Direct block by bisindolylmaleimide of rat Kv1.5 expressed in Chinese hamster ovary cells.

PubMed

Choi, B H; Choi, J S; Jeong, S W; Hahn, S J; Yoon, S H; Jo, Y H; Kim, M S

2000-05-01

The interaction of bisindolylmaleimide (BIM), widely used as a specific protein kinase C (PKC) inhibitor, with rat brain Kv1.5 (rKv1.5) channels stably expressed in Chinese hamster ovary cells was investigated using the whole-cell patch-clamp technique. BIM (I) and its inactive analog, BIM (V), inhibited rKv1.5 currents at +50 mV in a reversible concentration-dependent manner with an apparent K(d) value of 0.38 and 1.70 microM, respectively. BIM (I) accelerated the decay rate of inactivation of rKv1.5 currents but did not significantly modify the kinetics of current activation. Other specific PKC inhibitors, chelerythrine and PKC 19-36, had no effect on rKv1.5 and did not prevent the inhibitory effect of BIM (I). The inhibition of rKv1.5 by BIM (I) and BIM (V) was highly voltage-dependent between -30 and 0 mV (voltage range of channel opening), suggesting that both drugs interact preferentially with the open state of the channel. The additional inhibition by BIM (I) displayed a voltage dependence (delta = 0.19) in the full activation voltage range positive to 0 mV, but was not shown in BIM (V) (delta = 0). The rate constants of association and dissociation for BIM (I) were 9.63 microM(-1) s(-1) and 5.82 s(-1), respectively. BIM (I) increased the time constant of deactivation of tail currents from 26. 35 to 45.79 ms, resulting in tail crossover phenomenon. BIM (I) had no effect on the voltage dependence of steady-state inactivation. BIM (I) produced use-dependent inhibition of rKv1.5, which was consistent with the slow recovery from inactivation in the presence of drug. These results suggest that BIM (I) directly inhibits rKv1.5 channels in a phosphorylation-independent, and state-, voltage-, time-, and use-dependent manner.

Polarity effects and apparent ion recombination in microionization chambers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Miller, Jessica R., E-mail: miller@humonc.wisc.edu; Hooten, Brian D.; Micka, John A.

Purpose: Microchambers demonstrate anomalous voltage-dependent polarity effects. Existing polarity and ion recombination correction factors do not account for these effects. As a result, many commercial microchamber models do not meet the specification of a reference-class ionization chamber as defined by the American Association of Physicists in Medicine. The purpose of this investigation is to determine the cause of these voltage-dependent polarity effects. Methods: A series of microchamber prototypes were produced to isolate the source of the voltage-dependent polarity effects. Parameters including ionization-chamber collecting-volume size, stem and cable irradiation, chamber assembly, contaminants, high-Z materials, and individual chamber components were investigated. Measurementsmore » were performed with electrodes coated with graphite to isolate electrode conductivity. Chamber response was measured as the potential bias of the guard electrode was altered with respect to the collecting electrode, through the integration of additional power supplies. Ionization chamber models were also simulated using COMSOL Multiphysics software to investigate the effect of a potential difference between electrodes on electric field lines and collecting volume definition. Results: Investigations with microchamber prototypes demonstrated that the significant source of the voltage-dependent polarity effects was a potential difference between the guard and collecting electrodes of the chambers. The voltage-dependent polarity effects for each prototype were primarily isolated to either the guard or collecting electrode. Polarity effects were reduced by coating the isolated electrode with a conductive layer of graphite. Polarity effects were increased by introducing a potential difference between the electrodes. COMSOL simulations further demonstrated that for a given potential difference between electrodes, the collecting volume of the chamber changed as the applied voltage was altered, producing voltage-dependent polarity effects in the chamber response. Ionization chamber measurements and COMSOL simulations demonstrated an inverse relationship between the chamber collecting volume size and the severity of voltage-dependent polarity effects on chamber response. The effect of a given potential difference on chamber polarity effects was roughly ten times greater for microchambers as compared to Farmer-type chambers. Stem and cable irradiations, chamber assembly, contaminants, and high-Z materials were not found to be a significant source of the voltage-dependent polarity effects. Conclusions: A potential difference between the guard and collecting electrodes was found to be the primary source of the voltage-dependent polarity effects demonstrated by microchambers. For a given potential difference between electrodes, the relative change in the collecting volume is smaller for larger-volume chambers, illustrating why these polarity effects are not seen in larger-volume chambers with similar guard and collecting electrode designs. Thus, for small-volume chambers, it is necessary to reduce the potential difference between the guard and collecting electrodes in order to reduce polarity effects for reference dosimetry measurements.« less

Update on the mechanism of action of antiepileptic drugs.

PubMed

Meldrum, B S

1996-01-01

Novel antiepileptic drugs (AEDs) are thought to act on voltage-sensitive ion channels, on inhibitory neurotransmission or on excitatory neurotransmission. Two successful examples of rational AED design that potentiate GABA-mediated inhibition are vigabatrin (VGB) by irreversible inhibition of GABA-transaminase, and tiagabine (TGB) by blocking GABA uptake. Lamotrigine (LTG) prolongs inactivation of voltage-dependent sodium channels. The anticonvulsant action of remacemide (RCM) is probably largely due to blockade of NMDA receptors and prolonged inactivation of sodium channels induced by its desglycinated metabolite. Felbamate (FBM) apparently blocks NMDA receptors, potentiates GABA-mediated responses, blocks L-type calcium channels, and possibly also prolongs sodium channel inactivation. Similarly, topiramate (TPM) has multiple probable sites of action, including sodium channels, GABA receptors, and glutamate (AMPA) receptors. Gabapentin (GBP) apparently has a completely novel type of action, probably involving potentiation of GABA-mediated inhibition and possibly also inactivation of sodium channels. The therapeutic advantages of the novel AEDs are as yet only partially explained by our present understanding of their mechanisms of action.

Energetics of sodium transport in toad urinary bladder.

PubMed Central

Canessa, M; Labarca, P; DiBona, D R; Leaf, A

1978-01-01

The ratio of the rate of transepithelial sodium transport, JNa, across the isolated toad urinary bladder to the simultaneously measured rate of transport-dependent metabolism, JsbCO2, has been measured as a function of the transepithelial electrical voltage, deltapsi. The ratio remains constant with a mean value of 18 to 20 over the range of imposed voltages of 0 to +70 mV. With increasing hyperpolarization of the bladder, JNa decreases and the calculated electromotive force or apparent "ENa" of the sodium pump increases. From thermodynamic and kinetic arguments it is shown that the apparent "ENa" approaches the maximal electrochemical potential gradient, ENa, against which sodium can be transported by this tissue only when JNa approximately 0. At this unique condition F ENa (in which F is the Faraday constant) is the maximal free energy of the chemical reaction driving sodium transport and thus equal to the maximal extramitochondrial phosphorylation potential and the maximal free energy of the mitochondrial respiratory chain within the transporting cells. PMID:100789

Traps in AlGaN /GaN/SiC heterostructures studied by deep level transient spectroscopy

NASA Astrophysics Data System (ADS)

Fang, Z.-Q.; Look, D. C.; Kim, D. H.; Adesida, I.

2005-10-01

AlGaN /GaN/SiC Schottky barrier diodes (SBDs), with and without Si3N4 passivation, have been characterized by temperature-dependent current-voltage and capacitance-voltage measurements, and deep level transient spectroscopy (DLTS). A dominant trap A1, with activation energy of 1.0 eV and apparent capture cross section of 2×10-12cm2, has been observed in both unpassivated and passivated SBDs. Based on the well-known logarithmic dependence of DLTS peak height with filling pulse width for a line-defect related trap, A1, which is commonly observed in thin GaN layers grown by various techniques, is believed to be associated with threading dislocations. At high temperatures, the DLTS signal sometimes becomes negative, likely due to an artificial surface-state effect.

Ph-Dependent Inhibition of Voltage-Gated H+ Currents in Rat Alveolar Epithelial Cells by Zn2+ and Other Divalent Cations

PubMed Central

Cherny, Vladimir V.; DeCoursey, Thomas E.

1999-01-01

Inhibition by polyvalent cations is a defining characteristic of voltage-gated proton channels. The mechanism of this inhibition was studied in rat alveolar epithelial cells using tight-seal voltage clamp techniques. Metal concentrations were corrected for measured binding to buffers. Externally applied ZnCl2 reduced the H+ current, shifted the voltage-activation curve toward positive potentials, and slowed the turn-on of H+ current upon depolarization more than could be accounted for by a simple voltage shift, with minimal effects on the closing rate. The effects of Zn2+ were inconsistent with classical voltage-dependent block in which Zn2+ binds within the membrane voltage field. Instead, Zn2+ binds to superficial sites on the channel and modulates gating. The effects of extracellular Zn2+ were strongly pHo dependent but were insensitive to pHi, suggesting that protons and Zn2+ compete for external sites on H+ channels. The apparent potency of Zn2+ in slowing activation was ∼10× greater at pHo 7 than at pHo 6, and ∼100× greater at pHo 6 than at pHo 5. The pHo dependence suggests that Zn2+, not ZnOH+, is the active species. Evidently, the Zn2+ receptor is formed by multiple groups, protonation of any of which inhibits Zn2+ binding. The external receptor bound H+ and Zn2+ with pK a 6.2–6.6 and pK M 6.5, as described by several models. Zn2+ effects on the proton chord conductance–voltage (g H–V) relationship indicated higher affinities, pK a 7 and pK M 8. CdCl2 had similar effects as ZnCl2 and competed with H+, but had lower affinity. Zn2+ applied internally via the pipette solution or to inside-out patches had comparatively small effects, but at high concentrations reduced H+ currents and slowed channel closing. Thus, external and internal zinc-binding sites are different. The external Zn2+ receptor may be the same modulatory protonation site(s) at which pHo regulates H+ channel gating. PMID:10578017

Temperature dependence of current-and capacitance-voltage characteristics of an Au/4H-SiC Schottky diode

NASA Astrophysics Data System (ADS)

Gülnahar, Murat

2014-12-01

In this study, the current-voltage (I-V) and capacitance-voltage (C-V) measurements of an Au/4H-SiC Schottky diode are characterized as a function of the temperature in 50-300 K temperature range. The experimental parameters such as ideality factor and apparent barrier height presents to be strongly temperature dependent, that is, the ideality factor increases and the apparent barrier height decreases with decreasing temperature, whereas the barrier height values increase with the temperature for C-V data. Likewise, the Richardson plot deviates at low temperatures. These anomaly behaviors observed for Au/4H-SiC are attributed to Schottky barrier inhomogeneities. The barrier anomaly which relates to interface of Au/4H-SiC is also confirmed by the C-V measurements versus the frequency measured in 300 K and it is interpreted by both Tung's lateral inhomogeneity model and multi-Gaussian distribution approach. The values of the weighting coefficients, standard deviations and mean barrier height are calculated for each distribution region of Au/4H-SiC using the multi-Gaussian distribution approach. In addition, the total effective area of the patches NAe is obtained at separate temperatures and as a result, it is expressed that the low barrier regions influence meaningfully to the current transport at the junction. The homogeneous barrier height value is calculated from the correlation between the ideality factor and barrier height and it is noted that the values of standard deviation from ideality factor versus q/3kT curve are in close agreement with the values obtained from the barrier height versus q/2kT variation. As a result, it can be concluded that the temperature dependent electrical characteristics of Au/4H-SiC can be successfully commented on the basis of the thermionic emission theory with both models.

Diverse inhibitory actions of quaternary ammonium cholinesterase inhibitors on Torpedo nicotinic ACh receptors transplanted to Xenopus oocytes

PubMed Central

Olivera-Bravo, Silvia; Ivorra, Isabel; Morales, Andrés

2007-01-01

Background and purpose: This work was aimed at comparing and analysing the effects and mechanisms of action of the quaternary ammonium cholinesterase inhibitors (QChEIs) BW284c51, decamethonium and edrophonium, on nicotinic ACh receptor (nAChR) function. Experimental approach: nAChRs purified from Torpedo electroplax were transplanted to oocytes and currents elicited by ACh (IACh) either alone or in presence of these QChEIs were recorded. Key results: None of the QChEIs, by itself, elicited changes in membrane conductance; however, when co-applied with ACh, all of them decreased IACh in a concentration-dependent way. The mechanisms of nAChR inhibition were different for these QChEIs. BW284c51 blockade was non-competitive and voltage-dependent, although it also affected the nH of the dose-response curve. By contrast, decamethonium and edrophonium inhibition, at –60 mV, was apparently competitive and did not modify either desensitisation or nH. Decamethonium effects were voltage-independent and washed out slowly after its removal; by contrast, edrophonium blockade had strong voltage dependence and its effects disappeared quickly after its withdrawal. Analysis of the voltage-dependent blockade indicated that BW284c51 bound to a shallow site into the channel pore, whereas edrophonium bound to a deeper locus. Accordingly, additive inhibitory effects on IACh were found among any pairs of these QChEIs. Conclusions and implications: The tested QChEIs bound to the nAChR at several and different loci, which might account for their complex inhibitory behaviour, acting both as allosteric effectors and, in the case of BW284c51 and edrophonium, as open channel blockers. PMID:17572698

Polarization and Fowler-Nordheim tunneling in anodized Al-Al2O3-Au diodes

NASA Astrophysics Data System (ADS)

Hickmott, T. W.

2000-06-01

Polarization in anodic Al2O3 films is measured by using quasi-dc current-voltage (I-V) curves of Al-Al2O3-Au diodes. A reproducible polarization state is established by applying a negative voltage to the Au electrode of a rectifying Al-Al2O3-Au diode. The difference between subsequent I-V curves with Au positive is a measure of polarization in the sample. The magnitude of polarization charge in Al2O3 depends on the anodizing electrolyte. Al2O3 films formed in H2O-based electrolytes have approximately ten times the polarization charge of Al2O3 films formed in ethylene glycol-based electrolyte. Anodizing conditions that produce greater polarizing charge in anodic Al2O3 result in voltage-time curves during anodization under galvanostatic conditions that are nonlinear. Anodic films with greater polarizing charge also have a greater apparent interface capacitance which is independent of Al2O3 thickness. I-V curves of Al-Al2O3-Au diodes for increasing voltage are dominated by polarization. I-V curves for decreasing voltage are reproducible and parallel but depend on the maximum current and voltage reached during the measurement. There is no single current corresponding to a given voltage. I-V curves for decreasing voltage are analyzed assuming that the conduction mechanism is Fowler-Nordheim (FN) tunneling. There is a qualitative difference between the FN tunneling parameters for Al2O3 films formed in H2O-based electrolytes and those formed in ethylene glycol-based electrolyte. For the former the value of the exponential term in the FN analysis increases as the value of maximum voltage and current in an I-V characteristic increases, while the value of the pre-exponential term is nearly constant. For the latter, the exponential term is nearly constant as maximum voltage and current increase, but the pre-exponential term decreases by about 5 decades. Thus polarization charge incorporated during formation of anodized Al2O3 strongly affects the formation of the insulating film, the stability of the films under bias, and their conduction characteristics.

The human two-pore channel 1 is modulated by cytosolic and luminal calcium

PubMed Central

Lagostena, Laura; Festa, Margherita; Pusch, Michael; Carpaneto, Armando

2017-01-01

Two-pore channels (TPC) are intracellular endo-lysosomal proteins with only recently emerging roles in organellar signalling and involvement in severe human diseases. Here, we investigated the functional properties of human TPC1 expressed in TPC-free vacuoles from Arabidopsis thaliana cells. Large (20 pA/pF) TPC1 currents were elicited by cytosolic addition of the phosphoinositide phosphatidylinositol-(3,5)-bisphosphate (PI(3,5)P2) with an apparent binding constant of ~15 nM. The channel is voltage-dependent, activating at positive potentials with single exponential kinetics and currents are Na+ selective, with measurable but low permeability to Ca2+. Cytosolic Ca2+ modulated hTPC1 in dual way: low μM cytosolic Ca2+ increased activity by shifting the open probability towards negative voltages and by accelerating the time course of activation. This mechanism was well-described by an allosteric model. Higher levels of cytosolic Ca2+ induced a voltage-dependent decrease of the currents compatible with Ca2+ binding in the permeation pore. Conversely, an increase in luminal Ca2+ decreased hTPC1 activity. Our data point to a process in which Ca2+ permeation in hTPC1 has a positive feedback on channel activity while Na+ acts as a negative regulator. We speculate that the peculiar Ca2+ and Na+ dependence are key for the physiological roles of the channel in organellar homeostasis and signalling. PMID:28252105

Mechanism of block by tedisamil of transient outward current in human ventricular subepicardial myocytes

PubMed Central

Wettwer, Erich; Himmel, Herbert M; Amos, Gregory J; Li, Qi; Metzger, Franz; Ravens, Ursula

1998-01-01

Tedisamil is a new antiarrhythmic drug with predominant class III action. The aim of the present study was to investigate the blocking pattern of the compound on the transient outward current (Ito) in human subepicardial myocytes isolated from explanted left ventricles. Using the single electrode whole cell voltage clamp technique, Ito was analysed after appropriate voltage inactivation of sodium current and block of calcium current.Tedisamil reduced the amplitude of peak Ito, but did not affect the amplitude of non-inactivating outward current. The drug accelerated the apparent rate of Ito inactivation. The reduction in time constant of Ito inactivation depended on drug concentration, the apparent IC50 value was 4.4 μM.Tedisamil affected Ito amplitude in a use-dependent manner. After 2 min at −80 mV, maximum block of Ito was reached after 4–5 clamp steps either at the frequency of 0.2 or 2 Hz, indicating that the block was not frequency-dependent in an experimentally relevant range. Recovery from block was very slow and proceeded with a time constant of 12.1±1.8 s. Also in the presence of drug, a fraction of channels recovered from inactivation with a similar time constant as in control myocytes (i.e. 81±40 ms and 51±8 ms, respectively, n.s.).From the onset of fractional block of Ito by tedisamil during the initial 60 ms of a clamp step, we calculated k1=9×106 mol−1 s−1 for the association rate constant, and k2=23 s−1 for the dissociation rate constant. The resulting apparent KD was 2.6 μM and is similar to the IC50 value.The effects of tedisamil on Ito could be simulated by assuming a four state channel model where the drug binds to the channel in an open (activated) conformation. It is concluded that in human subepicardial myocytes tedisamil is an open channel blocker of Ito and that this effect probably contributes to the antiarrhythmic potential of this drug. PMID:9831899

Variable electronic stripe structures of the parent iron-chalcogenide superconductor Fe1 +dTe observed by STM-STS

NASA Astrophysics Data System (ADS)

Sugimoto, Akira; Ekino, Toshikazu; Gabovich, Alexander M.

2014-12-01

Nanoscale stripe structures of the parent iron-11 superconductor Fe1.033Te were investigated using low-temperature scanning tunnel microscopy-scanning tunnel spectroscopy (STM-STS). STM topographies and d I /d V maps show clear stripe structures with the bias-dependent multiple periods 2 ×a0 and a0, where a0 is the lattice constant ˜0.38 nm. The form of the stripe structures seen on d I /d V maps strongly depends on the bias voltage. Varying stripe structures are apparently driven by magnetic order appearing below the transition temperature Ts˜72 K, that is defined by the noticeable drop in the temperature dependence of resistivity, and are strongly influenced by the underlying excess Fe.

‘Sleepy’ inward rectifier channels in guinea-pig cardiomyocytes are activated only during strong hyperpolarization

PubMed Central

Liu, Gong Xin; Daut, Jürgen

2002-01-01

K+ channels of isolated guinea-pig cardiomyocytes were studied using the patch-clamp technique. At transmembrane potentials between −120 and −220 mV we observed inward currents through an apparently novel channel. The novel channel was strongly rectifying, no outward currents could be recorded. Between −200 and −160 mV it had a slope conductance of 42.8 ± 3.0 pS (s.d.; n = 96). The open probability (Po) showed a sigmoid voltage dependence and reached a maximum of 0.93 at −200 mV, half-maximal activation was approximately −150 mV. The voltage dependence of Po was not affected by application of 50 μm isoproterenol. The open-time distribution could be described by a single exponential function, the mean open time ranged between 73.5 ms at −220 mV and 1.4 ms at −160 mV. At least two exponential components were required to fit the closed time distribution. Experiments with different external Na+, K+ and Cl− concentrations suggested that the novel channel is K+ selective. Extracellular Ba2+ ions gave rise to a voltage-dependent reduction in Po by inducing long closed states; Cs+ markedly reduced mean open time at −200 mV. In cell-attached recordings the novel channel frequently converted to a classical inward rectifier channel, and vice versa. This conversion was not voltage dependent. After excision of the patch, the novel channel always converted to a classical inward rectifier channel within 0–3 min. This conversion was not affected by intracellular Mg2+, phosphatidylinositol (4,5)-bisphosphate or spermine. Taken together, our findings suggest that the novel K+ channel represents a different ‘mode’ of the classical inward rectifier channel in which opening occurs only at very negative potentials. PMID:11897847

Spinocerebellar ataxia type 6 knockin mice develop a progressive neuronal dysfunction with age-dependent accumulation of mutant CaV2.1 channels

PubMed Central

Watase, Kei; Barrett, Curtis F.; Miyazaki, Taisuke; Ishiguro, Taro; Ishikawa, Kinya; Hu, Yuanxin; Unno, Toshinori; Sun, Yaling; Kasai, Sayumi; Watanabe, Masahiko; Gomez, Christopher M.; Mizusawa, Hidehiro; Tsien, Richard W.; Zoghbi, Huda Y.

2008-01-01

Spinocerebellar ataxia type 6 (SCA6) is a neurodegenerative disorder caused by CAG repeat expansions within the voltage-gated calcium (CaV) 2.1 channel gene. It remains controversial whether the mutation exerts neurotoxicity by changing the function of CaV2.1 channel or through a gain-of-function mechanism associated with accumulation of the expanded polyglutamine protein. We generated three strains of knockin (KI) mice carrying normal, expanded, or hyperexpanded CAG repeat tracts in the Cacna1a locus. The mice expressing hyperexpanded polyglutamine (Sca684Q) developed progressive motor impairment and aggregation of mutant CaV2.1 channels. Electrophysiological analysis of cerebellar Purkinje cells revealed similar Ca2+ channel current density among the three KI models. Neither voltage sensitivity of activation nor inactivation was altered in the Sca684Q neurons, suggesting that expanded CAG repeat per se does not affect the intrinsic electrophysiological properties of the channels. The pathogenesis of SCA6 is apparently linked to an age-dependent process accompanied by accumulation of mutant CaV2.1 channels. PMID:18687887

Spatial orientation and electric-field-driven transport of hypericin inside of bilayer lipid membranes.

PubMed

Strejčková, Alena; Staničová, Jana; Jancura, Daniel; Miškovský, Pavol; Bánó, Gregor

2013-02-07

Fluorescence experiments were carried out to investigate the interaction of hypericin (Hyp), a natural hydrophobic photosensitizer, with artificial bilayer lipid membranes. The spatial orientation of Hyp monomers incorporated in diphytanoyl phosphatidylcholine (DPhPC) membranes was determined by measuring the dependence of the Hyp fluorescence intensity on the angle of incidence of p- and s-polarized excitation laser beams. Inside of the membrane, Hyp monomers are preferentially located in the layers near the membrane/water interface and are oriented with the S(1) ← S(0) transition dipole moments perpendicular to the membrane surface. Transport of Hyp anions between the two opposite sides of the lipid bilayer was induced by applying rectangular electric field pulses to the membrane. The characteristic time for Hyp transport through the membrane center was evaluated by the analysis of the Hyp fluorescence signal during the voltage pulses. In the zero-voltage limit, the transport time approached 70 ms and gradually decreased with higher voltage applied to the membrane. In addition, our measurements indicated an apparent pK(a) constant of 8 for Hyp deprotonation in the membrane.

The amiodarone derivative KB130015 activates hERG1 potassium channels via a novel mechanism

PubMed Central

Gessner, Guido; Macianskiene, Regina; Starkus, John G.; Schönherr, Roland; Heinemann, Stefan H.

2010-01-01

Human ether à go-go related gene (hERG1) potassium channels underlie the repolarizing IKr current in the heart. Since they are targets of various drugs with cardiac side effects we tested whether the amiodarone derivative 2-methyl-3-(3,5-diiodo-4-carboxymethoxybenzyl)benzofuran (KB130015) blocks hERG1 channels like its parent compound. Using patch-clamp and two-electrode voltage-clamp techniques we found that KB130015 blocks native and recombinant hERG1 channels at high voltages, but it activates them at low voltages. The activating effect has an apparent EC50 value of 12 μM and is brought about by an about 4-fold acceleration of activation kinetics and a shift in voltage-dependent activation by −16 mV. Channel activation was not use-dependent and was independent of inactivation gating. KB130015 presumably binds to the hERG1 pore from the cytosolic side and functionally competes with hERG1 block by amiodarone, E4031 (N-[4-[[1-[2-(6-methyl-2-pyridinyl)ethyl] -4-piperidinyl] carbonyl] phenyl] methanesulfonamide dihydrochloride), and sertindole. Vice versa, amiodarone attenuates hERG1 activation by KB130015. Based on synergic channel activation by mallotoxin and KB130015 we conclude that the hERG1 pore contains at least two sites for activators that are functionally coupled among each other and to the cavity-blocker site. KB130015 and amiodarone may serve as lead structures for the identification of hERG1 pore-interacting drugs favoring channel activation vs. block. PMID:20097192

Voltage Dependence of a Neuromodulator-Activated Ionic Current.

PubMed

Gray, Michael; Golowasch, Jorge

2016-01-01

The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca(2+), but that, in conditions of low Ca(2+), calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca(2+)/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR.

Voltage Dependence of a Neuromodulator-Activated Ionic Current123

PubMed Central

2016-01-01

Abstract The neuromodulatory inward current (IMI) generated by crab Cancer borealis stomatogastric ganglion neurons is an inward current whose voltage dependence has been shown to be crucial in the activation of oscillatory activity of the pyloric network of this system. It has been previously shown that IMI loses its voltage dependence in conditions of low extracellular calcium, but that this effect appears to be regulated by intracellular calmodulin. Voltage dependence is only rarely regulated by intracellular signaling mechanisms. Here we address the hypothesis that the voltage dependence of IMI is mediated by intracellular signaling pathways activated by extracellular calcium. We demonstrate that calmodulin inhibitors and a ryanodine antagonist can reduce IMI voltage dependence in normal Ca2+, but that, in conditions of low Ca2+, calmodulin activators do not restore IMI voltage dependence. Further, we show evidence that CaMKII alters IMI voltage dependence. These results suggest that calmodulin is necessary but not sufficient for IMI voltage dependence. We therefore hypothesize that the Ca2+/calmodulin requirement for IMI voltage dependence is due to an active sensing of extracellular calcium by a GPCR family calcium-sensing receptor (CaSR) and that the reduction in IMI voltage dependence by a calmodulin inhibitor is due to CaSR endocytosis. Supporting this, preincubation with an endocytosis inhibitor prevented W7 (N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide hydrochloride)-induced loss of IMI voltage dependence, and a CaSR antagonist reduced IMI voltage dependence. Additionally, myosin light chain kinase, which is known to act downstream of the CaSR, seems to play a role in regulating IMI voltage dependence. Finally, a Gβγ-subunit inhibitor also affects IMI voltage dependence, in support of the hypothesis that this process is regulated by a G-protein-coupled CaSR. PMID:27257619

Comparison of the quantitative analysis performance between pulsed voltage atom probe and pulsed laser atom probe.

PubMed

Takahashi, J; Kawakami, K; Raabe, D

2017-04-01

The difference in quantitative analysis performance between the voltage-mode and laser-mode of a local electrode atom probe (LEAP3000X HR) was investigated using a Fe-Cu binary model alloy. Solute copper atoms in ferritic iron preferentially field evaporate because of their significantly lower evaporation field than the matrix iron, and thus, the apparent concentration of solute copper tends to be lower than the actual concentration. However, in voltage-mode, the apparent concentration was higher than the actual concentration at 40K or less due to a detection loss of matrix iron, and the concentration decreased with increasing specimen temperature due to the preferential evaporation of solute copper. On the other hand, in laser-mode, the apparent concentration never exceeded the actual concentration, even at lower temperatures (20K), and this mode showed better quantitative performance over a wide range of specimen temperatures. These results indicate that the pulsed laser atom probe prevents both detection loss and preferential evaporation under a wide range of measurement conditions. Copyright © 2017 Elsevier B.V. All rights reserved.

Characterization of the cardiac Na+/K+ pump by development of a comprehensive and mechanistic model.

PubMed

Oka, Chiaki; Cha, Chae Young; Noma, Akinori

2010-07-07

A large amount of experimental data on the characteristics of the cardiac Na(+)/K(+) pump have been accumulated, but it remains difficult to predict the quantitative contribution of the pump in an intact cell because most measurements have been made under non-physiological conditions. To extrapolate the experimental findings to intact cells, we have developed a comprehensive Na(+)/K(+) pump model based on the thermodynamic framework (Smith and Crampin, 2004) of the Post-Albers reaction cycle combined with access channel mechanisms. The new model explains a variety of experimental results for the Na(+)/K(+) pump current (I(NaK)), including the dependency on the concentrations of Na(+) and K(+), the membrane potential and the free energy of ATP hydrolysis. The model demonstrates that both the apparent affinity and the slope of the substrate-I(NaK) relationship measured experimentally are affected by the composition of ions in the extra- and intracellular solutions, indirectly through alteration in the probability distribution of individual enzyme intermediates. By considering the voltage dependence in the Na(+)- and K(+)-binding steps, the experimental voltage-I(NaK) relationship could be reconstructed with application of experimental ionic compositions in the model, and the view of voltage-dependent K(+) binding was supported. Re-evaluation of charge movements accompanying Na(+) and K(+) translocations gave a reasonable number for the site density of the Na(+)/K(+) pump on the membrane. The new model is relevant for simulation of cellular functions under various interventions, such as depression of energy metabolism. (c) 2010 Elsevier Ltd. All rights reserved.

Voltage dependence of acetylcholine receptor channel gating in rat myoballs

PubMed Central

1992-01-01

Whole-cell currents from nicotinic acetylcholine receptor (AChR) channels were studied in rat myoballs using a light-activated agonist to determine the voltage dependence of the macroscopic opening and closing rate constants. Myoballs were bathed in a solution containing a low concentration of the inactive isomer of the photoisomerizable azobenzene derivative, cis-Bis-Q. A light flash was then presented to produce a known concentration jump of agonist, trans-Bis-Q, across a wide range of membrane potentials in symmetrical solutions (NaCl or CsCl on both sides) or asymmetrical solutions (NaCl in the bath and CsCl in the pipette). At the low agonist concentration used in this study, the reciprocal of the macroscopic time constants gives an unambiguous measure of the effective closing rate. It showed an exponential decrease with membrane hyperpolarization between +20 and - 100 mV, but tended to level off at more depolarized and at more hyperpolarized membrane potentials. The relative effective opening rate was derived from the steady-state conductance, the single-channel conductance, and the apparent closing rate; it decreased sharply in the depolarizing region and tended to level off and then turn up in the hyperpolarizing region. The two effective rate constants were shown to depend on the first, second, and third power of membrane potential. PMID:1460456

Activation of Ih and TTX-sensitive sodium current at subthreshold voltages during CA1 pyramidal neuron firing

PubMed Central

Yamada-Hanff, Jason

2015-01-01

We used dynamic clamp and action potential clamp techniques to explore how currents carried by tetrodotoxin-sensitive sodium channels and HCN channels (Ih) regulate the behavior of CA1 pyramidal neurons at resting and subthreshold voltages. Recording from rat CA1 pyramidal neurons in hippocampal slices, we found that the apparent input resistance and membrane time constant were strongly affected by both conductances, with Ih acting to decrease apparent input resistance and time constant and sodium current acting to increase both. We found that both Ih and sodium current were active during subthreshold summation of artificial excitatory postsynaptic potentials (EPSPs) generated by dynamic clamp, with Ih dominating at less depolarized voltages and sodium current at more depolarized voltages. Subthreshold sodium current—which amplifies EPSPs—was most effectively recruited by rapid voltage changes, while Ih—which blunts EPSPs—was maximal for slow voltage changes. The combined effect is to selectively amplify rapid EPSPs. We did similar experiments in mouse CA1 pyramidal neurons, doing voltage-clamp experiments using experimental records of action potential firing of CA1 neurons previously recorded in awake, behaving animals as command voltages to quantify flow of Ih and sodium current at subthreshold voltages. Subthreshold sodium current was larger and subthreshold Ih was smaller in mouse neurons than in rat neurons. Overall, the results show opposing effects of subthreshold sodium current and Ih in regulating subthreshold behavior of CA1 neurons, with subthreshold sodium current prominent in both rat and mouse CA1 pyramidal neurons and additional regulation by Ih in rat neurons. PMID:26289465

Voltage-dependent K+ channel gating and voltage sensor toxin sensitivity depend on the mechanical state of the lipid membrane.

PubMed

Schmidt, Daniel; MacKinnon, Roderick

2008-12-09

Voltage-dependent K(+) (Kv) channels underlie action potentials through gating conformational changes that are driven by membrane voltage. In this study of the paddle chimera Kv channel, we demonstrate that the rate of channel opening, the voltage dependence of the open probability, and the maximum achievable open probability depend on the lipid membrane environment. The activity of the voltage sensor toxin VsTx1, which interferes with voltage-dependent gating by partitioning into the membrane and binding to the channel, also depends on the membrane. Membrane environmental factors that influence channel function are divisible into two general categories: lipid compositional and mechanical state. The mechanical state can have a surprisingly large effect on the function of a voltage-dependent K(+) channel, including its pharmacological interaction with voltage sensor toxins. The dependence of VSTx1 activity on the mechanical state of the membrane leads us to hypothesize that voltage sensor toxins exert their effect by perturbing the interaction forces that exist between the channel and the membrane.

Voltage-dependent K+ channel gating and voltage sensor toxin sensitivity depend on the mechanical state of the lipid membrane

PubMed Central

Schmidt, Daniel; MacKinnon, Roderick

2008-01-01

Voltage-dependent K+ (Kv) channels underlie action potentials through gating conformational changes that are driven by membrane voltage. In this study of the paddle chimera Kv channel, we demonstrate that the rate of channel opening, the voltage dependence of the open probability, and the maximum achievable open probability depend on the lipid membrane environment. The activity of the voltage sensor toxin VsTx1, which interferes with voltage-dependent gating by partitioning into the membrane and binding to the channel, also depends on the membrane. Membrane environmental factors that influence channel function are divisible into two general categories: lipid compositional and mechanical state. The mechanical state can have a surprisingly large effect on the function of a voltage-dependent K+ channel, including its pharmacological interaction with voltage sensor toxins. The dependence of VSTx1 activity on the mechanical state of the membrane leads us to hypothesize that voltage sensor toxins exert their effect by perturbing the interaction forces that exist between the channel and the membrane. PMID:19050073

Actions and Mechanisms of Polyunsaturated Fatty Acids on Voltage-Gated Ion Channels.

PubMed

Elinder, Fredrik; Liin, Sara I

2017-01-01

Polyunsaturated fatty acids (PUFAs) act on most ion channels, thereby having significant physiological and pharmacological effects. In this review we summarize data from numerous PUFAs on voltage-gated ion channels containing one or several voltage-sensor domains, such as voltage-gated sodium (Na V ), potassium (K V ), calcium (Ca V ), and proton (H V ) channels, as well as calcium-activated potassium (K Ca ), and transient receptor potential (TRP) channels. Some effects of fatty acids appear to be channel specific, whereas others seem to be more general. Common features for the fatty acids to act on the ion channels are at least two double bonds in cis geometry and a charged carboxyl group. In total we identify and label five different sites for the PUFAs. PUFA site 1 : The intracellular cavity. Binding of PUFA reduces the current, sometimes as a time-dependent block, inducing an apparent inactivation. PUFA site 2 : The extracellular entrance to the pore. Binding leads to a block of the channel. PUFA site 3 : The intracellular gate. Binding to this site can bend the gate open and increase the current. PUFA site 4 : The interface between the extracellular leaflet of the lipid bilayer and the voltage-sensor domain. Binding to this site leads to an opening of the channel via an electrostatic attraction between the negatively charged PUFA and the positively charged voltage sensor. PUFA site 5 : The interface between the extracellular leaflet of the lipid bilayer and the pore domain. Binding to this site affects slow inactivation. This mapping of functional PUFA sites can form the basis for physiological and pharmacological modifications of voltage-gated ion channels.

Actions and Mechanisms of Polyunsaturated Fatty Acids on Voltage-Gated Ion Channels

PubMed Central

Elinder, Fredrik; Liin, Sara I.

2017-01-01

Polyunsaturated fatty acids (PUFAs) act on most ion channels, thereby having significant physiological and pharmacological effects. In this review we summarize data from numerous PUFAs on voltage-gated ion channels containing one or several voltage-sensor domains, such as voltage-gated sodium (NaV), potassium (KV), calcium (CaV), and proton (HV) channels, as well as calcium-activated potassium (KCa), and transient receptor potential (TRP) channels. Some effects of fatty acids appear to be channel specific, whereas others seem to be more general. Common features for the fatty acids to act on the ion channels are at least two double bonds in cis geometry and a charged carboxyl group. In total we identify and label five different sites for the PUFAs. PUFA site 1: The intracellular cavity. Binding of PUFA reduces the current, sometimes as a time-dependent block, inducing an apparent inactivation. PUFA site 2: The extracellular entrance to the pore. Binding leads to a block of the channel. PUFA site 3: The intracellular gate. Binding to this site can bend the gate open and increase the current. PUFA site 4: The interface between the extracellular leaflet of the lipid bilayer and the voltage-sensor domain. Binding to this site leads to an opening of the channel via an electrostatic attraction between the negatively charged PUFA and the positively charged voltage sensor. PUFA site 5: The interface between the extracellular leaflet of the lipid bilayer and the pore domain. Binding to this site affects slow inactivation. This mapping of functional PUFA sites can form the basis for physiological and pharmacological modifications of voltage-gated ion channels. PMID:28220076

Trans-channel interactions in batrachotoxin-modified skeletal muscle sodium channels: voltage-dependent block by cytoplasmic amines, and the influence of mu-conotoxin GIIIA derivatives and permeant ions.

PubMed

Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W; French, Robert J

2008-11-01

External mu-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two mu-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the mu-conotoxin and the DEA-binding site of approximately 15 A. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by approximately 4-fold; and 2), increasing external [Na(+)] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions.

Trans-Channel Interactions in Batrachotoxin-Modified Skeletal Muscle Sodium Channels: Voltage-Dependent Block by Cytoplasmic Amines, and the Influence of μ-Conotoxin GIIIA Derivatives and Permeant Ions

PubMed Central

Pavlov, Evgeny; Britvina, Tatiana; McArthur, Jeff R.; Ma, Quanli; Sierralta, Iván; Zamponi, Gerald W.; French, Robert J.

2008-01-01

External μ-conotoxins and internal amine blockers inhibit each other's block of voltage-gated sodium channels. We explore the basis of this interaction by measuring the shifts in voltage-dependence of channel inhibition by internal amines induced by two μ-conotoxin derivatives with different charge distributions and net charges. Charge changes on the toxin were made at residue 13, which is thought to penetrate most deeply into the channel, making it likely to have the strongest individual interaction with an internal charged ligand. When an R13Q or R13E molecule was bound to the channel, the voltage dependence of diethylammonium (DEA)-block shifted toward more depolarized potentials (23 mV for R13Q, and 16 mV for R13E). An electrostatic model of the repulsion between DEA and the toxin simulated these data, with a distance between residue 13 of the μ-conotoxin and the DEA-binding site of ∼15 Å. Surprisingly, for tetrapropylammonium, the shifts were only 9 mV for R13Q, and 7 mV for R13E. The smaller shifts associated with R13E, the toxin with a smaller net charge, are generally consistent with an electrostatic interaction. However, the smaller shifts observed for tetrapropylammonium than for DEA suggest that other factors must be involved. Two observations indicate that the coupling of permeant ion occupancy of the channel to blocker binding may contribute to the overall amine-toxin interaction: 1), R13Q binding decreases the apparent affinity of sodium for the conducting pore by ∼4-fold; and 2), increasing external [Na+] decreases block by DEA at constant voltage. Thus, even though a number of studies suggest that sodium channels are occupied by no more than one ion most of the time, measurable coupling occurs between permeant ions and toxin or amine blockers. Such interactions likely determine, in part, the strength of trans-channel, amine-conotoxin interactions. PMID:18658222

Effects of tetraethylammonium on potassium currents in a molluscan neurons

PubMed Central

1981-01-01

The effects of tetraethylammonium (TEA) on the delayed K+ current and on the Ca2+-activated K+ current of the Aplysia pacemaker neurons R-15 and L-6 were studied. The delayed outward K+ current was measured in Ca2+-free ASW containing tetrodotoxin (TTX), using brief depolarizing clamp pulses. External TEA blocks the delayed K+ current reversibly in a dose-dependent manner. The experimental results are well fitted with a Michaelis-Menten expression, assuming a one-to-one reaction between TEA and a receptor site, with an apparent dissociation constant of 6.0 mM. The block depends on membrane voltage and is reduced at positive membrane potentials. The Ca2+-activated K+ current was measured in Ca2+- free artificial seawater (ASW) containing TTX, using internal Ca2+ ion injection to directly activate the K+ conductance. External TEA and a number of other quaternary ammonium ions block the Ca2+-activated K+ current reversibly in a dose-dependent manner. TEA is the most effective blocker, with an apparent dissociation constant, for a one-to- one reaction with a receptor site, of 0.4 mM. The block decreases with depolarization. The Ca2+-activated K+ current was also measured after intracellular iontophoretic TEA injection. Internal TEA blocks the Ca2+- activated K+ current (but the block is only apparent at positive membrane potentials), is increased by depolarization, and is irreversible. The effects of external and internal TEA can be seen in measurements of the total outward K+ current at different membrane potentials in normal ASW. PMID:6265594

Mutation of a single residue in the S2-S3 loop of CNG channels alters the gating properties and sensitivity to inhibitors.

PubMed

Crary, J I; Dean, D M; Maroof, F; Zimmerman, A L

2000-12-01

We previously found that native cyclic nucleotide-gated (CNG) cation channels from amphibian rod cells are directly and reversibly inhibited by analogues of diacylglycerol (DAG), but little is known about the mechanism of this inhibition. We recently determined that, at saturating cGMP concentrations, DAG completely inhibits cloned bovine rod (Brod) CNG channels while only partially inhibiting cloned rat olfactory (Rolf) channels (Crary, J.I., D.M. Dean, W. Nguitragool, P.T. Kurshan, and A.L. Zimmerman. 2000. J. Gen. Phys. 116:755-768; in this issue). Here, we report that a point mutation at position 204 in the S2-S3 loop of Rolf and a mouse CNG channel (Molf) found in olfactory epithelium and heart, increased DAG sensitivity to that of the Brod channel. Mutation of this residue from the wild-type glycine to a glutamate (Molf G204E) or aspartate (Molf G204D) gave dramatic increases in DAG sensitivity without changing the apparent cGMP or cAMP affinities or efficacies. However, unlike the wild-type olfactory channels, these mutants demonstrated voltage-dependent gating with obvious activation and deactivation kinetics. Interestingly, the mutants were also more sensitive to inhibition by the local anesthetic, tetracaine. Replacement of the position 204 glycine with a tryptophan residue (Rolf G204W) not only gave voltage-dependent gating and an increased sensitivity to DAG and tetracaine, but also showed reduced apparent agonist affinity and cAMP efficacy. Sequence comparisons show that the glycine at position 204 in the S2-S3 loop is highly conserved, and our findings indicate that its alteration can have critical consequences for channel gating and inhibition.

Subdiaphragmatic vagotomy increases the sensitivity of lumbar Aδ primary afferent neurons along with voltage-dependent potassium channels in rats.

PubMed

Furuta, Sadayoshi; Watanabe, Lisa; Doi, Seira; Horiuchi, Hiroshi; Matsumoto, Kenjiro; Kuzumaki, Naoko; Suzuki, Tsutomu; Narita, Minoru

2012-02-01

Subdiaphragmatic vagal dysfunction causes chronic pain. To verify whether this chronic pain is accompanied by enhanced peripheral nociceptive sensitivity, we evaluated primary afferent neuronal excitability in subdiaphragmatic vagotomized (SDV) rats. SDV rats showed a decrease in the electrical stimuli-induced hind limb-flexion threshold at 250 Hz, but showed no similar effect at 5 or 2000 Hz, which indicated that lumbar primary afferent Aδ sensitivity was enhanced in SDV rats. The whole-cell patch-clamp technique also revealed the hyper-excitability of acutely dissociated medium-sized lumbar dorsal root ganglion (DRG) neurons isolated from SDV rats. The contribution of changes in voltage-dependent potassium (Kv) channels was assessed, and transient A-type K(+) (I(A) ) current density was apparently decreased. Moreover, Kv4.3 immunoreactivity in medium-sized DRG neurons was significantly reduced in SDV rats compared to sham. These results indicate that SDV causes hyper-excitability of lumbar primary Aδ afferent neurons, which may be induced along with suppressing I(A) currents via the decreased expression of Kv4.3. Thus, peripheral Aδ neuroplasticity may contribute to the chronic lower limb pain caused by SDV. Copyright © 2011 Wiley Periodicals, Inc.

Stabilization of the Activated hERG Channel Voltage Sensor by Depolarization Involves the S4-S5 Linker.

PubMed

Thouta, Samrat; Hull, Christina M; Shi, Yu Patrick; Sergeev, Valentine; Young, James; Cheng, Yen M; Claydon, Thomas W

2017-01-24

Slow deactivation of hERG channels is critical for preventing cardiac arrhythmia yet the mechanistic basis for the slow gating transition is unclear. Here, we characterized the temporal sequence of events leading to voltage sensor stabilization upon membrane depolarization. Progressive increase in step depolarization duration slowed voltage-sensor return in a biphasic manner (τ fast = 34 ms, τ slow  = 2.5 s). The faster phase of voltage-sensor return slowing correlated with the kinetics of pore opening. The slower component occurred over durations that exceeded channel activation and was consistent with voltage sensor relaxation. The S4-S5 linker mutation, G546L, impeded the faster phase of voltage sensor stabilization without attenuating the slower phase, suggesting that the S4-S5 linker is important for communications between the pore gate and the voltage sensor during deactivation. These data also demonstrate that the mechanisms of pore gate-opening-induced and relaxation-induced voltage-sensor stabilization are separable. Deletion of the distal N-terminus (Δ2-135) accelerated off-gating current, but did not influence the relative contribution of either mechanism of stabilization of the voltage sensor. Lastly, we characterized mode-shift behavior in hERG channels, which results from stabilization of activated channel states. The apparent mode-shift depended greatly on recording conditions. By measuring slow activation and deactivation at steady state we found the "true" mode-shift to be ∼15 mV. Interestingly, the "true" mode-shift of gating currents was ∼40 mV, much greater than that of the pore gate. This demonstrates that voltage sensor return is less energetically favorable upon repolarization than pore gate closure. We interpret this to indicate that stabilization of the activated voltage sensor limits the return of hERG channels to rest. The data suggest that this stabilization occurs as a result of reconfiguration of the pore gate upon opening by a mechanism that is influenced by the S4-S5 linker, and by a separable voltage-sensor intrinsic relaxation mechanism. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Characterization of two distinct depolarization-activated K+ currents in isolated adult rat ventricular myocytes

PubMed Central

1991-01-01

Depolarization-activated outward K+ currents in isolated adult rat ventricular myocytes were characterized using the whole-cell variation of the patch-clamp recording technique. During brief depolarizations to potentials positive to -40 mV, Ca(2+)-independent outward K+ currents in these cells rise to a transient peak, followed by a slower decay to an apparent plateau. The analyses completed here reveal that the observed outward current waveforms result from the activation of two kinetically distinct voltage-dependent K+ currents: one that activates and inactivates rapidly, and one that activates and inactivates slowly, on membrane depolarization. These currents are referred to here as Ito (transient outward) and IK (delayed rectifier), respectively, because their properties are similar (although not identical) to these K+ current types in other cells. Although the voltage dependences of Ito and IK activation are similar, Ito activates approximately 10-fold and inactivates approximately 30-fold more rapidly than IK at all test potentials. In the composite current waveforms measured during brief depolarizations, therefore, the peak current predominantly reflects Ito, whereas IK is the primary determinant of the plateau. There are also marked differences in the voltage dependences of steady-state inactivation of these two K+ currents: IK undergoes steady-state inactivation at all potentials positive to -120 mV, and is 50% inactivated at -69 mV; Ito, in contrast, is insensitive to steady-state inactivation at membrane potentials negative to -50 mV. In addition, Ito recovers from steady-state inactivation faster than IK: at -90 mV, for example, approximately 70% recovery from the inactivation produced at -20 mV is observed within 20 ms for Ito; IK recovers approximately 25-fold more slowly. The pharmacological properties of Ito and IK are also distinct: 4-aminopyridine preferentially attenuates Ito, and tetraethylammonium suppresses predominantly IK. The voltage- and time- dependent properties of these currents are interpreted here in terms of a model in which Ito underlies the initial, rapid repolarization phase of the action potential (AP), and IK is responsible for the slower phase of AP repolarization back to the resting membrane potential, in adult rat ventricular myocytes. PMID:1865177

Effects of calcium channel blockers on the kinetics of voltage-dependent changes in synaptosomal calcium concentrations.

PubMed

Thomas, M M; Puligandla, P S; Dunn, S M

1994-01-28

Synaptosomal preparations from rat cerebral cortex have been used in stopped-flow fluorescence studies to measure rapid changes in intrasynaptosomal calcium concentrations upon depolarization. Synaptosomes were loaded with the fluorescent calcium chelating dye, Fura-2, by incubation with the membrane permeant acetoxymethyl ester derivative. Depolarization by elevated external K+ concentration resulted in a rapid increase in cytoplasmic Ca2+ as measured by a quench in Fura-2 fluorescence when excited at 390 nm. The fluorescence change could be reasonably fit by a single exponential process with an apparent rate of 10-15 s-1 and the magnitude of the response was voltage-dependent, increasing with increasing external K+ over the range of 5-30 mM. The observed quench was blocked by micromolar concentrations of the inorganic calcium channel blockers, Cd2+, Co2+ and La3+. Nimodipine, a dihydropyridine which blocks L-type calcium channels, inhibited only 10-15% of the flux response while nitrendipine had no consistent effect. omega-Conotoxin GVIA, a blocker of N-type channels in many species, had only a small inhibitory effect at high (1-10 microM) concentrations. The response was, however, inhibited by pre-incubation of the synaptosomes with venom of the funnel web spider. Agelenopsis aperta (0.1-300 micrograms/ml). Inhibition was observed with both a purified polyamine fraction (FTX) from the venom (IC50 = 4 nl/ml) and a purified peptide toxin, omega-AgaIVA (IC50 = 30 nM). These results indicate that voltage-dependent Ca2+ uptake by mammalian nerve terminals is mediated primarily by channels that are insensitive to dihydropyridines and omega-conotoxin GVIA but are sensitive to components of funnel web spider venom.

Mechanisms of the anomalous Pockels effect in bulk water

NASA Astrophysics Data System (ADS)

Yukita, Shunpei; Suzuki, Yuto; Shiokawa, Naoyuki; Kobayashi, Takayoshi; Tokunaga, Eiji

2018-04-01

The "anomalous" Pockels effect is a phenomenon that a light beam passing between two electrodes in an aqueous electrolyte solution is deflected by an AC voltage applied between the electrodes: the deflection angle is proportional to the voltage such that the incident beam alternately changes its direction. This phenomenon, the Pockels effect in bulk water, apparently contradicts what is believed in nonlinear optics, i.e., macroscopic inversion symmetry should be broken for the second-order nonlinear optical effect to occur such as the first-order electro-optic effect, i.e., the Pockels effect. To clarify the underlying mechanism, the dependence of the effect on the electrode material is investigated to find that the Pockels coefficient with Pt electrodes is two orders of magnitude smaller than with indium tin oxide (ITO) electrodes. It is experimentally confirmed that the Pockels effect of interfacial water in the electric double layer (EDL) on these electrodes shows an electrode dependence similar to the effect in bulk water while the effects depend on the frequency of the AC voltage such that the interfacial signal decreases with frequency but the bulk signal increases with frequency up to 221 Hz. These experimental results lead to a conclusion that the beam deflection is caused by the refractive index gradient in the bulk water region, which is formed transiently by the Pockels effect of interfacial water in the EDL when an AC electric field is applied. The refractive index gradient is caused by the diffuse layer spreading into the bulk region to work as a breaking factor of inversion symmetry of bulk water due to its charge-biased ionic distribution. This mechanism does not contradict the principle of nonlinear optics.

Voltage-Dependent Gating: Novel Insights from KCNQ1 Channels

PubMed Central

Cui, Jianmin

2016-01-01

Gating of voltage-dependent cation channels involves three general molecular processes: voltage sensor activation, sensor-pore coupling, and pore opening. KCNQ1 is a voltage-gated potassium (Kv) channel whose distinctive properties have provided novel insights on fundamental principles of voltage-dependent gating. 1) Similar to other Kv channels, KCNQ1 voltage sensor activation undergoes two resolvable steps; but, unique to KCNQ1, the pore opens at both the intermediate and activated state of voltage sensor activation. The voltage sensor-pore coupling differs in the intermediate-open and the activated-open states, resulting in changes of open pore properties during voltage sensor activation. 2) The voltage sensor-pore coupling and pore opening require the membrane lipid PIP2 and intracellular ATP, respectively, as cofactors, thus voltage-dependent gating is dependent on multiple stimuli, including the binding of intracellular signaling molecules. These mechanisms underlie the extraordinary KCNE1 subunit modification of the KCNQ1 channel and have significant physiological implications. PMID:26745405

Phosphorylation of purified mitochondrial Voltage-Dependent Anion Channel by c-Jun N-terminal Kinase-3 modifies channel voltage-dependence.

PubMed

Gupta, Rajeev; Ghosh, Subhendu

2017-06-01

Voltage-Dependent Anion Channel (VDAC) phosphorylated by c-Jun N-terminal Kinase-3 (JNK3) was incorporated into the bilayer lipid membrane. Single-channel electrophysiological properties of the native and the phosphorylated VDAC were compared. The open probability versus voltage curve of the native VDAC displayed symmetry around the voltage axis, whereas that of the phosphorylated VDAC showed asymmetry. This result indicates that phosphorylation by JNK3 modifies voltage-dependence of VDAC.

Interactions among DIV voltage-sensor movement, fast inactivation, and resurgent Na current induced by the NaVβ4 open-channel blocking peptide

PubMed Central

Lewis, Amanda H.

2013-01-01

Resurgent Na current flows as voltage-gated Na channels recover through open states from block by an endogenous open-channel blocking protein, such as the NaVβ4 subunit. The open-channel blocker and fast-inactivation gate apparently compete directly, as slowing the onset of fast inactivation increases resurgent currents by favoring binding of the blocker. Here, we tested whether open-channel block is also sensitive to deployment of the DIV voltage sensor, which facilitates fast inactivation. We expressed NaV1.4 channels in HEK293t cells and assessed block by a free peptide replicating the cytoplasmic tail of NaVβ4 (the “β4 peptide”). Macroscopic fast inactivation was disrupted by mutations of DIS6 (L443C/A444W; “CW” channels), which reduce fast-inactivation gate binding, and/or by the site-3 toxin ATX-II, which interferes with DIV movement. In wild-type channels, the β4 peptide competed poorly with fast inactivation, but block was enhanced by ATX. With the CW mutation, large peptide-induced resurgent currents were present even without ATX, consistent with increased open-channel block upon depolarization and slower deactivation after blocker unbinding upon repolarization. The addition of ATX greatly increased transient current amplitudes and further enlarged resurgent currents, suggesting that pore access by the blocker is actually decreased by full deployment of the DIV voltage sensor. ATX accelerated recovery from block at hyperpolarized potentials, however, suggesting that the peptide unbinds more readily when DIV voltage-sensor deployment is disrupted. These results are consistent with two open states in Na channels, dependent on the DIV voltage-sensor position, which differ in affinity for the blocking protein. PMID:23940261

Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

NASA Astrophysics Data System (ADS)

Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

1993-06-01

Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

Determining insulation condition of 110kV instrument transformers. Linking PD measurement results from both gas chromatography and electrical method

NASA Astrophysics Data System (ADS)

Dan, C.; Morar, R.

2017-05-01

Working methods for on site testing of insulations: Gas chromatography (using the TFGA-P200 chromatographer); Electrical measurements of partial discharge levels using the digital detection, recording, analysis and partial discharge acquisition system, MPD600. First performed, between 2000-2015, were the chromatographic analyses concerning electrical insulating environments of: 102 current transformers, 110kV. Items in operation, functioning in 110/20kV substations. 38 voltage transformers, 110kV also in operation, functioning in 110/20kV substations. Then, electrical measurements of partial discharge inside instrument transformers, on site (power substations) were made (starting in the year 2009, over a 7-year period, collecting data until the year 2015) according to the provisions of standard EN 61869-1:2007 „Instrument transformers. General requirements”, applying, assimilated to it, type A partial discharge test procedure, using as test voltage the very rated 110kV distribution grid voltage. Given the results of two parallel measurements, containing: to this type of failure specific gas amount (H 2) and the quantitative partial discharge’ level, establishing a clear dependence between the quantity of partial discharges and the type and amount of in oil dissolved gases inside equipments affected by this type of defect: partial discharges, was expected. Of the „population” of instrument transformers subject of the two parallel measurements, the dependency between Q IEC (apparent charge) and (H 2) (hydrogen, gas amount dissolved within their insulating environment) represents a finite assemblage situated between the two limits developed on an empirical basis.

Virtual cathode emission of an annular cold cathode

NASA Astrophysics Data System (ADS)

Park, S.-d.; Kim, J.-h.; Han, J.; Yoon, M.; Park, S. Y.; Choi, D. W.; Shin, J. W.; So, J. H.

2009-11-01

Recent measurement of voltage V and current I of the electron gun of a relativistic klystron amplifier revealed that the resulting current-voltage relationship appeared to differ from the usual Child-Langmuir law (I∝V3/2) especially during the initial period of voltage increase. This paper attempts to explain this deviation by examining the emission mechanism using particle-in-cell simulation. The emission area in the cathode increased stepwise as the applied voltage increased and within each step the current and voltage followed the Child-Langmuir law. The electron emission began when the voltage reached a threshold, and the perveance increased with the emission area. Furthermore, an apparent virtual cathode was formed which was larger than the cathode tip. This occurs because, above a certain voltage, the emission from the edge and the side of the cathode surface dominates the emission from the front-end surface.

Kinetic properties of the sodium-calcium exchanger in rat brain synaptosomes.

PubMed Central

Fontana, G; Rogowski, R S; Blaustein, M P

1995-01-01

1. The kinetic properties of the internal Na+ (Na+i)- dependent 45Ca2+ influx and external Na+ (Na+o)-dependent 45Ca2+ efflux were determined in isolated rat brain nerve terminals (synaptosomes) under conditions which the concentrations of internal Na+ ([Na+]i), external Na+ ([Na+]o), external Ca2+ (Ca2+]o), and external K+ ([K+]o) were varied. Both fluxes are manifestations of Na(+)-Ca2+ exchange. 2. Ca2+ uptake was augmented by raising [Na+]i and / or lowering [Na+]o. The increase in Ca2+ uptake induced by removing external Na+ was, in most instances, quantitatively equal to the Na+i-dependent Ca2+ uptake. 3. The Na+i-dependent Ca2+ uptake (measured at 1 s) was activated with an apparent half-maximal [Ca2+]o (KCa(o)) of about 0.23 mM. External Na+ inhibited the uptake in a non- competitive manner: increasing [Na+]o from 4.7 to 96 mM reduced the maximal Na+(i)-dependent Ca2+ uptake but did not affect KCa(o). 4. The inhibition of Ca2+ uptake by Na+o was proportional to ([Na+]o)2, and had a Hill coefficient (nH) of approximately 2.0. The mean apparent half-maximal [Na+]o for inhibition (KI(Na)) was about 60mM, and was independent of [Ca2+]o between 0.1 and 1.2mM; this, too, is indicative of non-competitive inhibition. 5. Low concentrations of alkali metal ions (M+) in the medium, including Na+, stimulated the Na+i-dependent uptake. The external Na+ and K+ concentrations required for apparent half-maximal activation (KM(Na) and KM(K), respectively) were 0.12 and 0.10mM. Thus, the relationship between Ca2+ uptake and [Na+]o was biphasic: uptake was stimulated by [Na+]o < or = 10 mM, and inhibited by higher [Na+]o. 6. The calculated maximal Na+i-dependent Ca2+ uptake (Jmax) was about 1530 pmol (mg protein) -1s-1 at 30 degrees C saturating [Ca2+]o and external M+ concentration ([M+]o), and with negligible inhibition by external Na+. 7. Internal Na+ activated the Ca2+ uptake with an apparent half-maximal concentration (KNa(i)) of about 20 mM and a Hill coefficient, nH, of approximately 3.0. 8. The Jmax for the Na+o-dependent efflux of Ca2+ from 45Ca(2+)-loaded synaptosomes treated with carbonyl cyanide p-trifluormethoxy-phenylhydrazone (FCCP) and caffeine (to release stored Ca2+ and raise the internal Ca2+ concentration ([Ca2+]i) was about 1800-2000 pmol (mg protein -1s-1 at 37 degrees C. 9. When the membrane potential (Vm) was reduced (depolarized) by increasing [K+]o, the Na+i-dependent Ca2+ influx increased, and the Na+o-dependent Ca2+ efflux declined. Both fluxes changed about 2-fold per 60 mV change in Vm. This voltage sensitivity corresponds to the movement of one elementary charge through about 60% of the membrane electric field. The symmetry suggests that the voltage-sensitive step is reversible. 10. The Jmax values for both Ca2P influx and efflux correspond to a Na+-Ca2+ exchange-mediated flux of about 425-575 jumol Ca2P (1 cell water)-' s-' or a turnover of about one quarter of the total synaptosome Ca2P in 1 s. We conclude that the Na+-Ca2P exchanger may contribute to Ca2P entry during nerve terminal depolarization; it is likely to be a major mechanism mediating Ca2P extrusion during subsequent repolarization and recovery. PMID:7666363

Experimental Nanofluidics in an individual Nanotube

NASA Astrophysics Data System (ADS)

Siria, Alessandro; Poncharal, Philippe; Biance, Anne Laure; Fulcrand, Remy; Purcell, Stephen; Bocquet, Lyderic

2012-11-01

Building new devices that benefit from the strange transport behavior of fluids at nanoscales is an open and worthy challenge that may lead to new scientific and technological paradigms. We present here a new class of nanofluidic device, made of individual Boron-Nitride (BN) nanotube inserted in a pierced membrane and connecting two macroscopic reservoirs. We explore fluidic transport inside a single BN nanotube under electric fields, pressure drops, chemical gradients, and combinations of these. We show that in this transmembrane geometry, the pressure-driven streaming current is voltage gated, with an apparent electro-osmotic zeta potential raising up to one volt. Further, we measured the current induced by ion concentration gradients and show its dependency on the surface charge.

Ultrasteep Voltage Dependence in a Membrane Channel

NASA Astrophysics Data System (ADS)

Mangan, Patrick S.; Colombini, Marco

1987-07-01

A mechanism for regulating voltage-gated channels is presented. The treatment amplifies the effect of the applied membrane potential resulting in a dramatic increase in the channel's voltage dependence. Addition of a large polyvalent anion to the medium bathing a phospholipid bilayer containing the voltage-dependent channel from the mitochondrial outer membrane, VDAC, induced up to a 12-fold increase in the channel's voltage sensitivity. The highest polyvalent anion concentration tested resulted in an e-fold conductance change for a 0.36-mV change in membrane potential. On the low end, a concentration of 2 μ M resulted in a 50% increase in VDAC voltage dependence. A mechanism based on polyvalent anion accumulation in the access resistance region at the mouth of the pore is consistent with all findings. Perhaps the voltage dependence of voltage-gated channels is amplified in vivo by polyvalent ions. If so, the control of excitable phenomena may be under much finer regulation than that provided by membrane potential alone.

Effects of acidic pH on voltage-gated ion channels in rat trigeminal mesencephalic nucleus neurons.

PubMed

Han, Jin-Eon; Cho, Jin-Hwa; Choi, In-Sun; Kim, Do-Yeon; Jang, Il-Sung

2017-03-01

The effects of acidic pH on several voltage-dependent ion channels, such as voltage-dependent K + and Ca 2+ channels, and hyperpolarization-gated and cyclic nucleotide-activated cation (HCN) channels, were examined using a whole-cell patch clamp technique on mechanically isolated rat mesencephalic trigeminal nucleus neurons. The application of a pH 6.5 solution had no effect on the peak amplitude of voltage-dependent K + currents. A pH 6.0 solution slightly, but significantly inhibited the peak amplitude of voltage-dependent K + currents. The pH 6.0 also shifted both the current-voltage and conductance-voltage relationships to the depolarization range. The application of a pH 6.5 solution scarcely affected the peak amplitude of membrane currents mediated by HCN channels, which were profoundly inhibited by the general HCN channel blocker Cs + (1 mM). However, the pH 6.0 solution slightly, but significantly inhibited the peak amplitude of HCN-mediated currents. Although the pH 6.0 solution showed complex modulation of the current-voltage and conductance-voltage relationships, the midpoint voltages for the activation of HCN channels were not changed by acidic pH. On the other hand, voltage-dependent Ca 2+ channels were significantly inhibited by an acidic pH. The application of an acidic pH solution significantly shifted the current-voltage and conductance-voltage relationships to the depolarization range. The modulation of several voltage-dependent ion channels by an acidic pH might affect the excitability of mesencephalic trigeminal nucleus neurons, and thus physiological functions mediated by the mesencephalic trigeminal nucleus could be affected in acidic pH conditions.

Optimized expression and purification of NavAb provide the structural insight into the voltage dependence.

PubMed

Irie, Katsumasa; Haga, Yukari; Shimomura, Takushi; Fujiyoshi, Yoshinori

2018-01-01

Voltage-gated sodium channels are crucial for electro-signalling in living systems. Analysis of the molecular mechanism requires both fine electrophysiological evaluation and high-resolution channel structures. Here, we optimized a dual expression system of NavAb, which is a well-established standard of prokaryotic voltage-gated sodium channels, for E. coli and insect cells using a single plasmid vector to analyse high-resolution protein structures and measure large ionic currents. Using this expression system, we evaluated the voltage dependence and determined the crystal structures of NavAb wild-type and two mutants, E32Q and N49K, whose voltage dependence were positively shifted and essential interactions were lost in voltage sensor domain. The structural and functional comparison elucidated the molecular mechanisms of the voltage dependence of prokaryotic voltage-gated sodium channels. © 2017 Federation of European Biochemical Societies.

Design considerations for large space electric power systems

NASA Technical Reports Server (NTRS)

Renz, D. D.; Finke, R. C.; Stevens, N. J.; Triner, J. E.; Hansen, I. G.

1983-01-01

As power levels of spacecraft rise to the 50 to 100 kW range, it becomes apparent that low voltage (28 V) dc power distribution and management systems will not operate efficiently at these higher power levels. The concept of transforming a solar array voltage at 150 V dc into a 1000 V ac distribution system operating at 20 kHz is examined. The transformation is accomplished with series-resonant inverter by using a rotary transformer to isolate the solar array from the spacecraft. The power can then be distributed in any desired method such as three phase delta to delta. The distribution voltage can be easily transformed to any desired load voltage and operating frequency. The reasons for the voltage limitations on the solar array due to plasma interactions and the many advantages of a high voltage, high frequency at distribution system are discussed.

Time-domain electromagnetic soundings collected in Dawson County, Nebraska, 2007-09

USGS Publications Warehouse

Payne, Jason; Teeple, Andrew

2011-01-01

Between April 2007 and November 2009, the U.S. Geological Survey, in cooperation with the Central Platte Natural Resources District, collected time-domain electro-magnetic (TDEM) soundings at 14 locations in Dawson County, Nebraska. The TDEM soundings provide information pertaining to the hydrogeology at each of 23 sites at the 14 locations; 30 TDEM surface geophysical soundings were collected at the 14 locations to develop smooth and layered-earth resistivity models of the subsurface at each site. The soundings yield estimates of subsurface electrical resistivity; variations in subsurface electrical resistivity can be correlated with hydrogeologic and stratigraphic units. Results from each sounding were used to calculate resistivity to depths of approximately 90-130 meters (depending on loop size) below the land surface. Geonics Protem 47 and 57 systems, as well as the Alpha Geoscience TerraTEM, were used to collect the TDEM soundings (voltage data from which resistivity is calculated). For each sounding, voltage data were averaged and evaluated statistically before inversion (inverse modeling). Inverse modeling is the process of creating an estimate of the true distribution of subsurface resistivity from the mea-sured apparent resistivity obtained from TDEM soundings. Smooth and layered-earth models were generated for each sounding. A smooth model is a vertical delineation of calculated apparent resistivity that represents a non-unique estimate of the true resistivity. Ridge regression (Interpex Limited, 1996) was used by the inversion software in a series of iterations to create a smooth model consisting of 24-30 layers for each sounding site. Layered-earth models were then generated based on results of smooth modeling. The layered-earth models are simplified (generally 1 to 6 layers) to represent geologic units with depth. Throughout the area, the layered-earth models range from 2 to 4 layers, depending on observed inflections in the raw data and smooth model inversions. The TDEM data collected were considered good results on the basis of root mean square errors calculated after inversion modeling, comparisons with borehole geophysical logging, and repeatability.

Two Coincidence Detectors for Spike Timing-Dependent Plasticity in Somatosensory Cortex

PubMed Central

Bender, Vanessa A.; Bender, Kevin J.; Brasier, Daniel J.; Feldman, Daniel E.

2011-01-01

Many cortical synapses exhibit spike timing-dependent plasticity (STDP) in which the precise timing of presynaptic and postsynaptic spikes induces synaptic strengthening [long-term potentiation (LTP)] or weakening [long-term depression (LTD)]. Standard models posit a single, postsynaptic, NMDA receptor-based coincidence detector for LTP and LTD components of STDP. We show instead that STDP at layer 4 to layer 2/3 synapses in somatosensory (S1) cortex involves separate calcium sources and coincidence detection mechanisms for LTP and LTD. LTP showed classical NMDA receptor dependence. LTD was independent of postsynaptic NMDA receptors and instead required group I metabotropic glutamate receptors and calcium from voltage-sensitive channels and IP3 receptor-gated stores. Downstream of postsynaptic calcium, LTD required retrograde endocannabinoid signaling, leading to presynaptic LTD expression, and also required activation of apparently presynaptic NMDA receptors. These LTP and LTD mechanisms detected firing coincidence on ~25 and ~125 ms time scales, respectively, and combined to implement the overall STDP rule. These findings indicate that STDP is not a unitary process and suggest that endocannabinoid-dependent LTD may be relevant to cortical map plasticity. PMID:16624937

Size dependence of spin-torque induced magnetic switching in CoFeB-based perpendicular magnetization tunnel junctions (invited)

NASA Astrophysics Data System (ADS)

Sun, J. Z.; Trouilloud, P. L.; Gajek, M. J.; Nowak, J.; Robertazzi, R. P.; Hu, G.; Abraham, D. W.; Gaidis, M. C.; Brown, S. L.; O'Sullivan, E. J.; Gallagher, W. J.; Worledge, D. C.

2012-04-01

CoFeB-based magnetic tunnel junctions with perpendicular magnetic anisotropy are used as a model system for studies of size dependence in spin-torque-induced magnetic switching. For integrated solid-state memory applications, it is important to understand the magnetic and electrical characteristics of these magnetic tunnel junctions as they scale with tunnel junction size. Size-dependent magnetic anisotropy energy, switching voltage, apparent damping, and anisotropy field are systematically compared for devices with different materials and fabrication treatments. Results reveal the presence of sub-volume thermal fluctuation and reversal, with a characteristic length-scale of the order of approximately 40 nm, depending on the strength of the perpendicular magnetic anisotropy and exchange stiffness. To have the best spin-torque switching efficiency and best stability against thermal activation, it is desirable to optimize the perpendicular anisotropy strength with the junction size for intended use. It also is important to ensure strong exchange-stiffness across the magnetic thin film. These combine to give an exchange length that is comparable or larger than the lateral device size for efficient spin-torque switching.

Charged Residues at the First Transmembrane Region Contribute to the Voltage Dependence of the Slow Gate of Connexins.

PubMed

Pinto, Bernardo I; García, Isaac E; Pupo, Amaury; Retamal, Mauricio A; Martínez, Agustín D; Latorre, Ramón; González, Carlos

2016-07-22

Connexins (Cxs) are a family of membrane-spanning proteins that form gap junction channels and hemichannels. Connexin-based channels exhibit two distinct voltage-dependent gating mechanisms termed slow and fast gating. Residues located at the C terminus of the first transmembrane segment (TM-1) are important structural components of the slow gate. Here, we determined the role of the charged residues at the end of TM-1 in voltage sensing in Cx26, Cx46, and Cx50. Conductance/voltage curves obtained from tail currents together with kinetics analysis reveal that the fast and slow gates of Cx26 involves the movement of two and four charges across the electric field, respectively. Primary sequence alignment of different Cxs shows the presence of well conserved glutamate residues in the C terminus of TM-1; only Cx26 contains a lysine in that position (lysine 41). Neutralization of lysine 41 in Cx26 increases the voltage dependence of the slow gate. Swapping of lysine 41 with glutamate 42 maintains the voltage dependence. In Cx46, neutralization of negative charges or addition of a positive charge in the Cx26 equivalent region reduced the slow gate voltage dependence. In Cx50, the addition of a glutamate in the same region decreased the voltage dependence, and the neutralization of a negative charge increased it. These results indicate that the charges at the end of TM-1 are part of the slow gate voltage sensor in Cxs. The fact that Cx42, which has no charge in this region, still presents voltage-dependent slow gating suggests that charges still unidentified also contribute to the slow gate voltage sensitivity. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Charged Residues at the First Transmembrane Region Contribute to the Voltage Dependence of the Slow Gate of Connexins*

PubMed Central

Pinto, Bernardo I.; García, Isaac E.; Pupo, Amaury; Retamal, Mauricio A.; Martínez, Agustín D.; Latorre, Ramón; González, Carlos

2016-01-01

Connexins (Cxs) are a family of membrane-spanning proteins that form gap junction channels and hemichannels. Connexin-based channels exhibit two distinct voltage-dependent gating mechanisms termed slow and fast gating. Residues located at the C terminus of the first transmembrane segment (TM-1) are important structural components of the slow gate. Here, we determined the role of the charged residues at the end of TM-1 in voltage sensing in Cx26, Cx46, and Cx50. Conductance/voltage curves obtained from tail currents together with kinetics analysis reveal that the fast and slow gates of Cx26 involves the movement of two and four charges across the electric field, respectively. Primary sequence alignment of different Cxs shows the presence of well conserved glutamate residues in the C terminus of TM-1; only Cx26 contains a lysine in that position (lysine 41). Neutralization of lysine 41 in Cx26 increases the voltage dependence of the slow gate. Swapping of lysine 41 with glutamate 42 maintains the voltage dependence. In Cx46, neutralization of negative charges or addition of a positive charge in the Cx26 equivalent region reduced the slow gate voltage dependence. In Cx50, the addition of a glutamate in the same region decreased the voltage dependence, and the neutralization of a negative charge increased it. These results indicate that the charges at the end of TM-1 are part of the slow gate voltage sensor in Cxs. The fact that Cx42, which has no charge in this region, still presents voltage-dependent slow gating suggests that charges still unidentified also contribute to the slow gate voltage sensitivity. PMID:27143357

Pado, a fluorescent protein with proton channel activity can optically monitor membrane potential, intracellular pH, and map gap junctions.

