoptosis by increasing caspase-3 activity, TNF-α and IFN-γ release. When compared to their relative controls, the concentrations of both TNF-α and IFN-γ in extract-treated groups were significantly and dose dependently exalted. Conclusion: Taken together, our results indicate that the hydroalcoholic extracts of E. boissieri can be considered as a source of new anti-apoptotic and therefore anti-carcinogenic agent. PMID:26109772

  6. Clearance of apoptotic neutrophils and resolution of inflammation.

    PubMed

    Greenlee-Wacker, Mallary C

    2016-09-01

    The engulfment of apoptotic cells by phagocytes, a process referred to as efferocytosis, is essential for maintenance of normal tissue homeostasis and a prerequisite for the resolution of inflammation. Neutrophils are the predominant circulating white blood cell in humans, and contain an arsenal of toxic substances that kill and degrade microbes. Neutrophils are short-lived and spontaneously die by apoptosis. This review will highlight how the engulfment of apoptotic neutrophils by human phagocytes occurs, how heterogeneity of phagocyte populations influences efferocytosis signaling, and downstream consequences of efferocytosis. The efferocytosis of apoptotic neutrophils by macrophages promotes anti-inflammatory signaling, prevents neutrophil lysis, and dampens immune responses. Given the immunomodulatory properties of efferocytosis, understanding pathways that regulate and enhance efferocytosis could be harnessed to combat infection and chronic inflammatory conditions. PMID:27558346

  7. Opium induces apoptosis in Jurkat cells via promotion of pro-apoptotic and inhibition of anti-apoptotic molecules

    PubMed Central

    Arababadi, Mohammad Kazemi; Asadikaram, Gholamreza

    2016-01-01

    Objective(s): The aim of this study was to determine the important molecules involved in apoptosis induction by opium in Jurkat cell line. Materials and Methods: Jurkat cells were incubated 48 hrs with 2.86×10-5 g/ml concentration of opium and apoptosis as well as expression levels of related molecules were measured. Results: Our results demonstrated that 50.3±0.2 percent of opium treated Jurkat cells were revealed apoptotic features. The levels of mRNA of several pro-apoptotic and anti-apoptotic molecules were increased and decreased, respectively, in the opium treated cells. The results also demonstrated that expression levels of BCL2, DFFA and NOL3 as anti-apoptotic molecules were increased in the opium treated cells. Conclusion: It seems that opium induces apoptosis in Jurkat cells via both intrinsic and extrinsic pathways. Although opium induces apoptosis in the cells but increased expression of some anti-apoptotic molecules may be a normal resistance of the cell for death. PMID:27081468

  8. Green Pea Galaxies Reveal Secrets of Lyα Escape

    NASA Astrophysics Data System (ADS)

    Yang, Huan; Malhotra, Sangeeta; Gronke, Max; Rhoads, James E.; Jaskot, Anne; Zheng, Zhenya; Dijkstra, Mark; Wang, JunXian

    2016-01-01

    In star-forming galaxies, a lot of Lyα photons were generated in HII regions surrounding massive stars. The escape of Lyα photons from galaxies is a key issue in studying high redshift galaxies and probing cosmic reionization with Lyα. To understand Lyα escape, it is valuable to study high quality Lyα profiles in Lyα emitters. However, such studies are rare due to the faintness of high-z Lyα emitters and the lack of local analogs with high Lyα equivalent width. Here we show that "Green Pea" galaxies are the best local analogs of high-z Lyα emitters and their high quality Lyα profiles demonstrate low HI column density is the key to Lyα escape. The Lyα escape fraction shows correlations with the ratio of Lyα blue peak velocity to Hα line width, the normalized flux density at valley of Lyα profile, and a few other features of Lyα profiles. We compared the Lyα profiles with outflowing HI shell radiative transfer model and found that the best-fit HI column density is anti-correlated with the Lyα escape fraction. We also found an anti-correlation between Lyα escape fraction and galactic metallicity. Our results support that LAEs with high Lyα escape fraction have low metallicity, low HI column density, and mild HI gas outflow.

  9. Enzyme Kinetics

    PubMed Central

    Lam, C. F.; Priest, D. G.

    1972-01-01

    One of the most generally applicable algorithms for the derivation of steady-state rate equations for complex enzyme reaction mechanisms is that of King and Altman. Several modifications of this algorithm have been suggested; however, each requires the generation of numerous valid and invalid patterns and the subsequent elimination of those that are invalid. A method is presented, employing topological theory of linear graphs, for the systematic generation of only those patterns which are valid. This method is readily adaptable to use on a digital computer. An independent method for the calculation of the number of valid patterns is also presented. This calculation can be used to substantiate the accuracy of the patterns obtained. This calculation is also adaptable to computerization. Examples are included to demonstrate both the generation of patterns and the calculation of their number for specific enzyme mechanisms. PMID:5016111

  10. Alkylating enzymes.

    PubMed

    Wessjohann, Ludger A; Keim, Jeanette; Weigel, Benjamin; Dippe, Martin

    2013-04-01

    Chemospecific and regiospecific modifications of natural products by methyl, prenyl, or C-glycosyl moieties are a challenging and cumbersome task in organic synthesis. Because of the availability of an increasing number of stable and selective transferases and cofactor regeneration processes, enzyme-assisted strategies turn out to be promising alternatives to classical synthesis. Two categories of alkylating enzymes become increasingly relevant for applications: firstly prenyltransferases and terpene synthases (including terpene cyclases), which are used in the production of terpenoids such as artemisinin, or meroterpenoids like alkylated phenolics and indoles, and secondly methyltransferases, which modify flavonoids and alkaloids to yield products with a specific methylation pattern such as 7-O-methylaromadendrin and scopolamine.

  11. 42 CFR 84.300 - Closed-circuit escape respirator; description.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 42 Public Health 1 2012-10-01 2012-10-01 false Closed-circuit escape respirator; description. 84... Closed-Circuit Escape Respirators § 84.300 Closed-circuit escape respirator; description. The closed-circuit escape respirator (CCER), technically a subset of self-contained breathing apparatus (SCBAs)...

  12. 42 CFR 84.300 - Closed-circuit escape respirator; description.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 42 Public Health 1 2014-10-01 2014-10-01 false Closed-circuit escape respirator; description. 84... Closed-Circuit Escape Respirators § 84.300 Closed-circuit escape respirator; description. The closed-circuit escape respirator (CCER), technically a subset of self-contained breathing apparatus (SCBAs)...

  13. The Protective Properties of the Strawberry (Fragaria ananassa) against Carbon Tetrachloride-Induced Hepatotoxicity in Rats Mediated by Anti-Apoptotic and Upregulation of Antioxidant Genes Expression Effects.

    PubMed

    Hamed, Sherifa S; Al-Yhya, Nouf A; El-Khadragy, Manal F; Al-Olayan, Ebtesam M; Alajmi, Reem A; Hassan, Zeinab K; Hassan, Salwa B; Abdel Moneim, Ahmed E

    2016-01-01

    The strawberry (Fragaria ananassa) has been extensively used to treat a wide range of ailments in many cultures. The present study was aimed at evaluating the hepatoprotective effect of strawberry juice on experimentally induced liver injury in rats. To this end, rats were introperitoneally injected with carbon tetrachloride (CCl4) with or without strawberry juice supplementation for 12 weeks and the hepatoprotective effect of strawberry was assessed by measuring serum liver enzyme markers, hepatic tissue redox status and apoptotic markers with various techniques including biochemistry, ELISA, quantitative PCR assays and histochemistry. The hepatoprotective effect of the strawberry was evident by preventing CCl4-induced increase in liver enzymes levels. Determination of oxidative balance showed that strawberry treatment significantly blunted CCl4-induced increase in oxidative stress markers and decrease in enzymatic and non-enzymatic molecules in hepatic tissue. Furthermore, strawberry supplementation enhanced the anti-apoptotic protein, Bcl-2, and restrained the pro-apoptotic proteins Bax and caspase-3 with a marked reduction in collagen areas in hepatic tissue. These findings demonstrated that strawberry (F. ananassa) juice possessed antioxidant, anti-apoptotic and anti-fibrotic properties, probably mediated by the presence of polyphenols and flavonoids compounds. PMID:27547187

  14. The Protective Properties of the Strawberry (Fragaria ananassa) against Carbon Tetrachloride-Induced Hepatotoxicity in Rats Mediated by Anti-Apoptotic and Upregulation of Antioxidant Genes Expression Effects.

    PubMed

    Hamed, Sherifa S; Al-Yhya, Nouf A; El-Khadragy, Manal F; Al-Olayan, Ebtesam M; Alajmi, Reem A; Hassan, Zeinab K; Hassan, Salwa B; Abdel Moneim, Ahmed E

    2016-01-01

    The strawberry (Fragaria ananassa) has been extensively used to treat a wide range of ailments in many cultures. The present study was aimed at evaluating the hepatoprotective effect of strawberry juice on experimentally induced liver injury in rats. To this end, rats were introperitoneally injected with carbon tetrachloride (CCl4) with or without strawberry juice supplementation for 12 weeks and the hepatoprotective effect of strawberry was assessed by measuring serum liver enzyme markers, hepatic tissue redox status and apoptotic markers with various techniques including biochemistry, ELISA, quantitative PCR assays and histochemistry. The hepatoprotective effect of the strawberry was evident by preventing CCl4-induced increase in liver enzymes levels. Determination of oxidative balance showed that strawberry treatment significantly blunted CCl4-induced increase in oxidative stress markers and decrease in enzymatic and non-enzymatic molecules in hepatic tissue. Furthermore, strawberry supplementation enhanced the anti-apoptotic protein, Bcl-2, and restrained the pro-apoptotic proteins Bax and caspase-3 with a marked reduction in collagen areas in hepatic tissue. These findings demonstrated that strawberry (F. ananassa) juice possessed antioxidant, anti-apoptotic and anti-fibrotic properties, probably mediated by the presence of polyphenols and flavonoids compounds.

  15. The Protective Properties of the Strawberry (Fragaria ananassa) against Carbon Tetrachloride-Induced Hepatotoxicity in Rats Mediated by Anti-Apoptotic and Upregulation of Antioxidant Genes Expression Effects

    PubMed Central

    Hamed, Sherifa S.; AL-Yhya, Nouf A.; El-Khadragy, Manal F.; Al-Olayan, Ebtesam M.; Alajmi, Reem A.; Hassan, Zeinab K.; Hassan, Salwa B.; Abdel Moneim, Ahmed E.

    2016-01-01

    The strawberry (Fragaria ananassa) has been extensively used to treat a wide range of ailments in many cultures. The present study was aimed at evaluating the hepatoprotective effect of strawberry juice on experimentally induced liver injury in rats. To this end, rats were introperitoneally injected with carbon tetrachloride (CCl4) with or without strawberry juice supplementation for 12 weeks and the hepatoprotective effect of strawberry was assessed by measuring serum liver enzyme markers, hepatic tissue redox status and apoptotic markers with various techniques including biochemistry, ELISA, quantitative PCR assays and histochemistry. The hepatoprotective effect of the strawberry was evident by preventing CCl4-induced increase in liver enzymes levels. Determination of oxidative balance showed that strawberry treatment significantly blunted CCl4-induced increase in oxidative stress markers and decrease in enzymatic and non-enzymatic molecules in hepatic tissue. Furthermore, strawberry supplementation enhanced the anti-apoptotic protein, Bcl-2, and restrained the pro-apoptotic proteins Bax and caspase-3 with a marked reduction in collagen areas in hepatic tissue. These findings demonstrated that strawberry (F. ananassa) juice possessed antioxidant, anti-apoptotic and anti-fibrotic properties, probably mediated by the presence of polyphenols and flavonoids compounds. PMID:27547187

  16. MAVEN Measurements of the Ion Escape Rate from Mars

    NASA Astrophysics Data System (ADS)

    Brain, Dave; Dong, Yaxue; Fortier, Kier; Fang, Xiaohua; McFadden, James; Halekas, Jasper; Connerney, Jack; Eparvier, Frank; Dong, Chuanfei; Bougher, Stephen; Ma, Yingjuan; Modolo, Ronan; Lillis, Rob; Luhmann, Janet; Curry, Shannon; Seki, Kanako; Jakosky, Bruce

    2015-04-01

    The loss of atmospheric particles (neutral atoms, neutral molecules, ions) to space is thought to have played a role in the evolution of Martian climate over the past ~4 billion years. Due to the lack of a global magnetic field on Mars, the solar wind has direct access to the upper layers of the Martian atmosphere, and can drive non-thermal escape of charged particles (ions) from the atmosphere. Two spacecraft (Phobos 2 and Mars Express) have previously measured escaping ions at Mars. The recently arrived MAVEN spacecraft is equipped with instruments to measure escaping ions with high time cadence and high energy and mass resolution, as well as instruments to provide contextual information about what controls the variation in escape rates. We report on the total escape rate of heavy planetary ions from the Martian atmosphere measured by MAVEN. Heavy ions are identified in data from the SupraThermal And Thermal Ion Composition (STATIC) instrument. Rudimentary estimates of ion escape rate are obtained by summing the measured ion fluxes over a surface downstream from Mars with respect to the solar wind flow. This estimate can then be refined to account for the limited field of view of the instrument (investigation of measured particle distributions) and the limited spatial coverage of the spacecraft orbit trajectory. Variability in measured escape rates can also be grouped according to upstream conditions and the orientation of Mars (and its crustal magnetic fields) with respect to the solar wind. Important upstream drivers include the solar Extreme Ultraviolet (EUV) flux, solar wind pressure, and the interplanetary magnetic field strength and direction. These drivers are measured directly by MAVEN's EUV, SWIA, and MAG instruments. We will provide an initial estimate of ion escape rates based on the first several months of MAVEN data. We will then report on progress to refine these estimates to correct for instrument field of view and spacecraft coverage effects, as

  17. Levels of pro-apoptotic regulator Bad and anti-apoptotic regulator Bcl-xL determine the type of the apoptotic logic gate

    PubMed Central

    2013-01-01

    Background Apoptosis is a tightly regulated process: cellular survive-or-die decisions cannot be accidental and must be unambiguous. Since the suicide program may be initiated in response to numerous stress stimuli, signals transmitted through a number of checkpoints have to be eventually integrated. Results In order to analyze possible mechanisms of the integration of multiple pro-apoptotic signals, we constructed a simple model of the Bcl-2 family regulatory module. The module collects upstream signals and processes them into life-or-death decisions by employing interactions between proteins from three subgroups of the Bcl-2 family: pro-apoptotic multidomain effectors, pro-survival multidomain restrainers, and pro-apoptotic single domain BH3-only proteins. Although the model is based on ordinary differential equations (ODEs), it demonstrates that the Bcl-2 family module behaves akin to a Boolean logic gate of the type dependent on levels of BH3-only proteins (represented by Bad) and restrainers (represented by Bcl-xL). A low level of pro-apoptotic Bad or a high level of pro-survival Bcl-xL implies gate AND, which allows for the initiation of apoptosis only when two stress stimuli are simultaneously present: the rise of the p53 killer level and dephosphorylation of kinase Akt. In turn, a high level of Bad or a low level of Bcl-xL implies gate OR, for which any of these stimuli suffices for apoptosis. Conclusions Our study sheds light on possible signal integration mechanisms in cells, and spans a bridge between modeling approaches based on ODEs and on Boolean logic. In the proposed scheme, logic gates switching results from the change of relative abundances of interacting proteins in response to signals and involves system bistability. Consequently, the regulatory system may process two analogous inputs into a digital survive-or-die decision. PMID:23883471

  18. The apoptotic effect and the plausible mechanism of microwave radiation on rat myocardial cells.

    PubMed

    Zhu, Wenhe; Cui, Yan; Feng, Xianmin; Li, Yan; Zhang, Wei; Xu, Junjie; Wang, Huiyan; Lv, Shijie

    2016-08-01

    Microwaves may exert adverse biological effects on the cardiovascular system at the integrated system and cellular levels. However, the mechanism underlying such effects remains poorly understood. Here, we report a previously uncharacterized mechanism through which microwaves damage myocardial cells. Rats were treated with 2450 MHz microwave radiation at 50, 100, 150, or 200 mW/cm(2) for 6 min. Microwave treatment significantly enhanced the levels of various enzymes in serum. In addition, it increased the malondialdehyde content while decreasing the levels of antioxidative stress enzymes, activities of enzyme complexes I-IV, and ATP in myocardial tissues. Notably, irradiated myocardial cells exhibited structural damage and underwent apoptosis. Furthermore, Western blot analysis revealed significant changes in expression levels of proteins involved in oxidative stress regulation and apoptotic signaling pathways, indicating that microwave irradiation could induce myocardial cell apoptosis by interfering with oxidative stress and cardiac energy metabolism. Our findings provide useful insights into the mechanism of microwave-induced damage to the cardiovascular system. PMID:27203380

  19. The apoptotic effect and the plausible mechanism of microwave radiation on rat myocardial cells.

    PubMed

    Zhu, Wenhe; Cui, Yan; Feng, Xianmin; Li, Yan; Zhang, Wei; Xu, Junjie; Wang, Huiyan; Lv, Shijie

    2016-08-01

    Microwaves may exert adverse biological effects on the cardiovascular system at the integrated system and cellular levels. However, the mechanism underlying such effects remains poorly understood. Here, we report a previously uncharacterized mechanism through which microwaves damage myocardial cells. Rats were treated with 2450 MHz microwave radiation at 50, 100, 150, or 200 mW/cm(2) for 6 min. Microwave treatment significantly enhanced the levels of various enzymes in serum. In addition, it increased the malondialdehyde content while decreasing the levels of antioxidative stress enzymes, activities of enzyme complexes I-IV, and ATP in myocardial tissues. Notably, irradiated myocardial cells exhibited structural damage and underwent apoptosis. Furthermore, Western blot analysis revealed significant changes in expression levels of proteins involved in oxidative stress regulation and apoptotic signaling pathways, indicating that microwave irradiation could induce myocardial cell apoptosis by interfering with oxidative stress and cardiac energy metabolism. Our findings provide useful insights into the mechanism of microwave-induced damage to the cardiovascular system.

  20. History of oxygen and carbon escape from the Martian atmosphere

    NASA Technical Reports Server (NTRS)

    Luhmann, J. G.; Zhang, M. H. G.; Johnson, R. E.; Bougher, S. W.; Nagy, A. F.

    1992-01-01

    A fraction of the oxygen in the Martian atmosphere continually escapes to space because dissociative recombination of the O2(+) ions in the ionosphere can impart sufficient energy to the product O atoms. In addition, ionization of the extended atomic oxygen corona resulting from the above process adds to escape since the solar wind can carry away O(+) ions born above a few hundred km altitude. A further by-product of this ion-pickup by the solar wind is an additional population of escaping oxygen atoms that are sputtered from the atmosphere near the exobase by pickup ions that are on reentry rather than escaping trajectories. This sputtering process can also remove carbon in the form of intact or dissociated CO2 since all atoms and molecules in the 'target' gas are subject to the collisional energy transfer that characterizes sputtering. We have estimated the present rates of escape of oxygen and carbon due to these mechanisms, as well as the rates at several epochs in the history of the solar system.

  1. Enhancing endosomal escape for nanoparticle mediated siRNA delivery

    NASA Astrophysics Data System (ADS)

    Ma, Da

    2014-05-01

    Gene therapy with siRNA is a promising biotechnology to treat cancer and other diseases. To realize siRNA-based gene therapy, a safe and efficient delivery method is essential. Nanoparticle mediated siRNA delivery is of great importance to overcome biological barriers for systemic delivery in vivo. Based on recent discoveries, endosomal escape is a critical biological barrier to be overcome for siRNA delivery. This feature article focuses on endosomal escape strategies used for nanoparticle mediated siRNA delivery, including cationic polymers, pH sensitive polymers, calcium phosphate, and cell penetrating peptides. Work has been done to develop different endosomal escape strategies based on nanoparticle types, administration routes, and target organ/cell types. Also, enhancement of endosomal escape has been considered along with other aspects of siRNA delivery to ensure target specific accumulation, high cell uptake, and low toxicity. By enhancing endosomal escape and overcoming other biological barriers, great progress has been achieved in nanoparticle mediated siRNA delivery.

  2. Enhancing Endosomal Escape for Intracellular Delivery of Macromolecular Biologic Therapeutics

    PubMed Central

    Lönn, Peter; Kacsinta, Apollo D.; Cui, Xian-Shu; Hamil, Alexander S.; Kaulich, Manuel; Gogoi, Khirud; Dowdy, Steven F.

    2016-01-01

    Bioactive macromolecular peptides and oligonucleotides have significant therapeutic potential. However, due to their size, they have no ability to enter the cytoplasm of cells. Peptide/Protein transduction domains (PTDs), also called cell-penetrating peptides (CPPs), can promote uptake of macromolecules via endocytosis. However, overcoming the rate-limiting step of endosomal escape into the cytoplasm remains a major challenge. Hydrophobic amino acid R groups are known to play a vital role in viral escape from endosomes. Here we utilize a real-time, quantitative live cell split-GFP fluorescence complementation phenotypic assay to systematically analyze and optimize a series of synthetic endosomal escape domains (EEDs). By conjugating EEDs to a TAT-PTD/CPP spilt-GFP peptide complementation assay, we were able to quantitatively measure endosomal escape into the cytoplasm of live cells via restoration of GFP fluorescence by intracellular molecular complementation. We found that EEDs containing two aromatic indole rings or one indole ring and two aromatic phenyl groups at a fixed distance of six polyethylene glycol (PEG) units from the TAT-PTD-cargo significantly enhanced cytoplasmic delivery in the absence of cytotoxicity. EEDs address the critical rate-limiting step of endosomal escape in delivery of macromolecular biologic peptide, protein and siRNA therapeutics into cells. PMID:27604151

  3. Ion Energization and Escape on Mars and Venus

    NASA Astrophysics Data System (ADS)

    Dubinin, E.; Fraenz, M.; Fedorov, A.; Lundin, R.; Edberg, N.; Duru, F.; Vaisberg, O.

    2011-12-01

    Mars and Venus do not have a global magnetic field and as a result solar wind interacts directly with their ionospheres and upper atmospheres. Neutral atoms ionized by solar UV, charge exchange and electron impact, are extracted and scavenged by solar wind providing a significant loss of planetary volatiles. There are different channels and routes through which the ionized planetary matter escapes from the planets. Processes of ion energization driven by direct solar wind forcing and their escape are intimately related. Forces responsible for ion energization in different channels are different and, correspondingly, the effectiveness of escape is also different. Classification of the energization processes and escape channels on Mars and Venus and also their variability with solar wind parameters is the main topic of our review. We will distinguish between classical pickup and `mass-loaded' pickup processes, energization in boundary layer and plasma sheet, polar winds on unmagnetized planets with magnetized ionospheres and enhanced escape flows from localized auroral regions in the regions filled by strong crustal magnetic fields.

  4. Ion Energization and Escape on Mars and Venus

    NASA Astrophysics Data System (ADS)

    Dubinin, E.; Fraenz, M.; Fedorov, A.; Lundin, R.; Edberg, N.; Duru, F.; Vaisberg, O.

    Mars and Venus do not have a global magnetic field and as a result solar wind interacts directly with their ionospheres and upper atmospheres. Neutral atoms ionized by solar UV, charge exchange and electron impact, are extracted and scavenged by solar wind providing a significant loss of planetary volatiles. There are different channels and routes through which the ionized planetary matter escapes from the planets. Processes of ion energization driven by direct solar wind forcing and their escape are intimately related. Forces responsible for ion energization in different channels are different and, correspondingly, the effectiveness of escape is also different. Classification of the energization processes and escape channels on Mars and Venus and also their variability with solar wind parameters is the main topic of our review. We will distinguish between classical pickup and `mass-loaded' pickup processes, energization in boundary layer and plasma sheet, polar winds on unmagnetized planets with magnetized ionospheres and enhanced escape flows from localized auroral regions in the regions filled by strong crustal magnetic fields.

  5. THE ESCAPE FRACTION OF IONIZING RADIATION FROM GALAXIES

    SciTech Connect

    Benson, Andrew; Venkatesan, Aparna; Shull, J. Michael E-mail: avenkatesan@usfca.edu

    2013-06-10

    The escape of ionizing radiation from galaxies plays a critical role in the evolution of gas in galaxies, and the heating and ionization history of the intergalactic medium. We present semi-analytic calculations of the escape fraction of ionizing radiation for both hydrogen and helium from galaxies ranging from primordial systems to disk-type galaxies that are not heavily dust-obscured. We consider variations in the galaxy density profile, source type, location, and spectrum, and gas overdensity/distribution factors. For sufficiently hard first-light sources, the helium ionization fronts closely track or advance beyond that of hydrogen. Key new results in this work include calculations of the escape fractions for He I and He II ionizing radiation, and the impact of partial ionization from X-rays from early active galactic nuclei or stellar clusters on the escape fractions from galaxy halos. When factoring in frequency-dependent effects, we find that X-rays play an important role in boosting the escape fractions for both hydrogen and helium, but especially for He II. We briefly discuss the implications of these results for recent observations of the He II reionization epoch at low redshifts, as well as the UV data and emission-line signatures from early galaxies anticipated from future satellite missions.

  6. Single-File Escape of Colloidal Particles from Microfluidic Channels

    NASA Astrophysics Data System (ADS)

    Locatelli, Emanuele; Pierno, Matteo; Baldovin, Fulvio; Orlandini, Enzo; Tan, Yizhou; Pagliara, Stefano

    2016-07-01

    Single-file diffusion is a ubiquitous physical process exploited by living and synthetic systems to exchange molecules with their environment. It is paramount to quantify the escape time needed for single files of particles to exit from constraining synthetic channels and biological pores. This quantity depends on complex cooperative effects, whose predominance can only be established through a strict comparison between theory and experiments. By using colloidal particles, optical manipulation, microfluidics, digital microscopy, and theoretical analysis we uncover the self-similar character of the escape process and provide closed-formula evaluations of the escape time. We find that the escape time scales inversely with the diffusion coefficient of the last particle to leave the channel. Importantly, we find that at the investigated microscale, bias forces as tiny as 10-15 N determine the magnitude of the escape time by drastically reducing interparticle collisions. Our findings provide crucial guidelines to optimize the design of micro- and nanodevices for a variety of applications including drug delivery, particle filtering, and transport in geometrical constrictions.

  7. Single-File Escape of Colloidal Particles from Microfluidic Channels.

    PubMed

    Locatelli, Emanuele; Pierno, Matteo; Baldovin, Fulvio; Orlandini, Enzo; Tan, Yizhou; Pagliara, Stefano

    2016-07-15

    Single-file diffusion is a ubiquitous physical process exploited by living and synthetic systems to exchange molecules with their environment. It is paramount to quantify the escape time needed for single files of particles to exit from constraining synthetic channels and biological pores. This quantity depends on complex cooperative effects, whose predominance can only be established through a strict comparison between theory and experiments. By using colloidal particles, optical manipulation, microfluidics, digital microscopy, and theoretical analysis we uncover the self-similar character of the escape process and provide closed-formula evaluations of the escape time. We find that the escape time scales inversely with the diffusion coefficient of the last particle to leave the channel. Importantly, we find that at the investigated microscale, bias forces as tiny as 10^{-15}  N determine the magnitude of the escape time by drastically reducing interparticle collisions. Our findings provide crucial guidelines to optimize the design of micro- and nanodevices for a variety of applications including drug delivery, particle filtering, and transport in geometrical constrictions.

  8. Single-File Escape of Colloidal Particles from Microfluidic Channels.

    PubMed

    Locatelli, Emanuele; Pierno, Matteo; Baldovin, Fulvio; Orlandini, Enzo; Tan, Yizhou; Pagliara, Stefano

    2016-07-15

    Single-file diffusion is a ubiquitous physical process exploited by living and synthetic systems to exchange molecules with their environment. It is paramount to quantify the escape time needed for single files of particles to exit from constraining synthetic channels and biological pores. This quantity depends on complex cooperative effects, whose predominance can only be established through a strict comparison between theory and experiments. By using colloidal particles, optical manipulation, microfluidics, digital microscopy, and theoretical analysis we uncover the self-similar character of the escape process and provide closed-formula evaluations of the escape time. We find that the escape time scales inversely with the diffusion coefficient of the last particle to leave the channel. Importantly, we find that at the investigated microscale, bias forces as tiny as 10^{-15}  N determine the magnitude of the escape time by drastically reducing interparticle collisions. Our findings provide crucial guidelines to optimize the design of micro- and nanodevices for a variety of applications including drug delivery, particle filtering, and transport in geometrical constrictions. PMID:27472142

  9. Loss of water from Venus. I - Hydrodynamic escape of hydrogen

    NASA Technical Reports Server (NTRS)

    Kasting, J. F.; Pollack, J. B.

    1983-01-01

    A one-dimensional photochemical-dynamic model is used to study hydrodynamic loss of hydrogen from a primitive, water-rich atmosphere on Venus. The escape flux is calculated as a function of the H2O mixing ratio at the atmospheric cold trap. The cold trap mixing ratio is then related in an approximate fashion to the H2O concentration in the lower atmosphere. Hydrodynamic escape should have been the dominant loss process for hydroogen when the H2O mass mixing ratio in the lower atmosphere exceeded approximately 0.1. The escape rate would have depended upon the magnitude of the solar ultraviolet flux and the atmospheric EUV heating efficiency and, to a lesser extent, on the O2 content of the atmosphere. The time required for Venus to have lost the bulk of a terrestrial ocean of water is on the order of a billion years. Deuterium would have been swept away along with hydrogen if the escape rate was high enough, but some D/H enrichment should have occurred as the escape rate slowed down.

  10. Enhancing Endosomal Escape for Intracellular Delivery of Macromolecular Biologic Therapeutics.

    PubMed

    Lönn, Peter; Kacsinta, Apollo D; Cui, Xian-Shu; Hamil, Alexander S; Kaulich, Manuel; Gogoi, Khirud; Dowdy, Steven F

    2016-01-01

    Bioactive macromolecular peptides and oligonucleotides have significant therapeutic potential. However, due to their size, they have no ability to enter the cytoplasm of cells. Peptide/Protein transduction domains (PTDs), also called cell-penetrating peptides (CPPs), can promote uptake of macromolecules via endocytosis. However, overcoming the rate-limiting step of endosomal escape into the cytoplasm remains a major challenge. Hydrophobic amino acid R groups are known to play a vital role in viral escape from endosomes. Here we utilize a real-time, quantitative live cell split-GFP fluorescence complementation phenotypic assay to systematically analyze and optimize a series of synthetic endosomal escape domains (EEDs). By conjugating EEDs to a TAT-PTD/CPP spilt-GFP peptide complementation assay, we were able to quantitatively measure endosomal escape into the cytoplasm of live cells via restoration of GFP fluorescence by intracellular molecular complementation. We found that EEDs containing two aromatic indole rings or one indole ring and two aromatic phenyl groups at a fixed distance of six polyethylene glycol (PEG) units from the TAT-PTD-cargo significantly enhanced cytoplasmic delivery in the absence of cytotoxicity. EEDs address the critical rate-limiting step of endosomal escape in delivery of macromolecular biologic peptide, protein and siRNA therapeutics into cells. PMID:27604151

  11. Folding and escape of nascent proteins at ribosomal exit tunnel

    NASA Astrophysics Data System (ADS)

    Bui, Phuong Thuy; Hoang, Trinh Xuan

    2016-03-01

    We investigate the interplay between post-translational folding and escape of two small single-domain proteins at the ribosomal exit tunnel by using Langevin dynamics with coarse-grained models. It is shown that at temperatures lower or near the temperature of the fastest folding, folding proceeds concomitantly with the escape process, resulting in vectorial folding and enhancement of foldability of nascent proteins. The concomitance between the two processes, however, deteriorates as temperature increases. Our folding simulations as well as free energy calculation by using umbrella sampling show that, at low temperatures, folding at the tunnel follows one or two specific pathways without kinetic traps. It is shown that the escape time can be mapped to a one-dimensional diffusion model with two different regimes for temperatures above and below the folding transition temperature. Attractive interactions between amino acids and attractive sites on the tunnel wall lead to a free energy barrier along the escape route of the protein. It is suggested that this barrier slows down the escape process and consequently promotes correct folding of the released nascent protein.

  12. Immunosuppressive cells in tumor immune escape and metastasis.

    PubMed

    Liu, Yang; Cao, Xuetao

    2016-05-01

    Tumor immune escape and the initiation of metastasis are critical steps in malignant progression of tumors and have been implicated in the failure of some clinical cancer immunotherapy. Tumors develop numerous strategies to escape immune surveillance or metastasize: Tumors not only modulate the recruitment and expansion of immunosuppressive cell populations to develop the tumor microenvironment or pre-metastatic niche but also switch the phenotype and function of normal immune cells from a potentially tumor-reactive state to a tumor-promoting state. Immunosuppressive cells facilitate tumor immune escape by inhibiting antitumor immune responses and furthermore promote tumor metastasis by inducing immunosuppression, promoting tumor cell invasion and intravasation, establishing a pre-metastatic niche, facilitating epithelial-mesenchymal transition, and inducing angiogenesis at primary tumor or metastatic sites. Numerous translational studies indicate that it is possible to inhibit tumor immune escape and prevent tumor metastasis by blocking immunosuppressive cells and eliminating immunosuppressive mechanisms that are induced by either immunosuppressive cells or tumor cells. Furthermore, many clinical trials targeting immunosuppressive cells have also achieved good outcome. In this review, we focus on the underlying mechanisms of immunosuppressive cells in promoting tumor immune escape and metastasis, discuss our current understanding of the interactions between immunosuppressive cells and tumor cells in the tumor microenvironment, and suggest future research directions as well as potential clinical strategies in cancer immunotherapy.

  13. Escape Rates in a Stochastic Environment with Multiple Scales

    NASA Astrophysics Data System (ADS)

    Forgoston, Eric; Schwartz, Ira B.

    2009-01-01

    We consider a stochastic environment with two time scales and outline a general theory that compares two methods to reduce the dimension of the original system. The first method involves the computation of the underlying deterministic center manifold followed by a naive replacement of the stochastic term. The second method allows one to more accurately describe the stochastic effects and involves the derivation of a normal form coordinate transform that is used to find the stochastic center manifold. The results of both methods are used along with the path integral formalism of large fluctuation theory to predict the escape rate from one basin of attraction to another. The general theory is applied to the example of a surface flow described by a generic, singularly perturbed, damped, nonlinear oscillator with additive, Gaussian noise. We show how both nonlinear reduction methods compare in escape rate scaling. Additionally, the center manifolds are shown to predict high prehistory probability regions of escape. The theoretical results are confirmed using numerical computation of the mean escape time and escape prehistory, and we briefly discuss the extension of the theory to stochastic control.

  14. How embryos escape from danger: the mechanism of rapid, plastic hatching in red-eyed treefrogs.

    PubMed

    Cohen, Kristina L; Seid, Marc A; Warkentin, Karen M

    2016-06-15

    Environmentally cued hatching allows embryos to escape dangers and exploit new opportunities. Such adaptive responses require a flexibly regulated hatching mechanism sufficiently fast to meet relevant challenges. Anurans show widespread, diverse cued hatching responses, but their described hatching mechanisms are slow, and regulation of timing is unknown. Arboreal embryos of red-eyed treefrogs, Agalychnis callidryas, escape from snake attacks and other threats by very rapid premature hatching. We used videography, manipulation of hatching embryos and electron microscopy to investigate their hatching mechanism. High-speed video revealed three stages of the hatching process: pre-rupture shaking and gaping, vitelline membrane rupture near the snout, and muscular thrashing to exit through the hole. Hatching took 6.5-49 s. We hypothesized membrane rupture to be enzymatic, with hatching enzyme released from the snout during shaking. To test this, we displaced hatching embryos to move their snout from its location during shaking. The membrane ruptured at the original snout position and embryos became trapped in collapsed capsules; they either moved repeatedly to relocate the hole or shook again and made a second hole to exit. Electron microscopy revealed that hatching glands are densely concentrated on the snout and absent elsewhere. They are full of vesicles in embryos and release most of their contents rapidly at hatching. Agalychnis callidryas' hatching mechanism contrasts with the slow process described in anurans to date and exemplifies one way in which embryos can achieve rapid, flexibly timed hatching to escape from acute threats. Other amphibians with cued hatching may also have novel hatching mechanisms. PMID:27307544

  15. MAVEN measurements of photochemical escape of oxygen from the Martian atmosphere

    NASA Astrophysics Data System (ADS)

    Lillis, R. J.; Deighan, J.; Fox, J. L.; Bougher, S. W.; Cravens, T. E.; Lee, Y.; Mahaffy, P. R.; Benna, M.; Elrod, M. K.; Andersson, L.; McFadden, J.

