Nonequilibrium Plasma Research

DTIC Science & Technology

2010-05-01

Kulikovsky, IEEE Trans. Plasma Sci. 25, 439 (1997). 61. W. Yi and P. Williams, J. Phys. D: Appl. Phys. 35, 205 (2002). 62. E. van Veldhuizen and W...Rutgers, J. Phys. D: Appl. Phys. 35, 2169 (2002). 63. E. van Veldhuizen , A. Baede, D. Hayashi, and W. Rutgers, APP Spring Meeting (Bad Honnef...Nonequilibrium Air Plasmas at Atmosphere Pressure, (Institute of Physics, Bristol, UK 2005) Review Article: P. Bletzinger, B. N. Ganguly, D. Van Wie and

Exploring a Model of Situated Professional Development: Impact on Classroom Practice

ERIC Educational Resources Information Center

Singer, Jonathan; Lotter, Christine; Feller, Robert; Gates, Harry

2011-01-01

A hallmark of current science education reform involves teaching through inquiry. However, the widespread use of inquiry-based instruction in many classrooms has not occurred (Roehrig and Luft in "Int J Sci Educ" 26:3-24, 2004; Schneider et al. in "J Res Sci Teach" 42:283-312, 2005). The purpose of this study was to investigate the impact of a…

Optimal Transport, Convection, Magnetic Relaxation and Generalized Boussinesq Equations

NASA Astrophysics Data System (ADS)

Brenier, Yann

2009-10-01

We establish a connection between optimal transport theory (see Villani in Topics in optimal transportation. Graduate studies in mathematics, vol. 58, AMS, Providence, 2003, for instance) and classical convection theory for geophysical flows (Pedlosky, in Geophysical fluid dynamics, Springer, New York, 1979). Our starting point is the model designed few years ago by Angenent, Haker, and Tannenbaum (SIAM J. Math. Anal. 35:61-97, 2003) to solve some optimal transport problems. This model can be seen as a generalization of the Darcy-Boussinesq equations, which is a degenerate version of the Navier-Stokes-Boussinesq (NSB) equations. In a unified framework, we relate different variants of the NSB equations (in particular what we call the generalized hydrostatic-Boussinesq equations) to various models involving optimal transport (and the related Monge-Ampère equation, Brenier in Commun. Pure Appl. Math. 64:375-417, 1991; Caffarelli in Commun. Pure Appl. Math. 45:1141-1151, 1992). This includes the 2D semi-geostrophic equations (Hoskins in Annual review of fluid mechanics, vol. 14, pp. 131-151, Palo Alto, 1982; Cullen et al. in SIAM J. Appl. Math. 51:20-31, 1991, Arch. Ration. Mech. Anal. 185:341-363, 2007; Benamou and Brenier in SIAM J. Appl. Math. 58:1450-1461, 1998; Loeper in SIAM J. Math. Anal. 38:795-823, 2006) and some fully nonlinear versions of the so-called high-field limit of the Vlasov-Poisson system (Nieto et al. in Arch. Ration. Mech. Anal. 158:29-59, 2001) and of the Keller-Segel for Chemotaxis (Keller and Segel in J. Theor. Biol. 30:225-234, 1971; Jäger and Luckhaus in Trans. Am. Math. Soc. 329:819-824, 1992; Chalub et al. in Mon. Math. 142:123-141, 2004). Mathematically speaking, we establish some existence theorems for local smooth, global smooth or global weak solutions of the different models. We also justify that the inertia terms can be rigorously neglected under appropriate scaling assumptions in the generalized Navier-Stokes-Boussinesq equations. Finally, we show how a “stringy” generalization of the AHT model can be related to the magnetic relaxation model studied by Arnold and Moffatt to obtain stationary solutions of the Euler equations with prescribed topology (see Arnold and Khesin in Topological methods in hydrodynamics. Applied mathematical sciences, vol. 125, Springer, Berlin, 1998; Moffatt in J. Fluid Mech. 159:359-378, 1985, Topological aspects of the dynamics of fluids and plasmas. NATO adv. sci. inst. ser. E, appl. sci., vol. 218, Kluwer, Dordrecht, 1992; Schonbek in Theory of the Navier-Stokes equations, Ser. adv. math. appl. sci., vol. 47, pp. 179-184, World Sci., Singapore, 1998; Vladimirov et al. in J. Fluid Mech. 390:127-150, 1999; Nishiyama in Bull. Inst. Math. Acad. Sin. (N.S.) 2:139-154, 2007).

A Finite Difference Approximation for a Coupled System of Nonlinear Size-Structured Populations

DTIC Science & Technology

2000-01-01

are available. For a classical Lotka - Volterra competition model which is represented by a system of N di erential equations, conditions on the growth...Methods Appl. Sci., 9 (1999), 1379-1391. [5] S. Ahmed, Extinction of Species in Nonautonomous Lotka - Volterra Systems, Proc. Amer. Math. Soc., 127 (1999...Walter DeGruyter, Berlin, 1995. [7] S. Ahmed and F. Montes de Oca, Extinction in Nonautonomous T -periodic Lotka - Volterra System, Appl. Math. Comput

Geometry of PDE's. IV

NASA Astrophysics Data System (ADS)

Prástaro, Agostino

2008-02-01

Following our previous results on this subject [R.P. Agarwal, A. Prástaro, Geometry of PDE's. III(I): Webs on PDE's and integral bordism groups. The general theory, Adv. Math. Sci. Appl. 17 (2007) 239-266; R.P. Agarwal, A. Prástaro, Geometry of PDE's. III(II): Webs on PDE's and integral bordism groups. Applications to Riemannian geometry PDE's, Adv. Math. Sci. Appl. 17 (2007) 267-285; A. Prástaro, Geometry of PDE's and Mechanics, World Scientific, Singapore, 1996; A. Prástaro, Quantum and integral (co)bordism in partial differential equations, Acta Appl. Math. (5) (3) (1998) 243-302; A. Prástaro, (Co)bordism groups in PDE's, Acta Appl. Math. 59 (2) (1999) 111-201; A. Prástaro, Quantized Partial Differential Equations, World Scientific Publishing Co, Singapore, 2004, 500 pp.; A. Prástaro, Geometry of PDE's. I: Integral bordism groups in PDE's, J. Math. Anal. Appl. 319 (2006) 547-566; A. Prástaro, Geometry of PDE's. II: Variational PDE's and integral bordism groups, J. Math. Anal. Appl. 321 (2006) 930-948; A. Prástaro, Th.M. Rassias, Ulam stability in geometry of PDE's, Nonlinear Funct. Anal. Appl. 8 (2) (2003) 259-278; I. Stakgold, Boundary Value Problems of Mathematical Physics, I, The MacMillan Company, New York, 1967; I. Stakgold, Boundary Value Problems of Mathematical Physics, II, Collier-MacMillan, Canada, Ltd, Toronto, Ontario, 1968], integral bordism groups of the Navier-Stokes equation are calculated for smooth, singular and weak solutions, respectively. Then a characterization of global solutions is made on this ground. Enough conditions to assure existence of global smooth solutions are given and related to nullity of integral characteristic numbers of the boundaries. Stability of global solutions are related to some characteristic numbers of the space-like Cauchy dataE Global solutions of variational problems constrained by (NS) are classified by means of suitable integral bordism groups too.

Rapid Repairs: Surface Preparation of Ti-3 Al-2.5V Alloy Tubes by Fiber Laser and Welding

DTIC Science & Technology

2008-11-01

processing of titanium 6Al - 4V alloy for potential aerospace component cleaning application, Appl Surf Sci 2005;247:623-630. [11] Turner MW, Crouse...Debroy T, Heat transfer and fluid flow during keyhole mode laser welding of tantalum, Ti- 6Al - 4V , 304 Stainless Steel and Vanadium, J Phy D : Appl Phy...14Titanium alloys are used extensively in aerospace applications mainly due to their superior strength to weight ratio. Different grades of titanium

Phase Relations and Miscibility in Polymer Blends Containing Copolymers.

DTIC Science & Technology

1986-04-15

MacKnight, W. J ., Pure Appl. Chem. 52, 409 (1980). 36. Vukovic , R., Kuresevic, V., Karasz, F. E., and MacKnight, W. J ., Thermochim. Acta 54, 349 (1982). 37... Vukovic , R., Karasz, F. E., and MacKnight, W. J ., Polymer 24, 529 (1983). 38. Vukovic , R., Karasz, F. E., and MacKnight, W. J ., J . Appl. Polymer Sci...28, 219 (1983). 39. Zacharius, S. L., ten Brinke, G., MacKnight, W. J ., and Karasz, F. E., Macromolecules 16, 381 (1983). 40. Vukovic , R., Kuresevic

Poly (acrylonitrile - co -1-vinylimidazole): A New Melt Processable Carbon Fiber Precursor

DTIC Science & Technology

2011-01-01

changed fromwhite to brown and then black during stabilization as expected. The stabi- lized black copolymers were insoluble in DMF, showing good...Paliwal DK, Bajaj P. J Appl Polym Sci 1996;59:1819. [9] Bhanu VA, Rangarajan P, Wiles K, Bortner M, Sankarpandian M, Godshall D, et al. Polymer 2002;43:4841...AA. Carbon 2005;43:1065e72. [23] Bajaj P, Roopanwal AK. J Macromol Sci Rev Macromol Chem Phys 1997;C37:97. [24] Mukundan T, Bhanu VA, Wiles KB, Johnson

Liquid Chromatography Applications to Determination of Sorption on Aquifer Materials

DTIC Science & Technology

1989-11-01

and D. R. Nielsen. Modeling tritium and chloride 36 transport through an aggregated oxisol . Water Resources Res. 19 691-700 (1983). P. Nkedi-Kizza, J. W...describing ion exchange during transport through an aggregated oxisol . Water Resources Res. 20 1123-1130 (1984). P. Nkedi-Kizza, P. S. C. Rao, R. E. Jessup...and J. M. Davidson. Ion exchange and diffusive mass transfer during miscible displacement through an aggregated oxisol . Soil Sci. Soc. Am. J. 46 471

Stratigraphical evidence of late Amazonian periglaciation and glaciation in the Astapus Colles region of Mars

NASA Astrophysics Data System (ADS)

Soare, Richard J.; Osinski, Gordon R.

2009-07-01

Recent modeling of the meteorological conditions during and following times of high obliquity suggests that an icy mantle could have been emplaced in western Utopia Planitia by atmospheric deposition during the late Amazonian period [Costard, F.M., Forget, F., Madeleine, J.B., Soare, R.J., Kargel, J.S., 2008. Lunar Planet. Sci. 39. Abstract 1274; Madeleine, B., Forget, F., Head, J.W., Levrard, B., Montmessin, F., 2007. Lunar Planet. Sci. 38. Abstract 1778]. Astapus Colles (ABa) is a late Amazonian geological unit - located in this hypothesized area of accumulation - that comprises an icy mantle tens of meters thick [Tanaka, K.L., Skinner, J.A., Hare, T.M., 2005. US Geol. Surv. Sci. Invest., Map 2888]. For the most part, this unit drapes the early Amazonian Vastitas Borealis interior unit (ABvi); to a lesser degree it overlies the early Amazonian Vastitas Borealis marginal unit (ABvm) and the early to late Hesperian UP plains unit HBu2 [Tanaka, K.L., Skinner, J.A., Hare, T.M., 2005. US Geol. Surv. Sci. Invest., Map 2888]. Landscapes possibly modified by late-Amazonian periglacial processes [Costard, F.M., Kargel, J.S., 1995. Icarus 114, 93-112; McBride, S.A., Allen, C.C., Bell, M.S., 2005. Lunar Planet. Sci. 36. Abstract 1090; Morgenstern, A., Hauber, E., Reiss, D., van Gasselt, S., Grosse, G., Schirrmeister, L., 2007. J. Geophys. Res. 112, doi:10.1029/2006JE002869. E06010; Seibert, N.M., Kargel, J.S., 2001. Geophys. Res. Lett. 28, 899-902; Soare, R.J., Kargel, J.S., Osinski, G.R., Costard, F., 2007. Icarus 191, 95-112; Soare, R.J., Osinski, G.R., Roehm, C.L., 2008. Earth Planet. Sci. Lett. 272, 382-393] and glacial processes [Milliken, R.E., Mustard, J.F., Goldsby, D.L., 2003. J. Geophys. Res. 108 (E6), doi:10.1029/2002JE002005. 5057; Mustard, J.F., Cooper, C.D., Rifkin, M.K., 2001. Nature 412, 411-414; Tanaka, K.L., Skinner, J.A., Hare, T.M., 2005. US Geol. Surv. Sci. Invest., Map 2888] have been reported within the region. Researchers have assumed that the periglacial and glacial landscapes occur within the same geological unit, the ABa [i.e., Morgenstern, A., Hauber, E., Reiss, D., van Gasselt, S., Grosse, G., Schirrmeister, L., 2007. J. Geophys. Res. 112; doi:10.1029/2006JE002869. E06010; Tanaka, K.L., Skinner, J.A., Hare, T.M., 2005. US Geol. Surv. Sci. Invest., Map 2888]. In this study we use HiRISE (High Resolution Image Science Experiment, Mars Reconnaissance Orbiter) imagery to identify the stratigraphical separation of the two landscapes and show that periglacial landscape modification has occurred in the geological units that underlie the ABa, not in the ABa itself. Moreover, we suggest that the periglacial landscape extends well beyond the perimeter of the ABa and could be the product of "wet" cold-climate processes. These processes involve freeze-thaw cycles and intermittently stable liquid-water at or near the surface. By contrast, we propose that the ABa is a very recent late-Amazonian geological unit formed principally by "dry" cold-climate processes. These processes comprise accumulation (by atmospheric deposition) and ablation (by sublimation).

Encapsulation and Annealing of Sulfur and Selenium Implanted Gallium Arsenide

DTIC Science & Technology

1978-03-24

Nisse, and F. L. Vook, Plenum Press, New York 1974 (p. 141). 3. J. A. Borders and S. T. Picraux, Proc. IEEE 62, 1224 (1974). 4. A. Hiraki , M. A. Nicolet...and J. W. Mayer, Appl. Phys. Letters 18, 178 (1971). 5. A. Hiraki and E. Lugujjo, J. Vacuum Sci. Technol. 9, 155 (1972). 6. A. Hiraki , E. Lugujjo, M...A. Nicolet, and J. W. Mayer, phys. stat. sol (a) 7, 401 (1971). 7. A. Hiraki , E. Lugujjo, and J. W. Mayer, J. Appl. Phys. 43, 3643 (1972). 8. J. M

Dust Cloud Combustion for Defeat of Airborne Bio-WMD

DTIC Science & Technology

2017-12-01

Explosibility of metal powders,” DTIC Document, Report, (1964). [7] J. H. Burgoyne and L. Cohen, Proc. R. Soc. London. Ser. A. Math . Phys. Sci., 225...London. A. Math . Phys. Sci., 385, (1983), 21–51. [13] J. Sun, R. Dobashi, and T. Hirano, J. Loss Prev. Process Ind., 14, (2001), 463–467. [14] J.-H. Sun...J. Sung, Combust. Flame, 124, (2001), 35– 49. [27] B. Matkowsky and G. Sivashinsky, SIAM J. Appl. Math ., 35, (1978), 465–478. [28] G. Jomaas, J. K

A generalized nonlocal vector calculus

NASA Astrophysics Data System (ADS)

Alali, Bacim; Liu, Kuo; Gunzburger, Max

2015-10-01

A nonlocal vector calculus was introduced in Du et al. (Math Model Meth Appl Sci 23:493-540, 2013) that has proved useful for the analysis of the peridynamics model of nonlocal mechanics and nonlocal diffusion models. A formulation is developed that provides a more general setting for the nonlocal vector calculus that is independent of particular nonlocal models. It is shown that general nonlocal calculus operators are integral operators with specific integral kernels. General nonlocal calculus properties are developed, including nonlocal integration by parts formula and Green's identities. The nonlocal vector calculus introduced in Du et al. (Math Model Meth Appl Sci 23:493-540, 2013) is shown to be recoverable from the general formulation as a special example. This special nonlocal vector calculus is used to reformulate the peridynamics equation of motion in terms of the nonlocal gradient operator and its adjoint. A new example of nonlocal vector calculus operators is introduced, which shows the potential use of the general formulation for general nonlocal models.

Wrinkle surface instability of an inhomogeneous elastic block with graded stiffness

NASA Astrophysics Data System (ADS)

Yang, Shengyou; Chen, Yi-chao

2017-04-01

Surface instabilities have been studied extensively for both homogeneous materials and film/substrate structures but relatively less for materials with continuously varying properties. This paper studies wrinkle surface instability of a graded neo-Hookean block with exponentially varying modulus under plane strain by using the linear bifurcation analysis. We derive the first variation condition for minimizing the potential energy functional and solve the linearized equations of equilibrium to find the necessary conditions for surface instability. It is found that for a homogeneous block or an inhomogeneous block with increasing modulus from the surface, the critical stretch for surface instability is 0.544 (0.456 strain), which is independent of the geometry and the elastic modulus on the surface of the block. This critical stretch coincides with that reported by Biot (1963 Appl. Sci. Res. 12, 168-182. (doi:10.1007/BF03184638)) 53 years ago for the onset of wrinkle instabilities in a half-space of homogeneous neo-Hookean materials. On the other hand, for an inhomogeneous block with decreasing modulus from the surface, the critical stretch for surface instability ranges from 0.544 to 1 (0-0.456 strain), depending on the modulus gradient, and the length and height of the block. This sheds light on the effects of the material inhomogeneity and structural geometry on surface instability.

Heteroepitaxial Diamond Growth

DTIC Science & Technology

1994-02-01

by the Hiraki , Appl. Surf. Sci., 56-58 (1992) 89. HREELS measurement. Recent quantum 6. S.-T. Lee. and G. Apai., Phys. Rev. B 48 chemical calculations...1989) 171. carbon atoms undergoing dimerization and the [6] H. Kawarada, J.S. Ma, T. Yonehara and A. Hiraki , remainder of the lattice. The dimerization

Laughing Bear.

ERIC Educational Resources Information Center

Seeds, Michael A.; Seeds, Kathryn Anne

1983-01-01

Provided is a complete listing (Applesoft Basic) for a children's spelling program. The listing includes a machine language music utility that plays short tunes and uses the Apple's two hi-res screens for animation. Also included is a program that allows pictures to be drawn and saved to animate other programs. (JN)

SCAPS, a two-dimensional ion detector for mass spectrometer

NASA Astrophysics Data System (ADS)

Yurimoto, Hisayoshi

2014-05-01

Faraday Cup (FC) and electron multiplier (EM) are of the most popular ion detector for mass spectrometer. FC is used for high-count-rate ion measurements and EM can detect from single ion. However, FC is difficult to detect lower intensities less than kilo-cps, and EM loses ion counts higher than Mega-cps. Thus, FC and EM are used complementary each other, but they both belong to zero-dimensional detector. On the other hand, micro channel plate (MCP) is a popular ion signal amplifier with two-dimensional capability, but additional detection system must be attached to detect the amplified signals. Two-dimensional readout for the MCP signals, however, have not achieve the level of FC and EM systems. A stacked CMOS active pixel sensor (SCAPS) has been developed to detect two-dimensional ion variations for a spatial area using semiconductor technology [1-8]. The SCAPS is an integrated type multi-detector, which is different from EM and FC, and is composed of more than 500×500 pixels (micro-detectors) for imaging of cm-area with a pixel of less than 20 µm in square. The SCAPS can be detected from single ion to 100 kilo-count ions per one pixel. Thus, SCAPS can be accumulated up to several giga-count ions for total pixels, i.e. for total imaging area. The SCAPS has been applied to stigmatic ion optics of secondary ion mass spectrometer, as a detector of isotope microscope [9]. The isotope microscope has capabilities of quantitative isotope images of hundred-micrometer area on a sample with sub-micrometer resolution and permil precision, and of two-dimensional mass spectrum on cm-scale of mass dispersion plane of a sector magnet with ten-micrometer resolution. The performance has been applied to two-dimensional isotope spatial distribution for mainly hydrogen, carbon, nitrogen and oxygen of natural (extra-terrestrial and terrestrial) samples and samples simulated natural processes [e.g. 10-17]. References: [1] Matsumoto, K., et al. (1993) IEEE Trans. Electron Dev. 40, 82-85. [2] Takayanagi et al. (1999) Proc. 1999 IEEE workshop on Charge-Coupled Devices and Advanced Image Sensors, 159-162. [3] Kunihiro et al. (2001) Nucl. Instrum. Methods Phys. Res. Sec. A 470, 512-519. [4] Nagashima et al. (2001) Surface Interface Anal. 31, 131-137. [5] Takayanagi et al. (2003) IEEE Trans. Electron Dev. 50, 70- 76. [6] Sakamoto and Yurimoto (2006) Surface Interface Anal. 38, 1760-1762. [7] Yamamoto et al. (2010) Surface Interface Anal. 42, 1603-1605. [8] Sakamoto et al. (2012) Jpn. J. Appl. Phys. 51, 076701. [9] Yurimoto et al. (2003) Appl. Surf. Sci. 203-204, 793-797. [10] Nagashima et al. (2004) Nature 428, 921-924. [11] Kunihiro et al. (2005) Geochim. Cosmochim. Acta 69, 763-773. [12] Nakamura et al. (2005) Geology 33, 829-832. [13] Sakamoto et al. (2007) Science 317, 231-233. [14] Greenwood et al. (2008) Geophys. Res. Lett., 35, L05203. [15] Greenwood et al. (2011) Nature Geoscience 4, 79-82. [16] Park et al. (2012) Meteorit. Planet. Sci. 47, 2070-2083. [17] Hashiguchi et al. (2013) Geochim. Cosmochim. Acta. 122, 306-323.

Voltage and Pressure Scaling of Streamer Dynamics in a Helium Plasma Jet With N2 CO-Flow (Postprint)

DTIC Science & Technology

2014-08-14

de Wetering, R. Blanc, E. M. van Veldhuizen , and U. Ebert, J. Phys. D: Appl. Phys. 43, 145204 (2010). 26T. M. P. Briels, J. Kos, G. J. J. Winands, E. M... van Veldhuizen , and U. Ebert, J. Phys. D: Appl. Phys. 41, 234004 (2008). 27See http://physics.nist.gov/PhysRefData/ASD for National Institute of...T. Briels, and E. van Velduizen, J. Geophys. Res. 115, A00E43, doi:10.1029/2009JA014867 (2010) and references therein. 25S. Nijdam, F. M. J. H. van

Dihydropyridine Receotprs: Possible Allosteric Regulation by Tremorgenic Toxins.

DTIC Science & Technology

1986-11-01

important mycotoxins from the fungal genera Penicillium, Asperg illus, and Claviceps have been found to induce tremors and seizures in humans an cattle...Effects of Sheep and Cattle in Relation to Natu Staggers Syndromes . Res. Vet. Sci. 24, 49-56 (1977). 9. Takahashi, M., Ohizumi, Y., and Yasumoto, T

Modeling collective behavior of molecules in nanoscale direct deposition processes

NASA Astrophysics Data System (ADS)

Lee, Nam-Kyung; Hong, Seunghun

2006-03-01

We present a theoretical model describing the collective behavior of molecules in nanoscale direct deposition processes such as dip-pen nanolithography. We show that strong intermolecular interactions combined with nonuniform substrate-molecule interactions can produce various shapes of molecular patterns including fractal-like structures. Computer simulations reveal circular and starlike patterns at low and intermediate densities of preferentially attractive surface sites, respectively. At large density of such surface sites, the molecules form a two-dimensional invasion percolation cluster. Previous experimental results showing anisotropic patterns of various chemical and biological molecules correspond to the starlike regime [P. Manandhar et al., Phys. Rev. Lett. 90, 115505 (2003); J.-H. Lim and C. A. Mirkin, Adv. Mater. (Weinheim, Ger.) 14, 1474 (2002); D. L. Wilson et al., Proc. Natl. Acad. Sci. U.S.A. 98, 13660 (2001); M. Su et al., Appl. Phys. Lett. 84, 4200 (2004); R. McKendry et al., Nano Lett. 2, 713 (2002); H. Zhou et al., Appl. Surf. Sci. 236, 18 (2004); G. Agarwal et al., J. Am. Chem. Soc. 125, 580 (2003)].

Teacher beliefs and cultural models: A challenge for science teacher preparation programs

NASA Astrophysics Data System (ADS)

Bryan, Lynn A.; Atwater, Mary M.

2002-11-01

The purpose of this paper is to present an argument for developing science teacher education programs that examine teachers' beliefs about multicultural issues and their impact on science teaching and learning. In the paper, we (a) delineate a rationale for the study of teacher beliefs about issues of culture and its impact on science teaching and learning; (b) assert three major categories of teacher beliefs to examine for designing teacher education programs that aim to meet the challenges of increasingly culturally diverse classrooms; and (c) discuss implications for science teacher education programs and research. Research has shown that knowing teachers' beliefs and designing instruction and experiences to explicitly confront those beliefs facilitate refinement of and/or transformation of beliefs and practices (Bryan & Abell, J Res Sci Teaching, 36, 121-140, 1999; Harrington & Hathaway, J Teacher Education, 46, 275-284, 1995; Hollingsworth, Am Educational Res J, 26(2), 160-189, 1989; Olmedo, J Teaching Teacher Education, 13, 245-258, 1997; Tobin & LaMaster, J Res Sci Teaching, 32, 225-242, 1995). Furthermore, prior to student teaching, preservice teachers need to be at least culturally sensitive teachers (Gillette, In Teacher Thinking in Cultural Contexts, F. A. Rios (Ed.); Albany, NY: State University of New York Press; 1996, pp. 104-128). Science educators need to continue to identify those beliefs and practices that undergird desirable and equitable science instruction.

Middle School Students' Beliefs about Matter

ERIC Educational Resources Information Center

Nakhleh, Mary B.; Samarapungavan, Ala; Saglam, Yilmaz

2005-01-01

The objective of this study was to examine middle school students' developing understanding of the nature of matter and to compare middle school students' ideas to those of elementary schools students, as was done by Nakhleh and Samarapungavan ["J Res Sci Teach" 36(7):777-805, 1999]. Nine middle school students were interviewed using a scripted,…

Contact Lens Anterior Surface pH

DTIC Science & Technology

1991-02-01

greenhouse effect and contact lenses, in Trans- 4. Nom MS: Tear fluid pH in normals, contact lens wearers, actions of the British Contact Lens...Invest 3. Fullard R), Carney LG: Diurnal variation in human tear en- Op/hdanmol Vis Sci 1978;17:810-813. ymes. Exp Eye Res 1984;38:15-26. 20. Efron N: The

Targeting N-RAS as a Therapeutic Approach for Melanoma

DTIC Science & Technology

2014-12-01

cell death. Sci. World J. 10 (2272−84), 2272−2284. (16) Lonne, G. K., Masoumi, K. C., Lennartsson, J., and Larsson, C. (2009) Protein kinase Cδ supports...dehydrogenase 1 is a marker for normal and malignant human colonic stem cells (SC) and tracks SC overpopulation during colon tumorigenesis. Cancer Res 2009, 69

Comparative stability of the bioresorbable ferric crosslinked hyaluronic acid adhesion prevention solutions.

PubMed

Luu, Hoan-My Do; Chen, Angela; Isayeva, Irada S

2013-08-01

The Intergel® ferric crosslinked hyaluronate (FeHA) adhesion prevention solution (APS) (FDA) is associated with serious post-operative complications (Henley, http://www.lawyersandsettlements.com/features/gynecare-intergel/intergel-timeline.html, 2007; FDA, 2003; Roman et al., Fertil Steril 2005, 83 Suppl 1:1113-1118; Tang et al., Ann Surg 2006;243(4):449-455; Wiseman, Fertil Steril 2006;86(3):771; Wiseman, Fertil Steril 2006;85(4):e7). This prompted us to examine the in situ stability of crosslinked HA materials to hyaluronidase lyase degradation. Variables such as ferric ionic crosslink density, HA concentration, gel geometry, and molecular weight (MW) of HA polymer were studied. Various formulations of the crosslinked "in house" [Isayeva et al., J Biomed Mater Res: Part B - Appl Biomater 2010, 95B (1):9-18] FeHA (0.5%, w/v; 30, 50, 90% crosslinked), the Intergel® FeHA (0.5%, w/v; 90%), and the non-crosslinked HA (0.05-0.5%, w/v) were degraded at a fixed activity of hyaluronidase lyase from Streptomyces hyalurolyticus (Hyase) at 37°C over time according to the method [Payan et al., J Chrom B: Biomed Sci Appl 1991;566(1):9-18]. Under our conditions, the data show that the crosslink density affects degradation the most, followed by HA concentration and then gel geometry. We found that MW has no effect. Our results are one possible explanation of the observations that the Intergel® FeHA APS (0.5%, w/v; 90%) material persisted an order of magnitude longer than expected [t1/2 = 500 hrs vs. t1/2 = 50 hrs (FDA; Johns et al., Fertil Steril 1997;68(1):37-42)]. These data also demonstrate the sensitivity of the in vitro hyaluronidase assay to predict the in situ stability of crosslinked HA medical products as previously reported [Sall et al., Polym Degrad Stabil 2007;92(5):915-919]. Copyright © 2013 Wiley Periodicals, Inc.

Proceedings of a Workshop on Cognitive Testing Methodology (11-12 June 1984)

DTIC Science & Technology

1986-01-01

Becker , and G.E. Handlemann. 1979. Hippocampus, space, and memory. Behav. Brain Sci. 2:313-365. Osbourne, D.P., E.R. Brown, and C.T. Randt. 1982...the B complex. J. Appl. Psychol. 30:359-379. Chernorutskii, M.V. 1943. Problem of alimentary dystrophy . Stud. Lenirg:ad Physicians 3:3-13. Cited in A

Local Atomic Structure of Ca-Mg-Zn Metallic Glasses (Postprint)

DTIC Science & Technology

2010-09-16

218 2010. 23 A. C. Hannon, Nucl. Instrum. Methods Phys. Res. A 551, 88 2005. 24 A. K. Soper private communication; GUDRUN software, http...analysis/xrd-data-analysis9203 html 26 A. C. Hannon, W. S. Howells, and A. K. Soper , Inst. Phys. Conf. Ser. 107, 193 1990. 27 D. A. Keen, J. Appl

Elementary Preservice Teachers' Science Vocabulary: Knowledge and Application

ERIC Educational Resources Information Center

Carrier, Sarah J.

2013-01-01

Science vocabulary knowledge plays a role in understanding science concepts, and science knowledge is measured in part by correct use of science vocabulary (Lee et al. in "J Res Sci Teach" 32(8):797-816, 1995). Elementary school students have growing vocabularies and many are learning English as a secondary language or depend on schools to learn…

Globalisation and Science Education: The Case of "Sustainability by the Bay"

ERIC Educational Resources Information Center

Carter, Lyn; Dediwalage, Ranjith

2010-01-01

It is impossible to consider contemporary science education in isolation from globalisation as the dominant logic, rethinking and reconfiguring social and cultural life in which it is located. Carter (J Res Sci Teach 42, 561-580, "2005") calls for a close reading of policy documents, curriculum projects, research studies and a range of other…

National Centers for Environmental Prediction

Science.gov Websites

references for past and current documentation: Sort A-Z | Sort by Year Alpert, J.C., S-Y Hong and Y-J Kim -Scale Environment, Part I. J. Atmos. Sci., 31, 674-704. Asselin, R., 1972: Frequency filter for time observations and model computations. J. Clim. and Appl. Meteo., 25, 214-226. Campana, K. A., Y-T Hou, K. E

Strained InGaAs/InAlAs Quantum Wells for Complementary III-V Transistors

DTIC Science & Technology

2014-01-01

GaAs substrates for low power and high frequency applications, J. Appl. Phys. 109 (2011) 033706. [28] A. Ali, H. Madan , A. Agrawal, I. Ramirez, R...Growth of InAsSb-channel high electron mobility transistor structures, J. Vac. Sci. Technol. B 23 (2005) 1441–1444. [30] A. Ali, H. Madan , M.J

Acyclic N-Halamine Polymeric Biocidal Films

DTIC Science & Technology

2010-07-01

surfaces were rechargeable upon chlorine loss. antimicrobial, bacteria, biocidal coatings, biofilms , N-halamine U U U UU 14 Joe Wander 850 283-6240...halamine, biofilms , antimicrobial. INTRODUCTION A variety of antimicrobial organic materials, including phosp ho- nium salts [1-4], quaternary ammonium...Cotton Cellulose , J. Appl. Polym. Sci., 81: 617-624. 21. Sun, Y. and Sun, G. (2002). Durable and Regenerable Antimicrobial Textile Materials Prepared

Acupuncture-Based Biophysical Frontiers of Complementary Medicine

DTIC Science & Technology

2001-10-28

cf. Fig. 1, an evolutionary older type of intercell communications , transporting ionic electrical signals between excitable cells, whose conductivity...traditional psychology: Biophysical bases of psychosomatic disorders and transpersonal stress reprogramming", in Basic and Clinical Aspects of the Theory...biophysical basis of transpersonal transcendental phenomena", Int. J. Appl. Sci. & Computat, vol. 7, pp. 174-187, 2000 [also presented at Int. Conf

Halogen content in Lesser Antilles arc volcanic rocks : exploring subduction recycling

NASA Astrophysics Data System (ADS)

Thierry, Pauline; Villemant, Benoit; Caron, Benoit

2016-04-01

Halogens (F, Cl, Br and I) are strongly reactive volatile elements which can be used as tracers of igneous processes, through mantle melting, magma differentiation and degassing or crustal material recycling into mantle at subduction zones. Cl, Br and I are higly incompatible during partial melting or fractional cristallization and strongly depleted in melts by H2O degassing, which means that no Cl-Br-I fractionation is expected through magmatic differenciation [current thesis]. Thus, Cl/Br/I ratios in lavas reflect the halogen content of their mantle sources. Whereas these ratios seemed quite constant (e.g. Cl/Br =300 as seawater), recent works suggest significant variations in arc volcanism [1,2]. In this work we provide high-precision halogen measurements in volcanic rocks from the recent activity of the Lesser Antilles arc (Montserrat, Martinique, Guadeloupe, Dominique). Halogen contents of powdered samples were determined through extraction in solution by pyrohydrolysis and analysed by Ion Chromatography for F and Cl and high performance ICP-MS (Agilent 8800 Tripe Quad) for Cl, Br and I [3,4]. We show that lavas - and mantle sources - display significant vraiations in Cl/Br/I ratios along the Lesser Antilles arc. These variations are compared with Pb, Nd and Sr isotopes and fluid-mobile elements (Ba, U, Sr, Pb etc.) compositions which vary along the arc from a nothern ordinary arc compositions to a southern 'crustal-like' composition [5,6]. These characteristics are attributed to subducted sediments recycling into the mantle wedge, whose contribution vary along the arc from north to south [7,8]. The proportion of added sediments is also related to the distance to the trench as sediment melting and slab dehydration may occur depending on the slab depth [9]. Further Cl-Br-I in situ measurements by LA-ICP-MS in Lesser Antilles arc lavas melt inclusions will be performed, in order to provide better constraints on the deep halogen recycling cycle from crust to mantle. 1. Villemant, B., Mouatt, J. & Michel, A., 2008. Earth Planet. Sci. Lett. 269(1), 212-229. 2. Kutterolf, S. et al., 2015. Earth Planet. Sci. Lett. 429, 234-246. 3. Michel, A. & Villemant, B., 2003. Geostand. Geoanalytical Res. 27(2), 163-171. 4. Balcone-Boissard, H., Michel, A. & Villemant, B., 2009. Geostand. Geoanalytical Res. 33(4), 477-485. 5. White, W. M. & Dupré, B., 1986. J. Geophys. Res. 91(B6), 5927. 6. Labanieh, S. et al., 2010. Earth Planet. Sci. Lett. 298(1-2), 35-46. 7. Turner, S. et al., 1996. Earth Planet. Sci. Lett. 142(1-2), 191-207. 8. Carpentier, M., Chauvel, C. & Mattielli, N., 2008. Earth Planet. Sci. Lett. 272(1-2), 199-211. 9. Labanieh, S. et al., 2012. J. Petrol. 53(12), 2441-2464.

The Quality of Pre-Service Science Teachers' Argumentation: Influence of Content Knowledge

ERIC Educational Resources Information Center

Cetin, Pinar Seda; Dogan, Nihal; Kutluca, Ali Yigit

2014-01-01

Research exploring the possible link between quality of argumentation and content knowledge is not straightforward. Some studies suggest a positive relationship (e.g. Dawson & Schibeci in "J Biol Educ" 38(1):7-12, 2003) while others do not (e.g. Zohar & Nemet in "J Res Sci Teach" 39:35-62, 2002). This study examined the…

Re-Thinking Science Capital: The Role of "Capital" and "Identity" in Mediating Students' Engagement with Mathematically Demanding Programmes at University

ERIC Educational Resources Information Center

Black, Laura; Hernandez-Martinez, Paul

2016-01-01

A wide body of literature has highlighted how high achievement in mathematics in secondary school does not necessarily motivate students to both choose and succeed on mathematically demanding programmes at post-compulsory level. The recent Enterprising Science project [Archer et al. (2015, "J. Res. Sci. Teach.," 52, 922-948)] and before…

Changes Observed in Views of Nature of Science during a Historically Based Unit

ERIC Educational Resources Information Center

Rudge, David Wÿss; Cassidy, David Paul; Fulford, Janice Marie; Howe, Eric Michael

2014-01-01

Numerous empirical studies have provided evidence of the effectiveness of an explicit and reflective approach to the learning of issues associated with the nature of science (NOS) (c.f. Abd-El-Khalick and Lederman in "J Res Sci Teach" 37(10):1057-1095, 2000). This essay reports the results of a mixed-methods association study involving…

Development of a Small Molecule P2X7R Antagonist as a Treatment for Acute SCI

DTIC Science & Technology

2012-10-01

neurons. Nat Neurosci 10:615–622. Nagele RG, D’Andrea MR, Lee H, Venkataraman V, Wang HY (2003) Astrocytes accumulate Ab 42 and give rise to astrocytic...amyloid plaques in Alzheimer disease brains. Brain Res 971:197–209. Nagele RG, Wegiel J, Venkataraman V, Imaki H, Wang KC (2004) Contribution of glial

Silica-Immobilized Enzyme Reactors (Postprint)

DTIC Science & Technology

2007-09-01

mode of action of drugs such as aspirin and ibuprofen .[61] Serotonin reuptake inhibitors and monoamine oxidase inhibitors can function as...immobilizing PGA onto chromatography supports and using the enantiomeric selectivity of the enzyme to resolve racemic mixtures.[100] Immobilization onto...column. J. Chroma- togr. B. Biomed. Sci. Appl. 2001, 753, 375–383. 37. Jadaud, P.; Wainer, I.W. The stereochemical resolution of the enantiomers of

Episodic tectonic plate reorganizations driven by mantle convection

NASA Astrophysics Data System (ADS)

King, Scott D.; Lowman, Julian P.; Gable, Carl W.

2002-10-01

Periods of relatively uniform plate motion were interrupted several times throughout the Cenozoic and Mesozoic by rapid plate reorganization events [R. Hey, Geol. Soc. Am. Bull. 88 (1977) 1404-1420; P.A. Rona, E.S. Richardson, Earth Planet. Sci. Lett. 40 (1978) 1-11; D.C. Engebretson, A. Cox, R.G. Gordon, Geol. Soc. Am. Spec. Pap. 206 (1985); R.G. Gordon, D.M. Jurdy, J. Geophys. Res. 91 (1986) 12389-12406; D.A. Clague, G.B. Dalrymple, US Geol. Surv. Prof. Pap. 1350 (1987) 5-54; J.M. Stock, P. Molnar, Nature 325 (1987) 495-499; C. Lithgow-Bertelloni, M.A. Richards, Geophys. Res. Lett. 22 (1995) 1317-1320; M.A. Richards, C. Lithgow-Bertelloni, Earth Planet. Sci. Lett. 137 (1996) 19-27; C. Lithgow-Bertelloni, M.A. Richards, Rev. Geophys. 36 (1998) 27-78]. It has been proposed that changes in plate boundary forces are responsible for these events [M.A. Richards, C. Lithgow-Bertelloni, Earth Planet. Sci. Lett. 137 (1996) 19-27; C. Lithgow-Bertelloni, M.A. Richards, Rev. Geophys. 36 (1998) 27-78]. We present an alternative hypothesis: convection-driven plate motions are intrinsically unstable due to a buoyant instability that develops as a result of the influence of plates on an internally heated mantle. This instability, which has not been described before, is responsible for episodic reorganizations of plate motion. Numerical mantle convection experiments demonstrate that high-Rayleigh number convection with internal heating and surface plates is sufficient to induce plate reorganization events, changes in plate boundary forces, or plate geometry, are not required.

Grain-Structure Development in Heavily Cold-Rolled Alpha-Titanium (Postprint)

DTIC Science & Technology

2014-04-01

H.P. Lee, C. Esling , H.J. Bunge, Textures Microstruct. 7 (1988) 317–337. [10] S. Nourbakhsh, T.D. O’Brien, Mater. Sci. Eng. 100 (1988) 109–114. [11...2010) 4536–4548. [20] Y. Zhong, F. Yin, K. Nagai, J. Mater. Res. 23 (2008) 2954–2966. [21] M.J. Philippe, M. Serghat, P. Van Houtte, C. Esling , Acta

The Effects of Letter Spacing and Coloured Overlays on Reading Speed and Accuracy in Adult Dyslexia

ERIC Educational Resources Information Center

Sjoblom, Amanda M.; Eaton, Elizabeth; Stagg, Steven D.

2016-01-01

Background: Zorzi et al. (2012, Proc. Natl. Acad. Sci. U.S.A., 109, 11455) found evidence that extra-large letter spacing aids children with dyslexia, but the evidence for the coloured overlays is contradictory (e.g., Henderson et al., 2013, "J. Res. Special Educ. Needs," 13, 57; Wilkins, 2002, "Ophthalmic Physiol. Opt.," 22,…

Toward Re-Thinking Science Education in Terms of Affective Practices: Reflections from the Field

ERIC Educational Resources Information Center

Kayumova, Shakhnoza; Tippins, Deborah

2016-01-01

Rational and operationalized views of science and what it means for teachers and students to know and enact legitimate science practices have dominated science education research for many decades (Fusco and Barton in "J Res Sci Teach" 38(3):337-354, 2001. doi: 10.1002/1098-2736(200103)38:3<337::AID-TEA1009>3.0.CO;2-0). Michalinos…

Sensitivity analysis for parametric generalized implicit quasi-variational-like inclusions involving P-[eta]-accretive mappings

NASA Astrophysics Data System (ADS)

Kazmi, K. R.; Khan, F. A.

2008-01-01

In this paper, using proximal-point mapping technique of P-[eta]-accretive mapping and the property of the fixed-point set of set-valued contractive mappings, we study the behavior and sensitivity analysis of the solution set of a parametric generalized implicit quasi-variational-like inclusion involving P-[eta]-accretive mapping in real uniformly smooth Banach space. Further, under suitable conditions, we discuss the Lipschitz continuity of the solution set with respect to the parameter. The technique and results presented in this paper can be viewed as extension of the techniques and corresponding results given in [R.P. Agarwal, Y.-J. Cho, N.-J. Huang, Sensitivity analysis for strongly nonlinear quasi-variational inclusions, Appl. MathE Lett. 13 (2002) 19-24; S. Dafermos, Sensitivity analysis in variational inequalities, Math. Oper. Res. 13 (1988) 421-434; X.-P. Ding, Sensitivity analysis for generalized nonlinear implicit quasi-variational inclusions, Appl. Math. Lett. 17 (2) (2004) 225-235; X.-P. Ding, Parametric completely generalized mixed implicit quasi-variational inclusions involving h-maximal monotone mappings, J. Comput. Appl. Math. 182 (2) (2005) 252-269; X.-P. Ding, C.L. Luo, On parametric generalized quasi-variational inequalities, J. Optim. Theory Appl. 100 (1999) 195-205; Z. Liu, L. Debnath, S.M. Kang, J.S. Ume, Sensitivity analysis for parametric completely generalized nonlinear implicit quasi-variational inclusions, J. Math. Anal. Appl. 277 (1) (2003) 142-154; R.N. Mukherjee, H.L. Verma, Sensitivity analysis of generalized variational inequalities, J. Math. Anal. Appl. 167 (1992) 299-304; M.A. Noor, Sensitivity analysis framework for general quasi-variational inclusions, Comput. Math. Appl. 44 (2002) 1175-1181; M.A. Noor, Sensitivity analysis for quasivariational inclusions, J. Math. Anal. Appl. 236 (1999) 290-299; J.Y. Park, J.U. Jeong, Parametric generalized mixed variational inequalities, Appl. Math. Lett. 17 (2004) 43-48].

Recent Naval Postgraduate School Publications.

DTIC Science & Technology

1985-09-30

of the performance of a new storm tracking methodology Prepared for Naval Environmental Prediction Res. Facility Monterey, Calif., Naval Postgraduate...Aerospace Sci. Mtg., Jr’., 1983. Sarpkaya, T; Storm , M A ydrodynamic forces from combined wave and current flow on smooth and rough circular cylinders...Houston, Tx., May, 1982. IN Proc 1982 Offshore Technol. Conf., vol. 1, p.731-736, (1982). Sarpkaya, T; Storm , M A ydrodynamic forces from combined wave

Effects of Chronic Alcohol Exposure on Kainate Receptor-Mediated Neurotransmission in the Hippocampus

DTIC Science & Technology

2004-09-01

hippocampus and hypothalamus. J Neurosci Res 63:200-208. Thorpe GH et al. (1989) Chemiluminescent enzyme immunoassay of alpha - fetoprotein based on an...cells. Proc Natl Acad Sci USA 83:6213-6215. Montpied Pet al. (1991) Prolonged ethanol inhalation decreases gamma-aminobutyric acidA receptor alpha ...potentials mediated via alpha -bungarotoxin-sensitive nico- tinic acetylcholine receptors in rat hippocampal interneurons. J Neurosci 18:8228- 8235

Impact Experiments into Borosilicate Glass at Three Scale Sizes

DTIC Science & Technology

2009-11-01

DEDF and soda - lime glass during rod impact. Shock Compression in Condensed Matter–2005 (Furnish MD, Elert M, Russell TP, and White CT, Eds.) AIP Conf...in a float soda - lime silicate glass . Int. J. Appl. Glass Sci., to be submitted (2009). 18. Chocron S, Dannemann KA, Nicholls AE, and Anderson CE Jr...UNCLASSIFIED UNCLASSIFIED Impact Experiments into Borosilicate Glass at Three Scale Sizes Charles E. Anderson, Jr. Carl E. Weiss Sidney Chocron

Instrumentation for Spectroscopy of Impact Initiation of Reactive Materials

DTIC Science & Technology

2015-04-14

combustion of aluminum and nanocomposite thermite powders , Combust. Sci. and Tech. 179, 457-476 (2007). 8. M. Schoenitz, S. Umbrajkar, and E. L. Dreizin...L. Dreizin, Nanocomposite thermite powders prepared by cryomilling, Journal of Alloys and Compounds 488, 386-391 (2009). 10. J. A. Puszynski...reaction in a flake nickel + spherical aluminum powder mixture, J. Appl. Phys. 100, 113521 (2006). 13. A. S. Shteinberg, Y. C. Lin, S. F. Son, and A

Room temperature deposition of gold onto the diffuse and sharp diffraction spot Si(111)-( 3 × 3) R30° Au surfaces

NASA Astrophysics Data System (ADS)

Plass, Richard; Marks, Laurence D.

1996-06-01

Room temperature gold depositions onto Si(111)-( 3 × 3) R30° Au surfaces with diffuse and sharp diffraction spots [Surf. Sci. 242 (1991) 73] (diffuse and sharp 3 × 3 Au hereafter) under UHV conditions has been monitored using transmission electron diffraction (TED). Both systems display an increase in surface structure diffraction spot intensities up to the completion of 1.0 monolayer (ML) after which the surface beams display an exponential decrease in intensity with coverage. The exponential decay rate decreases after roughly 1.33 ML. These results can be attributed to gold initially diffusing to and filling 3 × 3 Au gold trimer sites in vacancy type surface domain walls [Surf. Sci. 342 (1995) 233], then filling one of three possible sites on the 3 × 3 Au structure with essentially no surface diffusion, disrupting nearby gold trimers. Gold deposition onto the diffuse type structure caused the formation and expansion of satellite arcs around the strongest 3 × 3 beams similar to those seen by others [Surf. Sci. 242 (1991) 73; Jpn. J. Appl. Phys. 16 (1977) 891; J. Vac. Sci. Technol. A 10 (1992) 3486] at elevated temperatures while the sharp structure displayed only a modest shoulder formation near the strongest 3 × 3 beams.

Micromolded PDMS planar electrode allows patch clamp electrical recordings from cells.

PubMed

Klemic, Kathryn G; Klemic, James F; Reed, Mark A; Sigworth, Fred J

2002-06-01

The patch clamp method measures membrane currents at very high resolution when a high-resistance 'gigaseal' is established between the glass microelectrode and the cell membrane (Pflugers Arch. 391 (1981) 85; Neuron 8 (1992) 605). Here we describe the first use of the silicone elastomer, poly(dimethylsiloxane) (PDMS), for patch clamp electrodes. PDMS is an attractive material for patch clamp recordings. It has low dielectric loss and can be micromolded (Annu. Rev. Mat. Sci. 28 (1998) 153) into a shape that mimics the tip of the glass micropipette. Also, the surface chemistry of PDMS may be altered to mimic the hydrophilic nature of glass (J. Appl. Polym. Sci. 14 (1970) 2499; Annu. Rev. Mat. Sci. 28 (1998) 153), thereby allowing a high-resistance seal to a cell membrane. We present a planar electrode geometry consisting of a PDMS partition with a small aperture sealed between electrode and bath chambers. We demonstrate that a planar PDMS patch electrode, after oxidation of the elastomeric surface, permits patch clamp recording on Xenopus oocytes. Our results indicate the potential for high-throughput patch clamp recording with a planar array of PDMS electrodes.

Joint Services Electronics Program.

DTIC Science & Technology

1986-09-30

IEEE Computer Society Conference on Trends and Aplications , Gaithersburg, MD, 57-62, May 1983. R.W. Miksad, D.W. Choi and E.J. Powers, "Application of...Estimators for Weakl Nonlinear Esti’mation Problems, M.S. Thesis , Dept. of Electrica Engineering, University of Texas at Austin, May 1982. 7 %- (Page...Chen, J. Vac. Sci. Technol. 17,911 (1980). 6. N.I. Cho, Masters Thesis , unpublished. 7. EI-Saied M. Aly and J.P. Stark, J. Appl. Phys. 53(4), 3063

Photodegradation of Polyimides 2. Thermal Property Changes of Polyimides Based on a Perfluorinated Dianhydride

DTIC Science & Technology

1989-05-31

BASED Ck ON A PERFLUORINATED DIANHYDRIDE a (𔃾 by i C. E. Hoyle and E. T. Anzures Prepared for Publicatlon in J. Appl. olym. Sci. SDTIC ELECTE...34Photodegradation of Polyimides 2. Thermal Property Changes of Polyimides Based on a Perfluorinated Dianhydride" 12. PERSONAL AUTHOR(S) C. E. Hoyle and E...Additionally, the glass transition of photolyzed of polyimides containing the perfluorinated moiety is lowered with increasing photolysis time. By

Marine Geophysics: a Navy Symposium

DTIC Science & Technology

1987-09-01

possible to have an active and productive research career into one’s sixties — especially if one remains an active sea-going oceanographer. 14...1962. Topography and structure of the Peru -Chile Trench. Deep-Sea Res. 9:423-443. Raitt, R. W., G. G. Shor, Jr., T. J. G. Francis, and G. B...Terrestrial heat flow measurements on Lake Titicaca, Peru . Earth Planet. Sci. Letts. 8:45-54. Shor, G. G., Jr. 1963. Refraction and reflection techniques

Eulerian Dynamics with a Commutator Forcing

DTIC Science & Technology

2017-01-09

SIAM Review 56(4) (2014) 577–621. [Pes2015] J. Peszek. Discrete Cucker-Smale flocking model with a weakly singular weight. SIAM J. Math . Anal., to...viscosities in bounded domains. J. Math . Pures Appl. (9), 87(2):227– 235, 2007. [CV2010] L. Caffarelli, A. Vasseur, Drift diffusion equations with...Further time regularity for fully non-linear parabolic equations. Math . Res. Lett., 22(6):1749–1766, 2015. [CCTT2016] José A. Carrillo, Young-Pil

The Shock and Vibration Digest. Volume 14, Number 1, January 1982

DTIC Science & Technology

1982-01-01

vibration, ity of the examples in those days. Morris and Head non4inear vibration, acoustics , and modeling and [45] discusses the ’escalator’ method which...with modeling and acoustic emission view on the testing techniques, philosophies, and monitoring. This session also contained several relationship of... Modelling R.K. Jeyapalan and NA. Halliwell Inst. Sound Vib. Res., Univ. of Southampton, South- ampton, UK, Appl. Acoust .. 1A (5), pp 361-376 (Sept

Exploring a Model of Situated Professional Development: Impact on Classroom Practice

NASA Astrophysics Data System (ADS)

Singer, Jonathan; Lotter, Christine; Feller, Robert; Gates, Harry

2011-04-01

A hallmark of current science education reform involves teaching through inquiry. However, the widespread use of inquiry-based instruction in many classrooms has not occurred (Roehrig and Luft in Int J Sci Educ 26:3-24, 2004; Schneider et al. in J Res Sci Teach 42:283-312, 2005). The purpose of this study was to investigate the impact of a professional development program on middle school science teachers' ability to enact inquiry-based pedagogical practices. Data were generated through evaluation of teacher practice using the Reformed Teaching Observation Protocol (RTOP) (Sawada et al. in School Sci Math 102:245-253, 2002) at three distinct junctures, before, during, and after the professional development treatment. Analysis of teacher-participant post-institute reflections was then utilized to determine the perceived role of the various institute components. Statistical significant changes in RTOP scores indicated that the teachers were able to successfully transfer the enactment of the inquiry-based practices into their classrooms. The subsequent discussion provides connection between these pedagogical changes with use of professional development strategies that provide a situated learning environment.

Corrigendum to "Synthesis of hydroxyapatite/multi-walled carbon nanotubes for the removal of fluoride ions from solution" [Appl. Surf. Sci. 412 (2017) 578-590

NASA Astrophysics Data System (ADS)

Ruan, Zhongyuan; Tian, Yaxi; Ruan, Jifu; Cui, Guijia; Iqbal, Kanwal; Iqbal, Anam; Ye, Herui; Yang, Zhangzhong; Yan, Shiqiang

2018-04-01

In our recent paper [1], we reported the synthesis of hydroxyapatite/multi-walled carbon nanotubes (HA-MWCNTs) and studied their performance for the removal of fluoride ions from solution. However, we have made some writing mistakes, especially in the section on adsorption kinetics analysis. Our mistakes were spotted by Prof. Yuandong Huang, who graciously noticed these errors. We are grateful to him, and have decided to write a "Corrigendum".

Transport and Reactivity of Decontaminants to Provide Hazard Mitigation of Chemical Warfare Agents from Materials

DTIC Science & Technology

2016-06-01

Membranes .2. Neoprene, SBR, EPDM , NBR, and Natural- Rubber Versus Normal-Alkanes. J. Appl. Polym. Sci. 1991, 42 (8), 2329–2336. 24. Harogoppad, S.B...highly absorptive (e.g., tire rubber ). Absorptive materials are often more challenging to decontaminate because of the reduced accessibility of the...then aged for 60 min. During the aging period, agent mass was absorbed by a flux-based process.7 The agent-contaminated area of the panel may affect

Lactate Accumulation in Muscle and Blood during Submaximal Exercise

DTIC Science & Technology

1981-09-21

exercise, fast and slow twitch fibers Short title: Lactate in muscle and blood P.A. Tesch, W.L. Daniels and D.S. Sharp Exercise Physiology Division, U.S...KIRBY, R.L. & BELCASTRO, A.N. 1978. Relationship between slow - twitch muscle fibres and lactic acid removal. Can J Appl Sports Sci 3:160-162. BRODAL, P...oxygen uptake (Karlsson 1971, Knuttgen & Saltin 1972). It is generally agreed that the main muscle fiber type to be recruited below this level is the slow

Fiber-Level Modeling of Dynamic Strength of Kevlar (registered trademark) KM2 Ballistic Fabric

DTIC Science & Technology

2012-07-01

Ballistic-Performance Optimization of a Hybrid Carbon - Nanotube /E-glass Reinforced Poly-Vinyl-Ester-Epoxy-Matrix Com- posite Armor, J. Mater. Sci...2007, 42, p 5347–5359 4. M. Grujicic, W.C. Bell, L.L. Thompson, K.L. Koudela, and B.A. Cheeseman, Ballistic-Protection Performance of Carbon - Nanotube ...Armor via the Use of a Carbon - Nanotube Forest-Mat Strike Face, Mater. Des. Appl., 2008, 222, p 15–28 6. Y. Wang and X. Sun, Determining the Geometry

Metabolism, Mass Spectral Analysis and Mode of Action of Trichothecene Mycotoxins

DTIC Science & Technology

1988-10-12

tissue, as well as depletion and mild necrosis of thymic lymphoid tissue. Two rats showed mild, acute necrosis of proximal renal tubular epithelium...toxicity in pigs. Res. in Vet. Sci. 31:131. Weaver GA, Hurt.z HJ, Mirocha CU, Bates FY, Behrens JC, Robison TS, and Swanson SP (1980) The failure of purified...by Professor Abraham Joffe. The problem was called alimentary toxic aleukia which affected (according to the chronicles ) thousands of people eating

Physical, Nutrient, and Biological Measurements of Coastal Waters off Central California in March 2012

DTIC Science & Technology

2012-10-01

Salinity Scale, 1978 ( UNESCO , 1981). Dissolved oxygen (Winkler) samples were collected at CTD stations 2, 6, 10, 16, 17, and 19. These were...the Farallones. Deep-Sea Res. II 47: 907- 946. UNESCO . Background papers and supporting data on the Practical Salinity Scale, 1978. 1981... UNESCO Tech. Pap. In: Mar. Sci. 37. Venrick, E. L., and T. L. Hayward. 1984. Determining chlorophyll on the 1984 CalCOFI surveys. CalCOFI Rep

Low-shear modeled microgravity: a global environmental regulatory signal affecting bacterial gene expression, physiology, and pathogenesis

NASA Technical Reports Server (NTRS)

Nickerson, Cheryl A.; Ott, C. Mark; Wilson, James W.; Ramamurthy, Rajee; LeBlanc, Carly L.; Honer zu Bentrup, Kerstin; Hammond, Timothy; Pierson, Duane L.

2003-01-01

Bacteria inhabit an impressive variety of ecological niches and must adapt constantly to changing environmental conditions. While numerous environmental signals have been examined for their effect on bacteria, the effects of mechanical forces such as shear stress and gravity have only been investigated to a limited extent. However, several important studies have demonstrated a key role for the environmental signals of low shear and/or microgravity in the regulation of bacterial gene expression, physiology, and pathogenesis [Chem. Rec. 1 (2001) 333; Appl. Microbiol. Biotechnol. 54 (2000) 33; Appl. Environ. Microbiol. 63 (1997) 4090; J. Ind. Microbiol. 18 (1997) 22; Curr. Microbiol. 34(4) (1997) 199; Appl. Microbiol. Biotechnol. 56(3-4) (2001) 384; Infect Immun. 68(6) (2000) 3147; Cell 109(7) (2002) 913; Appl. Environ. Microbiol. 68(11) (2002) 5408; Proc. Natl. Acad. Sci. U. S. A. 99(21) (2002) 13807]. The response of bacteria to these environmental signals, which are similar to those encountered during prokaryotic life cycles, may provide insight into bacterial adaptations to physiologically relevant conditions. This review focuses on the current and potential future research trends aimed at understanding the effect of the mechanical forces of low shear and microgravity analogues on different bacterial parameters. In addition, this review also discusses the use of microgravity technology to generate physiologically relevant human tissue models for research in bacterial pathogenesis.

Modulating Wnt Signaling Pathway to Enhance Allograft Integration in Orthopedic Trauma Treatment

DTIC Science & Technology

2014-04-01

Quantitative output provides an extensive set of data but we have chosen to present the most relevant parameters that are reflected in the following...have been harvested.  All harvested samples have been scanned by µCT and evaluated for multiple parameters .  All samples have been mechanically... Hydroxyapatite /Tricalcium Phosphate-Coated Implants in a Rat Model. J.Biomed.Mater.Res.B Appl.Biomater. 2005;74(2):712-7. 4. De Ranieri, A., Virdi, A. S

CG-MS/MS Analyses of Biological Samples in Support of Developmental Toxic Effects on Whole-Body Exposure of Rats to GB

DTIC Science & Technology

2015-03-01

Sensitivity to Organophosphorous Anticholinesterase Compounds. Prog. Neurobiol. 1987, 28, 97–129. Shih, T-M.; Penetar, D.M.; McDonough, J.H. Jr.; Romano...J.A.; King, J.M. Age- related Differences in Soman Toxicity and in Blood and Brain Regional Cholinesterase Activity . Brain Res. Bull. 1990, 24...Organophosphates. Toxicol. Appl. Pharmacol. 2004, 198, 132–151. Sterri, S.H.; Berge, G.; Fonnum, F. Esterase Activities and Soman Toxicity in

Limitations of Salivary Osmolality as a Marker of Hydration Status

DTIC Science & Technology

2011-01-01

volunteers were provided with a small, standardized meal (450 kcal; 57% CHO, 30% fat, 13% protein, 450 mg of Na+) and 200 mL of water or apple juice . No...TBW was calculated by dividing TBW by BM loss, with the assumption that corrected BM lost through sweating was entirely water. Body composition was... composition and cortisol in serum and saliva in man. J Dent Res. 1989;68(11):1495–7. 3. Cheuvront SN, Carter R III, Montain SJ, Sawka MN. Daily body mass

Increased delivery of condensation nuclei during the Late Heavy Bombardment to the terrestrial and martian atmospheres

NASA Astrophysics Data System (ADS)

Losiak, Anna

2014-05-01

During the period of the Late Heavy Bombardment (LHB), between 4.1 and 3.8 Ga, the impact rate within the entire Solar System was up to a few thousand times higher than the current value (Ryder 2002, Bottke et al. 2012, Fassett and Minton 2013). Multiple basin-forming events on inner planets that occurred during this time had a strong but short-lasting (up to few thousands of years) effect on atmospheres of Earth and Mars (Sleep et al. 1989, Segura et al. 2002, 2012). However, the role of the continuous flux of smaller impactors has not been assessed so far. We calculated the amount of meteoric material in the 10^-3 kg to 106 kg size range delivered to Earth and Mars during the LHB based on the impact flux at the top of the Earth's atmosphere based on results from Bland and Artemieva (2006). Those values were recalculated for Mars based on Ivanov and Hartmann (2009) and then recalculated to the LHB peak based on estimates from Ryder (2002), Bottke et al. (2012), Fassett and Minton (2013). During the LHB, the amount of meteoritic material within this size range delivered to Earth was up to ~1.7*10^10 kg/year and 1.4*10^10 kg/year for Mars. The impactors that ablate and are disrupted during atmospheric entry can serve as cloud condensation nuclei (Rosen 1968, Hunten et al. 1980, Ogurtsov and Raspopov 2011). The amount of material delivered during LHB to the upper stratosphere and lower mezosphere (Hunten et al. 1980, Bland and Artemieva 2006) is comparable to the current terrestrial annual emission of mineral cloud condensation nuclei of 0.5-8*10^12 kg/year (Tegen 2003). On Mars, the availability of condensation nuclei is one of the main factors guiding water-ice cloud formation (Montmessin et al. 2004), which is in turn one of the main climatic factors influencing the hydrological cycle (Michaels et al. 2006) and radiative balance of the planet (Haberle et al. 1999, Wordsworth et al. 2013, Urata and Toon 2013). Increased delivery of condensation nuclei during the LHB should be taken into account when constructing models of terrestrial and Martian climates around 4 Ga. Bland P.A., Artemieva N.A. (2006) Meteorit.Planet.Sci. 41:607-631. Bottke W.F. et al. (2012) Nature 485: 78-81. Fassett C.I., Minton D.A. (2013) Nat.Geosci. 6:520-524 (2013). Hunten D.M. et al. (1980) J.Atmos.Sci. 37:1342-1357. Haberle R.M. et al. (1999) J.Geophys.Res. 104:8957-8974. Ivanov B.A., Hartmann W.K. (2009) Planets and Moons: Treatise on Geophysics (eds. Spohn T.): 207-243. Michaels T.I. et al. (2006) Geophys.Res.Lett. 33:L16201. Montmessin F. et al. (2004) J.Geophys.Res. 109:E10004. Ogurtsov M.G., Raspopov O.M. (2011) Geomagnetism&Aeronomy 51:275-283. Rosen J.M. (1968) Space Sci.Rev. 9:58-89. Ryder G. (2002) J.Geophys.Res. 107: doi:10.1029/2001JE001583. Segura T.L. et al. (2002) Science 298:1977-1980. Segura T.L. et al. (2012) Icarus 220:144-148. Sleep N.S. et al. (1989) Nature 342:139-142. Tegen I. (2003) Quat.Sci.Rev. 22:1821-1834. Urata R.A., Toon O.B. (2013) Icarus 226:229-250. Wordsworth R. et al. (2012) Icarus 222:1-19.

Nanobridge SQUIDs as calorimetric inductive particle detectors

NASA Astrophysics Data System (ADS)

Gallop, John; Cox, David; Hao, Ling

2015-08-01

Superconducting transition edge sensors (TESs) have made dramatic progress since their invention some 65 years ago (Andrews et al 1949 Phys. Rev. 76 154-155 Irwin and Hilton 2005 Topics Appl. Phys. 99 63-149) until now there are major imaging arrays of TESs with as many as 7588 separate sensors. These are extensively used by astronomers for some ground-breaking observations (Hattori et al 2013 Nucl. Instrum. Methods Phys. Res. A 732 299-302). The great success of TES systems has tended to overshadow other superconducting sensor developments. However there are other types (Sobolewski et al 2003 IEEE Trans. Appl. Supercond. 13 1151-7 Hadfield 2009 Nat. Photonics 3 696-705) which are discussed in papers within this special edition of the journal. Here we describe a quite different type of detector, also applicable to single photon detection but possessing possible advantages (higher sensitivity, higher operating temperature) over the conventional TES, at least for single detectors.