PubMed

Kang, Bok Eum; Baker, Bradley J

2016-04-04

An in silico search strategy was developed to identify potential voltage-sensing domains (VSD) for the development of genetically encoded voltage indicators (GEVIs). Using a conserved charge distribution in the S2 α-helix, a single in silico search yielded most voltage-sensing proteins including voltage-gated potassium channels, voltage-gated calcium channels, voltage-gated sodium channels, voltage-gated proton channels, and voltage-sensing phosphatases from organisms ranging from mammals to bacteria and plants. A GEVI utilizing the VSD from a voltage-gated proton channel identified from that search was able to optically report changes in membrane potential. In addition this sensor was capable of manipulating the internal pH while simultaneously reporting that change optically since it maintains the voltage-gated proton channel activity of the VSD. Biophysical characterization of this GEVI, Pado, demonstrated that the voltage-dependent signal was distinct from the pH-dependent signal and was dependent on the movement of the S4 α-helix. Further investigation into the mechanism of the voltage-dependent optical signal revealed that inhibiting the dimerization of the fluorescent protein greatly reduced the optical signal. Dimerization of the FP thereby enabled the movement of the S4 α-helix to mediate a fluorescent response.

Pado, a fluorescent protein with proton channel activity can optically monitor membrane potential, intracellular pH, and map gap junctions

PubMed Central

Kang, Bok Eum; Baker, Bradley J.

2016-01-01

An in silico search strategy was developed to identify potential voltage-sensing domains (VSD) for the development of genetically encoded voltage indicators (GEVIs). Using a conserved charge distribution in the S2 α-helix, a single in silico search yielded most voltage-sensing proteins including voltage-gated potassium channels, voltage-gated calcium channels, voltage-gated sodium channels, voltage-gated proton channels, and voltage-sensing phosphatases from organisms ranging from mammals to bacteria and plants. A GEVI utilizing the VSD from a voltage-gated proton channel identified from that search was able to optically report changes in membrane potential. In addition this sensor was capable of manipulating the internal pH while simultaneously reporting that change optically since it maintains the voltage-gated proton channel activity of the VSD. Biophysical characterization of this GEVI, Pado, demonstrated that the voltage-dependent signal was distinct from the pH-dependent signal and was dependent on the movement of the S4 α-helix. Further investigation into the mechanism of the voltage-dependent optical signal revealed that inhibiting the dimerization of the fluorescent protein greatly reduced the optical signal. Dimerization of the FP thereby enabled the movement of the S4 α-helix to mediate a fluorescent response. PMID:27040905

Kir2.1 encodes the inward rectifier potassium channel in rat arterial smooth muscle cells

PubMed Central

Bradley, Karri K; Jaggar, Jonathan H; Bonev, Adrian D; Heppner, Thomas J; Flynn, Elaine RM; Nelson, Mark T; Horowitz, Burton

1999-01-01

The molecular nature of the strong inward rectifier K+ channel in vascular smooth muscle was explored by using isolated cell RT-PCR, cDNA cloning and expression techniques.RT-PCR of RNA from single smooth muscle cells of rat cerebral (basilar), coronary and mesenteric arteries revealed transcripts for Kir2.1. Transcripts for Kir2.2 and Kir2.3 were not found.Quantitative PCR analysis revealed significant differences in transcript levels of Kir2.1 between the different vascular preparations (n = 3; P < 0.05). A two-fold difference was detected between Kir2.1 mRNA and β-actin mRNA in coronary arteries when compared with relative levels measured in mesenteric and basilar preparations.Kir2.1 was cloned from rat mesenteric vascular smooth muscle cells and expressed in Xenopus oocytes. Currents were strongly inwardly rectifying and selective for K+.The effect of extracellular Ba2+, Ca2+, Mg2+ and Cs2+ ions on cloned Kir2.1 channels expressed in Xenopus oocytes was examined. Ba2+ and Cs+ block were steeply voltage dependent, whereas block by external Ca2+ and Mg2+ exhibited little voltage dependence. The apparent half-block constants and voltage dependences for Ba2+, Cs+, Ca2+ and Mg2+ were very similar for inward rectifier K+ currents from native cells and cloned Kir2.1 channels expressed in oocytes.Molecular studies demonstrate that Kir2.1 is the only member of the Kir2 channel subfamily present in vascular arterial smooth muscle cells. Expression of cloned Kir2.1 in Xenopus oocytes resulted in inward rectifier K+ currents that strongly resemble those that are observed in native vascular arterial smooth muscle cells. We conclude that Kir2.1 encodes for inward rectifier K+ channels in arterial smooth muscle. PMID:10066894

Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid

PubMed Central

Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

2016-01-01

The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112

Voltage-dependent motion of the catalytic region of voltage-sensing phosphatase monitored by a fluorescent amino acid.

PubMed

Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi

2016-07-05

The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.

Sweet taste transduction in hamster: sweeteners and cyclic nucleotides depolarize taste cells by reducing a K+ current.

PubMed

Cummings, T A; Daniels, C; Kinnamon, S C

1996-03-01

1. The gigaseal voltage-clamp technique was used to record responses of hamster taste receptor cells to synthetic sweeteners and cyclic nucleotides. Voltage-dependent currents and steady-state currents were monitored during bath exchanges of saccharin, two high-potency sweeteners, 8-chlorophenylthio-adenosine 3',5'-cyclic monophosphate (8cpt-cAMP), and dibutyryl-guanosine 3',5'-cyclic monophosphate (db-cGMP). 2. Of the 237 fungiform taste cells studied, only one in eight was sweet responsive. Outward currents, both voltage-dependent and resting, were reduced by all of the sweeteners tested in sweet-responsive taste cells, whereas these currents were unaffected by sweeteners in sweet-unresponsive taste cells. 3. In every sweet-responsive cell tested, 8cpt-cAMP and db-cGMP mimicked the response to the sweeteners, but neither nucleotide elicited responses in sweet-unresponsive cells. Thus there was a one-to-one correlation between sweet responsivity and cyclic nucleotide responsivity. 4. Sweet responses showed cross adaptation with cyclic nucleotide responses. This indicates that the same ion channel is modulated by sweeteners and cyclic nucleotides. 5. The sweetener- and cyclic nucleotide-blocked current had an apparent reversal potential of -50 mV, which was close to the potassium reversal potential in these experiments. In addition, there was no effect of sweeteners and cyclic nucleotides in the presence of the K+ channel blocker tetraethylammonium bromide (TEA). These data suggest that block of a resting, TEA-sensitive K+ current is the final common step leading to taste cell depolarization during sweet transduction. 6. These data, together with data from a previous study (Cummings et al. 1993), suggest that both synthetic sweeteners and sucrose utilize second-messenger pathways that block a resting K+ conductance to depolarize the taste cell membrane.

Bimodal voltage dependence of TRPA1: mutations of a key pore helix residue reveal strong intrinsic voltage-dependent inactivation.

PubMed

Wan, Xia; Lu, Yungang; Chen, Xueqin; Xiong, Jian; Zhou, Yuanda; Li, Ping; Xia, Bingqing; Li, Min; Zhu, Michael X; Gao, Zhaobing

2014-07-01

Transient receptor potential A1 (TRPA1) is implicated in somatosensory processing and pathological pain sensation. Although not strictly voltage-gated, ionic currents of TRPA1 typically rectify outwardly, indicating channel activation at depolarized membrane potentials. However, some reports also showed TRPA1 inactivation at high positive potentials, implicating voltage-dependent inactivation. Here we report a conserved leucine residue, L906, in the putative pore helix, which strongly impacts the voltage dependency of TRPA1. Mutation of the leucine to cysteine (L906C) converted the channel from outward to inward rectification independent of divalent cations and irrespective to stimulation by allyl isothiocyanate. The mutant, but not the wild-type channel, displayed exclusively voltage-dependent inactivation at positive potentials. The L906C mutation also exhibited reduced sensitivity to inhibition by TRPA1 blockers, HC030031 and ruthenium red. Further mutagenesis of the leucine to all natural amino acids individually revealed that most substitutions at L906 (15/19) resulted in inward rectification, with exceptions of three amino acids that dramatically reduced channel activity and one, methionine, which mimicked the wild-type channel. Our data are plausibly explained by a bimodal gating model involving both voltage-dependent activation and inactivation of TRPA1. We propose that the key pore helix residue, L906, plays an essential role in responding to the voltage-dependent gating.

Stress-Dependent Voltage Offsets From Polymer Insulators Used in Rock Mechanics and Material Testing

NASA Technical Reports Server (NTRS)

Carlson, G. G.; Dahlgren, Robert; Gray, Amber; Vanderbilt, V. C.; Freund, F.; Johnston, M. J.; Dunson, C.

2013-01-01

Dielectric insulators are used in a variety of laboratory settings when performing experiments in rock mechanics, petrology, and electromagnetic studies of rocks in the fields of geophysics,material science, and civil engineering. These components may be used to electrically isolate geological samples from the experimental equipment, to perform a mechanical compliance function between brittle samples and the loading equipment, to match ultrasonic transducers, or perform other functions. In manyexperimental configurations the insulators bear the full brunt of force applied to the sample but do not need to withstand high voltages, therefore the insulators are often thin sheets of mechanically tough polymers. From an instrument perspective, transduction from various types of mechanical perturbation has beenqualitatively compared for a number of polymers [1, 2] and these error sources are readily apparent duringhigh-impedance measurements if not mitigated. However even when following best practices, a force dependent voltage signal still remains and its behavior is explored in this presentation. In this experimenttwo thin sheets (0.25 mm) of high-density polyethylene (HDPE) were set up in a stack, held alternatelybetween three aluminum bars; this stack was placed on the platen of a 60T capacity hydraulic testingmachine. The surface area, A, over which the force is applied to the PE sheets in this sandwich is roughly 40 square cm, each sheet forming a parallel-plate capacitor having roughly 320 pF [3], assuming therelative dielectric permittivity of PE is approximately 2.3. The outer two aluminum bars were connected to the LO input ofthe electrometer and the central aluminum bar was connected to the HI input of a Keithley model 617 electrometer. Once the stack is mechanically well-seated with no air gaps, the voltage offset is observed tobe a linear function of the baseline voltage for a given change in applied force. For a periodically appliedforce of 66.7 kN the voltage offsets were measured as a function of initial voltage, and these data were fitwith a linear function that was constrained to pass through the origin. The best fit solution had a correlation coefficient of R=0.85 and a slope of approximately -0.0228 volts/volt. The voltage offset when normalizedis demonstrated to be constant -2.28% for both positive and negative polarities over nearly 3 orders ofbaseline voltage magnitude. From this, the voltage-force coefficient is derived to be -0.34 ppm/N. Thiscorrelates well to a first-order parallel plate capacitor model that assumes constant area, and smalldeformation such that the polymer may be mechanically modeled by a spring that obeys Hookes law. Thissimple model predicts that the coefficient of proportionality is a function of Youngs modulus E= 0.8 GPaand surface area of the insulator, theoretically -1EA= -0.31 ppm/N. The outcome of this work is animproved insulator made from ultra-high molecular weight (UHMW) polyethylene and other approachestoward the minimization of and compensation for these experimental artifacts.

Tailoring the High-Q LC Filter Arrays for Readout of Kilo-Pixel TES Arrays in the SPICA-SAFARI Instrument

NASA Astrophysics Data System (ADS)

Bruijn, M. P.; Gottardi, L.; den Hartog, R. H.; van der Kuur, J.; van der Linden, A. J.; Jackson, B. D.

2014-08-01

Following earlier presentations of arrays of high quality factor (Q 10.000) superconducting resonators in the MHz regime, we report on improvement of the packing density of resonance frequencies to 160 in the 1-3 MHz band. Spread in the spacing of resonances is found to be limited to 1 kHz (1 with the present fabrication procedure. The present packing density of frequencies and chip area approaches the requirements for the SAFARI instrument on the SPICA mission (in preparation). The a-Si:H dielectric layer in the planar S-I-S capacitors shows a presently unexplained apparent negative effective series resistance, depending on operating temperature and applied testing voltage.

Fabrication and Properties of Multilayer Structures

DTIC Science & Technology

1982-08-01

22- The relative voltage supported in each semiconductor is V -V NAc b 1 A227) Vb2 V2 NDlcl where V = V1 + V2. It is apparent that Eqs. 5-7 will...has more difficulty because the interface state capacitance must be extracted from the measured capacitance. When a voltage is applied, the interface...contain identical information about interface states. However, as Nicollian and Goetzberger (6 ) have shown, greater inaccuracies arise in extracting

Influence of proline position upon the ion channel activity of alamethicin.

PubMed Central

Kaduk, C; Duclohier, H; Dathe, M; Wenschuh, H; Beyermann, M; Molle, G; Bienert, M

1997-01-01

Alamethicin, a 20-residue peptaibol, induces voltage-dependent ion channels in lipid bilayers according to the barrel-stave model. To study relationships between the proline-14-induced kink region and the channel-forming behavior of the peptide, a set of alamethicin analogs with proline incorporated at positions 11, 12, 13, 14, 15, 16, and 17, respectively, as well as an analog with alanine instead of proline at position 14 were synthesized. Macroscopic conductance experiments show that the voltage dependence of the peptides is conserved although slightly influenced, but the apparent mean number of monomers forming the channels is significantly reduced when proline is not located at position 14. This is confirmed in single-channel experiments. The analogs with proline next to position 14 (i.e., 13, 15, 16) show stable conductance levels, but of reduced number, which follows the order Alam-P14 > Alam-P15 > Alam-P16 > Alam-P13. This reduction in the number of levels is connected with changes in the lifetime of the channels. Analogs with proline at position 11, 12, or 17 produce erratic, extremely short-lived current events that could not be resolved. The changes in functional properties are related to structural properties as probed by circular dichroism. The results indicate that proline at position 14 results in optimal channel activity, whereas channels formed by the analogs bearing proline at different positions are considerably less stable. PMID:9129817

Restricted ADP movement in cardiomyocytes: Cytosolic diffusion obstacles are complemented with a small number of open mitochondrial voltage-dependent anion channels.

PubMed

Simson, Päivo; Jepihhina, Natalja; Laasmaa, Martin; Peterson, Pearu; Birkedal, Rikke; Vendelin, Marko

2016-08-01

Adequate intracellular energy transfer is crucial for proper cardiac function. In energy starved failing hearts, partial restoration of energy transfer can rescue mechanical performance. There are two types of diffusion obstacles that interfere with energy transfer from mitochondria to ATPases: mitochondrial outer membrane (MOM) with voltage-dependent anion channel (VDAC) permeable to small hydrophilic molecules and cytoplasmatic diffusion barriers grouping ATP-producers and -consumers. So far, there is no method developed to clearly distinguish the contributions of cytoplasmatic barriers and MOM to the overall diffusion restriction. Furthermore, the number of open VDACs in vivo remains unknown. The aim of this work was to establish the partitioning of intracellular diffusion obstacles in cardiomyocytes. We studied the response of mitochondrial oxidative phosphorylation of permeabilized rat cardiomyocytes to changes in extracellular ADP by recording 3D image stacks of NADH autofluorescence. Using cell-specific mathematical models, we determined the permeability of MOM and cytoplasmatic barriers. We found that only ~2% of VDACs are accessible to cytosolic ADP and cytoplasmatic diffusion barriers reduce the apparent diffusion coefficient by 6-10×. In cardiomyocytes, diffusion barriers in the cytoplasm and by the MOM restrict ADP/ATP diffusion to similar extents suggesting a major role of both barriers in energy transfer and other intracellular processes. Copyright © 2016 Elsevier Ltd. All rights reserved.

Gating mechanism of Kv11.1 (hERG) K+ channels without covalent connection between voltage sensor and pore domains.

PubMed

de la Peña, Pilar; Domínguez, Pedro; Barros, Francisco

2018-03-01

Kv11.1 (hERG, KCNH2) is a voltage-gated potassium channel crucial in setting the cardiac rhythm and the electrical behaviour of several non-cardiac cell types. Voltage-dependent gating of Kv11.1 can be reconstructed from non-covalently linked voltage sensing and pore modules (split channels), challenging classical views of voltage-dependent channel activation based on a S4-S5 linker acting as a rigid mechanical lever to open the gate. Progressive displacement of the split position from the end to the beginning of the S4-S5 linker induces an increasing negative shift in activation voltage dependence, a reduced z g value and a more negative ΔG 0 for current activation, an almost complete abolition of the activation time course sigmoid shape and a slowing of the voltage-dependent deactivation. Channels disconnected at the S4-S5 linker near the S4 helix show a destabilization of the closed state(s). Furthermore, the isochronal ion current mode shift magnitude is clearly reduced in the different splits. Interestingly, the progressive modifications of voltage dependence activation gating by changing the split position are accompanied by a shift in the voltage-dependent availability to a methanethiosulfonate reagent of a Cys introduced at the upper S4 helix. Our data demonstrate for the first time that alterations in the covalent connection between the voltage sensor and the pore domains impact on the structural reorganizations of the voltage sensor domain. Also, they support the hypothesis that the S4-S5 linker integrates signals coming from other cytoplasmic domains that constitute either an important component or a crucial regulator of the gating machinery in Kv11.1 and other KCNH channels.

Voltage-dependent K+ channels improve the energy efficiency of signalling in blowfly photoreceptors

PubMed Central

2017-01-01

Voltage-dependent conductances in many spiking neurons are tuned to reduce action potential energy consumption, so improving the energy efficiency of spike coding. However, the contribution of voltage-dependent conductances to the energy efficiency of analogue coding, by graded potentials in dendrites and non-spiking neurons, remains unclear. We investigate the contribution of voltage-dependent conductances to the energy efficiency of analogue coding by modelling blowfly R1-6 photoreceptor membrane. Two voltage-dependent delayed rectifier K+ conductances (DRs) shape the membrane's voltage response and contribute to light adaptation. They make two types of energy saving. By reducing membrane resistance upon depolarization they convert the cheap, low bandwidth membrane needed in dim light to the expensive high bandwidth membrane needed in bright light. This investment of energy in bandwidth according to functional requirements can halve daily energy consumption. Second, DRs produce negative feedback that reduces membrane impedance and increases bandwidth. This negative feedback allows an active membrane with DRs to consume at least 30% less energy than a passive membrane with the same capacitance and bandwidth. Voltage-dependent conductances in other non-spiking neurons, and in dendrites, might be organized to make similar savings. PMID:28381642

Voltage-dependent K+ channels improve the energy efficiency of signalling in blowfly photoreceptors.

PubMed

Heras, Francisco J H; Anderson, John; Laughlin, Simon B; Niven, Jeremy E

2017-04-01

Voltage-dependent conductances in many spiking neurons are tuned to reduce action potential energy consumption, so improving the energy efficiency of spike coding. However, the contribution of voltage-dependent conductances to the energy efficiency of analogue coding, by graded potentials in dendrites and non-spiking neurons, remains unclear. We investigate the contribution of voltage-dependent conductances to the energy efficiency of analogue coding by modelling blowfly R1-6 photoreceptor membrane. Two voltage-dependent delayed rectifier K + conductances (DRs) shape the membrane's voltage response and contribute to light adaptation. They make two types of energy saving. By reducing membrane resistance upon depolarization they convert the cheap, low bandwidth membrane needed in dim light to the expensive high bandwidth membrane needed in bright light. This investment of energy in bandwidth according to functional requirements can halve daily energy consumption. Second, DRs produce negative feedback that reduces membrane impedance and increases bandwidth. This negative feedback allows an active membrane with DRs to consume at least 30% less energy than a passive membrane with the same capacitance and bandwidth. Voltage-dependent conductances in other non-spiking neurons, and in dendrites, might be organized to make similar savings. © 2017 The Author(s).

Effect of tyrphostin AG879 on Kv4.2 and Kv4.3 potassium channels

PubMed Central

Yu, Haibo; Zou, Beiyan; Wang, Xiaoliang; Li, Min

2015-01-01

Background and Purpose A-type potassium channels (IA) are important proteins for modulating neuronal membrane excitability. The expression and activity of Kv4.2 channels are critical for neurological functions and pharmacological inhibitors of Kv4.2 channels may have therapeutic potential for Fragile X syndrome. While screening various compounds, we identified tyrphostin AG879, a tyrosine kinase inhibitor, as a Kv4.2 inhibitor from. In the present study we characterized the effect of AG879 on cloned Kv4.2/Kv channel-interacting protein 2 (KChIP2) channels. Experimental Approach To screen the library of pharmacologically active compounds, the thallium flux assay was performed on HEK-293 cells transiently-transfected with Kv4.2 cDNA using the Maxcyte transfection system. The effects of AG879 were further examined on CHO-K1 cells expressing Kv4.2/KChIP2 channels using a whole-cell patch-clamp technique. Key Results Tyrphostin AG879 selectively and dose-dependently inhibited Kv4.2 and Kv4.3 channels. In Kv4.2/KChIP2 channels, AG879 induced prominent acceleration of the inactivation rate, use-dependent block and slowed the recovery from inactivation. AG879 induced a hyperpolarizing shift in the voltage-dependence of the steady-state inactivation of Kv4.2 channels without apparent effect on the V1/2 of the voltage-dependent activation. The blocking effect of AG879 was enhanced as channel inactivation increased. Furthermore, AG879 significantly inhibited the A-type potassium currents in the cultured hippocampus neurons. Conclusion and Implications AG879 was identified as a selective and potent inhibitor the Kv4.2 channel. AG879 inhibited Kv4.2 channels by preferentially interacting with the open state and further accelerating their inactivation. PMID:25752739

Effect of tyrphostin AG879 on Kv 4.2 and Kv 4.3 potassium channels.

PubMed

Yu, Haibo; Zou, Beiyan; Wang, Xiaoliang; Li, Min

2015-07-01

A-type potassium channels (IA) are important proteins for modulating neuronal membrane excitability. The expression and activity of Kv 4.2 channels are critical for neurological functions and pharmacological inhibitors of Kv 4.2 channels may have therapeutic potential for Fragile X syndrome. While screening various compounds, we identified tyrphostin AG879, a tyrosine kinase inhibitor, as a Kv 4.2 inhibitor from. In the present study we characterized the effect of AG879 on cloned Kv 4.2/Kv channel-interacting protein 2 (KChIP2) channels. To screen the library of pharmacologically active compounds, the thallium flux assay was performed on HEK-293 cells transiently-transfected with Kv 4.2 cDNA using the Maxcyte transfection system. The effects of AG879 were further examined on CHO-K1 cells expressing Kv 4.2/KChIP2 channels using a whole-cell patch-clamp technique. Tyrphostin AG879 selectively and dose-dependently inhibited Kv 4.2 and Kv 4.3 channels. In Kv 4.2/KChIP2 channels, AG879 induced prominent acceleration of the inactivation rate, use-dependent block and slowed the recovery from inactivation. AG879 induced a hyperpolarizing shift in the voltage-dependence of the steady-state inactivation of Kv 4.2 channels without apparent effect on the V1/2 of the voltage-dependent activation. The blocking effect of AG879 was enhanced as channel inactivation increased. Furthermore, AG879 significantly inhibited the A-type potassium currents in the cultured hippocampus neurons. AG879 was identified as a selective and potent inhibitor the Kv 4.2 channel. AG879 inhibited Kv 4.2 channels by preferentially interacting with the open state and further accelerating their inactivation. © 2015 The British Pharmacological Society.

Sputter erosion and deposition in the discharge chamber of a small mercury ion thruster

NASA Technical Reports Server (NTRS)

Power, J. L.

1973-01-01

A 5 cm diameter mercury ion thruster similar to one tested for 9715 hours was operated approximately 400 hrs each at discharge voltages of 36.6, 39.6, and 42.6 V, with corresponding discharge propellant utilizations of 58, 68, and 70 percent. The observed sputter erosion rates of the internal thruster parts and the anode weight gain rate all rose rapidly with discharge voltage and were roughly in the ratio of 1:3:5 for the three voltages. The combined weight loss of the internal thruster parts nearly balanced the anode weight gain. Hg(+2) ion apparently caused most of the observed erosion.

Mechanism of voltage-gated channel formation in lipid membranes.

PubMed

Guidelli, Rolando; Becucci, Lucia

2016-04-01

Although several molecular models for voltage-gated ion channels in lipid membranes have been proposed, a detailed mechanism accounting for the salient features of experimental data is lacking. A general treatment accounting for peptide dipole orientation in the electric field and their nucleation and growth kinetics with ion channel formation is provided. This is the first treatment that explains all the main features of the experimental current-voltage curves of peptides forming voltage-gated channels available in the literature. It predicts a regime of weakly voltage-dependent conductance, followed by one of strong voltage-dependent conductance at higher voltages. It also predicts values of the parameters expressing the exponential dependence of conductance upon voltage and peptide bulk concentration for both regimes, in good agreement with those reported in the literature. Most importantly, the only two adjustable parameters involved in the kinetics of nucleation and growth of ion channels can be varied over broad ranges without affecting the above predictions to a significant extent. Thus, the fitting of experimental current-voltage curves stems naturally from the treatment and depends only slightly upon the choice of the kinetic parameters. Copyright © 2015 Elsevier B.V. All rights reserved.

Mechanism of Tacrine Block at Adult Human Muscle Nicotinic Acetylcholine Receptors

PubMed Central

Prince, Richard J.; Pennington, Richard A.; Sine, Steven M.

2002-01-01

We used single-channel kinetic analysis to study the inhibitory effects of tacrine on human adult nicotinic receptors (nAChRs) transiently expressed in HEK 293 cells. Single channel recording from cell-attached patches revealed concentration- and voltage-dependent decreases in mean channel open probability produced by tacrine (IC50 4.6 μM at −70 mV, 1.6 μM at −150 mV). Two main effects of tacrine were apparent in the open- and closed-time distributions. First, the mean channel open time decreased with increasing tacrine concentration in a voltage-dependent manner, strongly suggesting that tacrine acts as an open-channel blocker. Second, tacrine produced a new class of closings whose duration increased with increasing tacrine concentration. Concentration dependence of closed-times is not predicted by sequential models of channel block, suggesting that tacrine blocks the nAChR by an unusual mechanism. To probe tacrine's mechanism of action we fitted a series of kinetic models to our data using maximum likelihood techniques. Models incorporating two tacrine binding sites in the open receptor channel gave dramatically improved fits to our data compared with the classic sequential model, which contains one site. Improved fits relative to the sequential model were also obtained with schemes incorporating a binding site in the closed channel, but only if it is assumed that the channel cannot gate with tacrine bound. Overall, the best description of our data was obtained with a model that combined two binding sites in the open channel with a single site in the closed state of the receptor. PMID:12198092

C-terminus-mediated voltage gating of Arabidopsis guard cell anion channel QUAC1.

PubMed

Mumm, Patrick; Imes, Dennis; Martinoia, Enrico; Al-Rasheid, Khaled A S; Geiger, Dietmar; Marten, Irene; Hedrich, Rainer

2013-09-01

Anion transporters in plants play a fundamental role in volume regulation and signaling. Currently, two plasma membrane-located anion channel families—SLAC/SLAH and ALMT—are known. Among the ALMT family, the root-expressed ALuminium-activated Malate Transporter 1 was identified by comparison of aluminum-tolerant and Al(3+)-sensitive wheat cultivars and was subsequently shown to mediate voltage-independent malate currents. In contrast, ALMT12/QUAC1 (QUickly activating Anion Channel1) is expressed in guard cells transporting malate in an Al(3+)-insensitive and highly voltage-dependent manner. So far, no information is available about the structure and mechanism of voltage-dependent gating with the QUAC1 channel protein. Here, we analyzed gating of QUAC1-type currents in the plasma membrane of guard cells and QUAC1-expressing oocytes revealing similar voltage dependencies and activation–deactivation kinetics. In the heterologous expression system, QUAC1 was electrophysiologically characterized at increasing extra- and intracellular malate concentrations. Thereby, malate additively stimulated the voltage-dependent QUAC1 activity. In search of structural determinants of the gating process, we could not identify transmembrane domains common for voltage-sensitive channels. However, site-directed mutations and deletions at the C-terminus of QUAC1 resulted in altered voltage-dependent channel activity. Interestingly, the replacement of a single glutamate residue, which is conserved in ALMT channels from different clades, by an alanine disrupted QUAC1 activity. Together with C- and N-terminal tagging, these results indicate that the cytosolic C-terminus is involved in the voltage-dependent gating mechanism of QUAC1.

Determination of appropriate DC voltage for switched mode power supply (SMPS) loads

NASA Astrophysics Data System (ADS)

Setiawan, Eko Adhi; Setiawan, Aiman; Purnomo, Andri; Djamal, Muchlishah Hadi

2017-03-01

Nowadays, most of modern and efficient household electronic devices operated based on Switched Mode Power Supply (SMPS) technology which convert AC voltage from the grid to DC voltage. Based on theory and experiment, SMPS loads could be supplied by DC voltage. However, the DC voltage rating to energize electronic home appliances is not standardized yet. This paper proposed certain method to determine appropriate DC voltage, and investigated comparison of SMPS power consumption which is supplied from AC and DC voltage. To determine the appropriate DC voltage, lux value of several lamps which have same specification energized by using AC voltage and the results is using as reference. Then, the lamps were supplied by various DC voltage to obtain the trends of the lux value to the applied DC voltage. After that, by using the trends and the reference lux value, the appropriate DC voltage can be determined. Furthermore, the power consumption on home appliances such as mobile phone, laptop and personal computer by using AC voltage and the appropriate DC voltage were conducted. The results show that the total power consumption of AC system is higher than DC system. The total power (apparent power) consumed by the lamp, mobile phone and personal computer which operated in 220 VAC were 6.93 VA, 34.31 VA and 105.85 VA respectively. On the other hand, under 277 VDC the load consumption were 5.83 W, 19.11 W and 74.46 W respectively.

Differential inhibition of N and P/Q Ca2+ currents by 5-HT1A and 5-HT1D receptors in spinal neurons of Xenopus larvae

PubMed Central

Sun, Qian-Quan; Dale, Nicholas

1998-01-01

In whole-cell patch clamp recordings made from non-sensory neurons acutely isolated from the spinal cord of Xenopus (stage 40–42) larvae, two forms of inhibition of the high voltage-activated (HVA) Ca2+ currents were produced by 5-HT. One was voltage dependent and associated with both slowing of the activation kinetics and shifting of the voltage dependence of the HVA currents. This inhibition was relieved by strong depolarizing prepulses. A second form of inhibition was neither associated with slowing of the activation kinetics nor relieved by depolarizing prepulses and was thus voltage independent. In all neurons examined, 5-HT (1 μM) reversibly reduced 34 ± 1.6 % (n = 102) of the HVA Ca2+ currents. In about 40 % of neurons, the inhibition was totally voltage independent. In another 5 %, the inhibition was totally voltage dependent. In the remaining neurons, inhibition was only partially (by around 40 %) relieved by a large depolarizing prepulse, suggesting that in these, the inhibition consisted of both voltage-dependent and -independent components. By using selective channel blockers, we found that 5-HT acted on both N- and P/Q-type channels. However, whereas the inhibition of P/Q-type currents was only voltage independent, the inhibition of N-type currents had both voltage-dependent and -independent components. The effects of 5-HT on HVA Ca2+ currents were mediated by 5-HT1A and 5-HT1D receptors. The 5-HT1A receptors not only preferentially caused voltage-independent inhibition, but did so by acting mainly on the ω-agatoxin-IVA-sensitive Ca2+ channels. In contrast, the 5-HT1D receptor produced both voltage-dependent and -independent inhibition and was preferentially coupled to ω-conotoxin-GVIA sensitive channels. This complexity of modulation may allow fine tuning of transmitter release and calcium signalling in the spinal circuitry of Xenopus larvae. PMID:9625870

High-voltage nano-oxidation in deionized water and atmospheric environments by atomic force microscopy.

PubMed

Huang, Jen-Ching; Chen, Chung-Ming

2012-01-01

This study used atomic force microscopy (AFM), metallic probes with a nanoscale tip, and high-voltage generators to investigate the feasibility of high-voltage nano-oxidation processing in deionized water (DI water) and atmospheric environments. Researchers used a combination of wire-cutting and electrochemical etching to transform a 20-μm-thick stainless steel sheet into a conductive metallic AFM probe with a tip radius of 60 nm, capable of withstanding high voltages. The combination of AFM, high-voltage generators, and nanoscale metallic probes enabled nano-oxidation processing at 200 V in DI water environments, producing oxides up to 66.6 nm in height and 467.03 nm in width. Oxides produced through high-voltage nano-oxidation in atmospheric environments were 117.29 nm in height and 551.28 nm in width, considerably exceeding the dimensions of those produced in DI water. An increase in the applied bias voltage led to an apparent logarithmic increase in the height of the oxide dots in the range of 200-400 V. The performance of the proposed high-voltage nano-oxidation technique was relatively high with seamless integration between the AFM machine and the metallic probe fabricated in this study. © Wiley Periodicals, Inc.

Report on Contract W911NF-05-1-0339 (Clarkson University)

DTIC Science & Technology

2012-11-30

voltammetry and impedance spectroscopy: voltage dependent parameters of a silicon solar cell under controlled illumination and temperature, Energy...voltammetry for quantitative evaluation of temperature and voltage dependent parameters of a silicon solar cell , Solar Energy, (11 2011): 0. doi: 10.1016...characterization of silicon solar cells in the electro-analytical approach: Combined measurements of temperature and voltage dependent electrical

Voltage-dependent formation of gramicidin channels in lipid bilayers.

PubMed Central

Sandblom, J; Galvanovskis, J; Jilderos, B

2001-01-01

The formation kinetics of gramicidin A channels in lipid bilayer membranes has been characterized as a function of voltage for different solution conditions and membrane composition. The frequency of channel events was measured during the application of voltage ramps and counted in given intervals, a procedure that eliminated the effects of drift in gramicidin concentration. The formation rate was found to increase strongly with voltages up to approximately 50 mV and then to level off slightly. The shape of the voltage dependence was independent of lipid solvent and ramp speed but differed for different ions and different solution concentrations. This suggested an ion occupancy effect on the formation rate that was further supported by the fact that the minimum of the formation rate was shifted toward the equilibrium potential in asymmetric solution concentrations. The effects are explained in terms of a model that contains two contributions to the voltage dependence, a voltage-dependent ion binding to the monomers and a polarization of monomers by the applied electric field and by the occupied ions. The theory is found to give a good fit to experimental data. PMID:11463628

Protective effect of vitamin B5 (dexpanthenol) on cardiovascular damage induced by streptozocin in rats.

PubMed

Demirci, B; Demir, O; Dost, T; Birincioglu, M

2014-01-01

This study investigated whether Dexpanthenol (DEX) improves diabetic cardiovascular function and cardiac performance by regulating total oxidant and antioxidant status. Diabetes was induced by a single intraperitoneal injection of Streptozocin (50 mg/kg in 1 ml of saline) and treatment groups received DEX (300 mg/kg/day) for 6 weeks. Endothelium (in)dependent relaxation responses were assessed in thoracic aortic rings and coronary vasculature together with alpha receptor and voltage dependant contractile responses of aorta. Myocardial contractility has been recorded by an intra ventricular latex balloon. Total oxidant and antioxidant status were measured from the serum samples. Induction of diabetes resulted in an apparent body weight loss, high blood glucose, endothelial dysfunction and increased serum oxidant status. DEX supplementation restored the endothelial dysfunction, antioxidant status and body weight whereas decreasing blood glucose level. Along with the standard therapy of diabetes, DEX can be used as a safe and economical way of adjuvant therapy to diminish the burden of the disease (Tab. 3, Fig. 3, Ref. 30).

[Effect of substance P on the potassium and calcium currents of colonic smooth muscle cells].

PubMed

Tang, Qincai; Luo, Hesheng; Quan, Xiaojing; Fan, Han; Yu, Guang

2015-08-11

To investigate the effect of substance P(SP) on the spontaneous contractile activity of smooth muscle cells,the large-conductance calcium-activated potassium channel currents (IBKCa) and the L-type calcium channel currents (ICaL) in rat smooth muscle cells of the proximal colon. A total of 24 healthy male Wista rats were used in this test. The change of smooth muscle strips spontaneous contraction of rat proximal colon after adding SP was recorded by a physiological signal stystem (RM6240). The IBKCa and ICaL were measured via the whole cell patch-clamp technique. The longitudinal muscle contraction was obviously increased concentration-dependently after adding different concentrations of SP (10(-7)-10(-6) mol/L), so as the circular muscle while adding SP(10(-8)-10(-6) mol/L) (all P<0.05). Compared with the control group, IBKCa was decreased after adding SP(10(-6) mol/L). Under the stimulating voltage of 60 mV, the IBKCa current density was (11.71±1.65) pA/pF, which was significantly lower compared with the control group (14.42±2.89) pA/pF (P<0.05). The ICaL) was apparently increased. Under the stimulating voltage of 0 mV, the ICaL) currents density was (-5.04±0.67) pA/pF, compared with the control group (-4.25±0.46) pA/pF, which was significantly increased (P<0.01). SP can promote the spontaneous contractile activity of colon smooth muscle of rats in vitro.And SP decrease IBKCa representatively while apparently increase ICaL). That is probably one of the mechanism SP regulate the gastrointestinal motility.

Role of the Charge-Transfer State in Reduced Langevin Recombination in Organic Solar Cells: A Theoretical Study

PubMed Central

2015-01-01

Reduced Langevin recombination has been observed in organic solar cells (OSCs) for many years, but its origin is still unclear. A recent work by Burke et al. (Adv. Energy Mater.2015, 5, 1500123-1) was inspired by this reduced Langevin recombination, and they proposed an equilibrium model of charge-transfer (CT) states that correlates the open-circuit voltage of OSCs with experimentally available device parameters. In this work, we extend Burke et al.’s CT model further and for the first time directly correlate the reduced Langevin recombination with the energetic and dynamic behavior of the CT state. Recombination through CT states leads in a straightforward manner to a decrease in the Langevin reduction factor with increasing temperature, without explicit consideration of the temperature dependence of the mobility. To verify the correlation between the CT states and reduced Langevin recombination, we incorporated this CT model and the reduced Langevin model into drift-diffusion simulations of a bilayer OSC. The simulations not only successfully reproduced realistic current–voltage (J–V) characteristics of the bilayer OSC, but also demonstrate that the two models consistently lead to same value of the apparent Langevin reduction factor. PMID:26640611

Relationship of genetically transmitted alpha EEG traits to anxiety disorders and alcoholism

DOE Office of Scientific and Technical Information (OSTI.GOV)

Enoch, M.A.; Rohrbaugh, W.; Harris, C.R.

We tested the hypothesis that a heritable EEG trait, the low voltage alpha (LV), is associated with psychiatric disorders. Modest to moderate evidence for genetic linkage of both panic disorder and the low voltage alpha trait to the same region of chromosome 20q has recently been reported, raising the issue of whether there is a phenotypic correlation between these traits. A total of 124 subjects including 50 unrelated index subjects and 74 relatives were studied. Alpha EEG power was measured and EEG phenotypes were impressionistically classified. Subjects were psychiatrically interviewed using the SADS-L and blind-rated by RDC criteria. Alcoholics weremore » four times more likely to be LV (including so-called borderline low voltage alpha) than were nonalcoholic, nonanxious subjects. Alcoholics with anxiety disorder are 10 times more likely to be LV. However, alcoholics without anxiety disorder were similar to nonalcoholics in alpha power. An anxiety disorder (panic disorder, phobia, or generalized anxiety) was found in 14/17 LV subjects as compared to 34/101 of the rest of the sample (P < 0.01). Support for these observations was found in the unrelated index subjects in whom no traits would be shared by familial clustering. Lower alpha power in anxiety disorders was not state-dependent, as indicated by the Spielberger Anxiety Scale. Familial covariance of alpha power was 0.25 (P < 0.01). These findings indicate there may be a shared factor underlying the transmissible low voltage alpha EEG variant and vulnerability to anxiety disorders with associated alcoholism. This factor is apparently not rare, because LV was found in approximately 10% of unrelated index subjects and 5% of subjects free of alcoholism and anxiety disorders. 43 refs., 1 fig., 3 tabs.« less

On the role of endogenous G-protein βγ subunits in N-type Ca2+ current inhibition by neurotransmitters in rat sympathetic neurones

PubMed Central

Delmas, Patrick; Brown, David A; Dayrell, Mariza; Abogadie, Fe C; Caulfield, Malcolm P; Buckley, Noel J

1998-01-01

Using whole-cell and perforated-patch recordings, we have examined the part played by endogenous G-protein βγ subunits in neurotransmitter-mediated inhibition of N-type Ca2+ channel current ICa) in dissociated rat superior cervical sympathetic neurones. Expression of the C-terminus domain of β-adrenergic receptor kinase 1 (βARK1), which contains the consensus motif (QXXER) for binding Gβγ, reduced the fast (pertussis toxin (PTX)-sensitive) and voltage-dependent inhibition of ICa by noradrenaline and somatostatin, but not the slow (PTX-insensitive) and voltage-independent inhibition induced by angiotensin II. βARK1 peptide reduced GTP-γ-S-induced voltage-dependent and PTX-sensitive inhibition of ICa but not GTP-γ-S-mediated voltage-independent inhibition. Overexpression of Gβ1γ2, which mimicked the voltage-dependent inhibition by reducing ICa density and enhancing basal facilitation, occluded the voltage-dependent noradrenaline- and somatostatin-mediated inhibitions but not the inhibition mediated by angiotensin II. Co-expression of the C-terminus of βARK1 with β1 and γ2 subunits prevented the effects of Gβγ dimers on basal Ca2+ channel behaviour in a manner consistent with the sequestering of Gβγ. The expression of the C-terminus of βARK1 slowed down reinhibition kinetics of ICa following conditioning depolarizations and induced long-lasting facilitation by cumulatively sequestering βγ subunits. Our findings identify endogenous Gβγ as the mediator of the voltage-dependent, PTX-sensitive inhibition of ICa induced by both noradrenaline and somatostatin but not the voltage-independent, PTX-insensitive inhibition by angiotensin II. They also support the view that voltage-dependent inhibition results from a direct Gβγ-Ca2+ channel interaction. PMID:9490860

Electrical characteristics of silicon percolating nanonet-based field effect transistors in the presence of dispersion

NASA Astrophysics Data System (ADS)

Cazimajou, T.; Legallais, M.; Mouis, M.; Ternon, C.; Salem, B.; Ghibaudo, G.

2018-05-01

We studied the current-voltage characteristics of percolating networks of silicon nanowires (nanonets), operated in back-gated transistor mode, for future use as gas or biosensors. These devices featured P-type field-effect characteristics. It was found that a Lambert W function-based compact model could be used for parameter extraction of electrical parameters such as apparent low field mobility, threshold voltage and subthreshold slope ideality factor. Their variation with channel length and nanowire density was related to the change of conduction regime from direct source/drain connection by parallel nanowires to percolating channels. Experimental results could be related in part to an influence of the threshold voltage dispersion of individual nanowires.

Nonsensing residues in S3-S4 linker's C terminus affect the voltage sensor set point in K+ channels.

PubMed

Carvalho-de-Souza, Joao L; Bezanilla, Francisco

2018-02-05

Voltage sensitivity in ion channels is a function of highly conserved arginine residues in their voltage-sensing domains (VSDs), but this conservation does not explain the diversity in voltage dependence among different K + channels. Here we study the non-voltage-sensing residues 353 to 361 in Shaker K + channels and find that residues 358 and 361 strongly modulate the voltage dependence of the channel. We mutate these two residues into all possible remaining amino acids (AAs) and obtain Q-V and G-V curves. We introduced the nonconducting W434F mutation to record sensing currents in all mutants except L361R, which requires K + depletion because it is affected by W434F. By fitting Q-Vs with a sequential three-state model for two voltage dependence-related parameters ( V 0 , the voltage-dependent transition from the resting to intermediate state and V 1 , from the latter to the active state) and G-Vs with a two-state model for the voltage dependence of the pore domain parameter ( V 1/2 ), Spearman's coefficients denoting variable relationships with hydrophobicity, available area, length, width, and volume of the AAs in 358 and 361 positions could be calculated. We find that mutations in residue 358 shift Q-Vs and G-Vs along the voltage axis by affecting V 0 , V 1 , and V 1/2 according to the hydrophobicity of the AA. Mutations in residue 361 also shift both curves, but V 0 is affected by the hydrophobicity of the AA in position 361, whereas V 1 and V 1/2 are affected by size-related AA indices. Small-to-tiny AAs have opposite effects on V 1 and V 1/2 in position 358 compared with 361. We hypothesize possible coordination points in the protein that residues 358 and 361 would temporarily and differently interact with in an intermediate state of VSD activation. Our data contribute to the accumulating knowledge of voltage-dependent ion channel activation by adding functional information about the effects of so-called non-voltage-sensing residues on VSD dynamics. © 2018 Carvalho-de-Souza and Bezanilla.

Bias Voltage-Dependent Impedance Spectroscopy Analysis of Hydrothermally Synthesized ZnS Nanoparticles

NASA Astrophysics Data System (ADS)

Dey, Arka; Dhar, Joydeep; Sil, Sayantan; Jana, Rajkumar; Ray, Partha Pratim

2018-04-01

In this report, bias voltage-dependent dielectric and electron transport properties of ZnS nanoparticles were discussed. ZnS nanoparticles were synthesized by introducing a modified hydrothermal process. The powder XRD pattern indicates the phase purity, and field emission scanning electron microscope image demonstrates the morphology of the synthesized sample. The optical band gap energy (E g = 4.2 eV) from UV measurement explores semiconductor behavior of the synthesized material. The electrical properties were performed at room temperature using complex impedance spectroscopy (CIS) technique as a function of frequency (40 Hz-10 MHz) under different forward dc bias voltages (0-1 V). The CIS analysis demonstrates the contribution of bulk resistance in conduction mechanism and its dependency on forward dc bias voltages. The imaginary part of the impedance versus frequency curve exhibits the existence of relaxation peak which shifts with increasing dc forward bias voltages. The dc bias voltage-dependent ac and dc conductivity of the synthesized ZnS was studied on thin film structure. A possible hopping mechanism for electrical transport processes in the system was investigated. Finally, it is worth to mention that this analysis of bias voltage-dependent dielectric and transport properties of as-synthesized ZnS showed excellent properties for emerging energy applications.

Integrative Approach with Electrophysiological and Theoretical Methods Reveals a New Role of S4 Positively Charged Residues in PKD2L1 Channel Voltage-Sensing.

PubMed

Numata, Tomohiro; Tsumoto, Kunichika; Yamada, Kazunori; Kurokawa, Tatsuki; Hirose, Shinichi; Nomura, Hideki; Kawano, Mitsuhiro; Kurachi, Yoshihisa; Inoue, Ryuji; Mori, Yasuo

2017-08-29

Numerical model-based simulations provide important insights into ion channel gating when experimental limitations exist. Here, a novel strategy combining numerical simulations with patch clamp experiments was used to investigate the net positive charges in the putative transmembrane segment 4 (S4) of the atypical, positively-shifted voltage-dependence of polycystic kidney disease 2-like 1 (PKD2L1) channel. Charge-neutralising mutations (K452Q, K455Q and K461Q) in S4 reduced gating charges, positively shifted the Boltzmann-type activation curve [i.e., open probability (P open )-V curve] and altered the time-courses of activation/deactivation of PKD2L1, indicating that this region constitutes part of a voltage sensor. Numerical reconstruction of wild-type (WT) and mutant PKD2L1-mediated currents necessitated, besides their voltage-dependent gating parameters, a scaling factor that describes the voltage-dependence of maximal conductance, G max . Subsequent single-channel conductance (γ) measurements revealed that voltage-dependence of G max in WT can be explained by the inward-rectifying property of γ, which is greatly changed in PKD2L1 mutants. Homology modelling based on PKD2 and Na V Ab structures suggest that such voltage dependence of P open and γ in PKD2L1 could both reflect the charged state of the S4 domain. The present conjunctive experimental and theoretical approaches provide a framework to explore the undetermined mechanism(s) regulating TRP channels that possess non-classical voltage-dependent properties.

Isolation and Characterization of a High Affinity Peptide Inhibitor of ClC-2 Chloride Channels*

PubMed Central

Thompson, Christopher H.; Olivetti, Pedro R.; Fuller, Matthew D.; Freeman, Cody S.; McMaster, Denis; French, Robert J.; Pohl, Jan; Kubanek, Julia; McCarty, Nael A.

2009-01-01

The ClC protein family includes voltage-gated chloride channels and chloride/proton exchangers. In eukaryotes, ClC proteins regulate membrane potential of excitable cells, contribute to epithelial transport, and aid in lysosomal acidification. Although structure/function studies of ClC proteins have been aided greatly by the available crystal structures of a bacterial ClC chloride/proton exchanger, the availability of useful pharmacological tools, such as peptide toxin inhibitors, has lagged far behind that of their cation channel counterparts. Here we report the isolation, from Leiurus quinquestriatus hebraeus venom, of a peptide toxin inhibitor of the ClC-2 chloride channel. This toxin, GaTx2, inhibits ClC-2 channels with a voltage-dependent apparent KD of ∼20 pm, making it the highest affinity inhibitor of any chloride channel. GaTx2 slows ClC-2 activation by increasing the latency to first opening by nearly 8-fold but is unable to inhibit open channels, suggesting that this toxin inhibits channel activation gating. Finally, GaTx2 specifically inhibits ClC-2 channels, showing no inhibitory effect on a battery of other major classes of chloride channels and voltage-gated potassium channels. GaTx2 is the first peptide toxin inhibitor of any ClC protein. The high affinity and specificity displayed by this toxin will make it a very powerful pharmacological tool to probe ClC-2 structure/function. PMID:19574231

The delayed rectifier potassium conductance in the sarcolemma and the transverse tubular system membranes of mammalian skeletal muscle fibers

PubMed Central

DiFranco, Marino; Quinonez, Marbella

2012-01-01

A two-microelectrode voltage clamp and optical measurements of membrane potential changes at the transverse tubular system (TTS) were used to characterize delayed rectifier K currents (IKV) in murine muscle fibers stained with the potentiometric dye di-8-ANEPPS. In intact fibers, IKV displays the canonical hallmarks of KV channels: voltage-dependent delayed activation and decay in time. The voltage dependence of the peak conductance (gKV) was only accounted for by double Boltzmann fits, suggesting at least two channel contributions to IKV. Osmotically treated fibers showed significant disconnection of the TTS and displayed smaller IKV, but with similar voltage dependence and time decays to intact fibers. This suggests that inactivation may be responsible for most of the decay in IKV records. A two-channel model that faithfully simulates IKV records in osmotically treated fibers comprises a low threshold and steeply voltage-dependent channel (channel A), which contributes ∼31% of gKV, and a more abundant high threshold channel (channel B), with shallower voltage dependence. Significant expression of the IKV1.4 and IKV3.4 channels was demonstrated by immunoblotting. Rectangular depolarizing pulses elicited step-like di-8-ANEPPS transients in intact fibers rendered electrically passive. In contrast, activation of IKV resulted in time- and voltage-dependent attenuations in optical transients that coincided in time with the peaks of IKV records. Normalized peak attenuations showed the same voltage dependence as peak IKV plots. A radial cable model including channels A and B and K diffusion in the TTS was used to simulate IKV and average TTS voltage changes. Model predictions and experimental data were compared to determine what fraction of gKV in the TTS accounted simultaneously for the electrical and optical data. Best predictions suggest that KV channels are approximately equally distributed in the sarcolemma and TTS membranes; under these conditions, >70% of IKV arises from the TTS. PMID:22851675

Voltage dependence of a stochastic model of activation of an alpha helical S4 sensor in a K channel membrane

NASA Astrophysics Data System (ADS)

Vaccaro, S. R.

2011-09-01

The voltage dependence of the ionic and gating currents of a K channel is dependent on the activation barriers of a voltage sensor with a potential function which may be derived from the principal electrostatic forces on an S4 segment in an inhomogeneous dielectric medium. By variation of the parameters of a voltage-sensing domain model, consistent with x-ray structures and biophysical data, the lowest frequency of the survival probability of each stationary state derived from a solution of the Smoluchowski equation provides a good fit to the voltage dependence of the slowest time constant of the ionic current in a depolarized membrane, and the gating current exhibits a rising phase that precedes an exponential relaxation. For each depolarizing potential, the calculated time dependence of the survival probabilities of the closed states of an alpha helical S4 sensor are in accord with an empirical model of the ionic and gating currents recorded during the activation process.

Contribution of Sialic Acid to the Voltage Dependence of Sodium Channel Gating

PubMed Central

Bennett, Eric; Urcan, Mary S.; Tinkle, Sally S.; Koszowski, Adam G.; Levinson, Simon R.

1997-01-01

A potential role for sialic acid in the voltage-dependent gating of rat skeletal muscle sodium channels (rSkM1) was investigated using Chinese hamster ovary (CHO) cells stably transfected with rSkM1. Changes in the voltage dependence of channel gating were observed after enzymatic (neuraminidase) removal of sialic acid from cells expressing rSkM1 and through the expression of rSkM1 in a sialylation-deficient cell line (lec2). The steady-state half-activation voltages (Va) of channels under each condition of reduced sialylation were ∼10 mV more depolarized than control channels. The voltage dependence of the time constants of channel activation and inactivation were also shifted in the same direction and by a similar magnitude. In addition, recombinant deletion of likely glycosylation sites from the rSkM1 sequence resulted in mutant channels that gated at voltages up to 10 mV more positive than wild-type channels. Thus three independent means of reducing channel sialylation show very similar effects on the voltage dependence of channel gating. Finally, steady-state activation voltages for channels subjected to reduced sialylation conditions were much less sensitive to the effects of external calcium than those measured under control conditions, indicating that sialic acid directly contributes to the negative surface potential. These results are consistent with an electrostatic mechanism by which external, negatively charged sialic acid residues on rSkM1 alter the electric field sensed by channel gating elements. PMID:9089440

Significance of the gate voltage-dependent mobility in the electrical characterization of organic field effect transistors

NASA Astrophysics Data System (ADS)

Kim, Jong Beom; Lee, Dong Ryeol

2018-04-01

We studied the effect of the addition of free hole- and electron-rich organic molecules to organic semiconductors (OSCs) in organic field effect transistors (OFETs) on the gate voltage-dependent mobility. The drain current versus gate voltage characteristics were quantitatively analyzed using an OFET mobility model of power law behavior based on hopping transport in an OSC. This analysis distinguished the threshold voltage shifts, depending on the materials and structures of the OFET device, and properly estimated the hopping transport of the charge carriers induced by the gate bias within the OSC from the power law exponent parameter. The addition of pentacene or C60 molecules to a one-monolayer pentacene-based OFET shifted the threshold voltages negatively or positively, respectively, due to the structural changes that occurred in the OFET device. On the other hand, the power law parameters revealed that the addition of charge carriers of the same or opposite polarity enhanced or hindered hopping transport, respectively. This study revealed the need for a quantitative analysis of the gate voltage-dependent mobility while distinguishing this effect from the threshold voltage effect in order to understand OSC hopping transport in OFETs.

Threshold-Voltage Shifts in Organic Transistors Due to Self-Assembled Monolayers at the Dielectric: Evidence for Electronic Coupling and Dipolar Effects.

PubMed

Aghamohammadi, Mahdieh; Rödel, Reinhold; Zschieschang, Ute; Ocal, Carmen; Boschker, Hans; Weitz, R Thomas; Barrena, Esther; Klauk, Hagen

2015-10-21

The mechanisms behind the threshold-voltage shift in organic transistors due to functionalizing of the gate dielectric with self-assembled monolayers (SAMs) are still under debate. We address the mechanisms by which SAMs determine the threshold voltage, by analyzing whether the threshold voltage depends on the gate-dielectric capacitance. We have investigated transistors based on five oxide thicknesses and two SAMs with rather diverse chemical properties, using the benchmark organic semiconductor dinaphtho[2,3-b:2',3'-f]thieno[3,2-b]thiophene. Unlike several previous studies, we have found that the dependence of the threshold voltage on the gate-dielectric capacitance is completely different for the two SAMs. In transistors with an alkyl SAM, the threshold voltage does not depend on the gate-dielectric capacitance and is determined mainly by the dipolar character of the SAM, whereas in transistors with a fluoroalkyl SAM the threshold voltages exhibit a linear dependence on the inverse of the gate-dielectric capacitance. Kelvin probe force microscopy measurements indicate this behavior is attributed to an electronic coupling between the fluoroalkyl SAM and the organic semiconductor.

CFTR fails to inhibit the epithelial sodium channel ENaC expressed in Xenopus laevis oocytes

PubMed Central

Nagel, G; Barbry, P; Chabot, H; Brochiero, E; Hartung, K; Grygorczyk, R

2005-01-01

The cystic fibrosis transmembrane conductance regulator (CFTR) plays a crucial role in regulating fluid secretion by the airways, intestines, sweat glands and other epithelial tissues. It is well established that the CFTR is a cAMP-activated, nucleotide-dependent anion channel, but additional functions are often attributed to it, including regulation of the epithelial sodium channel (ENaC). The absence of CFTR-dependent ENaC inhibition and the resulting sodium hyperabsorption were postulated to be a major electrolyte transport abnormality in cystic fibrosis (CF)-affected epithelia. Several ex vivo studies, including those that used the Xenopus oocyte expression system, have reported ENaC inhibition by activated CFTR, but contradictory results have also been obtained. Because CFTR–ENaC interactions have important implications in the pathogenesis of CF, the present investigation was undertaken by our three independent laboratories to resolve whether CFTR regulates ENaC in oocytes and to clarify potential sources of previously reported dissimilar observations. Using different experimental protocols and a wide range of channel expression levels, we found no evidence that activated CFTR regulates ENaC when oocyte membrane potential was carefully clamped. We determined that an apparent CFTR-dependent ENaC inhibition could be observed when resistance in series with the oocyte membrane was not low enough or the feedback voltage gain was not high enough. We suggest that the inhibitory effect of CFTR on ENaC reported in some earlier oocyte studies could be attributed to problems arising from high levels of channel expression and suboptimal recording conditions, that is, large series resistance and/or insufficient feedback voltage gain. PMID:15746174

Membrane Potential Controls the Efficacy of Catecholamine-induced β1-Adrenoceptor Activity*

PubMed Central

Birk, Alexandra; Rinne, Andreas; Bünemann, Moritz

2015-01-01

G protein-coupled receptors (GPCRs) are membrane-located proteins and, therefore, are exposed to changes in membrane potential (VM) in excitable tissues. These changes have been shown to alter receptor activation of certain Gi-and Gq-coupled GPCRs. By means of a combination of whole-cell patch-clamp and Förster resonance energy transfer (FRET) in single cells, we demonstrate that the activation of the Gs-coupled β1-adrenoreceptor (β1-AR) by the catecholamines isoprenaline (Iso) and adrenaline (Adr) is regulated by VM. This voltage-dependence is also transmitted to G protein and arrestin 3 signaling. Voltage-dependence of β2-AR activation, however, was weak compared with β1-AR voltage-dependence. Drug efficacy is a major target of β1-AR voltage-dependence as depolarization attenuated receptor activation, even under saturating concentrations of agonists, with significantly faster kinetics than the deactivation upon agonist withdrawal. Also the efficacy of the endogenous full agonist adrenaline was reduced by depolarization. This is a unique finding since reports of natural full agonists at other voltage-dependent GPCRs only show alterations in affinity during depolarization. Based on a Boltzmann function fit to the relationship of VM and receptor-arrestin 3 interaction we determined the voltage-dependence with highest sensitivity in the physiological range of membrane potential. Our data suggest that under physiological conditions voltage regulates the activity of agonist-occupied β1-adrenoceptors on a very fast time scale. PMID:26408198

Origin and voltage dependence of asparagine-induced depolarization in intestinal cells of Xenopus embryo.

PubMed Central

Bergman, C; Bergman, J

1985-01-01

The kinetics and voltage dependence of asparagine (Asn)-induced depolarization in endoderm cells from Xenopus laevis embryos were analysed using current-clamp techniques. The depolarization is assumed to reflect the activation of an amino acid membrane carrier; it is accompanied by a slight increase in membrane resistance and cannot be explained by only the electrogenic character of the Asn carrier. It is proposed that the Asn depolarization arises, at least in part, from the decrease of the permeability ratio PK/PNa indirectly associated with the Na-coupled amino acid uptake. At room temperature (20-23 degrees C) the Asn response develops according to a single exponential function whose time constant is correlated with the final level of depolarization. Both amplitude and rise time of the depolarization are sensitive to variations of membrane potential and changes in Asn or Na external concentrations. Lowering the temperature decreases the amplitude of the Asn depolarization and increases its rise time with a Q10 factor of two; the kinetics remain of the Michaelis-Menten type, with a marked decrease in delta Emax and no change in Km. When the holding potential is altered by depolarizing and hyperpolarizing currents, the Asn response varies according to a bell-shaped characteristic presenting an optimum near the normal resting level. Membrane depolarizations induced by Na/K-pump inhibitors or high external K concentrations reduce the size of the Asn response; repolarizing the cell by current injection does not reverse the inhibitory effect of external K ions. Hyperpolarizing the membrane with a K-free Ringer solution increases the amplitude of the Asn response. In all these cases a decrease in delta Emax accounts for the apparent voltage sensitivity of the carrier mechanism. When induced by alterations of [K]o, an additional change in Km is observed, suggesting a K/Na-competitive inhibition of the Asn carrier. The results are discussed in terms of the amino acid carrier and passive membrane properties. It is suggested that the outward K-electrochemical gradient contributes an additional source of energy to the Na-dependent Asn uptake. PMID:4057089

Crebanine inhibits voltage-dependent Na+ current in guinea-pig ventricular myocytes.

PubMed

Xiao-Shan, He; Qing, Lin; Yun-Shu, Ma; Ze-Pu, Yu

2014-01-01

To study the effects of crebanine on voltage-gated Na(+) channels in cardiac tissues. Single ventricular myocytes were enzymatically dissociated from adult guinea-pig heart. Voltage-dependent Na(+) current was recorded using the whole cell voltage-clamp technique. Crebanine reversibly inhibited Na(+) current with an IC50 value of 0.283 mmol·L(-1) (95% confidence range: 0.248-0.318 mmol·L(-1)). Crebanine at 0.262 mmol·L(-1) caused a negative shift (about 12 mV) in the voltage-dependence of steady-state inactivation of Na(+) current, and retarded its recovery from inactivation, but did not affect its activation curve. In addition to blocking other voltage-gated ion channels, crebanine blocked Na(+) channels in guinea-pig ventricular myocytes. Crebanine acted as an inactivation stabilizer of Na(+) channels in cardiac tissues. Copyright © 2014 China Pharmaceutical University. Published by Elsevier B.V. All rights reserved.

Voltage-Dependent Gating of hERG Potassium Channels

PubMed Central

Cheng, Yen May; Claydon, Tom W.

2012-01-01

The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397

Understanding Mott-Schottky Measurements under Illumination in Organic Bulk Heterojunction Solar Cells

NASA Astrophysics Data System (ADS)

Zonno, Irene; Martinez-Otero, Alberto; Hebig, Jan-Christoph; Kirchartz, Thomas

2017-03-01

The Mott-Schottky analysis in the dark is a frequently used method to determine the doping concentration of semiconductors from capacitance-voltage measurements, even for such complex systems as polymer:fullerene blends used for organic solar cells. While the analysis of capacitance-voltage measurements in the dark is relatively well established, the analysis of data taken under illumination is currently not fully understood. Here, we present experiments and simulations to show which physical mechanisms affect the Mott-Schottky analysis under illumination. We show that the mobility of the blend has a major influence on the shape of the capacitance-voltage curve and can be obtained from data taken under reverse bias. In addition, we show that the apparent shift of the built-in voltage observed previously can be explained by a shift of the onset of space-charge-limited collection with illumination intensity.

Excitatory synaptic inputs to mouse on-off direction-selective retinal ganglion cells lack direction tuning.

PubMed

Park, Silvia J H; Kim, In-Jung; Looger, Loren L; Demb, Jonathan B; Borghuis, Bart G

2014-03-12

Direction selectivity represents a fundamental visual computation. In mammalian retina, On-Off direction-selective ganglion cells (DSGCs) respond strongly to motion in a preferred direction and weakly to motion in the opposite, null direction. Electrical recordings suggested three direction-selective (DS) synaptic mechanisms: DS GABA release during null-direction motion from starburst amacrine cells (SACs) and DS acetylcholine and glutamate release during preferred direction motion from SACs and bipolar cells. However, evidence for DS acetylcholine and glutamate release has been inconsistent and at least one bipolar cell type that contacts another DSGC (On-type) lacks DS release. Here, whole-cell recordings in mouse retina showed that cholinergic input to On-Off DSGCs lacked DS, whereas the remaining (glutamatergic) input showed apparent DS. Fluorescence measurements with the glutamate biosensor intensity-based glutamate-sensing fluorescent reporter (iGluSnFR) conditionally expressed in On-Off DSGCs showed that glutamate release in both On- and Off-layer dendrites lacked DS, whereas simultaneously recorded excitatory currents showed apparent DS. With GABA-A receptors blocked, both iGluSnFR signals and excitatory currents lacked DS. Our measurements rule out DS release from bipolar cells onto On-Off DSGCs and support a theoretical model suggesting that apparent DS excitation in voltage-clamp recordings results from inadequate voltage control of DSGC dendrites during null-direction inhibition. SAC GABA release is the apparent sole source of DS input onto On-Off DSGCs.

A 3D resistivity model derived from the transient electromagnetic data observed on the Araba fault, Jordan

NASA Astrophysics Data System (ADS)

Rödder, A.; Tezkan, B.

2013-01-01

72 inloop transient electromagnetic soundings were carried out on two 2 km long profiles perpendicular and two 1 km and two 500 m long profiles parallel to the strike direction of the Araba fault in Jordan which is the southern part of the Dead Sea transform fault indicating the boundary between the African and Arabian continental plates. The distance between the stations was on average 50 m. The late time apparent resistivities derived from the induced voltages show clear differences between the stations located at the eastern and at the western part of the Araba fault. The fault appears as a boundary between the resistive western (ca. 100 Ωm) and the conductive eastern part (ca. 10 Ωm) of the survey area. On profiles parallel to the strike late time apparent resistivities were almost constant as well in the time dependence as in lateral extension at different stations, indicating a 2D resistivity structure of the investigated area. After having been processed, the data were interpreted by conventional 1D Occam and Marquardt inversion. The study using 2D synthetic model data showed, however, that 1D inversions of stations close to the fault resulted in fictitious layers in the subsurface thus producing large interpretation errors. Therefore, the data were interpreted by a 2D forward resistivity modeling which was then extended to a 3D resistivity model. This 3D model explains satisfactorily the time dependences of the observed transients at nearly all stations.

Capacitors in Series: A Laboratory Activity to Promote Critical Thinking.

ERIC Educational Resources Information Center

Noll, Ellis D.; Kowalski, Ludwik

1996-01-01

Describes experiments designed to explore the distribution of potential difference between two uncharged capacitors when they are suddenly connected to a source of constant voltage. Enables students to explore the evolution of a system in which initial voltage distribution depends on capacitor values, and the final voltage distribution depends on…

Synergistic effects of liquid and gas phase discharges using pulsed high voltage for dyes degradation in the presence of oxygen.

PubMed

Yang, Bin; Zhou, Minghua; Lei, Lecheng

2005-07-01

The technology of combined liquid and gas phase discharges (LGD) using pulsed high voltage for dyes degradation was developed in this study. Apparent synergistic effects for Acid orange II (AO) degradation in the presence of oxygen were observed. The enhancement of AO degradation rate was around 302%. Furthermore, higher energy efficiency was obtained comparing with individual liquid phase discharge (LD) or gas phase discharge process (GD). The AO degradation in the presence of oxygen by LGD proceeded through the direct ozone oxidation and the ozone decomposition induced by LD. Important operating parameters such as electrode distance, applied voltage, pulse repetition rate, and types of dyes were further investigated.

Origin of the transition voltage in gold-vacuum-gold atomic junctions.

PubMed

Wu, Kunlin; Bai, Meilin; Sanvito, Stefano; Hou, Shimin

2013-01-18

The origin and the distance dependence of the transition voltage of gold-vacuum-gold junctions are investigated by employing first-principles quantum transport simulations. Our calculations show that atomic protrusions always exist on the electrode surface of gold-vacuum-gold junctions fabricated using the mechanically controllable break junction (MCBJ) method. The transition voltage of these gold-vacuum-gold junctions with atomically sharp electrodes is determined by the local density of states (LDOS) of the apex gold atom on the electrode surface rather than by the vacuum barrier shape. More specifically, the absolute value of the transition voltage roughly equals the rising edge of the LDOS peak contributed by the 6p atomic orbitals of the gold atoms protruding from the electrode surface, whose local Fermi level is shifted downwards when a bias voltage is applied. Since the LDOS of the apex gold atom depends strongly on the exact shape of the electrode, the transition voltage is sensitive to the variation of the atomic configuration of the junction. For asymmetric junctions, the transition voltage may also change significantly depending on the bias polarity. Considering that the occurrence of the transition voltage requires the electrode distance to be larger than a critical value, the interaction between the two electrodes is actually rather weak. Consequently, the LDOS of the apex gold atom is mainly determined by its local atomic configuration and the transition voltage only depends weakly on the electrode distance as observed in the MCBJ experiments.

Multiple regulation by external ATP of nifedipine-insensitive, high voltage-activated Ca(2+) current in guinea-pig mesenteric terminal arteriole.

PubMed

Morita, Hiromitsu; Sharada, Thapaliya; Takewaki, Tadashi; Ito, Yushi; Inoue, Ryuji

2002-03-15

We investigated the receptor-mediated regulation of nifedipine-insensitive, high voltage-activated Ca(2+) currents in guinea-pig terminal mesenteric arterioles (I(mVDCC)) using the whole-cell clamp technique. Screening of various vasoactive substances revealed that ATP, histamine and substance P exert modulatory effects on I(mVDCC). The effects of ATP on I(mVDCC) after complete P2X receptor desensitization exhibited a complex concentration dependence. With 5 mM Ba(2+), ATP potentiated I(mVDCC) at low concentrations (approximately 1-100 microM), but inhibited it at higher concentrations (>100 microM). The potentiating effects of ATP were abolished by suramin (100 microM) and PPADS (10 microM) and by intracellular application of GDPbetaS (500 microM), whereas a substantial part of I(mVDCC) inhibition by milimolar concentrations of ATP remained unaffected; due probably to its divalent cation chelating actions. In divalent cation-free solution, I(mVDCC) was enlarged and underwent biphasic effects by ATPgammaS and ADP, while 2-methylthio ATP (2MeSATP) exerted only inhibition, and pyrimidines such as UTP and UDP were ineffective. ATP-induced I(mVDCC) potentiation was selectively inhibited by anti-Galpha(s) antibodies or protein kinase A (PKA) inhibitory peptides and mimicked by dibutyryl cAMP. In contrast, ATP-induced inhibition was selectively inhibited by Galpha(q/11) antibodies or protein kinase C (PKC) inhibitory peptides and mimicked by PDBu. Pretreatment with pertussis toxin was ineffective. The apparent efficacy for I(mVDCC) potentiation with PKC inhibitors was: ATPgammaS > ATP>/=ADP and for inhibition with PKA inhibitors was: 2MeSATP > ATPgammaS > ATP > ADP. Neither I(mVDCC) potentiation nor inhibition showed voltage dependence. These results suggest that I(mVDCC) is multi-phasically regulated by external ATP via P2Y(11)-resembling receptor/G(s)/PKA pathway, P2Y(1)-like receptor/G(q/11)/PKC pathway, and metal chelation.

Regulation of respiration in brain mitochondria and synaptosomes: restrictions of ADP diffusion in situ, roles of tubulin, and mitochondrial creatine kinase.

PubMed

Monge, Claire; Beraud, Nathalie; Kuznetsov, Andrey V; Rostovtseva, Tatiana; Sackett, Dan; Schlattner, Uwe; Vendelin, Marko; Saks, Valdur A

2008-11-01

The role of ubiquitous mitochondrial creatine kinase (uMtCK) reaction in regulation of mitochondrial respiration was studied in purified preparations of rat brain synaptosomes and mitochondria. In permeabilized synaptosomes, apparent Km for exogenous ADP, Km (ADP), in regulation of respiration in situ was rather high (110 +/- 11 microM) in comparison with isolated brain mitochondria (9 +/- 1 microM). This apparent Km for ADP observed in isolated mitochondria in vitro dramatically increased to 169 +/- 52 microM after their incubation with 1 muM of dimeric tubulin showing that in rat brain, particularly in synaptosomes, mitochondrial outer membrane permeability for ADP, and ATP may be restricted by tubulin binding to voltage dependent anion channel (VDAC). On the other hand, in synaptosomes apparent Km (ADP) decreased to 25 +/- 1 microM in the presence of 20 mM creatine. To fully understand this effect of creatine on kinetics of respiration regulation, complete kinetic analysis of uMtCK reaction in isolated brain mitochondria was carried out. This showed that oxidative phosphorylation specifically altered only the dissociation constants for MgATP, by decreasing that from ternary complex MtCK.Cr.MgATP (K (a)) from 0.13 +/- 0.02 to 0.018 +/- 0.007 mM and that from binary complex MtCK.MgATP (K (ia)) from 1.1 +/- 0.29 mM to 0.17 +/- 0.07 mM. Apparent decrease of dissociation constants for MgATP reflects effective cycling of ATP and ADP between uMtCK and adenine nucleotide translocase (ANT). These results emphasize important role and various pathophysiological implications of the phosphocreatine-creatine kinase system in energy transfer in brain cells, including synaptosomes.

Voltage-independent inhibition of Ca(V)2.2 channels is delimited to a specific region of the membrane potential in rat SCG neurons.

PubMed

Vivas, Oscar; Arenas, Isabel; García, David E

2012-06-01

Neurotransmitters and hormones regulate Ca(V)2.2 channels through a voltage-independent pathway which is not well understood. It has been suggested that this voltage-independent inhibition is constant at all membrane voltages. However, changes in the percent of voltage-independent inhibition of Ca(V)2.2 have not been tested within a physiological voltage range. Here, we used a double-pulse protocol to isolate the voltage-independent inhibition of Ca(V)2.2 channels induced by noradrenaline in rat superior cervical ganglion neurons. To assess changes in the percent of the voltage-independent inhibition, the activation voltage of the channels was tested between -40 and +40 mV. We found that the percent of voltage-independent inhibition induced by noradrenaline changed with the activation voltage used. In addition, voltage-independent inhibition induced by oxo-M, a muscarinic agonist, exhibited the same dependence on activation voltage, which supports that this pattern is not exclusive for adrenergic activation. Our results suggested that voltage-independent inhibition of Ca(V)2.2 channels depends on the activation voltage of the channel in a physiological voltage range. This may have relevant implications in the understanding of the mechanism involved in voltage-independent inhibition.

Breathing of voltage dependent anion channel as revealed by the fractal property of its gating

NASA Astrophysics Data System (ADS)

Manna, Smarajit; Banerjee, Jyotirmoy; Ghosh, Subhendu

2007-12-01

The gating of voltage dependent anion channel (VDAC) depends on the movement of voltage sensors in the transmembrane region, but the actual mechanism is still not well understood. With a view to understand the phenomenon we have analyzed the current recordings of VDAC in lipid bilayer membrane (BLM) and found that the data show self-similarity and fractal characteristics. We look for the microscopic and molecular basis of fractal behavior of gating of VDAC. A model describing the oscillatory dynamics of voltage sensors of VDAC in the transmembrane region under applied potential has been proposed which gives rise to the aforesaid fractal behavior.

Theory and experiment on charging and discharging a capacitor through a reverse-biased diode

NASA Astrophysics Data System (ADS)

Roy, Arijit; Mallick, Abhishek; Adhikari, Aparna; Guin, Priyanka; Chatterjee, Dibyendu

2018-06-01

The beauty of a diode lies in its voltage-dependent nonlinear resistance. The voltage on a charging and discharging capacitor through a reverse-biased diode is calculated from basic equations and is found to be in good agreement with experimental measurements. Instead of the exponential dependence of charging and discharging voltages with time for a resistor-capacitor circuit, a linear time dependence is found when the resistor is replaced by a reverse-biased diode. Thus, well controlled positive and negative ramp voltages are obtained from the charging and discharging diode-capacitor circuits. This experiment can readily be performed in an introductory physics and electronics laboratory.