    2015-10-01

    One of the primary goals of the Mars Atmosphere and Volatile Evolution Mission (MAVEN) mission is to characterize rates of atmospheric escape at the present epoch and relate those escape rates to solar drivers [1]. One of the major escape processes is known as photochemical escape, which is broadly defined as a process by which a) an exothermic reaction in the atmosphere/ionosphere results in an upward-traveling neutral particle whose velocity exceeds planetary escape velocity and b) the particle is not prevented from escaping through any subsequent collisions[2].At Mars, photochemical escape of oxygen is expected to be a significant channel for atmospheric escape, particularly in the early solar system when extreme ultraviolet (EUV) fluxes were much higher[3]. Thus characterizing this escape process is central to understanding the role escape to space has played in Mars' climate evolution.

  16. Coexisting chaotic and periodic dynamics in clock escapements.

    PubMed

    Moon, Francis C; Stiefel, Preston D

    2006-09-15

    This paper addresses the nature of noise in machines. As a concrete example, we examine the dynamics of clock escapements from experimental, historical and analytical points of view. Experiments on two escapement mechanisms from the Reuleaux kinematic collection at Cornell University are used to illustrate chaotic-like noise in clocks. These vibrations coexist with the periodic dynamics of the balance wheel or pendulum. A mathematical model is presented that shows how self-generated chaos in clocks can break the dry friction in the gear train. This model is shown to exhibit a strange attractor in the structural vibration of the clock. The internal feedback between the oscillator and the escapement structure is similar to anti-control of chaos models.

  17. Behavior of Ants Escaping from a Single-Exit Room

    PubMed Central

    Wang, Shujie; Lv, Wei; Song, Weiguo

    2015-01-01

    To study the rules of ant behavior and group-formation phenomena, we examined the behaviors of Camponotus japonicus, a species of large ant, in a range of situations. For these experiments, ants were placed inside a rectangular chamber with a single exit that also contained a filter paper soaked in citronella oil, a powerful repellent. The ants formed several groups as they moved toward the exit to escape. We measured the time intervals between individual escapes in six versions of the experiment, each containing an exit of a different width, to quantify the movement of the groups. As the ants exited the chamber, the time intervals between individual escapes changed and the frequency distribution of the time intervals exhibited exponential decay. We also investigated the relationship between the number of ants in a group and the group flow rate. PMID:26125191

  18. Neural Circuits Underlying Visually Evoked Escapes in Larval Zebrafish.

    PubMed

    Dunn, Timothy W; Gebhardt, Christoph; Naumann, Eva A; Riegler, Clemens; Ahrens, Misha B; Engert, Florian; Del Bene, Filippo

    2016-02-01

    Escape behaviors deliver organisms away from imminent catastrophe. Here, we characterize behavioral responses of freely swimming larval zebrafish to looming visual stimuli simulating predators. We report that the visual system alone can recruit lateralized, rapid escape motor programs, similar to those elicited by mechanosensory modalities. Two-photon calcium imaging of retino-recipient midbrain regions isolated the optic tectum as an important center processing looming stimuli, with ensemble activity encoding the critical image size determining escape latency. Furthermore, we describe activity in retinal ganglion cell terminals and superficial inhibitory interneurons in the tectum during looming and propose a model for how temporal dynamics in tectal periventricular neurons might arise from computations between these two fundamental constituents. Finally, laser ablations of hindbrain circuitry confirmed that visual and mechanosensory modalities share the same premotor output network. We establish a circuit for the processing of aversive stimuli in the context of an innate visual behavior. PMID:26804997

  19. Behavior of Ants Escaping from a Single-Exit Room.

    PubMed

    Wang, Shujie; Lv, Wei; Song, Weiguo

    2015-01-01

    To study the rules of ant behavior and group-formation phenomena, we examined the behaviors of Camponotus japonicus, a species of large ant, in a range of situations. For these experiments, ants were placed inside a rectangular chamber with a single exit that also contained a filter paper soaked in citronella oil, a powerful repellent. The ants formed several groups as they moved toward the exit to escape. We measured the time intervals between individual escapes in six versions of the experiment, each containing an exit of a different width, to quantify the movement of the groups. As the ants exited the chamber, the time intervals between individual escapes changed and the frequency distribution of the time intervals exhibited exponential decay. We also investigated the relationship between the number of ants in a group and the group flow rate.

  20. Kramers escape of a self-propelled particle

    NASA Astrophysics Data System (ADS)

    Geiseler, Alexander; Hänggi, Peter; Schmid, Gerhard

    2016-08-01

    We investigate the escape rate of an overdamped, self-propelled spherical Brownian particle on a surface from a metastable potential well. Within a modeling in terms of a 1D constant speed of the particle's active dynamics we consider the associated rate using both numerical and analytical approaches. Regarding the properties of the stationary state in the potential well, two major timescales exist, each governing the translational and the rotational dynamics of the particle, respectively. The particle radius is identified to present the essential quantity in charge of regulating the ratio between those timescales. For very small and very large particle radii, approximate analytic expressions for the particle's escape rate can be derived, which, within their respective range of validity, compare favorably with the precise escape numerics of the underlying full two-dimensional Fokker-Planck description.

  1. Abnormalities in Alternative Splicing of Apoptotic Genes and Cardiovascular Diseases

    PubMed Central

    Dlamini, Zodwa; Tshidino, Shonisani C.; Hull, Rodney

    2015-01-01

    Apoptosis is required for normal heart development in the embryo, but has also been shown to be an important factor in the occurrence of heart disease. Alternative splicing of apoptotic genes is currently emerging as a diagnostic and therapeutic target for heart disease. This review addresses the involvement of abnormalities in alternative splicing of apoptotic genes in cardiac disorders including cardiomyopathy, myocardial ischemia and heart failure. Many pro-apoptotic members of the Bcl-2 family have alternatively spliced isoforms that lack important active domains. These isoforms can play a negative regulatory role by binding to and inhibiting the pro-apoptotic forms. Alternative splicing is observed to be increased in various cardiovascular diseases with the level of alternate transcripts increasing elevated in diseased hearts compared to healthy subjects. In many cases these isoforms appear to be the underlying cause of the disease, while in others they may be induced in response to cardiovascular pathologies. Regardless of this, the detection of alternate splicing events in the heart can serve as useful diagnostic or prognostic tools, while those splicing events that seem to play a causative role in cardiovascular disease make attractive future drug targets. PMID:26580598

  2. A novel role for synaptic acetylcholinesterase as an apoptotic deoxyribonuclease

    PubMed Central

    Du, Aiying; Xie, Jing; Guo, Kaijie; Yang, Lei; Wan, Yihan; OuYang, Qi; Zhang, Xuejin; Niu, Xin; Lu, Lu; Wu, Jun; Zhang, Xuejun

    2015-01-01

    In addition to terminating neurotransmission by hydrolyzing acetylcholine, synaptic acetylcholinesterase (AChES) has been found to have a pro-apoptotic role. However, the underlying mechanism has rarely been investigated. Here, we report a nuclear translocation-dependent role for AChES as an apoptotic deoxyribonuclease (DNase). AChES polypeptide binds to and cleaves naked DNA at physiological pH in a Ca2+–Mg2+-dependent manner. It also cleaves chromosomal DNA both in pre-fixed and in apoptotic cells. In the presence of a pan-caspase inhibitor, the cleavage still occurred after nuclear translocation of AChES, implying that AChES-DNase acts in a CAD- and EndoG-independent manner. AChE gene knockout impairs apoptotic DNA cleavage; this impairment is rescued by overexpression of the wild-type but not (aa 32–138)-deleted AChES. Furthermore, in comparison with the nuclear-localized wild-type AChES, (aa 32–138)-deleted AChES loses the capacity to initiate apoptosis. These observations confirm that AChES mediates apoptosis via its DNase activity. PMID:27462404

  3. The apoptotic thanatotranscriptome associated with the liver of cadavers.

    PubMed

    Javan, Gulnaz T; Can, Ismail; Finley, Sheree J; Soni, Shivani

    2015-12-01

    Gene expression investigations are well-established components of ante mortem studies with broad applications ranging from elucidating basic mechanisms responsible for normal physiological processes to discovering therapeutic targets in pathophysiological conditions. However, gene expression studies and their application in the medico-legal field are still in their infancy. Therefore, the present study focuses on RNA using PCR array in the analysis of gene expression associated with tissues taken from actual criminal cases. RNA was extracted from the liver tissues of bodies with PMIs between 6 and 48 h. The results demonstrated that mRNA was stable up to 48 h postmortem. Further, as cell death is an indispensable and necessary part of the biological life cycle, apoptotic gene expression profiles were investigated. The gene expression related to the programmed cell death found in body tissues after death is defined as the apoptotic thanatotranscriptome (thanatos-, Greek for death). On comparison of control and decaying tissues, the results show that with time, pro-apoptotic genes such as caspases are up-regulated and the expression of genes responsible for anti-apoptosis such as BCL2 and BAG3 were down-regulated. Thus, this current work gives a unique perspective of the apoptotic thanatotranscriptome that is affected after death. Up to the present time, gene expression in bodies from criminal cases has not been reported in literature using PCR array techniques. Thus, this thanatotranscriptome study provides insight into postmortem gene activity with potential applications in medico-legal investigations.

  4. Regulation of Apoptotic Endonucleases by EndoG

    PubMed Central

    Zhdanov, Dmitry D.; Fahmi, Tariq; Wang, Xiaoying; Apostolov, Eugene O.; Sokolov, Nikolai N.; Javadov, Sabzali

    2015-01-01

    Cells contain several apoptotic endonucleases, which appear to act simultaneously before and after cell death by destroying the host cell DNA. It is largely unknown how the endonucleases are being induced and whether they can regulate each other. This study was performed to determine whether apoptotic mitochondrial endonuclease G (EndoG) can regulate expression of other apoptotic endonucleases. The study showed that overexpression of mature EndoG in kidney tubular epithelial NRK-52E cells can increase expression of caspase-activated DNase (CAD) and four endonucleases that belong to DNase I group including DNase I, DNase X, DNase IL2, and DNase γ, but not endonucleases of the DNase 2 group. The induction of DNase I-type endonucleases was associated with DNA degradation in promoter/exon 1 regions of the endonuclease genes. These results together with findings on colocalization of immunostained endonucleases and TUNEL suggest that DNA fragmentation after EndoG overexpression was caused by DNase I endonucleases and CAD in addition to EndoG itself. Overall, these data provide first evidence for the existence of the integral network of apoptotic endonucleases regulated by EndoG. PMID:25849439

  5. Monitoring circulating apoptotic cells by in-vivo flow cytometry

    NASA Astrophysics Data System (ADS)

    Wei, Xunbin; Tan, Yuan; Chen, Yun; Zhang, Li; Li, Yan; Liu, Guangda; Wu, Bin; Wang, Chen

    2008-02-01

    Chemotherapies currently constitute one main venue of cancer treatment. For a large number of adult and elderly patients, however, treatment options are poor. These patients may suffer from disease that is resistant to conventional chemotherapy or may not be candidates for curative therapies because of advanced age or poor medical conditions. To control disease in these patients, new therapies must be developed that are selectively targeted to unique characteristics of tumor cell growth and metastasis. A reliable early evaluation and prediction of response to the chemotherapy is critical to its success. Chemotherapies induce apoptosis in tumor cells and a portion of such apoptotic cancer cells may be present in the circulation. However, the fate of circulating tumor cells is difficult to assess with conventional methods that require blood sampling. We report the in situ measurement of circulating apoptotic cells in live animals using in vivo flow cytometry, a novel method that enables real-time detection and quantification of circulating cells without blood extraction. Apoptotic cells are rapidly cleared from the circulation with a half-life of ~10 minutes. Real-time monitoring of circulating apoptotic cells can be useful for detecting early changes in disease processes, as well as for monitoring response to therapeutic intervention.

  6. Autophagic and apoptotic cell death in amniotic epithelial cells.

    PubMed

    Shen, Z-Y; Li, E-M; Lu, S-Q; Shen, J; Cai, Y-M; Wu, Y-E; Zheng, R-M; Tan, L-J; Xu, L-Y

    2008-11-01

    The aim of this paper is to determine if autophagic cell death is associated with apoptosis and whether it participates in the process of term amniotic rupture. Forty pieces of fresh term amnions, including twenty from a position near the margin of the placentas and twenty from the margin of the naturally ruptured part of the placentas in term gestation were collected, respectively. The amnions were examined by scanning electron microscopy (SEM) and amniotic epithelial (AE) cells were examined by transmission electron microscopy (TEM). Autophagic and apoptotic cell death (PCD) were assayed by laser scanning confocal microscopy (LSCM) or flow cytometry using monodansylcadaverin (MDC) and propidium iodide (PI) stain. BCL(2) and BAX were examined by immunoblotting. Under SEM the amniotic epithelia appeared normal in the position near the placenta. They had an atrophied appearance in the margin of their natural broken parts. In the AE cells PCD was divided into three subtypes by TEM: autophagic cell death with positive stains of MDC and PI; apoptotic cell death; and the mixed type. Quantitative detection showed that there were more death cells, including autophagic and apoptotic, in the AE cells near the ruptured parts than near the placentas. An increased expression of BAX and a decreased expression of BCL(2) protein in the AE cells near the broken margin were observed. Apoptotic and autophagic cell death by the intrinsic pathway are the basic event in the AE cell and they are involved in the cause of membrane rupture of the human amnion in term gestation.

  7. The apoptotic thanatotranscriptome associated with the liver of cadavers.

    PubMed

    Javan, Gulnaz T; Can, Ismail; Finley, Sheree J; Soni, Shivani

    2015-12-01

    Gene expression investigations are well-established components of ante mortem studies with broad applications ranging from elucidating basic mechanisms responsible for normal physiological processes to discovering therapeutic targets in pathophysiological conditions. However, gene expression studies and their application in the medico-legal field are still in their infancy. Therefore, the present study focuses on RNA using PCR array in the analysis of gene expression associated with tissues taken from actual criminal cases. RNA was extracted from the liver tissues of bodies with PMIs between 6 and 48 h. The results demonstrated that mRNA was stable up to 48 h postmortem. Further, as cell death is an indispensable and necessary part of the biological life cycle, apoptotic gene expression profiles were investigated. The gene expression related to the programmed cell death found in body tissues after death is defined as the apoptotic thanatotranscriptome (thanatos-, Greek for death). On comparison of control and decaying tissues, the results show that with time, pro-apoptotic genes such as caspases are up-regulated and the expression of genes responsible for anti-apoptosis such as BCL2 and BAG3 were down-regulated. Thus, this current work gives a unique perspective of the apoptotic thanatotranscriptome that is affected after death. Up to the present time, gene expression in bodies from criminal cases has not been reported in literature using PCR array techniques. Thus, this thanatotranscriptome study provides insight into postmortem gene activity with potential applications in medico-legal investigations. PMID:26318598

  8. Differential nitric oxide synthesis and host apoptotic events correlate with bleaching susceptibility in reef corals

    NASA Astrophysics Data System (ADS)

    Hawkins, T. D.; Krueger, T.; Becker, S.; Fisher, P. L.; Davy, S. K.

    2014-03-01

    Coral bleaching poses a threat to coral reefs worldwide. As a consequence of the temperature-induced breakdown in coral-dinoflagellate symbiosis, bleaching can have extensive effects on reef communities. However, our understanding of bleaching at a cellular level is limited, and this is particularly true regarding differential susceptibility among coral species. Recent work suggests that bleaching may represent a host innate immune-like response to symbiont dysfunction that involves synthesis of the signalling compound nitric oxide (NO) and the induction of host apoptotic-like cell death. In this study, we examined the activity of apoptosis-regulating enzymes alongside oxidised NO accumulation (a proxy for NO synthesis) in the reef corals Acropora millepora, Montipora digitata, and Pocillopora damicornis during experimental thermal stress. P. damicornis was the most sensitive species, suffering mortality (tissue sloughing) after 5 days at 33 °C but non-lethal bleaching after 9 days at 31.5 °C. A. millepora bleached at 33 °C but remained structurally intact, while M. digitata showed little evidence of bleaching. P. damicornis and A. millepora both exhibited evidence of temperature-induced NO synthesis and, after 5 days of heating, levels of oxidised NO in both species were fivefold higher than in controls maintained at 28.5 °C. These responses preceded bleaching by a number of days and may have occurred before symbiont dysfunction (measured as chlorophyll a degradation and oxidised NO accumulation). In A. millepora, apparent NO synthesis correlated with the induction of host apoptotic-like pathways, while in P. damicornis, the upregulation of apoptotic pathways occurred later. No evidence of elevated NO production or apoptosis was observed in M. digitata at 33 °C and baseline activity of apoptosis-regulating enzymes was negligible in this species. These findings provide important physiological data in the context of the responses of corals to global change and

  9. Fractionation of the Early Terrestrial Atmospheres: Dynamical Escape

    NASA Technical Reports Server (NTRS)

    Hartle, Richard E.

    2002-01-01

    Hydrodynamic escape may have played a significant role in the early fractionation of the atmospheres of the terrestrial planets. This possibility has been demonstrated in the last two decades by numerous models that show radial, transonic flow of hydrogen can occur in the presence of sufficient solar EUV Hydrodynamic escape may have played a significant role in the early fractionation of the atmospheres of the terrestrial planets. This possibility has been demonstrated in the last two decades by numerous models that show radial, transonic flow of hydrogen can occur in the presence of sufficient solar EUV flux, thought to exist in the first 500 My. The models show that the larger the solar flux the greater the mass of the fractionating species, which are accelerated to escape speeds by the hydrogen wind through drag processes. As the atmospheres evolve and the solar EUV flux wanes, the maximum mass of flowing gas constituents decreases until all gases become static. We show that fractionation can continue beyond this point when non-radial flow and dynamically enhanced Jeans escape are considered. For example, the early terrestrial atmospheres are thought to have had large hydrogen contents, resulting in exobase altitudes of a planetary radius or more. In this case, rotational speeds at the exobases of Earth and Mars would be large enough so that light constituents would "spin" off and fractionate, especially at equatorial latitudes. Also, in the presence of transonic flow of hydrogen only, non-radial expansion throws heavier gases to high altitudes in the exosphere, accompanied by strong bulk speeds at the exobase, which results in enhanced thermal escape fluxes and fractionation. flux, thought to exist in the first 500 My. The models show that the larger the solar flux the greater the mass of the fractionating species, which are accelerated to escape speeds by the hydrogen wind through drag processes. As the atmospheres evolve and the solar EUV flux wanes, the

  10. Rapid endosomal escape of prickly nanodiamonds: implications for gene delivery

    NASA Astrophysics Data System (ADS)

    Chu, Zhiqin; Miu, Kaikei; Lung, Pingsai; Zhang, Silu; Zhao, Saisai; Chang, Huan-Cheng; Lin, Ge; Li, Quan

    2015-06-01

    The prickly nanodiamonds easily entered cells via endocytosis followed by unique intracellular translocation characteristics—quick endosomal escape followed by stable residence in cytoplasm. Endosomal membrane rupturing is identified as the major route of nanodiamonds’ escaping the vesicle confinement and to the cytoplasm. Little cytotoxicity is observed to associate with the nanodiamonds’ cytosolic release. Such features enable its application for gene delivery, which requires both effective cellular uptake and cytosolic release of the gene. Taking green fluorescent protein gene as an example, we demonstrate the successful cytosolic delivery and expression of such a gene using the prickly nanodiamonds as carrier.

  11. Measuring the escaping beam ions from a tokamak plasma

    SciTech Connect

    Buchenauer, D.; Heidbrink, W.W.; Roquemore, L.; McGuire, K.

    1987-12-01

    A new technique using a silicon surface barrier (SSB) diode has been developed for measuring the escaping fast ion flux from a tokamak plasma. Calibration of the detector with an ion beam showed that at a fixed energy the diode's output current varied linearly with the incident deuteron flux. The diode was mounted inside the PDX vacuum vessel with collimating apertures designed to admit the spiraling orbits of 50-keV deuterons expelled from the plasma by MHD instabilities. Results from PDX indicated that relative measurements of the escaping fast ion flux due to several plasma instabilities could be made.

  12. Rapid endosomal escape of prickly nanodiamonds: implications for gene delivery.

    PubMed

    Chu, Zhiqin; Miu, Kaikei; Lung, Pingsai; Zhang, Silu; Zhao, Saisai; Chang, Huan-Cheng; Lin, Ge; Li, Quan

    2015-01-01

    The prickly nanodiamonds easily entered cells via endocytosis followed by unique intracellular translocation characteristics—quick endosomal escape followed by stable residence in cytoplasm. Endosomal membrane rupturing is identified as the major route of nanodiamonds' escaping the vesicle confinement and to the cytoplasm. Little cytotoxicity is observed to associate with the nanodiamonds' cytosolic release. Such features enable its application for gene delivery, which requires both effective cellular uptake and cytosolic release of the gene. Taking green fluorescent protein gene as an example, we demonstrate the successful cytosolic delivery and expression of such a gene using the prickly nanodiamonds as carrier. PMID:26123532

  13. Rapid endosomal escape of prickly nanodiamonds: implications for gene delivery

    PubMed Central

    Chu, Zhiqin; Miu, Kaikei; Lung, Pingsai; Zhang, Silu; Zhao, Saisai; Chang, Huan-Cheng; Lin, Ge; Li, Quan

    2015-01-01

    The prickly nanodiamonds easily entered cells via endocytosis followed by unique intracellular translocation characteristics—quick endosomal escape followed by stable residence in cytoplasm. Endosomal membrane rupturing is identified as the major route of nanodiamonds’ escaping the vesicle confinement and to the cytoplasm. Little cytotoxicity is observed to associate with the nanodiamonds’ cytosolic release. Such features enable its application for gene delivery, which requires both effective cellular uptake and cytosolic release of the gene. Taking green fluorescent protein gene as an example, we demonstrate the successful cytosolic delivery and expression of such a gene using the prickly nanodiamonds as carrier. PMID:26123532

  14. Primary enzyme quantitation

    DOEpatents

    Saunders, G.C.

    1982-03-04

    The disclosure relates to the quantitation of a primary enzyme concentration by utilizing a substrate for the primary enzyme labeled with a second enzyme which is an indicator enzyme. Enzyme catalysis of the substrate occurs and results in release of the indicator enzyme in an amount directly proportional to the amount of primary enzyme present. By quantifying the free indicator enzyme one determines the amount of primary enzyme present.

  15. Apoptotic tubular cell death during acute renal allograft rejection.

    PubMed

    Wever, P C; Aten, J; Rentenaar, R J; Hack, C E; Koopman, G; Weening, J J; ten Berge, I J

    1998-01-01

    Tubular cells are important targets during acute renal allograft rejection and induction of apoptosis might be a mechanism of tubular cell destruction. Susceptibility to induction of apoptosis is regulated by the homologous Bcl-2 and Bax proteins. Expression of Bcl-2 and Bax is regulated by p53, which down-regulates expression of Bcl-2, while simultaneously up-regulating expression of Bax. We studied apoptotic tubular cell death in 10 renal allograft biopsies from transplant recipients with acute rejection by in situ end-labelling and the DNA-binding fluorochrome propidium iodide. Tubular expression of p53, Bcl-2 and Bax was studies by immunohistochemistry. Five renal allograft biopsies from transplant recipients with uncomplicated clinical course and histologically normal renal tissue present in nephrectomy specimens from 4 patients with renal adenocarcinoma served as control specimens. Apoptotic cells and apoptotic bodies were detected in tubular epithelia and tubular lumina in 9 out of 10 acute rejection biopsies. In control renal tissue, apoptotic cells were detected in 1 biopsy only. Compared to control renal tissue, acute renal allograft rejection was, furthermore, associated with a shift in the ratio of Bcl-2 to Bax in favour of Bax in tubular epithelia and increased expression of p53 in tubular nuclei. These observations demonstrate that apoptosis contributes in part to tubular cell destruction during acute renal allograft rejection. In accordance, the shift in the ratio of Bcl-2 to Bax in favour of Bax indicates increased susceptibility of tubular epithelia to induction of apoptosis. The expression of p53 in tubular nuclei during acute renal allograft rejection indicates the presence of damaged DNA, which can be important in initiation of part of the observed apoptosis. These findings elucidate part of the mechanisms controlling apoptotic tubular cell death during acute renal allograft rejection.

  16. The peculiar apoptotic behavior of skeletal muscle cells.

    PubMed

    Salucci, Sara; Burattini, Sabrina; Baldassarri, Valentina; Battistelli, Michela; Canonico, Barbara; Valmori, Aurelio; Papa, Stefano; Falcieri, Elisabetta

    2013-08-01

    Apoptosis plays an active role in maintaining skeletal muscle homeostasis. Its deregulation is involved in several skeletal muscle disorders such as dystrophies, myopathies, disuse and sarcopenia. The aim of this work was to study in vitro the apoptotic behavior induced by etoposide, staurosporine and hydrogen peroxide in the C2C12 skeletal muscle cell line, comparing myoblast vs myotube sensitivity, investigated by means of morphological and cytofluorimetric analyses. Myotubes appeared more resistant than myoblasts to apoptotic induction. In myoblasts treated with etoposide, nuclei with chromatin condensation were observed, in the presence of a diffuse DNA fragmentation, as shown by confocal microscopy. The latter also appeared in myotubes, where apoptotic and normal nuclei coexisted inside the same syncytium. After staurosporine treatment, myobalsts evidenced late apoptotic features and a high number of TUNEL-positive nuclei. Secondary necrosis appeared in myotubes, where myonuclei with cleaved DNA again coexisted with normal myonuclei. After H₂O₂ exposure, myotubes, differently from myoblasts, showed a poor sensitivity to cell death. Intriguingly, autophagic granules appeared abundantly in myotubes after each treatment. In myotubes, mitochondria were better preserved than in myoblasts since those which were damaged were probably degraded through autophagic processes. These findings demonstrate a scarce sensitivity of myotubes to apoptotic stimuli due to acquisition of an apoptosis-resistant phenotype during differentiation. The presence of nuclear-dependent "territorial" death domains in the syncytium could explain a slower death of myotubes compared to mononucleated cells. In addition, autophagy could preserve and protect muscle cell integrity against chemical stimuli, making C2C12 cells, in particular myotubes, more resistant to apoptosis induction. PMID:23400589

  17. Identification of apoptotic drugs: multiparametric evaluation in cultured hepatocytes.

    PubMed

    Gómez-Lechón, María José; O'Connor, José Enrique; Lahoz, Agustín; Castell, José V; Donato, María Teresa

    2008-01-01

    It is now recognized that necrosis is not the only mechanism responsible for chemically-induced cell death. It is believed that apoptosis could be the major form of cell death induced by toxicants and that necrosis is associated only with circumstances of gross cell injury. The liver is a key target organ for drug toxicity and an important effort in drug-discovery deals with the identification of molecules with hepatotoxic potential. The importance of apoptosis in toxicology has been underestimated given the difficulty of identifying apoptotic cells in in vitro models when apoptosis normally degenerates to secondary necrosis. Nowadays, the central role played by apoptosis in the toxicity of many xenobiotics and P450-generated metabolites is recognized. The detection of drug-induced apoptosis constitutes one of the highest priorities of the pharmaceutical industry. Different markers aimed at identifying apoptotic compounds irrespectively of the pathway of how cell apoptosis was initiated have been proposed. The aim of the present paper is to review the utility of some available in vitro strategies for studying drug-induced liver apoptosis. The evaluation of apoptotic or anti-apoptotic effects of chemicals in hepatocytes is illustrated by several examples including model apoptotic compounds, pharmaceutical drugs which have been shown to induce apoptosis as an adverse effect; and drugs preventing apoptosis. By combining appropriated markers, apoptosis can be detected in hepatocytes long before cell necrosis, at sub-cytotoxic concentrations of the drugs. The possibility of using small amounts of cells cultured in multiwell formats and automation has notably contributed to develop reproducible, reliable, sensitive, easy-to-handle and rapid multiparametric assays that are ideally amenable to high throughput screening (HTS).

  18. Entry of bacteriophage T7 DNA into the cell and escape from host restriction

    SciTech Connect

    Moffatt, B.A.; Studier, F.W.

    1988-05-01

    T7 DNA did not become susceptible to degradation by the host restriction enzymes EcoB, EcoK, or EcoP1 until 6 to 7 min after infection (at 30/sup 0/C). During this period, T7 gene 0.3 protein is made and inactivates EcoB and EcoK, allowing wild-type T7, or even a mutant that has recognition sites flanking gene 0.3, to escape restriction by these enzymes. However, T7 failed to escape restriction by EcoP1 even though 0.3 protein was made, evidently because 0.3 protein is unable to inactivate EcoP1. How T7 DNA can be accessible to transcription but not restriction in the first few minutes of infection is not yet understood, but we favor the idea that the entering DNA is initially segregated in a special place. Entry of T7 DNA into the cell is normally coupled to transcription. Tests of degradation of DNAs having their first restriction sites different distances from the end of the DNA indicated that only the first 1000 or so base pairs (2.5%) of the molecule enter the cell without transcription. An exception was the only mutant tested that lacks base pairs 343 to 393 of T7 DNA; most or all of this DNA entered the cell without being transcribed, apparently because it lacks a sequence that normally arrests entry. This block to DNA entry would normally be relieved by the host RNA polymerase transcribing from an appropriately situated promoter, but the block can also be relieved by T7 RNA polymerase, if supplied by the host cell. T7 mutants that lack all three strong early promoters A1, A2, and A3 could grow by using a secondary promoter.

  19. Chronic MDMA induces neurochemical changes in the hippocampus of adolescent and young adult rats: Down-regulation of apoptotic markers.

    PubMed

    García-Cabrerizo, Rubén; García-Fuster, M Julia

    2015-07-01

    While hippocampus is a brain region particularly susceptible to the effects of MDMA, the cellular and molecular changes induced by MDMA are still to be fully elucidated, being the dosage regimen, the species and the developmental stage under study great variables. This study compared the effects of one and four days of MDMA administration following a binge paradigm (3×5 mg/kg, i.p., every 2 h) on inducing hippocampal neurochemical changes in adolescent (PND 37) and young adult (PND 58) rats. The results showed that chronic MDMA caused hippocampal protein deficits in adolescent and young adult rats at different levels: (1) impaired serotonergic (5-HT2A and 5-HT2C post-synaptic receptors) and GABAergic (GAD2 enzyme) signaling, and (2) decreased structural cytoskeletal neurofilament proteins (NF-H, NF-M and NF-L). Interestingly, these effects were not accompanied by an increase in apoptotic markers. In fact, chronic MDMA inhibited proteins of the apoptotic pathway (i.e., pro-apoptotic FADD, Bax and cytochrome c) leading to an inhibition of cell death markers (i.e., p-JNK1/2, cleavage of PARP-1) and suggesting regulatory mechanisms in response to the neurochemical changes caused by the drug. The data, together with the observed lack of GFAP activation, support the view that chronic MDMA effects, regardless of the rat developmental age, extends beyond neurotransmitter systems to impair other hippocampal structural cell markers. Interestingly, inhibitory changes in proteins from the apoptotic pathway might be taking place to overcome the protein deficits caused by MDMA.

  20. Nickel oxide nanoparticles exert cytotoxicity via oxidative stress and induce apoptotic response in human liver cells (HepG2).

    PubMed

    Ahamed, Maqusood; Ali, Daoud; Alhadlaq, Hisham A; Akhtar, Mohd Javed

    2013-11-01

    Increasing use of nickel oxide nanoparticles (NiO NPs) necessitates an improved understanding of their potential impact on human health. Previously, toxic effects of NiO NPs have been investigated, mainly on airway cells. However, information on effect of NiO NPs on human liver cells is largely lacking. In this study, we investigated the reactive oxygen species (ROS) mediated cytotoxicity and induction of apoptotic response in human liver cells (HepG2) due to NiO NPs exposure. Prepared NiO NPs were crystalline and spherical shaped with an average diameter of 44 nm. NiO NPs induced cytotoxicity (cell death) and ROS generation in HepG2 cells in dose-dependent manner. Further, ROS scavenger vitamin C reduced cell death drastically caused by NiO NPs exposure indicating that oxidative stress plays an important role in NiO NPs toxicity. Micronuclei induction, chromatin condensation and DNA damage in HepG2 cells treated with NiO NPs suggest that NiO NPs induced cell death via apoptotic pathway. Quantitative real-time PCR analysis showed that following the exposure of HepG2 cells to NiO NPs, the expression level of mRNA of apoptotic genes (bax and caspase-3) were up-regulated whereas the expression level of anti-apoptotic gene bcl-2 was down-regulated. Moreover, activity of caspase-3 enzyme was also higher in NiO NPs treated cells. To the best of our knowledge this is the first report demonstrating that NiO NPs caused cytotoxicity via ROS and induced apoptosis in HepG2 cells, which is likely to be mediated through bax/bcl-2 pathway. This work warrants careful assessment of Ni NPs before their commercial and industrial applications. PMID:24139157

  1. Chronic MDMA induces neurochemical changes in the hippocampus of adolescent and young adult rats: Down-regulation of apoptotic markers.

    PubMed

    García-Cabrerizo, Rubén; García-Fuster, M Julia

    2015-07-01

    While hippocampus is a brain region particularly susceptible to the effects of MDMA, the cellular and molecular changes induced by MDMA are still to be fully elucidated, being the dosage regimen, the species and the developmental stage under study great variables. This study compared the effects of one and four days of MDMA administration following a binge paradigm (3×5 mg/kg, i.p., every 2 h) on inducing hippocampal neurochemical changes in adolescent (PND 37) and young adult (PND 58) rats. The results showed that chronic MDMA caused hippocampal protein deficits in adolescent and young adult rats at different levels: (1) impaired serotonergic (5-HT2A and 5-HT2C post-synaptic receptors) and GABAergic (GAD2 enzyme) signaling, and (2) decreased structural cytoskeletal neurofilament proteins (NF-H, NF-M and NF-L). Interestingly, these effects were not accompanied by an increase in apoptotic markers. In fact, chronic MDMA inhibited proteins of the apoptotic pathway (i.e., pro-apoptotic FADD, Bax and cytochrome c) leading to an inhibition of cell death markers (i.e., p-JNK1/2, cleavage of PARP-1) and suggesting regulatory mechanisms in response to the neurochemical changes caused by the drug. The data, together with the observed lack of GFAP activation, support the view that chronic MDMA effects, regardless of the rat developmental age, extends beyond neurotransmitter systems to impair other hippocampal structural cell markers. Interestingly, inhibitory changes in proteins from the apoptotic pathway might be taking place to overcome the protein deficits caused by MDMA. PMID:26068050

  2. 30 CFR 77.1101 - Escape and evacuation; plan.

    Code of Federal Regulations, 2012 CFR

    2012-07-01

    ....1101 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR COAL MINE SAFETY AND HEALTH MANDATORY SAFETY STANDARDS, SURFACE COAL MINES AND SURFACE WORK AREAS OF UNDERGROUND COAL MINES Fire Protection § 77.1101 Escape and evacuation; plan. (a) Before September 30, 1971, each operator...

  3. 30 CFR 77.1101 - Escape and evacuation; plan.

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ....1101 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR COAL MINE SAFETY AND HEALTH MANDATORY SAFETY STANDARDS, SURFACE COAL MINES AND SURFACE WORK AREAS OF UNDERGROUND COAL MINES Fire Protection § 77.1101 Escape and evacuation; plan. (a) Before September 30, 1971, each operator...

  4. 30 CFR 77.1101 - Escape and evacuation; plan.

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ....1101 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR COAL MINE SAFETY AND HEALTH MANDATORY SAFETY STANDARDS, SURFACE COAL MINES AND SURFACE WORK AREAS OF UNDERGROUND COAL MINES Fire Protection § 77.1101 Escape and evacuation; plan. (a) Before September 30, 1971, each operator...

  5. 30 CFR 77.1101 - Escape and evacuation; plan.

    Code of Federal Regulations, 2014 CFR

    2014-07-01

    ....1101 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR COAL MINE SAFETY AND HEALTH MANDATORY SAFETY STANDARDS, SURFACE COAL MINES AND SURFACE WORK AREAS OF UNDERGROUND COAL MINES Fire Protection § 77.1101 Escape and evacuation; plan. (a) Before September 30, 1971, each operator...

  6. 30 CFR 77.1101 - Escape and evacuation; plan.