Metabolite Differentiation and Discovery Lab (MeDDL): A New Tool for Biomarker Discovery and Mass Spectral Visualization

DTIC Science & Technology

2010-06-01

Jeremy Nicholson, Elaine Holmes , and John Lindon at the Imperial College in London1 utilizing nuclear magnetic resonance (NMR) based analysis, has...Lindon, J. C.; Holmes , E. Xenobiotica 1999, 29, 1181– 1189. (2) Pham-Tuan, H.; Kaskavelis, L.; Daykin, C.; Janssen, H. J. Chromatogr. B 2003, 789, 283...301. (3) Lindon, J.; Holmes , E.; Nicholson, J. Pharm. Res. 2006, 23, 1075–1088. (4) Robertson, D. Toxicol. Sci. 2005, 85, 809–822. (5) Nicholson, J

Genome-Wide Nucleic Acid/Protein Interaction in Breast Cancer

DTIC Science & Technology

2005-04-01

Chen W, Zhang J et al: Large-scale genotyping of complex DNA. Nat Biotechnol 2003, 21(10):1233-1237. 25. Bolstad BM, Irizarry RA, Astrand M, Speed TP...2124836802660188/sup8.xls 235 Analysis of RNA-protein interactions by flow cytometry Alexander S Brodsky’*, Angus PR Johnston 2, Matt Trau 2 & Pamela A Silver1...Natl Acad Sci USA (2001) 98(23):12954-12959. genotyping using the Qbead system: A quantum dot-encoded microsphere-based assay. Nucleic Acids Res (2003

Spontaneous Transitional Cell Carcinoma in the Urinary Bladder of a Strain 13 Guinea Pig.

DTIC Science & Technology

1985-05-01

less than I of all canine neoplasms. In the feline , the extremely low incidence of bladder tumors observed may well be due to a difference in...factor of age. Prog Exp Tumor Res 1967;9:261-85. ..................... , 12. Ediger R D, Rabstein M M. Spontaneous leukemia in a Hartley strain guinea pig...Intracisternal virus -like particles in two guinea pig mammary adenocarcinomas. Lab Anim Sci 1976;26:607-9. 17.. Yoshida A, Iqbal Z M, Epstein. S S

Movements and Habitat Use of Satellite-Tagged False Killer Whales Around the Main Hawaiian Islands

DTIC Science & Technology

2010-01-01

southern Ross Sea, Antarctica. Polar Biol 31:1461–1468 Baird RW, Gorgone AM (2005) False killer whale dorsal fin disfigurements as a possible indicator of...assessment of critical habitats of resident killer whales in waters off the Pacific coast of Canada. Can Sci Advis Secretariat Res Doc 2006/072...the high trophic level of false killer whales (Baird et al. 2008a), it is not surprising that the population size of false killer whales in Hawai‘i is

Learning Complex Cell Invariance from Natural Videos: A Plausibility Proof

DTIC Science & Technology

2007-12-26

is in the McGovern Institute for Brain Research at MIT, as well as in the Dept. of Brain & Cognitive Sciences, and which is affiliated with the...stimulation induce plasticity? Proc. Nat. Acad. Sci. USA, 92:9682–9686. Deco, G. and Rolls, E. T. (2004). A neurodynamical cor- tical model of visual attention...and invariant object recognition. Vision Res, 44(6):621–42. Deco, G. and Rolls, E. T. (2005). Neurodynamics of biased competition and cooperation for

The Isolation and Characterization of Human Prostate Cancer Stem Cells

DTIC Science & Technology

2015-05-01

GATGGAGTTGAAGGTAGTTTC GTG -30. Real time PCR was performed with iQ SYBR Green Supermix in an iCycler iQ System (Bio-Rad) using the SYBR Green Detection...initiate prostate tumorigenesis. Proc Natl Acad Sci USA 2005; 102(19):6942–6947. 16. Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer...receptor protein. Cancer Res. 1995; 55:3068–3072. [PubMed: 7541709] Huss WJ, Gray DR, Greenberg NM, Mohler JL, Smith GJ. Breast cancer resistance

Rapamycin suppresses microglial activation and reduces the development of neuropathic pain after spinal cord injury.

PubMed

Tateda, Satoshi; Kanno, Haruo; Ozawa, Hiroshi; Sekiguchi, Akira; Yahata, Kenichiro; Yamaya, Seiji; Itoi, Eiji

2017-01-01

Rapamycin is an inhibitor of the mammalian target of rapamycin (mTOR) signaling pathway, plays an important role in multiple cellular functions. Our previous study showed rapamycin treatment in acute phase reduced the neural tissue damage and locomotor impairment after spinal cord injury (SCI). However, there has been no study to investigate the therapeutic effect of rapamycin on neuropathic pain after SCI. In this study, we examined whether rapamycin reduces neuropathic pain following SCI in mice. We used a mouse model of thoracic spinal cord contusion injury, and divided the mice into the rapamycin-treated and the vehicle-treated groups. The rapamycin-treated mice were intraperitoneally injected with rapamycin (1 mg/kg) 4 h after SCI. The rapamycin treatment suppressed phosphorylated-p70S6K in the injured spinal cord that indicated inhibition of mTOR. The rapamycin treatment significantly improved not only locomotor function, but also mechanical and thermal hypersensitivity in the hindpaws after SCI. In an immunohistochemical analysis, Iba-1-stained microglia in the lumbar spinal cord was significantly decreased in the rapamycin-treated mice. In addition, the activity of p38 MAPK in the lumbar spinal cord was significantly attenuated by rapamycin treatment. Furthermore, phosphorylated-p38 MAPK-positive microglia was relatively decreased in the rapamycin-treated mice. These results indicated rapamycin administration in acute phase to reduce secondary neural tissue damage can contribute to the suppression of the microglial activation in the lumbar spinal cord and attenuate the development of neuropathic pain after SCI. The present study first demonstrated that rapamycin has significant therapeutic potential to reduce the development of neuropathic pain following SCI. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 35:93-103, 2017. © 2016 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.

Detailed spectroscopic analysis of chloride salt deposits in Terra Sirenum, Mars

NASA Astrophysics Data System (ADS)

Osterloo, M. M.; Glotch, T. D.; Bandfield, J. L.

2015-12-01

Chloride salt-bearing deposits have been identified throughout the southern highlands of Mars [1] based on the lack of diagnostic spectral features of anhydrous chlorides in both the visible near infrared (VNIR) and middle infrared (MIR) wavelength ranges [1,2]. A puzzling aspect of martian chloride deposits is the apparent lack of other weathering or evaporite phases associated with most of the deposits. A global analysis over the chloride salt sites conducted by [3] found that only ~9% of the deposits they analyzed were associated with minerals such as phyllosilicates. Most of these occurrences are in Terra Sirenum where [4] noted that salt-bearing deposits lie stratigraphically above Noachian phyllosilicates. Although a variety of formation mechanisms have been proposed for these intriguing deposits, detailed geologic mapping by [5] suggests that surface water and evaporation played a dominant role. On Earth, evaporative settings are often characterized by a multitude of evaporite and phyllosilicate phases including carbonates, sulfates, and nitrates. [6] evaluated chemical divides and brine evolution for martian systems and their results indicate three pathways wherein late-stage brines favor chloride precipitation. In each case the pathway to chloride formation includes precipitation of carbonates (calcite, siderite, and/or magnesite) and sulfates (gypsum, melanterite, and/or epsomite). Here, we present the results of our detailed and systematic spectroscopic study to identify additional evaporite phases associated with salt/silicate mixtures in Terra Sirenum. [1] Osterloo et al. (2008) Science, 319, [2] Glotch, T. D. et al. (2013) Lunar and Planet. Sci. XLIV, abstract #1549 [3] Ruesch, O. et al. (2012), J. Geophys. Res., 117, E00J13 [4] Glotch, T. D. et al. (2010) Geophys. Res. Lett. 37, L16202, [5] Osterloo, M. M. and B. M Hynek (2015) Lunar and Planet. Sci XLVI. Abstract #1054 [6] Tosca, N. J. and S. M. McLennan (2006), Earth and Planet. Sci. Lett., 241.

Pressure Effect on Hydrogen Tunneling and Vibrational Spectrum in α-Mn

NASA Astrophysics Data System (ADS)

Kolesnikov, Alexander; Podlesnyak, Andrey; Sadykov, Ravil; Antonov, Vladimir; Kuzovnikov, Michail; Ehlers, Georg; Granroth, Garrett

The pressure effect on the tunneling mode and vibrational spectra of hydrogen in α-MnH0.07 has been studied by inelastic neutron scattering. Applying hydrostatic pressure of up to 30 kbar is shown to shift both the hydrogen optical modes and the tunneling peak to higher energies. First-principles calculations show that the potential for hydrogen in α-Mn becomes overall steeper with increasing pressure. At the same time, the barrier height and its extent in the direction of tunneling decrease and the calculations predict significant changes of the dynamics of hydrogen in α-Mn at 100 kbar, when the estimated tunneling splitting of the hydrogen ground state exceeds the barrier height. Acknowledgments: Research at ORNL SNS was supported by the Sci. User Facilities Division, Office BES, US DOE, and was sponsored by the LDRD Program of ORNL, managed by UT-Battelle, LLC, for the US DOE. It used resources of the Nat. Energy Res. Sci. Comp. Center, which is supported by the Office of Sci. US DOE under Contract No. DE-AC02-05CH11231. A support by a Grant of the Program on Elementary Particle Physics, Fundamental Nuclear Physics and Nuclear Techn. RAS is also acknowledged.

Characterization of Ignition and Combustion Properties of Nanowire-based Energetics

DTIC Science & Technology

2013-07-23

Sannia, A. Cincotti, G. Cao, Chem. Eng. Sci. 54 (15–16) (1999) 3053–3061. [4] C. Rossi, K. Zhang, D. Esteve, P. Alphonse , P. Tailhades, C. Vahlas, J...94 (5) (2003) 2923–2929. [30] K. Zhang, C. Rossi, G.A.A. Rodriguez, C. Tenail- leau, P. Alphonse , Appl. Phys. Lett. 91 (11) (2007) 113117/1–113117/3...Pister, Smart Mater. Struct. 10(6), 1145 (2001). 8C. Rossi, K. Zhang, D. Esteve, P. Alphonse , P. Tailhades, and C. Vahlas, J. Microelectromech. Syst. 16

Interface Properties of Wide Bandgap Semiconductor Structures

DTIC Science & Technology

1994-06-01

resistive than silicides and their chemistry with 126I I Si-based materials more complex. However, in a series of studies, M. 0. Aboelfotoh et al. have...clarification of these issues. CuGe contacts on Ge:GaN and Mg:GaN. To date, the properties of Cu3Ge films have been documented by Aboelfotoh et al., but the...Martin, V. Malhotra, and J. E. Mahan, J. Vac. Sci. Technol. B 3, 836 (1985). 25. L. Krusin-Elbaum and M. 0. Aboelfotoh , Appl. Phys. Lett. 58(12), 1341

The Application of Advanced Diagnostics to the Study of Non-Equilibrium Air Plasmas

DTIC Science & Technology

2002-09-01

26. The 10-, 100-, and 1000-µs pulses monotonically increase with N2 dilution, and the shapes agree with the calculation of Garscadden and Nagpal ...efficiency of H2 in a steady-state H2–N2 gas-mixture discharge has been measured by Nagpal et al.,24 and their analysis of the energy balance showed that...Bletzinger, J. Appl. Phys. 82, 4772 (1997). 49 23. A. Garscadden and R. Nagpal , Plasma Sources Sci. Technol. 4, 268 (1995). 24. R. Nagpal , B. N

Chemical Bonding, Interdiffusion and Electronic Structure at InP, GaAs, and Si-Metal Interfaces.

DTIC Science & Technology

1984-01-15

1980) 420. 37. A. Hiraki , K. Shuts. F. Kim. W. Kammura. and W. Iwami, A\\ppl. Phys. Len. 31 (1977) 611, and references therein. 38. L.J. Brilison, C.F...and references therein. 5. A. Hiraki , M.A. Nicolet, and J.W. Mayer, Appi. Phys. Lett. !a, 178 (1971); A. Hiraki , K. Shuto, F. Kim, W. Kammura, and W...IZ, 1005 (1980) and references therein. 7. T. Narusawa, K. Kinoshita, W.M. Gibson, and A. Hiraki , J. Vac. Sci. Technol.. Ia. 872 (1981). 8. J

Responding to Students' Learning Preferences in Chemistry

NASA Astrophysics Data System (ADS)

Lewthwaite, Brian; Wiebe, Rick

2014-04-01

This paper reports on a teacher's and his students' responsiveness to a new tetrahedral-oriented (Mahaffy in J Chem Educ 83(1):49-55, 2006) curriculum requiring more discursive classroom practices in the teaching of chemistry. In this instrumental case study, we identify the intentions of this learner-centered curriculum and a teacher's development in response to this curriculum. We also explore the tensions this teacher experiences as students subsequently respond to his adjusted teaching. We use a Chemistry Teacher Inventory (Lewthwaite and Wiebe in Res Sci Educ 40(11):667-689, 2011; Lewthwaite and Wiebe in Can J Math Sci Technol Educ 12(1):36-61, 2012; Lewthwaite in Chem Educ Res Pract. doi:10.1039/C3RP00122A, 2014) to assist the teacher in monitoring how he teaches and how he would like to improve his teaching. We also use a student form of the instrument, the Chemistry Classroom Inventory and Classroom Observation Protocol (Lewthwaite and Wiebe 2011) to verify the teacher's teaching and perception of student preferences for his teaching especially in terms of the discursive processes the curriculum encourages. By so doing, the teacher is able to use both sets of data as a foundation for critical reflection and work towards resolution of the incongruence in data arising from students' preferred learning orientations and his teaching aspirations. Implications of this study in regards to the authority of students' voice in triggering teachers' pedagogical change and the adjustments in `teachering' and `studenting' required by such curricula are considered.

The universality of nucleosome organization: from yeast to human

NASA Astrophysics Data System (ADS)

Chereji, Razvan

The basic units of DNA packaging are called nucleosomes. Their locations on the chromosomes play an essential role in gene regulation. We study nucleosome positioning in yeast, fly, mouse, and human, and build biophysical models in order to explain the genome-wide nucleosome organization. We show that DNA sequence alone is not able to generate the phased arrays of nucleosomes observed in vivo near the transcription start sites. We discuss simple models which can account for the formation of nucleosome depleted regions and nucleosome phasing at the gene promoters. We show that the same principles apply to different organisms. References: [1] RV Chereji, D Tolkunov, G Locke, AV Morozov - Phys. Rev. E 83, 050903 (2011) [2] RV Chereji, AV Morozov - J. Stat. Phys. 144, 379 (2011) [3] RV Chereji, AV Morozov - Proc. Natl. Acad. Sci. U.S.A. 111, 5236 (2014) [4] RV Chereji, T-W Kan, et al. - Nucleic Acids Res. (2015) doi: 10.1093/nar/gkv978 [5] RV Chereji, AV Morozov - Brief. Funct. Genomics 14, 50 (2015) [6] HA Cole, J Ocampo, JR Iben, RV Chereji, DJ Clark - Nucleic Acids Res. 42, 12512 (2014) [7] D Ganguli, RV Chereji, J Iben, HA Cole, DJ Clark - Genome Res. 24, 1637 (2014)

TEMPOA: An Interactive Simulation for the Apple III Microcomputer.

DTIC Science & Technology

1982-10-01

25.1 1 ); sirte ’of a0 Pios Plaie 0, or M)l Is3 58 Reprdcdfrom~~ 58es a.vilabIe copy~U begin )o (dn’ SETCURL ’RES’)s~ exit( STARTUP) visa SETCLIPAJ’NRES...QUILARLF RUT NOT IN TNUEHOY, )I rOTQL 1) -tit(2.i.3 STEW TYPE) IN11EWORY 1OST COST UTILS LIM4IT OPC ",T iJTILS ) "cit tis * If tsw*(IJ-w*4al ’N *~P) W’md

In Vitro Evaluation of an Injectable Chitosan Gel for Sustained Local Delivery of BMP-2 for Osteoblastic Differentiation

DTIC Science & Technology

2011-11-01

Res Part B: Appl Biomater 99B: 380–390, 2011. Key Words: injectable gel, chitosan, b- glycerophosphate (b- GP), BMP-2, biocompatibility, release...supplemented with 100 ng/mL BMP-2, 50 l/mL ascorbic acid, and 7 mM b- glycerophosphate for up to 10 days.44 However, W-20-17 cells expressed osteocalcin...mineralization is rapidly initiated and enhanced to form apatite-like calcium mineral depositions. It has been suggested that ascorbic acid, b- glycerophosphate

On the Vanishing Dissipation Limit for the Full Navier-Stokes-Fourier System with Non-slip Condition

NASA Astrophysics Data System (ADS)

Wang, Y.-G.; Zhu, S.-Y.

2018-06-01

In this paper, we study the vanishing dissipation limit problem for the full Navier-Stokes-Fourier equations with non-slip boundary condition in a smooth bounded domain Ω \\subseteq R3. By using Kato's idea (Math Sci Res Inst Publ 2:85-98, 1984) of constructing an artificial boundary layer, we obtain a sufficient condition for the convergence of the solution of the full Navier-Stokes-Fourier equations to the solution of the compressible Euler equations in the energy space L2(Ω ) uniformly in time.

Molecular Cloning and Function of FAS/APO1 Associated Protein in Breast Cancer.

DTIC Science & Technology

1996-06-01

Ariyama T, Abe T, Druck T, Ohta M, Huebner K, Yanagisawa J, Reed JC, Sato T: PTPN13, a Fas-associated protein tyrosine phosphatase, is located on...20. Yang, Q., and Tonks, N. K. (1991). Isolation of a cDNA clone encoding a human protein-tyrosine phosphatase with homology 7. Huebner, K., Druck , T...Acad. Sci. U.S.A. 91, 7477 (1994). Res. 53, 1945 (1993).(Fig. 3D ). In contrast to Jurkat cells which 13. The original description of PTP-BAS (12

A Study of the Immunologic Response to Second Heterotypic Bluetongue Virus Infection in Mice

DTIC Science & Technology

1983-05-01

Bluetongue disease. Adv Vet Sci Comp Med 15: 1, 1971 24. Breckon RD, Luedke AJ, Walton TE: Bluetongue virus in bovine semen: Viral isolation. AM J Vet Res...Intervirology 3: 47, 1974 40. DuToit RM: Bluetongue --Recent advances in research. The role played by bovines in the transmission of bluetongue in sheep...AJ, Walton TE, Jones RE: Detection of bluetongue virus in bovine semen. Proc 20th World Vet Cong 3: 2039, 1975 154 99. Luedke AJ, Jochim MM, Jones RH

Ship-borne measurements of microbial enzymatic activity: A rapid biochemical indicator for microbial water quality monitoring

NASA Astrophysics Data System (ADS)

Stadler, Philipp; Loken, Luke; Crawford, John; Schramm, Paul; Sorsa, Kirsti; Kuhn, Catherine; Savio, Domenico; Striegl, Rob; Butman, David; Stanley, Emily; Farnleitner, Andreas H.; Zessner, Matthias

2017-04-01

Contamination of aquatic ecosystems by human and animal wastes is a global concern for water quality. Disclosing fate and transport processes of fecal indicator organism (FIO) in large water bodies is a big challenge due to material intensive and time consuming methods used in microbiological water quality monitoring. In respect of utilization of large surface water resources there is a dearth of rapid microbiological methods that allow a near-real time health related water quality monitoring to be implemented into early warning systems. The detection of enzymatic activities has been proposed as a rapid surrogate for microbiological pollution monitoring of water and water resources (Cabral, 2010; Farnleitner et al., 2001, 2002). Methods such as the beta-D-Glucuronidase assay (GLUC), targeting FIO such as E. coli, were established. New automated enzymatic assays have been implemented during the last years into on-site monitoring stations, ranging from ground- to surface waters (Ryzinska-Paier et al., 2014; Stadler et al., 2017, 2016). While these automated enzymatic methods cannot completely replace assays for culture-based FIO enumeration, they yielded significant information on pollution events and temporal dynamics on a catchment specific basis, but were restricted to stationary measurements. For the first time we conducted ship-borne and automated measurements of enzymatic GLUC activity on large fresh water bodies, including the Columbia River, the Mississippi River and Lake Mendota. Not only are automated enzymatic assays technically feasible from a mobile vessel, but also can be used to localize point sources of potential microbial fecal contamination, such as tributaries or storm drainages. Spatial and temporal patterns of enzymatic activity were disclosed and the habitat specific correlation with microbiological standard assays for FIO determined due to reference samples. The integration of rapid and automated enzymatic assays into well-established systems for ship-borne measurements of physico-chemical parameters, such as the FLAMe (Crawford et al., 2015), paves new ground for data interpretation and process understanding. Cabral, J.P.S., 2010. Water Microbiology. Bacterial Pathogens and Water. Int. J. Environ. Res. Public. Health 7, 3657-3703. doi:10.3390/ijerph7103657 Crawford, J.T., Loken, L.C., Casson, N.J., Smith, C., Stone, A.G., Winslow, L.A., 2015. High-speed limnology: using advanced sensors to investigate spatial variability in biogeochemistry and hydrology. Environ. Sci. Technol. 49, 442-450. doi:10.1021/es504773x Farnleitner, A. h., Hocke, L., Beiwl, C., Kavka, G. c., Zechmeister, T., Kirschner, A. k. t., Mach, R. l., 2001. Rapid enzymatic detection of Escherichia coli contamination in polluted river water. Lett. Appl. Microbiol. 33, 246-250. doi:10.1046/j.1472-765x.2001.00990.x Farnleitner, A.H., Hocke, L., Beiwl, C., Kavka, G.G., Mach, R.L., 2002. Hydrolysis of 4-methylumbelliferyl-β-d-glucuronide in differing sample fractions of river waters and its implication for the detection of fecal pollution. Water Res. 36, 975-981. doi:10.1016/S0043-1354(01)00288-3 Ryzinska-Paier, G., Lendenfeld, T., Correa, K., Stadler, P., Blaschke, A.P., Mach, R.L., Stadler, H., Kirschner, A.K.T., Farnleitner, A.H., 2014. A sensitive and robust method for automated on-line monitoring of enzymatic activities in water and water resources. Water Sci. Technol. J. Int. Assoc. Water Pollut. Res. 69, 1349-1358. doi:10.2166/wst.2014.032 Stadler, P., Blöschl, G., Vogl, W., Koschelnik, J., Epp, M., Lackner, M., Oismüller, M., Kumpan, M., Nemeth, L., Strauss, P., Sommer, R., Ryzinska-Paier, G., Farnleitner, A.H., Zessner, M., 2016. Real-time monitoring of beta-d-glucuronidase activity in sediment laden streams: A comparison of prototypes. Water Res. 101, 252-261. doi:10.1016/j.watres.2016.05.072 Stadler, P., Farnleitner, A.H., Zessner, M., 2017. Development and evaluation of a self-cleaning custom-built auto sampler controlled by a low-cost RaspberryPi microcomputer for online enzymatic activity measurements. Talanta 162, 390-397. doi:10.1016/j.talanta.2016.10.031

Corresponding color datasets and a chromatic adaptation model based on the OSA-UCS system.

PubMed

Oleari, Claudio

2014-07-01

Today chromatic adaptation transforms (CATs) are reconsidered, since their mathematical inconsistency has been shown in Color Res. Appl.38, 188 (2013) and by the CIE technical committee TC 8-11: CIECAM02 Mathematics. In 2004-2005 the author proposed an adaptation transform based on the uniform color scale system of the Optical Society of America (OSA-UCS) [J. Opt. Soc. Am. A21, 677 (2004); Color Res. Appl. 30, 31 (2005)] that transforms the cone-activation stimuli into adapted stimuli. The present work considers all the 37 available corresponding color (CC) datasets selected by CIE and (1) shows that the adapted stimuli obtained from CC data are defined up to an unknown transformation, and an unambiguous definition of the adapted stimuli requires additional hypotheses or suitable experimental data (as it is in the OSA-UCS system); (2) produces a CAT, represented by a linear transformation between CCs, associated with any CC dataset, whose high quality measured in ΔE units discards the possibility of nonlinear transformations; (3) analyzes these color-conversion matrices in a heuristic way with a reference adaptation that is approximately that of the OSA-UCS adapted colors for the D65 illuminant and particularly shows accordance with the Hunt effect and the Bezold-Brücke hue shift; (4) proposes the measurements of CC stimuli with a reference adaptation equal to that of the visual situation of the OSA-UCS system for defining adapted colors for any considered illumination adaptation and therefore for defining a general CAT formula.

Light emitting diodes as a monitor to study P-type doping of GaN-based heterostructures grown by MOVPE

NASA Astrophysics Data System (ADS)

Schineller, B.; Guttzeit, A.; Vertommen, F.; Schön, O.; Heuken, M.; Heime, K.; Beccard, R.

1998-06-01

The group-III nitrides are an interesting material system for applications in the blue spectral region and for high-power and high-temperature devices. P-type doping in the metalorganic vapour-phase growth process, however, suffers from the material's high-background donor concentration. Hydrogen passivation furthermore decreases the number of activated acceptors [N.M. Johnson, W. Götz, J. Neugebauer, C.G. van de Walle, Mater. Res. Soc. Symp. Proc. 395 (1996) 723; A. Bosin, V. Fiorentini, Mater. Res. Soc. Symp. Proc. 395 (1996) 503] [1, 2]. Thermal treatment was found to increase the amount of activated acceptors [S.J. Pearton, S. Bendi, K.S. Jones, V. Krishnamoorthy, R.G. Wilson, F. Ren, R.F. Karlicek, R.A. Stall, Appl. Phys. Lett. 69 (1996) 1879; Y. Li, Y. Lu, H. Shen, M. Wraback, C.Y. Hwang, M. Schurman, W. Mayo, T. Salagaj, R.A. Stall, Mater. Res. Soc. Symp. Proc. 395 (1996) 369] [3, 4]. We have investigated the influences of thermal treatment process steps on the electrical and optical properties of Mg-doped single layers and used the results to fabricate AlGaN/GaN heterostructure LED layers. A simple test structure was employed to assess the electro-optical properties of the LED structures.

A modified form of conjugate gradient method for unconstrained optimization problems

NASA Astrophysics Data System (ADS)

Ghani, Nur Hamizah Abdul; Rivaie, Mohd.; Mamat, Mustafa

2016-06-01

Conjugate gradient (CG) methods have been recognized as an interesting technique to solve optimization problems, due to the numerical efficiency, simplicity and low memory requirements. In this paper, we propose a new CG method based on the study of Rivaie et al. [7] (Comparative study of conjugate gradient coefficient for unconstrained Optimization, Aus. J. Bas. Appl. Sci. 5(2011) 947-951). Then, we show that our method satisfies sufficient descent condition and converges globally with exact line search. Numerical results show that our proposed method is efficient for given standard test problems, compare to other existing CG methods.

Soil Materials and Health: An new experience for teaching

NASA Astrophysics Data System (ADS)

Del Hoyo Martínez, Carmen

2014-05-01

Cationic clays are very extended compounds on the earth surface so they constitute the main component of soils and sedimentary rocks. Due to their presence and special properties that they have, mankind has used them with therapeutic aims from Prehistory, not being rare to find references to this subject in works of classic authors. During the Renaissance and with the appearance of the first Pharmacopeia, its use was regulated to a certain extent. The scientific development reached during the XXth century has allowed to understand and to study the reasons of the useful and peculiar properties of clays, directly related to their colloidal size and crystalline structure. These properties are translated in a high specific surface area, optimal rheological properties and/or excellent sorptive capacity; everything makes cationic clays very useful for a wide range of applications. In the field of health, cationic clays are used in Pharmaceutical Technology and Dermopharmacy as ideal excipients and substances of suitable biological activity due to their chemical inertness and low or null toxicity for the patient (Carretero, 2002; Lopez Galindo et al., 2005; Choy et al., 2007; del Hoyo, 2007). Cationic clays can be used in a wide range of applications in health. However, it must be also considered that the risk exposure to cationic clays may cause several diseases, as it has been seen above. Cationic clays have been used as excipients and active principles in the pharmaceutical industry. The last tendencies are their use in geomedicine, as much to come up as to treat diseases. One stands out his presence in spas and aesthetic medicine. Development of new pharmaceutical formulations is observed, based on cationic clays, for cancer therapy. It has to emphasize the importance in the synthesis of biosensors with cationic clays. Cationic clays can be considered a group of promising materials in the development of new health applications. The study of the use of the cationic clays in the field of the health is a source to develop numerous studies of cases in the teaching of different subjects related to the geoscience and a new opportunity to connect the learning with the reality. References -Carretero, MI 2002. Clay Minerals and Their Beneficial Effects upon Human Health. A review. Appl. Clay Sci. 21, pp. 155-163. -Choy, J.H., Choi, S.J., Oh, J.M., Park, T. 2007. Clay minerals and layered double hydroxides for novel biological applications. Appl. Clay Sci. 36 pp. 122-132. -Del Hoyo, C. 2007. Layered double hydroxides and human health: An overview. Appl. Clay Sci. 36, pp. 103-121. -Lopez-Galindo, A., Viseras Iborra, C. & Cerezo Gonzalez, P. 2005. Arcillas y salud. In: Conferencias de la XIX Reunion de la Sociedad Espanola de Arcillas. Rives, Ed., pp. 15-18.

Changes Observed in Views of Nature of Science During a Historically Based Unit

NASA Astrophysics Data System (ADS)

Rudge, David Wÿss; Cassidy, David Paul; Fulford, Janice Marie; Howe, Eric Michael

2014-09-01

Numerous empirical studies have provided evidence of the effectiveness of an explicit and reflective approach to the learning of issues associated with the nature of science (NOS) (c.f. Abd-El-Khalick and Lederman in J Res Sci Teach 37(10):1057-1095, 2000). This essay reports the results of a mixed-methods association study involving 130 preservice teachers during the course of a three class unit based upon the history of science using such an approach. Within the unit the phenomenon of industrial melanism was presented as a puzzle for students to solve. Students were explicitly asked to reflect upon several NOS issues as they developed and tested their own explanations for the "mystery phenomenon". NOS views of all participants were characterized by means of surveys and follow-up interviews with a subsample of 17 participants, using a modified version of the VNOS protocol (c.f. Lederman et al. in J Res Sci Teach 39(6):497-521, 2002). An analysis of the survey results informed by the interview data suggests NOS views became more sophisticated for some issues, e.g., whether scientific knowledge requires experimentation; but not others, e.g., why scientists experiment. An examination of the interview data informed by our experiences with the unit provides insight into why the unit may have been more effective with regard to some issues than others. This includes evidence that greater sophistication of some NOS issues was fostered by the use of multiple, contextualized examples. The essay concludes with a discussion of limitations, pedagogical implications, and avenues for further research.

Ascent Rates of Rhyolitic Magma During the Opening Stages of Explosive Caldera-Forming Eruptions

NASA Astrophysics Data System (ADS)

Myers, M.; Wallace, P. J.; Wilson, C. J. N.; Watkins, J. M.; Liu, Y.; Morgan, D. J.

2016-12-01

We investigate the timescales of rhyolitic magma ascent for three supereruptions that show contrasting eruptive behavior at eruption onset: (1) the Bishop Tuff, CA where early fallout graded directly into climactic eruption, (2) the Oruanui eruption, Taupo NZ, which experienced a significant time break between the initial fallout and subsequent activity and (3) the Huckleberry Ridge, Yellowstone where initial activity was episodic, with eruptive pauses totaling days to weeks. During ascent, decompression causes volatile exsolution from the host melt, creating H2O and CO2 gradients in reentrants (REs; unsealed inclusions) that can be modeled to estimate ascent timescales1,2,3. Using a code1 refined to include an error minimization function, we present modeled ascent rates for REs from Huckleberry Ridge (n=10), Bishop (n=14), and Oruanui (n=4), measured using FTIR (20 μm resolution, 4-15 points per RE). Best-fit profiles for the Bishop REs give ascent rates of 0.6-30 m/s, which overlap with those of the Huckleberry (0.3-5.5 m/s), but extend to higher values. Although ascent rate and initial eruptive behavior are somewhat decoupled, there is an increase in the number of faster ascent rates and greater starting depths with higher stratigraphic height in the Huckleberry Ridge and Bishop fall deposits. Preliminary work on Oruanui REs indicates rates of 0.15-2.0 m/s, which overlie the lower end of the Bishop and Huckleberry REs, in agreement with previous data1. Overall, there is significant overlap between the three datasets (average 4±7 m/s). Our calculated ascent rates fall towards the lower end of ascent rates that have been estimated (5-40 m/s4) using theoretical and numerical modeling of conduit flow for Plinian rhyolitic eruptions below the fragmentation depth. 1 Liu Y et al. 2007: J Geophys Res 112, B06204; 2 Humphreys MCS et al. 2008: Earth Planet Sci Lett 270, 25; 3 Lloyd et al., 2014: J Volcanol Geotherm Res 283, 1; 4Rutherford MJ 2008: Rev Mineral Geochem 69, 241.

Unstable infiltration fronts in porous media on laboratory scale

NASA Astrophysics Data System (ADS)

Schuetz, Cindi; Neuweiler, Insa

2014-05-01

Water flow and transport of substances in the unsaturated zone are important processes for the quality and quantity of water in the hydrologic cycle. The water movement through preferential paths is often much faster than standard models (e. g. Richards equation in homogeneous porous media) predict. One type/phenomenon of preferential flow can occur during water infiltration into coarse and/or dry porous media: the so-called gravity-driven fingering flow. To upscale the water content and to describe the averaged water fluxes in order to couple models of different spheres it is necessary to understand and to quantify the behavior of flow instabilities. We present different experiments of unstable infiltration in homogeneous and heterogeneous structures to analyze development and morphology of gravity-driven fingering flow on the laboratory scale. Experiments were carried out in two-dimensional and three-dimensional sand tanks as well as in larger two-dimensional sand tanks with homogeneous and heterogeneous filling of sand and glass beads. In the small systems, water content in the medium was measured at different times. We compare the experiments to prediction of theoretical approaches (e.g. Saffman and Taylor, 1958; Chuoke et al., 1959; Philip 1975a; White et al., 1976; Parlange and Hill, 1976a; Glass et al., 1989a; Glass et al., 1991; Wang et al., 1998c) that quantify properties of the gravity-driven fingers. We use hydraulic parameters needed for the theoretical predictions (the water-entry value (hwe), van Genuchten parameter (Wang et al., 1997, Wang et al., 2000) and saturated conductivity (Ks), van Genuchten parameter (Guarracino, 2007) to simplify the prediction of the finger properties and if necessary to identify a constant correction factor. We find in general that the finger properties correspond well to theoretical predictions. In heterogeneous settings, where fine inclusions are embedded into a coarse material, the finger properties do not change much, while the inclusions act as a storage that is filled during the infiltration process. References: Chouke, R.L., van Meurs, P., and van der Poel, C., 1959. The instability of slow immiscible, viscous liquid-liquid displacements in permeable media, Trans. AIME. 216:188-194. Glass, R.J., Steenhuis, T.S., and Parlange J.-Y., 1989a. Mechanism for finger persistence in homogeneous, unsaturated, porous media: Theory and verification, Soil Sci. 148:60-70. Glass R.J., Parlange, J.-Y., and Steenhuis, T.S., 1991. Immiscible displacement in porous media: Stability analysis of three-dimensional, axisymmetric disturbances with application to gravity-driven wetting front instability, Water Resour. Res., 27, 1947-1956. Guarracino, L., 2007. Estimation of saturated hydraulic conductivity Ks from the van Genuchten shape parameter , Water Resour. Res., 43, W11502. Parlange, J.-Y. and Hill, D.E., 1976a. Theoretical analysis of wetting front instability in soils, Soil Sci. 122:236-239. Philip, J. 1975a. Stability analysis of infiltration, Soil Sci. Soc. Am. Proc. 39:1042-1049. Saffman, P.G. and Taylor, G., 1958. The penetration of a fluid into a porous medium or hele-shaw cell containing a more viscous liquid, Proc. R. Soc. London, 245:312-329. Wang Z., Feyen, J., Nielsen, D.R., and van Genuchten, M.T., 1997. Two-phase flow infiltration equations accounting for air entrapment effects, Water Resour. Res., 33:2759-2767. Wang, Z., Feyen, J., and Elrick, D.E., 1998c. Prediction of fingering in porous media, Water Resour. Res. 34(9):2183-2190. Wang Z., Wu, L., and Wu, Q.J., 2000. Water-entry value as an alternative indicator of soil water-repellency and wettability, Journal of Hydrology., 231-232, 76-83. White, I., Colombera, P.M., and Philip, J.R., 1976. Experimental studies of wetting front instability induced by sudden changes of pressure gradient, Soil Sci. Soc. Am. Proc., 40:824-829.

Laboratory Simulations of Space Weathering of Asteroid Surfaces by Solar Wind Ions.

NASA Astrophysics Data System (ADS)

Miller, Kenneth A.; De Ruette, Nathalie; Harlow, George; Domingue, Deborah L.; Savin, Daniel Wolf

2014-06-01

Studies into the formation of the terrestrial planets rely on the analysis of asteroids and meteorites. Asteroids are solar system remnants from the planetary formation period. By characterizing their mineralogical composition we can better constrain the formation and evolution of the inner planets.Remote sensing is the primary means for studying asteroids. Sample return missions, such as Hayabusa, are complex and expensive, hence we rely on asteroid reflectance spectra to determine chemical composition. Links have been made and debated between meteorite classes and asteroid types [1, 2]. If such relationships can be confirmed, then meteorites would provide a low cost asteroid sample set for study. However, a major issue in establishing this link is the spectral differences between meteorite samples and asteroid surfaces. The most commonly invoked explanation for these differences is that the surfaces of asteroids are space weathered [2, 3]. The dominant mechanism for this weathering is believed to be solar-wind ion irradiation [2, 4, 5]. Laboratory simulations of space weathering have demonstrated changes in the general direction required to alter spectra from unweathered meteorite samples to asteroid observations [3, 6 -10], but many open questions remain and we still lack a comprehensive understanding. We propose to explore the alleged connection of ordinary chondrite (OC) meteorites to S-type asteroids through a series of systematic laboratory simulations of solar-wind space weathering of asteroid surface materials. Here we describe the issue in more detail and describe the proposed apparatus. [1] Chapman C. R. (1996) Meteorit. Planet. Sci., 31, 699-725. [2] Chapman C. R. (2004), Annu. Rev. Earth Planet. Sci., 32, 539-567. [3] Hapke B. (2001) J. Ge-ophys. Res., 106, 10039-10074. [4] Pieters C.M. et al. (2000) Meteorit. Planet. Sci., 35, 1101-1107. [5] Ver-nazza P. et al. (2009) Nature, 458, 993-995. [6] Stra-zulla G. et al. (2005) Icarus, 174, 31-35 (2005). [7] Brunetto R and Strazzulla G (2005) Icarus, 179, 265-273. [8] Marchi S et al. (2005) Astron. Astrophys., 443, 769-775. [9] Loeffler M. J. et al. (2009) J. Geo-phys. Res., 114, E03003. [10] Fu X. et al. (2012) Ica-rus, 219, 630-640

Energetic Neutral Atom Imaging of the Lunar Poles and Night-Side

NASA Astrophysics Data System (ADS)

Vorburger, Audrey; Wurz, Peter; Barabash, Stas; Wieser, Martin; Futaana, Yoshifumi; Bhardwaj, Anil; Dhanya, Mb; Asamura, Kazushi

2016-04-01

So far all reported scientific results derived from measurements of the Chandrayaan-1 Energetic Neutral Analyzer (CENA) on board the Indian lunar mission Chandrayaan-1 focused on the sun-lit part of the Moon. Here, for the first time, we present the analysis of the Moon - solar wind interaction in Energetic Neutral Atoms (ENAs) from measurements over the poles and the night-side of the Moon. The Moon, not being protected by a global magnetic field or an atmosphere, is constantly bombarded by solar wind ions. Until recently, it was tacitly assumed that the solar wind ions that impinge onto the lunar surface are almost completely absorbed ( < 1% reflection) by the lunar surface (e.g. Crider and Vondrak [Adv. Space Res., 2002]; Feldman et al. [J. Geophys. Res., 2000]). However, recent observations conducted by the two ENA sensors of NASA's Interstellar Boundary Explorer and by Chandrayaan-1/CENA showed an average global energetic neutral atom (ENA) albedo of 10% - 20% (e.g. McComas et al. [Geophys. Res. Lett., 2009], Wieser et al. [Planet. Space Sci., 2009], Vorburger et al. [J. Geophys. Res., 2013]). In the past 6 years, several studies have closely investigated this solar wind - lunar surface interaction from various viewpoints. The main findings of these studies include (1) the dependency of the hydrogen reflection ratio on the local crustal magnetic fields (e.g., Wieser et al. [Geophys. Res. Lett. ,2010] and Vorburger et al. [J. Geophys. Res., 2012]), (2) the determination of the energy spectra of backscattered neutralized solar wind protons (Futaana et al. [J. Geophys. Res., 2012]) (3) the use of the spectra shape to remotely define an electric potential above a lunar magnetic anomaly (Futaana et al. [Geophys. Res. Lett., 2012]), (4) the favouring of backscattering over forward-scattering of impinging solar wind hydrogen particles (Vorburger et al. [Geophys. Res. Lett., 2011]), (5) the first-ever measurements of sputtered lunar oxygen (Vorburger et al. [J. Geophys. Res., 2012]), (6) the first-ever observation of backscattered solar wind helium (Vorburger et al. [J. Geophys. Res., 2012]), and (7) the determination of the scattering properties of backscattered solar wind hydrogen measured when the Moon transversed Earth's magneto-sheath (Lue et al. [J. Geophys. Res., 2016]). All findings above are based on measurements from the sun-lit side of the Moon's surface, where solar wind particles can impinge freely onto the lunar surface. On the night-side, in contrast, a large scale wake structure is formed as a result of the high absorption of solar wind plasma on the lunar day-side. Very recent ion measurements of Chandrayaan-1's Solar Wind Monitor (SWIM) have revealed the presence of protons in the near-lunar wake, though (Dhanya et al., [Icarus 2016 (submitted)]). The presence of protons in the near lunar wake implies that there is also some sort of solar wind - lunar surface interaction on the lunar night-side. A complete analysis of this interaction will be presented herein.

Characterization of emergent leakage neutrons from multiple layers of hydrogen/water in the lunar regolith by Monte Carlo simulation

NASA Astrophysics Data System (ADS)

SU, J.; Sagdeev, R.; Usikov, D.; Chin, G.; Boyer, L.; Livengood, T. A.; McClanahan, T. P.; Murray, J.; Starr, R. D.

2013-12-01

Introduction: The leakage flux of lunar neutrons produced by precipitation of galactic cosmic ray (GCR) particles in the upper layer of the lunar regolith and measured by orbital instruments such as the Lunar Exploration Neutron Detector (LEND) is investigated by Monte Carlo simulation. Previous Monte Carlo (MC) simulations have been used to investigate neutron production and leakage from the lunar surface to assess the elemental composition of lunar soil [1-6] and its effect on the leakage neutron flux. We investigate effects on the emergent flux that depend on the physical distribution of hydrogen within the regolith. We use the software package GEANT4 [7] to calculate neutron production from spallation by GCR particles [8,9] in the lunar soil. Multiple layers of differing hydrogen/water at different depths in the lunar regolith model are introduced to examine enhancement or suppression of leakage neutron flux. We find that the majority of leakage thermal and epithermal neutrons are produced in 25 cm to 75 cm deep from the lunar surface. Neutrons produced in the shallow top layer retain more of their original energy due to fewer scattering interactions and escape from the lunar surface mostly as fast neutrons. This provides a diagnostic tool in interpreting leakage neutron flux enhancement or suppression due to hydrogen concentration distribution in lunar regolith. We also find that the emitting angular distribution of thermal and epithermal leakage neutrons can be described by cos3/2(theta) where the fast neutrons emitting angular distribution is cos(theta). The energy sensitivity and angular response of the LEND detectors SETN and CSETN are investigated using the leakage neutron spectrum from GEANT4 simulations. A simplified LRO model is used to benchmark MCNPX[10] and GEANT4 on CSETN absolute count rate corresponding to neutron flux from bombardment of 120MV solar potential GCR particles on FAN lunar soil. We are able to interpret the count rates of SETN and CSETN from the leakage neutron spectrum, emission angle, detector energy sensitivity and angular response. Reference: [1] W. C. Feldman, et al., Science 4 September 1998: Vol. 281 no. 5382 pp. 1496-1500. [2] Gasnault, O., et al., (2000) J. Geophys. Res., 105(E2), 4263-4271. [3] Little, R. C., et al. (2003), J. Geophys. Res., 108(E5), 5046. [4] McKinney et al., (2006), J. Geophys. Res., 111, E06004. [5] Lawrence et al., (2006), J. Geophys. Res., 111, E08001. [6] Looper et al, (2013), Space Weather, VOL. 11, 142-152. [7] J. Allison, et al, (2006) IEEE TRANS. ON NUCL SCI, VOL. 53, NO. 1. [8] J. Masarik and R. Reedy (1996), J. Geophys. Res., 101, 18,891-18,912. [9] P. O'Neil (2010) IEEE Trans. Nucl. Sci., 57(6), 3148-3153. [10] D. Pelowitz, (2005), Rep. LA-CP-05-0369, LANL, Los Alamos, NM.

Liquid Chromatographic Analysis of the Free Sugars in Sweet Corn: a Method Indicative of Maturity and of Quality Changes Related to Processing Techniques

DTIC Science & Technology

1977-07-01

F. Flora and R. C. Wiley, J . Food Scl., 39, 770 (1974). 2G. Rumpf, J . Mawson and H. Hansen, J . Sci. Food Agric., 23, 193 (1972). L Hough and J . K. N...Clamp, T . Bhatti and R. E. Chambers, Methods Biochem. Anal., 19, 229 (1971). 11 J . M. Richey, H. G. Richey, Jr. and R. Schraer, Analyt. Biochem., 9...C W Culpepper and C, A. Magoon, J . Agr. Res., 28, 403 (1924). -0. M Doty, G. M. Smith, J . R. Roach and J . T . Sullivan, Indiana Agr. Exp. Sta. Bull

Gravity Waves in the Atmosphere of Mars as seen by the Radio Science Experiment MaRS on Mars Express

NASA Astrophysics Data System (ADS)

Tellmann, S.; Paetzold, M.; Häusler, B.; Bird, M. K.; Tyler, G. L.; Hinson, D. P.

2016-12-01

Gravity waves are atmospheric waves whose restoring force is the buoyancy. They are known to play an essential role in the redistribution of energy, momentum and atmospheric constituents in all stably stratified planetary atmospheres. Possible excitation mechanisms comprise convection in an adjacent atmospheric layer, other atmospheric instabilities like wind shear instabilities, or air flow over orographic obstacles especially in combination with the strong winter jets on Mars. Gravity waves on Mars were observed in the lower atmosphere [1,2] but are also expected to play a major role in the cooling of the thermosphere [3] and the polar warming [4]. A fundamental understanding of the possible source mechanisms is required to reveal the influence of small scale gravity waves on the global atmospheric circulation. Radio occultation profiles from the MaRS experiment on Mars Express [5] with their exceptionally high vertical resolution can be used to study small-scale vertical gravity waves and their global distribution in the lower atmosphere from the planetary boundary layer up to 40 km altitude. Atmospheric instabilities, which are clearly identified in the data, are used to gain further insight into possible atmospheric processes contributing to the excitation of gravity waves. [1] Creasey, J. E., et al.,(2006), Geophys. Res. Lett., 33, L01803, doi:10.1029/2005GL024037. [2]Tellmann, S., et al.(2013), J. Geophys. Res. Planets, 118, 306-320, doi:10.1002/jgre.20058. [3]Medvedev, A. S., et al.(2015), J. Geophys. Res. Planets, 120, 913-927. doi:10.1002/2015JE004802.[4] Barnes, J. R. (1990), J. Geophys. Res., 95, B2, 1401-1421. [5] Pätzold, M., et al. (2016), Planet. Space Sci., 127, 44 - 90.

On the interconnection between Natural Time and Network Theory as a tool for predicting extreme events in seismology

NASA Astrophysics Data System (ADS)

Sarlis, N. V.; Skordas, E. S.; Varotsos, P.

2009-12-01

A new time domain, termed natural time χ, has been introduced by the authors[1]. This enables, among others, the distinction of Seismic Electric Signals (SES), which are low frequency geoelectric signals (≤1Hz) characterized by critical dynamics and precede earthquakes, from noise emitted from human made sources[2]. If one analyzes in natural time the seismicity subsequent to the SES by using an appropriately constructed network of earthquakes, the time of the impending mainshock can be identified within a few days[3-8]. The values of natural time specify the nodes of this network. Examples are presented, which include the prediction of the largest earthquake that occurred in Greece during the last twenty five years [9]. These examples provide evidence that natural time in conjunction with network theory is beneficial for the prediction of extreme events in seismology[3-6,8] and volcanology[7]. References: [1] P.A. Varotsos, N.V. Sarlis, and E.S. Skordas, Phys. Rev. E 66 , 011902 (2002). [2] P.A. Varotsos, N.V. Sarlis, and E.S. Skordas, Phys. Rev. E 67 , 021109 (2003); 68 , 031106 (2003); Phys. Rev. Lett. 91, 148501(2003). [3] P.A. Varotsos, N.V. Sarlis, H.K. Tanaka, and E.S. Skordas, Phys. Rev. E 72, 041103 (2005). [4] P. A. Varotsos, N. V. Sarlis, E. S. Skordas, H. K. Tanaka, and M. S. Lazaridou, Phys. Rev. E 73 , 031114 (2006); 74 , 021123 (2006). [5] P. A. Varotsos, N. V. Sarlis, E. S. Skordas, and M. S. Lazaridou, J. Appl. Phys. 103 , 014906 (2008). [6] N. V. Sarlis, E. S. Skordas, M. S. Lazaridou, and P. A. Varotsos, Proc. Jpn. Acad., Ser. B: Phys. Biol. Sci. 84 , 331 (2008) [7] S. Uyeda, M. Kamogawa and H. Tanaka, J. Geophys. Res. 114, B02310 (2009). [8] P. A. Varotsos, N. V. Sarlis and E. S. Skordas, CHAOS 19 , 023114 (2009). [9] Uyeda, S., and Kamogawa, M. Eos Trans. AGU 89 , 363 (2008).

Amphibolite of the Xinghuadukou group from the Xinlin-Xiguitu belt, NE China: new evidence for the NE branch of the Paleo-Asian Ocean

NASA Astrophysics Data System (ADS)

Hou, Wenzhu

2017-04-01

The tectonic evolution of the Paleo-Asian Ocean (PAO) witnessed the cycling of two supercontinents, Rodinia and Pangea, in Earth's geological history. This long-lasting paleo-ocean was initiated by the breakup of the supercontinent Rodinia during the Early Neoproterozoic (1,2) and terminated by the final collage of the supercontinent Pangea from Central to Eastern (current coordinates) Asia, likely lasting to the Late Permian or Early Triassic (3,4). Numerous continental and island arcs, seamounts, mid-ocean ridges and micro-blocks were amalgamated responding to the subduction and consumption of the oceanic crust of the PAO, to form the most complex and long-living Phanerozoic accretionary orogenic belt, the Central Asian Orogenic Belt (CAOB) (5,6). Trapped by the collision and amalgamation of the eastern segment of CAOB, several rock suites of oceanic affinity were reported along the Xinlin-Xiguitu belt that connects the Erguna block to the northwest and the Xing'an block to the southeast in NE China, including the Toudaoqiao blueschist (7), Jifeng ophiolite (although the forming environment remains debatable, see 8 and 9), and Xinlin ophiolite (10,11). All these suites have been proposed to be the relics of the NE branch of the PAO. However, along the northeastern extension of this belt, outcropped the Xinghuadukou group that was previously thought Paleoproterozoic in age yet has been reconsidered to be Cambrian (12), the relationship of which and this belt remains unclear. In this study, a suite of amphibolite was collected from the Xinghuadukou group outcropped in the easternmost Xinlin-Xiguitu belt in NE China and conducted geochemical analysis to discuss their forming environment and tectonic implications. Samples display low SiO2 (45%-49%wt), low K2O (0.55%-1.07%wt) compositions, low in A/CNK, but high in A/NK and FeOt/MgO ratios. REE compositions are relative low (ΣREE=52-122ppm) showing a flat chondrite normative pattern with slight enrichment in LREE ((La/Ya)N=1.5-2.4) and no Eu anomaly (Eu/Eu*=0.9-1.0). The LILE fractionation is indistinctive ((Sr/Y)N=1.1-1.8). Samples show an evident E-MORB affinity. Along with the previous studies, it can be concluded: 1) the protolith of the amphibolite of the Xinghuadukou group is a suite of tholeiitic basalt that formed in the oceanic islands environment; 2) with all the oceanic suites reported in Xinlin-Xiguitu belt, a branch of the Eastern PAO can be well defined, which likely existed from the Late Neoproterozoic to Late Cambrian, so called the Xinlin-Xiguitu Ocean. Acknowledgements: This study was financially supported by the National Natural Science Foundation of China (Projects 41190075, 41190070, 41230207, 41390441), the Hong Kong Research Grants Council General Research Fund (HKU7063/13P and 17301915), and the HKU Seed Funding Programme for Basic Research (201311159126). References: 1. N. L. Dobretsov et al., Gondwana Res. 6(2), 143-159 (2003). 2. J. Tang et al., Precambrian Res. 224, 597-611 (2013). 3. J. Y. Li, J. Asian Earth Sci. 26(3), 207-224 (2006). 4. P. R. Eizenhöfer et al., Tectonics 33(4), 441-463 (2014). 5. B. F. Windley et al., J. Geol. Soc. 164(1), 31-47 (2007). 6. W. Xiao et al., Annu. Rev. Earth Planet. Sci. 43, 477-507 (2015). 7. J. B. Zhou et al., J. Asian Earth Sci. 97, 197-210 (2015). 8. Z. Feng et al., Int. J. Earth Sci. 105(2), 491-505 (2016). 9. D. H. Ni, Int. J. Earth Sci. (2016). doi:10.1007/s00531-016-1412-2 10. R. S. Li, Heilongjiang Geology, 2(1), 21-32 (1991). 11. W. Yan et al., Earth Sci. - J. Chin. Uni. Geo. 8 (2014). 12. L. Miao et al., Chin. Sci. Bull. 52(8), 1112-1124 (2007).

Physical properties of interplanetary dust: laboratory and numerical simulations

NASA Astrophysics Data System (ADS)

Hadamcik, Edith; Lasue, Jeremie; Levasseur-Regourd, Anny-Chantal; Renard, Jean-Baptiste; Buch, Arnaud; Carrasco, Nathalie; Cottin, Hervé; Fray, Nicolas; Guan, Yuan Yong; Szopa, Cyril

Laboratory light scattering measurements with the PROGRA2 experiment, in A300-CNES and ESA dedicated microgravity flights or in ground based configurations, offer an alternative to models for exploring the scattering properties of particles with structures too complex to be easily handled by computer simulations [1,2]. The technique allows the use of large size distributions (nanometers to hundreds of micrometers) and a large variety of materials, similar to those suspected to compose the interplanetary particles [3]. Asteroids are probably the source of compact particles, while comets have been shown to eject compact and fluffy materials [4]. Moreover giant planets provide further a small number of interplanetary particles. Some interstellar particles are also present. To choose the best samples and size distributions, we consider previous numerical models for the interplanetary particles and their evolution with solar distance. In this model, fluffy particles are simulated by fractal aggregates and compact particles by ellipsoids. The materials considered are silicates and carbonaceous compound. The silicate grains can be coated by the organics. Observations are fitted with two parameters: the size distribution of the particles and the ratio of silicates over carbonaceous compounds. From the light scattering properties of the particles, their equilibrium temperature can be calculated for different structures and composition. The variation of their optical properties and temperatures are studied with the heliocentric distance [5,6]. Results on analogs of cometary particles [7] and powdered meteorites as asteroidal particles will be presented and compared to numerical simulations as well as observations. Organics on cometary grains can constitute distributed sources if degraded by solar UV and heat [8, 9]. The optical properties of CxHyNz compounds are studied after thermal evolution [10]. As a first approach, they are used to simulate the evolution of cometary or interplanetary dust organics approaching the Sun. Albedo and polarization variations will be discussed. The polarization evolution will be compared to those obtained through observations [11]. Studies of the properties of our interplanetary dust cloud should provide information to better interpret observations of dust around exoplanets. Some of these planets are very close to their star. The thermal evolution of organics driven by chemical reactions will represent a fundamental knowledge to interpret the relevant polarimetric observations. We acknowledge CNES for funding the PROGRA2 experiment, CNES and ESA for the micro-gravity flights. [1] Renard J.-B. et al., Appl. Opt. 41, 609 (2002) [2] Hadamcik E. et al., In: Light scattering rev. 4, 31 (Kokhanovszky ed.), Springer -Praxis, Berlin (2009) [3] Mann I. et al., Space Sci. Rev. 110, 269 (2004) [4] Hoertz F. et al., Science 314, 716 (2006) [5] Lasue J. et al., Astron. Astrophys. 473, 641 (2007) [6] Levasseur-Regourd A.C et al., Planet Space Sci. 55, 1010 (2007) [7] Hadamcik E. et al., Icarus 190, 660 (2007) [8] Cottin H. et al., Adv. Space Res. 42, 2019 (2008) [9] Fray N. et al., Planet. Space Sci. 53, 1243 (2005) [10] Sciamma-O'Brien E. et al., Icarus, accepted [11] Levasseur-Regourd A.C., et al., In: Interplanetary dust, Gruen, Gustafson B., Dermott S., Fechtig H. (Eds), Springer, Berlin, 57 (2001)

Solving multi-customer FPR model with quality assurance and discontinuous deliveries using a two-phase algebraic approach.

PubMed

Chiu, Yuan-Shyi Peter; Chou, Chung-Li; Chang, Huei-Hsin; Chiu, Singa Wang

2016-01-01

A multi-customer finite production rate (FPR) model with quality assurance and discontinuous delivery policy was investigated in a recent paper (Chiu et al. in J Appl Res Technol 12(1):5-13, 2014) using differential calculus approach. This study employs mathematical modeling along with a two-phase algebraic method to resolve such a specific multi-customer FPR model. As a result, the optimal replenishment lot size and number of shipments can be derived without using the differential calculus. Such a straightforward method may assist practitioners who with insufficient knowledge of calculus in learning and managing the real multi-customer FPR systems more effectively.

On the zero-Rossby limit for the primitive equations of the atmosphere*

NASA Astrophysics Data System (ADS)

Chen, Gui-Qiang; Zhang, Ping

2001-09-01

The zero-Rossby limit for the primitive equations governing atmospheric motions is analysed. The limit is important in geophysics for large-scale models (cf Lions 1996 Int. Conf. IAM 95 (Hamburg 1995) (Math. Res. vol 87) (Berlin: Akademie) pp 177-212) and is in the level of the zero relaxation limit for nonlinear partial differential equations (cf Chen et al 1994 Commun. Pure Appl. Math. 47 787-830). It is proved that, if the initial data appropriately approximate data of geostrophic type, the corresponding solutions of the simplified primitive equations approximate the solutions of the quasigeostrophic equations with order ɛ accuracy as the Rossby number ɛ goes to zero.

A review of the liquid metal diffusion data obtained from the space shuttle endeavour mission STS-47 and the space shuttle columbia mission STS-52

NASA Astrophysics Data System (ADS)

Shirkhanzadeh, Morteza

Accurate data of liquid-phase solute diffusion coefficients are required to validate the condensed -matter physics theories. However, the required data accuracy to discriminate between com-peting theoretical models is 1 to 2 percent(1). Smith and Scott (2) have recently used the measured values of diffusion coefficients for Pb-Au in microgravity to validate the theoretical values of the diffusion coefficients derived from molecular dynamics simulations and several Enskog hard sphere models. The microgravity data used was obtained from the liquid diffusion experiments conducted on board the Space Shuttle Endeavour (mission STS-47) and the Space Shuttle Columbia (mission STS-52). Based on the analysis of the results, it was claimed that the measured values of diffusion coefficients were consistent with the theoretical results and that the data fit a linear relationship with a slope slightly greater than predicted by the molecular dynamics simulations. These conclusions, however, contradict the claims made in previous publications (3-5) where it was reported that the microgravity data obtained from the shuttle experiments fit the fluctuation theory (D proportional to T2). A thorough analysis of data will be presented to demonstrate that the widely-reported micro-gravity results obtained from shuttle experiments are not reliable and sufficiantly accurate to discriminate between competing theoretical models. References: 1. J.P. Garandet, G. Mathiak, V. Botton, P. Lehmann and A. Griesche, Int. J. Thermophysics, 25, 249 (2004). 2.P.J. Scott and R.W. Smith, J. Appl. Physics 104, 043706 (2008). 3. R.W. Smith, Microgravity Sci. Technol. XI (2) 78-84 (1998). 4.Smith et al, Ann. N.Y. Acad. Sci. 974:56-67 (2002) (retracted). 5.R.A. Herring et al, J. Jpn. Soc. Microgravity Appl., Vol.16, 234-244 (1999).

Infusing Authentic Inquiry into Biotechnology

NASA Astrophysics Data System (ADS)

Hanegan, Nikki L.; Bigler, Amber

2009-10-01

Societal benefit depends on the general public's understandings of biotechnology (Betsch in World J Microbiol Biotechnol 12:439-443, 1996; Dawson and Cowan in Int J Sci Educ 25(1):57-69, 2003; Schiller in Business Review: Federal Reserve Bank of Philadelphia (Fourth Quarter), 2002; Smith and Emmeluth in Am Biol Teach 64(2):93-99, 2002). A National Science Foundation funded survey of high school biology teachers reported that hands-on biotechnology education exists in advanced high school biology in the United States, but is non-existent in mainstream biology coursework (Micklos et al. in Biotechnology labs in American high schools, 1998). The majority of pre-service teacher content preparation courses do not teach students appropriate content knowledge through the process of inquiry. A broad continuum exists when discussing inquiry-oriented student investigations (Hanegan et al. in School Sci Math J 109(2):110-134, 2009). Depending on the amount of structure in teacher lessons, inquiries can often be categorized as guided or open. The lesson can be further categorized as simple or authentic (Chinn and Malhotra in Sci Educ 86(2):175-218, 2002). Although authentic inquiries provide the best opportunities for cognitive development and scientific reasoning, guided and simple inquiries are more often employed in the classroom (Crawford in J Res Sci Teach 37(9):916-937, 2000; NRC in Inquiry and the national science education standards: a guide for teaching and learning, 2000). For the purposes of this study we defined inquiry as "authentic" if original research problems were resolved (Hanegan et al. in School Sci Math J 109(2):110-134, 2009; Chinn and Malhotra in Sci Educ 86(2):175-218, 2002; Roth in Authentic school science: knowing and learning in open-inquiry science laboratories, 1995). The research question to guide this study through naturalistic inquiry research methods was: How will participants express whether or not an authentic inquiry experience enhanced their understanding of biotechnology? As respondents explored numerous ideas in order to develop a workable research question, struggled to create a viable protocol, executed their experiment, and then evaluated their results, they commented on unexpected topics regarding the nature of science as well as specific content knowledge relating to their experiments. Four out of five participants reported they learned the most during authentic inquiry laboratory experience.

The effect of fatigue on the corrosion resistance of common medical alloys.

PubMed

Di Prima, Matthew; Gutierrez, Erick; Weaver, Jason D

2017-10-01

The effect of mechanical fatigue on the corrosion resistance of medical devices has been a concern for devices that experience significant fatigue during their lifespan and devices made from metallic alloys. The Food and Drug Administration had recommended in some instances for corrosion testing to be performed on post-fatigued devices [Non-clinical tests and recommended labeling for intravascular stents and associated delivery systems: guidance for industry and FDA staff. 2005: Food and Drug Administration, Center for Devices and Radiological Health], although the need for this has been debated [Nagaraja S, et al., J Biomed Mater Res Part B: Appl Biomater 2016, 8.] This study seeks to evaluate the effect of fatigue on the corrosion resistance of 5 different materials commonly used in medical devices: 316 LVM stainless steel, MP35N cobalt chromium, electropolished nitinol, mechanically polished nitinol, and black oxide nitinol. Prior to corrosion testing per ASTM F2129, wires of each alloy were split into subgroups and subjected to either nothing (that is, as received); high strain fatigue for less than 8 min; short-term phosphate buffered saline (PBS) soak for less than 8 min; low strain fatigue for 8 days; or long-term PBS soak for 8 days. Results from corrosion testing showed that the rest potential trended to an equilibrium potential with increasing time in PBS and that there was no statistical (p > 0.05) difference in breakdown potential between the fatigued and matching PBS soak groups for 9 out of 10 test conditions. Our results suggest that under these nonfretting conditions, corrosion susceptibility as measured by breakdown potential per ASTM F2129 was unaffected by the fatigue condition. 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 2019-2026, 2017. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.

Modeling of a new electron-streamer acceleration mechanism

NASA Astrophysics Data System (ADS)

Ihaddadene, K. M. A.; Dwyer, J. R.; Liu, N.; Celestin, S. J.

2017-12-01

Lightning stepped leaders and laboratory spark discharges in air are known to produce X-rays [e.g., Dwyer et al., Geophys. Res. lett., 32, L20809, 2005; Kochkin et al., J. Phys. D: Appl. Phys., 45, 425202, 2012]. However, the processes behind the production of these X-rays are still not very well understood. During discharges, encounters between streamers of different polarities are very common. For example, during the formation of a new leader step, the negative streamer zone around the tip of a negative leader and the positive streamers initiated from the posiive part of a bidirectional space leader strongly interact. In laboratory experiments, when streamers are approaching a sharp electrode, streamers with the opposite polarity are initiated from the electrode and collide with the former streamers. Recently, the encounter between negative and positive streamers has been proposed as a plausible mechanism for the production of X-rays by spark discharges [Cooray et la., JASTP, 71, 1890, 2009; Kochkin et al., J. Phys. D: Appl. Phys., 45, 425202, 2012], but modeling results have shown later that the increase of the electric field involved in this process, which is above the conventional breakdown threshold field, is accompanied by a strong increase of the electron density. The resulting increase in the conductivity, in turn, causes this electric field to collapse over a few tens of picoseconds, preventing the electrons reaching high energies and producing significant X-ray emissions [e.g., Ihaddadene and Celestin, Geophys. Res. Lett., 45, 5644, 2015]. In this work, we will present simulation results of a new electron acceleration mechanism for producing runaway electron energies above hundred keV. The mechanism couples multiple single streamers and streamer head-on collisions, similar to a laboratory discharge, and is suitable for explaining the high-energy X-rays produced by discharges in air and by lightning stepped leaders.