Electrical probe characteristic recovery by measuring only one time-dependent parameter

NASA Astrophysics Data System (ADS)

Costin, C.; Popa, G.; Anita, V.

2016-03-01

Two straightforward methods for recovering the current-voltage characteristic of an electrical probe are proposed. Basically, they consist of replacing the usual power supply from the probe circuit with a capacitor which can be charged or discharged by the probe current drained from the plasma. The experiment requires the registration of only one time-dependent electrical parameter, either the probe current or the probe voltage. The corresponding time-dependence of the second parameter, the probe voltage, or the probe current, respectively, can be calculated using an integral or a differential relation and the current-voltage characteristic of the probe can be obtained.

Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe

2011-07-29

Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channelmore » expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.« less

Validating and improving a zero-dimensional stack voltage model of the Vanadium Redox Flow Battery

NASA Astrophysics Data System (ADS)

König, S.; Suriyah, M. R.; Leibfried, T.

2018-02-01

Simple, computationally efficient battery models can contribute significantly to the development of flow batteries. However, validation studies for these models on an industrial-scale stack level are rarely published. We first extensively present a simple stack voltage model for the Vanadium Redox Flow Battery. For modeling the concentration overpotential, we derive mass transfer coefficients from experimental results presented in the 1990s. The calculated mass transfer coefficient of the positive half-cell is 63% larger than of the negative half-cell, which is not considered in models published to date. Further, we advance the concentration overpotential model by introducing an apparent electrochemically active electrode surface which differs from the geometric electrode area. We use the apparent surface as fitting parameter for adapting the model to experimental results of a flow battery manufacturer. For adapting the model, we propose a method for determining the agreement between model and reality quantitatively. To protect the manufacturer's intellectual property, we introduce a normalization method for presenting the results. For the studied stack, the apparent electrochemically active surface of the electrode is 41% larger than its geometrical area. Hence, the current density in the diffusion layer is 29% smaller than previously reported for a zero-dimensional model.

Voltage-dependent blockade of muscle Na+ channels by guanidinium toxins

PubMed Central

1984-01-01

Na+ channels from rat muscle plasma membrane vesicles were inserted into neutral planar phospholipid bilayers and were activated by batrachotoxin. Single channel blocking events induced by the addition of various guanidinium toxins were analyzed to derive the rates of channel-toxin association and dissociation. Blocking by tetrodotoxin, saxitoxin, and six natural saxitoxin derivatives containing sulfate or hydroxyl groups were studied. Although the binding affinities vary over 2,000-fold, all of the toxins exhibit identical voltage dependence of the blocking reactions, regardless of the toxin's net charge. The results suggest that the voltage dependence of toxin binding is due to a voltage-dependent conformational equilibrium of the toxin receptor, rather than to direct entry of the charged toxin molecule into the applied transmembrane electric field. PMID:6096479

Stress-dependent voltage offsets from polymer insulators used in rock mechanics and material testing

NASA Astrophysics Data System (ADS)

Carlson, G. G.; Dahlgren, R.; Vanderbilt, V. C.; Johnston, M. J.; Dunson, C.; Gray, A.; Freund, F.

2013-12-01

Dielectric insulators are used in a variety of laboratory settings when performing experiments in rock mechanics, petrology, and electromagnetic studies of rocks in the fields of geophysics, material science, and civil engineering. These components may be used to electrically isolate geological samples from the experimental equipment, to perform a mechanical compliance function between brittle samples and the loading equipment, to match ultrasonic transducers, or perform other functions. In many experimental configurations the insulators bear the full brunt of force applied to the sample but do not need to withstand high voltages, therefore the insulators are often thin sheets of mechanically tough polymers. From an instrument perspective, transduction from various types of mechanical perturbation has been qualitatively compared for a number of polymers [1, 2] and these error sources are readily apparent during high-impedance measurements if not mitigated. However even when following best practices, a force-dependent voltage signal still remains and its behavior is explored in this presentation. In this experiment two thin sheets (0.25 mm) of high-density polyethylene (HDPE) were set up in a stack, held alternately between three aluminum bars; this stack was placed on the platen of a 60T capacity hydraulic testing machine. The surface area, A, over which the force is applied to the PE sheets in this sandwich is roughly 40 square cm, each sheet forming a parallel-plate capacitor having roughly 320 pF [3], assuming the relative dielectric permittivity of PE is ~2.3. The outer two aluminum bars were connected to the LO input of the electrometer and the central aluminum bar was connected to the HI input of a Keithley model 617 electrometer. Once the stack is mechanically well-seated with no air gaps, the voltage offset is observed to be a linear function of the baseline voltage for a given change in applied force. For a periodically applied force of 66.7 kN the voltage offsets were measured as a function of initial voltage, and these data were fit with a linear function that was constrained to pass through the origin. The best fit solution had a correlation coefficient of R = 0.85 and a slope of approximately -0.0228 volts/volt. The voltage offset when normalized is demonstrated to be constant -2.28 % for both positive and negative polarities over nearly 3 orders of baseline voltage magnitude. From this, the voltage-force coefficient is derived to be -0.34 ppm/N. This correlates well to a first-order parallel plate capacitor model that assumes constant area, and small deformation such that the polymer may be mechanically modeled by a spring that obeys Hooke's law. This simple model predicts that the coefficient of proportionality is a function of Young's modulus E = 0.8 GPa and surface area of the insulator, theoretically -1/EA = -0.31 ppm/N. The outcome of this work is an improved insulator made from ultra-high molecular weight (UHMW) polyethylene and other approaches toward the minimization of and compensation for these experimental artifacts. References: [1] Keithley Instruments, Low level measurements handbook, 'Choosing the best insulator,' 2-11 (2004). [2] Ibid., 2-26. [3] A. Skumiel, 'How to transform mechanical work into electrical energy using a capacitor,' European Journal of Physics 32, 625-630 (2011).

Determination of secondary electron emission characteristics of lunar soil samples

NASA Technical Reports Server (NTRS)

Gold, T.; Baron, R. L.; Bilson, E.

1979-01-01

A procedure is described for the determination of the 'apparent crossover voltage', i.e. the value of the primary (bombarding) electron energy at which an insulating sample surface changes the average sign of its charge. This apparent crossover point is characteristic of the secondary emission properties of insulating powders such as the lunar soil samples. Lunar core samples from well-defined, distinct soil layers are found to differ significantly in their secondary emission properties. This observation supports the suggestion that soil layers were deposited by an electrostatic transport process.

Grafting voltage and pharmacological sensitivity in potassium channels.

PubMed

Lan, Xi; Fan, Chunyan; Ji, Wei; Tian, Fuyun; Xu, Tao; Gao, Zhaobing

2016-08-01

A classical voltage-gated ion channel consists of four voltage-sensing domains (VSDs). However, the roles of each VSD in the channels remain elusive. We developed a GVTDT (Graft VSD To Dimeric TASK3 channels that lack endogenous VSDs) strategy to produce voltage-gated channels with a reduced number of VSDs. TASK3 channels exhibit a high host tolerance to VSDs of various voltage-gated ion channels without interfering with the intrinsic properties of the TASK3 selectivity filter. The constructed channels, exemplified by the channels grafted with one or two VSDs from Kv7.1 channels, exhibit classical voltage sensitivity, including voltage-dependent opening and closing. Furthermore, the grafted Kv7.1 VSD transfers the potentiation activity of benzbromarone, an activator that acts on the VSDs of the donor channels, to the constructed channels. Our study indicates that one VSD is sufficient to voltage-dependently gate the pore and provides new insight into the roles of VSDs.

Dependence of Na+ pump current on external monovalent cations and membrane potential in rabbit cardiac Purkinje cells.

PubMed Central

Bielen, F V; Glitsch, H G; Verdonck, F

1991-01-01

1. The effect of membrane potential and various extracellular monovalent cations on the Na+ pump current (Ip) was studied on isolated, single Purkinje cells of the rabbit heart by means of whole-cell recording. 2. Ip was identified as current activated by external K+ or its congeners NH4+ and Tl+. The current was blocked by dihydroouabain (1-5 x 10(-4) M) over the whole range of membrane potentials tested. 3. In Na(+)-containing solution half-maximum Ip activation (K0.5) occurred at 0.4 mM-Tl+, 1.9 mM-K+ and 5.7 mM-NH4+ (holding potential, -20 mV). 4. The pump current (Ip)-voltage (V) relationship of the cells in Na(+)-containing media with K+ or its congeners at the tested concentrations greater than K0.5 displayed a steep positive slope at negative membrane potentials between -120 and -20 mV. Little voltage dependence of Ip was observed at more positive potentials up to +40 mV. At even more positive potentials Ip measured at 2 and 5.4 mM-K+ decreased. 5. Lowering the concentration of K+ or its congeners below the K0.5 value in Na(+)-containing solution induced a region of negative slope of the Ip-V curve at membrane potentials positive to -20 mV. 6. The shape of the Ip-V relationship remained unchanged when the K+ concentration (5.4 mM) of the Na(+)-containing medium was replaced by NH4+ or Tl+ concentrations of similar potency to activate Ip (20 mM-NH4+ or 2 mM-Tl+). 7. In Na(+)-free, choline-containing solution half-maximum Ip activation occurred at 0.13 mM-K+ (holding potential, -20 mV). 8. At negative membrane potentials the positive slope of the Ip-V curve was flatter in Na(+)-free than in Na(+)-containing media. A reduced voltage dependence of Ip persisted, regardless of whether choline ions or Li+ were used as a Na+ substitute. 9. Lowering the K+ concentration of the Na(+)-free, choline-containing solution to 0.05 mM evoked an extended region of negative slope in the Ip-V relationship at membrane potentials between -40 and +60 mV. 10. It is concluded that the apparent affinity of the Na(+)-K+ pump towards K+ in cardiac Purkinje cells depends on both the membrane potential and the extracellular Na+ concentration. 11. The region of negative slope of the Ip-V curve observed in cells which were superfused with media containing low concentrations of K+ or its congeners strongly suggests the existence of at least two voltage-sensitive steps in the cardiac Na(+)-K+ pump cycle.(ABSTRACT TRUNCATED AT 400 WORDS) PMID:1665855

Conformational changes in the M2 muscarinic receptor induced by membrane voltage and agonist binding

PubMed Central

Navarro-Polanco, Ricardo A; Galindo, Eloy G Moreno; Ferrer-Villada, Tania; Arias, Marcelo; Rigby, J Ryan; Sánchez-Chapula, José A; Tristani-Firouzi, Martin

2011-01-01

Abstract The ability to sense transmembrane voltage is a central feature of many membrane proteins, most notably voltage-gated ion channels. Gating current measurements provide valuable information on protein conformational changes induced by voltage. The recent observation that muscarinic G-protein-coupled receptors (GPCRs) generate gating currents confirms their intrinsic capacity to sense the membrane electrical field. Here, we studied the effect of voltage on agonist activation of M2 muscarinic receptors (M2R) in atrial myocytes and how agonist binding alters M2R gating currents. Membrane depolarization decreased the potency of acetylcholine (ACh), but increased the potency and efficacy of pilocarpine (Pilo), as measured by ACh-activated K+ current, IKACh. Voltage-induced conformational changes in M2R were modified in a ligand-selective manner: ACh reduced gating charge displacement while Pilo increased the amount of charge displaced. Thus, these ligands manifest opposite voltage-dependent IKACh modulation and exert opposite effects on M2R gating charge displacement. Finally, mutations in the putative ligand binding site perturbed the movement of the M2R voltage sensor. Our data suggest that changes in voltage induce conformational changes in the ligand binding site that alter the agonist–receptor interaction in a ligand-dependent manner. Voltage-dependent GPCR modulation has important implications for cellular signalling in excitable tissues. Gating current measurement allows for the tracking of subtle conformational changes in the receptor that accompany agonist binding and changes in membrane voltage. PMID:21282291

Spin-dependent electrical conduction in a pentacene Schottky diode explored by electrically detected magnetic resonance

NASA Astrophysics Data System (ADS)

Fukuda, Kunito; Asakawa, Naoki

2017-02-01

Reported is the observation of dark spin-dependent electrical conduction in a Schottky barrier diode with pentacene (PSBD) using electrically detected magnetic resonance at room temperature. It is suggested that spin-dependent conduction exists in pentacene thin films, which is explored by examining the anisotropic linewidth of the EDMR signal and current density-voltage (J-V) measurements. The EDMR spectrum can be decomposed to Gaussian and Lorentzian components. The dependency of the two signals on the applied voltage was consistent with the current density-voltage (J-V) of the PSBD rather than that of the electron-only device of Al/pentacene/Al, indicating that the spin-dependent conduction is due to bipolaron formation associated with hole polaronic hopping processes. The applied-voltage dependence of the ratio of intensity of the Gaussian line to the Lorentzian may infer that increasing current density should make conducting paths more dispersive, thereby resulting in an increased fraction of the Gaussian line due to the higher dispersive g-factor.

Relaxation of Isolated Ventricular Cardiomyocytes by a Voltage-Dependent Process

NASA Astrophysics Data System (ADS)

Bridge, John H. B.; Spitzer, Kenneth W.; Ershler, Philip R.

1988-08-01

Cell contraction and relaxation were measured in single voltage-clamped guinea pig cardiomyocytes to investigate the contribution of sarcolemmal Na+-Ca2+ exchange to mechanical relaxation. Cells clamped from -80 to 0 millivolts displayed initial phasic and subsequent tonic contractions; caffeine reduced or abolished the phasic and enlarged the tonic contraction. The rate of relaxation from tonic contractions was steeply voltage-dependent and was significantly slowed in the absence of a sarcolemmal Na+ gradient. Tonic contractions elicited in the absence of a Na+ gradient promptly relaxed when external Na+ was applied, reflecting activation of Na+-Ca2+ exchange. It appears that a voltage-dependent Na+-Ca2+ exchange can rapidly mechanically relax mammalian heart muscle.

Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.

PubMed

Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan

2018-04-18

Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.

Three-dimensional current flow in a large-scale model of the cochlea and the mechanism of amplification of sound.

PubMed

Mistrík, Pavel; Mullaley, Chris; Mammano, Fabio; Ashmore, Jonathan

2009-03-06

The mammalian inner ear uses its sensory hair cells to detect and amplify incoming sound. It is unclear whether cochlear amplification arises uniquely from a voltage-dependent mechanism (electromotility) associated with outer hair cells (OHCs) or whether other mechanisms are necessary, for the voltage response of OHCs is apparently attenuated excessively by the membrane electrical filter. The cochlea contains many thousands of hair cells organized in extensive arrays, embedded in an electrically coupled system of supporting cells. We have therefore constructed a multi-element, large-scale computational model of cochlear sound transduction to study the underlying potassium (K+) recirculation. We have included experimentally determined parameters of cochlear macromechanics, which govern sound transduction, and data on hair cells' electrical parameters including tonotopical variation in the membrane conductance of OHCs. In agreement with the experiment, the model predicts an exponential decay of extracellular longitudinal K+ current spread. In contrast to the predictions from isolated cells, it also predicts low attenuation of the OHC transmembrane receptor potential (-5 dB per decade) in the 0.2-30 kHz range. This suggests that OHC electromotility could be driven by the transmembrane potential. Furthermore, the OHC electromotility could serve as a single amplification mechanism over the entire hearing range.

Association of EEG alpha variants and alpha power with alcohol dependence in Mexican American young adults.

PubMed

Ehlers, Cindy L; Phillips, Evelyn

2007-02-01

Several studies support an association between electroencephalogram (EEG) voltage and alcohol dependence. However, the distribution of EEG variants also appears to differ depending on an individual's ethnic heritage, suggesting significant genetic stratification of this EEG phenotype. The present study's aims were to investigate the incidence of EEG alpha variants and spectral power in the alpha frequency range in Mexican American young adults based on gender, and personal and family history of alcohol dependence. Clinical ratings (high-, medium-, and low alpha voltage variants) and spectral characteristics of the EEG in the alpha frequency range (7.5-12 Hz) were investigated in young adult (age 18-25 years) Mexican American men (n=98) and women (n=138) who were recruited from the community. Nineteen percent (n=45) of the participants had a low-voltage alpha EEG variant, 18% had a high-voltage variant, and 63% had a medium-voltage variant. There were no significant differences in the distribution of the EEG variants based on family history of alcohol dependence. There was a significant relationship between gender and the three alpha variants (chi2=9.7; df=2; P<.008), and there were no male participants with alcohol dependence with high alpha variants (chi2=5.8; df=2; P<.056). Alcohol dependence, but not a family history of alcohol dependence, was associated with lower spectral power in the alpha frequency range in the right (F=4.4; df=1,96; P<.04) and left (F=5.3; df=1.96; P<.02) occipital areas in the men but not in the women. In conclusion, in this select population of Mexican American young adults, male gender and alcohol dependence are associated with an absence of high-voltage alpha variants and lower alpha power in the EEG. These data suggest that EEG low voltage, a highly heritable trait, may represent an important endophenotype in male Mexican Americans that may aid in linking brain function with genetic factors underlying alcohol dependence in this ethnic group.

Voltage-dependent Ca2+ release from the SR of feline ventricular myocytes is explained by Ca2+-induced Ca2+ release.

PubMed

Piacentino, V; Dipla, K; Gaughan, J P; Houser, S R

2000-03-15

1. Direct voltage-gated (voltage-dependent Ca2+ release, VDCR) and Ca2+ influx-gated (Ca2+-induced Ca2+ release, CICR) sarcoplasmic reticulum (SR) Ca2+ release were studied in feline ventricular myocytes. The voltage-contraction relationship predicted by the VDCR hypothesis is sigmoidal with large contractions at potentials near the Ca2+ equilibrium potential (ECa). The relationship predicted by the CICR hypothesis is bell-shaped with no contraction at ECa. 2. The voltage dependence of contraction was measured in ventricular myocytes at physiological temperature (37 C), resting membrane potential and physiological [K+]. Experiments were performed with cyclic adenosine 3',5'-monophosphate (cAMP) in the pipette or in the presence of the beta-adrenergic agonist isoproterenol (isoprenaline; ISO). 3. The voltage-contraction relationship was bell-shaped in Na+-free solutions (to eliminate the Na+ current and Na+-Ca2+ exchange, NCX) but the relationship was broader than the L-type Ca2+ current (ICa,L)-voltage relationship. 4. Contractions induced with voltage steps from normal resting potentials to -40 mV are thought to represent VDCR rather than CICR. We found that cAMP and ISO shifted the voltage dependence of ICa,L activation to more negative potentials so that ICa,L was always present with steps to -40 mV. ICa,L at -40 mV inactivated when the holding potential was decreased (VŁ = -57.8 +/- 0.49 mV). 5. ISO increased inward current, SR Ca2+ load and contraction in physiological [Na+] and a broad bell-shaped voltage-contraction relationship was observed. Inhibition of reverse-mode NCX, decreasing ICa,L and decreasing SR Ca2+ loading all decreased contractions at strongly positive potentials near ECa. 6. The voltage-contraction relationship in 200 microM cadmium (Cd2+) was bell-shaped, supporting a role of ICa,L rather than VDCR. 7. All results could be accounted for by the CICR hypothesis, and many results exclude the VDCR hypothesis.

Block of calcium channels by enkephalin and somatostatin in neuroblastoma-glioma hybrid NG108-15 cells.

PubMed

Tsunoo, A; Yoshii, M; Narahashi, T

1986-12-01

Leucine-enkephalin, methionine-enkephalin, and morphine caused a reversible block of Ca2+ channel currents in neuroblastoma-glioma hybrid cells (NG108-15). The long-lasting (type 2) component of the Ca2+ channel current was blocked by leucine-enkephalin, while the transient (type 1) component was not affected. The enkephalin-induced blocking action was antagonized by naloxone and appears to be mediated by delta-opiate receptors. Two different aspects of the blocking effect were detected, a resting block and a recovery from block during prolonged depolarizing pulses. Recovery from block was more complete, and its time course was more rapid, with depolarization to more positive potentials. The dose dependence of the type 2 channel block at rest indicated a one-to-one binding stoichiometry, with an apparent dissociation constant of 8.8 nM. Somatostatin exerted a similar selective blocking action on the type 2 Ca2+ channel. The time- and voltage-dependent block of type 2 Ca2+ channels may provide a mechanism underlying the enkephalinergic presynaptic inhibition of transmitter release and the somatostatin block of pituitary growth hormone release.

Inhibitory effects of magnolol on voltage-gated Na+ and K+ channels of NG108-15 cells.

PubMed

Gong, Chi-Li; Wong, Kar-Lok; Cheng, Ka-Shun; Kuo, Chang-Shin; Chao, Chia-Chia; Tsai, Min-Fan; Leung, Yuk-Man

2012-05-05

Magnolol, a polyphenolic compound isolated from Houpu, a Chinese herb from the bark of Magnolia officinalis, has been reported to have in vitro and in vivo neuroprotective effects. In spite of these reported beneficial effects, studies on the direct impact of magnolol on neuronal ion channels have been scarce. Whether magnolol affects voltage-gated Na(+) channels (VGSC) and voltage-gated K(+) (Kv) channels is unknown. Using the whole-cell voltage-clamp method, we studied the effects of magnolol on voltage-gated ion channels in neuronal NG108-15 cells. Magnolol inhibited VGSC channels with mild state-dependence (IC(50) of 15 and 30 μM, at holding potentials of -70 and -100 mV, respectively). No frequency-dependence was observed in magnolol block. Magnolol caused a left-shift of 18 mV in the steady-state inactivation curve but did not affect the voltage-dependence of activation. Magnolol inhibited Kv channels with an IC(50) of 21 μM, and it caused a 20-mV left-shift in the steady-state inactivation curve without affecting the voltage-dependence of activation. In conclusion, magnolol is an inhibitor of both VGSC and Kv channels and these inhibitory effects may in part contribute to some of the reported neuroprotective effects of magnolol. Copyright © 2012 Elsevier B.V. All rights reserved.

Atomistic Modeling of Ion Conduction through the Voltage-Sensing Domain of the Shaker K+ Ion Channel.

PubMed

Wood, Mona L; Freites, J Alfredo; Tombola, Francesco; Tobias, Douglas J

2017-04-20

Voltage-sensing domains (VSDs) sense changes in the membrane electrostatic potential and, through conformational changes, regulate a specific function. The VSDs of wild-type voltage-dependent K + , Na + , and Ca 2+ channels do not conduct ions, but they can become ion-permeable through pathological mutations in the VSD. Relatively little is known about the underlying mechanisms of conduction through VSDs. The most detailed studies have been performed on Shaker K + channel variants in which ion conduction through the VSD is manifested in electrophysiology experiments as a voltage-dependent inward current, the so-called omega current, which appears when the VSDs are in their resting state conformation. Only monovalent cations appear to permeate the Shaker VSD via a pathway that is believed to be, at least in part, the same as that followed by the S4 basic side chains during voltage-dependent activation. We performed μs-time scale atomistic molecular dynamics simulations of a cation-conducting variant of the Shaker VSD under applied electric fields in an experimentally validated resting-state conformation, embedded in a lipid bilayer surrounded by solutions containing guanidinium chloride or potassium chloride. Our simulations provide insights into the Shaker VSD permeation pathway, the protein-ion interactions that control permeation kinetics, and the mechanism of voltage-dependent activation of voltage-gated ion channels.

Nonlinear antiferroelectric-like capacitance-voltage curves in ferroelectric BiFeO3 thin films

NASA Astrophysics Data System (ADS)

Jiang, A. Q.; Zhang, D. W.; Tang, T. A.

2013-07-01

The ferroelectric capacitance is usually nonlinear against increasing/decreasing voltage in sweeping time longer than 1 s and achieves a maximum value at around a coercive voltage within each loop. With the improved short-pulse measurements, we estimated the differential capacitance of ferroelectric Au/BiFeO3/LaNiO3/SrTiO3 thin-film capacitors from a nanosecond discharging current induced by a delta voltage after a stressing voltage pulse with widths of 500 ns-50 ms. With the shortening of the voltage sweeping time, we clearly observed two capacitance maxima from each branch of a capacitance-voltage (C-V) loop, reminiscent of an antiferroelectric behavior. After transformation of nanosecond domain switching current transients under pulses into polarization-voltage hysteresis loops, we further measured time dependent polarization retention as well as imprint in the range of 100 ns-1 s. Both positive and negative polarizations decay exponentially at characteristic times of 2.25 and 198 μs, suggesting the coexistence of preferred domains pointing to top and bottom electrodes in most epitaxial films. This exponential time dependence is similar to the dielectric degradation under a dc voltage, and the polarization retention can be improved through long-time opposite voltage stressing. With this improvement, the additional antiferroelectric-like dielectric maximum within each branch of a C-V loop disappears. This experiment provides the strong evidence of the effect of time-dependent charge injection on polarization retention and dielectric degradation.

Admittance Spectroscopy in CZTSSe: Metastability Behavior and Voltage Dependent Defect Study

DOE Office of Scientific and Technical Information (OSTI.GOV)

Koeper, Mark J.; Hages, Charles J.; Li, Jian V.

2016-11-21

Admittance spectroscopy has been performed on a CZTSSe device with a carrier injection pretreatment and under electronically relaxed conditions to demonstrate metastability behavior. We show that the measurements with the carrier injection pretreatment demonstrate two admittance signatures while the relaxed measurement demonstrates only one admittance signature with a different activation energy. Additionally, voltage dependent admittance spectroscopy was performed using the carrier injection pretreatment method at each of the applied voltage bias. The activation energies of the two admittance signatures were calculated and are shown to be independent of the voltage bias.

Reversible voltage dependent transition of abnormal and normal bipolar resistive switching.

PubMed

Wang, Guangyu; Li, Chen; Chen, Yan; Xia, Yidong; Wu, Di; Xu, Qingyu

2016-11-14

Clear understanding the mechanism of resistive switching is the important prerequisite for the realization of high performance nonvolatile resistive random access memory. In this paper, binary metal oxide MoO x layer sandwiched by ITO and Pt electrodes was taken as a model system, reversible transition of abnormal and normal bipolar resistive switching (BRS) in dependence on the maximum voltage was observed. At room temperature, below a critical maximum voltage of 2.6 V, butterfly shaped I-V curves of abnormal BRS has been observed with low resistance state (LRS) to high resistance state (HRS) transition in both polarities and always LRS at zero field. Above 2.6 V, normal BRS was observed, and HRS to LRS transition happened with increasing negative voltage applied. Temperature dependent I-V measurements showed that the critical maximum voltage increased with decreasing temperature, suggesting the thermal activated motion of oxygen vacancies. Abnormal BRS has been explained by the partial compensation of electric field from the induced dipoles opposite to the applied voltage, which has been demonstrated by the clear amplitude-voltage and phase-voltage hysteresis loops observed by piezoelectric force microscopy. The normal BRS was due to the barrier modification at Pt/MoO x interface by the accumulation and depletion of oxygen vacancies.

Subthreshold voltage noise of rat neocortical pyramidal neurones

PubMed Central

Jacobson, Gilad A; Diba, Kamran; Yaron-Jakoubovitch, Anat; Oz, Yasmin; Koch, Christof; Segev, Idan; Yarom, Yosef

2005-01-01

Neurones are noisy elements. Noise arises from both intrinsic and extrinsic sources, and manifests itself as fluctuations in the membrane potential. These fluctuations limit the accuracy of a neurone's output but have also been suggested to play a computational role. We present a detailed study of the amplitude and spectrum of voltage noise recorded at the soma of layer IV–V pyramidal neurones in slices taken from rat neocortex. The dependence of the noise on holding potential, synaptic activity and Na+ conductance is systematically analysed. We demonstrate that voltage noise increases non-linearly as the cell depolarizes (from a standard deviation (s.d.) of 0.19 mV at −75 mV to an s.d. of 0.54 mV at −55 mV). The increase in voltage noise is accompanied by an increase in the cell impedance, due to voltage dependence of Na+ conductance. The impedance increase accounts for the majority (70%) of the voltage noise increase. The increase in voltage noise and impedance is restricted to the low-frequency range (0.2–2 Hz). At the high frequency range (5–100 Hz) the voltage noise is dominated by synaptic activity. In our slice preparation, synaptic noise has little effect on the cell impedance. A minimal model reproduces qualitatively these data. Our results imply that ion channel noise contributes significantly to membrane voltage fluctuations at the subthreshold voltage range, and that Na+ conductance plays a key role in determining the amplitude of this noise by acting as a voltage-dependent amplifier of low-frequency transients. PMID:15695244

[Study on the movement of the carrier recombination region in organic light-emitting diodes (OLEDs) based on DPVBi/Alq3].

PubMed

Yan, Guang; Zhao, Su-ling; Xu, Zheng; Zhang, Fu-jun; Kong, Chao; Liu, Xiao-dong; Gong, Wei; Gao, Li-yan

2011-07-01

Series of organic light emitting devices with basic structure of ITO/PCBM: PVK(x Wt%, approximately 40 nm)/DPVBi(30 nm)/Alq3 (30 nm)/Al were fabricated in order to investigate the carrier recombination region movement in these devices. The carrier injection-dependent, the carrier transport-dependent and the voltage-dependent carrier recombination region movements were investigated respectively by modifying cathode with lithium fluoride, by changing the doping concentration of PCBM and by changing the voltage on the devices. The physical mechanism behind the voltage-dependent carrier recombination region movement was discussed.

Engineering of a genetically encodable fluorescent voltage sensor exploiting fast Ci-VSP voltage-sensing movements.

PubMed

Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar; Akemann, Walther; Knöpfel, Thomas

2008-06-25

Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP) in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.

Rectification of Acetylcholine-Elicited Currents in PC12 Pheochromocytoma Cells

NASA Astrophysics Data System (ADS)

Ifune, C. K.; Steinbach, J. H.

1990-06-01

The current-voltage (I-V) relationship for acetylcholine-elicited currents in the rat pheochromocytoma cell line PC12 is nonlinear. Two voltage-dependent processes that could account for the whole-cell current rectification were examined, receptor channel gating and single receptor channel permeation. We found that both factors are involved in the rectification of the whole-cell currents. The voltage dependence of channel gating determines the shape of the I-V curve at negative potentials. The single-channel I-V relationship is inwardly rectifying and largely responsible for the characteristic shape of the whole-cell I-V curve at positive potentials. The rectification of the single-channel currents is produced by the voltage-dependent block of outward currents by intracellular Mg2+ ions.

Chiral tunneling modulated by a time-periodic potential on the surface states of a topological insulator

PubMed Central

Li, Yuan; Jalil, Mansoor B. A.; Tan, S. G.; Zhao, W.; Bai, R.; Zhou, G. H.

2014-01-01

Time-periodic perturbation can be used to modify the transport properties of the surface states of topological insulators, specifically their chiral tunneling property. Using the scattering matrix method, we study the tunneling transmission of the surface states of a topological insulator under the influence of a time-dependent potential and finite gate bias voltage. It is found that perfect transmission is obtained for electrons which are injected normally into the time-periodic potential region in the absence of any bias voltage. However, this signature of Klein tunneling is destroyed when a bias voltage is applied, with the transmission probability of normally incident electrons decreasing with increasing gate bias voltage. Likewise, the overall conductance of the system decreases significantly when a gate bias voltage is applied. The characteristic left-handed helicity of the transmitted spin polarization is also broken by the finite gate bias voltage. In addition, the time-dependent potential modifies the large-angle transmission profile, which exhibits an oscillatory or resonance-like behavior. Finally, time-dependent transport modes (with oscillating potential in the THz frequency) can result in enhanced overall conductance, irrespective of the presence or absence of the gate bias voltage. PMID:24713634

Frequency Dependence of Low-Voltage Electrowetting Investigated by Impedance Spectroscopy.

PubMed

Li, Ying-Jia; Cahill, Brian P

2017-11-14

An electrowetting-on-dielectric (EWOD) electrode was developed that facilitates the use of low alternating voltages (≤5 V AC ). This allows online investigation of the frequency dependence of electrowetting by means of impedance spectroscopy. The EWOD electrode is based on a dielectric bilayer consisting of an anodic tantalum pentoxide (Ta 2 O 5 ) thin film (d = 59.35 nm) with a high relative permittivity (ε d = 26.3) and a self-assembled hydrophobic silane monolayer. The frequency dependence of electrowetting was studied using an aqueous μL-sized sessile droplet on the planar EWOD electrode in oil. Experiments using electrochemical impedance spectroscopy and optical imaging indicate the frequency dependence of all three variables in the Young-Lippmann equation: the voltage drop across the dielectric layers, capacitance per unit area, and contact angle under voltage. The electrowetting behavior induced by AC voltages is shown to be well described by the Young-Lippmann equation for AC applications below a frequency threshold. Moreover, the dielectric layers act as a capacitor and the stored electrostatic potential energy is revealed to only partially contribute to the electrowetting.

Recombination in polymer-fullerene bulk heterojunction solar cells

NASA Astrophysics Data System (ADS)

Cowan, Sarah R.; Roy, Anshuman; Heeger, Alan J.

2010-12-01

Recombination of photogenerated charge carriers in polymer bulk heterojunction (BHJ) solar cells reduces the short circuit current (Jsc) and the fill factor (FF). Identifying the mechanism of recombination is, therefore, fundamentally important for increasing the power conversion efficiency. Light intensity and temperature-dependent current-voltage measurements on polymer BHJ cells made from a variety of different semiconducting polymers and fullerenes show that the recombination kinetics are voltage dependent and evolve from first-order recombination at short circuit to bimolecular recombination at open circuit as a result of increasing the voltage-dependent charge carrier density in the cell. The “missing 0.3 V” inferred from comparison of the band gaps of the bulk heterojunction materials and the measured open-circuit voltage at room-temperature results from the temperature dependence of the quasi-Fermi levels in the polymer and fullerene domains—a conclusion based on the fundamental statistics of fermions.

Structural and dipolar properties of the voltage-dependent pore former alamethicin in octanol/dioxane.

PubMed Central

Schwarz, G; Savko, P

1982-01-01

Dielectric constant and loss of the membrane-active peptide alamethicin in octanol/dioxane mixtures have been measured at frequencies between 5 kHz and 50 MHz. On the basis of a rotational mechanism of dipolar orientation, the observed dispersion provides information regarding size, shape, and dipole moment of the structural entities which the solute may assume in media of diverse lipophilicity. Particularly detailed results are obtained in a pure octanol solvent where an apparent molecular weight of alamethicin could be determined. It turns out that in this quite lipophilic medium most of the peptide material exists as a monomer particle that has approximate length and diameter of 35 and 13 A, respectively. It carries a dipole moment of approximately 75 Debye units (directed nearly parallel to the long axis). At our concentrations of a few milligrams per milliliters, appreciable formation of dimers by head-to-tail linkage is indicated. When the octanol content is reduced by adding greater amounts of dioxane, larger particles are encountered. This is accompanied by a decrease of the effective polarity. The inherent increase of hydrophilicity in the dioxane-enriched solvent apparently favors another monomer conformation that has a low dipole moment and easily aggregates to some kind of micelle. PMID:7115881

Microwave radiometer for subsurface temperature measurement

NASA Technical Reports Server (NTRS)

Porter, R. A.; Bechis, K. P.

1976-01-01

A UHF radiometer, operating at a frequency of 800 MHz, was modified to provide an integral, three frequency voltage standing wave ratio (VSWR) circuit in the radio frequency (RF) head. The VSWR circuit provides readings of power transmission at the antenna-material interface with an accuracy of plus or minus 5 percent. The power transmission readings are numerically equal to the emissivity of the material under observation. Knowledge of material emissivity is useful in the interpretation of subsurface apparent temperatures obtained on phantom models of biological tissue. The emissivities of phantom models consisting of lean beefsteak were found to lie in the range 0.623 to 0.779, depending on moisture content. Radiometric measurements performed on instrumented phantoms showed that the radiometer was capable of sensing small temperature changes occurring at depths of at least 19 to 30 mm. This is consistent with previously generated data which showed that the radiometer could sense temperatures at a depth of 38 mm.

Trap-assisted and Langevin-type recombination in organic light-emitting diodes

NASA Astrophysics Data System (ADS)

Wetzelaer, G. A. H.; Kuik, M.; Nicolai, H. T.; Blom, P. W. M.

2011-04-01

Trapping of charges is known to play an important role in the charge transport of organic semiconductors, but the role of traps in the recombination process has not been addressed. Here we show that the ideality factor of the current of organic light-emitting diodes (OLEDs) in the diffusion-dominated regime has a temperature-independent value of 2, which reveals that nonradiative trap-assisted recombination dominates the current. In contrast, the ideality factor of the light output approaches unity, demonstrating that luminance is governed by recombination of the bimolecular Langevin type. This apparent contradiction can be resolved by measuring the current and luminance ideality factor for a white-emitting polymer, where both free and trapped charge carriers recombine radiatively. With increasing bias voltage, Langevin recombination becomes dominant over trap-assisted recombination due to its stronger dependence on carrier density, leading to an enhancement in OLED efficiency.

Size-dependent magnetic tuning of lateral photovoltaic effect in nonmagnetic Si-based Schottky junctions

PubMed Central

Zhou, Peiqi; Gan, Zhikai; Huang, Xu; Mei, Chunlian; Xia, Yuxing; Wang, Hui

2017-01-01

In this article, we report a magnetic tuning lateral photovoltaic effect (LPE) in a nonmagnetic Si-based Schottky junctions. In the magnetic field intensity range of 0 to 1.6 T, the variation amplitude of LPE sensitivity is as high as 94.8%, the change of LPV is and the change rate of lateral photo-voltage even reaches 520 mV/T at 1.5 T, which is apparently higher than the results of previous reported researches in magnetic materials. This effect is attributed to the combined result of the influence of magnetic field on diffusion current and the rectification property of our anisotropic structure. This work may expand the application of LPE in magnetism field such as magnetic sensor and magnetoresistance, and it suggests a new way to investigate the carrier transport in Schottky junctions under magnetic field. PMID:28397819

High frequency measures of OHC nonlinear capacitance (NLC) and their significance: Why measures stray away from predictions

NASA Astrophysics Data System (ADS)

Santos-Sacchi, Joseph

2018-05-01

Measures of membrane capacitance (Cm) can be used to assess important characteristics of voltage-dependent membrane proteins (e.g., channels and transporters). In particular, a protein's time-dependent voltage-sensor charge movement is equivalently represented as a frequency-dependent component of Cm, telling much about the kinetics of the protein's conformational behavior. Recently, we have explored the frequency dependence of OHC voltage-dependent capacitance (aka nonlinear capacitance, NLC) to query rates of conformational switching within prestin (SLC26a5), the cell's lateral membrane molecular motor 1. Following removal of confounding stray capacitance effects, high frequency Cm measures using wide-band stimuli accurately reveal unexpected low pass behavior in prestin's molecular motions.

GaN HEMTs with p-GaN gate: field- and time-dependent degradation

NASA Astrophysics Data System (ADS)

Meneghesso, G.; Meneghini, M.; Rossetto, I.; Canato, E.; Bartholomeus, J.; De Santi, C.; Trivellin, N.; Zanoni, E.

2017-02-01

GaN-HEMTs with p-GaN gate have recently demonstrated to be excellent normally-off devices for application in power conversion systems, thanks to the high and robust threshold voltage (VTH>1 V), the high breakdown voltage, and the low dynamic Ron increase. For this reason, studying the stability and reliability of these devices under high stress conditions is of high importance. This paper reports on our most recent results on the field- and time-dependent degradation of GaN-HEMTs with p-GaN gate submitted to stress with positive gate bias. Based on combined step-stress experiments, constant voltage stress and electroluminescence testing we demonstrated that: (i) when submitted to high/positive gate stress, the transistors may show a negative threshold voltage shift, that is ascribed to the injection of holes from the gate metal towards the p-GaN/AlGaN interface; (ii) in a step-stress experiment, the analyzed commercial devices fail at gate voltages higher than 9-10 V, due to the extremely high electric field over the p-GaN/AlGaN stack; (iii) constant voltage stress tests indicate that the failure is also time-dependent and Weibull distributed. The several processes that can explain the time-dependent failure are discussed in the following.

Solutions for transients in arbitrarily branching cables: III. Voltage clamp problems.

PubMed

Major, G

1993-07-01

Branched cable voltage recording and voltage clamp analytical solutions derived in two previous papers are used to explore practical issues concerning voltage clamp. Single exponentials can be fitted reasonably well to the decay phase of clamped synaptic currents, although they contain many underlying components. The effective time constant depends on the fit interval. The smoothing effects on synaptic clamp currents of dendritic cables and series resistance are explored with a single cylinder + soma model, for inputs with different time courses. "Soma" and "cable" charging currents cannot be separated easily when the soma is much smaller than the dendrites. Subtractive soma capacitance compensation and series resistance compensation are discussed. In a hippocampal CA1 pyramidal neurone model, voltage control at most dendritic sites is extremely poor. Parameter dependencies are illustrated. The effects of series resistance compound those of dendritic cables and depend on the "effective capacitance" of the cell. Plausible combinations of parameters can cause order-of-magnitude distortions to clamp current waveform measures of simulated Schaeffer collateral inputs. These voltage clamp problems are unlikely to be solved by the use of switch clamp methods.

Measured radial dependence of the peak sheath voltages present in very high frequency capacitive discharges

DOE PAGES

Barnat, E. V.; Miller, P. A.; Hebner, G. A.; ...

2007-05-16

In this paper, the radial distribution of the measured voltage drop across a sheath formed between a 300mm electrode and an argon plasma discharge is shown to depend on the excitation radio frequency, under constant power and pressure conditions. At a lower frequency of 13.56MHz, the voltage drop across the sheath is uniform across the 300mm electrode, while at higher frequencies of 60 and 162MHz the voltage drop becomes radially nonuniform. Finally, the magnitude and spatial extent of the nonuniformity become greater with increasing frequency.

Breakdown voltage mapping through voltage dependent ReBEL intensity imaging of multi-crystalline Si solar cells

NASA Astrophysics Data System (ADS)

Dix-Peek, RM.; van Dyk, EE.; Vorster, FJ.; Pretorius, CJ.

2018-04-01

Device material quality affects both the efficiency and the longevity of photovoltaic (PV) cells. Therefore, identifying these defects can be beneficial in the development of more efficient and longer lasting PV cells. In this study, a combination of spatially-resolved, electroluminescence (EL), and light beam induced current (LBIC) measurements, were used to identify specific defects and features of a multi-crystalline Si PV cells. In this study, a novel approach is used to map the breakdown voltage of a PV cell through voltage dependent Reverse Bias EL (ReBEL) intensity imaging.

Voltage-Gated Lipid Ion Channels

PubMed Central

Blicher, Andreas; Heimburg, Thomas

2013-01-01

Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times. PMID:23823188

Non-linear Membrane Properties in Entorhinal Cortical Stellate Cells Reduce Modulation of Input-Output Responses by Voltage Fluctuations

PubMed Central

Fernandez, Fernando R.; Malerba, Paola; White, John A.

2015-01-01

The presence of voltage fluctuations arising from synaptic activity is a critical component in models of gain control, neuronal output gating, and spike rate coding. The degree to which individual neuronal input-output functions are modulated by voltage fluctuations, however, is not well established across different cortical areas. Additionally, the extent and mechanisms of input-output modulation through fluctuations have been explored largely in simplified models of spike generation, and with limited consideration for the role of non-linear and voltage-dependent membrane properties. To address these issues, we studied fluctuation-based modulation of input-output responses in medial entorhinal cortical (MEC) stellate cells of rats, which express strong sub-threshold non-linear membrane properties. Using in vitro recordings, dynamic clamp and modeling, we show that the modulation of input-output responses by random voltage fluctuations in stellate cells is significantly limited. In stellate cells, a voltage-dependent increase in membrane resistance at sub-threshold voltages mediated by Na+ conductance activation limits the ability of fluctuations to elicit spikes. Similarly, in exponential leaky integrate-and-fire models using a shallow voltage-dependence for the exponential term that matches stellate cell membrane properties, a low degree of fluctuation-based modulation of input-output responses can be attained. These results demonstrate that fluctuation-based modulation of input-output responses is not a universal feature of neurons and can be significantly limited by subthreshold voltage-gated conductances. PMID:25909971

Non-linear Membrane Properties in Entorhinal Cortical Stellate Cells Reduce Modulation of Input-Output Responses by Voltage Fluctuations.

PubMed

Fernandez, Fernando R; Malerba, Paola; White, John A

2015-04-01

The presence of voltage fluctuations arising from synaptic activity is a critical component in models of gain control, neuronal output gating, and spike rate coding. The degree to which individual neuronal input-output functions are modulated by voltage fluctuations, however, is not well established across different cortical areas. Additionally, the extent and mechanisms of input-output modulation through fluctuations have been explored largely in simplified models of spike generation, and with limited consideration for the role of non-linear and voltage-dependent membrane properties. To address these issues, we studied fluctuation-based modulation of input-output responses in medial entorhinal cortical (MEC) stellate cells of rats, which express strong sub-threshold non-linear membrane properties. Using in vitro recordings, dynamic clamp and modeling, we show that the modulation of input-output responses by random voltage fluctuations in stellate cells is significantly limited. In stellate cells, a voltage-dependent increase in membrane resistance at sub-threshold voltages mediated by Na+ conductance activation limits the ability of fluctuations to elicit spikes. Similarly, in exponential leaky integrate-and-fire models using a shallow voltage-dependence for the exponential term that matches stellate cell membrane properties, a low degree of fluctuation-based modulation of input-output responses can be attained. These results demonstrate that fluctuation-based modulation of input-output responses is not a universal feature of neurons and can be significantly limited by subthreshold voltage-gated conductances.

Chemistry at molecular junctions: Rotation and dissociation of O2 on the Ag(110) surface induced by a scanning tunneling microscope.

PubMed

Roy, Sharani; Mujica, Vladimiro; Ratner, Mark A

2013-08-21

The scanning tunneling microscope (STM) is a fascinating tool used to perform chemical processes at the single-molecule level, including bond formation, bond breaking, and even chemical reactions. Hahn and Ho [J. Chem. Phys. 123, 214702 (2005)] performed controlled rotations and dissociations of single O2 molecules chemisorbed on the Ag(110) surface at precise bias voltages using STM. These threshold voltages were dependent on the direction of the bias voltage and the initial orientation of the chemisorbed molecule. They also observed an interesting voltage-direction-dependent and orientation-dependent pathway selectivity suggestive of mode-selective chemistry at molecular junctions, such that in one case the molecule underwent direct dissociation, whereas in the other case it underwent rotation-mediated dissociation. We present a detailed, first-principles-based theoretical study to investigate the mechanism of the tunneling-induced O2 dynamics, including the origin of the observed threshold voltages, the pathway dependence, and the rate of O2 dissociation. Results show a direct correspondence between the observed threshold voltage for a process and the activation energy for that process. The pathway selectivity arises from a competition between the voltage-modified barrier heights for rotation and dissociation, and the coupling strength of the tunneling electrons to the rotational and vibrational modes of the adsorbed molecule. Finally, we explore the "dipole" and "resonance" mechanisms of inelastic electron tunneling to elucidate the energy transfer between the tunneling electrons and chemisorbed O2.

Using lidocaine and benzocaine to link sodium channel molecular conformations to state-dependent antiarrhythmic drug affinity.

PubMed

Hanck, Dorothy A; Nikitina, Elena; McNulty, Megan M; Fozzard, Harry A; Lipkind, Gregory M; Sheets, Michael F

2009-08-28

Lidocaine and other antiarrhythmic drugs bind in the inner pore of voltage-gated Na channels and affect gating use-dependently. A phenylalanine in domain IV, S6 (Phe1759 in Na(V)1.5), modeled to face the inner pore just below the selectivity filter, is critical in use-dependent drug block. Measurement of gating currents and concentration-dependent availability curves to determine the role of Phe1759 in coupling of drug binding to the gating changes. The measurements showed that replacement of Phe1759 with a nonaromatic residue permits clear separation of action of lidocaine and benzocaine into 2 components that can be related to channel conformations. One component represents the drug acting as a voltage-independent, low-affinity blocker of closed channels (designated as lipophilic block), and the second represents high-affinity, voltage-dependent block of open/inactivated channels linked to stabilization of the S4s in domains III and IV (designated as voltage-sensor inhibition) by Phe1759. A homology model for how lidocaine and benzocaine bind in the closed and open/inactivated channel conformation is proposed. These 2 components, lipophilic block and voltage-sensor inhibition, can explain the differences in estimates between tonic and open-state/inactivated-state affinities, and they identify how differences in affinity for the 2 binding conformations can control use-dependence, the hallmark of successful antiarrhythmic drugs.

Frequency and voltage dependent electrical responses of poly(triarylamine) thin film-based organic Schottky diode

NASA Astrophysics Data System (ADS)

Anuar Mohamad, Khairul; Tak Hoh, Hang; Alias, Afishah; Ghosh, Bablu Kumar; Fukuda, Hisashi

2017-11-01

A metal-organic-metal (MOM) type Schottky diode based on poly (triarylamine) (PTAA) thin films has been fabricated by using the spin coating method. Investigation of the frequency dependent conductance-voltage (G-V-f) and capacitance-voltage (C-V-f) characteristics of the ITO/PTAA/Al MOM type diode were carried out in the frequency range from 12 Hz to 100 kHz using an LCR meter at room temperature. The frequency and bias voltage dependent electrical response were determined by admittance-based measured method in terms of an equivalent circuit model of the parallel combination of resistance and capacitance (RC circuit). Investigation revealed that the conductance is frequency and a bias voltage dependent in which conductance continuous increase as the increasing frequency, respectively. Meanwhile, the capacitance is dependent on frequency up to a certain value of frequency (100 Hz) but decreases at high frequency (1 - 10 kHz). The interface state density in the Schottky diode was determined from G-V and C-V characteristics. The interface state density has values almost constant of 2.8 x 1012 eV-1cm-2 with slightly decrease by increasing frequencies. Consequently, both series resistance and interface trap density were found to decrease with increasing frequency. The frequency dependence of the electrical responses is attributed the distribution density of interface states that could follow the alternating current (AC) signal.

Brivaracetam: review of its pharmacology and potential use as adjunctive therapy in patients with partial onset seizures.

PubMed

Mumoli, Laura; Palleria, Caterina; Gasparini, Sara; Citraro, Rita; Labate, Angelo; Ferlazzo, Edoardo; Gambardella, Antonio; De Sarro, Giovambattista; Russo, Emilio

2015-01-01

Brivaracetam (BRV), a high-affinity synaptic vesicle protein 2A ligand, reported to be 10-30-fold more potent than levetiracetam (LEV), is highly effective in a wide range of experimental models of focal and generalized seizures. BRV and LEV similarly bind to synaptic vesicle protein 2A, while differentiating for other pharmacological effects; in fact, BRV does not inhibit high voltage Ca(2+) channels and AMPA receptors as LEV. Furthermore, BRV apparently exhibits inhibitory activity on neuronal voltage-gated sodium channels playing a role as a partial antagonist. BRV is currently waiting for approval both in the United States and the European Union as adjunctive therapy for patients with partial seizures. In patients with photosensitive epilepsy, BRV showed a dose-dependent effect in suppressing or attenuating the photoparoxysmal response. In well-controlled trials conducted to date, adjunctive BRV demonstrated efficacy and good tolerability in patients with focal epilepsy. BRV has a linear pharmacokinetic profile. BRV is extensively metabolized and excreted by urine (only 8%-11% unchanged). The metabolites of BRV are inactive, and hydrolysis of the acetamide group is the mainly involved metabolic pathway; hepatic impairment probably requires dose adjustment. BRV does not seem to influence other antiepileptic drug plasma levels. Six clinical trials have so far been completed indicating that BRV is effective in controlling seizures when used at doses between 50 and 200 mg/d. The drug is generally well-tolerated with only mild-to-moderate side effects; this is confirmed by the low discontinuation rate observed in these clinical studies. The most common side effects are related to central nervous system and include fatigue, dizziness, and somnolence; these apparently disappear during treatment. In this review, we analyzed BRV, focusing on the current evidences from experimental animal models to clinical studies with particular interest on potential use in clinical practice. Finally, pharmacological properties of BRV are summarized with a description of its pharmacokinetics, safety, and potential/known drug-drug interactions.

Concentration-jump analysis of voltage-dependent conductances activated by glutamate and kainate in neurons of the avian cochlear nucleus.

PubMed Central

Raman, I M; Trussell, L O

1995-01-01

We have examined the mechanisms underlying the voltage sensitivity of alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionate receptors in voltage-clamped outside-out patches and whole cells taken from the nucleus magnocellularis of the chick. Responses to either glutamate or kainate had outwardly rectifying current-voltage relations. The rate and extent of desensitization during prolonged exposure to agonist, and the rate of deactivation after brief exposure to agonist, decreased at positive potentials, suggesting that a kinetic transition was sensitive to membrane potential. Voltage dependence of the peak conductance and of the deactivation kinetics persisted when desensitization was reduced with aniracetam or blocked with cyclothiazide. Furthermore, the rate of recovery from desensitization to glutamate was not voltage dependent. Upon reduction of extracellular divalent cation concentration, kainate-evoked currents increased but preserved rectifying current-voltage relations. Rectification was strongest at lower kainate concentrations. Surprisingly, nonstationary variance analysis of desensitizing responses to glutamate or of the current deactivation after kainate removal revealed an increase in the mean single-channel conductance with more positive membrane potentials. These data indicate that the rectification of the peak response to a high agonist concentration reflects an increase in channel conductance, whereas rectification of steady-state current is dominated by voltage-sensitive channel kinetics. Images FIGURE 2 FIGURE 3 PMID:8580330

Bias voltage dependence of the electron spin depolarization in quantum wires in the quantum Hall regime detected by the resistively detected NMR

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chida, K.; Yamauchi, Y.; Arakawa, T.

2013-12-04

We performed the resistively-detected nuclear magnetic resonance (RDNMR) to study the electron spin polarization in the non-equilibrium quantum Hall regime. By measuring the Knight shift, we derive source-drain bias voltage dependence of the electron spin polarization in quantum wires. The electron spin polarization shows minimum value around the threshold voltage of the dynamic nuclear polarization.

Voltage Stress on Y Capacitors from Indirect Lightning Pulses According to ED-14/DO-160

NASA Astrophysics Data System (ADS)

Meier, F.

2012-05-01

Transients due to lightning strikes on an aircraft's fuselage impose stress on the input filters of elec- tronic equipment. Permanent damage can occur when exceeding the voltage handling capacity of filter components causing a short circuit to ground. In ED-14/DO-160, section 22, a number of waveforms and levels are defined which are used to check the airworthiness of avionics equipment. Depending on pro- cedure and level, Y-capacitors are stressed by transient voltages which exceed their dielectric strength. The design engineer's task is a properly select the type and voltage rating of capacitors. With moderate simplifications, a LCR-series network is justified to calculate the peak voltage dependent on the capacitance.

Insulin increases excitability via a dose-dependent dual inhibition of voltage-activated K+ currents in differentiated N1E-115 neuroblastoma cells.

PubMed

Lima, Pedro A; Vicente, M Inês; Alves, Frederico M; Dionísio, José C; Costa, Pedro F

2008-04-01

A role in the control of excitability has been attributed to insulin via modulation of potassium (K(+)) currents. To investigate insulin modulatory effects on voltage-activated potassium currents in a neuronal cell line with origin in the sympathetic system, we performed whole-cell voltage-clamp recordings in differentiated N1E-115 neuroblastoma cells. Two main voltage-activated K(+) currents were identified: (a) a relatively fast inactivating current (I(fast) - time constant 50-300 ms); (b) a slow delayed rectifying K(+) current (I(slow) - time constant 1-4 s). The kinetics of inactivation of I(fast), rather than I(slow), showed clear voltage dependence. I(fast) and I(slow) exhibited different activation and inactivation dependence for voltage, and have different but nevertheless high sensitivities to tetraethylammonium, 4-aminopyridine and quinidine. In differentiated cells - rather than in non-differentiated cells - application of up to 300 nm insulin reduced I(slow) only (IC(50) = 6.7 nm), whereas at higher concentrations I(fast) was also affected (IC(50) = 7.7 microm). The insulin inhibitory effect is not due to a change in the activation or inactivation current-voltage profiles, and the time-dependent inactivation is also not altered; this is not likely to be a result of activation of the insulin-growth-factor-1 (IGF1) receptors, as application of IGF1 did not result in significant current alteration. Results suggest that the current sensitive to low concentrations of insulin is mediated by erg-like channels. Similar observations concerning the insulin inhibitory effect on slow voltage-activated K(+) currents were also made in isolated rat hippocampal pyramidal neurons, suggesting a widespread neuromodulator role of insulin on K(+) channels.

Voltage-dependent Ca2+ release from the SR of feline ventricular myocytes is explained by Ca2+-induced Ca2+ release

PubMed Central

Piacentino, Valentino; Dipla, Konstantina; Gaughan, John P; Houser, Steven R

2000-01-01

Direct voltage-gated (voltage-dependent Ca2+ release, VDCR) and Ca2+ influx-gated (Ca2+-induced Ca2+ release, CICR) sarcoplasmic reticulum (SR) Ca2+ release were studied in feline ventricular myocytes. The voltage-contraction relationship predicted by the VDCR hypothesis is sigmoidal with large contractions at potentials near the Ca2+ equilibrium potential (ECa). The relationship predicted by the CICR hypothesis is bell-shaped with no contraction at ECa. The voltage dependence of contraction was measured in ventricular myocytes at physiological temperature (37 °C), resting membrane potential and physiological [K+]. Experiments were performed with cyclic adenosine 3′,5′-monophosphate (cAMP) in the pipette or in the presence of the β-adrenergic agonist isoproterenol (isoprenaline; ISO). The voltage-contraction relationship was bell-shaped in Na+-free solutions (to eliminate the Na+ current and Na+-Ca2+ exchange, NCX) but the relationship was broader than the L-type Ca2+ current (ICa,L)-voltage relationship. Contractions induced with voltage steps from normal resting potentials to -40 mV are thought to represent VDCR rather than CICR. We found that cAMP and ISO shifted the voltage dependence of ICa,L activation to more negative potentials so that ICa,L was always present with steps to -40 mV. ICa,L at -40 mV inactivated when the holding potential was decreased (V½ =−57·8 ± 0·49 mV). ISO increased inward current, SR Ca2+ load and contraction in physiological [Na+] and a broad bell-shaped voltage-contraction relationship was observed. Inhibition of reverse-mode NCX, decreasing ICa,L and decreasing SR Ca2+ loading all decreased contractions at strongly positive potentials near ECa. The voltage-contraction relationship in 200 μM cadmium (Cd2+) was bell-shaped, supporting a role of ICa,L rather than VDCR. All results could be accounted for by the CICR hypothesis, and many results exclude the VDCR hypothesis. PMID:10718736

Current-voltage characteristics of manganite-titanite perovskite junctions.

PubMed

Ifland, Benedikt; Peretzki, Patrick; Kressdorf, Birte; Saring, Philipp; Kelling, Andreas; Seibt, Michael; Jooss, Christian

2015-01-01

After a general introduction into the Shockley theory of current voltage (J-V) characteristics of inorganic and organic semiconductor junctions of different bandwidth, we apply the Shockley theory-based, one diode model to a new type of perovskite junctions with polaronic charge carriers. In particular, we studied manganite-titanate p-n heterojunctions made of n-doped SrTi1- y Nb y O3, y = 0.002 and p-doped Pr1- x Ca x MnO3, x = 0.34 having a strongly correlated electron system. The diffusion length of the polaron carriers was analyzed by electron beam-induced current (EBIC) in a thin cross plane lamella of the junction. In the J-V characteristics, the polaronic nature of the charge carriers is exhibited mainly by the temperature dependence of the microscopic parameters, such as the hopping mobility of the series resistance and a colossal electro-resistance (CER) effect in the parallel resistance. We conclude that a modification of the Shockley equation incorporating voltage-dependent microscopic polaron parameters is required. Specifically, the voltage dependence of the reverse saturation current density is analyzed and interpreted as a voltage-dependent electron-polaron hole-polaron pair generation and separation at the interface.

Current–voltage characteristics of manganite–titanite perovskite junctions

PubMed Central

Ifland, Benedikt; Peretzki, Patrick; Kressdorf, Birte; Saring, Philipp; Kelling, Andreas; Seibt, Michael

2015-01-01

Summary After a general introduction into the Shockley theory of current voltage (J–V) characteristics of inorganic and organic semiconductor junctions of different bandwidth, we apply the Shockley theory-based, one diode model to a new type of perovskite junctions with polaronic charge carriers. In particular, we studied manganite–titanate p–n heterojunctions made of n-doped SrTi1− yNbyO3, y = 0.002 and p-doped Pr1− xCaxMnO3, x = 0.34 having a strongly correlated electron system. The diffusion length of the polaron carriers was analyzed by electron beam-induced current (EBIC) in a thin cross plane lamella of the junction. In the J–V characteristics, the polaronic nature of the charge carriers is exhibited mainly by the temperature dependence of the microscopic parameters, such as the hopping mobility of the series resistance and a colossal electro-resistance (CER) effect in the parallel resistance. We conclude that a modification of the Shockley equation incorporating voltage-dependent microscopic polaron parameters is required. Specifically, the voltage dependence of the reverse saturation current density is analyzed and interpreted as a voltage-dependent electron–polaron hole–polaron pair generation and separation at the interface. PMID:26199851

Contamination of current-clamp measurement of neuron capacitance by voltage-dependent phenomena

PubMed Central

White, William E.

2013-01-01

Measuring neuron capacitance is important for morphological description, conductance characterization, and neuron modeling. One method to estimate capacitance is to inject current pulses into a neuron and fit the resulting changes in membrane potential with multiple exponentials; if the neuron is purely passive, the amplitude and time constant of the slowest exponential give neuron capacitance (Major G, Evans JD, Jack JJ. Biophys J 65: 423–449, 1993). Golowasch et al. (Golowasch J, Thomas G, Taylor AL, Patel A, Pineda A, Khalil C, Nadim F. J Neurophysiol 102: 2161–2175, 2009) have shown that this is the best method for measuring the capacitance of nonisopotential (i.e., most) neurons. However, prior work has not tested for, or examined how much error would be introduced by, slow voltage-dependent phenomena possibly present at the membrane potentials typically used in such work. We investigated this issue in lobster (Panulirus interruptus) stomatogastric neurons by performing current clamp-based capacitance measurements at multiple membrane potentials. A slow, voltage-dependent phenomenon consistent with residual voltage-dependent conductances was present at all tested membrane potentials (−95 to −35 mV). This phenomenon was the slowest component of the neuron's voltage response, and failure to recognize and exclude it would lead to capacitance overestimates of several hundredfold. Most methods of estimating capacitance depend on the absence of voltage-dependent phenomena. Our demonstration that such phenomena make nonnegligible contributions to neuron responses even at well-hyperpolarized membrane potentials highlights the critical importance of checking for such phenomena in all work measuring neuron capacitance. We show here how to identify such phenomena and minimize their contaminating influence. PMID:23576698

Molecular analysis and functional expression of the human type E neuronal Ca2+ channel alpha 1 subunit.

PubMed

Schneider, T; Wei, X; Olcese, R; Costantin, J L; Neely, A; Palade, P; Perez-Reyes, E; Qin, N; Zhou, J; Crawford, G D

1994-01-01

A human brain alpha 1 Ca2+ channel subunit was cloned and expressed in Xenopus laevis oocytes. The open reading frame, encoding 2,312 amino acids, has high homology to the marine ray doe-1, the rat E-type, and the rabbit brain BII alpha 1 subunits. The amino and carboxy termini of this human.E-type alpha 1 subunit (alpha 1E) are most similar to the rabbit BII-1 splice variant, the remainder being colinear with the BII alpha 1 with the exception of two insertions, one of 43 amino acids in the C-terminus and another of 7 amino acids, found also in the rat alpha 1E, between domains II and III. Two potential Ca2+ binding sites are predicted from its primary structure. The expression of inward Ba2+ currents reveals voltage-dependent activation and inactivation measured by the cut-open oocyte vaseline-gap technique, with kinetics that correspond to that of a high-voltage-activated neuronal Ca2+ channel, and pharmacologic properties that resemble those of some low-voltage-activated neuronal Ca2+ currents. The human alpha 1E currents are insensitive to omega-conotoxin-GVIA (1 microM), omega-agatoxin-IVA (200 nM), a synthetic funnel web spider toxin (FTX, 20 microM), and Bay-K8644 (0.5 microM); they are inhibited 20% by high concentrations of methoxyverapamil and diltiazem, 65% by 0.1% crude funnel web spider venom and 100% by Ni2+ (IC50 = 30 nM). Single-channel records show a complex activity pattern with several apparent conductance states, the largest having a conductance of 14 pS.

Electromagnetic fields act via activation of voltage-gated calcium channels to produce beneficial or adverse effects

PubMed Central

Pall, Martin L

2013-01-01

The direct targets of extremely low and microwave frequency range electromagnetic fields (EMFs) in producing non-thermal effects have not been clearly established. However, studies in the literature, reviewed here, provide substantial support for such direct targets. Twenty-three studies have shown that voltage-gated calcium channels (VGCCs) produce these and other EMF effects, such that the L-type or other VGCC blockers block or greatly lower diverse EMF effects. Furthermore, the voltage-gated properties of these channels may provide biophysically plausible mechanisms for EMF biological effects. Downstream responses of such EMF exposures may be mediated through Ca2+/calmodulin stimulation of nitric oxide synthesis. Potentially, physiological/therapeutic responses may be largely as a result of nitric oxide-cGMP-protein kinase G pathway stimulation. A well-studied example of such an apparent therapeutic response, EMF stimulation of bone growth, appears to work along this pathway. However, pathophysiological responses to EMFs may be as a result of nitric oxide-peroxynitrite-oxidative stress pathway of action. A single such well-documented example, EMF induction of DNA single-strand breaks in cells, as measured by alkaline comet assays, is reviewed here. Such single-strand breaks are known to be produced through the action of this pathway. Data on the mechanism of EMF induction of such breaks are limited; what data are available support this proposed mechanism. Other Ca2+-mediated regulatory changes, independent of nitric oxide, may also have roles. This article reviews, then, a substantially supported set of targets, VGCCs, whose stimulation produces non-thermal EMF responses by humans/higher animals with downstream effects involving Ca2+/calmodulin-dependent nitric oxide increases, which may explain therapeutic and pathophysiological effects. PMID:23802593

Tl+-induced micros gating of current indicates instability of the MaxiK selectivity filter as caused by ion/pore interaction.

PubMed

Schroeder, Indra; Hansen, Ulf-Peter

2008-04-01

Patch clamp experiments on single MaxiK channels expressed in HEK293 cells were performed at high temporal resolution (50-kHz filter) in asymmetrical solutions containing 0, 25, 50, or 150 mM Tl+ on the luminal or cytosolic side with [K+] + [Tl+] = 150 mM and 150 mM K+ on the other side. Outward current in the presence of cytosolic Tl+ did not show fast gating behavior that was significantly different from that in the absence of Tl+. With luminal Tl+ and at membrane potentials more negative than -40 mV, the single-channel current showed a negative slope resistance concomitantly with a flickery block, resulting in an artificially reduced apparent single-channel current I(app). The analysis of the amplitude histograms by beta distributions enabled the estimation of the true single-channel current and the determination of the rate constants of a simple two-state O-C Markov model for the gating in the bursts. The voltage dependence of the gating ratio R = I(true)/I(app) = (k(CO) + k(OC))/k(CO) could be described by exponential functions with different characteristic voltages above or below 50 mM Tl(+). The true single-channel current I(true) decreased with Tl+ concentrations up to 50 mM and stayed constant thereafter. Different models were considered. The most likely ones related the exponential increase of the gating ratio to ion depletion at the luminal side of the selectivity filter, whereas the influence of [Tl+] on the characteristic voltage of these exponential functions and of the value of I(true) were determined by [Tl+] at the inner side of the selectivity filter or in the cavity.

Source-drain burnout mechanism of GaAs power MESFETS: Three terminal effects

NASA Astrophysics Data System (ADS)

Takamiya, Saburo; Sonoda, Takuji; Yamanouchi, Masahide; Fujioka, Takashi; Kohno, Masaki

1997-03-01

Theoretical expressions for thermal and electrical feedback effects are derived. These limit the power capability of a power FET and lead a device to catastrophic breakdown (source-drain burnout) when the loop gain of the former reaches unity. Field emission of thermally excited electrons at the Schottky gate plays the key role in thermal feedback, while holes being impact ionized by the drain current play a similar role in the electrical feedback. Thermal feedback is dominant in a high temperature and low drain voltage area. Electrical feedback is dominant in a high drain voltage and low temperature area. In the first area, a high junction temperature is the main factor causing the thermal runaway of the device. In the second area, the electrcal feedback increases the drain current and the temperature and gives a trigger to the thermal feedback so that it reaches unity more easily. Both effects become significant in proportion to transconductance and gate bias resistance, and cause simultaneous runaway of the gate and drain currents. The expressions of the loop gains clearly indicate the safe operating conditions for a power FET. C-band 4 W (1 chip) and 16 W (4 chip) GaAs MESFETs were used as the experimental samples. With these devices the simultaneous runaway of the gate and the drain currents, apparent dependence of the three teminal breakdown voltage on the gate bias resistance in the region dominated by electrical feedback, the rapid increase of the field emitted current at the critical temperature and clear coincidence between the measured and calculated three terminal gate currents both in the thermal feedback dominant region, etc. are demonstrated. The theory explains the experimental results well.

Application of Microsecond Voltage Pulses for Water Disinfection by Diaphragm Electric Discharge

NASA Astrophysics Data System (ADS)

Kakaurov, S. V.; Suvorov, I. F.; Yudin, A. S.; Solovyova, T. L.; Kuznetsova, N. S.

2015-11-01

The paper presents the dependence of copper and silver ions formation on the duration of voltage pulses of diaphragm electric discharge and on the pH of treated liquid medium. Knowing it allows one to create an automatic control system to control bactericidal agent's parameters obtained in diaphragm electric discharge reactor. The current-voltage characteristic of the reactor with a horizontal to the diaphragm membrane water flow powered from the author's custom pulse voltage source is also presented. The results of studies of the power consumption of diaphragm electric discharge depending on temperature of the treated liquid medium are given.

Signature and Pathophysiology of Non-canonical Pores in Voltage-Dependent Cation Channels.

PubMed

Held, Katharina; Voets, Thomas; Vriens, Joris

2016-01-01

Opening and closing of voltage-gated cation channels allows the regulated flow of cations such as Na(+), K(+), and Ca(2+) across cell membranes, which steers essential physiological processes including shaping of action potentials and triggering Ca(2+)-dependent processes. Classical textbooks describe the voltage-gated cation channels as membrane proteins with a single, central aqueous pore. In recent years, however, evidence has accumulated for the existence of additional ion permeation pathways in this group of cation channels, distinct from the central pore, which here we collectively name non-canonical pores. Whereas the first non-canonical pores were unveiled only after making specific point mutations in the voltage-sensor region of voltage-gated Na(+) and K(+) channels, recent evidence indicates that they may also be functional in non-mutated channels. Moreover, several channelopathies have been linked to mutations that cause the appearance of a non-canonical ion permeation pathway as a new pathological mechanism. This review provides an integrated overview of the biophysical properties of non-canonical pores described in voltage-dependent cation channels (KV, NaV, Cav, Hv1, and TRPM3) and of the (patho)physiological impact of opening of such pores.

M-currents and other potassium currents in bullfrog sympathetic neurones

PubMed Central

Adams, P. R.; Brown, D. A.; Constanti, A.

1982-01-01

1. Bullfrog lumbar sympathetic neurones were voltage-clamped in vitro through twin micro-electrodes. Four different outward (K+) currents could be identified: (i) a large sustained voltage-sensitive delayed rectifier current (IK) activated at membrane potentials more positive than -25 mV; (ii) a calcium-dependent sustained outward current (IC) activated at similar positive potentials and peaking at +20 to +60 mV; (iii) a transient current (IA) activated at membrane potentials more positive than -60 mV after a hyperpolarizing pre-pulse, but which was rapidly and totally inactivated at all potentials within its activation range; and (iv) a new K+ current, the M-current (IM). 2. IM was detected as a non-inactivating current with a threshold at -60 mV. The underlying conductance GM showed a sigmoidal activation curve between -60 and -10 mV, with half-activation at -35 mV and a maximal value (ḠM) of 84±14 (S.E.M.) nS per neurone. The voltage sensitivity of GM could be expressed in terms of a simple Boltzmann distribution for a single multivalent gating particle. 3. IM activated and de-activated along an exponential time course with a time constant uniquely dependent upon voltage, maximizing at ≃ 150 ms at -35 mV at 22 °C. 4. Instantaneous current—voltage (I/V) curves were approximately linear in the presence of IM, suggesting that the M-channels do not show appreciable rectification. However, the time- and voltage-dependent opening of the M-channels induced considerable rectification in the steady-state I/V curves recorded under both voltage-clamp and current-clamp modes between -60 and -25 mV. Both time- and voltage-dependent rectification in the voltage responses to current injection over this range could be predicted from the kinetic properties of IM. 5. It is suggested that IM exerts a strong potential-clamping effect on the behaviour of these neurones at membrane potentials subthreshold to excitation. PMID:6294290

Free-energy relationships in ion channels activated by voltage and ligand

PubMed Central

Chowdhury, Sandipan

2013-01-01

Many ion channels are modulated by multiple stimuli, which allow them to integrate a variety of cellular signals and precisely respond to physiological needs. Understanding how these different signaling pathways interact has been a challenge in part because of the complexity of underlying models. In this study, we analyzed the energetic relationships in polymodal ion channels using linkage principles. We first show that in proteins dually modulated by voltage and ligand, the net free-energy change can be obtained by measuring the charge-voltage (Q-V) relationship in zero ligand condition and the ligand binding curve at highly depolarizing membrane voltages. Next, we show that the voltage-dependent changes in ligand occupancy of the protein can be directly obtained by measuring the Q-V curves at multiple ligand concentrations. When a single reference ligand binding curve is available, this relationship allows us to reconstruct ligand binding curves at different voltages. More significantly, we establish that the shift of the Q-V curve between zero and saturating ligand concentration is a direct estimate of the interaction energy between the ligand- and voltage-dependent pathway. These free-energy relationships were tested by numerical simulations of a detailed gating model of the BK channel. Furthermore, as a proof of principle, we estimate the interaction energy between the ligand binding and voltage-dependent pathways for HCN2 channels whose ligand binding curves at various voltages are available. These emerging principles will be useful for high-throughput mutagenesis studies aimed at identifying interaction pathways between various regulatory domains in a polymodal ion channel. PMID:23250866

Calibration of Voltage Transformers and High- Voltage Capacitors at NIST

PubMed Central

Anderson, William E.