    Code of Federal Regulations, 2013 CFR

    2013-07-01

    ....1101 Mineral Resources MINE SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR COAL MINE SAFETY AND HEALTH MANDATORY SAFETY STANDARDS, SURFACE COAL MINES AND SURFACE WORK AREAS OF UNDERGROUND COAL MINES Fire Protection § 77.1101 Escape and evacuation; plan. (a) Before September 30, 1971, each operator...

  7. Brain size as a driver of avian escape strategy

    PubMed Central

    Samia, Diogo S. M.; Pape Møller, Anders; Blumstein, Daniel T.

    2015-01-01

    After detecting an approaching predator, animals make a decision when to flee. Prey will initiate flight soon after detecting a predator so as to minimize attentional costs related to on-going monitoring of the whereabouts of the predator. Such costs may compete with foraging and other maintenance activities and hence be larger than the costs of immediate flight. The drivers of interspecific variation in escape strategy are poorly known. Here we investigated the morphological, life history and natural history traits that correlate with variation in avian escape strategy across a sample of 96 species of birds. Brain mass, body size, habitat structure and group size were the main predictors of escape strategy. The direction of the effect of these traits was consistent with selection for a reduction of monitoring costs. Therefore, attentional costs depend on relative brain size, which determines the ability to monitor the whereabouts of potential predators and the difficulty of this task as reflected by habitat and social complexity. Thus brain size, and the cognitive functions associated with it, constitute a general framework for explaining the effects of body size, habitat structure and sociality identified as determinants of avian escape strategy. PMID:26139474

  8. Magnetic buoyancy and the escape of magnetic fields from stars

    NASA Astrophysics Data System (ADS)

    Parker, E. N.

    1984-06-01

    Magnetic buoyancy causes the azimuthal magnetic fields of stars to rise rapidly to the surface, from where they are generally assumed to escape freely into space. However, a closer look at the problem reveals the simple fact that disengagement of the field from the gas, and escape into space, require a convoluted field configuration, producing neutral point reconnection of the flux in the tenuous gas above the surface of the star. Only that flux which reconnects can escape. Recent observations of the magnetic fields emerging through the surface of the Sun show that even at sunspot maximum the gaps in longitude between bipolar magnetic regions are so wide as to limit severely the reconnection between regions. We suggest from the observations that no more than perhaps 3% of the flux that is observed to emerge through the surface is able to reconnect and escape. Hence the surface of the Sun approximates to an impenetrable barrier rather than an open surface, with quantitative consequences for theoretical dynamo models. Recent observations of the retraction of bipolar fields at the end of their appearance at the surface suggest active dynamical control by the convection beneath the surface.

  9. 46 CFR 116.500 - Means of escape.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... escape must not be less than 810 millimeters (32 inches) in width, however, doors or passageways used solely by crew members must have a clear opening not less than 710 millimeters (28 inches). The sum of... millimeters (0.333 inches) multiplied by the number of passengers for which the space is designed. (g) A...

  10. 46 CFR 116.500 - Means of escape.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... escape must not be less than 810 millimeters (32 inches) in width, however, doors or passageways used solely by crew members must have a clear opening not less than 710 millimeters (28 inches). The sum of... millimeters (0.333 inches) multiplied by the number of passengers for which the space is designed. (g) A...

  11. Neutral atmospheric escape at Venus and Mars (Invited)

    NASA Astrophysics Data System (ADS)

    Leblanc, F.

    2013-12-01

    Neutral escape is referring to neutral particles leaving a planetary object and never reimpacting it. Such particles can ultimately get ionized or simply reach the Hill sphere. The Jeans and/or hydrodynamic fluxes represent the thermal component of the neutral escape, that is, that portion of the velocity distribution at the external boundary of that object that can evaporate with enough energy to definitively escape. A second component is also usually introduced to describe the products of several energetic mechanisms that could lead also to planetary erosion. This second component, called supra-thermal, is particularly important at Mars since it is thought to be one of the possible driver of Mars' atmospheric erosion during the last 4 Gyr. Because Venus and Mars are so similar in terms of interaction with the solar wind, there are many reasons to believe that these energetic mechanisms occur at both planets. In this presentation, I will present what is understood on the possible past and present channels of neutral escape at both Mars and Venus. The respective importance of the thermal and supra-thermal components along Mars and Venus histories, the main signatures of these components in the present atmosphere and what should be learned from the forthcoming space missions will be discussed.

  12. Enuresis Control through Fading, Escape, and Avoidance Training.

    ERIC Educational Resources Information Center

    Hansen, Gordon D.

    1979-01-01

    A twin signal device that provides both escape and avoidance conditioning in enuresis control was documented with case studies of two enuretic children (eight and nine years old). In addition, a technique of fading as an adjunct to the process was utilized with one subject. (Author/SBH)

  13. Speed kills: ineffective avian escape responses to oncoming vehicles.

    PubMed

    DeVault, Travis L; Blackwell, Bradley F; Seamans, Thomas W; Lima, Steven L; Fernández-Juricic, Esteban

    2015-02-22

    Animal-vehicle collisions cause high levels of vertebrate mortality worldwide, and what goes wrong when animals fail to escape and ultimately collide with vehicles is not well understood. We investigated alert and escape behaviours of captive brown-headed cowbirds (Molothrus ater) in response to virtual vehicle approaches of different sizes and at speeds ranging from 60 to 360 km h(-1). Alert and flight initiation distances remained similar across vehicle speeds, and accordingly, alert and flight initiation times decreased at higher vehicle speeds. Thus, avoidance behaviours in cowbirds appeared to be based on distance rather than time available for escape, particularly at 60-150 km h(-1); however, at higher speeds (more than or equal to 180 km h(-1)) no trend in response behaviour was discernible. As vehicle speed increased, cowbirds did not have enough time to assess the approaching vehicle, and cowbirds generally did not initiate flight with enough time to avoid collision when vehicle speed exceeded 120 km h(-1). Although potentially effective for evading predators, the decision-making process used by cowbirds in our study appears maladaptive in the context of avoiding fast-moving vehicles. Our methodological approach and findings provide a framework to assess how novel management strategies could affect escape rules, and the sensory and cognitive abilities animals use to avoid vehicle collisions.

  14. 46 CFR 28.390 - Means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 1 2012-10-01 2012-10-01 false Means of escape. 28.390 Section 28.390 Shipping COAST... emergency exits, passageways, stairways, ladders, deck scuttles, and windows. (b) At least one of the means... suitable for use in emergency conditions and must be of rigid construction. (f) A window or windshield...

  15. 6. UNDERGROUND FIRING CONTROL ROOM, INTERIOR. Looking southeast to escape ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    6. UNDERGROUND FIRING CONTROL ROOM, INTERIOR. Looking southeast to escape tunnel. - Edwards Air Force Base, Air Force Rocket Propulsion Laboratory, Firing Control Building, Test Area 1-100, northeast end of Test Area 1-100 Road, Boron, Kern County, CA

  16. The magnetic anomalies significantrly reduce the Martian ionospheric escape rate

    NASA Astrophysics Data System (ADS)

    Fedorov, A.; Barabash, S.; Sauvaud, J.-A.

    2012-09-01

    Looking forward to the MAVEN mission, it seems very useful to return to Mars Express data to refresh an important problem of Martian atmosphere escape: what role the crustal magnetic field may play in this process? There are several publications on this topic with completely opposite conclusions. The last hybrid simulations show that the magnetic anomalies significantly reduce the ion loss rate during solar minimum. We are trying to use a new approach to Mars Express IMA data analysis to check how it is possible. On the base of a statistical study of the ion distributions in the Martian magnetotail we show that the characteristic accelerated ions are not associated with the magnetic anomalies but only with interplanetary magnetic field clock angle. Moreover the magnetic anomalies screen and deviate the escaping flow leading to reducing of the total loss rate. We have calculated a "quasiexperimental" escaping rate in an assumption of the total absence of the magnetic anomalies. We are comparing this value with a real measured escape rate.

  17. 46 CFR 127.240 - Means of escape.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... portholes, from each of the following spaces: (1) Each space accessible to offshore workers. (2) Crew accommodations and each space where the crew may normally be employed. (b) At least one of the two means of... sides of the space, to minimize the possibility that one incident will block both escapes. (d) Except...

  18. 46 CFR 127.240 - Means of escape.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... portholes, from each of the following spaces: (1) Each space accessible to offshore workers. (2) Crew accommodations and each space where the crew may normally be employed. (b) At least one of the two means of... sides of the space, to minimize the possibility that one incident will block both escapes. (d) Except...

  19. 46 CFR 127.240 - Means of escape.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... portholes, from each of the following spaces: (1) Each space accessible to offshore workers. (2) Crew accommodations and each space where the crew may normally be employed. (b) At least one of the two means of... sides of the space, to minimize the possibility that one incident will block both escapes. (d) Except...

  20. Viral escape mechanisms--escapology taught by viruses.

    PubMed

    Lucas, M; Karrer, U; Lucas, A; Klenerman, P

    2001-10-01

    Viruses have 'studied' immunology over millions of years of coevolution with their hosts. During this ongoing education they have developed countless mechanisms to escape from the host's immune system. To illustrate the most common strategies of viral immune escape we have focused on two murine models of persistent infection, lymphocytic choriomeningitis virus (LCMV) and murine cytomegalovirus (MCMV). LCMV is a fast replicating small RNA virus with a genome prone to mutations. Therefore, LCMV escapes from the immune system mainly by two strategies: 'speed' and 'shape change'. At the opposite extreme, MCMV is a large, complex DNA virus with a more rigid genome and thus the strategies used by LCMV are no option. However, MCMV has the coding capacity for additional genes which interfere specifically with the immune response of the host. These escape strategies have been described as 'camouflage' and 'sabotage'. Using these simple concepts we describe the spectrum of viral escapology, giving credit not only to the researchers who uncovered this fascinating area of immunology but also to the viruses themselves, who still have a few lessons to teach.

  1. 46 CFR 108.445 - Alarm and means of escape.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 4 2010-10-01 2010-10-01 false Alarm and means of escape. 108.445 Section 108.445 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Fire Extinguishing Systems Fixed Carbon Dioxide Fire Extinguishing Systems §...

  2. 46 CFR 108.445 - Alarm and means of escape.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 4 2011-10-01 2011-10-01 false Alarm and means of escape. 108.445 Section 108.445 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) A-MOBILE OFFSHORE DRILLING UNITS DESIGN AND EQUIPMENT Fire Extinguishing Systems Fixed Carbon Dioxide Fire Extinguishing Systems §...

  3. Action of cocaine and chronic sympathetic denervation on vagal escape

    PubMed Central

    Campos, H. A.; Urquilla, P. R.

    1969-01-01

    1. The effect of cocaine has been studied on vagal escape and on the tachycardia due to vagal stimulation in the atropinized dog. All the dogs were submitted to acute cervical section of the spinal cord and acute or chronic sympathetic denervation. 2. Cocaine, 5 mg/kg or 40 μg/kg/min, I.V., induces a significant enhancement of the ventricular escape. The effects of a continuous infusion of cocaine are more reproducible than those of a single injection of the drug. 3. Cocaine, 40 μg/kg/min, I.V., potentiates the tachycardia due to vagal stimulation in the atropinized dog. 4. Chronic thoracic sympathectomy markedly retards the recovery of the ventricular rate from the inhibitory action of the vagus. Under this condition, the infusion of cocaine does not significantly enhance the ventricular escape. 5. These findings suggest that an adrenergic mechanism located at the sympathetic nerves supplying the heart is substantially involved in the phenomenon of vagal escape. PMID:5249864

  4. 2. WEST REAR, WITH PORTHOLE ESCAPE HATCH ABOVE ENTRY DOOR. ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    2. WEST REAR, WITH PORTHOLE ESCAPE HATCH ABOVE ENTRY DOOR. - Edwards Air Force Base, South Base Sled Track, Firing & Control Blockhouse for 10,000-foot Track, South of Sled Track at midpoint of 20,000-foot track, Lancaster, Los Angeles County, CA

  5. Social Escape Behaviors in Children with Fragile X Syndrome

    ERIC Educational Resources Information Center

    Hall, Scott; DeBernardis, Marie; Reiss, Allan

    2006-01-01

    Social escape behavior is a common behavioral feature of individuals with fragile X syndrome (fraX). In this observational study, we examined the effect of antecedent social and performance demands on problem behaviors in four conditions: face-to-face interview, silent reading, oral reading and a singing task. Results showed that problem behaviors…

  6. Spatial and Nonspatial Escape Strategies in the Barnes Maze

    ERIC Educational Resources Information Center

    Harrison, Fiona E.; Reiserer, Randall S.; Tomarken, Andrew J.; McDonald, Michael P.

    2006-01-01

    The Barnes maze is a spatial memory task that requires subjects to learn the position of a hole that can be used to escape the brightly lit, open surface of the maze. Two experiments assessed the relative importance of spatial (extra-maze) versus proximal visible cues in solving the maze. In Experiment 1, four groups of mice were trained either…

  7. Escaping Embarrassment: Face-Work in the Rap Cipher

    ERIC Educational Resources Information Center

    Lee, Jooyoung

    2009-01-01

    How do individuals escape embarrassing moments in interaction? Drawing from ethnographic fieldwork, in-depth interviews, and video recordings of weekly street corner ciphers (impromptu rap sessions), this paper expands Goffman's theory of defensive and protective face-work. The findings reveal formulaic and indirect dimensions of face-work. First,…

  8. 46 CFR 108.445 - Alarm and means of escape.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... Alarm and means of escape. (a) Each CO2 system that has a supply of more than 136 kilograms (300 pounds) of CO2, except a system that protects a tank, must have an alarm that sounds for at least 20 seconds before the CO2 is released into the space. (b) Each audible alarm for a CO2 system must have the...

  9. 46 CFR 108.445 - Alarm and means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... Alarm and means of escape. (a) Each CO2 system that has a supply of more than 136 kilograms (300 pounds) of CO2, except a system that protects a tank, must have an alarm that sounds for at least 20 seconds before the CO2 is released into the space. (b) Each audible alarm for a CO2 system must have the...

  10. 46 CFR 108.445 - Alarm and means of escape.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... Alarm and means of escape. (a) Each CO2 system that has a supply of more than 136 kilograms (300 pounds) of CO2, except a system that protects a tank, must have an alarm that sounds for at least 20 seconds before the CO2 is released into the space. (b) Each audible alarm for a CO2 system must have the...

  11. Evolving Project E-Scape for National Assessment

    ERIC Educational Resources Information Center

    Kimbell, Richard

    2012-01-01

    In the opening paper in this Special Edition I outlined the major issues that led to the establishment of "project e-scape". The project was intended to develop systems and approaches that enabled learners to build real-time web-based portfolios of their performance (initially) in design & technology and additionally to build systems and…

  12. Speed kills: ineffective avian escape responses to oncoming vehicles

    PubMed Central

    DeVault, Travis L.; Blackwell, Bradley F.; Seamans, Thomas W.; Lima, Steven L.; Fernández-Juricic, Esteban

    2015-01-01

    Animal–vehicle collisions cause high levels of vertebrate mortality worldwide, and what goes wrong when animals fail to escape and ultimately collide with vehicles is not well understood. We investigated alert and escape behaviours of captive brown-headed cowbirds (Molothrus ater) in response to virtual vehicle approaches of different sizes and at speeds ranging from 60 to 360 km h−1. Alert and flight initiation distances remained similar across vehicle speeds, and accordingly, alert and flight initiation times decreased at higher vehicle speeds. Thus, avoidance behaviours in cowbirds appeared to be based on distance rather than time available for escape, particularly at 60–150 km h−1; however, at higher speeds (more than or equal to 180 km h−1) no trend in response behaviour was discernible. As vehicle speed increased, cowbirds did not have enough time to assess the approaching vehicle, and cowbirds generally did not initiate flight with enough time to avoid collision when vehicle speed exceeded 120 km h−1. Although potentially effective for evading predators, the decision-making process used by cowbirds in our study appears maladaptive in the context of avoiding fast-moving vehicles. Our methodological approach and findings provide a framework to assess how novel management strategies could affect escape rules, and the sensory and cognitive abilities animals use to avoid vehicle collisions. PMID:25567648

  13. 46 CFR 167.20-10 - Means of escape.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Means of escape. 167.20-10 Section 167.20-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Hull Requirements, Construction and Arrangement of Nautical School Ships § 167.20-10 Means of...

  14. 46 CFR 167.20-10 - Means of escape.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 7 2011-10-01 2011-10-01 false Means of escape. 167.20-10 Section 167.20-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Hull Requirements, Construction and Arrangement of Nautical School Ships § 167.20-10 Means of...

  15. 46 CFR 167.20-10 - Means of escape.

    Code of Federal Regulations, 2014 CFR

    2014-10-01

    ... 46 Shipping 7 2014-10-01 2014-10-01 false Means of escape. 167.20-10 Section 167.20-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Hull Requirements, Construction and Arrangement of Nautical School Ships § 167.20-10 Means of...

  16. 46 CFR 167.20-10 - Means of escape.

    Code of Federal Regulations, 2012 CFR

    2012-10-01

    ... 46 Shipping 7 2012-10-01 2012-10-01 false Means of escape. 167.20-10 Section 167.20-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Hull Requirements, Construction and Arrangement of Nautical School Ships § 167.20-10 Means of...

  17. 46 CFR 167.20-10 - Means of escape.

    Code of Federal Regulations, 2013 CFR

    2013-10-01

    ... 46 Shipping 7 2013-10-01 2013-10-01 false Means of escape. 167.20-10 Section 167.20-10 Shipping COAST GUARD, DEPARTMENT OF HOMELAND SECURITY (CONTINUED) NAUTICAL SCHOOLS PUBLIC NAUTICAL SCHOOL SHIPS Hull Requirements, Construction and Arrangement of Nautical School Ships § 167.20-10 Means of...

  18. 12. CLOSEUP VIEW FROM NORTHWEST, SHOWING DETAILS OF FIRE ESCAPE ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    12. CLOSE-UP VIEW FROM NORTHWEST, SHOWING DETAILS OF FIRE ESCAPE NEAR CORNER OF MILLS HALL MAIN WING NORTH WALL, AND MILLS HALL NORTH WING WEST WALL. - Mills Hall, Mills College, 5000 MacArthur Boulevard, Oakland, Alameda County, CA

  19. Magnetic Field Influence on Atmospheric Escape and Planetary Evolution

    NASA Astrophysics Data System (ADS)

    Driscoll, P. E.; Bercovici, D.

    2012-12-01

    Planetary magnetic fields are maintained by a convective dynamo within the deep interior but their influence extends all the way up to the magnetopause, where the solar wind is deflect around the planet. The presence of a magnetic field is thought to influence the atmosphere-solar wind interaction in a variety of ways, but there is no clear consensus as to whether it impedes or facilitates volatile loss to space. Escape of planetary atmospheres to space is of central importance to studying the evolution of planetary climates, volatile exchange with the interior, and interaction with the space environment. Out of the terrestrial planets Earth has by far the largest surface hydrogen inventory (mainly in the form of liquid water) and furthest magnetopause at ~10 Earth radii. Evidence from volatile concentrations and isotopic ratios imply that Mars and Venus have both lost a significant amount of H over their history, and have maintained little to no magnetic barrier, respectively, to hold off the erosive solar wind. Venus is a particularly interesting case because it is most similar to Earth in mass and density, yet has no detectable magnetic field and an isotopic D/H ratio that implies the loss of a significant amount of water in the past. Is the decline of Venus' dynamo related to the loss of hydrogen from its atmosphere? Is the stability of Earth's unusually large volatile reservoir over billions of years related to the presence of a strong magnetic field over that period of time? We explore conditions under which the presence of a magnetic barrier at the top of the atmosphere may operate as an additional limit to escape. We derive a model for magnetic field limited escape that depends on the terrestrial number density, area, scale height, and loss time scale at the magnetopause. This model predicts rapid escape when magnetic field is weak and magnetopause altitude is low, and a decrease in escape as magnetic field strength increases. This coupling between field

  20. A Functional Yeast Survival Screen of Tumor-Derived cDNA Libraries Designed to Identify Anti-Apoptotic Mammalian Oncogenes

    PubMed Central

    Melzer, Inga Maria; Moser, Julia; Siele, Dagmar; Köhl, Ulrike; Rieker, Ralf Joachim; Wachter, David Lukas; Agaimy, Abbas; Herpel, Esther; Baumgarten, Peter; Mittelbronn, Michel; Rakel, Stefanie; Kögel, Donat; Böhm, Stefanie; Gutschner, Tony; Diederichs, Sven; Zörnig, Martin

    2013-01-01

    Yeast cells can be killed upon expression of pro-apoptotic mammalian proteins. We have established a functional yeast survival screen that was used to isolate novel human anti-apoptotic genes overexpressed in treatment-resistant tumors. The screening of three different cDNA libraries prepared from metastatic melanoma, glioblastomas and leukemic blasts allowed for the identification of many yeast cell death-repressing cDNAs, including 28% of genes that are already known to inhibit apoptosis, 35% of genes upregulated in at least one tumor entity and 16% of genes described as both anti-apoptotic in function and upregulated in tumors. These results confirm the great potential of this screening tool to identify novel anti-apoptotic and tumor-relevant molecules. Three of the isolated candidate genes were further analyzed regarding their anti-apoptotic function in cell culture and their potential as a therapeutic target for molecular therapy. PAICS, an enzyme required for de novo purine biosynthesis, the long non-coding RNA MALAT1 and the MAST2 kinase are overexpressed in certain tumor entities and capable of suppressing apoptosis in human cells. Using a subcutaneous xenograft mouse model, we also demonstrated that glioblastoma tumor growth requires MAST2 expression. An additional advantage of the yeast survival screen is its universal applicability. By using various inducible pro-apoptotic killer proteins and screening the appropriate cDNA library prepared from normal or pathologic tissue of interest, the survival screen can be used to identify apoptosis inhibitors in many different systems. PMID:23717670

  1. Plasma-induced Escape and Alterations of Planetary Atmospheres

    NASA Astrophysics Data System (ADS)

    Johnson, R. E.; Tucker, O. J.; Ewrin, J.; Cassidy, T. A.; Leblanc, F.

    2009-12-01

    The atmospheres of planets and planetary satellites are typically imbedded in space plasmas. Depending on the interaction with the induced or intrinsic fields energetic ions can have access to the thermosphere and the corona affecting their composition and thermal structure and causing loss to space. These processes are often lumped together as ‘atmospheric sputtering’ (Johnson 1994). In this talk I will review the results of simulations of the plasma bombardment at a number of solar system bodies and use those data to describe the effect on the upper atmosphere and on escape. Of considerable recent interest is the modeling of escape from Titan. Prior to Cassini’s tour of the Saturnian system, plasma-induced escape was suggested to be the dominant loss process, but recent models of enhanced thermal escape, often referred to as ‘slow hydrodynamic’ escape, have been suggested to lead to much larger Titan atmospheric loss rates (Strobel 2008; Cui et al. 2008). Such a process has been suggested to be active at some point in time on a number of solar system bodies. I will present hybrid fluid/ kinetic models of the upper atmosphere of certain bodies in order to test both the plasma-induced and thermal escape processes. Preliminary results suggest that the loss rates estimated using the ‘slow hydrodynamic’ escape process can be orders of magnitude too large. The implications for Mars, Titan and Pluto will be discussed. Background for this talk is contained in the following papers (Johnson 2004; 2009; Chaufray et al. 2007; Johnson et al. 2008; 2009; Tucker and Johnson 2009). References: Chaufray, J.Y., R. Modolo, F. Leblanc, G. Chanteur, R.E. Johnson, and J.G. Luhmann, Mars Solar Wind interaction: formation of the Martian corona and atmosphric loss to space, JGR 112, E09009, doi:10.1029/2007JE002915 (2007) Cui, J., Yelle, R. V., Volk, K. Distribution and escape of molecular hydrogen in Titan's thermosphere and exosphere. J. Geophys. Res. 113, doi:10

  2. Recording Field Potentials From Zebrafish Larvae During Escape Responses

    PubMed Central

    Monesson-Olson, Bryan D.; Troconis, Eileen L.; Trapani, Josef G.

    2014-01-01

    Among vertebrates, startle responses are a ubiquitous method for alerting, and avoiding or escaping from alarming or dangerous stimuli. In zebrafish larvae, fast escape behavior is easily evoked through either acoustic or tactile stimuli. For example, a light touch to the head will excite trigeminal neurons that in turn excite a large reticulospinal neuron in the hindbrain called the Mauthner cell (M-cell). The M-cell action potential then travels down the contralateral trunk of the larva exciting motoneurons, which subsequently excite the entire axial musculature, producing a large amplitude body bend away from the source of the stimulus. This body conformation is known as the “C-bend” due to the shape of the larva during the behavior. As a result of the semi-synchronized activation of the M-cell, the population of motor neurons, and the axial trunk muscles, a large field potential is generated and can be recorded from free-swimming or fixed-position larvae. Undergraduate laboratories that record field potentials during escape responses in larval zebrafish are relatively simple to setup and allow students to observe and study the escape reflex circuit. Furthermore, by testing hypotheses, analyzing data and writing journal-style laboratory reports, students have multiple opportunities to learn about many neuroscience topics including vertebrate reflexes; sensory transduction; synaptic-, neuro-, and muscle-physiology; the M-cell mediated escape response; and the zebrafish as a model organism. Here, we detail the equipment, software, and recording setup necessary to observe field potentials in an undergraduate teaching lab. Additionally, we discuss potential advanced laboratory exercises and pedagogical outcomes. Finally, we note possible low-cost alternatives for recording field potentials. PMID:25565920

  3. Escape manoeuvres in the spiny dogfish (Squalus acanthias).

    PubMed

    Domenici, Paolo; Standen, Emily M; Levine, Robert P

    2004-06-01

    The locomotor performance of dogfish during escape responses was observed by means of high-speed video. Dogfish show C-type escape responses that are comparable with those shown previously in teleosts. Dogfish show high variability of turning rates of the anterior part of the body (head to centre of mass), i.e. with peak values from 434 to 1023 deg. s(-1). We suggest that this variability may be due to the presence of two types of escape manoeuvres, i.e. responses with high and low turning rates, as previously found in a teleost species. Fast responses (i.e. with high maximum turning rates, ranging between 766 and 1023 deg. s(-1)) showed significantly higher locomotor performance than slow responses (i.e. with low maximum turning rates, ranging between 434 and 593 deg. s(-1)) in terms of distance covered, speed and acceleration, although no differences were found in the turning radius of the centre of mass during the escape manoeuvres. The existence of two types of escape responses would have implications in terms of both neural control and muscular activation patterns. When compared with literature data for the locomotor performance of bony fishes, dogfish showed relatively low speed and acceleration, comparable turning rates and a turning radius that is in the low part of the range when compared with teleosts, indicating relatively high manoeuvrability. The locomotor performance observed in dogfish is consistent with their morphological characteristics: (1) low locomotor performance associated with low thrust developed by their relatively small posterior depth of section and (2) relatively high manoeuvrability associated with their high flexibility.

  4. Erratum: The Escape of Ionizing Photons from the Galaxy

    NASA Astrophysics Data System (ADS)

    Bland-Hawthorn, J.; Maloney, P. R.

    2001-04-01

    In the Letter ``The Escape of Ionizing Photons from the Galaxy'' by J. Bland-Hawthorn & P. R. Maloney (ApJ, 510, L33 [1999]), there is an error in Figure 4 that bears on the derived escape fraction of ionizing photons from star-forming regions in the Galaxy's disk. For the quoted distance (55 kpc) of the Magellanic Stream, the predicted emission measures should be reduced by a factor of (20/55)2. Our derived value of fesc~6%, the escape fraction normal to the disk, must be raised by the inverse of this factor, which makes it unlikely that the Stream Hα arises from UV produced by the Galaxy's young stellar disk. This is exacerbated by new Hα observations that show that the Stream is even brighter than originally thought (Weiner, Vogel, & Williams 2001). Bland-Hawthorn & Putman (2001) discuss possible sources of ionization for the Magellanic Stream. We note with interest that high-velocity clouds have now been detected in Hα (e.g., Tufte, Reynolds, & Haffner 1998). Some of these have well-established distance bounds. Bland-Hawthorn & Putman (2001) and Weiner et al. (2001) find that the observed Hα is roughly consistent with fesc~5%, although the present uncertainties are about a factor of 2. It should be noted that fesc refers to the escape fraction normal to the disk. The escape fraction averaged over 4π sr, fesc, is about a factor of 3 smaller and depends on the details of the opacity model (Bland-Hawthorn 1998, Appendix 1). The present uncertainties on fesc for the Galaxy mean that we cannot determine whether star-forming regions dominate the extragalactic UV background (cf. Shull et al. 1999).

  5. Formulation of a Cooperative-Confinement-Escape problem of multiple cooperative defenders against an evader escaping from a circular region

    NASA Astrophysics Data System (ADS)

    Li, Wei

    2016-10-01

    In this paper, we propose and formulate the Cooperative-Confinement-Escape (CCE) problem of multiple cooperative defenders against an evader escaping from a circular region, in which the defenders are moving on the circle with attempt to prevent possible escape of a single evader who is initially located inside the circle. The main contributions are summarized as follows: (1) we first provide an effective formulation of the CCE problem, which is an emphasis of this paper, with design of two nonlinear control strategies for the cooperative defenders and the adversarial evader, respectively. Particularly, we consider to include a proper interaction between each pair of the nearest-neighbor defenders, and an adaptive trajectory prediction mechanism in the strategies of the defenders to increase the chance of successful confinement. (2) For the first attempt on analyzing the CCE dynamics which is unavoidably strongly nonlinear, we analyze the minimum energy of the evader for possible escape. (3) For understanding of the behaviors of the system under different parameters, (i) we illustrate the effectiveness of the confinement strategy using the adaptive trajectory prediction mechanism, and (ii) the physical roles of the system parameters with respect to the system dynamics, some of which may be unexpected or not straightforward. A separate paper will be presented for systematic analysis of the agents' behaviors with respect to the large intervals of the parameter settings.

  6. An Empirical Investigation of Time-Out with and without Escape Extinction to Treat Escape-Maintained Noncompliance

    ERIC Educational Resources Information Center

    Everett, Gregory E.; Olmi, D. Joe; Edwards, Ron P.; Tingstrom, Daniel H.; Sterling-Turner, Heather E.; Christ, Theodore J.

    2007-01-01

    The present study evaluates the effectiveness of two time-out (TO) procedures in reducing escape-maintained noncompliance of 4 children. Noncompliant behavioral function was established via a functional assessment (FA), including indirect and direct descriptive procedures and brief confirmatory experimental analyses. Following FA, parents were…

  7. Reducing VDAC1 expression induces a non-apoptotic role for pro-apoptotic proteins in cancer cell differentiation.

    PubMed

    Arif, Tasleem; Krelin, Yakov; Shoshan-Barmatz, Varda

    2016-08-01

    Proteins initially identified as essential for apoptosis also mediate a wide range of non-apoptotic functions that include cell cycle progression, differentiation and metabolism. As this phenomenon was mostly reported with non-cancer cells, we considered non-conventional roles for the apoptotic machinery in the cancer setting. We found that treating glioblastoma (GBM) tumors with siRNA against VDAC1, a mitochondrial protein found at the crossroads of metabolic and survival pathways and involved in apoptosis, inhibited tumor growth while leading to differentiation of tumor cells into neuronal-like cells, as reflected in the expression of specific markers. Although VDAC1 depletion did not induce apoptosis, the expression levels of several pro-apoptotic regulatory proteins were changed. Specifically, VDAC1 deletion led to up-regulation of caspases, p53, cytochrome c, and down-regulation of SMAC/Diablo, AIF and TSPO. The down-regulated group was highly expressed in U-87MG xenografts, as well as in GBMs from human patients. We also showed that the rewired cancer-cell metabolism resulting from VDAC1 depletion reinforced cell growth arrest and differentiation via alterations in the transcription factors p53, c-Myc, HIF-1α and NF-κB. The decrease in c-Myc, HIF-1α and NF-κB levels was in accord with reduced cell proliferation, whereas increased p53 expression promoted differentiation. Thus, upon metabolic re-programing induced by VDAC1 depletion, the levels of pro-apoptotic proteins associated with cell growth decreased, while those connected to cell differentiation increased, converting GBM cells into astrocyte- and neuron-like cells. The results reveal that in tumors, pro-apoptotic proteins can perform non-apoptotic functions, acting as regulators of cell growth and differentiation, making these molecules potential new targets for cancer therapy. This article is part of a Special Issue entitled 'EBEC 2016: 19th European Bioenergetics Conference, Riva del Garda, Italy

  8. A mathematical model for apoptotic switch in Drosophila

    NASA Astrophysics Data System (ADS)

    Ziraldo, Riccardo; Ma, Lan

    2015-10-01

    Apoptosis is an evolutionarily-conserved process of autonomous cell death. The molecular switch mechanism underlying the fate decision of apoptosis in mammalian cells has been intensively studied by mathematical modeling. In contrast, the apoptotic switch in invertebrates, with highly conserved signaling proteins and pathway, remains poorly understood mechanistically and calls for theoretical elucidation. In this study, we develop a mathematical model of the apoptosis pathway in Drosophila and compare the switch mechanism to that in mammals. Enumeration of the elementary reactions for the model demonstrates that the molecular interactions among the signaling components are considerably different from their mammalian counterparts. A notable distinction in network organization is that the direct positive feedback from the effector caspase (EC) to the initiator caspase in mammalian pathway is replaced by a double-negative regulation in Drosophila. The model is calibrated by experimental input-output relationship and the simulated trajectories exhibit all-or-none bimodal behavior. Bifurcation diagrams confirm that the model of Drosophila apoptotic switch possesses bistability, a well-recognized feature for an apoptosis system. Since the apoptotic protease activating factor-1 (APAF1) induced irreversible activation of caspase is an essential and beneficial property for the mammalian apoptotic switch, we perform analysis of the bistable caspase activation with respect to the input of DARK protein, the Drosophila homolog of APAF1. Interestingly, this bistable behavior in Drosophila is predicted to be reversible. Further analysis suggests that the mechanism underlying the systems property of reversibility is the double-negative feedback from the EC to the initiator caspase. Using theoretical modeling, our study proposes plausible evolution of the switch mechanism for apoptosis between organisms.

  9. A mathematical model for apoptotic switch in Drosophila.

    PubMed

    Ziraldo, Riccardo; Ma, Lan

    2015-08-20

    Apoptosis is an evolutionarily-conserved process of autonomous cell death. The molecular switch mechanism underlying the fate decision of apoptosis in mammalian cells has been intensively studied by mathematical modeling. In contrast, the apoptotic switch in invertebrates, with highly conserved signaling proteins and pathway, remains poorly understood mechanistically and calls for theoretical elucidation. In this study, we develop a mathematical model of the apoptosis pathway in Drosophila and compare the switch mechanism to that in mammals. Enumeration of the elementary reactions for the model demonstrates that the molecular interactions among the signaling components are considerably different from their mammalian counterparts. A notable distinction in network organization is that the direct positive feedback from the effector caspase (EC) to the initiator caspase in mammalian pathway is replaced by a double-negative regulation in Drosophila. The model is calibrated by experimental input-output relationship and the simulated trajectories exhibit all-or-none bimodal behavior. Bifurcation diagrams confirm that the model of Drosophila apoptotic switch possesses bistability, a well-recognized feature for an apoptosis system. Since the apoptotic protease activating factor-1 (APAF1) induced irreversible activation of caspase is an essential and beneficial property for the mammalian apoptotic switch, we perform analysis of the bistable caspase activation with respect to the input of DARK protein, the Drosophila homolog of APAF1. Interestingly, this bistable behavior in Drosophila is predicted to be reversible. Further analysis suggests that the mechanism underlying the systems property of reversibility is the double-negative feedback from the EC to the initiator caspase. Using theoretical modeling, our study proposes plausible evolution of the switch mechanism for apoptosis between organisms.