Climate Consensus and `Misinformation': A Rejoinder to Agnotology, Scientific Consensus, and the Teaching and Learning of Climate Change

NASA Astrophysics Data System (ADS)

Legates, David R.; Soon, Willie; Briggs, William M.; Monckton of Brenchley, Christopher

2015-04-01

Agnotology is the study of how ignorance arises via circulation of misinformation calculated to mislead. Legates et al. (Sci Educ 22:2007-2017, 2013) had questioned the applicability of agnotology to politically-charged debates. In their reply, Bedford and Cook (Sci Educ 22:2019-2030, 2013), seeking to apply agnotology to climate science, asserted that fossil-fuel interests had promoted doubt about a climate consensus. Their definition of climate `misinformation' was contingent upon the post-modernist assumptions that scientific truth is discernible by measuring a consensus among experts, and that a near unanimous consensus exists. However, inspection of a claim by Cook et al. (Environ Res Lett 8:024024, 2013) of 97.1 % consensus, heavily relied upon by Bedford and Cook, shows just 0.3 % endorsement of the standard definition of consensus: that most warming since 1950 is anthropogenic. Agnotology, then, is a two-edged sword since either side in a debate may claim that general ignorance arises from misinformation allegedly circulated by the other. Significant questions about anthropogenic influences on climate remain. Therefore, Legates et al. appropriately asserted that partisan presentations of controversies stifle debate and have no place in education.

Gravity Waves in the Atmospheres of Mars and Venus

NASA Astrophysics Data System (ADS)

Tellmann, Silvia; Paetzold, Martin; Häusler, Bernd; Bird, Michael K.; Tyler, G. Leonard; Hinson, David P.; Imamura, Takeshi

2016-10-01

Gravity waves are ubiquitous in all stably stratified planetary atmospheres and play a major role in the redistribution of energy and momentum. Gravity waves can be excited by many different mechanisms, e.g. by airflow over orographic obstacles or by convection in an adjacent layer.Gravity waves on Mars were observed in the lower atmosphere [1,2] but are also expected to play a major role in the cooling of the thermosphere [3] and the polar warming [4]. They might be excited by convection in the daytime boundary layer or by strong winter jets in combination with the pronounced topographic diversity on Mars.On Venus, gravity waves play an important role in the mesosphere above the cloud layer [5] and probably below. Convection in the cloud layer is one of the most important source mechanisms but certain correlations with topography were observed by different experiments [6,7,8].Temperature height profiles from the radio science experiments on Mars Express (MaRS) [9] and Venus Express (VeRa) [10] have the exceptionally high vertical resolution necessary to study small-scale vertical gravity waves, their global distribution, and possible source mechanisms.Atmospheric instabilities, which are clearly identified in the data, can be investigated to gain further insight into possible atmospheric processes contributing to the excitation of gravity waves.[1] Creasey, J. E., et al.,(2006), Geophys. Res. Lett., 33, L01803, doi:10.1029/2005GL024037.[2]Tellmann, S., et al.(2013), J. Geophys. Res. Planets, 118, 306-320, doi:10.1002/jgre.20058.[3]Medvedev, A. S., et al.(2015), J. Geophys. Res. Planets, 120, 913-927. doi:10.1002/2015JE004802.[4] Barnes, J. R. (1990), J. Geophys. Res., 95, B2, 1401-1421.[5] Tellmann, S., et al. (2012), Icarus, 221, 471 - 480.[6] Blamont, J.E. et al., (1986) 231, 1422-1425.[7] Bertaux J.-L., et al. (2016), J. Geophys. Res., Planets, in press.[8] Piccialli, A., et al. (2014), Icarus, 227, 94 - 111.[9] Pätzold, M., et al. (2016), Planet. Space Sci., 127, 44 - 90.[10] Häusler, B. et al., (2006). 1315-1335.

Rapid characterisation of surface modifications and treatments using a benchtop SIMS instrument

NASA Astrophysics Data System (ADS)

McPhail, D. S.; Sokhan, M.; Rees, E. E.; Cliff, B.; Eccles, A. J.; Chater, R. J.

2004-06-01

The development of a novel benchtop SIMS instrument (Millbrook MiniSIMS) [Appl. Surf. Sci. 144 (1999) 106] has brought routine SIMS analysis to many new users, for example museum conservators. This is a result of the simple operation and the relatively low capital cost of the instrument. We report here on the continued development of the system in terms of increasing performance and functionality and its use in museum conservation based applications where a mobile instrument for high throughput, rapid SIMS analysis has proven to be of great benefit to the user. The example we describe here is the application of the MiniSIMS to the analysis of silver thread woven into a silk dress before and after laser cleaning.

Chronic exposure to pulsed low-intensity microwaves is carcinogenic and tumorogenic

NASA Astrophysics Data System (ADS)

Lundquist, Marjorie

2004-03-01

To study health effects of lifetime exposure to low-intensity pulsed radiation >890 MHz, one controlled laboratory study of SPF* rats[1-3] and two of mice[4,5] were conducted, but only one[4] reported that its data showed an association between irradiation and cancer; reports of the other two studies minimized or denied such association. Critical review of these identified data evaluation errors; their correction enables a conclusion of microwave carcinogenicity from each study (the rat study also shows an association with endocrine-system primary malignancies and with a benign tumor of the adrenal medulla), enhancing the credibility of an epidemiological study[6] reporting a brain cancer risk for users of both analog and digital cellular phones. [1] J. Raloff. Science News 126(7):103(1984). [2] K. R. Foster & A. W. Guy. Sci Am 255(3):32-39(1986). [3] C.-K. Chou et al. Bioelectromagnetics 13:469-496(1992). [4] M. H. Repacholi et al. Radiat Res 147:631-640(1990)SPF\\. [5] T. D. Utteridge et al. Radiat Res 158:357-364(2002)non-SPF\\. [6] L. Hardell et al. Int J Oncol 22:399-407(2003). * SPF = specific-pathogen-free

Special issue: diagnostics of atmospheric pressure microplasmas

NASA Astrophysics Data System (ADS)

Bruggeman, Peter; Czarnetzki, Uwe; Tachibana, Kunihide

2013-11-01

In recent decades, a strong revival of non-equilibrium atmospheric pressure plasma studies has developed in the form of microplasmas. Microplasmas have typical scales of 1 mm or less and offer a very exciting research direction in the field of plasma science and technology as the discharge physics can be considerably different due to high collisionality and the importance of plasma-surface interaction. These high-pressure small-scale plasmas have a diverse range of physical and chemical properties. This diversity coincides with various applications including light/UV sources [1], material processing [2], chemical analysis [3], material synthesis [4], electromagnetics [5], combustion [6] and even medicine [7]. At atmospheric pressure, large scale plasmas have the tendency to become unstable due to the high collision rates leading to enhanced heating and ionization compared to their low-pressure counterparts. As low-pressure plasmas typically operate in reactors with sizes of tens of centimetres, scaling up the pressure to atmospheric pressure the size of the plasma reduces to typical sizes below 1 mm. A natural approach of stabilizing atmospheric pressure plasmas is thus the use of microelectrode geometries. Traditionally microplasmas have been produced in confined geometries which allow one to stabilize dc excited discharges. This stabilization is intrinsically connected to the large surface-to-volume ratio which enhances heat transfer and losses of charged and excited species to the walls. Currently challenging boundaries are pushed by producing microcavity geometries with dimensions of the order of 1 µm [8]. The subject of this special issue, diagnostics of microplasmas, is motivated by the many challenges in microplasma diagnostics in view of the complex chemistry and strong spatial (and even temporal) gradients of species densities and plasma properties. Atmospheric pressure plasmas have a very long history dating back more than 100 years, with early work of, e.g. Werner von Siemens [9], who studied a dielectric barrier discharge (DBD) in the context of ozone generation. DBD discharges often consist of numerous filamentary discharges which are inherently transient in nature and with a characteristic size similar to the dimensions of microplasmas. Several groups are investigating the stabilization of such plasma filaments to perform temporal and spatial resolved diagnostics. To this end and due to the many similar challenges for diagnostics, this type of discharge is also included in this special issue. Research on microplasmas is performed in many groups spread all over the world, and a biannual workshop is devoted to the topic. The 7th edition of this International Workshop on Microplasmas was held in Beijing in May 2013. Large research programs consisting of clusters of research labs such as in Japan, Germany, France and the USA have been producing a wealth of information available in the literature. As the editors of this special issue, we are very pleased to have attracted a collection of excellent papers from leading experts in the field covering most of the current diagnostics performed in microplasmas. As an introduction to the regular special issue papers, a review paper is included [10]. It describes the key characteristics of atmospheric pressure plasmas and microplasmas in particular, and reviews the state of the art in plasma diagnostics. Special attention has been given in this review to highlighting the issues and challenges to probe microplasmas. The regular papers cover a large range of different diagnostics including coherent anti-Stokes Raman scattering (CARS) [11], (two-photon) laser induced fluorescence ((Ta)LIF) [12, 13, 18, 24], absorption spectroscopy [13-18], optical emission spectroscopy [12, 16-21, 24], imaging [22, 23], surface diagnostics [24, 25] and mass spectrometry [26, 27]. Different aspects of microplasmas are broadly investigated from a perspective of diagnostics, modelling and applications. Diagnostics are pivotal to both the development of models and the optimization and exploration of novel applications. Consequently, this special issue is focused on the various aspects and challenges for diagnostics in microplasmas. In addition, previous special issues on the topic of microplasmas have already covered many aspects of source development, applications and modelling [28-31]. The reader who wishes to access additional background information on microplasmas is referred to the following review papers [32-35]. We would like to thank all the contributors and the editorial staff who were of tremendous support in the preparation of this special issue. It is our sincere hope that you enjoy reading this special issue and that it will be a reference and helpful guidance for young researchers embarking in the field of microplasmas. The continued effort to increase our understanding of plasmas by modelling and diagnostics is of key importance for plasma science and the development of novel technologies. References [1] Eden J G, Park S-J, Herring C M and Bulson J M 2011 J. Phys. D: Appl. Phys. 44 224011 [2] Lucas N, Ermel V, Kurrat M and Buttgenbach S 2008 J. Phys. D: Appl. Phys. 41 215202 [3] Karnassios V 2004 Spectrochim. Acta B 59 909-28 [4] Mariotti D and Sankaran RM 2010 J. Phys. D: Appl. Phys. 43 323001 [5] Sakai O and Tachibana K 2012 Plasma Sources Sci. Technol. 21 013001 [6] Starikovskaia S M 2006 Plasma assisted ignition and combustion J. Phys. D.: Appl. Phys. 39 R265-99 [7] Fridman G, Friedman G, Gutsol A, Shekhter A B, Vasilets V N and Fridman A 2008 Plasma Process. Polym. 5 503-33 [8] Eden G et al 2013 IEEE Trans. Plasma Sci. 41 661-75 [9] Siemens W 1857 Poggendorffs. Ann. Phys. Chem. 102 66-122 [10] Bruggeman P and Brandenburg R 2013 J. Phys. D: Appl. Phys. 46 464001 [11] Montello A et al 2013 J. Phys. D: Appl. Phys. 46 464002 [12] Schröder D et al 2013 J. Phys. D: Appl. Phys. 46 464003 [13] Verreycken T et al 2013 J. Phys. D: Appl. Phys. 46 464004 [14] Sousa J S and Puech V 2013 J. Phys. D: Appl. Phys. 46 464005 [15] Takeda K et al 2013 J. Phys. D: Appl. Phys. 46 464006 [16] Vallade J and Massines F 2013 J. Phys. D: Appl. Phys. 46 464007 [17] Wang C and Wu W 2013 J. Phys. D: Appl. Phys. 46 464008 [18] Schröter S et al 2013 J. Phys. D: Appl. Phys. 46 464009 [19] Rusterholtz D L et al 2013 J. Phys. D: Appl. Phys. 46 464010 [20] Huang B-D et al 2013 J. Phys. D: Appl. Phys. 46 464011 [21] Pothiraja R et al 2013 J. Phys. D: Appl. Phys. 46 464012 [22] Marinov I et al 2013 J. Phys. D: Appl. Phys. 46 464013 [23] Akishev Y et al 2013 J. Phys. D: Appl. Phys. 46 464014 [24] Brandenburg R et al 2013 J. Phys. D: Appl. Phys. 46 464015 [25] Houlahan T J Jret al 2013 J. Phys. D: Appl. Phys. 46 464016 [26] Benedikt J et al 2013 J. Phys. D: Appl. Phys. 46 464017 [27] McKay K et al 2013 J. Phys. D: Appl. Phys. 46 464018 [28] Selected papers from the 2nd International Workshop on Microplasmas 2005 J. Phys. D: Appl. Phys. 38 1633-759 [29] Special issue: 3rd International Workshop on Microplasmas 2007 Control. Plasma Phys. 47 3-128 [30] Cluster issue on Microplasmas: 4th International Workshop on Microplasmas 2008 J. Phys. D: Appl. Phys. 41 1904001 [31] Microplasmas: scientific challenges and technological opportunities 2010 Eur. Phys. J. D 60 437-608 [32] Becker K H, Schoenbach K H and Eden J G 2006 J. Phys. D: Appl. Phys. 39 R55 [33] Iza F, Kim G J, Lee S M, Lee J K, Walsh J L, Zhang Y T and Kong M G 2008 Plasma Process. Polym. 5 322-44 [34] Tachibana K 2006 Trans. Electr. Electron. Eng. 1 145-55 [35] Samukawa S et al 2012 J. Phys. D: Appl. Phys. 45 253001

Cross Calibration of Omnidirectional Orbital Neutron Detectors of Lunar Prospector (LP) and Lunar Exploration Neutron Detector (LEND) by Monte Carlo Simulation

NASA Astrophysics Data System (ADS)

Murray, J.; SU, J. J.; Sagdeev, R.; Chin, G.

2014-12-01

Introduction:Monte Carlo (MC) simulations have been used to investigate neutron production and leakage from the lunar surface to assess the composition of the lunar soil [1-3]. Orbital measurements of lunar neutron flux have been made by the Lunar Prospector Neutron Spectrometer (LPNS)[4] of the Lunar Prospector mission and the Lunar Exploration Neutron Detector (LEND)[5] of the Lunar Reconnaissance Orbiter mission. While both are cylindrical helium-3 detectors, LEND's SETN (Sensor EpiThermal Neutrons) instrument is shorter, with double the helium-3 pressure than that of LPNS. The two instruments therefore have different angular sensitivities and neutron detection efficiencies. Furthermore, the Lunar Prospector's spin-stabilized design makes its detection efficiency latitude-dependent, while the SETN instrument faces permanently downward toward the lunar surface. We use the GEANT4 Monte Carlo simulation code[6] to investigate the leakage lunar neutron energy spectrum, which follows a power law of the form E-0.9 in the epithermal energy range, and the signals detected by LPNS and SETN in the LP and LRO mission epochs, respectively. Using the lunar neutron flux reconstructed for LPNS epoch, we calculate the signal that would have been observed by SETN at that time. The subsequent deviation from the actual signal observed during the LEND epoch is due to the significantly higher intensity of Galactic Cosmic Rays during the anomalous Solar Minimum of 2009-2010. References: [1] W. C. Feldman, et al., (1998) Science Vol. 281 no. 5382 pp. 1496-1500. [2] Gasnault, O., et al.,(2000) J. Geophys. Res., 105(E2), 4263-4271. [3] Little, R. C., et al. (2003), J. Geophys. Res., 108(E5), 5046. [4]W. C. Feldman, et al., (1999) Nucl. Inst. And Method in Phys. Res. A 422, [5] M. L. Litvak, et al., (2012) J.Geophys. Res. 117, E00H32 [6] J. Allison, et al, (2006) IEEE Trans. on Nucl Sci, Vol 53, No 1.

Areal Crater Density Analysis of Volcanic Smooth Plains: A New Approach to Distinguishing Age Units

NASA Astrophysics Data System (ADS)

Ostrach, L. R.; Robinson, M. S.

2013-12-01

It is well documented that the lunar maria were emplaced over an extended period of time [e.g., 1-3], and mare units exhibit significant color differences in multispectral data that are interpreted to correlate with distinct mineralogical compositions and ages [e.g., 3-7]. Areal crater density (ACD) analysis is used as a novel approach to identify resurfacing boundaries within Mare Imbrium as a test case for mercurian studies. Absolute model age dating and measures of ACD from crater counts on Lunar Reconnaissance Orbiter Wide Angle Camera (LRO WAC) mosaics reveal two spatially expansive, statistically separable units in Mare Imbrium. The older, spectrally red unit (~15-18 wt% FeO, ~2-5 wt% TiO2 [8]) in the east is ~3.3 Ga, and the younger, spectrally blue unit (~17-20 wt% FeO, ~7-10 wt% TiO2 [8]) in the west is ~2.2 Ga. ACD measurements show a regional boundary at the contact between these two regions. The geologic contact is confidently observed in ACD maps derived for regions with model age differences >300-500 million years and spatial extents >1 × 104 km2. The older, spectrally red unit exhibits higher ACD (>35000 craters with diameters ≥500 m per 106 km2) and the younger, spectrally blue unit has a lower ACD (<26000 craters with diameters ≥500 m per 106 km2); the absolute model ages and ACD results agree with other dating studies of this region [5, 9-12]. Thus, ACD measurements provide a reliable technique to distinguish relative ages among geologic units as well as a means to explore the statistical significance of published absolute model ages. Moreover, the ability to distinguish surface units of different ages from measures of crater frequencies in Mare Imbrium, when spectral information is not available or units do not exhibit spectral contrasts, shows that the ACD technique may be applied to other planetary bodies to search for age boundaries within contiguous smooth plains units. For example, multispectral differences within volcanic units (age and composition) are not observed on Mercury [e.g., 13-15], so the ACD method can be used to test hypotheses concerning timing of smooth plains emplacement [15]. [1] Hartmann W.K. et al. (1981) In: BVTP, 1049-1127. [2] Stöffler D. et al. (2006) Rev. Mineral. Geochem, 60, 519-596. [3] Hiesinger H. et al. (2011) Spec. Pap. - Geol. Soc. Am, 477, 1-51. [4] Pieters C.M. (1978) Proc. Lunar Plan. Sci. Conf, 9th, 2825-2849. [5] Hiesinger H. et al. (2000) J. Geophys. Res, 105, 29239-29275. [6] Staid M.I. and C.M. Pieters (2001) J. Geophys. Res, 106, 27887-27900. [7] Staid M.I. et al. (2011) J. Geophys. Res, 116, E00G10. [8] Lucey P.G. et al. (2000) J. Geophys. Res, 105, 20297-20306. [9] Schaber G.G. (1973) In: Apollo 17 PSR, NASA SP-330, 30-17 to 30-25. [10] Schaber G.G. et al. (1975) The Moon, 13, 395-423. [11] Boyce J.M. and A.L. Dial Jr. (1975) Proc. Lunar Sci. Conf, 6th, 2585-2595. [12] Bugiolacchi R. and J.E. Guest (2008) Icarus, 197, 1-18. [13] Robinson M.S. et al. (2008) Science, 321, 66-69. [14] Denevi B.W. et al. (2009) Science, 324, 613-618. [15] Denevi B.W. et al. (2013) J. Geophys. Res, 118, 1-17.

Detecting discontinuities in GNSS coordinate time series with STARS: case study, the Bologna and Medicina GPS sites

NASA Astrophysics Data System (ADS)

Bruni, S.; Zerbini, Susanna; Raicich, F.; Errico, M.; Santi, E.

2014-12-01

Global navigation satellite systems (GNSS) data are a fundamental source of information for achieving a better understanding of geophysical and climate-related phenomena. However, discontinuities in the coordinate time series might be a severe limiting factor for the reliable estimate of long-term trends. A methodological approach has been adapted from Rodionov (Geophys Res Lett 31:L09204, 2004; Geophys Res Lett 31:L12707, 2006) and from Rodionov and Overland (J Marine Sci 62:328-332, 2005) to identify both the epoch of occurrence and the magnitude of jumps corrupting GNSS data sets without any a priori information on these quantities. The procedure is based on the Sequential t test Analysis of Regime Shifts (STARS) (Rodionov in Geophys Res Lett 31:L09204, 2004). The method has been tested against a synthetic data set characterized by typical features exhibited by real GNSS time series, such as linear trend, seasonal cycle, jumps, missing epochs and a combination of white and flicker noise. The results show that the offsets identified by the algorithm are split into 48 % of true-positive, 28 % of false-positive and 24 % of false-negative events. The procedure has then been applied to GPS coordinate time series of stations located in the southeastern Po Plain, in Italy. The series span more than 15 years and are affected by offsets of different nature. The methodology proves to be effective, as confirmed by the comparison between the corrected GPS time series and those obtained by other observation techniques.

Development and Application of Decision Aid for Tactical Control of Battlefield Operations: Bibliographic Sort of the Decision Aiding Literature

DTIC Science & Technology

1973-12-01

THEORY GAML THE’RY GROUP PROb SQL= U tIC PMLTRIC3b 63 C.LARKSON G a DEC MAK IN SMALL GROUPS A SIM STUDY bLHt SCI 6t0 13 2081 bRUNER J b STUDIES IN...MAK IN SMALL GROUPS A SIN STUDY : BLH 5(1 6d 13 2861 DODSON j 0 AS SIN RES FACILITYz SIN SYS DGN FOR TE AkCRL 111 PRI9I4• FLEEING R ASKS PROC.CONFLICTING...POU315IC HF. 66 MAR 7-1 SHURL ( H NNUAtCENTER FOR COMP BASED BEH STUDIES UCLA SEMIA NTIS-AD 731059 713 CLARKSON b DEC MAK IN SMALL GROUPS A SIM STUDY

Polypodium sp. (Coelenterata) infection of paddlefish (Polyodon spathula) eggs

USGS Publications Warehouse

Suppes, V. Charles; Meyer, Fred P.

1975-01-01

Parasitism of fish by coelenterates is rare and the first North American infection was reported in sturgeon (Hoffman et al., 1974, J Parasitol 60: 548-550). In the USSR parasitism of sturgeon (Acipenser sp.) eggs by the coelenterate Polypodium hydriforme Ussov 1885 has long been reported and investigated [Raikova, 1959, in Parasites of Freshwater Fish and the Biological Basis for their Control. Bull State Sci Res Inst Lake and River Fish. XLIX. Eng. transl. No. TT61-31056, O. T. S., U. S. Dep. Commerce, Washington, D. C., 1962, 235 p.: Raikova, 1973, (Proc Second Internat Symp on Cnidaria), Seto Marine Biological Laboratory 20: 165-173]. This report represents the first known infection of Polypodium in the paddlefish (Polyodon spathula).

What is behind "centromere repositioning"?

PubMed

Schubert, Ingo

2018-06-01

An increasing number of observations suggest an evolutionary switch of centromere position on monocentric eukaryotic chromosomes which otherwise display a conserved sequence of genes and markers. Such observations are particularly frequent for primates and equidae (for review see Heredity 108:59-67, 2012) but occur also in marsupials (J Hered 96:217-224, 2005) and in plants (Chromosome Res 25:299-311, 2017 and references therein). The actual mechanism(s) behind remained unclear in many cases (Proc Natl Acad Sci USA 101:6542-6547, 2004; Trends Genet 30:66-74, 2014). The same is true for de novo centromere formation on chromosomes lacking an active centromere. This article focuses on recent reports on centromere repositioning and possible mechanisms behind and addresses open questions.

Tsallis non-additive entropy and natural time analysis of seismicity

NASA Astrophysics Data System (ADS)

Sarlis, N. V.; Skordas, E. S.; Varotsos, P.

2017-12-01

Within the context of Tsallis non-additive entropy [1] statistical mechanics -in the frame of which kappa distributions arise [2,3]- a derivation of the Gutenberg-Richter (GR) law of seismicity has been proposed [4,5]. Such an analysis leads to a generalized GR law [6,7] which is applied here to the earthquakes in Japan and California. These seismic data are also studied in natural time [6] revealing that although some properties of seismicity may be recovered by the non-additive entropy approach, temporal correlations between successive earthquake magnitudes should be also taken into account [6,8]. The importance of such correlations is strengthened by the observation of periods of long range correlated earthquake magnitude time series [9] a few months before all earthquakes of magnitude 7.6 or larger in the entire Japanese area from 1 January 1984 to 11 March 2011 (the day of the magnitude 9.0 Tohoku-Oki earthquake) almost simultaneously with characteristic order parameter variations of seismicity [10]. These variations appear approximately when low frequency abnormal changes of the electric and magnetic field of the Earth (less than around 1Hz) are recorded [11] before strong earthquakes as the magnitude 9.0 Tohoku-Oki earthquake in Japan in 2011 [12]. 1. C Tsallis, J Stat Phys 52 (1988) 479 2. G Livadiotis, and D J McComas, J Geophys Res 114 (2009) A11105 3. G Livadiotis, Kappa Distributions. (Elsevier, Amsterdam) 2017. doi: 10.1016/B978-0-12-804638-8.01001-9 4. O Sotolongo-Costa, A Posadas, Phys Rev Lett 92 (2004) 048501 5. R Silva, G França, C Vilar, J Alcaniz, Phys Rev E 73 (2006) 026102 6. N Sarlis, E Skordas, P Varotsos, Phys Rev E 82 (2010) 021110 7. L Telesca, Bull Seismol Soc Am 102 (2012) 886-891 8. P Varotsos, N Sarlis, E Skordas, Natural Time Analysis: The new view of time. (Springer, Berlin) 2011. doi: 10.1007/978-3-642-16449-1 9. P Varotsos, N Sarlis, E Skordas, J Geophys Res Space Physics 119 (2014) 9192. 10. N Sarlis, E Skordas, P Varotsos, T Nagao, M Kamogawa, H Tanaka, S Uyeda, Proc Natl Acad Sci USA 110 (2013) 13734. 11. P Varotsos, N Sarlis, E Skordas, M Lazaridou-Varotsos, Earthq Sci 30 (2017) doi: 10.1007/s11589-017-0189-0 12. P Varotsos, N Sarlis, E Skordas, Earthq Sci 30 (2017) doi: 10.1007/s11589-017-0182-7

Extensive decarbonation of continuously hydrated subducting slabs

NASA Astrophysics Data System (ADS)

Arzilli, F.; Burton, M. R.; La Spina, G.; Macpherson, C.

2016-12-01

CO2 release from subducting slabs is a key element of Earth's carbon cycle, consigning slab carbon either to mantle burial or recycling to the surface through arc volcanism, however, what controls subducted carbon's fate is poorly understood. Fluids mobilized by devolatilization of subducting slabs play a fundamental role in the melting of mantle wedges and in global geochemical cycles [1]. The effect of such fluids on decarbonation in subducting lithologies has been investigated recently [2-5] but mechanisms of carbon transfer from the slab to wedge are poorly understood [2-6]. Several thermodynamic models [2-3], and experimental studies [6] suggest that carbon-bearing phases are stable at sub-arc depths (80-140 km; 2.6-4.5 GPa), implying that this carbon can be subducted to mantle depths of >140 km. This is inconsistent with observations of voluminous CO2 release from arc volcanoes [7-10], located above slabs that are at 2.6-4.5 GPa pressure. Here, we show that continuous hydrated of sediment veneers on subducting slabs by H2O released from oceanic crust and serpentinised mantle lithosphere [11-13], produces extensive slab decarbonation over a narrow, sub-arc pressure range, even for low temperature subduction pathways. This explains the location of CO2-rich volcanism, quantitatively links the sedimentary composition of slab material to the degree of decarbonation and greatly increases estimates for the magnitude of carbon flux through the arc in subduction zones. [1] Hilton, D.R. et al. (2002) Rev. Mineral. Geochem. 47, 319-370. [2] Gorman, P.J. et al. (2006) Geochem. Geophys. Geosyst. 7. [3] Kerrick, D.M. and Connolly, J.A.D. (2001) Nature 411, 293-296. [4] Cook-Kollars, J. et al. (2014) Chem. Geol. 386, 31-48. [5] Collins, N.C. et al. (2015) Chem. Geol. 412, 132-150. [6] Poli, S. et al. (2009) Earth Planet. Sci. Lett. 278, 350-360. [7] Sano, Y. and Williams, S.N. (1996) Geophys. Res. Lett. 23, 2749-2752. [8] Marty, B. and Tolstikhin, I.N. (1998) Chem. Geol. 145, 233-248. [9] Wallace, P.J. (2005) J. Volcanol. Geoth. Res. 140, 217-240. [10] Burton, M.R. et al. (2013) Rev. Mineral. Geochem. 75, 323-354. [11] Ulmer, P. and Trommsdorff, V. (1995) Science 268, 858-861. [12] Schmidt, M.W. and Poli, S. (1998) Earth Planet. Sci. Lett. 163, 361-379. [13] van Keken, P. E. et al. (2011) J. Geophys. Res. 116.

Reactive high power impulse magnetron sputtering

NASA Astrophysics Data System (ADS)

Gudmundsson, J. T.; Magnus, F.; Tryggvason, T. K.; Sveinsson, O. B.; Olafsson, S.

2012-10-01

Here we discuss reactive high power impulse magnetron sputtering sputtering (HiPIMS) [1] of Ti target in an Ar/N2 and Ar/O2 atmosphere. The discharge current waveform is highly dependent on both the pulse repetition frequency and discharge voltage. The discharge current increases with decreasing frequency or voltage. This we attribute to an increase in the secondary electron emission yield during the self-sputtering phase of the pulse, as nitride [2] or oxide [3] forms on the target. We also discuss the growth of TiN films on SiO2 at temperatures of 22-600 ^oC. The HiPIMS process produces denser films at lower growth temperature and the surface is much smoother and have a significantly lower resistivity than dc magnetron sputtered films on SiO2 at all growth temperatures due to reduced grain boundary scattering [4].[4pt] [1] J. T. Gudmundsson, N. Brenning, D. Lundin and U. Helmersson, J. Vac. Sci. Technol. A, 30 030801 (2012)[0pt] [2] F. Magnus, O. B. Sveinsson, S. Olafsson and J. T. Gudmundsson, J. Appl. Phys., 110 083306 (2011)[0pt] [3] F. Magnus, T. K. Tryggvason, S. Olafsson and J. T. Gudmundsson, J. Vac. Sci. Technol., submitted 2012[0pt] [4] F. Magnus, A. S. Ingason, S. Olafsson and J. T. Gudmundsson, IEEE Elec. Dev. Lett., accepted 2012

Dynamics of δ-dopant redistribution during heterostructure growth

NASA Astrophysics Data System (ADS)

Pankratov, E. L.

2007-06-01

It has recently been shown that growth of a multilayer structure with one or more delta-layers at high temperature leads to spreading and asymmetrization of the dopant distribution [see, for example, E.F.J. Schubert, Vac. Sci. Technol. A. 8, 2980 (1990), A.M. Nazmul, S. Sugahara, M. Tanaka, J. Crystal Growth 251, 303 (2003); R.C. Newman, M.J. Ashwin, M.R. Fahy, L. Hart, S.N. Holmes, C. Roberts, X. Zhang, Phys. Rev. B 54, 8769 (1996); E.F. Schubert, J.M. Kuo, R.F. Kopf, H.S. Luftman, L.C. Hopkins, N.J. Sauer, J. Appl. Phys. 67, 1969 (1990); P.M. Zagwijn, J.F. van der Veen, E. Vlieg, A.H. Reader, D.J. Gravesteijn, J. Appl. Phys. 78, 4933 (1995); W.S. Hobson, S.J. Pearton, E.F. Schubert, G. Cabaniss, Appl. Phys. Lett. 55, 1546 (1989); Delta Doping of Semiconductors, edited by E.F. Schubert (Cambridge University Press, Cambridge, 1996); Yu.N. Drozdov, N.B. Baidus', B.N. Zvonkov, M.N. Drozdov, O.I. Khrykin, V.I. Shashkin, Semiconductors 37, 194 (2003); E. Skuras, A.R. Long, B. Vogele, M.C. Holland, C.R. Stanley, E.A. Johnson, M. van der Burgt, H. Yaguchi, J. Singleton, Phys. Rev. B 59, 10712 (1999); G. Li, C. Jagadish, Solid-State Electronics 41, 1207 (1997)]. In this work analytical and numerical analysis of dopant dynamics in a delta-doped area of a multilayer structure has been accomplished using Fick's second law. Some reasons for asymmetrization of a delta-dopant distribution are illustrated. The spreading of a delta-layer has been estimated using example materials of a multilayer structure, a delta-layer and an overlayer.

A Rigorous Sharp Interface Limit of a Diffuse Interface Model Related to Tumor Growth

NASA Astrophysics Data System (ADS)

Rocca, Elisabetta; Scala, Riccardo

2017-06-01

In this paper, we study the rigorous sharp interface limit of a diffuse interface model related to the dynamics of tumor growth, when a parameter ɛ, representing the interface thickness between the tumorous and non-tumorous cells, tends to zero. More in particular, we analyze here a gradient-flow-type model arising from a modification of the recently introduced model for tumor growth dynamics in Hawkins-Daruud et al. (Int J Numer Math Biomed Eng 28:3-24, 2011) (cf. also Hilhorst et al. Math Models Methods Appl Sci 25:1011-1043, 2015). Exploiting the techniques related to both gradient flows and gamma convergence, we recover a condition on the interface Γ relating the chemical and double-well potentials, the mean curvature, and the normal velocity.

Contributions from the data samples in NOC technique on the extracting of the Sq variation

NASA Astrophysics Data System (ADS)

Wu, Yingyan; Xu, Wenyao

2015-04-01

The solar quiet daily variation, Sq, a rather regular variation is usually observed at mid-low latitudes on magnetic quiet days or less-disturbed days. It is mainly resulted from the dynamo currents in the ionospheric E region, which are driven by the atmospheric tidal wind and different processes and flow as two current whorls in each of the northern and southern hemispheres[1]. The Sq exhibits a conspicuous day-to-day (DTD) variability in daily range (or strength), shape (or phase) and its current focus. This variability is mainly attributed to changes in the ionospheric conductivity and tidal winds, varying with solar radiation and ionospheric conditions. Furthermore, it presents a seasonal variation and solar cycle variation[2-4]. In generally, Sq is expressed with the average value of the five international magnetic quiet days. Using data from global magnetic stations, equivalent current system of daily variation can be constructed to reveal characteristics of the currents[5]. In addition, using the differences of H component at two stations on north and south side of the Sq currents of focus, Sq is extracted much better[6]. Recently, the method of Natural Orthoganal Components (NOC) is used to decompose the magnetic daily variation and express it as the summation of eigenmodes, and indicate the first NOC eigenmode as the solar quiet daily variation, the second as the disturbance daily variation[7-9]. As we know, the NOC technique can help reveal simpler patterns within a complex set of variables, without designed basic-functions such as FFT technique. But the physical explanation of the NOC eigenmodes is greatly depends on the number of data samples and data regular-quality. Using the NOC method, we focus our present study on the analysis of the hourly means of the H component at BMT observatory in China from 2001 to 2008. The contributions of the number and the regular-quality of the data samples on which eigenmode corresponds to the Sq are analyzed, by using different number of data sample from 5 to 365. The result shows the first eigenmode expresses the Sq in most cases. 1.Campbell, W, Introduction to Geomagnetic Fields, Cambridge Univ. Press, New York. 1997 2.Hasegawa, M, Geomagnetic Sq current system, J. Geophys. Res., 1960, 65: 1437~ 1447 3.Tarpley J D. The Ionospheric wind dynanmo 2 solar tides. Planet. Space Sci., 1970, 18: 1091~ 1103 4.Richmond A D. Modeling the ionospheric wind dynamo a review. Pure Appl. Geophys., 1989, 131: 413 ~ 435 5.Suzuki, A., and H. Maeda (1978), Equivalent current systems of the daily geomagnetic variations in December 1964, Data Book No. 1, World Data Center C2 for Geomagnetic. 6.Hibberd, F H. Day-to-day variability of the Sq geomagnetic field variation, Aust. J. Phys., 1981, 34: 81~ 90 7.Xu, W.-Y., and Y. Kamide (2004), Decomposition of daily geomagnetic variation by using method of natural orthogonal component, J. Geophys. Res., 109(A5), A05218, doi:10.1029/2003JA010216. 8.Chen G X, Xu W Y, Du A M, and et al, Statistical characteristics of the day-to-day variability in the geomagnetic Sq field, J. Geophys. Res.,2007, 112, A06320, doi:10.1029/2006JA012059 9.Michelis P. De. Principal components' features of mid-latitude geomagnetic daily variation. Ann. Geophys., 2010,28: 1-14

Recent development of transcatheter closure of atrial septal defect and patent foramen ovale with occluders.

PubMed

Tang, Baiyu; Su, Feng; Sun, Xiangke; Wu, Qin; Xing, Quansheng; Li, Suming

2018-01-01

Atrial septal defect (ASD) and patent foramen ovale (PFO) are common clinical congenital heart defects. As an effective method for the treatment of ASD and PFO, transcatheter closure with occluders presents many advantages, including safety, ease of operation, minimal invasiveness, and reduced complications. This contribution reviews the various types of occluders currently used in clinical applications and under development, including non degradable occluders, partially degradable occluders, and totally degradable occluders. A number of case studies are described in detail. Comparison is made on the treatment outcomes using different occulders. Future development of transcatheter closure is discussed, in particular the use of totally degradable occluders. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 106B: 433-443, 2018. © 2016 Wiley Periodicals, Inc.

Calculating correlated color temperatures across the entire gamut of daylight and skylight chromaticities.

PubMed

Hernández-Andrés, J; Lee, R L; Romero, J

1999-09-20

Natural outdoor illumination daily undergoes large changes in its correlated color temperature (CCT), yet existing equations for calculating CCT from chromaticity coordinates span only part of this range. To improve both the gamut and accuracy of these CCT calculations, we use chromaticities calculated from our measurements of nearly 7000 daylight and skylight spectra to test an equation that accurately maps CIE 1931 chromaticities x and y into CCT. We extend the work of McCamy [Color Res. Appl. 12, 285-287 (1992)] by using a chromaticity epicenter for CCT and the inverse slope of the line that connects it to x and y. With two epicenters for different CCT ranges, our simple equation is accurate across wide chromaticity and CCT ranges (3000-10(6) K) spanned by daylight and skylight.

Biocompatibility and mechanical properties of diamond-like coatings on cobalt-chromium-molybdenum steel and titanium-aluminum-vanadium biomedical alloys.

PubMed

Hinüber, C; Kleemann, C; Friederichs, R J; Haubold, L; Scheibe, H J; Schuelke, T; Boehlert, C; Baumann, M J

2010-11-01

Diamond-like carbon (DLC) films are favored for wear components because of diamond-like hardness, low friction, low wear, and high corrosion resistance (Schultz et al., Mat-wiss u Werkstofftech 2004;35:924-928; Lappalainen et al., J Biomed Mater Res B Appl Biomater 2003;66B:410-413; Tiainen, Diam Relat Mater 2001;10:153-160). Several studies have demonstrated their inertness, nontoxicity, and the biocompatibility, which has led to interest among manufacturers of surgical implants (Allen et al., J Biomed Mater Res B Appl Biomater 2001;58:319-328; Uzumaki et al., Diam Relat Mater 2006;15:982-988; Hauert, Diam Relat Mater 2003;12:583-589; Grill, Diam Relat Mater 2003;12:166-170). In this study, hydrogen-free amorphous, tetrahedrally bonded DLC films (ta-C) were deposited at low temperatures by physical vapor deposition on medical grade Co28Cr6Mo steel and the titanium alloy Ti6Al4V (Scheibe et al., Surf Coat Tech 1996;85:209-214). The mechanical performance of the ta-C was characterized by measuring its surface roughness, contact angle, adhesion, and wear behavior, whereas the biocompatibility was assessed by osteoblast (OB) attachment and cell viability via Live/Dead assay. There was no statistical difference found in the wettability as measured by contact angle measurements for the ta-C coated and the uncoated samples of either Co28Cr6Mo or Ti6Al4V. Rockwell C indentation and dynamic scratch testing on 2-10 μm thick ta-C films on Co28Cr6Mo substrates showed excellent adhesion with HF1 grade and up to 48 N for the critical load L(C2) during scratch testing. The ta-C coating reduced the wear from 3.5 × 10(-5) mm(3)/Nm for an uncoated control sample (uncoated Co28Cr6Mo against uncoated stainless steel) to 1.1 × 10(-7) mm(3)/Nm (coated Co28Cr6Mo against uncoated stainless steel) in reciprocating pin-on-disk testing. The lowest wear factor of 3.9 × 10(-10) mm(3)/Nm was measured using a ta-C coated steel ball running against a ta-C coated and polished Co28Cr6Mo disk. Student's t-test found that the ta-C coating had no statistically significant (p < 0.05) effect on OB attachment, when compared with the uncoated control samples. There was no significant difference (p < 0.05) in the Live/Dead assay results in cell death between the ta-C coated Co28Cr6Mo and Ti6Al4V samples and the uncoated controls. Therefore, these ta-C coatings show improved wear and corrosion (Dorner-Reisel et al., Diam Relat Mater 2003;11:823-827; Affato et al., J Biomed Mater Res B Appl Biomater 2000;53:221-226; Dorner-Reisel et al., Surf Coat Tech 2004;177-178:830-837; Kim et al., Diam Relat Mater 2004;14:35-41) performance and excellent in vitro cyto-compatibility, when compared with currently used uncoated Co28Cr6Mo and Ti6Al4V implant materials.

Melting curve of materials: theory versus experiments

NASA Astrophysics Data System (ADS)

Alfè, D.; Vocadlo, L.; Price, G. D.; Gillan, M. J.

2004-04-01

A number of melting curves of various materials have recently been measured experimentally and calculated theoretically, but the agreement between different groups is not always good. We discuss here some of the problems which may arise in both experiments and theory. We also report the melting curves of Fe and Al calculated recently using quantum mechanics techniques, based on density functional theory with generalized gradient approximations. For Al our results are in very good agreement with both low pressure diamond-anvil-cell experiments (Boehler and Ross 1997 Earth Planet. Sci. Lett. 153 223, Hänström and Lazor 2000 J. Alloys Compounds 305 209) and high pressure shock wave experiments (Shaner et al 1984 High Pressure in Science and Technology ed Homan et al (Amsterdam: North-Holland) p 137). For Fe our results agree with the shock wave experiments of Brown and McQueen (1986 J. Geophys. Res. 91 7485) and Nguyen and Holmes (2000 AIP Shock Compression of Condensed Matter 505 81) and the recent diamond-anvil-cell experiments of Shen et al (1998 Geophys. Res. Lett. 25 373). Our results are at variance with the recent calculations of Laio et al (2000 Science 287 1027) and, to a lesser extent, with the calculations of Belonoshko et al (2000 Phys. Rev. Lett. 84 3638). The reasons for these disagreements are discussed.

Analysis of Complex Carbohydrate Composition in Plant Cell Wall Using Fourier Transformed Mid-Infrared Spectroscopy (FT-IR).

PubMed

Badhan, Ajay; Wang, Yuxi; McAllister, Tim A

2017-01-01

Fourier transformed mid-infrared spectroscopy (FTIR) is a powerful tool for compositional analysis of plant cell walls (Acebes et al., Front Plant Sci 5:303, 2014; Badhan et al., Biotechnol Biofuels 7:1-15, 2014; Badhan et al., BioMed Res Int 2015: 562952, 2015; Roach et al., Plant Physiol 156:1351-1363, 2011). The infrared spectrum generates a fingerprint of a sample with absorption peaks corresponding to the frequency of vibrations between the bonds of the atoms making up the material. Here, we describe a method focused on the use of FTIR in combination with principal component analysis (PCA) to characterize the composition of the plant cell wall. This method has been successfully used to study complex enzyme saccharification processes like rumen digestion to identify recalcitrant moieties in low-quality forage which resist rumen digestion (Badhan et al., BioMed Res Int 2015: 562952, 2015), as well as to characterize cell wall mutant lines or transgenic lines expressing exogenous hydrolases (Badhan et al., Biotechnol Biofuels 7:1-15, 2014; Roach et al., Plant Physiol 156:1351-1363, 2011). The FTIR method described here facilitates high-throughput identification of the major compositional differences across a large set of samples in a low cost and nondestructive manner.

Ultraviolet imaging of planetary nebulae with GALEX

NASA Astrophysics Data System (ADS)

Bianchi, Luciana; Thilker, David

2018-05-01

Over four hundred Galactic Planetary Nebulae (PNe) have been imaged by GALEX in two ultraviolet (UV) bands, far-UV (FUV, 1344-1786 Å, λ _{eff}= 1528 Å) and near-NUV (NUV, 1771-2831 Å, λ _{eff} = 2271 Å). We present examples of extended PNe, for which UV spectroscopy is also available, to illustrate the variety in UV morphology and color, which reflects ionization conditions. The depth of the GALEX imaging varies from flux ≈ 0.4/5× 10 ^{-18} ergs cm^{-2} s^{-1} Å^{-1} \\square ^'' -1} (FUV/NUV) for exposures of the order of ˜ 100 seconds, typical of the survey with the largest area coverage, to ˜ 0.3/8.3× 10^{-19} ergs cm^{-2} s^{-1} Å^{-1} \\square ^'' -1} (FUV/NUV) for ˜ 1500 sec exposures, typical of the second largest survey (see Bianchi in Astrophys. Space Sci. 320:11, 2009; Bianchi et al. in Adv. Space Res. 53:900, 2014). GALEX broad-band FUV and NUV fluxes include nebular emission lines and in some cases nebular continuum emission. The sensitivity of the GALEX instrument and the low sky background, especially in FUV, enable detection and mapping of very faint ionization regions and fronts, including outermost wisps and bow shocks. The FUV-NUV color of the central star provides a good indication of its T_{eff}, because the GALEX FUV-NUV color is almost reddening-free for Milky Way type dust (Bianchi et al. in Astrophys. J. Suppl. Ser. 230:24, 2017; Bianchi in Astrophys. Space Sci. 335:51, 2011, Bianchi in Astrophys. Space Sci. 354:103, 2014) and it is more sensitive to hot temperatures than optical colors.

Reactive Gaseous Mercury Formation Over The North Pacific Ocean: Influence Of Environmental Parameters On Elemental Mercury Oxidation In The Marine Boundary Layer

NASA Astrophysics Data System (ADS)

Laurier, F. J.

2002-12-01

Global mercury models have identified wet and dry particle deposition and evasion of dissolved gaseous mercury from the ocean and from land as key controls over global mercury cycling (1,2). Recent ocean studies (3,4) however, have indicated that estimated mercury evasion rates from the ocean substantially exceed estimated deposition. Oxidized reactive gaseous mercury species (RGHg) are now known to play a major role in the global mercury cycle (2,5). RGHg species are water-soluble, exhibit a much shorter atmospheric lifetime than elemental mercury, and contribute to a large extent to atmospheric mercury deposition (2,3,6). Although recent global mercury models have accounted for the dry deposition of RGHg derived from point source emissions (6,7), the formation and deposition of RGHg in remote areas have not been incorporated. We suggest that the oxidation of elemental mercury over the ocean, by gas phase or heterogeneous reactions, is an important part the global mercury cycle. In agreement with previous studies (3,8,9) our recent data from atmospheric collections over the North Pacific Ocean support the notion of enhanced oxidation in the marine boundary layer. Our results show an inverse correlation between RGHg production and ozone, and a diurnal cycle with highest concentrations during periods of highest UV irradiation. In addition, the relationship between RGHg and other parameters measured during the cruise will be discussed. Our results clearly show that RGHg deposition to the ocean must be an important Hg source, and a crucial part of the global Hg cycle. (1) Mason R.P., Fitzgerald W.F., and Morel F.M.M. (1994), The biogeochemical cycling of elemental mercury: Anthropogenic influences, Geochim. Cosmochim. Acta, 58: 3191-3198 (2) Shia R.L., Seigneur C., Pai P., Ko M., and Sze N.-D. (1999), Global simulation of atmospheric mercury concentrations and deposition fluxes, J. Geophy. Res., 104(D19), 23, 747-23, 760 (3) Mason, R.P., Lawson N.M., and Sheu G.-R. (2001), Mercury in the Atlantic Ocean: factors controlling air-sea exchange of mercury and its distribution in the upper water, Deep-Sea Res. II, 2829-2853 (4) Lamborg, C.H., Rolfus K.R., and Fitzgerald W.F. (1999), The atmospheric cycling and air-sea exchange of mercury species in the south and equatorial Atlantic Ocean, Deep-Sea Res. II, 957-977 (5) Lindberg S.E., Brooks S., Lin C.-J., Scott K. J., Landis M. S., Stevens R.K., Goodsite M., and Richter A. (2002), Dynamic oxidation of gaseous mercury in the arctic troposphere at polar sunrise, Environ. Sci. Technol., 1245-1256 (6) Bullock O.R. (2000), Modeling assessment of transport and deposition patterns of anthropogenic mercury air emissions in the United States and Canada, Sci Total Environ., 259(1-3), 145-157 (7) Xu X., Yang X., Miller d.R., Helble J.J., and Carley R.J. (2000), a regional scale modelling study of atmospheric transport and formation of mercury. II. Simulation results for the northeast United states, Atmos. Environ., 34: 4945-4955 (8) Sheu G.-R. (2001), Speciation and distribution of atmospheric mercury: Significance of reactive gaseous mercury in the global mercury cycle. PhD. thesis, University of Maryland, College park, pp. 170 (9) Guentzel J.L., Landing W.M., Gill G.A., and Pollman C.D. (2001), Processes influencing rainfall deposition of mercury in Florida, Environ. Sci. Technol., 35: 863-873

Hydrated Minerals in Circumpolar Terrains: Geographic Distribution, Mineralogical Composition and Possible Origins

NASA Astrophysics Data System (ADS)

Langevin, Y.; Poulet, F.; Fishbaugh, K. E.; Roach, L.; Vincendon, M.; Gondet, B.; Bibring, J.; Murchie, S.

2007-12-01

The nearly global mapping provided at a scale of a few km by the OMEGA Vis/NIR imaging spectrometer on board Mars Express revealed that hydrated minerals on Mars are mostly observed in ancient terrains (Bibring et al., 2005). These discoveries led to the conclusion that surface water on Mars was mainly present early in the history of the planet, and that Mars has remained cold and dry during the last 3 billion years (Bibring et al., 2006). The observation by OMEGA of a very strong calcium sulfate signature (most likely dominated by gypsum) within the boundaries of the Olympia Planitia Dune field (Langevin et al., 2005) is a major puzzle as this geological feature is at most a few 100 m.y. old. An independent analysis of the OMEGA data (Horgan et al. 2007) confirmed the results of Langevin et al. (2005), in particular the identification of gypsum as the dominant mineralogical hydrated species in the dune field. The extended region richest in gypsum (~ 60 km x 200 km) remained unresolved at a resolution of 1 km/pixel (Langevin et al., 2006). With its 20 m resolution, CRISM, the Vis/NIR imaging spectrometer on board MRO, secured the relationship between the gypsum signature and the dune field as well as its absence over the "basal unit" (only a few pixels wide in OMEGA data) which is exposed between the dune field and the ice (Roach et al., 2007). CRISM showed that the gypsum signatures were highest over dune crests and weakest over exposed bedrock. Mineralogical modeling of the CRISM and OMEGA spectra shows that Gypsum represents at least 60% of the dune material in the eastern part of the Olympia field and decreases towards the western part. This lower limit has been raised since then by accounting for aerosol contributions which reduce the strength of absorption bands. The low albedo (< 20%) requires significant intimate and/or intra- mixture of dark material. The low thermal inertia (Herkenhoff and Vasavada, 1999) is difficult to reconcile with morphologic evidence for induration (Schatz et al., 2006). Weaker occurrences of the 1.93 µm OH stretch band have been observed in other northern and southern circumpolar locations. Sulfates and hydrated oxides provide much better matches for these signatures than phyllosilicates. The formation of large amounts of hydrated sulfates in the relatively young northern circumpolar terrains requires a source of sulfur (already present in soils? volcanic activity?) as well as water, which most likely is provided by outflows from the nearby polar cap (Fishbaugh et al., 2007). This process for generating hydrated minerals is distinct from that which was active during the first few hundred million years of the history of the planet. Bibring et al., Science 307, p. 1576-1581 (2005); Bibring et al., Science 312, p. 400-404 (2006); Feldman et al., Lunar Planet. Sci. 38 #2311 (2007); Fishbaugh et al., J. Geophys. Res. 112, E07002 (2007); Herkenhoff and Vasavada, J. Geophys. Res. 104, 16484. Horgan et al., 7th Int. Conf. on Mars #3241 (2007); Langevin et al., Science 307, p. 1581-1583 ; Langevin et al., Lunar Planet. Sci. 36 #1652 (2005) ; Roach et al., Lunar Planet. Sci. 38 #1970 (2007) ; Schatz et al., J. Geophys. Res. 111, E04006 (2006).

Water vapor in Titan's stratosphere from Cassini CIRS far-infrared spectra

NASA Astrophysics Data System (ADS)

Cottini, V.; Nixon, C. A.; Jennings, D. E.; Anderson, C. M.; Gorius, N.; Bjoraker, G. L.; Coustenis, A.; Teanby, N. A.; Achterberg, R. K.; Bézard, B.; de Kok, R.; Lellouch, E.; Irwin, P. G. J.; Flasar, F. M.; Bampasidis, G.

2012-08-01

Here we report the measurement of water vapor in Titan's stratosphere using the Cassini Composite Infrared Spectrometer (CIRS, Flasar, F.M. et al. [2004]. Space Sci. Rev. 115, 169-297). CIRS senses water emissions in the far infrared spectral region near 50 μm, which we have modeled using two independent radiative transfer codes (NEMESIS (Irwin, P.G.J. et al. [2008]. J. Quant. Spectrosc. Radiat. Trans. 109, 1136-1150) and ART (Coustenis, A. et al. [2007]. Icarus 189, 35-62; Coustenis, A. et al. [2010]. Icarus 207, 461-476). From the analysis of nadir spectra we have derived a mixing ratio of 0.14 ± 0.05 ppb at an altitude of 97 km, which corresponds to an integrated (from 0 to 600 km) surface normalized column abundance of 3.7 ± 1.3 × 1014 molecules/cm2. In the latitude range 80°S to 30°N we see no evidence for latitudinal variations in these abundances within the error bars. Using limb observations, we obtained mixing ratios of 0.13 ± 0.04 ppb at an altitude of 115 km and 0.45 ± 0.15 ppb at an altitude of 230 km, confirming that the water abundance has a positive vertical gradient as predicted by photochemical models (e.g. Lara, L.M., Lellouch, F., Lopez-Moreno, J.J., Rodrigo, R. [1996]. J. Geophys. Res. 101(23), 261; Wilson, E.H., Atreya, S.K. [2004]. J. Geophys. Res. 109, E6; Hörst, S.M., Vuitton, V., Yelle, R.V. [2008]. J. Geophys. Res., 113, E10). We have also fitted our data using scaling factors of ˜0.1-0.6 to these photochemical model profiles, indicating that the models over-predict the water abundance in Titan's lower stratosphere.

Thermodynamic and Thermoelastic properties of the NAL Phase

NASA Astrophysics Data System (ADS)

Marcondes, M. L.; Yao, C.; Wu, Z.; Wentzcovitch, R.

2017-12-01

Subduction of Mid Ocean Ridge Basalt (MORB) transports crust elements to the deep Earth. Therefore, it is important to study MORB in order to understand geophysical processes in the mantle. The high Al2O3 content of the MORB gives rise to a new aluminous phase (NAL) that constitutes up to 25% of its composition [1]. Phase equilibrium study of MgAl2O4-CaAl2O4 generated the mineral CaMg2Al6O12 with hexagonal symmetry, which was proposed for the NAL phase [2,3]. The NAL chemical composition, however, shows significantly less calcium [1,4] and several compositions have been considered in previous studies of this phase [5,6]. Here we present an ab initio study of NAL phases at high temperatures with several possible compositions. We used the quasiharmonic approximation to address thermodynamic and thermoelastic properties and seismic velocities of this phase as function of composition. References[1] T. Irifune and A. E. Ringwood, Earth Planet. Sci. Lett. 117, 101 (1993). [2] H. Miura, Y. Hamada, T. Suzuki, M. Akaogi, N. Miyajima, and K. Fujino, Am. Mineral. 85, 1799 (2000). [3] M. Akaogi, Y. Hamada, T. Suzuki, M. Kobayashi, and M. Okada, Phys. Earth Planet. Inter. 115, 67 (1999). [4] A. Ricolleau, J. P. Perrillat, G. Fiquet, I. Daniel, J. Matas, A. Addad, N. Menguy, H. Cardon, M. Mezouar, and N. Guignot, J. Geophys. Res. Solid Earth 115, B08202 (2010). [5] M. Mookherjee, B. B. Karki, L. Stixrude, and C. Lithgow-Bertelloni, Geophys. Res. Lett. 39, L19306 (2012). [6] K. Kawai and T. Tsuchiya, Geophys. Res. Lett. 37, L17302 (2010).

Modeling serotonin uptake in the lung shows endothelial transporters dominate over cleft permeation

PubMed Central

Bassingthwaighte, James B.

2013-01-01

A four-region (capillary plasma, endothelium, interstitial fluid, cell) multipath model was configured to describe the kinetics of blood-tissue exchange for small solutes in the lung, accounting for regional flow heterogeneity, permeation of cell membranes and through interendothelial clefts, and intracellular reactions. Serotonin uptake data from the Multiple indicator dilution “bolus sweep” experiments of Rickaby and coworkers (Rickaby DA, Linehan JH, Bronikowski TA, Dawson CA. J Appl Physiol 51: 405–414, 1981; Rickaby DA, Dawson CA, and Linehan JH. J Appl Physiol 56: 1170–1177, 1984) and Malcorps et al. (Malcorps CM, Dawson CA, Linehan JH, Bronikowski TA, Rickaby DA, Herman AG, Will JA. J Appl Physiol 57: 720–730, 1984) were analyzed to distinguish facilitated transport into the endothelial cells (EC) and the inhibition of tracer transport by nontracer serotonin in the bolus of injectate from the free uninhibited permeation through the clefts into the interstitial fluid space. The permeability-surface area products (PS) for serotonin via the inter-EC clefts were ∼0.3 ml·g−1·min−1, low compared with the transporter-mediated maximum PS of 13 ml·g−1·min−1 (with Km = ∼0.3 μM and Vmax = ∼4 nmol·g−1·min−1). The estimates of serotonin PS values for EC transporters from their multiple data sets were similar and were influenced only modestly by accounting for the cleft permeability in parallel. The cleft PS estimates in these Ringer-perfused lungs are less than half of those for anesthetized dogs (Yipintsoi T. Circ Res 39: 523–531, 1976) with normal hematocrits, but are compatible with passive noncarrier-mediated transport observed later in the same laboratory (Dawson CA, Linehan JH, Rickaby DA, Bronikowski TA. Ann Biomed Eng 15: 217–227, 1987; Peeters FAM, Bronikowski TA, Dawson CA, Linehan JH, Bult H, Herman AG. J Appl Physiol 66: 2328–2337, 1989) The identification and quantitation of the cleft pathway conductance from these studies affirms the importance of the cleft permeation. PMID:23645496

Self-Organized Composition Modulation During Epitaxial Growth

NASA Astrophysics Data System (ADS)

Barabási

1998-03-01

There is extensive recent experimental evidence of spontaneous superlattice (SL) formation in various II-VI and III-V semiconductors. Here we propose an atomistic mechanism responsible for SL formation, and derive a relation predicting the temperature, flux and miscut dependence of the SL layer thickness(A.-L. Barabási, Appl. Phys. Lett.) 70, 764 (1996).. Moreover, the model explains the existence of a critical miscut angle below which no SL is formed, in agreement with results on ZnSeTe(S.P Ahrenkiel et al.), Phys. Rev. Lett. 75, 1586 (1995)., and predicts the formation of a platelet structure for deposition onto high symmetry surfaces, similar to that observed in InAsSb(A.G. Norman, et al.) Semicond. Sci. Technol. 8, S9 (1991).. Work done in collaboration with I. Daruka and J.K. Furdyna.

A Hele-Shaw-Cahn-Hilliard Model for Incompressible Two-Phase Flows with Different Densities

NASA Astrophysics Data System (ADS)

Dedè, Luca; Garcke, Harald; Lam, Kei Fong

2017-07-01

Topology changes in multi-phase fluid flows are difficult to model within a traditional sharp interface theory. Diffuse interface models turn out to be an attractive alternative to model two-phase flows. Based on a Cahn-Hilliard-Navier-Stokes model introduced by Abels et al. (Math Models Methods Appl Sci 22(3):1150013, 2012), which uses a volume-averaged velocity, we derive a diffuse interface model in a Hele-Shaw geometry, which in the case of non-matched densities, simplifies an earlier model of Lee et al. (Phys Fluids 14(2):514-545, 2002). We recover the classical Hele-Shaw model as a sharp interface limit of the diffuse interface model. Furthermore, we show the existence of weak solutions and present several numerical computations including situations with rising bubbles and fingering instabilities.

Dust Plasma Environment between Saturn's Rings and Mimas' L Shell

NASA Astrophysics Data System (ADS)

Sittler, E. C., Jr.; Johnson, R. E.

2015-12-01

We will present a new analysis of the available data on the extension of Saturn's ring atmosphere into the magnetosphere beyond the A-ring outer edge (Johnson et al. 2006) out to the orbit of Mimas. This is an interesting region in Saturn's magnetosphere containing the F and G rings and penetrated by the E-ring and the Enceladus neutral torus. This analysis will include a comparison of the Cassini Plasma Spectrometer (CAPS) plasma data, Radio and Plasma Wave Spectrometer (RPWS) plasma wave observations, RPWS Langmuir Probe (LP) observations and Cassini Dust Analyzer (CDA). The central focus will be on the dust plasma interactions. Specific attention will be paid to the SOI data for which there are considerable differences between the ion and electron densities (Elrod et al., 2012) while for other close flybys inside Mimas' L shell such differences are less obvious but the electron data appear to be highly variable. Using previous identifications of nm particles (Jones et al., 2010) inferred from CAPS data and micron sized particles that can be detected by CDA (Kempf et al., 2006) and the RPWS plasma wave dust impact signatures (Kurth et al., 2006) we will attempt to infer the full particle size distribution between the A-ring and Mimas. These nm to micron sized particles can accumulate considerable charge and under certain circumstances could account for the radial trend in the ion density described in Elrod et al. (2014) a critical issue in preparation for the Cassini proximal orbits. References: Elrod, M.K., W.-L. Tseng, R.J. Wilson, R.E. Johnson, J. Geophys. Res., 117, A03207, 2012. Elrod, M.K., W-L Tseng, A.K. Woodson, R.E. Johnson, Icarus, 242, 130-137,2014. Johnson, R. E., et al., Icarus, 180, 393-402, 2006. Jones, G. H., et al., Geophys. Res. Lett., 36, L16204, 2009. Kempf, S., U. Beckmann, R. Srama, M. Horanyi, S. Auerd, E. Grun, Planet. Space Sci., 54, 999-1006, 2006. Kurth, W. S., T.F. Averkamp, D.A. Gurnett, Z. Wang, Planet. Space Sci., 54, 988-998, 2006.

Ocean Compositions on Europa and Ganymede

NASA Astrophysics Data System (ADS)

Leitner, M. A.; Bothamy, N.; Choukroun, M.; Pappalardo, R. T.; Vance, S.

2014-12-01

The ocean compositions of icy Galilean satellites Europa and Ganymede are highly uncertain. Spectral observations of the satellites' surfaces provide clues for the interior composition. Putative sulfate hydration features in Galileo near-infrared reflectance spectra suggest fractionation of Na and Mg sulfates from a subsurface reservoir (McCord et al. 1998, Sci. 278, 271; McCord et al. 1998, Sci. 280, 1242; Dalton et al. 2005, Icarus, 177, 472). Recent spatially resolved spectral mapping of Europa hints at possible partitioning of near-surface brines in Europa's low-lying planes (Shirley et al. 2010; Icarus, 210, 358; Dalton et al. 2012; J. Geophys. Res. 117, E03003). Surface materials can be modified by the delivery of material from impacts and Io's active volcanoes as well as intense irradiation from Jupiter's magnetic field interaction with the jovian magnetosphere. These factors, combined with observations of high Cl/K ratios in Europa's exosphere, have led other investigators to suggest that Europa's ocean is dominated by dissolved chloride rather than sulfate (Brown and Hand 2013; Astr. J. 145, 110). There is still much uncertainty regarding how well the surface composition approximates the interior ocean composition. Exogenic materials, seafloor hydrothermal processes, and fractional crystallization during ice formation will determine the abundances of species in the ocean and by extension those present on Europa's surface. We develop a bottom-up model for oceans on Europa and Ganymede, assuming initial compositions of chondritic and cometary materials including an Fe core for Europa and an Fe-FeS eutectic core for Ganymede. We calculate an ocean composition by employing a Bulk Silicate Earth approach, also used by Zolotov and Shock (2001; J. Geophys. Res. 106, 32815) at Europa, which assess element partitioning between the rocky mantle, Fe-rich core, and water ocean. Partitioning factors are based on terrestrial estimates for Earth. The resulting ocean composition is used to assess solid precipitation into the ocean and ice shell using FREZCHEM modeling software (Marion et al. 2010; Icarus, 207, 675). These results are then compared with measured compositions of brines on Europa's surface. We develop the model in a way that permits ready application to other icy satellites, such as Titan or Enceladus.

Studies of giant magnetoresistance and interfacial structure in Cu/Co and Co/Re multilayers

NASA Astrophysics Data System (ADS)

Setty, Arun; Fernando, G.; Cooper, B. R.