1989-01-01

The National Institute of Standards and Technology (NIST) calibration service for voltage transformers and high-voltage capacitors is described. The service for voltage transformers provides measurements of ratio correction factors and phase angles at primary voltages up to 170 kV and secondary voltages as low as 10 V at 60 Hz. Calibrations at frequencies from 50–400 Hz are available over a more limited voltage range. The service for high-voltage capacitors provides measurements of capacitance and dissipation factor at applied voltages ranging from 100 V to 170 kV at 60 Hz depending on the nominal capacitance. Calibrations over a reduced voltage range at other frequencies are also available. As in the case with voltage transformers, these voltage constraints are determined by the facilities at NIST. PMID:28053409

The acetylcholinesterase inhibitor BW284c51 is a potent blocker of Torpedo nicotinic AchRs incorporated into the Xenopus oocyte membrane

PubMed Central

Olivera-Bravo, Silvia; Ivorra, Isabel; Morales, Andrés

2004-01-01

This work was aimed to determine if 1,5-bis(4-allyldimethylammoniumphenyl)pentan-3-one dibromide (BW284c51), the most selective acetylcholinesterase inhibitor (AchEI), affects the nicotinic acetylcholine (Ach) receptor (AchR) function. Purified Torpedo nicotinic AchRs were injected into Xenopus laevis oocytes and BW284c51 effects on Ach- and carbamylcholine (Cch)-elicited currents were assessed using the voltage-clamp technique. BW284c51 (up to 1 mM) did not evoke any change in the oocyte membrane conductance. When BW284c51 (10 pM–100 μM) and Ach were coapplied, Ach-evoked currents (IAch) were reversibly inhibited in a concentration-dependent manner (Hill coefficient, 1; IC50, 0.2–0.5 μM for 0.1–1000 μM Ach). Cch-elicited currents showed a similar inhibition by BW284c51. IAch blockade by BW284c51 showed a strong voltage dependence, being only apparent at hyperpolarising potentials. BW284c51 also enhanced IAch desensitisation. BW284c51 changed the Ach concentration-dependence curve of Torpedo AchR response from two-site to single-site kinetics, without noticeably affecting the EC50 value. The BW284c51 blocking effect was highly selective for nicotinic over muscarinic receptors. BW284c51 inhibition potency was stronger than that of tacrine, and similar to that of d-tubocurarine (d-TC). Coapplication of BW284c51 with either tacrine or d-TC revealed synergistic inhibitory effects. Our results indicate that BW284c51 antagonises nicotinic AchRs in a noncompetitive way by blocking the receptor channel, and possibly by other, yet unknown, mechanisms. Therefore, besides acting as a selective AchEI, BW284c51 constitutes a powerful and reversible blocker of nicotinic AchRs that might be used as a valuable tool for understanding their function. PMID:15644872

Voltage and frequency dependence of prestin-associated charge transfer

PubMed Central

Sun, Sean X.; Farrell, Brenda; Chana, Matthew S.; Oster, George; Brownell, William E.; Spector, Alexander A.

2009-01-01

Membrane protein prestin is a critical component of the motor complex that generates forces and dimensional changes in cells in response to changes in the cell membrane potential. In its native cochlear outer hair cell, prestin is crucial to the amplification and frequency selectivity of the mammalian ear up to frequencies of tens of kHz. Other cells transfected with prestin acquire voltage-dependent properties similar to those of the native cell. The protein performance is critically dependent on chloride ions, and intrinsic protein charges also play a role. We propose an electro-diffusion model to reveal the frequency and voltage dependence of electric charge transfer by prestin. The movement of the combined charge (i.e., anion and protein charges) across the membrane is described with a Fokker-Planck equation coupled to a kinetic equation that describes the binding of chloride ions to prestin. We found a voltage-and frequency-dependent phase shift between the transferred charge and the applied electric field that determines capacitive and resistive components of the transferred charge. The phase shift monotonically decreases from zero to -90 degree as a function of frequency. The capacitive component as a function of voltage is bell-shaped, and decreases with frequency. The resistive component is bell-shaped for both voltage and frequency. The capacitive and resistive components are similar to experimental measurements of charge transfer at high frequencies. The revealed nature of the transferred charge can help reconcile the high-frequency electrical and mechanical observations associated with prestin, and it is important for further analysis of the structure and function of this protein. PMID:19490917

In vivo voltage-dependent influences on summation of synaptic potentials in neurons of the lateral nucleus of the amygdala

PubMed Central

Rosenkranz, J. Amiel

2012-01-01

The amygdala has a fundamental role in driving affective behaviors in response to sensory cues. To accomplish this, neurons of the lateral nucleus (LAT) must integrate a large number of synaptic inputs. A wide range of factors influence synaptic integration, including membrane potential, voltage-gated ion channels and GABAergic inhibition. However, little is known about how these factors modulate integration of synaptic inputs in LAT neurons in vivo. The purpose of this study was to determine the voltage-dependent factors that modify in vivo integration of synaptic inputs in the soma of LAT neurons. In vivo intracellular recordings from anesthetized rats were used to measure post-synaptic potentials (PSPs) and clusters of PSPs across a range of membrane potentials. These studies found that the relationship between membrane potential and PSP clusters was sublinear, due to a reduction of cluster amplitude and area at depolarized membrane potentials. In combination with intracellular delivery of pharmacological agents, it was found that the voltage-dependent suppression of PSP clusters was sensitive to tetraethylammonium (TEA), but not cesium or a blocker of fast GABAergic inhibition. These findings indicate that integration of PSPs in LAT neurons in vivo is strongly modified by somatic membrane potential, likely through voltage-dependent TEA-sensitive potassium channels. Conditions that lead to a shift in membrane potential, or a modulation of the number or function of these ion channels will lead to a more uniform capacity for integration across voltages, and perhaps greatly facilitate amygdala-dependent behaviors. PMID:22989917

Influence of temperature on Al/p-CuInAlSe2 thin-film Schottky diodes

NASA Astrophysics Data System (ADS)

Parihar, Usha; Ray, Jaymin; Panchal, C. J.; Padha, Naresh

2016-06-01

Al/p-CuInAlSe2 Schottky diodes were fabricated using the optimized thin layers of CuInAlSe2 semiconductor. These diodes were used to study their temperature-dependent current-voltage (I-V) and capacitance-voltage (C-V) analysis over a wide range of 233-353 K. Based on these measurements, diode parameters such as ideality factor ( η), barrier height (ϕbo) and series resistance ( R s) were determined from the downward curvature of I-V characteristics using Cheung and Cheung method. The extracted parameters were found to be strongly temperature dependent; ϕbo increases, while η and R s decrease with increasing temperature. This behavior of ϕbo and η with change in temperature has been explained on the basis of barrier inhomogeneities over the MS interface by assuming a Gaussian distribution (GD) of the ϕbo at the interface. GD of barrier height (BH) was confirmed from apparent BH (ϕap) versus q/2 kT plot, and the values of the mean BH and standard deviation (σs) obtained from this plot at zero bias were found to be 1.02 and 0.14 eV, respectively. Also, a modified ln ( {J_{{s}} /T2 } ) - q2 σ_{{s}}2 /2k2 T2 versus q/ kT plot for Al/p-CuInAlSe2 Schottky diodes according to the GD gives ϕbo and Richardson constant ( A ** ) as 1.01 eV and 26 Acm-2 K-2, respectively. The Richardson constant value of 26 Acm-2 K-2 is very close to the theoretical value of 30 Acm-2 K-2. The discrepancy between BHs obtained from I-V and C-V measurements has also been interpreted.

The relationship between Q gamma and Ca release from the sarcoplasmic reticulum in skeletal muscle

PubMed Central

1991-01-01

Asymmetric membrane currents and fluxes of Ca2+ release were determined in skeletal muscle fibers voltage clamped in a Vaseline-gap chamber. The conditioning pulse protocol 1 for suppressing Ca2+ release and the "hump" component of charge movement current (I gamma), described in the first paper of this series, was applied at different test pulse voltages. The amplitude of the current suppressed during the ON transient reached a maximum at slightly suprathreshold test voltages (- 50 to -40 mV) and decayed at higher voltages. The component of charge movement current suppressed by 20 microM tetracaine also went through a maximum at low pulse voltages. This anomalous voltage dependence is thus a property of I gamma, defined by either the conditioning protocol or the tetracaine effect. A negative (inward-going) phase was often observed in the asymmetric current during the ON of depolarizing pulses. This inward phase was shown to be an intramembranous charge movement based on (a) its presence in the records of total membrane current, (b) its voltage dependence, with a maximum at slightly suprathreshold voltages, (c) its association with a "hump" in the asymmetric current, (d) its inhibition by interventions that reduce the "hump", (e) equality of ON and OFF areas in the records of asymmetric current presenting this inward phase, and (f) its kinetic relationship with the time derivative of Ca release flux. The nonmonotonic voltage dependence of the amplitude of the hump and the possibility of an inward phase of intramembranous charge movement are used as the main criteria in the quantitative testing of a specific model. According to this model, released Ca2+ binds to negatively charged sites on the myoplasmic face of the voltage sensor and increases the local transmembrane potential, thus driving additional charge movement (the hump). This model successfully predicts the anomalous voltage dependence and all the kinetic properties of I gamma described in the previous papers. It also accounts for the inward phase in total asymmetric current and in the current suppressed by protocol 1. According to this model, I gamma accompanies activating transitions at the same set of voltage sensors as I beta. Therefore it should open additional release channels, which in turn should cause more I gamma, providing a positive feedback mechanism in the regulation of calcium release. PMID:1650812

Using Lidocaine and Benzocaine to Link Sodium Channel Molecular Conformations to State-Dependent Antiarrhythmic Drug Affinity

PubMed Central

Hanck, Dorothy A.; Nikitina, Elena; McNulty, Megan M.; Fozzard, Harry A.; Lipkind, Gregory M.; Sheets, Michael F.

2009-01-01

Rationale Lidocaine and other antiarrhythmic drugs bind in the inner pore of voltage-gated Na channels and affect gating use-dependently. A phenylalanine in domain IV, S6 (Phe1759 in NaV1.5), modeled to face the inner pore just below the selectivity filter, is critical in use-dependent drug block. Objective Measurement of gating currents and concentration-dependent availability curves to determine the role of Phe1759 in coupling of drug binding to the gating changes. Methods & Results The measurements showed that replacement of Phe1759 with a non-aromatic residue permits clear separation of action of lidocaine and benzocaine into two components that can be related to channel conformations. One component represents the drug acting as a voltage-independent, low-affinity blocker of closed channels (designated as lipophilic block), and the second represents high-affinity, voltage-dependent block of open/inactivated channels linked to stabilization of the S4's in domains III and IV (designated as voltage-sensor inhibition) by Phe1759. A homology model for how lidocaine and benzocaine bind in the closed and open/inactivated channel conformation is proposed. Conclusions These two components, lipophilic block and voltage-sensor inhibition, can explain the differences in estimates between tonic and open-state/inactivated-state affinities, and they identify how differences in affinity for the two binding conformations can control use-dependence, the hallmark of successful antiarrhythmic drugs. PMID:19661462

Temperature dependence of frequency response characteristics in organic field-effect transistors

NASA Astrophysics Data System (ADS)

Lu, Xubing; Minari, Takeo; Liu, Chuan; Kumatani, Akichika; Liu, J.-M.; Tsukagoshi, Kazuhito

2012-04-01

The frequency response characteristics of semiconductor devices play an essential role in the high-speed operation of electronic devices. We investigated the temperature dependence of dynamic characteristics in pentacene-based organic field-effect transistors and metal-insulator-semiconductor capacitors. As the temperature decreased, the capacitance-voltage characteristics showed large frequency dispersion and a negative shift in the flat-band voltage at high frequencies. The cutoff frequency shows Arrhenius-type temperature dependence with different activation energy values for various gate voltages. These phenomena demonstrate the effects of charge trapping on the frequency response characteristics, since decreased mobility prevents a fast charge response for alternating current signals at low temperatures.

Gating currents from Kv7 channels carrying neuronal hyperexcitability mutations in the voltage-sensing domain.

PubMed

Miceli, Francesco; Vargas, Ernesto; Bezanilla, Francisco; Taglialatela, Maurizio

2012-03-21

Changes in voltage-dependent gating represent a common pathogenetic mechanism for genetically inherited channelopathies, such as benign familial neonatal seizures or peripheral nerve hyperexcitability caused by mutations in neuronal K(v)7.2 channels. Mutation-induced changes in channel voltage dependence are most often inferred from macroscopic current measurements, a technique unable to provide a detailed assessment of the structural rearrangements underlying channel gating behavior; by contrast, gating currents directly measure voltage-sensor displacement during voltage-dependent gating. In this work, we describe macroscopic and gating current measurements, together with molecular modeling and molecular-dynamics simulations, from channels carrying mutations responsible for benign familial neonatal seizures and/or peripheral nerve hyperexcitability; K(v)7.4 channels, highly related to K(v)7.2 channels both functionally and structurally, were used for these experiments. The data obtained showed that mutations affecting charged residues located in the more distal portion of S(4) decrease the stability of the open state and the active voltage-sensing domain configuration but do not directly participate in voltage sensing, whereas mutations affecting a residue (R4) located more proximally in S(4) caused activation of gating-pore currents at depolarized potentials. These results reveal that distinct molecular mechanisms underlie the altered gating behavior of channels carrying disease-causing mutations at different voltage-sensing domain locations, thereby expanding our current view of the pathogenesis of neuronal hyperexcitability diseases. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

MIS diode structure in As/+/ implanted CdS

NASA Technical Reports Server (NTRS)

Hutchby, J. A.

1977-01-01

Structure made by As implantation of carefully prepared high-conductivity CdS surfaces followed by Pt deposition and 450 C anneal display rectifying, although substantially different, I-V characteristics in the dark and during illumination with subband-gap light. Structures prepared in the same way on an unimplanted portion of the substrate have similar I-V characteristics, except that the forward turnover voltage for an illuminated unimplanted diode is much smaller than that for an implanted diode. It is suggested that the charge conduction in both structures is dominated by hole and/or electron tunneling through a metal-semiconductor potential barrier. The tunneling processes appear to be quite sensitive to subband-gap illumination, which causes the dramatic decreases of turnover voltages and apparent series resistances. The difference in turnover voltage appears to be caused by interface states between the Pt electrode and the implanted layer, which suggests a MIS model.

Surface and allied studies in silicon solar cells

NASA Technical Reports Server (NTRS)

Lindholm, F. A.

1984-01-01

Measuring small-signal admittance versus frequency and forward bias voltage together with a new transient measurement apparently provides the most reliable and flexible method available for determining back surface recombination velocity and low-injection lifetime of the quasineutral base region of silicon solar cells. The new transient measurement reported here is called short-circuit-current decay (SCCD). In this method, forward voltage equal to about the open-circuit or the maximum power voltage establishes excess holes and electrons in the junction transition region and in the quasineutral regions. The sudden application of a short circuit causes an exiting of the excess holes and electrons in the transition region within about ten picoseconds. From observing the slope and intercept of the subsequent current decay, the base lifetime and surface recombination velocity can be determined. The admittance measurement previously mentioned then enters to increase accuracy particularly for devices for which the diffusion length exceeds the base thickness.

Review of biased solar arraay. Plasma interaction studies

NASA Technical Reports Server (NTRS)

Stevens, N. J.

1981-01-01

The Solar Electric Propulsion System (SEPS) is proposed for a variety of space missions. Power for operating SEPS is obtained from large solar array wings capable of generating tens of kilowatts of power. To minimize resistive losses in the solar array bus lines, the array is designed to operate at voltages up to 400 volts. This use of high voltage can increase interactions between the biased solar cell interconnects and plasma environments. With thrusters operating, the system ground is maintained at space plasma potential which exposes large areas of the arrays at the operating voltages. This can increase interactions with both the natural and enhanced charged particle environments. Available data on interactions between biased solar array surfaces and plasma environments are summarized. The apparent relationship between collection phenomena and solar cell size and effects of array size on interactions are discussed. The impact of these interactions on SEPS performance is presented.

The Segregated Expression of Voltage-Gated Potassium and Sodium Channels in Neuronal Membranes: Functional Implications and Regulatory Mechanisms

PubMed Central

Duménieu, Maël; Oulé, Marie; Kreutz, Michael R.; Lopez-Rojas, Jeffrey

2017-01-01

Neurons are highly polarized cells with apparent functional and morphological differences between dendrites and axon. A critical determinant for the molecular and functional identity of axonal and dendritic segments is the restricted expression of voltage-gated ion channels (VGCs). Several studies show an uneven distribution of ion channels and their differential regulation within dendrites and axons, which is a prerequisite for an appropriate integration of synaptic inputs and the generation of adequate action potential (AP) firing patterns. This review article will focus on the signaling pathways leading to segmented expression of voltage-gated potassium and sodium ion channels at the neuronal plasma membrane and the regulatory mechanisms ensuring segregated functions. We will also discuss the relevance of proper ion channel targeting for neuronal physiology and how alterations in polarized distribution contribute to neuronal pathology. PMID:28484374

Identification of the pH sensor and activation by chemical modification of the ClC-2G Cl- channel.

PubMed

Stroffekova, K; Kupert, E Y; Malinowska, D H; Cuppoletti, J

1998-10-01

Rabbit and human ClC-2G Cl- channels are voltage sensitive and activated by protein kinase A and low extracellular pH. The objective of the present study was to investigate the mechanism involved in acid activation of the ClC-2G Cl- channel and to determine which amino acid residues play a role in this acid activation. Channel open probability (Po) at +/-80 mV holding potentials increased fourfold in a concentration-dependent manner with extracellular H+ concentration (that is, extracellular pH, pHtrans), with an apparent acidic dissociation constant of pH 4.95 +/- 0.27. 1-Ethyl-3(3-dimethylaminopropyl)carbodiimide-catalyzed amidation of the channel with glycine methyl ester increased Po threefold at pHtrans 7.4, at which the channel normally exhibits low Po. With extracellular pH reduction (protonation) or amidation, increased Po was due to a significant increase in open time constants and a significant decrease in closed time constants of the channel gating, and this effect was insensitive to applied voltage. With the use of site-directed mutagenesis, the extracellular region EELE (amino acids 416-419) was identified as the pH sensor and amino acid Glu-419 was found to play the key or predominant role in activation of the ClC-2G Cl- channel by extracellular acid.

Inhibition of veratridine-induced delayed inactivation of the voltage-sensitive sodium channel by synthetic analogs of crambescin B.

PubMed

Tsukamoto, Tadaaki; Chiba, Yukie; Nakazaki, Atsuo; Ishikawa, Yuki; Nakane, Yoshiki; Cho, Yuko; Yotsu-Yamashita, Mari; Nishikawa, Toshio; Wakamori, Minoru; Konoki, Keiichi

2017-03-01

Crambescin B carboxylic acid, a synthetic analog of crambescin B, was recently found to inhibit the voltage-sensitive sodium channels (VSSC) in a cell-based assay using neuroblastoma Neuro 2A cells. In the present study, whole-cell patch-clamp recordings were conducted with three heterologously expressed VSSC subtypes, Na v 1.2, Na v 1.6 and Na v 1.7, in a human embryonic kidney cell line HEK293T to further characterize the inhibition of VSSC by crambescin B carboxylic acid. Contrary to the previous observation, crambescin B carboxylic acid did not inhibit peak current evoked by depolarization from the holding potential of -100mV to the test potential of -10mV in the absence or presence of veratridine (VTD). In the presence of VTD, however, crambescin B carboxylic acid diminished VTD-induced sustained and tail currents through the three VSSC subtypes in a dose-dependent manner, whereas TTX inhibited both the peak current and the VTD-induced sustained and tail currents through all subtypes of VSSC tested. We thus concluded that crambescin B carboxylic acid does not block VSSC in a similar manner to TTX but modulate the action of VTD, thereby causing an apparent block of VSSC in the cell-based assay. Copyright © 2017 Elsevier Ltd. All rights reserved.

Two separate interfaces between the voltage sensor and pore are required for the function of voltage-dependent K(+) channels.

PubMed

Lee, Seok-Yong; Banerjee, Anirban; MacKinnon, Roderick

2009-03-03

Voltage-dependent K(+) (Kv) channels gate open in response to the membrane voltage. To further our understanding of how cell membrane voltage regulates the opening of a Kv channel, we have studied the protein interfaces that attach the voltage-sensor domains to the pore. In the crystal structure, three physical interfaces exist. Only two of these consist of amino acids that are co-evolved across the interface between voltage sensor and pore according to statistical coupling analysis of 360 Kv channel sequences. A first co-evolved interface is formed by the S4-S5 linkers (one from each of four voltage sensors), which form a cuff surrounding the S6-lined pore opening at the intracellular surface. The crystal structure and published mutational studies support the hypothesis that the S4-S5 linkers convert voltage-sensor motions directly into gate opening and closing. A second co-evolved interface forms a small contact surface between S1 of the voltage sensor and the pore helix near the extracellular surface. We demonstrate through mutagenesis that this interface is necessary for the function and/or structure of two different Kv channels. This second interface is well positioned to act as a second anchor point between the voltage sensor and the pore, thus allowing efficient transmission of conformational changes to the pore's gate.

Biophysical characterization of the fluorescent protein voltage probe VSFP2.3 based on the voltage-sensing domain of Ci-VSP.

PubMed

Lundby, Alicia; Akemann, Walther; Knöpfel, Thomas

2010-11-01

A voltage sensitive phosphatase was discovered in the ascidian Ciona intestinalis. The phosphatase, Ci-VSP, contains a voltage-sensing domain homologous to those known from voltage-gated ion channels, but unlike ion channels, the voltage-sensing domain of Ci-VSP can reside in the cell membrane as a monomer. We fused the voltage-sensing domain of Ci-VSP to a pair of fluorescent reporter proteins to generate a genetically encodable voltage-sensing fluorescent probe, VSFP2.3. VSFP2.3 is a fluorescent voltage probe that reports changes in membrane potential as a FRET (fluorescence resonance energy transfer) signal. Here we report sensing current measurements from VSFP2.3, and show that VSFP2.3 carries 1.2 e sensing charges, which are displaced within 1.5 ms. The sensing currents become faster at higher temperatures, and the voltage dependence of the decay time constants is temperature dependent. Neutralization of an arginine in S4, previously suggested to be a sensing charge, and measuring associated sensing currents indicate that this charge is likely to reside at the membrane-aqueous interface rather than within the membrane electric field. The data presented give us insights into the voltage-sensing mechanism of Ci-VSP, which will allow us to further improve the sensitivity and kinetics of the family of VSFP proteins.

Transfer of Kv3.1 voltage sensor features to the isolated Ci-VSP voltage-sensing domain.

PubMed

Mishina, Yukiko; Mutoh, Hiroki; Knöpfel, Thomas

2012-08-22

Membrane proteins that respond to changes in transmembrane voltage are critical in regulating the function of living cells. The voltage-sensing domains (VSDs) of voltage-gated ion channels are extensively studied to elucidate voltage-sensing mechanisms, and yet many aspects of their structure-function relationship remain elusive. Here, we transplanted homologous amino acid motifs from the tetrameric voltage-activated potassium channel Kv3.1 to the monomeric VSD of Ciona intestinalis voltage-sensitive phosphatase (Ci-VSP) to explore which portions of Kv3.1 subunits depend on the tetrameric structure of Kv channels and which properties of Kv3.1 can be transferred to the monomeric Ci-VSP scaffold. By attaching fluorescent proteins to these chimeric VSDs, we obtained an optical readout to establish membrane trafficking and kinetics of voltage-dependent structural rearrangements. We found that motifs extending from 10 to roughly 100 amino acids can be readily transplanted from Kv3.1 into Ci-VSP to form engineered VSDs that efficiently incorporate into the plasma membrane and sense voltage. Some of the functional features of these engineered VSDs are reminiscent of Kv3.1 channels, indicating that these properties do not require interactions between Kv subunits or between the voltage sensing and the pore domains of Kv channels. Copyright © 2012 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Clues to understanding cold sensation: Thermodynamics and electrophysiological analysis of the cold receptor TRPM8

PubMed Central

Brauchi, Sebastian; Orio, Patricio; Latorre, Ramon

2004-01-01

The cold and menthol receptor, TRPM8, also designated CMR1, is a member of the transient receptor potential (TRP) family of excitatory ion channels. TRPM8 is a channel activated by cold temperatures, voltage, and menthol. In this study, we characterize the cold- and voltage-induced activation of TRPM8 channel in an attempt to identify the temperature- and voltage-dependent components involved in channel activation. Under equilibrium conditions, decreasing temperature has two effects. (i) It shifts the normalized conductance vs. voltage curves toward the left, along the voltage axis. This effect indicates that the degree of order is higher when the channel is in the open configuration. (ii) It increases the maximum channel open probability, suggesting that temperature affects both voltage-dependent and -independent pathways. In the temperature range between 18°C and 25°C, large changes in enthalpy (ΔH = -112 kcal/mol) and entropy (ΔS = -384 cal/mol K) accompany the activation process. The Q10 calculated in the same temperature range is 24. This thermodynamic analysis strongly suggests that the process of opening involves large conformational changes of the channel-forming protein. Therefore, the highly temperature-dependent transition between open and closed configurations is possible because enthalpy and entropy are both large and compensate each other. Our data also demonstrate that temperature and voltage interact allosterically to enhance channel opening. PMID:15492228

Fabrication and Characteristics of Pentacene/Vanadium Pentoxide Field-Effect Transistors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Minagawa, M.; Nakai, K.; Baba, A.

2011-12-23

Organic field-effect transistors (OFETs) were fabricated using pentacene thin layer, and the effects of inserted Lewis-acid thin layers on electrical properties were investigated. The OFETs have active layers of pentacene and vanadium pentoxide (V{sub 2}O{sub 5}) as a Lewis-acid layer. Typical source-drain current (I{sub DS}) vs. source-drain voltage (V{sub DS}) curves were observed under negative gate voltages (V{sub G}S) application, and the shift of the threshold voltage for FET driving (V{sub t}) to positive side was also observed by V{sub 2}O{sub 5} layer insertion, that is, -2.5 V for device with V{sub 2}O{sub 5} layer and -5.7 V for devicemore » without V{sub 2}O{sub 5} layer. It was thought that charge transfer (CT) complexes which were formed at the interface between pentacene and V{sub 2}O{sub 5} layer were dissociated by the applied gate voltage, and the generated holes seem to contribute to drain current and the apparent V{sub t} improvement.« less

Scan-rate-dependent current rectification of cone-shaped silica nanopores in quartz nanopipettes.

PubMed

Guerrette, Joshua P; Zhang, Bo

2010-12-08

Here we report the voltammetric behavior of cone-shaped silica nanopores in quartz nanopipettes in aqueous solutions as a function of the scan rate, v. Current rectification behavior for silica nanopores with diameters in the range 4-25 nm was studied. The rectification behavior was found to be strongly dependent on the scan rate. At low scan rates (e.g., v < 1 V/s), the rectification ratio was found to be at its maximum and relatively independent of v. At high scan rates (e.g., v > 200 V/s), a nearly linear current-voltage response was obtained. In addition, the initial voltage was shown to play a critical role in the current-voltage response of cone-shaped nanopores at high scan rates. We explain this v-dependent current-voltage response by ionic redistribution in the vicinity of the nanopore mouth.

Action potentials drive body wall muscle contractions in Caenorhabditis elegans

PubMed Central

Gao, Shangbang; Zhen, Mei

2011-01-01

The sinusoidal locomotion exhibited by Caenorhabditis elegans predicts a tight regulation of contractions and relaxations of its body wall muscles. Vertebrate skeletal muscle contractions are driven by voltage-gated sodium channel–dependent action potentials. How coordinated motor outputs are regulated in C. elegans, which does not have voltage-gated sodium channels, remains unknown. Here, we show that C. elegans body wall muscles fire all-or-none, calcium-dependent action potentials that are driven by the L-type voltage-gated calcium and Kv1 voltage-dependent potassium channels. We further demonstrate that the excitatory and inhibitory motoneuron activities regulate the frequency of action potentials to coordinate muscle contraction and relaxation, respectively. This study provides direct evidence for the dual-modulatory model of the C. elegans motor circuit; moreover, it reveals a mode of motor control in which muscle cells integrate graded inputs of the nervous system and respond with all-or-none electrical signals. PMID:21248227

Gating transitions in the selectivity filter region of a sodium channel are coupled to the domain IV voltage sensor.

PubMed

Capes, Deborah L; Arcisio-Miranda, Manoel; Jarecki, Brian W; French, Robert J; Chanda, Baron

2012-02-14

Voltage-dependent ion channels are crucial for generation and propagation of electrical activity in biological systems. The primary mechanism for voltage transduction in these proteins involves the movement of a voltage-sensing domain (D), which opens a gate located on the cytoplasmic side. A distinct conformational change in the selectivity filter near the extracellular side has been implicated in slow inactivation gating, which is important for spike frequency adaptation in neural circuits. However, it remains an open question whether gating transitions in the selectivity filter region are also actuated by voltage sensors. Here, we examine conformational coupling between each of the four voltage sensors and the outer pore of a eukaryotic voltage-dependent sodium channel. The voltage sensors of these sodium channels are not structurally symmetric and exhibit functional specialization. To track the conformational rearrangements of individual voltage-sensing domains, we recorded domain-specific gating pore currents. Our data show that, of the four voltage sensors, only the domain IV voltage sensor is coupled to the conformation of the selectivity filter region of the sodium channel. Trapping the outer pore in a particular conformation with a high-affinity toxin or disulphide crossbridge impedes the return of this voltage sensor to its resting conformation. Our findings directly establish that, in addition to the canonical electromechanical coupling between voltage sensor and inner pore gates of a sodium channel, gating transitions in the selectivity filter region are also coupled to the movement of a voltage sensor. Furthermore, our results also imply that the voltage sensor of domain IV is unique in this linkage and in the ability to initiate slow inactivation in sodium channels.

Interplay of activation kinetics and the derivative conductance determines resonance properties of neurons

NASA Astrophysics Data System (ADS)

Pena, Rodrigo F. O.; Ceballos, Cesar C.; Lima, Vinicius; Roque, Antonio C.

2018-04-01

In a neuron with hyperpolarization activated current (Ih), the correct input frequency leads to an enhancement of the output response. This behavior is known as resonance and is well described by the neuronal impedance. In a simple neuron model we derive equations for the neuron's resonance and we link its frequency and existence with the biophysical properties of Ih. For a small voltage change, the component of the ratio of current change to voltage change (d I /d V ) due to the voltage-dependent conductance change (d g /d V ) is known as derivative conductance (GhDer). We show that both GhDer and the current activation kinetics (characterized by the activation time constant τh) are mainly responsible for controlling the frequency and existence of resonance. The increment of both factors (GhDer and τh) greatly contributes to the appearance of resonance. We also demonstrate that resonance is voltage dependent due to the voltage dependence of GhDer. Our results have important implications and can be used to predict and explain resonance properties of neurons with the Ih current.

Voltage-Clamp Studies on Uterine Smooth Muscle

PubMed Central

Anderson, Nels C.

1969-01-01

These studies have developed and tested an experimental approach to the study of membrane ionic conductance mechanisms in strips of uterine smooth muscle. The experimental and theoretical basis for applying the double sucrose-gap technique is described along with the limitations of this system. Nonpropagating membrane action potentials were produced in response to depolarizing current pulses under current-clamp conditions. The stepwise change of membrane potential under voltage-clamp conditions resulted in a family of ionic currents with voltage- and time-dependent characteristics. In sodium-free solution the peak transient current decreased and its equilibrium potential shifted along the voltage axis toward a more negative internal potential. These studies indicate a sodium-dependent, regenerative excitation mechanism. PMID:5796366

Modeling of Gate Bias Modulation in Carbon Nanotube Field-Effect-Transistor

NASA Technical Reports Server (NTRS)

Toshishige, Yamada; Biegel, Bryan A. (Technical Monitor)

2002-01-01

The threshold voltages of a carbon-nanotube (CNT) field-effect transistor (FET) are studied. The CNT channel is so thin that there is no voltage drop perpendicular to the gate electrode plane, and this makes the device characteristics quite unique. The relation between the voltage and the electrochemical potentials, and the mass action law for electrons and holes are examined in the context of CNTs, and inversion and accumulation threshold voltages (V(sub Ti), and V(sub Ta)) are derived. V(sub Ti) of the CNTFETs has a much stronger doping dependence than that of the metal-oxide- semiconductor FETs, while V(sub Ta) of both devices depends weakly on doping with the same functional form.

Plasma formation in water vapour layers in high conductivity liquids

NASA Astrophysics Data System (ADS)

Kelsey, C. P.; Schaper, L.; Stalder, K. R.; Graham, W. G.

2011-10-01

The vapour layer development stage of relatively low voltage plasmas in conducting solutions has already been well explored. The nature of the discharges formed within the vapour layer however is still largely unexplored. Here we examine the nature of such discharges through a combination of fast imaging and spatially, temporally resolved spectroscopy and electrical characterisation. The experimental setup used is a pin-to-plate discharge configuration with a -350V, 200 μs pulse applied at a repetition rate of 2Hz. A lens, followed by beam splitter allows beams to one Andor ICCD camera to capture images of the plasma emission with a second camera at the exit of a high resolution spectrometer. Through synchronization of the camera images at specified times after plasma ignition (as determined from current-voltage characteristics) they can be correlated with the spectra features. Initial measurements reveal two apparently different plasma formations. Stark broadening of the hydrogen Balmer beta line indicate electron densities of 3 to 5 ×1020 m-3 for plasmas produced early in the voltage pulse and an order of magnitude less for the later plasmas. The vapour layer development stage of relatively low voltage plasmas in conducting solutions has already been well explored. The nature of the discharges formed within the vapour layer however is still largely unexplored. Here we examine the nature of such discharges through a combination of fast imaging and spatially, temporally resolved spectroscopy and electrical characterisation. The experimental setup used is a pin-to-plate discharge configuration with a -350V, 200 μs pulse applied at a repetition rate of 2Hz. A lens, followed by beam splitter allows beams to one Andor ICCD camera to capture images of the plasma emission with a second camera at the exit of a high resolution spectrometer. Through synchronization of the camera images at specified times after plasma ignition (as determined from current-voltage characteristics) they can be correlated with the spectra features. Initial measurements reveal two apparently different plasma formations. Stark broadening of the hydrogen Balmer beta line indicate electron densities of 3 to 5 ×1020 m-3 for plasmas produced early in the voltage pulse and an order of magnitude less for the later plasmas. Colin Kelsey is supported by a DEL NI PhD studentship.

Gating Charge Calculations by Computational Electrophysiology Simulations.

PubMed

Machtens, Jan-Philipp; Briones, Rodolfo; Alleva, Claudia; de Groot, Bert L; Fahlke, Christoph

2017-04-11

Electrical cell signaling requires adjustment of ion channel, receptor, or transporter function in response to changes in membrane potential. For the majority of such membrane proteins, the molecular details of voltage sensing remain insufficiently understood. Here, we present a molecular dynamics simulation-based method to determine the underlying charge movement across the membrane-the gating charge-by measuring electrical capacitor properties of membrane-embedded proteins. We illustrate the approach by calculating the charge transfer upon membrane insertion of the HIV gp41 fusion peptide, and validate the method on two prototypical voltage-dependent proteins, the Kv1.2 K + channel and the voltage sensor of the Ciona intestinalis voltage-sensitive phosphatase, against experimental data. We then use the gating charge analysis to study how the T1 domain modifies voltage sensing in Kv1.2 channels and to investigate the voltage dependence of the initial binding of two Na + ions in Na + -coupled glutamate transporters. Our simulation approach quantifies various mechanisms of voltage sensing, enables direct comparison with experiments, and supports mechanistic interpretation of voltage sensitivity by fractional amino acid contributions. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Functional diversity of voltage-sensing phosphatases in two urodele amphibians.

PubMed

Mutua, Joshua; Jinno, Yuka; Sakata, Souhei; Okochi, Yoshifumi; Ueno, Shuichi; Tsutsui, Hidekazu; Kawai, Takafumi; Iwao, Yasuhiro; Okamura, Yasushi

2014-07-16

Voltage-sensing phosphatases (VSPs) share the molecular architecture of the voltage sensor domain (VSD) with voltage-gated ion channels and the phosphoinositide phosphatase region with the phosphatase and tensin homolog (PTEN), respectively. VSPs enzymatic activities are regulated by the motions of VSD upon depolarization. The physiological role of these proteins has remained elusive, and insights may be gained by investigating biological variations in different animal species. Urodele amphibians are vertebrates with potent activities of regeneration and also show diverse mechanisms of polyspermy prevention. We cloned cDNAs of VSPs from the testes of two urodeles; Hynobius nebulosus and Cynops pyrrhogaster, and compared their expression and voltage-dependent activation. Their molecular architecture is highly conserved in both Hynobius VSP (Hn-VSP) and Cynops VSP (Cp-VSP), including the positively-charged arginine residues in the S4 segment of the VSD and the enzymatic active site for substrate binding, yet the C-terminal C2 domain of Hn-VSP is significantly shorter than that of Cp-VSP and other VSP orthologs. RT-PCR analysis showed that gene expression pattern was distinct between two VSPs. The voltage sensor motions and voltage-dependent phosphatase activities were investigated electrophysiologically by expression in Xenopus oocytes. Both VSPs showed "sensing" currents, indicating that their voltage sensor domains are functional. The phosphatase activity of Cp-VSP was found to be voltage dependent, as shown by its ability to regulate the conductance of coexpressed GIRK2 channels, but Hn-VSP lacked such phosphatase activity due to the truncation of its C2 domain. © 2014 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

Mapping of voltage sensor positions in resting and inactivated mammalian sodium channels by LRET

PubMed Central

Kubota, Tomoya; Durek, Thomas; Dang, Bobo; Finol-Urdaneta, Rocio K.; Craik, David J.; Kent, Stephen B. H.; French, Robert J.; Bezanilla, Francisco; Correa, Ana M.

2017-01-01

Voltage-gated sodium channels (Navs) play crucial roles in excitable cells. Although vertebrate Nav function has been extensively studied, the detailed structural basis for voltage-dependent gating mechanisms remain obscure. We have assessed the structural changes of the Nav voltage sensor domain using lanthanide-based resonance energy transfer (LRET) between the rat skeletal muscle voltage-gated sodium channel (Nav1.4) and fluorescently labeled Nav1.4-targeting toxins. We generated donor constructs with genetically encoded lanthanide-binding tags (LBTs) inserted at the extracellular end of the S4 segment of each domain (with a single LBT per construct). Three different Bodipy-labeled, Nav1.4-targeting toxins were synthesized as acceptors: β-scorpion toxin (Ts1)-Bodipy, KIIIA-Bodipy, and GIIIA-Bodipy analogs. Functional Nav-LBT channels expressed in Xenopus oocytes were voltage-clamped, and distinct LRET signals were obtained in the resting and slow inactivated states. Intramolecular distances computed from the LRET signals define a geometrical map of Nav1.4 with the bound toxins, and reveal voltage-dependent structural changes related to channel gating. PMID:28202723

Molecular mechanism of voltage sensing in voltage-gated proton channels

PubMed Central

Rebolledo, Santiago; Perez, Marta E.

2013-01-01

Voltage-gated proton (Hv) channels play an essential role in phagocytic cells by generating a hyperpolarizing proton current that electrically compensates for the depolarizing current generated by the NADPH oxidase during the respiratory burst, thereby ensuring a sustained production of reactive oxygen species by the NADPH oxidase in phagocytes to neutralize engulfed bacteria. Despite the importance of the voltage-dependent Hv current, it is at present unclear which residues in Hv channels are responsible for the voltage activation. Here we show that individual neutralizations of three charged residues in the fourth transmembrane domain, S4, all reduce the voltage dependence of activation. In addition, we show that the middle S4 charged residue moves from a position accessible from the cytosolic solution to a position accessible from the extracellular solution, suggesting that this residue moves across most of the membrane electric field during voltage activation of Hv channels. Our results show for the first time that the charge movement of these three S4 charges accounts for almost all of the measured gating charge in Hv channels. PMID:23401575

Mapping of voltage sensor positions in resting and inactivated mammalian sodium channels by LRET.

PubMed

Kubota, Tomoya; Durek, Thomas; Dang, Bobo; Finol-Urdaneta, Rocio K; Craik, David J; Kent, Stephen B H; French, Robert J; Bezanilla, Francisco; Correa, Ana M

2017-03-07

Voltage-gated sodium channels (Navs) play crucial roles in excitable cells. Although vertebrate Nav function has been extensively studied, the detailed structural basis for voltage-dependent gating mechanisms remain obscure. We have assessed the structural changes of the Nav voltage sensor domain using lanthanide-based resonance energy transfer (LRET) between the rat skeletal muscle voltage-gated sodium channel (Nav1.4) and fluorescently labeled Nav1.4-targeting toxins. We generated donor constructs with genetically encoded lanthanide-binding tags (LBTs) inserted at the extracellular end of the S4 segment of each domain (with a single LBT per construct). Three different Bodipy-labeled, Nav1.4-targeting toxins were synthesized as acceptors: β-scorpion toxin (Ts1)-Bodipy, KIIIA-Bodipy, and GIIIA-Bodipy analogs. Functional Nav-LBT channels expressed in Xenopus oocytes were voltage-clamped, and distinct LRET signals were obtained in the resting and slow inactivated states. Intramolecular distances computed from the LRET signals define a geometrical map of Nav1.4 with the bound toxins, and reveal voltage-dependent structural changes related to channel gating.

Acidosis Differentially Modulates Inactivation in NaV1.2, NaV1.4, and NaV1.5 Channels

PubMed Central

Vilin, Yury Y.; Peters, Colin H.; Ruben, Peter C.

2012-01-01

NaV channels play a crucial role in neuronal and muscle excitability. Using whole-cell recordings we studied effects of low extracellular pH on the biophysical properties of NaV1.2, NaV1.4, and NaV1.5, expressed in cultured mammalian cells. Low pH produced different effects on different channel subtypes. Whereas NaV1.4 exhibited very low sensitivity to acidosis, primarily limited to partial block of macroscopic currents, the effects of low pH on gating in NaV1.2 and NaV1.5 were profound. In NaV1.2 low pH reduced apparent valence of steady-state fast inactivation, shifted the τ(V) to depolarizing potentials and decreased channels availability during onset to slow and use-dependent inactivation (UDI). In contrast, low pH delayed open-state inactivation in NaV1.5, right-shifted the voltage-dependence of window current, and increased channel availability during onset to slow and UDI. These results suggest that protons affect channel availability in an isoform-specific manner. A computer model incorporating these results demonstrates their effects on membrane excitability. PMID:22701426

Indistinguishable Synaptic Pharmacodynamics of the N-Methyl-d-Aspartate Receptor Channel Blockers Memantine and Ketamine

PubMed Central

Emnett, Christine M.; Eisenman, Lawrence N.; Taylor, Amanda M.; Izumi, Yukitoshi; Zorumski, Charles F.

2013-01-01

Memantine and ketamine, voltage- and activation-dependent channel blockers of N-methyl-d-aspartate (NMDA) receptors (NMDARs), have enjoyed a recent resurgence in clinical interest. Steady-state pharmacodynamic differences between these blockers have been reported, but it is unclear whether the compounds differentially affect dynamic physiologic signaling. In this study, we explored nonequilibrium conditions relevant to synaptic transmission in hippocampal networks in dissociated culture and hippocampal slices. Equimolar memantine and ketamine had indistinguishable effects on the following measures: steady-state NMDA currents, NMDAR excitatory postsynaptic current (EPSC) decay kinetics, progressive EPSC inhibition during repetitive stimulation, and extrasynaptic NMDAR inhibition. Therapeutic drug efficacy and tolerability of memantine have been attributed to fast kinetics and strong voltage dependence. However, pulse depolarization in drug presence revealed a surprisingly slow and similar time course of equilibration for the two compounds, although memantine produced a more prominent fast component (62% versus 48%) of re-equilibration. Simulations predicted that low gating efficacy underlies the slow voltage–dependent relief from block. This prediction was empirically supported by faster voltage-dependent blocker re-equilibration with several experimental manipulations of gating efficacy. Excitatory postsynaptic potential–like voltage commands produced drug differences only with large, prolonged depolarizations unlikely to be attained physiologically. In fact, we found no difference between drugs on measures of spontaneous network activity or acute effects on plasticity in hippocampal slices. Despite indistinguishable synaptic pharmacodynamics, ketamine provided significantly greater neuroprotection from damage induced by oxygen glucose deprivation, consistent with the idea that under extreme depolarizing conditions, the biophysical difference between drugs becomes detectable. We conclude that despite subtle differences in voltage dependence, during physiologic activity, blocker pharmacodynamics are largely indistinguishable and largely voltage independent. PMID:24101301

Effect of air gap on apparent temperature of body wearing various sizes of T-shirt

NASA Astrophysics Data System (ADS)

Takatera, M.; Uchiyama, E.; Zhu, C.; Kim, KO; Ishizawa, H.

2017-10-01

We investigated the effect of air gap on the apparent temperature. Using the developed thermocouple fabric and a thermal manikin, we measured temperature distribution of the measuring garments due to the change of T-shirt sizes. We were able to measure the apparent temperature distribution at points near a body while wearing different sizes of T-shirts. It was observed that the temperature distribution depending on different air gap between clothing and body. The apparent temperature depends on garment size and place. The effect of air gap on apparent temperature of body was experimentally confirmed.

Flexible $$I_{Q}\\!\\!-\\!\\!V$$ Scheme of a DFIG for Rapid Voltage Regulation of a Wind Power Plant

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Jinho; Muljadi, Eduard; Park, Jung -Wook

This paper proposes a flexible reactive current-to-voltage (I Q-V) scheme of a doubly-fed induction generator (DFIG) for the rapid voltage regulation of a wind power plant (WPP). In the proposed scheme, the WPP controller dispatches different voltage set points to the DFIGs depending on their rotor voltage margins. The DFIGs inject different reactive power with the flexible I Q-V schemes implemented in the rotor-side and grid-side converters. The I Q-V characteristic, which consists of the gain and width of a linear band and I Q capability, varies with time depending on the I Q capability of the converters and amore » voltage dip at the point of interconnection (POI). To increase the I Q capability during a fault, the active current is reduced in proportion to a voltage dip. If the I Q capability and/or the POI voltage dip are large, the I Q-V gain is set to be high, thereby providing rapid voltage regulation. To avoid an overvoltage after the fault clearance, a rapid I Q reduction scheme is implemented in the WPP and DFIG controllers. The performance of the proposed flexible scheme was verified under scenarios with various disturbances. In conclusion, the proposed scheme can help increase wind power penetration without jeopardizing voltage stability.« less

Low-power low-voltage superior-order curvature corrected voltage reference

NASA Astrophysics Data System (ADS)

Popa, Cosmin

2010-06-01

A complementary metal oxide semiconductor (CMOS) voltage reference with a logarithmic curvature-correction will be presented. The first-order compensation is realised using an original offset voltage follower (OVF) block as a proportional to absolute temperature (PTAT) voltage generator, with the advantages of reducing the silicon area and of increasing accuracy by replacing matched resistors with matched transistors. The new logarithmic curvature-correction technique will be implemented using an asymmetric differential amplifier (ADA) block for compensating the logarithmic temperature dependent term from the first-order compensated voltage reference. In order to increase the circuit accuracy, an original temperature-dependent current generator will be designed for computing the exact type of the implemented curvature-correction. The relatively small complexity of the current squarer allows an important increasing of the circuit accuracy that could be achieved by increasing the current generator complexity. As a result of operating most of the MOS transistors in weak inversion, the original proposed voltage reference could be valuable for low-power applications. The circuit is implemented in 0.35 μm CMOS technology and consumes only 60μA for t = 25°C, being supplied at the minimal supply voltage V DD = 1.75V. The temperature coefficient of the reference voltage is 8.7 ppm/°C, while the line sensitivity is 0.75 mV/V for a supply voltage between 1.75 V and 7 V.

Flexible $$I_{Q}\\!\\!-\\!\\!V$$ Scheme of a DFIG for Rapid Voltage Regulation of a Wind Power Plant

DOE PAGES

Kim, Jinho; Muljadi, Eduard; Park, Jung -Wook; ...

2017-04-28

This paper proposes a flexible reactive current-to-voltage (I Q-V) scheme of a doubly-fed induction generator (DFIG) for the rapid voltage regulation of a wind power plant (WPP). In the proposed scheme, the WPP controller dispatches different voltage set points to the DFIGs depending on their rotor voltage margins. The DFIGs inject different reactive power with the flexible I Q-V schemes implemented in the rotor-side and grid-side converters. The I Q-V characteristic, which consists of the gain and width of a linear band and I Q capability, varies with time depending on the I Q capability of the converters and amore » voltage dip at the point of interconnection (POI). To increase the I Q capability during a fault, the active current is reduced in proportion to a voltage dip. If the I Q capability and/or the POI voltage dip are large, the I Q-V gain is set to be high, thereby providing rapid voltage regulation. To avoid an overvoltage after the fault clearance, a rapid I Q reduction scheme is implemented in the WPP and DFIG controllers. The performance of the proposed flexible scheme was verified under scenarios with various disturbances. In conclusion, the proposed scheme can help increase wind power penetration without jeopardizing voltage stability.« less

NO involvement in the inhibition of ghrelin on voltage-dependent potassium currents in rat hippocampal cells.

PubMed

Lu, Yong; Dang, Shaokang; Wang, Xu; Zhang, Junli; Zhang, Lin; Su, Qian; Zhang, Huiping; Lin, Tianwei; Zhang, Xiaoxiao; Zhang, Yurong; Sun, Hongli; Zhu, Zhongliang; Li, Hui

2018-01-01

Ghrelin is a peptide hormone that plays an important role in promoting appetite, regulating distribution and rate of use of energy, cognition, and mood disorders, but the relevant neural mechanisms of these function are still not clear. In this study, we examined the effect of ghrelin on voltage-dependent potassium (K + ) currents in hippocampal cells of 1-3 days SD rats by whole-cell patch-clamp technique, and discussed whether NO was involved in this process. The results showed that ghrelin significantly inhibited the voltage-dependent K + currents in hippocampal cells, and the inhibitory effect was more significant when l-arginine was co-administered. In contrast, N-nitro- l-arginine methyl ester increased the ghrelin inhibited K + currents and attenuated the inhibitory effect of ghrelin. While d-arginine (D-AA) showed no significant impact on the ghrelin-induced decrease in K + current. These results show that ghrelin may play a physiological role by inhibiting hippocampal voltage dependent K + currents, and the NO pathway may be involved in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

Hysteresis in voltage-gated channels.

PubMed

Villalba-Galea, Carlos A

2017-03-04

Ion channels constitute a superfamily of membrane proteins found in all living creatures. Their activity allows fast translocation of ions across the plasma membrane down the ion's transmembrane electrochemical gradient, resulting in a difference in electrical potential across the plasma membrane, known as the membrane potential. A group within this superfamily, namely voltage-gated channels, displays activity that is sensitive to the membrane potential. The activity of voltage-gated channels is controlled by the membrane potential, while the membrane potential is changed by these channels' activity. This interplay produces variations in the membrane potential that have evolved into electrical signals in many organisms. These signals are essential for numerous biological processes, including neuronal activity, insulin release, muscle contraction, fertilization and many others. In recent years, the activity of the voltage-gated channels has been observed not to follow a simple relationship with the membrane potential. Instead, it has been shown that the activity of voltage-gated channel displays hysteresis. In fact, a growing number of evidence have demonstrated that the voltage dependence of channel activity is dynamically modulated by activity itself. In spite of the great impact that this property can have on electrical signaling, hysteresis in voltage-gated channels is often overlooked. Addressing this issue, this review provides examples of voltage-gated ion channels displaying hysteretic behavior. Further, this review will discuss how Dynamic Voltage Dependence in voltage-gated channels can have a physiological role in electrical signaling. Furthermore, this review will elaborate on the current thoughts on the mechanism underlying hysteresis in voltage-gated channels.

Increasing The Electric Field For An Improved Search For Time-Reversal Violation Using Radium-225

NASA Astrophysics Data System (ADS)

Powers, Adam

2017-09-01

Radium-225 atoms, because of their unusual pear-shaped nuclei, have an enhanced sensitivity to the violation of time reversal symmetry. A breakdown of this fundamental symmetry could help explain the apparent scarcity of antimatter in the Universe. Our goal is to improve the statistical sensitivity of an ongoing experiment that precisely measures the EDM of Radium-225. This can be done by increasing the electric field acting on the Radium atoms. We do this by increasing the voltage that can be reliably applied between two electrodes, and narrowing the gap between them. We use a varying high voltage system to condition the electrodes using incremental voltage ramp tests to achieve higher voltage potential differences. Using an adjustable gap mount to change the distance between the electrodes, specific metals for their composition, and a clean room procedure to keep particulates out of the system, we produce a higher and more stable electric field. Progress is marked by measurements of the leakage current between the electrodes during our incremental voltage ramp tests or emulated tests of the actual experiment, with low and constant current showing stability of the field. This project is supported by Michigan State University, and the US DOE, Office of Science, Office of Nuclear Physics, under Contract DE-AC02-06CH11357.

Priming with real motion biases visual cortical response to bistable apparent motion

PubMed Central

Zhang, Qing-fang; Wen, Yunqing; Zhang, Deng; She, Liang; Wu, Jian-young; Dan, Yang; Poo, Mu-ming

2012-01-01

Apparent motion quartet is an ambiguous stimulus that elicits bistable perception, with the perceived motion alternating between two orthogonal paths. In human psychophysical experiments, the probability of perceiving motion in each path is greatly enhanced by a brief exposure to real motion along that path. To examine the neural mechanism underlying this priming effect, we used voltage-sensitive dye (VSD) imaging to measure the spatiotemporal activity in the primary visual cortex (V1) of awake mice. We found that a brief real motion stimulus transiently biased the cortical response to subsequent apparent motion toward the spatiotemporal pattern representing the real motion. Furthermore, intracellular recording from V1 neurons in anesthetized mice showed a similar increase in subthreshold depolarization in the neurons representing the path of real motion. Such short-term plasticity in early visual circuits may contribute to the priming effect in bistable visual perception. PMID:23188797

Scorpion β-toxin interference with NaV channel voltage sensor gives rise to excitatory and depressant modes

PubMed Central

Leipold, Enrico; Borges, Adolfo

2012-01-01

Scorpion β toxins, peptides of ∼70 residues, specifically target voltage-gated sodium (NaV) channels to cause use-dependent subthreshold channel openings via a voltage–sensor trapping mechanism. This excitatory action is often overlaid by a not yet understood depressant mode in which NaV channel activity is inhibited. Here, we analyzed these two modes of gating modification by β-toxin Tz1 from Tityus zulianus on heterologously expressed NaV1.4 and NaV1.5 channels using the whole cell patch-clamp method. Tz1 facilitated the opening of NaV1.4 in a use-dependent manner and inhibited channel opening with a reversed use dependence. In contrast, the opening of NaV1.5 was exclusively inhibited without noticeable use dependence. Using chimeras of NaV1.4 and NaV1.5 channels, we demonstrated that gating modification by Tz1 depends on the specific structure of the voltage sensor in domain 2. Although residue G658 in NaV1.4 promotes the use-dependent transitions between Tz1 modification phenotypes, the equivalent residue in NaV1.5, N803, abolishes them. Gating charge neutralizations in the NaV1.4 domain 2 voltage sensor identified arginine residues at positions 663 and 669 as crucial for the outward and inward movement of this sensor, respectively. Our data support a model in which Tz1 can stabilize two conformations of the domain 2 voltage sensor: a preactivated outward position leading to NaV channels that open at subthreshold potentials, and a deactivated inward position preventing channels from opening. The results are best explained by a two-state voltage–sensor trapping model in that bound scorpion β toxin slows the activation as well as the deactivation kinetics of the voltage sensor in domain 2. PMID:22450487

C-terminal modulatory domain controls coupling of voltage-sensing to pore opening in Cav1.3 L-type Ca(2+) channels.

PubMed

Lieb, Andreas; Ortner, Nadine; Striessnig, Jörg

2014-04-01

Activity of voltage-gated Cav1.3 L-type Ca(2+) channels is required for proper hearing as well as sinoatrial node and brain function. This critically depends on their negative activation voltage range, which is further fine-tuned by alternative splicing. Shorter variants miss a C-terminal regulatory domain (CTM), which allows them to activate at even more negative potentials than C-terminally long-splice variants. It is at present unclear whether this is due to an increased voltage sensitivity of the Cav1.3 voltage-sensing domain, or an enhanced coupling of voltage-sensor conformational changes to the subsequent opening of the activation gate. We studied the voltage-dependence of voltage-sensor charge movement (QON-V) and of current activation (ICa-V) of the long (Cav1.3L) and a short Cav1.3 splice variant (Cav1.342A) expressed in tsA-201 cells using whole cell patch-clamp. Charge movement (QON) of Cav1.3L displayed a much steeper voltage-dependence and a more negative half-maximal activation voltage than Cav1.2 and Cav3.1. However, a significantly higher fraction of the total charge had to move for activation of Cav1.3 half-maximal conductance (Cav1.3: 68%; Cav1.2: 52%; Cav3.1: 22%). This indicated a weaker coupling of Cav1.3 voltage-sensor charge movement to pore opening. However, the coupling efficiency was strengthened in the absence of the CTM in Cav1.342A, thereby shifting ICa-V by 7.2 mV to potentials that were more negative without changing QON-V. We independently show that the presence of intracellular organic cations (such as n-methyl-D-glucamine) induces a pronounced negative shift of QON-V and a more negative activation of ICa-V of all three channels. These findings illustrate that the voltage sensors of Cav1.3 channels respond more sensitively to depolarization than those of Cav1.2 or Cav3.1. Weak coupling of voltage sensing to pore opening is enhanced in the absence of the CTM, allowing short Cav1.342A splice variants to activate at lower voltages without affecting QON-V. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

Insulation Resistance and Leakage Currents in Low-Voltage Ceramic Capacitors with Cracks

NASA Technical Reports Server (NTRS)

Teverovsky, Alexander A.

2014-01-01

Measurement of insulation resistance (IR) in multilayer ceramic capacitors (MLCCs) is considered a screening technique that ensures the dielectric is defect-free. This work analyzes the effectiveness of this technique for revealing cracks in ceramic capacitors. It is shown that absorption currents prevail over the intrinsic leakage currents during standard IR measurements at room temperature. Absorption currents, and consequently IR, have a weak temperature dependence, increase linearly with voltage (before saturation), and are not sensitive to the presence of mechanical defects. In contrary, intrinsic leakage currents increase super-linearly with voltage and exponentially with temperature (activation energy is in the range from 0.6 eV to 1.1 eV). Leakage currents associated with the presence of cracks have a weaker dependence on temperature and voltage compared to the intrinsic leakage currents. For this reason, intrinsic leakage currents prevail at high temperatures and voltages, thus masking the presence of defects.

Insulation Resistance and Leakage Currents in Low-Voltage Ceramic Capacitors with Cracks

NASA Technical Reports Server (NTRS)

Teverovsky, Alexander A.

2016-01-01

Measurement of insulation resistance (IR) in multilayer ceramic capacitors (MLCCs) is considered a screening technique that ensures the dielectric is defect-free. This work analyzes the effectiveness of this technique for revealing cracks in ceramic capacitors. It is shown that absorption currents prevail over the intrinsic leakage currents during standard IR measurements at room temperature. Absorption currents, and consequently IR, have a weak temperature dependence, increase linearly with voltage (before saturation), and are not sensitive to the presence of mechanical defects. In contrary, intrinsic leakage currents increase super-linearly with voltage and exponentially with temperature (activation energy is in the range from 0.6 eV to 1.1 eV). Leakage currents associated with the presence of cracks have a weaker dependence on temperature and voltage compared to the intrinsic leakage currents. For this reason, intrinsic leakage currents prevail at high temperatures and voltages, thus masking the presence of defects.

Absorption Voltages and Insulation Resistance in Ceramic Capacitors with Cracks

NASA Technical Reports Server (NTRS)

Teverovsky, Alexander

2016-01-01

Time dependence of absorption voltages (Vabs) in different types of low-voltage X5R and X7R ceramic capacitors was monitored for a maximum duration of hundred hours after polarization. To evaluate the effect of mechanical defects on Vabs, cracks in the dielectric were introduced either mechanically or by thermal shock. The maximum absorption voltage, time to roll-off, and the rate of voltage decrease are shown to depend on the crack-related leakage currents and insulation resistance in the parts. A simple model that is based on the Dow equivalent circuit for capacitors with absorption has been developed to assess the insulation resistance of capacitors. Standard measurements of the insulation resistance, contrary to the measurements based on Vabs, are not sensitive to the presence of mechanical defects and fail to reveal capacitors with cracks. Index Terms: Ceramic capacitor, insulation resistance, dielectric absorption, cracking.

Absorption Voltages and Insulation Resistance in Ceramic Capacitors with Cracks

NASA Technical Reports Server (NTRS)

Teverovsky, Alexander

2014-01-01

Time dependence of absorption voltages (V(sub abs)) in different types of low-voltage X5R and X7R ceramic capacitors was monitored for a maximum duration of hundred hours after polarization. To evaluate the effect of mechanical defects on V(sub abs)), cracks in the dielectric were introduced either mechanically or by thermal shock. The maximum absorption voltage, time to roll-off, and the rate of voltage decrease are shown to depend on the crack-related leakage currents and insulation resistance in the parts. A simple model that is based on the Dow equivalent circuit for capacitors with absorption has been developed to assess the insulation resistance of capacitors. Standard measurements of the insulation resistance, contrary to the measurements based on V(sub abs)), are not sensitive to the presence of mechanical defects and fail to reveal capacitors with cracks.

Structural mechanism of voltage-dependent gating in an isolated voltage-sensing domain.

PubMed

Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos A; Hulse, Raymond E; Roux, Benoît; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo

2014-03-01

The transduction of transmembrane electric fields into protein motion has an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSDs) carry out these functions through reorientations of positive charges in the S4 helix. Here, we determined crystal structures of the Ciona intestinalis VSD (Ci-VSD) in putatively active and resting conformations. S4 undergoes an ~5-Å displacement along its main axis, accompanied by an ~60° rotation. This movement is stabilized by an exchange in countercharge partners in helices S1 and S3 that generates an estimated net charge transfer of ~1 eo. Gating charges move relative to a ''hydrophobic gasket' that electrically divides intra- and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent enzymes and ion channels.

The voltage-sensing domain of a phosphatase gates the pore of a potassium channel.

PubMed

Arrigoni, Cristina; Schroeder, Indra; Romani, Giulia; Van Etten, James L; Thiel, Gerhard; Moroni, Anna

2013-03-01

The modular architecture of voltage-gated K(+) (Kv) channels suggests that they resulted from the fusion of a voltage-sensing domain (VSD) to a pore module. Here, we show that the VSD of Ciona intestinalis phosphatase (Ci-VSP) fused to the viral channel Kcv creates Kv(Synth1), a functional voltage-gated, outwardly rectifying K(+) channel. Kv(Synth1) displays the summed features of its individual components: pore properties of Kcv (selectivity and filter gating) and voltage dependence of Ci-VSP (V(1/2) = +56 mV; z of ~1), including the depolarization-induced mode shift. The degree of outward rectification of the channel is critically dependent on the length of the linker more than on its amino acid composition. This highlights a mechanistic role of the linker in transmitting the movement of the sensor to the pore and shows that electromechanical coupling can occur without coevolution of the two domains.

The effect of external visible light on the breakdown voltage of a long discharge tube

NASA Astrophysics Data System (ADS)

Shishpanov, A. I.; Ionikh, Yu. Z.; Meshchanov, A. V.

2016-06-01

The breakdown characteristics of a discharge tube with a configuration typical of gas-discharge light sources and electric-discharge lasers (a so-called "long discharge tube") filled with argon or helium at a pressure of 1 Torr have been investigated. A breakdown has been implemented using positive and negative voltage pulses with a linear leading edge having a slope dU/ dt ~ 10-107 V/s. Visible light from an external source (halogen incandescent lamp) is found to affect the breakdown characteristics. The dependences of the dynamic breakdown voltage of the tube on dU/ dt and on the incident light intensity are measured. The breakdown voltage is found to decrease under irradiation of the high-voltage anode of the tube in a wide range of dU/ dt. A dependence of the effect magnitude on the light intensity and spectrum is obtained. Possible physical mechanisms of this phenomenon are discussed.

Gating by Cyclic Gmp and Voltage in the α Subunit of the Cyclic Gmp–Gated Channel from Rod Photoreceptors

PubMed Central

Benndorf, Klaus; Koopmann, Rolf; Eismann, Elisabeth; Kaupp, U. Benjamin

1999-01-01

Gating by cGMP and voltage of the α subunit of the cGMP-gated channel from rod photoreceptor was examined with a patch-clamp technique. The channels were expressed in Xenopus oocytes. At low [cGMP] (<20 μM), the current displayed strong outward rectification. At low and high (700 μM) [cGMP], the channel activity was dominated by only one conductance level. Therefore, the outward rectification at low [cGMP] results solely from an increase in the open probability, P o. Kinetic analysis of single-channel openings revealed two exponential distributions. At low [cGMP], the larger P o at positive voltages with respect to negative voltages is caused by an increased frequency of openings in both components of the open-time distribution. In macroscopic currents, depolarizing voltage steps, starting from −100 mV, generated a time-dependent current that increased with the step size (activation). At low [cGMP] (20 μM), the degree of activation was large and the time course was slow, whereas at saturating [cGMP] (7 mM) the respective changes were small and fast. The dose–response relation at −100 mV was shifted to the right and saturated at significantly lower P o values with respect to that at +100 mV (0.77 vs. 0.96). P o was determined as function of the [cGMP] (at +100 and −100 mV) and voltage (at 20, 70, and 700 μM, and 7 mM cGMP). Both relations could be fitted with an allosteric state model consisting of four independent cGMP-binding reactions and one voltage-dependent allosteric opening reaction. At saturating [cGMP] (7 mM), the activation time course was monoexponential, which allowed us to determine the individual rate constants for the allosteric reaction. For the rapid rate constants of cGMP binding and unbinding, lower limits are determined. It is concluded that an allosteric model consisting of four independent cGMP-binding reactions and one voltage-dependent allosteric reaction, describes the cGMP- and voltage-dependent gating of cGMP-gated channels adequately. PMID:10498668

Alcohol modulation of BK channel gating depends on β subunit composition

PubMed Central

Kuntamallappanavar, Guruprasad

2016-01-01

In most mammalian tissues, Ca2+i/voltage-gated, large conductance K+ (BK) channels consist of channel-forming slo1 and auxiliary (β1–β4) subunits. When Ca2+i (3–20 µM) reaches the vicinity of BK channels and increases their activity at physiological voltages, β1- and β4-containing BK channels are, respectively, inhibited and potentiated by intoxicating levels of ethanol (50 mM). Previous studies using different slo1s, lipid environments, and Ca2+i concentrations—all determinants of the BK response to ethanol—made it impossible to determine the specific contribution of β subunits to ethanol action on BK activity. Furthermore, these studies measured ethanol action on ionic current under a limited range of stimuli, rendering no information on the gating processes targeted by alcohol and their regulation by βs. Here, we used identical experimental conditions to obtain single-channel and macroscopic currents of the same slo1 channel (“cbv1” from rat cerebral artery myocytes) in the presence and absence of 50 mM ethanol. First, we assessed the role five different β subunits (1,2,2-IR, 3-variant d, and 4) in ethanol action on channel function. Thus, two phenotypes were identified: (1) ethanol potentiated cbv1-, cbv1+β3-, and cbv1+β4-mediated currents at low Ca2+i while inhibiting current at high Ca2+i, the potentiation–inhibition crossover occurring at 20 µM Ca2+i; (2) for cbv1+β1, cbv1+wt β2, and cbv1+β2-IR, this crossover was shifted to ∼3 µM Ca2+i. Second, applying Horrigan–Aldrich gating analysis on both phenotypes, we show that ethanol fails to modify intrinsic gating and the voltage-dependent parameters under examination. For cbv1, however, ethanol (a) drastically increases the channel’s apparent Ca2+ affinity (nine-times decrease in Kd) and (b) very mildly decreases allosteric coupling between Ca2+ binding and channel opening (C). The decreased Kd leads to increased channel activity. For cbv1+β1, ethanol (a) also decreases Kd, yet this decrease (two times) is much smaller than that of cbv1; (b) reduces C; and (c) decreases coupling between Ca2+ binding and voltage sensing (parameter E). Decreased allosteric coupling leads to diminished BK activity. Thus, we have identified critical gating modifications that lead to the differential actions of ethanol on slo1 with and without different β subunits. PMID:27799321

Characteristics of arc currents on a negatively biased solar cell array in a plasma

NASA Technical Reports Server (NTRS)

Snyder, D. B.

1984-01-01

The time dependence of the emitted currents during arcing on solar cell arrays is being studied. The arcs are characterized using three parameters: the voltage change of the array during the arc (i.e., the charge lost), the peak current during the arc, and the time constant describing the arc current. This paper reports the dependence of these characteristics on two array parameters, the interconnect bias voltage and the array capacitance to ground. It was found that the voltage change of the array during an arc is nearly equal to the bias voltage. The array capacitance, on the other hand, influences both the peak current and the decay time constant of the arc. Both of these characteristics increase with increasing capacitance.

Flicker Vision of Selected Light Sources

NASA Astrophysics Data System (ADS)

Otomański, Przemysław; Wiczyński, Grzegorz; Zając, Bartosz

2017-10-01

The results of the laboratory research concerning a dependence of flicker vision on voltage fluctuations are presented in the paper. The research was realized on a designed measuring stand, which included an examined light source, a voltage generator with amplitude modulation supplying the light source and a positioning system of the observer with respect to the observed surface. In this research, the following light sources were used: one incandescent lamp and four LED luminaires by different producers. The research results formulate a conclusion concerning the description of the influence of voltage fluctuations on flicker viewing for selected light sources. The research results indicate that LED luminaires are less susceptible to voltage fluctuations than incandescent bulbs and that flicker vision strongly depends on the type of LED source.

The drift-diffusion interpretation of the electron current within the organic semiconductor characterized by the bulk single energy trap level

NASA Astrophysics Data System (ADS)

Cvikl, B.

2010-01-01

The closed solution for the internal electric field and the total charge density derived in the drift-diffusion approximation for the model of a single layer organic semiconductor structure characterized by the bulk shallow single trap-charge energy level is presented. The solutions for two examples of electric field boundary conditions are tested on room temperature current density-voltage data of the electron conducting aluminum/tris(8-hydroxyquinoline aluminum/calcium structure [W. Brütting et al., Synth. Met. 122, 99 (2001)] for which jexp∝Va3.4, within the interval of bias 0.4 V≤Va≤7. In each case investigated the apparent electron mobility determined at given bias is distributed within a given, finite interval of values. The bias dependence of the logarithm of their lower limit, i.e., their minimum values, is found to be in each case, to a good approximation, proportional to the square root of the applied electric field. On account of the bias dependence as incorporated in the minimum value of the apparent electron mobility the spatial distribution of the organic bulk electric field as well as the total charge density turn out to be bias independent. The first case investigated is based on the boundary condition of zero electric field at the electron injection interface. It is shown that for minimum valued apparent mobilities, the strong but finite accumulation of electrons close to the anode is obtained, which characterize the inverted space charge limited current (SCLC) effect. The second example refers to the internal electric field allowing for self-adjustment of its boundary values. The total electron charge density is than found typically to be of U shape, which may, depending on the parameters, peak at both or at either Alq3 boundary. It is this example in which the proper SCLC effect is consequently predicted. In each of the above two cases, the calculations predict the minimum values of the electron apparent mobility, which substantially exceed the corresponding published measurements. For this reason the effect of the drift term alone is additionally investigated. On the basis of the published empirical electron mobilities and the diffusion term revoked, it is shown that the steady state electron current density within the Al/Alq3 (97 nm)/Ca single layer organic structure may well be pictured within the drift-only interpretation of the charge carriers within the Alq3 organic characterized by the single (shallow) trap energy level. In order to arrive at this result, it is necessary that the nonzero electric field, calculated to exist at the electron injecting Alq3/Ca boundary, is to be appropriately accounted for in the computation.

Myosin light chain kinase controls voltage-dependent calcium channels in vascular smooth muscle.

PubMed

Martinsen, A; Schakman, O; Yerna, X; Dessy, C; Morel, N

2014-07-01

The Ca(2+)-dependent kinase myosin light chain kinase (MLCK) is the activator of smooth muscle contraction. In addition, it has been reported to be involved in Ca(2+) channel regulation in cultured cells, and we previously showed that the MLCK inhibitor ML-7 decreases arginine vasopressin (AVP)-induced Ca(2+) influx in rat aorta. This study was designed to investigate whether MLCK is involved in Ca(2+) regulation in resistance artery smooth muscle cell, which plays a major role in the control of blood pressure. As ML compounds were shown to have off-target effects, MLCK was downregulated by transfection with a small interfering RNA targeting MLCK (MLCK-siRNA) in rat small resistance mesenteric artery (RMA) and in the rat embryonic aortic cell line A7r5. Noradrenaline-induced contraction and Ca(2+) signal were significantly depressed in MLCK-siRNA compared to scramble-siRNA-transfected RMA. Contraction and Ca(2+) signal induced by high KCl and voltage-activated Ca(2+) current were also significantly decreased in MLCK-siRNA-transfected RMA, suggesting that MLCK depletion modifies voltage-operated Ca(2+) channels. KCl- and AVP-induced Ca(2+) signals and voltage-activated Ca(2+) current were decreased in MLCK-depleted A7r5 cells. Eventually, real-time quantitative PCR analysis indicated that in A7r5, MLCK controlled mRNA expression of CaV1.2 (L-type) and CaV3.1 (T-type) voltage-dependent Ca(2+) channels. Our results suggest that MLCK controls the transcription of voltage-dependent Ca(2+) channels in vascular smooth muscle cells.

Modulation of BK channel voltage gating by different auxiliary β subunits

PubMed Central

Contreras, Gustavo F.; Neely, Alan; Alvarez, Osvaldo; Gonzalez, Carlos; Latorre, Ramon

2012-01-01

Calcium- and voltage-activated potassium channels (BK) are regulated by a multiplicity of signals. The prevailing view is that different BK gating mechanisms converge to determine channel opening and that these gating mechanisms are allosterically coupled. In most instances the pore forming α subunit of BK is associated with one of four alternative β subunits that appear to target specific gating mechanisms to regulate the channel activity. In particular, β1 stabilizes the active configuration of the BK voltage sensor having a large effect on BK Ca2+ sensitivity. To determine the extent to which β subunits regulate the BK voltage sensor, we measured gating currents induced by the pore-forming BK α subunit alone and with the different β subunits expressed in Xenopus oocytes (β1, β2IR, β3b, and β4). We found that β1, β2, and β4 stabilize the BK voltage sensor in the active conformation. β3 has no effect on voltage sensor equilibrium. In addition, β4 decreases the apparent number of charges per voltage sensor. The decrease in the charge associated with the voltage sensor in α β4 channels explains most of their biophysical properties. For channels composed of the α subunit alone, gating charge increases slowly with pulse duration as expected if a significant fraction of this charge develops with a time course comparable to that of K+ current activation. In the presence of β1, β2, and β4 this slow component develops in advance of and much more rapidly than ion current activation, suggesting that BK channel opening proceeds in two steps. PMID:23112204

Noise and current-voltage characterization of complementary heterojunction field-effect transistor (CHFET) structures below 8 K

NASA Technical Reports Server (NTRS)

Cunningham, Thomas J.; Fossum, Eric R.; Baier, Steven M.

1992-01-01

Noise and current-voltage characterization of complementary heterojunction field-effect transistor (CHFET) structures below 8 K are presented. It is shown that the CHFET exhibits normal transistor operation down to 6 K. Some of the details of the transistor operation, such as the gate-voltage dependence of the channel potential, are analyzed. The gate current is examined and is shown to be due to several mechanisms acting in parallel. These include field-emission and thermionic-field-emission, conduction through a temperature-activated resistance, and thermionic emission. The input referred noise for n-channel CHFETs is presented and discussed. The noise has the spectral dependence of 1/f noise, but does not exhibit the usual area dependence.

Measurement and statistical analysis of single-molecule current-voltage characteristics, transition voltage spectroscopy, and tunneling barrier height.

PubMed

Guo, Shaoyin; Hihath, Joshua; Díez-Pérez, Ismael; Tao, Nongjian

2011-11-30

We report on the measurement and statistical study of thousands of current-voltage characteristics and transition voltage spectra (TVS) of single-molecule junctions with different contact geometries that are rapidly acquired using a new break junction method at room temperature. This capability allows one to obtain current-voltage, conductance voltage, and transition voltage histograms, thus adding a new dimension to the previous conductance histogram analysis at a fixed low-bias voltage for single molecules. This method confirms the low-bias conductance values of alkanedithiols and biphenyldithiol reported in literature. However, at high biases the current shows large nonlinearity and asymmetry, and TVS allows for the determination of a critically important parameter, the tunneling barrier height or energy level alignment between the molecule and the electrodes of single-molecule junctions. The energy level alignment is found to depend on the molecule and also on the contact geometry, revealing the role of contact geometry in both the contact resistance and energy level alignment of a molecular junction. Detailed statistical analysis further reveals that, despite the dependence of the energy level alignment on contact geometry, the variation in single-molecule conductance is primarily due to contact resistance rather than variations in the energy level alignment.