  10. Apoptotic Death of Cancer Stem Cells for Cancer Therapy

    PubMed Central

    He, Ying-Chun; Zhou, Fang-Liang; Shen, Yi; Liao, Duan-Fang; Cao, Deliang

    2014-01-01

    Cancer stem cells (CSCs) play crucial roles in tumor progression, chemo- and radiotherapy resistance, and recurrence. Recent studies on CSCs have advanced understanding of molecular oncology and development of novel therapeutic strategies. This review article updates the hypothesis and paradigm of CSCs with a focus on major signaling pathways and effectors that regulate CSC apoptosis. Selective CSC apoptotic inducers are introduced and their therapeutic potentials are discussed. These include synthetic and natural compounds, antibodies and recombinant proteins, and oligonucleotides. PMID:24823879

  11. Altered mitochondrial apoptotic pathway in placentas from undernourished rat gestations.

    PubMed

    Belkacemi, Louiza; Desai, Mina; Nelson, D Michael; Ross, Michael G

    2011-12-01

    Maternal undernutrition (MUN) during pregnancy results in intrauterine growth-restricted (IUGR) fetuses and small placentas. Although reduced fetal nutrient supply has been presumed to be etiologic in IUGR, MUN-induced placental dysfunction may occur prior to detectable fetal growth restriction. Placental growth impairment may result from apoptosis signaled by mitochondria in response to reduced energy substrate. Therefore, we sought to determine the presence of mitochondrial-induced apoptosis under MUN and ad libitum diet (AdLib) pregnancies. Pregnant rats were fed an AdLib or a 50% MUN diet from embryonic day 10 (E10) to E20. At E20, fetuses and placentas from proximal- and mid-horns (extremes of nutrient/oxygen supply) were collected. Right-horn placentas were used to quantify apoptosis. Corresponding left-horn placentas were separated into basal (hormone production) and labyrinth (feto-maternal exchange) zones, and protein expression of the mitochondrial pathway was determined. Our results show that the MUN placentas had significantly increased apoptosis, with lower expression of cytosolic and mitochondrial anti-apoptotic Bcl2 and Bcl-X(L), and significantly higher expression of pro-apoptotic Bax and Bak especially in the labyrinth zone. This was paralleled by higher coimmunostaining with the mitochondrial marker manganese superoxide dismutase (MnSOD), indicating transition of pro-apoptotic factors to the mitochondrial membrane. Also, cytosolic cytochrome c and activated caspases-9 and -3 were significantly higher in all MUN. Conversely, peroxisome proliferator-activator receptor-γ (PPARγ), a member of the nuclear receptor family with anti-apoptotic properties, was significantly downregulated in both zones and horns. Our results suggest that MUN during rat pregnancy enhances mitochondria-dependent apoptosis in the placenta, probably due to the downregulation of PPARγ expression.

  12. Methane attenuates myocardial ischemia injury in rats through anti-oxidative, anti-apoptotic and anti-inflammatory actions.

    PubMed

    Chen, Ouyang; Ye, Zhouheng; Cao, Zhiyong; Manaenko, Anatol; Ning, Ke; Zhai, Xiao; Zhang, Rongjia; Zhang, Ting; Chen, Xiao; Liu, Wenwu; Sun, Xuejun

    2016-01-01

    Myocardial infarction (MI) remains the most frequent cardiovascular disease with high mortality. Recently, methane has been shown protective effects on small intestinal ischemia-reperfusion injury. We hypothesized that methane-rich saline (MS) could protect the myocardium again MI via its anti-oxidative, anti-apoptotic and anti-inflammatory effects. In experiment 1, tetrazolium chloride staining and detection of myocardial enzymes and oxidative and inflammatory parameters were performed at 12h after MI to determine the optimal dose at which intraperitoneal MS exerted the best protective effects on MI. In experiment 2, rats were treated with 10 ml/kg MS. Myocyte apoptosis was detected 72 h after MI, and cardiac function and myocardial remodeling were evaluated 4 weeks after MI. Results showed different dose of MS reduced infarct area, decreased myocardial enzymes, inhibited inflammation and oxidative stress following MI. The optimal dose of MS was 10 mg/kg. Moreover, treatment with 10mg/kg MS for 3 days significantly reduced myocyte apoptosis, improved cardiac function and inhibited myocardial remodeling (reduced anterior wall thickness, attenuated myocyte hypertrophy, and decreased myocardial collagen). MS protects the myocardium of MI rats via its anti-oxidative, anti-inflammatory, anti-apoptotic and anti-remodeling activities. Thus, MS provides a novel and promising strategy for the treatment of ischemic heart diseases. PMID:26585905

  13. Expression of apoptotic regulatory molecules in renal cell carcinoma: elevated expression of Fas ligand.

    PubMed

    Olive, C; Cheung, C; Nicol, D; Falk, M C

    1999-02-01

    Renal cell carcinoma (RCC) is the most common renal neoplasm. Despite being infiltrated by tumour infiltrating lymphocytes (TIL), these TIL are unable to control tumour growth in vivo, suggesting that the cytotoxic capacity of TIL against RCC is impaired, or that the tumour cells are resistant to killing and therefore escape detection by the immune system. It is postulated that the expression of apoptotic regulatory molecules in RCC favours tumour cell survival. The present study has therefore determined the expression of Fas (APO-1/CD95), Fas ligand (Fas L) and bcl-2 in these tumours. The expression of Fas, Fas L and bcl-2 mRNA transcripts was determined in RCC, normal kidney and peripheral blood by semiquantitative reverse transcriptase polymerase chain reaction (RT-PCR), following RNA extraction and cDNA synthesis from tissues and cell samples. Transcript levels were measured by densitometry after Southern blot hybridization of PCR products with internal radio-labelled oligonucleotide probes; a densitometry score was assigned to each hybridizing DNA band and expressed as a ratio of the glyceraldehyde-3-phosphate dehydrogenase content. In peripheral blood, the expression of Fas L and bcl-2 transcripts was similar between patients and normal healthy individuals; however, Fas transcript expression was significantly down-regulated in the patients' versus normal peripheral blood (P = 0.026). Most interestingly, significantly up-regulated Fas L expression was observed in RCC compared to normal kidney (P = 0.041). In contrast, bcl-2 transcripts were well represented in normal kidney but markedly decreased in RCC (P = 0.021). The expression of Fas transcripts in normal kidney and RCC was variable. These data demonstrate elevated expression of Fas L transcripts in RCC, but the functional relevance of this remains to be investigated. PMID:10101681

  14. The inflammatory role of phagocyte apoptotic pathways in rheumatic diseases.

    PubMed

    Cuda, Carla M; Pope, Richard M; Perlman, Harris

    2016-08-23

    Rheumatoid arthritis affects nearly 1% of the world's population and is a debilitating autoimmune condition that can result in joint destruction. During the past decade, inflammatory functions have been described for signalling molecules classically involved in apoptotic and non-apoptotic death pathways, including, but not limited to, Toll-like receptor signalling, inflammasome activation, cytokine production, macrophage polarization and antigen citrullination. In light of these remarkable advances in the understanding of inflammatory mechanisms of the death machinery, this Review provides a snapshot of the available evidence implicating death pathways, especially within the phagocyte populations of the innate immune system, in the perpetuation of rheumatoid arthritis and other rheumatic diseases. Elevated levels of signalling mediators of both extrinsic and intrinsic apoptosis, as well as the autophagy, are observed in the joints of patients with rheumatoid arthritis. Furthermore, risk polymorphisms are present in signalling molecules of the extrinsic apoptotic and autophagy death pathways. Although research into the mechanisms underlying these pathways has made considerable progress, this Review highlights areas where further investigation is particularly needed. This exploration is critical, as new discoveries in this field could lead to the development of novel therapies for rheumatoid arthritis and other rheumatic diseases. PMID:27549026

  15. PDT-treated apoptotic cells induce macrophage synthesis NO

    NASA Astrophysics Data System (ADS)

    Song, S.; Xing, D.; Zhou, F. F.; Chen, W. R.

    2009-11-01

    Nitric oxide (NO) is a biologically active molecule which has multi-functional in different species. As a second messenger and neurotransmitter, NO is not only an important regulatory factor between cells' information transmission, but also an important messenger in cell-mediated immunity and cytotoxicity. On the other side, NO is involving in some diseases' pathological process. In pathological conditions, the macrophages are activated to produce a large quantity of nitric oxide synthase (iNOS), which can use L-arginine to produce an excessive amount of NO, thereby killing bacteria, viruses, parasites, fungi, tumor cells, as well as in other series of the immune process. In this paper, photofrin-based photodynamic therapy (PDT) was used to treat EMT6 mammary tumors in vitro to induce apoptotic cells, and then co-incubation both apoptotic cells and macrophages, which could activate macrophage to induce a series of cytotoxic factors, especially NO. This, in turn, utilizes macrophages to activate a cytotoxic response towards neighboring tumor cells. These results provided a new idea for us to further study the immunological mechanism involved in damaging effects of PDT, also revealed the important function of the immune effect of apoptotic cells in PDT.

  16. Carbon disulfide induces rat testicular injury via mitochondrial apoptotic pathway.

    PubMed

    Guo, Yinsheng; Wang, Wei; Dong, Yu; Zhang, Zhen; Zhou, Yijun; Chen, Guoyuan

    2014-08-01

    Carbon disulfide (CS2), one of the most important volatile organic chemicals, was shown to have serious impairment to male reproductive system. But the underline mechanism is still unclear. In the present study, we aim to investigate the male germ cell apoptosis induced by CS2 exposure alone and by co-administration with cyclosporin A (CsA), which is the inhibitor of membrane permeability transition pore (MPTP). It was shown that CS2 exposure impaired ultrastructure of germ cells, increased the numbers of apoptotic germ cells, accumulated intracellular level of calcium, elevated ROS level, and increased activities of complexes of respiratory chain. Meanwhile, exposure to CS2 dramatically decreased the mitochondrial transmembrane potential (ΔΨm) and levels of ATP and MPTP opening. Exposure to CS2 can also cause a significantly dose-dependent increase in the expression levels of Bax, Cytc, Caspase-9, and Caspase-3, but decreased the expression level of Bcl-2. Moreover, co-administration of CsA with CS2 can reverse or alleviate the above apoptotic damage effects of CS2 on testicular germ cells. Taken together, our findings suggested that CS2 can cause damage to testicular germ cells via mitochondrial apoptotic pathway, and MPTP play a crucial role in this process. PMID:24582363

  17. Cytotoxic and apoptotic effects of constituents from Millettia pachycarpa Benth.

    PubMed

    Ye, Haoyu; Fu, Afu; Wu, Wenshuang; Li, Yanfang; Wang, Guangcheng; Tang, Minghai; Li, Shucai; He, Shichao; Zhong, Shijie; Lai, Huijun; Yang, Jianhong; Xiang, Minli; Peng, Aihua; Chen, Lijuan

    2012-12-01

    The aim of this study is to investigate the cytotoxic and apoptotic effects of constituents from the seeds of Millettia pachycarpa Benth. Fourteen compounds (1-14) including one novel chalcone (10) were isolated as active principles from Chinese herbal medicine M. pachycarpa Benth. Their structures were identified by using spectroscopic methods. All isolates were then evaluated for their cytotoxic effects against several cancer cell lines (HepG2, C26, LL2 and B16) with cisplatin as a positive control. And their apoptosis-inducing effects were tested against HeLa-C3 cells with taxol as a positive control. Both studies showed that compounds 1, 2, 7 and 10 demonstrated significant cytotoxic and apoptotic effects against cancer cells. Moreover, in the apoptosis assay the novel chalcone (10) showed strong apoptosis inducing effects at a concentration of 2μM within 36h. It was found to be the most potent apoptotic inducer of the compounds isolated from M. pachycarpa Benth. PMID:22902267

  18. Apoptotic and autophagic cell death induced by glucolaxogenin in cervical cancer cells.

    PubMed

    Sánchez-Sánchez, L; Escobar, M L; Sandoval-Ramírez, J; López-Muñoz, H; Fernández-Herrera, M A; Hernández-Vázquez, J M V; Hilario-Martínez, C; Zenteno, E

    2015-12-01

    The antiproliferative and cytotoxic activity of glucolaxogenin and its ability to induce apoptosis and autophagy in cervical cancer cells are reported. We ascertained that glucolaxogenin exerts an inhibitory effect on the proliferation of HeLa, CaSki and ViBo cells in a dose-dependent manner. Analysis of DNA distribution in the cell-cycle phase of tumor cells treated with glucolaxogenin suggests that the anti-proliferative activity of this steroid is not always dependent on the cell cycle. Cytotoxic activity was evaluated by detection of the lactate dehydrogenase enzyme in supernatants from tumor cell cultures treated with the steroid. Glucolaxogenin exhibited null cytotoxic activity. With respect to the apoptotic activity, the generation of apoptotic bodies, the presence of active caspase-3 and annexin-V, as well as the DNA fragmentation observed in all tumor lines after treatment with glucolaxogenin suggests that this compound does indeed induce cell death by apoptosis. Also, a significantly increased presence of the LC3-II, LC3 and Lamp-1 proteins was evidenced with the ultrastructural existence of autophagic vacuoles in cells treated with this steroidal glycoside, indicating that glucolaxogenin also induces autophagic cell death. It is important to note that this compound showed no cytotoxic effect and did not affect the proliferative capacity of mononuclear cells obtained from normal human peripheral blood activated by phytohaemagglutinin. Thus, glucolaxogenin is a compound with anti-proliferative properties that induces programmed cell death in cancer cell lines, though it is selective with respect to normal lymphocytic cells. These findings indicate that this glycoside could have a selective action on tumor cells and, therefore, be worthy of consideration as a therapeutic candidate with anti-tumor potential.

  19. Usage of whey protein may cause liver damage via inflammatory and apoptotic responses.

    PubMed

    Gürgen, S G; Yücel, A T; Karakuş, A Ç; Çeçen, D; Özen, G; Koçtürk, S

    2015-07-01

    The purpose of this study was to investigate the long- and short-term inflammatory and apoptotic effects of whey protein on the livers of non-exercising rats. Thirty rats were divided into three groups namely (1) control group, (2) short-term whey (WS) protein diet (252 g/kg for 5 days), and (3) long-term whey (WL) protein diet (252 g/kg for 4 weeks). Interleukin 1β (IL-1β), IL-6, tumor necrosis factor α (TNF-α), and cytokeratin 18 (CK-18-M30) were assessed using enzyme-linked immunosorbent assay and immunohistochemical methods. Apoptosis was evaluated using the terminal transferase-mediated deoxyuridine triphosphate nick-end labeling (TUNEL) method. Hepatotoxicity was evaluated by quantitation of serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT). Based on the biochemical levels and immunohistochemical results, the highest level of IL-1β was identified in the WL group (p < 0.01). The IL-6 and TNF-α results were slightly lower in the WS group than in the control group and were highest in the WL group (p < 0.01). The CK-18-M30 and TUNEL results were highest in the WS group and exhibited medium intensity in the WL group (p < 0.01). AST results were statistically significant for all groups, while our ALT groups were particularly significant between the WL and control groups (p < 0.01). The results showed that when whey protein is used in an uninformed manner and without exercising, adverse effects on the liver may occur by increasing the apoptotic signal in the short term and increasing inflammatory markers and hepatotoxicity in the long term.

  20. Apoptotic and autophagic cell death induced by glucolaxogenin in cervical cancer cells.

    PubMed

    Sánchez-Sánchez, L; Escobar, M L; Sandoval-Ramírez, J; López-Muñoz, H; Fernández-Herrera, M A; Hernández-Vázquez, J M V; Hilario-Martínez, C; Zenteno, E

    2015-12-01

    The antiproliferative and cytotoxic activity of glucolaxogenin and its ability to induce apoptosis and autophagy in cervical cancer cells are reported. We ascertained that glucolaxogenin exerts an inhibitory effect on the proliferation of HeLa, CaSki and ViBo cells in a dose-dependent manner. Analysis of DNA distribution in the cell-cycle phase of tumor cells treated with glucolaxogenin suggests that the anti-proliferative activity of this steroid is not always dependent on the cell cycle. Cytotoxic activity was evaluated by detection of the lactate dehydrogenase enzyme in supernatants from tumor cell cultures treated with the steroid. Glucolaxogenin exhibited null cytotoxic activity. With respect to the apoptotic activity, the generation of apoptotic bodies, the presence of active caspase-3 and annexin-V, as well as the DNA fragmentation observed in all tumor lines after treatment with glucolaxogenin suggests that this compound does indeed induce cell death by apoptosis. Also, a significantly increased presence of the LC3-II, LC3 and Lamp-1 proteins was evidenced with the ultrastructural existence of autophagic vacuoles in cells treated with this steroidal glycoside, indicating that glucolaxogenin also induces autophagic cell death. It is important to note that this compound showed no cytotoxic effect and did not affect the proliferative capacity of mononuclear cells obtained from normal human peripheral blood activated by phytohaemagglutinin. Thus, glucolaxogenin is a compound with anti-proliferative properties that induces programmed cell death in cancer cell lines, though it is selective with respect to normal lymphocytic cells. These findings indicate that this glycoside could have a selective action on tumor cells and, therefore, be worthy of consideration as a therapeutic candidate with anti-tumor potential. PMID:26437916

  1. Escape rate in the gene transcriptional regulatory system with time delay

    NASA Astrophysics Data System (ADS)

    Zeng, Chun-Hua; Xie, Chong-Wei

    2008-09-01

    The escape rate in the gene transcriptional regulatory system with time delay in the presence of cross-correlation noises is studied. The expression of the escape rate is derived under the condition of small delay time. Based on the escape rate, we investigated the effects of both cross-correlation intensity (λ) and delay time (τ) on the escape rate. Our results indicate that: (i) under positively correlated noises action (i.e. λ> 0), the escape rate exhibits one minimum value as the intensities of the multiplicative and additive noises vary, namely the suppression effect. However, for the case of uncorrelated noises (λ=0) and negatively correlated noises (λ<0), the suppression phenomenon disappears. (ii) λ and τ have opposite effects on the escape rate of the system, i.e. under positively correlated noises action, an increase of λ can intensify the suppression of the escape rate, but an increase of τ can weaken the suppression of the escape rate.

  2. 20. DETAIL VIEW IN 18FOOT LOCK, ESCAPE TRAINING TANK, SHOWING ...

    Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

    20. DETAIL VIEW IN 18-FOOT LOCK, ESCAPE TRAINING TANK, SHOWING DOOR INTO TANK AT RIGHT - U.S. Naval Submarine Base, New London Submarine Escape Training Tank, Albacore & Darter Roads, Groton, New London County, CT

  3. Escape of Mars atmospheric carbon through time by photochemical means

    NASA Astrophysics Data System (ADS)

    Luhmann, J. G.; Kim, J.; Nagy, A. F.

    Luhmann et al. recently suggested that sputtering of the Martian atmosphere by re-entering O(+) pickup ions could have provided a significant route of escape for CO2 and its products throughout Mars' history. They estimated that the equivalent of C in an approximately 140-mbar CO2 atmosphere should have been lost this way if the Sun and solar wind evolved according to available models. Another source of escaping C (and O) that is potentially important is the dissociative recombination of ionospheric CO(+) near the exobase. We have evaluated the loss rates due to this process for 'ancient' solar EUV radiation fluxes of 1, 3, and 6 times the present flux in order to calculate the possible cumulative loss over the last 3.5 Gyr.

  4. Escape of Mars atmospheric carbon through time by photochemical means

    NASA Technical Reports Server (NTRS)

    Luhmann, J. G.; Kim, J.; Nagy, A. F.

    1993-01-01

    Luhmann et al. recently suggested that sputtering of the Martian atmosphere by re-entering O(+) pickup ions could have provided a significant route of escape for CO2 and its products throughout Mars' history. They estimated that the equivalent of C in an approximately 140-mbar CO2 atmosphere should have been lost this way if the Sun and solar wind evolved according to available models. Another source of escaping C (and O) that is potentially important is the dissociative recombination of ionospheric CO(+) near the exobase. We have evaluated the loss rates due to this process for 'ancient' solar EUV radiation fluxes of 1, 3, and 6 times the present flux in order to calculate the possible cumulative loss over the last 3.5 Gyr.

  5. Escape of heated ions upstream of quasi-parallel shocks

    NASA Technical Reports Server (NTRS)

    Edmiston, J. P.; Kennel, C. F.; Eichler, D.

    1982-01-01

    A simple theoretical criterion by which quasi-parallel and quasi-perpendicular collisionless shocks may be distinguished is proposed on the basis of an investigation of the free escape of ions from the post-shock plasma into the region upstream of a fast collisionless shock. It was determined that the accessibility of downstream ions to the upstream region depends on upstream magnetic field shock normal angle, in addition to the upstream plasma parameters, with post-shock ions escaping upstream for shock normal angles of less than 45 deg, in agreement with the observed transition between quasi-parallel and quasi-perpendicular shock structure. Upstream ion distribution functions resembling those of observed intermediate ions and beams are also calculated.

  6. Predator-induced morphology enhances escape locomotion in crucian carp

    PubMed Central

    Domenici, Paolo; Turesson, Håkan; Brodersen, Jakob; Brönmark, Christer

    2007-01-01

    Fishes show a remarkable diversity of shapes which have been associated with their swimming abilities and anti-predator adaptations. The crucian carp (Carassius carassius) provides an extreme example of phenotypic plasticity in body shape which makes it a unique model organism for evaluating the relationship between body form and function in fishes. In crucian carp, a deep body is induced by the presence of pike (Esox lucius), and this results in lower vulnerability to gape-limited predators, such as pike itself. Here, we demonstrate that deep-bodied crucian carp attain higher speed, acceleration and turning rate during anti-predator responses than shallow-bodied crucian carp. Therefore, a predator-induced morphology in crucian carp enhances their escape locomotor performance. The deep-bodied carp also show higher percentage of muscle mass. Therefore, their superior performance in escape swimming may be due to a combination of higher muscle power and higher thrust. PMID:17971327

  7. Ionospheric Flow and Escape of Ions from Titan and Venus

    NASA Technical Reports Server (NTRS)

    Hartle, R. E.; Intriligator, D. S.; Grebowsky, Joseph M.; Vondrak, Richard R. (Technical Monitor)

    2001-01-01

    Knowledge gained from measurements and models is used to study the high-speed plasmas interacting with the atmospheres and ionospheres of Titan and Venus. Considering the similarities of the interactions, comparative analysis is used to support the interpretations of observations made at each body. Ionospheric flow inferred to exist by analysis of measurements made from the Pioneer Venus Orbiter supports the interpretation of similar flow in the ionosphere of Titan. The concept that cold ions escape from the ionosphere of Venus is supported by the Voyager I observation that cold ions escape down the magnetic tail of Titan. Pickup O+ ion energy distributions observed at their source in the ionosheath of Venus are shown to be influenced by finite gyroradius effects. The signatures of such effects are expected to be retained as the ions move into the wakes of Titan and Venus.

  8. Fractionation of noble gases by thermal escape from accreting planetesimals

    NASA Technical Reports Server (NTRS)

    Donahue, T. M.

    1986-01-01

    Assuming solar initial elemental and isotopic ratios and a determination of the degree of fractionation occurring by competition between gravitational binding and escape, a model is developed for selective noble gas loss through escape during the growth of planetesimals to form the terrestrial planets. Of the two classes of planetesimals that can form on a time scale that is consistent with modern accretion models, one is depleted in neon while the other is neon-rich. The mechanism is noted to be capable of accounting for all known properties of the noble gas volatiles on the terrestrial planets, with only one exception, namely the Ar-36/Ar-38 ratios for Mars and the earth, which are much lower than observed.

  9. Behavioral analysis of the escape response in larval zebrafish

    NASA Astrophysics Data System (ADS)

    Feng, Ruopei; Girdhar, Kiran; Chemla, Yann; Gruebele, Martin

    The behavior of larval zebrafish is of great interest because the limited number of locomotor neurons in larval zebrafish couples with its rich repertoire of movements as a vertebrate animal. Current research uses a priori-selected parameters to describe their swimming behavior while our lab has built a parameter-free model based on singular value decomposition analysis to characterize it. Our previous work has analyzed the free swimming of larval zebrafish and presented a different picture from the current classification of larval zebrafish locomotion. Now we are extending this work to the studies of their escape response to acoustic stimulus. Analysis has shown intrinsic difference in the locomotion between escape response and free swimming.

  10. Planetary loss from light ion escape on Venus

    NASA Technical Reports Server (NTRS)

    Hartle, R. E.; Grebowsky, J. M.

    1995-01-01

    Using Pioneer Venus data, hydrogen and deuterium ions are shown to escape from the hydrogen bulge region in the nightside ionosphere. The polarization electric field propels these light ions upward through the ionosphere and into the ion-exosphere, where H(+) and D(+) continue to be accelerated away from Venus and move into the ionotail and beyond. The vertical flow speeds of H(+) and D(+) are found to be about the same; therefore, selective escape between H(+) and D(+) is negligible for this mechanism. Present day planetary loss rates of about 8.6 x 10(exp 25)/s and 3.2 X 10(exp 23)/s were obtained for H(+) and D(+), respectively. Such rates, persisting over a few billion years, should have significantly affected the planetary water budget.

  11. Fixation and escape times in stochastic game learning

    NASA Astrophysics Data System (ADS)

    Realpe-Gomez, John; Szczesny, Bartosz; Dall'Asta, Luca; Galla, Tobias

    2012-10-01

    Evolutionary dynamics in finite populations is known to fixate eventually in the absence of mutation. We here show that a similar phenomenon can be found in stochastic game dynamical batch learning, and investigate fixation in learning processes in a simple 2×2 game, for two-player games with cyclic interaction, and in the context of the best-shot network game. The analogues of finite populations in evolution are here finite batches of observations between strategy updates. We study when and how such fixation can occur, and present results on the average time-to-fixation from numerical simulations. Simple cases are also amenable to analytical approaches and we provide estimates of the behaviour of so-called escape times as a function of the batch size. The differences and similarities with escape and fixation in evolutionary dynamics are discussed.

  12. The production and escape of nitrogen atoms on Mars

    NASA Astrophysics Data System (ADS)

    Fox, J. L.

    1993-02-01

    Updated rate coefficients and a revised ionosphere-thermosphere model are used to compute the production rates and densities of odd nitrogen species in the Martian atmosphere. Computed density profiles for N(4S), N(2D), N(2P), and NO are presented. The model NO densities are found to be about a factor of 2-3 less than those measured by the Viking 1 mass spectrometer. Revised values for the escape rates of N atoms from dissociative recombination and ionospheric reactions are also computed. Dissociative recombination is found to be comparable in importance to photodissociation at low solar activity, but it is still the most important escape mechanism for N-14 at high solar activity.

  13. Failed Escape: Solid Surfaces Prevent Tumbling of Escherichia coli

    NASA Astrophysics Data System (ADS)

    Molaei, Mehdi; Barry, Michael; Stocker, Roman; Sheng, Jian

    2014-08-01

    Understanding how bacteria move close to surfaces is crucial for a broad range of microbial processes including biofilm formation, bacterial dispersion, and pathogenic infections. We used digital holographic microscopy to capture a large number (>103) of three-dimensional Escherichia coli trajectories near and far from a surface. We found that within 20 μm from a surface tumbles are suppressed by 50% and reorientations are largely confined to surface-parallel directions, preventing escape of bacteria from the near-surface region. A hydrodynamic model indicates that the tumble suppression is likely due to a surface-induced reduction in the hydrodynamic force responsible for the flagellar unbundling that causes tumbling. These findings imply that tumbling does not provide an effective means to escape trapping near surfaces.

  14. Corona-like atmospheric escape from KBOs. I. Gas dynamics

    NASA Astrophysics Data System (ADS)

    Levi, Amit; Podolak, Morris

    2009-08-01

    We show that for low temperatures ( T˜30 K) and small, but non-negligible, gravitational fields the hydrodynamic escape of gas can be treated by Parker's theory of coronal expansion [Parker, E.N., 1963. Interplanetary Dynamical Processes. Interscience Publishers, New York]. We apply this theory to gas escape from Kuiper belt objects. We derive limits on the density and radius of the bodies for which this theory is applicable, and show how the flow depends on the mean molecular weight and internal degrees of freedom of the gas molecules. We use these results to explain the CH 4 dichotomy seen on KBOs [Schaller, E.L., Brown, M.E., 2007. Astrophys. J., 659, L61-L64].

  15. Transcriptional control of behavior: Engrailed knockout changes cockroach escape trajectories

    PubMed Central

    Booth, David; Marie, Bruno; Domenici, Paolo; Blagburn, Jonathan M; Bacon, Jonathan P

    2009-01-01

    The cerci of the cockroach are covered with identified sensory hairs, which detect air movements. The sensory neurons which innervate these hairs synapse with giant interneurons (GIs) in the terminal ganglion which in turn synapse with interneurons and leg motorneurons in thoracic ganglia. This neural circuit mediates the animal's escape behavior. The transcription factor Engrailed (En) is expressed only in the medially born sensory neurons, which suggested it could work as a positional determinant of sensory neuron identity. Previously, we used dsRNA interference to abolish En expression, and found that the axonal arborization and synaptic outputs of an identified En-positive sensory neuron changed so that it came to resemble a nearby En-negative cell, which was itself unaffected. We thus demonstrated directly that En controls synaptic choice, as well as axon projections. Is escape behavior affected as a result of this mis-wiring? We recently showed that adult cockroaches keep each escape unpredictable by running along one of a set of preferred escape trajectories (ETs) at fixed angles from the direction of the threatening stimulus. The probability of selecting a particular ET is influenced by wind direction. In this present study we show that early instar juvenile cockroaches also use those same ETs. En knockout significantly perturbs the animals' perception of posterior wind, altering the choice of ETs to one more appropriate for anterior wind. This is the first time that it has been shown that knockout of a transcription factor controlling synaptic connectivity can alter the perception of a directional stimulus. PMID:19494140

  16. Escaping radio emission from pulsars: Possible role of velocity shear

    SciTech Connect

    Mahajan, S.M. |; Machabeli, G.Z.; Rogava, A.D. |

    1997-01-01

    It is demonstrated that the velocity shear, intrinsic to the e{sup +}e{sup {minus}} plasma present in the pulsar magnetosphere, can efficiently convert the nonescaping longitudinal Langmuir waves (produced by some kind of a beam or stream instability) into propagating (escaping) electromagnetic waves. It is suggested that this shear induced transformation may be the basic mechanism needed for the eventual generation of the observed pulsar radio emission.

  17. Helicopter crash in water: effects of simulator escape training.

    PubMed

    Hytten, K

    1989-01-01

    Findings are presented from an interview study of five crew members who survived a helicopter crash. Four of the five surviving men had received simulated helicopter accident training prior to the crash. One untrained crew member died. The four previously trained survivors claimed that the training was of decisive moment in their escape and survival. Contributions from training appeared to be provision of confidence and thought control. The author discusses these as the development of a positive response-outcome expectancy.

  18. Several immune escape patterns in non-Hodgkin's lymphomas

    PubMed Central

    Laurent, Camille; Charmpi, Konstantina; Gravelle, Pauline; Tosolini, Marie; Franchet, Camille; Ysebaert, Loïc; Brousset, Pierre; Bidaut, Alexandre; Ycart, Bernard; Fournié, Jean-Jacques

    2015-01-01

    Follicular Lymphomas (FL) and diffuse large B cell lymphomas (DLBCL) must evolve some immune escape strategy to develop from lymphoid organs, but their immune evasion pathways remain poorly characterized. We investigated this issue by transcriptome data mining and immunohistochemistry (IHC) of FL and DLBCL lymphoma biopsies. A set of genes involved in cancer immune-evasion pathways (Immune Escape Gene Set, IEGS) was defined and the distribution of the expression levels of these genes was compared in FL, DLBCL and normal B cell transcriptomes downloaded from the GEO database. The whole IEGS was significantly upregulated in all the lymphoma samples but not in B cells or other control tissues, as shown by the overexpression of the PD-1, PD-L1, PD-L2 and LAG3 genes. Tissue microarray immunostainings for PD-1, PD-L1, PD-L2 and LAG3 proteins on additional biopsies from 27 FL and 27 DLBCL patients confirmed the expression of these proteins. The immune infiltrates were more abundant in FL than DLBCL samples, and the microenvironment of FL comprised higher rates of PD-1+ lymphocytes. Further, DLBCL tumor cells comprised a higher proportion of PD-1+, PD-L1+, PD-L2+ and LAG3+ lymphoma cells than the FL tumor cells, confirming that DLBCL mount immune escape strategies distinct from FL. In addition, some cases of DLBCL had tumor cells co-expressing both PD-1, PD-L1 and PD-L2. Among the DLBCLs, the activated B cell (ABC) subtype comprised more PD-L1+ and PD-L2+ lymphoma cells than the GC subtype. Thus, we infer that FL and DLBCL evolved several pathways of immune escape. PMID:26405585

  19. Escape factors in zero-dimensional radiation-transfer codes

    NASA Astrophysics Data System (ADS)

    Phillips, G. J.; Wark, J. S.; Kerr, F. M.; Rose, S. J.; Lee, R. W.

    2008-04-01

    Several zero-dimensional non-LTE radiation-transfer codes are in common use within the laser-plasma community (for example, RATION, FLY, FLYCHK and GALAXY). These codes are capable of generating calculated emission spectra for a plasma of given density and temperature in the presence of a radiation field. Although dimensionless in nature, these codes can take into account the coupling of radiation and populations by use of the escape factor method, and in this sense the codes incorporate the finite size of the plasma of interest in two ways - firstly in the calculation of the effect of the radiation on the populations and secondly when using these populations to generate a spectrum. Different lengths can be used within these two distinct operations, though it has not been made clear what these lengths should be. We submit that the appropriate length to use for the calculation of populations in such zero-dimensional codes is the mean chord of the system, whilst when calculating the spectrum the appropriate length is the size of the plasma along the line of sight. Indeed, for specific plasma shapes using the appropriate escape factors it can be shown that this interpretation agrees with analytic results. However, this is only the case if the correct escape factor is employed: use of the Holstein escape factor (which is in widely distributed versions of the codes mentioned above) is found to be significantly in error under most conditions. We also note that for the case where a plasma is close to coronal equilibrium, some limited information concerning the shape of the plasma can be extracted merely from the ratio of optically thick to optically thin lines, without the need for any explicit spatial resolution.

  20. Transitions between three swimming gaits in Paramecium escape

    PubMed Central

    Hamel, Amandine; Fisch, Cathy; Combettes, Laurent; Dupuis-Williams, Pascale; Baroud, Charles N.

    2011-01-01

    Paramecium and other protists are able to swim at velocities reaching several times their body size per second by beating their cilia in an organized fashion. The cilia beat in an asymmetric stroke, which breaks the time reversal symmetry of small scale flows. Here we show that Paramecium uses three different swimming gaits to escape from an aggression, applied in the form of a focused laser heating. For a weak aggression, normal swimming is sufficient and produces a steady swimming velocity. As the heating amplitude is increased, a higher acceleration and faster swimming are achieved through synchronized beating of the cilia, which begin by producing oscillating swimming velocities and later give way to the usual gait. Finally, escape from a life-threatening aggression is achieved by a “jumping” gait, which does not rely on the cilia but is achieved through the explosive release of a group of trichocysts in the direction of the hot spot. Measurements through high-speed video explain the role of trichocysts in defending against aggressions while showing unexpected transitions in the swimming of microorganisms. These measurements also demonstrate that Paramecium optimizes its escape pattern by taking advantage of its inertia. PMID:21464291

  1. Comparison of operant escape and reflex tests of nociceptive sensitivity.

    PubMed

    Vierck, Charles J; Yezierski, Robert P

    2015-04-01

    Testing of reflexes such as flexion/withdrawal or licking/guarding is well established as the standard for evaluating nociceptive sensitivity and its modulation in preclinical investigations of laboratory animals. Concerns about this approach have been dismissed for practical reasons - reflex testing requires no training of the animals; it is simple to instrument; and responses are characterized by observers as latencies or thresholds for evocation. In order to evaluate this method, the present review summarizes a series of experiments in which reflex and operant escape responding are compared in normal animals and following surgical models of neuropathic pain or pharmacological intervention for pain. Particular attention is paid to relationships between reflex and escape responding and information on the pain sensitivity of normal human subjects or patients with pain. Numerous disparities between results for reflex and operant escape measures are described, but the results of operant testing are consistent with evidence from humans. Objective reasons are given for experimenters to choose between these and other methods of evaluating the nociceptive sensitivity of laboratory animals.

  2. ESCAPE FROM SD ASSOCIATED WITH FIXED-RATIO REINFORCEMENT.

    PubMed

    THOMPSON, D M

    1964-01-01

    Throughout ascending and descending fixed-ratio (FR) sequences, rats were allowed to terminate the FR stimulus control by pressing a time-out (TO) lever. To minimize chance or accidental responses on this second lever, three presses were required to produce the 30-sec S(Delta) period. As FR performance became more "strained," there was an increased predisposition to escape from the time-in stimulus complex. The generality of this finding was extended by obtaining recoverability (independent of the direction of stimulus change) of the FR-TO function in the descending series. Typically, escapes were produced only during the post-reinforcement pause; however, under a mixed FR FR schedule, their occurrence shifted to a point within the inter-reinforcement interval corresponding to the unreinforced completion of the lower ratio component. It appears that the point where the rat can discriminate the size of the ratio requirement will be the place where TOs are imposed. This inference was supported by a substantial increase in TO frequency accompanying a shift from CRF to extinction on the FR lever. Finally, the escape lever was placed on a progressively increasing FR schedule and later extinguished to demonstrate that the TO condition was in fact reinforcing.