2003-03-01

A study of giant magnetoresistance (GMR) in the Cu/Co [1]and Co/Re multilayer [2,3] systems is presented. The role of interface structure in such systems is significant, and is being investigated using an ab-initio based approach [4]. The role of intermixing [5], impurities and growth textures have been considered. Structural relaxation is taken into account using Hellman-Feynman and symmetry-based approaches. We find lattice spacings in agreement with experiment, energetically establish the favored growth textures and find results motivating the existence of the observed wavy interface in the Cu/Co system [6]. The transport properties of these multilayer systems will be studied using a theoretical model [7] incorporating material parameters obtained from the multiscale modeling approach we envisage. [1] S.S.P. Parkin, Z.G. Li, and D. J. Smith, Appl. Phys. Lett., 58, 2710-2712 (1991). [2] T. Charlton et al, Phys. Rev. B 63, 094404 (2001) [3] T. Charlton et al, Phys. Rev. B 59, 11897-11908 (1999) [4] C. Villagonzalo, A.K. Setty and B.R. Cooper, submitted to Phys. Rev. [5] J. Fassbender, R. Allenspach, and U. Durig. Surf. Sci., 383, L742-L748, (1997). [6] D.J. Larson et al, Appl. Phys. Lett., 73:1125-1127, (1998). [7] J. C. Slonczewski, Phys. Rev. B 39, 6995 (1989).

Toward re-thinking science education in terms of affective practices: reflections from the field

NASA Astrophysics Data System (ADS)

Kayumova, Shakhnoza; Tippins, Deborah

2016-09-01

Rational and operationalized views of science and what it means for teachers and students to know and enact legitimate science practices have dominated science education research for many decades (Fusco and Barton in J Res Sci Teach 38(3):337-354, 2001. doi: 10.1002/1098-2736(200103)38:3<337::AID-TEA1009>3.0.CO;2-0). Michalinos Zembylas challenges historically prevalent dichotomies of mind/body, reason/emotion, and emotion/affect, calling researchers and educators to move beyond the Cartesian dualisms, which have perpetuated a myth of scientific objectivity devoid of bias, subjectivity and emotions. Zembylas (Crit Stud Teach Learn 1(1):1-21, 2013. doi: 10.14426/cristal.v1i1.2) contends that the role of emotions and affect are best understood as relational and entangled in epistemological, cultural, and historical contexts of education, which represent contested sites of control and resistance. We argue that Zembylas' work is pivotal since "theoretical frames of reference for doing research in science education…[and] what constitutes knowledge and being within a particular frame" carry material bearings over the enactments of science teaching and learning (Kyle in J Res Sci Teach 31:695-696, 1994, p. 321. doi: 10.1002/tea.3660310703). In this paper, we hold cogen dialogue about how re-thinking notions of emotion and affect affords us, both science educators and researchers, to re-envision science education beyond cognitive and social frames. The framing of our dialogue as cogen builds on Wolff-Michael Roth and Kenneth Tobin's (At the elbows of another: learning to teach through coteaching. Peter Lang Publishing, New York, 2002) notion of cogenerative dialogue. Holding cogen is an invitation to an openly dialogic and safe area, which serves as a space for a dialogic inquiry that includes radical listening of situated knowledges and learning from similarities as well as differences of experiences (Tobin in Cult Stud Sci Educ, in review, 2015). From our situated experiences reforms, colleges of education, schools, and curriculum place not enough emphasis on affective and bodily dimensions of teaching and learning. Instead, the privilege seems to be given to reason, evidence, and rationalities, which continue to reinforce dominant ways of knowing and experiencing. The separation of mind and body, reason and emotion, effect and affect in teaching and research might bear unintended and negative consequences for many children and teachers who are engaged in bodily and affective forms of learning science. In this forum we wish to expand on the discussion to consider the interdependent nature of learning, experience, and affect by drawing on our work with science teachers and culturally and linguistically diverse students, juxtaposed alongside Zembylas' reflections, to further theorize the affective turn in science education.

Variation in 142Nd/144Nd of Archean rocks from southwest Greenland : Implications for early Earth mantle dynamics

NASA Astrophysics Data System (ADS)

Rizo, H.; Boyet, M.; Blichert-Toft, J.; Rosing, M.; Paquette, J. L.

2012-04-01

The short-lived 146Sm-142Nd chronometer (half-life = 103 Ma) has proven successful in bringing constraints on the dynamics of the early Earth mantle. Since the parent isotope, 146Sm, was extant only during the first 300 Ma of the history of the Solar System, the positive 142Nd anomalies measured in southwest Greenland Archean rocks imply that their incompatible element-depleted mantle source formed during the Hadean. Interestingly, the magnitude of these anomalies seems to decrease over time. 3.7-3.8 Ga old rocks from the Amitsoq Complex have revealed +10 to +20 ppm 142Nd anomalies [1, 2, 3, 4, 5, 6, 7], whereas younger 3.0 Ga old samples from the Ivisaartoq greenstone belt yield smaller positive anomalies, ranging from +5.5 to +8.5 ppm [8]. Thus, the chemical heterogeneities detected in the southwest Greenland mantle were formed during the first 150 Ma of Earth's history, and seem to have resisted re-mixing by mantle convection until 3.0 Ga. In this study, we investigate the evolution of the southwest Greenland mantle during the time period of 3.3-3.4 Ga. The samples analyzed come from both the ~3.3 Ga amphibolite unit and the ~3.4 Ga Ameralik basic dyke swarm from the Amitsoq Complex. Coupled Sm-Nd and Lu-Hf bulk-rock ages obtained for seven amphibolites are in good agreement (3351 ± 210 Ma and 3302 ± 260 Ma, respectively) and consistent with the minimum age found by Nutman and Friend (2009) [9] for this formation. We further obtained coherent bulk-rock 147Sm-143Nd and zircon+baddeleyite 207Pb/206Pb ages for the Ameralik dykes (3428 ± 250 Ma and 3421 ± 34 Ma, respectively), in line with ages suggested by Nielsen at al., (2002) [10] and Nutman et al., (2004) [11]. We are currently in the process of analyzing these samples for 142Nd isotopic compositions and the results will be compared with the existing southwest Greenland data in order to shed new light on the evolution and destruction of heterogeneities in the early Earth mantle. [1] Rizo et al., (2011) Earth Planet. Sci. Lett. [2] Bennett et al., (2007b) Science. [3] Boyet et al., (2003) Earth Planet. Sci. Lett. [4] Boyet and Carlson (2006) Earth Planet. Sci. Lett. [5] Caro et al., (2003) Nature. [6] Caro et al., (2006) Geochim. Cosmochim. Acta. [7] Harper and Jacobsen (1992) Nature. [8] Bennett et al., (2010) Goldschmidt 2010. [9] Nutman and Friend (2009) Precamb. Res. [10] Nielsen et al., (2002) Precamb. Res. [11] Nutman et al., (2004) J. Geol. Soc. Lond.

Holocene geological records of flood regime in French Alps

NASA Astrophysics Data System (ADS)

Arnaud, Fabien; Wilhelm, Bruno; Giguet-Covex, Charline; Jenny, Jean-Philippe; Fouinat, Laurent; Sabatier, Pierre; Debret, Maxime; Révillon, Sidonie; Chapron, Emmanuel; Revel, Marie

2014-05-01

In this paper we present a review of a ca. 10-years research effort (1-9) aiming at reconstructing floods dynamics in in French Alps through the Holocene, based on lake sediment records. We will particularly discuss how such geological records can be considered as representative of past climate. This implies a wise interpretation of data in order to really understand "what does the core really says". Namely, we showed that different lake systems record different types of flood events. Low altitude lakes, fed by large-scale catchment areas are more sensitive to regional heavy rainfall events (2-5), whereas high altitude small lakes record local extreme rainfall events (6). Moreover, human societies' development must be taken into account as it is susceptible to modulate the climate-geological record relationship (7). Altogether our data permit the establishment of a Holocene-long perspective upon both regional heavy rainfall and torrential activities in high elevation sites. We hence show that both types of events frequency co-evolve in Northern as well as Southern French Alps where Holocene colder spells generally present higher flood frequencies (6-9). On the other hand, intensities of torrential events present a North-South opposite pattern: during warm spells (e.g. the Medieval Warm Period or nowadays), northern Alps are subject to rare but extremely intense heavy rainfall events, whereas in the southern Alps torrential floods are both rare and weak. During cold spells (e.g. the Little Ice Age), the inverse pattern is observed: torrential floods are more frequent everywhere and above-average intensity in Southern Alps. This point is particularly important for risk management in mountain areas in a context of global warming. Our results point out how complex can be the response of regional system to global climate changes. We are hence far from completely understanding this complexity which is moreover imperfectly simulated by climate models. As geological records represent the only way to reconstruct long-term trends in flood regimes, more efforts must still be pursued to get a more complete image of this complexity and further improve climate models. 1. Chapron et al. The Holocene 12, 177-185 (2002) 2. Arnaud et al. Quat. Sci. Rev. 51, 81-92 (2012) 3. Debret et al. Quat. Sci. Rev. 29, 2185-2200 (2010) 4. Arnaud et al. The Holocene 15, 420-428 (2005) 5. Revel-Rolland et al. Chem. Geol. 224, 183-200 (2005) 6. Wilhelm et al. Clim. Change 113, 563-581 (2012) 7. Giguet-Covex et al. Quat. Res. 77, 12-22 (2012) 8. Wilhelm et al. Quat. Res. 78, 1-12 (2012) 9. Wilhelm et al. J. Quat. Sci. 28, 189-199 (2013)

Evaluation of Sulfate and Organic Aerosol in the Global UTLS: Budget and Size Distribution

NASA Astrophysics Data System (ADS)

Yu, P.; Froyd, K. D.; Murphy, D. M.; Jimenez, J. L.; Campuzano Jost, P.; Williamson, C.; Kupc, A.; Brock, C. A.; Liu, S.; Gao, R. S.; Thornberry, T. D.; Portmann, R. W.; Jensen, E. J.; Toon, O. B.; Rosenlof, K. H.

2017-12-01

Stratospheric sulfate and organic aerosols account for 20% of the total direct aerosol radiative forcing since 1850 [Yu et al., 2016]. Limited in-situ measurements on aerosol composition have been made in the upper troposphere and lower stratosphere (UTLS), mostly in the Northern Hemispheric mid-latitudes and tropics [Froyd et al., 2009; Murphy et al., 2014; Liao et al., 2015]. Based on those measurements and recent modeling studies [Yu et al., 2015a, 2015b, 2016], organic material commonly contributes half of the aerosol mass in the UTLS in the North Hemisphere. We summarize the global UTLS aerosol mass, size distribution and composition using in-situ measurements over the past 15 years including NASA SEAC4RS in 2013 [Liao et al., 2015; Yu et al., 2015a; Toon et al., 2016], NASA ATom in 2016 and 2017, NASA AVE in 2004 and 2006 [Froyd et al., 2009] and a balloon-borne campaign from Kunming in 2015 [Yu et al., 2017]. The most recent aerosol measurements on sulfate, organics, and their size distributions from the NASA ATom deployments provide a global view of upper tropospheric aerosol composition over remote regions (i.e. the Pacific and Atlantic oceans) in both hemispheres. These in-situ measurements are compared with a sectional aerosol model coupled with the NCAR Community Earth System Model (CESM-CARMA). The comparisons and simulations demonstrate the importance of UTLS aerosols on aerosol-radiation-climate interactions, and highlight the need for a better understanding on the UTLS aerosols' budget, sources, seasonal cycle, transport pathways and linkage to climate change. References:Froyd et al. (2009), Atmospheric Chemistry and Physics, 9(13), 4363-4385. Liao et al. (2016), J. Geophys. Res. Atmos., 120, 2990-3005. Murphy et al. (2014), Q.J.R. Meteorol. Soc., 140: 1269-1278 Toon, O. B. et al. (2016) , J. Geophys. Res. Atmos., 121, 4967-5009 Yu, P. et al. (2015a), J. Adv. Model. Earth Syst., 7, 865-914 Yu, P. et al. (2015b), Geophys. Res. Lett., 42, 2540-2546 Yu, P. et al. (2016), Geophys. Res. Lett., 43, 9361-9367 Yu, P. et al. (2017), , Proc. Natl. Acad. Sci., 114 (27) 6972-6977

Re-evaluation of constant versus varied punishers using empirically derived consequences.

PubMed

Toole, Lisa M; DeLeon, Iser G; Kahng, SungWoo; Ruffin, Geri E; Pletcher, Carrie A; Bowman, Lynn G

2004-01-01

Charlop, Burgio, Iwata, and Ivancic [J. Appl. Behav. Anal. 21 (1988) 89] demonstrated that varied punishment procedures produced greater or more consistent reductions of problem behavior than a constant punishment procedure. More recently, Fisher and colleagues [Res. Dev. Disabil. 15 (1994) 133; J. Appl. Behav. Anal. 27 (1994) 447] developed a systematic methodology for predicting the efficacy of various punishment procedures. Their procedure identified reinforcers and punishers (termed "empirically derived consequences" or EDC) that, when used in combination, reduced the destructive behavior of individuals with developmental disabilities who displayed automatically maintained destructive behavior. The current investigation combines these two lines of research by comparing the effects of constant versus varied punishers on the self-injury of two individuals with developmental disabilities. The punishing stimuli were selected via the procedures described by Fisher et al. and were predicted to be at varying levels of effectiveness. The varied presentation of punishers resulted in enhanced suppressive effects over the constant presentation of a punisher for one of two individuals, but only in comparison to a single stimulus predicted to be minimally effective. Even then, the differences were small. These results suggest that the additive effects of varied punishment are negligible if clinicians use stimuli predicted to be effective and are discussed in terms of the conditions under which stimulus variation could potentially enhance the effects of punishers.

Global map and spectroscopic analyses of Martian fluvial systems: paleoclimatic implications

NASA Astrophysics Data System (ADS)

Alemanno, Giulia; Orofino, Vincenzo; Mancarella, Francesca; Fonti, Sergio

2017-04-01

Currently environmental conditions on Mars do not allow the presence of liquid water on its surface for long periods of time. However, there are various evidences for past water flow at its surface. In fact, the ancient terrains of Mars are covered with fluvial and lacustrine features such as valley networks, longitudinal valleys and basin lakes. There are no doubts about the fact that the Martian valleys were originated by water flow. This led many researchers to think that probably, at the time of their formation, the conditions of atmospheric pressure and surface temperature were different from the present[1]. To infer the climate history of Mars from valley networks, a global approach is necessary. We produced a global map of Martian valleys. We manually mapped all the valleys (longer than 20 km) as vector-based polylines within the QGIS software, using THEMIS daytime IR (100 m/pixel), and where possible CTX images (up to 6 m/pixel), plus topographic MOLA data ( 500 m/pixel). Respect to the previous manual maps[1,2] data of higher image quality (new THEMIS mosaic) and topographic information allow us to identify new structures and more tributaries for a large number of systems. We also used the geologic map of Mars[3] in order to determine the valleys age distribution. Most valleys are too small for age determination from superposition of impact craters so we have assumed that a valley is as old as the terrain on which it has been carved[1]. Furthermore we are, currently, analyzing spectroscopic data from CRISM instrument (Compact Reconnaissance Imaging Spectrometer for Mars) onboard Mars Reconnaissance Orbiter, concerning the mapped valleys or associated basin lakes with the aim of assessing the mineralogy of these structures. Our attention is especially focused on the possible detection of any hydrated minerals (e.g. phyllosilicates, hydrated silica) or evaporites (e.g. carbonates, sulfates, chlorides). Phyllosilicates- bearing rocks are considered as an ideal place on Mars for prebiotic chemistry and the possible development of life[4]. Using spectral parameters[5], applied to the images to highlight the presence of different aqueous alteration minerals, we have found deposits of possible hydrated minerals in some of these structures. References [1]Hynek B.M., Hoke M.R.T., Beach M.: 2010, Jou. Geophys. Res., 115, doi:10.1029/2009JE003548. [2]Carr M.H.: 1995, Jou. Geophys. Res., 100, 7479, doi:10.1029/95JE00260. [3]Tanaka K. L. et al.: 2014, Planet. and Spa. Sci., 95, 11. [4]Bishop et al.: 2013, Planet. and Spa. Sci., 86, 130. [5]Viviano-Beck C.E. et al.: 2014, Jou. Geophys. Res., 119, doi: 10.1002/2014JE004627.

Comparative Study on Hot Atom Coronae of Solar and Extrasolar Planets

NASA Astrophysics Data System (ADS)

Shematovich, Valery

Solar/stellar forcing on the upper atmospheres of the solar and extrasolar planets via both absorption of the XUV (soft X-rays and extreme ultraviolet) radiation and atmospheric sputtering results in the formation of an extended neutral corona populated by the suprathermal (hot) H, C, N, and O atoms (see, e.g., Johnson et al., 2008). The hot corona, in turn, is altered by an inflow of the solar wind/magnetospheric plasma and local pick-up ions onto the planetary exosphere. Such inflow results in the formation of the superthermal atoms (energetic neutral atoms - ENAs) due to the charge exchange with the high-energy precipitating ions and can affect the long-term evolution of the atmosphere due to the atmospheric escape. The origin, kinetics and transport of the suprathermal H, C, N, and O atoms in the transition regions (from thermosphere to exosphere) of the planetary atmospheres are discussed. Reactions of dissociative recombination of the ionospheric ions CO _{2} (+) , CO (+) , O _{2} (+) , and N _{2} (+) with thermal electrons are the main photochemical sources of hot atoms. The dissociation of atmospheric molecules by the solar/stellar XUV radiation and accompanying photoelectron fluxes and the induced exothermic photochemistry are also the important sources of the suprathermal atoms. Such kinetic systems with the non-thermal processes are usually investigated with the different (test particles, DSMC, and hybrid) versions of the kinetic Monte Carlo method. In our studies the kinetic energy distribution functions of suprathermal and superthermal atoms were calculated using the stochastic model of the hot planetary corona (Shematovich, 2004, 2010; Groeller et al., 2014), and the Monte Carlo model (Shematovich et al., 2011, 2013) of the high-energy proton and hydrogen atom precipitation into the atmosphere respectively. These functions allowed us to estimate the space distribution of suprathermals in the planetary transition regions. An application of these numerical models to study the atmospheric gas flow in the transition region from the collision-dominated thermosphere to collisionless exosphere, and the non-thermal escape will be discussed and illustrated with the simple 1D-models of the hot coronae of the solar and extrasolar planets. This work is supported by the RFBR project No. 14-02-00838a and by the Basic Research Program of the Presidium of the Russian Academy of Sciences (Program 22). begin{itemize} Johnson et al., Sp. Sci.Rev., 2008, v. 139, 355. Shematovich, Solar System Res., 2004, v.38, 28. Shematovich, Solar System Res., 2010, v.44, 96. Shematovich et al., J. Geophys. Res., 2011, v.116, A11320; 2013, v. 118, 1231. Groeller et al., Planet. Space Sci., 2014.

Shock vaporization of carbonate and sulfate minerals

NASA Astrophysics Data System (ADS)

Shen, A. H.; Ahrens, T. J.; O'Keefe, J. D.

2001-12-01

Strong shock waves induced by impacts can cause vaporization of rocks and minerals. The products of such process play important roles in planetary differentiation (Yakovlev et al., Geochem. International, 38, 1027, 2000) and in effecting the planetary climate. Many experiments and computer simulations have been performed to simulate the Chicxulub impact at Cretaceous/Tertiary boundary (see, for example, Pierazzo et al., J. Geophys. Res., 103, 28607, 1998 and Pope et al., J. Geophys. Res., 102, 21645, 1997). However, the pressure range for incipient and complete vaporization of carbonates and sulfates are not well constrained, especially, for minerals with various initial porosities. Furthermore, evidence for chemical species in the products of vaporized carbonate and sulfate minerals is almost non-existing. In this study, we employed published Hugoniot data for carbonate and sulfate minerals. By using the methods described in Ahrens (J. Appl. Phys., 43, 2443, 1972) and Ahrens and O'Keefe (The Moon, 4, 214, 1972), we calculated the entropy associated with the thermodynamic states produced by hypervelocity impacts at various velocities for carbonate and sulfate minerals with different initial porosities. The results were compared with the entropy of incipient vaporization and complete vaporization of these minerals to determine the degree of vaporization due to impacts. Moreover, these results are utilized to guide our experimental study in speciation reactions in shock-induced vaporization of carbonates and sulfates.

High resolution x-ray Thomson scattering measurements from cryogenic hydrogen jets using the linac coherent light source

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fletcher, L. B., E-mail: lbfletch@slac.stanford.edu; Galtier, E.; Gamboa, E. J.

2016-11-15

We present the first spectrally resolved measurements of x-rays scattered from cryogenic hydrogen jets in the single photon counting limit. The 120 Hz capabilities of the LCLS, together with a novel hydrogen jet design [J. B. Kim et al., Rev. Sci. Instrum. (these proceedings)], allow for the ability to record a near background free spectrum. Such high-dynamic-range x-ray scattering measurements enable a platform to study ultra-fast, laser-driven, heating dynamics of hydrogen plasmas. This measurement has been achieved using two highly annealed pyrolytic graphite crystal spectrometers to spectrally resolve 5.5 keV x-rays elastically and inelastically scattered from cryogenic hydrogen and focusedmore » on Cornell-SLAC pixel array detectors [S. Herrmann et al., Nucl. Instrum. Methods Phys. Res., Sect. A 718, 550 (2013)].« less

Particle processing technology

NASA Astrophysics Data System (ADS)

Sakka, Yoshio

2014-02-01

In recent years, there has been strong demand for the development of novel devices and equipment that support advanced industries including IT/semiconductors, the environment, energy and aerospace along with the achievement of higher efficiency and reduced environmental impact. Many studies have been conducted on the fabrication of innovative inorganic materials with novel individual properties and/or multifunctional properties including electrical, dielectric, thermal, optical, chemical and mechanical properties through the development of particle processing. The fundamental technologies that are key to realizing such materials are (i) the synthesis of nanoparticles with uniform composition and controlled crystallite size, (ii) the arrangement/assembly and controlled dispersion of nanoparticles with controlled particle size, (iii) the precise structural control at all levels from micrometer to nanometer order and (iv) the nanostructural design based on theoretical/experimental studies of the correlation between the local structure and the functions of interest. In particular, it is now understood that the application of an external stimulus, such as magnetic energy, electrical energy and/or stress, to a reaction field is effective in realizing advanced particle processing [1-3]. This special issue comprises 12 papers including three review papers. Among them, seven papers are concerned with phosphor particles, such as silicon, metals, Si3N4-related nitrides, rare-earth oxides, garnet oxides, rare-earth sulfur oxides and rare-earth hydroxides. In these papers, the effects of particle size, morphology, dispersion, surface states, dopant concentration and other factors on the optical properties of phosphor particles and their applications are discussed. These nanoparticles are classified as zero-dimensional materials. Carbon nanotubes (CNT) and graphene are well-known one-dimensional (1D) and two-dimensional (2D) materials, respectively. This special issue also includes two papers on the fabrication of mechanically reliable nanocomposites by dispersing graphene into a ceramic matrix, and on supercapacitors with high energy densities in a Co(OH)2 system decorated with graphene and carbon nanotubes. As a novel preparation method of oxide films, the fabrication of alumina films with laminated structures by ac anodization is reviewed. Moreover a new type of nanosheet has been fabricated by the exfoliation of layered, ternary transition-metal carbide and nitride compounds, known as Mn + 1AXn phases (or MAX phases) where M is an early transition metal, such as Ti or Nb, A is an A group element, such as Si or Al, X is carbon and/or nitrogen and n = 1-3 [4]. Among the MAX phases, those containing Mo have been theoretically calculated by first-principles calculations to be a source for obtaining Mo2C nanosheets with potentially unique properties. As an example of improving bulk ceramic properties, texturing by using a high magnetic field [5] and sintering by the electric current activated/assisted sintering (ECAS) technology [6] have been demonstrated for ultra-high temperature ceramics with high-temperature strength. A project on the development of materials and particle processing for the field of environment and energy has been ongoing at the National Institute for Materials Science since April 2011. This project employs various core competence technologies for particle processing such as ion beam irradiation for nanoparticle fabrication [7], fullerene nanomaterial processing using liquid-liquid interface precipitation [8], a gas reduction nitridation process to obtain Si3N4-based phosphor materials [9], advanced phosphors via novel processing [10, 11], ultra-high pressure technology for processing and in situ analysis [12, 13], colloidal processing in a high magnetic field to obtain laminated, textured ceramics [1, 3, 5], the ECAS process for nanostructuring ceramics [6] and so forth. Here, I would like to introduce some research achievements that are not covered in this special issue. (1) The evolution of hydrogen by the reaction of fine metal particles such as Al [14] and Mg [15] with water; the specific surface area and surface modification are important factors.(2) The realization of new carbon related materials with 1D and 2D structures consisting of fullerenes prepared by liquid-liquid interface precipitation: alkaline-doped superconductive nanotubes consisting of fullerenes [16], application to solar cells of fullerene/cobalt porphyrin hybrid nanosheets [17], etc.(3) The fabrication of textured films and bulk materials with excellent functional properties by colloidal processing methods such as slip casting [5], gel casting [18] and electrophoretic deposition [3, 19], in a high magnetic field, and with subsequent heating; examples of such materials include dye-sensitized TiO2 solar cells, thermoelectric materials and cathode materials for solid state Li-ion batteries and dielectric ceramics.(4) The fabrication of high-strength and high-toughness MAX phase ceramics [20, 21] inspired by the nacreous structure [22].(5) The modeling and development of the ECAS process [6]. This involves two-step pressure application [23] and high-pressure application above 400 MPa to fabricate transparent oxides [24-26], and rapid heating to obtain dense nanocomposites of ceramic-CNT [27] and diamonds [28].(6) The contraction of ternary phase diagrams for oxide ion conductor systems such as zirconia [29] and apatite systems [30], leading to an increased understanding of the stability of such systems and assisting the search for high oxygen ion conductors. Acknowledgments I am grateful to the authors who have contributed to this special issue, and sincerely hope that the readers will expand their knowledge of particle processing technology. References [1] Sakka Y 2006 J. Ceram. Soc. Japan 114 371 [2] Badica P, Crisan A, Aldica G, Endo K, Borodianska H, Togano K, Awaji S, Vasylkiv O and Sakka Y 2011 Sci. Technol. Adv. Mater. 12 013001 [3] Sakka Y and Uchikoshi T 2010 KONA Powder Particle J. 28 74 (kona.or.jp/search/28_074.pdf) [4] Naguib M, Mashtalir O, Carle J, Presser V, Lu J, Hultman L, Gogotsi Y and Barsoum M W 2012 ACS Nano 6 1322 [5] Sakka Y and Suzuki T S 2005 J. Ceram. Soc. Japan 113 26 [6] Grasso S, Sakka Y and Maizza G 2009 Sci. Technol. Adv. Mater. 10 053001 [7] Nakao H, Tokonami S, Hamada T, Shiigi H, Nagaoka T, Iwate F and Takeda Y 2012 Nanoscale 4 6814 [8] Miyazawa K and Hotta K 2010 J. Cryst. Growth 312 2764 [9] Suehiro T, Xie R and Hirosaki N 2013 Indust. Eng. Chem. Res. 52 7453 [10] Zhu Q, Li J-G, Li X, Sun X and Sakka Y 2011 Sci. Technol. Adv. Mater. 12 055001 [11] Li J, Li J-G, Zhang Z, Wu X, Liu S, Li X, Sun X and Sakka Y 2012 Sci. Technol. Adv. Mater. 13 035007 [12] Kawamura F, Yusa H and Taniguchi T 2012 Appl. Phys. Lett. 100 251910 [13] Watanabe K and Taniguchi T 2011 Int. J. Appl. Ceram. Technol. 8 977 [14] Deng Z-Y, Ferreira J M F and Sakka Y 2008 J. Am. Ceram. Soc. 91 3825 [15] Uda M, Okuyama H, Suzuki T S and Sakka Y 2012 Sci. Technol. Adv. Mater. 13 025009 [16] Takeya H, Kato R, Wakahara T, Miyazawa K, Yamaguchi T, Ozaki T, Okazaki H and Takano Y 2013 Mater. Res. Bull. 48 343 [17] Wakahara T, D'Angelo P, Miyazawa K, Nemoto Y, Ito O, Tanigaki N, Bradley D D C and Anthopoulos T D 2012 J. Am. Chem. Soc. 134 7204 [18] Wiecinska P, Sakka Y, Suzuki T S, Uchikoshi T, Mizerski T and Szafran M 2013 J. Ceram. Soc. Japan 121 89 [19] Kawakita M, Uchikoshi T, Kawakita J and Sakka Y 2009 J. Am. Ceram. Soc. 92 984 [20] Hu C, Sakka Y, Grasso S, Nishimura T, Guo S and Tanaka H 2011 Scr. Mater. 64 765 [21] Hu C, Sakka Y, Nishimura T, Guo S, Grasso S and Tanaka H 2011 Sci. Technol. Adv. Mater. 12 044603 [22] Kakisawa H and Sumitomo T 2011 Sci. Technol. Adv. Mater. 12 064710 [23] Grasso S, Hu C F, Maizza G, Kim B N and Sakka Y 2011 J. Am. Ceram. Soc. 94 1405 [24] Grasso S, Kim B N, Hu C F, Maizza G and Sakka Y 2010 J. Am. Ceram. Soc. 93 2460 [25] Zhang H B, Kim B N, Morita K, Hiraga K, Yoshida H and Sakka Y 2012 Sci. Technol. Adv. Mater. 13 055003 [26] Kim B-N, Hiraga K, Grasso S, Morita K, Yoshida H, Zhang H and Sakka Y 2012 J. Ceram. Soc. Japan 120 116 [27] Estili M, Kawasaki A and Sakka Y 2012 Adv. Mater. 24 4322 [28] Grasso S, Hu C F, Maizza G and Sakka Y 2012 J. Am. Ceram. Soc. 95 2423 [29] Andrievskaya E R, Kornienko O A, Sayir A, Vasylkiv O and Sakka Y 2011 J. Am. Ceram. Soc. 94 1911 [30] Kobayashi K and Sakka Y 2012 Sci. Technol. Adv. Mater. 13 045006

Intermittency and universality of small scales of passive scalar in turbulence

NASA Astrophysics Data System (ADS)

Gotoh, Toshiyuki; Watanabe, Takeshi

2014-11-01

Recent experiments and Direct Numerical Simulations (DNSs) suggest that the small scale statistics of passive scalar may not be as ``universal'' as in the velocity case. To address this problem, we study the moments of scalar increment in steady turbulence at Rλ > 800 by using DNS up to the grid points of 40963. In order for the scalar and turbulent flow to be as faithful as possible to the assumptions that would be made in theories, Scalar 1 and Scalar 2 are simultaneously convected by the identical isotropic turbulent flow but excited by two different methods. Scalar 1 is excited by the random scalar injection which is isotropic, Gaussian and white in time at low wavenumber band, while Scalar 2 is excited by the uniform mean scalar gradient. The moments of two scalars as functions of the separation vector are expanded in terms of the Legendre polynomials to extract the scaling exponents of the moments up to the 4th anisotropic sector for Scalar 2. It is found that the exponents of the isotropic sectors seem to have the same values at separation distances in the narrow range over which the 4/3 law holds simultaneously for two scalars. The exponents of the anisotropic sectors and the cumulants of the moments will also be reported. HPCI, JHPCN, Grant-in-Aid for Sci. Res. No.24360068, Ministry of Edu. Sci., Japan.

Initial assessment of the infiltration and overland flow for different rainfall events in land constituted of sandstones of the Botucatu Formation (Guarani Aquifer), State of São Paulo, Brazil

NASA Astrophysics Data System (ADS)

Zuquette, Lázaro Valentin; Palma, Janaina Barrios; Pejon, Osni José

2006-06-01

This study was carried out in the Córrego do Vaçununga basin constituted of eolic sandstones of Botucatu Formation and residual unconsolidated materials (>90%), considered the most important unconfined aquifer in Brazil, in the city of Luiz Antonio, State of São Paulo, Brazil. Laboratory and in situ tests were performed to characterize the unconsolidated materials in terms of basic physical properties, potential infiltration rate, suction and hydraulic conductivity. The results for infiltration and overland flow depths were obtained according to Morel-Seytoux and Khanji (Water Resour Res 10(4):795-800, 1976) and Chu (Water Resour Res 14(3):461-466, 1978) adaptation of the Green and Ampt [J Agr Sci 4(Part 1):1-24, 1911] model for steady and transient rainfalls, respectively. Rainfall data were collected from January of 2000 to December of 2002, and 12 scenarios were defined considering the intensity and durations. Rather than high homogeneity in terms of the texture of unconsolidated materials, the infiltration and overland flow ratio depends on the type of land use and associated management practices. The results showed that rainfall with high intensity and short duration do not produce high overland flow ratio as we have observed for transient scenarios with long duration and low intensities.

The appearance of Carbonaceous Chondrites on (1) Ceres from observations by the Dawn Framing Camera

NASA Astrophysics Data System (ADS)

Schäfer, Tanja; Schäfer, Michael; Mengel, Kurt; Cloutis, Edward A.; Izawa, Matthew R. M.; Thangjam, Guneshwar; Hoffmann, Martin; Platz, Thomas; Nathues, Andreas; Kallisch, Jan; Ripken, Joachim; Russel, Christopher T.

2016-04-01

NASA's Dawn spacecraft reached dwarf planet Ceres in March 2015 and started data acquisition using three different instruments. These are the Framing Camera (FC; [1]), the Visible & Infrared Spectrometer (VIR; [2]), and the Gamma Ray and Neutron Detector (GRaND; [3]). In our work we focus on the potential appearance of carbonaceous chondritic (CC) material on the cerean surface using Dawn FC color mosaics covering the VIS/NIR wavelength region. In preparation of the Dawn arrival at Ceres, a discrimination scheme for CC groups using FC color ratios was developed by [4] and is based on 121 CC laboratory spectra compiled from RELAB. As the cerean surface material mainly differs by its spectral slope over the whole FC wavelength range (0.44-0.97 μm), we classified the color mosaics by this parameter. We applied the CC discrimination scheme only to those regions on the cerean surface (more than 90 %) which exhibit spectral slopes ≥ -1 % reflectance per μm to exclude the strongly negative sloped regions of large young craters such as Occator, Haulani, and Oxo. These are not likely to be similar to pure CC material as can be seen by their brightness and their bluish spectral slope [5]. We found that the surface material of Ceres is, among the suite of CCs, most similar to Ivuna samples artificially heated to 200 and 300°C [6] and unusual CCs, which naturally experienced heating. The latter ones comprise Dhofar 225, Y-86789 and Y-82162, which have been determined to have undergone aqueous alteration and subsequent thermal metamorphism (e.g. [7,8]).Our comparison with VIR data shows, that the spectra of Ivuna heated to 200°C and 300°C match well the OH-absorption at 2.7 μm but do not show the smaller 3.05-3.1 μm absorption observed on Ceres [9,10,11]. Nevertheless, the remarkably flat UV drop-off detected on the cerean surface may, at least spectrally, correspond to highly aqueously altered and subsequently thermally metamorphosed CC material. Further alteration of this material on a parent body like Ceres may produce spectral changes affecting the 3 μm region, while showing no additional modification in the VIS/NIR region. Scenarios of thermal and geophysical evolution models allow Ceres' differentiation into a core of dehydrated silicates and a shell of hydrated silicates overlain by an icy shell [12,13]. The widespread occurence of material on the cerean surface, spectrally similar to thermally altered CC material, suggests that we possibly see the mineralogy of the hydrated-dehydrated boundary of Ceres exposed by impact gardening and simultaneous loss of the icy shell. Also differing recent models of a convecting mud ocean on Ceres, introduced by [14] and enhanced by [15], allow a lag deposit of aqueously altered fine material on the surface, spectrally corresponding to mildly heated Ivuna samples. References: [1] Sierks, H. et al. 2011. Space Sci. Rev., 163, 1-4, 263-327. [2] De Sanctis, C.M. et al. 2011. Space Sci. Rev., 163, 1-4, 329-369. [3] Prettyman, T.H. et al. 2011. Space Sci. Rev., 163, 1-4, 371-459. [4] Schäfer, T. et al., 2015. Icarus 265, 149-160. [5] Nathues, A. et al., 2015. Nature 528 (7581), 237-240. [6] Hiroi, T. et al., 1996. Lunar Planet. Sci. 27, 551. [7] Brearley, A.J., Jones, R.H., 1998. Chondritic meteorites. In: Planetary Materials, Papike, J.J. (Ed.). Rev. in Mineralogy and Geochem. 36 (1), ch. 3, 1-398. [8] Ivanova, M.A. et al., 2010. Meteoritics & Planet. Sci. 45 (7), 1108-1123. [9] King, T.V.V., et al., 1992. Science 255, 1551-1553. [10] De Sanctis, M.C. et al., 2015. Nature 528 (7581), 241-244. [11] Milliken, R.E., Rivkin, A.S., 2009. Nature Geosci. 2 (4), 258-261. [12] Castillo-Rogez, J.C., McCord, T.B., 2010. Icarus 205 (2), 443-459. [13] Neveu, M., Desch, S.J., Castillo-Rogez, J.C., 2015. J. Geophys. Res. Planets 120 (2), 123-154. [14] Travis, B.J. et al., 2015. Lunar Planet. Sci., #2360. [15] Neveu, M., Desch, S.J., 2015. Geophys. Res. Lett. 42 (23), 10197-10206.

Advancing Renewable Materials by Light and X-ray Scattering

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akpalu, Yvonne A

With the ultimate goal to design PHA polymer nanocomposites with tailored properties, we have completed systematic study of the influence of cooling rate [Xie et al, J. Appl. Poly. Sci., 2008] and nanofiller [Xie et al, Polymer 2009] characteristics on model bionanocomposites. Structure-property relationships for a model bionanocomposites system were investigated. These results yielded new fundamental knowledge that supports the discovery of cost-effective manufacturing technologies for a family of promising polyhydroxyalkanoates (PHAs) polyesters, with the potential to replace polyethylene and polypropylene (see Noda letter). Our results show that simple two-phase composite models do not account for the data. Although improvementmore » of the mechanical properties (stiffness/modulus and toughness) must be due to alteration of the matrix by the nanoparticle filler, the observed improvement was not caused by the change of crystallinity or spherulitic morphology. Instead, improvement depends on the molecular weight of the polymer matrix and unknown filler-matrix interactions.« less

Local energy decay for linear wave equations with variable coefficients

NASA Astrophysics Data System (ADS)

Ikehata, Ryo

2005-06-01

A uniform local energy decay result is derived to the linear wave equation with spatial variable coefficients. We deal with this equation in an exterior domain with a star-shaped complement. Our advantage is that we do not assume any compactness of the support on the initial data, and its proof is quite simple. This generalizes a previous famous result due to Morawetz [The decay of solutions of the exterior initial-boundary value problem for the wave equation, Comm. Pure Appl. Math. 14 (1961) 561-568]. In order to prove local energy decay, we mainly apply two types of ideas due to Ikehata-Matsuyama [L2-behaviour of solutions to the linear heat and wave equations in exterior domains, Sci. Math. Japon. 55 (2002) 33-42] and Todorova-Yordanov [Critical exponent for a nonlinear wave equation with damping, J. Differential Equations 174 (2001) 464-489].

Decay of solutions of the wave equation with arbitrary localized nonlinear damping

NASA Astrophysics Data System (ADS)

Bellassoued, Mourad

We study the problem of decay rate for the solutions of the initial-boundary value problem to the wave equation, governed by localized nonlinear dissipation and without any assumption on the dynamics (i.e., the control geometric condition is not satisfied). We treat separately the autonomous and the non-autonomous cases. Providing regular initial data, without any assumption on an observation subdomain, we prove that the energy decays at last, as fast as the logarithm of time. Our result is a generalization of Lebeau (in: A. Boutet de Monvel, V. Marchenko (Eds.), Algebraic and Geometric Methods in Mathematical Physics, Kluwer Academic Publishers, Dordrecht, the Netherlands, 1996, pp. 73) result in the autonomous case and Nakao (Adv. Math. Sci. Appl. 7 (1) (1997) 317) work in the non-autonomous case. In order to prove that result we use a new method based on the Fourier-Bross-Iaglintzer (FBI) transform.

Roughness in the Kolmogorov Johnson Mehl Avrami framework: extension to (2+1)D of the Trofimov Park model

NASA Astrophysics Data System (ADS)

Pacchiarotti, Barbara; Fanfoni, Massimo; Tomellini, Massimo

2005-12-01

In this paper the reformulation of Trofimov-Park (TP) model, [V.I. Trofimov, Appl. Surf. Sci. 219 (2003) 93), of thin film roughness evolution during nucleation and growth of islands in case of simultaneous nucleation is presented. The calculation of TP restricted to one-dimensional triangular islands has been extended to both the one-dimensional elliptical case and to the pyramidal two-dimensional one. The kinetics of the interface width, w, and the height-height autocorrelation function G, through which the correlation length ξ has been defined, have been estimated. Moreover, w(Θ) and ξ(Θ), where Θ is the fraction of the covered substrate, if properly rescaled to the density of nuclei N and to the aspect ratio of islands, are universal functions that, for a conspicuous range of Θ, obey a power law with the exponent depending upon island shape.

The existence results and Tikhonov regularization method for generalized mixed variational inequalities in Banach spaces

NASA Astrophysics Data System (ADS)

Wang, Min

2017-06-01

This paper aims to establish the Tikhonov regularization method for generalized mixed variational inequalities in Banach spaces. For this purpose, we firstly prove a very general existence result for generalized mixed variational inequalities, provided that the mapping involved has the so-called mixed variational inequality property and satisfies a rather weak coercivity condition. Finally, we establish the Tikhonov regularization method for generalized mixed variational inequalities. Our findings extended the results for the generalized variational inequality problem (for short, GVIP( F, K)) in R^n spaces (He in Abstr Appl Anal, 2012) to the generalized mixed variational inequality problem (for short, GMVIP(F,φ , K)) in reflexive Banach spaces. On the other hand, we generalized the corresponding results for the generalized mixed variational inequality problem (for short, GMVIP(F,φ ,K)) in R^n spaces (Fu and He in J Sichuan Norm Univ (Nat Sci) 37:12-17, 2014) to reflexive Banach spaces.

Elasticity, strength, and toughness of single crystal silicon carbide, ultrananocrystalline diamond, and hydrogen-free tetrahedral amorphous carbon

NASA Astrophysics Data System (ADS)

Espinosa, H. D.; Peng, B.; Moldovan, N.; Friedmann, T. A.; Xiao, X.; Mancini, D. C.; Auciello, O.; Carlisle, J.; Zorman, C. A.; Merhegany, M.

2006-08-01

In this work, the authors report the mechanical properties of three emerging materials in thin film form: single crystal silicon carbide (3C-SiC), ultrananocrystalline diamond, and hydrogen-free tetrahedral amorphous carbon. The materials are being employed in micro- and nanoelectromechanical systems. Several reports addressed some of the mechanical properties of these materials but they are based in different experimental approaches. Here, they use a single testing method, the membrane deflection experiment, to compare these materials' Young's moduli, characteristic strengths, fracture toughnesses, and theoretical strengths. Furthermore, they analyze the applicability of Weibull theory [Proc. Royal Swedish Inst. Eng. Res. 153, 1 (1939); ASME J. Appl. Mech. 18, 293 (1951)] in the prediction of these materials' failure and document the volume- or surface-initiated failure modes by fractographic analysis. The findings are of particular relevance to the selection of micro- and nanoelectromechanical systems materials for various applications of interest.

Index of Refraction of Shock Loaded Soda-Lime Glass

NASA Astrophysics Data System (ADS)

Alexander, C. S.

2009-12-01

Soda-lime glass (SLG) is a potential low-cost VISAR window for use at moderate shock pressures (up to 2430 GPa) where the material remains transparent. In order for SLG to be practical as a VISAR window, the correction factor, which describes the frequency correction related to the strain dependence of the refractive index, and hence the index of refraction itself, must be characterized as a function of pressure. Characterization data are reported in this paper and compared to previous results. The present data show good agreement with those of Dandekar [J. Appl. Phys. 84, 6614 (1998)] and separate study results by Gibbons and Ahrens [J. Geophys. Res. 76, 5489 (1971)] up to 7 GPa. However, at stresses over 7 GPa, marked discrepancies are evident between the present data and that of Gibbons and Ahrens. Differences in test methods may explain these discrepancies.

INDEX OF REFRACTION OF SHOCK LOADED SODA-LIME GLASS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Alexander, C. S.

2009-12-28

Soda-lime glass (SLG) is a potential low-cost VISAR window for use at moderate shock pressures (up to 2430 GPa) where the material remains transparent. In order for SLG to be practical as a VISAR window, the correction factor, which describes the frequency correction related to the strain dependence of the refractive index, and hence the index of refraction itself, must be characterized as a function of pressure. Characterization data are reported in this paper and compared to previous results. The present data show good agreement with those of Dandekar [J. Appl. Phys. 84, 6614 (1998)] and separate study results bymore » Gibbons and Ahrens [J. Geophys. Res. 76, 5489 (1971)] up to 7 GPa. However, at stresses over 7 GPa, marked discrepancies are evident between the present data and that of Gibbons and Ahrens. Differences in test methods may explain these discrepancies.« less

Characterization of damage modes in dental ceramic bilayer structures.

PubMed

Deng, Yan; Lawn, Brian R; Lloyd, Isabel K

2002-01-01

Results of contact tests using spherical indenters on flat ceramic coating layers bonded to compliant substrates are reported for selected dental ceramics. Critical loads to produce various damage modes, cone cracking, and quasiplasticity at the top surfaces and radial cracking at the lower (inner) surfaces are measured as a function of ceramic-layer thickness. It is proposed that these damage modes, especially radial cracking, are directly relevant to the failure of all-ceramic dental crowns. The critical load data are analyzed with the use of explicit fracture-mechanics relations, expressible in terms of routinely measurable material parameters (elastic modulus, strength, toughness, hardness) and essential geometrical variables (layer thickness, contact radius). The utility of such analyses in the design of ceramic/substrate bilayer systems for optimal resistance to lifetime-threatening damage is discussed. Copyright 2002 Wiley Periodicals, Inc. J Biomed Mater Res (Appl Biomater) 63: 137--145, 2002; DOI 10.1002/jbm.10091

On a quadrature formula of Gori and Micchelli

NASA Astrophysics Data System (ADS)

Yang, Shijun

2005-04-01

Sparked by Bojanov (J. Comput. Appl. Math. 70 (1996) 349), we provide an alternate approach to quadrature formulas based on the zeros of the Chebyshev polynomial of the first kind for any weight function w introduced and studied in Gori and Micchelli (Math. Comp. 65 (1996) 1567), thereby improving on their observations. Upon expansion of the divided differences, we obtain explicit expressions for the corresponding Cotes coefficients in Gauss-Turan quadrature formulas for and I(fTn;w) for a Gori-Micchelli weight function. It is also interesting to mention what has been neglected for about 30 years by the literature is that, as a consequence of expansion of the divided differences in the special case when , the solution of the famous Turan's Problem 26 raised in 1980 was in fact implied by a result of Micchelli and Rivlin (IBM J. Res. Develop. 16 (1972) 372) in 1972. Some concluding comments are made in the final section.

An ecological valence theory of human color preference.

PubMed

Palmer, Stephen E; Schloss, Karen B

2010-05-11

Color preference is an important aspect of visual experience, but little is known about why people in general like some colors more than others. Previous research suggested explanations based on biological adaptations [Hurlbert AC, Ling YL (2007) Curr Biol 17:623-625] and color-emotions [Ou L-C, Luo MR, Woodcock A, Wright A (2004) Color Res Appl 29:381-389]. In this article we articulate an ecological valence theory in which color preferences arise from people's average affective responses to color-associated objects. An empirical test provides strong support for this theory: People like colors strongly associated with objects they like (e.g., blues with clear skies and clean water) and dislike colors strongly associated with objects they dislike (e.g., browns with feces and rotten food). Relative to alternative theories, the ecological valence theory both fits the data better (even with fewer free parameters) and provides a more plausible, comprehensive causal explanation of color preferences.

ResDE Two-Component Regulatory System Mediates Oxygen Limitation-Induced Biofilm Formation by Bacillus amyloliquefaciens SQR9.

PubMed

Zhou, Xuan; Zhang, Nan; Xia, Liming; Li, Qing; Shao, Jiahui; Shen, Qirong; Zhang, Ruifu

2018-04-15

Efficient biofilm formation and root colonization capabilities facilitate the ability of beneficial plant rhizobacteria to promote plant growth and antagonize soilborne pathogens. Biofilm formation by plant-beneficial Bacillus strains is triggered by environmental cues, including oxygen deficiency, but the pathways that sense these environmental signals and regulate biofilm formation have not been thoroughly elucidated. In this study, we showed that the ResDE two-component regulatory system in the plant growth-promoting rhizobacterium Bacillus amyloliquefaciens strain SQR9 senses the oxygen deficiency signal and regulates biofilm formation. ResE is activated by sensing the oxygen limitation-induced reduction of the NAD + /NADH pool through its PAS domain, stimulating its kinase activity, and resulting in the transfer of a phosphoryl group to ResD. The phosphorylated ResD directly binds to the promoter regions of the qoxABCD and ctaCDEF operons to improve the biosynthesis of terminal oxidases, which can interact with KinB to activate biofilm formation. These results not only revealed the novel regulatory function of the ResDE two-component system but also contributed to the understanding of the complicated regulatory network governing Bacillus biofilm formation. This research may help to enhance the root colonization and the plant-beneficial efficiency of SQR9 and other Bacillus rhizobacteria used in agriculture. IMPORTANCE Bacillus spp. are widely used as bioinoculants for plant growth promotion and disease suppression. The exertion of their plant-beneficial functions is largely dependent on their root colonization, which is closely related to their biofilm formation capabilities. On the other hand, Bacillus is the model bacterium for biofilm study, and the process and molecular network of biofilm formation are well characterized (B. Mielich-Süss and D. Lopez, Environ Microbiol 17:555-565, 2015, https://doi.org/10.1111/1462-2920.12527; L. S. Cairns, L. Hobley, and N. R. Stanley-Wall, Mol Microbiol 93:587-598, 2014, https://doi.org/10.1111/mmi.12697; H. Vlamakis, C. Aguilar, R. Losick, and R. Kolter, Genes Dev 22:945-953, 2008, https://doi.org/10.1101/gad.1645008; S. S. Branda, A. Vik, L. Friedman, and R. Kolter, Trends Microbiol 13:20-26, 2005, https://doi.org/10.1016/j.tim.2004.11.006; C. Aguilar, H. Vlamakis, R. Losick, and R. Kolter, Curr Opin Microbiol 10:638-643, 2007, https://doi.org/10.1016/j.mib.2007.09.006; S. S. Branda, J. E. González-Pastor, S. Ben-Yehuda, R. Losick, and R. Kolter, Proc Natl Acad Sci U S A 98:11621-11626, 2001, https://doi.org/10.1073/pnas.191384198). However, the identification and sensing of environmental signals triggering Bacillus biofilm formation need further research. Here, we report that the oxygen deficiency signal inducing Bacillus biofilm formation is sensed by the ResDE two-component regulatory system. Our results not only revealed the novel regulatory function of the ResDE two-component regulatory system but also identified the sensing system of a biofilm-triggering signal. This knowledge can help to enhance the biofilm formation and root colonization of plant-beneficial Bacillus strains and also provide new insights of bacterial biofilm formation regulation. Copyright © 2018 American Society for Microbiology.

Investigation of Intravenous Hydroxocobalamin Compared to Hextend for Resuscitation in a Swine Model of Uncontrolled Hemorrhagic Shock: A Preliminary Report

DTIC Science & Technology

2017-06-16

Iy Dlrec~ b. Is not ~j’lnll I’cr ~pport. res, ~ es or otollr~phs for pu -.. 2. Pilnt your ~me, r~nk;;. l ~Ge. sllln dll~ tt. ’brm In tt.e ~utho(s block...or e eledronl: slgnal1Jre. :> ..••• 1t21 a COP)’of the S9 [e.O.=e report, QA’ DWIR:E> IAC\\JC sl1JGY,progr ev~1 ~ the r8~arch ~ l ". ed l .1udy. If this...a ~chnl~1 U! l caU:,"!IJ~SCI’l~3I1on,~e the ~pe rn~DtlTllI.llon report. eft< , etc.) In the "P~co Tltee" t: x. 4 ..•••1tll a copy of your b’WIlc1

Studies on the mechanism of action of 6-mercaptopurine. Interaction with copper and xanthine oxidase.

PubMed

Kela, U; Vijayvargiya, R

1981-03-01

Interaction between 6-mercaptopurine, Cu2+ and the enzyme xanthine oxidase (EC 1.2.3.2.) was examined. Whereas Cu2+ was found to inhibit the enzyme, 6-mercaptopurine could protect as well as reverse the enzyme inhibition produced by the metal ion. The formation of a complex between 6-mercaptopurine and Cu2+ seems to be responsible for the observed effect. Job's [(1928) Ann. Chem. 9, 113] method has shown the composition of the complex to be 1:1. The apparent stability constant (log K value), as determined by Subhrama Rao & Raghav Rao's [(1955) J. Sci. Chem. Ind. Res. 143, 278], method is found to be 6.74. It is suggested that the formation of a stable complex between 6-mercaptopurine molecules and Cu2+ may be an additional mechanism of action of 6-mercaptopurine, particularly with reference to its anti-inflammatory properties.

High resolution x-ray Thomson scattering measurements from cryogenic hydrogen jets using the linac coherent light source

DOE PAGES

Fletcher, L. B.; Zastrau, U.; Galtier, E.; ...

2016-08-15

Here, we present the first spectrally resolved measurements of x-rays scattered from cryogenic hydrogen jets in the single photon counting limit. The 120 Hz capabilities of the LCLS, together with a novel hydrogen jet design [J. B. Kim et al., Rev. Sci. Instrum. (these proceedings)], allow for the ability to record a near background free spectrum. Such high-dynamic-range x-ray scattering measurements enable a platform to study ultra-fast, laser-driven, heating dynamics of hydrogen plasmas. This measurement has been achieved using two highly annealed pyrolytic graphite crystal spectrometers to spectrally resolve 5.5 keV x-rays elastically and inelastically scattered from cryogenic hydrogen andmore » focused on Cornell-SLAC pixel array detectors [S. Herrmann et al., Nucl. Instrum. Methods Phys. Res., Sect. A 718, 550 (2013)].« less

Mathematical modeling of a multi-product EMQ model with an enhanced end items issuing policy and failures in rework.

PubMed

Chiu, Yuan-Shyi Peter; Sung, Peng-Cheng; Chiu, Singa Wang; Chou, Chung-Li

2015-01-01

This study uses mathematical modeling to examine a multi-product economic manufacturing quantity (EMQ) model with an enhanced end items issuing policy and rework failures. We assume that a multi-product EMQ model randomly generates nonconforming items. All of the defective are reworked, but a certain portion fails and becomes scraps. When rework process ends and the entire lot of each product is quality assured, a cost reduction n + 1 end items issuing policy is used to transport finished items of each product. As a result, a closed-form optimal production cycle time is obtained. A numerical example demonstrates the practical usage of our result and confirms a significant savings in stock holding and overall production costs as compared to that of a prior work (Chiu et al. in J Sci Ind Res India, 72:435-440 2013) in the literature.

Studies on the mechanism of action of 6-mercaptopurine. Interaction with copper and xanthine oxidase.

PubMed Central

Kela, U; Vijayvargiya, R

1981-01-01

Interaction between 6-mercaptopurine, Cu2+ and the enzyme xanthine oxidase (EC 1.2.3.2.) was examined. Whereas Cu2+ was found to inhibit the enzyme, 6-mercaptopurine could protect as well as reverse the enzyme inhibition produced by the metal ion. The formation of a complex between 6-mercaptopurine and Cu2+ seems to be responsible for the observed effect. Job's [(1928) Ann. Chem. 9, 113] method has shown the composition of the complex to be 1:1. The apparent stability constant (log K value), as determined by Subhrama Rao & Raghav Rao's [(1955) J. Sci. Chem. Ind. Res. 143, 278], method is found to be 6.74. It is suggested that the formation of a stable complex between 6-mercaptopurine molecules and Cu2+ may be an additional mechanism of action of 6-mercaptopurine, particularly with reference to its anti-inflammatory properties. PMID:6895465

Ballistic low-temperature magnon heat conduction in the helimagnetic insulator Cu2OSeO3

NASA Astrophysics Data System (ADS)

Prasai, Narayan; Akopyan, Artem; Huang, Sunxiang; Cohn, Joshua L.; Trump, Benjamin; Marcus, Guy G.; McQueen, Tyrel M.

We report on the observation of magnon thermal conductivities κm 80 W/mK near T = 5 K in single crystals of the helimagnetic insulator Cu2OSeO3, exceeding those observed previously in any other ferro- or ferrimagnet by almost two orders of magnitude. Distinguished in applied magnetic field, both magnon and phonon thermal conductivities exhibit ballistic behavior below 1K, with mean free paths limited by specimen boundaries. Changes in κm through the helical-conical and conical-collinear spin-phase transitions with increasing applied field will also be discussed. This material is based on work supported by the U.S. DOE, Off. of BES, Div. of Mater. Sci. and Eng., under Grants No. DEFG02-12ER46888 (Miami), DEFG02-08ER46544 (JHU), and the NSF, Div. of Mater. Res., Sol. St. Chem., CAREER Grant No. DMR-1253562 (JHU).

Low-temperature spin-Seebeck effect in the helimagnetic insulator Cu2OSeO3

NASA Astrophysics Data System (ADS)

Akopyan, Artem; Prasai, Narayan; Huang, Sunxiang; Cohn, Joshua L.; Trump, Benjamin; Marcus, Guy G.; McQueen, Tyrel M.

We report on measurements of the longitudinal spin-Seebeck effect in single crystals of the helimagnetic insulator Cu2OSeO3 in the range 0 . 5 K <= T <= 15 K , using sputtered Pt thin films for spin-current detection. Simultaneous determination of magnon thermal conductivities for each specimen allows for a ``calibration'' of the spin current. The influence on the inverse spin-Hall signal of the helical-conical and conical-collinear magnetic phase transitions as well as different crystallographic orientations for the heat flow and applied magnetic field, will be discussed. This material is based on work supported by the U.S. DOE, Off. of BES, Div. of Mater. Sci. and Eng., under Grants No. DEFG02-12ER46888 (Miami), DEFG02-08ER46544 (JHU), and the NSF, Div. of Mater. Res., Sol. St. Chem., CAREER Grant No. DMR-1253562 (JHU).

Re-inhabiting place in contemporary rural communities: Moving toward a critical pedagogy of place

NASA Astrophysics Data System (ADS)

Huffling, Lacey D.; Carlone, Heidi B.; Benavides, Aerin

2017-03-01

Heather Zimmerman and Jennifer Weible's (Cult Stud Sci Educ, 2016) use of place-based pedagogy in high school science education honors their participants' lived experiences and the rural communities from which they come. They raise an unresolved tension in their findings: Why did the youth in their study, who clearly learned a lot about the local watershed, not feel empowered or knowledgeable enough to propose collective, action-oriented strategies to address the poor quality of the water? We use this tension as a focus point of our response, drawing on one author's (Huffling's) biography and David Gruenewald's (Educ Res 32:3-12, 2003. doi: 10.3102/0013189X032004003) critical pedagogy of place to re-imagine the curriculum that Zimmerman and Weible describe. We provide strategies that align with Gruenewald's (2003) constructs of decolonization and reinhabitation that could promote youths' collective empowerment.

Secondary structure and phylogeny of Staphylococcus and Micrococcus 5S rRNAs.

PubMed Central

Dekio, S; Yamasaki, R; Jidoi, J; Hori, H; Osawa, S

1984-01-01

Nucleotide sequences of 5S rRNAs from four bacteria, Staphylococcus aureus Smith (diffuse), Staphylococcus epidermidis ATCC 14990, Micrococcus luteus ATCC 9341 and Micrococcus luteus ATCC 4698, were determined. The secondary structural models of S. aureus and S. epidermidis sequences showed characteristics of the gram-positive bacterial 5S rRNA (116-N type [H. Hori and S. Osawa, Proc. Natl. Acad. Sci. U.S.A. 76:381-385, 1979]). Those of M. luteus ATCC 9341 and M. luteus ATCC 4698 together with that of Streptomyces griseus (A. Simoncsits, Nucleic Acids Res. 8:4111-4124, 1980) showed intermediary characteristics between the gram-positive and gram-negative (120-N type [H. Hori and S. Osawa, 1979]) 5S rRNAs. This and previous studies revealed that there exist at least three major groups of eubacteria having distinct 5S rRNA and belonging to different stems in the 5S rRNA phylogenic tree. PMID:6735981

Application of remote sensing and geographical information system for generation of runoff curve number

NASA Astrophysics Data System (ADS)

Meshram, S. Gajbhiye; Sharma, S. K.; Tignath, S.

2017-07-01

Watershed is an ideal unit for planning and management of land and water resources (Gajbhiye et al., IEEE international conference on advances in technology and engineering (ICATE), Bombay, vol 1, issue 9, pp 23-25, 2013a; Gajbhiye et al., Appl Water Sci 4(1):51-61, 2014a; Gajbhiye et al., J Geol Soc India (SCI-IF 0.596) 84(2):192-196, 2014b). This study aims to generate the curve number, using remote sensing and geographical information system (GIS) and the effect of slope on curve number values. The study was carried out in Kanhaiya Nala watershed located in Satna district of Madhya Pradesh. Soil map, Land Use/Land cover and slope map were generated in GIS Environment. The CN parameter values corresponding to various soil, land cover, and land management conditions were selected from Natural Resource Conservation Service (NRCS) standard table. Curve number (CN) is an index developed by the NRCS, to represent the potential for storm water runoff within a drainage area. The CN for a drainage basin is estimated using a combination of land use, soil, and antecedent soil moisture condition (AMC). In present study effect of slope on CN values were determined. The result showed that the CN unadjusted value are higher in comparison to CN adjusted with slope. Remote sensing and GIS is very reliable technique for the preparation of most of the input data required by the SCS curve number model.

A multicharge ion source (Supernanogan) for the OLIS facility at ISAC/TRIUMF.

PubMed

Jayamanna, K; Wight, G; Gallop, D; Dube, R; Jovicic, V; Laforge, C; Marchetto, M; Leross, M; Louie, D; Laplante, R; Laxdal, R; McDonald, M; Wiebe, G J; Wang, V; Yan, F

2010-02-01

The Off-Line Ion Source (OLIS) [K. Jayamanna, D. Yuan, T. Kuo, M. MacDonald, P. Schmor, and G. Dutto, Rev. Sci. Instrum. 67, 1061 (1996); K. Jayamanna, Rev. Sci. Instrum. 79, 02711 (2008)] facility consists of a high voltage terminal containing a microwave cusp ion source, either a surface ion source or a hybrid surface-arc discharge ion source [K. Jayamanna and C. Vockenhuber, Rev. Sci. Instrum. 79, 02C712 (2008)], and an electrostatic switch that allows the selection of any one of the sources without mechanical intervention. These sources provide a variety of +1 beams up to mass 30 for Isotope Separator and ACcelerator (ISAC) [R. E. Laxdal, Nucl. Instrum. Methods Phys. Res. B 204, 400 (2003)] experiments, commissioning the accelerators, setting up the radioactive experiments, and for tuning the beam lines. The radio frequency quadrupole (RFQ) [M. Marchetto, Z. T. Ang, K. Jayamanna, R. E. Laxdal, A. Mitra, and V. Zvyagintsev, Eur. Phys. J. Spec. Top. 150, 241 (2005)] injector accelerator is a constant velocity machine designed to accept only 2 keV/u and the source extraction energy is limited to 60 kV. Further stripping is then needed downstream of the RFQ to inject the beam into the drift tube linac [M. Marchetto, Z. T. Ang, K. Jayamanna, R. E. Laxdal, A. Mitra, and V. Zvyagintsev, Eur. Phys. J. Spec. Top. 150, 241 (2005)] accelerator that requires A/q up to 6. Base on this constraints a multicharge ion source capable to deliver beams above mass 30 with A/q up to 6 was needed in order to reach full capability of the ISAC facility. A Supernanogan [C. Bieth et al., Nucleonika 48, S93 (2003)] multicharge ion source was then purchased from Pantechnik and was installed in the OLIS terminal. Commissioning and performance of the Supernanogan with some results such as emittance dependence of the charge states as well as charge state efficiencies are presented.

15-digit accuracy calculations of Ambartsumian-Chandrasekhar's H-functions for four-term phase functions with the double-exponential formula

NASA Astrophysics Data System (ADS)

Kawabata, Kiyoshi

2018-01-01

We have established an iterative scheme to calculate with 15-digit accuracy the numerical values of Ambartsumian-Chandrasekhar's H-functions for anisotropic scattering characterized by the four-term phase function: the method incorporates some advantageous features of the iterative procedure of Kawabata (Astrophys. Space Sci. 358:32, 2015) and the double-exponential integration formula (DE-formula) of Takahashi and Mori (Publ. Res. Inst. Math. Sci. Kyoto Univ. 9:721, 1974), which proved highly effective in Kawabata (Astrophys. Space Sci. 361:373, 2016). Actual calculations of the H-functions have been carried out employing 27 selected cases of the phase function, 56 values of the single scattering albedo π0, and 36 values of an angular variable μ(= cosθ), with θ being the zenith angle specifying the direction of incidence and/or emergence of radiation. Partial results obtained for conservative isotropic scattering, Rayleigh scattering, and anisotropic scattering due to a full four-term phase function are presented. They indicate that it is important to simultaneously verify accuracy of the numerical values of the H-functions for μ<0.05, the domain often neglected in tabulation. As a sample application of the isotropic scattering H-function, an attempt is made in Appendix to simulate by iteratively solving the Ambartsumian equation the values of the plane and spherical albedos of a semi-infinite, homogeneous atmosphere calculated by Rogovtsov and Borovik (J. Quant. Spectrosc. Radiat. Transf. 183:128, 2016), who employed their analytical representations for these quantities and the single-term and two-term Henyey-Greenstein phase functions of appreciably high degrees of anisotropy. While our results are in satisfactory agreement with theirs, our procedure is in need of a faster algorithm to routinely deal with problems involving highly anisotropic phase functions giving rise to near-conservative scattering.