Formation and characterization of microcrystalline semiconductor particles on bilayer lipid membranes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Baral, S.; Zhao, X.K.; Rolandi, R.

Microcrystalline cadmium, indium, copper, and zinc sulfides were generated in situ on the surface of bilayer lipid membranes (BLMs) prepared from bovine-brain phosphatidylserine (PS), glyceryl monooleate (GMO), and a synthetic, polymerizable surfactant (n-C/sub 15/H/sub 31/CO/sub 2/(CH/sub 2/)/sub 2/)/sub 2/N/sup +/(CH/sub 3/)CH/sub 2/C/sub 6/H/sub 4/CH double bond CH/sub 2/, Cl/sup -/ (STYRS). Semiconductor-containing BLMs remained stable for days. Semiconductor formation on the BLM surface was monitored by optical microscopy, voltage-dependent capacitance measurements, and absorption and intracavity-laser-absorption spectroscopy. Band gap excitation of GMO- BLM-incorporated CdS resulted in the development of photovoltage. Irradiation of CdS incorporated into BLMs formed from STYRS (using amore » 350-nm cutoff filter) led to absorption losses due to the styrene moiety in the surfactant. Apparently, CdS sensitized the photopolymerization of STRYS BLMs.« less

Determination of intrinsic mobility of a bilayer oxide thin-film transistor by pulsed I-V method

NASA Astrophysics Data System (ADS)

Woo, Hyunsuk; Kim, Taeho; Hur, Jihyun; Jeon, Sanghun

2017-04-01

Amorphous oxide semiconductor thin-film transistors (TFT) have been considered as outstanding switch devices owing to their high mobility. However, because of their amorphous channel material with a certain level of density of states, a fast transient charging effect in an oxide TFT occurs, leading to an underestimation of the mobility value. In this paper, the effects of the fast charging of high-performance bilayer oxide semiconductor TFTs on mobility are examined in order to determine an accurate mobility extraction method. In addition, an approach based on a pulse I D -V G measurement method is proposed to determine the intrinsic mobility value. Even with the short pulse I D -V G measurement, a certain level of fast transient charge trapping cannot be avoided as long as the charge-trap start time is shorter than the pulse rising time. Using a pulse-amplitude-dependent threshold voltage characterization method, we estimated a correction factor for the apparent mobility, thus allowing us to determine the intrinsic mobility.

Modulated CH3NH3PbI3−xBrx film for efficient perovskite solar cells exceeding 18%

PubMed Central

Tu, Yongguang; Wu, Jihuai; Lan, Zhang; He, Xin; Dong, Jia; Jia, Jinbiao; Guo, Panfeng; Lin, Jianming; Huang, Miaoliang; Huang, Yunfang

2017-01-01

The organic-inorganic lead halide perovskite layer is a crucial factor for the high performance perovskite solar cell (PSC). We introduce CH3NH3Br in the precursor solution to prepare CH3NH3PbI3−xBrx hybrid perovskite, and an uniform perovskite layer with improved crystallinity and apparent grain contour is obtained, resulting in the significant improvement of photovoltaic performance of PSCs. The effects of CH3NH3Br on the perovskite morphology, crystallinity, absorption property, charge carrier dynamics and device characteristics are discussed, and the improvement of open circuit voltage of the device depended on Br doping is confirmed. Based on above, the device based on CH3NH3PbI2.86Br0.14 exhibits a champion power conversion efficiency (PCE) of 18.02%. This study represents an efficient method for high-performance perovskite solar cell by modulating CH3NH3PbI3−xBrx film. PMID:28303938

Delayed rectifier K channels contribute to contrast adaptation in mammalian retinal ganglion cells

PubMed Central

Weick, Michael; Demb, Jonathan B.

2011-01-01

SUMMARY Retinal ganglion cells adapt by reducing their sensitivity during periods of high contrast. Contrast adaptation in the firing response depends on both presynaptic and intrinsic mechanisms. Here, we investigated intrinsic mechanisms for contrast adaptation in OFF Alpha ganglion cells in the in vitro guinea pig retina. Using either visual stimulation or current injection, we show that brief depolarization evoked spiking and suppressed firing during subsequent depolarization. The suppression could be explained by Na channel inactivation, as shown in salamander cells. However, brief hyperpolarization in the physiological range (5–10 mV) also suppressed firing during subsequent depolarization. This suppression was sensitive selectively to blockers of delayed-rectifier K channels (KDR). Somatic membrane patches showed TEA-sensitive KDR currents with activation near −25 mV and removal of inactivation at voltages negative to Vrest. Brief periods of hyperpolarization apparently remove KDR inactivation and thereby increase the channel pool available to suppress excitability during subsequent depolarization. PMID:21745646

Kinetic and functional analysis of transient, persistent and resurgent sodium currents in rat cerebellar granule cells in situ: an electrophysiological and modelling study

PubMed Central

Magistretti, Jacopo; Castelli, Loretta; Forti, Lia; D'Angelo, Egidio

2006-01-01

Cerebellar neurones show complex and differentiated mechanisms of action potential generation that have been proposed to depend on peculiar properties of their voltage-dependent Na+ currents. In this study we analysed voltage-dependent Na+ currents of rat cerebellar granule cells (GCs) by performing whole-cell, patch-clamp experiments in acute rat cerebellar slices. A transient Na+ current (INaT) was always present and had the properties of a typical fast-activating/inactivating Na+ current. In addition to INaT, robust persistent (INaP) and resurgent (INaR) Na+ currents were observed. INaP peaked at ∼−40 mV, showed half-maximal activation at ∼−55 mV, and its maximal amplitude was about 1.5% of that of INaT. INaR was elicited by repolarizing pulses applied following step depolarizations able to activate/inactivate INaT, and showed voltage- and time-dependent activation and voltage-dependent decay kinetics. The conductance underlying INaR showed a bell-shaped voltage dependence, with peak at −35 mV. A significant correlation was found between GC INaR and INaT peak amplitudes; however, GCs expressing INaT of similar size showed marked variability in terms of INaR amplitude, and in a fraction of cells INaR was undetectable. INaT, INaP and INaR could be accounted for by a 13-state kinetic scheme comprising closed, open, inactivated and blocked states. Current-clamp experiments carried out to identify possible functional correlates of INaP and/or INaR revealed that in GCs single action potentials were followed by depolarizing afterpotentials (DAPs). In a majority of cells, DAPs showed properties consistent with INaR playing a role in their generation. Computer modelling showed that INaR promotes DAP generation and enhances high-frequency firing, whereas INaP boosts near-threshold firing activity. Our findings suggest that special properties of voltage-dependent Na+ currents provides GCs with mechanisms suitable for shaping activity patterns, with potentially important consequences for cerebellar information transfer and computation. PMID:16527854

Unfolding of a Temperature-Sensitive Domain Controls Voltage-Gated Channel Activation.

PubMed

Arrigoni, Cristina; Rohaim, Ahmed; Shaya, David; Findeisen, Felix; Stein, Richard A; Nurva, Shailika Reddy; Mishra, Smriti; Mchaourab, Hassane S; Minor, Daniel L

2016-02-25

Voltage-gated ion channels (VGICs) are outfitted with diverse cytoplasmic domains that impact function. To examine how such elements may affect VGIC behavior, we addressed how the bacterial voltage-gated sodium channel (BacNa(V)) C-terminal cytoplasmic domain (CTD) affects function. Our studies show that the BacNa(V) CTD exerts a profound influence on gating through a temperature-dependent unfolding transition in a discrete cytoplasmic domain, the neck domain, proximal to the pore. Structural and functional studies establish that the BacNa(V) CTD comprises a bi-partite four-helix bundle that bears an unusual hydrophilic core whose integrity is central to the unfolding mechanism and that couples directly to the channel activation gate. Together, our findings define a general principle for how the widespread four-helix bundle cytoplasmic domain architecture can control VGIC responses, uncover a mechanism underlying the diverse BacNa(V) voltage dependencies, and demonstrate that a discrete domain can encode the temperature-dependent response of a channel. Copyright © 2016 Elsevier Inc. All rights reserved.

Unfolding of a temperature-sensitive domain controls voltage-gated channel activation

PubMed Central

Arrigoni, Cristina; Rohaim, Ahmed; Shaya, David; Findeisen, Felix; Stein, Richard A.; Nurva, Shailika Reddy; Mishra, Smriti; Mchaourab, Hassane S.; Minor, Daniel L.

2016-01-01

Voltage-gated ion channels (VGICs) are outfitted with diverse cytoplasmic domains that impact function. To examine how such elements may affect VGIC behavior, we addressed how the bacterial voltage-gated sodium channel (BacNaV) C-terminal cytoplasmic domain (CTD) affects function. Our studies show that the BacNaV CTD exerts a profound influence on gating through a temperature-dependent unfolding transition in a discrete cytoplasmic domain, the neck domain, proximal to the pore. Structural and functional studies establish that the BacNaV CTD comprises a bi-partite four-helix bundle that bears an unusual hydrophilic core whose integrity is central to the unfolding mechanism and that couples directly to the channel activation gate. Together, our findings define a general principle for how the widespread four-helix bundle cytoplasmic domain architecture can control VGIC responses, uncover a mechanism underlying the diverse BacNaV voltage dependencies, and demonstrate that a discrete domain can encode the temperature dependent response of a channel. PMID:26919429

Abnormal bias dependence of magnetoresistance in CoFeB/MgO/Si spin-injection tunnel contacts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Park, June-Young; Park, Byong-Guk, E-mail: bgpark@kaist.ac.kr; Baek, Seung-heon Chris

We report a strong bias voltage dependence of magnetoresistance (MR) in CoFeB/MgO/Si spin-injection tunnel contacts using the three-terminal Hanle geometry. When a bias voltage is relatively large, the MR is composed of two characteristic signals: a conventional Hanle signal observed at a low magnetic field, which is due to the precession of injected spins, and another signal originating from the rotation of the magnetization at a larger magnetic field. In contrast, for a small bias voltage, additional signals appear at a wide range of magnetic fields, which occasionally overwhelms the conventional Hanle signals. Because the additional signals are pronounced atmore » a low bias and are significantly reduced by annealing at moderate temperatures, they can be attributed to multi-step tunneling via defect states at the interfaces or tunnel barrier. Our results demonstrate that the spin injection signal caused by the defect states can be evaluated by its bias voltage dependence.« less

Doping dependence of laser-induced transverse thermoelectric voltages in the perovskite Nd2- x Ce x CuO4 thin films

NASA Astrophysics Data System (ADS)

Xiong, Fei; Zhang, Hui; Yang, Sheng'an; Li, Dongqi; Zhang, Zheng; Chen, Qingming

2015-08-01

Large laser-induced thermoelectric voltages (LITVs) are measured in the electron-doped Nd2- x Ce x CuO4 thin films grown on the vicinal-cut SrTiO3 substrates by pulsed laser deposition. The dependence of LITV signals upon the doping carrier density is investigated by changing the Ce content of the films. The optimum Ce dopant corresponding to the largest voltage is found and is attributed to the two-dimensional transport behaviors of the localized electrons. The shorter laser irradiation always induces the larger voltage signals in samples with richer Ce content, suggesting the optimum dopant level is sensitive to the wavelength of excitation source. Thus, the behaviors of LITV signals are resulted from both effects of the anisotropic thermoelectric transport and the optical properties of the thin films. The doping dependence related with an anisotropic charge transport may come from the change in carrier density and the modification in energy band configuration.

Cytoplasmic Domains and Voltage-Dependent Potassium Channel Gating

PubMed Central

Barros, Francisco; Domínguez, Pedro; de la Peña, Pilar

2012-01-01

The basic architecture of the voltage-dependent K+ channels (Kv channels) corresponds to a transmembrane protein core in which the permeation pore, the voltage-sensing components and the gating machinery (cytoplasmic facing gate and sensor–gate coupler) reside. Usually, large protein tails are attached to this core, hanging toward the inside of the cell. These cytoplasmic regions are essential for normal channel function and, due to their accessibility to the cytoplasmic environment, constitute obvious targets for cell-physiological control of channel behavior. Here we review the present knowledge about the molecular organization of these intracellular channel regions and their role in both setting and controlling Kv voltage-dependent gating properties. This includes the influence that they exert on Kv rapid/N-type inactivation and on activation/deactivation gating of Shaker-like and eag-type Kv channels. Some illustrative examples about the relevance of these cytoplasmic domains determining the possibilities for modulation of Kv channel gating by cellular components are also considered. PMID:22470342

A Novel Voltage Sensor in the Orthosteric Binding Site of the M2 Muscarinic Receptor.

PubMed

Barchad-Avitzur, Ofra; Priest, Michael F; Dekel, Noa; Bezanilla, Francisco; Parnas, Hanna; Ben-Chaim, Yair

2016-10-04

G protein-coupled receptors (GPCRs) mediate many signal transduction processes in the body. The discovery that these receptors are voltage-sensitive has changed our understanding of their behavior. The M2 muscarinic acetylcholine receptor (M2R) was found to exhibit depolarization-induced charge movement-associated currents, implying that this prototypical GPCR possesses a voltage sensor. However, the typical domain that serves as a voltage sensor in voltage-gated channels is not present in GPCRs, making the search for the voltage sensor in the latter challenging. Here, we examine the M2R and describe a voltage sensor that is comprised of tyrosine residues. This voltage sensor is crucial for the voltage dependence of agonist binding to the receptor. The tyrosine-based voltage sensor discovered here constitutes a noncanonical by which membrane proteins may sense voltage. Copyright © 2016 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Two distinct voltage-sensing domains control voltage sensitivity and kinetics of current activation in CaV1.1 calcium channels.

PubMed

Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred; Flucher, Bernhard E

2016-06-01

Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3-S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3-S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3-S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3-S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3-S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms within the IV and I VSDs, respectively. © 2016 Tuluc et al.

Two distinct voltage-sensing domains control voltage sensitivity and kinetics of current activation in CaV1.1 calcium channels

PubMed Central

Tuluc, Petronel; Benedetti, Bruno; Coste de Bagneaux, Pierre; Grabner, Manfred

2016-01-01

Alternative splicing of the skeletal muscle CaV1.1 voltage-gated calcium channel gives rise to two channel variants with very different gating properties. The currents of both channels activate slowly; however, insertion of exon 29 in the adult splice variant CaV1.1a causes an ∼30-mV right shift in the voltage dependence of activation. Existing evidence suggests that the S3–S4 linker in repeat IV (containing exon 29) regulates voltage sensitivity in this voltage-sensing domain (VSD) by modulating interactions between the adjacent transmembrane segments IVS3 and IVS4. However, activation kinetics are thought to be determined by corresponding structures in repeat I. Here, we use patch-clamp analysis of dysgenic (CaV1.1 null) myotubes reconstituted with CaV1.1 mutants and chimeras to identify the specific roles of these regions in regulating channel gating properties. Using site-directed mutagenesis, we demonstrate that the structure and/or hydrophobicity of the IVS3–S4 linker is critical for regulating voltage sensitivity in the IV VSD, but by itself cannot modulate voltage sensitivity in the I VSD. Swapping sequence domains between the I and the IV VSDs reveals that IVS4 plus the IVS3–S4 linker is sufficient to confer CaV1.1a-like voltage dependence to the I VSD and that the IS3–S4 linker plus IS4 is sufficient to transfer CaV1.1e-like voltage dependence to the IV VSD. Any mismatch of transmembrane helices S3 and S4 from the I and IV VSDs causes a right shift of voltage sensitivity, indicating that regulation of voltage sensitivity by the IVS3–S4 linker requires specific interaction of IVS4 with its corresponding IVS3 segment. In contrast, slow current kinetics are perturbed by any heterologous sequences inserted into the I VSD and cannot be transferred by moving VSD I sequences to VSD IV. Thus, CaV1.1 calcium channels are organized in a modular manner, and control of voltage sensitivity and activation kinetics is accomplished by specific molecular mechanisms within the IV and I VSDs, respectively. PMID:27185857

A common pathway for charge transport through voltage-sensing domains.

PubMed

Chanda, Baron; Bezanilla, Francisco

2008-02-07

Voltage-gated ion channels derive their voltage sensitivity from the movement of specific charged residues in response to a change in transmembrane potential. Several studies on mechanisms of voltage sensing in ion channels support the idea that these gating charges move through a well-defined permeation pathway. This gating pathway in a voltage-gated ion channel can also be mutated to transport free cations, including protons. The recent discovery of proton channels with sequence homology to the voltage-sensing domains suggests that evolution has perhaps exploited the same gating pathway to generate a bona fide voltage-dependent proton transporter. Here we will discuss implications of these findings on the mechanisms underlying charge (and ion) transport by voltage-sensing domains.

Hysteresis in voltage-gated channels

PubMed Central

2017-01-01

ABSTRACT Ion channels constitute a superfamily of membrane proteins found in all living creatures. Their activity allows fast translocation of ions across the plasma membrane down the ion's transmembrane electrochemical gradient, resulting in a difference in electrical potential across the plasma membrane, known as the membrane potential. A group within this superfamily, namely voltage-gated channels, displays activity that is sensitive to the membrane potential. The activity of voltage-gated channels is controlled by the membrane potential, while the membrane potential is changed by these channels' activity. This interplay produces variations in the membrane potential that have evolved into electrical signals in many organisms. These signals are essential for numerous biological processes, including neuronal activity, insulin release, muscle contraction, fertilization and many others. In recent years, the activity of the voltage-gated channels has been observed not to follow a simple relationship with the membrane potential. Instead, it has been shown that the activity of voltage-gated channel displays hysteresis. In fact, a growing number of evidence have demonstrated that the voltage dependence of channel activity is dynamically modulated by activity itself. In spite of the great impact that this property can have on electrical signaling, hysteresis in voltage-gated channels is often overlooked. Addressing this issue, this review provides examples of voltage-gated ion channels displaying hysteretic behavior. Further, this review will discuss how Dynamic Voltage Dependence in voltage-gated channels can have a physiological role in electrical signaling. Furthermore, this review will elaborate on the current thoughts on the mechanism underlying hysteresis in voltage-gated channels. PMID:27689426

Development of a voltage-dependent current noise algorithm for conductance-based stochastic modelling of auditory nerve fibres.

PubMed

Badenhorst, Werner; Hanekom, Tania; Hanekom, Johan J

2016-12-01

This study presents the development of an alternative noise current term and novel voltage-dependent current noise algorithm for conductance-based stochastic auditory nerve fibre (ANF) models. ANFs are known to have significant variance in threshold stimulus which affects temporal characteristics such as latency. This variance is primarily caused by the stochastic behaviour or microscopic fluctuations of the node of Ranvier's voltage-dependent sodium channels of which the intensity is a function of membrane voltage. Though easy to implement and low in computational cost, existing current noise models have two deficiencies: it is independent of membrane voltage, and it is unable to inherently determine the noise intensity required to produce in vivo measured discharge probability functions. The proposed algorithm overcomes these deficiencies while maintaining its low computational cost and ease of implementation compared to other conductance and Markovian-based stochastic models. The algorithm is applied to a Hodgkin-Huxley-based compartmental cat ANF model and validated via comparison of the threshold probability and latency distributions to measured cat ANF data. Simulation results show the algorithm's adherence to in vivo stochastic fibre characteristics such as an exponential relationship between the membrane noise and transmembrane voltage, a negative linear relationship between the log of the relative spread of the discharge probability and the log of the fibre diameter and a decrease in latency with an increase in stimulus intensity.

Zero-bias offsets in I-V characteristics of the staircase type quantum well infrared photodetectors

NASA Astrophysics Data System (ADS)

Nutku, Ferhat; Erol, Ayse; Arikan, M. Cetin; Ergun, Yuksel

2014-11-01

In this work, observed zero-bias offsets in I-V characteristics and differences in J-V characteristics of staircase quantum well infrared photodetectors were investigated. Temperature and voltage sweep rate dependence of the zero-bias offsets were studied on mesa structures shaped in different diameters. Furthermore, effect of mesa diameter on J-V characteristics was investigated. The temperature, initial bias voltage and voltage sweep rate dependence of the zero-bias offsets were explained by a qualitative model, which is based on a RC equivalent circuit of the quantum well infrared photodetector.

Extracellular protons enable activation of the calcium-dependent chloride channel TMEM16A.

PubMed

Cruz-Rangel, Silvia; De Jesús-Pérez, José J; Aréchiga-Figueroa, Iván A; Rodríguez-Menchaca, Aldo A; Pérez-Cornejo, Patricia; Hartzell, H Criss; Arreola, Jorge

2017-03-01

The calcium-activated chloride channel TMEM16A provides a pathway for chloride ion movements that are key in preventing polyspermy, allowing fluid secretion, controlling blood pressure, and enabling gastrointestinal activity. TMEM16A is opened by voltage-dependent calcium binding and regulated by permeant anions and intracellular protons. Here we show that a low proton concentration reduces TMEM16A activity while maximum activation is obtained when the external proton concentration is high. In addition, protonation conditions determine the open probability of TMEM16A without changing its calcium sensitivity. External glutamic acid 623 (E623) is key for TMEM16A's ability to respond to external protons. At physiological pH, E623 is un-protonated and TMEM16A is activated when intracellular calcium increases; however, under acidic conditions E623 is partially protonated and works synergistically with intracellular calcium to activate the channel. These findings are critical for understanding physiological and pathological processes that involve changes in pH and chloride flux via TMEM16A. Transmembrane protein 16A (TMEM16A), also known as ANO1, the pore-forming subunit of a Ca 2+ -dependent Cl - channel (CaCC), is activated by direct, voltage-dependent, binding of intracellular Ca 2+ . Endogenous CaCCs are regulated by extracellular protons; however, the molecular basis of such regulation remains unidentified. Here, we evaluated the effects of different extracellular proton concentrations ([H + ] o ) on mouse TMEM16A expressed in HEK-293 cells using whole-cell and inside-out patch-clamp recordings. We found that increasing the [H + ] o from 10 -10 to 10 -5.5  m caused a progressive increase in the chloride current (I Cl ) that is described by titration of a protonatable site with pK = 7.3. Protons regulate TMEM16A in a voltage-independent manner, regardless of channel state (open or closed), and without altering its apparent Ca 2+ sensitivity. Noise analysis showed that protons regulate TMEM16A by tuning its open probability without modifying the single channel current. We found a robust reduction of the proton effect at high [Ca 2+ ] i . To identify protonation targets we mutated all extracellular glutamate and histidine residues and 4 of 11 aspartates. Most mutants were sensitive to protons. However, mutation that substituted glutamic acid (E) for glutamine (Q) at amino acid position 623 (E623Q) displayed a titration curve shifted to the left relative to wild type channels and the I Cl was nearly insensitive to proton concentrations between 10 -5.5 and 10 -9.0  m. Additionally, I Cl of the mutant containing an aspartic acid (D) to asparagine (N) substitution at position 405 (D405N) mutant was partially inhibited by a proton concentration of 10 -5.5  m, but 10 -9.0  m produced the same effect as in wild type. Based on our findings we propose that external protons titrate glutamic acid 623, which enables voltage activation of TMEM16A at non-saturating [Ca 2+ ] i . © 2016 The Authors. The Journal of Physiology © 2016 The Physiological Society.

KCNE1 divides the voltage sensor movement in KCNQ1/KCNE1 channels into two steps

NASA Astrophysics Data System (ADS)

Barro-Soria, Rene; Rebolledo, Santiago; Liin, Sara I.; Perez, Marta E.; Sampson, Kevin J.; Kass, Robert S.; Larsson, H. Peter

2014-04-01

The functional properties of KCNQ1 channels are highly dependent on associated KCNE-β subunits. Mutations in KCNQ1 or KCNE subunits can cause congenital channelopathies, such as deafness, cardiac arrhythmias and epilepsy. The mechanism by which KCNE1-β subunits slow the kinetics of KCNQ1 channels is a matter of current controversy. Here we show that KCNQ1/KCNE1 channel activation occurs in two steps: first, mutually independent voltage sensor movements in the four KCNQ1 subunits generate the main gating charge movement and underlie the initial delay in the activation time course of KCNQ1/KCNE1 currents. Second, a slower and concerted conformational change of all four voltage sensors and the gate, which opens the KCNQ1/KCNE1 channel. Our data show that KCNE1 divides the voltage sensor movement into two steps with widely different voltage dependences and kinetics. The two voltage sensor steps in KCNQ1/KCNE1 channels can be pharmacologically isolated and further separated by a disease-causing mutation.

The effects of ion gun beam voltage on the electrical characteristics of NbCN/PbBi edge junctions

NASA Technical Reports Server (NTRS)

Lichtenberger, A. W.; Feldman, M. J.; Mattauch, R. J.; Cukauskas, E. J.

1989-01-01

The authors have succeeded in fabricating high-quality submicron NbCN edge junctions using a technique which is commonly used to make Nb edge junctions. A modified commercial ion gun was used to cut an edge in SiO2/NbCN films partially covered with photoresist. An insulating barrier was then formed on the exposed edge by reactive ion beam oxidation, and a counterelectrode of PbBi was deposited. The electrical quality of the resulting junctions was found to be strongly influenced by the ion beam acceleration voltages used to cut the edge and to oxidize it. For low ion beam voltages, the junction quality parameter was as high as Vm = 55 mV (measured at 3 mV), but higher ion beam voltages yielded strikingly poorer quality junctions. In light of the small coherence length of NbN, the dependence of the electrical characteristics on ion beam voltage is presumably due to mechanical damage of the NbCN surface. In contrast, for similar ion beam voltages, no such dependence was found for Nb edge junctions.

A Non-canonical Voltage-Sensing Mechanism Controls Gating in K2P K(+) Channels.

PubMed

Schewe, Marcus; Nematian-Ardestani, Ehsan; Sun, Han; Musinszki, Marianne; Cordeiro, Sönke; Bucci, Giovanna; de Groot, Bert L; Tucker, Stephen J; Rapedius, Markus; Baukrowitz, Thomas

2016-02-25

Two-pore domain (K2P) K(+) channels are major regulators of excitability that endow cells with an outwardly rectifying background "leak" conductance. In some K2P channels, strong voltage-dependent activation has been observed, but the mechanism remains unresolved because they lack a canonical voltage-sensing domain. Here, we show voltage-dependent gating is common to most K2P channels and that this voltage sensitivity originates from the movement of three to four ions into the high electric field of an inactive selectivity filter. Overall, this ion-flux gating mechanism generates a one-way "check valve" within the filter because outward movement of K(+) induces filter opening, whereas inward movement promotes inactivation. Furthermore, many physiological stimuli switch off this flux gating mode to convert K2P channels into a leak conductance. These findings provide insight into the functional plasticity of a K(+)-selective filter and also refine our understanding of K2P channels and the mechanisms by which ion channels can sense voltage. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

ARC and Melting Efficiency of Plasma ARC Welds

NASA Technical Reports Server (NTRS)

McClure, J. C.; Nunes, A. C.; Evans, D. M.

1999-01-01

A series of partial penetration Variable Polarity Plasma Arc welds were made at equal power but various combinations of current and voltage on 2219 Aluminum. Arc efficiency was measured calorimetrically and ranged between 48% and 66% for the conditions of the welds. Arc efficiency depends in different ways on voltage and current. The voltage effect dominates. Raising voltage while reducing current increases arc efficiency. Longer, higher voltage arcs are thought to transfer a greater portion of arc power to the workpiece through shield gas convection. Melting efficiency depends upon weld pool shape as well as arc efficiency. Increased current increases the melting efficiency as it increases the depth to width ratio of the weld pool. Increased plasma gas flow does the same thing. Higher currents are thought to raise arc pressure and depress liquid at the bottom of the weld pool. More arc power then transfers to the workpiece through increasing plasma gas convection. If the power is held constant, the reduced voltage lowers the arc efficiency, while the pool shape change increases the melting efficiency,

Temperature, illumination and fluence dependence of current and voltage in electron irradiated solar cells

NASA Technical Reports Server (NTRS)

Obenschain, A. F.; Faith, T. J.

1973-01-01

Emperical equations have been derived from measurements of solar cell photovoltaic characteristics relating light generated current, IL, and open circuit voltage, VO, to cell temperature, T, intensity of illumination, W, and 1 Mev electron fluence, phi both 2 ohm-cm and 10 ohm-cm cells were tested. The temperature dependency of IL is similar for both resistivities at 140mw/sq cm; at high temperature the coefficient varies with fluence as phi 0.18, while at low temperatures the coefficient is relatively independent of fluence. Fluence dependent degration causes a decrease in IL at a rate proportional to phi 0.153 for both resistivities. At all intensities other than 560 mw/sq cm, a linear dependence of IL on illumination was found. The temperature coefficient of voltage was, to a good approximation, independent of both temperature and illumination for both resistivities. Illumination dependence of VOC was logarithmic, while the decrease with fluence of VOC varied as phi 0.25 for both resistivities.

External Barium Affects the Gating of KCNQ1 Potassium Channels and Produces a Pore Block via Two Discrete Sites

PubMed Central

Gibor, Gilad; Yakubovich, Daniel; Peretz, Asher; Attali, Bernard

2004-01-01

The pore properties and the reciprocal interactions between permeant ions and the gating of KCNQ channels are poorly understood. Here we used external barium to investigate the permeation characteristics of homomeric KCNQ1 channels. We assessed the Ba2+ binding kinetics and the concentration and voltage dependence of Ba2+ steady-state block. Our results indicate that extracellular Ba2+ exerts a series of complex effects, including a voltage-dependent pore blockade as well as unique gating alterations. External barium interacts with the permeation pathway of KCNQ1 at two discrete and nonsequential sites. (a) A slow deep Ba2+ site that occludes the channel pore and could be simulated by a model of voltage-dependent block. (b) A fast superficial Ba2+ site that barely contributes to channel block and mostly affects channel gating by shifting rightward the voltage dependence of activation, slowing activation, speeding up deactivation kinetics, and inhibiting channel inactivation. A model of voltage-dependent block cannot predict the complex impact of Ba2+ on channel gating in low external K+ solutions. Ba2+ binding to this superficial site likely modifies the gating transitions states of KCNQ1. Both sites appear to reside in the permeation pathway as high external K+ attenuates Ba2+ inhibition of channel conductance and abolishes its impact on channel gating. Our data suggest that despite the high degree of homology of the pore region among the various K+ channels, KCNQ1 channels display significant structural and functional uniqueness. PMID:15226366

Irritable bowel syndrome patients have SCN5A channelopathies that lead to decreased NaV1.5 current and mechanosensitivity.

PubMed

Strege, Peter R; Mazzone, Amelia; Bernard, Cheryl E; Neshatian, Leila; Gibbons, Simon J; Saito, Yuri A; Tester, David J; Calvert, Melissa L; Mayer, Emeran A; Chang, Lin; Ackerman, Michael J; Beyder, Arthur; Farrugia, Gianrico

2018-04-01

The SCN5A-encoded voltage-gated mechanosensitive Na + channel Na V 1.5 is expressed in human gastrointestinal smooth muscle cells and interstitial cells of Cajal. Na V 1.5 contributes to smooth muscle electrical slow waves and mechanical sensitivity. In predominantly Caucasian irritable bowel syndrome (IBS) patient cohorts, 2-3% of patients have SCN5A missense mutations that alter Na V 1.5 function and may contribute to IBS pathophysiology. In this study we examined a racially and ethnically diverse cohort of IBS patients for SCN5A missense mutations, compared them with IBS-negative controls, and determined the resulting Na V 1.5 voltage-dependent and mechanosensitive properties. All SCN5A exons were sequenced from somatic DNA of 252 Rome III IBS patients with diverse ethnic and racial backgrounds. Missense mutations were introduced into wild-type SCN5A by site-directed mutagenesis and cotransfected with green fluorescent protein into HEK-293 cells. Na V 1.5 voltage-dependent and mechanosensitive functions were studied by whole cell electrophysiology with and without shear force. Five of 252 (2.0%) IBS patients had six rare SCN5A mutations that were absent in 377 IBS-negative controls. Six of six (100%) IBS-associated Na V 1.5 mutations had voltage-dependent gating abnormalities [current density reduction (R225W, R433C, R986Q, and F1293S) and altered voltage dependence (R225W, R433C, R986Q, G1037V, and F1293S)], and at least one kinetic parameter was altered in all mutations. Four of six (67%) IBS-associated SCN5A mutations (R225W, R433C, R986Q, and F1293S) resulted in altered Na V 1.5 mechanosensitivity. In this racially and ethnically diverse cohort of IBS patients, we show that 2% of IBS patients harbor SCN5A mutations that are absent in IBS-negative controls and result in Na V 1.5 channels with abnormal voltage-dependent and mechanosensitive function. NEW & NOTEWORTHY The voltage-gated Na + channel Na V 1.5 contributes to smooth muscle physiology and electrical slow waves. In a racially and ethnically mixed irritable bowel syndrome cohort, 2% had mutations in the Na V 1.5 gene SCN5A. These mutations were absent in irritable bowel syndrome-negative controls. Most mutant Na V 1.5 channels were loss of function in voltage dependence or mechanosensitivity.

Observation of electrostatically released DNA from gold electrodes with controlled threshold voltages.

PubMed

Takeishi, Shunsaku; Rant, Ulrich; Fujiwara, Tsuyoshi; Buchholz, Karin; Usuki, Tatsuya; Arinaga, Kenji; Takemoto, Kazuya; Yamaguchi, Yoshitaka; Tornow, Marc; Fujita, Shozo; Abstreiter, Gerhard; Yokoyama, Naoki

2004-03-22

DNA oligo-nucleotides, localized at Au metal electrodes in aqueous solution, are found to be released when applying a negative bias voltage to the electrode. The release was confirmed by monitoring the intensity of the fluorescence of cyanine dyes (Cy3) linked to the 5' end of the DNA. The threshold voltage of the release changes depending on the kind of linker added to the DNA 3'-terminal. The amount of released DNA depends on the duration of the voltage pulse. Using this technique, we can retain DNA at Au electrodes or Au needles, and release the desired amount of DNA at a precise location in a target. The results suggest that DNA injection into living cells is possible with this method. (c) 2004 American Institute of Physics

The Effect of a Constant Level Lighting Control System on Small Offices With Windows

DTIC Science & Technology

1992-01-01

Scientific 2101 Digital Power Analyzer. The power factor was calculated by dividing the real power by the apparent power (current multiplied by voltage...CBNSC-TT-P 22060 INSODM - Cb. huad. Div. Delace Tockslcol to. C 2M30 US Arm Bo~kuau Disvriaw Pt Dalvoir VA 22M6 AWN: DTIC-AB (2) ATTN: Libary (41) ATmN

Effect of transmitter turn-off time on transient soundings

USGS Publications Warehouse

Fitterman, D.V.; Anderson, W.L.

1987-01-01

A general procedure for computing the effect of non-zero turn-off time on the transient electromagnetic response is presented which can be applied to forward and inverse calculation methods for any transmitter-receiver configuration. We consider in detail the case of a large transmitter loop which has a receiver coil located at the center of the loop (central induction or in-loop array). For a linear turn-off ramp of width t0, the voltage response is shown to be the voltage due to an ideal step turn-off averaged over windows of width t0. Thus the effect is similar to that obtained by using averaging windows in the receiver. In general when time zero is taken to be the end of the ramp, the apparent resistivity increases for a homogeneous half-space over a limited time range. For time zero taken to be the start of the ramp the apparent resistivity is affected in the opposite direction. The effect of the ramp increases with increasing t0 and first-layer resistivity, is largest during the intermediate stage, and decreases with increasing time. It is shown that for a ramp turn-off, there is no effect in the early and late stages. For two-layered models with a resistive first layer (??1>??2), the apparent resistivity is increased in the intermediate stage. When the first layer is more conductive than the second layer (??1

Addition and subtraction of spin pumping voltages in magnetic hybrid structures

DOE Office of Scientific and Technical Information (OSTI.GOV)

Azevedo, A., E-mail: aac@df.ufpe.br; Alves Santos, O.; Cunha, R. O.

2014-04-14

We report an investigation of the spin pumping voltage generated in bilayers of ferromagnetic/normal metal in which the ferromagnetic layer is yttrium iron garnet or Permalloy and the normal-metal layer is Pt or Ta. We also investigated a special case in which the voltage is detected in single layer of Permalloy under ferromagnetic resonance condition. It is shown that the spin pumping voltage generated in metallic bilayers have contributions from both layers and the resulting voltage depends on the relative signs of charge currents generated by the inverse spin Hall effect. For instance, the spin pumping voltage generated in Tamore » has the same sign as the one generate in single layer of Permalloy, but contrary to the voltage generated in Pt. When the voltage is measured in shunted metallic bilayers, the resulting voltage can be a sum or a subtraction of the voltages generated in both layers.« less

Single-contact tunneling thermometry

DOEpatents

Maksymovych, Petro

2016-02-23

A single-contact tunneling thermometry circuit includes a tunnel junction formed between two objects. Junction temperature gradient information is determined based on a mathematical relationship between a target alternating voltage applied across the junction and the junction temperature gradient. Total voltage measured across the junction indicates the magnitude of the target alternating voltage. A thermal gradient is induced across the junction. A reference thermovoltage is measured when zero alternating voltage is applied across the junction. An increasing alternating voltage is applied while measuring a thermovoltage component and a DC rectification voltage component created by the applied alternating voltage. The target alternating voltage is reached when the thermovoltage is nullified or doubled by the DC rectification voltage depending on the sign of the reference thermovoltage. Thermoelectric current and current measurements may be utilized in place of the thermovoltage and voltage measurements. The system may be automated with a feedback loop.

Gigantic transverse voltage induced via off-diagonal thermoelectric effect in CaxCoO2 thin films

NASA Astrophysics Data System (ADS)

Takahashi, Kouhei; Kanno, Tsutomu; Sakai, Akihiro; Adachi, Hideaki; Yamada, Yuka

2010-07-01

Gigantic transverse voltages exceeding several tens volt have been observed in CaxCoO2 thin films with tilted c-axis orientation upon illumination of nanosecond laser pulses. The voltage signals were highly anisotropic within the film surface showing close relation with the c-axis tilt direction. The magnitude and the decay time of the voltage strongly depended on the film thickness. These results confirm that the large laser-induced voltage originates from a phenomenon termed the off-diagonal thermoelectric effect, by which a film out-of-plane temperature gradient leads to generation of a film in-plane voltage.

Unraveling the temperature and voltage dependence of magnetic field effects in organic semiconductors

NASA Astrophysics Data System (ADS)

Janssen, Paul; Wouters, Steinar H. W.; Cox, Matthijs; Koopmans, Bert

2013-11-01

In recent years, it was discovered that the current through an organic semiconductor, sandwiched between two non-magnetic electrodes, can be changed significantly by applying a small magnetic field. This surprisingly large magnetoresistance effect, often dubbed as organic magnetoresistance (OMAR), has puzzled the young field of organic spintronics during the last decade. Here, we present a detailed study on the voltage and temperature dependence of OMAR, aiming to unravel the lineshapes of the magnetic field effects and thereby gain a deeper fundamental understanding of the underlying microscopic mechanism. Using a full quantitative analysis of the lineshapes, we are able to extract all linewidth parameters and the voltage and temperature dependencies are explained with a recently proposed trion mechanism. Moreover, explicit microscopic simulations show a qualitative agreement to the experimental results.

Passive Cooling Enabled by Polymer Composite Coating: Dependence on Filler, Filler Size and Coating Thickness

NASA Astrophysics Data System (ADS)

Shao, Yue; Shi, Frank G.

2017-07-01

The effective passive radiation cooling that is enabled by silicone-based composites is investigated for its dependence on coating thickness and filler size in the range of nanometers to micrometers. It is established, contrary to prior reports, that the effective passive radiation cooling does not exhibit a filler size dependence, i.e., there is no optimal size at which a maximum cooling would be reached. However, the apparent cooling effect is filler type dependent and among the fillers investigated, Al2O3 exhibits the best apparent cooling effect. In addition, the apparent cooling effect is dependent on coating thickness: the thickness dependence is non-monotonic, and the maximum cooling occurs at an optimal thickness of 70 μm, regardless of filler type. Potential significant implications of the findings are also discussed.

Stray voltage and milk quality: a review.

PubMed

Reinemann, Douglas J

2012-07-01

If animal contact voltage reaches sufficient levels, animals coming into contact with grounded devices may receive a mild electric shock that can cause a behavioral response. At voltage levels that are just perceptible to the animal, behaviors indicative of perception (eg, flinches) may result with little change in normal routines. At higher exposure levels, avoidance behaviors may result. The direct effect of animal contact with electrical current can range from: • Mild behavioral reactions indicative of sensation, to • Involuntary muscle contraction, or twitching, to • Intense behavioral responses indicative of pain. The indirect effects of these behaviors can vary considerably depending on the specifics of the contact location, level of current flow, body pathway, frequency of occurrence, and many other factors related to the daily activities of animals. There are several common situations of concern in animal environments: • Animals avoiding certain exposure locations, which may result in: X Reduced water intake if exposure is required for animals to access watering devices, X Reduced feed intake if exposure is required for animals to accesses feeding devices or locations. • Difficulty of moving or handling animals in areas of voltage/current exposure• The physiologic implications of the release of stress hormones produced by contact with painful stimuli. The severity of response will depend on the amount of electrical current (measured in milliamps) flowing through the animal’s body, the pathway it takes through the body, and the sensitivity of the individual animal. The results of the combined current dose-response experiments, voltage exposure response experiments, and measurements of body and contact resistances is consistent with the lowest (worst case) cow + contact resistance as low as 500 as estimated by Lefcourt that may occur in some unusual situations on farms (firm application of the muzzle to a wet metallic watering device and hoof contact on a clean, wet, contoured metallic plate on the floor). These studies on responses of dairy cows to electrical exposure agree well with each other and with predictions from neuroelectric theory and practice. There is a high degree of repeatability across studies in which exposures and responses have been appropriately quantified. For confirmation, a potential of 2 to 4 V (60 Hz, rms) must be measured between 2 points that an animal might contact (or animal contact measurement), and some animals should exhibit signs of avoidance behavior. The animal contact voltage measurement with an appropriate shunt resistor value provides the only reliable indication of exposure levels. Voltage readings at cow contact points should be made with a 500- or 1000- resistor across the 2 measuring leads to the cow contact points in addition to open circuit measurements. The only studies that have documented adverse effects of voltage and current on cows had both sufficient current applied to cause aversion and forced exposures (ie, animals could not eat or drink without being exposed to voltage and current) and all of the indirect responses (reduced water or intake and milk production) were behaviorally mediated. It is typical for voltage levels to vary considerably at different locations on a farm. Decreased water and/or feed intake or undesired behaviors result only if current levels are sufficient to produce aversion at locations that are critical to daily animal activity, such as feeders, waterers, and milking areas. If an aversive current occurs only a few times per day, it is not likely to have an adverse effect on cow behavior. The more often an aversive voltage occurs in areas critical to cows’ normal feeding, drinking, or resting, the more likely it is to affect cows. A number of studies have been done to investigate potential detrimental physiologic responses that may result from animals’ exposure to voltage and current. The literature review presented here summarizes 46 research trials on groups of cows exposed to know levels of voltage and/or current. Many of these were part of the same experiment but exposed cows at different levels of voltage or current. None of these trials or experiments (some using aggressive exposure of cows to mastitis organisms) showed a significant effect of voltage/current exposure on SCC or the incidence of mastitis. Many of these studies showed behavioral modification and some showed minor changes in milk yield, milk composition, or stress hormones (especially cortisol). These studies have shown that increased concentrations of the stress hormone cortisol do not occur at levels below behavioral response levels and only become apparent in some, but not all, cows at substantially higher voltage/current exposures than the threshold required for behavioral modification. This body of research indicates that while exposure to stray voltage at levels of 2 V to 4 V may be a mild stressor to dairy cows, it does not contribute to increased SCC or incidence of mastitis or reduced milk yield.

Brivaracetam: review of its pharmacology and potential use as adjunctive therapy in patients with partial onset seizures

PubMed Central

Mumoli, Laura; Palleria, Caterina; Gasparini, Sara; Citraro, Rita; Labate, Angelo; Ferlazzo, Edoardo; Gambardella, Antonio; De Sarro, Giovambattista; Russo, Emilio

2015-01-01

Brivaracetam (BRV), a high-affinity synaptic vesicle protein 2A ligand, reported to be 10–30-fold more potent than levetiracetam (LEV), is highly effective in a wide range of experimental models of focal and generalized seizures. BRV and LEV similarly bind to synaptic vesicle protein 2A, while differentiating for other pharmacological effects; in fact, BRV does not inhibit high voltage Ca2+ channels and AMPA receptors as LEV. Furthermore, BRV apparently exhibits inhibitory activity on neuronal voltage-gated sodium channels playing a role as a partial antagonist. BRV is currently waiting for approval both in the United States and the European Union as adjunctive therapy for patients with partial seizures. In patients with photosensitive epilepsy, BRV showed a dose-dependent effect in suppressing or attenuating the photoparoxysmal response. In well-controlled trials conducted to date, adjunctive BRV demonstrated efficacy and good tolerability in patients with focal epilepsy. BRV has a linear pharmacokinetic profile. BRV is extensively metabolized and excreted by urine (only 8%–11% unchanged). The metabolites of BRV are inactive, and hydrolysis of the acetamide group is the mainly involved metabolic pathway; hepatic impairment probably requires dose adjustment. BRV does not seem to influence other antiepileptic drug plasma levels. Six clinical trials have so far been completed indicating that BRV is effective in controlling seizures when used at doses between 50 and 200 mg/d. The drug is generally well-tolerated with only mild-to-moderate side effects; this is confirmed by the low discontinuation rate observed in these clinical studies. The most common side effects are related to central nervous system and include fatigue, dizziness, and somnolence; these apparently disappear during treatment. In this review, we analyzed BRV, focusing on the current evidences from experimental animal models to clinical studies with particular interest on potential use in clinical practice. Finally, pharmacological properties of BRV are summarized with a description of its pharmacokinetics, safety, and potential/known drug–drug interactions. PMID:26543353

Phosphatase activity of the voltage-sensing phosphatase, VSP, shows graded dependence on the extent of activation of the voltage sensor

PubMed Central

Sakata, Souhei; Okamura, Yasushi

2014-01-01

The voltage-sensing phosphatase (VSP) consists of a voltage sensor and a cytoplasmic phosphatase region, and the movement of the voltage sensor is coupled to the phosphatase activity. However, its coupling mechanisms still remain unclear. One possible scenario is that the phosphatase is activated only when the voltage sensor is in a fully activated state. Alternatively, the enzymatic activity of single VSP proteins could be graded in distinct activated states of the voltage sensor, and partial activation of the voltage sensor could lead to partial activation of the phosphatase. To distinguish between these two possibilities, we studied a voltage sensor mutant of zebrafish VSP, where the voltage sensor moves in two steps as evidenced by analyses of charge movements of the voltage sensor and voltage clamp fluorometry. Measurements of the phosphatase activity toward phosphatidylinositol 4,5-bisphosphate revealed that both steps of voltage sensor activation are coupled to the tuning of phosphatase activities, consistent with the idea that the phosphatase activity is graded by the magnitude of the movement of the voltage sensor. PMID:24277865

Phosphatase activity of the voltage-sensing phosphatase, VSP, shows graded dependence on the extent of activation of the voltage sensor.

PubMed

Sakata, Souhei; Okamura, Yasushi

2014-03-01

The voltage-sensing phosphatase (VSP) consists of a voltage sensor and a cytoplasmic phosphatase region, and the movement of the voltage sensor is coupled to the phosphatase activity. However, its coupling mechanisms still remain unclear. One possible scenario is that the phosphatase is activated only when the voltage sensor is in a fully activated state. Alternatively, the enzymatic activity of single VSP proteins could be graded in distinct activated states of the voltage sensor, and partial activation of the voltage sensor could lead to partial activation of the phosphatase. To distinguish between these two possibilities, we studied a voltage sensor mutant of zebrafish VSP, where the voltage sensor moves in two steps as evidenced by analyses of charge movements of the voltage sensor and voltage clamp fluorometry. Measurements of the phosphatase activity toward phosphatidylinositol 4,5-bisphosphate revealed that both steps of voltage sensor activation are coupled to the tuning of phosphatase activities, consistent with the idea that the phosphatase activity is graded by the magnitude of the movement of the voltage sensor.

Genetically-encoded fluorescent voltage sensors using the voltage-sensing domain of Nematostella and Danio phosphatases exhibit fast kinetics

PubMed Central

Baker, Bradley J.; Jin, Lei; Han, Zhou; Cohen, Lawrence B.; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent

2012-01-01

A substantial increase in the speed of the optical response of genetically-encoded Fluorescent Protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1–S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tauoff <5 msec). However, the signal was small (ΔF/F= 0.6%/200 mV). FP voltage sensors using the D. rerio voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2 msec of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. PMID:22634212

Exploring the validity and limitations of the Mott-Gurney law for charge-carrier mobility determination of semiconducting thin-films.

PubMed

Röhr, Jason A; Moia, Davide; Haque, Saif A; Kirchartz, Thomas; Nelson, Jenny

2018-03-14

Using drift-diffusion simulations, we investigate the voltage dependence of the dark current in single carrier devices typically used to determine charge-carrier mobilities. For both low and high voltages, the current increases linearly with the applied voltage. Whereas the linear current at low voltages is mainly due to space charge in the middle of the device, the linear current at high voltage is caused by charge-carrier saturation due to a high degree of injection. As a consequence, the current density at these voltages does not follow the classical square law derived by Mott and Gurney, and we show that for trap-free devices, only for intermediate voltages, a space-charge-limited drift current can be observed with a slope that approaches a value of two. We show that, depending on the thickness of the semiconductor layer and the size of the injection barriers, the two linear current-voltage regimes can dominate the whole voltage range, and the intermediate Mott-Gurney regime can shrink or disappear. In this case, which will especially occur for thicknesses and injection barriers typical of single-carrier devices used to probe organic semiconductors, a meaningful analysis using the Mott-Gurney law will become unachievable, because a square-law fit can no longer be achieved, resulting in the mobility being substantially underestimated. General criteria for when to expect deviations from the Mott-Gurney law when used for analysis of intrinsic semiconductors are discussed.

Exploring the validity and limitations of the Mott-Gurney law for charge-carrier mobility determination of semiconducting thin-films

NASA Astrophysics Data System (ADS)

Röhr, Jason A.; Moia, Davide; Haque, Saif A.; Kirchartz, Thomas; Nelson, Jenny

2018-03-01

Using drift-diffusion simulations, we investigate the voltage dependence of the dark current in single carrier devices typically used to determine charge-carrier mobilities. For both low and high voltages, the current increases linearly with the applied voltage. Whereas the linear current at low voltages is mainly due to space charge in the middle of the device, the linear current at high voltage is caused by charge-carrier saturation due to a high degree of injection. As a consequence, the current density at these voltages does not follow the classical square law derived by Mott and Gurney, and we show that for trap-free devices, only for intermediate voltages, a space-charge-limited drift current can be observed with a slope that approaches a value of two. We show that, depending on the thickness of the semiconductor layer and the size of the injection barriers, the two linear current-voltage regimes can dominate the whole voltage range, and the intermediate Mott-Gurney regime can shrink or disappear. In this case, which will especially occur for thicknesses and injection barriers typical of single-carrier devices used to probe organic semiconductors, a meaningful analysis using the Mott-Gurney law will become unachievable, because a square-law fit can no longer be achieved, resulting in the mobility being substantially underestimated. General criteria for when to expect deviations from the Mott-Gurney law when used for analysis of intrinsic semiconductors are discussed.

Charge transport study in bis{2-(2-hydroxyphenyl) benzoxazolate} zinc [Zn(hpb)2

NASA Astrophysics Data System (ADS)

Rai, Virendra Kumar; Srivastava, Ritu; Chauhan, Gayatri; Kumar, Arunandan; Kamalasanan, M. N.

2008-10-01

The nature of the electrical transport mechanism for carrier transport in pure bis {2-(2-hydroxyphenyl) benzoxazolate} zinc [Zn(hpb)2] has been studied by current voltage measurements of samples at different thicknesses and at different temperatures. Hole-only devices show ohmic conduction at low voltages and space charge conduction at high voltages. The space charge conduction is clearly identifiable with a square law dependence of current on voltage as well as the scaling of current inversely with the cube of thickness. With a further increase in voltage, the current increases with a Vm dependence with m varying with temperature typical of trap limited conduction with an exponential distribution of trap states. From the square law region the effective charge carrier mobility of holes has been evaluated as 2.5 × 10-11 m2 V-1 s-1. Electron-only devices however show electrode limited conduction, which was found to obey the Scott Malliaras model of charge injection.

A Model of Anode Sheath Potential Evolution in a Transverse Magnetic Field

NASA Astrophysics Data System (ADS)

Foster, John E.; Gallimore, Alec D.

1996-11-01

It has been conjectured that the growth in the magnitude of the anode fall voltage with changing transverse magnetic field is a function of the ratio of available transverse current to the discharge current. It has been postulated that at small values of this ratio, the anode fall voltage and thus the near-anode electric field increases in order to assure that the prescribed discharge is maintained.footnote H. Hugel, IEEE Tran. Plas. Sci., PS-8,4, 1980 In this present work, a model is presented which predicts the behavior of the anode fall voltage as a function of transverse magnetic field. The model attempts to explain why the anode fall voltage depends so strongly on this ratio. In addition, it is further shown that because of the current ratio's strong dependence on local electron number density, ultimately it is the changes in near-anode ionization processes with varying transverse magnetic field that control the anode fall voltage.

Structural Mechanism of Voltage-Dependent Gating in an Isolated Voltage-Sensing Domain

PubMed Central

Li, Qufei; Wanderling, Sherry; Paduch, Marcin; Medovoy, David; Singharoy, Abhishek; McGreevy, Ryan; Villalba-Galea, Carlos; Hulse, Raymond E.; Roux, Benoit; Schulten, Klaus; Kossiakoff, Anthony; Perozo, Eduardo

2014-01-01

SUMMARY The transduction of transmembrane electric fields into protein motion plays an essential role in the generation and propagation of cellular signals. Voltage-sensing domains (VSD) carry out these functions through reorientations of S4 helix with discrete gating charges. Here, crystal structures of the VSD from Ci-VSP were determined in both, active (Up) and resting (Down) conformations. The S4 undergoes a ~5 Å displacement along its main axis accompanied by a ~60o rotation, consistent with the helix-screw gating mechanism. This movement is stabilized by a change in countercharge partners in helices S1 and S3, generating an estimated net charge transfer of ~1 eo. Gating charges move relative to a “hydrophobic gasket” that electrically divides intra and extracellular compartments. EPR spectroscopy confirms the limited nature of S4 movement in a membrane environment. These results provide an explicit mechanism for voltage sensing and set the basis for electromechanical coupling in voltage-dependent cellular activities. PMID:24487958

The voltage-sensing domain of a phosphatase gates the pore of a potassium channel

PubMed Central

Arrigoni, Cristina; Schroeder, Indra; Romani, Giulia; Van Etten, James L.; Thiel, Gerhard

2013-01-01

The modular architecture of voltage-gated K+ (Kv) channels suggests that they resulted from the fusion of a voltage-sensing domain (VSD) to a pore module. Here, we show that the VSD of Ciona intestinalis phosphatase (Ci-VSP) fused to the viral channel Kcv creates KvSynth1, a functional voltage-gated, outwardly rectifying K+ channel. KvSynth1 displays the summed features of its individual components: pore properties of Kcv (selectivity and filter gating) and voltage dependence of Ci-VSP (V1/2 = +56 mV; z of ∼1), including the depolarization-induced mode shift. The degree of outward rectification of the channel is critically dependent on the length of the linker more than on its amino acid composition. This highlights a mechanistic role of the linker in transmitting the movement of the sensor to the pore and shows that electromechanical coupling can occur without coevolution of the two domains. PMID:23440279

Regulation of CaV2 calcium channels by G protein coupled receptors

PubMed Central

Zamponi, Gerald W.; Currie, Kevin P.M.

2012-01-01

Voltage gated calcium channels (Ca2+ channels) are key mediators of depolarization induced calcium influx into excitable cells, and thereby play pivotal roles in a wide array of physiological responses. This review focuses on the inhibition of CaV2 (N- and P/Q-type) Ca2+-channels by G protein coupled receptors (GPCRs), which exerts important autocrine/paracrine control over synaptic transmission and neuroendocrine secretion. Voltage-dependent inhibition is the most widespread mechanism, and involves direct binding of the G protein βγ dimer (Gβγ) to the α1 subunit of CaV2 channels. GPCRs can also recruit several other distinct mechanisms including phosphorylation, lipid signaling pathways, and channel trafficking that result in voltage-independent inhibition. Current knowledge of Gβγ-mediated inhibition is reviewed, including the molecular interactions involved, determinants of voltage-dependence, and crosstalk with other cell signaling pathways. A summary of recent developments in understanding the voltage-independent mechanisms prominent in sympathetic and sensory neurons is also included. PMID:23063655

Online Tester for a Symbol Generator

NASA Technical Reports Server (NTRS)

Juday, D.; Mcconaugy, K.

1985-01-01

About 95 percent of faults detected. Programable instrument periodically checks for failures in system that generates alphanumerical and other symbol voltages for cathode-ray-tube displays. Symbol-generator tester compares gated test-point voltages with predetermined voltage limits while circuit under test performs commanded operation. A go/no-go indication given, depending on whether test voltage is or is not within its specification. Tester in plug-in modular form, temporarily wired to generator test points, or permanently wired to these points.

Dopamine Induces LTP Differentially in Apical and Basal Dendrites through BDNF and Voltage-Dependent Calcium Channels

ERIC Educational Resources Information Center

Navakkode, Sheeja; Sajikumar, Sreedharan; Korte, Martin; Soong, Tuck Wah

2012-01-01

The dopaminergic modulation of long-term potentiation (LTP) has been studied well, but the mechanism by which dopamine induces LTP (DA-LTP) in CA1 pyramidal neurons is unknown. Here, we report that DA-LTP in basal dendrites is dependent while in apical dendrites it is independent of activation of L-type voltage-gated calcium channels (VDCC).…

Reconstruction of ionic currents in a molluscan photoreceptor.

PubMed Central

Sakakibara, M.; Ikeno, H.; Usui, S.; Collin, C.; Alkon, D. L.

1993-01-01

Two-microelectrode voltage-clamp measurements were made to determine the kinetics and voltage dependence of ionic currents across the soma membrane of the Hermissenda type B photoreceptor. The voltage-dependent outward potassium currents, IA and ICa(2+)-K+, the inward voltage-dependent calcium current, ICa2+ and the light-induced current, IIgt, were then described with Hodgkin-Huxley-type equations. The fast-activating and inactivating potassium current, IA, was described by the equation; IA(t) = gA(max)(ma infinity[1-exp(-t/tau ma)])3 x (ha infinity [1-exp(-t/tau ha)] + exp(-t/tau ha)) (Vm-EK), where the parameters ma infinity, ha infinity, tau ma, and tau ha are functions of membrane potential, Vm, and ma infinity and ha infinity are steady-state activation and inactivation parameters. Similarly, the calcium-dependent outward potassium current, ICa(2+)-K+, was described by the equation, ICa(2+)-K+ (t) = gc(max)(mc infinity(VC)(1-exp[-t/tau mc (VC)]))pc (hc infinity(VC) [1-exp(-t/tau hc)] + exp(-t/tau hc(VC)])pc(VC-EK). In high external potassium, ICa(2+)-K+ could be measured in approximate isolation from other currents as a voltage-dependent inward tail current following a depolarizing command pulse from a holding potential of -60 mV. A voltage-dependent inward calcium current across the type B soma membrane, ICa2+, activated rapidly, showed little inactivation, and was described by the equation: ICa2+ = gCa(max) [1 + exp](-Vm-5)/7]-1 (Vm-ECa), where gCa(max) was 0.5 microS. The light-induced current with both fast and slow phases was described by: IIgt(t) = IIgt1 + IIgt2 + IIgt3, IIgti = gIgti [1-exp(- ton/tau mi)] exp(-ton/tau hi)(Vm-EIgti) (i = 1, 2). For i = 3, /Igt(t) = gigt3m33h3(Vm - Eigt3)exp(-ton/Ton) x exp(-tfoff/t Off). Based on these reconstructions of ionic currents, learning-induced enhancement of the long lasting depolarization (LLD) of the photoreceptor'slight response was shown to arise from progressive inactivation of /A, lca2+ -K+, and lCa2+. PMID:8369456

Power conditioning using dynamic voltage restorers under different voltage sag types.

PubMed

Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A

2016-01-01

Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.

Power conditioning using dynamic voltage restorers under different voltage sag types

PubMed Central

Saeed, Ahmed M.; Abdel Aleem, Shady H.E.; Ibrahim, Ahmed M.; Balci, Murat E.; El-Zahab, Essam E.A.

2015-01-01

Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type. PMID:26843975

Disulfide mapping the voltage-sensing mechanism of a voltage-dependent potassium channel.

PubMed

Nozaki, Tomohiro; Ozawa, Shin-Ichiro; Harada, Hitomi; Kimura, Tomomi; Osawa, Masanori; Shimada, Ichio

2016-11-17

Voltage-dependent potassium (Kv) channels allow for the selective permeability of potassium ions in a membrane potential dependent manner, playing crucial roles in neurotransmission and muscle contraction. Kv channel is a tetramer, in which each subunit possesses a voltage-sensing domain (VSD) and a pore domain (PD). Although several lines of evidence indicated that membrane depolarization is sensed as the movement of helix S4 of the VSD, the detailed voltage-sensing mechanism remained elusive, due to the difficulty of structural analyses at resting potential. In this study, we conducted a comprehensive disulfide locking analysis of the VSD using 36 double Cys mutants, in order to identify the proximal residue pairs of the VSD in the presence or absence of a membrane potential. An intramolecular SS-bond was formed between 6 Cys pairs under both polarized and depolarized environment, and one pair only under depolarized environment. The multiple conformations captured by the SS-bond can be divided by two states, up and down, where S4 lies on the extracellular and intracellular sides of the membrane, respectively, with axial rotation of 180°. The transition between these two states is caused by the S4 translocation of 12 Å, enabling allosteric regulation of the gating at the PD.

Binding site in eag voltage sensor accommodates a variety of ions and is accessible in closed channel.

PubMed

Silverman, William R; Bannister, John P A; Papazian, Diane M

2004-11-01

In ether-a-go-go K+ channels, voltage-dependent activation is modulated by ion binding to a site located in an extracellular-facing crevice between transmembrane segments S2 and S3 in the voltage sensor. We find that acidic residues D278 in S2 and D327 in S3 are able to coordinate a variety of divalent cations, including Mg2+, Mn2+, and Ni2+, which have qualitatively similar functional effects, but different half-maximal effective concentrations. Our data indicate that ions binding to individual voltage sensors in the tetrameric channel act without cooperativity to modulate activation gating. We have taken advantage of the unique phenotype of Ni2+ in the D274A channel, which contains a mutation of a nonbinding site residue, to demonstrate that ions can access the binding site from the extracellular solution when the voltage sensor is in the resting conformation. Our results are difficult to reconcile with the x-ray structure of the KvAP K+ channel, in which the binding site residues are widely separated, and with the hydrophobic paddle model for voltage-dependent activation, in which the voltage sensor domain, including the S3-S4 loop, is near the cytoplasmic side of the membrane in the closed channel.

A weak electric field-assisted ultrafast electrical switching dynamics in In3SbTe2 phase-change memory devices

NASA Astrophysics Data System (ADS)

Pandey, Shivendra Kumar; Manivannan, Anbarasu

2017-07-01

Prefixing a weak electric field (incubation) might enhance the crystallization speed via pre-structural ordering and thereby achieving faster programming of phase change memory (PCM) devices. We employed a weak electric field, equivalent to a constant small voltage (that is incubation voltage, Vi of 0.3 V) to the applied voltage pulse, VA (main pulse) for a systematic understanding of voltage-dependent rapid threshold switching characteristics and crystallization (set) process of In3SbTe2 (IST) PCM devices. Our experimental results on incubation-assisted switching elucidate strikingly one order faster threshold switching, with an extremely small delay time, td of 300 ps, as compared with no incubation voltage (Vi = 0 V) for the same VA. Also, the voltage dependent characteristics of incubation-assisted switching dynamics confirm that the initiation of threshold switching occurs at a lower voltage of 0.82 times of VA. Furthermore, we demonstrate an incubation assisted ultrafast set process of IST device for a low VA of 1.7 V (˜18 % lesser compared to without incubation) within a short pulse-width of 1.5 ns (full width half maximum, FWHM). These findings of ultrafast switching, yet low power set process would immensely be helpful towards designing high speed PCM devices with low power operation.

Effects of atmospheric composition on apparent activation energy of silicate weathering: I. Model formulation

NASA Astrophysics Data System (ADS)

Kanzaki, Yoshiki; Murakami, Takashi

2018-07-01

We have developed a weathering model to comprehensively understand the determining factors of the apparent activation energy of silicate weathering in order to better estimate the silicate-weathering flux in the Precambrian. The model formulates the reaction rate of a mineral as a basis, then the elemental loss by summing the reaction rates of whole minerals, and finally the weathering flux from a given weathering profile by integrating the elemental losses along the depth of the profile. The rate expressions are formulated with physicochemical parameters relevant to weathering, including solution and atmospheric compositions. The apparent activation energies of silicate weathering are then represented by the temperature dependences of the physicochemical parameters based on the rate expressions. It was found that the interactions between individual mineral-reactions and the compositions of solution and atmosphere are necessarily accompanied by those of temperature-dependence counterparts. Indeed, the model calculates the apparent activation energy of silicate weathering as a function of the temperature dependence of atmospheric CO2 (Δ HCO2‧) . The dependence of the apparent activation energy of silicate weathering on Δ HCO2‧ may explain the empirical dependence of silicate weathering on the atmospheric composition. We further introduce a compensation law between the apparent activation energy and the pre-exponential factor to obtain the relationship between the silicate-weathering flux (FCO2), temperature and the apparent activation energy. The model calculation and the compensation law enable us to predict FCO2 as a function of temperature, once Δ HCO2‧ is given. The validity of the model is supported by agreements between the model prediction and observations of the apparent activation energy and FCO2 in the modern weathering systems. The present weathering model will be useful for the estimation of FCO2 in the Precambrian, for which Δ HCO2‧ can be deduced from the greenhouse effect of atmospheric CO2.

A Voltage Dependent Non-Inactivating Na+ Channel Activated during Apoptosis in Xenopus Oocytes

PubMed Central

Englund, Ulrika H.; Gertow, Jens; Kågedal, Katarina; Elinder, Fredrik

2014-01-01

Ion channels in the plasma membrane are important for the apoptotic process. Different types of voltage-gated ion channels are up-regulated early in the apoptotic process and block of these channels prevents or delays apoptosis. In the present investigation we examined whether ion channels are up-regulated in oocytes from the frog Xenopus laevis during apoptosis. The two-electrode voltage-clamp technique was used to record endogenous ion currents in the oocytes. During staurosporine-induced apoptosis a voltage-dependent Na+ current increased three-fold. This current was activated at voltages more positive than 0 mV (midpoint of the open-probability curve was +55 mV) and showed almost no sign of inactivation during a 1-s pulse. The current was resistant to the Na+-channel blockers tetrodotoxin (1 µM) and amiloride (10 µM), while the Ca2+-channel blocker verapamil (50 µM) in the bath solution completely blocked the current. The intracellular Na+ concentration increased in staurosporine-treated oocytes, but could be prevented by replacing extracellular Na+ whith either K+ or Choline+. Prevention of this influx of Na+ also prevented the STS-induced up-regulation of the caspase-3 activity, suggesting that the intracellular Na+ increase is required to induce apoptosis. Taken together, we have found that a voltage dependent Na+ channel is up-regulated during apoptosis and that influx of Na+ is a crucial step in the apoptotic process in Xenopus oocytes. PMID:24586320

Hydrogen ion block of the sodium pore in squid giant axons

PubMed Central

1983-01-01

The block of squid axon sodium channels by H ions was studied using voltage-clamp and internal perfusion techniques. An increase in the concentration of internal permeant ions decreased the block produced by external H ions. The voltage dependence of the block was found to be nonmonotonic: it was reduced by both large positive and large negative potentials. The ability of internal ions to modify the block by external H+ is explained by a competition among these ions for a binding site within the pore. The nonmonotonic voltage dependence is consistent with this picture if the hydrogen ions are allowed to be permeant. PMID:6315859

Molecular determinants of voltage-dependent gating and binding of pore-blocking drugs in transmembrane segment IIIS6 of the Na(+) channel alpha subunit.

PubMed

Yarov-Yarovoy, V; Brown, J; Sharp, E M; Clare, J J; Scheuer, T; Catterall, W A

2001-01-05

Mutations of amino acid residues in the inner two-thirds of the S6 segment in domain III of the rat brain type IIA Na(+) channel (G1460A to I1473A) caused periodic positive and negative shifts in the voltage dependence of activation, consistent with an alpha-helix having one face on which mutations to alanine oppose activation. Mutations in the outer one-third of the IIIS6 segment all favored activation. Mutations in the inner half of IIIS6 had strong effects on the voltage dependence of inactivation from closed states without effect on open-state inactivation. Only three mutations had strong effects on block by local anesthetics and anticonvulsants. Mutations L1465A and I1469A decreased affinity of inactivated Na(+) channels up to 8-fold for the anticonvulsant lamotrigine and its congeners 227c89, 4030w92, and 619c89 as well as for the local anesthetic etidocaine. N1466A decreased affinity of inactivated Na(+) channels for the anticonvulsant 4030w92 and etidocaine by 3- and 8-fold, respectively, but had no effect on affinity of the other tested compounds. Leu-1465, Asn-1466, and Ile-1469 are located on one side of the IIIS6 helix, and mutation of each caused a positive shift in the voltage dependence of activation. Evidently, these amino acid residues face the lumen of the pore, contribute to formation of the high-affinity receptor site for pore-blocking drugs, and are involved in voltage-dependent activation and coupling to closed-state inactivation.

Voltage-dependent calcium-permeable channels in the plasma membrane of a higher plant cell.

PubMed

Thuleau, P; Ward, J M; Ranjeva, R; Schroeder, J I

1994-07-01

Numerous biological assays and pharmacological studies on various higher plant tissues have led to the suggestion that voltage-dependent plasma membrane Ca2+ channels play prominent roles in initiating signal transduction processes during plant growth and development. However, to date no direct evidence has been obtained for the existence of such depolarization-activated Ca2+ channels in the plasma membrane of higher plant cells. Carrot suspension cells (Daucus carota L.) provide a well-suited system to determine whether voltage-dependent Ca2+ channels are present in the plasma membrane of higher plants and to characterize the properties of putative Ca2+ channels. It is known that both depolarization, caused by raising extracellular K+, and exposure to fungal toxins or oligogalacturonides induce Ca2+ influx into carrot cells. By direct application of patch-clamp techniques to isolated carrot protoplasts, we show here that depolarization of the plasma membrane positive to -135 mV activates Ca(2+)-permeable channels. These voltage-dependent ion channels were more permeable to Ca2+ than K+, while displaying large permeabilities to Ba2+ and Mg2+ ions. Ca(2+)-permeable channels showed slow and reversible inactivation. The single-channel conductance was 13 pS in 40 mM CaCl2. These data provide direct evidence for the existence of voltage-dependent Ca2+ channels in the plasma membrane of a higher plant cell and point to physiological mechanisms for plant Ca2+ channel regulation. The depolarization-activated Ca(2+)-permeable channels identified here could constitute a regulated pathway for Ca2+ influx in response to physiologically occurring stimulus-induced depolarizations in higher plant cells.

Temperature dependence of the enhanced inverse spin Hall voltage in Pt/Antiferromagnetic/ Y3Fe5O12

NASA Astrophysics Data System (ADS)

Brangham, J. T.; Lee, A. J.; Cheng, Y.; Yu, S. S.; Dunsiger, S. R.; Page, M. R.; Hammel, P. C.; Yang, F. Y.

The generation, propagation, and detection of spin currents are of intense interest in the field of spintronics. Spin current generation by FMR spin pumping using Y3Fe5O12 (YIG) and spin current detection by the inverse spin Hall effect (ISHE) in metals such as Pt have been well studied. This is due to YIG's exceptionally low damping and insulating behavior and the large spin Hall angle of Pt. Previously, our group showed that the ISHE voltages are significantly enhanced by adding a thin intermediate layer of an antiferromagnet (AFM) between Pt and YIG at room temperature. Recent theoretical work predicts a mechanism for this enhancement as well as the temperature dependence of the ISHE voltages of metal/AFM/YIG trilayers. The predictions show a maximum in the ISHE voltages for these systems near the magnetic phase transition temperature of the AFM. Here we present experimental results showing the temperature dependence for Pt/AFM/YIG structures with various AFMs. DOE Grant No. DE-SC0001304.

The human red cell voltage-regulated cation channel. The interplay with the chloride conductance, the Ca(2+)-activated K(+) channel and the Ca(2+) pump.

PubMed

Bennekou, P; Kristensen, B I; Christophersen, P

2003-09-01

The activation/deactivation kinetics of the human erythrocyte voltage-dependent cation channel was characterized at the single-channel level using inside-out patches. It was found that the time dependence for voltage activation after steps to positive membrane potentials was slow ( t(1/2) about 30 s), whereas the deactivation was fast ( t(1/2) about 15 ms). Both activation and deactivation of this channel were also demonstrated in intact red cells in suspension. At very positive membrane potentials generated by suspension in extracellular low Cl(-) concentrations, the cation conductance switched on with a time constant of about 2 min. Deactivation of the cation channel was clearly demonstrated during transient activation of the Gárdos channel elicited by Ca(2+) influx via the cation channel and ensuing efflux via the Ca(2+) pump. Thus, the voltage-dependent cation channel, the Gárdos channel and the Ca(2+) pump constitute a coupled feedback-regulated system that may become operative under physiological conditions.

[VGKC antibodies associated with limbic encephalitis].

PubMed

Soeder, B M; Urbach, H; Elger, C E; Bien, C G; Beyenburg, S

2005-06-01

Since the initial description of limbic encephalitis (LE) in 1960/1968, several subforms of this clinico-neuropathological syndrome have been identified. The best known is paraneoplastic LE. However, non-paraneoplastic forms have been reported, too. Very recently, autoantibodies against voltage-gated potassium channels have been described in association with LE. The diagnostic workup of such a case and the apparently typical good response to long-term immunotherapy of this LE subform are described.

Non-Invasive Monitoring of Intra-Abdominal Bleeding Rate Using Electrical Impedance Tomography

DTIC Science & Technology

2009-09-01

labeled ‘Measurement Index’, represents each of the 40 transimpedance measurements. The measurement index variable corresponds to the 40 measurements...system are amplified , and digitized by a 14-bit ADC (AD9240, Analog Devices). Waveforms are then sampled synchronous with the source, at 32 samples per...voltage changes (decreases in transimpedance ) during this phase were in measurements between the two outermost electrodes. We believe the apparent

Mining Protein Evolution for Insights into Mechanisms of Voltage-Dependent Sodium Channel Auxiliary Subunits.