  3. Transitions between three swimming gaits in Paramecium escape.

    PubMed

    Hamel, Amandine; Fisch, Cathy; Combettes, Laurent; Dupuis-Williams, Pascale; Baroud, Charles N

    2011-05-01

    Paramecium and other protists are able to swim at velocities reaching several times their body size per second by beating their cilia in an organized fashion. The cilia beat in an asymmetric stroke, which breaks the time reversal symmetry of small scale flows. Here we show that Paramecium uses three different swimming gaits to escape from an aggression, applied in the form of a focused laser heating. For a weak aggression, normal swimming is sufficient and produces a steady swimming velocity. As the heating amplitude is increased, a higher acceleration and faster swimming are achieved through synchronized beating of the cilia, which begin by producing oscillating swimming velocities and later give way to the usual gait. Finally, escape from a life-threatening aggression is achieved by a "jumping" gait, which does not rely on the cilia but is achieved through the explosive release of a group of trichocysts in the direction of the hot spot. Measurements through high-speed video explain the role of trichocysts in defending against aggressions while showing unexpected transitions in the swimming of microorganisms. These measurements also demonstrate that Paramecium optimizes its escape pattern by taking advantage of its inertia.

  4. A Treatment Package without Escape Extinction to Address Food Selectivity.

    PubMed

    Weber, Jessica; Gutierrez, Anibal

    2015-08-21

    Feeding difficulties and feeding disorders are a commonly occurring problem for young children, particularly children with developmental delays including autism. Behavior analytic interventions for the treatment of feeding difficulties oftentimes include escape extinction as a primary component of treatment. The use of escape extinction, while effective, may be problematic as it is also associated with the emergence of challenging behavior (e.g., extinction burst). Such challenging behavior may be an acceptable side effect in treatment cases where feeding problems are severe and chronic (e.g., failure to thrive). However, in more acute cases (e.g., selective eating), the negative side effect may be unwarranted and undesired. More recent research on the behavioral treatment of food selectivity has begun to evaluate treatments for feeding difficulties that do not include escape extinction (e.g., demand fading, behavioral momentum), with some success. However, research to date reveals individual differences in responsiveness to such treatments and no clear preferable treatment has emerged. This manuscript describes a multi-component treatment package that includes shaping, sequential presentation and simultaneous presentation, for the treatment of food selectivity in four young children with developmental delays. This treatment package extends the literature on the behavioral treatment for food selectivity and offers a multi-component treatment protocol that may be clinically applicable across a range of treatment scenarios and settings.

  5. Fleeing to refuge: Escape decisions in the race for life.

    PubMed

    Cooper, William E

    2016-10-01

    Economic escape theory that predicts that flight initiation distance (FID=predator-prey distance when a prey begins to flee from an approaching predator) increases as predation risk increases has been overwhelmingly supported. However, the vast majority of empirical tests have focused on effects of single predation risk factors. Even studies that have included multiple risk factors have not predicted how they jointly affect FID. I present a model that predicts joint effects of several predation risk factors that affect the outcome of a race between predator and prey to the prey's refuge. As a prey's distance to refuge and predator attack speed increase, and as the prey's location forces it to flee more toward a predator to reach refuge, FID increases. A published model proposed and experiment showed that FID is longer when prey flee directly toward than directly away from a predator to a refuge. We present a new geometric model that predicts FID for all angles between the prey's and predator's paths to refuge, distance of the prey from refuge when escape begins, predator and prey speeds, and a margin of safety allowing the prey to reach refuge before the predator. The model provides many new, testable predictions about relationships among its variables and FID. Most notably, it predicts that FID increases sigmoidally as the angle between predator and prey paths to refuge increases. Although the model is not economic (cost-benefit), we discuss its relationship to economic escape theory.

  6. On the Relative Contributions of Noncontingent Reinforcement and Escape Extinction in the Treatment of Food Refusal

    ERIC Educational Resources Information Center

    Reed, Gregory K.; Piazza, Cathleen C.; Patel, Meeta R.; Layer, Stacy A.; Bachmeyer, Melanie H.; Bethke, Stephanie D.; Gutshall, Katharine A.

    2004-01-01

    In the current investigation, we evaluated the relative effects of noncontingent reinforcement (NCR), escape extinction, and a combination of NCR and escape extinction as treatment for the feeding problems exhibited by 4 children. For each participant, consumption increased only when escape extinction was implemented, independent of whether NCR…

  7. Escape Geography--Developing Middle-School Students' Sense of Place.

    ERIC Educational Resources Information Center

    Allen, Rodney F.; Molina, Laurie E. S.

    1992-01-01

    Suggests a social studies unit on escaping geography. Examines escape from dangerous places including an airliner, hotel fire, or war zone or from a social situation such as a boring speech or party. Describes historic escapes such as the Underground Railroad and the Berlin Wall. Lists learning strategies such as awareness of space and cognitive…

  8. 33 CFR 149.691 - What means of escape are required?

    Code of Federal Regulations, 2011 CFR

    2011-07-01

    ... and secondary means of escape. Each of these means must either: (1) Comply with 46 CFR 108.151; or (2... in 29 CFR 1910.2, for use in evacuating the port. (b) A primary means of escape consists of a fixed stairway or a fixed ladder, constructed of steel. (c) A secondary means of escape consists of either: (1)...

  9. 46 CFR 56.50-25 - Safety and relief valve escape piping.

    Code of Federal Regulations, 2011 CFR

    2011-10-01

    ... 46 Shipping 2 2011-10-01 2011-10-01 false Safety and relief valve escape piping. 56.50-25 Section... valve escape piping. (a) Escape piping from unfired steam generator, boiler, and superheater safety valves shall have an area of not less than that of the combined areas of the outlets of all...

  10. 46 CFR 56.50-25 - Safety and relief valve escape piping.

    Code of Federal Regulations, 2010 CFR

    2010-10-01

    ... 46 Shipping 2 2010-10-01 2010-10-01 false Safety and relief valve escape piping. 56.50-25 Section... valve escape piping. (a) Escape piping from unfired steam generator, boiler, and superheater safety valves shall have an area of not less than that of the combined areas of the outlets of all...

  11. 78 FR 13811 - Safety Zone; Underwater Escape Event, Seaport, East River, NY

    Federal Register 2010, 2011, 2012, 2013, 2014

    2013-03-01

    ... Federal Register on November 9, 2011 (76 FR 69614). ] Table 1 1. Merlini Underwater Escape Launch site... SECURITY Coast Guard 33 CFR Part 165 Safety Zone; Underwater Escape Event, Seaport, East River, NY AGENCY... escape artist event and associated pyrotechnics display. During the enforcement period, no person...

  12. Escape Performance Following Exposure to Inescapable Shock: Deficits in Motor Response Maintenance

    ERIC Educational Resources Information Center

    Anisman, Hymie; And Others

    1978-01-01

    A series of 13 experiments employing mice systematically investigated shock-elicited activity in a circular field and escape performance in a shuttle box following exposure to either escapable or inescapable shock. Results show that escape interference induced by inescapable shock may be comfortably interpreted in terms of a decreased tendency for…

  13. NAMPT inhibition synergizes with NQO1-targeting agents in inducing apoptotic cell death in non-small cell lung cancer cells.

    PubMed

    Liu, Hui-Ying; Li, Qing-Ran; Cheng, Xue-Fang; Wang, Guang-Ji; Hao, Hai-Ping

    2016-08-01

    Nicotinamide phosphoribosyltransferase (NAMPT) catalyzes the first rate-limiting step in converting nicotinamide to NAD(+), essential for a number of enzymes and regulatory proteins involved in a variety of cellular processes, including deacetylation enzyme SIRT1 which modulates several tumor suppressors such as p53 and FOXO. Herein we report that NQO1 substrates Tanshione IIA (TSA) and β-lapachone (β-lap) induced a rapid depletion of NAD(+) pool but adaptively a significant upregulation of NAMPT. NAMPT inhibition by FK866 at a nontoxic dose significantly enhanced NQO1-targeting agent-induced apoptotic cell death. Compared with TSA or β-lap treatment alone, co-treatment with FK866 induced a more dramatic depletion of NAD(+), repression of SIRT1 activity, and thereby the increased accumulation of acetylated FOXO1 and the activation of apoptotic pathway. In conclusion, the results from the present study support that NAMPT inhibition can synergize with NQO1 activation to induce apoptotic cell death, thereby providing a new rationale for the development of combinative therapeutic drugs in combating non-small lung cancer. PMID:27608947

  14. Harnessing the apoptotic programs in cancer stem-like cells

    PubMed Central

    Wang, Ying-Hua; Scadden, David T

    2015-01-01

    Elimination of malignant cells is an unmet challenge for most human cancer types even with therapies targeting specific driver mutations. Therefore, a multi-pronged strategy to alter cancer cell biology on multiple levels is increasingly recognized as essential for cancer cure. One such aspect of cancer cell biology is the relative apoptosis resistance of tumor-initiating cells. Here, we provide an overview of the mechanisms affecting the apoptotic process in tumor cells emphasizing the differences in the tumor-initiating or stem-like cells of cancer. Further, we summarize efforts to exploit these differences to design therapies targeting that important cancer cell population. PMID:26253117

  15. CD44, α4 integrin, and fucoidin receptor-mediated phagocytosis of apoptotic leukocytes

    PubMed Central

    Johnson, Jacob D.; Hess, Krista L.; Cook-Mills, Joan M.

    2011-01-01

    Various types of phagocytes mediate the clearance of apoptotic cells. We previously reported that human and murine high endothelial venule (HEV) cells ingest apoptotic cells. In this report, we examined endothelial cell fucoidin receptor-mediated phagocytosis using a murine endothelial cell model mHEV. mHEV cell recognition of apoptotic leukocytes was blocked by fucoidin but not by other phagocytic receptor inhibitors such as mannose, fucose, N-acetylglucosamine, phosphatidylserine (PS), or blocking anti-PS receptor antibodies. Thus, the mHEV cells used fucoidin receptors for recognition and phagocytosis of apoptotic leukocytes. The fucoidin receptor-mediated endothelial cell phagocytosis was specific for apoptotic leukocytes, as necrotic cells were not ingested. This is in contrast to macrophages, which ingest apoptotic and necrotic cells. Endothelial cell phagocytosis of apoptotic cells did not alter viable lymphocyte migration across these endothelial cells. Antibody blocking of CD44 and α4 integrin on the apoptotic leukocyte inhibited this endothelial cell phagocytosis, suggesting a novel function for these adhesion molecules in the removal of apoptotic targets. The removal of apoptotic leukocytes by endothelial cells may protect the microvasculature, thus ensuring that viable lymphocytes can successfully migrate into tissues. PMID:12960273

  16. Activation-induced CD154 expression abrogates tolerance induced by apoptotic cells*

    PubMed Central

    Gurung, Prajwal; Kucaba, Tamara A.; Ferguson, Thomas A.; Griffith, Thomas S.

    2009-01-01

    The decision to generate a productive immune response or tolerance often depends on the context in which T cells first see Ag. Using a classical system of tolerance induction, we examined the immunological consequence of Ag encountered in the presence of naïve or activated apoptotic cells. Naïve apoptotic cells induced tolerance when injected i.v.; however, previously activated apoptotic cells induced immunity. Further analysis revealed a key role for CD154, as tolerance resulted after i.v. injection of either naïve or activated apoptotic CD154−/− T cells, while co-injection of an agonistic anti-CD40 mAb with naïve apoptotic T cells induced robust immunity. DC fed activated apoptotic T cells in vitro produced IL-12p40 in a CD154-dependent manner, and the use of IL-12p40−/− mice or mAb-mediated neutralization of IL-12 revealed a link between CD154, IL-12, and the ability of activated apoptotic T cells to induce immunity rather than tolerance. Collectively these results show that CD154 expression on apoptotic T cells can determine the outcome of an immune response to Ag recognized within the context of the apoptotic cells, and suggest the balance between naïve and activated apoptotic T cells may dictate whether a productive immune response is encouraged. PMID:19841180

  17. Lunar mission safety and rescue: Escape/rescue analysis and plan

    NASA Technical Reports Server (NTRS)

    1971-01-01

    The results are presented of the technical analysis of escape/rescue/survival situations, crew survival techniques, alternate escape/rescue approaches and vehicles, and the advantages and disadvantages of each for advanced lunar exploration. Candidate escape/rescue guidelines are proposed and elements of a rescue plan developed. The areas of discussions include the following: lunar arrival/departure operations, lunar orbiter operations, lunar surface operations, lunar surface base escape/rescue analysis, lander tug location operations, portable airlock, emergency pressure suit, and the effects of no orbiting lunar station, no lunar surface base, and no foreign lunar orbit/surface operations on the escape/rescue plan.

  18. Broad CTL Response in Early HIV Infection Drives Multiple Concurrent CTL Escapes.

    PubMed

    Leviyang, Sivan; Ganusov, Vitaly V

    2015-10-01

    Recent studies have highlighted the ability of HIV to escape from cytotoxic T lymphocyte (CTL) responses that concurrently target multiple viral epitopes. Yet, the viral dynamics involved in such escape are incompletely understood. Previous analyses have made several strong assumptions regarding HIV escape from CTL responses such as independent or non-concurrent escape from individual CTL responses. Using experimental data from evolution of HIV half genomes in four patients we observe concurrent viral escape from multiple CTL responses during early infection (first 100 days of infection), providing confirmation of a recent result found in a study of one HIV-infected patient. We show that current methods of estimating CTL escape rates, based on the assumption of independent escapes, are biased and perform poorly when CTL escape proceeds concurrently at multiple epitopes. We propose a new method for analyzing longitudinal sequence data to estimate the rate of CTL escape across multiple epitopes; this method involves few parameters and performs well in simulation studies. By applying our novel method to experimental data, we find that concurrent multiple escapes occur at rates between 0.03 and 0.4 day(-1), a relatively broad range that reflects uncertainty due to sparse sampling and wide ranges of parameter values. However, we show that concurrent escape at rates 0.1-0.2 day(-1) across multiple epitopes is consistent with our patient datasets.

  19. A comparison of positive and negative reinforcement for compliance to treat problem behavior maintained by escape.

    PubMed

    Slocum, Sarah K; Vollmer, Timothy R

    2015-09-01

    Previous research has shown that problem behavior maintained by escape can be treated using positive reinforcement. In the current study, we directly compared functional (escape) and nonfunctional (edible) reinforcers in the treatment of escape-maintained problem behavior for 5 subjects. In the first treatment, compliance produced a break from instructions. In the second treatment, compliance produced a small edible item. Neither treatment included escape extinction. Results suggested that the delivery of a positive reinforcer for compliance was effective for treating escape-maintained problem behavior for all 5 subjects, and the delivery of escape for compliance was ineffective for 3 of the 5 subjects. Implications and future directions related to the use of positive reinforcers in the treatment of escape behavior are discussed.

  20. The effects of escape from self and interpersonal relationship on the pathological use of Internet games.

    PubMed

    Kwon, Jung-Hye; Chung, Chung-Suk; Lee, Jung

    2011-02-01

    The purpose of the present study was to examine whether Baumeister's escape from self theory may account for the pathological use of Internet games among Korean adolescents. A sample of 1,136 junior high school students completed measures assessing Internet game addiction (IGA), real-ideal self discrepancy, escape from self, current mood, peer relationships, perceived parent-child relationship, and parental supervision. IGA was significantly correlated with all of these variables. Multiple regression analysis showed that escape from self best explained the adolescents' IGA. A path model yielded significant paths from self-discrepancy to negative mood, from negative mood to escape from self, and from escape from self to IGA. These results support the validity of using the escape from self theory to explain the adolescents' IGA, thereby suggesting that adolescents become addicted to Internet games in an attempt to escape from self and reality.

  1. Inhibition of Rho-ROCK signaling induces apoptotic and non-apoptotic PS exposure in cardiomyocytes via inhibition of flippase.

    PubMed

    Krijnen, Paul A J; Sipkens, Jessica A; Molling, Johan W; Rauwerda, Jan A; Stehouwer, Coen D A; Muller, Alice; Paulus, Walter J; van Nieuw Amerongen, Geerten P; Hack, C Erik; Verhoeven, Arthur J; van Hinsbergh, Victor W M; Niessen, Hans W M

    2010-11-01

    Subsequent to myocardial infarction, cardiomyocytes within the infarcted areas and border zones expose phosphatidylserine (PS) in the outer plasma membrane leaflet (flip-flop). We showed earlier that in addition to apoptosis, this flip-flop can be reversible in cardiomyocytes. We now investigated a possible role for Rho and downstream effector Rho-associated kinase (ROCK) in the process of (reversible) PS exposure and apoptosis in cardiomyocytes. In rat cardiomyoblasts (H9c2 cells) and isolated adult ventricular rat cardiomyocytes Clostridium difficile Toxin B (TcdB), a Rho GTPase family inhibitor, C3 transferase (C3), a Rho(A,B,C) inhibitor and the ROCK inhibitors Y27632 and H1152 were used to inhibit Rho-ROCK signaling. PS exposure was assessed via flow cytometry and fluorescent digital imaging microscopy using annexin V. Akt expression and phosphorylation were analyzed via Western blot, and Akt activity was inhibited by wortmannin. The cellular concentration activated caspase 3 was determined as a measure of apoptosis, and flippase activity was assessed via flow cytometry using NBD-labeled PS. TcdB, C3, Y27632 and H1152 all significantly increased PS exposure. TcdB, Y27632 and H1152 all significantly inhibited phosphorylation of the anti-apoptotic protein Akt and Akt inhibition by wortmannin lead to increased PS exposure. However, only TcdB and C3, but not ROCK- or Akt inhibition led to caspase 3 activation and thus apoptosis. Notably, pancaspase inhibitor zVAD only partially inhibited TcdB-induced PS exposure indicating the existence of apoptotic and non-apoptotic PS exposure. The induced PS exposure coincided with decreased flippase activity as measured with NBD-labeled PS flip-flop. In this study, we show a regulatory role for a novel signaling route, Rho-ROCK-flippase signaling, in maintaining asymmetrical membrane phospholipid distribution in cardiomyocytes.

  2. In vitro apoptotic and DNA damaging potential of nanobarium oxide.

    PubMed

    Alarifi, Saud; Ali, Daoud; Al-Bishri, Widad

    2016-01-01

    Barium oxide nanoparticles (BaONPs) are an important industrial compound and are widely used in polymers and paints. In this study, apoptotic and genotoxic effects of BaONPs in mouse embryonic fibroblast (L929) cells were determined by using single-cell gel test. In vitro cytotoxicity assays were performed to assess BaONPs' toxicity in L929 cells. Mild cytotoxicity was observed in L929 cells due to BaONPs. BaONPs increased lipid peroxidation, catalase, and superoxide dismutase levels and lowered glutathione levels in L929 cells. This was accompanied by concomitant generation of reactive oxygen species and activation of caspase-3 in BaONPs-treated L929 cells. On the other hand, when we exposed L929 cells to BaONPs for 24 and 48 hours (comet assay), there was a duration- and dose-dependent increase in DNA impairment detected in the single-cell gel test. Thus, BaONPs exhibit genotoxic and apoptotic effects in L929 cells, most likely due to initiation of oxidative damage. PMID:26834473

  3. Heat-Induced Fibrillation of BclXL Apoptotic Repressor

    PubMed Central

    Bhat, Vikas; Olenick, Max B.; Schuchardt, Brett J.; Mikles, David C.; Deegan, Brian J.; McDonald, Caleb B.; Seldeen, Kenneth L.; Kurouski, Dmitry; Faridi, Mohd Hafeez; Shareef, Mohammed M.; Gupta, Vineet; Lednev, Igor K.; Farooq, Amjad

    2013-01-01

    The BclXL apoptotic repressor bears the propensity to associate into megadalton oligomers in solution, particularly under acidic pH. Herein, using various biophysical methods, we analyze the effect of temperature on the oligomerization of BclXL. Our data show that BclXL undergoes irreversible aggregation and assembles into highly-ordered rope-like homogeneous fibrils with length in the order of mm and a diameter in the μm-range under elevated temperatures. Remarkably, the formation of such fibrils correlates with the decay of a largely α-helical fold into a predominantly β-sheet architecture of BclXL in a manner akin to the formation of amyloid fibrils. Further interrogation reveals that while BclXL fibrils formed under elevated temperatures show no observable affinity toward BH3 ligands, they appear to be optimally primed for insertion into cardiolipin bicelles. This salient observation strongly argues that BclXL fibrils likely represent an on-pathway intermediate for insertion into mitochondrial outer membrane during the onset of apoptosis. Collectively, our study sheds light on the propensity of BclXL to form amyloid-like fibrils with important consequences on its mechanism of action in gauging the apoptotic fate of cells in health and disease. PMID:23714425

  4. PUMA-mediated mitochondrial apoptotic disruption by hypoxic postconditioning.

    PubMed

    Li, YuZhen; Guo, Qi; Liu, XiuHua; Wang, Chen; Song, DanDan

    2015-08-01

    Postconditioning can reduce ischemia-reperfusion (I/R)-induced cardiomyocyte apoptosis by targeting mitochondria. p53 upregulated modulator of apoptosis (PUMA) is involved in lethal I/R injury. Here, we hypothesized that postconditioning might inhibit mitochondrial pathway-mediated cardiomyocyte apoptosis by controlling PUMA expression. The cultured neonatal rat cardiomyocytes underwent 3 h of hypoxia and 3 h of reoxygenation. Postconditioning consisted of three cycles of 5 min reoxygenation and 5 min hypoxia after prolonged hypoxia. Hypoxic postconditioning reduced the levels of PUMA mRNA and protein. Concomitantly, the loss of mitochondrial membrane potential, cytochrome c release and caspase-3 activation were decreased significantly by postconditioning. Overexpression of PUMA increased greatly not only the number of apoptotic cardiomyocytes, but also the collapse of mitochondrial membrane potential, cytochrome c release and caspase-3 activation under postconditioning condition. The data suggest that reduction of PUMA expression mediates the endogenous cardioprotective mechanisms of postconditioning by disrupting mitochondrial apoptotic pathway.

  5. Heat-induced fibrillation of BclXL apoptotic repressor.

    PubMed

    Bhat, Vikas; Olenick, Max B; Schuchardt, Brett J; Mikles, David C; Deegan, Brian J; McDonald, Caleb B; Seldeen, Kenneth L; Kurouski, Dmitry; Faridi, Mohd Hafeez; Shareef, Mohammed M; Gupta, Vineet; Lednev, Igor K; Farooq, Amjad

    2013-09-01

    The BclXL apoptotic repressor bears the propensity to associate into megadalton oligomers in solution, particularly under acidic pH. Herein, using various biophysical methods, we analyze the effect of temperature on the oligomerization of BclXL. Our data show that BclXL undergoes irreversible aggregation and assembles into highly-ordered rope-like homogeneous fibrils with length in the order of mm and a diameter in the μm-range under elevated temperatures. Remarkably, the formation of such fibrils correlates with the decay of a largely α-helical fold into a predominantly β-sheet architecture of BclXL in a manner akin to the formation of amyloid fibrils. Further interrogation reveals that while BclXL fibrils formed under elevated temperatures show no observable affinity toward BH3 ligands, they appear to be optimally primed for insertion into cardiolipin bicelles. This salient observation strongly argues that BclXL fibrils likely represent an on-pathway intermediate for insertion into mitochondrial outer membrane during the onset of apoptosis. Collectively, our study sheds light on the propensity of BclXL to form amyloid-like fibrils with important consequences on its mechanism of action in gauging the apoptotic fate of cells in health and disease. PMID:23714425

  6. Histone Deacetylase Inhibitor Upregulates Peroxisomal Fatty Acid Oxidation and Inhibits Apoptotic Cell Death in Abcd1-Deficient Glial Cells

    PubMed Central

    Singh, Jaspreet; Khan, Mushfiquddin; Pujol, Aurora; Baarine, Mauhamad; Singh, Inderjit

    2013-01-01

    In X-ALD, mutation/deletion of ALD gene (ABCD1) and the resultant very long chain fatty acid (VLCFA) derangement has dramatically opposing effects in astrocytes and oligodendrocytes. While loss of Abcd1 in astrocytes produces a robust inflammatory response, the oligodendrocytes undergo cell death leading to demyelination in X-linked adrenoleukodystrophy (X-ALD). The mechanisms of these distinct pathways in the two cell types are not well understood. Here, we investigated the effects of Abcd1-knockdown and the subsequent alteration in VLCFA metabolism in human U87 astrocytes and rat B12 oligodendrocytes. Loss of Abcd1 inhibited peroxisomal β-oxidation activity and increased expression of VLCFA synthesizing enzymes, elongase of very long chain fatty acids (ELOVLs) (1 and 3) in both cell types. However, higher induction of ELOVL's in Abcd1-deficient B12 oligodendrocytes than astrocytes suggests that ELOVL pathway may play a prominent role in oligodendrocytes in X-ALD. While astrocytes are able to maintain the cellular homeostasis of anti-apoptotic proteins, Abcd1-deletion in B12 oligodendrocytes downregulated the anti-apototic (Bcl-2 and Bcl-xL) and cell survival (phospho-Erk1/2) proteins, and upregulated the pro-apoptotic proteins (Bad, Bim, Bax and Bid) leading to cell loss. These observations provide insights into different cellular signaling mechanisms in response to Abcd1-deletion in two different cell types of CNS. The apoptotic responses were accompanied by activation of caspase-3 and caspase-9 suggesting the involvement of mitochondrial-caspase-9-dependent mechanism in Abcd1-deficient oligodendrocytes. Treatment with histone deacetylase (HDAC) inhibitor suberoylanilide hydroxamic acid (SAHA) corrected the VLCFA derangement both in vitro and in vivo, and inhibited the oligodendrocytes loss. These observations provide a proof-of principle that HDAC inhibitor SAHA may have a therapeutic potential for X-ALD. PMID:23923017

  7. The Coxsackievirus B 3Cpro Protease Cleaves MAVS and TRIF to Attenuate Host Type I Interferon and Apoptotic Signaling

    PubMed Central

    Mukherjee, Amitava; Morosky, Stefanie A.; Delorme-Axford, Elizabeth; Dybdahl-Sissoko, Naomi; Oberste, M. Steven; Wang, Tianyi; Coyne, Carolyn B.

    2011-01-01

    The host innate immune response to viral infections often involves the activation of parallel pattern recognition receptor (PRR) pathways that converge on the induction of type I interferons (IFNs). Several viruses have evolved sophisticated mechanisms to attenuate antiviral host signaling by directly interfering with the activation and/or downstream signaling events associated with PRR signal propagation. Here we show that the 3Cpro cysteine protease of coxsackievirus B3 (CVB3) cleaves the innate immune adaptor molecules mitochondrial antiviral signaling protein (MAVS) and Toll/IL-1 receptor domain-containing adaptor inducing interferon-beta (TRIF) as a mechanism to escape host immunity. We found that MAVS and TRIF were cleaved in CVB3-infected cells in culture. CVB3-induced cleavage of MAVS and TRIF required the cysteine protease activity of 3Cpro, occurred at specific sites and within specialized domains of each molecule, and inhibited both the type I IFN and apoptotic signaling downstream of these adaptors. 3Cpro-mediated MAVS cleavage occurred within its proline-rich region, led to its relocalization from the mitochondrial membrane, and ablated its downstream signaling. We further show that 3Cpro cleaves both the N- and C-terminal domains of TRIF and localizes with TRIF to signalosome complexes within the cytoplasm. Taken together, these data show that CVB3 has evolved a mechanism to suppress host antiviral signal propagation by directly cleaving two key adaptor molecules associated with innate immune recognition. PMID:21436888

  8. Allograft tolerance induced by donor apoptotic lymphocytes requires phagocytosis in the recipient

    NASA Technical Reports Server (NTRS)

    Sun, E.; Gao, Y.; Chen, J.; Roberts, A. I.; Wang, X.; Chen, Z.; Shi, Y.

    2004-01-01

    Cell death through apoptosis plays a critical role in regulating cellular homeostasis. Whether the disposal of apoptotic cells through phagocytosis can actively induce immune tolerance in vivo, however, remains controversial. Here, we report in a rat model that without using immunosuppressants, transfusion of apoptotic splenocytes from the donor strain prior to transplant dramatically prolonged survival of heart allografts. Histological analysis verified that rejection signs were significantly ameliorated. Splenocytes from rats transfused with donor apoptotic cells showed a dramatically decreased response to donor lymphocyte stimulation. Most importantly, blockade of phagocytosis in vivo, either with gadolinium chloride to disrupt phagocyte function or with annexin V to block binding of exposed phosphotidylserine to its receptor on phagocytes, abolished the beneficial effect of transfused apoptotic cells on heart allograft survival. Our results demonstrate that donor apoptotic cells promote specific allograft acceptance and that phagocytosis of apoptotic cells in vivo plays a crucial role in maintaining immune tolerance.

  9. ExoMars alternative escape trajectories with Soyuz/Fregat.

    PubMed

    Gil-Fernández, Jesús; Van Damme, Carlos Corral; Graziano, Mariella; Amata, G B; Cogo, F; Perino, M A

    2005-12-01

    The objectives of ExoMars are to inject an orbiter around Mars and to land a rover on the surface to look for possible traces of life. During the first stages of the feasibility analysis, the mass margin of the orbiter was very small for a direct transfer in the Soyuz/Fregat scenario. An analysis of the combined use of lunar swing-bys and the Sun gravity gradient is performed with WESBOT in order to obtain alternative trajectories for injecting higher mass into Mars transfer. WESBOT is a GMV tool to find WSB transfers to the Moon and to design escape trajectories by performing several swing-bys with the Moon and the Earth. The weak stability boundary has been successfully used for lunar transfers (Hiten, SMART-1). For escape trajectories from the Earth, the potential mass gains depend on the escape direction and the departure date to make a series of gravity assists with the help of the Sun gravity gradient to save DeltaV. Several strategies are studied depending on the number and order of swing-bys. The departing conditions (date and orbit) are optimized but the arrival date to Mars is maintained because of mission requirements. For each type of strategy, a systematic search of initial guess trajectories is performed. The initial guess trajectory is made up of patched conics arcs and multiple shooting arcs when necessary. The optimal trajectories for the various scenarios are presented and show different morphologies. An analysis in terms of applicability to the ExoMars mission is included.

  10. Service-Life Extension of Explosive Escape Devices

    NASA Technical Reports Server (NTRS)

    Bement, L. J.; Schimmel, M. L.

    1987-01-01

    Chemical and functional tests yield conservative service-life estimates. Approach to extension of service lives of explosive devices in aircraft escape system developed, supported by testing of representative candidate devices to evaluate quantitatively effects of service, age, and degradation, and to enable responsible, conservative service-life determinations. Five types of explosive components evaluated: rigid and flexible explosive transfer lines; one-way transfers; flexible, linear-shaped charges; and initiation-handles. Extension of service in realistic manner provides both cost savings and increased system reliability.

  11. The age structure of selected countries in the ESCAP region.

    PubMed

    Hong, S

    1982-01-01

    The study objective was to examine the age structure of selected countries in the Economic and Social Commission for Asia and the Pacific (ESCAP) region, using available data and frequently applied indices such as the population pyramid, aged-child ratio, and median age. Based on the overall picture of the age structure thus obtained, age trends and their implication for the near future were arrived at. Countries are grouped into 4 types based on the fertility and mortality levels. Except for Japan, Hong Kong, and Singapore, the age structure in the 18 ESCAP region countries changed comparatively little over the 1950-80 period. The largest structural change occurred in Singapore, where the proportion of children under age 15 in the population declined significantly from 41-27%, while that of persons 65 years and older more than doubled. This was due primarily to the marked decline in fertility from a total fertility rate (TFR) of 6.7-1.8 during the period. Hong Kong also had a similar major transformation during the same period: the proportion of the old age population increased 2 1/2 times, from 2.5-6.3%. The age structures of the 18 ESCAP countries varied greatly by country. 10 countries of the 2 high fertility and mortality types showed a similar young age structural pattern, i.e., they have higher dependency ratios, a higher proportion of children under 15 years, a lower proportion of population 65 years and older, lower aged-child ratios, and younger median ages than the average countries in the less developed regions of the world. With minimal changes over the 1950-80 period, the gap between these countries and the average of the less developed regions widened. Unlike these 10 (mostly South Asian) countries, moderately low fertility and mortality countries (China, Korea, and Sri Lanka) are located between the world average and the less developed region in most of the indices, particularly during the last decade. Although their rate of population aging is not

  12. Experimental study of subsonic microjet escaping from a rectangular nozzle

    NASA Astrophysics Data System (ADS)

    Aniskin, V. M.; Maslov, A. A.; Mukhin, K. A.

    2016-10-01

    The first experiments on the subsonic laminar microjets escaping from the nozzles of rectangular shape are carried out. The nozzle size is 83.3x3823 microns. Reynolds number calculated by the nozzle height and the average flow velocity at the nozzle exit ranged from 58 to 154. The working gas was air at room temperature. The velocity decay and velocity fluctuations along the center line of the jet are determined. The fundamental difference between the laminar microjets characteristics and subsonic turbulent jets of macro size is shown. Based on measurements of velocity fluctuations it is shown the presence of laminar-turbulent transition in microjets and its location is determined.

  13. Development of a canine nociceptive thermal escape model.

    PubMed

    Wegner, Kirsten; Horais, Kjersti A; Tozier, Nicolle A; Rathbun, Michael L; Shtaerman, Yuri; Yaksh, Tony L

    2008-02-15

    Acute nociceptive models which have been validated for large animal species are limited, yet nociceptive assessment in non-rodent species is important in analgesic drug development where larger animals may be necessary because of the technical requirements of the study. Here we report development and validation of a canine hind paw thermal escape model and the effect of analgesics on withdrawal latencies. Individual focused projection bulbs were used as left and right voltage-adjusted thermal stimuli placed below a glass plate in a specifically designed canine holding apparatus. After acclimation, dogs were lightly restrained in a fabric sling while standing on the glass plate. The anterior center of the metatarsal pad of the left and right hind paw was positioned on the glass over each light, and duration of stimulation tolerance timed. For every trial, the escape latency from lamp actuation to paw withdrawal was recorded twice for each hind paw. The mean population baseline withdrawal latency of 9.3+/-1.7s (mean+/-S.D., n=12 dogs) was shown to be repeatable between paws, within and between individual animals, and between test days. This latency corresponded to a glass surface temperature of 49.5 degrees C. A cut-off time of 20s (corresponding to a glass surface temperature of 56.5 degrees C) was set to prevent tissue damage. Intravenous administration (mg/kg) of morphine (1.0), hydromorphone (0.2), butorphanol (0.4), fentanyl (0.01), and dexmedetomidine (0.01) significantly (p<0.05) increased withdrawal latency from baseline within 15-30 min of administration while buprenorphine (0.03) produced a delayed, modest but significant latency increase. Rank order of opioid analgesic duration was morphine=hydromorphone>butorphanol>bupenorphine>fentanyl=saline. A dose-effect curve for hydromorphone was generated and corresponded to previously described dose-effect relationships in other species. The non-analgesic tranquilizer acepromazine (0.1mg/kg) produced mild sedation

  14. Test of time: what if little Albert had escaped?

    PubMed

    Field, Andy P; Nightingale, Zoë C

    2009-04-01

    Watson and Rayner's (1920) ;Little Albert' experiment has become one of the most famous studies in psychology. It is a staple of many general psychology textbooks and is part of the very fabric of the discipline's folklore. Despite this fame, the study has been widely criticized in the nearly 90 years since it was published for its lack of methodological rigour. This article attempts to evaluate the contribution of the ;little Albert' study to modern clinical psychology by speculating on what theories and treatments of child anxiety would look like in a parallel universe in which the study never took place because ;little Albert' escaped from the hospital in which Watson tested him.