Development of a Short-Form Measure of Science and Technology Self-efficacy Using Rasch Analysis

NASA Astrophysics Data System (ADS)

Lamb, Richard L.; Vallett, David; Annetta, Leonard

2014-10-01

Despite an increased focus on science, technology, engineering, and mathematics (STEM) in U.S. schools, today's students often struggle to maintain adequate performance in these fields compared with students in other countries (Cheek in Thinking constructively about science, technology, and society education. State University of New York, Albany, 1992; Enyedy and Goldberg 2004; Mandinach and Lewis 2006). In addition, despite considerable pressure to promote the placement of students into STEM career fields, U.S. placement is relatively low (Sadler et al. in Sci Educ 96(3):411-427, 2012; Subotnik et al. in Identifying and developing talent in science, technology, engineering, and mathematics (STEM): an agenda for research, policy and practice. International handbook, part XII, pp 1313-1326, 2009). One explanation for the decline of STEM career placement in the U.S. rests with low student affect concerning STEM concepts and related content, especially in terms of self-efficacy. Researchers define self-efficacy as the internal belief that a student can succeed in learning, and that understanding student success lies in students' externalized actions or behaviors (Bandura in Psychol Rev 84(2):191-215, 1977). Evidence suggests that high self-efficacy in STEM can result in student selection of STEM in later educational endeavors, culminating in STEM career selection (Zeldin et al. in J Res Sci Teach 45(9):1036-1058, 2007). However, other factors such as proficiency play a role as well. The lack of appropriate measures of self-efficacy can greatly affect STEM career selection due to inadequate targeting of this affective trait and loss of opportunity for early intervention by educators. Lack of early intervention decreases selection of STEM courses and careers (Valla and Williams in J Women Minor Sci Eng 18(1), 2012; Lent et al. in J Couns Psychol 38(4), 1991). Therefore, this study developed a short-form measure of self-efficacy to help identify students in need of intervention.

Observing terrestrial water storage and land-atmosphere dynamics from space: Implications for forecasting and climate projections

NASA Astrophysics Data System (ADS)

Seneviratne, S. I.; Humphrey, V.; Nicolai-Shaw, N.; Gudmundsson, L.; Guillod, B.; Hirschi, M.; Michel, D.; Orth, R.; Zscheischler, J.

2016-12-01

In recent years, several new satellite products have been derived which allow an unprecendented assessment of terrestrial water storage and land-atmosphere dynamics. This presentation will review some of these new developments, with a focus on drought dynamics, plant-water interactions, and soil moisture-atmosphere feedbacks. Results derived based on the Gravity Recovery and Climate Experiment (GRACE, Humphrey et al. 2016) and the European Space Agency Climate Change Initiative (ESA CCI) Soil Moisture dataset (Nicolai-Shaw et al. 2015, 2016; Hirschi et al. 2014) will be highlighted, as well as assessments using satellite-based estimates of evapotranspiration (Mueller and Seneviratne 2014, Michel et al. 2016), vegetation activity (Zscheischler et al. 2015), and combined soil moisture and precipitation analyses (Guillod et al. 2015). These findings provide new insights on the development of prediction capabilities for droughts, precipitation events, and heat waves, and the reduction of uncertainties in climate model projections. References: Guillod, B.P., B. Orlowsky, D.G. Miralles, A.J. Teuling, and S.I. Seneviratne, 2015. Nature Communications, 6:6443, DOI: 10.1038/ncomms7443 Hirschi, M., B. Mueller, W. Dorigo, and S.I. Seneviratne, 2014. Remote Sensing of Environment, 154, 246-252. Humphrey, V., L. Gudmundsson, and S.I. Seneviratne, 2016. Surv. Geophysics, 37, 357-395, DOI 10.1007/s10712-016-9367-1. Michel, D., et al. 2016. Hydrol. Earth Syst. Sci. 20, 803-822, doi:10.5194/hess-20-803-2016. Mueller, M., and S.I. Seneviratne, 2014. Geophys. Res. Lett., 41, 1-7, doi:10.1002/2013GL058055. Nicolai-Shaw, N., L. Gudmundsson, M. Hirschi, and S.I. Seneviratne, 2016. Geophys. Res. Lett., in review. Nicolai-Shaw, N., M. Hirschi, H. Mittelbach, and S.I. Seneviratne, 2015. Journal of Geophysical Research, 120, doi:10.1002/2015JD023305. Zscheischler, J., R. Orth, and S.I. Seneviratne, 2015. Geophys. Res. Lett., 42, 9816-9824, doi:10.1002/2015GL066563.

Extensive decarbonation of continuously hydrated subducting slabs

NASA Astrophysics Data System (ADS)

Arzilli, Fabio; Burton, Mike; La Spina, Giuseppe; Macpherson, Colin G.

2017-04-01

CO2 release from subducting slabs is a key element of Earth's carbon cycle, consigning slab carbon either to mantle burial or recycling to the surface through arc volcanism, however, what controls subducted carbon's fate is poorly understood. Fluids mobilized by devolatilization of subducting slabs play a fundamental role in the melting of mantle wedges and in global geochemical cycles [1]. The effect of such fluids on decarbonation in subducting lithologies has been investigated recently [2-5], but several thermodynamic models [2-3], and experimental studies [6] suggest that carbon-bearing phases are stable at sub-arc depths (80-140 km; 2.6-4.5 GPa), implying that this carbon can be carried to mantle depths of >140 km. This is inconsistent with observations of voluminous CO2 release from arc volcanoes [7-10], located above slabs that are at 2.6-4.5 GPa pressure. The aim of this study is to re-evaluate the role of metamorphic decarbonation, showing if decarbonation reactions could be feasible at sub-arc depths combined with a continuous hydration scenario. We used the PerpleX software combined with a custom-designed algorithm to simulate a pervasive fluid infiltration characterized by "continuous hydration" combined with a distillation model, in which is possible to remove CO2 when decarbonation occurs, to obtain an open-system scenario. This is performed by repeatedly flushing the sediment with pure H2O at 0.5, 1.0 or 5 wt.% until no further decarbonation occurs. Here we show that continuous hydrated of sediment veneers on subducting slabs by H2O released from oceanic crust and serpentinised mantle lithosphere [11-13], produces extensive slab decarbonation over a narrow, sub-arc pressure range, even for low temperature subduction pathways. This explains the location of CO2-rich volcanism, quantitatively links the sedimentary composition of slab material to the degree of decarbonation and greatly increases estimates for the magnitude of carbon flux through the arc in subduction zones. [1] Hilton, D.R. et al. (2002) Rev. Mineral. Geochem. 47, 319-370. [2] Gorman, P.J. et al. (2006) Geochem. Geophys. Geosyst. 7. [3] Kerrick, D.M. and Connolly, J.A.D. (2001) Nature 411, 293-296. [4] Cook-Kollars, J. et al. (2014) Chem. Geol. 386, 31-48. [5] Collins, N.C. et al. (2015) Chem. Geol. 412, 132-150. [6] Poli, S. et al. (2009) Earth Planet. Sci. Lett. 278, 350-360. [7] Sano, Y. and Williams, S.N. (1996) Geophys. Res. Lett. 23, 2749-2752. [8] Marty, B. and Tolstikhin, I.N. (1998) Chem. Geol. 145, 233-248. [9] Wallace, P.J. (2005) J. Volcanol. Geoth. Res. 140, 217-240. [10] Burton, M.R. et al. (2013) Rev. Mineral. Geochem. 75, 323-354. [11] Ulmer, P. and Trommsdorff, V. (1995) Science 268, 858-861. [12] Schmidt, M.W. and Poli, S. (1998) Earth Planet. Sci. Lett. 163, 361-379. [13] van Keken, P. E. et al. (2011) J. Geophys. Res. 116.

Seasonal and radial trends in Saturn’s thermal plasma between the main rings and Enceladus

NASA Astrophysics Data System (ADS)

Elrod, M. K.; Tseng, W.-L.; Woodson, A. K.; Johnson, R. E.

2014-11-01

A goal of Cassini's extended mission is to examine the seasonal variations of Saturn's magnetosphere, moons, and rings. Recently we showed that the thermal plasma between the main rings and Enceladus exhibited a time dependence that we attributed to a seasonally variable source of oxygen from the main rings (Elrod, M.K., Tseng, W.-L., Wilson, R.J., Johnson, R.E. [2012]. J. Geophys. Res. 117, A03207. http://dx.doi.org/10.1029/2011JA017332). Such a temporal variation was subsequently seen in the energetic ion composition (Christon, S.P., Hamilton, D.C., DiFabio, R.D., Mitchel, D.G., Krimigis, S.M., Jontof-Hutter, D.S. [2013]. J. Geophys. Res. 28. http://dx.doi.org/10.1002/jgra.50383; Christon, S.P., Hamilton, D.C., Mitchell, D.G., DiFabio, R.D., Krimigis, S.M. [2014]. J. Geophys. Res., submitted for publication). Here we incorporate the most recent measurements by the Cassini Plasma Spectrometer (CAPS) into our earlier analysis (Elrod, M.K., Tseng, W.-L., Wilson, R.J., Johnson, R.E. [2012]. J. Geophys. Res. 117, A03207. http://dx.doi.org/10.1029/2011JA017332) and our modeling (Tseng, W.-L., Johnson, R.E., Elrod, M.K. [2013a]. Planet. Space Sci. 77, 126-135) of the thermal plasma in the region between the main rings and the orbit of Enceladus. Data taken in 2012, well past equinox for which the northern side of the main rings were illuminated, appear consistent with a seasonal variation. Although the thermal plasma in this region comes from two sources that have very different radial and temporal trends, the extended ring atmosphere and the Enceladus torus, the heavy ion density is found to exhibit a steep radial dependence that is similar for the years examined. Using our chemical model, we show that this dependence requires either a radial dependence for Enceladus torus that differs significantly from recent models or, as we suggest here, enhanced heavy ion quenching/neutralization with decreasing distance from the edge of the main rings. We examine the possible physical processes and suggest that the presence of small grains and the precipitation of the inward diffusing high-energy background radiation onto the edge of the main rings play important roles.

Detection of negative pickup ions at Saturn's moon Dione

NASA Astrophysics Data System (ADS)

Nordheim, T.; Jones, G. H.; Coates, A. J.; Wellbrock, A.; Hand, K. P.; Waite, J. H., Jr.

2015-12-01

Negative ions may be formed in both tenuous and dense planetary atmospheres and have been observed in-situ at Earth, Titan [Coates et al., 2007, 2009; Wellbrock et al., 2013] and Enceladus [Coates et al., 2010] as well as at comet Halley [Chaizy et al., 1991]. In the case of Titan, heavy hydrocarbon and nitrile based ions with masses reaching almost 14,000 amu/q have been observed using the CAPS Electron Spectrometer (ELS) onboard Cassini. These are believed to form even more massive organic aerosols termed tholins which fall to lower altitudes where they make up the distinct haze layers, and eventually rain down onto Titan's surface perhaps forming the organic-rich dunes. Very tenuous atmospheres were predicted at the smaller icy moons of Saturn [Sittler et al., 2004; Saur and Strobel, 2005], and subsequently detected [Teolis et al., 2010; Tokar et al., 2012]. These are produced when charged particles from Saturn's magnetosphere interact with moon surfaces, ejecting neutral species. Some portion of these atmospheric neutrals will in turn become ionized and 'picked up' by Saturn's corotating magnetosphere. These pickup ions will then move in cycloidal trajectories that we may intercept using the Cassini spacecraft, even at considerable distance from the moon itself. In this fashion, negative and positive pickup ions have been used to infer a tenuous CO2-O2 atmosphere at Saturn's moon Rhea [Teolis et al., 2010], and positive pickup ions at Dione [Tokar et al., 2012]. Here we report on the detection of negative pickup ions during a close flyby of Dione by the Cassini CAPS ELS instrument, and the implications that these observations may have for the Dionian atmosphere. Chaizy, P., et al. (1991), Nature, 349(6308), 393-396 Coates, A. J., et al. (2007), Geophys. Res. Lett., 34(22), 6-11 Coates, A. J., et al. (2009), Planet. Space Sci., 57(14-15), 1866-1871 Coates, A. J., et al. (2010), Icarus, 206(2), 618-622 Saur, J., and D. F. Strobel (2005), Astrophys. J. Lett., 620, L115. Sittler, E. C., et al. (2004), J. Geophys. Res., 109(A1) Teolis, B. D., et al. (2010), Science, 330(6012), 1813-5 Tokar, R. L., et al. (2012) Geophys. Res. Lett., 39(3), 1-7 Wellbrock, A., et al.(2013), Geophys. Res. Lett., 40(17), 4481-4485

Observation of reflected electrons driven quasi- longitudinal (QL) whistlers in large laboratory plasma

NASA Astrophysics Data System (ADS)

Sanyasi, A. K.; Awasthi, L. M.; Srivastava, P. K.; Mattoo, S. K.; Sharma, D.; Singh, R.; Paikaray, R.; Kaw, P. K.

2017-10-01

This paper reports experimental and theoretical investigations on plasma turbulence in the source plasma of a Large Volume Plasma Device. It is shown that a highly asymmetrical localized thin rectangular slab of strong plasma turbulence is excited by loss cone instability. The position of the slab coincides with the injection line of the primary ionizing energetic electrons. Outside the slab, in the core, the turbulence is weaker by a factor of 30 . The plasma turbulence consists of oblique [ θ=tan-1(k⊥/k||)≈87 ° ] Quasi-Longitudinal (QL) electromagnetic whistlers in a broad band of 40 kHz

Optical Emissions of Sprite Streamers in Weak Electric Fields

NASA Astrophysics Data System (ADS)

Liu, N.; Pasko, V. P.

2004-12-01

Sprites commonly consist of large numbers of needle-shaped filaments of ionization [e.g., Gerken and Inan, JASTP, 65, 567, 2003] and typically initiate at altitudes 70-75 km in a form of upward and downward propagating streamers [Stanley et al., GRL, 26, 3201, 1999; Stenbaek-Nielsen et al., GRL, 27, 3829, 2000; McHarg et al., JGR, 107, 1364, 2002; Moudry et al., JASTP, 65, 509, 2003]. The strong electric fields E exceeding the conventional breakdown threshold field Ek are needed for initiation of sprite streamers from single electron avalanches and recent modeling studies indicate that streamers propagating in fields E>Ek experience strong acceleration and expansion in good agreement with the above cited observations [Liu and Pasko, JGR, 109, A04301, 2004]. The initiated streamers are capable of propagating in fields substantially lower than Ek [Allen and Ghaffar, J. Phys. D: Appl. Phys., 28, 331, 1995] and it is expected that a significant part of sprite optical output comes from regions with EEk). Additionally, the values of electric fields inside of the streamer channel are always well below Ek and since the excitation coefficients for optical emissions are very sensitive to the driving electric field magnitude most of the optical luminosity of streamers in this case arises from streamer tips, indicating that observed streamer filaments in many cases may be produced by time averaging of optical luminosity coming from localized regions around streamer tips as streamers move through an instrument's field of view. We will discuss pressure dependent differences of optical emissions at different sprite altitudes, and important similarities between observed sprite streamers and recent time resolved (<1 ns) imaging of laboratory streamers in point-to-plane discharge geometry conducted at ground and near ground pressures [van Veldhuizen et al., IEEE Trans. Plasma Sci., 30, 162, 2002; Yi and Williams, J. Phys. D. Appl. Phys., 35, 205, 2002].

Performance evaluation of different diamond-like carbon samples as charge state conversion surfaces for neutral atom imaging detectors in space applications

NASA Astrophysics Data System (ADS)

Brigitte Neuland, Maike; Allenbach, Marc; Föhn, Martina; Wurz, Peter

2017-04-01

The detection of energetic neutral atoms is a substantial requirement on every space mission mapping particle populations of a planetary magnetosphere or plasma of the interstellar medium. For imaging neutrals, these first have to be ionised. Regarding the constraints of weight, volume and power consumption, the technique of surface ionisation complies with all specifications of a space mission. Particularly low energy neutral atoms, which cannot be ionised by passing through a foil, are ionised by scattering on a charge state conversion surface [1]. Since more than 30 years intense research work is done to find and optimise suitable materials for use as charge state conversion surfaces for space application. Crucial parameters are the ionisation efficiency of the surface material and the scattering properties. Regarding these parameters, diamond-like carbon was proven advantageously: While efficiently ionising incoming neutral atoms, diamond stands out by its durability and chemical inertness [2]. In the IBEX-Lo sensor, a diamond-like carbon surface is used for ionisation of neutral atoms. Building on the successes of the IBEX mission [3], the follow up mission IMAP (InterstellarMApping Probe) will take up to further explore the boundaries of the heliosphere. The IMAP mission is planned to map neutral atoms in a larger energy range and with a distinct better angular resolution and sensitivity than IBEX [4]. The aspired performance of the IMAP sensors implies also for charge state conversion surfaces with improved characteristics. We investigated samples of diamond-like carbon, manufactured by the chemical vapour deposition (CVD) method, regarding their ionisation efficiency, scattering and reflexion properties. Experiments were carried out at the ILENA facility at the University of Bern [5] with hydrogen and oxygen atoms, which are the species of main interest in magnetospheric research [1]. We compare the results of earlier investigations of a metallised CVD sample [6] to our latest measurements of a Boron-doped CVD diamond sample. We additionally measured the B-concentration in the sample to prove our predictions of the B-concentration needed to reach sufficient conductibility for the sample not getting electrostatically charged during instrument operation. The results of narrower scattering cones and higher ionisation efficiency show that diamond-like carbon still is the preferred material for charge state conversion surfaces and that new surface technologies offer improved diamond conversion surfaces with different properties and hence the possibility for improvement of the performance of neutral atom imaging instruments. References: [1] P. Wurz, Detection of Energetic Neutral Atoms, in The Outer Heliosphere: Beyond the Planets, Copernicus Gesellschaft e.V., Katlenburg-Lindau, Germany, 2000, p. 251-288. [2] P. Wurz, R. Schletti, M.R. Aellig, Surf. Sci. 373(1997), 56-66. [3] D.J. McComas et al., Geophys. Res. Lett. 38(2011), L18101. [4] N.A. Schwadron et al., J. of Phys.. Conf. Series 767(2016): 012025 [5] P. Wahlström, J.A. Scheer, A. Riedo, P. Wurz and M. Wieser, J. Spacecr. Rockets 50 (2013): 402-410. [6] M.B. Neuland, J.A. Scheer, A. Riedo and P. Wurz, Appl. Surf. Sci. 313(2014):293-303.

A deep scar in the flank of Tenerife (Canary Islands): Geophysical contribution to tsunami hazard assessment

NASA Astrophysics Data System (ADS)

Coppo, Nicolas P.; Schnegg, Pierre-André; Falco, Pierik; Costa, Roberto

2009-05-01

Among the high-intensity on-Earth tsunami generating events, seismicity, submarine landslides, and volcano lateral collapses are the most important [Ward, S.H., 2001. Landslide tsunami. J. Geophy. Res. 106, 11201-11215; Holcomb, R.T., Searle, R.C., 1991. Large landslides from oceanic volcanoes. Mar. Geotech. 10, 19-32; Tinti, S., Bortolucci, E., Romagnoli, C., 2000. Computer simulations of tsunamis due to the sector collapse ar Stromboli, Italy. J. Volcano. Geotherm. Res. 96, 103-128; Ward, S.N., Day, S., 2003. Ritter Island Volcano — lateral collapse and the tsunami of 1888. Geophys. J. Int. 154, 891-902; MacGuire, W.J., 2003. Volcano instability and lateral collapse. Revista 1, 33-45]. Offshore bathymetry studies highlighted huge accumulations of large mass-waste flows (up to thousands cubic kilometres) inherited from past lateral collapses or submarine landslides [ Le Friant, A., Boudon, G., Deplus, C., Villemant, B., 2003. Large-scale flank collapse events during the activity of Montagne Pelée, Martinique, Lesser Antilles. J. Geophys. Res. 108, ECV13; Moore, J.G. et al., 1989. Prodigious submarine Landslides on the Hawaiian ridge. J. Geophys. Res. 94, 17465-17484] which spread over more than 100 km off the northern Tenerife (Canary Islands) coastline [Watts, A.B., Masson, D.G., 1995. A giant landslide on the north flank of Tenerife, Canary Islands. J. Geophys. Res. 100, 24487-24498]. Although mechanics and dynamics triggering such catastrophic events follow from combined complex processes and interactions [Hürlimann, M., Garcia-Piera, J.-O., Ledesma, A., 2000. Causes and mobility of large volcanic landslides: application to Tenerife, Canary Islands. J. Volcano. Geotherm. Res. 103, 121-134; Masson, D.G. et al., 2002. Slope failures on the flanks of the western Canary Islands. Earth-Sci. Rev. 57, 1-35; Reid, M.E., Sisson, T.W., Brien, D.L., 2001. Volcano collapse promoted by hydrothermal alteration and edifice shape, Mount Rainier, Washington. Geology 29, 779-782], potential movable volume is an unavoidable parameter to quantify and constrain tsunamigenic hazard. Numerical modelling of a tsunami generated by the potential La Palma landslide concluded that high amplitude waves threaten North Atlantic shorelines [Ward, S.N., Day, S.J., 2001. Cumbre Vieja volcano — Potential collapse and tsunami at La Palma, Canary Islands. Geophys. Res. Lett. 28, 397-400]. New audiomagnetotelluric results provide for the first time a good estimation of the Icod Valley (Tenerife, Canary Islands) volume, a potential giant landslide threatening the same shorelines. Two profiles image its electrically conductive roots with a characteristic of a U-shaped cross-section thought to be the consequence of previous landslides. By this study, we show that North Atlantic Ocean shorelines might be exposed to a destructive tsunami generated by a subaerial lateral collapse of at least 120 km 3 during the next strong felsic eruptive activity of the Teide-Pico Viejo complex. This article highlights the degree of urgency of carrying out geophysical investigations on the flanks of most volcanic islands prone to potential flank collapse. These investigations will contribute to the understanding of their structure — a key parameter in the sliding process. Finally, all results should be included in model, providing a global map of tsunami hazard assessment.

Characteristics of High-Density Helicon Plasma Sources and Their Application to Electrodeless Electric Propulsion

NASA Astrophysics Data System (ADS)

Shinohara, S.; Nishida, H.; Nakamura, T.; Mishio, A.; Ishii, H.; Teshigahara, N.; Fujitsuka, H.; Waseda, S.; Tanikawa, T.; Hada, T.; Otsuka, F.; Funaki, I.; Matsuoka, T.; Shamrai, K.; Rudenko, T.

2012-10-01

High-density but low temperature helicon plasmas have been proved to be very useful for fundamental research as well as for various applications. First, we introduce our very large helicon sources [1] with a diameter up to 74 cm. For the industrial and propulsion applications, we have reduced the aspect ratio (axial length-to-diameter) down to 0.075, and examined the discharge performance and wave characteristics. Then, we discuss our small helicon sources [1] for developing new electrodeless acceleration schemes. Some experimental and theoretical results [2] by applying the rotating magnetic (or electric) fields to the helicon plasma under the divergent magnetic field will be presented, along with other propulsion schemes. In addition, an initial plasma production experiment with very small diameter will be described.[4pt] [1] S. Shinohara et al., Jpn. J. Appl. Phys. 35 (1996) 4503; Rev. Sci. Instrum. 75 (2004) 1941; Phys. Plasmas 16 (2009) 057104.[0pt] [2] S. Shinohara et al., 32th Int. Electric Propul. Conf., IEPC-2011-056, 2011.

Correlation of process parameters and properties of TiO2 films grown by ion beam sputter deposition from a ceramic target

NASA Astrophysics Data System (ADS)

Bundesmann, Carsten; Lautenschläge, Thomas; Spemann, Daniel; Finzel, Annemarie; Mensing, Michael; Frost, Frank

2017-10-01

The correlation between process parameters and properties of TiO2 films grown by ion beam sputter deposition from a ceramic target was investigated. TiO2 films were grown under systematic variation of ion beam parameters (ion species, ion energy) and geometrical parameters (ion incidence angle, polar emission angle) and characterized with respect to film thickness, growth rate, structural properties, surface topography, composition, optical properties, and mass density. Systematic variations of film properties with the scattering geometry, namely the scattering angle, have been revealed. There are also considerable differences in film properties when changing the process gas from Ar to Xe. Similar systematics were reported for TiO2 films grown by reactive ion beam sputter deposition from a metal target [C. Bundesmann et al., Appl. Surf. Sci. 421, 331 (2017)]. However, there are some deviations from the previously reported data, for instance, in growth rate, mass density and optical properties.

Origin of the enhanced exchange bias in polycrystalline-BiFeO3/Co bilayers by X-ray absorption Spectroscopy

NASA Astrophysics Data System (ADS)

Shen, J. D.; Yang, W. B.; Kumar, A.; Zhao, H. H.; Lai, Y. J.; Feng, L. S.; Xu, Q. Y.; Zhang, Y. Q.; Du, J.; Li, Q.

2018-04-01

Polycrystalline-BiFeO3(BFO)/Co bilayers were grown by pulsed laser deposition (PLD) and magnetron sputtering, with fast laser annealing under magnetic field. The enhanced exchange bias (EB) had been found in the BFO/Co bilayers (Appl. Surf. Sci. 367 (2016) 418). In order to reveal the origin of the enhanced EB in the samples, X-ray absorption Spectroscopy (XAS) of Fe 2p, Co 2p and O 1s were performed. The Co 2p XAS indicated the increase of Co oxidation state and the Fe 2p XAS of sample A and B under laser annealing processes showed that crystal field splitting energy decreased and led to the weakening of spin-orbit coupling with the increasing of the laser fluence. It was considered that the appearance of the oxidation state of Co and Fe2+ ions and the existence of the unidirectional anisotropy due to the laser fluence was responsible for the results and also for the enhanced EB.

Nanostructured silicon via metal assisted catalyzed etch (MACE): chemistry fundamentals and pattern engineering

NASA Astrophysics Data System (ADS)

Toor, Fatima; Miller, Jeffrey B.; Davidson, Lauren M.; Nichols, Logan; Duan, Wenqi; Jura, Michael P.; Yim, Joanne; Forziati, Joanne; Black, Marcie R.

2016-10-01

There are a range of different methods to generate a nanostructured surface on silicon (Si) but the most cost effective and optically interesting is the metal assisted wet chemical etching (MACE) (Koynov et al 2006 Appl. Phys. Lett. 88 203107). MACE of Si is a controllable, room-temperature wet-chemical technique that uses a thin layer of metal to etch the surface of Si, leaving behind various nano- and micro-scale surface features or ‘black silicon’. MACE-fabricated nanowires (NWs) provide improved antireflection and light trapping functionality (Toor et al 2016 Nanoscale 8 15448-66) compared with the traditional ‘iso-texturing’ (Campbell and Green 1987 J. Appl. Phys. 62 243-9). The resulting lower reflection and improved light trapping can lead to higher short circuit currents in NW solar cells (Toor et al 2011 Appl. Phys. Lett. 99 103501). In addition, NW cells can have higher fill factors and voltages than traditionally processed cells, thus leading to increased solar cell efficiencies (Cabrera et al 2013 IEEE J. Photovolt. 3 102-7). MACE NW processing also has synergy with next generation Si solar cell designs, such as thin epitaxial-Si and passivated emitter rear contact (Toor et al 2016 Nanoscale 8 15448-66). While several companies have begun manufacturing black Si, and many more are researching these techniques, much of the work has not been published in traditional journals and is publicly available only through conference proceedings and patent publications, which makes learning the field challenging. There have been three specialized review articles published recently on certain aspects of MACE or black Si, but do not present a full review that would benefit the industry (Liu et al 2014 Energy Environ. Sci. 7 3223-63 Yusufoglu et al 2015 IEEE J. Photovolt. 5 320-8 Huang et al 2011 Adv. Mater. 23 285-308). In this feature article, we review the chemistry of MACE and explore how changing parameters in the wet etch process effects the resulting texture on the Si surface. Then we review efforts to increase the uniformity and reproducibility of the MACE process, which is critical for commercializing the black Si technology.

Photovoltaic reciprocity and quasi-Fermi level splitting in nanostructure-based solar cells (Conference Presentation)

NASA Astrophysics Data System (ADS)

Aeberhard, Urs

2017-04-01

The photovoltaic reciprocity theory relates the electroluminescence spectrum of a solar cell under applied bias to the external photovoltaic quantum efficiency of the device as measured at short circuit conditions [1]. So far, the theory has been verified for a wide range of devices and material systems and forms the basis of a growing number of luminesecence imaging techniques used in the characterization of photovoltaic materials, cells and modules [2-5]. However, there are also some examples where the theory fails, such as in the case of amorphous silicon. In our contribution, we critically assess the assumptions made in the derivation of the theory and compare its predictions with rigorous formal relations as well as numerical computations in the framework of a comprehensive quantum-kinetic theory of photovoltaics [6] as applied to ultra-thin absorber architectures [7]. One of the main applications of the photovoltaic reciprocity relation is the determination of quasi-Fermi level splittings (QFLS) in solar cells from the measurement of luminescence. In nanostructure-based photovoltaic architectures, the determination of QFLS is challenging, but instrumental to assess the performance potential of the concepts. Here, we use our quasi-Fermi level-free theory to investigate existence and size of QFLS in quantum well and quantum dot solar cells. [1] Uwe Rau. Reciprocity relation between photovoltaic quantum efficiency and electrolumines- cent emission of solar cells. Phys. Rev. B, 76(8):085303, 2007. [2] Thomas Kirchartz and Uwe Rau. Electroluminescence analysis of high efficiency cu(in,ga)se2 solar cells. J. Appl. Phys., 102(10), 2007. [3] Thomas Kirchartz, Uwe Rau, Martin Hermle, Andreas W. Bett, Anke Helbig, and Jrgen H. Werner. Internal voltages in GaInP-GaInAs-Ge multijunction solar cells determined by electro- luminescence measurements. Appl. Phys. Lett., 92(12), 2008. [4] Thomas Kirchartz, Anke Helbig, Wilfried Reetz, Michael Reuter, Jürgen H. Werner, and Uwe Rau. Reciprocity between electroluminescence and quantum efficiency used for the characterization of silicon solar cells. Prog. Photovolt: Res. Appl., 17(6):394-402, 2009. [5] U. Hoyer, M. Wagner, Th. Swonke, J. Bachmann, R. Auer, A. Osvet, and C. J. Brabec. Electroluminescence imaging of organic photovoltaic modules. Appl. Phys. Lett., 97(23), 2010. [6] U. Aeberhard. Theory and simulation of quantum photovoltaic devices based on the non-equilibrium Greens function formalism. J. Comput. Electron., 10:394-413, 2011. [7] U. Aeberhard. Simulation of ultrathin solar cells beyond the limits of the semiclassical bulk picture. IEEE J. Photovolt., 6(3):654-660, 2016.

The fabrication of well-interconnected polycaprolactone/hydroxyapatite composite scaffolds, enhancing the exposure of hydroxyapatite using the wire-network molding technique.

PubMed

Cho, Yong Sang; Hong, Myoung Wha; Jeong, Hoon-Jin; Lee, Seung-Jae; Kim, Young Yul; Cho, Young-Sam

2017-11-01

In this study, the fabrication method was proposed for the well-interconnected polycaprolactone/hydroxyapatite composite scaffold with exposed hydroxyapatite using modified WNM technique. To characterize well-interconnected scaffolds in terms of hydroxyapatite exposure, several assessments were performed as follows: morphology, mechanical property, wettability, calcium ion release, and cell response assessments. The results of these assessments were compared with those of control scaffolds which were fabricated by precision extruding deposition (PED) apparatus. The control PED scaffolds have interconnected pores with nonexposed hydroxyapatite. Consequently, cell attachment of proposed WNM scaffold was improved by increased hydrophilicity and surface roughness of scaffold surface resulting from the exposure of hydroxyapatite particles and fabrication process using powders. Moreover, cell proliferation and differentiation of WNM scaffold were increased, because the exposure of hydroxyapatite particles may enhance cell adhesion and calcium ion release. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 2315-2325, 2017. © 2016 Wiley Periodicals, Inc.

Adhesive and robust multilayered poly(lactic acid) nanosheets for hemostatic dressing in liver injury model.

PubMed

Komachi, Takuya; Sumiyoshi, Hideaki; Inagaki, Yutaka; Takeoka, Shinji; Nagase, Yu; Okamura, Yosuke

2017-10-01

Freestanding biodegradable nanosheets composed of poly(l-lactic acid) (PLLA) have been developed for various biomedical applications. These nanosheets exhibit unique properties such as high adhesiveness and exquisite flexibility; however, they burst easily due to their nanometer thickness. We herein describe a freestanding, multilayered nanosheet composed of PLLA fabricated using a simple combination procedure: (i) multilayering of PLLA and alginate, (ii) gelation of the alginate layers, (iii) fusion-cut sealing, and (iv) elution of the alginate layers. The multilayered nanosheets not only reinforced the bursting strength but also provided a high level of adhesive strength. In fact, they were found to show potential as a hemostatic dressing, and they tended to show reduced tissue adhesion that accompanies liver injury. Therefore, we propose this biomaterial as a candidate for an alternative to conventional therapy in hemorrhage. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 1747-1757, 2017. © 2016 Wiley Periodicals, Inc.

A new photocrosslinkable polycaprolactone-based ink for three-dimensional inkjet printing.

PubMed

He, Yinfeng; Tuck, Christopher J; Prina, Elisabetta; Kilsby, Sam; Christie, Steven D R; Edmondson, Stephen; Hague, Richard J M; Rose, Felicity R A J; Wildman, Ricky D

2017-08-01

A new type of photocrosslinkable polycaprolactone (PCL) based ink that is suitable for three-dimensional (3D) inkjet printing has been developed. Photocrosslinkable Polycaprolactone dimethylacrylate (PCLDMA) was synthesized and mixed with poly(ethylene glycol) diacrylate (PEGDA) to prepare an ink with a suitable viscosity for inkjet printing. The ink performance under different printing environments, initiator concentrations, and post processes was studied. This showed that a nitrogen atmosphere during printing was beneficial for curing and material property optimization, as well as improving the quality of structures produced. A simple structure, built in the z-direction, demonstrated the potential for this material for the production of 3D printed objects. Cell tests were carried out to investigate the biocompatibility of the developed ink. © 2016 The Authors Journal of Biomedical Materials Research Part B: Applied Biomaterials Published by Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 1645-1657, 2017. © 2016 The Authors Journal of Biomedical Materials Research Part B: Applied Biomaterials Published by Wiley Periodicals, Inc.

The combined effect of thermal and chemotherapy on HeLa cells using magnetically actuated smart textured fibrous system.

PubMed

Tiwari, Pranav; Agarwal, Sakshi; Srivastava, Sachchidanand; Jain, Shilpee

2018-01-01

Thermal therapy combined with chemotherapy is one of the advanced and efficient methods to eradicate cancer. In this work, we fabricated magnetically actuated smart textured (MAST) fibrous systems and studied their candidacy for cancer treatment. The polycaprolactone-Fe 3 O 4 based MAST fibers were fabricated using electrospinning technique. These MAST fibrous systems contained carbogenic quantum dots as a tracking agent and doxorubicin hydrochloride anticancer drug. Additionally, as fabricated MAST fibrous systems were able to deliver anticancer drug and heat energy simultaneously to kill HeLa cells in a 10 min period in vitro. After treatment, the metabolic activity and morphology of HeLa cells were analyzed. In addition, the mechanism of cell death was studied using flow cytometry. Interestingly, the navigation of these systems in the fluid can be controlled with the application of gradient magnetic field. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 106B: 40-51, 2018. © 2016 Wiley Periodicals, Inc.

3D bioprinting and its in vivo applications.

PubMed

Hong, Nhayoung; Yang, Gi-Hoon; Lee, JaeHwan; Kim, GeunHyung

2018-01-01

The purpose of 3D bioprinting technology is to design and create functional 3D tissues or organs in situ for in vivo applications. 3D cell-printing, or additive biomanufacturing, allows the selection of biomaterials and cells (bioink), and the fabrication of cell-laden structures in high resolution. 3D cell-printed structures have also been used for applications such as research models, drug delivery and discovery, and toxicology. Recently, numerous attempts have been made to fabricate tissues and organs by using various 3D printing techniques. However, challenges such as vascularization are yet to be solved. This article reviews the most commonly used 3D cell-printing techniques with their advantages and drawbacks. Furthermore, up-to-date achievements of 3D bioprinting in in vivo applications are introduced, and prospects for the future of 3D cell-printing technology are discussed. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 106B: 444-459, 2018. © 2017 Wiley Periodicals, Inc.

Three-dimensional patterning in biomedicine: Importance and applications in neuropharmacology.

PubMed

Vikram Singh, Ajay; Gharat, Tanmay; Batuwangala, Madu; Park, Byung-Wook; Endlein, Thomas; Sitti, Metin

2018-04-01

Nature manufactures biological systems in three dimensions with precisely controlled spatiotemporal profiles on hierarchical length and time scales. In this article, we review 3D patterning of biological systems on synthetic platforms for neuropharmacological applications. We briefly describe 3D versus 2D chemical and topographical patterning methods and their limitations. Subsequently, an overview of introducing a third dimension in neuropharmacological research with delineation of chemical and topographical roles is presented. Finally, toward the end of this article, an explanation of how 3D patterning has played a pivotal role in relevant fields of neuropharmacology to understand neurophysiology during development, normal health, and disease conditions is described. The future prospects of organs-on-a--like devices to mimic patterned blood-brain barrier in the context of neurotherapeutic discovery and development for the prioritization of lead candidates, membrane potential, and toxicity testing are also described. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 106B: 1369-1382, 2018. © 2017 Wiley Periodicals, Inc.

Subcritical crack growth behavior of Al2O3-glass dental composites.

PubMed

Zhu, Qingshan; de With, Gijsbertus; Dortmans, Leonardus J M G; Feenstra, Frits

2003-05-15

The purpose of this study is to investigate the subcritical crack growth (SCG) behavior of alumina-glass dental composites. Alumina-glass composites were fabricated by infiltrating molten glass to porous alumina preforms. Rectangular bars of the composite were subject to dynamic loading in air, with stressing rates ranging from 0.01 MPa/s to 2 MPa/s. The SCG parameter n was determined to be 22.1 for the composite, which is substantially lower than those of high-purity dense alumina. Investigations showed that glass phases are responsible for the low n value as cracks propagate preferentially within glass phases or along the interface between glass phases and alumina phases, due to the fact that glasses are more vulnerable to chemical attacks by water molecules under stress corrosion conditions. The SCG behavior of the infiltration glass was also investigated and the SCG parameter n was determined to be 18.7. Copyright 2003 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater 65B: 233-238, 2003

An ecological valence theory of human color preference

PubMed Central

Palmer, Stephen E.; Schloss, Karen B.

2010-01-01

Color preference is an important aspect of visual experience, but little is known about why people in general like some colors more than others. Previous research suggested explanations based on biological adaptations [Hurlbert AC, Ling YL (2007) Curr Biol 17:623–625] and color-emotions [Ou L-C, Luo MR, Woodcock A, Wright A (2004) Color Res Appl 29:381–389]. In this article we articulate an ecological valence theory in which color preferences arise from people’s average affective responses to color-associated objects. An empirical test provides strong support for this theory: People like colors strongly associated with objects they like (e.g., blues with clear skies and clean water) and dislike colors strongly associated with objects they dislike (e.g., browns with feces and rotten food). Relative to alternative theories, the ecological valence theory both fits the data better (even with fewer free parameters) and provides a more plausible, comprehensive causal explanation of color preferences. PMID:20421475

The Use of Lego Technologies in Elementary Teacher Preparation

NASA Astrophysics Data System (ADS)

Hadjiachilleos, Stella; Avraamidou, Lucy; Papastavrou, Stavros

2013-10-01

The need to reform science teacher preparation programs has been pointed out in research (Bryan and Abell in J Res Sci Teach 36:121-140, 1999; Bryan and Atwater in Sci Educ 8(6):821-839, 2002; Harrington and Hathaway in J Teach Educ 46(4):275-284, 1995). Science teachers are charged with the responsibility of incorporating both cognitive and non-cognitive parameters in their everyday teaching practices. This often results in their reluctance to teach science because they often lack disciplinary and/or pedagogical expertise required to promote science learning. The purpose of this study is to propose an alternative instructional approach in which Lego vehicles were used as a tool to promote pre-service elementary teachers' development and to examine whether there are non-cognitive parameters that promote or obstruct them from using Lego Technologies as a teaching tool. The context of the study was defined by a teacher preparation program of a private university in a small Mediterranean country. A sample of 28 pre-service elementary teachers, working in five 5-6-member groups were involved in scientific inquiries, during which they had to use vehicles in order to solve scientific problems related to concepts such as gear functioning, force, and motion. The nature of their cognitive engagement in the scientific inquiry process, non-cognitive parameters contributing to their cognitive engagement, and the impact of their involvement in the process on their development were examined through qualitative analysis of pre- and post-inquiry interviews, presentations of their solutions to the scientific problems and of their personal reflective journals.

The study of the geomagnetic excursions and the relative intensities from Chinese loess 10Be over the past 130 ka

NASA Astrophysics Data System (ADS)

Zhou, W.; Xian, F.; Beck, J.; An, Z.; Wu, Z.; Liu, M.; Chen, M.; Priller, A.; Kutschera, W.; Jull, A. T.; Yu, H.; Song, S.; Cheng, P.; Kong, X.

2009-12-01

Chinese loess is well-known archive for the paleogeomagnetic and paleoclimatic studies [Zhou et al., 1990; An et al., 1990; Zhu et al., 2007]. However, earlier efforts to extract weak geomagnetic excursion signals from Chinese loess 10Be were always unsuccessful due to the complexities of loess 10Be, which results in the fact that loess 10Be was only used as a climatic proxy [Shen et al., 1992; Beer et al.,1993; Gu et al.,1996]. Meanwhile, knowledge on the precise stratigraphic horizons of geomagnetic excursions with a reliable dating [Channell, 2006], on whether the short-lived excursions such as Blake can not be recorded in paleosol unit are still controversial. Here, we present the reconstructed past 130ka geomagnetic excursions and relative paleointensities for the first time from 10Be records in two Chinese loess sections. Results are comparative with those of independent geomagnetic research on Atlantic and Pacific sediments. The derived Laschamp and Blake events lie in the loess-paleosol (L1SS1 and S1SS3) corresponding to mid MIS 3 and 5e respectively. Our studies prove the potential application of the complex loess 10Be for long-term geomagnetic tracing and provide new evidence to answer the long-existing debates on the precise stratigraphic horizon of geomagnetic excursions. Our study suggests the potential application of loess-paleosol 10Be for reconstructing geomagnetic intensity variations spanning the whole Quaternary. References 1. Zhou, L. P., F. Oldfield, A. G. Wintle, S. G. Robinson, and J. T. Wang (1990), Partly pedogenic origin of magnetic variations in Chinese loess, Nature, 346, 737-739. 2. An, Z. S., T. S. Liu, Y. C. Lu, S. C. Porter, G. Kukla, X. H. Wu, and Y. M. Hua (1990), The long-term paleomonsoon variation recorded by the loess-paleosol sequence in Central China, Quat. Int., 7-8, 91-95. 3. Zhu, R. X., R. Zhang, C. L. Deng, Y. X. Pan, Q. S. Liu, and Y. B. Sun (2007), Are Chinese loess deposits essentially continuous?, Geophys. Res. Lett., 34, L17306. 4. Shen, C. D., J. Beer, T. S. Liu, H. Oeschger, G. Bonani, M. Suter, and W.Wolfli (1992), 10Be in Chinese loess, Earth Planet. Sci. Lett., 109(1-2), 169-177. 5. Gu, Z. Y., D. Lal, T. S. Liu, J. Southon, M. W. Caffee, Z. T. Guo, and M. Y.Chen (1996), Five million year 10Be record in Chinese loess and red-clay: climate and weathering relationships, Earth Planet. Sci. Lett., 144(1-2), 273-287. 6. Beer, J., C. D. Shen, F. Heller ,T.S. Liu, G. Bonani, B. Dittrich, M. Suter, and P.W. Kubik (1993), 10Be and magnetic susceptibility in Chinese Loess, Geophys. Res. Lett., 20(1), 57-60 7. Channell, J. E. T.(2006), Late Brunhes polarity excursions (Mono Lake, Laschamp, Iceland Basin and Pringle Falls) recorded at ODP Site 919 (Irminger Basin), Earth Planet. Sci. Lett., 244(1-2), 378-393.

Model analysis of secondary organic aerosol formation by glyoxal in laboratory studies: the case for photoenhanced chemistry.

PubMed

Sumner, Andrew J; Woo, Joseph L; McNeill, V Faye

2014-10-21

The reactive uptake of glyoxal by atmospheric aerosols is believed to be a significant source of secondary organic aerosol (SOA). Several recent laboratory studies have been performed with the goal of characterizing this process, but questions remain regarding the effects of photochemistry on SOA growth. We applied GAMMA (McNeill et al. Environ. Sci. Technol. 2012, 46, 8075-8081), a photochemical box model with coupled gas-phase and detailed aqueous aerosol-phase chemistry, to simulate aerosol chamber studies of SOA formation by the uptake of glyoxal by wet aerosol under dark and irradiated conditions (Kroll et al. J. Geophys. Res. 2005, 110 (D23), 1-10; Volkamer et al. Atmos. Chem. Phys. 2009, 9, 1907-1928; Galloway et al. Atmos. Chem. Phys. 2009, 9, 3331- 306 3345 and Geophys. Res. Lett. 2011, 38, L17811). We find close agreement between simulated SOA growth and the results of experiments conducted under dark conditions using values of the effective Henry's Law constant of 1.3-5.5 × 10(7) M atm(-1). While irradiated conditions led to the production of some organic acids, organosulfates, and other oxidation products via well-established photochemical mechanisms, these additional product species contribute negligible aerosol mass compared to the dark uptake of glyoxal. Simulated results for irradiated experiments therefore fell short of the reported SOA mass yield by up to 92%. This suggests a significant light-dependent SOA formation mechanism that is not currently accounted for by known bulk photochemistry, consistent with recent laboratory observations of SOA production via photosensitizer chemistry.

A mathematical analysis of the ABCD criteria for diagnosing malignant melanoma

NASA Astrophysics Data System (ADS)

Lee, Hyunju; Kwon, Kiwoon

2017-03-01

The medical community currently employs the ABCD (asymmetry, border irregularity, color variegation, and diameter of the lesion) criteria in the early diagnosis of a malignant melanoma. Although many image segmentation and classification methods are used to analyze the ABCD criteria, it is rare to see a study containing mathematical justification of the parameters that are used to quantify the ABCD criteria. In this paper, we suggest new parameters to assess asymmetry, border irregularity, and color variegation, and explain the mathematical meaning of the parameters. The suggested parameters are then tested with 24 skin samples. The parameters suggested for the 24 skin samples are displayed in three-dimensional coordinates and are compared to those presented in other studies (Ercal et al 1994 IEEE Trans. Biomed. Eng. 41 837-45, Cheerla and Frazier 2014 Int. J. Innovative Res. Sci., Eng. Technol. 3 9164-83) in terms of Pearson correlation coefficient and classification accuracy in determining the malignancy of the lesions.

Quasi-Axially Symmetric Stellarators with 3 Field Periods

NASA Astrophysics Data System (ADS)

Garabedian, Paul; Ku, Long-Poe

1998-11-01

Compact hybrid configurations with 2 field periods have been studied recently as candidates for a proof of principle experiment at PPPL, cf. A. Reiman et al., Physics design of a high beta quasi-axially symmetric stellarator, J. Plas. Fus. Res. SERIES 1, 429(1998). This enterprise has led us to the discovery of a family of quasi-axially symmetric stellarators with 3 field periods that seem to have significant advantages, although their aspect ratios are a little larger. They have reversed shear and perform better in a local analysis of ballooning modes. Nonlinear equilibrium and stability calculations predict that the average beta limit may be as high as 6% if the bootstrap current turns out to be as big as that expected in comparable tokamaks. The concept relies on a combination of helical fields and bootstrap current to achieve adequate rotational transform at low aspect ratio. A detailed manuscript describing some of this work will be published soon, cf. P.R. Garabedian, Quasi-axially symmetric stellarators, Proc. Natl. Acad. Sci. USA 95 (1998).

Collagen/heparin sulfate scaffolds fabricated by a 3D bioprinter improved mechanical properties and neurological function after spinal cord injury in rats.

PubMed

Chen, Chong; Zhao, Ming-Liang; Zhang, Ren-Kun; Lu, Gang; Zhao, Chang-Yu; Fu, Feng; Sun, Hong-Tao; Zhang, Sai; Tu, Yue; Li, Xiao-Hong

2017-05-01

Effective treatments promoting axonal regeneration and functional recovery for spinal cord injury (SCI) are still in the early stages of development. Most approaches have been focused on providing supportive substrates for guiding neurons and overcoming the physical and chemical barriers to healing that arise after SCI. Although collagen has become a promising natural substrate with good compatibility, its low mechanical properties restrict its potential applications. The mechanical properties mainly rely on the composition and pore structure of scaffolds. For the composition of a scaffold, we used heparin sulfate to react with collagen by crosslinking. For the structure, we adopted a three-dimensional (3D) printing technology to fabricate a scaffold with a uniform pore distributions. We observed that the internal structure of the scaffold printed with a 3D bioprinter was regular and porous. We also found that both the compression modulus and strengths of the scaffold were significantly enhanced by the collagen/heparin sulfate composition compared to a collagen scaffold. Meanwhile, the collagen/heparin sulfate scaffold presented good biocompatibility when it was co-cultured with neural stem cells in vitro. We also demonstrated that heparin sulfate modification significantly improved bFGF immobilization and absorption to the collagen by examining the release kinetics of bFGF from scaffolds. Two months after implantating the scaffold into transection lesions in T10 of the spinal cord in rats, the collagen/heparin sulfate group demonstrated significant recovery of locomotor function and according to electrophysiological examinations. Parallel to functional recovery, collagen/heparin sulfate treatment further ameliorated the pathological process and markedly increased the number of neurofilament (NF) positive cells compared to collagen treatment alone. These data suggested that a collagen/heparin sulfate scaffold fabricated by a 3D bioprinter could enhance the mechanical properties of collagen and provide continuous guidance channels for axons, which would improve the neurological function after SCI. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 1324-1332, 2017. © 2017 Wiley Periodicals, Inc.

Assessment of the reduced allergenic properties of the Santana apple.

PubMed

Kootstra, Helmi S; Vlieg-Boerstra, Berber J; Dubois, Anthony E J

2007-12-01

Approximately 2% of the Northern and Central European population is allergic to apples. Because of symptoms of oral allergy syndrome, many individuals avoid eating fresh apples. A strategy to allow apple allergic individuals to eat apples is the development of hypoallergenic apple varieties. To investigate the allergenicity of a putatively hypoallergenic apple cultivar, the Santana apple, on apple allergic individuals using a method of challenge in which loss of allergenicity is minimized. The study population consisted of 15 apple allergic individuals, who underwent an open oral challenge with 3 different apple cultivars: Santana, Golden Delicious, and Topaz. Food challenges were performed between February 1 and May 31, 2005, during the birch tree pollen season. Sensory perception during challenges was minimized by use of a blindfold and nose clip and randomization of challenge order. Subjective symptoms were scored by a visual analog scale. After challenge with the Santana apple, 8 of 15 study participants (53%) developed no symptoms, which was a significantly greater proportion than after challenge with the Topaz apple (1 participant) and Golden Delicious apple (1 participant) (P = .002). The visual analog scale scores for the Santana apple (dose 1) were significantly lower than that for the Golden Delicious and Topaz apples. A total of 73% of the participants stated they would eat Santana apples in the future. The Santana apple caused significantly fewer allergic symptoms in apple allergic individuals than the Golden Delicious and Topaz apples. The Santana apple may be a good choice for most apple allergic individuals who want to eat apples.

What influences climate and glacier change in southwestern China?

NASA Astrophysics Data System (ADS)

Yasunari, Teppei J.

2011-12-01

The subject of climate change in the Tibetan Plateau (TP) and Himalayas has taken on increasing importance because of the availability of water resources from their mountain glaciers (Immerzeel et al 2010). Many of the glaciers over these regions have been retreating, while some are advancing and stable (Yao et al 2004, Scherler et al 2011). Other studies report that some glaciers in the Himalayas show acceleration of their shrinkage (e.g., Fujita and Nuimura 2011). However, the causes of glacier melting are still difficult to grasp because of the complexity of climatic change and its influence on glacier issues. Despite this, it is vital that we pursue further study to enable future predictions of glacier changes. The paper entitled 'Climate and glacier change in southwestern China during the past several decades' by Li et al (2011) provided carefully analyzed, quality controlled, long-term data on atmospheric temperature and precipitation during the period 1961-2008. The data were obtained from 111 Chinese stations. The researchers performed systematic analyses of temperature and precipitation over the whole southwestern Chinese domain. They discussed those changes in terms of other meteorological components such as atmospheric circulation patterns, radiation and altitude difference, and then showed how these factors could contribute to climate and glacier changes in the region. Air temperature and precipitation are strongly associated with glacier mass balance because of heat balance and the addition of mass when it snows. Temperature warming trends over many places in southwestern China were unequivocally dominant in all seasons and at higher altitudes. This indicates that the heat contribution to the glaciers has been increasing. On the other hand, precipitation has a wider variability in time and space. It is more difficult to clearly understand the effect of precipitation on the climate and glacier melting characteristics in the whole of southwestern China as a collective view. However, the precipitation patterns in southwestern China are probably modulated by climate feedbacks through many factors. Precipitation seasonality may also affect the climatic sensitivity of glacier mass balance (Fujita 2008). In addition to the authors' main focus above, other factors, also probably directly and indirectly, influence the climate and glacier mass balance changes. Those factors are: (a) The debris-covered effect which heats (if it is thin) or insulates (if it is thick) the ice below the debris; it probably causes no uniform response on glacier melting (Scherler et al 2011); (b) Interaction between glacial lakes and exposed ice parts on glaciers (e.g., Sakai et al 2009, Fujita et al 2009); (c) The atmospheric heating effect over the foothills of the Himalayas due to the Atmospheric Brown Cloud (ABC), including absorbing aerosols such as black carbon, dust and organic matters (Ramanathan et al 2007), the so called Elevated Heat Pump (EHP) effect suggested by Lau et al (2006, 2010); (d) The snow darkening effect over non debris-covered parts of glaciers as the absorbing aerosol depositions reduce snow albedo and accelerate snow melting by absorbing more solar energy at the snow surface (Warren and Wiscombe 1980, Flanner et al 2007, 2009, Yasunari et al 2010, Qian et al 2011); (e) Another kind of snow darkening effect over non debris-covered glaciers due to the growth of biological activities, with dark-colored materials on glaciers also reducing snow albedo (Takeuchi et al 2001); (f) Other factors on snow albedo reductions such as snow grain size, specific surface area and depth changes, melt-water effect on snow, and changes in solar illumination conditions (e.g., Wiscombe and Warren 1980, Flanner et al 2006, Yasunari et al 2011, Aoki et al 1999, 2011); and finally, (g) Feedbacks via interactions between the snow surface and atmosphere including all the factors above. What I'd like to emphasize is that the atmospheric warming trend indicated by Li et al (2011) is robust and very likely associated with the dominant characteristics of glacier shrinkage across southwestern China, as discussed by the authors. However, the shrinkage rate of sub-regional scale variability is probably due to the modulation of precipitation, as well as the other factors identified above. Further, atmospheric warming is not limited only to southwestern China, but is also probable in the surrounding Tibetan and Himalayan regions (Gautam et al 2010). Comprehensive studies, including international projects discussing all the contributors above by (a) field observations, (b) global or regional modeling, and (c) satellite data analyses, are essential to assess the future climate change and glacier retreat in/around the TP and Himalayas. The authors' findings showed robust information on atmospheric warming trends and some wider variety on precipitation during 1961-2008 in southwestern China. In addition, they indicated some possible connections between these findings and atmospheric circulation, altitudinal difference and meteorological conditions. Future studies should promote a deeper discussion and understanding of these relationships. Hereafter, we must make a committed effort to study climate and glacier issues in/around the TP and Himalayas involving the existing warming trend. This trend fluctuates year-by-year. The fluctuation of the warming and precipitation changes may directly contribute to climate change and glacier retreats. However, the seven factors noted above likely modulate the climate change and glacier melting patterns in southwestern China on the warming trend in intra- and inter-annual timescales. The temperature and precipitation data in this study offer a terrific asset for future studies on climate and glacier issues in/around this region. Acknowledgement I wish to thank Jan Angevine at NASA/GSFC for proofreading. References Aoki Te, Aoki Ta, Fukabori M and Uchiyama A 1999 Numerical simulation of the atmospheric effects on snow albedo with a multiple scattering radiative transfer model for the atmosphere-snow system J. Meteorol. Soc. Japan 77 595-614 Aoki Te, Kuchiki K, Niwano M, Kodama Y, Hosaka M and Tanaka T 2011 Physically based snow albedo model for calculating broadband albedos and the solar heating profile in snowpack for general circulation models J. Geophys. Res. 116 D11114 Flanner M G and Zender C S 2006 Linking snowpack microphysics and albedo evolution J. Geophys. Res. 111 D12208 Flanner M G, Zender C S, Randerson J T and Rasch P J 2007 Present-day climate forcing and response from black carbon in snow J. Geophys. Res. 112 D11202 Flanner M G, Zender C S, Hess P G, Mahowald N M, Painter T H, Ramanathan V and Rasch P J 2009 Springtime warming and reduced snow cover from carbonaceous particles Atmos. Chem. Phys. 9 2481-97 Fujita K 2008 Effect of precipitation seasonality on climatic sensitivity of glacier mass balance Earth Planet. Sci. Lett. 276 14-9 Fujita K, Sakai A, Nuimura T, Yamaguchi S and Sharma R 2009 Recent changes in Imja Glacial Lake and its damming moraine in the Nepal Himalaya revealed by in situ surveys and multi-temporal ASTER imagery Environ. Res. Lett. 4 045205 Fujita K and Nuimura T 2011 Spatially heterogeneous wastage of Himalayan glaciers Proc. Natl Acad. Sci. USA at press doi: 10.1073/pnas.1106242108 Gautam R, Hsu N C and Lau K M 2010 Premonsoon aerosol characterization and radiative effects over the Indo-Gangetic Plains: Implications for regional climate warming J. Geophys. Res. 115 D17208 Immerzeel W W, van Beek L P H and Bjerkens M F P 2010 Climate change will affect the Asian water towers Science 328 1382-5 Lau K M, Kim M K and Kim K M 2006 Asian monsoon anomalies induced by aerosol direct effects Clim. Dyn. 26 855-64 Lau K M, Kim M K, Kim K M and Lee W S 2010 Enhanced surface warming and accelerated snow melt in the Himalayas and Tibetan Plateau induced by absorbing aerosols Environ. Res. Lett. 5 025204 Li Z, He Y, An W, Song L, Zhang W, Norm C, Cao W, Wilfred H T, Liu H, Wang S, Du J, Xin H and Chang Li 2011 Climate and glacier change in southwestern China during the past several decades Environ. Res. Lett. 6 045404 Qian Y, Flanner M G, Leung L R and Wang W 2011 Sensitivity studies on the impacts of Tibetan Plateau snowpack pollution on the Asian hydrological cycle and monsoon climate Atmos. Chem. Phys. 11 1929-48 Ramanathan V, Li F, Ramana M V, Praveen P S, Kim D, Corrigan C E, Nguyen H, Stone E A, Schauer J J, Carmichael G R, Adhikary B and Yoon S C 2007 Atmospheric brown clouds: Hemispherical and regional variations in long-range transport, absorption, and radiative forcing J. Geophys. Res. 112 D22S21 Sakai A, Nakawo M and Fujita K 1998 Melt rate of ice cliffs on the Lirung Glacier, Nepal Himalayas, 1996 Bull. Glaciol. Res. 16 57-66 Sakai A, Nishimura K, Kadota T and Takeuchi N 2009 Onset of calving at supraglacial lakes on debris covered glaciers of the Nepal Himalayas J. Glaciol. 55 909-17 Scherler D, Bookhagen B and Strecker M R 2011 Spatially variable response of Himalayan glaciers to climate change affected by debris cover Nature Geosci. 4 156-9 Takeuchi N, Kohshima S and Seko K 2001 Structure, formation, darkening process of albedo reducing material (cryoconite) on a Himalayan glacier: a granular algal mat growing on the glacier Arct. Antarct. Alp. Res. 33 115-22 Warren S G and Wiscombe W J 1980 A model for the spectral albedo of snow. II: Snow containing atmospheric aerosols J. Atmos. Sci. 37 2734-45 Wiscombe W J and Warren S G 1980 A model for the spectral albedo of snow. I: Pure snow J. Atmos. Sci. 37 2712-3 Yao T D, Wang Y, Liu S, Pu J, Shen Y and Lu A 2004 Recent glacial retreat in high Asia in China and its impact on water resource in Northwest China Sci. China Ser. D 47 1065-75 Yasunari T J, Bonasoni P, Laj P, Fujita K, Vuillermoz E, Marinoni A, Cristofanelli P, Duchi R, Tartari G and Lau K M 2010 Estimated impact of black carbon deposition during pre-monsoon season from Nepal Climate Observatory--Pyramid data and snow albedo changes over Himalayan glaciers Atmos. Chem. Phys. 10 6603-15 Yasunari T J, Koster R D, Lau K M, Aoki Te, Sud Y C, Yamazaki T, Motoyoshi H and Kodama Y 2011 Influence of dust and black carbon on the snow albedo in the NASA GEOS-5 land surface model J. Geophys. Res. 116 D02210

A New Carbonate Chemistry in the Earth's Lower Mantle

NASA Astrophysics Data System (ADS)

Boulard, E.; Gloter, A.; Corgne, A.; Antonangeli, D.; Auzende, A.; Perrillat, J.; Guyot, F. J.; Fiquet, G.

2010-12-01

The global geochemical carbon cycle involves exchange between the Earth’s mantle and the surface. Carbon (C) is recycled into the mantle via subduction and released to the atmosphere via volcanic outgassing. Carbonates are the main C-bearing minerals that are transported deep in the Earth’s mantle via subduction of the oceanic lithosphere [1]. The way C is recycled and its contribution to the lower mantle reservoir is however largely unknown [ e.g 2, 3]. In this respect, it is important to assess if carbonates can be preserved in the deep mantle, or if decarbonatation, melting or reduction play a role in the deep carbon cycle. To clarify the fate of carbonates in the deep mantle, we carried out high-pressure and high-temperature experiments up to 105 GPa and 2850 K. Natural Fe-Mg carbonates or oxide mixtures of (Mg,Fe)O + CO2 were loaded into laser heated diamond anvil cells. In situ characterizations were done by X-ray Diffraction (XRD) using synchrotron radiation at the high-pressure beamline ID27 of the European Synchrotron Radiation Facility. A focused ion beam technique was then used to prepare the recovered samples for electron energy loss spectroscopy in a dedicated scanning transmission electron microscope (EELS-STEM) and scanning transmission X-ray microscopy (STXM). In situ XRD clearly shows the transformation of the initial carbonate phase into a new Mg-Fe high pressure carbonate phase at lower mantle conditions. We also provide direct evidence for recombination of CO2 with (Mg,Fe)O to form this new carbonate structure. In addition, subsequent EELS-STEM and STXM spectroscopies carried out on recovered samples yields C K-edge and stoechiometry characteristic to this new carbonate structure. This new high pressure phase concentrates a large amount of Fe(III), as a result of redox reactions within the siderite-rich carbonate. The oxidation of iron is balanced by partial reduction of carbon into CO groups and/or diamond. These reactions may provide an explanation for the coexistence of oxidized and reduced C species observed on natural samples [4, 5], but also a new diamond formation mechanism at lower mantle conditions. [1] Sleep, N. H., and K. Zahnle (2001) J. Geophys. Res.-Planets 106(E1), 1373-1399. [2] Javoy, M. (1997) Geophys. Res. Lett. 24(2), 177-180. [3] Lecuyer et al. (2000) Earth Planet. Sci. Lett. 181(1-2), 33-40. [4] Brenker et al. (2007) Earth Planet. Sci. Lett. 260(1-2), 1-9. [5] Stachel et al. (2000) Contrib. Mineral. Petrol. 140(1), 16-27.

Excavation of buried hydrated minerals on Mars by impact cratering? (Invited)

NASA Astrophysics Data System (ADS)

Carter, J.; Poulet, F.; Loizeau, D.; Bibring, J.

2010-12-01

Impact cratering is a key process when studying Mars’s past aqueous environments. It is a widespread and dynamic process which has been active throughout Mars’s history, especially during the Noachian era. Noachian-aged hydrated minerals have been reported on Mars (e.g. [1, 2]) and provide strong constrains on the alleged early wet Martian environment [3]. Our knowledge of this early wet environment will be greatly improved if we understand how hydrated minerals are formed, modified or destroyed by impact processes. One main consequence of impact cratering is the excavation of buried material. Excavated material is found in walls, ejecta and central uplifts in the case of large complex craters. It may originate from the deeply buried crust or subsurface, depending on crater size [4]. In this case craters act as natural boreholes that allow orbital spectroscopic inquiry of otherwise hidden material and is of great importance when investigating the aqueous alteration of Mars. This process has proven particularly useful when studying the northern crust of Mars which is covered by a thick mantling unit [5]. Large craters have penetrated the cover and exhumed buried hydrated crustal material, including the low-grade metamorphic mineral prehnite and there is evidence that the ancient crust has been altered by water down to kilometer depths, both in the northern plains and southern highlands [6]. Using the OMEGA and CRISM [7, 8] near-infrared hyperspectral instruments currently in orbit around Mars we have mapped surface exposures of hydrated minerals and found that many are associated with impact structures [9]. Here we report how detailed analysis of these sites reveal exposures of various hydrated minerals including phyllosilicates, zeolites and sulfates, associated with crater central uplifts, floors, walls, rims and ejecta. We focus on the heavily cratered Tyrrhena Terra region of Mars as well as the large northern plain craters. In both cases, excavation of buried, pre-existing phyllosilicates is thought to be the driving process. Other hydrated mineral formation pathways linked with impact cratering include impact-induced hydrothermal alteration [10-12], shock-induced and post-impact changes to mineral composition. [1]Poulet et al., Nature 438, 623 (2005). [2]Murchie et al., J. Geophys. Res. 114, E00D06 (2009). [3]Bibring et al., Science 312, 5772 (2006). [4]Baratoux et al., J. Geophys. Res. 112, E08S05 (2007). [5]Tanaka et al., J. Geophys. Res. 108, (E4), 8043 (2003). [6]Carter et al., Science 328, 1682 (2010). [7]Bibring et al., Eur. Space Agency Spec. Pub. 1240, 37 (2004). [8]Murchie et al., J. Geophys. Res. 114, E00D07 (2009). [9]Carter et al., Proc. Lunar Planet. Sci. Conf. 40, abstr. 2028 (2009). [10]Abramov and Kring, J. Geophys. Res. 110, (E12), E12S09 (2005). [11]Schwenzer and Kring, Geology 37, 1091 (2009). [12]Marzo et al., Icarus 208, 667-683 (2010).