PubMed

Molinarolo, Steven; Granata, Daniele; Carnevale, Vincenzo; Ahern, Christopher A

2018-02-21

Voltage-gated sodium channel (VGSC) beta (β) subunits have been called the "overachieving" auxiliary ion channel subunit. Indeed, these subunits regulate the trafficking of the sodium channel complex at the plasma membrane and simultaneously tune the voltage-dependent properties of the pore-forming alpha-subunit. It is now known that VGSC β-subunits are capable of similar modulation of multiple isoforms of related voltage-gated potassium channels, suggesting that their abilities extend into the broader voltage-gated channels. The gene family for these single transmembrane immunoglobulin beta-fold proteins extends well beyond the traditional VGSC β1-β4 subunit designation, with deep roots into the cell adhesion protein family and myelin-related proteins - where inherited mutations result in a myriad of electrical signaling disorders. Yet, very little is known about how VGSC β-subunits support protein trafficking pathways, the basis for their modulation of voltage-dependent gating, and, ultimately, their role in shaping neuronal excitability. An evolutionary approach can be useful in yielding new clues to such functions as it provides an unbiased assessment of protein residues, folds, and functions. An approach is described here which indicates the greater emergence of the modern β-subunits roughly 400 million years ago in the early neurons of Bilateria and bony fish, and the unexpected presence of distant homologues in bacteriophages. Recent structural breakthroughs containing α and β eukaryotic sodium channels containing subunits suggest a novel role for a highly conserved polar contact that occurs within the transmembrane segments. Overall, a mixture of approaches will ultimately advance our understanding of the mechanism for β-subunit interactions with voltage-sensor containing ion channels and membrane proteins.

Effect of localized states on the current-voltage characteristics of metal-semiconductor contacts with thin interfacial layer

NASA Astrophysics Data System (ADS)

Chattopadhyay, P.

1994-10-01

The role of discrete localized states on the current-voltage characteristics of metal-semiconductor contact is examined. It is seen that, because of these localized states, the logarithmic current vs voltage characteristics become nonlinear. Such nonlinearity is found sensitive to the temperature, and the energy and density of the localized states. The predicted temperature dependence of barrier height and the current-voltage characteristics are in agreement with the experimental results of Aboelfotoh [ Phys. Rev. B39, 5070 (1989)].

Shaping charge excitations in chiral edge states with a time-dependent gate voltage

NASA Astrophysics Data System (ADS)

Misiorny, Maciej; Fève, Gwendal; Splettstoesser, Janine

2018-02-01

We study a coherent conductor supporting a single edge channel in which alternating current pulses are created by local time-dependent gating and sent on a beam-splitter realized by a quantum point contact. The current response to the gate voltage in this setup is intrinsically linear. Based on a fully self-consistent treatment employing a Floquet scattering theory, we analyze the effect of different voltage shapes and frequencies, as well as the role of the gate geometry on the injected signal. In particular, we highlight the impact of frequency-dependent screening on the process of shaping the current signal. The feasibility of creating true single-particle excitations with this method is confirmed by investigating the suppression of excess noise, which is otherwise created by additional electron-hole pair excitations in the current signal.

Photoelectrochemical Stability and Alteration Products of n-Type Single-Crystal ZnO Photoanodes

DOE PAGES

Paulauskas, I. E.; Jellison, G. E.; Boatner, L. A.; ...

2011-01-01

The photoelectrochemical stability and surface-alteration characteristics of doped and undoped n-type ZnO single-crystal photoanode electrodes were investigated. The single-crystal ZnO photoanode properties were analyzed using current-voltage measurements plus spectral and time-dependent quantum-yield methods. These measurements revealed a distinct anodic peak and an accompanying cathodic surface degradation process at negative potentials. The features of this peak depended on time and the NaOH concentration in the electrolyte, but were independent of the presence of electrode illumination. Current measurements performed at the peak indicate that charging and discharging effects are apparently taking place at the semiconductor/electrolyte interface. This result is consistent with themore » significant reactive degradation that takes place on the ZnO single crystal photoanode surface and that ultimately leads to the reduction of the ZnO surface to Zn metal. The resulting Zn-metal reaction products create unusual, dendrite-like, surface alteration structural features that were analyzed using x-ray diffraction, energy-dispersive analysis, and scanning electron microscopy. ZnO doping methods were found to be effective in increasing the n-type character of the crystals. Higher doping levels result in smaller depletion widths and lower quantum yields, since the minority carrier diffusion lengths are very short in these materials.« less

Muscimol increases acetylcholine release by directly stimulating adult striatal cholinergic interneurons.

PubMed

Login, I S; Pal, S N; Adams, D T; Gold, P E

1998-01-01

Because GabaA ligands increase acetylcholine (ACh) release from adult striatal slices, we hypothesized that activation of GabaA receptors on striatal cholinergic interneurons directly stimulates ACh secretion. Fractional [3H]ACh release was recorded during perifusion of acutely dissociated, [3H]choline-labeled, adult male rat striata. The GabaA agonist, muscimol, immediately stimulated release maximally approximately 300% with EC50 = approximately 1 microM. This action was enhanced by the allosteric GabaA receptor modulators, diazepam and secobarbital, and inhibited by the GabaA antagonist, bicuculline, by ligands for D2 or muscarinic cholinergic receptors or by low calcium buffer, tetrodotoxin or vesamicol. Membrane depolarization inversely regulated muscimol-stimulated secretion. Release of endogenous and newly synthesized ACh was stimulated in parallel by muscimol without changing choline release. Muscimol pretreatment inhibited release evoked by K+ depolarization or by receptor-mediated stimulation with glutamate. Thus, GabaA receptors on adult striatal cholinergic interneurons directly stimulate voltage- and calcium-dependent exocytosis of ACh stored in vesamicol-sensitive synaptic vesicles. The action depends on the state of membrane polarization and apparently depolarizes the membrane in turn. This functional assay demonstrates that excitatory GabaA actions are not limited to neonatal tissues. GabaA-stimulated ACh release may be prevented in situ by normal tonic dopaminergic and muscarinic input to cholinergic neurons.

Influence of an anomalous dimension effect on thermal instability in amorphous-InGaZnO thin-film transistors

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liu, Kuan-Hsien; Chou, Wu-Ching, E-mail: tcchang3708@gmail.com, E-mail: wuchingchou@mail.nctu.edu.tw; Chang, Ting-Chang, E-mail: tcchang3708@gmail.com, E-mail: wuchingchou@mail.nctu.edu.tw

2014-10-21

This paper investigates abnormal dimension-dependent thermal instability in amorphous indium-gallium-zinc-oxide (a-IGZO) thin-film transistors. Device dimension should theoretically have no effects on threshold voltage, except for in short channel devices. Unlike short channel drain-induced source barrier lowering effect, threshold voltage increases with increasing drain voltage. Furthermore, for devices with either a relatively large channel width or a short channel length, the output drain current decreases instead of saturating with an increase in drain voltage. Moreover, the wider the channel and the shorter the channel length, the larger the threshold voltage and output on-state current degradation that is observed. Because of themore » surrounding oxide and other thermal insulating material and the low thermal conductivity of the IGZO layer, the self-heating effect will be pronounced in wider/shorter channel length devices and those with a larger operating drain bias. To further clarify the physical mechanism, fast I{sub D}-V{sub G} and modulated peak/base pulse time I{sub D}-V{sub D} measurements are utilized to demonstrate the self-heating induced anomalous dimension-dependent threshold voltage variation and on-state current degradation.« less

Origin of negative resistance in anion migration controlled resistive memory

NASA Astrophysics Data System (ADS)

Banerjee, Writam; Wu, Facai; Hu, Yuan; Wu, Quantan; Wu, Zuheng; Liu, Qi; Liu, Ming

2018-03-01

Resistive random access memory (RRAM) is one of the most promising emerging nonvolatile technologies for the futuristic memory devices. Resistive switching behavior often shows negative resistance (NR), either voltage controlled or current controlled. In this work, the origin of a current compliance dependent voltage controlled NR effect during the resetting of anion migration based RRAM devices is discussed. The N-type voltage controlled NR is a high field driven phenomena. The current conduction within the range of a certain negative voltage is mostly dominated by space charge limited current. But with the higher negative voltage, a field induced tunneling effect is generated in the NR region. The voltage controlled NR is strongly dependent on the compliance current. The area independent behavior indicates the filamentary switching. The peak to valley ratio (PVR) is > 5. The variation of PVR as a function of the conduction band offset is achieved. Compared to other reported works, based on the PVR, it is possible to distinguish the RRAM types. Generally, due to the higher electric field effect on the metallic bridge during RESET, the electrochemical metallization type RRAM shows much higher PVR than the valance change type RRAM.

Voltage Sensing in Membranes: From Macroscopic Currents to Molecular Motions

PubMed Central

Freites, J. Alfredo; Tobias, Douglas J.

2015-01-01

Voltage-sensing domains (VSDs) are integral membrane protein units that sense changes in membrane electric potential, and through the resulting conformational changes, regulate a specific function. VSDs confer voltage-sensitivity to a large superfamily of membrane proteins that includes voltage-gated Na+, K+, Ca2+, and H+ selective channels, hyperpolarization-activated cyclic nucleotide-gated channels, and voltage-sensing phosphatases. VSDs consist of four transmembrane segments (termed S1 through S4). Their most salient structural feature is the highly conserved positions for charged residues in their sequences. S4 exhibits at least three conserved triplet repeats composed of one basic residue (mostly arginine) followed by two hydrophobic residues. These S4 basic side chains participate in a state-dependent internal salt-bridge network with at least four acidic residues in S1–S3. The signature of voltage-dependent activation in electrophysiology experiments is a transient current (termed gating or sensing current) upon a change in applied membrane potential as the basic side chains in S4 move across the membrane electric field. Thus, the unique structural features of the VSD architecture allow for competing requirements: maintaining a series of stable transmembrane conformations, while allowing charge motion, as briefly reviewed here. PMID:25972106

Quadratic electromechanical strain in silicon investigated by scanning probe microscopy

NASA Astrophysics Data System (ADS)

Yu, Junxi; Esfahani, Ehsan Nasr; Zhu, Qingfeng; Shan, Dongliang; Jia, Tingting; Xie, Shuhong; Li, Jiangyu

2018-04-01

Piezoresponse force microscopy (PFM) is a powerful tool widely used to characterize piezoelectricity and ferroelectricity at the nanoscale. However, it is necessary to distinguish microscopic mechanisms between piezoelectricity and non-piezoelectric contributions measured by PFM. In this work, we systematically investigate the first and second harmonic apparent piezoresponses of a silicon wafer in both vertical and lateral modes, and we show that it exhibits an apparent electromechanical response that is quadratic to the applied electric field, possibly arising from ionic electrochemical dipoles induced by the charged probe. As a result, the electromechanical response measured is dominated by the second harmonic response in the vertical mode, and its polarity can be switched by the DC voltage with the evolving coercive field and maximum amplitude, in sharp contrast to typical ferroelectric materials we used as control. The ionic activity in silicon is also confirmed by the scanning thermo-ionic microscopy measurement, and the work points toward a set of methods to distinguish true piezoelectricity from the apparent ones.

Progress in the structural understanding of voltage-gated calcium channel (CaV) function and modulation.

PubMed

Minor, Daniel L; Findeisen, Felix

2010-01-01

Voltage-gated calcium channels (CaVs) are large, transmembrane multiprotein complexes that couple membrane depolarization to cellular calcium entry. These channels are central to cardiac action potential propagation, neurotransmitter and hormone release, muscle contraction, and calcium-dependent gene transcription. Over the past six years, the advent of high-resolution structural studies of CaV components from different isoforms and CaV modulators has begun to reveal the architecture that underlies the exceptionally rich feedback modulation that controls CaV action. These descriptions of CaV molecular anatomy have provided new, structure-based insights into the mechanisms by which particular channel elements affect voltage-dependent inactivation (VDI), calcium‑dependent inactivation (CDI), and calcium‑dependent facilitation (CDF). The initial successes have been achieved through structural studies of soluble channel domains and modulator proteins and have proven most powerful when paired with biochemical and functional studies that validate ideas inspired by the structures. Here, we review the progress in this growing area and highlight some key open challenges for future efforts.

Voltage-dependent gating of KCNH potassium channels lacking a covalent link between voltage-sensing and pore domains

PubMed Central

Lörinczi, Éva; Gómez-Posada, Juan Camilo; de la Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.

2015-01-01

Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4–S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4–S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules. PMID:25818916

Voltage-dependent gating of KCNH potassium channels lacking a covalent link between voltage-sensing and pore domains.

PubMed

Lörinczi, Éva; Gómez-Posada, Juan Camilo; de la Peña, Pilar; Tomczak, Adam P; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A

2015-03-30

Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.

Voltage-dependent gating of KCNH potassium channels lacking a covalent link between voltage-sensing and pore domains

NASA Astrophysics Data System (ADS)

Lörinczi, Éva; Gómez-Posada, Juan Camilo; de La Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.

2015-03-01

Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.

A voltage-controlled superconducting quantum bus

NASA Astrophysics Data System (ADS)

Casparis, Lucas; Pearson, Natalie; KringhøJ, Anders; Larsen, Thorvald; Kuemmeth, Ferdinand; Krogstrup, Peter; Nygard, Jesper; Petersson, Karl; Marcus, Charles

Superconducting qubits couple strongly to microwave photons and can therefore be coupled over long distances through a superconducting cavity acting as a quantum bus. To avoid frequency-crowding it is desirable to turn qubit coupling off while rearranging qubit frequencies. Here, we present experiments with two gatemon qubits coupled through a cavity, which can be tuned by a voltage-controlled superconducting switch. We characterize the bus tunability and demonstrate switchable qubit coupling with an on/off ratio up to 8. We find that pulsing the bus switch on nanosecond timescales results in the apparent loss of qubit coherence. Further work is needed to understand how dynamic control of the tuneable bus affects qubit operation. We acknowledge financial support from Microsoft Project Q, the Danish National Research Foundation and the US Army Research Office.

Capacitance of the Double Layer Formed at the Metal/Ionic-Conductor Interface: How Large Can It Be?

NASA Astrophysics Data System (ADS)

Skinner, Brian; Loth, M. S.; Shklovskii, B. I.

2010-03-01

The capacitance of the double layer formed at a metal/ionic-conductor interface can be remarkably large, so that the apparent width of the double layer is as small as 0.3 Å. Mean-field theories fail to explain such large capacitance. We propose an alternate theory of the ionic double layer which allows for the binding of discrete ions to their image charges in the metal. We show that at small voltages the capacitance of the double layer is limited only by the weak dipole-dipole repulsion between bound ions, and is therefore very large. At large voltages the depletion of bound ions from one of the capacitor electrodes triggers a collapse of the capacitance to the mean-field value.

Functional ion channels in human pulmonary artery smooth muscle cells: Voltage-dependent cation channels

PubMed Central

Firth, Amy L.; Remillard, Carmelle V.; Platoshyn, Oleksandr; Fantozzi, Ivana; Ko, Eun A.; Yuan, Jason X.-J.

2011-01-01

The activity of voltage-gated ion channels is critical for the maintenance of cellular membrane potential and generation of action potentials. In turn, membrane potential regulates cellular ion homeostasis, triggering the opening and closing of ion channels in the plasma membrane and, thus, enabling ion transport across the membrane. Such transmembrane ion fluxes are important for excitation–contraction coupling in pulmonary artery smooth muscle cells (PASMC). Families of voltage-dependent cation channels known to be present in PASMC include voltage-gated K+ (Kv) channels, voltage-dependent Ca2+-activated K+ (Kca) channels, L- and T- type voltage-dependent Ca2+ channels, voltage-gated Na+ channels and voltage-gated proton channels. When cells are dialyzed with Ca2+-free K+- solutions, depolarization elicits four components of 4-aminopyridine (4-AP)-sensitive Kvcurrents based on the kinetics of current activation and inactivation. In cell-attached membrane patches, depolarization elicits a wide range of single-channel K+ currents, with conductances ranging between 6 and 290 pS. Macroscopic 4-AP-sensitive Kv currents and iberiotoxin-sensitive Kca currents are also observed. Transcripts of (a) two Na+ channel α-subunit genes (SCN5A and SCN6A), (b) six Ca2+ channel α–subunit genes (α1A, α1B, α1X, α1D, α1Eand α1G) and many regulatory subunits (α2δ1, β1-4, and γ6), (c) 22 Kv channel α–subunit genes (Kv1.1 - Kv1.7, Kv1.10, Kv2.1, Kv3.1, Kv3.3, Kv3.4, Kv4.1, Kv4.2, Kv5.1, Kv 6.1-Kv6.3, Kv9.1, Kv9.3, Kv10.1 and Kv11.1) and three Kv channel β-subunit genes (Kvβ1-3) and (d) four Kca channel α–subunit genes (Sloα1 and SK2-SK4) and four Kca channel β-subunit genes (Kcaβ1-4) have been detected in PASMC. Tetrodotoxin-sensitive and rapidly inactivating Na+ currents have been recorded with properties similar to those in cardiac myocytes. In the presence of 20 mM external Ca2+, membrane depolarization from a holding potential of -100 mV elicits a rapidly inactivating T-type Ca2+ current, while depolarization from a holding potential of -70 mV elicits a slowly inactivating dihydropyridine-sensitive L-type Ca2+ current. This review will focus on describing the electrophysiological properties and molecular identities of these voltage-dependent cation channels in PASMC and their contribution to the regulation of pulmonary vascular function and its potential role in the pathogenesis of pulmonary vascular disease. PMID:21927714

Experimental investigation of mode transitions in asymmetric capacitively coupled radio-frequency Ne and CF4 plasmas

NASA Astrophysics Data System (ADS)

Liu, Gang-Hu; Liu, Yong-Xin; Bai, Li-Shui; Zhao, Kai; Wang, You-Nian

2018-02-01

The dependence of the electron density and the emission intensity on external parameters during the transitions of the electron power absorption mode is experimentally studied in asymmetric electropositive (neon) and electronegative (CF4) capacitively coupled radio-frequency plasmas. The spatio-temporal distribution of the emission intensity is measured with phase resolved optical emission spectroscopy and the electron density at the discharge center is measured by utilizing a floating hairpin probe. In neon discharge, the emission intensity increases almost linearly with the rf voltage at all driving frequencies covered here, while the variation of the electron density with the rf voltage behaves differently at different driving frequencies. In particular, the electron density increases linearly with the rf voltage at high driving frequencies, while at low driving frequencies the electron density increases slowly at the low-voltage side and, however, grows rapidly, when the rf voltage is higher than a certain value, indicating a transition from α to γ mode. The rf voltage, at which the mode transition occurs, increases with the decrease of the driving frequency/the working pressure. By contrast, in CF4 discharge, three different electron power absorption modes can be observed and the electron density and emission intensity do not exhibit a simple dependence on the rf voltage. In particular, the electron density exhibits a minimum at a certain rf voltage when the electron power absorption mode is switching from drift-ambipolar to the α/γ mode. A minimum can also be found in the emission intensity at a higher rf voltage when a discharge is switching into the γ mode.

Temperature and Voltage Coupling to Channel Opening in Transient Receptor Potential Melastatin 8 (TRPM8)*♦

PubMed Central

Raddatz, Natalia; Castillo, Juan P.; Gonzalez, Carlos; Alvarez, Osvaldo; Latorre, Ramon

2014-01-01

Expressed in somatosensory neurons of the dorsal root and trigeminal ganglion, the transient receptor potential melastatin 8 (TRPM8) channel is a Ca2+-permeable cation channel activated by cold, voltage, phosphatidylinositol 4,5-bisphosphate, and menthol. Although TRPM8 channel gating has been characterized at the single channel and macroscopic current levels, there is currently no consensus regarding the extent to which temperature and voltage sensors couple to the conduction gate. In this study, we extended the range of voltages where TRPM8-induced ionic currents were measured and made careful measurements of the maximum open probability the channel can attain at different temperatures by means of fluctuation analysis. The first direct measurements of TRPM8 channel temperature-driven conformational rearrangements provided here suggest that temperature alone is able to open the channel and that the opening reaction is voltage-independent. Voltage is a partial activator of TRPM8 channels, because absolute open probability values measured with fully activated voltage sensors are less than 1, and they decrease as temperature rises. By unveiling the fast temperature-dependent deactivation process, we show that TRPM8 channel deactivation is well described by a double exponential time course. The fast and slow deactivation processes are temperature-dependent with enthalpy changes of 27.2 and 30.8 kcal mol−1. The overall Q10 for the closing reaction is about 33. A three-tiered allosteric model containing four voltage sensors and four temperature sensors can account for the complex deactivation kinetics and coupling between voltage and temperature sensor activation and channel opening. PMID:25352597

Genetically encoded fluorescent voltage sensors using the voltage-sensing domain of Nematostella and Danio phosphatases exhibit fast kinetics.

PubMed

Baker, Bradley J; Jin, Lei; Han, Zhou; Cohen, Lawrence B; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent

2012-07-15

A substantial increase in the speed of the optical response of genetically encoded fluorescent protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1-S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tau(off)<5ms). However, the signal was small (ΔF/F=0.4%/200mV). FP voltage sensors using the D. rerio voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2ms of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. Copyright © 2012 Elsevier B.V. All rights reserved.

Equilibrium fluctuation relations for voltage coupling in membrane proteins.

PubMed

Kim, Ilsoo; Warshel, Arieh

2015-11-01

A general theoretical framework is developed to account for the effects of an external potential on the energetics of membrane proteins. The framework is based on the free energy relation between two (forward/backward) probability densities, which was recently generalized to non-equilibrium processes, culminating in the work-fluctuation theorem. Starting from the probability densities of the conformational states along the "voltage coupling" reaction coordinate, we investigate several interconnected free energy relations between these two conformational states, considering voltage activation of ion channels. The free energy difference between the two conformational states at zero (depolarization) membrane potential (i.e., known as the chemical component of free energy change in ion channels) is shown to be equivalent to the free energy difference between the two "equilibrium" (resting and activated) conformational states along the one-dimensional voltage couplin reaction coordinate. Furthermore, the requirement that the application of linear response approximation to the free energy functionals of voltage coupling should satisfy the general free energy relations, yields a novel closed-form expression for the gating charge in terms of other basic properties of ion channels. This connection is familiar in statistical mechanics, known as the equilibrium fluctuation-response relation. The theory is illustrated by considering the coupling of a unit charge to the external voltage in the two sites near the surface of membrane, representing the activated and resting states. This is done using a coarse-graining (CG) model of membrane proteins, which includes the membrane, the electrolytes and the electrodes. The CG model yields Marcus-type voltage dependent free energy parabolas for the response of the electrostatic environment (electrolytes etc.) to the transition from the initial to the final configuratinal states, leading to equilibrium free energy difference and free energy barrier that follow the trend of the equilibrium fluctuation relation and the Marcus theory of electron transfer. These energetics also allow for a direct estimation of the voltage dependence of channel activation (Q-V curve), offering a quantitative rationale for a correlation between the voltage dependence parabolas and the Q-V curve, upon site-directed mutagenesis or drug binding. Taken together, by introducing the voltage coupling as the energy gap reaction coordinate, our framework brings new perspectives to the thermodynamic models of voltage activation in voltage-sensitive membrane proteins, offering an a framework for a better understating of the structure-function correlations of voltage gating in ion channels as well as electrogenic phenomena in ion pumps and transporters. Significantly, this formulation also provides a powerful bridge between the CG model of voltage coupling and the conventional macroscopic treatments. Copyright © 2015 Elsevier B.V. All rights reserved.

Bias-dependent oscillatory electron transport of monatomic sulfur chains

NASA Astrophysics Data System (ADS)

Yu, Jing-Xin; Cheng, Yan; Sanvito, Stefano; Chen, Xiang-Rong

2012-03-01

The bias-dependent oscillatory electron transport of monatomic sulfur chains sandwiched between gold electrodes is investigated with density functional theory and non-equilibrium Green's function method. At zero bias, in contrast to the typical odd-even oscillations observed in most metallic chains, we find that the conductance oscillates with a period of four atoms. However, as the bias voltage is increased the current displays a two-atom periodicity. This emerges gradually, first for the longer chains and then, at voltages larger than 0.7 V, for lengths. The oscillatory behaviors are analyzed by the density of states and the energy-dependent and bias-dependent transmission coefficients.

Depolarization of the conductance-voltage relationship in the NaV1.5 mutant, E1784K, is due to altered fast inactivation

PubMed Central

Yu, Alec; Zhu, Wandi; Silva, Jonathan R.; Ruben, Peter C.

2017-01-01

E1784K is the most common mixed long QT syndrome/Brugada syndrome mutant in the cardiac voltage-gated sodium channel NaV1.5. E1784K shifts the midpoint of the channel conductance-voltage relationship to more depolarized membrane potentials and accelerates the rate of channel fast inactivation. The depolarizing shift in the midpoint of the conductance curve in E1784K is exacerbated by low extracellular pH. We tested whether the E1784K mutant shifts the channel conductance curve to more depolarized membrane potentials by affecting the channel voltage-sensors. We measured ionic currents and gating currents at pH 7.4 and pH 6.0 in Xenopus laevis oocytes. Contrary to our expectation, the movement of gating charges is shifted to more hyperpolarized membrane potentials by E1784K. Voltage-clamp fluorimetry experiments show that this gating charge shift is due to the movement of the DIVS4 voltage-sensor being shifted to more hyperpolarized membrane potentials. Using a model and experiments on fast inactivation-deficient channels, we show that changes to the rate and voltage-dependence of fast inactivation are sufficient to shift the conductance curve in E1784K. Our results localize the effects of E1784K to DIVS4, and provide novel insight into the role of the DIV-VSD in regulating the voltage-dependencies of activation and fast inactivation. PMID:28898267

Depolarization of the conductance-voltage relationship in the NaV1.5 mutant, E1784K, is due to altered fast inactivation.

PubMed

Peters, Colin H; Yu, Alec; Zhu, Wandi; Silva, Jonathan R; Ruben, Peter C

2017-01-01

E1784K is the most common mixed long QT syndrome/Brugada syndrome mutant in the cardiac voltage-gated sodium channel NaV1.5. E1784K shifts the midpoint of the channel conductance-voltage relationship to more depolarized membrane potentials and accelerates the rate of channel fast inactivation. The depolarizing shift in the midpoint of the conductance curve in E1784K is exacerbated by low extracellular pH. We tested whether the E1784K mutant shifts the channel conductance curve to more depolarized membrane potentials by affecting the channel voltage-sensors. We measured ionic currents and gating currents at pH 7.4 and pH 6.0 in Xenopus laevis oocytes. Contrary to our expectation, the movement of gating charges is shifted to more hyperpolarized membrane potentials by E1784K. Voltage-clamp fluorimetry experiments show that this gating charge shift is due to the movement of the DIVS4 voltage-sensor being shifted to more hyperpolarized membrane potentials. Using a model and experiments on fast inactivation-deficient channels, we show that changes to the rate and voltage-dependence of fast inactivation are sufficient to shift the conductance curve in E1784K. Our results localize the effects of E1784K to DIVS4, and provide novel insight into the role of the DIV-VSD in regulating the voltage-dependencies of activation and fast inactivation.

Large Magnetoresistance at High Bias Voltage in Double-layer Organic Spin Valves

NASA Astrophysics Data System (ADS)

Subedi, R. C.; Liang, S. H.; Geng, R.; Zhang, Q. T.; Lou, L.; Wang, J.; Han, X. F.; Nguyen, T. D.

We report studies of magnetoresistance (MR) in double-layer organic spin valves (DOSV) using tris (8-hydroxyquinolinato) aluminum (Alq3) spacers. The device exhibits three distinct resistance levels depending on the relative magnetizations of the ferromagnetic electrodes. We observed a much weaker bias voltage dependence of MR in the device compared to that in the conventional organic spin valve (OSV). The MR magnitude reduces by the factor of two at 0.7 V bias voltage in the DOSV compared to 0.02 V in the conventional OSV. Remarkably, the MR magnitude reaches 0.3% at 6 V bias in the DOSVs, the largest MR response ever reported in OSVs at this bias. Our finding may have a significant impact on achieving high efficient bipolar OSVs strictly performed at high voltages. University of Georgia start-up fund, Ministry of Education, Singapore, National Natural Science Foundation of China.

Effect of inductive and capacitive coupling on the current–voltage characteristic and electromagnetic radiation from a system of Josephson junctions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rahmonov, I. R., E-mail: rahmonov@theor.jinr.ru, E-mail: ilhom-tj@inbox.ru; Shukrinov, Yu. M.; Atanasova, P. Kh.

We have studied the current–voltage characteristic of a system of long Josephson junctions taking into account the inductive and capacitive coupling. The dependence of the average time derivative of the phase difference on the bias current and spatiotemporal dependences of the phase difference and magnetic field in each junction are considered. The possibility of branching of the current–voltage characteristic in the region of zero field step, which is associated with different numbers of fluxons in individual Josephson junctions, is demonstrated. The current–voltage characteristic of the system of Josephson junctions is compared with the case of a single junction, and itmore » is shown that the observed branching is due to coupling between the junctions. The intensity of electromagnetic radiation associated with motion of fluxons is calculated, and the effect of coupling between junctions on the radiation power is analyzed.« less

Modulation of Kv4.2 channels by a peptide isolated from the venom of the giant bird-eating tarantula Theraphosa leblondi.

PubMed

Ebbinghaus, Jan; Legros, Christian; Nolting, Andreas; Guette, Catherine; Celerier, Marie-Louise; Pongs, Olaf; Bähring, Robert

2004-06-15

In order to find new peptide inhibitors for voltage-dependent potassium (Kv) channels, we examined the effects of venom from Theraphosa leblondi on Kv channel-mediated currents with the whole-cell patch-clamp technique. Both A-type currents in cultured hippocampal neurons and A-type currents recorded from HEK 293 cells transiently expressing recombinant Kv4.2 channels were selectively inhibited by T. leblondi venom. No venom activity was observed on recombinant Kv1.3, Kv1.4, Kv2.1 or Kv3.4 channels. We purified and sequenced three novel homologous peptides from this venom, which are related to previously identified Kv4 channel-specific peptide inhibitors and were named T. leblondi toxin (TLTx) 1, 2 and 3. The mode of action of TLTx1 on recombinant Kv4.2 channels was studied in more detail. TLTx1 inhibited Kv4.2-mediated currents with an IC50 of approximately 200 nM, and macroscopic current inactivation was slowed in the presence of TLTx1. Notably, TLTx1 also caused a shallower voltage dependence of Kv4.2 peak conductance and a shift of the activation midpoint to more positive potentials (DeltaV1/2 = +35 mV). TLTx1 caused a noticable slowing of Kv4.2 activation kinetics, and Kv4.2 deactivation kinetics were accelerated by TLTx1 as infered from Rb+ tail current measurements. Chimeric Kv2.1(4.2L3-4) channels, in which the linker region between S3 and S4 of the TLTx1-insensitive Kv2.1 channel was replaced by the corresponding Kv4.2 domain, were sensitive to TLTx1. Apparently, TLTx1 can act as a gating modifier of Kv4.2 channels. Copyright 2004 Elsevier Ltd.

Interaction between permeation and gating in a putative pore domain mutant in the cystic fibrosis transmembrane conductance regulator.

PubMed Central

Zhang, Z R; McDonough, S I; McCarty, N A

2000-01-01

The cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel with distinctive kinetics. At the whole-cell level, CFTR currents in response to voltage steps are time independent for wild type and for the many mutants reported so far. Single channels open for periods lasting up to tens of seconds; the openings are interrupted by brief closures at hyperpolarized, but not depolarized, potentials. Here we report a serine-to-phenylalanine mutation (S1118F) in the 11th transmembrane domain that confers voltage-dependent, single-exponential current relaxations and moderate inward rectification of the macroscopic currents upon expression in Xenopus oocytes. At steady state, the S1118F-CFTR single-channel conductance rectifies, corresponding to the whole-cell rectification. In addition, the open-channel burst duration is decreased 10-fold compared with wild-type channels. S1118F-CFTR currents are blocked in a voltage-dependent manner by diphenylamine-2-carboxylate (DPC); the affinity of S1118F-CFTR for DPC is similar to that of the wild-type channel, but blockade exhibits moderately reduced voltage dependence. Selectivity of the channel to a range of anions is also affected by this mutation. Furthermore, the permeation properties change during the relaxations, which suggests that there is an interaction between gating and permeation in this mutant. The existence of a mutation that confers voltage dependence upon CFTR currents and that changes kinetics and permeation properties of the channel suggests a functional role for the 11th transmembrane domain in the pore in the wild-type channel. PMID:10866956

Structural Implications of Fluorescence Quenching in the Shaker K+ Channel

PubMed Central

Cha, Albert; Bezanilla, Francisco

1998-01-01

When attached to specific sites near the S4 segment of the nonconducting (W434F) Shaker potassium channel, the fluorescent probe tetramethylrhodamine maleimide undergoes voltage-dependent changes in intensity that correlate with the movement of the voltage sensor (Mannuzzu, L.M., M.M. Moronne, and E.Y. Isacoff. 1996. Science. 271:213–216; Cha, A., and F. Bezanilla. 1997. Neuron. 19:1127–1140). The characteristics of this voltage-dependent fluorescence quenching are different in a conducting version of the channel with a different pore substitution (T449Y). Blocking the pore of the T449Y construct with either tetraethylammonium or agitoxin removes a fluorescence component that correlates with the voltage dependence but not the kinetics of ionic activation. This pore-mediated modulation of the fluorescence quenching near the S4 segment suggests that the fluorophore is affected by the state of the external pore. In addition, this modulation may reflect conformational changes associated with channel opening that are prevented by tetraethylammonium or agitoxin. Studies of pH titration, collisional quenchers, and anisotropy indicate that fluorophores attached to residues near the S4 segment are constrained by a nearby region of protein. The mechanism of fluorescence quenching near the S4 segment does not involve either reorientation of the fluorophore or a voltage-dependent excitation shift and is different from the quenching mechanism observed at a site near the S2 segment. Taken together, these results suggest that the extracellular portion of the S4 segment resides in an aqueous protein vestibule and is influenced by the state of the external pore. PMID:9758859

Nitric oxide augments voltage-activated calcium currents of crustacea (Idotea baltica) skeletal muscle.

PubMed

Erxleben, C; Hermann, A

2001-03-16

Invertebrate skeletal muscle contraction is regulated by calcium influx through voltage-dependent calcium channels in the sarcolemmal membrane. In present study we investigated the effects of nitric oxide (NO) donors on calcium currents of single skeletal muscle fibres from the marine isopod, Idotea baltica, using two-electrode voltage clamp recording techniques. The NO donors, S-nitrosocysteine, S-nitroso-N-acetyl-penicillamine or hydroxylamine reversibly increased calcium inward currents in a time dependent manner. The increase of the current was prevented by methylene blue. Our experiments suggest that NO increases calcium inward currents. NO, by acting on calcium ion channels in the sarcolemmal membrane, therefore, may directly be involved in the modulation of muscle contraction.

Direct Analysis of JV-Curves Applied to an Outdoor-Degrading CdTe Module (Presentation)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jordan, D; Kurtz, S.; Ulbrich, C.

2014-03-01

We present the application of a phenomenological four parameter equation to fit and analyze regularly measured current density-voltage JV curves of a CdTe module during 2.5 years of outdoor operation. The parameters are physically meaningful, i.e. the short circuit current density Jsc, open circuit voltage Voc and differential resistances Rsc, and Roc. For the chosen module, the fill factor FF degradation overweighs the degradation of Jsc and Voc. Interestingly, with outdoor exposure, not only the conductance at short circuit, Gsc, increases but also the Gsc(Jsc)-dependence. This is well explained with an increase in voltage dependent charge carrier collection in CdTe.

Faster voltage-dependent activation of Na+ channels in growth cones versus somata of neuroblastoma N1E-115 cells.

PubMed Central

Zhang, J; Loew, L M; Davidson, R M

1996-01-01

Kinetics of voltage-gated ionic channels fundamentally reflect the response of the channels to local electric fields. In this report cell-attached patch-clamp studies reveal that the voltage-dependent activation rate of sodium channels residing in the growth cone membrane differs from that of soma sodium channels in differentiating N1E-115 neuroblastoma cells. Because other electrophysiological properties of these channels do not differ, this finding may be a reflection of the difference in intramembrane electric field in these two regions of the cell. This represents a new mechanism for channels to attain a range of activities both within and between cells. PMID:8913589

Faster voltage-dependent activation of Na+ channels in growth cones versus somata of neuroblastoma N1E-115 cells.

PubMed

Zhang, J; Loew, L M; Davidson, R M

1996-11-01

Kinetics of voltage-gated ionic channels fundamentally reflect the response of the channels to local electric fields. In this report cell-attached patch-clamp studies reveal that the voltage-dependent activation rate of sodium channels residing in the growth cone membrane differs from that of soma sodium channels in differentiating N1E-115 neuroblastoma cells. Because other electrophysiological properties of these channels do not differ, this finding may be a reflection of the difference in intramembrane electric field in these two regions of the cell. This represents a new mechanism for channels to attain a range of activities both within and between cells.

Electric-regulated enhanced in-plane uniaxial anisotropy in FeGa/PMN-PT composite using oblique pulsed laser deposition

NASA Astrophysics Data System (ADS)

Zhang, Yi; Huang, Chaojuan; Turghun, Mutellip; Duan, Zhihua; Wang, Feifei; Shi, Wangzhou

2018-04-01

The FeGa film with in-plane uniaxial magnetic anisotropy was fabricated onto different oriented single-crystal lead magnesium niobate-lead titanate using oblique pulsed laser deposition. An enhanced in-plane uniaxial magnetic anisotropy field of FeGa film can be adjusted from 18 Oe to 275 Oe by tuning the oblique angle and polarizing voltage. The competitive relationship of shape anisotropy and strain anisotropy has been discussed, which was induced by oblique angle and polarizing voltage, respectively. The (100)-oriented and (110)-oriented PMN-PT show completely different characters on voltage-dependent magnetic properties, which could be attributed to various anisotropy directions depended on different strain directions.

Electric field-induced ferromagnetic resonance in a CoFeB/MgO magnetic tunnel junction under dc bias voltages

NASA Astrophysics Data System (ADS)

Kanai, Shun; Gajek, Martin; Worledge, D. C.; Matsukura, Fumihiro; Ohno, Hideo

2014-12-01

We measure homodyne-detected ferromagnetic resonance (FMR) induced by the electric-field effect in a CoFeB/MgO/CoFeB magnetic tunnel junction (MTJ) with perpendicular magnetic easy axis under dc bias voltages up to 0.1 V. From the bias dependence of the resonant frequency, we find that the first order perpendicular magnetic anisotropy is modulated by the applied electric field, whereas the second order component is virtually independent of the electric field. The lineshapes of the FMR spectra are bias dependent, which are explained by the combination of electric-field effect and reflection of the bias voltage from the MTJ.

Electric characteristics of a surface barrier discharge with a plasma induction electrode

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alemskii, I. N.; Lelevkin, V. M.; Tokarev, A. V.

2006-07-15

Static and dynamic current-voltage and charge-voltage characteristics of a surface barrier discharge with a plasma induction electrode have been investigated experimentally. The dependences of the discharge current on both the gas pressure in the induction electrode tube and the winding pitch of the corona electrode, as well as of the discharge power efficiency on the applied voltage, have been measured.

Scaling effects of a graphene field effect transistor for radiation detection

NASA Astrophysics Data System (ADS)

Shollar, Zachary Frank

Radiation detectors based on graphene is a burgeoning research topic within the immense field of graphene research. Although papers continue to parse out their mysteries, the devices remain simplistic and small. New fabrication techniques have allowed for millimeter scale and larger monolayer graphene sheets to be grown with increasingly better quality. It is the goal of this thesis to investigate the scaling effects of millimeter scale graphene for radiation detection purposes. To this end, chemical vapor deposition grown monolayer graphene was purchased and transferred to Si/SiO2 substrates. The devices were patterned into simple rectangular strips varying in size from 3000 x 500 mum, 600 x 100 mum, 300 x 50 mum, and 60 x 11 mum. Four metal contacts were patterned onto each strip for electrical characterization. Two probe resistance measurements were performed on all four sizes, at three different lengths along the graphene. Using the field effect, the graphene resistance response was measured at 0 V back-gate voltage to obtain graphene resistivity on SiO2, which showed an increase in resistivity as the graphene strip size increased. Further, the response was measured for varying back-gate sweep ranges and speeds. This lead to the conclusion that strong p-doping was inherent in the graphene strips, as evidenced by charge neutral points located above +50 V. Strong hysteresis observed in those tests alluded to trapped charge having a major effect on voltage sweeps. Mobility values for the graphene strips were extracted from the back-gate voltage sweeps and fixed gate voltage stabilization curves. Mobility values overall were less than 400 cm2 V-1 s-1, and showed a modest increase in mobility as graphene length increased. Lastly, the largest graphene strip had a light response and radiation response measured. Light response showed a dependence on gate voltage magnitude that favored positive gate voltages, on an n-type Silicon substrate. A saturation effect above +15 V seemed apparent with a resistance increase of only 0.61% +/- 0.062% for +15 V to 0.69% +/- 0.097% for the +50 V back-gate. Response of the largest graphene strip size to forward facing alpha irradiation showed a modest 0.32% +/- 0.082% increase in response, for a -15 V back- gate. Overall, millimeter scale graphene field effect devices showed a light and radiation response, proving their viability. However, results showed fabricated samples had numerous defects and were far from pristine. Fabrication of pristine graphene strips at millimeter scales is of concern. Further work into large scale GFET patterning, testing at more length and width dimensions, and further investigating metal contact and carrier transport in millimeter scales is needed.

Tonic dopamine induces persistent changes in the transient potassium current through translational regulation

PubMed Central

Rodgers, EW; Krenz, W-D; Baro, DJ

2012-01-01

Neuromodulatory effects can vary with their mode of transmission. Phasic release produces local and transient increases in dopamine (DA) up to micromolar concentrations. Additionally, since DA is released from open synapses and reuptake mechanisms are not nearby, tonic nanomolar DA exists in the extracellular space. Do phasic and tonic transmissions similarly regulate voltage dependent ionic conductances in a given neuron? It was previously shown that DA could immediately alter the transient potassium current (IA) of identified neurons in the stomatogastric ganglion (STG) of the spiny lobster, Panulirus interruptus. Here we show that DA can also persistently alter IA, and that DA’s immediate and persistent effects oppose one another. The lateral pyloric neuron (LP) exclusively expresses type 1 DA receptors (D1Rs). Micromolar DA produces immediate depolarizing shifts in the voltage dependence of LP IA, whereas tonic nanomolar DA produces a persistent increase in LP IA maximal conductance (Gmax) through a translation dependent mechanism involving target of rapamycin (TOR). The pyloric dilator neuron (PD) exclusively expresses type 2 DA receptors (D2Rs). Micromolar DA produces an immediate hyperpolarizing shift in PD IA voltage dependence of activation, whereas tonic DA persistently decreases PD IA Gmax through a translation dependent mechanism not involving TOR. The persistent effects on IA Gmax do not depend on LP or PD activity. These data suggest a role for tonic modulators in the regulation of voltage gated ion channel number; and furthermore, that dopaminergic systems may be organized to limit the amount of change they can impose on a circuit. PMID:21917788

Comparison of simulations to experiment for a detailed analysis of space-charge-limited transient current measurements in organic semiconductors

NASA Astrophysics Data System (ADS)

Szymanski, Marek Z.; Kulszewicz-Bajer, Irena; Faure-Vincent, Jérôme; Djurado, David

2012-05-01

Space-charge-limited current transients (also referred as time resolved dark injection) is an attractive technique for mobility measurements in low mobility materials, particularly the organic semiconductors. Transients are generally analyzed in terms of the Many-Rakavy theory, which is an approximate analytical solution of the time-dependent drift-diffusion problem after application of a voltage step. In this contribution, we perform full time-dependent drift-diffusion simulation and compare simulated and experimental transients measured on a sample of triaryl-amine based electroactive dendrimer (experimental conditions: μ≈10-5 cm2/(Vs), L=300 nm, E<105 V/cm). We have found that the Many-Rakavy theory is indeed valid for estimating the mobility value, but it fails to predict quantitatively the time-dependent current response. In order to obtain a good agreement in between simulation and experiment, trapping and quasi-ohmic contact models were needed to be taken into account. In the case of the studied electroactive dendrimer, the experimental results were apparently consistent with the constant mobility Many-Rakavy theory, but with this model, a large uncertainty of 20% was found for the mobility value. We show that this uncertainty can be significantly reduced to 10% if a field-dependent mobility is taken into account in the framework of the extended Gaussian disorder model. Finally, we demonstrate that this fitting procedure between simulated and experimental transient responses also permits to unambiguously provide the values of the contact barrier, the trap concentration, the trap depth in addition to that of the mobility of carriers.

Compatibility of Automatic Exposure Control with New Screen Phosphors in Diagnostic Roentgenography.

NASA Astrophysics Data System (ADS)

Mulvaney, James Arthur

1982-03-01

Automatic exposure control systems are used in diagnostic roentgenography to obtain proper film density for a variety of patient examinations and roentgenographic techniques. Most automatic exposure control systems have been designed for use with par speed, calcium tungstate intensifying screens. The use of screens with faster speeds and new phosphor materials has put extreme demands on present systems. The performance of a representative automatic exposure control system is investigated to determine its ability to maintain constant film density over a wide range of x-ray tube voltages and acrylic phantom thicknesses with four different intensifying screen phosphors. The effects of x-ray energy dependence, generator switching time and stored change are investigated. The system is able to maintain film density to within plus or minus 0.2 optical density units for techniques representing adult patients. A single nonadjustable tube voltage compensation circuit is adequate for the four different screen phosphors for x-ray tube voltages above sixty peak kilovolts. For techniques representing pediatric patients at high x-ray tube voltages, excess film density occurs due to stored charge in the transformer and high-voltage cables. An anticipation circuit in the automatic exposure control circuit can be modified to correct for stored charge effects. In a separate experiment the energy dependence of three different ionization chamber detectors used in automatic exposure control systems is compared directly with the energy dependence of three different screen phosphors. The data on detector sensitivity and screen speed are combined to predict the best tube voltage compensation for each combination of screen and detector.

Autoradiographic localization of voltage-dependent sodium channels on the mouse neuromuscular junction using /sup 125/I-alpha scorpion toxin. I. Preferential labeling of glial cells on the presynaptic side

DOE Office of Scientific and Technical Information (OSTI.GOV)

Boudier, J.L.; Jover, E.; Cau, P.

1988-05-01

Alpha-scorpion toxins bind specifically to the voltage-sensitive sodium channel in excitable membranes, and binding is potential-dependent. The radioiodinated toxin II from the scorpion Androctonus australis Hector (alpha ScTx) was used to localize voltage-sensitive sodium channels on the presynaptic side of mouse neuromuscular junctions (NMJ) by autoradiography using both light and electron microscopy. Silver grain localization was analyzed by the cross-fire method. At the light-microscopic level, grain density over NMJ appeared 6-8x higher than over nonjunctional muscle membrane. The specificity of labeling was verified by competition/displacement with an excess of native alpha ScTx. Labeling was also inhibited by incubation in depolarizingmore » conditions, showing its potential-dependence. At the electron-microscopic level, analysis showed that voltage-sensitive sodium channels labeled with alpha ScTx were almost exclusively localized on membranes, as expected. Due to washout after incubation, appreciable numbers of binding sites were not found on the postsynaptic membranes. However, on the presynaptic side, alpha ScTx-labeled voltage-sensitive sodium channels were localized on the membrane of non-myelin-forming Schwann cells covering NMJ. The axonal presynaptic membrane was not labeled. These results show that voltage-sensitive sodium channels are present on glial cells in vivo, as already demonstrated in vitro. It is proposed that these glial channels could be indirectly involved in the ionic homeostasis of the axonal environment.« less

Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe1.64Ga0.36O3 oxide

NASA Astrophysics Data System (ADS)

Bhowmik, R. N.; Vijayasri, G.

2015-06-01

We have studied current-voltage (I-V) characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (˜500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

Separate Cl^- Conductances Activated by cAMP and Ca2+ in Cl^--Secreting Epithelial Cells

NASA Astrophysics Data System (ADS)

Cliff, William H.; Frizzell, Raymond A.

1990-07-01

We studied the cAMP- and Ca2+-activated secretory Cl^- conductances in the Cl^--secreting colonic epithelial cell line T84 using the whole-cell patch-clamp technique. Cl^- and K^+ currents were measured under voltage clamp. Forskolin or cAMP increased Cl^- current 2-15 times with no change in K^+ current. The current-voltage relation for cAMP-activated Cl^- current was linear from -100 to +100 mV and showed no time-dependent changes in current during voltage pulses. Ca2+ ionophores or increased pipette Ca2+ increased both Cl^- and K^+ currents 2-30 times. The Ca2+-activated Cl^- current was outwardly rectified, activated during depolarizing voltage pulses, and inactivated during hyperpolarizing voltage pulses. Addition of ionophore after forskolin further increased Cl^- conductance 1.5-5 times, and the current took on the time-dependent characteristics of that stimulated by Ca2+. Thus, cAMP and Ca2+ activate Cl^- conductances with different properties, implying that these second messengers activate different Cl^- channels or that they induce different conductive and kinetic states in the same Cl^- channel.

Carvacrol modulates voltage-gated sodium channels kinetics in dorsal root ganglia.

PubMed

Joca, Humberto Cavalcante; Vieira, Daiana Cardoso Oliveira; Vasconcelos, Aliny Perreira; Araújo, Demetrius Antônio Machado; Cruz, Jader Santos

2015-06-05

Recent studies have shown that many of plant-derived compounds interact with specific ion channels and thereby modulate many sensing mechanisms, such as nociception. The monoterpenoid carvacrol (5-isopropyl-2-methylphenol) has an anti-nociceptive effect related to a reduction in neuronal excitability and voltage-gated Na(+) channels (NaV) inhibition in peripheral neurons. However, the detailed mechanisms of carvacrol-induced inhibition of neuronal NaV remain elusive. This study explores the interaction between carvacrol and NaV in isolated dorsal root ganglia neurons. Carvacrol reduced the total voltage-gated Na(+) current and tetrodotoxin-resistant (TTX-R) Na(+) current component in a concentration-dependent manner. Carvacrol accelerates current inactivation and induced a negative-shift in voltage-dependence of steady-state fast inactivation in total and TTX-R Na(+) current. Furthermore, carvacrol slowed the recovery from inactivation. Carvacrol provoked a leftward shift in both the voltage-dependence of steady-state inactivation and activation of the TTX-R Na(+) current component. In addition, carvacrol-induced inhibition of TTX-R Na(+) current was enhanced by an increase in stimulation frequency and when neurons were pre-conditioned with long depolarization pulse (5s at -50 mV). Taken all results together, we herein demonstrated that carvacrol affects NaV gating properties. The present findings would help to explain the mechanisms underlying the analgesic activity of carvacrol. Copyright © 2015 Elsevier B.V. All rights reserved.

Elevated Neuronal Excitability Due to Modulation of the Voltage-Gated Sodium Channel Nav1.6 by Aβ1−42

PubMed Central

Wang, Xi; Zhang, Xiao-Gang; Zhou, Ting-Ting; Li, Na; Jang, Chun-Yan; Xiao, Zhi-Cheng; Ma, Quan-Hong; Li, Shao

2016-01-01

Aberrant increases in neuronal network excitability may contribute to the cognitive deficits in Alzheimer's disease (AD). However, the mechanisms underlying hyperexcitability are not fully understood. Such overexcitation of neuronal networks has been detected in the brains of APP/PS1 mice. In the present study, using current-clamp recording techniques, we observed that 12 days in vitro (DIV) primary cultured pyramidal neurons from P0 APP/PS1 mice exhibited a more prominent action potential burst and a lower threshold than WT littermates. Moreover, after treatment with Aβ1−42 peptide, 12 DIV primary cultured neurons showed similar changes, to a greater degree than in controls. Voltage-clamp recordings revealed that the voltage-dependent sodium current density of neurons incubated with Aβ1−42 was significantly increased, without change in the voltage-dependent sodium channel kinetic characteristics. Immunohistochemistry and western blot results showed that, after treatment with Aβ1−42, expressions of Nav and Nav1.6 subtype increased in cultured neurons or APP/PS1 brains compared to control groups. The intrinsic neuronal hyperexcitability of APP/PS1 mice might thus be due to an increased expression of voltage-dependent sodium channels induced by Aβ1−42. These results may illuminate the mechanism of aberrant neuronal networks in AD. PMID:27013956

Electrically Tunable Mid-Infrared Single-Mode High-Speed Semiconductor Laser

DTIC Science & Technology

2010-11-01

effective and the net tunnel rate may decrease in spite of progressing carrier density buildup in the accumulation well. Enforcing the bias current at...In te ns ity , a .u . E, eV Regular ICL Figure 4 The dependence of the electroluminescence (EL) quantum energy on the bias voltage for a...spectral maximum energy increases linearly with the bias voltage. Since the dependence is measured in the sub-threshold pumping region, the linear

Lack of voltage-dependent calcium channel opening during the calcium influx induced by progesterone in human sperm. Effect of calcium channel deactivation and inactivation.

PubMed

Guzmán-Grenfell, Alberto Martín; González-Martínez, Marco T

2004-01-01

Progesterone induces calcium influx and acrosomal exocytosis in human sperm. Pharmacologic evidence suggests that voltage-dependent calcium channels (VDCCs) are involved. In this study, membrane potential (Vm) and intracellular calcium concentration ([Ca(2+)](i)) were monitored simultaneously to assess the effect of VDCC gating on the calcium influx triggered by progesterone. Holding the Vm to values that maintained VDCCs in a deactivated (-71 mV) closed state inhibited the calcium influx induced by progesterone by approximately 40%. At this Vm, the acrosomal reaction induced by progesterone, but not by A23187, was inhibited. However, when the Vm was held at -15 mV (which maintains VDCCs in an inactivated closed state), the progesterone-induced calcium influx was stimulated. Furthermore, the progesterone and voltage-dependent calcium influxes were additive. These findings indicate that progesterone does not produce VDCC gating in human sperm.

Field-Polarity-Dependent Domain Growth in Epitaxial BaTiO 3 Films

DOE Office of Scientific and Technical Information (OSTI.GOV)

Roth, Robert; Guo, Er-Jia; Rafique, Mohsin

The growth of circular tip-induced domains has been studied in epitaxial BaTiO 3 (BTO) films as a function of writing voltage and time using piezoresponse force microscopy (PFM). While abundant for Pb(Zr,Ti)O 3 (PZT) films, such studies are rare for BTO. Strong relaxation of written domains is observed in the form of reduction of the PFM amplitude inside the area of written domains which occurs additionally to a decrease of the domain radius. The domain wall velocity observed for negative tip voltage is systematically smaller than that for positive tip voltage. Based on maps of the positive and negative switchingmore » fields, the effective driving field for both polarities has been estimated. The polarity-dependent effective field cannot account for the different velocities, indicating a polarity-dependent mobility of the domain walls.« less

Field-Polarity-Dependent Domain Growth in Epitaxial BaTiO 3 Films

DOE PAGES

Roth, Robert; Guo, Er-Jia; Rafique, Mohsin; ...

2018-03-23

The growth of circular tip-induced domains has been studied in epitaxial BaTiO 3 (BTO) films as a function of writing voltage and time using piezoresponse force microscopy (PFM). While abundant for Pb(Zr,Ti)O 3 (PZT) films, such studies are rare for BTO. Strong relaxation of written domains is observed in the form of reduction of the PFM amplitude inside the area of written domains which occurs additionally to a decrease of the domain radius. The domain wall velocity observed for negative tip voltage is systematically smaller than that for positive tip voltage. Based on maps of the positive and negative switchingmore » fields, the effective driving field for both polarities has been estimated. The polarity-dependent effective field cannot account for the different velocities, indicating a polarity-dependent mobility of the domain walls.« less

Voltage activation and hysteresis of the non-selective voltage-dependent channel in the intact human red cell.

PubMed

Bennekou, Poul; Barksmann, Trine L; Jensen, Lars R; Kristensen, Berit I; Christophersen, Palle

2004-05-01

Suspension of intact human red cells in media with low chloride and sodium concentrations (isotonic sucrose substitution) results in strongly inside positive membrane potentials, which activate the voltage-dependent non-selective cation (NSVDC) channel. By systematic variation of the initial Nernst potentials for chloride (degree of ion substitution) as well as the chloride conductance (block by NS1652), and by exploiting the interplay between the Ca(2+)-permeable NSVDC channel, the Ca(2+)-activated K+ channel (the Gárdos channel) and the Ca(2+)-pump, a graded activation of the NSVDC channel was achieved. Under these conditions, it was shown that the NSVDC channels exist in two states of activation depending on the initial conditions for the activation. The hysteretic behaviour, which in patch clamp experiments has been found for the individual channel unit, is thus retained at the cellular level and can be demonstrated with red cells in suspension.

Recombination in liquid-filled ionization chambers beyond the Boag limit

DOE Office of Scientific and Technical Information (OSTI.GOV)

Brualla-González, L.; Roselló, J.

Purpose: The high mass density and low mobilities of charge carriers can cause important recombination in liquid-filled ionization chambers (LICs). Saturation correction methods have been proposed for LICs. Correction methods for pulsed irradiation are based on Boag equation. However, Boag equation assumes that the charge ionized by one pulse is fully collected before the arrival of the next pulse. This condition does not hold in many clinical beams where the pulse repetition period may be shorter than the charge collection time, causing overlapping between charge carriers ionized by different pulses, and Boag equation is not applicable there. In this work,more » the authors present an experimental and numerical characterization of collection efficiencies in LICs beyond the Boag limit, with overlapping between charge carriers ionized by different pulses. Methods: The authors have studied recombination in a LIC array for different dose-per-pulse, pulse repetition frequency, and polarization voltage values. Measurements were performed in a Truebeam Linac using FF and FFF modalities. Dose-per-pulse and pulse repetition frequency have been obtained by monitoring the target current with an oscilloscope. Experimental collection efficiencies have been obtained by using a combination of the two-dose-rate method and ratios to the readout of a reference chamber (CC13, IBA). The authors have also used numerical simulation to complement the experimental data. Results: The authors have found that overlap significantly increases recombination in LICs, as expected. However, the functional dependence of collection efficiencies on the dose-per-pulse does not change (a linear dependence has been observed in the near-saturation region for different degrees of overlapping, the same dependence observed in the nonoverlapping scenario). On the other hand, the dependence of collection efficiencies on the polarization voltage changes in the overlapping scenario and does not follow that of Boag equation, the reason being that changing the polarization voltage also affects the charge collection time, thus changing the amount of overlapping. Conclusions: These results have important consequences for saturation correction methods for LICs. On one hand, the two-dose-rate method, which relies on the functional dependence of the collection efficiencies on dose-per-pulse, can also be used in the overlapping situation, provided that the two measurements needed to feed the method are performed at the same pulse repetition frequency (monitor unit rate). This result opens the door to computing collection efficiencies in LICs in many clinical setups where charge overlap in the LIC exists. On the other hand, correction methods based on the voltage-dependence of Boag equation like the three-voltage method or the modified two-voltage method will not work in the overlapping scenario due to the different functional dependence of collection efficiencies on the polarization voltage.« less

Commercial Building Motor Protection Response Report

DOE Office of Scientific and Technical Information (OSTI.GOV)

James, Daniel P.; Kueck, John

2015-06-17

When voltages recover, motors may immediately reenergize and reaccelerate, or delay for a few minutes, or stay stalled. The estimated motor response is given for both the voltage sag magnitude and voltage sag duration. These response estimates are based on experience and available test data. Good data is available for voltage sag response for many components such as relays and contactors, but little data is available for both voltage sag and recovery response. The tables in Appendix A include data from recent voltage sag and recovery tests performed by SCE and BPA on air conditioners and energy management systems. Themore » response of the motor can vary greatly depending on the type of protection and control. The time duration for the voltage sag consists of those times that are of interest for bulk power system modelers.« less

Solid state safety jumper cables

DOEpatents

Kronberg, James W.

1993-01-01

Solid state jumper cables for connecting two batteries in parallel, having two bridge rectifiers for developing a reference voltage, a four-input decoder for determining which terminals are to be connected based on a comparison of the voltage at each of the four terminals to the reference voltage, and a pair of relays for effecting the correct connection depending on the determination of the decoder. No connection will be made unless only one terminal of each battery has a higher voltage than the reference voltage, indicating "positive" terminals, and one has a lower voltage than the reference voltage, indicating "negative" terminals, and that, therefore, the two high voltage terminals may be connected and the two lower voltage terminals may be connected. Current flows once the appropriate relay device is closed. The relay device is preferably a MOSFET (metal oxide semiconductor field effect transistor) combined with a series array of photodiodes that develop MOSFET gate-closing potential when the decoder output causes an LED to light.

Solid state safety jumper cables

DOEpatents

Kronberg, J.W.

1993-02-23

Solid state jumper cables for connecting two batteries in parallel, having two bridge rectifiers for developing a reference voltage, a four-input decoder for determining which terminals are to be connected based on a comparison of the voltage at each of the four terminals to the reference voltage, and a pair of relays for effecting the correct connection depending on the determination of the decoder. No connection will be made unless only one terminal of each battery has a higher voltage than the reference voltage, indicating positive'' terminals, and one has a lower voltage than the reference voltage, indicating negative'' terminals, and that, therefore, the two high voltage terminals may be connected and the two lower voltage terminals may be connected. Current flows once the appropriate relay device is closed. The relay device is preferably a MOSFET (metal oxide semiconductor field effect transistor) combined with a series array of photodiodes that develop MOSFET gate-closing potential when the decoder output causes an LED to light.

Voltage-clamp analysis of membrane currents and excitation-contraction coupling in a crustacean muscle.

PubMed

Weiss, T; Erxleben, C; Rathmayer, W

2001-01-01

A single fibre preparation from the extensor muscle of a marine isopod crustacean is described which allows the analysis of membrane currents and simultaneously recorded contractions under two-electrode voltage-clamp conditions. We show that there are three main depolarisation-gated currents, two are outward and carried by K+, the third is an inward Ca2+ current, I(Ca). Normally, the K+ currents which can be isolated by using K+ channel blockers, mask I(Ca). I(Ca) activates at potentials more positive than -40 mV, is maximal around 0 mV, and shows strong inactivation at higher depolarisation. Inactivation depends on current rather than voltage. Ba2+, Sr2+ and Mg2+ can substitute for Ca2+. Ba2+ currents are about 80% larger than Ca2+ currents and inactivate little. The properties of I(Ca) characterise it as a high threshold L-type current. The outward current consists primarily of a fast, transient A current, I(K(A)) and a maintained, delayed rectifier current, I(K(V)). In some fibres, a small Ca2+-dependent K+ current is also present. I(K(A)) activates fast at depolarisation above -45 mV, shows pronounced inactivation and is almost completely inactivated at holding potentials more positive than -40 mV. I(K(A)) is half-maximally blocked by 70 microM 4-aminopyridine (4-AP), and 70 mM tetraethylammonium (TEA). I(K(V)) activates more slowly, at about -30 mV, and shows no inactivation. It is half-maximally blocked by 2 mM TEA but rather insensitive to 4-AP. Physiologically, the two K+ currents prevent all-or-nothing action potentials and determine the graded amplitude of active electrical responses and associated contractions. Tension development depends on and is correlated with depolarisation-induced Ca2+ influx mediated by I(Ca). The voltage dependence of peak tension corresponds directly to the voltage dependence of the integrated I(Ca). The threshold potential for contraction is at about -38 mV. Peak tension increases with increasing voltage steps, reaches maximum at around 0 mV, and declines with further depolarisation.

Coupling p+n Field-Effect Transistor Circuits for Low Concentration Methane Gas Detection

PubMed Central

Zhou, Xinyuan; Yang, Liping; Bian, Yuzhi; Ma, Xiang; Chen, Yunfa

2018-01-01

Nowadays, the detection of low concentration combustible methane gas has attracted great concern. In this paper, a coupling p+n field effect transistor (FET) amplification circuit is designed to detect methane gas. By optimizing the load resistance (RL), the response to methane of the commercial MP-4 sensor can be magnified ~15 times using this coupling circuit. At the same time, it decreases the limit of detection (LOD) from several hundred ppm to ~10 ppm methane, with the apparent response of 7.0 ± 0.2 and voltage signal of 1.1 ± 0.1 V. This is promising for the detection of trace concentrations of methane gas to avoid an accidental explosion because its lower explosion limit (LEL) is ~5%. The mechanism of this coupling circuit is that the n-type FET firstly generates an output voltage (VOUT) amplification process caused by the gate voltage-induced resistance change of the FET. Then, the p-type FET continues to amplify the signal based on the previous VOUT amplification process. PMID:29509659

Coupling p+n Field-Effect Transistor Circuits for Low Concentration Methane Gas Detection.

PubMed

Zhou, Xinyuan; Yang, Liping; Bian, Yuzhi; Ma, Xiang; Han, Ning; Chen, Yunfa

2018-03-06

Nowadays, the detection of low concentration combustible methane gas has attracted great concern. In this paper, a coupling p+n field effect transistor (FET) amplification circuit is designed to detect methane gas. By optimizing the load resistance ( R L ), the response to methane of the commercial MP-4 sensor can be magnified ~15 times using this coupling circuit. At the same time, it decreases the limit of detection (LOD) from several hundred ppm to ~10 ppm methane, with the apparent response of 7.0 ± 0.2 and voltage signal of 1.1 ± 0.1 V. This is promising for the detection of trace concentrations of methane gas to avoid an accidental explosion because its lower explosion limit (LEL) is ~5%. The mechanism of this coupling circuit is that the n-type FET firstly generates an output voltage ( V OUT ) amplification process caused by the gate voltage-induced resistance change of the FET. Then, the p-type FET continues to amplify the signal based on the previous V OUT amplification process.

Voltage-dependent dynamic FRET signals from the transverse tubules in mammalian skeletal muscle fibers.

PubMed

DiFranco, Marino; Capote, Joana; Quiñonez, Marbella; Vergara, Julio L

2007-12-01

Two hybrid voltage-sensing systems based on fluorescence resonance energy transfer (FRET) were used to record membrane potential changes in the transverse tubular system (TTS) and surface membranes of adult mice skeletal muscle fibers. Farnesylated EGFP or ECFP (EGFP-F and ECFP-F) were used as immobile FRET donors, and either non-fluorescent (dipicrylamine [DPA]) or fluorescent (oxonol dye DiBAC(4)(5)) lipophilic anions were used as mobile energy acceptors. Flexor digitorum brevis (FDB) muscles were transfected by in vivo electroporation with pEGFP-F and pECFP-F. Farnesylated fluorescent proteins were efficiently expressed in the TTS and surface membranes. Voltage-dependent optical signals resulting from resonance energy transfer from fluorescent proteins to DPA were named QRET transients, to distinguish them from FRET transients recorded using DiBAC(4)(5). The peak DeltaF/F of QRET transients elicited by action potential stimulation is twice larger in fibers expressing ECFP-F as those with EGFP-F (7.1% vs. 3.6%). These data provide a unique experimental demonstration of the importance of the spectral overlap in FRET. The voltage sensitivity of QRET and FRET signals was demonstrated to correspond to the voltage-dependent translocation of the charged acceptors, which manifest as nonlinear components in current records. For DPA, both electrical and QRET data were predicted by radial cable model simulations in which the maximal time constant of charge translocation was 0.6 ms. FRET signals recorded in response to action potentials in fibers stained with DiBAC(4)(5) exhibit DeltaF/F amplitudes as large as 28%, but their rising phase was slower than those of QRET signals. Model simulations require a time constant for charge translocation of 1.6 ms in order to predict current and FRET data. Our results provide the basis for the potential use of lipophilic ions as tools to test for fast voltage-dependent conformational changes of membrane proteins in the TTS.

Domain switching kinetics in ferroelectric-resistive BiFeO3 thin film memories

NASA Astrophysics Data System (ADS)

Meng, Jianwei; Jiang, Jun; Geng, Wenping; Chen, Zhihui; Zhang, Wei; Jiang, Anquan

2015-02-01

We fabricated (00l) BiFeO3 (BFO) thin films in different growth modes on SrRuO3/SrTiO3 substrates using a pulsed laser deposition technique. X-ray diffraction patterns show an out-of-plane lattice constant of 4.03 Å and ferroelectric polarization of 82 µC/cm2 for the BFO thin film in a layer-by-layer growth mode (2D-BFO), larger than 3.96 Å and 51 µC/cm2 for the thin film in the 3D-island formation growth mode (3D-BFO). The 2D-BFO thin film at 300 K shows switchable on/off diode currents upon polarization flipping near a negative coercive voltage, which is nevertheless absent from the above 3D-BFO thin film. From a positive-up-negative-down pulse characterization technique, we measured domain switching current transients as well as polarization-voltage (Pf-Vf) hysteresis loops in both semiconducting thin films. Pf-Vf hysteresis loops after 1 µs-retention time show the preferred domain orientation pointing to bottom electrodes in a 3D-BFO thin film. The poor retention of the domains pointing to top electrodes can be improved considerably in a 2D-BFO thin film. From these measurements, we extracted domain switching time dependence of coercive voltage at temperatures of 78-300 K. From these dependences, we found coercive voltages in semiconducting ferroelectric thin films much higher than those in insulating thin films, disobeying the traditional Merz equation. Finally, an equivalent resistance model in description of free-carrier compensation of the front domain boundary charge is developed to interpret this difference. This equivalent resistance can be coincidently extracted either from domain switching time dependence of coercive voltage or from applied voltage dependence of domain switching current, which drops almost linearly with the temperature until down to 0 in a ferroelectric insulator at 78 K.

Central action of dendrotoxin: selective reduction of a transient K conductance in hippocampus and binding to localized acceptors.

PubMed

Halliwell, J V; Othman, I B; Pelchen-Matthews, A; Dolly, J O

1986-01-01

Dendrotoxin, a small single-chain protein from the venom of Dendroaspis angusticeps, is highly toxic following intracerebroventricular injection into rats. Voltage-clamp analysis of CA1 neurons in hippocampal slices, treated with tetrodotoxin, revealed that nanomolar concentrations of dendrotoxin reduce selectively a transient, voltage-dependent K conductance. Epileptiform activity known to be induced by dendrotoxin can be attributed to such an action. Membrane currents not affected directly by the toxin include (i) Ca-activated K conductance; (ii) noninactivating voltage-dependent K conductance; (iii) inactivating and noninactivating Ca conductances; (iv) persistent inward (anomalous) rectifier current. Persistence of the effects of the toxin when Cd was included to suppress spontaneous transmitter release indicates a direct action on the neuronal membrane. Using biologically active, 125I-labeled dendrotoxin, protein acceptor sites of high affinity were detected on cerebrocortical synaptosomal membranes and sections of rat brain. In hippocampus, toxin binding was shown autoradiographically to reside in synapse-rich and white matter regions, with lower levels in cell body layers. This acceptor is implicated in the action of toxin because its affinities for dendrotoxin congeners are proportional to their central neurotoxicities and potencies in reducing the transient, voltage-dependent K conductance.

Method and device for ion mobility separations

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ibrahim, Yehia M.; Garimella, Sandilya V. B.; Smith, Richard D.

2017-07-11

Methods and devices for ion separations or manipulations in gas phase are disclosed. The device includes a single non-planar surface. Arrays of electrodes are coupled to the surface. A combination of RF and DC voltages are applied to the arrays of electrodes to create confining and driving fields that move ions through the device. The DC voltages are static DC voltages or time-dependent DC potentials or waveforms.

The theoretical current-voltage dependence of a non-degenerate disordered organic material obtained with conductive atomic force microscopy

NASA Astrophysics Data System (ADS)

Woellner, Cristiano F.; Freire, José A.; Guide, Michele; Nguyen, Thuc-Quyen

2011-08-01

We develop a simple continuum model for the current voltage characteristics of a material as measured by the conducting atomic force microscopy, including space charge effects. We address the effect of the point contact on the magnitude of the current and on the transition voltages between the different current regimes by comparing these with the corresponding expressions obtained with planar electrodes.

Palladium configuration dependence of hydrogen detection sensitivity based on graphene FET for breath analysis

NASA Astrophysics Data System (ADS)

Sakamoto, Yuri; Uemura, Kohei; Ikuta, Takashi; Maehashi, Kenzo

2018-04-01

We have succeeded in fabricating a hydrogen gas sensor based on palladium-modified graphene field-effect transistors (FETs). The negative-voltage shift in the transfer characteristics was observed with exposure to hydrogen gas, which was explained by the change in work function. The hydrogen concentration dependence of the voltage shift was investigated using graphene FETs with palladium deposited by three different evaporation processes. The results indicate that the hydrogen detection sensitivity of the palladium-modified graphene FETs is strongly dependent on the palladium configuration. Therefore, the palladium-modified graphene FET is a candidate for breath analysis.

A unified physical model of Seebeck coefficient in amorphous oxide semiconductor thin-film transistors

NASA Astrophysics Data System (ADS)

Lu, Nianduan; Li, Ling; Sun, Pengxiao; Banerjee, Writam; Liu, Ming

2014-09-01

A unified physical model for Seebeck coefficient was presented based on the multiple-trapping and release theory for amorphous oxide semiconductor thin-film transistors. According to the proposed model, the Seebeck coefficient is attributed to the Fermi-Dirac statistics combined with the energy dependent trap density of states and the gate-voltage dependence of the quasi-Fermi level. The simulation results show that the gate voltage, energy disorder, and temperature dependent Seebeck coefficient can be well described. The calculation also shows a good agreement with the experimental data in amorphous In-Ga-Zn-O thin-film transistor.

Voltage-Dependent Charge Storage in Cladded Zn0.56Cd0.44Se Quantum Dot MOS Capacitors for Multibit Memory Applications

NASA Astrophysics Data System (ADS)

Khan, J.; Lingalugari, M.; Al-Amoody, F.; Jain, F.

2013-11-01

As conventional memories approach scaling limitations, new storage methods must be utilized to increase Si yield and produce higher on-chip memory density. Use of II-VI Zn0.56Cd0.44Se quantum dots (QDs) is compatible with epitaxial gate insulators such as ZnS-ZnMgS. Voltage-dependent charging effects in cladded Zn0.56Cd0.44Se QDs are presented in a conventional metal-oxide-semiconductor capacitor structure. Charge storage capabilities in Si and ZnMgS QDs have been reported by various researchers; this work is focused on II-VI material Zn0.56Cd0.44Se QDs nucleated using photoassisted microwave plasma metalorganic chemical vapor deposition. Using capacitance-voltage hysteresis characterization, the multistep charging and discharging capabilities of the QDs at room temperature are presented. Three charging states are presented within a 10 V charging voltage range. These characteristics exemplify discrete charge states in the QD layer, perfect for multibit, QD-functionalized high-density memory applications. Multiple charge states with low operating voltage provide device characteristics that can be used for multibit storage by allowing varying charges to be stored in a QD layer based on the applied "write" voltage.

Adaptive Hierarchical Voltage Control of a DFIG-Based Wind Power Plant for a Grid Fault

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Jinho; Muljadi, Eduard; Park, Jung-Wook

This paper proposes an adaptive hierarchical voltage control scheme of a doubly-fed induction generator (DFIG)-based wind power plant (WPP) that can secure more reserve of reactive power (Q) in the WPP against a grid fault. To achieve this, each DFIG controller employs an adaptive reactive power to voltage (Q-V) characteristic. The proposed adaptive Q-V characteristic is temporally modified depending on the available Q capability of a DFIG; it is dependent on the distance from a DFIG to the point of common coupling (PCC). The proposed characteristic secures more Q reserve in the WPP than the fixed one. Furthermore, it allowsmore » DFIGs to promptly inject up to the Q limit, thereby improving the PCC voltage support. To avert an overvoltage after the fault clearance, washout filters are implemented in the WPP and DFIG controllers; they can prevent a surplus Q injection after the fault clearance by eliminating the accumulated values in the proportional-integral controllers of both controllers during the fault. Test results demonstrate that the scheme can improve the voltage support capability during the fault and suppress transient overvoltage after the fault clearance under scenarios of various system and fault conditions; therefore, it helps ensure grid resilience by supporting the voltage stability.« less

Voltage Sensing in Membranes: From Macroscopic Currents to Molecular Motions.