  15. Overcoming resistance of targeted EGFR monotherapy by inhibition of STAT3 escape pathway in soft tissue sarcoma

    PubMed Central

    Wang, Xiaochun; Goldstein, David; Crowe, Philip J.; Yang, Mark; Garrett, Kerryn; Zeps, Nikolajs; Yang, Jia-Lin

    2016-01-01

    Although epidermal growth factor receptor (EGFR) is often over-expressed in soft tissue sarcoma (STS), a phase II trial using an EGFR inhibitor gefitinib showed a low response rate. This study identified a new secondary resistance mechanism of gefitinib in STS, and developed new strategies to improve the effectiveness of EGFR inhibition particularly by blocking the STAT3 pathway. We demonstrated that seven STS cell lines of diverse histological origin showed resistance to gefitinib despite blockade of phosphorylated EGFR (pEGFR) and downstream signal transducers (pAKT and pERK) in PI3K/AKT and RAS/ERK pathways. Gefitinib exposure was not associated with decrease in the ratio of pSTAT3/pSTAT1. The relative STAT3 abundance and activation may be responsible for the drug resistance. We therefore hypothesized that the addition of a STAT3 inhibitor could overcome the STAT3 escape pathway. We found that the addition of STAT3 inhibitor S3I-201 to gefitinib achieved synergistic anti-proliferative and pro-apoptotic effects in all three STS cell lines examined. This was confirmed in a fibrosarcoma xenografted mouse model, where the tumours from the combination group (418mm3) were significantly smaller than those from untreated (1032mm3) or single drug (912 and 798mm3) groups. Our findings may have clinical implications for optimising EGFR-targeted therapy in STS. PMID:26909593

  16. Oxidative stress and apoptotic events during thermal stress in the symbiotic sea anemone, Anemonia viridis.

    PubMed

    Richier, Sophie; Sabourault, Cécile; Courtiade, Juliette; Zucchini, Nathalie; Allemand, Denis; Furla, Paola

    2006-09-01

    Symbiosis between cnidarian and photosynthetic protists is widely distributed over temperate and tropical seas. These symbioses can periodically breakdown, a phenomenon known as cnidarian bleaching. This event can be irreversible for some associations subjected to acute and/or prolonged environmental disturbances, and leads to the death of the animal host. During bleaching, oxidative stress has been described previously as acting at molecular level and apoptosis is suggested to be one of the mechanisms involved. We focused our study on the role of apoptosis in bleaching via oxidative stress in the association between the sea anemone Anemonia viridis and the dinoflagellates Symbiodinium species. Characterization of caspase-like enzymes were conducted at the biochemical and molecular level to confirm the presence of a caspase-dependent apoptotic phenomenon in the cnidarian host. We provide evidence of oxidative stress followed by induction of caspase-like activity in animal host cells after an elevated temperature stress, suggesting the concomitant action of these components in bleaching. PMID:16907933

  17. Barley aleurone cell death is not apoptotic: characterization of nuclease activities and DNA degradation.

    PubMed

    Fath, A; Bethke, P C; Jones, R L

    1999-11-01

    Barley aleurone cells undergo programmed cell death (PCD) when exposed to gibberellic acid (GA), but incubation in abscisic acid (ABA) prevent PCD. We tested the hypothesis that PCD in aleurone cells occurs by apoptosis, and show that the hallmark of apoptosis, namely DNA cleavage into 180 bp fragments, plasma membrane blebbing, and the formation of apoptotic bodies do not occur when aleurone cells die. We show that endogenous barley aleurone nucleases and nucleases present in enzymes used for protoplast preparation degrade aleurone DNA and that DNA degradation by these nucleases is rapid and can result in the formation of 180 bp DNA ladders. Methods are described that prevent DNA degradation during isolation from aleurone layers or protoplasts. Barley aleurone cells contain three nucleases whose activities are regulated by GA and ABA. CA induction and ABA repression of nuclease activities correlate with PCD in aleurone cells. Cells incubated in ABA remain alive and do not degrade their DNA, but living aleurone cells treated with GA accumulate nucleases and hydrolyze their nuclear DNA. We propose that barley nucleases play a role in DNA cleavage during aleurone PCD.

  18. Barley aleurone cell death is not apoptotic: characterization of nuclease activities and DNA degradation

    PubMed

    Fath; Bethke; Jones

    1999-11-01

    Barley aleurone cells undergo programmed cell death (PCD) when exposed to gibberellic acid (GA), but incubation in abscisic acid (ABA) prevents PCD. We tested the hypothesis that PCD in aleurone cells occurs by apoptosis, and show that the hallmarks of apoptosis, namely DNA cleavage into 180 bp fragments, plasma membrane blebbing, and the formation of apoptotic bodies do not occur when aleurone cells die. We show that endogenous barley aleurone nucleases and nucleases present in enzymes used for protoplast preparation degrade aleurone DNA and that DNA degradation by these nucleases is rapid and can result in the formation of 180 bp DNA ladders. Methods are described that prevent DNA degradation during isolation from aleurone layers or protoplasts. Barley aleurone cells contain three nucleases whose activities are regulated by GA and ABA. GA induction and ABA repression of nuclease activities correlate with PCD in aleurone cells. Cells incubated in ABA remain alive and do not degrade their DNA, but living aleurone cells treated with GA accumulate nucleases and hydrolyze their nuclear DNA. We propose that barley nucleases play a role in DNA cleavage during aleurone PCD.

  19. Oxidative stress and apoptotic events during thermal stress in the symbiotic sea anemone, Anemonia viridis.

    PubMed

    Richier, Sophie; Sabourault, Cécile; Courtiade, Juliette; Zucchini, Nathalie; Allemand, Denis; Furla, Paola

    2006-09-01

    Symbiosis between cnidarian and photosynthetic protists is widely distributed over temperate and tropical seas. These symbioses can periodically breakdown, a phenomenon known as cnidarian bleaching. This event can be irreversible for some associations subjected to acute and/or prolonged environmental disturbances, and leads to the death of the animal host. During bleaching, oxidative stress has been described previously as acting at molecular level and apoptosis is suggested to be one of the mechanisms involved. We focused our study on the role of apoptosis in bleaching via oxidative stress in the association between the sea anemone Anemonia viridis and the dinoflagellates Symbiodinium species. Characterization of caspase-like enzymes were conducted at the biochemical and molecular level to confirm the presence of a caspase-dependent apoptotic phenomenon in the cnidarian host. We provide evidence of oxidative stress followed by induction of caspase-like activity in animal host cells after an elevated temperature stress, suggesting the concomitant action of these components in bleaching.

  20. Tuberin and PRAS40 are anti-apoptotic gatekeepers during early human amniotic fluid stem-cell differentiation.

    PubMed

    Fuchs, Christiane; Rosner, Margit; Dolznig, Helmut; Mikula, Mario; Kramer, Nina; Hengstschläger, Markus

    2012-03-01

    Embryoid bodies (EBs) are three-dimensional multicellular aggregates allowing the in vitro investigation of stem-cell differentiation processes mimicking early embryogenesis. Human amniotic fluid stem (AFS) cells harbor high proliferation potential, do not raise the ethical issues of embryonic stem cells, have a lower risk for tumor development, do not need exogenic induction of pluripotency and are chromosomal stable. Starting from a single human AFS cell, EBs can be formed accompanied by the differentiation into cells of all three embryonic germ layers. Here, we report that siRNA-mediated knockdown of the endogenous tuberous sclerosis complex-2 (TSC2) gene product tuberin or of proline-rich Akt substrate of 40 kDa (PRAS40), the two major negative regulators of mammalian target of rapamycin (mTOR), leads to massive apoptotic cell death during EB development of human AFS cells without affecting the endodermal, mesodermal and ectodermal cell differentiation spectrum. Co-knockdown of endogenous mTOR demonstrated these effects to be mTOR-dependent. Our findings prove this enzyme cascade to be an essential anti-apoptotic gatekeeper of stem-cell differentiation during EB formation. These data allow new insights into the regulation of early stem-cell maintenance and differentiation and identify a new role of the tumor suppressor tuberin and the oncogenic protein PRAS40 with the relevance for a more detailed understanding of the pathogenesis of diseases associated with altered activities of these gene products.

  1. PKC{eta} confers protection against apoptosis by inhibiting the pro-apoptotic JNK activity in MCF-7 cells

    SciTech Connect

    Rotem-Dai, Noa; Oberkovitz, Galia; Abu-Ghanem, Sara; Livneh, Etta

    2009-09-10

    Apoptosis is frequently regulated by different protein kinases including protein kinase C family enzymes. Both inhibitory and stimulatory effects were demonstrated for several of the different PKC isoforms. Here we show that the novel PKC isoform, PKC{eta}, confers protection against apoptosis induced by the DNA damaging agents, UVC irradiation and the anti-cancer drug - Camptothecin, of the breast epithelial adenocarcinoma MCF-7 cells. The induced expression of PKC{eta} in MCF-7 cells, under the control of the tetracycline-responsive promoter, resulted in increased cell survival and inhibition of cleavage of the apoptotic marker PARP-1. Activation of caspase-7 and 9 and the release of cytochrome c were also inhibited by the inducible expression of PKC{eta}. Furthermore, JNK activity, required for apoptosis in MCF-7, as indicated by the inhibition of both caspase-7 cleavage and cytochrome c release from the mitochondria in the presence of the JNK inhibitor SP600125, was also suppressed by PKC{eta} expression. Hence, in contrast to most PKC isoforms enhancing JNK activation, our studies show that PKC{eta} is an anti-apoptotic protein, acting as a negative regulator of JNK activity. Thus, PKC{eta} could represent a target for intervention aimed to reduce resistance to anti-cancer treatments.

  2. Effects of cinnamon (Cinnamomum zeylanicum) bark oil on testicular antioxidant values, apoptotic germ cell and sperm quality.

    PubMed

    Yüce, A; Türk, G; Çeribaşi, S; Sönmez, M; Çiftçi, M; Güvenç, M

    2013-08-01

    Cinnamon and its contents have multifactorial properties such as antioxidant, anti-inflammatory and antidiabetic. Male infertility is one of the major health problems in life. The aim of this study was to investigate the effects of long-term cinnamon bark oil (CBO) ingestion on testicular antioxidant values, apoptotic germ cell and sperm quality of adult rats. Twelve male healthy Wistar rats were divided into two groups, each group containing six rats. While olive oil was given to control group, 100 mg kg(-1)  CBO was administered to the other group by gavage daily for 10 weeks. Body and reproductive organ weights, sperm characteristics, testicular lipid peroxidation and antioxidant enzyme activities, and testicular apoptosis via terminal deoxynucleotidyl transferase-mediated dUTP nick end labelling (TUNEL) method were examined. A significant decrease in malondialdehyde level and marked increases in reduced glutathione level, glutathione peroxidase and catalase activities were observed in rats treated with CBO compared with the control group. CBO consumption provided a significant increase in weights of testes and epididymides, epididymal sperm concentration, sperm motility and diameter of seminiferous tubules when compared with the control group. However, CBO consumption tended to decrease the abnormal sperm rate and apoptotic germ cell count, but it did not reach statistical significance. It is concluded that CBO has improvement effect on testicular oxidant-antioxidant balance and sperm quality, and its consumption may be useful for asthenozoospermic men.

  3. Pre-B-cell colony-enhancing factor protects against apoptotic neuronal death and mitochondrial damage in ischemia

    PubMed Central

    Wang, Xiaowan; Li, Hailong; Ding, Shinghua

    2016-01-01

    We previously demonstrated that Pre-B-cell colony-enhancing factor (PBEF), also known as nicotinamide phosphoribosyltransferase (NAMPT), the rate-limiting enzyme in mammalian NAD+ biosynthesis pathway, plays a brain and neuronal protective role in ischemic stroke. In this study, we further investigated the mechanism of its neuroprotective effect after ischemia in the primary cultured mouse cortical neurons. Using apoptotic cell death assay, fluorescent imaging, molecular biology, mitochondrial biogenesis measurements and Western blotting analysis, our results show that the overexpression of PBEF in neurons can significantly promote neuronal survival, reduce the translocation of apoptosis inducing factor (AIF) from mitochondria to nuclei and inhibit the activation of capase-3 after glutamate-induced excitotoxicity. We further found that the overexpression of PBEF can suppress glutamate-induced mitochondrial fragmentation, the loss of mitochondrial DNA (mtDNA) content and the reduction of PGC-1 and NRF-1 expressions. Furthermore, these beneficial effects by PBEF are dependent on its enzymatic activity of NAD+ synthesis. In summary, our study demonstrated that PBEF ameliorates ischemia-induced neuronal death through inhibiting caspase-dependent and independent apoptotic signaling pathways and suppressing mitochondrial damage and dysfunction. Our study provides novel insights into the mechanisms underlying the neuroprotective effect of PBEF, and helps to identify potential targets for ischemic stroke therapy. PMID:27576732

  4. Pre-B-cell colony-enhancing factor protects against apoptotic neuronal death and mitochondrial damage in ischemia.

    PubMed

    Wang, Xiaowan; Li, Hailong; Ding, Shinghua

    2016-01-01

    We previously demonstrated that Pre-B-cell colony-enhancing factor (PBEF), also known as nicotinamide phosphoribosyltransferase (NAMPT), the rate-limiting enzyme in mammalian NAD(+) biosynthesis pathway, plays a brain and neuronal protective role in ischemic stroke. In this study, we further investigated the mechanism of its neuroprotective effect after ischemia in the primary cultured mouse cortical neurons. Using apoptotic cell death assay, fluorescent imaging, molecular biology, mitochondrial biogenesis measurements and Western blotting analysis, our results show that the overexpression of PBEF in neurons can significantly promote neuronal survival, reduce the translocation of apoptosis inducing factor (AIF) from mitochondria to nuclei and inhibit the activation of capase-3 after glutamate-induced excitotoxicity. We further found that the overexpression of PBEF can suppress glutamate-induced mitochondrial fragmentation, the loss of mitochondrial DNA (mtDNA) content and the reduction of PGC-1 and NRF-1 expressions. Furthermore, these beneficial effects by PBEF are dependent on its enzymatic activity of NAD(+) synthesis. In summary, our study demonstrated that PBEF ameliorates ischemia-induced neuronal death through inhibiting caspase-dependent and independent apoptotic signaling pathways and suppressing mitochondrial damage and dysfunction. Our study provides novel insights into the mechanisms underlying the neuroprotective effect of PBEF, and helps to identify potential targets for ischemic stroke therapy. PMID:27576732

  5. The ubiquitin-editing protein A20 prevents dendritic cell activation, recognition of apoptotic cells, and systemic autoimmunity.

    PubMed

    Kool, Mirjam; van Loo, Geert; Waelput, Wim; De Prijck, Sofie; Muskens, Femke; Sze, Mozes; van Praet, Jens; Branco-Madeira, Filipe; Janssens, Sophie; Reizis, Boris; Elewaut, Dirk; Beyaert, Rudi; Hammad, Hamida; Lambrecht, Bart N

    2011-07-22

    Dendritic cells (DCs) regulate both immunity and tolerance. Here we have shown that the ubiquitin editing enzyme A20 (Tnfaip3) determines the activation threshold of DCs, via control of canonical NF-κB activation. Tnfaip3(fl/fl)Cd11c-cre(+) mice lacking A20 in DCs demonstrated spontaneous proliferation of conventional and double-negative T cells, their conversion to interferon-γ (IFN-γ)-producing effector cells, and expansion of plasma cells. They developed ds-DNA antibodies, nephritis, the antiphospholipid syndrome, and lymphosplenomegaly-features of systemic lupus erythematosus-and extramedullary hematopoiesis. A20-deficient DCs were resistant to apoptosis, caused by increased sensitivity to CD40L and RANKL prosurvival signals and upregulation of antiapoptotic proteins Bcl-2 and Bcl-x. They captured injected apoptotic cells more efficiently, resisted the inhibitory effects of apoptotic cells, and induced self-reactive effector lymphocytes. Because genetic polymorphisms in TNFAIP3 are associated with human autoimmune disorders, these findings identify A20-mediated control of DC activation as a crucial checkpoint in the development of systemic autoimmunity.

  6. Chromatin-independent binding of serum amyloid P component to apoptotic cells.

    PubMed

    Familian, A; Zwart, B; Huisman, H G; Rensink, I; Roem, D; Hordijk, P L; Aarden, L A; Hack, C E

    2001-07-15

    Human serum amyloid P component (SAP) is a glycoprotein structurally belonging to the pentraxin family of proteins, which has a characteristic pentameric organization. Mice with a targeted deletion of the SAP gene develop antinuclear Abs, which was interpreted as evidence for a role of SAP in controlling the degradation of chromatin. However, in vitro SAP also can bind to phosphatidylethanolamine, a phospholipid which in normal cells is located mainly in the inner leaflet of the cell membrane, to be translocated to the outer leaflet of the cell membrane during a membrane flip-flop. We hypothesized that SAP, because of its specificity for phosphatidylethanolamine, may bind to apoptotic cells independent of its nuclear binding. Calcium-dependent binding of SAP to early, nonpermeable apoptotic Jurkat, SKW, and Raji cells was indeed observed. Experiments with flip-flopped erythrocytes confirmed that SAP bound to early apoptotic cells via exposed phosphatidylethanolamine. Binding of SAP was stronger to late, permeable apoptotic cells. Experiments with enucleated neutrophils, with DNase/RNase treatment of late apoptotic Jurkat cells, and competition experiments with histones suggested that binding of SAP to late apoptotic cells was largely independent of chromatin. Confocal laser microscopic studies indeed suggested that SAP bound to these apoptotic cells mainly via the blebs. Thus, this study shows that SAP binds to apoptotic cells already at an early stage, which raises the possibility that SAP is involved in dealing with apoptotic cells in vivo.

  7. A novel system enhancing the endosomal escapes of peptides promotes Bak BH3 peptide inducing apoptosis in lung cancer A549 cells.

    PubMed

    Lin, Nanjing; Zheng, Wenyun; Li, Linfeng; Liu, Hui; Wang, Tianwen; Wang, Ping; Ma, Xingyuan

    2014-06-01

    Therapeutic peptides have been proven useful for treating various diseases. However, it is difficult for therapeutic peptides to reach their target sites with an effective concentration due to inefficient intracellular delivery. Although Tat transduction peptide is a promising tool to deliver therapeutic peptides into cells, the entrapment within endosomes and the nuclear localization of Tat transduction peptide severely limited the biological effects of Tat-linked cargos. In this study, we designed a novel peptide delivering system, Tat-INF7-ubiquitin (TIU), which consisted of Tat transduction peptide, endosomal escape enhancer peptide INF7, and ubiquitin protein. We found that the TIU system was able to efficiently deliver the mCherry fluorescent proteins and the apoptosis-inducing Bak BH3 peptide into the cytosol. The Bak BH3 peptide transported into the cells by the TIU system increased the apoptotic rate to 46.15 ± 4.86% (p < 0.001) in A549 cells, while Tat-BH3 could result in only 20.45 ± 2.89%. These results demonstrated that the TIU system could enhance the effects of therapeutic peptides by facilitating the transmembrane delivery of peptides into the cells and the escape of target proteins from the endosome efficiently.

  8. Biocatalytic Single Enzyme Nanoparticles

    SciTech Connect

    Grate, Jay W.; Kim, Jungbae

    2004-03-31

    As an innovative way of enzyme stabilization, we recently developed a new enzyme composite of nano-meter scale that we call "single-enzyme nanoparticles (SENs)" (9). Each enzyme molecule is surrounded with a porous composite organic/inorganic network of less than a few nanometers think. This approach represents a new type of enzyme-containing nanostructure. In experiments with perotease (chymotrypsin, CT), the activity of single enzyme nanoparticle form of the enzyme was greatly stabilized compared to the free form, without imposing a serious mass transfer limitation of substrates. In this chapter we will describe the synthesis, characterization and catalytic activity of the new SENs.

  9. Autoimmunity as a result of escape from RNA surveillance.

    PubMed

    Bachmann, Michael P; Bartsch, Holger; Gross, Joanne K; Maier, Shannon M; Gross, Timothy F; Workman, Jennifer L; James, Judith A; Farris, A Darise; Jung, Bettina; Franke, Claudia; Conrad, Karsten; Schmitz, Marc; Büttner, Cordula; Buyon, Jill P; Semsei, Imre; Harley, John B; Rieber, E Peter

    2006-08-01

    In previous studies, we detected a frame shift mutation in the gene encoding the autoantigen La of a patient with systemic lupus erythematosus. The mutant La mRNA contains a premature termination codon. mRNAs that prematurely terminate translation should be eliminated by RNA quality control mechanisms. As we find Abs specific for the mutant La form in approximately 30% of sera from anti-La-positive patients, we expected that mutant La mRNAs circumvent RNA control and the expression of mutant La protein could become harmful. Indeed, real-time PCR, immunostaining, and immunoblotting data of mice transgenic for the mutant La form show that mutant La mRNAs are not repressed in these animals and are translated to mutant La protein. In addition to the mutant La protein, we detected a minor portion of native human La in the mutant La-transgenic mice. Therefore, ribosomal frame shifting may allow the mutant La mRNA to escape from RNA control. Interestingly, expression of the mutant La mRNA results in a lupus-like disease in the experimental mice. Consequently, escape of mutant La mRNA from RNA control can have two effects: it 1) results in the expression of an immunogenic (neo)epitope, and 2) predisposes to autoimmunity. PMID:16849479

  10. Autoimmunity as a Result of Escape from RNA Surveillance

    PubMed Central

    Bachmann, Michael P.; Bartsch, Holger; Gross, Joanne K.; Maier, Shannon M.; Gross, Timothy F.; Workman, Jennifer L.; James, Judith A.; Farris, A. Darise; Jung, Bettina; Franke, Claudia; Conrad, Karsten; Schmitz, Marc; Büttner, Cordula; Buyon, Jill P.; Semsei, Imre; Harley, John B.; Rieber, E. Peter

    2006-01-01

    In previous studies we detected a frame shift mutation in the gene encoding the autoantigen La of a patient with systemic lupus erythematosus. The mutant La mRNA contains a premature termination codon. mRNAs that prematurely terminate translation should be eliminated by RNA quality control mechanisms. As we find Abs specific for the mutant La form in about 30% of sera from anti-La positive patients we expected that mutant La mRNAs circumvent RNA control and the expression of mutant La protein could become harmful. Indeed, realtime PCR, immunostaining, and immunoblotting data of mice transgenic for the mutant La form show that mutant La mRNAs are not repressed in these animals and are translated to mutant La protein. In addition to the mutant La protein, we detected a minor portion of native human La in the mutant La transgenic mice. Therefore, ribosomal frame shifting may allow the mutant La mRNA to escape from RNA control. Interestingly, expression of the mutant La mRNA results in a lupus like disease in the experimental mice. Consequently, escape of mutant La mRNA from RNA control can have two effects: It (i) results in the expression of an immunogenic (neo)epitope, and (ii) predisposes to autoimmunity. PMID:16849479

  11. Group chase and escape model with chasers' interaction

    NASA Astrophysics Data System (ADS)

    Saito, Takuya; Nakamura, Tomomichi; Ohira, Toru

    2016-04-01

    Group chase and escape is a new direction of studying collective behaviors merged with the traditional mathematical problems of chases and escapes proposed by Kamimura and Ohira in 2010. In their model, the chasers recognize only the escapees and pursue the nearest neighbor escapee, and the escapees recognize only the chasers and flee from the nearest neighbor chaser. We call the basic moving rule the nearest opponent interaction (NOI) strategy. In this paper we introduce a new strategy in the model. It is a local interaction that the chasers do not get too close each other, where we call the chasers' local interaction (CLI) strategy. The result of comparisons of the two strategies shows that when the number of the chasers is relatively small compared to the number of the escapees, the trapping time by the CLI strategy is much shorter than that by the NOI strategy. On the other hand, when the number of the chasers is larger than that of the escapees, this advantage of the CLI strategy does not appear. Also, we find that although chasers form clusters (spatial aggregates of chasers) when we apply the NOI strategy, the clusters appear less when we apply the CLI strategy.

  12. Escape of Hydrogen from the Exosphere of Mars

    NASA Astrophysics Data System (ADS)

    Bhattacharyya, Dolon; Clarke, John T.; Bertaux, Jean-Loup; Chaufray, Jean-Yves; Mayyasi-Matta, Majd A.

    2016-10-01

    After decades of exploration, the martian neutral hydrogen exosphere has remained largely uncharacterized even today. In my dissertation I have attempted to constrain the characteristics of the martian hydrogen exosphere using Hubble Space Telescope observations obtained during October-November 2007 and 2014. These observations reveal short-term seasonal changes exhibited by the martian hydrogen exosphere that are inconsistent with the diffusion-limited escape scenario. This seasonal behavior adds a new element towards backtracking the history of water loss from Mars. Modeling of the data also indicates the likely presence of a superthermal population of hydrogen created by non-thermal processes at Mars, another key element to understand the present-day escape. Exploration of the latitudinal symmetry of the martian exosphere indicates that it is symmetric above 2.5 martian radii and asymmetric below this altitude, which could be due to temperature differences between the day and night sides. Finally, the large uncertainties in determining the characteristics of the martian exosphere after decades of exploration is due to various assumptions about the intrinsic characteristics of the martian exosphere in the modeling process, degeneracy in the two modeling parameters temperature and density of the hydrogen atoms, unaccounted seasonal effects, and uncertainties introduced from spacecraft instrumentation as well as their viewing geometry.

  13. Ultra-fast Escape of a Octopus-inspired Rocket

    NASA Astrophysics Data System (ADS)

    Weymouth, Gabriel; Triantafyllou, Michael

    2013-11-01

    The octopus, squid, and other cephalopods inflate with water and then release a jet to accelerate in the opposite direction. This escape mechanism is particularly interesting in the octopus because they become initially quite bluff, yet this does not hinder them in achieving impressive bursts of speed. We examine this somewhat paradoxical maneuver using a simple deflating spheroid model in both potential and viscous flow. We demonstrate that the dynamic reduction of the width of the body completely changes the flow and forces acting on the escaping rocket in three ways. First, a body which reduces in size can generate an added mass thrust which counteracts the added mass inertia. Second, the motion of the shrinking wall acts similar to suction on a static wall, reducing separation and drag forces in a viscous fluid, but that this effects depends on the rate of size change. Third, using a combination of these two features it is possible to initially load the fluid with kinetic energy when heavy and bluff and then recover that energy when streamlined and light, enabling ultra-fast accelerations. As a notable example, these mechanisms allow a shrinking spheroid rocket in a heavy inviscid fluid to achieve speeds greater than an identical rocket in the vacuum of space. Southampton Marine and Maritime Institute.

  14. Quantification of Nociceptive Escape Response in C.elegans

    NASA Astrophysics Data System (ADS)

    Leung, Kawai; Mohammadi, Aylia; Ryu, William; Nemenman, Ilya

    2013-03-01

    Animals cannot rank and communicate their pain consciously. Thus in pain studies on animal models, one must infer the pain level from high precision experimental characterization of behavior. This is not trivial since behaviors are very complex and multidimensional. Here we explore the feasibility of C.elegans as a model for pain transduction. The nematode has a robust neurally mediated noxious escape response, which we show to be partially decoupled from other sensory behaviors. We develop a nociceptive behavioral response assay that allows us to apply controlled levels of pain by locally heating worms with an IR laser. The worms' motions are captured by machine vision programming with high spatiotemporal resolution. The resulting behavioral quantification allows us to build a statistical model for inference of the experienced pain level from the behavioral response. Based on the measured nociceptive escape of over 400 worms, we conclude that none of the simple characteristics of the response are reliable indicators of the laser pulse strength. Nonetheless, a more reliable statistical inference of the pain stimulus level from the measured behavior is possible based on a complexity-controlled regression model that takes into account the entire worm behavioral output. This work was partially supported by NSF grant No. IOS/1208126 and HFSP grant No. RGY0084/2011.

  15. Magnetic buoyancy and the escape of magnetic fields from stars

    NASA Technical Reports Server (NTRS)

    Parker, E. N.

    1984-01-01

    A loss of magnetic flux through the free surface of a star into the surrounding space has important implications for the generation of the field within the star. The present investigation is concerned with the physics of the escape of net azimuthal flux from a star. The obtained results are used as a basis for the interpretation of some recent observations of the detailed behavior of magnetic fields emerging through the surface of the sun. The buoyancy of an isolated horizontal magnetic flux tube beneath the surface of a star causes the tube to rise at a rate comparable to the Alfven speed. The necessary conditions for escape of the flux are considered along with aspects of magnetic buoyancy, and the conditions on the sun. It appears that the observed retraction of bipolar magnetic fields at the end of their life at the surface is the one phenomenon which requires dynamical intervention. Attention is given to known dynamical effects which suppress the buoyant rise of an azimuthal magnetic field.

  16. On the escape of pollutants from urban street canyons

    NASA Astrophysics Data System (ADS)

    Baik, Jong-Jin; Kim, Jae-Jin

    Pollutant transport from urban street canyons is numerically investigated using a two-dimensional flow and dispersion model. The ambient wind blows perpendicular to the street and passive pollutants are released at the street level. Results from the control experiment with a street aspect ratio of 1 show that at the roof level of the street canyon, the vertical turbulent flux of pollutants is upward everywhere and the vertical flux of pollutants by mean flow is upward or downward. The horizontally integrated vertical flux of pollutants by mean flow at the roof level of the street canyon is downward and its magnitude is much smaller than that by turbulent process. These results indicate that pollutants escape from the street canyon mainly by turbulent process and that the net effect of mean flow is to make some escaped pollutants reenter the street canyon. Further experiments with different inflow turbulence intensities, inflow wind speeds, and street aspect ratio confirm the findings from the control experiment. In the case of two isolated buildings, the horizontally integrated vertical flux of pollutants by mean flow is upward due to flow separation but the other main results are the same as those from the control experiment.

  17. FEM analysis of escape capsule suffered to gas explosion

    NASA Astrophysics Data System (ADS)

    Li, Chang-lu; Mei, Rui-bin; Li, Chang-sheng; Cai, Ban; Liu, Xiang-hua

    2013-05-01

    Escape capsules are new devices for underground coal mines that provide air, water, food and supplies in the event of an emergency in where miners are unable to escape. It is difficult to carry out the experiments of explosion and safety because the danger and nonrepeatability of explosion. The structure deformation and distribution of equivalent stress has been investigated under different impact pressure conditions including unimodal and bimodal loads based on the FEM and software LS-DYNA. The results show that the distribution of deformation and equivalent stress has the same trend on the same surface with the increment of explosion pressure. The deformation and stress are larger with side impact pressure compared with that of the same front impact pressure. Furthermore, the maximum equivalent stress is 246MPa and 260MPa on the front and sides of capsule with five times for national standard impact pressure 1.5MPa. Under these conditions, the deformation is less than about 9.97mm and 10.47mm, respectively. When the front impact pressure is 2.0MPa, the deformation of capsule still belongs to elasticity but the less plastic deformation occurs on the Ushape stiffening channels with the same side impact pressure. However, it is safe for capsule structure because the equivalent stress 283MPa is much less than the tensile strength. It is noted that bimodal load accelerates the capsule deformation so that it is more dangerous compared with unimodal load.

  18. Numerical simulation of a self-propelled copepod during escape

    NASA Astrophysics Data System (ADS)

    Sotiropoulos, Fotis; Borazjani, Iman; Malkiel, Edwin; Katz, Josef

    2008-11-01

    Obtaining the 3D flow field, forces, and power is essential for understanding the high accelerations of a copepod during the escap. We carry out numerical simulations to study a free swimming copepod using the sharp-interface immersed boundary, fluid-structure interaction (FSI) approach of Borazjani et al. (J Compu Phys, 2008, 227, p 7587-7620). We use our previous tethered copepod model with a realistic copepod-like body, including all the appendages with the appendages motion prescribed from high-resolution, cinematic dual digital holography. The simulations are performed in a frame of reference attached to the copepod whose velocity is calculated by considering the forces acting on the copepod. The self-propelled simulations are challenging due to the destabilizing effects of the large added mass resulting from the low copepod mass and fast acceleration during the escape. Strongly-coupled FSI with under-relaxation and the Aitken acceleration technique is used to obtain stable and robust FSI iterations. The computed results for the self-propelled model are analyzed and compared with our earlier results for the tethered model.

  19. Formation and Internal Structure of Terrestrial Planets, and Atmospheric Escape

    NASA Astrophysics Data System (ADS)

    Jin, S.

    2014-11-01

    As of 2014 April 21, over 1490 confirmed exoplanets and 3705 Kepler candidates have been detected. This implies that exoplanets may be ubiquitous in the universe. In this paper, we focus on the formation, evolution, and internal structure of terrestrial planets, and the atmospheric escape of close-in planets. In chapter 2, we investigate the dynamical evolution of planetary system after the protoplanetary disk has dissipated. We find that in the final assembly stage, the occurrence of terrestrial planets is quite common and in 40% of our simulations finally at least one planet is formed in the habitable zone. We also find that if there is a highly-inclined giant planet in the system, a great many bodies will be either driven out of the system, or collide with the giant planet or the central star. This will lead to the difficulty in planetary accretion. Moreover, our results show that planetary migration can lead to the formation of close-in planets. Besides migration, close-in terrestrial planets can also be formed by a collision-merger mechanism, which means that planetary embryos can kick terrestrial planets directly into orbits that are extremely close to their parent stars. In chapter 3, we construct numerically an internal structure model for terrestrial planets, and provide three kinds of possible internal structures of Europa (Jupiter's moon) based on this model. Then, we calculate the radii of low-mass exoplanets for various mass combinations of core and mantle, and find that some of them are inconsistent with the observed radius of rocky planets. This phenomenon can be explained only if there exists a large amount of water in the core, or they own gaseous envelopes. In chapter 4, we improve our planetary evolution codes using the semi-gray model of Guillot (2010), which includes the incident flux from the host star as a heating source in planetary atmosphere. The updated codes can solve the structure of the top radiative zone of intensely irradiated

  20. Myotonic dystrophy protein kinase (DMPK) induces actin cytoskeletal reorganization and apoptotic-like blebbing in lens cells

    NASA Technical Reports Server (NTRS)

    Jin, S.; Shimizu, M.; Balasubramanyam, A.; Epstein, H. F.

    2000-01-01

    DMPK, the product of the DM locus, is a member of the same family of serine-threonine protein kinases as the Rho-associated enzymes. In DM, membrane inclusions accumulate in lens fiber cells producing cataracts. Overexpression of DMPK in cultured lens epithelial cells led to apoptotic-like blebbing of the plasma membrane and reorganization of the actin cytoskeleton. Enzymatically active DMPK was necessary for both effects; inactive mutant DMPK protein did not produce either effect. Active RhoA but not constitutive GDP-state mutant protein produced similar effects as DMPK. The similar actions of DMPK and RhoA suggest that they may function in the same regulatory network. The observed effects of DMPK may be relevant to the removal of membrane organelles during normal lens differentiation and the retention of intracellular membranes in DM lenses. Copyright 2000 Wiley-Liss, Inc.