Microfluidic Experiments Studying Pore Scale Interactions of Microbes and Geochemistry

NASA Astrophysics Data System (ADS)

Chen, M.; Kocar, B. D.

2016-12-01

Understanding how physical phenomena, chemical reactions, and microbial behavior interact at the pore-scale is crucial to understanding larger scale trends in groundwater chemistry. Recent studies illustrate the utility of microfluidic devices for illuminating pore-scale physical-biogeochemical processes and their control(s) on the cycling of iron, uranium, and other important elements 1-3. These experimental systems are ideal for examining geochemical reactions mediated by microbes, which include processes governed by complex biological phenomenon (e.g. biofilm formation, etc.)4. We present results of microfluidic experiments using a model metal reducing bacteria and varying pore geometries, exploring the limitations of the microorganisms' ability to access tight pore spaces, and examining coupled biogeochemical-physical controls on the cycling of redox sensitive metals. Experimental results will provide an enhanced understanding of coupled physical-biogeochemical processes transpiring at the pore-scale, and will constrain and compliment continuum models used to predict and describe the subsurface cycling of redox-sensitive elements5. 1. Vrionis, H. A. et al. Microbiological and geochemical heterogeneity in an in situ uranium bioremediation field site. Appl. Environ. Microbiol. 71, 6308-6318 (2005). 2. Pearce, C. I. et al. Pore-scale characterization of biogeochemical controls on iron and uranium speciation under flow conditions. Environ. Sci. Technol. 46, 7992-8000 (2012). 3. Zhang, C., Liu, C. & Shi, Z. Micromodel investigation of transport effect on the kinetics of reductive dissolution of hematite. Environ. Sci. Technol. 47, 4131-4139 (2013). 4. Ginn, T. R. et al. Processes in microbial transport in the natural subsurface. Adv. Water Resour. 25, 1017-1042 (2002). 5. Scheibe, T. D. et al. Coupling a genome-scale metabolic model with a reactive transport model to describe in situ uranium bioremediation. Microb. Biotechnol. 2, 274-286 (2009).

Shock Compression Induced Hot Spots in Energetic Material Detected by Thermal Imaging Microscopy

NASA Astrophysics Data System (ADS)

Chen, Ming-Wei; Dlott, Dana

2014-06-01

The chemical reaction of powder energetic material is of great interest in energy and pyrotechnic applications since the high reaction temperature. Under the shock compression, the chemical reaction appears in the sub-microsecond to microsecond time scale, and releases a large amount of energy. Experimental and theoretical research progresses have been made in the past decade, in order to characterize the process under the shock compression. However, the knowledge of energy release and temperature change of this procedure is still limited, due to the difficulties of detecting technologies. We have constructed a thermal imaging microscopy apparatus, and studied the temperature change in energetic materials under the long-wavelength infrared (LWIR) and ultrasound exposure. Additionally, the real-time detection of the localized heating and energy concentration in composite material is capable with our thermal imaging microscopy apparatus. Recently, this apparatus is combined with our laser driven flyer plate system to provide a lab-scale source of shock compression to energetic material. A fast temperature increase of thermite particulars induced by the shock compression is directly observed by thermal imaging with 15-20 μm spatial resolution. Temperature change during the shock loading is evaluated to be at the order of 10^9K/s, through the direct measurement of mid-wavelength infrared (MWIR) emission intensity change. We observe preliminary results to confirm the hot spots appear with shock compression on energetic crystals, and will discuss the data and analysis in further detail. M.-W. Chen, S. You, K. S. Suslick, and D. D. Dlott, {Rev. Sci. Instr., 85, 023705 (2014) M.-W. Chen, S. You, K. S. Suslick, and D. D. Dlott, {Appl. Phys. Lett., 104, 061907 (2014)} K. E. Brown, W. L. Shaw, X. Zheng, and D. D. Dlott, {Rev. Sci. Instr., 83, 103901 (2012)}

40 CFR 407.20 - Applicability; description of the apple products subcategory.

Code of Federal Regulations, 2012 CFR

2012-07-01

... apple products subcategory. 407.20 Section 407.20 Protection of Environment ENVIRONMENTAL PROTECTION... PROCESSING POINT SOURCE CATEGORY Apple Products Subcategory § 407.20 Applicability; description of the apple... processing of apples into apple products. The processing of apples into caustic peeled or dehydrated products...

40 CFR 407.20 - Applicability; description of the apple products subcategory.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 30 2013-07-01 2012-07-01 true Applicability; description of the apple... SOURCE CATEGORY Apple Products Subcategory § 407.20 Applicability; description of the apple products... apples into apple products. The processing of apples into caustic peeled or dehydrated products is...

40 CFR 407.10 - Applicability; description of the apple juice subcategory.

Code of Federal Regulations, 2012 CFR

2012-07-01

... apple juice subcategory. 407.10 Section 407.10 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY... SOURCE CATEGORY Apple Juice Subcategory § 407.10 Applicability; description of the apple juice... apples into apple juice or apple cider. When a plant is subject to effluent limitations covering more...

40 CFR 407.20 - Applicability; description of the apple products subcategory.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 28 2010-07-01 2010-07-01 true Applicability; description of the apple... SOURCE CATEGORY Apple Products Subcategory § 407.20 Applicability; description of the apple products... apples into apple products. The processing of apples into caustic peeled or dehydrated products is...

40 CFR 407.10 - Applicability; description of the apple juice subcategory.

Code of Federal Regulations, 2010 CFR

2010-07-01

... 40 Protection of Environment 28 2010-07-01 2010-07-01 true Applicability; description of the apple... SOURCE CATEGORY Apple Juice Subcategory § 407.10 Applicability; description of the apple juice... apples into apple juice or apple cider. When a plant is subject to effluent limitations covering more...

40 CFR 407.10 - Applicability; description of the apple juice subcategory.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 29 2011-07-01 2009-07-01 true Applicability; description of the apple... SOURCE CATEGORY Apple Juice Subcategory § 407.10 Applicability; description of the apple juice... apples into apple juice or apple cider. When a plant is subject to effluent limitations covering more...

40 CFR 407.10 - Applicability; description of the apple juice subcategory.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 29 2014-07-01 2012-07-01 true Applicability; description of the apple... SOURCE CATEGORY Apple Juice Subcategory § 407.10 Applicability; description of the apple juice... apples into apple juice or apple cider. When a plant is subject to effluent limitations covering more...

40 CFR 407.10 - Applicability; description of the apple juice subcategory.

Code of Federal Regulations, 2013 CFR

2013-07-01

... 40 Protection of Environment 30 2013-07-01 2012-07-01 true Applicability; description of the apple... SOURCE CATEGORY Apple Juice Subcategory § 407.10 Applicability; description of the apple juice... apples into apple juice or apple cider. When a plant is subject to effluent limitations covering more...

40 CFR 407.20 - Applicability; description of the apple products subcategory.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 29 2014-07-01 2012-07-01 true Applicability; description of the apple... SOURCE CATEGORY Apple Products Subcategory § 407.20 Applicability; description of the apple products... apples into apple products. The processing of apples into caustic peeled or dehydrated products is...

40 CFR 407.20 - Applicability; description of the apple products subcategory.

Code of Federal Regulations, 2011 CFR

2011-07-01

... 40 Protection of Environment 29 2011-07-01 2009-07-01 true Applicability; description of the apple... SOURCE CATEGORY Apple Products Subcategory § 407.20 Applicability; description of the apple products... apples into apple products. The processing of apples into caustic peeled or dehydrated products is...

Smartphone-based grading of apple quality

NASA Astrophysics Data System (ADS)

Li, Xianglin; Li, Ting

2018-02-01

Apple quality grading is a critical issue in apple industry which is one economical pillar of many countries. Artificial grading is inefficient and of poor accuracy. Here we proposed to develop a portable, convenient, real-time, and low cost method aimed at grading apple. Color images of the apples were collected with a smartphone and the grade of sampled apple was assessed by a customized smartphone app, which offered the functions translating RGB color values of the apple to color grade and translating the edge of apple image to weight grade. The algorithms are based on modeling with a large number of apple image at different grades. The apple grade data evaluated by the smartphone are in accordance with the actual data. This study demonstrated the potential of smart phone in apple quality grading/online monitoring at gathering and transportation stage for apple industry.

Cancer chemopreventive potential of apples, apple juice, and apple components.

PubMed

Gerhauser, Clarissa

2008-10-01

Apples ( MALUS sp., Rosaceae) are a rich source of nutrient as well as non-nutrient components and contain high levels of polyphenols and other phytochemicals. Main structural classes of apple constituents include hydroxycinnamic acids, dihydrochalcones, flavonols (quercetin glycosides), catechins and oligomeric procyanidins, as well as triterpenoids in apple peel and anthocyanins in red apples. Several lines of evidence suggest that apples and apple products possess a wide range of biological activities which may contribute to health beneficial effects against cardiovascular disease, asthma and pulmonary dysfunction, diabetes, obesity, and cancer (reviewed by Boyer and Liu, Nutr J 2004). The present review will summarize the current knowledge on potential cancer preventive effects of apples, apple juice and apple extracts (jointly designated as apple products). In brief, apple extracts and components, especially oligomeric procyanidins, have been shown to influence multiple mechanisms relevant for cancer prevention in IN VITRO studies. These include antimutagenic activity, modulation of carcinogen metabolism, antioxidant activity, anti-inflammatory mechanisms, modulation of signal transduction pathways, antiproliferative and apoptosis-inducing activity, as well as novel mechanisms on epigenetic events and innate immunity. Apple products have been shown to prevent skin, mammary and colon carcinogenesis in animal models. Epidemiological observations indicate that regular consumption of one or more apples a day may reduce the risk for lung and colon cancer.

The domestication and evolutionary ecology of apples.

PubMed

Cornille, Amandine; Giraud, Tatiana; Smulders, Marinus J M; Roldán-Ruiz, Isabel; Gladieux, Pierre

2014-02-01

The cultivated apple is a major fruit crop in temperate zones. Its wild relatives, distributed across temperate Eurasia and growing in diverse habitats, represent potentially useful sources of diversity for apple breeding. We review here the most recent findings on the genetics and ecology of apple domestication and its impact on wild apples. Genetic analyses have revealed a Central Asian origin for cultivated apple, together with an unexpectedly large secondary contribution from the European crabapple. Wild apple species display strong population structures and high levels of introgression from domesticated apple, and this may threaten their genetic integrity. Recent research has revealed a major role of hybridization in the domestication of the cultivated apple and has highlighted the value of apple as an ideal model for unraveling adaptive diversification processes in perennial fruit crops. We discuss the implications of this knowledge for apple breeding and for the conservation of wild apples. Copyright © 2013 Elsevier Ltd. All rights reserved.

Micro-Raman spectroscopy a powerful technique to identify crocidolite and erionite fibers in tissue sections

NASA Astrophysics Data System (ADS)

Rinaudo, C.; Croce, A.; Allegrina, M.; Baris, I. Y.; Dogan, A.; Powers, A.; Rivera, Z.; Bertino, P.; Yang, H.; Gaudino, G.; Carbone, M.

2013-05-01

Exposure to mineral fibers such asbestos and erionite is widely associated with the development of lung cancer and pleural malignant mesothelioma (MM). Pedigree and mineralogical studies indicated that genetics may influence mineral fiber carcinogenesis. Although dimensions strongly impact on the fiber carcinogenic potential, also the chemical composition and the fiber is relevant. By using micro-Raman spectroscopy we show here persistence and identification of different mineral phases, directly on histopathological specimens of mice and humans. Fibers of crocidolite asbestos and erionite of different geographic areas (Oregon, US and Cappadocia, Turkey) were injected in mice intra peritoneum. MM developed in 10/15 asbestos-treated mice after 5 months, and in 8-10/15 erionite-treated mice after 14 months. The persistence of the injected fibers was investigated in pancreas, liver, spleen and in the peritoneal tissue. The chemical identification of the different phases occurred in the peritoneal cavity or at the organ borders, while only rarely fibers were localized in the parenchyma. Raman patterns allow easily to recognize crocidolite and erionite fibers. Microscopic analysis revealed that crocidolite fibers were frequently coated by ferruginous material ("asbestos bodies"), whereas erionite fibers were always free from coatings. We also analyzed by micro-Raman spectroscopy lung tissues, both from MM patients of the Cappadocia, where a MM epidemic developed because of environmental exposure to erionite, and from Italian MM patients with occupational exposure to asbestos. Our findings demonstrate that micro-Raman spectroscopy is technique able to identify mineral phases directly on histopathology specimens, as routine tissue sections prepared for diagnostic purpose. REFERENCES A.U. Dogan, M. Dogan. Environ. Geochem. Health 2008, 30(4), 355. M. Carbone, S. Emri, A.U. Dogan, I. Steele, M. Tuncer, HI. Pass, et al. Nat. Rev. Cancer. 2007, 7 (2),147. M. Carbone, Y.I. Baris, P. Bertino, B. Brass, S. Comertpay, A.U. Dogan et al. Proc. Nat. Acad. Sci U S A 2011;108 (33), 13618. A.U. Dogan, Y.I.Baris, M. Dogan, S. Emri, I. Steele, A.G. Elmishad et al. Cancer Res. 2006,66 (10), 5063. M. Dogan. Scanning. 2012, 34 (1), 37. C. Rinaudo, M. Allegrina, E. Fornero, M. Musa, A. Croce, D. Bellis. J. Raman Spectrosc. 2010, 41 (1), 27. C. Rinaudo, A. Croce, M. Musa, E. Fornero, M. Allegrina, P. Trivero, et al. Appl. Spectrosc. 2010, 64 (6), 571. M. Musa, A. Croce, M. Allegrina, C. Rinaudo, E. Belluso, D. Bellis, et al. Vib. Spectrosc. 2012, 61, 66.

The online measured black carbon aerosol and source orientations in the Nam Co region, Tibet.

PubMed

Zhang, Xin; Ming, Jing; Li, Zhongqin; Wang, Feiteng; Zhang, Guoshuai

2017-11-01

Equivalent black carbon (eBC) mass concentrations were measured by an aethalometer (AE-31) in the Nam Co, central Tibet from 2010 to 2014. Different from previous filter-sampling studies (Ming et al., J Environ Sci 22(11):1748-1756, 2010; Zhao et al., Environ Sci Pollut Res 20:5827-5838, 2013), the first high-resolution online eBC measurement conducted in central Tibet is reported here, allowing to discuss the diurnal variations as well as seasonal variabilities of eBC. Average daily eBC concentration was 74 ± 50 ng/m 3 , reflecting a global background level. Meteorological conditions influenced eBC concentrations largely at seasonal scale, which are higher in February-May but lower in June-January. The highest eBC concentrations (greater than 210 ng/m 3 ) were more associated with the W and WSW winds smaller than 6 m/s. The diurnal variations of eBC showed plateaus from 10:00 to 15:00 with seasonal variations, associated with local anthropogenic activities, such as indigenous Tibetan burning animal waste and tourism traffic. The PBLHs showed a co-variance with eBC concentrations, implicating close sources. The aerosol optical depths derived from the MODIS data over the Nam Co Observatory Station (NCOS)-included sub-area (30° N-40° N, 90° E-100° E) showed significant relationship with eBC concentrations. This suggests that nearby or short-distance sources other than long-distance transported pollutants could be important contributors to eBC concentrations at the NCOS, different from the conclusions suggested by previous studies.

First principles study of iron-bearing MgO under ultrahigh pressure

NASA Astrophysics Data System (ADS)

Umemoto, K.; Hsu, H.

2017-12-01

Understanding of minerals under ultrahigh pressure is essential to model interiors of super-Earths. Chemical compositions of the super-Earths are expected to be similar to those of the Earth. Computational studies on Mg-Si-O ternary systems under ultrahigh pressures, which are difficult to be achieved by diamond-anvil-cell experiments, have been intensively performed (e.g., [1] for MgO, [2,3] for SiO2, and [4,5] for MgSiO3). However, as far as we know, these studies have been restricted to pure Mg-Si-O systems. In the mantles of super-Earths, we expect that there should be impurities as in the Earth's mantle. Among candidates of impurities, iron is especially important to model interiors of super-Earths. Here, we investigate iron-bearing MgO under ultrahigh pressures by first principles. We clarify effects of iron on the phase transition of MgO and thermodynamic quantities by first principles. The role of the 3d electrons will be elucidated. [1] Z. Wu, R. M. Wentzcovitch, K. Umemoto, B. Li, K. Hirose, and J. C. Zheng, J. Geophys. Res. 113, B06204 (2008). [2] S. Q. Wu, K. Umemoto, M. Ji, C. Z. Wang, K. M. Ho, and R. M. Wentzcovitch, Phys. Rev. B 83, 184102 (2011). [3] T. Tsuchiya and J. Tsuchiya, Proc. Nat. Acad. Sci. 108, 1252 (2011) [4] S. Q. Wu, M. Ji, C. Z. Wang, M. C. Nguye, X. Zhao, K. Umemoto, R. M. Wentzcovitch, and K. M. Ho, J. Phys.: Condens. Matter 26, 035402 (2014). [5] H. Niu, A. R. Oganov, X.-C. Chen, and D. Li, Sci. Rep. 5, 18347 (2015).

Cosmic dust flux on Earth inferred from the Concordia micrometeorite collection

NASA Astrophysics Data System (ADS)

Engrand, Cécile; Duprat, Jean; Dartois, Emmanuel; Godard, Marie; Delauche, Lucie

2017-04-01

The present extraterrestrial flux incoming to Earth is dominated by cosmic dust, i.e. micrometeorites in the 20-500 microns size range. Prior to atmospheric entry, the flux is estimated to ˜30 000 tons.yr-1 [1]. The proportion of this flux reaching the earth surface as dust particles is debated [e.g. 2]. Since 2000, we recover micrometeorites from ultraclean snow in the vicinity of the Dome C Concordia station in Antarctica. This region has a well-characterized and small precipitation rate (˜ 3.5 g of water per year) that allows collecting micrometeorites from large equivalent surfaces (> 100 m2.yrs) by sampling reasonable volumes of snow. The high efficiency and cleanliness of the collecting process at Dome C has enabled the recovery of several thousands of particles larger than ˜ 20 μm, constituting the Concordia micrometeorite collection [3]. The Concordia micrometeorites have a young terrestrial age of about 50 years. We characterized more than three thousand micrometeorites (both melted and unmelted particles) by secondary electron microscopy and classified them in the textural types defined in [4]. A preliminary flux value of 6,000 tons.yr-1 was given in [5] from the early Concordia collection examination. We now have better statistics to update this value. References: [1] Love S.G. and Brownlee D.E. (1993) Science 262, 550-553. [2] Peucker-Ehrenbrink B., et al. (2016) Elements 12, 191-196. [3] Duprat J., et al. (2007) Adv. Space Res. 39, 605-611. [4] Genge M.J., et al. (2008) Meteorit. Planet. Sci. 43, 497-515. [5] Duprat J., et al. (2006) Meteorit. Planet. Sci. 41 Suppl., A48 (#5239).

Short-term biomarkers of apple consumption.

PubMed

Saenger, Theresa; Hübner, Florian; Humpf, Hans-Ulrich

2017-03-01

Urinary biomarkers are used to estimate the nutritional intake of humans. The aim of this study was to distinguish between low, medium, and high apple consumption by quantifying possible intake biomarkers in urine samples after apple consumption by HPLC-MS/MS. Apples were chosen as they are the most consumed fruits in Germany. Thirty subjects took part in 7-day study. They abstained from apples and apple products except for one weighed apple portion resembling one, two, or four apples. Before apple consumption and during the following days spot urine samples were collected. These urine samples were incubated with β-glucuronidase, diluted, and directly measured by HPLC-MS/MS. Phloretin, epicatechin, procyanidin B2, and quercetin were detected in urine using Scheduled MRM TM mode. Phloretin was confirmed as a urinary biomarker of apple intake and had the ability to discriminate between low or medium (one or two apples) and high apple consumption (four apples). The groups also differ in the excretion of epicatechin and procyanidin B2. Apple consumption can be monitored by urinary biomarkers for a period of at least 12 h after consumption. Furthermore the amount of apples consumed can be estimated by the concentration of certain biomarkers. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Titan's chemical complexity

NASA Astrophysics Data System (ADS)

Vuitton, Veronique

2012-04-01

We review here our current knowledge of Titan's gas phase chemistry. We base our discussion on photochemical models as well as on laboratory experiments. We identify the lower mass positive [1,2] and negative [3] ions detected in the upper atmosphere and we show that their formation is a direct consequence of the presence of heavy neutrals. We demonstrate that the observed densities of CO, CO2 and H2O can be explained by a combination of exogenous O, and OH/H2O input [4]. We argue that benzene [5] and ammonia [6] are created in the upper atmosphere through complex chemical processes involving both neutral and ion chemistry. These species diffuse downward where they are at the origin of heavier aromatics and amines, respectively. Finally, we discuss the impact on hydrocarbon densities of recent theoretical calculations of the rate constants of association reactions [7]. [1] V. Vuitton, R. V. Yelle and V. G. Anicich, Astrophys. J., 647, L175 (2006). [2] V. Vuitton, R. V. Yelle and M. J. McEwan, Icarus, 191, 722 (2007). [3] V. Vuitton, P. Lavvas, R. V. Yelle, M. Galand, A. Wellbrock, G. R. Lewis, A. J. Coates and J.-E. Wahlund, Planet. Space Sci., 57, 1558 (2009). [4] S. M. Hörst, V. Vuitton, and R. V. Yelle, J. Geophys. Res., 113, E10006 (2008). [5] V. Vuitton, R. V. Yelle and J. Cui, J. Geophys. Res., 113, E05007 (2008). [6] R. V. Yelle, V. Vuitton, P. Lavvas, S. J. Klippenstein, M. A. Smith, S. M. Hörst and J. Cui, Faraday Discuss., 147, 31 (2010). [7] V. Vuitton, R. V. Yelle, S. J. Klippenstein and P. Lavvas, Astrophys. J., in press.

Formation Of Amino Acids And Nucleotide Bases In A Titan Atmosphere Simulation Experiment

NASA Astrophysics Data System (ADS)

Horst, Sarah; Yelle, R. V.; Buch, A.; Carrasco, N.; Cernogora, G.; Dutuit, O.; Quirico, E.; Sciamma-O'Brien, E.; Smith, M. A.; Somogyi, A.; Szopa, C.; Thissen, R.; Vuitton, V.

2010-10-01

Titan has been a subject of astrobiological interest since the Voyager spacecraft first revealed the diversity of the organic chemistry occurring in the atmosphere. However, it was not until the arrival of Cassini-Huygens that the chemical complexity of Titan's atmosphere was fully appreciated. The Cassini Plasma Spectrometer (CAPS) observed negative ions with m/z values up to 10,000 u/q at 950 km [1] and positive ions with m/z up to 400 u/q [2]. CAPS has also observed O+ flowing into Titan's atmosphere [3]. While Titan's atmosphere is relatively oxygen poor compared to terrestrial planets, CO is the fourth most abundant molecule in the atmosphere (˜50 ppm). The fact that the observed O+ flux is deposited in the region now known to contain large organic molecules leads to the exciting possibility that oxygen can be incorporated into these molecules resulting in the production of prebiotic molecules. In this work, Titan aerosol analogues (or "tholins") produced in PAMPRE, a Titan atmosphere simulation experiment, have been analyzed in a very high resolution LTQ Orbitrap mass spectrometer. These PAMPRE tholins were produced by capacitively coupled RF discharge in a mixture of N2, CH4 and CO. The tholins were found to contain 18 molecules with molecular formulae corresponding to biological amino acids and nucleotide bases. GC-MS measurements have confirmed the structure of seven: adenine, cytosine, uracil, thymine, guanine, glycine and alanine. The production of prebiotic molecules under atmospheric conditions presents a new source of prebiotic material and may increase the range of planets where life could begin. [1] Coates AJ, et al. (2007). Geophys. Res. Lett. 34:22103- +. [2] Crary FJ, et al. (2009). Planet. Space Sci. 57:1847- 1856. [3] Hartle RE, et al. (2006). Geophys. Res. Lett. 33:8201-+.

Natural time analysis and Tsallis non-additive entropy statistical mechanics.

NASA Astrophysics Data System (ADS)

Sarlis, N. V.; Skordas, E. S.; Varotsos, P.

2016-12-01

Upon analyzing the seismic data in natural time and employing a sliding natural time window comprising a number of events that would occur in a few months, it has been recently uncovered[1] that a precursory Seismic Electric Signals activity[2] initiates almost simultaneously with the appearance of a minimum in the fluctuations of the order parameter of seismicity [3]. Such minima have been ascertained [4] during periods of the magnitude time series exhibiting long range correlations [5] a few months before all earthquakes of magnitude 7.6 or larger that occurred in the entire Japanese area from 1 January 1984 to 11 March 2011 (the day of the M9 Tohoku-Oki earthquake). Before and after these minima, characteristic changes of the temporal correlations between earthquake magnitudes are observed which cannot be captured by Tsallis non-additive entropy statistical mechanics in the frame of which it has been suggested that kappa distributions arise [6]. Here, we extend the study concerning the existence of such minima in a large area that includes Aegean Sea and its surrounding area which exhibits in general seismo-tectonics [7] different than that of the entire Japanese area. References P. A. Varotsos et al., Tectonophysics, 589 (2013) 116. P. Varotsos and M. Lazaridou, Tectonophysics 188 (1991) 321. P.A. Varotsos et al., Phys Rev E 72 (2005) 041103. N. V. Sarlis et al., Proc Natl Acad Sci USA 110 (2013) 13734. P. A. Varotsos, N. V. Sarlis, and E. S. Skordas, J Geophys Res Space Physics 119 (2014), 9192, doi: 10.1002/2014JA0205800. G. Livadiotis, and D. J. McComas, J Geophys Res 114 (2009) A11105, doi:10.1029/2009JA014352. S. Uyeda et al., Tectonophysics, 304 (1999) 41.

Diclofenac degradation by heterogeneous photocatalysis with Fe3O4/Ti x O y /activated carbon fiber composite synthesized by ultrasound irradiation

NASA Astrophysics Data System (ADS)

Moreno-Valencia, E. I.; Paredes-Carrera, S. P.; Sánchez-Ochoa, J. C.; Flores-Valle, S. O.; Avendaño-Gómez, J. R.

2017-11-01

In this work, a photocatalytic system to degrade diclofenac was developed using a composite Fe3O4/Ti x O y on an activated carbon fiber. Diclofenac is widely used as an anti-inflammatory compound worldwide and it is constantly being added as waste in the environment (Heberer 2002 J. Hydrol. 266 175-89), exceeding the permissible maximum concentration in the wastewater (GEO-3 2002 Programa de las Naciones Unidas para el Medio Ambiente; Golet et al 2003 Environ. Sci. Technol. 37 3243-9 Oviedo et al 2010 Environ. Toxicol. Pharmacol. 29 9-43 Le-Minh et al 2010 Water Res. 44 4295-323 Legrini et al 1993 Chem. Rev. 1093 671-98). The composite was synthesized by sol-gel technique with and without ultrasound irradiation (Singh and Nakate 2014 J. Nanopart. 2014 326747). The solids were deposited by ultrasound irradiation on active carbon fiber in order to optimize the diclofenac degradation. The solids were characterized by x-ray diffraction (XRD), nitrogen physisorption (BET), and scanning electron microscopy with EDS microanalysis (SEM-EDS). The crystal size was calculated with the Debye-Scherrer equation, and the band gap values by the diffuse reflectance method. The evaluation process was studied by UV-vis spectroscopy (Rizzoa et al 2009 Water Res. 43 979-88). It was found that in this synthesis method (ultrasound), textural properties such as porosity, specific surface area and morphology depend on the ultrasound irradiation. The proposed system, Fe3O4/titanium oxide hydrate showed better degradation profile than TiO2 anatase phase; the increase of diclofenac degradation was attributed to the textural properties of the composite, it avoids the filtering process since the separation can be achieved by magnetizing and/or decantation.

On physical-constraints-preserving schemes for special relativistic magnetohydrodynamics with a general equation of state

NASA Astrophysics Data System (ADS)

Wu, Kailiang; Tang, Huazhong

2018-06-01

The paper studies the physical-constraints-preserving (PCP) schemes for multi-dimensional special relativistic magnetohydrodynamics with a general equation of state (EOS) on more general meshes. It is an extension of the work (Wu and Tang in Math. Models Methods Appl. Sci. 27:1871-1928, 2017) which focuses on the ideal EOS and uniform Cartesian meshes. The general EOS without a special expression poses some additional difficulties in discussing the mathematical properties of admissible state set with the physical constraints on the fluid velocity, density and pressure. Rigorous analyses are provided for the PCP property of finite volume or discontinuous Galerkin schemes with the Lax-Friedrichs (LxF)-type flux on a general mesh with non-self-intersecting polytopes. Those are built on a more general form of generalized LxF splitting property and a different convex decomposition technique. It is shown in theory that the PCP property is closely connected with a discrete divergence-free condition, which is proposed on the general mesh and milder than that in Wu and Tang (2017).

Unified Model of the rf Plasma Sheath, Part II

NASA Astrophysics Data System (ADS)

Riley, Merle

1996-10-01

By developing an approximation to the first integral of the Poisson equation, one can obtain solutions for the current-voltage characteristics of an rf plasma sheath that are valid over the whole range of inertial response of the ions to an imposed rf voltage or current. (M.E.Riley, 1995 GEC, abstract QA5, published in Bull. Am. Phys. Soc., 40, 1587 (1995).) The theory has been shown to adequately reproduce current-voltage characteristics of two extreme cases (M.A. Lieberman, IEEE Trans. Plasma Sci. 16, 638 (1988). A. Metze, D.W. Ernie, and H.J.Oskam, J.Appl.Phys., 60, 3081 (1986).) of ion response. In this work I show the effect of different conventions for connecting the sheath model to the bulk plasma. Modifications of the Mach number and a finite electric field at the Bohm point are natural choices. The differences are examined for a sheath in a high density Ar plasma and are found to be insignificant. A theoretical argument favors the electric field modification. *Work performed at Sandia National Labs and supported by US DoE under contract DE-AC04-94AL85000.

Resistive sensitivity functions for van der Pauw astroid and rounded crosses and cloverleafs

NASA Astrophysics Data System (ADS)

Koon, Daniel; Hansen, Ole

2014-03-01

We have calculated the sensitivity of van der Pauw resistances to local resistive variations for circular, square and astroid discs of infinitesimal thickness, as well as for the families of rounded crosses and cloverleafs, as a function of specimen parameters, using the direct formulas of our recent paper (Koon et al. 2013 J. Appl. Phys.114 163710) applied to ``reciprocally dual geometries'' (swapped Dirichlet and Neumann boundary conditions) described by Mareš et al.(2012 Meas. Sci. Technol. 23 045004). These results show that (a) the product of any such sensitivity function times differential area, and thus (b) the ratio of any two sensitivities, is invariant under conformal mapping, allowing for the pointwise determination of the conformal mapping function. The family of rounded crosses, which is bounded in parameter space by the square, the astroid and an ``infinitesimally thin'' cross, seems to represent the best geometry for focusing transport measurements on the center of the specimen while minimizing errors due to edge- or contact-effects. Made possible by an SLU Faculty research grant.

Micromorphic approach for gradient-extended thermo-elastic-plastic solids in the logarithmic strain space

NASA Astrophysics Data System (ADS)

Aldakheel, Fadi

2017-11-01

The coupled thermo-mechanical strain gradient plasticity theory that accounts for microstructure-based size effects is outlined within this work. It extends the recent work of Miehe et al. (Comput Methods Appl Mech Eng 268:704-734, 2014) to account for thermal effects at finite strains. From the computational viewpoint, the finite element design of the coupled problem is not straightforward and requires additional strategies due to the difficulties near the elastic-plastic boundaries. To simplify the finite element formulation, we extend it toward the micromorphic approach to gradient thermo-plasticity model in the logarithmic strain space. The key point is the introduction of dual local-global field variables via a penalty method, where only the global fields are restricted by boundary conditions. Hence, the problem of restricting the gradient variable to the plastic domain is relaxed, which makes the formulation very attractive for finite element implementation as discussed in Forest (J Eng Mech 135:117-131, 2009) and Miehe et al. (Philos Trans R Soc A Math Phys Eng Sci 374:20150170, 2016).

Simplified multiple headspace extraction gas chromatographic technique for determination of monomer solubility in water.

PubMed

Chai, X S; Schork, F J; DeCinque, Anthony

2005-04-08

This paper reports an improved headspace gas chromatographic (GC) technique for determination of monomer solubilities in water. The method is based on a multiple headspace extraction GC technique developed previously [X.S. Chai, Q.X. Hou, F.J. Schork, J. Appl. Polym. Sci., in press], but with the major modification in the method calibration technique. As a result, only a few iterations of headspace extraction and GC measurement are required, which avoids the "exhaustive" headspace extraction, and thus the experimental time for each analysis. For highly insoluble monomers, effort must be made to minimize adsorption in the headspace sampling channel, transportation conduit and capillary column by using higher operating temperature and a short capillary column in the headspace sampler and GC system. For highly water soluble monomers, a new calibration method is proposed. The combinations of these technique modifications results in a method that is simple, rapid and automated. While the current focus of the authors is on the determination of monomer solubility in aqueous solutions, the method should be applicable to determination of solubility of any organic in water.

Boundedness and exponential convergence in a chemotaxis model for tumor invasion

NASA Astrophysics Data System (ADS)

Jin, Hai-Yang; Xiang, Tian

2016-12-01

We revisit the following chemotaxis system modeling tumor invasion {ut=Δu-∇ṡ(u∇v),x∈Ω,t>0,vt=Δv+wz,x∈Ω,t>0,wt=-wz,x∈Ω,t>0,zt=Δz-z+u,x∈Ω,t>0, in a smooth bounded domain Ω \\subset {{{R}}n}(n≥slant 1) with homogeneous Neumann boundary and initial conditions. This model was recently proposed by Fujie et al (2014 Adv. Math. Sci. Appl. 24 67-84) as a model for tumor invasion with the role of extracellular matrix incorporated, and was analyzed later by Fujie et al (2016 Discrete Contin. Dyn. Syst. 36 151-69), showing the uniform boundedness and convergence for n≤slant 3 . In this work, we first show that the {{L}∞} -boundedness of the system can be reduced to the boundedness of \\parallel u(\\centerdot,t){{\\parallel}{{L\\frac{n{4}+ɛ}}(Ω )}} for some ɛ >0 alone, and then, for n≥slant 4 , if the initial data \\parallel {{u}0}{{\\parallel}{{L\\frac{n{4}}}}} , \\parallel {{z}0}{{\\parallel}{{L\\frac{n{2}}}}} and \\parallel \

Passive hind-limb cycling improves cardiac function and reduces cardiovascular disease risk in experimental spinal cord injury.

PubMed

West, Christopher R; Crawford, Mark A; Poormasjedi-Meibod, Malihe-Sadat; Currie, Katharine D; Fallavollita, Andre; Yuen, Violet; McNeill, John H; Krassioukov, Andrei V

2014-04-15

Spinal cord injury (SCI) causes altered autonomic control and severe physical deconditioning that converge to drive maladaptive cardiac remodelling. We used a clinically relevant experimental model to investigate the cardio-metabolic responses to SCI and to establish whether passive hind-limb cycling elicits a cardio-protective effect. Initially, 21 male Wistar rats were evenly assigned to three groups: uninjured control (CON), T3 complete SCI (SCI) or T3 complete SCI plus passive hind-limb cycling (SCI-EX; 2 × 30 min day(-1), 5 days week(-1) for 4 weeks beginning 6 days post-SCI). On day 32, cardio-metabolic function was assessed using in vivo echocardiography, ex vivo working heart assessments, cardiac histology/molecular biology and blood lipid profiles. Twelve additional rats (n = 6 SCI and n = 6 SCI-EX) underwent in vivo echocardiography and basal haemodynamic assessments pre-SCI and at days 7, 14 and 32 post-SCI to track temporal cardiovascular changes. Compared with CON, SCI exhibited a rapid and sustained reduction in left ventricular dimensions and function that ultimately manifested as reduced contractility, increased myocardial collagen deposition and an up-regulation of transforming growth factor beta-1 (TGFβ1) and mothers against decapentaplegic homolog 3 (Smad3) mRNA. For SCI-EX, the initial reduction in left ventricular dimensions and function at day 7 post-SCI was completely reversed by day 32 post-SCI, and there were no differences in myocardial contractility between SCI-EX and CON. Collagen deposition was similar between SCI-EX and CON. TGFβ1 and Smad3 were down-regulated in SCI-EX. Blood lipid profiles were improved in SCI-EX versus SCI. We provide compelling novel evidence that passive hind-limb cycling prevents cardiac dysfunction and reduces cardiovascular disease risk in experimental SCI.

7 CFR 33.5 - Apples.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 7 Agriculture 2 2012-01-01 2012-01-01 false Apples. 33.5 Section 33.5 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... ISSUED UNDER AUTHORITY OF THE EXPORT APPLE ACT Definitions § 33.5 Apples. Apples mean fresh whole apples...

7 CFR 33.5 - Apples.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 7 Agriculture 2 2014-01-01 2014-01-01 false Apples. 33.5 Section 33.5 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... ISSUED UNDER AUTHORITY OF THE EXPORT APPLE ACT Definitions § 33.5 Apples. Apples mean fresh whole apples...

7 CFR 33.5 - Apples.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false Apples. 33.5 Section 33.5 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... ISSUED UNDER AUTHORITY OF THE EXPORT APPLE ACT Definitions § 33.5 Apples. Apples mean fresh whole apples...

7 CFR 33.5 - Apples.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 2 2011-01-01 2011-01-01 false Apples. 33.5 Section 33.5 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... ISSUED UNDER AUTHORITY OF THE EXPORT APPLE ACT Definitions § 33.5 Apples. Apples mean fresh whole apples...

7 CFR 33.5 - Apples.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 7 Agriculture 2 2013-01-01 2013-01-01 false Apples. 33.5 Section 33.5 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... ISSUED UNDER AUTHORITY OF THE EXPORT APPLE ACT Definitions § 33.5 Apples. Apples mean fresh whole apples...

Volatility of patulin in apple juice.

PubMed

Kryger, R A

2001-08-01

Patulin is a mycotoxin produced by certain fungi, such as those found commonly on apples. The patulin content of apple juice is a regulatory concern because patulin is a suspected carcinogen and mutagen. A simple model of the apple juice concentration process was carried out to examine the possible contamination of patulin in apple aroma, a distillate produced commercially in the concentration of apple juice. The results show no evidence for patulin volatility, and document a reduction in patulin content by at least a factor of 250 in the apple distillate obtained from apple juice. Furthermore, a survey of several commercial apple aroma samples found no evidence of patulin content.

Novel Applications of Peroxidase

NASA Astrophysics Data System (ADS)

Rob, Abdul; Ball, Andrew S.; Tuncer, Munir; Wilson, Michael T.

1997-02-01

The article entitled "Novel Biocatalysts Will Work Even Better for Industry" published recently in this Journal (1) was informative and interesting. However it touched only briefly on the application of peroxidase as catalyst. Here, we would like to mention in more detail the novel applications of peroxidase in agricultural, paper pulp, water treatment, pharmaceutical, and medical situations. Firstly, the peroxidase isolated from Phanerochaete chyrosporium has been shown to detoxify herbicides such as atrazine to less toxic compounds and would certainly find potential application in agriculture (2). Secondly, the peroxidase produced by Streptomyces thermoviolaceus may find application in the paper pulp industry as a delignifying agent (3). Thirdly, it has been shown that extracellular peroxidase produced by Streptomyces avermitilis can remove the intense color from paper-mill effluent obtained after semichemical alkaline pulping of wheat straw (4), and thus this enzyme might find application as a catalyst in water treatment plants. Fourthly, the heme-containing horseradish peroxidase enzyme has been exploited in several diagnostic applications in pharmaceutics and medicine, such as the detection of human immunodeficiency virus and cystic fibrosis (5-10). Finally, recent work from our laboratory has suggested that thermophilic nonheme peroxidase produced by Thermomonospora fusca BD25 may find medical use in the diagnosis of myocardial infarction (11, 12). Literature Cited 1. Wiseman, A. J. Chem. Educ. 1996, 73, 55-58. 2. Mougin, C. Appl. Environ. Microbiol. 1994, 60, 705-708. 3. McCarthy A. J.; Peace, W.; Broda, P. Appl. Microbiol. Technol. 1985, 23, 238-244. 4. Hernandez, M; Rodriguez J; Soliveri, J; Copa, J. L; Perez, M. I; Arias, M. E. Appl. Environ. Microbiol. 1994, 60, 3909-3913. 5. Hopfer, S. M.; Aslanzadeh, J. Ann. Clin. Lab. Sci. 1995, 25, 475-480. 6. Suzuki, K; Iman, M. J. Virol. Methods 1995, 55, 347-356. 7. Nielsen, K. J. Immunoassay 1995, 16, 183-197. 8. Warhol, M. J.; Heitz, P. U. Lab. Invest. 1992, 67, 263-269. 9. Pergande, M.; Jung, K. Clin. Chem. 1993, 39, 1885-1890. 10. Allain, C. C; Poon, L. S.; Chan, C. S. G; Richmond, W.; Fu, P. C. Clin. Chem. 1974, 20, 470-475. 11. Rob, A; Ball, A. S.; Tuncer, M; Wilson, M. T. Biochem. Soc. Trans. 1995, 23, 507. 12. Rob, A.; Ball, A. S.; Tuncer, M.; Jones, G. D.; Taylor, P. D; Wilson, M. T. Biochem. Soc. Trans. 1996, 24, 455.

Scaffolds and tissue regeneration: An overview of the functional properties of selected organic tissues.

PubMed

Rebelo, Márcia A; Alves, Thais F R; de Lima, Renata; Oliveira, José M; Vila, Marta M D C; Balcão, Victor M; Severino, Patrícia; Chaud, Marco V

2016-10-01

Tissue engineering plays a significant role both in the re-establishment of functions and regeneration of organic tissues. Success in manufacturing projects for biological scaffolds, for the purpose of tissue regeneration, is conditioned by the selection of parameters such as the biomaterial, the device architecture, and the specificities of the cells making up the organic tissue to create, in vivo, a microenvironment that preserves and further enhances the proliferation of a specific cell phenotype. To support this approach, we have screened scientific publications that show biomedical applications of scaffolds, biomechanical, morphological, biochemical, and hemodynamic characteristics of the target organic tissues, and the possible interactions between different cell matrices and biological scaffolds. This review article provides an overview on the biomedical application of scaffolds and on the characteristics of the (bio)materials commonly used for manufacturing these biological devices used in tissue engineering, taking into consideration the cellular specificity of the target tissue. © 2015 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 104B: 1483-1494, 2016. © 2015 Wiley Periodicals, Inc.

Lithium doped calcium phosphate cement maintains physical mechanical properties and promotes osteoblast proliferation and differentiation.

PubMed

Li, Li; Wang, Renchong; Li, Baichuan; Liang, Wei; Pan, Haobo; Cui, Xu; Tang, Jingli; Li, Bing

2017-07-01

Calcium phosphate cement (CPC) has been widely used in bone tissue repairing due to its physical mechanical properties and biocompatibility. Addition of trace element to CPC has shown promising evidence to improve the physical properties and biological activities of CPC. Lithium (Li) has effect on osteoblast proliferation and differentiation. In this study, we incorporated Li to CPC and examined the physical properties of Li/CPC and its effect on osteoblast proliferation and differentiation. We found that Li doped CPC maintained similar setting time, pore size distribution, compressive strength, composition, and morphology as CPC without Li. Additionally, Li doped CPC improved osteoblast proliferation and differentiation significantly compared to CPC without Li. To our knowledge, our results, for the first time, show that Li doped CPC has beneficial effect on osteoblast in cell culture while keeps the excellent physical-mechanical properties of CPC. This study will lead to potential application of Li doped CPC in bone tissue engineering. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 944-952, 2017. © 2016 Wiley Periodicals, Inc.

Galvanic corrosion of nitinol under deaerated and aerated conditions.

PubMed

Pound, Bruce G

2016-10-01

Various studies have examined the corrosion rate of nitinol generally under deaerated conditions. Likewise, galvanic corrosion studies have typically involved deaerated solutions. This work addressed the effect of galvanic coupling on the corrosion current of electropolished nitinol in phosphate buffered saline and 0.9% sodium chloride under dearated and aerated conditions for times up to 24 h. Tests were performed on nitinol alone and coupled with MP35N in both the mechanically polished and passivated conditions. Aeration and galvanic coupling were found to have relatively little effect, indicating that the corrosion current is controlled by the anodic reaction. The current can be attributed entirely to Ni(2+) dissolution, which appears to be governed by solid-state mass transport of Ni(2+) through the passive oxide film. Because corrosion of EP nitinol is controlled by the anodic reaction, contact between EP nitinol and MP35N or other biomedical Co-Cr alloys is unlikely to result in significant galvanic effects in vivo. © 2015 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 104B: 1322-1327, 2016. © 2015 Wiley Periodicals, Inc.

Optimization of a RF-generated CF4/O2 gas plasma sterilization process.

PubMed

Lassen, Klaus S; Nordby, Bolette; Grün, Reinar

2003-05-15

A sterilization process with the use of RF-generated (13.56 MHz) CF(4)/O(2) gas plasma was optimized in regards to power, flow rate, exposure time, and RF-system type. The dependency of the sporicidal effect on the spore inoculum positioning in the chamber of the RF systems was also investigated. Dried Bacillus stearothermophilus ATCC 7953 endospores were used as test organisms. The treatments were evaluated on the basis of survival curves and corresponding D values. The only parameter found to affect the sterilization process was the power of the RF system. Higher power resulted in higher kill. Finally, when the samples were placed more than 3-8 cm away from a centrally placed electrode in System 2, the sporicidal effect was reduced. The results are discussed and compared to results from the present literature. The RF excitation source is evaluated to be more appropriate for sterilization processes than the MW source. Copyright 2003 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater 65B: 239-244, 2003

"Click" on PLGA-PEG and hyaluronic acid: Gaining access to anti-leishmanial pentamidine bioconjugates.

PubMed

Scala, Angela; Piperno, Anna; Micale, Nicola; Mineo, Placido G; Abbadessa, Antonio; Risoluti, Roberta; Castelli, Germano; Bruno, Federica; Vitale, Fabrizio; Cascio, Antonio; Grassi, Giovanni

2017-12-08

Pentamidine (Pent), an antiparasitic drug used for the treatment of visceral leishmaniasis, has been modified with terminal azide groups and conjugated to two different polymer backbones (PLGA-PEG [PP] copolymer and hyaluronic acid [HA]) armed with alkyne end-groups. The conjugation has been performed by Copper Catalyzed Azido Alkyne Cycloaddition (CuAAC) using CuSO 4 /sodium ascorbate as metal source. The novel PP-Pent and HA-Pent bioconjugates are proposed, respectively, as non-targeted and targeted drug delivery systems against Leishmania infections. Moreover, Pent has been encapsulated into PP nanoparticles by the oil-in-water emulsion method, with the aim to compare the biological activity of the bioconjugates with that of the classical drug-loaded delivery system that physically entraps the therapeutic agent. Biological assays against Leishmania infantum amastigote-infected macrophages and primary macrophages revealed that Pent, either covalently conjugated with polymers or loaded into polymeric nanoparticles, turned out to be more potent and less toxic than the free Pent. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 2017. © 2017 Wiley Periodicals, Inc.

An improved correlation to predict molecular weight between crosslinks based on equilibrium degree of swelling of hydrogel networks.

PubMed

Jimenez-Vergara, Andrea C; Lewis, John; Hahn, Mariah S; Munoz-Pinto, Dany J

2018-04-01

Accurate characterization of hydrogel diffusional properties is of substantial importance for a range of biotechnological applications. The diffusional capacity of hydrogels has commonly been estimated using the average molecular weight between crosslinks (M c ), which is calculated based on the equilibrium degree of swelling. However, the existing correlation linking M c and equilibrium swelling fails to accurately reflect the diffusional properties of highly crosslinked hydrogel networks. Also, as demonstrated herein, the current model fails to accurately predict the diffusional properties of hydrogels when polymer concentration and molecular weight are varied simultaneously. To address these limitations, we evaluated the diffusional properties of 48 distinct hydrogel formulations using two different photoinitiator systems, employing molecular size exclusion as an alternative methodology to calculate average hydrogel mesh size. The resulting data were then utilized to develop a revised correlation between M c and hydrogel equilibrium swelling that substantially reduces the limitations associated with the current correlation. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 106B: 1339-1348, 2018. © 2017 Wiley Periodicals, Inc.

Wear characteristics of an unconstrained lumbar total disc replacement under a range of in vitro test conditions

PubMed Central

Fisher, John; Hall, Richard M.

2015-01-01

Abstract The effect of kinematics, loading and centre of rotation on the wear of an unconstrained total disc replacement have been investigated using the ISO 18192‐1 standard test as a baseline. Mean volumetric wear rate and surface morphological effects were reported. Changing the phasing of the flexions to create a low (but finite) amount of crossing path motion at the bearing surfaces resulted in a significant fall in wear volume. However, the rate of wear was still much larger than previously reported values under zero cross shear conditions. Reducing the load did not result in a significant change in wear rate. Moving the centre of rotation of the disc inferiorly did significantly increase wear rate. A phenomenon of debris re‐attachment on the UHMWPE surface was observed and hypothesised to be due to a relatively harsh tribological operating regime in which lubricant replenishment and particle migration out of the bearing contact zone were limited. © 2015 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 46–52, 2017. PMID:26411540

Microstructural design of functionally graded coatings composed of suspension plasma sprayed hydroxyapatite and bioactive glass.

PubMed

Cattini, Andrea; Bellucci, Devis; Sola, Antonella; Pawłowski, Lech; Cannillo, Valeria

2014-04-01

Various bioactive glass/hydroxyapatite (HA) functional coatings were designed by the suspension plasma spraying (SPS) technique. Their microstructure, scratch resistance, and apatite-forming ability in a simulated body fluid (SBF) were compared. The functional coatings design included: (i) composite coating, that is, randomly distributed constituent phases; (ii) duplex coating with glass top layer onto HA layer; and (iii) graded coating with a gradual changing composition starting from pure HA at the interface with the metal substrate up to pure glass on the surface. The SPS was a suitable coating technique to produce all the coating designs. The SBF tests revealed that the presence of a pure glass layer on the working surface significantly improved the reactivity of the duplex and graded coatings, but the duplex coating suffered a relatively low scratch resistance because of residual stresses. The graded coating therefore provided the best compromise between mechanical reliability and apatite-forming ability in SBF. © 2013 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 102B: 551-560, 2014. Copyright © 2013 Wiley Periodicals, Inc.

Antimicrobial activity of immobilized lactoferrin and lactoferricin.

PubMed

Chen, Renxun; Cole, Nerida; Dutta, Debarun; Kumar, Naresh; Willcox, Mark D P

2017-11-01

Lactoferrin and lactoferricin were immobilized on glass surfaces via two linkers, 4-azidobenzoic acid (ABA) or 4-fluoro-3-nitrophenyl azide (FNA). The resulting surfaces were characterized by X-ray photoelectron spectroscopy (XPS) and contact angle measurements. The antimicrobial activity of the surfaces was determined using Pseudomonas aeruginosa and Staphylococcus aureus strains by fluorescence microscopy. Lactoferrin and lactoferricin immobilization was confirmed by XPS showing significant increases (p < 0.05) in nitrogen on the glass surface. The immobilization of both proteins slightly increased the overall hydrophobicity of the glass. Both lactoferrin and lactoferricin immobilized on glass significantly (p < 0.05) reduced the numbers of viable bacterial cells adherent to the glass. For P. aeruginosa, the immobilized proteins consistently increased the percentage of dead cells compared to the total cells adherent to the glass surfaces (p < 0.03). Lactoferrin and lactoferricin were successfully immobilized on glass surfaces and showed promising antimicrobial activity against pathogenic bacteria. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 2612-2617, 2017. © 2016 Wiley Periodicals, Inc.

Plasma iron levels appraised 15 days after spinal cord injury in a limb movement animal model.

PubMed

Reis, F M; Esteves, A M; Tufik, S; de Mello, M T

2011-03-01

Experimental, controlled trial. The purpose of this study was to evaluate plasma iron and transferrin levels in a limb movement animal model with spinal cord injury (SCI). Universidade Federal de São Paulo, Departamento de Psicobiologia. In all, 72 male Wistar rats aged 90 days were divided into four groups: (1) acute SCI (1 day, SCI1), (2) 3 days post-SCI (SCI3), (3) 7 days post-SCI (SCI7) and (4) 15 days post-SCI (SCI15). Each of these groups had corresponding control (CTRL) and SHAM groups. Plasma iron and transferrin levels of the different groups were analyzed using a one-way analysis of variance (ANOVA) followed by Tukey's test. We found a significant reduction in iron plasma levels after SCI compared with the CTRL group: SCI1 (CTRL: 175±10.58 μg dl(-1); SCI: 108.28±11.7 μg dl(-1)), SCI3 (CTRL: 195.5±11.00 μg dl(-1); SCI: 127.88±12.63 μg dl(-1)), SCI7 (CTRL: 186±2.97 μg dl(-1); SCI: 89.2±15.39 μg dl(-1)) and SCI15 (CTRL: 163±5.48 μg dl(-1); SCI: 124.44±10.30 μg dl(-1)) (P<0.05; ANOVA). The SHAM1 group demonstrated a reduction in iron plasma after acute SCI (CTRL: 175±10.58 μg dl(-1); SHAM: 114.60±7.81 μg dl(-1)) (P<0.05; ANOVA). Reduced iron metabolism after SCI may be one of the mechanisms involved in the pathogenesis of sleep-related movement disorders.

The SDF-1/CXCR4 axis promotes recovery after spinal cord injury by mediating bone marrow-derived from mesenchymal stem cells

PubMed Central

Wang, Xiao; Zhang, Yong-Le; Zhang, Ya-Dong; Xue, Feng

2017-01-01

This study aims to explore the role of the SDF-1/CXCR4 axis in mediating BMSCs and SCI recovery. BMSCs were collected and SCI rat models were established. Wistar rats were assigned into the blank control, sham, SCI, SCI + BMSCs, SCI + BMSCs + SDF-1, SCI + BMSCs + AMD3100 (an inhibitor of SDF-1/CXCR4 axis) and SCI + BMSCs + SDF-1 + AMD3100 groups. Hind limb motor function was measured 7, 14, 21 and 28 days after operation. qRT-PCR, western blotting and ELISA was performed to determine the expressions of SDF-1, CXCR4, NGF, BDNF, GFAP and GAP-43, TNF-α, IL-1β, L-6 and IFN-γ. Hind limb motor function scores 7 days after the operation were reduced in the SCI rats of the blank control and sham groups. Hind limb function was found to be better in the SCI + BMSCs and SCI + BMSCs + SDF-1 groups than in the SCI, SCI + BMSCs + AMD3100 and SCI + BMSCs + SDF-1 + AMD3100 groups 14, 21 and 28 days after operation. Furthermore, the SCI group had lower SDF-1, CXCR4, NGF, BDNF and GAP-43 expressions but higher GFAP, TNF-α, IL-1β, IL-6 and IFN-γ than the blank control and sham groups 28 days after operation. While, the SCI + BMSCs, SCI + BMSCs + SDF-1 and SCI + BMSCs + SDF-1 + AMD3100 groups displayed opposite trends to the SCI and SCI + BMSCs + AMD3100 groups. In conclusion, SDF-1/CXCR4 axis promotes recovery after SCI by mediating BMSCs. PMID:28099928

Cryotherapy by encapsulation-dehydration is effective for in vitro eradication of latent viruses from ‘Marubakaido’ apple rootstock

USDA-ARS?s Scientific Manuscript database

Apple stem pitting virus (ASPV), Apple chlorotic leaf spot virus (ACLSV) and Apple stem grooving virus (ASGV) are several major viral pathogens of apple trees, responsible for substantial damage to the world's apple industry. This study aimed to evaluate the effectiveness of encapsulation-dehydratio...

Passive hind-limb cycling improves cardiac function and reduces cardiovascular disease risk in experimental spinal cord injury

PubMed Central

West, Christopher R; Crawford, Mark A; Poormasjedi-Meibod, Malihe-Sadat; Currie, Katharine D; Fallavollita, Andre; Yuen, Violet; McNeill, John H; Krassioukov, Andrei V

2014-01-01

Spinal cord injury (SCI) causes altered autonomic control and severe physical deconditioning that converge to drive maladaptive cardiac remodelling. We used a clinically relevant experimental model to investigate the cardio-metabolic responses to SCI and to establish whether passive hind-limb cycling elicits a cardio-protective effect. Initially, 21 male Wistar rats were evenly assigned to three groups: uninjured control (CON), T3 complete SCI (SCI) or T3 complete SCI plus passive hind-limb cycling (SCI-EX; 2 × 30 min day−1, 5 days week−1 for 4 weeks beginning 6 days post-SCI). On day 32, cardio-metabolic function was assessed using in vivo echocardiography, ex vivo working heart assessments, cardiac histology/molecular biology and blood lipid profiles. Twelve additional rats (n = 6 SCI and n = 6 SCI-EX) underwent in vivo echocardiography and basal haemodynamic assessments pre-SCI and at days 7, 14 and 32 post-SCI to track temporal cardiovascular changes. Compared with CON, SCI exhibited a rapid and sustained reduction in left ventricular dimensions and function that ultimately manifested as reduced contractility, increased myocardial collagen deposition and an up-regulation of transforming growth factor beta-1 (TGFβ1) and mothers against decapentaplegic homolog 3 (Smad3) mRNA. For SCI-EX, the initial reduction in left ventricular dimensions and function at day 7 post-SCI was completely reversed by day 32 post-SCI, and there were no differences in myocardial contractility between SCI-EX and CON. Collagen deposition was similar between SCI-EX and CON. TGFβ1 and Smad3 were down-regulated in SCI-EX. Blood lipid profiles were improved in SCI-EX versus SCI. We provide compelling novel evidence that passive hind-limb cycling prevents cardiac dysfunction and reduces cardiovascular disease risk in experimental SCI. PMID:24535438

Fate of Listeria monocytogenes in Fresh Apples and Caramel Apples.

PubMed

Salazar, Joelle K; Carstens, Christina K; Bathija, Vriddi M; Narula, Sartaj S; Parish, Mickey; Tortorello, Mary Lou

2016-05-01

An outbreak of listeriosis in late 2014 and early 2015 associated with caramel apples led to questions about how this product became a vector for Listeria monocytogenes. This investigation aimed to determine information about the survival and growth of L. monocytogenes in both fresh apples and caramel apples, specifically examining the effects of site and level of inoculation, inoculum drying conditions, and storage temperature. At a high inoculation level (7 log CFU per apple), L. monocytogenes inoculated at the stem end proliferated on Gala caramel apples at both 5 and 25°C and on Granny Smith caramel apples at 25°C by as much as 3 to 5 log CFU per apple. Fresh apples and caramel apples inoculated at the equatorial surface supported survival but not growth of the pathogen. Growth rates (μmax) for apples inoculated at the stem end, as determined using the Baranyi and Roberts growth model, were 1.64 ± 0.27 and 1.38 ± 0.20 log CFU per apple per day for Gala and Granny Smith caramel apples, respectively, stored at 25°C. At a low inoculation level (3 log CFU per apple), L. monocytogenes inoculated at the stem end and the equatorial surface survived but did not grow on fresh Gala and Granny Smith apples stored at 25°C for 49 days; however, on caramel apples inoculated at the stem end, L. monocytogenes had significant growth under the same conditions. Although certain conditions did not support growth, the pathogen was always detectable by enrichment culture. The inoculation procedure had a significant effect on results; when the inoculum was allowed to dry for 24 h at 5°C, growth was significantly slowed compared with inoculum allowed to dry for 2 h at 25°C. Variation in stick materials did affect L. monocytogenes survival, but these differences were diminished once sticks were placed into caramel apples.

The symbiotic fauna of the African termite Hodotermes mossambicus identification of four flagellate species of the genera Spironympha, Trichomonoides and Retortamonas.

PubMed

Brugerolle, Guy

2006-02-01

Two Spironympha species were described by light immunofluorescence and electron microscopy. Spironympha fibrosa n. sp. has a narrow columella, several axostylar fibres and original striated myoneme-like fibres attached to the last basal body of each flagellar line. Spironympha simplex n. sp. is small and has non-striated microfibrils attached to the basal body section and an axostyle composed of two fibres. Trichomonas termitidis, as reported by Dogiel (Researches on parasitic protozoa from the intestine of termites. II. Lophomonadidae. Sci Res Zool Exped Brit E Africa made by Prof. V. Dogiel and I. Sokolow in 1914 10:20-35, 1917), has the features of Trichomonoides trypanoides, as reported by Brugerolle and Bordereau (Eur J Protistol 40:163-174, 2004). Retortamonas hodotermitis n. sp. shares the characteristics of insect retortamonads, as reported by Brugerolle (Protistologica 8:233-240, 1976), but does not correspond to any species described to date. The species identification differs from that of described in Dogiel (Russkii Arkhiv Protistologii 1:172-234, 1922).

HiTEC: a connectionist model of the interaction between perception and action planning.

PubMed

Haazebroek, Pascal; Raffone, Antonino; Hommel, Bernhard

2017-11-01

Increasing evidence suggests that perception and action planning do not represent separable stages of a unidirectional processing sequence, but rather emerging properties of highly interactive processes. To capture these characteristics of the human cognitive system, we have developed a connectionist model of the interaction between perception and action planning: HiTEC, based on the Theory of Event Coding (Hommel et al. in Behav Brain Sci 24:849-937, 2001). The model is characterized by representations at multiple levels and by shared representations and processes. It complements available models of stimulus-response translation by providing a rationale for (1) how situation-specific meanings of motor actions emerge, (2) how and why some aspects of stimulus-response translation occur automatically and (3) how task demands modulate sensorimotor processing. The model is demonstrated to provide a unitary account and simulation of a number of key findings with multiple experimental paradigms on the interaction between perception and action such as the Simon effect, its inversion (Hommel in Psychol Res 55:270-279, 1993), and action-effect learning.

Globalisation and science education: the case of Sustainability by the Bay

NASA Astrophysics Data System (ADS)

Carter, Lyn; Dediwalage, Ranjith

2010-06-01

It is impossible to consider contemporary science education in isolation from globalisation as the dominant logic, rethinking and reconfiguring social and cultural life in which it is located. Carter (J Res Sci Teach 42, 561-580, 2005) calls for a close reading of policy documents, curriculum projects, research studies and a range of other science education texts using key concepts from globalisation theory to elucidate the ways in which globalisation shapes and is expressed within science education. In this paper, we consider an example from our own practice of a school-based curriculum project, Sustainable Living by the Bay, as one such instance. The first section reviews neoliberalism and neoconservativism necessary to understand how globalisation penetrates education, while the second outlines aspects of the curriculum project itself. As there were many different facets to the development and implementation of a project like Sustainable Living by the Bay, there is space only to elaborate two examples of the globalisation discourse. The first example concerns the government policy initiative that funded the project while the second example focuses on learner- centred pedagogies as globalisation's pedagogies of choice.

Spiritual Transcendence and Psychological Adjustment: The Moderating Role of Personality in Burn Patients.

PubMed

Jibeen, Tahira; Mahfooz, Musferah; Fatima, Shamem

2017-08-30

The current study examined the moderating role of personality traits (neuroticism and extraversion) on the relationship between spiritual transcendence and positive change, and spiritual transcendence and distress in burn patients. The sample (N = 98) comprised adult burn patients (age = 25-50) admitted to three hospitals in Lahore, Pakistan. They were assessed according to a demographic information sheet, the NEO Personality Inventory (McCrae and Costa in J Personal Soc Psychol 52:81-90, 1987), the Spiritual Transcendence Index (Seidlitz et al. in J Sci Study Relig 41:439-453, 2002), the Depression, Anxiety, Stress Scales-21 (Lovibond and Lovibond in Manual for the Depression Anxiety Stress scales, Psychology Foundation, Sydney, 1995), and the Perceived Benefit Scales (McMillen and Fisher in Soc Work Res 22(3):173-186, 1998). Stepwise moderated regression analysis showed that both personality traits (neuroticism and extraversion) played a moderating role in the relationship between spiritual transcendence and positive change, and spiritual transcendence and distress in burn patients. The findings highlight the potential role spiritual transcendence may have in understanding and improving the psychological adjustment of burn patients.

Apple Pomace as Potential Source of Natural Active Compounds.

PubMed

Waldbauer, Katharina; McKinnon, Ruxandra; Kopp, Brigitte

2017-08-01

Apple pomace is a waste product of the apple manufacturing industry that has been in the focus of life sciences as it represents a low-cost source of fruit-derived compounds. High fruit consumption is associated with beneficial health effects, and therefore, apple pomace and its constituents raise therapeutic interest. The present work reviews (i) the chemical constituents of apple pomace, (ii) optimized extraction methods of apple pomace compounds, and (iii) biological activities of apple pomace. Current evidence of apple pomace influence on digestion and metabolism, cholesterol and triglyceride homeostasis, diabetes, and sex hormones is summarized. Furthermore, studies regarding its antioxidative, anti-inflammatory, antiproliferative, antibacterial and antiviral effects are presented. The review concludes that apple pomace is an underutilized waste product of the apple industry with the potential of being processed for its nutritional and pharmaceutical value. Georg Thieme Verlag KG Stuttgart · New York.