PubMed

Freites, J Alfredo; Tobias, Douglas J

2015-06-01

Voltage-sensing domains (VSDs) are integral membrane protein units that sense changes in membrane electric potential, and through the resulting conformational changes, regulate a specific function. VSDs confer voltage-sensitivity to a large superfamily of membrane proteins that includes voltage-gated Na[Formula: see text], K[Formula: see text], Ca[Formula: see text] ,and H[Formula: see text] selective channels, hyperpolarization-activated cyclic nucleotide-gated channels, and voltage-sensing phosphatases. VSDs consist of four transmembrane segments (termed S1 through S4). Their most salient structural feature is the highly conserved positions for charged residues in their sequences. S4 exhibits at least three conserved triplet repeats composed of one basic residue (mostly arginine) followed by two hydrophobic residues. These S4 basic side chains participate in a state-dependent internal salt-bridge network with at least four acidic residues in S1-S3. The signature of voltage-dependent activation in electrophysiology experiments is a transient current (termed gating or sensing current) upon a change in applied membrane potential as the basic side chains in S4 move across the membrane electric field. Thus, the unique structural features of the VSD architecture allow for competing requirements: maintaining a series of stable transmembrane conformations, while allowing charge motion, as briefly reviewed here.

Voltage gating by molecular subunits of Na+ and K+ ion channels: higher-dimensional cubic kinetics, rate constants, and temperature

PubMed Central

2015-01-01

The structural similarity between the primary molecules of voltage-gated Na and K channels (alpha subunits) and activation gating in the Hodgkin-Huxley model is brought into full agreement by increasing the model's sodium kinetics to fourth order (m3 → m4). Both structures then virtually imply activation gating by four independent subprocesses acting in parallel. The kinetics coalesce in four-dimensional (4D) cubic diagrams (16 states, 32 reversible transitions) that show the structure to be highly failure resistant against significant partial loss of gating function. Rate constants, as fitted in phase plot data of retinal ganglion cell excitation, reflect the molecular nature of the gating transitions. Additional dimensions (6D cubic diagrams) accommodate kinetically coupled sodium inactivation and gating processes associated with beta subunits. The gating transitions of coupled sodium inactivation appear to be thermodynamically irreversible; response to dielectric surface charges (capacitive displacement) provides a potential energy source for those transitions and yields highly energy-efficient excitation. A comparison of temperature responses of the squid giant axon (apparently Arrhenius) and mammalian channel gating yields kinetic Q10 = 2.2 for alpha unit gating, whose transitions are rate-limiting at mammalian temperatures; beta unit kinetic Q10 = 14 reproduces the observed non-Arrhenius deviation of mammalian gating at low temperatures; the Q10 of sodium inactivation gating matches the rate-limiting component of activation gating at all temperatures. The model kinetics reproduce the physiologically large frequency range for repetitive firing in ganglion cells and the physiologically observed strong temperature dependence of recovery from inactivation. PMID:25867741

Optical and Electrical Performance of MOS-Structure Silicon Solar Cells with Antireflective Transparent ITO and Plasmonic Indium Nanoparticles under Applied Bias Voltage.

PubMed

Ho, Wen-Jeng; Sue, Ruei-Siang; Lin, Jian-Cheng; Syu, Hong-Jang; Lin, Ching-Fuh

2016-08-10

This paper reports impressive improvements in the optical and electrical performance of metal-oxide-semiconductor (MOS)-structure silicon solar cells through the incorporation of plasmonic indium nanoparticles (In-NPs) and an indium-tin-oxide (ITO) electrode with periodic holes (perforations) under applied bias voltage. Samples were prepared using a plain ITO electrode or perforated ITO electrode with and without In-NPs. The samples were characterized according to optical reflectance, dark current voltage, induced capacitance voltage, external quantum efficiency, and photovoltaic current voltage. Our results indicate that induced capacitance voltage and photovoltaic current voltage both depend on bias voltage, regardless of the type of ITO electrode. Under a bias voltage of 4.0 V, MOS cells with perforated ITO and plain ITO, respectively, presented conversion efficiencies of 17.53% and 15.80%. Under a bias voltage of 4.0 V, the inclusion of In-NPs increased the efficiency of cells with perforated ITO and plain ITO to 17.80% and 16.87%, respectively.

Optical and Electrical Performance of MOS-Structure Silicon Solar Cells with Antireflective Transparent ITO and Plasmonic Indium Nanoparticles under Applied Bias Voltage

PubMed Central

Ho, Wen-Jeng; Sue, Ruei-Siang; Lin, Jian-Cheng; Syu, Hong-Jang; Lin, Ching-Fuh

2016-01-01

This paper reports impressive improvements in the optical and electrical performance of metal-oxide-semiconductor (MOS)-structure silicon solar cells through the incorporation of plasmonic indium nanoparticles (In-NPs) and an indium-tin-oxide (ITO) electrode with periodic holes (perforations) under applied bias voltage. Samples were prepared using a plain ITO electrode or perforated ITO electrode with and without In-NPs. The samples were characterized according to optical reflectance, dark current voltage, induced capacitance voltage, external quantum efficiency, and photovoltaic current voltage. Our results indicate that induced capacitance voltage and photovoltaic current voltage both depend on bias voltage, regardless of the type of ITO electrode. Under a bias voltage of 4.0 V, MOS cells with perforated ITO and plain ITO, respectively, presented conversion efficiencies of 17.53% and 15.80%. Under a bias voltage of 4.0 V, the inclusion of In-NPs increased the efficiency of cells with perforated ITO and plain ITO to 17.80% and 16.87%, respectively. PMID:28773801

Novel efficient promoter of the mitochondrial porin, voltage-dependent anion channel (VDAC), in the genome of the Yarrowia lipolytica yeast.

PubMed

Kulanbaewa, F F; Sekova, V Yu; Isakova, E P; Deryabina, Y I; Nikolaev, A V

2016-09-01

This article presents the characteristics of the highly inducible promoter of the gene encoding the mitochondrial porin, the voltage-dependent anion channel (VDAC). This promoter is recommended for use in new genetic constructs both in basic research for assessing the adaptive strategy of lower eukaryotes under adverse conditions and in designing new highly competitive transformants producing economically important compounds (proteins, lipids, and organic acids) on its basis.

The temperature dependence of the BK channel activity - kinetics, thermodynamics, and long-range correlations.

PubMed

Wawrzkiewicz-Jałowiecka, Agata; Dworakowska, Beata; Grzywna, Zbigniew J

2017-10-01

Large-conductance, voltage dependent, Ca 2+ -activated potassium channels (BK) are transmembrane proteins that regulate many biological processes by controlling potassium flow across cell membranes. Here, we investigate to what extent temperature (in the range of 17-37°C with ΔT=5°C step) is a regulating parameter of kinetic properties of the channel gating and memory effect in the series of dwell-time series of subsequent channel's states, at membrane depolarization and hyperpolarization. The obtained results indicate that temperature affects strongly the BK channels' gating, but, counterintuitively, it exerts no effect on the long-range correlations, as measured by the Hurst coefficient. Quantitative differences between dependencies of appropriate channel's characteristics on temperature are evident for different regimes of voltage. Examining the characteristics of BK channel activity as a function of temperature allows to estimate the net activation energy (E act ) and changes of thermodynamic parameters (ΔH, ΔS, ΔG) by channel opening. Larger E act corresponds to the channel activity at membrane hyperpolarization. The analysis of entropy and enthalpy changes of closed to open channel's transition suggest the entropy-driven nature of the increase of open state probability during voltage activation and supports the hypothesis about the voltage-dependent geometry of the channel vestibule. Copyright © 2017 Elsevier B.V. All rights reserved.

Effect of electrical coupling on ionic current and synaptic potential measurements.

PubMed

Rabbah, Pascale; Golowasch, Jorge; Nadim, Farzan

2005-07-01

Recent studies have found electrical coupling to be more ubiquitous than previously thought, and coupling through gap junctions is known to play a crucial role in neuronal function and network output. In particular, current spread through gap junctions may affect the activation of voltage-dependent conductances as well as chemical synaptic release. Using voltage-clamp recordings of two strongly electrically coupled neurons of the lobster stomatogastric ganglion and conductance-based models of these neurons, we identified effects of electrical coupling on the measurement of leak and voltage-gated outward currents, as well as synaptic potentials. Experimental measurements showed that both leak and voltage-gated outward currents are recruited by gap junctions from neurons coupled to the clamped cell. Nevertheless, in spite of the strong coupling between these neurons, the errors made in estimating voltage-gated conductance parameters were relatively minor (<10%). Thus in many cases isolation of coupled neurons may not be required if a small degree of measurement error of the voltage-gated currents or the synaptic potentials is acceptable. Modeling results show, however, that such errors may be as high as 20% if the gap-junction position is near the recording site or as high as 90% when measuring smaller voltage-gated ionic currents. Paradoxically, improved space clamp increases the errors arising from electrical coupling because voltage control across gap junctions is poor for even the highest realistic coupling conductances. Furthermore, the common procedure of leak subtraction can add an extra error to the conductance measurement, the sign of which depends on the maximal conductance.

The allosteric site regulates the voltage sensitivity of muscarinic receptors.

PubMed

Hoppe, Anika; Marti-Solano, Maria; Drabek, Matthäus; Bünemann, Moritz; Kolb, Peter; Rinne, Andreas

2018-01-01

Muscarinic receptors (M-Rs) for acetylcholine (ACh) belong to the class A of G protein-coupled receptors. M-Rs are activated by orthosteric agonists that bind to a specific site buried in the M-R transmembrane helix bundle. In the active conformation, receptor function can be modulated either by allosteric modulators, which bind to the extracellular receptor surface or by the membrane potential via an unknown mechanism. Here, we compared the modulation of M 1 -Rs and M 3 -Rs induced by changes in voltage to their allosteric modulation by chemical compounds. We quantified changes in receptor signaling in single HEK 293 cells with a FRET biosensor for the G q protein cycle. In the presence of ACh, M 1 -R signaling was potentiated by voltage, similarly to positive allosteric modulation by benzyl quinolone carboxylic acid. Conversely, signaling of M 3 -R was attenuated by voltage or the negative allosteric modulator gallamine. Because the orthosteric site is highly conserved among M-Rs, but allosteric sites vary, we constructed "allosteric site" M 3 /M 1 -R chimeras and analyzed their voltage dependencies. Exchanging the entire allosteric sites eliminated the voltage sensitivity of ACh responses for both receptors, but did not affect their modulation by allosteric compounds. Furthermore, a point mutation in M 3 -Rs caused functional uncoupling of the allosteric and orthosteric sites and abolished voltage dependence. Molecular dynamics simulations of the receptor variants indicated a subtype-specific crosstalk between both sites, involving the conserved tyrosine lid structure of the orthosteric site. This molecular crosstalk leads to receptor subtype-specific voltage effects. Copyright © 2017 Elsevier Inc. All rights reserved.

Expression, purification, and reconstitution of the voltage-sensing domain from Ci-VSP.

PubMed

Li, Qufei; Jogini, Vishwanath; Wanderling, Sherry; Cortes, D Marien; Perozo, Eduardo

2012-10-16

The voltage-sensing domain (VSD) is the common scaffold responsible for the functional behavior of voltage-gated ion channels, voltage sensitive enzymes, and proton channels. Because of the position of the voltage dependence of the available VSD structures, at present, they all represent the activated state of the sensor. Yet in the absence of a consensus resting state structure, the mechanistic details of voltage sensing remain controversial. The voltage dependence of the VSD from Ci-VSP (Ci-VSD) is dramatically right shifted, so that at 0 mV it presumably populates the putative resting state. Appropriate biochemical methods are an essential prerequisite for generating sufficient amounts of Ci-VSD protein for high-resolution structural studies. Here, we present a simple and robust protocol for the expression of eukaryotic Ci-VSD in Escherichia coli at milligram levels. The protein is pure, homogeneous, monodisperse, and well-folded after solubilization in Anzergent 3-14 at the analyzed concentration (~0.3 mg/mL). Ci-VSD can be reconstituted into liposomes of various compositions, and initial site-directed spin labeling and electron paramagnetic resonance (EPR) spectroscopic measurements indicate its first transmembrane segment folds into an α-helix, in agreement with the homologous region of other VSDs. On the basis of our results and enhanced relaxation EPR spectroscopy measurement, Ci-VSD reconstitutes essentially randomly in proteoliposomes, precluding straightforward application of transmembrane voltages in combination with spectroscopic methods. Nevertheless, these results represent an initial step that makes the resting state of a VSD accessible to a variety of biophysical and structural approaches, including X-ray crystallography, spectroscopic methods, and electrophysiology in lipid bilayers.

Expression, Purification and Reconstitution of the Voltage Sensing Domain from Ci-VSP

PubMed Central

Li, Qufei; Jogini, Vishwanath; Wanderling, Sherry; Cortes, D. Marien; Perozo, Eduardo

2013-01-01

The voltage-sensing domain (VSD) is the common scaffold responsible for the functional behavior of voltage gated ion channels, voltage sensitive enzymes and proton channels. Because of the position of the voltage dependence of the available VSD structures, at present, they all represent the activated state of the sensor. Yet, in the absence of a consensus resting state structure, the mechanistic details of voltage sensing remain controversial. The voltage dependence of the VSD from Ci-VSP (Ci-VSD) is dramatically right shifted, so that at 0 mV It presumably populates the putative resting state. Appropriate biochemical methods are an essential prerequisite to generate sufficient amounts of Ci-VSD protein for high-resolution structural studies. Here, we present a simple and robust protocol for the Escherichia coli expression of eukaryotic Ci-VSD at milligram levels. The protein is pure, homogeneous, mono-disperse and well folded after solubilization in Anzergent 3-14 at the analyzed concentration (~ 0.3 mg/mL). Ci-VSD can be reconstituted into liposomes of various compositions and initial site-directed spin labeling and EPR spectroscopic measurements indicate its first transmembrane segment folds into an α-helix, in agreement to the homologous region of other VSDs. Based on current results and enhanced relaxation EPR spectroscopy measurement, Ci-VSD reconstitutes essentially randomly in proteo-liposomes, precluding straightforward application of transmembrane voltages in combination with spectroscopic methods. Nevertheless, the present results represent an initial step that makes the resting state of a VSD accessible to a variety of biophysical and structural approaches, including X-ray crystallography, spectroscopic methods and electrophysiology in lipid bilayers. PMID:22989304

Conductive tracks of 30-MeV C60 clusters in doped and undoped tetrahedral amorphous carbon

NASA Astrophysics Data System (ADS)

Krauser, J.; Gehrke, H.-G.; Hofsäss, H.; Trautmann, C.; Weidinger, A.

2013-07-01

In insulating tetrahedral amorphous carbon (ta-C), the irradiation with 30-MeV C60 cluster ions leads to the formation of well conducting tracks. While electrical currents through individual tracks produced with monoatomic projectiles (e.g. Au or U) often exhibit rather large track to track fluctuations, C60 clusters are shown to generate highly conducting tracks with very narrow current distributions. Additionally, all recorded current-voltage curves show linear characteristics. These findings are attributed to the large specific energy loss dE/dx of the 30-MeV C60 clusters. We also investigated C60 tracks in ta-C films which were slightly doped with B, N or Fe during film growth. Doping apparently increases the ion track conductivity. However, at the same time the insulating characteristics of the pristine ta-C film can be reduced. The present C60 results are compared with data from earlier experiments with monoatomic heavy ion beams. The investigations were performed by means of atomic force microscopy including temperature dependent conductivity measurements of single ion tracks.

The Bacterial (Vibrio alginolyticus) Production of Tetrodotoxin in the Ribbon Worm Lineus longissimus—Just a False Positive?

PubMed Central

Strand, Malin; Hedström, Martin; Seth, Henrik; McEvoy, Eric G.; Jacobsson, Erik; Göransson, Ulf; Andersson, Håkan S.; Sundberg, Per

2016-01-01

We test previous claims that the bacteria Vibrio alginolyticus produces tetrodotoxin (TTX) when living in symbiosis with the nemertean Lineus longissimus by a setup with bacteria cultivation for TTX production. Toxicity experiments on the shore crab, Carcinus maenas, demonstrated the presence of a paralytic toxin, but evidence from LC-MS and electrophysiological measurements of voltage-gated sodium channel–dependent nerve conductance in male Wistar rat tissue showed conclusively that this effect did not originate from TTX. However, a compound of similar molecular weight was found, albeit apparently non-toxic, and with different LC retention time and MS/MS fragmentation pattern than those of TTX. We conclude that C. maenas paralysis and death likely emanate from a compound <5 kDa, and via a different mechanism of action than that of TTX. The similarity in mass between TTX and the Vibrio-produced low-molecular-weight, non-toxic compound invokes that thorough analysis is required when assessing TTX production. Based on our findings, we suggest that re-examination of some published claims of TTX production may be warranted. PMID:27023570

Mobile patient monitoring based on impedance-loaded SAW-sensors.

PubMed

Karilainen, Anna; Finnberg, Thomas; Uelzen, Thorsten; Dembowski, Klaus; Müller, Jörg

2004-11-01

A remotely requestable, passive, short-range sensor network for measuring small voltages is presented. The sensor system is able to simultaneously monitor six small voltages in millivolt-range, and it can be used for Holter-electrocardiogram (ECG) and other biopotential monitoring, or in industrial applications. The sensors are based on a surface acoustic wave (SAW) delay line with voltage-dependent, impedance loading on a reflector interdigital transducer (IDT). The load circuit impedance is varied by the capacitance of the voltage-controlled varactor. High resolution is achieved by developing a MOS-capacitor with a thin oxide, low flat-band voltage, and zero-voltage capacitance in the space-charge region, as well as a high-Q-microcoil by thick metal electroplating. Simultaneous monitoring of multiple potentials is realized by time-division-multiplexing of different sensor signals.

Novel voltage signal at proximity-induced superconducting transition temperature in gold nanowires

NASA Astrophysics Data System (ADS)

Wang, Jian; Tang, JunXiong; Wang, ZiQiao; Sun, Yi; Sun, QingFeng; Chan, Moses H. W.

2018-08-01

We observed a novel voltage peak in the proximity-induced superconducting gold (Au) nanowire while cooling the sample through the superconducting transition temperature. The voltage peak turned dip during warming. The voltage peak or dip was found to originate respectively from the emergence or vanishing of the proximity-induced superconductivity in the Au nanowire. The amplitude of the voltage signal depends on the temperature scanning rate, and it cannot be detected when the temperature is changed slower than 0.03 K/min. This transient feature suggests the non-equilibrium property of the effect. Ginzburg-Landau model clarified the voltage peak by considering the emergence of Cooper pairs of relatively lower free energy in superconducting W contact and the non-equilibrium diffusion of Cooper pairs and quasiparticles.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vargas, Asticio; Center for Optics and Photonics, Universidad de Concepción, Casilla 4016, Concepción; Mar Sánchez-López, María del

Multiple-beam Fabry-Perot (FP) interferences occur in liquid crystal retarders (LCR) devoid of an antireflective coating. In this work, a highly accurate method to obtain the spectral retardance of such devices is presented. On the basis of a simple model of the LCR that includes FP effects and by using a voltage transfer function, we show how the FP features in the transmission spectrum can be used to accurately retrieve the ordinary and extraordinary spectral phase delays, and the voltage dependence of the latter. As a consequence, the modulation characteristics of the device are fully determined with high accuracy by meansmore » of a few off-state physical parameters which are wavelength-dependent, and a single voltage transfer function that is valid within the spectral range of characterization.« less

Temperature-dependent degradation mechanisms of threshold voltage in La2O3-gated n-channel metal-oxide-semiconductor field-effect transistors

NASA Astrophysics Data System (ADS)

Wang, Ming-Tsong; Hsu, De-Cheng; Juan, Pi-Chun; Wang, Y. L.; Lee, Joseph Ya-min

2010-09-01

Metal-oxide-semiconductor capacitors and n-channel metal-oxide-semiconductor field-effect transistors with La2O3 gate dielectric were fabricated. The positive bias temperature instability was studied. The degradation of threshold voltage (ΔVT) showed an exponential dependence on the stress time in the temperature range from 25 to 75 °C. The degradation of subthreshold slope (ΔS) and gate leakage (IG) with stress voltage was also measured. The degradation of VT is attributed to the oxide trap charges Qot. The extracted activation energy of 0.2 eV is related to a degradation dominated by the release of atomic hydrogen in La2O3 thin films.

Time and voltage dependences of nanoscale dielectric constant modulation on indium tin oxide films

NASA Astrophysics Data System (ADS)

Li, Liang; Hao, Haoyue; Zhao, Hua

2017-01-01

The modulation of indium tin oxide (ITO) films through surface charge accumulation plays an important role in many different applications. In order to elaborately study the modulation, we measured the dielectric constant of the modulated layer through examining the excitation of surface plasmon polaritons. Charges were pumped on the surfaces of ITO films through applying high voltage in appropriate directions. Experiments unveiled that the dielectric constant of the modulated layer had large variation along with the nanoscale charge accumulation. Corresponding numerical results were worked out through combining Drude model and Mayadas-Shatzkes model. Based on the above results, we deduced the time and voltage dependences of accumulated charge density, which revealed a long-time charge accumulation process.

Biphasic voltage-dependent inactivation of human NaV 1.3, 1.6 and 1.7 Na+ channels expressed in rodent insulin-secreting cells.

PubMed

Godazgar, Mahdieh; Zhang, Quan; Chibalina, Margarita V; Rorsman, Patrik

2018-05-01

Na + current inactivation is biphasic in insulin-secreting cells, proceeding with two voltage dependences that are half-maximal at ∼-100 mV and -60 mV. Inactivation of voltage-gated Na + (Na V ) channels occurs at ∼30 mV more negative voltages in insulin-secreting Ins1 and primary β-cells than in HEK, CHO or glucagon-secreting αTC1-6 cells. The difference in inactivation between Ins1 and non-β-cells persists in the inside-out patch configuration, discounting an involvement of a diffusible factor. In Ins1 cells and primary β-cells, but not in HEK cells, inactivation of a single Na V subtype is biphasic and follows two voltage dependences separated by 30-40 mV. We propose that Na V channels adopt different inactivation behaviours depending on the local membrane environment. Pancreatic β-cells are equipped with voltage-gated Na + channels that undergo biphasic voltage-dependent steady-state inactivation. A small Na + current component (10-15%) inactivates over physiological membrane potentials and contributes to action potential firing. However, the major Na + channel component is completely inactivated at -90 to -80 mV and is therefore inactive in the β-cell. It has been proposed that the biphasic inactivation reflects the contribution of different Na V α-subunits. We tested this possibility by expression of TTX-resistant variants of the Na V subunits found in β-cells (Na V 1.3, Na V 1.6 and Na V 1.7) in insulin-secreting Ins1 cells and in non-β-cells (including HEK and CHO cells). We found that all Na V subunits inactivated at 20-30 mV more negative membrane potentials in Ins1 cells than in HEK or CHO cells. The more negative inactivation in Ins1 cells does not involve a diffusible intracellular factor because the difference between Ins1 and CHO persisted after excision of the membrane. Na V 1.7 inactivated at 15--20 mV more negative membrane potentials than Na V 1.3 and Na V 1.6 in Ins1 cells but this small difference is insufficient to solely explain the biphasic inactivation in Ins1 cells. In Ins1 cells, but never in the other cell types, widely different components of Na V inactivation (separated by 30 mV) were also observed following expression of a single type of Na V α-subunit. The more positive component exhibited a voltage dependence of inactivation similar to that found in HEK and CHO cells. We propose that biphasic Na V inactivation in insulin-secreting cells reflects insertion of channels in membrane domains that differ with regard to lipid and/or membrane protein composition. © 2018 The Authors. The Journal of Physiology published by John Wiley & Sons Ltd on behalf of The Physiological Society.

Temperature dependent charge transport studies across thermodynamic glass transition in P3HT:PCBM bulk heterojunction: insight from J-V and impedance spectroscopy

NASA Astrophysics Data System (ADS)

Sarkar, Atri; Rahaman, Abdulla Bin; Banerjee, Debamalya

2018-03-01

Temperature dependent charge transport properties of P3HT:PCBM bulk heterojunction are analysed by dc and ac measurements under dark conditions across a wide temperature range of 110-473 K, which includes the thermodynamic glass transition temperature (Tg ˜320 K) of the system. A change from Ohmic conduction to space charge limited current conduction at higher (⩾1.2 V) applied bias voltages above  ⩾200 K is observed from J-V characteristics. From capacitance-voltage (C-V) measurement at room temperature, the occurrence of a peak near the built-in voltage is observed below the dielectric relaxation frequency, originating from the competition between drift and diffusion driven motions of charges. Carrier concentration (N) is calculated from C-V measurements taken at different temperatures. Room temperature mobility values at various applied bias voltages are in accordance with that obtained from transient charge extraction by linearly increasing voltage measurement. Sample impedance is measured over five decades of frequency across temperature range by using lock-in detection. This data is used to extract temperature dependence of carrier mobility (μ), and dc conductivity (σ_dc ) which is low frequency extrapolation of ac conductivity. An activation energy of  ˜126 meV for the carrier hopping process at the metal-semiconductor interface is estimated from temperature dependence of σ_dc . Above T g, μ levels off to a constant value, whereas σ_dc starts to decrease after a transition knee at T g that can be seen as a combined effect of changes in μ and N. All these observed changes across T g can be correlated to enhanced polymer motion above the glass transition.

D242N, a KV7.1 LQTS mutation uncovers a key residue for IKs voltage dependence.

PubMed

Moreno, Cristina; Oliveras, Anna; Bartolucci, Chiara; Muñoz, Carmen; de la Cruz, Alicia; Peraza, Diego A; Gimeno, Juan R; Martín-Martínez, Mercedes; Severi, Stefano; Felipe, Antonio; Lambiase, Pier D; Gonzalez, Teresa; Valenzuela, Carmen

2017-09-01

K V 7.1 and KCNE1 co-assemble to give rise to the I Ks current, one of the most important repolarizing currents of the cardiac action potential. Its relevance is underscored by the identification of >500 mutations in K V 7.1 and, at least, 36 in KCNE1, that cause Long QT Syndrome (LQTS). The aim of this study was to characterize the biophysical and cellular consequences of the D242N K V 7.1 mutation associated with the LQTS. The mutation is located in the S4 transmembrane segment, within the voltage sensor of the K V 7.1 channel, disrupting the conserved charge balance of this region. Perforated patch-clamp experiments show that, unexpectedly, the mutation did not disrupt the voltage-dependent activation but it removed the inactivation and slowed the activation kinetics of D242N K V 7.1 channels. Biotinylation of cell-surface protein and co-immunoprecipitation experiments revealed that neither plasma membrane targeting nor co-assembly between K V 7.1 and KCNE1 was altered by the mutation. However, the association of D242N K V 7.1 with KCNE1 strongly shifted the voltage dependence of activation to more depolarized potentials (+50mV), hindering I Ks current at physiologically relevant membrane potentials. Both functional and computational analysis suggest that the clinical phenotype of the LQTS patients carrying the D242N mutation is due to impaired action potential adaptation to exercise and, in particular, to increase in heart rate. Moreover, our data identify D242 aminoacidic position as a potential residue involved in the KCNE1-mediated regulation of the voltage dependence of activation of the K V 7.1 channel. Copyright © 2017 Elsevier Ltd. All rights reserved.

An electrostatic potassium channel opener targeting the final voltage sensor transition

PubMed Central

Börjesson, Sara I.

2011-01-01

Free polyunsaturated fatty acids (PUFAs) modulate the voltage dependence of voltage-gated ion channels. As an important consequence thereof, PUFAs can suppress epileptic seizures and cardiac arrhythmia. However, molecular details for the interaction between PUFA and ion channels are not well understood. In this study, we have localized the site of action for PUFAs on the voltage-gated Shaker K channel by introducing positive charges on the channel surface, which potentiated the PUFA effect. Furthermore, we found that PUFA mainly affects the final voltage sensor movement, which is closely linked to channel opening, and that specific charges at the extracellular end of the voltage sensor are critical for the PUFA effect. Because different voltage-gated K channels have different charge profiles, this implies channel-specific PUFA effects. The identified site and the pharmacological mechanism will potentially be very useful in future drug design of small-molecule compounds specifically targeting neuronal and cardiac excitability. PMID:21624947

Progress in the structural understanding of voltage-gated calcium channel (CaV) function and modulation

PubMed Central

Findeisen, Felix

2010-01-01

Voltage-gated calcium channels (CaVs) are large, transmembrane multiprotein complexes that couple membrane depolarization to cellular calcium entry. These channels are central to cardiac action potential propagation, neurotransmitter and hormone release, muscle contraction and calcium-dependent gene transcription. Over the past six years, the advent of high-resolution structural studies of CaV components from different isoforms and CaV modulators has begun to reveal the architecture that underlies the exceptionally rich feedback modulation that controls CaV action. These descriptions of CaV molecular anatomy have provided new, structure-based insights into the mechanisms by which particular channel elements affect voltage-dependent inactivation (VDI), calcium-dependent inactivation (CDI) and calcium-dependent facilitation (CDF). The initial successes have been achieved through structural studies of soluble channel domains and modulator proteins and have proven most powerful when paired with biochemical and functional studies that validate ideas inspired by the structures. Here, we review the progress in this growing area and highlight some key open challenges for future efforts. PMID:21139419

Voltage-gated Proton Channels

PubMed Central

DeCoursey, Thomas E.

2014-01-01

Voltage-gated proton channels, HV1, have vaulted from the realm of the esoteric into the forefront of a central question facing ion channel biophysicists, namely the mechanism by which voltage-dependent gating occurs. This transformation is the result of several factors. Identification of the gene in 2006 revealed that proton channels are homologues of the voltage-sensing domain of most other voltage-gated ion channels. Unique, or at least eccentric, properties of proton channels include dimeric architecture with dual conduction pathways, perfect proton selectivity, a single-channel conductance ~103 smaller than most ion channels, voltage-dependent gating that is strongly modulated by the pH gradient, ΔpH, and potent inhibition by Zn2+ (in many species) but an absence of other potent inhibitors. The recent identification of HV1 in three unicellular marine plankton species has dramatically expanded the phylogenetic family tree. Interest in proton channels in their own right has increased as important physiological roles have been identified in many cells. Proton channels trigger the bioluminescent flash of dinoflagellates, facilitate calcification by coccolithophores, regulate pH-dependent processes in eggs and sperm during fertilization, secrete acid to control the pH of airway fluids, facilitate histamine secretion by basophils, and play a signaling role in facilitating B-cell receptor mediated responses in B lymphocytes. The most elaborate and best-established functions occur in phagocytes, where proton channels optimize the activity of NADPH oxidase, an important producer of reactive oxygen species. Proton efflux mediated by HV1 balances the charge translocated across the membrane by electrons through NADPH oxidase, minimizes changes in cytoplasmic and phagosomal pH, limits osmotic swelling of the phagosome, and provides substrate H+ for the production of H2O2 and HOCl, reactive oxygen species crucial to killing pathogens. PMID:23798303

Synaptic calcium regulation in hair cells of the chicken basilar papilla.

PubMed

Im, Gi Jung; Moskowitz, Howard S; Lehar, Mohammed; Hiel, Hakim; Fuchs, Paul Albert

2014-12-10

Cholinergic inhibition of hair cells occurs by activation of calcium-dependent potassium channels. A near-membrane postsynaptic cistern has been proposed to serve as a store from which calcium is released to supplement influx through the ionotropic ACh receptor. However, the time and voltage dependence of acetylcholine (ACh)-evoked potassium currents reveal a more complex relationship between calcium entry and release from stores. The present work uses voltage steps to regulate calcium influx during the application of ACh to hair cells in the chicken basilar papilla. When calcium influx was terminated at positive membrane potential, the ACh-evoked potassium current decayed exponentially over ∼100 ms. However, at negative membrane potentials, this current exhibited a secondary rise in amplitude that could be eliminated by dihydropyridine block of the voltage-gated calcium channels of the hair cell. Calcium entering through voltage-gated channels may transit through the postsynaptic cistern, since ryanodine and sarcoendoplasmic reticulum calcium-ATPase blockers altered the time course and magnitude of this secondary, voltage-dependent contribution to ACh-evoked potassium current. Serial section electron microscopy showed that efferent and afferent synaptic structures are juxtaposed, supporting the possibility that voltage-gated influx at afferent ribbon synapses influences calcium homeostasis during long-lasting cholinergic inhibition. In contrast, spontaneous postsynaptic currents ("minis") resulting from stochastic efferent release of ACh were made briefer by ryanodine, supporting the hypothesis that the synaptic cistern serves primarily as a calcium barrier and sink during low-level synaptic activity. Hypolemmal cisterns such as that at the efferent synapse of the hair cell can play a dynamic role in segregating near-membrane calcium for short-term and long-term signaling. Copyright © 2014 the authors 0270-6474/14/3416688-10$15.00/0.

Synaptic Calcium Regulation in Hair Cells of the Chicken Basilar Papilla

PubMed Central

Im, Gi Jung; Moskowitz, Howard S.; Lehar, Mohammed; Hiel, Hakim

2014-01-01

Cholinergic inhibition of hair cells occurs by activation of calcium-dependent potassium channels. A near-membrane postsynaptic cistern has been proposed to serve as a store from which calcium is released to supplement influx through the ionotropic ACh receptor. However, the time and voltage dependence of acetylcholine (ACh)-evoked potassium currents reveal a more complex relationship between calcium entry and release from stores. The present work uses voltage steps to regulate calcium influx during the application of ACh to hair cells in the chicken basilar papilla. When calcium influx was terminated at positive membrane potential, the ACh-evoked potassium current decayed exponentially over ∼100 ms. However, at negative membrane potentials, this current exhibited a secondary rise in amplitude that could be eliminated by dihydropyridine block of the voltage-gated calcium channels of the hair cell. Calcium entering through voltage-gated channels may transit through the postsynaptic cistern, since ryanodine and sarcoendoplasmic reticulum calcium-ATPase blockers altered the time course and magnitude of this secondary, voltage-dependent contribution to ACh-evoked potassium current. Serial section electron microscopy showed that efferent and afferent synaptic structures are juxtaposed, supporting the possibility that voltage-gated influx at afferent ribbon synapses influences calcium homeostasis during long-lasting cholinergic inhibition. In contrast, spontaneous postsynaptic currents (“minis”) resulting from stochastic efferent release of ACh were made briefer by ryanodine, supporting the hypothesis that the synaptic cistern serves primarily as a calcium barrier and sink during low-level synaptic activity. Hypolemmal cisterns such as that at the efferent synapse of the hair cell can play a dynamic role in segregating near-membrane calcium for short-term and long-term signaling. PMID:25505321

Sustained acute voltage-dependent blood pressure decrease with prolonged carotid baroreflex activation in therapy-resistant hypertension.

PubMed

Alnima, Teba; Scheffers, Ingrid; De Leeuw, Peter W; Winkens, Bjorn; Jongen-Vancraybex, Heidi; Tordoir, Jan H M; Schmidli, Jürg; Mohaupt, Markus G; Allemann, Yves; Kroon, Abraham A

2012-08-01

Chronic carotid baroreflex stimulation (Rheos system) has been shown to effectively reduce blood pressure in patients with resistant hypertension. Upon acute stimulation blood pressure also falls as a function of voltage. the aim of this study is to evaluate whether this voltage-dependent blood pressure decrease is preserved after long-term carotid baroreflex stimulation. Forty-five patients implanted with Rheos underwent a voltage response test (VRT) before the start of carotid baroreflex activation (1m), as well as after 4 (4m) and 13 months (13 m) of device implantation. After switching off the device for 10 min (0 V), we started the VRT by increasing voltage from 1 to 6 V, by 1-V steps every 5 min. Blood pressure and heart rate were measured at the end of every step. At 1m, mean blood pressure was 178/101 mmHg at 0 V and fell to 142/83 mmHg at 6 V. Heart rate fell from 75 to 65 beats/min. At 4m and 13 m mean blood pressure was significantly lower compared to 1m when VRT started at 0 V (170/96 and 161/93 mmHg, respectively). However, pattern of blood pressure decrease during VRT was comparable with this at 1m. Maximum SBP reduction during VRT did not change with long-term therapy. Acute voltage-dependent blood pressure and heart rate decrease with electrical baroreflex stimulation is preserved after at least 1 year of continuous activation in patients with resistant hypertension. This indicates that response adaptation and nerve fatigue are very unlikely in long-term carotid baroreflex activation.

Voltage-dependent neuromodulation of Na+ channels by D1-like dopamine receptors in rat hippocampal neurons.

PubMed

Cantrell, A R; Scheuer, T; Catterall, W A

1999-07-01

Activation of D1-like dopamine (DA) receptors reduces peak Na+ current in acutely isolated hippocampal neurons through phosphorylation of the alpha subunit of the Na+ channel by cAMP-dependent protein kinase (PKA). Here we report that neuromodulation of Na+ currents by DA receptors via PKA is voltage-dependent in the range of -110 to -70 mV and is also sensitive to concurrent activation of protein kinase C (PKC). Depolarization enhanced the ability of D1-like DA receptors to reduce peak Na+ currents via the PKA pathway. Similar voltage-dependent modulation was observed when PKA was activated directly with the membrane-permeant PKA activator DCl-cBIMPS (cBIMPS; 20 microM), indicating that the membrane potential dependence occurs downstream of PKA. PKA activation caused only a small (-2.9 mV) shift in the voltage dependence of steady-state inactivation and had no effect on slow inactivation or on the rates of entry into the fast or slow inactivated states, suggesting that another mechanism is responsible for coupling of membrane potential changes to PKA modulation. Activation of PKC with a low concentration of the membrane-permeant diacylglycerol analog oleylacetyl glycerol also potentiated modulation by SKF 81297 or cBIMPS, and these effects were most striking at hyperpolarized membrane potentials where PKA modulation was not stimulated by membrane depolarization. Thus, activation of D1-like DA receptors causes a strong reduction in Na+ current via the PKA pathway, but it is effective primarily when it is combined with depolarization or activation of PKC. The convergence of these three distinct signaling modalities on the Na+ channel provides an intriguing mechanism for integration of information from multiple signaling pathways in the hippocampus and CNS.

Voltage Gating of Shaker K+ Channels

PubMed Central

Rodríguez, Beatriz M.; Sigg, Daniel; Bezanilla, Francisco

1998-01-01

Ionic (Ii) and gating currents (Ig) from noninactivating Shaker H4 K+ channels were recorded with the cut-open oocyte voltage clamp and macropatch techniques. Steady state and kinetic properties were studied in the temperature range 2–22°C. The time course of Ii elicited by large depolarizations consists of an initial delay followed by an exponential rise with two kinetic components. The main Ii component is highly temperature dependent (Q10 > 4) and mildly voltage dependent, having a valence times the fraction of electric field (z) of 0.2–0.3 eo. The Ig On response obtained between −60 and 20 mV consists of a rising phase followed by a decay with fast and slow kinetic components. The main Ig component of decay is highly temperature dependent (Q10 > 4) and has a z between 1.6 and 2.8 eo in the voltage range from −60 to −10 mV, and ∼0.45 eo at more depolarized potentials. After a pulse to 0 mV, a variable recovery period at −50 mV reactivates the gating charge with a high temperature dependence (Q10 > 4). In contrast, the reactivation occurring between −90 and −50 mV has a Q10 = 1.2. Fluctuation analysis of ionic currents reveals that the open probability decreases 20% between 18 and 8°C and the unitary conductance has a low temperature dependence with a Q10 of 1.44. Plots of conductance and gating charge displacement are displaced to the left along the voltage axis when the temperature is decreased. The temperature data suggests that activation consists of a series of early steps with low enthalpic and negative entropic changes, followed by at least one step with high enthalpic and positive entropic changes, leading to final transition to the open state, which has a negative entropic change. PMID:9689029

Volume-dependent ATP-conductive large-conductance anion channel as a pathway for swelling-induced ATP release.

PubMed

Sabirov, R Z; Dutta, A K; Okada, Y

2001-09-01

In mouse mammary C127i cells, during whole-cell clamp, osmotic cell swelling activated an anion channel current, when the phloretin-sensitive, volume-activated outwardly rectifying Cl(-) channel was eliminated. This current exhibited time-dependent inactivation at positive and negative voltages greater than around +/-25 mV. The whole-cell current was selective for anions and sensitive to Gd(3)+. In on-cell patches, single-channel events appeared with a lag period of approximately 15 min after a hypotonic challenge. Under isotonic conditions, cell-attached patches were silent, but patch excision led to activation of currents that consisted of multiple large-conductance unitary steps. The current displayed voltage- and time-dependent inactivation similar to that of whole-cell current. Voltage-dependent activation profile was bell-shaped with the maximum open probability at -20 to 0 mV. The channel in inside-out patches had the unitary conductance of approximately 400 pS, a linear current-voltage relationship, and anion selectivity. The outward (but not inward) single-channel conductance was suppressed by extracellular ATP with an IC(50) of 12.3 mM and an electric distance (delta) of 0.47, whereas the inward (but not outward) conductance was inhibited by intracellular ATP with an IC(50) of 12.9 mM and delta of 0.40. Despite the open channel block by ATP, the channel was ATP-conductive with P(ATP)/P(Cl) of 0.09. The single-channel activity was sensitive to Gd(3)+, SITS, and NPPB, but insensitive to phloretin, niflumic acid, and glibenclamide. The same pharmacological pattern was found in swelling-induced ATP release. Thus, it is concluded that the volume- and voltage-dependent ATP-conductive large-conductance anion channel serves as a conductive pathway for the swelling-induced ATP release in C127i cells.

Characterization of TTX-sensitive and TTX-resistant sodium currents in small cells from adult rat dorsal root ganglia.

PubMed

Elliott, A A; Elliott, J R

1993-04-01

1. The whole-cell patch-clamp technique was used to investigate the characteristics of two types of sodium current (INa) recorded at room temperature from small diameter (13-25 microns) dorsal root ganglion (DRG) cells, isolated from adult rats and maintained overnight in culture. 2. Sodium currents were isolated pharmacologically. Internal Cs+ and external tetraethylammonium (TEA) ions were used to suppress potassium currents. A combination of internal EGTA, internal F-, a low (10 microM) concentration of external Ca2+ and a relatively high (5 mM) concentration of internal and external Mg2+ was used to block calcium channels. The remaining voltage-dependent currents reversed direction at the calculated sodium equilibrium potential. Both the reversal potential and magnitude of the currents exhibited the expected dependence on the external sodium concentration. 3. INa subtypes were characterized initially in terms of their sensitivity to tetrodotoxin (TTX). TTX-sensitive (TTXs) currents were at least 97% suppressed by 0.1 microM TTX. TTX-resistant (TTXr) INa were recorded in the presence of 0.3 microM TTX and appeared to be reduced in amplitude by less than 50% in 75 microM TTX (n = 1). 4. As in earlier studies, the peak of the current-voltage relationship, the mid-point of the normalized conductance curve and the potential (Vh) at which the steady-state inactivation parameter (h infinity) was 0.5 were found to be significantly more depolarized for the TTXr INa (by ca 10, 14 and 37 mV respectively). There was little difference in the slope at the mid-point of the normalized conductance curves (the mean slope factors were 5.1 mV for the TTXs INa and 4.9 mV for the TTXr current) but the h infinity curves for TTXr currents were significantly steeper than those for TTXs currents (mean slope factors of 3.8 and 11.5 mV respectively). Both the time to peak and the decay time constant of the peak current recorded from a holding potential of -67 mV were more than a factor of three slower for the TTXr INa than for the TTXs current. 5. However, in direct contrast to the difference in activation and decay kinetics, 'slow' TTXr INa recovered from inactivation at -67mV, or reprimed, more than a factor of ten faster than 'fast' TTXs INa. 6. The differences apparent in both the repriming kinetics of TTXs and TTXr INa at -67 mV and the kinetics of the decay phase of the peak INa are shown to be explicable largely in terms of the voltage dependence of their respective inactivation systems.(ABSTRACT TRUNCATED AT 400 WORDS)

A novel NaV1.5 voltage sensor mutation associated with severe atrial and ventricular arrhythmias.

PubMed

Wang, Hong-Gang; Zhu, Wandi; Kanter, Ronald J; Silva, Jonathan R; Honeywell, Christina; Gow, Robert M; Pitt, Geoffrey S

2016-03-01

Inherited autosomal dominant mutations in cardiac sodium channels (NaV1.5) cause various arrhythmias, such as long QT syndrome and Brugada syndrome. Although dozens of mutations throughout the protein have been reported, there are few reported mutations within a voltage sensor S4 transmembrane segment and few that are homozygous. Here we report analysis of a novel lidocaine-sensitive recessive mutation, p.R1309H, in the NaV1.5 DIII/S4 voltage sensor in a patient with a complex arrhythmia syndrome. We expressed the wild type or mutant NaV1.5 heterologously for analysis with the patch-clamp and voltage clamp fluorometry (VCF) techniques. p.R1309H depolarized the voltage-dependence of activation, hyperpolarized the voltage-dependence of inactivation, and slowed recovery from inactivation, thereby reducing the channel availability at physiologic membrane potentials. Additionally, p.R1309H increased the "late" Na(+) current. The location of the mutation in DIIIS4 prompted testing for a gating pore current. We observed an inward current at hyperpolarizing voltages that likely exacerbates the loss-of-function defects at resting membrane potentials. Lidocaine reduced the gating pore current. The p.R1309H homozygous NaV1.5 mutation conferred both gain-of-function and loss-of-function effects on NaV1.5 channel activity. Reduction of a mutation-induced gating pore current by lidocaine suggested a therapeutic mechanism. Copyright © 2016 Elsevier Ltd. All rights reserved.

Redox artifacts in electrophysiological recordings

PubMed Central

Berman, Jonathan M.

2013-01-01

Electrophysiological techniques make use of Ag/AgCl electrodes that are in direct contact with cells or bath. In the bath, electrodes are exposed to numerous experimental conditions and chemical reagents that can modify electrode voltage. We examined voltage offsets created in Ag/AgCl electrodes by exposure to redox reagents used in electrophysiological studies. Voltage offsets were measured in reference to an electrode separated from the solution by an agar bridge. The reducing reagents Tris-2-carboxyethly-phosphine, dithiothreitol (DTT), and glutathione, as well as the oxidizing agent H2O2 used at experimentally relevant concentrations reacted with Ag in the electrodes to produce voltage offsets. Chloride ions and strong acids and bases produced offsets at millimolar concentrations. Electrolytic depletion of the AgCl layer, to replicate voltage clamp and sustained use, resulted in increased sensitivity to flow and DTT. Offsets were sensitive to electrode silver purity and to the amount and method of chloride deposition. For example, exposure to 10 μM DTT produced a voltage offset between 10 and 284 mV depending on the chloride deposition method. Currents generated by these offsets are significant and dependent on membrane conductance and by extension the expression of ion channels and may therefore appear to be biological in origin. These data demonstrate a new source of artifacts in electrophysiological recordings that can affect measurements obtained from a variety of experimental techniques from patch clamp to two-electrode voltage clamp. PMID:23344161

Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3} oxide

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bhowmik, R. N., E-mail: rnbhowmik.phy@pondiuni.edu.in; Vijayasri, G.

2015-06-15

We have studied current-voltage (I-V) characteristics of α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3}, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling.more » The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔV{sub P}) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.« less

Effects of shields on cables

NASA Technical Reports Server (NTRS)

1977-01-01

Aircraft wiring subjected to rapidly changing electromagnetic fields was considered. The ways in which shielded cables reduce surge voltages were studied along with the ways in which common practice regarding the use of shields may be at variance with the use required for the control of lightning effects. Courses in which this apparent conflict of use may be resolved were suggested. Noise currents flowing on shields of cables related to the noise signals coupled onto signal conductors were also investigated.

Thermal Dependence of the Apparent Km of Glutathione Reductases from Three Plant Species

PubMed Central

Mahan, James R.; Burke, John J.; Orzech, Karen A.

1990-01-01

The thermal dependencies of the apparent Km of the glutathione reductases from spinach (Spinacia oleracea L.) corn (Zea mays L.), and cucumber (Cucumis sativus L.) were determined. The apparent Km of the enzymes were found to vary up to 9-fold between 12.5 and 45°C. Values of the apparent Km in excess of 200% of the observed minimum are suggested to be detrimental to the normal function of the enzyme. We propose the term “thermal kinetic window” to describe to the range of temperatures over which the apparent Km of the glutathione reductase is within 200% of its minimum and suggest that it may be a useful indicator of the limits of thermal stress for a given species. The thermal kinetic windows determined in this study are: <16°C for spinach, 23 to 32°C for corn, and 35 to 41°C for cucumber. PMID:16667543

The 20 kW battery study program

NASA Technical Reports Server (NTRS)

1971-01-01

Six battery configurations were selected for detailed study and these are described. A computer program was modified for use in estimation of the weights, costs, and reliabilities of each of the configurations, as a function of several important independent variables, such as system voltage, battery voltage ratio (battery voltage/bus voltage), and the number of parallel units into which each of the components of the power subsystem was divided. The computer program was used to develop the relationship between the independent variables alone and in combination, and the dependent variables: weight, cost, and availability. Parametric data, including power loss curves, are given.

Interpretation of current-voltage relationships for "active" ion transport systems: I. Steady-state reaction-kinetic analysis of class-I mechanisms.

PubMed

Hansen, U P; Gradmann, D; Sanders, D; Slayman, C L

1981-01-01

This paper develops a simple reaction-kinetic model to describe electrogenic pumping and co- (or counter-) transport of ions. It uses the standard steady-state approach for cyclic enzyme- or carrier-mediated transport, but does not assume rate-limitation by any particular reaction step. Voltage-dependence is introduced, after the suggestion of Läuger and Stark (Biochim. Biophys. Acta 211:458-466, 1970), via a symmetric Eyring barrier, in which the charge-transit reaction constants are written as k12 = ko12 exp(zF delta psi/2RT) and k21 = ko21 exp(-zF delta psi/2RT). For interpretation of current-voltage relationships, all voltage-independent reaction steps are lumped together, so the model in its simplest form can be described as a pseudo-2-state model. It is characterized by the two voltage-dependent reaction constants, two lumped voltage-independent reaction constants (k12, k21), and two reserve factors (ri, ro) which formally take account of carrier states that are indistinguishable in the current-voltage (I-V) analysis. The model generates a wide range of I-V relationships, depending on the relative magnitudes of the four reaction constants, sufficient to describe essentially all I-V datas now available on "active" ion-transport systems. Algebraic and numerical analysis of the reserve factors, by means of expanded pseudo-3-, 4-, and 5-state models, shows them to be bounded and not large for most combinations of reaction constants in the lumped pathway. The most important exception to this rule occurs when carrier decharging immediately follows charge transit of the membrane and is very fast relative to other constituent voltage-independent reactions. Such a circumstance generates kinetic equivalence of chemical and electrical gradients, thus providing a consistent definition of ion-motive forces (e.g., proton-motive force, PMF). With appropriate restrictions, it also yields both linear and log-linear relationships between net transport velocity and either membrane potential or PMF. The model thus accommodates many known properties of proton-transport systems, particularly as observed in "chemiosmotic" or energy-coupling membranes.

Voltage-sensing phosphatase modulation by a C2 domain.

PubMed

Castle, Paul M; Zolman, Kevin D; Kohout, Susy C

2015-01-01

The voltage-sensing phosphatase (VSP) is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD), the inter-domain linker, the cytosolic catalytic domain, and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate (PIP) lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] (Kalli et al., 2014). Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5)P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry (VCF) were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5)P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in VSP function.

Voltage-sensing phosphatase modulation by a C2 domain

PubMed Central

Castle, Paul M.; Zolman, Kevin D.; Kohout, Susy C.

2015-01-01

The voltage-sensing phosphatase (VSP) is the first example of an enzyme controlled by changes in membrane potential. VSP has four distinct regions: the transmembrane voltage-sensing domain (VSD), the inter-domain linker, the cytosolic catalytic domain, and the C2 domain. The VSD transmits the changes in membrane potential through the inter-domain linker activating the catalytic domain which then dephosphorylates phosphatidylinositol phosphate (PIP) lipids. The role of the C2, however, has not been established. In this study, we explore two possible roles for the C2: catalysis and membrane-binding. The Ci-VSP crystal structures show that the C2 residue Y522 lines the active site suggesting a contribution to catalysis. When we mutated Y522 to phenylalanine, we found a shift in the voltage dependence of activity. This suggests hydrogen bonding as a mechanism of action. Going one step further, when we deleted the entire C2 domain, we found voltage-dependent enzyme activity was no longer detectable. This result clearly indicates the entire C2 is necessary for catalysis as well as for modulating activity. As C2s are known membrane-binding domains, we tested whether the VSP C2 interacts with the membrane. We probed a cluster of four positively charged residues lining the top of the C2 and suggested by previous studies to interact with phosphatidylinositol 4,5-bisphosphate [PI(4,5)P2] (Kalli et al., 2014). Neutralizing those positive charges significantly shifted the voltage dependence of activity to higher voltages. We tested membrane binding by depleting PI(4,5)P2 from the membrane using the 5HT2C receptor and found that the VSD motions as measured by voltage clamp fluorometry (VCF) were not changed. These results suggest that if the C2 domain interacts with the membrane to influence VSP function it may not occur exclusively through PI(4,5)P2. Together, this data advances our understanding of the VSP C2 by demonstrating a necessary and critical role for the C2 domain in VSP function. PMID:25904865

The properties of single cones isolated from the tiger salamander retina

PubMed Central

Attwell, David; Werblin, Frank S.; Wilson, Martin

1982-01-01

1. The properties of isolated single cones were studied using the voltage-clamp technique, with two micro-electrodes inserted under visual control. 2. Single cones had input resistances, when impaled with two electrodes, of up to 270 MΩ. This is probably lower than the true membrane resistance, because of damage by the impaling electrodes. The cone capacitance was about 85 pF. 3. The cone membrane contains a time-dependent current, IB, controlled by voltage, and a separate photosensitive current. 4. The gated current, IB, is an inward current with a reversal potential around -25 mV. It is activated by hyperpolarization over the range -30 to -80 mV, and at constant voltage obeys first order (exponential) kinetics. The gating time constant is typically 50 ms at the resting potential of -45 mV, rises to 170 ms at -70 mV, and decreases for further hyperpolarization. 5. The spectral sensitivity curve of the cone light response peaks at 620 nm wave-length, and is narrower than the nomogram for vitamin A2-based pigments. The light responses of isolated cones are spectrally univariant. 6. Voltage-clamped photocurrents were recorded at various membrane potentials, for light steps of various intensities. The photocurrent reversed at around -8 mV. The time course of the photocurrent, for a given intensity, was approximately independent of voltage (although its magnitude was voltage-dependent). The shape of the peak current—voltage relation of the light-sensitive current was independent of light intensity (although its magnitude was intensity-dependent). 7. These results can be explained if: (a) light simply changes the number of photosensitive channels open, without altering the properties of an open channel; (b) the reactions controlling the production of internal transmitter, the binding of internal transmitter to the photosensitive channels, and the closing and opening of the channels are unaffected by the electric field in the cone membrane, even though at least some of these reactions take place in the membrane. 8. IB plays only a small role in shaping the cone voltage response to light. ImagesPlate 1 PMID:7131315

Logarithmic singularities and quantum oscillations in magnetically doped topological insulators

NASA Astrophysics Data System (ADS)

Nandi, D.; Sodemann, Inti; Shain, K.; Lee, G. H.; Huang, K.-F.; Chang, Cui-Zu; Ou, Yunbo; Lee, S. P.; Ward, J.; Moodera, J. S.; Kim, P.; Yacoby, A.

2018-02-01

We report magnetotransport measurements on magnetically doped (Bi,Sb ) 2Te3 films grown by molecular beam epitaxy. In Hall bar devices, we observe logarithmic dependence of transport coefficients in temperature and bias voltage which can be understood to arise from electron-electron interaction corrections to the conductivity and self-heating. Submicron scale devices exhibit intriguing quantum oscillations at high magnetic fields with dependence on bias voltage. The observed quantum oscillations can be attributed to bulk and surface transport.

Frequency Dependence of Single-event Upset in Advanced Commerical PowerPC Microprocessors

NASA Technical Reports Server (NTRS)

Irom, Frokh; Farmanesh, Farhad F.; Swift, Gary M.; Johnston, Allen H.

2004-01-01

This paper examines single-event upsets in advanced commercial SOI microprocessors in a dynamic mode, studying SEU sensitivity of General Purpose Registers (GPRs) with clock frequency. Results are presented for SOI processors with feature sizes of 0.18 microns and two different core voltages. Single-event upset from heavy ions is measured for advanced commercial microprocessors in a dynamic mode with clock frequency up to 1GHz. Frequency and core voltage dependence of single-event upsets in registers is discussed.

Experimental breakdown of selected anodized aluminum samples in dilute plasmas

NASA Technical Reports Server (NTRS)

Grier, Norman T.; Domitz, Stanley

1992-01-01

Anodized aluminum samples representative of Space Station Freedom structural material were tested for electrical breakdown under space plasma conditions. In space, this potential arises across the insulating anodized coating when the spacecraft structure is driven to a negative bias relative to the external plasma potential due to plasma-surface interaction phenomena. For anodized materials used in the tests, it was found that breakdown voltage varied from 100 to 2000 volts depending on the sample. The current in the arcs depended on the sample, the capacitor, and the voltage. The level of the arc currents varied from 60 to 1000 amperes. The plasma number density varied from 3 x 10 exp 6 to 10 exp 3 ions per cc. The time between arcs increased as the number density was lowered. Corona testing of anodized samples revealed that samples with higher corona inception voltage had higher arcing inception voltages. From this it is concluded that corona testing may provide a method of screening the samples.

Kinetics of transient electroluminescence in organic light emitting diodes

NASA Astrophysics Data System (ADS)

Shukla, Manju; Kumar, Pankaj; Chand, Suresh; Brahme, Nameeta; Kher, R. S.; Khokhar, M. S. K.

2008-08-01

Mathematical simulation on the rise and decay kinetics of transient electroluminescence (EL) in organic light emitting diodes (OLEDs) is presented. The transient EL is studied with respect to a step voltage pulse. While rising, for lower values of time, the EL intensity shows a quadratic dependence on (t - tdel), where tdel is the time delay observed in the onset of EL, and finally attains saturation at a sufficiently large time. When the applied voltage is switched off, the initial EL decay shows an exponential dependence on (t - tdec), where tdec is the time when the voltage is switched off. The simulated results are compared with the transient EL performance of a bilayer OLED based on small molecular bis(2-methyl 8-hydroxyquinoline)(triphenyl siloxy) aluminium (SAlq). Transient EL studies have been carried out at different voltage pulse amplitudes. The simulated results show good agreement with experimental data. Using these simulated results the lifetime of the excitons in SAlq has also been calculated.

Dual patch voltage clamp study of low membrane resistance astrocytes in situ.

PubMed

Ma, Baofeng; Xu, Guangjin; Wang, Wei; Enyeart, John J; Zhou, Min

2014-03-17

Whole-cell patch clamp recording has been successfully used in identifying the voltage-dependent gating and conductance properties of ion channels in a variety of cells. However, this powerful technique is of limited value in studying low membrane resistance cells, such as astrocytes in situ, because of the inability to control or accurately measure the real amplitude of command voltages. To facilitate the study of ionic conductances of astrocytes, we have developed a dual patch recording method which permits membrane current and membrane potential to be simultaneously recorded from astrocytes in spite of their extraordinarily low membrane resistance. The utility of this technique is demonstrated by measuring the voltage-dependent activation of the inwardly rectifying K+ current abundantly expressed in astrocytes and multiple ionic events associated with astrocytic GABAA receptor activation. This protocol can be performed routinely in the study of astrocytes. This method will be valuable for identifying and characterizing the individual ion channels that orchestrate the electrical activity of low membrane resistance cells.

Electro-chemical coupling in the voltage-dependent phosphatase Ci-VSP

PubMed Central

Kohout, Susy C.; Bell, Sarah C.; Liu, Lijun; Xu, Qiang; Minor, Daniel L.; Isacoff, Ehud Y.

2010-01-01

In the voltage sensing phosphatase, Ci-VSP, a voltage sensing domain (VSD) controls a lipid phosphatase domain (PD). The mechanism by which the domains are allosterically coupled is not well understood. Using an in vivo assay, we find that the inter-domain linker that connects the VSD to the PD is essential for coupling the full-length protein. Biochemical assays show that the linker is also needed for activity in the isolated PD. We identify a late step of VSD motion in the full-length protein that depends on the linker. Strikingly, this VSD motion is found to require PI(4,5)P2, a substrate of Ci-VSP. These results suggest that the voltage-driven motion of the VSD turns the enzyme on by rearranging the linker into an activated conformation, and that this activated conformation is stabilized by PI(4,5)P2. We propose that Ci-VSP activity is self-limited because its decrease of PI(4,5)P2 levels decouples the VSD from the enzyme. PMID:20364128

A single-molecule diode.

PubMed

Elbing, Mark; Ochs, Rolf; Koentopp, Max; Fischer, Matthias; von Hänisch, Carsten; Weigend, Florian; Evers, Ferdinand; Weber, Heiko B; Mayor, Marcel

2005-06-21

We have designed and synthesized a molecular rod that consists of two weakly coupled electronic pi -systems with mutually shifted energy levels. The asymmetry thus implied manifests itself in a current-voltage characteristic with pronounced dependence on the sign of the bias voltage, which makes the molecule a prototype for a molecular diode. The individual molecules were immobilized by sulfur-gold bonds between both electrodes of a mechanically controlled break junction, and their electronic transport properties have been investigated. The results indeed show diode-like current-voltage characteristics. In contrast to that, control experiments with symmetric molecular rods consisting of two identical pi-systems did not show significant asymmetries in the transport properties. To investigate the underlying transport mechanism, phenomenological arguments are combined with calculations based on density functional theory. The theoretical analysis suggests that the bias dependence of the polarizability of the molecule feeds back into the current leading to an asymmetric shape of the current-voltage characteristics, similar to the phenomena in a semiconductor diode.

A single-molecule diode

PubMed Central

Elbing, Mark; Ochs, Rolf; Koentopp, Max; Fischer, Matthias; von Hänisch, Carsten; Weigend, Florian; Evers, Ferdinand; Weber, Heiko B.; Mayor, Marcel

2005-01-01

We have designed and synthesized a molecular rod that consists of two weakly coupled electronic π -systems with mutually shifted energy levels. The asymmetry thus implied manifests itself in a current–voltage characteristic with pronounced dependence on the sign of the bias voltage, which makes the molecule a prototype for a molecular diode. The individual molecules were immobilized by sulfur–gold bonds between both electrodes of a mechanically controlled break junction, and their electronic transport properties have been investigated. The results indeed show diode-like current–voltage characteristics. In contrast to that, control experiments with symmetric molecular rods consisting of two identical π -systems did not show significant asymmetries in the transport properties. To investigate the underlying transport mechanism, phenomenological arguments are combined with calculations based on density functional theory. The theoretical analysis suggests that the bias dependence of the polarizability of the molecule feeds back into the current leading to an asymmetric shape of the current–voltage characteristics, similar to the phenomena in a semiconductor diode. PMID:15956208

Revisiting the positive DC corona discharge theory: Beyond Peek's and Townsend's law

NASA Astrophysics Data System (ADS)

Monrolin, Nicolas; Praud, Olivier; Plouraboué, Franck

2018-06-01

The classical positive Corona Discharge theory in a cylindrical axisymmetric configuration is revisited in order to find analytically the influence of gas properties and thermodynamic conditions on the corona current. The matched asymptotic expansion of Durbin and Turyn [J. Phys. D: Appl. Phys. 20, 1490-1495 (1987)] of a simplified but self-consistent problem is performed and explicit analytical solutions are derived. The mathematical derivation enables us to express a new positive DC corona current-voltage characteristic, choosing either a dimensionless or dimensional formulation. In dimensional variables, the current voltage law and the corona inception voltage explicitly depend on the electrode size and physical gas properties such as ionization and photoionization parameters. The analytical predictions are successfully confronted with experiments and Peek's and Townsend's laws. An analytical expression of the corona inception voltage φ o n is proposed, which depends on the known values of physical parameters without adjustable parameters. As a proof of consistency, the classical Townsend current-voltage law I = C φ ( φ - φ o n ) is retrieved by linearizing the non-dimensional analytical solution. A brief parametric study showcases the interest in this analytical current model, especially for exploring small corona wires or considering various thermodynamic conditions.

Redefining the Speed Limit of Phase Change Memory Revealed by Time-resolved Steep Threshold-Switching Dynamics of AgInSbTe Devices

NASA Astrophysics Data System (ADS)

Shukla, Krishna Dayal; Saxena, Nishant; Durai, Suresh; Manivannan, Anbarasu

2016-11-01

Although phase-change memory (PCM) offers promising features for a ‘universal memory’ owing to high-speed and non-volatility, achieving fast electrical switching remains a key challenge. In this work, a correlation between the rate of applied voltage and the dynamics of threshold-switching is investigated at picosecond-timescale. A distinct characteristic feature of enabling a rapid threshold-switching at a critical voltage known as the threshold voltage as validated by an instantaneous response of steep current rise from an amorphous off to on state is achieved within 250 picoseconds and this is followed by a slower current rise leading to crystallization. Also, we demonstrate that the extraordinary nature of threshold-switching dynamics in AgInSbTe cells is independent to the rate of applied voltage unlike other chalcogenide-based phase change materials exhibiting the voltage dependent transient switching characteristics. Furthermore, numerical solutions of time-dependent conduction process validate the experimental results, which reveal the electronic nature of threshold-switching. These findings of steep threshold-switching of ‘sub-50 ps delay time’, opens up a new way for achieving high-speed non-volatile memory for mainstream computing.

Current-Voltage Characteristic of Nanosecond - Duration Relativistic Electron Beam

NASA Astrophysics Data System (ADS)

Andreev, Andrey

2005-10-01

The pulsed electron-beam accelerator SINUS-6 was used to measure current-voltage characteristic of nanosecond-duration thin annular relativistic electron beam accelerated in vacuum along axis of a smooth uniform metal tube immersed into strong axial magnetic field. Results of these measurements as well as results of computer simulations performed using 3D MAGIC code show that the electron-beam current dependence on the accelerating voltage at the front of the nanosecond-duration pulse is different from the analogical dependence at the flat part of the pulse. In the steady-state (flat) part of the pulse), the measured electron-beam current is close to Fedosov current [1], which is governed by the conservation law of an electron moment flow for any constant voltage. In the non steady-state part (front) of the pulse, the electron-beam current is higher that the appropriate, for a giving voltage, steady-state (Fedosov) current. [1] A. I. Fedosov, E. A. Litvinov, S. Ya. Belomytsev, and S. P. Bugaev, ``Characteristics of electron beam formed in diodes with magnetic insulation,'' Soviet Physics Journal (A translation of Izvestiya VUZ. Fizika), vol. 20, no. 10, October 1977 (April 20, 1978), pp.1367-1368.

Multiple pore conformations driven by asynchronous movements of voltage sensors in a eukaryotic sodium channel

PubMed Central

Goldschen-Ohm, Marcel P.; Capes, Deborah L.; Oelstrom, Kevin M.; Chanda, Baron

2013-01-01

Voltage-dependent Na+ channels are crucial for electrical signalling in excitable cells. Membrane depolarization initiates asynchronous movements in four non-identical voltage-sensing domains of the Na+ channel. It remains unclear to what extent this structural asymmetry influences pore gating as compared with outwardly rectifying K+ channels, where channel opening results from a final concerted transition of symmetric pore gates. Here we combine single channel recordings, cysteine accessibility and voltage clamp fluorimetry to probe the relationships between voltage sensors and pore conformations in an inactivation deficient Nav1.4 channel. We observe three distinct conductance levels such that DI-III voltage sensor activation is kinetically correlated with formation of a fully open pore, whereas DIV voltage sensor movement underlies formation of a distinct subconducting pore conformation preceding inactivation in wild-type channels. Our experiments reveal that pore gating in sodium channels involves multiple transitions driven by asynchronous movements of voltage sensors. These findings shed new light on the mechanism of coupling between activation and fast inactivation in voltage-gated sodium channels. PMID:23322038

Undersize solute element effects on defect structure development in copper under electron irradiation

NASA Astrophysics Data System (ADS)

Satoh, Y.; Yoshiie, T.; Arai, S.

2018-03-01

We conducted systematic experiments of defect structure development in Cu base binary alloys under 1000 kV electron irradiation at temperatures higher than 300 K, using in situ observations with high voltage electron microscopy. This report describes the effects of undersize elements: Co (-3.78%), Ni (-8.45%) and Be (-26.45%). The volume size factors are given in parentheses. The amounts of the respective elements were 2, 0.3, 0.05 at.%, or less. In Cu-Ni and Cu-Co and in the reference Cu, temperature dependence of the number density of interstitial-type dislocation loops had a down peak (i.e. loops hardly formed) at approximately 373 K, attributed to unexpected impurity atoms. Above the down-peak temperature, the addition of Co or Ni increased the loop number density through continuous nucleation of loops, extended the loop formation to higher temperatures, and decreased the apparent activation energy of loop growth rate. The addition of Be for 0.3 at.% or more delayed loop formation after formation of stacking fault tetrahedra (SFTs) around 300 K. The apparent mobility of self-interstitial atoms is expected to be smaller than that of vacancies because of strong binding with Be. Loop formation at temperatures higher than 373 K was enhanced by Be for 0.3 or 2 at.%, although it was suppressed greatly for 0.05 at.% or less. All undersize atoms increased the stability of SFTs under irradiation. Mechanisms of those effects were discussed and were briefly compared with earlier results found for oversize elements in Cu.

Combined electrical transport and capacitance spectroscopy of a MoS2-LiNbO3 field effect transistor

NASA Astrophysics Data System (ADS)

Michailow, Wladislaw; Schülein, Florian J. R.; Möller, Benjamin; Preciado, Edwin; Nguyen, Ariana E.; von Son, Gretel; Mann, John; Hörner, Andreas L.; Wixforth, Achim; Bartels, Ludwig; Krenner, Hubert J.

2017-01-01

We have measured both the current-voltage ( ISD - VGS ) and capacitance-voltage (C- VGS ) characteristics of a MoS2-LiNbO3 field effect transistor. From the measured capacitance, we calculate the electron surface density and show that its gate voltage dependence follows the theoretical prediction resulting from the two-dimensional free electron model. This model allows us to fit the measured ISD - VGS characteristics over the entire range of VGS . Combining this experimental result with the measured current-voltage characteristics, we determine the field effect mobility as a function of gate voltage. We show that for our device, this improved combined approach yields significantly smaller values (more than a factor of 4) of the electron mobility than the conventional analysis of the current-voltage characteristics only.

Probing of barrier induced deviations in current-voltage characteristics of polymer devices by impedance spectroscopy

NASA Astrophysics Data System (ADS)

Khan, Motiur Rahman; Rao, K. S. R. Koteswara; Menon, R.

2017-05-01

Temperature dependent current-voltage measurements have been performed on poly(3-methylthiophene) based devices in metal/polymer/metal geometry in temperature range 90-300 K. Space charge limited current (SCLC) controlled by exponentially distributed traps is observed at all the measured temperatures at intermediate voltage range. At higher voltages, trap-free SCLC is observed at 90 K only while slope less than 2 is observed at higher temperatures which is quiet unusual in polymer devices. Impedance measurements were performed at different bias voltages. The unusual behavior observed in current-voltage characteristics is explained by Cole-Cole plot which gives the signature of interface dipole on electrode/polymer interface. Two relaxation mechanisms are obtained from the real part of impedance vs frequency spectra which confirms the interface related phenomena in the device

Switch contact device for interrupting high current, high voltage, AC and DC circuits

DOEpatents

Via, Lester C.; Witherspoon, F. Douglas; Ryan, John M.

2005-01-04

A high voltage switch contact structure capable of interrupting high voltage, high current AC and DC circuits. The contact structure confines the arc created when contacts open to the thin area between two insulating surfaces in intimate contact. This forces the arc into the shape of a thin sheet which loses heat energy far more rapidly than an arc column having a circular cross-section. These high heat losses require a dramatic increase in the voltage required to maintain the arc, thus extinguishing it when the required voltage exceeds the available voltage. The arc extinguishing process with this invention is not dependent on the occurrence of a current zero crossing and, consequently, is capable of rapidly interrupting both AC and DC circuits. The contact structure achieves its high performance without the use of sulfur hexafluoride.

Current-voltage characteristics and transition voltage spectroscopy of individual redox proteins.

PubMed

Artés, Juan M; López-Martínez, Montserrat; Giraudet, Arnaud; Díez-Pérez, Ismael; Sanz, Fausto; Gorostiza, Pau

2012-12-19

Understanding how molecular conductance depends on voltage is essential for characterizing molecular electronics devices. We reproducibly measured current-voltage characteristics of individual redox-active proteins by scanning tunneling microscopy under potentiostatic control in both tunneling and wired configurations. From these results, transition voltage spectroscopy (TVS) data for individual redox molecules can be calculated and analyzed statistically, adding a new dimension to conductance measurements. The transition voltage (TV) is discussed in terms of the two-step electron transfer (ET) mechanism. Azurin displays the lowest TV measured to date (0.4 V), consistent with the previously reported distance decay factor. This low TV may be advantageous for fabricating and operating molecular electronic devices for different applications. Our measurements show that TVS is a helpful tool for single-molecule ET measurements and suggest a mechanism for gating of ET between partner redox proteins.

Universal dependence on the channel conductivity of the competing weak localization and antilocalization in amorphous InGaZnO4 thin-film transistors

NASA Astrophysics Data System (ADS)

Wang, Wei-Hsiang; Lyu, Syue-Ru; Heredia, Elica; Liu, Shu-Hao; Jiang, Pei-hsun; Liao, Po-Yung; Chang, Ting-Chang

2017-05-01

We investigate the gate-voltage dependence of the magnetoconductivity of several amorphous InGaZnO4 (a-IGZO) thin-film transistors (TFTs). The magnetoconductivity exhibits gate-voltage-controlled competitions between weak localization (WL) and weak antilocalization (WAL), and the respective weights of WL and WAL contributions demonstrate an intriguing universal dependence on the channel conductivity regardless of the difference in the electrical characteristics of the a-IGZO TFTs. Our findings help build a theoretical interpretation of the competing WL and WAL observed in the electron systems in a-IGZO TFTs.

Biphasic Effect of Nitric Oxide on the Cardiac Voltage-dependent Anion Channel

PubMed Central

Cheng, Qunli; Sedlic, Filip; Pravdic, Danijel; Bosnjak, Zeljko J.; Kwok, Wai-Meng

2010-01-01

Nitric oxide (NO˙) effects on the cardiac mitochondrial voltage-dependent anion channel (VDAC) are unknown. The effects of exogenous NO˙ on VDAC purified from rat hearts were investigated in this study. When incorporated into lipid bilayers, VDAC was inhibited directly by an NO˙ donor, PAPA NONOate, in a concentration-dependent biphasic manner. This was prevented by an NO˙ scavenger, PTIO. The effect paralleled that of NO˙ in delaying the opening of the mitochondrial permeability transition (PT) pore. These biphasic effects on the cardiac VDAC and the PT pore reveal a tandem impact of NO˙ on the two mitochondrial entities. PMID:21156174

Linear analysis of time dependent properties of Child-Langmuir flow

DOE Office of Scientific and Technical Information (OSTI.GOV)

Rokhlenko, A.

We continue our analysis of the time dependent behavior of the electron flow in the Child-Langmuir system, removing an approximation used earlier. We find a modified set of oscillatory decaying modes with frequencies of the same order as the inverse of the electron transient time. This range (typically MHz) allows simple experimental detection and maybe exploitation. We then study the time evolution of the current in response to a slow change of the anode voltage where the same modes of oscillations appear too. The cathode current in this case is systematically advanced or retarded depending on the direction of themore » voltage change.« less

Frequency-dependent shot noise in long disordered superconductor-normal-metal-superconductor contacts.

PubMed

Nagaev, K E

2001-04-02

The shot noise in long diffusive superconductor-normal-metal-superconductor contacts is calculated using the semiclassical approach. At low frequencies and for purely elastic scattering, the voltage dependence of the noise is of the form S(I) = (4Delta+2eV)/3R. The electron-electron scattering suppresses the noise at small voltages resulting in vanishing noise yet infinite dS(I)/dV at V = 0. The distribution function of electrons consists of a series of steps, and the frequency dependence of noise exhibits peculiarities at omega = neV, omega = neV-2Delta, and omega = 2Delta-neV for integer n.