  1. Involvement of caspase-12-dependent apoptotic pathway in ionic radiocontrast urografin-induced renal tubular cell injury

    SciTech Connect

    Wu, Cheng Tien; Weng, Te I.; Chen, Li Ping; Chiang, Chih Kang; Liu, Shing Hwa

    2013-01-01

    Contrast medium (CM) induces a direct toxic effect on renal tubular cells. This toxic effect subjects in the disorder of CM-induced nephropathy. Our previous work has demonstrated that CM shows to activate the endoplasmic reticulum (ER)-related adaptive unfolding protein response (UPR) activators. Glucose-regulated protein 78 (GRP78)/eukaryotic initiation factor 2α (eIF2α)-related pathways play a protective role during the urografin (an ionic CM)-induced renal tubular injury. However, the involvement of ER stress-related apoptotic signals in the urografin-induced renal tubular cell injury remains unclear. Here, we examined by the in vivo and in vitro experiments to explore whether ER stress-regulated pro-apoptotic activators participate in urografin-induced renal injury. Urografin induced renal tubular dilation, tubular cells detachment, and necrosis in the kidneys of rats. The tubular apoptosis, ER stress-related pro-apoptotic transcriptional factors, and kidney injury marker-1 (kim-1) were also conspicuously up-regulated in urografin-treated rats. Furthermore, treatment of normal rat kidney (NRK)-52E tubular cells with urografin augmented the expressions of activating transcription factor-6 (ATF-6), C/EBP homologous protein (CHOP), Bax, caspase-12, JNK, and inositol-requiring enzyme (IRE) 1 signals. Urografin-induced renal tubular cell apoptosis was not reversed by the inhibitors of ATF-6, JNK signals or CHOP siRNA transfection, but it could be partially reversed by the inhibitor of caspase-12. Taken together, the present results and our previous findings suggest that exposure of CM/urografin activates the ER stress-regulated survival- and apoptosis-related signaling pathways in renal tubular cells. Caspase-12-dependent apoptotic pathway may be partially involved in the urografin-induced nephropathy. -- Highlights: ► Ionic contrast medium-urografin induces renal tubular cell apoptosis. ► Urografin induces the ER stress-regulated survival and apoptosis

  2. Apoptotic pathway induced by diallyl trisulfide in pancreatic cancer cells

    PubMed Central

    Ma, Hong-Bing; Huang, Shan; Yin, Xiao-Ran; Zhang, Yang; Di, Zheng-Li

    2014-01-01

    AIM: To investigate the effects of diallyl trisulfide (DATS), a garlic-derived organosulfur compound, in pancreatic cancer cells. METHODS: Human pancreatic cancer cells with wild-type p53 gene (Capan-2) and normal pancreatic epithelial cells (H6C7) were cultured in RPMI1640. DATS was prepared at a concentration of 100 μmol/L. Cell viability was determined via the methyl thiazolyl tetrazolium assay. Apoptotic cells were detected by TUNEL assay. Cell cycle analysis was performed using flow cytometry. Protein expression was determined by Western blot. Bax and Bcl-2 expression was detected by immunofluorescence. Apoptosis genes and cell cycle were assessed by quantitative real-time polymerase chain reaction. RESULTS: DATS suppressed the viability of cultured human pancreatic cancer cells (Capan-2) by increasing the proportion of cells in the G2/M phase and induced apoptotic cell death. Western blot analysis indicated that DATS enhanced the expression of Fas, p21, p53 and cyclin B1, but downregulated the expression of Akt, cyclin D1, MDM2 and Bcl-2. DATS induced cell cycle inhibition which was correlated with elevated levels of cyclin B1 and p21, and reduced levels of cyclin D1 in Capan-2 cells and H6C7 cells. DATS-induced apoptosis was markedly elevated in Capan-2 cells compared with H6C7 cells, and this was correlated with elevated levels of cyclin B1 and p53, and reduced levels of Bcl-2. DATS-induced apoptosis was correlated with down-regulation of Bcl-2, Akt and cyclin D1 protein levels, and up-regulation of Bax, Fas, p53 and cyclin B protein levels in Capan-2 cells. CONCLUSION: DATS induces apoptosis of pancreatic cancer cells (Capan-2) and non-tumorigenic pancreatic ductal epithelial cells (H6C7). PMID:24415872

  3. Role of apoptotic hepatocytes in HCV dissemination: regulation by acetaldehyde.

    PubMed

    Ganesan, Murali; Natarajan, Sathish Kumar; Zhang, Jinjin; Mott, Justin L; Poluektova, Larisa I; McVicker, Benita L; Kharbanda, Kusum K; Tuma, Dean J; Osna, Natalia A

    2016-06-01

    Alcohol consumption exacerbates hepatitis C virus (HCV) pathogenesis and promotes disease progression, although the mechanisms are not quite clear. We have previously observed that acetaldehyde (Ach) continuously produced by the acetaldehyde-generating system (AGS), temporarily enhanced HCV RNA levels, followed by a decrease to normal or lower levels, which corresponded to apoptosis induction. Here, we studied whether Ach-induced apoptosis caused depletion of HCV-infected cells and what role apoptotic bodies (AB) play in HCV-alcohol crosstalk. In liver cells exposed to AGS, we observed the induction of miR-122 and miR-34a. As miR-34a has been associated with apoptotic signaling and miR-122 with HCV replication, these findings may suggest that cells with intensive viral replication undergo apoptosis. Furthermore, when AGS-induced apoptosis was blocked by a pan-caspase inhibitor, the expression of HCV RNA was not changed. AB from HCV-infected cells contained HCV core protein and the assembled HCV particle that infect intact hepatocytes, thereby promoting the spread of infection. In addition, AB are captured by macrophages to switch their cytokine profile to the proinflammatory one. Macrophages exposed to HCV(+) AB expressed more IL-1β, IL-18, IL-6, and IL-10 mRNAs compared with those exposed to HCV(-) AB. The generation of AB from AGS-treated HCV-infected cells even enhanced the induction of aforementioned cytokines. We conclude that HCV and alcohol metabolites trigger the formation of AB containing HCV particles. The consequent spread of HCV to neighboring hepatocytes via infected AB, as well as the induction of liver inflammation by AB-mediated macrophage activation potentially exacerbate the HCV infection course by alcohol and worsen disease progression. PMID:27056722

  4. In vitro apoptotic cell death during erythroid differentiation.

    PubMed

    Zamai, L; Burattini, S; Luchetti, F; Canonico, B; Ferri, P; Melloni, E; Gonelli, A; Guidotti, L; Papa, S; Falcieri, E

    2004-03-01

    Erythropoiesis occurs in bone marrow and it has been shown that during in vivo erythroid differentiation some immature erythroblasts undergo apoptosis. In this regard, it is known that immature erythroblasts are FasL- and TRAIL-sensitive and can be killed by cells expressing these ligand molecules. In the present study, we have investigated the cell death phenomenon that occurs during a common unilineage model of erythroid development. Purified CD34+ human haemopoietic progenitors were cultured in vitro in the presence of SCF, IL-3 and erythropoietin. Their differentiation stages and apoptosis were followed by multiple technical approaches. Flow cytometric evaluation of surface and intracellular molecules revealed that glycophorin A appeared at day 3-4 of incubation and about 75% of viable cells co-expressed high density glycophorin A (Gly(bright)) and adult haemoglobin at day 14 of culture, indicating that this system reasonably recapitulates in vivo normal erythropoiesis. Interestingly, when mature (Gly(bright)) erythroid cells reached their higher percentages (day 14) almost half of cultured cells were apoptotic. Morphological studies indicated that the majority of dead cells contained cytoplasmic granular material typical of basophilic stage, and DNA analysis by flow cytometry and TUNEL reaction revealed nuclear fragmentation. These observations indicate that in vitro unilineage erythroid differentiation, as in vivo, is associated with apoptotic cell death of cells with characteristics of basophilic erythroblasts. We suggest that the interactions between different death receptors on immature basophilic erythroblasts with their ligands on more mature erythroblasts may contribute to induce apoptosis in vitro. PMID:15004520

  5. Increased synthesis and release of atrial peptide during DOCA escape in conscious dogs

    SciTech Connect

    Metzler, C.H.; Gardner, D.G.; Keil, L.C.; Baxter, J.D.; Ramsay, D.J.

    1987-01-01

    The escape from the sodium-retaining effects of prolonged mineralocorticoid treatment in animals and humans was first noted over 40 yr ago, but despite intense study the mechanisms responsible for the escape phenomenon have not been identified. Putative natriuretic hormones have been proposed to account for the escape phenomenon. To determine whether atrial natriuretic peptides (ANP) could participate in the escape phenomenon, the mineralocorticoid deoxycorticosterone acetate (DOCA) was administered to conscious dogs for 14 days. Escape was accompanied by a doubling of plasma ANP concentration, determined by radioimmunoassay, and four- to sevenfold increases in caridac ANP messenger RNA. There were also significant increases in mean arterial blood pressure during the last 8 days of DOCA treatment. Thus increases in the synthesis and secretion of ANP and increases in atrial pressure may represent mechanisms that contribute to the escape from mineralocorticoid-induced sodium retention.

  6. Characterization of escape times of Josephson junctions for signal detection.

    PubMed

    Addesso, Paolo; Filatrella, Giovanni; Pierro, Vincenzo

    2012-01-01

    The measurement of the escape time of a Josephson junction might be used to detect the presence of a sinusoidal signal embedded in noise when use of standard signal processing tools can be prohibitive due to the extreme weakness of the source or to the huge amount of data. In this paper we show that the prescriptions for the experimental setup and some physical behaviors depend on the detection strategy. More specifically, by exploitation of the sample mean of escape times to perform detection, two resonant regions are identified. At low frequencies there is a stochastic resonance or activation phenomenon, while near the plasma frequency a geometric resonance appears. Furthermore, detection performance in the geometric resonance region is maximized at the prescribed value of the bias current. The naive sample mean detector is outperformed, in terms of error probability, by the optimal likelihood ratio test. The latter exhibits only geometric resonance, showing monotonically increasing performance as the bias current approaches the junction critical current. In this regime the escape times are vanishingly small and therefore performance is essentially limited by measurement electronics. The behavior of the likelihood ratio and sample mean detector for different values of incoming signal to noise ratio is discussed, and a relationship with the error probability is found. Detectors based on the likelihood ratio test could be employed also to estimate unknown parameters in the applied input signal. As a prototypical example we study the phase estimation problem of a sinusoidal current, which is accomplished by using the filter bank approach. Finally we show that for a physically feasible detector the performances are found to be very close to the Cramer-Rao theoretical bound. Applications might be found, for example, in some astronomical detection problems (where the all-sky gravitational and/or radio wave search for pulsars requires the analysis of nearly sinusoidal

  7. Characterization of escape times of Josephson junctions for signal detection

    NASA Astrophysics Data System (ADS)

    Addesso, Paolo; Filatrella, Giovanni; Pierro, Vincenzo

    2012-01-01

    The measurement of the escape time of a Josephson junction might be used to detect the presence of a sinusoidal signal embedded in noise when use of standard signal processing tools can be prohibitive due to the extreme weakness of the source or to the huge amount of data. In this paper we show that the prescriptions for the experimental setup and some physical behaviors depend on the detection strategy. More specifically, by exploitation of the sample mean of escape times to perform detection, two resonant regions are identified. At low frequencies there is a stochastic resonance or activation phenomenon, while near the plasma frequency a geometric resonance appears. Furthermore, detection performance in the geometric resonance region is maximized at the prescribed value of the bias current. The naive sample mean detector is outperformed, in terms of error probability, by the optimal likelihood ratio test. The latter exhibits only geometric resonance, showing monotonically increasing performance as the bias current approaches the junction critical current. In this regime the escape times are vanishingly small and therefore performance is essentially limited by measurement electronics. The behavior of the likelihood ratio and sample mean detector for different values of incoming signal to noise ratio is discussed, and a relationship with the error probability is found. Detectors based on the likelihood ratio test could be employed also to estimate unknown parameters in the applied input signal. As a prototypical example we study the phase estimation problem of a sinusoidal current, which is accomplished by using the filter bank approach. Finally we show that for a physically feasible detector the performances are found to be very close to the Cramer-Rao theoretical bound. Applications might be found, for example, in some astronomical detection problems (where the all-sky gravitational and/or radio wave search for pulsars requires the analysis of nearly sinusoidal

  8. Characterization of escape times of Josephson junctions for signal detection.

    PubMed

    Addesso, Paolo; Filatrella, Giovanni; Pierro, Vincenzo

    2012-01-01

    The measurement of the escape time of a Josephson junction might be used to detect the presence of a sinusoidal signal embedded in noise when use of standard signal processing tools can be prohibitive due to the extreme weakness of the source or to the huge amount of data. In this paper we show that the prescriptions for the experimental setup and some physical behaviors depend on the detection strategy. More specifically, by exploitation of the sample mean of escape times to perform detection, two resonant regions are identified. At low frequencies there is a stochastic resonance or activation phenomenon, while near the plasma frequency a geometric resonance appears. Furthermore, detection performance in the geometric resonance region is maximized at the prescribed value of the bias current. The naive sample mean detector is outperformed, in terms of error probability, by the optimal likelihood ratio test. The latter exhibits only geometric resonance, showing monotonically increasing performance as the bias current approaches the junction critical current. In this regime the escape times are vanishingly small and therefore performance is essentially limited by measurement electronics. The behavior of the likelihood ratio and sample mean detector for different values of incoming signal to noise ratio is discussed, and a relationship with the error probability is found. Detectors based on the likelihood ratio test could be employed also to estimate unknown parameters in the applied input signal. As a prototypical example we study the phase estimation problem of a sinusoidal current, which is accomplished by using the filter bank approach. Finally we show that for a physically feasible detector the performances are found to be very close to the Cramer-Rao theoretical bound. Applications might be found, for example, in some astronomical detection problems (where the all-sky gravitational and/or radio wave search for pulsars requires the analysis of nearly sinusoidal

  9. Insolubilization process increases enzyme stability

    NASA Technical Reports Server (NTRS)

    Billingham, J.; Lyn, J.

    1971-01-01

    Enzymes complexed with polymeric matrices contain properties suggesting application to enzyme-controlled reactions. Stability of insolubilized enzyme derivatives is markedly greater than that of soluble enzymes and physical form of insolubilized enzymes is useful in column and batch processes.

  10. Escape through a time-dependent hole in the doubling map

    NASA Astrophysics Data System (ADS)

    Livorati, André L. P.; Georgiou, Orestis; Dettmann, Carl P.; Leonel, Edson D.

    2014-05-01

    We investigate the escape dynamics of the doubling map with a time-periodic hole. Ulam's method was used to calculate the escape rate as a function of the control parameters. We consider two cases, oscillating or breathing holes, where the sides of the hole are moving in or out of phase respectively. We find out that the escape rate is well described by the overlap of the hole with its images, for holes centered at periodic orbits.

  11. Dynamic process of phagocytosis and forms of macrophage cell death induced by ingestion of apoptotic neutrophils.

    PubMed

    Wang, Jiong; Huang, WeiLin; Wang, Cheng; Liu, RongYu

    2014-10-01

    Clearance of apoptotic neutrophils by macrophages is important for both the successful resolution of acute inflammation and homeostasis. However, the dynamic process of phagocytosis of apoptotic neutrophils by macrophages and the fate of macrophages after the ingestion of apoptotic neutrophils has not been well documented. In the present study, we staged the recognition and tethering, internalization, digestion and exocytosis steps of phagocytosis of apoptotic neutrophils. Furthermore, we found that after the ingestion of apoptotic cells, a subset of macrophages underwent cell death by autophagy, apoptosis or oncosis as revealed by transmission electron microscopy and confocal microscopy combined with specific dyes. The percentage of autophagic, apoptotic and oncotic macrophages were 8.00%±2.00%, 12.33%±2.08%, and 3.66%±1.50%, respectively. These results indicated that after ingestion of apoptotic neutrophils, a subset of macrophages undergoes autophagy and apoptosis. We propose that autophagy of macrophages after the ingestion of apoptotic cells may be a new mechanism present in the resolution of inflammation.

  12. The role of nucleotides in apoptotic cell clearance: implications for disease pathogenesis

    PubMed Central

    Chekeni, Faraaz B.; Ravichandran, Kodi S.

    2011-01-01

    Apoptosis occurs in many tissues, during both normal and pathogenic processes. Normally, apoptotic cells are rapidly cleared, either by neighboring or recruited phagocytes. The prompt clearance of apoptotic cells requires that the apoptotic cells announce their presence through the release of chemotactic factors, known as ‘find-me’ signals, to recruit phagocytes to the site of death, and through the exposure of so-called ‘eat-me’ signals, which are ligands for phagocytic uptake. The importance of prompt apoptotic cell clearance is revealed by findings that decreasing the efficiency of engulfment results in the persistence of apoptotic cells, which is often associated with chronic inflammation and autoimmunity. Additionally, the proper clearance of apoptotic cells is actively anti-inflammatory, which is thought to play a crucial role in immunologic tolerance. Therefore, defects associated with clearance of apoptotic cells may contribute to the pathogenesis of several inflammatory diseases, including autoimmunity and atherosclerosis. Here, we review the role of nucleotides in the apoptotic cell clearance process, and discuss their implications for disease pathogenesis. PMID:20809090

  13. Pro-apoptotic gene regulation in the Caribbean fruit fly, Anastrepha suspensa

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Transcriptional activation of pro-apoptotic genes in response to cytotoxic stimuli is a conserved feature of the cell death pathway proposed for metazoans. However, understanding the extent of this conservation in insects, as well as other organisms, has been limited by the lack of known pro-apoptot...

  14. On the relative contributions of positive reinforcement and escape extinction in the treatment of food refusal.

    PubMed Central

    Piazza, Cathleen C; Patel, Meeta R; Gulotta, Charles S; Sevin, Bari M; Layer, Stacy A

    2003-01-01

    We compared the effects of positive reinforcement alone, escape extinction alone, and positive reinforcement with escape extinction in the treatment of the food and fluid refusal of 4 children who had been diagnosed with a pediatric feeding disorder. Consumption did not increase when positive reinforcement was implemented alone. By contrast, consumption increased for all participants when escape extinction was implemented, independent of the presence or absence of positive reinforcement. However, the addition of positive reinforcement to escape extinction was associated with beneficial effects (e.g., greater decreases in negative vocalizations and inappropriate behavior) for some participants. PMID:14596572

  15. Experiment for Development of Simple Escape Countermeasures for Frogs Falling into Concrete Canals

    NASA Astrophysics Data System (ADS)

    Watabe, Keiji; Mori, Atsushi; Koizumi, Noriyuki; Takemura, Takeshi; Park, Myeong Soo

    Three prototype escape countermeasures for frogs that can be easily installed in U-shaped canals with widths of 30-50 cm and depths of 30-50 cm were experimentally produced because frogs cannot escape from agricultural canals with deep concrete walls after falling into the canal. The differences of effectiveness of the 3 prototypes in places for the countermeasures (1 and 2) and flow conditions (dry and water running) were investigated for 2 frog species (Tokyo Daruma Pond Frog and Japanese Brown Frog). The brown frogs escaped from the canals more easily than the pond frogs. The brown frogs escaped regardless of their body size, but the small pond frogs escaped more easily than the large pond frogs. The prototype with slopes beside both canal walls and a net spread across the center line of the canal enabled frogs to escape from the canal more easily than the prototypes with only slopes or nets beside both canal walls. Increasing the number of places for the countermeasures enhanced frog escape. The differences in frog escape between dry canals and canals with water running were not significant. Therefore, the prototypes were confirmed sufficient as escape countermeasures that is inexpensive and can be easily placed in and removed from agricultural canals.

  16. How moths escape bats: predicting outcomes of predator-prey interactions.

    PubMed

    Corcoran, Aaron J; Conner, William E

    2016-09-01

    What determines whether fleeing prey escape from attacking predators? To answer this question, biologists have developed mathematical models that incorporate attack geometries, pursuit and escape trajectories, and kinematics of predator and prey. These models have rarely been tested using data from actual predator-prey encounters. To address this problem, we recorded multi-camera infrared videography of bat-insect interactions in a large outdoor enclosure. We documented 235 attacks by four Myotis volans bats on a variety of moths. Bat and moth flight trajectories from 50 high-quality attacks were reconstructed in 3-D. Despite having higher maximum velocity, deceleration and overall turning ability, bats only captured evasive prey in 69 of 184 attacks (37.5%); bats captured nearly all moths not evading attack (50 of 51; 98%). Logistic regression indicated that prey radial acceleration and escape angle were the most important predictors of escape success (44 of 50 attacks correctly classified; 88%). We found partial support for the turning gambit mathematical model; however, it underestimated the escape threshold by 25% of prey velocity and did not account for prey escape angle. Whereas most prey escaping strikes flee away from predators, moths typically escaped chasing bats by turning with high radial acceleration toward 'safety zones' that flank the predator. This strategy may be widespread in prey engaged in chases. Based on these findings, we developed a novel geometrical model of predation. We discuss implications of this model for the co-evolution of predator and prey kinematics and pursuit and escape strategies.

  17. Sharks modulate their escape behavior in response to predator size, speed and approach orientation.

    PubMed

    Seamone, Scott; Blaine, Tristan; Higham, Timothy E

    2014-12-01

    Escape responses are often critical for surviving predator-prey interactions. Nevertheless, little is known about how predator size, speed and approach orientation impact escape performance, especially in larger prey that are primarily viewed as predators. We used realistic shark models to examine how altering predatory behavior and morphology (size, speed and approach orientation) influences escape behavior and performance in Squalus acanthias, a shark that is preyed upon by apex marine predators. Predator models induced C-start escape responses, and increasing the size and speed of the models triggered a more intense response (increased escape turning rate and acceleration). In addition, increased predator size resulted in greater responsiveness from the sharks. Among the responses, predator approach orientation had the most significant impact on escapes, such that the head-on approach, as compared to the tail-on approach, induced greater reaction distances and increased escape turning rate, speed and acceleration. Thus, the anterior binocular vision in sharks renders them less effective at detecting predators approaching from behind. However, it appears that sharks compensate by performing high-intensity escapes, likely induced by the lateral line system, or by a sudden visual flash of the predator entering their field of view. Our study reveals key aspects of escape behavior in sharks, highlighting the modulation of performance in response to predator approach.

  18. On the relative contributions of positive reinforcement and escape extinction in the treatment of food refusal.

    PubMed

    Piazza, Cathleen C; Patel, Meeta R; Gulotta, Charles S; Sevin, Bari M; Layer, Stacy A

    2003-01-01

    We compared the effects of positive reinforcement alone, escape extinction alone, and positive reinforcement with escape extinction in the treatment of the food and fluid refusal of 4 children who had been diagnosed with a pediatric feeding disorder. Consumption did not increase when positive reinforcement was implemented alone. By contrast, consumption increased for all participants when escape extinction was implemented, independent of the presence or absence of positive reinforcement. However, the addition of positive reinforcement to escape extinction was associated with beneficial effects (e.g., greater decreases in negative vocalizations and inappropriate behavior) for some participants.

  19. On the relative contributions of noncontingent reinforcement and escape extinction in the treatment of food refusal.

    PubMed

    Reed, Gregory K; Piazza, Cathleen C; Patel, Meeta R; Layer, Stacy A; Bachmeyer, Melanie H; Bethke, Stephanie D; Gutshall, Katharine A

    2004-01-01

    In the current investigation, we evaluated the relative effects of noncontingent reinforcement (NCR), escape extinction, and a combination of NCR and escape extinction as treatment for the feeding problems exhibited by 4 children. For each participant, consumption increased only when escape extinction was implemented, independent of whether NCR was present or absent. These results were consistent with prior research suggesting that positive reinforcement alone is insufficient for increasing consumption, and that escape extinction often is necessary to increase and maintain food acceptance. However, NCR appeared to decrease inappropriate behavior for some participants.

  20. Escape dynamics and fractal basin boundaries in the planar Earth-Moon system

    NASA Astrophysics Data System (ADS)

    de Assis, Sheila C.; Terra, Maisa O.

    2014-10-01

    The escape of trajectories of a spacecraft, or comet or asteroid in the presence of the Earth-Moon system is investigated in detail in the context of the planar circular restricted three-body problem, in a scattering region around the Moon. The escape through the necks around the collinear points and as well as the leaking produced by considering collisions with the Moon surface, taking the lunar mean radius into account, were considered. Given that different transport channels are available as a function of the Jacobi constant, four distinct escape regimes are analyzed. Besides the calculation of exit basins and of the spatial distribution of escape time, the qualitative dynamical investigation through Poincaré sections is performed in order to elucidate the escape process. Our analyses reveal the dependence of the properties of the considered escape basins with the energy, with a remarkable presence of fractal basin boundaries along all the escape regimes. Finally, we observe the plentiful presence of stickiness motion near stability islands which plays a remarkable role in the longest escape time behavior. The application of this analysis is important both in space mission design and study of natural systems, given that fractal boundaries are related with high sensitivity to initial conditions, implying in uncertainty between safe and unsafe solutions, as well as between escaping solutions that evolve to different phase space regions.

  1. On the hydrodynamic model of thermal escape from planetary atmospheres and its comparison with kinetic simulations

    NASA Astrophysics Data System (ADS)

    Volkov, A. N.

    2016-06-01

    Parkers' model of thermal escape implies the search of solutions of one-dimensional hydrodynamic equations for an inviscid but thermally conducting gas with a critical point and vanishing temperature far from the source. The properties of solutions of this model are studied for neutral mon- and diatomic gases with the viscosity index varying from 1/2 to 1. The domains of existence and uniqueness of solutions in terms of the source Jeans escape parameter and Knudsen number are established. The solutions are found to exist only in a narrow range of the critical point Jeans parameter. The lower and upper limits of this range correspond to solutions that are dominated by either heat conduction or adiabatic expansion. Thermal escape described by Parker's model occurs in two asymptotic regimes: the low-density (LD) regime, when escape is dominated by heat conduction, and the high-density (HD) regime, when escape is dominated by adiabatic expansion. Expressions for the mass and energy escape rates in these regimes are found theoretically. The comparison of results of hydrodynamic and kinetic simulations performed in identical conditions shows that Parker's model is capable of describing thermal escape only in the HD regime, providing decent agreement with the kinetic model in terms of the atmospheric structure below the exobase and the mass and energy escape rates. In the LD regime, Parker's model predicts a much faster drop in atmospheric temperature and less extended atmospheres, and can both over- and underestimate the escape rates in orders of magnitude.

  2. Escaping Antiangiogenic Therapy: Strategies Employed by Cancer Cells

    PubMed Central

    Pinto, Mauricio P.; Sotomayor, Paula; Carrasco-Avino, Gonzalo; Corvalan, Alejandro H.; Owen, Gareth I.

    2016-01-01

    Tumor angiogenesis is widely recognized as one of the “hallmarks of cancer”. Consequently, during the last decades the development and testing of commercial angiogenic inhibitors has been a central focus for both basic and clinical cancer research. While antiangiogenic drugs are now incorporated into standard clinical practice, as with all cancer therapies, tumors can eventually become resistant by employing a variety of strategies to receive nutrients and oxygen in the event of therapeutic assault. Herein, we concentrate and review in detail three of the principal mechanisms of antiangiogenic therapy escape: (1) upregulation of compensatory/alternative pathways for angiogenesis; (2) vasculogenic mimicry; and (3) vessel co-option. We suggest that an understanding of how a cancer cell adapts to antiangiogenic therapy may also parallel the mechanisms employed in the bourgeoning tumor and isolated metastatic cells delivering responsible for residual disease. Finally, we speculate on strategies to adapt antiangiogenic therapy for future clinical uses. PMID:27608016

  3. Escape and avoidance learning in the earthworm Eisenia hortensis

    PubMed Central

    Ferrara, Nicole C.; Blaker, Amanda L.; Giddings, Charisa E.

    2014-01-01

    Interest in instrumental learning in earthworms dates back to 1912 when Yerkes concluded that they can learn a spatial discrimination in a T-maze. Rosenkoetter and Boice determined in the 1970s that the “learning” that Yerkes observed was probably chemotaxis and not learning at all. We examined a different form of instrumental learning: the ability to learn both to escape and to avoid an aversive stimulus. Freely moving “master” worms could turn off an aversive white light by increasing their movement; the behavior of yoked controls had no effect on the light. We demonstrate that in as few as 12 trials the behavior of the master worms comes under the control of this contingency. PMID:24498578

  4. On Escaping a Galaxy Cluster in an Accelerating Universe

    NASA Astrophysics Data System (ADS)

    Stark, Alejo; Miller, Christopher J.; Gifford, Daniel

    2016-10-01

    We derive the escape velocity profile for an Einasto density field in an accelerating universe and demonstrate its physical viability by comparing theoretical expectations to both light-cone data generated from N-body simulations and archival data on 20 galaxy clusters. We demonstrate that the projection function (g(β )) is deemed physically viable only for the theoretical expectation that includes a cosmology-dependent term. Using simulations, we show that the inferred velocity anisotropy is more than 6σ away from the expected value for the theoretical profile that ignores the acceleration of the universe. In the archival data, we constrain the average velocity anisotropy parameter of a sample of 20 clusters to be β ={0.248}-0.360+0.164 at the 68% confidence level. Lastly, we briefly discuss how our analytic model may be used as a novel cosmological probe based on galaxy clusters.

  5. Semiclassical theory of energy diffusive escape in a Duffing oscillator.

    PubMed

    Verso, Alvise; Ankerhold, Joachim

    2010-11-01

    Motivated by recent experimental progress to readout quantum bits implemented in superconducting circuits via the phenomenon of dynamical bifurcation, transitions between steady orbits in a driven anharmonic oscillator, the Duffing oscillator, are analyzed. In the regime of weak dissipation a consistent diffusion equation in the semiclassical limit is derived to capture the intimate relation between finite tunneling and reflection and bath induced quantum fluctuations. From the corresponding steady-state distribution an analytical expression for the switching probability is obtained. It is shown that a reduction of the transition rate due to finite reflection at the phase-space barrier is overcompensated by an increase due to environmental quantum fluctuations that are specific for diffusion processes over dynamical barriers. The scaling behavior of the rate is discussed and it is revealed that close to the bifurcation threshold the escape dynamics enters an overdamped domain such that the quantum-mechanical energy scale associated with friction even exceeds the thermal energy scale. PMID:21230446

  6. Determination of the Electron Escape Depth for NEXAFS Spectropy

    SciTech Connect

    Sohn, K.; Dimitriou, M; Genzer, J; Fisher, D; Hawker, C; Kramer, E

    2009-01-01

    A novel method was developed to determine carbon atom density as a function of depth by analyzing the postedge signal in near-edge X-ray absorption fine structure (NEXAFS) spectra. We show that the common assumption in the analysis of NEXAFS data from polymer films, namely, that the carbon atom density is constant as a function of depth, is not valid. This analysis method is then used to calculate the electron escape depth (EED) for NEXAFS in a model bilayer system that contains a perfluorinated polyether (PFPE) on top of a highly oriented pyrolitic graphite (HOPG) sample. Because the carbon atom densitites of both layers are known, in addition to the PFPE surface layer thickness, the EED is determined to be 1.95 nm. This EED is then used to measure the thickness of the perfluorinated surface layer of poly(4-(1H,1H,2H,2H-perfluorodecyl)oxymethylstyrene) (PFPS).

  7. Test of time: what if little Albert had escaped?

    PubMed

    Field, Andy P; Nightingale, Zoë C

    2009-04-01

    Watson and Rayner's (1920) ;Little Albert' experiment has become one of the most famous studies in psychology. It is a staple of many general psychology textbooks and is part of the very fabric of the discipline's folklore. Despite this fame, the study has been widely criticized in the nearly 90 years since it was published for its lack of methodological rigour. This article attempts to evaluate the contribution of the ;little Albert' study to modern clinical psychology by speculating on what theories and treatments of child anxiety would look like in a parallel universe in which the study never took place because ;little Albert' escaped from the hospital in which Watson tested him. PMID:19293325

  8. Lightning tests of the orbiter pyrotechnic escape system

    NASA Technical Reports Server (NTRS)

    Cohen, R.; Schulte, E. H.

    1977-01-01

    An experimental test program was undertaken to demonstrate that the Space Shuttle Orbiter Vehicle pyrotechnics actuated Crew Escape System was not subject to failure resulting from a lightning strike in the vicinity of the cockpit. A test sample representing a full-scale portion of the Orbiter Outer Panel was preheated to 325 F and struck with three different current waveforms to simulate the various effects of lightning: (1) 2 micro sec risetime, to 180 kA pulse to evaluate fast current rise shock effects; (2) a 205 kA, 100 micro sec wide pulse to evaluate full energy shock effects; and (3) a 490 ampere, 370 msec continuing current to evaluate the thermal effects of a lightning strike. These tests show that the Orbiter outer panel pyrotechnics are adequately protected against damage resulting from a lightning strike.

  9. Escaping Antiangiogenic Therapy: Strategies Employed by Cancer Cells.

    PubMed

    Pinto, Mauricio P; Sotomayor, Paula; Carrasco-Avino, Gonzalo; Corvalan, Alejandro H; Owen, Gareth I

    2016-01-01

    Tumor angiogenesis is widely recognized as one of the "hallmarks of cancer". Consequently, during the last decades the development and testing of commercial angiogenic inhibitors has been a central focus for both basic and clinical cancer research. While antiangiogenic drugs are now incorporated into standard clinical practice, as with all cancer therapies, tumors can eventually become resistant by employing a variety of strategies to receive nutrients and oxygen in the event of therapeutic assault. Herein, we concentrate and review in detail three of the principal mechanisms of antiangiogenic therapy escape: (1) upregulation of compensatory/alternative pathways for angiogenesis; (2) vasculogenic mimicry; and (3) vessel co-option. We suggest that an understanding of how a cancer cell adapts to antiangiogenic therapy may also parallel the mechanisms employed in the bourgeoning tumor and isolated metastatic cells delivering responsible for residual disease. Finally, we speculate on strategies to adapt antiangiogenic therapy for future clinical uses. PMID:27608016

  10. Self-learning metabasin escape algorithm for supercooled liquids.

    PubMed

    Cao, Penghui; Li, Minghai; Heugle, Ravi J; Park, Harold S; Lin, Xi

    2012-07-01

    A generic history-penalized metabasin escape algorithm that contains no predetermined parameters is presented in this work. The spatial location and volume of imposed penalty functions in the configurational space are determined in self-learning processes as the 3N-dimensional potential energy surface is sampled. The computational efficiency is demonstrated using a binary Lennard-Jones liquid supercooled below the glass transition temperature, which shows an O(10(3)) reduction in the quadratic scaling coefficient of the overall computational cost as compared to the previous algorithm implementation. Furthermore, the metabasin sizes of supercooled liquids are obtained as a natural consequence of determining the self-learned penalty function width distributions. In the case of a bulk binary Lennard-Jones liquid at a fixed density of 1.2, typical metabasins are found to contain about 148 particles while having a correlation length of 3.09 when the system temperature drops below the glass transition temperature.

  11. An Introduction to Survival, Evasion, Resistance, and Escape (SERE) Medicine.

    PubMed

    Smith, Michael B

    2013-01-01

    When an individual finds himself/herself in a survival, evasion, resistance, or escape (SERE) scenario, the ability to treat injuries/illnesses can be the difference between life and death. SERE schools are responsible for preparing military members for these situations, but the concept of SERE medicine is not particularly well defined. To provide a comprehensive working description of SERE medicine, operational and training components were examined. Evidence suggests that SERE medicine is diverse, injury/illness patterns are situationally dependent, and treatment options often differ from conventional clinical medicine. Ideally, medical lessons taught in SERE training are based on actual documented events. Unfortunately, the existing body of literature is dated and does not appear to be expanding. In this article, four distinct facets of SERE medicine are presented to establish a basis for future discussion and research. Recommendations to improve SERE medical curricula and data-gathering processes are also provided.

  12. Endoplasmic reticulum stress-induced apoptotic pathway and mitochondrial dysregulation in HeLa cells treated with dichloromethane extract of Dillenia suffruticosa

    PubMed Central

    Wan Nor Hafiza, Wan Abd Ghani; Yazan, Latifah Saiful; Tor, Yin Sim; Foo, Jhi Biau; Armania, Nurdin; Rahman, Heshu Sulaiman

    2016-01-01

    Ethyl acetate and dichloromethane extract of Dillenia suffruticosa (EADS and DCMDS, respectively) can be a potential anticancer agent. The effects of EADS and DCMDS on the growth of HeLa cervical cancer cells and the expression of apoptotic-related proteins had been investigated in vitro. Cytotoxicity of the extracts toward the cells was determined by 5-diphenyltetrazolium bromide assay, the effects on cell cycle progression and the mode of cell death were analyzed by flow cytometry technique, while the effects on apoptotic-related genes and proteins were evaluated by quantitative real-time polymerase chain reaction, and Western blot and enzyme-linked immunosorbent assay, respectively. Treatment with DCMDS inhibited (P < 0.05) proliferation and induced apoptosis in HeLa cells. The expression of cyclin B1 was downregulated that led to G2/M arrest in the cells after treatment with DCMDA. In summary, DCMDS induced apoptosis in HeLa cells via endoplasmic reticulum stress-induced apoptotic pathway and dysregulation of mitochondria. The data suggest the potential application of DCMDS in the treatment of cervical cancer. PMID:27041866

  13. Anti-apoptotic mechanism of Bacoside rich extract against reactive nitrogen species induced activation of iNOS/Bax/caspase 3 mediated apoptosis in L132 cell line.

    PubMed

    Anand, T; Pandareesh, M D; Bhat, Pratiksha V; Venkataramana, M

    2014-10-01

    Nitric oxide is a highly reactive free radical gas that reacts with a wide range of bio-molecules to produce reactive nitrogen species and exerts nitrative stress. Bacopa monniera is a traditional folk and ayurvedic medicine known to alleviate a variety of disorders. Aim of the present study is to evaluate the protective propensity of Bacopa monniera extract (BME) through its oxido-nitrosative and anti-apoptotic mechanism to attenuate sodium nitroprusside (SNP)-induced apoptosis in a human embryonic lung epithelial cell line (L132). Our results elucidate that pre-treatment of L132 cells with BME ameliorates the mitochondrial and plasma membrane damage induced by SNP as evidenced by MTT and LDH leakage assays. BME pre-treatment inhibited NO generation by down-regulating inducible nitric oxide synthase expression. BME exhibited potent antioxidant activity by up-regulating the antioxidant enzymes. SNP-induced damage to cellular, nuclear and mitochondrial integrity was also restored by BME, which was confirmed by ROS estimation, comet assay and mitochondrial membrane potential assays respectively. BME pre-treatment efficiently attenuated the SNP-induced apoptotic biomarkers such as Bax, cytochrome-c and caspase-3, which orchestrate the proteolytic damage of the cell. By considering all these findings, we report that BME protects L132 cells against SNP-induced toxicity via its free radical scavenging and anti-apoptotic mechanism.