Discrepancies between implicit and explicit self-concepts of intelligence: relations to modesty, narcissism, and achievement motivation

PubMed Central

Gerstenberg, Friederike X. R.; Imhoff, Roland; Banse, Rainer; Schmitt, Manfred

2014-01-01

Previous research has shown that different configurations of the implicit self-concept of intelligence (iSCI) and the explicit self-concept of intelligence (eSCI) are consistently related to individuals’ performance on different intelligence tests (Dislich etal., 2012). The results indicated that any discrepant configuration between the iSCI and the eSCI impairs performance. In the present study, how correspondence between the iSCI and the eSCI is related to intelligence test performance as well as personality traits of modesty (low eSCI, high iSCI), narcissism (high eSCI, low iSCI), and achievement motivation was investigated. Furthermore, a moderated mediation analysis showed that the relation between the iSCI–eSCI configurations and intelligence test performance was mediated by achievement motivation for modest individuals. PMID:24575063

Length of stay and medical stability for spinal cord-injured patients on admission to an inpatient rehabilitation hospital: a comparison between a model SCI trauma center and non-SCI trauma center.

PubMed

Ploumis, A; Kolli, S; Patrick, M; Owens, M; Beris, A; Marino, R J

2011-03-01

Retrospective database review. To compare lengths of stay (LOS), pressure ulcers and readmissions to the acute care hospital of patients admitted to the inpatient rehabilitation facility (IRF) from a model spinal cord injury (SCI) trauma center or from a non-SCI acute hospital. Only sparse data exist comparing the status of patients admitted to IRF from a model SCI trauma center or from a non-SCI acute hospital. Acute care, IRF and total LOS were compared between patients transferred to IRF from the SCI center (n=78) and from non-SCI centers (n=131). The percentages of pressure ulcers on admission to IRF and transfer back to acute care were also compared. Patients admitted to IRF from the SCI trauma center (SCI TC) had significantly shorter (P=0.01) acute care LOS and total LOS compared with patients admitted from non-SCI TCs. By neurological category, acute-care LOS was less for all groups admitted from the SCI center, but statistically significant only for tetraplegia. There was no significant difference in the incidence of readmissions to acute care from IRF. More patients from non-SCI centers (34%) than SCI centers (12%) had pressure ulcers (P<0.001). Acute care in organized SCI TCs before transfer to IRF can significantly lower acute-care LOS or total LOS and incidence of pressure ulcers compared with non-SCI TCs. Patients admitted to IRF from SCI TCs are no more likely to be sent back to an acute hospital than those from non-SCI TCs.

Is there a self-organization principle of river deltas?

NASA Astrophysics Data System (ADS)

Tejedor, Alejandro; Longjas, Anthony; Foufoula-Georgiou, Efi

2017-04-01

River deltas are known to possess a complex topological and flux-partitioning structure which has recently been quantified using spectral graph theory [Tejedor et al., 2015a,b]. By analysis of real and simulated deltas it has also been shown that there is promise in formalizing relationships between this topo-dynamic delta structure and the underlying delta forming processes [e.g., Tejedor et al., 2016]. The question we pose here is whether there exists a first order organizational principle behind the self-organization of river deltas and whether this principle can be unraveled from the co-evolving topo-dynamic structure encoded in the delta planform. To answer this question, we introduce a new metric, the nonlocal Entropy Rate (nER) that captures the information content of a delta network in terms of the degree of uncertainty in delivering fluxes from any point of the network to the shoreline. We hypothesize that if the "guiding principle" of undisturbed deltas is to efficiently and robustly build land by increasing the diversity of their flux pathways over the delta plane, then they would exhibit maximum nonlocal Entropy Rate at states at which geometry and flux dynamics are at equilibrium. At the same time, their nER would be non-optimal at transient states, such as before and after major avulsions during which topology and dynamics adjust to each other to reach a new equilibrium state. We will present our results for field and simulated deltas, which confirm this hypothesis and open up new ways of thinking about self-organization, complexity and robustness in river deltas. One particular connection of interest might have important implications since entropy rate and resilience are related by the fluctuation theorem [Demetrius and Manke, 2005], and therefore our results suggest that deltas might in fact self-organize to maximize their resilience to structural and dynamic perturbations. References: Tejedor, A., A. Longjas, I. Zaliapin, and E. Foufoula­-Georgiou (2015), Water Resour. Res., 51, 3998-4018. Tejedor, A., A. Longjas, I. Zaliapin, and E. Foufoula-­Georgiou (2015), Water Resour. Res., 51, 4019-4045. Tejedor, A., A. Longjas, R. Caldwell, D. A. Edmonds, I. Zaliapin, and E. Foufoula­-Georgiou (2016), Geophys. Res. Lett., 43, 3280-3287. Demetrius, L., and T. Manke (2005), Phys. A Stat. Mech. Appl., 346, 682-696.

Fate of Listeria monocytogenes on Fresh Apples under Different Storage Temperatures.

PubMed

Sheng, Lina; Edwards, Katheryn; Tsai, Hsieh-Chin; Hanrahan, Ines; Zhu, Mei-Jun

2017-01-01

Fresh apples are typically stored for up to 1 year commercially; different apple varieties require different storage temperatures to maintain their quality characteristics. There is sparse information available about Listeria monocytogenes survival on fresh apples under various storage temperatures. The objective of this study was to comprehensively evaluate the effect of storage temperature on apple fruit decay and L. monocytogenes survival. Unwaxed apple fruits of selected varieties (Fuji and Granny Smith) were dip inoculated in a three-strain L. monocytogenes cocktail to establish ∼3.5 and 6.0 Log 10 CFU/apple. Twenty-four hours post-inoculation, apples were subjected to 1, 4, 10, or 22°C storage for up to 3 months. Apples under the different storage treatments were sampled at 1-, 4-, 7- and 14-day for short-term storage under all four tested temperatures, and 2-, 4-, 8-, and 12-week for long-term storage at 1, 4, and 10°C. A set of uninoculated and unwaxed apples were simultaneously subjected to the previously mentioned storage temperatures and sampled biweekly for their total bacterial count (TPC) and yeasts/molds (Y/M) count. During the 2-week short-term storage, L. monocytogenes population on organic Granny Smith apples stored at 1, 4, or 10°C was reduced by 0.2-0.3 Log. When apples were stored at 22°C, there was a 0.5-1.2 Log 10 CFU/apple reduction 14-day post storage dependent on the initial inoculation level. During the 12-week cold storage under 1, 4, and 10°C, L. monocytogenes count on organic Granny Smith apples decreased by 0.5-1.5 Log 10 CFU/apple for both inoculation levels. L. monocytogenes had similar survival pattern on conventional Granny Smith and Fuji apples with 0.8-2.0 Log 10 CFU/apple reduction over a 3-month cold storage period. Interestingly, both TPC and Y/M count were stable regardless of apple variety or cultivation practice during the 12-week storage at all tested temperatures. In summary, while L. monocytogenes did not proliferate on apple surfaces during 12 weeks of refrigerated storage, only a limited reduction of L. monocytogenes was observed in this study. Therefore, the apple industry cannot rely on cold storage alone to control this pathogen. Additional interventions are needed to eradicate Listeria on fresh apples during long-term cold storage.

Consumption of apples is associated with a better diet quality and reduced risk of obesity in children: National Health and Nutrition Examination Survey (NHANES) 2003-2010

USDA-ARS?s Scientific Manuscript database

Most children do not meet the recommendation for fruit consumption. Apples are the second most commonly consumed fruit in the US; however, no studies have examined the association of total apple products, apples, apple sauce, and 100 % apple juice consumption on diet quality and weight/adiposity in ...

High Temperature, Controlled-Atmosphere Aerodynamic Levitation Experiments with Applications in Planetary Science

NASA Astrophysics Data System (ADS)

Macris, C. A.; Badro, J.; Eiler, J. M.; Stolper, E. M.

2016-12-01

The aerodynamic levitation laser apparatus is an instrument in which spherical samples are freely floated on top of a stream of gas while being heated with a CO2laser to temperatures up to about 3500 °C. Laser heated samples, ranging in size from 0.5 to 3.5 mm diameter, can be levitated in a variety of chemically active or inert atmospheres in a gas-mixing chamber (e.g., Hennet et al. 2006; Pack et al. 2010). This allows for containerless, controlled-atmosphere, high temperature experiments with potential for applications in earth and planetary science. A relatively new technique, aerodynamic levitation has been used mostly for studies of the physical properties of liquids at high temperatures (Kohara et al. 2011), crystallization behavior of silicates and oxides (Arai et al. 2004), and to prepare glasses from compositions known to crystallize upon quenching (Tangeman et al. 2001). More recently, however, aerodynamic levitation with laser heating has been used as an experimental technique to simulate planetary processes. Pack et al. (2010) used levitation and melting experiments to simulate chondrule formation by using Ar-H2 as the flow gas, thus imposing a reducing atmosphere, resulting in reduction of FeO, Fe2O3, and NiO to metal alloys. Macris et al. (2015) used laser heating with aerodynamic levitation to reproduce the textures and diffusion profiles of major and minor elements observed in impact ejecta from the Australasian strewn field, by melting a powdered natural tektite mixed with 60-100 μm quartz grains on a flow of pure Ar gas. These experiments resulted in quantitative modeling of Si and Al diffusion, which allowed for interpretations regarding the thermal histories of natural tektites and their interactions with the surrounding impact vapor plume. Future experiments will employ gas mixing (CO, CO2, H2, O, Ar) in a controlled atmosphere levitation chamber to explore the range of fO2applicable to melt-forming impacts on other rocky planetary bodies, including the Moon and Mars. Arai et al., Rev. Sci. Instrum. 75, 2262-2265 (2004) Hennet et al., Rev. Sci. Instrum. 73, 124-129 (2001) Kohara et al., P. Natl. Acad. Sci.USA 108, 14780-14785 (2011) Macris et al., GSA Abstracts with Programs 47, 437 (2015) Pack et al., Geochem. T. 11, 1-16 (2010) Tangeman et al., Geophys. Res. Lett. 28, 2517-2520 (2001)

Homozygous Expression of Mutant ELOVL4 Leads to Seizures and Death in a Novel Animal Model of Very Long-Chain Fatty Acid Deficiency.

PubMed

Hopiavuori, Blake R; Deák, Ferenc; Wilkerson, Joseph L; Brush, Richard S; Rocha-Hopiavuori, Nicole A; Hopiavuori, Austin R; Ozan, Kathryn G; Sullivan, Michael T; Wren, Jonathan D; Georgescu, Constantin; Szweda, Luke; Awasthi, Vibhudutta; Towner, Rheal; Sherry, David M; Anderson, Robert E; Agbaga, Martin-Paul

2018-02-01

Lipids are essential components of the nervous system. However, the functions of very long-chain fatty acids (VLC-FA; ≥ 28 carbons) in the brain are unknown. The enzyme ELOngation of Very Long-chain fatty acids-4 (ELOVL4) catalyzes the rate-limiting step in the biosynthesis of VLC-FA (Agbaga et al., Proc Natl Acad Sci USA 105(35): 12843-12848, 2008; Logan et al., J Lipid Res 55(4): 698-708, 2014), which we identified in the brain as saturated fatty acids (VLC-SFA). Homozygous mutations in ELOVL4 cause severe neuropathology in humans (Ozaki et al., JAMA Neurol 72(7): 797-805, 2015; Mir et al., BMC Med Genet 15: 25, 2014; Cadieux-Dion et al., JAMA Neurol 71(4): 470-475, 2014; Bourassa et al., JAMA Neurol 72(8): 942-943, 2015; Aldahmesh et al., Am J Hum Genet 89(6): 745-750, 2011) and are post-natal lethal in mice (Cameron et al., Int J Biol Sci 3(2): 111-119, 2007; Li et al., Int J Biol Sci 3(2): 120-128, 2007; McMahon et al., Molecular Vision 13: 258-272, 2007; Vasireddy et al., Hum Mol Genet 16(5): 471-482, 2007) from dehydration due to loss of VLC-SFA that comprise the skin permeability barrier. Double transgenic mice with homozygous knock-in of the Stargardt-like macular dystrophy (STDG3; 797-801_AACTT) mutation of Elovl4 with skin-specific rescue of wild-type Elovl4 expression (S + Elovl4 mut/mut mice) develop seizures by P19 and die by P21. Electrophysiological analyses of hippocampal slices showed aberrant epileptogenic activity in S + Elovl4 mut/mut mice. FM1-43 dye release studies showed that synapses made by cultured hippocampal neurons from S + Elovl4 mut/mut mice exhibited accelerated synaptic release kinetics. Supplementation of VLC-SFA to cultured hippocampal neurons from mutant mice rescued defective synaptic release to wild-type rates. Together, these studies establish a critical, novel role for ELOVL4 and its VLC-SFA products in regulating synaptic release kinetics and epileptogenesis. Future studies aimed at understanding the molecular mechanisms by which VLC-SFA regulate synaptic function may provide new targets for improved seizure therapies.

Reduced representation genome sequencing reveals patterns of genetic diversity and selection in apple.

PubMed

Ma, Baiquan; Liao, Liao; Peng, Qian; Fang, Ting; Zhou, Hui; Korban, Schuyler S; Han, Yuepeng

2017-03-01

Identifying DNA sequence variations is a fundamental step towards deciphering the genetic basis of traits of interest. Here, a total of 20 cultivated and 10 wild apples were genotyped using specific-locus amplified fragment sequencing, and 39,635 single nucleotide polymorphisms with no missing genotypes and evenly distributed along the genome were selected to investigate patterns of genome-wide genetic variations between cultivated and wild apples. Overall, wild apples displayed higher levels of genetic diversity than cultivated apples. Linkage disequilibrium (LD) decays were observed quite rapidly in cultivated and wild apples, with an r 2 -value below 0.2 at 440 and 280 bp, respectively. Moreover, bidirectional gene flow and different distribution patterns of LD blocks were detected between domesticated and wild apples. Most LD blocks unique to cultivated apples were located within QTL regions controlling fruit quality, thus suggesting that fruit quality had probably undergone selection during apple domestication. The genome of the earliest cultivated apple in China, Nai, was highly similar to that of Malus sieversii, and contained a small portion of genetic material from other wild apple species. This suggested that introgression could have been an important driving force during initial domestication of apple. These findings will facilitate future breeding and genetic dissection of complex traits in apple. © 2017 Institute of Botany, Chinese Academy of Sciences.

Appl1 Is Dispensable for Mouse Development, and Loss of Appl1 Has Growth Factor-selective Effects on Akt Signaling in Murine Embryonic Fibroblasts*

PubMed Central

Tan, Yinfei; You, Huihong; Wu, Chao; Altomare, Deborah A.; Testa, Joseph R.

2010-01-01

The adaptor protein APPL1 (adaptor protein containing pleckstrin homology (PH), phosphotyrosine binding (PTB), and leucine zipper motifs) was first identified as a binding protein of AKT2 by yeast two-hybrid screening. APPL1 was subsequently found to bind to several membrane-bound receptors and was implicated in their signal transduction through AKT and/or MAPK pathways. To determine the unambiguous role of Appl1 in vivo, we generated Appl1 knock-out mice. Here we report that Appl1 knock-out mice are viable and fertile. Appl1-null mice were born at expected Mendelian ratios, without obvious phenotypic abnormalities. Moreover, Akt activity in various fetal tissues was unchanged compared with that observed in wild-type littermates. Studies of isolated Appl1−/− murine embryonic fibroblasts (MEFs) showed that Akt activation by epidermal growth factor, insulin, or fetal bovine serum was similar to that observed in wild-type MEFs, although Akt activation by HGF was diminished in Appl1−/− MEFs. To rule out a possible redundant role played by the related Appl2, we used small interfering RNA to knock down Appl2 expression in Appl1−/− MEFs. Unexpectedly, cell survival was unaffected under normal culture conditions, and activation of Akt was unaltered following epidermal growth factor stimulation, although Akt activity did decrease further after HGF stimulation. Furthermore, we found that Appl proteins are required for HGF-induced cell survival and migration via activation of Akt. Our studies suggest that Appl1 is dispensable for development and only participate in Akt signaling under certain conditions. PMID:20040596

Patulin and patulin producing Penicillium spp. occurrence in apples and apple-based products including baby food.

PubMed

Hammami, Walid; Al-Thani, Roda; Fiori, Stefano; Al-Meer, Saeed; Atia, Fathy Atia; Rabah, Duha; Migheli, Quirico; Jaoua, Samir

2017-04-30

Patulin has raised the international attention because of its health risk. In fact, it has mutagenic, neurotoxic, immunotoxic, genotoxic and gastrointestinal effects in animals. In the present work, patulin and patulin-producing Penicillium spp. in apple and apple-based products marketed in Qatar were analysed. Sampling was carried out using apple fruits and apple-based products. Fungi were isolated from undamaged apples, apple juice and baby apple food. DNA extraction was carried out with DNeasy Plant Mini Kit (QIAGEN, Valencia, USA). The molecular identification of fungal isolates was carried out using ITS1-ITS4 PCR. PCR products were sequenced and blasted. Patulin was extracted and analyzed by LC/MS/MS, then quantified using Agilent 1290UHPLC coupled to 6460 triple quadruple mass spectrometer. Forty-five samples of undamaged fresh apple fruits, apple juice and apple-based baby food products sold in different markets in Qatar were surveyed for both fungal and patulin contamination using Liquid Chromatography Tandem Mass Spectrometery (LC/MS/MS). Twenty-five Penicillium spp. isolates were selected, including 23 P. expansum and one isolate each of P. brevicompactum and P. commune. All the tested Penicillium spp. isolates produced patulin in vitro (from 40 to 100 μg/g on Malt Yeast Extract agar medium). Patulin was detected in 100% of apple juice samples at levels ranging from 5.27 to 82.21 µg/kg. Only 5 samples contained patulin levels higher than European Union recommended limit (50 µg/kg). The average patulin contamination was 30.67 µg/kg and 10.92 µg/kg in baby apple juice and in baby apple compote, respectively.

The Implementation Challenge and the Learning Health System for SCI Initiative.

PubMed

Stucki, Gerold; Bickenbach, Jerome

2017-02-01

The paper introduces the special issue by linking the International Spinal Cord Injury (InSCI) Community Survey study to the Learning Health System for SCI Initiative (LHS-SCI). The LHS-SCI was designed to respond to the implementation challenge of bringing about policy reform in light of the targeted policy recommendations of World Health Organization's International Perspectives on SCI report as well as the call for action of WHO's Global Disability Action Plan. The paper reviews the components of LHS-SCI relevant to internationally comparable information, a theory of change to guide for action, and the tools for evidence-informed policy. The interplay between persons, their health needs, and the societal response to those needs provides the foundation for the organization of the LHS-SCI Initiative. Moreover, as the other articles in this special issue describe in detail, the rationale, conceptualization, and study design of the InSCI study are also informed by the rationale, and mission, of the LHS for SCI Initiative. The LHS-SCI, and the implementation challenge that motivates it, is responsible for the design of the InSCI study and the overall mission of LHS-SCI to continuously improve the lived experience of people living with SCI around the world through an international evidence- and rights-informed research and policy reform effort.

Association between apple consumption and physician visits: appealing the conventional wisdom that an apple a day keeps the doctor away.

PubMed

Davis, Matthew A; Bynum, Julie P W; Sirovich, Brenda E

2015-05-01

Fruit consumption is believed to have beneficial health effects, and some claim, "An apple a day keeps the doctor away." To examine the relationship between eating an apple a day and keeping the doctor away. A cross-sectional study of a nationally representative sample of the noninstitutionalized US adult population. A total of 8728 adults 18 years and older from the 2007-2008 and 2009-2010 National Health and Nutrition Examination Survey completed a 24-hour dietary recall questionnaire and reported that the quantity of food they ate was reflective of their usual daily diet. Daily apple eaters (consuming the equivalent of at least 1 small apple daily, or 149 g of raw apple) vs non-apple eaters, based on the reported quantity of whole apple consumed during the 24-hour dietary recall period. The primary outcome measure was success at "keeping the doctor away," measured as no more than 1 visit (self-reported) to a physician during the past year; secondary outcomes included successful avoidance of other health care services (ie, no overnight hospital stays, visits to a mental health professional, or prescription medications). Of 8399 eligible study participants who completed the dietary recall questionnaire, we identified 753 adult apple eaters (9.0%)--those who typically consume at least 1 small apple per day. Compared with the 7646 non-apple eaters (91.0%), apple eaters had higher educational attainment, were more likely to be from a racial or ethnic minority, and were less likely to smoke (P<.001 for each comparison). Apple eaters were more likely, in the crude analysis, to keep the doctor (and prescription medications) away: 39.0% of apple eaters avoided physician visits vs 33.9% of non-apple eaters (P=.03). After adjusting for sociodemographic and health-related characteristics, however, the association was no longer statistically significant (OR, 1.19; 95% CI, 0.93-1.53; P=.15). In the adjusted analysis, apple eaters also remained marginally more successful at avoiding prescription medications (odds ratio, 1.27; 95% CI, 1.00-1.63). There were no differences seen in overnight hospital stay or mental health visits. Evidence does not support that an apple a day keeps the doctor away; however, the small fraction of US adults who eat an apple a day do appear to use fewer prescription medications.

Slow softening of Kanzi apples (Malus×domestica L.) is associated with preservation of pectin integrity in middle lamella.

PubMed

Gwanpua, Sunny George; Verlinden, Bert E; Hertog, Maarten L A T M; Nicolai, Bart M; Hendrickx, Marc; Geeraerd, Annemie

2016-11-15

Kanzi is a recently developed apple cultivar that has an extremely low ethylene production, and maintains its crispiness during ripening. To identify key determinants of the slow softening behaviour of Kanzi apples, a comparative analysis of pectin biochemistry and tissue fracture pattern during different ripening stages of Kanzi apples was performed against Golden Delicious, a rapid softening cultivar. While substantial pectin depolymerisation and solubilisation was observed during softening in Golden Delicious apples, no depolymerisation or increased solubilisation was observed in Kanzi apples. Moreover, tissue failure during ripening was mainly by cell breakage in Kanzi apples and, in contrast, by cell separation in Golden Delicious apples. Kanzi apples had lower activity of beta-galactosidase, with no decline in the extent of branching of the pectin chain. A sudden decrease in firmness observed during senescence in Kanzi apples was not due to middle lamella dissolution, as tissue failure still occurred by cell breakage. Copyright © 2016 Elsevier Ltd. All rights reserved.

Phylogenetic analysis of 47 chloroplast genomes clarifies the contribution of wild species to the domesticated apple maternal line.

PubMed

Nikiforova, Svetlana V; Cavalieri, Duccio; Velasco, Riccardo; Goremykin, Vadim

2013-08-01

Both the origin of domesticated apple and the overall phylogeny of the genus Malus are still not completely resolved. Having this as a target, we built a 134,553-position-long alignment including two previously published chloroplast DNAs (cpDNAs) and 45 de novo sequenced, fully colinear chloroplast genomes from cultivated apple varieties and wild apple species. The data produced are free from compositional heterogeneity and from substitutional saturation, which can adversely affect phylogeny reconstruction. Phylogenetic analyses based on this alignment recovered a branch, having the maximum bootstrap support, subtending a large group of the cultivated apple sorts together with all analyzed European wild apple (Malus sylvestris) accessions. One apple cultivar was embedded in a monophylum comprising wild M. sieversii accessions and other Asian apple species. The data demonstrate that M. sylvestris has contributed chloroplast genome to a substantial fraction of domesticated apple varieties, supporting the conclusion that different wild species should have contributed the organelle and nuclear genomes to the domesticated apple.

Apple phytochemicals and their health benefits

PubMed Central

Boyer, Jeanelle; Liu, Rui Hai

2004-01-01

Evidence suggests that a diet high in fruits and vegetables may decrease the risk of chronic diseases, such as cardiovascular disease and cancer, and phytochemicals including phenolics, flavonoids and carotenoids from fruits and vegetables may play a key role in reducing chronic disease risk. Apples are a widely consumed, rich source of phytochemicals, and epidemiological studies have linked the consumption of apples with reduced risk of some cancers, cardiovascular disease, asthma, and diabetes. In the laboratory, apples have been found to have very strong antioxidant activity, inhibit cancer cell proliferation, decrease lipid oxidation, and lower cholesterol. Apples contain a variety of phytochemicals, including quercetin, catechin, phloridzin and chlorogenic acid, all of which are strong antioxidants. The phytochemical composition of apples varies greatly between different varieties of apples, and there are also small changes in phytochemicals during the maturation and ripening of the fruit. Storage has little to no effect on apple phytochemicals, but processing can greatly affect apple phytochemicals. While extensive research exists, a literature review of the health benefits of apples and their phytochemicals has not been compiled to summarize this work. The purpose of this paper is to review the most recent literature regarding the health benefits of apples and their phytochemicals, phytochemical bioavailability and antioxidant behavior, and the effects of variety, ripening, storage and processing on apple phytochemicals. PMID:15140261

Lightning impact on micro-second long ionospheric variability

NASA Astrophysics Data System (ADS)

Koh, Kuang Liang; Liu, Zhongjian; Fullekrug, Martin

2017-04-01

Lightning discharges cause electron heating and enhanced ionisation in the D region ionosphere which disturb the transmission of VLF communications [Inan et al., 2010]. A disturbance of such nature was measured in a VLF transmission with a sampling rate of 1 MHz, enabling much faster ionospheric variability to be observed when compared to previous studies which typically report results with a time resolution >5-20ms. The disturbance resembles "Long Recovery Early VLF" (LORE) events [Haldoupis et al. 2013, Cotts & Inan 2007]. LOREs exhibit observable ionospheric effects that last longer (>200s) than other lightning related disturbances. It was proposed that the mechanism behind the long-lasting effects of LOREs is different to shorter events [Gordillo-Vázquez et al. 2016]. The ionospheric variability inferred from the transmitted signal is seen to change dramatically after the lightning onset, suggesting that there are fast processes in the ionosphere affected or produced which have not been considered in previous research. The ionospheric variability inferred from the main two frequencies of the transmission is different. A possible explanation is a difference in the propagation paths of the two main frequencies of the transmission [Füllekrug et al., 2015]. References Inan, U.S., Cummer, S.A., Marshall, R.A., 2010. A survey of ELF and VLF research on lightning-ionosphere interactions and causative discharges. J. Geophys. Res. 115, A00E36. doi:10.1029/2009JA014775 Cotts, B.R.T., Inan, U.S., 2007. VLF observation of long ionospheric recovery events. Geophys. Res. Lett. 34, L14809. doi:10.1029/2007GL030094 Haldoupis, C., Cohen, M., Arnone, E., Cotts, B., Dietrich, S., 2013. The VLF fingerprint of elves: Step-like and long-recovery early VLF perturbations caused by powerful ±CG lightning EM pulses. J. Geophys. Res. Space Physics 118, 5392-5402. doi:10.1002/jgra.50489 Gordillo-Vázquez, F.J., Luque, A., Haldoupis, C., 2016. Upper D region chemical kinetic modeling of LORE relaxation times: KINETIC MODEL OF LORE RELAXATION TIMES. Journal of Geophysical Research: Space Physics 121, 3525-3544. doi:10.1002/2015JA021408 Füllekrug, M., Smith, N., Mezentsev, A., Watson, R., Astin, I., Gaffet, S., Evans, A., Rycroft, M., 2015. Multipath propagation of low-frequency radio waves inferred from high-resolution array analysis. Radio Sci. 50, 2015RS005781. doi:10.1002/2015RS005781

A post-Tohoku earthquake review of earthquake probabilities in the Southern Kanto District, Japan

NASA Astrophysics Data System (ADS)

Somerville, Paul G.

2014-12-01

The 2011 Mw 9.0 Tohoku earthquake generated an aftershock sequence that affected a large part of northern Honshu, and has given rise to widely divergent forecasts of changes in earthquake occurrence probabilities in northern Honshu. The objective of this review is to assess these forecasts as they relate to potential changes in the occurrence probabilities of damaging earthquakes in the Kanto Region. It is generally agreed that the 2011 Mw 9.0 Tohoku earthquake increased the stress on faults in the southern Kanto district. Toda and Stein (Geophys Res Lett 686, 40: doi:10.1002, 2013) further conclude that the probability of earthquakes in the Kanto Corridor has increased by a factor of 2.5 for the time period 11 March 2013 to 10 March 2018 in the Kanto Corridor. Estimates of earthquake probabilities in a wider region of the Southern Kanto District by Nanjo et al. (Geophys J Int, doi:10.1093, 2013) indicate that any increase in the probability of earthquakes is insignificant in this larger region. Uchida et al. (Earth Planet Sci Lett 374: 81-91, 2013) conclude that the Philippine Sea plate the extends well north of the northern margin of Tokyo Bay, inconsistent with the Kanto Fragment hypothesis of Toda et al. (Nat Geosci, 1:1-6,2008), which attributes deep earthquakes in this region, which they term the Kanto Corridor, to a broken fragment of the Pacific plate. The results of Uchida and Matsuzawa (J Geophys Res 115:B07309, 2013)support the conclusion that fault creep in southern Kanto may be slowly relaxing the stress increase caused by the Tohoku earthquake without causing more large earthquakes. Stress transfer calculations indicate a large stress transfer to the Off Boso Segment as a result of the 2011 Tohoku earthquake. However, Ozawa et al. (J Geophys Res 117:B07404, 2012) used onshore GPS measurements to infer large post-Tohoku creep on the plate interface in the Off-Boso region, and Uchida and Matsuzawa (ibid.) measured similar large creep off the Boso Peninsula. Thus some of the large stress transfer may be undergoing aseismic release, consistent with pre-Tohoku geodetic data, so a large earthquake on the Off Boso segment may have a low probability.

Impact of convective activity on precipitation δ18O in isotope-enabled models

NASA Astrophysics Data System (ADS)

Hu, J.; Emile-Geay, J.; Dee, S.

2017-12-01

The ^18O signal preserved in paleo-archives (e.g. speleothem, tree ring cellulose, ice cores) is widely used to reconstruct precipitation or temperature. In the tropics, the inverse relationship between precipitation ^18O and rainfall amount, namely "amount effect" [Dansgaard, Tellus, 1964], is often used to interpret precipitation ^18O. However, recent studies have shown that precipitation ^18O is also influenced by precipitation type [Kurita et al, JGR, 2009; Moerman et al, EPSL, 2013], and recent observations indicate that it is negatively correlated with the fraction of precipitation associated with stratiform clouds [Aggarwal et al, Nature Geosci, 2016]. It is thus important to determine to what extent isotope-enabled climate models can reproduce these relationships. Here we do so using output from LMDZ, CAM2, and isoGSM from the Stable Water Isotope Intercomparison Group, Phase 2 (SWING2) project and results of SPEEDY-IER [Dee et al, JGR, 2015] from an AMIP-style experiment. The results show that these models simulate the "amount effect" well in the tropics, and the relationship between precipitation ^18O and precipitation is reversed in many places in mid-latitudes, in accordance with observations [Bowen, JGR, 2008]. Also, these models can all reproduce the negative correlation between monthly precipitation ^18O and stratiform precipitation proportion in mid-latitude (30°N-50°N; 50°S-30°S), but in the tropics (30°S-30°N), models show a positive correlation instead. The reason for this bias will be investigated within idealized experiments with SPEEDY-IER. The correct simulations of the impact of convective activity on precipitation ^18O in isotope-enabled models will improve our interpretation of paleoclimate proxies with respect to hydroclimate variability. P. K. Aggarwal et al. (2016), Nature Geosci., 9, 624-629, doi:10.1038/ngeo2739. G. J. Bowen. (2008), J. Geophys. Res., 113, D05113, doi:10.1029/2007JD009295. W. Dansgaard (1964), Tellus, 16(4), 436-468. S. Dee et al. (2015), J. Geophys. Res. Atmos., 120, 73-91, doi:10.1002/2014JD022194. N. Kurita. (2013), J. Geophys. Res. Atmos. 118, 10,376-10,390, doi:10.1002/jgrd.50754. J. W. Moerman et al. (2013), Earth Planet. Sci. Lett., 369, 108-119.

Adaptor protein containing PH domain, PTB domain and leucine zipper (APPL1) regulates the protein level of EGFR by modulating its trafficking

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, Jae-Rin; Hahn, Hwa-Sun; Kim, Young-Hoon

2011-11-11

Highlights: Black-Right-Pointing-Pointer APPL1 regulates the protein level of EGFR in response to EGF stimulation. Black-Right-Pointing-Pointer Depletion of APPL1 accelerates the movement of EGF/EGFR from the cell surface to the perinuclear region in response to EGF. Black-Right-Pointing-Pointer Knockdown of APPL1 enhances the activity of Rab5. -- Abstract: The EGFR-mediated signaling pathway regulates multiple biological processes such as cell proliferation, survival and differentiation. Previously APPL1 (adaptor protein containing PH domain, PTB domain and leucine zipper 1) has been reported to function as a downstream effector of EGF-initiated signaling. Here we demonstrate that APPL1 regulates EGFR protein levels in response to EGF stimulation.more » Overexpression of APPL1 enhances EGFR stabilization while APPL1 depletion by siRNA reduces EGFR protein levels. APPL1 depletion accelerates EGFR internalization and movement of EGF/EGFR from cell surface to the perinuclear region in response to EGF treatment. Conversely, overexpression of APPL1 decelerates EGFR internalization and translocation of EGF/EGFR to the perinuclear region. Furthermore, APPL1 depletion enhances the activity of Rab5 which is involved in internalization and trafficking of EGFR and inhibition of Rab5 in APPL1-depleted cells restored EGFR levels. Consistently, APPL1 depletion reduced activation of Akt, the downstream signaling effector of EGFR and this is restored by inhibition of Rab5. These findings suggest that APPL1 is required for EGFR signaling by regulation of EGFR stabilities through inhibition of Rab5.« less

Consumption of apples is associated with a better diet quality and reduced risk of obesity in children: National Health and Nutrition Examination Survey (NHANES) 2003-2010.

PubMed

O'Neil, Carol E; Nicklas, Theresa A; Fulgoni, Victor L

2015-05-14

Most children do not meet the recommendation for fruit consumption. Apples are the second most commonly consumed fruit in the US; however, no studies have examined the association of total apple products, apples, apple sauce, and 100 % apple juice consumption on diet quality and weight/adiposity in children. The purpose of this study was to examine the association between various apple consumption forms with diet quality and weight/adiposity in a nationally representative sample of children. Participants were children 2-18 years of age (N = 13,339) from the National Health and Nutrition Examination Survey 2003-2010. Intake was determined using a single interview administered 24-h diet recall. Apple product consumption was determined using the cycle-appropriate USDA Food and Nutrient Database for Dietary Studies food codes. Total diet quality and component scores were determined using the Healthy Eating Index-2010 (HEI). Anthropometrics were determined using standard methods. Covariate adjusted linear and logistic regressions were used to compare apple product consumers with non-consumers; sample weights were used. Probability was set at <0.01. Approximately 26 % of the population (n = 3,482) consumed some form of apple products. Consumers of apple products, whole apples, apple sauce, and 100 % apple juice had higher HEI scores than non-consumers: 50.4 ± 0.4 v 41.9 ± 0.3, 52.5 ± 0.5 v 42.7 ± 0.3, 52.1 ± 0.8 v 47.2 ± 0.4, and 51.4 ± 0.6 v 46.5 ± 0.4, respectively. Apple products and whole apple consumers had lower BMI z-scores than non-consumers: 0.4 ± 0.04 v 0.5 ± 0.03 and 0.3 ± 0.1 v 0.5 ± 0.02, respectively. Apple products and whole apple consumers were 25 % (0.59-0.95 99(th) CI) and 30 % (0.52-0.95 99(th) CI), respectively, were less likely to be obese than non-consumers. Consumption of any form of apples contributed to the fruit recommendation of children and improved diet quality. Apples should be included in the diets of children as a component of an overall healthy diet.

Vertical velocity-CCN correlations

NASA Astrophysics Data System (ADS)

Hudson, J. G.; Noble, S. R.

2013-12-01

The realization that smaller cloud droplets evaporate more readily (Xue and Feingold 2006; Jiang et al. 2002) gives rise to an anti-indirect aerosol effect (IAE); less cloudiness with pollution. The greater latent heat exchange of the greater evaporation in more polluted clouds adds TKE and buoyancy gradients that can enhance vertical velocity (W), mixing and entrainment (Zhao and Austin 2005). Stronger W can increase horizontal motions, which can further enhance droplet evaporation, which further enhances latent heat exchange and vertical motions, thus, positive feedback. This could also include latent heat released during condensation (Lee and Feingold 2010), which is more rapid for the greater surface areas of the smaller more numerous droplets. These theories imply a positive relationship between within-cloud W variations; i.e., standard deviation of W (σw) and CCN concentration (NCCN) rather than W and NCCN. This implies greater turbulence in polluted clouds, which could possibly counteract the reduction of cloudiness of anti-IAE. During two stratus cloud projects, 50 cloud penetrations in 9 MASE flights and 34 cloud penetrations in 13 POST flights, within-cloud σw-NCCN showed correlation coefficients (R) of 0.50 and 0.39. Panel a shows similar within-cloud σw-NCCN R in all altitude bands for 17 RICO flights in small cumulus clouds. R for W-NCCN showed similar values but only at low altitudes. Out-of-cloud σw-NCCN showed similar high values except at the highest altitudes. Within-cloud σw showed higher R than within-cloud W with droplet concentrations (Nc), especially at higher altitudes. Panel b for 13 ICE-T cumulus cloud flights in the same location as RICO but during the opposite season, however, showed σw and W uncorrelated with NCCN at all altitudes; and W and σw correlated with Nc only at the highest altitudes. On the other hand, out-of-cloud σw was correlated with NCCN at all altitudes with R similar to the corresponding R of the other projects. Overall these results are consistent with the theories noted above. Supported by NSF AGS-1035230 and DOE SC0009162. Jiang, H., G. Feingold, and W.R. Cotton, 2002: J. Geophys. Res, 107, D24, 4813. Lee, S.-S., and G. Feingold, 2010: Geophys. Res. Lett., 37, L23806. Xue, H., and G. Feingold, 2006: J. Atmos. Sci., 63, 1605-1622. Zhao, M., and P.H. Austin, 2005: J. Atmos. Sci., 62, 1291-1310. Fig. Correlation coefficients (R) between mean and standard deviations of vertical velocity (W; σw within and outside of clouds) with CCN concentrations at 1% supersaturation (N1%) measured below the clouds and with droplet concentrations (Nc) within various altitude bands.

Mars Exploration Rover Landing Site Hectometer Slopes

NASA Astrophysics Data System (ADS)

Haldemann, A. F.; Anderson, F. S.

2002-12-01

The Mars Exploration Rover (MER) airbag landing system imposes a maximum slope of 5 degrees over 100 m length-scales. This limit avoids dangerous changes in elevation over the horizontal travel distance of the lander on its parachute between the time of the last radar altimeter detection of the surface and the time the retro-rockets fire and the bridle to the airbags is cut. Stereo imagery from the MGS MOC can provide information at this length scale, but MOC stereo coverage is sparse, even when targeted to MER landing sites. Additionally, MGS spacecraft stability issues affect the DEMs at precisely the hectometric length-scale1. The MOLA instrument provides global coverage pulse-width measurements2 over a single MOLA-pulse footprint, which is about 100 m in diameter. However, the pulse spread only provides an upper bound on the 100 m slope. We chose another approach. We sample the inter-pulse root-mean-square (RMS) height deviations for MOLA track segments restricted to pixels of 0.1 deg latitude by 0.1 deg longitude. Then, under the assumption of self-affine topography, we determine the scale-dependence of the RMS deviations and extrapolate that behavior over the range of 300 m to 1.2 km downward to the 100 m scale. Shepard et al.3 clearly summarize the statistical properties of the RMS deviation (noting that it also goes by the name structure function, variogram or Allan deviation), and we follow their nomenclature. The RMS deviation is a useful measure in that it can be directly converted to RMS-slope for a given length-scale. We map the results of this self-affine extrapolation method for each of the proposed MER landing sites as well as Viking Lander 1 (VL1) and Pathfiner (MPF). In order of decreasing average hectometer RMS-slopes, Melas (about 4.5 degrees) > Elysium EP80 > Gusev > MPF > Elysium EP78 > VL1 > Athabasca > Isidis > Hematite (about 1 degree). We also map the scaling parameter (Hurst exponent); its behavior in the MER landing site regions is interesting in how it ties together the regional behavior of kilometer slopes (directly measured with MOLA) with the decameter and meter slopes (locally derived from stereo image analysis or radar scattering). 1Kirk, R. L., E. Howington-Kraus, and B. A. Archinal, Int. Arch. Photogramm. Remote Sens., XXVIII(B4), 476 (CD-ROM), 2001; Kirk, R. L., E. Howington-Kraus, and B. A. Archinal, Lunar Planet Sci., XXXIII, abs 1988, 2002. 2Garvin, J. B., and J. J. Frawley, Lunar Planet. Sci., XXXI, abs 1884, 2000. 3Shepard, M. K., R. A. Brackett, and R. E. Arvidson, J. Geophys. Res., 100, 11709-11718, 1995.; Shepard, M. K., et al., J. Geophys. Res., 106, 32777-32796, 2001.

Has Martian History Been Dominated by Explosive Rather than Effusive Volcanism?

NASA Astrophysics Data System (ADS)

Bandfield, J. L.; Edwards, C. S.; Montgomery, D. R.

2010-12-01

It is important to gain a clear understanding of basic physical properties of the upper martian crust. We can use these derived properties to test a range of plausible formation mechanisms and place constraints on the processes involved in the creation of the martian crust. Previous studies have addressed this problem using a variety of techniques and observations. It has been well-established that the martian upper crust is typically mechanically weak (e.g. Pike, 1980; Schultz, 2002; Stewart and Valiant, 2006) and the notion of a highly fractured mega-regolith has often been invoked as the cause of this weakness. There are apparent contradictions in the interpretations of separate observations, such as the fine-scale layering in canyon walls that would not be preserved in a mega-regolith (McEwen et al., 1999). In all cases, however, the original material that makes up either the layering or mega-regolith has been assumed to originate as effusive volcanic materials. We have re-examined the body of previous work in the light of more recent global thermophysical observations to place further constraints on the nature of the upper martian crust. Although the upper ~10 km of the crust is indeed mechanically weak, consistent with previous studies, these crustal materials are also inconsistent with a mega-regolith composed of fractured blocks. Thermal inertia derived from Thermal Emission Imaging System (THEMIS) data, High Resolution Imaging Science Experiment (HiRISE) images, and Mars Exploration Rover observations clearly indicate that the upper martian crust is more typically composed of weakly consolidated fine-particulate materials. These materials are consistent with a volcaniclastic origin rather than effusive volcanism. Mechanically competent material akin to what might be derived from lava flows is clearly present on Mars in locations such as Hesperia Planum and at low latitudes within the northern lowlands, but it is much less common than has been assumed. It appears that Mars has a unique style of crustal formation that is distinct from that of the Moon and the other terrestrial planets. References: McEwen, A. S., and 14 colleagues (2007) Mars Reconnaissance Orbiter's High Resolution Imaging Science Experiment (HiRISE). J. Geophys. Res., 112, 10.1029/2005JE002605. Pike, R.J. (1980) Control of crater morphology by gravity and target type - Mars, earth, moon. Proc. Lun. Planet. Sci. Conf., 11, 2159-2189. Schultz, R. A. (2002) Stability of rock slopes in Valles Marineris, Mars. Geophys. Res. Let., 29, 10.1029/2002GL015728. Stewart, S. T. and G. J. Valiant (2006) Martian subsurface properties and crater formation processes inferred from fresh impact crater geometries. Meteor. Planet. Sci., 41, 1509-1537.

Laser-based mass spectrometry for in situ chemical composition analysis of planetary surfaces

NASA Astrophysics Data System (ADS)

Frey, Samira; Neuland, Maike B.; Grimaudo, Valentine; Moreno-García, Pavel; Riedo, Andreas; Tulej, Marek; Broekmann, Peter; Wurz, Peter

2016-04-01

Mass spectrometry is an important analytical technique in space research. The chemical composition of planetary surface material is a key scientific question on every space mission to a planet, moon or asteroid. Chemical composition measurements of rocky material on the surface are of great importance to understand the origin and evolution of the planetary body.[1] A miniature laser ablation/ionisation reflectron- type time-of-flight mass spectrometer (instrument name LMS) was designed and built at the University of Bern for planetary research.[2] Despite its small size and light weight, the LMS instrument still maintains the same capabilities as large laboratory systems, which makes it suitable for its application on planetary space missions.[3-5] The high dynamic range of about eight orders of magnitude, high lateral (μm-level) and vertical (sub-nm level) resolution and high detection sensitivity for almost all elements (10 ppb, atomic fraction) make LMS a versatile instrument for various applications. LMS is a suitable instrument for in situ measurements of elemental and isotope composition with high precision and accuracy. Measurements of Pb- isotope abundances can be used for dating of planetary material. Measurements of bio-relevant elements allow searching for past or present life on a planetary surface. The high spatial resolution, both in lateral and vertical direction, is of considerable interest, e.g. for analysis of inhomogeneous, extraterrestrial samples as well as weathering processes of planetary material. References [1] P. Wurz, D. Abplanalp, M. Tulej, M. Iakovleva, V.A. Fernandes, A. Chumikov, and G. Managadze, "Mass Spectrometric Analysis in Planetary Science: Investigation of the Surface and the Atmosphere", Sol. Sys. Res., 2012, 46, 408. [2] U. Rohner, J.A. Whitby, P. Wurz, "A miniature laser ablation time of flight mass spectrometer for in situ planetary exploration" Meas. Sci. Tch., 2003, 14, 2159. [3] M. Tulej, A. Riedo, M.B. Neuland, S. Meyer, P. Wurz, N. Thomas, V. Grimaudo, P. Moreno-García, P. Broekmann, A. Neubeck and M. Ivarsson, "CAMAM: A miniature laser ablation ionisation mass spectrometer and microscope-camera system for in situ investigation of the composition and morphology of extraterrestrial materials", Geostand. Geoanal. Res., 2014, 38, 441. [4] A. Riedo, M. Neuland, S. Meyer, M. Tulej and P. Wurz, "Coupling of LMS with a fs-laser ablation ion source: elemental and isotope composition measurements", J. Anal. At. Spectrom., 2013, 28, 1256. [5] A. Riedo, S. Meyer, B. Heredia, M. Neuland, A. Bieler, M. Tulej, I. Leya, M. Iakovleva, K. Mezger and P. Wurz, "Highly accurate isotope composition measurements by a miniature laser ablation mass spectrometer designed for in situ investigations on planetary surfaces", Planet. Space Sci., 2013, 87, 1.

Orienting apples for imaging using their inertial properties and random apple loading

USDA-ARS?s Scientific Manuscript database

The inability to control apple orientation during imaging has hindered development of automated systems for sorting apples for defects such as bruises and for safety issues such as fecal contamination. Recently, a potential method for orienting apples based on their inertial properties was discovere...

Are Red Apples Sweeter Than Green Apples?

ERIC Educational Resources Information Center

Fraser, Chris

1999-01-01

Describes how a classroom observation of apples led to the development of a science project. Discusses the correlation between the greenness and the acidity of apples. Finds that the greener the apple, the lower its pH, and thus the more acidic and less sweet it tastes. (Author/CCM)

Portable programming on parallel/networked computers using the Application Portable Parallel Library (APPL)

NASA Technical Reports Server (NTRS)

Quealy, Angela; Cole, Gary L.; Blech, Richard A.

1993-01-01

The Application Portable Parallel Library (APPL) is a subroutine-based library of communication primitives that is callable from applications written in FORTRAN or C. APPL provides a consistent programmer interface to a variety of distributed and shared-memory multiprocessor MIMD machines. The objective of APPL is to minimize the effort required to move parallel applications from one machine to another, or to a network of homogeneous machines. APPL encompasses many of the message-passing primitives that are currently available on commercial multiprocessor systems. This paper describes APPL (version 2.3.1) and its usage, reports the status of the APPL project, and indicates possible directions for the future. Several applications using APPL are discussed, as well as performance and overhead results.

Study of the cross-contamination and survival of Salmonella in fresh apples.

PubMed

Perez-Rodriguez, F; Begum, M; Johannessen, G S

2014-08-01

The present work aimed at studying the cross contamination of apples by Salmonella during the processing of commercial fresh apples and its survival capacity on apple at room temperature. For the first study, the typical process of fresh apples was simulated at laboratory scale in which an apple that was artificially contaminated by Salmonella at different concentration levels (8, 6 and 5 log cfu/apple) was introduced in one batch and processed including a simulated transport/washing step and drying step using sponges to simulate the porous material used in the industry. Results indicated that at 8 log cfu/apple, 50% fresh apples were contaminated after processing, with all analysed environmental samples being positive for the pathogen, consisting of washing water and sponges. However, at lower inoculum levels (5-6 log cfu/apple) no cross contamination was detected in apples, and only environmental samples showed contamination by Salmonella after processing including both water and sponges. Experiments on the survival of Salmonella on apple showed that the pathogen was capable to survive for 12 days, only showing a significant drop at the end of the experiment. Finally, two-class attribute sampling plans were assessed as tool to detect Salmonella in different contamination scenarios in fresh apple. This analysis indicated that with the highest inoculum level, a total of 16 apples would be needed to reach 95% of detecting Salmonella (i.e. lot rejection). In turn, when low levels were assessed (5-6 log cfu/apple), a large number of apples (n=1021) would have to be sampled to obtain the same confidence level (95%). If the environment is sampled (i.e. water and sponges), a lower number of samples would be needed to detect the pathogen. However, the feasibility of environmental sampling has not been assessed from a practical point of view. Overall, the results in this study evidenced that cross contamination by Salmonella might occur during processing of fresh apples and subsequently, the pathogen might survive for a noticeable period of time. Copyright © 2014 Elsevier B.V. All rights reserved.

Use of cyclodextrin-based polymer for patulin analysis in apple juice

USDA-ARS?s Scientific Manuscript database

Penicillium expansum, one of the patulin producing fungi that causes decay on apple, is recognized as the main source of patulin contamination on apple and apple products. The widely used method for patulin analysis in apple juice is liquid-liquid extraction with ethyl acetate followed by HPLC-UV or...

7 CFR 33.12 - Apples not subject to regulation.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 7 Agriculture 2 2013-01-01 2013-01-01 false Apples not subject to regulation. 33.12 Section 33.12... REGULATIONS REGULATIONS ISSUED UNDER AUTHORITY OF THE EXPORT APPLE ACT Exemptions § 33.12 Apples not subject... this part, transport or receive for transportation to any foreign destination: (a) A quantity of apples...

7 CFR 33.12 - Apples not subject to regulation.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 7 Agriculture 2 2014-01-01 2014-01-01 false Apples not subject to regulation. 33.12 Section 33.12... REGULATIONS REGULATIONS ISSUED UNDER AUTHORITY OF THE EXPORT APPLE ACT Exemptions § 33.12 Apples not subject... this part, transport or receive for transportation to any foreign destination: (a) A quantity of apples...

7 CFR 33.12 - Apples not subject to regulation.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 2 2011-01-01 2011-01-01 false Apples not subject to regulation. 33.12 Section 33.12... REGULATIONS REGULATIONS ISSUED UNDER AUTHORITY OF THE EXPORT APPLE ACT Exemptions § 33.12 Apples not subject... this part, transport or receive for transportation to any foreign destination: (a) A quantity of apples...

7 CFR 33.12 - Apples not subject to regulation.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false Apples not subject to regulation. 33.12 Section 33.12... REGULATIONS REGULATIONS ISSUED UNDER AUTHORITY OF THE EXPORT APPLE ACT Exemptions § 33.12 Apples not subject... this part, transport or receive for transportation to any foreign destination: (a) A quantity of apples...

7 CFR 33.12 - Apples not subject to regulation.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 7 Agriculture 2 2012-01-01 2012-01-01 false Apples not subject to regulation. 33.12 Section 33.12... REGULATIONS REGULATIONS ISSUED UNDER AUTHORITY OF THE EXPORT APPLE ACT Exemptions § 33.12 Apples not subject... this part, transport or receive for transportation to any foreign destination: (a) A quantity of apples...

78 FR 42086 - Draft Guidance for Industry on Arsenic in Apple Juice: Action Level; Supporting Document for...

Federal Register 2010, 2011, 2012, 2013, 2014

2013-07-15

... Level for Arsenic in Apple Juice; A Quantitative Assessment of Inorganic Arsenic in Apple Juice... Arsenic in Apple Juice'' (the draft supporting document) and ``A Quantitative Assessment of Inorganic... document entitled ``A Quantitative Assessment of Inorganic Arsenic in Apple Juice.'' The draft guidance...

75 FR 65213 - Removal of Varietal Restrictions on Apples From Japan

Federal Register 2010, 2011, 2012, 2013, 2014

2010-10-22

...-0020] RIN 0579-AD08 Removal of Varietal Restrictions on Apples From Japan AGENCY: Animal and Plant... the importation of Fuji variety apples from Japan to allow all varieties of Malus domestica apples... that the risk associated with allowing other varieties of M. domestica apples from Japan into the...

First report of Apple necrotic mosaic virus infecting apple trees in Korea

USDA-ARS?s Scientific Manuscript database

In September 2016, two apple trees (Malus domestica Borkh) cv. Shinano Sweet showing bright cream spot and mosaic patterns on leaves were observed in Pocheon, South Korea. Mosaic symptoms are common on leaves of apple trees infected with Apple mosaic virus (ApMV). Symptomatic leaves were tested by e...

Mapping the sensory perception of apple using descriptive sensory evaluation in a genome wide association study

PubMed Central

Amyotte, Beatrice; Bowen, Amy J.; Banks, Travis; Rajcan, Istvan; Somers, Daryl J.

2017-01-01

Breeding apples is a long-term endeavour and it is imperative that new cultivars are selected to have outstanding consumer appeal. This study has taken the approach of merging sensory science with genome wide association analyses in order to map the human perception of apple flavour and texture onto the apple genome. The goal was to identify genomic associations that could be used in breeding apples for improved fruit quality. A collection of 85 apple cultivars was examined over two years through descriptive sensory evaluation by a trained sensory panel. The trained sensory panel scored randomized sliced samples of each apple cultivar for seventeen taste, flavour and texture attributes using controlled sensory evaluation practices. In addition, the apple collection was subjected to genotyping by sequencing for marker discovery. A genome wide association analysis suggested significant genomic associations for several sensory traits including juiciness, crispness, mealiness and fresh green apple flavour. The findings include previously unreported genomic regions that could be used in apple breeding and suggest that similar sensory association mapping methods could be applied in other plants. PMID:28231290

Mapping the sensory perception of apple using descriptive sensory evaluation in a genome wide association study.

PubMed

Amyotte, Beatrice; Bowen, Amy J; Banks, Travis; Rajcan, Istvan; Somers, Daryl J

2017-01-01

Breeding apples is a long-term endeavour and it is imperative that new cultivars are selected to have outstanding consumer appeal. This study has taken the approach of merging sensory science with genome wide association analyses in order to map the human perception of apple flavour and texture onto the apple genome. The goal was to identify genomic associations that could be used in breeding apples for improved fruit quality. A collection of 85 apple cultivars was examined over two years through descriptive sensory evaluation by a trained sensory panel. The trained sensory panel scored randomized sliced samples of each apple cultivar for seventeen taste, flavour and texture attributes using controlled sensory evaluation practices. In addition, the apple collection was subjected to genotyping by sequencing for marker discovery. A genome wide association analysis suggested significant genomic associations for several sensory traits including juiciness, crispness, mealiness and fresh green apple flavour. The findings include previously unreported genomic regions that could be used in apple breeding and suggest that similar sensory association mapping methods could be applied in other plants.

Effect of ultrasound dielectric pretreatment on the oxidation resistance of vacuum-fried apple chips.

PubMed

Shen, Xu; Zhang, Min; Bhandari, Bhesh; Guo, Zhimei

2018-02-15

In order to investigate the effect of ultrasound dielectric pretreatment on the oxidation resistance of vacuum-fried apple chips, apple slices were pretreated at ultrasonic powers of 150, 250 and 400 W for times of 10, 20 and 30 min before vacuum frying. The quality and oxidation resistance of fried apple were evaluated by testing the dielectric properties and comparing the moisture content, oil uptake, color, acid value (AV) and peroxide value (PV) of apple chips. Ultrasonic treatment significantly changed the dielectric properties of apple slices. Moisture and oil contents of apple chips decreased with increasing ultrasonic power and time. During storage, the color retention of fried apple chips processed by ultrasound was improved. AV and PV values of fried apple chips processed by ultrasound were lower, which improved their antioxidant properties. The results of the present study indicated that ultrasound dielectric pretreatment improved not only the quality of vacuum-fried apple chips but also their antioxidant properties. © 2018 Society of Chemical Industry. © 2018 Society of Chemical Industry.

Cost-benefit trade-offs of bird activity in apple orchards.

PubMed

Peisley, Rebecca K; Saunders, Manu E; Luck, Gary W

2016-01-01

Birds active in apple orchards in south-eastern Australia can contribute positively (e.g., control crop pests) or negatively (e.g., crop damage) to crop yields. Our study is the first to identify net outcomes of these activities, using six apple orchards, varying in management intensity, in south-eastern Australia as a study system. We also conducted a predation experiment using real and artificial codling moth (Cydia pomonella) larvae (a major pest in apple crops). We found that: (1) excluding birds from branches of apple trees resulted in an average of 12.8% more apples damaged by insects; (2) bird damage to apples was low (1.9% of apples); and (3) when trading off the potential benefits (biological control) with costs (bird damage to apples), birds provided an overall net benefit to orchard growers. We found that predation of real codling moth larvae was higher than for plasticine larvae, suggesting that plasticine prey models are not useful for inferring actual predation levels. Our study shows how complex ecological interactions between birds and invertebrates affect crop yield in apples, and provides practical strategies for improving the sustainability of orchard systems.

Flow visualization around an apple with and without bagging

NASA Astrophysics Data System (ADS)

Matsumoto, H.; Kubota, Y.; Ohishi, M.; Mochizuki, O.

2017-04-01

The typhoon often causes the vast damage to drop the apple before harvest. Many apples fall from trees by the strong wind. These apples are usually bagged to protect them from insects and control sun light for the apples colouring while they are ripening on the tree. We directly measured the drag force acting on an apple with and without bagging experimentally to bare the influence of the bagging on the dropping mechanism. There are two interesting results through the experiment: the drag coefficient of a naked apple is smaller than a sphere, and the bagging is a cause of increasing drag coefficient. To know the reason of these results, we visualized flow around the apple with and without bagging by using the hydrogen bubbles method in an open water channel in this study. We found two facts as follows: the hollow on the top of an apple plays reduction of width of the wake of an apple and reason of increasing the wake width is the flow separation from peripheral edge of the bagging.

Increasing specialty care access through use of an innovative home telehealth-based spinal cord injury disease management protocol (SCI DMP)

PubMed Central

Seton, Jacinta M.; Washington, Monique; Tomlinson, Suk C.; Phrasavath, Douangmala; Farrell, Karen R.; Goldstein, Barry

2016-01-01

Background A spinal cord injury disease management protocol (SCI DMP) was developed to address the unique medical, physical, functional, and psychosocial needs of those living with spinal cord injuries and disorders (SCI/D). The SCI DMP was piloted to evaluate DMP clinical content and to identify issues for broader implementation across the Veterans Affairs (VA) SCI System of Care. Methods Thirty-three patients with SCI/D from four VA SCI centers participated in a 6-month pilot. Patients received customized SCI DMP questions through a data messaging device (DMD). Nurse home telehealth care coordinators (HTCC) monitored responses and addressed clinical alerts daily. One site administered the Duke Severity of Illness (DUSOI) Checklist and Short Form-8 (SF-8™) to evaluate the changes in comorbidity severity and health-related quality of life while on the SCI DMP. Results Patients remained enrolled an average of 116 days, with a mean response rate of 56%. The average distance between patient's home and their VA SCI center was 59 miles. Feedback on SCI DMP content and the DMD included requests for additional clinical topics, changes in administration frequency, and adapting the DMD for functional impairments. Improvement in clinical outcomes was seen in a subset of patients enrolled on the SCI DMP. Conclusion SCI HTCCs and patients reported that the program was most beneficial for newly injured patients recently discharged from acute rehabilitation that live far from specialty SCI care facilities. SCI DMP content changes and broader implementation strategies are currently being evaluated based on lessons learned from the pilot. PMID:24617497

Increasing specialty care access through use of an innovative home telehealth-based spinal cord injury disease management protocol (SCI DMP).

PubMed

Woo, Christine; Seton, Jacinta M; Washington, Monique; Tomlinson, Suk C; Phrasavath, Douangmala; Farrell, Karen R; Goldstein, Barry

2016-01-01

A spinal cord injury disease management protocol (SCI DMP) was developed to address the unique medical, physical, functional, and psychosocial needs of those living with spinal cord injuries and disorders (SCI/D). The SCI DMP was piloted to evaluate DMP clinical content and to identify issues for broader implementation across the Veterans Affairs (VA) SCI System of Care. Thirty-three patients with SCI/D from four VA SCI centers participated in a 6-month pilot. Patients received customized SCI DMP questions through a data messaging device (DMD). Nurse home telehealth care coordinators (HTCC) monitored responses and addressed clinical alerts daily. One site administered the Duke Severity of Illness (DUSOI) Checklist and Short Form-8 (SF-8™) to evaluate the changes in comorbidity severity and health-related quality of life while on the SCI DMP. Patients remained enrolled an average of 116 days, with a mean response rate of 56%. The average distance between patient's home and their VA SCI center was 59 miles. Feedback on SCI DMP content and the DMD included requests for additional clinical topics, changes in administration frequency, and adapting the DMD for functional impairments. Improvement in clinical outcomes was seen in a subset of patients enrolled on the SCI DMP. SCI HTCCs and patients reported that the program was most beneficial for newly injured patients recently discharged from acute rehabilitation that live far from specialty SCI care facilities. SCI DMP content changes and broader implementation strategies are currently being evaluated based on lessons learned from the pilot.

Psychometric evaluation of the Spanish version of the MPI-SCI.

PubMed

Soler, M D; Cruz-Almeida, Y; Saurí, J; Widerström-Noga, E G

2013-07-01

Postal surveys. To confirm the factor structure of the Spanish version of the MPI-SCI (MPI-SCI-S, Multidimensional Pain Inventory in the SCI population) and to test its internal consistency and construct validity in a Spanish population. Guttmann Institute, Barcelona, Spain. The MPI-SCI-S along with Spanish measures of pain intensity (Numerical Rating Scale), pain interference (Brief Pain Inventory), functional independence (Functional Independence Measure), depression (Beck Depression Inventory), locus of control (Multidimensional health Locus of Control), support (Functional Social Support Questionnaire (Duke-UNC)), psychological well-being (Psychological Global Well-Being Index) and demographic/injury characteristics were assessed in persons with spinal cord injury (SCI) and chronic pain (n=126). Confirmatory factor analysis suggested an adequate factor structure for the MPI-SCI-S. The internal consistency of the MPI-SCI-S subscales ranged from acceptable (r=0.66, Life Control) to excellent (r=0.94, Life Interference). All MPI-SCI-S subscales showed adequate construct validity, with the exception of the Negative and Solicitous Responses subscales. The Spanish version of the MPI-SCI is adequate for evaluating chronic pain impact following SCI in a Spanish-speaking population. Future studies should include additional measures of pain-related support in the Spanish-speaking SCI population.

Infertility in Men with Spinal Cord Injury: Research and Treatment

PubMed Central

Brackett, Nancy L.

2012-01-01

Spinal cord injury (SCI) occurs most often to young men. Following SCI, most men are infertile due to a combination of erectile dysfunction, ejaculatory dysfunction and semen abnormalities. Erectile dysfunction may be treated by the same therapies that are used in the general population. Similarly, the same treatments that are effective to assist conception in couples with non-SCI male factor patients are effective in assisting conception in SCI male-factor patients. The most apparent differences in male-factor symptoms between SCI and non-SCI patients are the high occurrences of anejaculation and atypical semen profiles in men with SCI. Methods available to assist ejaculation in men with SCI include penile vibratory stimulation and EEJ. Use of surgical sperm retrieval as the first line of treatment for anejaculation in men with SCI is controversial. Most men with SCI have a unique semen profile characterized by normal sperm concentration, but abnormally low sperm motility. Toxic substances in the semen contribute to this problem. Despite impaired sperm parameters, pregnancy outcomes using sperm from men with SCI are similar to pregnancy outcomes using sperm from non-SCI men. Future studies should focus on improving natural ejaculation and improving semen quality in these men. PMID:24278717

Comparison of nonfried apple snacks with commercially available fried snacks.

PubMed

Joshi, A P K; Rupasinghe, H P V; Pitts, N L

2011-06-01

The study was carried out to evaluate the selected quality attributes of a prototype nonfried apple snack produced by application of vacuum impregnation (VI) of maple syrup and vacuum drying. When maple syrup concentration was adjusted to 20-40% in the VI solution, vacuum-dried apple slices are resulted in the greatest textural attributes, whiteness index, and desirable moisture content and water activity. Comparison of the VI-treated, vacuum-dried apple slices with commercially fried apple and potato snacks revealed that the consumer acceptability was greater for the fried snack products due to their flavor and texture; however, in addition to higher oil content (>30%), commercial fried apple and potato snacks possessed lower antioxidant capacity than nonfried apple snacks. VI process enhanced the calcium content of the nonfried apple snack products.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hang, Y.D.

Nearly 36 million tons of apples are produced annually in the US. Approximately 45% of the total US apple production is used for processing purposes. The primary by-product of apple processing is apple pomace. It consists of the presscake resulting from pressing apples for juice or cider, including the presscake obtained in pressing peel and core wastes generated in the manufacture of apple sauce or slices. More than 500 food processing plants in the US produce a total of about 1.3 million metric tons of apple pomace each year, and it is likely that annual disposal fees exceed $10 million.more » Apple pomace has the potential to be used for the production of fuels (ethanol and biogas containing 60% methane) and food-grade chemicals. These uses will be reviewed in this article.« less

Characterization of cider apples on the basis of their fatty acid profiles.

PubMed

Blanco-Gomis, Domingo; Mangas Alonso, Juan J; Margolles Cabrales, Inmaculada; Arias Abrodo, Pilar

2002-02-27

In the current study, the fatty acids composition of 30 monovarietal apple juices from six cider apple varieties belonging to two categories was analyzed. The different apple juices were obtained from three consecutive harvests (1997, 1998, and 1999). The fatty acids concentration in apple juice together with chemometric techniques such as principal components analysis (PCA), soft independent modeling of class analogy (SIMCA), and linear discriminant analysis (LDA), allowed us to differentiate apple juices on the basis of the sweet or sharp category to which the cider apple variety belongs. Fatty acids such as the unsaturated oleic and linoleic acids, and saturated caprylic, capric, stearic, and palmitic acids were related to the sweet cider apple category, while pentadecanoic acid is related to the sharp class.