Linear analysis of time dependent properties of Child-Langmuir flow

NASA Astrophysics Data System (ADS)

Rokhlenko, A.

2013-01-01

We continue our analysis of the time dependent behavior of the electron flow in the Child-Langmuir system, removing an approximation used earlier. We find a modified set of oscillatory decaying modes with frequencies of the same order as the inverse of the electron transient time. This range (typically MHz) allows simple experimental detection and maybe exploitation. We then study the time evolution of the current in response to a slow change of the anode voltage where the same modes of oscillations appear too. The cathode current in this case is systematically advanced or retarded depending on the direction of the voltage change.

Induction motors airgap-eccentricity detection through the discrete wavelet transform of the apparent power signal under non-stationary operating conditions.

PubMed

Yahia, K; Cardoso, A J M; Ghoggal, A; Zouzou, S E

2014-03-01

Fast Fourier transform (FFT) analysis has been successfully used for fault diagnosis in induction machines. However, this method does not always provide good results for the cases of load torque, speed and voltages variation, leading to a variation of the motor-slip and the consequent FFT problems that appear due to the non-stationary nature of the involved signals. In this paper, the discrete wavelet transform (DWT) of the apparent-power signal for the airgap-eccentricity fault detection in three-phase induction motors is presented in order to overcome the above FFT problems. The proposed method is based on the decomposition of the apparent-power signal from which wavelet approximation and detail coefficients are extracted. The energy evaluation of a known bandwidth permits to define a fault severity factor (FSF). Simulation as well as experimental results are provided to illustrate the effectiveness and accuracy of the proposed method presented even for the case of load torque variations. Copyright © 2013 ISA. Published by Elsevier Ltd. All rights reserved.

Non-scaling behavior of electroosmotic flow in voltage-gated nanopores

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lian, Cheng; Gallegos, Alejandro; Liu, Honglai

2017-01-01

Ionic size effects and electrostatic correlations result in the non-monotonic dependence of the electrical conductivity on the pore size. For ion transport at a high gating voltage, the conductivity oscillates with the pore size due to a significant overlap of the electric double layers.

Noise Properties of Rectifying Nanopore

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vlassiouk, Ivan V

2011-01-01

Ion currents through three types of rectifying nanoporous structures are studied and compared: conically shaped polymer nanopores, glass nanopipettes, and silicon nitride nanopores. Time signals of ion currents are analyzed by the power spectrum. We focus on the low-frequency range where the power spectrum magnitude scales with frequency, f, as 1/f. Glass nanopipettes and polymer nanopores exhibit nonequilibrium 1/f noise; thus, the normalized power spectrum depends on the voltage polarity and magnitude. In contrast, 1/f noise in rectifying silicon nitride nanopores is of equilibrium character. Various mechanisms underlying the voltage-dependent 1/f noise are explored and discussed, including intrinsic pore wallmore » dynamics and formation of vortices and nonlinear flow patterns in the pore. Experimental data are supported by modeling of ion currents based on the coupled Poisson-Nernst-Planck and Navier-Stokes equations. We conclude that the voltage-dependent 1/f noise observed in polymer and glass asymmetric nanopores might result from high and asymmetric electric fields, inducing secondary effects in the pore, such as enhanced water dissociation.« less

Effect of combined platinum and electron on the temperature dependence of forward voltage in fast recovery diode

NASA Astrophysics Data System (ADS)

Jia, Yun-Peng; Zhao, Bao; Yang, Fei; Wu, Yu; Zhou, Xuan; Li, Zhe; Tan, Jian

2015-12-01

The temperature dependences of forward voltage drop (VF) of the fast recovery diodes (FRDs) are remarkably influenced by different lifetime controlled treatments. In this paper the results of an experimental study are presented, which are the lifetime controls of platinum treatment, electron irradiation treatment, and the combined treatment of the above ones. Based on deep level transient spectroscopy (DLTS) measurements, a new level E6 (EC-0.376 eV) is found in the combined lifetime treated (CLT) sample, which is different from the levels of the individual platinum and electron irradiation ones. Comparing the tested VF results of CLT samples with the others, the level E6 is responsible for the degradation of temperature dependence of the forward voltage drop in the FRD. Project supported by the Doctoral Fund of Ministry of Education of China (Grant No. 20111103120016) and the State Grid Corporation of China Program of Science and Technology, China (Grant No. 5455DW140003).

Cloning and functional expression of a plant voltage-dependent chloride channel.

PubMed Central

Lurin, C; Geelen, D; Barbier-Brygoo, H; Guern, J; Maurel, C

1996-01-01

Plant cell membrane anion channels participate in basic physiological functions, such as cell volume regulation and signal transduction. However, nothing is known about their molecular structure. Using a polymerase chain reaction strategy, we have cloned a tobacco cDNA (CIC-Nt1) encoding a 780-amino acid protein with several putative transmembrane domains. CIC-Nt1 displays 24 to 32% amino acid identity with members of the animal voltage-dependent chloride channel (CIC) family, whose archetype is CIC-0 from the Torpedo marmorata electric organ. Injection of CIC-Nt1 complementary RNA into Xenopus oocytes elicited slowly activating inward currents upon membrane hyperpolarization more negative than -120 mV. These currents were carried mainly by anions, modulated by extracellular anions, and totally blocked by 10 mM extracellular calcium. The identification of CIC-Nt1 extends the CIC family to higher plants and provides a molecular probe for the study of voltage-dependent anion channels in plants. PMID:8624442

Miscibility Gap Closure, Interface Morphology, and Phase Microstructure of 3D Li xFePO 4 Nanoparticles from Surface Wetting and Coherency Strain

DOE PAGES

Welland, Michael J.; Karpeyev, Dmitry; O’Connor, Devin T.; ...

2015-09-10

We study the mesoscopic effects which suppress phase-segregation in Li xFePO 4 nanoparticles using a multiphysics phase-field model implement on a high performance cluster. We simulate 3D spherical particles of radii from 3nm to 40nm and examine the equilibrium microstructure and voltage profiles as a they depend on size and overall lithiation. The model includes anisotropic, concentration-dependent elastic moduli, misfit strain, and facet dependent surface wetting within a Cahn-Hilliard formulation. Here, we find that the miscibility gap vanishes for particles of radius ~ 5 nm, and the solubility limits change with overall particle lithiation. The corresponding voltage plateau, indicative ofmore » phase-segregation, changes in extent and also vanishes. Surface wetting is found to have a strong effect on stabilizing a variety of microstructures, exaggerating the shifting of solubility limits, and shortening the voltage plateau.« less

Separating inverse spin Hall voltage and spin rectification voltage by inverting spin injection direction

NASA Astrophysics Data System (ADS)

Zhang, Wenxu; Peng, Bin; Han, Fangbin; Wang, Qiuru; Soh, Wee Tee; Ong, Chong Kim; Zhang, Wanli

2016-03-01

We develop a method for universally resolving the important issue of separating the inverse spin Hall effect (ISHE) from the spin rectification effect (SRE) signal. This method is based on the consideration that the two effects depend on the spin injection direction: The ISHE is an odd function of the spin injection direction while the SRE is independent on it. Thus, the inversion of the spin injection direction changes the ISHE voltage signal, while the SRE voltage remains. It applies generally to analyzing the different voltage contributions without fitting them to special line shapes. This fast and simple method can be used in a wide frequency range and has the flexibility of sample preparation.

Physical implication of transition voltage in organic nano-floating-gate nonvolatile memories

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang, Shun; Gao, Xu, E-mail: wangsd@suda.edu.cn, E-mail: gaoxu@suda.edu.cn; Zhong, Ya-Nan

High-performance pentacene-based organic field-effect transistor nonvolatile memories, using polystyrene as a tunneling dielectric and Au nanoparticles as a nano-floating-gate, show parallelogram-like transfer characteristics with a featured transition point. The transition voltage at the transition point corresponds to a threshold electric field in the tunneling dielectric, over which stored electrons in the nano-floating-gate will start to leak out. The transition voltage can be modulated depending on the bias configuration and device structure. For p-type active layers, optimized transition voltage should be on the negative side of but close to the reading voltage, which can simultaneously achieve a high ON/OFF ratio andmore » good memory retention.« less

Numerical Simulation on the Induced Voltage Across the Coil Terminal by the Segmented Flow of Ferrofluid and Air-Layer.

PubMed

Lee, Won-Ho; Lee, Sangyoup; Lee, Jong-Chul

2018-09-01

Nanoparticles and nanofluids have been implemented in energy harvesting devices, and energy harvesting based on magnetic nanofluid flow was recently achieved by using a layer-built magnet and microbubble injection to induce a voltage on the order of 10-1 mV. However, this is not yet suitable for some commercial purpose. The air bubbles must be segmented in the base fluid, and the magnetic flux of the ferrofluids should change over time to increase the amount of electric voltage and current from energy harvesting. In this study, we proposed a novel technique to achieve segmented flow of the ferrofluids and the air layers. This segmented ferrofluid flow linear generator can increase the magnitude of the induced voltage from the energy harvesting system. In our experiments, a ferrofluid-filled capsule produced time-dependent changes in the magnetic flux through a multi-turn coil, and the induced voltage was generated on the order of about 101 mV at a low frequency of 2 Hz. A finite element analysis was used to describe the time-dependent change of the magnetic flux through the coil according to the motion of the segmented flow of the ferrofluid and the air-layer, and the induced voltage was generated to the order of 102 mV at a high frequency of 12.5 Hz.

Adenosine A1 receptors modulate high voltage-activated Ca2+ currents and motor pattern generation in the Xenopus embryo

PubMed Central

Brown, Paul; Dale, Nicholas

2000-01-01

Adenosine causes voltage- and non-voltage-dependent inhibition of high voltage-activated (HVA) Ca2+ currents in Xenopus laevis embryo spinal neurons. As this inhibition can be blocked by 8-cyclopentyl-1,3-dipropylxanthine (DPCPX) and mimicked by N6-cyclopentyladenosine (CPA) it appears to be mediated by A1 receptors. Agents active at A2 receptors either were without effect or could be blocked by DPCPX. AMP had no agonist action on these receptors. By using ω-conotoxin GVIA we found that adenosine inhibited an N-type Ca2+ current as well as a further unidentified HVA current that was insensitive to dihydropyridines, ω-agatoxin TK and ω-conotoxin MVIIC. Both types of current were subject to voltage- and non-voltage-dependent inhibition. We used CPA and DPCPX to test whether A1 receptors regulated spinal motor pattern generation in spinalized Xenopus embryos. DPCPX caused a near doubling of, while CPA greatly shortened, the length of swimming episodes. In addition, DPCPX slowed, while CPA greatly speeded up, the rate of run-down of motor activity. Our results demonstrate a novel action of A1 receptors in modulating spinal motor activity. Furthermore they confirm that adenosine is produced continually throughout swimming episodes and acts to cause the eventual termination of activity. PMID:10856119

Substitutions in the domain III voltage-sensing module enhance the sensitivity of an insect sodium channel to a scorpion beta-toxin.

PubMed

Song, Weizhong; Du, Yuzhe; Liu, Zhiqi; Luo, Ningguang; Turkov, Michael; Gordon, Dalia; Gurevitz, Michael; Goldin, Alan L; Dong, Ke

2011-05-06

Scorpion β-toxins bind to the extracellular regions of the voltage-sensing module of domain II and to the pore module of domain III in voltage-gated sodium channels and enhance channel activation by trapping and stabilizing the voltage sensor of domain II in its activated state. We investigated the interaction of a highly potent insect-selective scorpion depressant β-toxin, Lqh-dprIT(3), from Leiurus quinquestriatus hebraeus with insect sodium channels from Blattella germanica (BgNa(v)). Like other scorpion β-toxins, Lqh-dprIT(3) shifts the voltage dependence of activation of BgNa(v) channels expressed in Xenopus oocytes to more negative membrane potentials but only after strong depolarizing prepulses. Notably, among 10 BgNa(v) splice variants tested for their sensitivity to the toxin, only BgNa(v)1-1 was hypersensitive due to an L1285P substitution in IIIS1 resulting from a U-to-C RNA-editing event. Furthermore, charge reversal of a negatively charged residue (E1290K) at the extracellular end of IIIS1 and the two innermost positively charged residues (R4E and R5E) in IIIS4 also increased the channel sensitivity to Lqh-dprIT(3). Besides enhancement of toxin sensitivity, the R4E substitution caused an additional 20-mV negative shift in the voltage dependence of activation of toxin-modified channels, inducing a unique toxin-modified state. Our findings provide the first direct evidence for the involvement of the domain III voltage-sensing module in the action of scorpion β-toxins. This hypersensitivity most likely reflects an increase in IIS4 trapping via allosteric mechanisms, suggesting coupling between the voltage sensors in neighboring domains during channel activation.

The Voltage-Sensing Domain of K(v)7.2 Channels as a Molecular Target for Epilepsy-Causing Mutations and Anticonvulsants.

PubMed

Miceli, Francesco; Soldovieri, Maria Virginia; Iannotti, Fabio Arturo; Barrese, Vincenzo; Ambrosino, Paolo; Martire, Maria; Cilio, Maria Roberta; Taglialatela, Maurizio

2011-01-01

Understanding the molecular mechanisms underlying voltage-dependent gating in voltage-gated ion channels (VGICs) has been a major effort over the last decades. In recent years, changes in the gating process have emerged as common denominators for several genetically determined channelopathies affecting heart rhythm (arrhythmias), neuronal excitability (epilepsy, pain), or skeletal muscle contraction (periodic paralysis). Moreover, gating changes appear as the main molecular mechanism by which several natural toxins from a variety of species affect ion channel function. In this work, we describe the pathophysiological and pharmacological relevance of the gating process in voltage-gated K(+) channels encoded by the K(v)7 gene family. After reviewing the current knowledge on the molecular mechanisms and on the structural models of voltage-dependent gating in VGICs, we describe the physiological relevance of these channels, with particular emphasis on those formed by K(v)7.2-K(v)7.5 subunits having a well-established role in controlling neuronal excitability in humans. In fact, genetically determined alterations in K(v)7.2 and K(v)7.3 genes are responsible for benign familial neonatal convulsions, a rare seizure disorder affecting newborns, and the pharmacological activation of K(v)7.2/3 channels can exert antiepileptic activity in humans. Both mutation-triggered channel dysfunction and drug-induced channel activation can occur by impeding or facilitating, respectively, channel sensitivity to membrane voltage and can affect overlapping molecular sites within the voltage-sensing domain of these channels. Thus, understanding the molecular steps involved in voltage-sensing in K(v)7 channels will allow to better define the pathogenesis of rare human epilepsy, and to design innovative pharmacological strategies for the treatment of epilepsies and, possibly, other human diseases characterized by neuronal hyperexcitability.

The Voltage-Sensing Domain of Kv7.2 Channels as a Molecular Target for Epilepsy-Causing Mutations and Anticonvulsants

PubMed Central

Miceli, Francesco; Soldovieri, Maria Virginia; Iannotti, Fabio Arturo; Barrese, Vincenzo; Ambrosino, Paolo; Martire, Maria; Cilio, Maria Roberta; Taglialatela, Maurizio

2010-01-01

Understanding the molecular mechanisms underlying voltage-dependent gating in voltage-gated ion channels (VGICs) has been a major effort over the last decades. In recent years, changes in the gating process have emerged as common denominators for several genetically determined channelopathies affecting heart rhythm (arrhythmias), neuronal excitability (epilepsy, pain), or skeletal muscle contraction (periodic paralysis). Moreover, gating changes appear as the main molecular mechanism by which several natural toxins from a variety of species affect ion channel function. In this work, we describe the pathophysiological and pharmacological relevance of the gating process in voltage-gated K+ channels encoded by the Kv7 gene family. After reviewing the current knowledge on the molecular mechanisms and on the structural models of voltage-dependent gating in VGICs, we describe the physiological relevance of these channels, with particular emphasis on those formed by Kv7.2–Kv7.5 subunits having a well-established role in controlling neuronal excitability in humans. In fact, genetically determined alterations in Kv7.2 and Kv7.3 genes are responsible for benign familial neonatal convulsions, a rare seizure disorder affecting newborns, and the pharmacological activation of Kv7.2/3 channels can exert antiepileptic activity in humans. Both mutation-triggered channel dysfunction and drug-induced channel activation can occur by impeding or facilitating, respectively, channel sensitivity to membrane voltage and can affect overlapping molecular sites within the voltage-sensing domain of these channels. Thus, understanding the molecular steps involved in voltage-sensing in Kv7 channels will allow to better define the pathogenesis of rare human epilepsy, and to design innovative pharmacological strategies for the treatment of epilepsies and, possibly, other human diseases characterized by neuronal hyperexcitability. PMID:21687499

Voltage-gated proton (H(v)1) channels, a singular voltage sensing domain.

PubMed

Castillo, Karen; Pupo, Amaury; Baez-Nieto, David; Contreras, Gustavo F; Morera, Francisco J; Neely, Alan; Latorre, Ramon; Gonzalez, Carlos

2015-11-14

The main role of voltage-gated proton channels (Hv1) is to extrude protons from the intracellular milieu when, mediated by different cellular processes, the H(+) concentration increases. Hv1 are exquisitely selective for protons and their structure is homologous to the voltage sensing domain (VSD) of other voltage-gated ion channels like sodium, potassium, and calcium channels. In clear contrast to the classical voltage-dependent channels, Hv1 lacks a pore domain and thus permeation necessarily occurs through the voltage sensing domain. Hv1 channels are activated by depolarizing voltages, and increases in internal proton concentration. It has been proposed that local conformational changes of the transmembrane segment S4, driven by depolarization, trigger the molecular rearrangements that open Hv1. However, it is still unclear how the electromechanical coupling is achieved between the VSD and the potential pore, allowing the proton flux from the intracellular to the extracellular side. Here we provide a revised view of voltage activation in Hv1 channels, offering a comparative scenario with other voltage sensing channels domains. Copyright © 2015 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

The effects of the activation of the inner-hair-cell basolateral K+ channels on auditory nerve responses.

PubMed

Altoè, Alessandro; Pulkki, Ville; Verhulst, Sarah

2018-07-01

The basolateral membrane of the mammalian inner hair cell (IHC) expresses large voltage and Ca 2+ gated outward K + currents. To quantify how the voltage-dependent activation of the K + channels affects the functionality of the auditory nerve innervating the IHC, this study adopts a model of mechanical-to-neural transduction in which the basolateral K + conductances of the IHC can be made voltage-dependent or not. The model shows that the voltage-dependent activation of the K + channels (i) enhances the phase-locking properties of the auditory fiber (AF) responses; (ii) enables the auditory nerve to encode a large dynamic range of sound levels; (iii) enables the AF responses to synchronize precisely with the envelope of amplitude modulated stimuli; and (iv), is responsible for the steep offset responses of the AFs. These results suggest that the basolateral K + channels play a major role in determining the well-known response properties of the AFs and challenge the classical view that describes the IHC membrane as an electrical low-pass filter. In contrast to previous models of the IHC-AF complex, this study ascribes many of the AF response properties to fairly basic mechanisms in the IHC membrane rather than to complex mechanisms in the synapse. Copyright © 2018 Elsevier B.V. All rights reserved.

Calcium channel currents in bovine adrenal chromaffin cells and their modulation by anaesthetic agents.

PubMed Central

Charlesworth, P; Pocock, G; Richards, C D

1994-01-01

1. The calcium channel currents of bovine adrenal chromaffin cells were characterized using a variety of voltage pulse protocols and selective channel blockers before examination of their modulation by anaesthetic agents. 2. All the anaesthetics studied (halothane, methoxyflurane, etomidate and methohexitone) inhibited the calcium channel currents in a concentration-dependent manner and increased the rate of current decay. 3. The anaesthetics did not shift the current-voltage relation nor did they change the voltage for half-maximal channel activation derived from analysis of the voltage dependence of the tail currents. None of the anaesthetics appeared to alter the time constant of tail current decay. 4. To complement earlier studies of the inhibitory actions of anaesthetics on K(+)-evoked catecholamine secretion and the associated Ca2+ uptake, the IC50 values for etomidate and methohexitone were determined using a biochemical assay. The IC50 values for anaesthetic inhibition of calcium channel currents corresponded closely with those for inhibition of K(+)-evoked calcium uptake and catecholamine secretion. 5. The inhibitory effect of the volatile anaesthetics and etomidate is best explained by dual action: a reduction in the probability of channel opening coupled with an increase in the rate of channel inactivation. Methohexitone appeared to inhibit the currents by a use-dependent slow block. PMID:7707224

Analog performance of vertical nanowire TFETs as a function of temperature and transport mechanism

NASA Astrophysics Data System (ADS)

Martino, Marcio Dalla Valle; Neves, Felipe; Ghedini Der Agopian, Paula; Martino, João Antonio; Vandooren, Anne; Rooyackers, Rita; Simoen, Eddy; Thean, Aaron; Claeys, Cor

2015-10-01

The goal of this work is to study the analog performance of tunnel field effect transistors (TFETs) and its susceptibility to temperature variation and to different dominant transport mechanisms. The experimental input characteristic of nanowire TFETs with different source compositions (100% Si and Si1-xGex) has been presented, leading to the extraction of the Activation Energy for each bias condition. These first results have been connected to the prevailing transport mechanism for each configuration, namely band-to-band tunneling (BTBT) or trap assisted tunneling (TAT). Afterward, this work analyzes the analog behavior, with the intrinsic voltage gain calculated in terms of Early voltage, transistor efficiency, transconductance and output conductance. Comparing the results for devices with different source compositions, it is interesting to note how the analog trends vary depending on the source characteristics and the prevailing transport mechanisms. This behavior results in a different suitability analysis depending on the working temperature. In other words, devices with full-Silicon source and non-abrupt junction profile present the worst intrinsic voltage gain at room temperature, but the best results for high temperatures. This was possible since, among the 4 studied devices, this configuration was the only one with a positive intrinsic voltage gain dependence on the temperature variation.

Effects of RTV coating on the electrical performance of polymer insulator under lightning impulse voltage condition.

PubMed

Jamaludin, Farah Adilah; Ab-Kadir, Mohd Zainal Abidin; Izadi, Mahdi; Azis, Norhafiz; Jasni, Jasronita; Abd-Rahman, Muhammad Syahmi

2017-01-01

Located near the equator, Malaysia is a country with one of the highest lightning densities in the world. Lightning contributes to 70% of the power outages in Malaysia and affects power equipment, automated network systems, causes data losses and monetary losses in the nation. Therefore, consideration of insulator evaluation under lightning impulses can be crucial to evaluate and attempt to overcome this issue. This paper presents a new approach to increase the electrical performance of polymer insulators using a Room Temperature Vulcanisation (RTV) coating. The evaluation involves three different settings of polymer insulator, namely uncoated, RTV type 1, and RTV type 2 upper surface coatings. All the insulators were tested under three different conditions as dry, clean wet and salty under different impulse polarities using the even-rising test method. The voltage breakdown for each test was recorded. From the experiment, it was found that the effectiveness of the RTV coating application became apparent when tested under salty or polluted conditions. It increased the voltage withstand capabilities of the polymer insulator up to 50% from the basic uncoated insulator. Under dry and clean conditions, the RTV coating provided just a slight increase of the breakdown voltage. The increase in voltage breakdown capability decreased the probability of surface discharge and dry band arcing that could cause degradation of the polymeric material housing. The RTV type 1 coating was found to be more effective when performing under a lightning impulse. The findings might help the utility companies improve the performance of their insulators in order to increase power system reliability.

Effects of RTV coating on the electrical performance of polymer insulator under lightning impulse voltage condition

PubMed Central

Jamaludin, Farah Adilah; Ab-Kadir, Mohd Zainal Abidin; Izadi, Mahdi; Azis, Norhafiz; Jasni, Jasronita; Abd-Rahman, Muhammad Syahmi

2017-01-01

Located near the equator, Malaysia is a country with one of the highest lightning densities in the world. Lightning contributes to 70% of the power outages in Malaysia and affects power equipment, automated network systems, causes data losses and monetary losses in the nation. Therefore, consideration of insulator evaluation under lightning impulses can be crucial to evaluate and attempt to overcome this issue. This paper presents a new approach to increase the electrical performance of polymer insulators using a Room Temperature Vulcanisation (RTV) coating. The evaluation involves three different settings of polymer insulator, namely uncoated, RTV type 1, and RTV type 2 upper surface coatings. All the insulators were tested under three different conditions as dry, clean wet and salty under different impulse polarities using the even-rising test method. The voltage breakdown for each test was recorded. From the experiment, it was found that the effectiveness of the RTV coating application became apparent when tested under salty or polluted conditions. It increased the voltage withstand capabilities of the polymer insulator up to 50% from the basic uncoated insulator. Under dry and clean conditions, the RTV coating provided just a slight increase of the breakdown voltage. The increase in voltage breakdown capability decreased the probability of surface discharge and dry band arcing that could cause degradation of the polymeric material housing. The RTV type 1 coating was found to be more effective when performing under a lightning impulse. The findings might help the utility companies improve the performance of their insulators in order to increase power system reliability. PMID:29136025

Control of Gastric H,K-ATPase Activity by Cations, Voltage and Intracellular pH Analyzed by Voltage Clamp Fluorometry in Xenopus Oocytes

PubMed Central

Dürr, Katharina L.; Tavraz, Neslihan N.; Friedrich, Thomas

2012-01-01

Whereas electrogenic partial reactions of the Na,K-ATPase have been studied in depth, much less is known about the influence of the membrane potential on the electroneutrally operating gastric H,K-ATPase. In this work, we investigated site-specifically fluorescence-labeled H,K-ATPase expressed in Xenopus oocytes by voltage clamp fluorometry to monitor the voltage-dependent distribution between E1P and E2P states and measured Rb+ uptake under various ionic and pH conditions. The steady-state E1P/E2P distribution, as indicated by the voltage-dependent fluorescence amplitudes and the Rb+ uptake activity were highly sensitive to small changes in intracellular pH, whereas even large extracellular pH changes affected neither the E1P/E2P distribution nor transport activity. Notably, intracellular acidification by approximately 0.5 pH units shifted V0.5, the voltage, at which the E1P/E2P ratio is 50∶50, by −100 mV. This was paralleled by an approximately two-fold acceleration of the forward rate constant of the E1P→E2P transition and a similar increase in the rate of steady-state cation transport. The temperature dependence of Rb+ uptake yielded an activation energy of ∼90 kJ/mol, suggesting that ion transport is rate-limited by a major conformational transition. The pronounced sensitivity towards intracellular pH suggests that proton uptake from the cytoplasmic side controls the level of phosphoenzyme entering the E1P→E2P conformational transition, thus limiting ion transport of the gastric H,K-ATPase. These findings highlight the significance of cellular mechanisms contributing to increased proton availability in the cytoplasm of gastric parietal cells. Furthermore, we show that extracellular Na+ profoundly alters the voltage-dependent E1P/E2P distribution indicating that Na+ ions can act as surrogates for protons regarding the E2P→E1P transition. The complexity of the intra- and extracellular cation effects can be rationalized by a kinetic model suggesting that cations reach the binding sites through a rather high-field intra- and a rather low-field extracellular access channel, with fractional electrical distances of ∼0.5 and ∼0.2, respectively. PMID:22448261

Whole-cell and single channel monovalent cation currents through the novel rabbit epithelial Ca2+ channel ECaC

PubMed Central

Nilius, Bernd; Vennekens, Rudi; Prenen, Jean; Hoenderop, Joost G J; Bindels, René J M; Droogmans, Guy

2000-01-01

This study describes properties of monovalent cation currents through ECaC, a recently cloned epithelial Ca2+-permeable channel from rabbit. The kinetics of currents through ECaC was strongly modulated by divalent cations. Currents were inhibited in the presence of extracellular Ca2+. They showed an initial voltage-dependent decay in the presence of 1 mm Mg2+ at hyperpolarizing steps in Ca2+-free solutions, which represents a voltage-dependent Mg2+ block through binding of Mg2+ to a site localized in the electrical field of the membrane (δ = 0.31) and a voltage-dependent binding constant (at 0 mV 3.1 mm Ca2+, obtained from a Woodhull type analysis). Currents were only stable in the absence of divalent cations and showed under these conditions a small time- and voltage-dependent component of activation. Single channel currents in cell-attached and inside-out patches had a conductance of 77.5 ± 4.9 pS (n = 11) and reversed at +14.8 ± 1.6 mV (n = 9) in the absence of divalent cations. The permeation sequence for monovalent cations through ECaC was Na+ > Li+ > K+ > Cs+ > NMDG+ which is identical to the Eisenmann sequence X for a strong field-strength binding site. It is concluded that the permeation profile of ECaC for monovalent cations suggests a strong field-strength binding site that may be involved in Ca2+ permeation and Mg2+ block. PMID:10970426

Contribution of S4 segments and S4-S5 linkers to the low-voltage activation properties of T-type CaV3.3 channels.

PubMed

Sanchez-Sandoval, Ana Laura; Herrera Carrillo, Zazil; Díaz Velásquez, Clara Estela; Delgadillo, Dulce María; Rivera, Heriberto Manuel; Gomora, Juan Carlos

2018-01-01

Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA) and low-voltage (LVA) activated calcium channels is around 30-40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C) induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers.

Gating of Connexin Channels by transjunctional-voltage: Conformations and models of open and closed states.

PubMed

Bargiello, Thaddeus A; Oh, Seunghoon; Tang, Qingxiu; Bargiello, Nicholas K; Dowd, Terry L; Kwon, Taekyung

2018-01-01

Voltage is an important physiologic regulator of channels formed by the connexin gene family. Connexins are unique among ion channels in that both plasma membrane inserted hemichannels (undocked hemichannels) and intercellular channels (aggregates of which form gap junctions) have important physiological roles. The hemichannel is the fundamental unit of gap junction voltage-gating. Each hemichannel displays two distinct voltage-gating mechanisms that are primarily sensitive to a voltage gradient formed along the length of the channel pore (the transjunctional voltage) rather than sensitivity to the absolute membrane potential (V m or V i-o ). These transjunctional voltage dependent processes have been termed V j - or fast-gating and loop- or slow-gating. Understanding the mechanism of voltage-gating, defined as the sequence of voltage-driven transitions that connect open and closed states, first and foremost requires atomic resolution models of the end states. Although ion channels formed by connexins were among the first to be characterized structurally by electron microscopy and x-ray diffraction in the early 1980's, subsequent progress has been slow. Much of the current understanding of the structure-function relations of connexin channels is based on two crystal structures of Cx26 gap junction channels. Refinement of crystal structure by all-atom molecular dynamics and incorporation of charge changing protein modifications has resulted in an atomic model of the open state that arguably corresponds to the physiologic open state. Obtaining validated atomic models of voltage-dependent closed states is more challenging, as there are currently no methods to solve protein structure while a stable voltage gradient is applied across the length of an oriented channel. It is widely believed that the best approach to solve the atomic structure of a voltage-gated closed ion channel is to apply different but complementary experimental and computational methods and to use the resulting information to derive a consensus atomic structure that is then subjected to rigorous validation. In this paper, we summarize our efforts to obtain and validate atomic models of the open and voltage-driven closed states of undocked connexin hemichannels. This article is part of a Special Issue entitled: Gap Junction Proteins edited by Jean Claude Herve. Copyright © 2017 Elsevier B.V. All rights reserved.

Contribution of S4 segments and S4-S5 linkers to the low-voltage activation properties of T-type CaV3.3 channels

PubMed Central

Sanchez-Sandoval, Ana Laura; Herrera Carrillo, Zazil; Díaz Velásquez, Clara Estela; Delgadillo, Dulce María; Rivera, Heriberto Manuel

2018-01-01

Voltage-gated calcium channels contain four highly conserved transmembrane helices known as S4 segments that exhibit a positively charged residue every third position, and play the role of voltage sensing. Nonetheless, the activation range between high-voltage (HVA) and low-voltage (LVA) activated calcium channels is around 30–40 mV apart, despite the high level of amino acid similarity within their S4 segments. To investigate the contribution of S4 voltage sensors for the low-voltage activation characteristics of CaV3.3 channels we constructed chimeras by swapping S4 segments between this LVA channel and the HVA CaV1.2 channel. The substitution of S4 segment of Domain II in CaV3.3 by that of CaV1.2 (chimera IIS4C) induced a ~35 mV shift in the voltage-dependence of activation towards positive potentials, showing an I-V curve that almost overlaps with that of CaV1.2 channel. This HVA behavior induced by IIS4C chimera was accompanied by a 2-fold decrease in the voltage-dependence of channel gating. The IVS4 segment had also a strong effect in the voltage sensing of activation, while substitution of segments IS4 and IIIS4 moved the activation curve of CaV3.3 to more negative potentials. Swapping of IIS4 voltage sensor influenced additional properties of this channel such as steady-state inactivation, current decay, and deactivation. Notably, Domain I voltage sensor played a major role in preventing CaV3.3 channels to inactivate from closed states at extreme hyperpolarized potentials. Finally, site-directed mutagenesis in the CaV3.3 channel revealed a partial contribution of the S4-S5 linker of Domain II to LVA behavior, with synergic effects observed in double and triple mutations. These findings indicate that IIS4 and, to a lesser degree IVS4, voltage sensors are crucial in determining the LVA properties of CaV3.3 channels, although the accomplishment of this function involves the participation of other structural elements like S4-S5 linkers. PMID:29474447

An allosteric model of the molecular interactions of excitation- contraction coupling in skeletal muscle

PubMed Central

1993-01-01

A contact interaction is proposed to exist between the voltage sensor of the transverse tubular membrane of skeletal muscle and the calcium release channel of the sarcoplasmic reticulum. This interaction is given a quantitative formulation inspired in the Monod, Wyman, and Changeux model of allosteric transitions in hemoglobin (Monod, J., J. Wyman, and J.-P. Changeux. 1965. Journal of Molecular Biology. 12:88- 118), and analogous to one proposed by Marks and Jones for voltage- dependent Ca channels (Marks, T. N., and S. W. Jones. 1992. Journal of General Physiology. 99:367-390). The allosteric protein is the calcium release channel, a homotetramer, with two accessible states, closed and open. The kinetics and equilibrium of this transition are modulated by voltage sensors (dihydropyridine receptors) pictured as four units per release channel, each undergoing independent voltage-driven transitions between two states (resting and activating). For each voltage sensor that moves to the activating state, the tendency of the channel to open increases by an equal (large) factor. The equilibrium and kinetic equations of the model are solved and shown to reproduce well a number of experimentally measured relationships including: charge movement (Q) vs. voltage, open probability of the release channel (Po) vs. voltage, the transfer function relationship Po vs. Q, and the kinetics of charge movement, release activation, and deactivation. The main consequence of the assumption of allosteric coupling is that primary effects on the release channel are transmitted backward to the voltage sensor and give secondary effects. Thus, the model reproduces well the effects of perchlorate, described in the two previous articles, under the assumption that the primary effect is to increase the intrinsic tendency of the release channel to open, with no direct effects on the voltage sensor. This modification of the open-closed equilibrium of the release channel causes a shift in the equilibrium dependency of charge movement with voltage. The paradoxical slowing of charge movement by perchlorate also results from reciprocal effects of the channel on the allosterically coupled voltage sensors. The observations of the previous articles plus the simulations in this article constitute functional evidence of allosteric transmission. PMID:8245819

REVEALING THE ACTIVATION PATHWAY FOR TMEM16A CHLORIDE CHANNELS FROM MACROSCOPIC CURRENTS AND KINETIC MODELS

PubMed Central

Contreras-Vite, Juan A.; Cruz-Rangel, Silvia; De Jesús-Pérez, José J.; Aréchiga Figueroa, Iván A.; Rodríguez-Menchaca, Aldo A.; Pérez-Cornejo, Patricia; Hartzell, H. Criss; Arreola, Jorge

2017-01-01

TMEM16A (ANO1), the pore-forming subunit of calcium-activated chloride channels, regulates several physiological and pathophysiological processes such as smooth muscle contraction, cardiac and neuronal excitability, salivary secretion, tumour growth, and cancer progression. Gating of TMEM16A is complex because it involves the interplay between increases in intracellular calcium concentration ([Ca2+]i), membrane depolarization, extracellular Cl− or permeant anions, and intracellular protons. Our goal here was to understand how these variables regulate TMEM16A gating and to explain four observations. a) TMEM16A is activated by voltage in the absence of intracellular Ca2+. b) The Cl− conductance is decreased after reducing extracellular Cl− concentration ([Cl−]o). c) ICl is regulated by physiological concentrations of [Cl−]o. d) In cells dialyzed with 0.2 µM [Ca2+]i, Cl− has a bimodal effect: at [Cl−]o < 30 mM TMEM16A current activates with a monoexponential time course, but above 30 mM [Cl−]o ICl activation displays fast and slow kinetics. To explain the contribution of Vm, Ca2+ and Cl− to gating, we developed a 12-state Markov chain model. This model explains TMEM16A activation as a sequential, direct, and Vm-dependent binding of two Ca2+ ions coupled to a Vm-dependent binding of an external Cl− ion, with Vm-dependent transitions between states. Our model predicts that extracellular Cl− does not alter the apparent Ca2+ affinity of TMEM16A, which we corroborated experimentally. Rather, extracellular Cl− acts by stabilizing the open configuration induced by Ca2+ and by contributing to the Vm dependence of activation. PMID:27138167

Conventional voltage electrophoresis for formiminoglutamic-acid determination in folic acid deficiency

PubMed Central

Kohn, J.; Mollin, D. L.; Rosenbach, L. M.

1961-01-01

A new method for the determination of urinary formiminoglutamic acid (FIGLU) using conventional electrophoresis at 200 to 500 v. on cellulose acetate strips is reported. Experience in 166 determinations on 137 patients shows the method to be a simple, practical, and apparently sensitive one for the determination of FIGLU in the urine. Results of the application of the measurement of urinary FIGLU with histidine loading as a test for folic acid deficiency are also reported. Images PMID:13757596

Electrostatically Driven Nanoballoon Actuator.

PubMed

Barzegar, Hamid Reza; Yan, Aiming; Coh, Sinisa; Gracia-Espino, Eduardo; Dunn, Gabriel; Wågberg, Thomas; Louie, Steven G; Cohen, Marvin L; Zettl, Alex

2016-11-09

We demonstrate an inflatable nanoballoon actuator based on geometrical transitions between the inflated (cylindrical) and collapsed (flattened) forms of a carbon nanotube. In situ transmission electron microscopy experiments employing a nanoelectromechanical manipulator show that a collapsed carbon nanotube can be reinflated by electrically charging the nanotube, thus realizing an electrostatically driven nanoballoon actuator. We find that the tube actuator can be reliably cycled with only modest control voltages (few volts) with no apparent wear or fatigue. A complementary theoretical analysis identifies critical parameters for nanotube nanoballoon actuation.

Electromagnetic tracking system with reduced distortion using quadratic excitation.

PubMed

Bien, Tomasz; Li, Mengfei; Salah, Zein; Rose, Georg

2014-03-01

Electromagnetic tracking systems, frequently used in minimally invasive surgery, are affected by conductive distorters. The influence of conductive distorters on electromagnetic tracking system accuracy can be reduced through magnetic field modifications. This approach was developed and tested. The voltage induced directly by the emitting coil in the sensing coil without additional influence by the conductive distorter depends on the first derivative of the voltage on the emitting coil. The voltage which is induced indirectly by the emitting coil across the conductive distorter in the sensing coil, however, depends on the second derivative of the voltage on the emitting coil. The electromagnetic tracking system takes advantage of this difference by supplying the emitting coil with a quadratic excitation voltage. The method is adaptive relative to the amount of distortion cause by the conductive distorters. This approach is evaluated with an experimental setup of the electromagnetic tracking system. In vitro testing showed that the maximal error decreased from 10.9 to 3.8 mm when the quadratic voltage was used to excite the emitting coil instead of the sinusoidal voltage. Furthermore, the root mean square error in the proximity of the aluminum disk used as a conductive distorter was reduced from 3.5 to 1.6 mm when the electromagnetic tracking system used the quadratic instead of sinusoidal excitation. Electromagnetic tracking with quadratic excitation is immune to the effects of a conductive distorter, especially compared with sinusoidal excitation of the emitting coil. Quadratic excitation of electromagnetic tracking for computer-assisted surgery is promising for clinical applications.

An investigation on the effects of air on electron energy in atmospheric pressure helium plasma jets

NASA Astrophysics Data System (ADS)

Liu, Yadi; Tan, Zhenyu; Chen, Xinxian; Li, Xiaotong; Zhang, Huimin; Pan, Jie; Wang, Xiaolong

2018-03-01

In this work, the effects of air on electron energy in the atmospheric pressure helium plasma jet produced by a needle-plane discharge system have been investigated by means of the numerical simulation based on a two-dimensional fluid model, and the air concentration dependences of the reactive species densities have also been calculated. In addition, the synergistic effects of the applied voltage and air concentration on electron energy have been explored. The present work gives the following significant results. For a fixed applied voltage, the averaged electron energy is basically a constant at air concentrations below about 0.5%, but it evidently decreases above the concentration of 0.5%. Furthermore, the averaged densities of four main reactive species O, O(1D), O2(1Δg), and N2(A3Σu+) increase with the increasing air concentration, but the increase becomes slow at air concentrations above 0.5%. The air concentration dependences of the averaged electron energy under different voltage amplitudes are similar, and for a given air concentration, the averaged electron energy increases with the increase in the voltage amplitude. For the four reactive species, the effects of the air concentration on their averaged densities are similar for a given voltage amplitude. In addition, the averaged densities of the four reactive species increase with increasing voltage amplitude for a fixed air concentration. The present work suggests that a combination of high voltage amplitude and the characteristic air concentration, 0.5% in the present discharge system, allows an expected electron energy and also generates abundant reactive species.

Mechanism of Small Current Generation under Impulse Voltage Applications in Vacuum

NASA Astrophysics Data System (ADS)

Aoki, Keita; Yasukawa, Hideaki; Kojima, Hiroki; Homma, Mitsutaka; Shioiri, Tetsu; Okubo, Hitoshi

Small discharge not to accompany breakdown can occur under high electric field in vacuum, however the mechanism is not well clarified. We have found that the current of small discharge decreases with repeated voltage applications, and leads to electrode conditioning effect of raising withstand voltage. The inception of the current is delayed with the decrease of current, and the inception time and waveform change by gap length. On the other hand, under low vacuum condition, the current increases and reaches saturation with repeated voltage applications. From these discussions, we concluded that the generating process of small current depended on the adsorption and absorption gas of electrodes.

CURRENT-VOLTAGE CHARACTERISTICS OF THERMALLY ANNEALED Ni/n-GaAs SCHOTTKY CONTACTS

NASA Astrophysics Data System (ADS)

Yildirim, Nezir; Turut, Abdulmecit; Dogan, Hulya

The Schottky barrier type Ni/n-GaAs contacts fabricated by us were thermally annealed at 600∘C and 700∘C for 1min. The apparent barrier height Φap and ideality factor of the diodes were calculated from the forward bias current-voltage characteristic in 60-320K range. The Φap values for the nonannealed and 600∘C and 700∘C annealed diodes were obtained as 0.80, 0.81 and 0.67eV at 300K, respectively. Thus, it has been concluded that the reduced barrier due to the thermal annealing at 700∘C promises some device applications. The current preferentially flows through the lowest barrier height (BH) with the temperature due to the BH inhomogeneities. Therefore, it was seen that the Φap versus (2kT)‑1 plots for the nonannealed and annealed diodes showed the linear behavior according to Gaussian distributions.

The thermodynamic origin of hysteresis in insertion batteries

NASA Astrophysics Data System (ADS)

Dreyer, Wolfgang; Jamnik, Janko; Guhlke, Clemens; Huth, Robert; Moškon, Jože; Gaberšček, Miran

2010-05-01

Lithium batteries are considered the key storage devices for most emerging green technologies such as wind and solar technologies or hybrid and plug-in electric vehicles. Despite the tremendous recent advances in battery research, surprisingly, several fundamental issues of increasing practical importance have not been adequately tackled. One such issue concerns the energy efficiency. Generally, charging of 1010-1017 electrode particles constituting a modern battery electrode proceeds at (much) higher voltages than discharging. Most importantly, the hysteresis between the charge and discharge voltage seems not to disappear as the charging/discharging current vanishes. Herein we present, for the first time, a general explanation of the occurrence of inherent hysteretic behaviour in insertion storage systems containing multiple particles. In a broader sense, the model also predicts the existence of apparent equilibria in battery electrodes, the sequential particle-by-particle charging/discharging mechanism and the disappearance of two-phase behaviour at special experimental conditions.

The thermodynamic origin of hysteresis in insertion batteries.

PubMed

Dreyer, Wolfgang; Jamnik, Janko; Guhlke, Clemens; Huth, Robert; Moskon, Joze; Gaberscek, Miran

2010-05-01

Lithium batteries are considered the key storage devices for most emerging green technologies such as wind and solar technologies or hybrid and plug-in electric vehicles. Despite the tremendous recent advances in battery research, surprisingly, several fundamental issues of increasing practical importance have not been adequately tackled. One such issue concerns the energy efficiency. Generally, charging of 10(10)-10(17) electrode particles constituting a modern battery electrode proceeds at (much) higher voltages than discharging. Most importantly, the hysteresis between the charge and discharge voltage seems not to disappear as the charging/discharging current vanishes. Herein we present, for the first time, a general explanation of the occurrence of inherent hysteretic behaviour in insertion storage systems containing multiple particles. In a broader sense, the model also predicts the existence of apparent equilibria in battery electrodes, the sequential particle-by-particle charging/discharging mechanism and the disappearance of two-phase behaviour at special experimental conditions.

Disruption of the IS6-AID linker affects voltage-gated calcium channel inactivation and facilitation.

PubMed

Findeisen, Felix; Minor, Daniel L

2009-03-01

Two processes dominate voltage-gated calcium channel (Ca(V)) inactivation: voltage-dependent inactivation (VDI) and calcium-dependent inactivation (CDI). The Ca(V)beta/Ca(V)alpha(1)-I-II loop and Ca(2+)/calmodulin (CaM)/Ca(V)alpha(1)-C-terminal tail complexes have been shown to modulate each, respectively. Nevertheless, how each complex couples to the pore and whether each affects inactivation independently have remained unresolved. Here, we demonstrate that the IS6-alpha-interaction domain (AID) linker provides a rigid connection between the pore and Ca(V)beta/I-II loop complex by showing that IS6-AID linker polyglycine mutations accelerate Ca(V)1.2 (L-type) and Ca(V)2.1 (P/Q-type) VDI. Remarkably, mutations that either break the rigid IS6-AID linker connection or disrupt Ca(V)beta/I-II association sharply decelerate CDI and reduce a second Ca(2+)/CaM/Ca(V)alpha(1)-C-terminal-mediated process known as calcium-dependent facilitation. Collectively, the data strongly suggest that components traditionally associated solely with VDI, Ca(V)beta and the IS6-AID linker, are essential for calcium-dependent modulation, and that both Ca(V)beta-dependent and CaM-dependent components couple to the pore by a common mechanism requiring Ca(V)beta and an intact IS6-AID linker.

Disruption of the IS6-AID Linker Affects Voltage-gated Calcium Channel Inactivation and Facilitation

PubMed Central

Findeisen, Felix

2009-01-01

Two processes dominate voltage-gated calcium channel (CaV) inactivation: voltage-dependent inactivation (VDI) and calcium-dependent inactivation (CDI). The CaVβ/CaVα1-I-II loop and Ca2+/calmodulin (CaM)/CaVα1–C-terminal tail complexes have been shown to modulate each, respectively. Nevertheless, how each complex couples to the pore and whether each affects inactivation independently have remained unresolved. Here, we demonstrate that the IS6–α-interaction domain (AID) linker provides a rigid connection between the pore and CaVβ/I-II loop complex by showing that IS6-AID linker polyglycine mutations accelerate CaV1.2 (L-type) and CaV2.1 (P/Q-type) VDI. Remarkably, mutations that either break the rigid IS6-AID linker connection or disrupt CaVβ/I-II association sharply decelerate CDI and reduce a second Ca2+/CaM/CaVα1–C-terminal–mediated process known as calcium-dependent facilitation. Collectively, the data strongly suggest that components traditionally associated solely with VDI, CaVβ and the IS6-AID linker, are essential for calcium-dependent modulation, and that both CaVβ-dependent and CaM-dependent components couple to the pore by a common mechanism requiring CaVβ and an intact IS6-AID linker. PMID:19237593

Dimerization of the voltage-sensing phosphatase controls its voltage-sensing and catalytic activity.

PubMed

Rayaprolu, Vamseedhar; Royal, Perrine; Stengel, Karen; Sandoz, Guillaume; Kohout, Susy C

2018-05-07

Multimerization is a key characteristic of most voltage-sensing proteins. The main exception was thought to be the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP). In this study, we show that multimerization is also critical for Ci-VSP function. Using coimmunoprecipitation and single-molecule pull-down, we find that Ci-VSP stoichiometry is flexible. It exists as both monomers and dimers, with dimers favored at higher concentrations. We show strong dimerization via the voltage-sensing domain (VSD) and weak dimerization via the phosphatase domain. Using voltage-clamp fluorometry, we also find that VSDs cooperate to lower the voltage dependence of activation, thus favoring the activation of Ci-VSP. Finally, using activity assays, we find that dimerization alters Ci-VSP substrate specificity such that only dimeric Ci-VSP is able to dephosphorylate the 3-phosphate from PI(3,4,5)P 3 or PI(3,4)P 2 Our results indicate that dimerization plays a significant role in Ci-VSP function. © 2018 Rayaprolu et al.

PIP₂ hydrolysis is responsible for voltage independent inhibition of CaV2.2 channels in sympathetic neurons.

PubMed

Vivas, Oscar; Castro, Hector; Arenas, Isabel; Elías-Viñas, David; García, David E

2013-03-08

GPCRs regulate Ca(V)2.2 channels through both voltage dependent and independent inhibition pathways. The aim of the present work was to assess the phosphatidylinositol-4,5-bisphosphate (PIP2) as the molecule underlying the voltage independent inhibition of Ca(V)2.2 channels in SCG neurons. We used a double pulse protocol to study the voltage independent inhibition and changed the PIP(2) concentration by means of blocking the enzyme PLC, filling the cell with a PIP(2) analogue and preventing the PIP(2) resynthesis with wortmannin. We found that voltage independent inhibition requires the activation of PLC and can be hampered by internal dialysis of exogenous PIP(2). In addition, the recovery from voltage independent inhibition is blocked by inhibition of the enzymes involved in the resynthesis of PIP(2). These results support that the hydrolysis of PIP(2) is responsible for the voltage independent inhibition of Ca(V)2.2 channels. Copyright © 2013 Elsevier Inc. All rights reserved.

New quantum oscillations in current driven small junctions

NASA Technical Reports Server (NTRS)

Ben-Jacob, E.; Gefen, Y.

1985-01-01

The response of current-biased Josephson and normal tunnel junctions (JJs and NTJs) such as those fabricated by Voss and Webb (1981) is predicted from a quantum-mechanical description based on the observation that the response of a current-driven open system is equivalent to that of a closed system subject to an external time-dependent voltage bias. Phenomena expected include voltage oscillations with no dc voltage applied, inverse Shapiro steps of dc voltage in the presence of microwave radiation, voltage oscillation in a JJ and an NTJ coupled by a capacitance to a current-biased junction, JJ voltage oscillation frequency = I/e rather than I/2e, and different NTJ resistance than in the voltage-driven case. The effects require approximate experimental parameter values Ic = 15 nA, C = 1 fF, and T much less than 0.4 K for JJs and Ic = a few nA, C = 1 fF, and R = 3 kiloohms for 100-microV inverse Shapiro steps at 10 GHz in NTJs.

Stability of Triggering of the Switch with Sharply Non-Uniform Electric Field at the Electrode with Negative Potential

NASA Astrophysics Data System (ADS)

Kovalchuk, B. M.; Zherlitsyn, A. A.; Kumpyak, E. V.

2017-12-01

Results of investigations into a two-electrode high-pressure gas switch with sharply non-uniform field at the electrode with negative potential operating in the self-breakdown regime with pulsed charging of a highvoltage capacitive energy storage for 100 μs to voltage exceeding 200 kV are presented. It is demonstrated that depending on the air pressure and the gap length, the corona-streamer discharge, whose current increases with voltage, arises in the switch at a voltage of 0.2-0.3 of the self-breakdown voltage. At the moment of switch self-breakdown, the corona-streamer discharge goes over to one or several spark channels. The standard deviation of the triggering moment can be within 1.5 μs, which corresponds to the standard deviation of the self-breakdown voltage less than 2 kV. The voltage stability can be better than 1.5%.

Ion extraction capabilities of closely spaced grids

NASA Technical Reports Server (NTRS)

Rovang, D. C.; Wilbur, P. J.

1982-01-01

The ion extraction capabilities of accelerator systems with small screen hole diameters (less than 2.0 mm) are investigated at net-accelerating voltages of 100, 300, and 500 V. Results show that the impingement-limited perveance is not dramatically affected by reductions in screen hole diameter to 1.0 mm, but impingement-limited performance was found to be dependent on the grid separation distance, the discharge-to-total accelerating voltage ratio, and the net-to-total accelerating voltage ratio. Results obtained using small hole diameters and closely spaced grids indicate a new mode of grid operation where high current density operation can be achieved with a specified net acceleration voltage by operating the grids at a high rather than low net-to-total acceleration voltage. Beam current densities as high as 25 mA/sq cm were obtained using grids with 1.0 mm diameter holes operating at a net accelerating voltage of 500 V.

Voltage-dependent and -independent titration of specific residues accounts for complex gating of a ClC chloride channel by extracellular protons

PubMed Central

Niemeyer, María Isabel; Cid, L Pablo; Yusef, Yamil R; Briones, Rodolfo; Sepúlveda, Francisco V

2009-01-01

The ClC transport protein family comprises both Cl− ion channel and H+/Cl− and H+/NO3− exchanger members. Structural studies on a bacterial ClC transporter reveal a pore obstructed at its external opening by a glutamate side-chain which acts as a gate for Cl− passage and in addition serves as a staging post for H+ exchange. This same conserved glutamate acts as a gate to regulate Cl− flow in ClC channels. The activity of ClC-2, a genuine Cl− channel, has a biphasic response to extracellular pH with activation by moderate acidification followed by abrupt channel closure at pH values lower than ∼7. We have now investigated the molecular basis of this complex gating behaviour. First, we identify a sensor that couples extracellular acidification to complete closure of the channel. This is extracellularly-facing histidine 532 at the N-terminus of transmembrane helix Q whose neutralisation leads to channel closure in a cooperative manner. We go on to show that acidification-dependent activation of ClC-2 is voltage dependent and probably mediated by protonation of pore gate glutamate 207. Intracellular Cl− acts as a voltage-independent modulator, as though regulating the pKa of the protonatable residue. Our results suggest that voltage dependence of ClC-2 is given by hyperpolarisation-dependent penetration of protons from the extracellular side to neutralise the glutamate gate deep within the channel, which allows Cl− efflux. This is reminiscent of a partial exchanger cycle, suggesting that the ClC-2 channel evolved from its transporter counterparts. PMID:19153159

Kv7.1 ion channels require a lipid to couple voltage sensing to pore opening.

PubMed

Zaydman, Mark A; Silva, Jonathan R; Delaloye, Kelli; Li, Yang; Liang, Hongwu; Larsson, H Peter; Shi, Jingyi; Cui, Jianmin

2013-08-06

Voltage-gated ion channels generate dynamic ionic currents that are vital to the physiological functions of many tissues. These proteins contain separate voltage-sensing domains, which detect changes in transmembrane voltage, and pore domains, which conduct ions. Coupling of voltage sensing and pore opening is critical to the channel function and has been modeled as a protein-protein interaction between the two domains. Here, we show that coupling in Kv7.1 channels requires the lipid phosphatidylinositol 4,5-bisphosphate (PIP2). We found that voltage-sensing domain activation failed to open the pore in the absence of PIP2. This result is due to loss of coupling because PIP2 was also required for pore opening to affect voltage-sensing domain activation. We identified a critical site for PIP2-dependent coupling at the interface between the voltage-sensing domain and the pore domain. This site is actually a conserved lipid-binding site among different K(+) channels, suggesting that lipids play an important role in coupling in many ion channels.

A kinetic Monte Carlo model with improved charge injection model for the photocurrent characteristics of organic solar cells

NASA Astrophysics Data System (ADS)

Kipp, Dylan; Ganesan, Venkat

2013-06-01

We develop a kinetic Monte Carlo model for photocurrent generation in organic solar cells that demonstrates improved agreement with experimental illuminated and dark current-voltage curves. In our model, we introduce a charge injection rate prefactor to correct for the electrode grid-size and electrode charge density biases apparent in the coarse-grained approximation of the electrode as a grid of single occupancy, charge-injecting reservoirs. We use the charge injection rate prefactor to control the portion of dark current attributed to each of four kinds of charge injection. By shifting the dark current between electrode-polymer pairs, we align the injection timescales and expand the applicability of the method to accommodate ohmic energy barriers. We consider the device characteristics of the ITO/PEDOT/PSS:PPDI:PBTT:Al system and demonstrate the manner in which our model captures the device charge densities unique to systems with small injection energy barriers. To elucidate the defining characteristics of our model, we first demonstrate the manner in which charge accumulation and band bending affect the shape and placement of the various current-voltage regimes. We then discuss the influence of various model parameters upon the current-voltage characteristics.

Calcium dependent current recordings in Xenopus laevis oocytes in microgravity

NASA Astrophysics Data System (ADS)

Wuest, Simon L.; Roesch, Christian; Ille, Fabian; Egli, Marcel

2017-12-01

Mechanical unloading by microgravity (or weightlessness) conditions triggers profound adaptation processes at the cellular and organ levels. Among other mechanisms, mechanosensitive ion channels are thought to play a key role in allowing cells to transduce mechanical forces. Previous experiments performed under microgravity have shown that gravity affects the gating properties of ion channels. Here, a method is described to record a calcium-dependent current in native Xenopus laevis oocytes under microgravity conditions during a parabolic flight. A 3-voltage-step protocol was applied to provoke a calcium-dependent current. This current increased with extracellular calcium concentration and could be reduced by applying extracellular gadolinium. The custom-made ;OoClamp; hardware was validated by comparing the results of the 3-voltage-step protocol to results obtained with a well-established two-electrode voltage clamp (TEVC). In the context of the 2nd Swiss Parabolic Flight Campaign, we tested the OoClamp and the method. The setup and experiment protocol worked well in parabolic flight. A tendency that the calcium-dependent current was smaller under microgravity than under 1 g condition could be observed. However, a conclusive statement was not possible due to the small size of the data base that could be gathered.

Pharmacology of the human red cell voltage-dependent cation channel; Part I. Activation by clotrimazole and analogues.

PubMed

Barksmann, Trine L; Kristensen, Berit I; Christophersen, Palle; Bennekou, Poul

2004-01-01

The activation and pharmacological modulation of the nonselective voltage-dependent cation (NSVDC) channel from human erythrocytes were studied. Basic channel activation was achieved by suspending red cells in a low Cl(-) Ringer (2 mM), where a positive membrane potential (V(m) = E(Cl)) immediately developed. Voltage- and time-dependent activation of the NSVDC channel occurred, reaching a cation conductance (g+) of 1.5-2.0 microS cm(-2). In the presence of the classical Gárdos channel blocker clotrimazole (0-50 microM), activation occurred faster, and g+ saturated dose-dependently (EC50 = 14 microM) at a value of about 4 microS cm(-2). The clotrimazole analogues TRAM-34, econazole, and miconazole also stimulated the channel, whereas the chemically more distant Gárdos channel inhibitors nitrendipine and cetiedil had no effects. Although the potency for modulation of the NSVDC channel is much lower than the IC50 value for Gárdos channel inhibition, clotrimazole (and its analogues) constitutes the first chemical class of positive modulators of the NSVDC channel. This may be an important pharmacological "fingerprint" in the identification of the cloned equivalent of the erythrocyte channel.

Purification and Characterization of Two Voltage-Dependent Anion Channel Isoforms from Plant Seeds1

PubMed Central

Abrecht, Helge; Wattiez, Ruddy; Ruysschaert, Jean-Marie; Homblé, Fabrice

2000-01-01

Mitochondria were isolated from imbibed seeds of lentil (Lens culinaris) and Phaseolus vulgaris. We copurified two voltage-dependent anion channel from detergent solubilized mitochondria in a single purification step using hydroxyapatite. The two isoforms from P. vulgaris were separated by chromatofocusing chromatography in 4 m urea without any loss of channel activity. Channel activity of each isoform was characterized upon reconstitution into diphytanoyl phosphatidylcholine planar lipid bilayers. Both isoforms form large conductance channels that are slightly anion selective and display cation selective substates. PMID:11080295

Electroluminescence of a polythiophene molecular wire suspended between a metallic surface and the tip of a scanning tunneling microscope.

PubMed

Reecht, Gaël; Scheurer, Fabrice; Speisser, Virginie; Dappe, Yannick J; Mathevet, Fabrice; Schull, Guillaume

2014-01-31

The electroluminescence of a polythiophene wire suspended between a metallic surface and the tip of a scanning tunneling microscope is reported. Under positive sample voltage, the spectral and voltage dependencies of the emitted light are consistent with the fluorescence of the wire junction mediated by localized plasmons. This emission is strongly attenuated for the opposite polarity. Both emission mechanism and polarity dependence are similar to what occurs in organic light emitting diodes (OLED) but at the level of a single molecular wire.

Tunneling contact IGZO TFTs with reduced saturation voltages

NASA Astrophysics Data System (ADS)

Wang, Longyan; Sun, Yin; Zhang, Xintong; Zhang, Lining; Zhang, Shengdong; Chan, Mansun

2017-04-01

We report a tunneling contact indium-gallium-zinc oxide (IGZO) thin film transistor (TFT) with a graphene interlayer technique in this paper. A Schottky junction is realized between a metal and IGZO with a graphene interlayer, leading to a quantum tunneling of the TFT transport in saturation regions. This tunneling contact enables a significant reduction in the saturation drain voltage Vdsat compared to that of the thermionic emission TFTs, which is usually equal to the gate voltage minus their threshold voltages. Measured temperature independences of the subthreshold swing confirm a transition from the thermionic emission to quantum tunneling transports depending on the gate bias voltages in the proposed device. The tunneling contact TFTs with the graphene interlayer have implications to reduce the power consumptions of certain applications such as the active matrix OLED display.

Nanowire NMOS Logic Inverter Characterization.

PubMed

Hashim, Yasir

2016-06-01

This study is the first to demonstrate characteristics optimization of nanowire N-Channel Metal Oxide Semiconductor (NW-MOS) logic inverter. Noise margins and inflection voltage of transfer characteristics are used as limiting factors in this optimization. A computer-based model used to produce static characteristics of NW-NMOS logic inverter. In this research two circuit configuration of NW-NMOS inverter was studied, in first NW-NMOS circuit, the noise margin for (low input-high output) condition was very low. For second NMOS circuit gives excellent noise margins, and results indicate that optimization depends on applied voltage to the inverter. Increasing gate to source voltage with (2/1) nanowires ratio results better noise margins. Increasing of applied DC load transistor voltage tends to increasing in decreasing noise margins; decreasing this voltage will improve noise margins significantly.

Current-voltage characteristics in organic field-effect transistors. Effect of interface dipoles

NASA Astrophysics Data System (ADS)

Sworakowski, Juliusz

2015-07-01

The role of polar molecules present at dielectric/semiconductor interfaces of organic field-effect transistors (OFETs) has been assessed employing the electrostatic model put forward in a recently published paper (Sworakowski et al., 2014). The interface dipoles create dipolar traps in the surface region of the semiconductor, their depths decreasing with the distance from the interface. This feature results in appearance of mobility gradients in the direction perpendicular to the dielectric/semiconductor interface, manifesting themselves in modification of the shapes of current-voltage characteristics. The effect may account for differences in carrier mobilities determined from the same experimental data using methods scanning different ranges of channel thicknesses (e.g., transconductances vs. transfer characteristics), differences between turn-on voltages and threshold voltages, and gate voltage dependence of mobility.

Battery and capacitor technology for uniform charge time in implantable cardioverter-defibrillators

NASA Astrophysics Data System (ADS)

Skarstad, Paul M.

Implantable cardioverter-defibrillators (ICDs) are implantable medical devices designed to treat ventricular fibrillation by administering a high-voltage shock directly to the heart. Minimizing the time a patient remains in fibrillation is an important goal of this therapy. Both batteries and high-voltage capacitors used in these devices can display time-dependency in performance, resulting in significant extension of charge time. Altering the electrode balance in lithium/silver vanadium oxide batteries used to power these devices has minimized time-dependent changes in battery resistance. Charge-interval dependent changes in capacitor cycling efficiency have been minimized for stacked-plate aluminum electrolytic capacitors by a combination of material and processing factors.

Measuring Multi-Megavolt Diode Voltages

NASA Astrophysics Data System (ADS)

Pereira, N. R.; Swanekamp, S. B.; Weber, B. V.; Commisso, R. J.; Hinshelwood, D. D.; Stephanakis, S. J.

2002-12-01

The voltage in high-power diodes can be determined by measuring the Compton electrons generated by the diode's bremsstrahlung radiation. This technique is implemented with a Compton-Hall (C-H) voltmeter that collimates the bremsstrahlung onto a Compton target and bends the emitted Compton electron orbits off to the side with an applied magnetic field off to Si pin diode detectors. Voltage is determined from the ratio of the Compton electron dose to the forward x-ray dose. The instrument's calibration and response are determined from coupled electron/photon transport calculations. The applicable voltage range is tuned by adjusting the position of the electron detector relative to the Compton target or by varying the magnetic field strength. The instrument was used to obtain time-dependent voltage measurements for a pinched-beam diode whose voltage is enhanced by an upstream opening switch. In this case, plasmas and vacuum electron flow from the opening switch make it difficult to determine the voltage accurately from electrical measurements. The C-H voltmeter gives voltages that are significantly higher than those obtained from electrical measurements but are consistent with measurements of peak voltage based on nuclear activation of boron-nitride targets.

Adaptive Q–V Scheme for the Voltage Control of a DFIG-Based Wind Power Plant

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kim, Jinho; Seok, Jul-Ki; Muljadi, Eduard

Wind generators within a wind power plant (WPP) will produce different amounts of active power because of the wake effect, and therefore, they have different reactive power capabilities. This paper proposes an adaptive reactive power to the voltage (Q-V) scheme for the voltage control of a doubly fed induction generator (DFIG)-based WPP. In the proposed scheme, the WPP controller uses a voltage control mode and sends a voltage error signal to each DFIG. The DFIG controller also employs a voltage control mode utilizing the adaptive Q-V characteristics depending on the reactive power capability such that a DFIG with a largermore » reactive power capability will inject more reactive power to ensure fast voltage recovery. Test results indicate that the proposed scheme can recover the voltage within a short time, even for a grid fault with a small short-circuit ratio, by making use of the available reactive power of a WPP and differentiating the reactive power injection in proportion to the reactive power capability. This will, therefore, help to reduce the additional reactive power and ensure fast voltage recovery.« less

Concentration-dependent changes in apparent diffusion coefficients as indicator for colloidal stability of protein solutions.

PubMed

Bauer, Katharina Christin; Göbel, Mathias; Schwab, Marie-Luise; Schermeyer, Marie-Therese; Hubbuch, Jürgen

2016-09-10

The colloidal stability of a protein solution during downstream processing, formulation, and storage is a key issue for the biopharmaceutical production process. Thus, knowledge about colloidal solution characteristics, such as the tendency to form aggregates or high viscosity, at various processing conditions is of interest. This work correlates changes in the apparent diffusion coefficient as a parameter of protein interactions with observed protein aggregation and dynamic viscosity of the respective protein samples. For this purpose, the diffusion coefficient, the protein phase behavior, and the dynamic viscosity in various systems containing the model proteins α-lactalbumin, lysozyme, and glucose oxidase were studied. Each of these experiments revealed a wide range of variations in protein interactions depending on protein type, protein concentration, pH, and the NaCl concentration. All these variations showed to be mirrored by changes in the apparent diffusion coefficient in the respective samples. Whereas stable samples with relatively low viscosity showed an almost linear dependence, the deviation from the concentration-dependent linearity indicated both an increase in the sample viscosity and probability of protein aggregation. This deviation of the apparent diffusion coefficient from concentration-dependent linearity was independent of protein type and solution properties for this study. Thus, this single parameter shows the potential to act as a prognostic tool for colloidal stability of protein solutions. Copyright © 2016 Elsevier B.V. All rights reserved.

Modeling of Metal-Ferroelectric-Semiconductor Field Effect Transistors

NASA Technical Reports Server (NTRS)

Duen Ho, Fat; Macleod, Todd C.

1998-01-01

The characteristics for a MFSFET (metal-ferroelectric-semiconductor field effect transistor) is very different than a conventional MOSFET and must be modeled differently. The drain current has a hysteresis shape with respect to the gate voltage. The position along the hysteresis curve is dependent on the last positive or negative polling of the ferroelectric material. The drain current also has a logarithmic decay after the last polling. A model has been developed to describe the MFSFET drain current for both gate voltage on and gate voltage off conditions. This model takes into account the hysteresis nature of the MFSFET and the time dependent decay. The model is based on the shape of the Fermi-Dirac function which has been modified to describe the MFSFET's drain current. This is different from the model proposed by Chen et. al. and that by Wu.

Enhanced inverse spin Hall contribution at high microwave power levels in La{sub 0.67}Sr{sub 0.33}MnO{sub 3}/SrRuO{sub 3} epitaxial bilayers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haidar, S. M., E-mail: haidar@imr.tohoku.ac.jp; Lustikova, J.; Shiomi, Y.

2015-10-12

We have investigated microwave power dependence of dc voltage generated upon ferromagnetic resonance in a La{sub 0.67}Sr{sub 0.33}MnO{sub 3}/SrRuO{sub 3} epitaxial bilayer film at room temperature. With increasing microwave power above ∼75 mW, the magnitude of the voltage signal decreases as the sample temperature approaches the Curie temperature of La{sub 0.67}Sr{sub 0.33}MnO{sub 3} due to heating effects. By analyzing the dependence of the voltage signal on the direction of the magnetic field, we show that with increasing microwave power the contribution from the inverse spin Hall effect becomes more dominant than that from the anisotropic magnetoresistance effect.

The significance of temperature dependence on the piezoelectric energy harvesting by using a phononic crystal

NASA Astrophysics Data System (ADS)

Aly, Arafa H.; Nagaty, Ahmed; Khalifa, Zaki; Mehaney, Ahmed

2018-05-01

In this study, an acoustic energy harvester based on a two-dimensional phononic crystal has been constructed. The present structure consists of silicon cylinders in the air background with a polyvinylidene fluoride cylinder as a defect to confine the acoustic energy. The presented energy harvester depends on the piezoelectric effect (using the piezoelectric material polyvinylidene fluoride) that converts the confined acoustic energy to electric energy. The maximum output voltage obtained equals 170 mV. Moreover, the results revealed that the output voltage can be increased with increasing temperature. In addition, the effects of the load resistance and the geometry of the piezoelectric material on the output voltage have been studied theoretically. Based on these results, all previous studies about energy harvesting in phononic structures must take temperature effects into account.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Pharmacological consequences of the coexpression of BK channel α and auxiliary β subunits

PubMed Central

Torres, Yolima P.; Granados, Sara T.; Latorre, Ramón

2014-01-01

Coded by a single gene (Slo1, KCM) and activated by depolarizing potentials and by a rise in intracellular Ca2+ concentration, the large conductance voltage- and Ca2+-activated K+ channel (BK) is unique among the superfamily of K+ channels. BK channels are tetramers characterized by a pore-forming α subunit containing seven transmembrane segments (instead of the six found in voltage-dependent K+ channels) and a large C terminus composed of two regulators of K+ conductance domains (RCK domains), where the Ca2+-binding sites reside. BK channels can be associated with accessory β subunits and, although different BK modulatory mechanisms have been described, greater interest has recently been placed on the role that the β subunits may play in the modulation of BK channel gating due to its physiological importance. Four β subunits have currently been identified (i.e., β1, β2, β3, and β4) and despite the fact that they all share the same topology, it has been shown that every β subunit has a specific tissue distribution and that they modify channel kinetics as well as their pharmacological properties and the apparent Ca2+ sensitivity of the α subunit in different ways. Additionally, different studies have shown that natural, endogenous, and synthetic compounds can modulate BK channels through β subunits. Considering the importance of these channels in different pathological conditions, such as hypertension and neurological disorders, this review focuses on the mechanisms by which these compounds modulate the biophysical properties of BK channels through the regulation of β subunits, as well as their potential therapeutic uses for diseases such as those mentioned above. PMID:25346693

Voltage gating by molecular subunits of Na+ and K+ ion channels: higher-dimensional cubic kinetics, rate constants, and temperature.

PubMed

Fohlmeister, Jürgen F

2015-06-01

The structural similarity between the primary molecules of voltage-gated Na and K channels (alpha subunits) and activation gating in the Hodgkin-Huxley model is brought into full agreement by increasing the model's sodium kinetics to fourth order (m(3) → m(4)). Both structures then virtually imply activation gating by four independent subprocesses acting in parallel. The kinetics coalesce in four-dimensional (4D) cubic diagrams (16 states, 32 reversible transitions) that show the structure to be highly failure resistant against significant partial loss of gating function. Rate constants, as fitted in phase plot data of retinal ganglion cell excitation, reflect the molecular nature of the gating transitions. Additional dimensions (6D cubic diagrams) accommodate kinetically coupled sodium inactivation and gating processes associated with beta subunits. The gating transitions of coupled sodium inactivation appear to be thermodynamically irreversible; response to dielectric surface charges (capacitive displacement) provides a potential energy source for those transitions and yields highly energy-efficient excitation. A comparison of temperature responses of the squid giant axon (apparently Arrhenius) and mammalian channel gating yields kinetic Q10 = 2.2 for alpha unit gating, whose transitions are rate-limiting at mammalian temperatures; beta unit kinetic Q10 = 14 reproduces the observed non-Arrhenius deviation of mammalian gating at low temperatures; the Q10 of sodium inactivation gating matches the rate-limiting component of activation gating at all temperatures. The model kinetics reproduce the physiologically large frequency range for repetitive firing in ganglion cells and the physiologically observed strong temperature dependence of recovery from inactivation. Copyright © 2015 the American Physiological Society.

Pharmacological consequences of the coexpression of BK channel α and auxiliary β subunits.

PubMed

Torres, Yolima P; Granados, Sara T; Latorre, Ramón

2014-01-01

Coded by a single gene (Slo1, KCM) and activated by depolarizing potentials and by a rise in intracellular Ca(2+) concentration, the large conductance voltage- and Ca(2+)-activated K(+) channel (BK) is unique among the superfamily of K(+) channels. BK channels are tetramers characterized by a pore-forming α subunit containing seven transmembrane segments (instead of the six found in voltage-dependent K(+) channels) and a large C terminus composed of two regulators of K(+) conductance domains (RCK domains), where the Ca(2+)-binding sites reside. BK channels can be associated with accessory β subunits and, although different BK modulatory mechanisms have been described, greater interest has recently been placed on the role that the β subunits may play in the modulation of BK channel gating due to its physiological importance. Four β subunits have currently been identified (i.e., β1, β2, β3, and β4) and despite the fact that they all share the same topology, it has been shown that every β subunit has a specific tissue distribution and that they modify channel kinetics as well as their pharmacological properties and the apparent Ca(2+) sensitivity of the α subunit in different ways. Additionally, different studies have shown that natural, endogenous, and synthetic compounds can modulate BK channels through β subunits. Considering the importance of these channels in different pathological conditions, such as hypertension and neurological disorders, this review focuses on the mechanisms by which these compounds modulate the biophysical properties of BK channels through the regulation of β subunits, as well as their potential therapeutic uses for diseases such as those mentioned above.