  14. Endoplasmic reticulum stress-induced apoptotic pathway and mitochondrial dysregulation in HeLa cells treated with dichloromethane extract of Dillenia suffruticosa.

    PubMed

    Wan Nor Hafiza, Wan Abd Ghani; Yazan, Latifah Saiful; Tor, Yin Sim; Foo, Jhi Biau; Armania, Nurdin; Rahman, Heshu Sulaiman

    2016-01-01

    Ethyl acetate and dichloromethane extract of Dillenia suffruticosa (EADS and DCMDS, respectively) can be a potential anticancer agent. The effects of EADS and DCMDS on the growth of HeLa cervical cancer cells and the expression of apoptotic-related proteins had been investigated in vitro. Cytotoxicity of the extracts toward the cells was determined by 5-diphenyltetrazolium bromide assay, the effects on cell cycle progression and the mode of cell death were analyzed by flow cytometry technique, while the effects on apoptotic-related genes and proteins were evaluated by quantitative real-time polymerase chain reaction, and Western blot and enzyme-linked immunosorbent assay, respectively. Treatment with DCMDS inhibited (P < 0.05) proliferation and induced apoptosis in HeLa cells. The expression of cyclin B1 was downregulated that led to G2/M arrest in the cells after treatment with DCMDA. In summary, DCMDS induced apoptosis in HeLa cells via endoplasmic reticulum stress-induced apoptotic pathway and dysregulation of mitochondria. The data suggest the potential application of DCMDS in the treatment of cervical cancer. PMID:27041866

  15. The scavenger receptor SCARF1 mediates apoptotic cell clearance and prevents autoimmunity

    PubMed Central

    Ramirez-Ortiz, Zaida G.; Pendergraft, William F.; Prasad, Amit; Byrne, Michael H.; Iram, Tal; Blanchette, Christopher J.; Luster, Andrew D.; Hacohen, Nir; Khoury, Joseph El; Means, Terry K.

    2013-01-01

    Clearance of apoptotic cells is critical for control of tissue homeostasis however the full range of receptor(s) on phagocytes responsible for recognition of apoptotic cells remains to be identified. Here we show that dendritic cells (DCs), macrophages and endothelial cells use scavenger receptor type F family member 1 (SCARF1) to recognize and engulf apoptotic cells via C1q. Loss of SCARF1 impairs uptake of apoptotic cells. Consequently, in SCARF1-deficient mice, dying cells accumulate in tissues leading to a lupus-like disease with the spontaneous generation of autoantibodies to DNA-containing antigens, immune cell activation, dermatitis and nephritis. The discovery of SCARF1 interactions with C1q and apoptotic cells provides insights into molecular mechanisms involved in maintenance of tolerance and prevention of autoimmune disease. PMID:23892722

  16. Cooperative binding of Annexin A5 to phosphatidylserine on apoptotic cell membranes

    NASA Astrophysics Data System (ADS)

    Janko, Christina; Jeremic, Ivica; Biermann, Mona; Chaurio, Ricardo; Schorn, Christine; Muñoz, Luis E.; Herrmann, Martin

    2013-12-01

    Healthy cells exhibit an asymmetric plasma membrane with phosphatidylserine (PS) located on the cytoplasmic leaflet of the plasma membrane bilayer. Annexin A5-FITC, a PS binding protein, is commonly used to evaluate apoptosis in flow cytometry. PS exposed by apoptotic cells serves as a major ‘eat-me’ signal for phagocytes. Although exposition of PS has been observed after alternative stimuli, no clearance of viable, PS exposing cells has been detected. Thus, besides PS exposure, membranes of viable and apoptotic cells might exhibit specific characteristics. Here, we show that Annexin A5 binds in a cooperative manner to different types of dead cells. Shrunken apoptotic cells thereby showed the highest Hill coefficient values. Contrarily, parafomaldehyde fixation of apoptotic cells completely abrogates the cooperativity effect seen with dead and dying cells. We tend to speculate that the cooperative binding of Annexin A5 to the membranes of apoptotic cells reflects higher fluidity of the exposed membranes facilitating PS clustering.

  17. ESCAP holds expert group meeting on population issues facing adolescents.

    PubMed

    1997-01-01

    This article summarizes the activities at the ESCAP Population Division Expert Group Meeting on Adolescents that was held during September-October 1997 in Bangkok, Thailand. The meeting was a follow-up to the 1994 International Conference on Population and Development (ICPD). The meeting considered 1) the ICPD recommendations; 2) the recommendations contained in the Jakarta Plan of Action on Human Resource Development; and 3) the Proposals for Action on Human Resources Development for Youth in Asia and the Pacific. Participants included about 25 people from Australia, Bangladesh, China, India, Indonesia, Philippines, Sri Lanka, and Thailand. The conference relied on 8 invited experts, two resource persons, advisors from the UNFPA Country Support Team for East and Southeast Asia, and representatives of UNFPA, the Population Council, and the East-West Center. A concern was the declining age of menarche of girls in the ESCAP region and the increasing age of marriage. During the time of menarche and marriage, girls are migrating and moving away from their family and community in rural areas. Family structure and relationships are changing. Increases are observed in adolescent premarital sexual activity, the incidence of sexually transmitted diseases, substance abuse, teenage pregnancy, and abortion. The mass media and information technologies have both a positive and a negative influence on adolescents. Parent-child communication exchanges and teacher-student exchanges are "less than ideal." Old traditions and practices change slower than people change. Boys and girls are affected differently by the sociocultural and economic environment. The societal norms set expectations for behavior that may conflict with individual beliefs and practices. Changes brought by globalization and rapid economic growth provide greater opportunity for young girls and women to obtain employment and autonomy.

  18. Phenotypic Mismatches Reveal Escape from Arms-Race Coevolution

    PubMed Central

    Hanifin, Charles T; Brodie, Edmund D; Brodie, Edmund D

    2008-01-01

    Because coevolution takes place across a broad scale of time and space, it is virtually impossible to understand its dynamics and trajectories by studying a single pair of interacting populations at one time. Comparing populations across a range of an interaction, especially for long-lived species, can provide insight into these features of coevolution by sampling across a diverse set of conditions and histories. We used measures of prey traits (tetrodotoxin toxicity in newts) and predator traits (tetrodotoxin resistance of snakes) to assess the degree of phenotypic mismatch across the range of their coevolutionary interaction. Geographic patterns of phenotypic exaggeration were similar in prey and predators, with most phenotypically elevated localities occurring along the central Oregon coast and central California. Contrary to expectations, however, these areas of elevated traits did not coincide with the most intense coevolutionary selection. Measures of functional trait mismatch revealed that over one-third of sampled localities were so mismatched that reciprocal selection could not occur given current trait distributions. Estimates of current locality-specific interaction selection gradients confirmed this interpretation. In every case of mismatch, predators were “ahead” of prey in the arms race; the converse escape of prey was never observed. The emergent pattern suggests a dynamic in which interacting species experience reciprocal selection that drives arms-race escalation of both prey and predator phenotypes at a subset of localities across the interaction. This coadaptation proceeds until the evolution of extreme phenotypes by predators, through genes of large effect, allows snakes to, at least temporarily, escape the arms race. PMID:18336073

  19. Initiating a watch list for Ebola virus antibody escape mutations.

    PubMed

    Miller, Craig R; Johnson, Erin L; Burke, Aran Z; Martin, Kyle P; Miura, Tanya A; Wichman, Holly A; Brown, Celeste J; Ytreberg, F Marty

    2016-01-01

    The 2014 Ebola virus (EBOV) outbreak in West Africa is the largest in recorded history and resulted in over 11,000 deaths. It is essential that strategies for treatment and containment be developed to avoid future epidemics of this magnitude. With the development of vaccines and antibody-based therapies using the envelope glycoprotein (GP) of the 1976 Mayinga strain, one important strategy is to anticipate how the evolution of EBOV might compromise these efforts. In this study we have initiated a watch list of potential antibody escape mutations of EBOV by modeling interactions between GP and the antibody KZ52. The watch list was generated using molecular modeling to estimate stability changes due to mutation. Every possible mutation of GP was considered and the list was generated from those that are predicted to disrupt GP-KZ52 binding but not to disrupt the ability of GP to fold and to form trimers. The resulting watch list contains 34 mutations (one of which has already been seen in humans) at six sites in the GP2 subunit. Should mutations from the watch list appear and spread during an epidemic, it warrants attention as these mutations may reflect an evolutionary response from the virus that could reduce the effectiveness of interventions such as vaccination. However, this watch list is incomplete and emphasizes the need for more experimental structures of EBOV interacting with antibodies in order to expand the watch list to other epitopes. We hope that this work provokes experimental research on evolutionary escape in both Ebola and other viral pathogens.

  20. Mars Ion Outflow and Escape - Solar Cycle Dependence

    NASA Astrophysics Data System (ADS)

    Lundin, Rickard; Barabash, Stas; Nilsson, Hans; Yamauchi, Masatoshi; Dubinin, Edic

    2013-04-01

    With 9 years of data from the ASPERA-3 experiment on Mars Express (MEX) it is now feasible to analyze the solar cycle impact on the ion outflow and escape from Mars - from the end of solar cycle 23, through solar minimum 2008, up to the solar maximum of cycle 24. The study is based on average fluxes of low-energy (<300 eV) O+ and O2+, derived for selected periods when MEX traversed the central tail near the noon-midnight meridian. A time series plot of average O+ and O2+ fluxes, and solar activity proxies (RI and F10.7) display how the heavy ion outflow from Mars vary with solar activity. We note that the average O+, O2+ flux increased by a factor of ≈10 from 2008 (solar minimum) to 2013, while RI rose from ≈ 3 to 60, and a normalized F10.7* (F10.7-60) rose from ≈6 - 60, F10.7* suggesting a close correlation with heavy ion outflow. A correlation analysis between the two solar activity proxies (RI and F10.7*) and the O+ and O2+ average flux gives correlation coefficients (R2) greater than 0.6, i.e. there is a strong positive correlation between the energization and outflow of ionospheric heavy ions and solar activity. A preliminary estimate of the total escape rate of heavy ions (O++O2+) from Mars is ≈1-2·1024 ions/s (2008, solar minimum) and 1-2·1025 ions/s (2013, solar maximum?)

  1. Phenotypic mismatches reveal escape from arms-race coevolution.

    PubMed

    Hanifin, Charles T; Brodie, Edmund D; Brodie, Edmund D

    2008-03-11

    Because coevolution takes place across a broad scale of time and space, it is virtually impossible to understand its dynamics and trajectories by studying a single pair of interacting populations at one time. Comparing populations across a range of an interaction, especially for long-lived species, can provide insight into these features of coevolution by sampling across a diverse set of conditions and histories. We used measures of prey traits (tetrodotoxin toxicity in newts) and predator traits (tetrodotoxin resistance of snakes) to assess the degree of phenotypic mismatch across the range of their coevolutionary interaction. Geographic patterns of phenotypic exaggeration were similar in prey and predators, with most phenotypically elevated localities occurring along the central Oregon coast and central California. Contrary to expectations, however, these areas of elevated traits did not coincide with the most intense coevolutionary selection. Measures of functional trait mismatch revealed that over one-third of sampled localities were so mismatched that reciprocal selection could not occur given current trait distributions. Estimates of current locality-specific interaction selection gradients confirmed this interpretation. In every case of mismatch, predators were "ahead" of prey in the arms race; the converse escape of prey was never observed. The emergent pattern suggests a dynamic in which interacting species experience reciprocal selection that drives arms-race escalation of both prey and predator phenotypes at a subset of localities across the interaction. This coadaptation proceeds until the evolution of extreme phenotypes by predators, through genes of large effect, allows snakes to, at least temporarily, escape the arms race.

  2. Searching for a life history approach to salmon escapement management

    USGS Publications Warehouse

    Knudsen, E.E.; Symmes, E.W.; Margraf, F.J.

    2003-01-01

    A number of Pacific salmon populations have already been lost and many others throughout the range are in various states of decline. Recent research has documented that Pacific salmon carcasses serve as a key delivery vector of marine-derived nutrients into the freshwater portions of their ecosystems. This nutrient supply plays a critical biological feedback role in salmon sustainability by supporting juvenile salmon production. We first demonstrate how nutrient feedback potential to juvenile production may be unaccounted for in spawner-recruit models of populations under long-term exploitation. We then present a heuristic, life history-based, spreadsheet survival model that incorporates salmon carcass-driven nutrient feedback to the freshwater components of the salmon ecosystem. The productivity of a hypothetical coho salmon population was simulated using rates from the literature for survival from spawner to egg, egg to fry, fry to smolt, and smolt to adult. The effects of climate variation and nutrient feedback on survival were incorporated, as were density-dependent effects of the numbers of spawners and fry on freshwater survival of eggs and juveniles. The unexploited equilibrium population was subjected to 100 years of 20, 40, 60, and 80% harvest. Each harvest scenario greater than 20% brought the population to a reduced steady state, regardless of generous compensatory survival at low population sizes. Increasing harvest reduced the positive effects of nutrient contributions to population growth. Salmon researchers should further explore this modeling approach for establishing escapement goals. Given the importance of nutrient feedback, managers should strive for generous escapements that support nutrient rebuilding, as well as egg deposition, to ensure strong future salmon production.

  3. Initiating a watch list for Ebola virus antibody escape mutations.

    PubMed

    Miller, Craig R; Johnson, Erin L; Burke, Aran Z; Martin, Kyle P; Miura, Tanya A; Wichman, Holly A; Brown, Celeste J; Ytreberg, F Marty

    2016-01-01

    The 2014 Ebola virus (EBOV) outbreak in West Africa is the largest in recorded history and resulted in over 11,000 deaths. It is essential that strategies for treatment and containment be developed to avoid future epidemics of this magnitude. With the development of vaccines and antibody-based therapies using the envelope glycoprotein (GP) of the 1976 Mayinga strain, one important strategy is to anticipate how the evolution of EBOV might compromise these efforts. In this study we have initiated a watch list of potential antibody escape mutations of EBOV by modeling interactions between GP and the antibody KZ52. The watch list was generated using molecular modeling to estimate stability changes due to mutation. Every possible mutation of GP was considered and the list was generated from those that are predicted to disrupt GP-KZ52 binding but not to disrupt the ability of GP to fold and to form trimers. The resulting watch list contains 34 mutations (one of which has already been seen in humans) at six sites in the GP2 subunit. Should mutations from the watch list appear and spread during an epidemic, it warrants attention as these mutations may reflect an evolutionary response from the virus that could reduce the effectiveness of interventions such as vaccination. However, this watch list is incomplete and emphasizes the need for more experimental structures of EBOV interacting with antibodies in order to expand the watch list to other epitopes. We hope that this work provokes experimental research on evolutionary escape in both Ebola and other viral pathogens. PMID:26925318

  4. Optogenetic Stimulation of Escape Behavior in Drosophila melanogaster

    PubMed Central

    de Vries, Saskia E.J.; Clandinin, Tom

    2013-01-01

    A growing number of genetically encoded tools are becoming available that allow non-invasive manipulation of the neural activity of specific neurons in Drosophila melanogaster1. Chief among these are optogenetic tools, which enable the activation or silencing of specific neurons in the intact and freely moving animal using bright light. Channelrhodopsin (ChR2) is a light-activated cation channel that, when activated by blue light, causes depolarization of neurons that express it. ChR2 has been effective for identifying neurons critical for specific behaviors, such as CO2 avoidance, proboscis extension and giant-fiber mediated startle response2-4. However, as the intense light sources used to stimulate ChR2 also stimulate photoreceptors, these optogenetic techniques have not previously been used in the visual system. Here, we combine an optogenetic approach with a mutation that impairs phototransduction to demonstrate that activation of a cluster of loom-sensitive neurons in the fly's optic lobe, Foma-1 neurons, can drive an escape behavior used to avoid collision. We used a null allele of a critical component of the phototransduction cascade, phospholipase C-β, encoded by the norpA gene, to render the flies blind and also use the Gal4-UAS transcriptional activator system to drive expression of ChR2 in the Foma-1 neurons. Individual flies are placed on a small platform surrounded by blue LEDs. When the LEDs are illuminated, the flies quickly take-off into flight, in a manner similar to visually driven loom-escape behavior. We believe that this technique can be easily adapted to examine other behaviors in freely moving flies. PMID:23380919

  5. Initiating a watch list for Ebola virus antibody escape mutations

    PubMed Central

    Johnson, Erin L.; Burke, Aran Z.; Martin, Kyle P.; Miura, Tanya A.; Wichman, Holly A.; Brown, Celeste J.

    2016-01-01

    The 2014 Ebola virus (EBOV) outbreak in West Africa is the largest in recorded history and resulted in over 11,000 deaths. It is essential that strategies for treatment and containment be developed to avoid future epidemics of this magnitude. With the development of vaccines and antibody-based therapies using the envelope glycoprotein (GP) of the 1976 Mayinga strain, one important strategy is to anticipate how the evolution of EBOV might compromise these efforts. In this study we have initiated a watch list of potential antibody escape mutations of EBOV by modeling interactions between GP and the antibody KZ52. The watch list was generated using molecular modeling to estimate stability changes due to mutation. Every possible mutation of GP was considered and the list was generated from those that are predicted to disrupt GP-KZ52 binding but not to disrupt the ability of GP to fold and to form trimers. The resulting watch list contains 34 mutations (one of which has already been seen in humans) at six sites in the GP2 subunit. Should mutations from the watch list appear and spread during an epidemic, it warrants attention as these mutations may reflect an evolutionary response from the virus that could reduce the effectiveness of interventions such as vaccination. However, this watch list is incomplete and emphasizes the need for more experimental structures of EBOV interacting with antibodies in order to expand the watch list to other epitopes. We hope that this work provokes experimental research on evolutionary escape in both Ebola and other viral pathogens. PMID:26925318

  6. Developments in Enzyme Technology.

    ERIC Educational Resources Information Center

    Chaplin, M. F.

    1984-01-01

    Enzyme technology has a well-established industrial base, with applications that have survived competition. The most prominent applications of enzymes in biotechnology are examined with an explanation of some theoretical background. Topics include extending an enzyme's useful life, partition and diffusion, industrial uses, and therapeutic uses.…

  7. Chloroplast and Cytoplasmic Enzymes

    PubMed Central

    Anderson, Louise E.; Advani, Vimal R.

    1970-01-01

    Three pea (Pisum sativum) leaf chloroplast enzymes—triose phosphate isomerase, glyceric acid 3-phosphate kinase, and fructose 1,6-diphosphate aldolase—have been separated from the corresponding cytoplasmic enzymes by isoelectric focusing. These three enzymes of the reductive pentose phosphate cycle are therefore distinct proteins, not identical with the analogous enzymes of the Embden-Meyerhof-Parnas pathway. PMID:16657347

  8. Drug-induced apoptotic neurodegeneration in the developing brain.

    PubMed

    Olney, John W; Wozniak, David F; Jevtovic-Todorovic, Vesna; Farber, Nuri B; Bittigau, Petra; Ikonomidou, Chysanthy

    2002-10-01

    Physiological cell death (PCD), a process by which redundant or unsuccessful neurons are deleted by apoptosis (cell suicide) from the developing central nervous system, has been recognized as a natural phenomenon for many years. Whether environmental factors can interact with PCD mechanisms to increase the number of neurons undergoing PCD, thereby converting this natural phenomenon into a pathological process, is an interesting question for which new answers are just now becoming available. In a series of recent studies we have shown that 2 major classes of drugs (those that block NMDA glutamate receptors and those that promote GABAA receptor activation), when administered to immature rodents during the period of synaptogenesis, trigger widespread apoptotic neurodegeneration throughout the developing brain. In addition, we have found that ethanol, which has both NMDA antagonist and GABAmimetic properties, triggers a robust pattern of apoptotic neurodegeneration, thereby deleting large numbers of neurons from many different regions of the developing brain. These findings provide a more likely explanation than has heretofore been available for the reduced brain mass and lifelong neurobehavioral disturbances associated with the human fetal alcohol syndrome (FAS). The period of synaptogenesis, also known as the brain growth spurt period, occurs in different species at different times relative to birth. In rats and mice it is a postnatal event, but in humans it extends from the sixth month of gestation to several years after birth. Thus, there is a period in pre- and postnatal human development, lasting for several years, during which immature CNS neurons are prone to commit suicide if exposed to intoxicating concentrations of drugs with NMDA antagonist or GABAmimetic properties. These findings are important, not only because of their relevance to the FAS, but because there are many agents in the human environment, other than ethanol, that have NMDA antagonist or

  9. Apoptotic effect of noscapine in breast cancer cell lines.

    PubMed

    Quisbert-Valenzuela, Edwin O; Calaf, Gloria M

    2016-06-01

    Cancer is a public health problem in the world and breast cancer is the most frequently cancer in women. Approximately 15% of the breast cancers are triple-negative. Apoptosis regulates normal growth, homeostasis, development, embryogenesis and appropriate strategy to treat cancer. Bax is a protein pro-apoptotic enhancer of apoptosis in contrast to Bcl-2 with antiapoptotic properties. Initiator caspase-9 and caspase-8 are features of intrinsic and extrinsic apoptosis pathway, respectively. NF-κB is a transcription factor known to be involved in the initiation and progression of breast cancer. Noscapine, an alkaloid derived from opium is used as antitussive and showed antitumor properties that induced apoptosis in cancer cell lines. The aim of the present study was to determine the apoptotic effect of noscapine in breast cancer cell lines compared to breast normal cell line. Three cell lines were used: i) a control breast cell line MCF-10F; ii) a luminal-like adenocarcinoma triple-positive breast cell line MCF-7; iii) breast cancer triple-negative cell line MDA-MB-231. Our results showed that noscapine had lower toxicity in normal cells and was an effective anticancer agent that induced apoptosis in breast cancer cells because it increases Bax gene and protein expression in three cell lines, while decreases Bcl-xL gene expression, and Bcl-2 protein expression decreased in breast cancer cell lines. Therefore, Bax/Bcl-2 ratio increased in the three cell lines. This drug increased caspase-9 gene expression in breast cancer cell lines and caspase-8 gene expression increased in MCF-10F and MDA-MB-231. Furthermore, it increased cleavage of caspase-8, suggesting that noscapine-induced apoptosis is probably due to the involvement of extrinsic and intrinsic apoptosis pathways. Antiapoptotic gene and protein expression diminished and proapoptotic gene and protein expression increased noscapine-induced expression, probably due to decrease in NF-κB gene and protein expression

  10. Photochemical escape of oxygen from the Martian atmosphere: first results from MAVEN

    NASA Astrophysics Data System (ADS)

    Lillis, Rob; Deigan, Justin; Fox, Jane; Bougher, Steve; Lee, Yuni; Cravens, Thomas; Rahmati, Ali; Jakosky, Bruce

    2015-04-01

    One of the primary goals of the MAVEN mission is to characterize rates of atmospheric escape at the present epoch and relate those escape rates to solar drivers. One of the major escape processes is known as photochemical escape, which is broadly defined as a process by which a) an exothermic reaction in the atmosphere results in an upward-traveling neutral particle whose velocity exceeds planetary escape velocity and b) the particle is not prevented from escaping through any subsequent collisions. At Mars, photochemical escape of oxygen is expected to be a significant channel for atmospheric escape, particularly in the early solar system when extreme ultraviolet (EUV) fluxes were much higher. Thus characterizing this escape process is central to understanding the role escape to space has played in Mars' climate evolution. Because escaping hot atoms cannot easily be directly measured, models of production and transport (through the atmosphere) of such atoms must be used to constrain escape rates. These models require altitude profiles of neutral densities and electron and ion densities and temperatures, as well as compositional information. All the relevant quantities upon which photochemical escape depends will be measured by MAVEN at the relevant altitudes (150-250 km). LPW will measure electron density and temperature, NGIMS will measure neutral and ion density and STATIC will measure ion density and temperature. 4 separate calculations must be made for every altitude profile: Profiles of O2+dissociative recombination (DR) rates will be calculated straightforwardly from electron temperature, electron density and O2+density. Profiles of rotational and vibrational distributions of O2+ ions will be calculated from profiles of CO2, O, O2, O+, CO2+ and CO+ via a lookup table from an empirical model. Profiles of energy distributions of hot O atoms will be calculated from the results of step 2 and from profiles of electron and ion temperatures. Profiles of all neutral

  11. MAVEN in situ measurements of photochemical escape of oxygen from Mars

    NASA Astrophysics Data System (ADS)

    Lillis, Robert; Deighan, Justin; Fox, Jane; Bougher, Stephen; Lee, Yuni; Cravens, Thomas; Rahmati, Ali; Mahaffy, Paul; Benna, Mehdi; Groller, Hannes; Jakosky, Bruce

    2016-04-01

    One of the primary goals of the MAVEN mission is to characterize rates of atmospheric escape from Mars at the present epoch and relate those escape rates to solar drivers. One of the known escape processes is photochemical escape, where a) an exothermic chemical reaction in the atmosphere results in an upward-traveling neutral particle whose velocity exceeds planetary escape velocity and b) the particle is not prevented from escaping through subsequent collisions. At Mars, photochemical escape of oxygen is expected to be a significant channel for atmospheric escape, particularly in the early solar system when extreme ultraviolet (EUV) fluxes were much higher. Thus characterizing this escape process and its variability with solar drivers is central to understanding the role escape to space has played in Mars' climate evolution. We use near-periapsis (<400 km altitude) data from three MAVEN instruments: the Langmuir Probe and Waves (LPW) instrument measures electron density and temperature, the Suprathermal And Thermal Ion Composition (STATIC) experiment measures ion temperature and the Neutral Gas and Ion Mass Spectrometer (NGIMS) measures neutral and ion densities. For each profile of in situ measurements, we make several calculations, each as a function of altitude. The first uses electron and temperatures and simulates the dissociative recombination of both O2+ and CO2+ to calculate the probability distribution for the initial energies of the resulting hot oxygen atoms. The second is a Monte Carlo hot atom transport model that takes that distribution of initial O energies and the measured neutral density profiles and calculates the probability that a hot atom born at that altitude will escape. The third takes the measured electron and ion densities and electron temperatures and calculates the production rate of hot O atoms. We then multiply together the profiles of hot atom production and escape probability to get profiles of the production rate of escaping atoms

  12. The average enzyme principle.

    PubMed

    Reznik, Ed; Chaudhary, Osman; Segrè, Daniel

    2013-09-01

    The Michaelis-Menten equation for an irreversible enzymatic reaction depends linearly on the enzyme concentration. Even if the enzyme concentration changes in time, this linearity implies that the amount of substrate depleted during a given time interval depends only on the average enzyme concentration. Here, we use a time re-scaling approach to generalize this result to a broad category of multi-reaction systems, whose constituent enzymes have the same dependence on time, e.g. they belong to the same regulon. This "average enzyme principle" provides a natural methodology for jointly studying metabolism and its regulation.

  13. Bak apoptotic function is not directly regulated by phosphorylation.

    PubMed

    Tran, V H; Bartolo, R; Westphal, D; Alsop, A; Dewson, G; Kluck, R M

    2013-01-01

    During apoptosis, Bak and Bax permeabilize the mitochondrial outer membrane by undergoing major conformational change and oligomerization. This activation process in Bak is reported to require dephosphorylation of tyrosine-108 close to an activation trigger site. To investigate how dephosphorylation of Bak contributes to its activation and conformational change, one-dimensional isoelectric focusing (1D-IEF) and mutagenesis was used to monitor Bak phosphorylation. On 1D-IEF, Bak extracted from a range of cell types migrated as a single band near the predicted isoelectric point of 5.6 both before and after phosphatase treatment, indicating that Bak is not significantly phosphorylated at any residue. In contrast, three engineered 'phosphotagged' Bak variants showed a second band at lower pI, indicating phosphorylation. Apoptosis induced by several stimuli failed to alter Bak pI, indicating little change in phosphorylation status. In addition, alanine substitution of tyrosine-108 and other putative phosphorylation sites failed to enhance Bak activation or pro-apoptotic function. In summary, Bak is not significantly phosphorylated at any residue, and Bak activation during apoptosis does not require dephosphorylation. PMID:23303126

  14. Microparticles from apoptotic platelets promote resident macrophage differentiation

    PubMed Central

    Vasina, E M; Cauwenberghs, S; Feijge, M A H; Heemskerk, J W M; Weber, C; Koenen, R R

    2011-01-01

    Platelets shed microparticles not only upon activation, but also upon ageing by an apoptosis-like process (apoptosis-induced platelet microparticles, PMap). While the activation-induced microparticles have widely been studied, not much is known about the (patho)physiological consequences of PMap formation. Flow cytometry and scanning electron microscopy demonstrated that PMap display activated integrins and interact to form microparticle aggregates. PMap were chemotactic for monocytic cells, bound to these cells, an furthermore stimulated cell adhesion and spreading on a fibronectin surface. After prolonged incubation, PMap promoted cell differentiation, but inhibited proliferation. Monocyte membrane receptor analysis revealed increased expression levels of CD11b (integrin αMβ2), CD14 and CD31 (platelet endothelial cell adhesion molecule-1), and the chemokine receptors CCR5 and CXCR4, but not of CCR2. This indicated that PMap polarized the cells into resident M2 monocytes. Cells treated with PMap actively consumed oxidized low-density lipoprotein (oxLDL), and released matrix metalloproteinases and hydrogen peroxide. Further confirmation for the differentiation towards resident professional phagocytes came from the finding that PMap stimulated the expression of the (ox)LDL receptors, CD36 and CD68, and the production of proinflammatory and immunomodulating cytokines by monocytes. In conclusion, interaction of PMap with monocytic cells has an immunomodulating potential. The apoptotic microparticles polarize the cells into a resident M2 subset, and induce differentiation to resident professional phagocytes. PMID:21956548

  15. Genes of the mitochondrial apoptotic pathway in Mytilus galloprovincialis.

    PubMed

    Estévez-Calvar, Noelia; Romero, Alejandro; Figueras, Antonio; Novoa, Beatriz

    2013-01-01

    Bivalves play vital roles in marine, brackish, freshwater and terrestrial habitats. In recent years, these ecosystems have become affected through anthropogenic activities. The ecological success of marine bivalves is based on the ability to modify their physiological functions in response to environmental changes. One of the most important mechanisms involved in adaptive responses to environmental and biological stresses is apoptosis, which has been scarcely studied in mollusks, although the final consequence of this process, DNA fragmentation, has been frequently used for pollution monitoring. Environmental stressors induce apoptosis in molluscan cells via an intrinsic pathway. Many of the proteins involved in vertebrate apoptosis have been recognized in model invertebrates; however, this process might not be universally conserved. Mytilus galloprovincialis is presented here as a new model to study the linkage between molecular mechanisms that mediate apoptosis and marine bivalve ecological adaptations. Therefore, it is strictly necessary to identify the key elements involved in bivalve apoptosis. In the present study, six mitochondrial apoptotic-related genes were characterized, and their gene expression profiles following UV irradiation were evaluated. This is the first step for the development of potential biomarkers to assess the biological responses of marine organisms to stress. The results confirmed that apoptosis and, more specifically, the expression of the genes involved in this process can be used to assess the biological responses of marine organisms to stress.

  16. Evidence of apoptotic cell death in HIV encephalitis.

    PubMed Central

    Petito, C. K.; Roberts, B.

    1995-01-01

    The mechanism of cell death in the brains of patients with acquired immune deficiency syndrome was examined in 15 cases, 8 of whom had human immunodeficiency virus (HIV) encephalitis, and in 8 control cases. Postmortem formalin-fixed, paraffin-embedded sections were prepared for routine histology and immunohistochemistry to detect cell-specific antigens. Apoptosis was detected by its morphology and by in situ end labeling of its characteristic oligonucleosomal fragments. Combined in situ end labeling and immunohistochemistry identified specific cell types. Six acquired immune deficiency syndrome brains, 5 of which had HIV encephalitis, contained positive nuclei by in situ end labeling. Co-labeling studies identified the cells as neurons, reactive astrocytes, and, rarely, the multinucleated giant cells of HIV encephalitis. The only control with nuclei positive by in situ end labeling had hepatic encephalopathy and Alzheimer type II astrocytes; the location and absence of cell-specific markers suggested a glial origin for the labeled cells. These results demonstrate that at least some neuronal and astrocytic death in HIV infection occurs by apoptosis. Its stimuli are unknown, but likely candidates include tumor necrosis factor or HIV viral products. Additionally, we hypothesize that apoptotic death of reactive astrocytes may be a normal mechanism whereby the brain removes an excess number of astrocytes that have proliferated after certain types of brain injury. Images Figure 1 Figure 2 Figure 3 Figure 5 Figure 4 PMID:7747806

  17. Lysosomal photodamage induces cell death via mitochondrial apoptotic pathway

    NASA Astrophysics Data System (ADS)

    Liu, Lei; Wang, Xian-wang; Li, Hui

    2009-11-01

    Lysosomal photosensitizers have been used in photodynamic therapy (PDT). Combination of such photosensitizers and light causes lysosomal photodamage, inducing cell death. The lysosomal disruption can lead to apoptosis but its signaling pathways remain to be elucidated. In this study, we selected N-aspartyl chlorin e6 (NPe6), an effective photosensitizer which preferentially accumulates in lysosomes, to study the mechanism of apoptosis caused by lysosomal photodamage. Apoptosis in living human lung adenocarcinoma cells treated by NPe6-PDT was studied using real-time single-cell analysis. In this study, the fluorescence probes Cyto c-GFP and DsRed-Mit were used to detect the spatial and temporal changes of cytochrome c in real-time in sub-cell level; the Rhodamine 123 dyes were used to monitor the changes of mitochondrial membrane potential. The results showed that, after PDT treatment,the mitochondrial membrane potential decreased, and cytochrome c released from mitochondria; The caspase-3 was activated obviously. These results suggested that lysosomal photodamage activates mitochondrial apoptotic pathway to induce cell death.

  18. 33 CFR 149.691 - What means of escape are required?

    Code of Federal Regulations, 2010 CFR

    2010-07-01

    ... and secondary means of escape. Each of these means must either: (1) Comply with 46 CFR 108.151; or (2... in 29 CFR 1910.2, for use in evacuating the port. (b) A primary means of escape consists of a fixed... fixed stairway or a fixed ladder, constructed of steel; or (2) A marine evacuation system, a...

  19. Treatment of Escape-Maintained Behavior with Positive Reinforcement: The Role of Reinforcement Contingency and Density

    ERIC Educational Resources Information Center

    Ingvarsson, Einar T.; Hanley, Gregory P.; Welter, Katherine M.

    2009-01-01

    Functional analyses suggested that the disruptive behavior of three preschool children was maintained by escape from demands. While keeping the escape contingency intact, we conducted (a) a density analysis in which the children earned preferred items for task completion according to two schedules that varied in reinforcement density, and (b) a…

  20. Anticipating and blocking HIV-1 escape by second generation antiviral shRNAs

    PubMed Central

    2010-01-01

    Background RNA interference (RNAi) is an evolutionary conserved gene silencing mechanism that mediates the sequence-specific breakdown of target mRNAs. RNAi can be used to inhibit HIV-1 replication by targeting the viral RNA genome. However, the error-prone replication machinery of HIV-1 can generate RNAi-resistant variants with specific mutations in the target sequence. For durable inhibition of HIV-1 replication the emergence of such escape viruses must be controlled. Here we present a strategy that anticipates HIV-1 escape by designing 2nd generation short hairpin RNAs (shRNAs) that form a complete match with the viral escape sequences. Results To block the two favorite viral escape routes observed when the HIV-1 integrase gene sequence is targeted, the original shRNA inhibitor was combined with two 2nd generation shRNAs in a single lentiviral expression vector. We demonstrate in long-term viral challenge experiments that the two dominant viral escape routes were effectively blocked. Eventually, virus breakthrough did however occur, but HIV-1 evolution was skewed and forced to use new escape routes. Conclusion These results demonstrate the power of the 2nd generation RNAi concept. Popular viral escape routes are blocked by the 2nd generation RNAi strategy. As a consequence viral evolution was skewed leading to new escape routes. These results are of importance for a deeper understanding of HIV-1 evolution under RNAi pressure. PMID:20529316