Prevalence and Etiology of Hypogonadism in Young Men With Chronic Spinal Cord Injury: A Cross-Sectional Analysis From Two University-Based Rehabilitation Centers.

PubMed

Sullivan, Shannon D; Nash, Mark S; Tefera, Eshetu; Tinsley, Emily; Blackman, Marc R; Groah, Suzanne

2017-08-01

Spinal cord injury (SCI) triggers an "accelerated aging" process that may include development of hypogonadism, even among younger men with SCI; however, few studies have investigated the prevalence or etiology of hypogonadism in men with SCI. Young men with SCI also are at increased risk for developing metabolic dysfunction after injury, which may be exacerbated by concomitant testosterone (T) deficiency, thus identifying the prevalence and risk factors for T deficiency in men with SCI is important for their long-term health. To investigate the prevalence, risk factors, and etiology of T deficiency (hypogonadism) in otherwise-healthy men with chronic, motor complete SCI. Secondary cross-sectional analysis. Rehabilitation research centers in Washington, DC, and Miami, Florida. Men (n = 58) aged 18-45 years with chronic (≥1 year), motor complete SCI without comorbidities or use of testosterone therapy. Plasma concentrations of hormones were measured with standardized assays. Body composition was assessed with dual-energy x-ray absorptiometry scan. Serum total T and calculated free T. T deficiency was more common in men after SCI than in a matched cohort of similarly-aged men without SCI (25%, SCI versus 6.7%, non-SCI, P < .001). The risk of hypogonadism appeared to be increased in men with more extensive injury and with higher percent body fat. The majority of men with SCI with low T had low serum LH levels, suggesting that central suppression of the hypothalamic-pituitary-gonadal axis may be the most common etiology of hypogonadism after SCI. Hypogonadism is more common in young men with SCI than in similarly aged men without SCI, suggesting that SCI should be identified as a risk factor for T deficiency and that routine screening for hypogonadism should be performed in the SCI population. II. Copyright © 2017 American Academy of Physical Medicine and Rehabilitation. Published by Elsevier Inc. All rights reserved.

Physical and antibacterial properties of edible films formulated with apple skin polyphenols.

PubMed

Du, W-X; Olsen, C W; Avena-Bustillos, R J; Friedman, M; McHugh, T H

2011-03-01

Fruit and vegetable skins have polyphenolic compounds, terpenes, and phenols with antimicrobial and antioxidant activity. These flavoring plant essential oil components are generally regarded as safe. Edible films made from fruits or vegetables containing apple skin polyphenols have the potential to be used commercially to protect food against contamination by pathogenic bacteria. The main objective of this study was to evaluate physical properties as well as antimicrobial activities against Listeria monocytogenes, Escherichia coli O157:H7, and Salmonella enterica of apple skin polyphenols at 0% to 10% (w/w) concentrations in apple puree film-forming solutions formulated into edible films. Commercial apple skin polyphenol powder had a water activity of 0.44 and high total soluble phenolic compounds and antioxidant capacity (995.3 mg chlorogenic acid/100 g and 14.4 mg Trolox/g, respectively). Antimicrobial activities of edible film containing apple skin polyphenols were determined by the overlay method. Apple edible film with apple skin polyphenols was highly effective against L. monocytogenes. The minimum concentration need to inactive L. monocytogenes was 1.5%. However, apple skin polyphenols did not show any antimicrobial effect against E. coli O157:H7 and S. enterica even at 10% level. The presence of apple skin polyphenols reduced water vapor permeability of films. Apple skin polyphenols increased elongation of films and darkened the color of films. The results of the present study show that apple skin polyphenols can be used to prepare apple-based antimicrobial edible films with good physical properties for food applications by direct contact.

Choosing between an Apple and a Chocolate Bar: the Impact of Health and Taste Labels

PubMed Central

Forwood, Suzanna E.; Walker, Alexander D.; Hollands, Gareth J.; Marteau, Theresa M.

2013-01-01

Increasing the consumption of fruit and vegetables is a central component of improving population health. Reasons people give for choosing one food over another suggest health is of lower importance than taste. This study assesses the impact of using a simple descriptive label to highlight the taste as opposed to the health value of fruit on the likelihood of its selection. Participants (N=439) were randomly allocated to one of five groups that varied in the label added to an apple: apple; healthy apple; succulent apple; healthy and succulent apple; succulent and healthy apple. The primary outcome measure was selection of either an apple or a chocolate bar as a dessert. Measures of the perceived qualities of the apple (taste, health, value, quality, satiety) and of participant characteristics (restraint, belief that tasty foods are unhealthy, BMI) were also taken. When compared with apple selection without any descriptor (50%), the labels combining both health and taste descriptors significantly increased selection of the apple (’healthy & succulent’ 65.9% and ‘succulent & healthy’ 62.4%), while the use of a single descriptor had no impact on the rate of apple selection (‘healthy’ 50.5% and ‘succulent’ 52%). The strongest predictors of individual dessert choice were the taste score given to the apple, and the lack of belief that healthy foods are not tasty. Interventions that emphasize the taste attributes of healthier foods are likely to be more effective at achieving healthier diets than those emphasizing health alone. PMID:24155964

Patulin Production in Apples Decayed by Penicillium expansum1

PubMed Central

Wilson, D. M.; Nuovo, G. J.

1973-01-01

Sixty isolates of Penicillium expansum were tested for patulin production in decaying apples. All the isolates were found to produce the mycotoxin patulin as determined by thin-layer chromatography. Since patulin is known to be stable in many apple products, the results indicate that apple products made partially from apples decayed by P. expansum will contain patulin which may present a health hazard. The results also suggest that patulin may be important in the decay of apples by P. expansum. PMID:4726831

Combined SCI and TBI: Recovery of forelimb function after unilateral cervical spinal cord injury (SCI) is retarded by contralateral traumatic brain injury (TBI), and ipsilateral TBI balances the effects of SCI on paw placement

PubMed Central

Inoue, Tomoo; Lin, Amity; Ma, Xiaokui; McKenna, Stephen L.; Creasey, Graham H.; Manley, Geoffrey T.; Ferguson, Adam R.; Bresnahan, Jacqueline C.; Beattie, Michael S.

2015-01-01

A significant proportion (estimates range from 16–74%) of patients with spinal cord injury (SCI) have concomitant traumatic brain injury (TBI), and the combination often produces difficulties in planning and implementing rehabilitation strategies and drug therapies. For example, many of the drugs used to treat SCI may interfere with cognitive rehabilitation, and conversely drugs that are used to control seizures in TBI patients may undermine locomotor recovery after SCI. The current paper presents an experimental animal model for combined SCI and TBI to help drive mechanistic studies of dual diagnosis. Rats received a unilateral SCI (75 kdyn) at C5 vertebral level, a unilateral TBI (2.0 mm depth, 4.0 m/s velocity impact on the forelimb sensori-motor cortex), or both SCI + TBI. TBI was placed either contralateral or ipsilateral to the SCI. Behavioral recovery was examined using paw placement in a cylinder, grooming, open field locomotion, and the IBB cereal eating test. Over 6 weeks, in the paw placement test, SCI + contralateral TBI produced a profound deficit that failed to recover, but SCI + ipsilateral TBI increased the relative use of the paw on the SCI side. In the grooming test, SCI + contralateral TBI produced worse recovery than either lesion alone even though contralateral TBI alone produced no observable deficit. In the IBB forelimb test, SCI + contralateral TBI revealed a severe deficit that recovered in 3 weeks. For open field locomotion, SCI alone or in combination with TBI resulted in an initial deficit that recovered in 2 weeks. Thus, TBI and SCI affected forelimb function differently depending upon the test, reflecting different neural substrates underlying, for example, exploratory paw placement and stereotyped grooming. Concurrent SCI and TBI had significantly different effects on outcomes and recovery, depending upon laterality of the two lesions. Recovery of function after cervical SCI was retarded by the addition of a moderate TBI in the contralateral hemisphere in all tests, but forepaw placements were relatively increased by an ipsilateral TBI relative to SCI alone, perhaps due to the dual competing injuries influencing the use of both forelimbs. These findings emphasize the complexity of recovery from combined CNS injuries, and the possible role of plasticity and laterality in rehabilitation, and provide a start towards a useful preclinical model for evaluating effective therapies for combine SCI and TBI. PMID:23770071

Combined SCI and TBI: recovery of forelimb function after unilateral cervical spinal cord injury (SCI) is retarded by contralateral traumatic brain injury (TBI), and ipsilateral TBI balances the effects of SCI on paw placement.

PubMed

Inoue, Tomoo; Lin, Amity; Ma, Xiaokui; McKenna, Stephen L; Creasey, Graham H; Manley, Geoffrey T; Ferguson, Adam R; Bresnahan, Jacqueline C; Beattie, Michael S

2013-10-01

A significant proportion (estimates range from 16 to 74%) of patients with spinal cord injury (SCI) have concomitant traumatic brain injury (TBI), and the combination often produces difficulties in planning and implementing rehabilitation strategies and drug therapies. For example, many of the drugs used to treat SCI may interfere with cognitive rehabilitation, and conversely drugs that are used to control seizures in TBI patients may undermine locomotor recovery after SCI. The current paper presents an experimental animal model for combined SCI and TBI to help drive mechanistic studies of dual diagnosis. Rats received a unilateral SCI (75 kdyn) at C5 vertebral level, a unilateral TBI (2.0 mm depth, 4.0 m/s velocity impact on the forelimb sensori-motor cortex), or both SCI+TBI. TBI was placed either contralateral or ipsilateral to the SCI. Behavioral recovery was examined using paw placement in a cylinder, grooming, open field locomotion, and the IBB cereal eating test. Over 6weeks, in the paw placement test, SCI+contralateral TBI produced a profound deficit that failed to recover, but SCI+ipsilateral TBI increased the relative use of the paw on the SCI side. In the grooming test, SCI+contralateral TBI produced worse recovery than either lesion alone even though contralateral TBI alone produced no observable deficit. In the IBB forelimb test, SCI+contralateral TBI revealed a severe deficit that recovered in 3 weeks. For open field locomotion, SCI alone or in combination with TBI resulted in an initial deficit that recovered in 2 weeks. Thus, TBI and SCI affected forelimb function differently depending upon the test, reflecting different neural substrates underlying, for example, exploratory paw placement and stereotyped grooming. Concurrent SCI and TBI had significantly different effects on outcomes and recovery, depending upon laterality of the two lesions. Recovery of function after cervical SCI was retarded by the addition of a moderate TBI in the contralateral hemisphere in all tests, but forepaw placements were relatively increased by an ipsilateral TBI relative to SCI alone, perhaps due to the dual competing injuries influencing the use of both forelimbs. These findings emphasize the complexity of recovery from combined CNS injuries, and the possible role of plasticity and laterality in rehabilitation, and provide a start towards a useful preclinical model for evaluating effective therapies for combine SCI and TBI. Copyright © 2013 Elsevier Inc. All rights reserved.

Creating, Storing, and Dumping Low and High Resolution Graphics on the Apple IIe Microcomputer System.

ERIC Educational Resources Information Center

Fletcher, Richard K., Jr.

This description of procedures for dumping high and low resolution graphics using the Apple IIe microcomputer system focuses on two special hardware configurations that are commonly used in schools--the Apple Dot Matrix Printer with the Apple Parallel Interface Card, and the Imagewriter Printer with the Apple Super Serial Interface Card. Special…

7 CFR 51.301 - U.S. Fancy.

Code of Federal Regulations, 2012 CFR

2012-01-01

... Standards for Grades of Apples Grades § 51.301 U.S. Fancy. “U.S. Fancy” consists of apples of one variety... injury, visible water core, and broken skins. The apples are also free from damage caused by bruises... variety of apples. Invisible water core shall not be scored against the Fuji variety of apples under any...

7 CFR 33.50 - Apples for processing.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 7 Agriculture 2 2012-01-01 2012-01-01 false Apples for processing. 33.50 Section 33.50 Agriculture... ISSUED UNDER AUTHORITY OF THE EXPORT APPLE ACT Interpretive Rules § 33.50 Apples for processing. The terms “apples for processing” as used in § 33.12 of this part apply only and is restricted to packages...

7 CFR 33.50 - Apples for processing.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 7 Agriculture 2 2014-01-01 2014-01-01 false Apples for processing. 33.50 Section 33.50 Agriculture... ISSUED UNDER AUTHORITY OF THE EXPORT APPLE ACT Interpretive Rules § 33.50 Apples for processing. The terms “apples for processing” as used in § 33.12 of this part apply only and is restricted to packages...

7 CFR 33.50 - Apples for processing.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 2 2011-01-01 2011-01-01 false Apples for processing. 33.50 Section 33.50 Agriculture... ISSUED UNDER AUTHORITY OF THE EXPORT APPLE ACT Interpretive Rules § 33.50 Apples for processing. The terms “apples for processing” as used in § 33.12 of this part apply only and is restricted to packages...

7 CFR 51.301 - U.S. Fancy.

Code of Federal Regulations, 2011 CFR

2011-01-01

... Standards for Grades of Apples Grades § 51.301 U.S. Fancy. “U.S. Fancy” consists of apples of one variety... injury, visible water core, and broken skins. The apples are also free from damage caused by bruises... variety of apples. Invisible water core shall not be scored against the Fuji variety of apples under any...

7 CFR 51.301 - U.S. Fancy.

Code of Federal Regulations, 2010 CFR

2010-01-01

... Standards for Grades of Apples Grades § 51.301 U.S. Fancy. “U.S. Fancy” consists of apples of one variety... injury, visible water core, and broken skins. The apples are also free from damage caused by bruises... variety of apples. Invisible water core shall not be scored against the Fuji variety of apples under any...

7 CFR 33.50 - Apples for processing.

Code of Federal Regulations, 2010 CFR

2010-01-01

... 7 Agriculture 2 2010-01-01 2010-01-01 false Apples for processing. 33.50 Section 33.50 Agriculture... ISSUED UNDER AUTHORITY OF THE EXPORT APPLE ACT Interpretive Rules § 33.50 Apples for processing. The terms “apples for processing” as used in § 33.12 of this part apply only and is restricted to packages...

7 CFR 33.50 - Apples for processing.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 7 Agriculture 2 2013-01-01 2013-01-01 false Apples for processing. 33.50 Section 33.50 Agriculture... ISSUED UNDER AUTHORITY OF THE EXPORT APPLE ACT Interpretive Rules § 33.50 Apples for processing. The terms “apples for processing” as used in § 33.12 of this part apply only and is restricted to packages...

Melatonin in Apples and Juice: Inhibition of Browning and Microorganism Growth in Apple Juice.

PubMed

Zhang, Haixia; Liu, Xuan; Chen, Ting; Ji, Yazhen; Shi, Kun; Wang, Lin; Zheng, Xiaodong; Kong, Jin

2018-02-27

Synthetic melatonin ( N -acetyl-5-methoxytryptamine, MT) is popular in the US and Asian markets as a health supplement. Here, we identified a naturally occurring melatonin source in apple juice. Melatonin was present in all 18 apple cultivars tested. The highest melatonin level of the edible part of apple was detected in the apple peel. The melatonin content in 'Fuji' apple juice is comparable to the level of its flesh. Melatonin was consumed during the process of juicing due to its interaction with the oxidants. Melatonin addition significantly reduced the juice color change to brown (browning). The mechanism is that melatonin scavenges the free radicals, which was indicated by the ASBT analysis; therefore, inhibiting the conversion of o -diphenolic compounds into quinones. Most importantly, melatonin exhibited powerful anti-microorganism activity in juice. The exact mechanisms of this action are currently unknown. These effects of melatonin can preserve the quality and prolong the shelf life of apple juice. The results provide valuable information regarding commerciall apple juice processing and storage.

Neuroprotective effects of lycopene in spinal cord injury in rats via antioxidative and anti-apoptotic pathway.

PubMed

Hu, Wei; Wang, Hongbo; Liu, Zhenfeng; Liu, Yanlu; Wang, Rong; Luo, Xiao; Huang, Yifei

2017-03-06

Oxidative damage induced-mitochondrial dysfunction and apoptosis has been widely studied in spinal cord injury (SCI). Lycopene, a polyunsaturated hydrocarbon, has the highest antioxidant capacity compared to the other carotenoids. However, the role of lycopene in SCI is unknown. In the present study, we evaluated the antioxidant effects of lycopene on mitochondrial dysfunction and apoptosis following T10 contusion SCI in rats. The rats were randomized into 5 groups: the sham group, the SCI group and the SCI pre-treated with lycopene (5, 10, or 20mg/kg) group. The SCI group showed increased malondialdehyde (MDA) content, decreased superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px) ability, which indicated that SCI could induce oxidative damage. What's more, the SCI group showed decreased mRNA expression of cytochrome b and mitochondrial transcription factor A (Tfam), and decreased mitochondrial membrane potential (ΔYm), which indicated that SCI could induce mitochondrial dysfunction. Besides, the SCI group showed decreased protein expression of bcl-2 and mitochondrial cytochrome C, increased protein expression of cytosolic cytochrome C, cleaved caspase-9, cleaved caspase-3 and bax, and increased TUNEL-positive cell numbers, which indicated that SCI could induce cell apoptosis. Fortunately, the lycopene treatment significantly ameliorated oxidative damage, mitochondrial dysfunction and cell apoptosis via the reversion of those parameters described above in the dose of lycopene of 10 and 20mg/kg. In addition, lycopene significantly ameliorated the hind limb motor disturbances in the SCI+lyco10 group and the SCI+lyco20 group compared with the SCI group. These results suggested that lycopene administration could improve total antioxidant status and might have neuroprotective effects on SCI. Copyright © 2017 Elsevier B.V. All rights reserved.

New biotechnological tools to accelerate scab-resistance trait transfer to apple.

PubMed

Cusin, Roberta; Revers, Luís Fernando; Maraschin, Felipe Dos Santos

2017-01-01

Apple is a fruit crop cultivated worldwide. Apple orchards are exposed to a diverse set of environmental and biological factors that affect the productivity and sustainability of the culture. Many of the efforts and costs for apple production rely on reducing the incidence of fungal diseases, and one of the main diseases is apple scab caused by the fungus Venturia inaequalis. The economic impact of scab on apple productivity has guided many breeding programs to search for cultivars resistant to apple scab. Introgression from wild relatives has been successful to some extent, and genetic engineering for resistant cultivars has even been employed. This review presents the techniques used to the present time to obtain pathogen-resistant apple cultivars and introduces new biotechnological approaches based on plant plasmids that show promising results for delivering genetic traits with a short-term perspective.

Association Between Apple Consumption and Physician Visits

PubMed Central

Davis, Matthew A.; Bynum, Julie P.W.; Sirovich, Brenda E.

2015-01-01

IMPORTANCE Fruit consumption is believed to have beneficial health effects, and some claim, “An apple a day keeps the doctor away.” OBJECTIVE To examine the relationship between eating an apple a day and keeping the doctor away. DESIGN, SETTING, AND PARTICIPANTS A cross-sectional study of a nationally representative sample of the noninstitutionalized US adult population. A total of 8728 adults 18 years and older from the 2007–2008 and 2009–2010 National Health and Nutrition Examination Survey completed a 24-hour dietary recall questionnaire and reported that the quantity of food they ate was reflective of their usual daily diet. EXPOSURES Daily apple eaters (consuming the equivalent of at least 1 small apple daily, or 149 g of raw apple) vs non–apple eaters, based on the reported quantity of whole apple consumed during the 24-hour dietary recall period. MAIN OUTCOMES AND MEASURES The primary outcome measure was success at “keeping the doctor away,” measured as no more than 1 visit (self-reported) to a physician during the past year; secondary outcomes included successful avoidance of other health care services (ie, no overnight hospital stays, visits to a mental health professional, or prescription medications). RESULTS Of 8399 eligible study participants who completed the dietary recall questionnaire, we identified 753 adult apple eaters (9.0%)—those who typically consume at least 1 small apple per day. Compared with the 7646 non–apple eaters (91.0%), apple eaters had higher educational attainment, were more likely to be from a racial or ethnic minority, and were less likely to smoke (P < .001 for each comparison). Apple eaters were more likely, in the crude analysis, to keep the doctor (and prescription medications) away: 39.0% of apple eaters avoided physician visits vs 33.9%of non–apple eaters (P = .03). After adjusting for sociodemographic and health-related characteristics, however, the association was no longer statistically significant (OR, 1.19; 95%CI, 0.93–1.53; P = .15). In the adjusted analysis, apple eaters also remained marginally more successful at avoiding prescription medications (odds ratio, 1.27; 95%CI, 1.00–1.63). There were no differences seen in overnight hospital stay or mental health visits. CONCLUSIONS AND RELEVANCE Evidence does not support that an apple a day keeps the doctor away; however, the small fraction of US adults who eat an apple a day do appear to use fewer prescription medications. PMID:25822137

Genome re-sequencing reveals the history of apple and supports a two-stage model for fruit enlargement.

PubMed

Duan, Naibin; Bai, Yang; Sun, Honghe; Wang, Nan; Ma, Yumin; Li, Mingjun; Wang, Xin; Jiao, Chen; Legall, Noah; Mao, Linyong; Wan, Sibao; Wang, Kun; He, Tianming; Feng, Shouqian; Zhang, Zongying; Mao, Zhiquan; Shen, Xiang; Chen, Xiaoliu; Jiang, Yuanmao; Wu, Shujing; Yin, Chengmiao; Ge, Shunfeng; Yang, Long; Jiang, Shenghui; Xu, Haifeng; Liu, Jingxuan; Wang, Deyun; Qu, Changzhi; Wang, Yicheng; Zuo, Weifang; Xiang, Li; Liu, Chang; Zhang, Daoyuan; Gao, Yuan; Xu, Yimin; Xu, Kenong; Chao, Thomas; Fazio, Gennaro; Shu, Huairui; Zhong, Gan-Yuan; Cheng, Lailiang; Fei, Zhangjun; Chen, Xuesen

2017-08-15

Human selection has reshaped crop genomes. Here we report an apple genome variation map generated through genome sequencing of 117 diverse accessions. A comprehensive model of apple speciation and domestication along the Silk Road is proposed based on evidence from diverse genomic analyses. Cultivated apples likely originate from Malus sieversii in Kazakhstan, followed by intensive introgressions from M. sylvestris. M. sieversii in Xinjiang of China turns out to be an "ancient" isolated ecotype not directly contributing to apple domestication. We have identified selective sweeps underlying quantitative trait loci/genes of important fruit quality traits including fruit texture and flavor, and provide evidences supporting a model of apple fruit size evolution comprising two major events with one occurring prior to domestication and the other during domestication. This study outlines the genetic basis of apple domestication and evolution, and provides valuable information for facilitating marker-assisted breeding and apple improvement.Apple is one of the most important fruit crops. Here, the authors perform deep genome resequencing of 117 diverse accessions and reveal comprehensive models of apple origin, speciation, domestication, and fruit size evolution as well as candidate genes associated with important agronomic traits.

Cost-benefit trade-offs of bird activity in apple orchards

PubMed Central

Saunders, Manu E.; Luck, Gary W.

2016-01-01

Birds active in apple orchards in south–eastern Australia can contribute positively (e.g., control crop pests) or negatively (e.g., crop damage) to crop yields. Our study is the first to identify net outcomes of these activities, using six apple orchards, varying in management intensity, in south–eastern Australia as a study system. We also conducted a predation experiment using real and artificial codling moth (Cydia pomonella) larvae (a major pest in apple crops). We found that: (1) excluding birds from branches of apple trees resulted in an average of 12.8% more apples damaged by insects; (2) bird damage to apples was low (1.9% of apples); and (3) when trading off the potential benefits (biological control) with costs (bird damage to apples), birds provided an overall net benefit to orchard growers. We found that predation of real codling moth larvae was higher than for plasticine larvae, suggesting that plasticine prey models are not useful for inferring actual predation levels. Our study shows how complex ecological interactions between birds and invertebrates affect crop yield in apples, and provides practical strategies for improving the sustainability of orchard systems. PMID:27413639

Effects of Spinal Cord Injury in Heart Rate Variability After Acute and Chronic Exercise: A Systematic Review.

PubMed

Buker, Daniel Bueno; Oyarce, Cristóbal Castillo; Plaza, Raúl Smith

2018-01-01

Background: Spinal cord injury (SCI) above T6 is followed by a loss of sympathetic supraspinal control of the heart, disturbing the autonomic balance and increasing cardiovascular risk. Heart rate variability (HRV) is a widely used tool for assessing the cardiac autonomic nervous system and positive adaptations after regular exercise in able-bodied subjects. However, adaptations in SCI subjects are not well known. Objectives: To compare HRV between able-bodied and SCI subjects and analyze the effects of chronic and acute exercise on HRV in the SCI group. Methods: We searched MEDLINE, Embase, Web of Science, SciELO, and Google Scholar databases to July 2016. We selected English and Spanish observational or experimental studies reporting HRV after training or acute exercise in SCI patients. We also included studies comparing HRV in SCI individuals with able-bodied subjects. Animal studies and nontraumatic SCI studies were excluded. We screened 279 articles by title and abstract; of these, we fully reviewed 29 articles. Eighteen articles fulfilled criteria for inclusion in this study. Results: SCI individuals showed lower HRV values in the low frequency band compared to able-bodied subjects. Regular exercise improved HRV in SCI subjects, however time and intensity data were lacking. HRV decreases after an acute bout of exercise on SCI subjects, but recovery kinetics are unknown. Conclusion: HRV is affected following SCI. Able-bodied subjects and SCI individuals have different values of HRV. Acute bouts of exercise change HRV temporarily, and chronic exercise might improve autonomic balance in SCI.

Overview of the Spinal Cord Injury--Quality of Life (SCI-QOL) measurement system.

PubMed

Tulsky, David S; Kisala, Pamela A; Victorson, David; Tate, Denise G; Heinemann, Allen W; Charlifue, Susan; Kirshblum, Steve C; Fyffe, Denise; Gershon, Richard; Spungen, Ann M; Bombardier, Charles H; Dyson-Hudson, Trevor A; Amtmann, Dagmar; Kalpakjian, Claire Z; Choi, Seung W; Jette, Alan M; Forchheimer, Martin; Cella, David

2015-05-01

The Spinal Cord Injury--Quality of Life (SCI-QOL) measurement system was developed to address the shortage of relevant and psychometrically sound patient reported outcome (PRO) measures available for clinical care and research in spinal cord injury (SCI) rehabilitation. Using a computer adaptive testing (CAT) approach, the SCI-QOL builds on the Patient Reported Outcomes Measurement Information System (PROMIS) and the Quality of Life in Neurological Disorders (Neuro-QOL) initiative. This initial manuscript introduces the background and development of the SCI-QOL measurement system. Greater detail is presented in the additional manuscripts of this special issue. Classical and contemporary test development methodologies were employed. Qualitative input was obtained from individuals with SCI and clinicians through interviews, focus groups, and cognitive debriefing. Item pools were field tested in a multi-site sample (n=877) and calibrated using item response theory methods. Initial reliability and validity testing was performed in a new sample of individuals with traumatic SCI (n=245). Five Model SCI System centers and one Department of Veterans Affairs Medical Center across the United States. Adults with traumatic SCI. n/a n/a The SCI-QOL consists of 19 item banks, including the SCI-Functional Index banks, and 3 fixed-length scales measuring physical, emotional, and social aspects of health-related QOL (HRQOL). The SCI-QOL measurement system consists of psychometrically sound measures for individuals with SCI. The manuscripts in this special issue provide evidence of the reliability and initial validity of this measurement system. The SCI-QOL also links to other measures designed for a general medical population.

Transformation of apple (Malus × domestica) using mutants of apple acetolactate synthase as a selectable marker and analysis of the T-DNA integration sites.

PubMed

Yao, Jia-Long; Tomes, Sumathi; Gleave, Andrew P

2013-05-01

Apple acetolactate synthase mutants were generated by site-specific mutagenesis and successfully used as selection marker in tobacco and apple transformation. T-DNA/Apple genome junctions were analysed using genome-walking PCR and sequencing. An Agrobacterium-mediated genetic transformation system was developed for apple (Malus × domestica), using mutants of apple acetolactate synthase (ALS) as a selectable marker. Four apple ALS mutants were generated by site-specific mutagenesis and subsequently cloned under the transcriptional control of the CaMV 35S promoter and ocs 3' terminator, in a pART27-derived plant transformation vector. Three of the four mutations were found to confer resistance to the herbicide Glean(®), containing the active agent chlorsulfuron, in tobacco (Nicotiana tabacum) transformation. In apple transformation, leaf explants infected with Agrobacterium tumefaciens EHA105 containing one of the three ALS mutants resulted in the production of shoots on medium containing 2-8 μg L(-1) Glean(®), whilst uninfected wild-type explants failed to regenerate shoots or survive on medium containing 1 and 3 μg L(-1) Glean(®), respectively. Glean(®)-resistant, regenerated shoots were further multiplied and rooted on medium containing 10 μg L(-1) Glean(®). The T-DNA and apple genome-DNA junctions from eight rooted transgenic apple plants were analysed using genome-walking PCR amplification and sequencing. This analysis confirmed T-DNA integration into the apple genome, identified the genome integration sites and revealed the extent of any vector backbone integration, T-DNA rearrangements and deletions of apple genome DNA at the sites of integration.

Schizosaccharomyces pombe and Saccharomyces cerevisiae yeasts in sequential fermentations: Effect on phenolic acids of fermented Kei-apple (Dovyalis caffra L.) juice.

PubMed

Minnaar, P P; Jolly, N P; Paulsen, V; Du Plessis, H W; Van Der Rijst, M

2017-09-18

Kei-apple (Dovyalis caffra) is an evergreen tree indigenous to Southern Africa. The fruit contains high concentrations of l-malic acid, ascorbic acid, and phenolic acids. Kei-apple juice was sequentially inoculated with Schizosaccharomyces pombe and Saccharomyces cerevisiae yeasts. A reference fermentation using only S. cerevisiae was included. The fermentation was monitored by recording mass loss. At the end of fermentation, twelve untrained judges conducted free choice aroma profiling on the fruit wines. The Kei-apple juice and wines were analysed for total titratable acidity, total soluble solids, pH, alcohol, l-malic acid, and phenolic acids. Total titratable acidity was ca. 70% lower in Kei-apple wines produced with S. pombe+S. cerevisiae than in Kei-apple juice. Kei-apple wines produced with S. pombe+S. cerevisiae showed substantially lower concentrations of l-malic acid than Kei-apple wines produced with S. cerevisiae only. Wines produced with S. cerevisiae only proved higher in phenolic acid concentrations than wines produced with S. pombe+S. cerevisiae. Chlorogenic acid was the most abundant phenolic acid measured in the Kei-apple wines, followed by protocatechuic acid. Judges described the Kei-apple wines produced with S. pombe+S. cerevisiae as having noticeable off-odours, while wines produced with S. cerevisiae were described as fresh and fruity. Kei-apple wines (S. pombe+S. cerevisiae and S. cerevisiae) were of comparable vegetative and organic character. Saccharomyces cerevisiae produced Kei-apple wine with increased caffeic, chlorogenic, protocatechuic, and sinapic acids, whereas S. pombe+S. cerevisiae produced Kei-apple wines with increased ferulic, and p-coumaric acids and low l-malic acid. Copyright © 2017 Elsevier B.V. All rights reserved.

Bacterial susceptibility patterns in patients with spinal cord injury and disorder (SCI/D): an opportunity for customized stewardship tools.

PubMed

Suda, K J; Patel, U C; Sabzwari, R; Cao, L; Ramanathan, S; Hill, J N; Evans, C T

2016-11-01

Retrospective observational study of bacterial susceptibilities in Veterans with SCI/D as compared to a general patient population. The purpose of this project was to evaluate the prevalence and susceptibility of bacteria isolated from spinal cord injury and disorder (SCI/D) patients as compared with a general patient population and determine whether a SCI/D-specific antibiogram, a report of bacterial susceptibilities used to guide empiric antibiotic selection, would be a useful stewardship tool. Veterans Affairs Medical Center located in Cook county, IL, USA. Microbiology reports from 1 October 2012 to 30 September 2013 were compiled into a SCI/D-specific antibiogram and compared to a non-SCI/D antibiogram. Persons with positive cultures and SCI/D were younger and had a higher Charlson Index as compared to non-SCI/D patients (P<0.0001 for both). Five thousand one hundred and thirty-one unique isolate cultures were evaluated (SCI/D=23.0%). Frequencies of pathogens isolated in SCI/D and non-SCI/D differed. Methicillin-resistant Staphylococcus aureus occurred more frequently in SCI/D (27.8% vs 55.4%; P<0.0001). Gram-negatives had generally lower susceptibilities in SCI/D and a higher frequency of organisms producing extended-spectrum Beta-lactamases (17.6% vs 5.0%; P<0.0001), carbapenem-resistant Enterobacteriaceae (2.4% vs 0.5%; P<0.0001), carbapenem resistance (7.6% vs 2.4%; P<0.0001) and isolates resistant to ⩾3 antibiotic classes (60.7% vs 28.0%; P=0.0001). Different pathogens with poorer susceptibilities are isolated in SCI/D. Thus an SCI/D-specific antibiogram reflective of resistance patterns in these patients may increase the appropriateness of empiric antibiotic selection. The frequency of multi-drug resistant organisms in cultures obtained from patients with SCI/D is worrisome.

Tracking functional status across the spinal cord injury lifespan: linking pediatric and adult patient-reported outcome scores.

PubMed

Tian, Feng; Ni, Pengsheng; Mulcahey, M J; Hambleton, Ronald K; Tulsky, David; Haley, Stephen M; Jette, Alan M

2014-11-01

To use item response theory (IRT) methods to link scores from 2 recently developed contemporary functional outcome measures, the adult Spinal Cord Injury-Functional Index (SCI-FI) and the Pedi SCI (both the parent version and the child version). Secondary data analysis of the physical functioning items of the adult SCI-FI and the Pedi SCI instruments. We used a nonequivalent group design with items common to both instruments and the Stocking-Lord method for the linking. Linking was conducted so that the adult SCI-FI and Pedi SCI scaled scores could be compared. Community. This study included a total sample of 1558 participants. Pedi SCI items were administered to a sample of children (n=381) with SCI aged 8 to 21 years, and of parents/caregivers (n=322) of children with SCI aged 4 to 21 years. Adult SCI-FI items were administered to a sample of adults (n=855) with SCI aged 18 to 92 years. Not applicable. Five scales common to both instruments were included in the analysis: Wheelchair, Daily Routine/Self-care, Daily Routine/Fine Motor, Ambulation, and General Mobility functioning. Confirmatory factor analysis and exploratory factor analysis results indicated that the 5 scales are unidimensional. A graded response model was used to calibrate the items. Misfitting items were identified and removed from the item banks. Items that function differently between the adult and child samples (ie, exhibit differential item functioning) were identified and removed from the common items used for linking. Domain scores from the Pedi SCI instruments were transformed onto the adult SCI-FI metric. This IRT linking allowed estimation of adult SCI-FI scale scores based on Pedi SCI scale scores and vice versa; therefore, it provides clinicians with a means of tracking long-term functional data for children with an SCI across their entire lifespan. Copyright © 2014 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

Report of Freshwater Mussels Workshop Held at St. Louis, Missouri on 26-27 October 1982.

DTIC Science & Technology

1983-10-01

I was accosted by a toddler armed .. with a large red apple, a double handful for him. The apple was brought down on my knee with all the force the...my best diction. "Apple!" the youngster cried, "Apple, apple, apple!" banging my knee in perfect time. Then back to his mother down the aisle he...neither simple nor perfect, but it is available and should be used. One of the basic rules , perhaps the basic rule , of the International Code of

Towards improved photovoltaic conversion using dilute magnetic semiconductors (abstract only)

NASA Astrophysics Data System (ADS)

Olsson, Pär; Guillemoles, J.-F.; Domain, C.

2008-02-01

Present photovoltaic devices, based on p/n junctions, are limited from first principles to maximal efficiencies of 31% (40% under full solar concentration; Shockley and Queisser 1961 J. Appl. Phys. 32 510). However, more innovative schemes may overcome the Shockley-Queisser limit since the theoretical maximal efficiency of solar energy conversion is higher than 85% (Harder and Würfel 2003 Semicond. Sci. Technol. 18 S151). To date, the only practical realization of such an innovative scheme has been multi-junction devices, which at present hold the world record for efficiency at nearly 41% at significant solar concentration (US DOE news site: http://www.energy.gov/news/4503.htm). It has been proposed that one could make use of the solar spectrum in much the same way as the multi-junction devices do but in a single cell, using impurity induced intermediate levels to create gaps of different sizes. This intermediate level semiconductor (ILSC) concept (Green and Wenham 1994 Appl. Phys. Lett. 65 2907; Luque and Martí1997 Phys. Rev. Lett. 78 5014) has a maximal efficiency similar to that of multi-junction devices but suffers from prohibitively large non-radiative recombination rates. We here propose to use a ferromagnetic impurity scheme in order to reduce the non-radiative recombination rates while maintaining the high theoretical maximum efficiency of the ILSC scheme, that is about 46%. Using density functional theory calculations, the electronic and energetic properties of transition metal impurities for a wide range of semiconductors have been analysed. Of the several hundred compounds studied, only a few fulfil the design criteria that we present here. As an example, wide gap AlP is one of the most promising compounds. It was found that inclusion of significant amounts of Mn in AlP induces band structures providing conversion efficiencies potentially close to the theoretical maximum, with an estimated Curie temperature reaching above 100 K.

Consumption of various forms of apples is associated with a better nutrient intake and improved nutrient adequacy in diets of children: National Health and Nutrition Examination Survey 2003–2010

PubMed Central

Nicklas, Theresa A.; O'Neil, Carol E.; Fulgoni, Victor L.

2015-01-01

Background Consumption of fruit has been associated with a variety of health benefits, yet, 75% of children have usual intakes of total fruit below minimum recommended amounts. Apples are the second most commonly consumed fruit in the United States; however, no studies have examined the impact of apple consumption on nutrient intake and adequacy in children's diets. Objective The purpose of this study is to examine the association between apple (various forms) consumption with nutrient intake and nutrient adequacy in a nationally representative sample of children. Design Participants were children aged 2–18 years (n=13,339), from the National Health and Nutrition Examination Survey 2003–2010. Least square means of total energy and nutrient intake, and the percentage of the population below the estimated average requirement (EAR) or above the adequate intake (AI) among apple consumers and non-consumers were examined. Results Consumers of total apple products had higher (p<0.01) total intakes of fiber, magnesium, and potassium and lower intakes of total fat, saturated fatty acids, monounsaturated fatty acid, and sodium than non-consumers. Apple consumers had higher (p<0.01) total sugar intake, but lower intake of added sugars compared to non-consumers. A lower (p<0.01) percentage of apple consumers were below the EAR for 13 of the 16 nutrients studied. Apple consumers had approximately a 10 percentage unit difference below the EAR for calcium and magnesium, and vitamins A, C, D, and E, than non-consumers. The percentage above the AI for fiber was significantly (p<0.0001) higher among total apple consumers (6.24±0.45 g) compared to non-consumers (0.57±0.07 g). The results were similar for individual apple products (i.e. apple juice, applesauce, and whole apples). Conclusion Consumption of any forms of apples provided valuable nutrients in the diets of children. PMID:26445211

Consumption of various forms of apples is associated with a better nutrient intake and improved nutrient adequacy in diets of children: National Health and Nutrition Examination Survey 2003-2010.

PubMed

Nicklas, Theresa A; O'Neil, Carol E; Fulgoni, Victor L

2015-01-01

Consumption of fruit has been associated with a variety of health benefits, yet, 75% of children have usual intakes of total fruit below minimum recommended amounts. Apples are the second most commonly consumed fruit in the United States; however, no studies have examined the impact of apple consumption on nutrient intake and adequacy in children's diets. The purpose of this study is to examine the association between apple (various forms) consumption with nutrient intake and nutrient adequacy in a nationally representative sample of children. Participants were children aged 2-18 years (n=13,339), from the National Health and Nutrition Examination Survey 2003-2010. Least square means of total energy and nutrient intake, and the percentage of the population below the estimated average requirement (EAR) or above the adequate intake (AI) among apple consumers and non-consumers were examined. Consumers of total apple products had higher (p<0.01) total intakes of fiber, magnesium, and potassium and lower intakes of total fat, saturated fatty acids, monounsaturated fatty acid, and sodium than non-consumers. Apple consumers had higher (p<0.01) total sugar intake, but lower intake of added sugars compared to non-consumers. A lower (p<0.01) percentage of apple consumers were below the EAR for 13 of the 16 nutrients studied. Apple consumers had approximately a 10 percentage unit difference below the EAR for calcium and magnesium, and vitamins A, C, D, and E, than non-consumers. The percentage above the AI for fiber was significantly (p<0.0001) higher among total apple consumers (6.24±0.45 g) compared to non-consumers (0.57±0.07 g). The results were similar for individual apple products (i.e. apple juice, applesauce, and whole apples). Consumption of any forms of apples provided valuable nutrients in the diets of children.

FRAUD/SABOTAGE Killing Nuclear-Reactors!!! ``Super"alloys GENERIC ENDEMIC Wigner's-Disease IN-stability!!!

NASA Astrophysics Data System (ADS)

Asphahani, Aziz; Siegel, Sidney; Siegel, Edward

2010-03-01

Siegel [[J.Mag.Mag.Mtls.7,312(78); PSS(a)11,45(72); Semis.& Insuls.5(79)] (at: ORNL, ANS, Westin``KL"ouse, PSEG, IAEA, ABB) warning of old/new nuclear-reactors/spent-fuel-casks/refineries/ jet/missile/rocket-engines austenitic/FCC Ni/Fe-based (so MIS- called)``super"alloys(182/82;Hastelloy-X; 600;304/304L-SSs; 690 !!!) GENERIC ENDEMIC EXTANT detrimental(synonyms): Wigner's- diseas(WD)[J.Appl.Phys.17,857(46)]; Ostwald-ripening; spinodal- decomposition; overageing-embrittlement; thermomechanical- INstability: Mayo[Google: ``If Leaks Could Kill"; at flickr.com search on ``Giant-Magnotoresistance"; find: [Siegel<<<``Fert"(88) 2007-Nobel/Wolf/Japan-prizes]necessitating NRC inspections on 40+25=65 Westin``KL"ouse PWRs(12/06)]; Lai[Met.Trans.AIME,9A,827 (78)]-Sabol-Stickler[PSS(70)]; Ashpahani[Intl.Conf. H in Metals (77)]; Russell[Prog. Mtls.Sci.(83)]; Pollard[last UCS rept. (9/95)]; Lofaro[BNL/DOE/NRC Repts.]; Pringle[Nuclear-Power:From Physics to Politics(79)]; Hoffman[animatedsoftware.com],...what DOE/NRC MISlabels as ``butt-welds" ``stress-corrosion cracking" endpoint's ROOT-CAUSE ULTIMATE-ORIGIN is WD overageing-embrit- tlement caused brittle-fracture cracking from early/ongoing AEC/DOE-n``u''tional-la``v''atories sabotage!!!

FRAUD/SABOTAGE Killing Nuclear-Reactors Need Modeling!!!: "Super"alloys GENERIC ENDEMIC Wigner's-Disease/.../IN-stability: Ethics? SHMETHICS!!!

NASA Astrophysics Data System (ADS)

Asphahani, Aziz; Siegel, Sidney; Siegel, Edward

2010-03-01

Carbides solid-state chemistry domination of old/new nuclear- reactors/spent-fuel-casks/refineries/jet/missile/rocket-engines in austenitic/FCC Ni/Fe-based(so miscalled)``super"alloys(182/82; Hastelloy-X,600,304/304L-SSs,...,690!!!) GENERIC ENDEMIC EXTANT detrimental(synonyms): Wigner's-diseas(WD)[J.Appl.Phys.17,857 (1946)]/Ostwald-ripening/spinodal-decomposition/overageing- embrittlement/thermal-leading-to-mechanical(TLTM)-INstability: Mayo[Google:``If Leaks Could Kill"; at flickr.com search on ``Giant-Magnotoresistance"; find: Siegel[J.Mag.Mag.Mtls.7,312 (1978)]<<<``Fert"-"Gruenberg"(1988/89)2007-physics Nobel/Wolf/ Japan-prizes]necessitating NRC-inspections of 40+25 = 65 Westin- ``KLouse PWRs(12/2006)]-Lai[Met.Trans.AIME,9A,827(1978)]-Sabol- Stickler[Phys.Stat.Sol.(1970)]-Ashpahani[Intl.Conf. H in Metals, Paris(1977]-Russell[Prog.Mtls.Sci.(1983)]-Pollard[last UCS rept. (9/1995)]-Lofaro[BNL/DOE/NRC Repts.]-Pringle[Nuclear-Power:From Physics to Politics(1979)]-Hoffman[animatedsoftware.com], what DOE/NRC MISlabels as ``butt-welds" ``stress-corrosion cracking" endpoint's ROOT-CAUSE ULTIMATE-ORIGIN is WD overageing-embritt- lement caused brittle-fracture cracking from early/ongoing AEC/ DOE-n"u"tional-la"v"atories sabotage!!!

FRAUD/SABOTAGE Killing Nuclear-Reactors Need Modeling!!!: ``Super'' alloys GENERIC ENDEMIC Wigner's-Disease/.../IN-stability: Ethics? SHMETHICS!!!

NASA Astrophysics Data System (ADS)

O'Grady, Joseph; Bument, Arlden; Siegel, Edward

2011-03-01

Carbides solid-state chemistry domination of old/new nuclear-reactors/spent-fuel-casks/refineries/jet/missile/rocket-engines is austenitic/FCC Ni/Fe-based (so miscalled)"super"alloys(182/82;Hastelloy-X,600,304/304L-SSs,...690!!!) GENERIC ENDEMIC EXTANT detrimental(synonyms): Wigner's-disease(WD) [J.Appl.Phys.17,857 (46)]/Ostwald-ripening/spinodal-decomposition/overageing-embrittlement/thermal-leading-to-mechanical(TLTM)-INstability: Mayo[Google: fLeaksCouldKill > ; - Siegel [ J . Mag . Mag . Mtls . 7 , 312 (78) = atflickr . comsearchonGiant - Magnotoresistance [Fert" [PRL(1988)]-"Gruenberg"[PRL(1989)] 2007-Nobel]necessitating NRC inspections on 40+25=65 Westin"KL"ouse PWRs(12/2006)]-Lai [Met.Trans.AIME, 9A,827(78)]-Sabol-Stickler[Phys.Stat.Sol.(70)]-Ashpahani[ Intl.Conf. Hydrogen in Metals, Paris(1977]-Russell [Prog.Mtls.Sci.(1983)]-Pollard [last UCS rept.(9/1995)]-Lofaro [BNL/DOE/NRC Repts.]-Pringle [ Nuclear-Power:From Physics to Politics(1979)]-Hoffman [animatedsoftware.com], what DOE/NRC MISlabels as "butt-welds" "stress-corrosion cracking" endpoint's ROOT-CAUSE ULTIMATE-ORIGIN is WD overageing-embrittlement caused brittle-fracture cracking from early/ongoing AEC/DOE-n"u"tional-la"v"atories sabotage!!!

A new approach to the inverse problem for current mapping in thin-film superconductors

NASA Astrophysics Data System (ADS)

Zuber, J. W.; Wells, F. S.; Fedoseev, S. A.; Johansen, T. H.; Rosenfeld, A. B.; Pan, A. V.

2018-03-01

A novel mathematical approach has been developed to complete the inversion of the Biot-Savart law in one- and two-dimensional cases from measurements of the perpendicular component of the magnetic field using the well-developed Magneto-Optical Imaging technique. Our approach, especially in the 2D case, is provided in great detail to allow a straightforward implementation as opposed to those found in the literature. Our new approach also refines our previous results for the 1D case [Johansen et al., Phys. Rev. B 54, 16264 (1996)], and streamlines the method developed by Jooss et al. [Physica C 299, 215 (1998)] deemed as the most accurate if compared to that of Roth et al. [J. Appl. Phys. 65, 361 (1989)]. We also verify and streamline the iterative technique, which was developed following Laviano et al. [Supercond. Sci. Technol. 16, 71 (2002)] to account for in-plane magnetic fields caused by the bending of the applied magnetic field due to the demagnetising effect. After testing on magneto-optical images of a high quality YBa2Cu3O7 superconducting thin film, we show that the procedure employed is effective.

Numerical algorithms for cold-relativistic plasma models in the presence of discontinuties

NASA Astrophysics Data System (ADS)

Hakim, Ammar; Cary, John; Bruhwiler, David; Geddes, Cameron; Leemans, Wim; Esarey, Eric

2006-10-01

A numerical algorithm is presented to solve cold-relativistic electron fluid equations in the presence of sharp gradients and discontinuities. The intended application is to laser wake-field accelerator simulations in which the laser induces accelerating fields thousands of times those achievable in conventional RF accelerators. The relativistic cold-fluid equations are formulated as non-classical system of hyperbolic balance laws. It is shown that the flux Jacobian for this system can not be diagonalized which causes numerical difficulties when developing shock-capturing algorithms. Further, the system is shown to admit generalized delta-shock solutions, first discovered in the context of sticky-particle dynamics (Bouchut, Ser. Adv. Math App. Sci., 22 (1994) pp. 171--190). A new approach, based on relaxation schemes proposed by Jin and Xin (Comm. Pure Appl. Math. 48 (1995) pp. 235--276) and LeVeque and Pelanti (J. Comput. Phys. 172 (2001) pp. 572--591) is developed to solve this system of equations. The method consists of finding an exact solution to a Riemann problem at each cell interface and coupling these to advance the solution in time. Applications to an intense laser propagating in an under-dense plasma are presented.

New biotechnological tools to accelerate scab-resistance trait transfer to apple

PubMed Central

Cusin, Roberta; Revers, Luís Fernando; Maraschin, Felipe dos Santos

2017-01-01

Abstract Apple is a fruit crop cultivated worldwide. Apple orchards are exposed to a diverse set of environmental and biological factors that affect the productivity and sustainability of the culture. Many of the efforts and costs for apple production rely on reducing the incidence of fungal diseases, and one of the main diseases is apple scab caused by the fungus Venturia inaequalis. The economic impact of scab on apple productivity has guided many breeding programs to search for cultivars resistant to apple scab. Introgression from wild relatives has been successful to some extent, and genetic engineering for resistant cultivars has even been employed. This review presents the techniques used to the present time to obtain pathogen-resistant apple cultivars and introduces new biotechnological approaches based on plant plasmids that show promising results for delivering genetic traits with a short-term perspective. PMID:28199444

Nondestructive Detection of the Internalquality of Apple Using X-Ray and Machine Vision

NASA Astrophysics Data System (ADS)

Yang, Fuzeng; Yang, Liangliang; Yang, Qing; Kang, Likui

The internal quality of apple is impossible to be detected by eyes in the procedure of sorting, which could reduce the apple’s quality reaching market. This paper illustrates an instrument using X-ray and machine vision. The following steps were introduced to process the X-ray image in order to determine the mould core apple. Firstly, lifting wavelet transform was used to get a low frequency image and three high frequency images. Secondly, we enhanced the low frequency image through image’s histogram equalization. Then, the edge of each apple's image was detected using canny operator. Finally, a threshold was set to clarify mould core and normal apple according to the different length of the apple core’s diameter. The experimental results show that this method could on-line detect the mould core apple with less time consuming, less than 0.03 seconds per apple, and the accuracy could reach 92%.

Apples prevent mammary tumors in rats.

PubMed

Liu, Rui Hai; Liu, Jiaren; Chen, Bingqing

2005-03-23

Regular consumption of fruits and vegetables has been consistently shown to be associated with reduced risk of developing chronic diseases such as cancer and cardiovascular disease. Apples are commonly consumed and are the major contributors of phytochemicals in human diets. It was previously reported that apple extracts exhibit strong antioxidant and antiproliferative activities and that the major part of total antioxidant activity is from the combination of phytochemicals. Phytochemicals, including phenolics and flavonoids, are suggested to be the bioactive compounds contributing to the health benefits of apples. Here it is shown that whole apple extracts prevent mammary cancer in a rat model in a dose-dependent manner at doses comparable to human consumption of one, three, and six apples a day. This study demonstrated that whole apple extracts effectively inhibited mammary cancer growth in the rat model; thus, consumption of apples may be an effective strategy for cancer protection.

Physical and sensory properties of ready to eat apple chips produced by osmo-convective drying.

PubMed

Velickova, Elena; Winkelhausen, Eleonora; Kuzmanova, Slobodanka

2014-12-01

The low cost raw material, apple variety Idared, was turned into value-added product, apple chips. The apple chips were produced in a two-step process consisting of osmotic treatment and conventional drying. Osmotic treatment was carried out in 40 % glucose solution at room temperature, followed by convective drying at 105 °C, till reaching water activity of 0.3. Mechanical properties of the apple chips measured by compression and penetration tests were correlated with the sorption properties. The low browning index, 25.5 and high whitening index, 63.7, proved the good retention of the color of the apple chips. The instrumental characteristics of the apple chips were correlated with the sensory characteristics of the product. The new product was accepted by the 95 % of the panelists. The stored apple chips under modified atmosphere showed no significant changes in the quality parameters over 6 month period.

7 CFR 319.56-27 - Apples from Japan and the Republic of Korea.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 7 Agriculture 5 2014-01-01 2014-01-01 false Apples from Japan and the Republic of Korea. 319.56-27... § 319.56-27 Apples from Japan and the Republic of Korea. Any variety of Malus domestica apples may be imported into the United States from Japan, and Fuji variety apples may be imported into the United States...

7 CFR 319.56-27 - Apples from Japan and the Republic of Korea.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 7 Agriculture 5 2012-01-01 2012-01-01 false Apples from Japan and the Republic of Korea. 319.56-27... § 319.56-27 Apples from Japan and the Republic of Korea. Any variety of Malus domestica apples may be imported into the United States from Japan, and Fuji variety apples may be imported into the United States...

7 CFR 319.56-27 - Apples from Japan and the Republic of Korea.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 7 Agriculture 5 2013-01-01 2013-01-01 false Apples from Japan and the Republic of Korea. 319.56-27... § 319.56-27 Apples from Japan and the Republic of Korea. Any variety of Malus domestica apples may be imported into the United States from Japan, and Fuji variety apples may be imported into the United States...

7 CFR 319.56-27 - Apples from Japan and the Republic of Korea.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 5 2011-01-01 2011-01-01 false Apples from Japan and the Republic of Korea. 319.56-27... § 319.56-27 Apples from Japan and the Republic of Korea. Any variety of Malus domestica apples may be imported into the United States from Japan, and Fuji variety apples may be imported into the United States...

Developing Inventory Records Using the AppleWorks Data Base Subprogram and Apple IIe or GS Computers.

ERIC Educational Resources Information Center

Schlenker, Richard M.

This manual is a "how to" training device for developing inventory records in the AppleWorks program using an Apple IIe or Apple IIGS Computer with Duodisk or two disk drives and an 80-column card. The manual provides step-by-step directions, and includes 17 figures depicting the computer screen at the various stages of the inventory…

X-ray micro-computer tomographic method to visualize the microstructure of different apple cultivars.

PubMed

Ting, Valentina J L; Silcock, Patrick; Bremer, Phil J; Biasioli, Franco

2013-11-01

Apples are appreciated for their texture with firmness acting as an indicator of quality. During prolonged storage, apples can soften and their texture can become undesirably mealy. Using an X-ray microcomputer tomography (μ-CT) scanner, the porosity (ratio of intercellular space [IS] to total volume) and the structural arrangement of the parenchyma tissue of 4 apple cultivars (Braeburn, Fuji, Golden Delicious, Jazz) stored under similar conditions for 100 d were visualized via the development of 2D and 3D images. The texture of the apples was also measured using a puncture test. The morphometric and textural measurements revealed that firm Jazz apples (flesh firmness: 29.84N) had a lower porosity (17%) compared to soft Golden Delicious apples (flesh firmness: 14.16N; porosity: 29.8%). In general, firm apples had a higher dry matter (%) and a lower porosity (%), while the reverse was true for softer apples. However, this was not an absolute trend as cultivar specific differences in the microstructural organization and consequent mechanical strength of the parenchyma tissue also influenced firmness. For example, although Fuji apples were firm (28.42N), they had a high porosity (29.3%) due to the presence of numerous small and compact IS. In comparison, soft Golden Delicious apples had a high porosity (29.8%) due to the presence of large, interconnected IS. Imaging technologies have the potential to provide a pictorial or graphical database showing the size range distribution of IS corresponding to different parenchyma tissue types and how they relate to apple texture and eating quality. © 2013 Institute of Food Technologists®

Soft x-ray microscopy and extreme ultraviolet lithography: Imaging in the 20-50 nm regime (abstract) (invited)

NASA Astrophysics Data System (ADS)

Attwood, David

2002-03-01

Advances in short wavelength optics, covering the range from 1 to 14 nm, are providing new results and new opportunities. Zone plate lenses [E. Anderson et al., J. Vac. Sci. Techno. B 18, 2970 (2000)] for soft x-ray microscopy [G. Denbeaux, Rev. Sci. Instrum. (these proceedings); W. Chao, Proc. SPIE 4146, 171 (2000)] are now made to high accuracy with outer zone widths of 25 nm, and demonstrated resolution of 23 nm with proper illumination and stability. These permit important advances in the study of protein specific transport and structure in the life sciences [C. Larabell (private communication); W. Meyer-Ilse et al., J. Microsc. 201, 395 (2001)] and the study of magnetic materials [P. Fischer et al., J. Synchrotron. Radiat. 8, 325 (2001)] with elemental sensitivity at the resolution of individual domains. Major corporations (members of the EUV Limited Liability Company are Intel, Motorola, AMD, Micron, Infineon, and IBM) are now preparing the path for the fabrication of future computer chips, in the years 2007 and beyond, using multilayer coated reflective optics, which achieve reflectivities of 70% in the 11-14 nm region [T. Barbee et al., Appl. Opt. 24, 883 (1985); C. Montcalm et al., Proc. SPIE 3676, 710 (1999)]. These coated optics are to be incorporated in extreme ultraviolet (EUV) print cameras, known as "steppers." Electronic patterns with features in the range of 50-70 nm have been printed. The first alpha tool stepper recently demonstrated all critical technologies [D. Tichenor et al., Proc. SPIE 4343, 19 (2001)] needed for EUV lithography. Preproduction beta tools are targeted for delivery by leading suppliers [ASML, the Netherlands, at the SPIE Microlithography Conference, Santa Clara, CA, March 2001] in 2004, with high volume production tools available in late 2006 for manufacturing in 2007. New results in these two areas will be discussed in the context of the synergy of science and technology.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Benson, N.R.; Covey, R.P. Jr.; Haglund, W.

The growth of apple seedlings (Malus domestica Brokh.) is negatively correlated with soil arsenic and zero growth occurs at about 450 ppm total arsenic. Soil arsenic concentrations less than 150 ppm, which are frequently found in orchard soils, contribute less to the replant problem than biological factors. Growth of apple trees was increased 50% or more by preplant soil fumigation with methyl bromide or trichloronitromethane (chloropicrin) in 87.5% of the trials in 17 apple orchard soils tested. Non-specific plant pathogens in orchard soils attack cereals as well as apple seedlings, but apple orchard soils also contain an entity that specificallymore » affects apples. This is probably the same unknown entity that is responsible for specific apple replant disease in Europe, Australia, and elsewhere.« less

Lipid Peroxidation and Its Role in the Expression of NLRP1a and NLRP3 Genes in Testicular Tissue of Male Rats: a Model of Spinal Cord Injury

PubMed

Bazrafkan, Mahshid; Nikmehr, Banafsheh; Shahverdi, Abdolhossein; Hosseini, Seyed Reza; Hassani, Fatemeh; Poorhassan, Mahnaz; Mokhtari, Tahmineh; Abolhassani, Farid; Choobineh, Hamid; Beyer, Cordian; Hassanzadeh, Gholamreza

2017-10-16

The majority of male patients with spinal cord injury (SCI) suffer from infertility. Nucleotide-binding oligomerization domain-like receptors NOD-like receptors (NLRs) are a kind of receptors that corporate in the inflammasome complex. Recent studies have introduced the inflammasome as the responsible agent for secreting cytokines in semen. Reactive oxygen species (ROS) is one of the elements that trigger inflammasome activation. Genital infections in SCI can lead to ROS generation. We investigated the relation between lipid peroxidation and inflammasome complex activity in testicular tissue of SCI rats. Adult male rats (n=20), weighting 200-250 g, were included and divided into four groups: three experimental groups, including SCI1, SCI3, and SCI7, i.e. the rats were subjected to SCI procedure and sacrificed after one, three, and seven days, respectively and a control group. We performed a moderate, midline spinal contusion injury at thoracic level 10. The animals were anesthetized, and testes were collected for measurement of gene expression by real-time PCR. Caudal parts of epididymis were collected for malondialdehyde (MDA) measurement. No NLRP1a mRNA over expression was seen in the testes of control and SCI groups. After seven days from SCI surgery, NLRP3 mRNA expression was significantly increased in SCI7 animals (P≤0.05). There was a significant difference in MDA level in SCI7 versus control group, as well as SCI1 and SCI3 animals (P≤0.05). NLRP3 overexpression occurs due to the increased ROS production in testicular tissue of SCI rats.

Lipid Peroxidation and Its Role in the Expression of NLRP1a and NLRP3 Genes in Testicular Tissue of Male Rats: A Model of Spinal Cord Injury

PubMed Central

Bazrafkan, Mahshid; Nikmehr, Banafsheh; Shahverdi, Abdolhossein; Hosseini, Seyed Reza; Hassani, Fatemeh; Poorhassan, Mahnaz; Mokhtari, Tahmineh; Abolhassani, Farid; Choobineh, Hamid; Beyer, Cordian; Hassanzadeh, Gholamreza

2018-01-01

Background: The majority of male patients with spinal cord injury (SCI) suffer from infertility. Nucleotide-binding oligomerization domain-like receptors NOD-like receptors (NLRs) are a kind of receptors that corporate in the inflammasome complex. Recent studies have introduced the inflammasome as the responsible agent for secreting cytokines in semen. Reactive oxygen species (ROS) is one of the elements that trigger inflammasome activation. Genital infections in SCI can lead to ROS generation. We investigated the relation between lipid peroxidation and inflammasome complex activity in testicular tissue of SCI rats. Methods: Adult male rats (n=20), weighting 200-250 g, were included and divided into four groups: three experimental groups, including SCI1, SCI3, and SCI7, i.e. the rats were subjected to SCI procedure and sacrificed after one, three, and seven days, respectively and a control group. We performed a moderate, midline spinal contusion injury at thoracic level 10. The animals were anesthetized, and testes were collected for measurement of gene expression by real-time PCR. Caudal parts of epididymis were collected for malondialdehyde (MDA) measurement. Results: No NLRP1a mRNA overexpression was seen in the testes of control and SCI groups. After seven days from SCI surgery, NLRP3 mRNA expression was significantly increased in SCI7 animals (p ≤ 0.05). There was a significant difference in MDA level in SCI7 versus control group, as well as SCI1 and SCI3 animals (p ≤ 0.05). Conclusion: NLRP3 overexpression occurs due to the increased ROS production in testis tissue of SCI rats

Overview of the Spinal Cord Injury – Quality of Life (SCI-QOL) measurement system

PubMed Central

Tulsky, David S.; Kisala, Pamela A.; Victorson, David; Tate, Denise G.; Heinemann, Allen W.; Charlifue, Susan; Kirshblum, Steve C.; Fyffe, Denise; Gershon, Richard; Spungen, Ann M.; Bombardier, Charles H.; Dyson-Hudson, Trevor A.; Amtmann, Dagmar; Z. Kalpakjian, Claire; W. Choi, Seung; Jette, Alan M.; Forchheimer, Martin; Cella, David

2015-01-01

Context/Objective The Spinal Cord Injury – Quality of Life (SCI-QOL) measurement system was developed to address the shortage of relevant and psychometrically sound patient reported outcome (PRO) measures available for clinical care and research in spinal cord injury (SCI) rehabilitation. Using a computer adaptive testing (CAT) approach, the SCI-QOL builds on the Patient Reported Outcomes Measurement Information System (PROMIS) and the Quality of Life in Neurological Disorders (Neuro-QOL) initiative. This initial manuscript introduces the background and development of the SCI-QOL measurement system. Greater detail is presented in the additional manuscripts of this special issue. Design Classical and contemporary test development methodologies were employed. Qualitative input was obtained from individuals with SCI and clinicians through interviews, focus groups, and cognitive debriefing. Item pools were field tested in a multi-site sample (n = 877) and calibrated using item response theory methods. Initial reliability and validity testing was performed in a new sample of individuals with traumatic SCI (n = 245). Setting Five Model SCI System centers and one Department of Veterans Affairs Medical Center across the United States. Participants Adults with traumatic SCI. Interventions n/a Outcome Measures n/a Results The SCI-QOL consists of 19 item banks, including the SCI-Functional Index banks, and 3 fixed-length scales measuring physical, emotional, and social aspects of health-related QOL (HRQOL). Conclusion The SCI-QOL measurement system consists of psychometrically sound measures for individuals with SCI. The manuscripts in this special issue provide evidence of the reliability and initial validity of this measurement system. The SCI-QOL also links to other measures designed for a general medical population. PMID:26010962

Circulating sclerostin is elevated in short-term and reduced in long-term SCI

PubMed Central

Battaglino, Ricardo A.; Sudhakar, Supreetha; Lazzari, Antonio; Garshick, Eric; Zafonte, Ross; Morse, Leslie R.

2012-01-01

Spinal cord injury (SCI) causes profound bone loss due to muscle paralysis resulting in the inability to walk. Sclerostin, a Wnt signaling pathway antagonist produced by osteocytes, is a potent inhibitor of bone formation. Short-term studies in rodent models have demonstrated increased sclerostin in response to mechanical unloading that is reversed with reloading. Although sclerostin inhibition has been proposed as a potential therapy for bone loss, it is not known if sclerostin levels vary with duration of SCI in humans. We analyzed circulating sclerostin in 155 men with varying degrees of SCI who were 1 year or more post-injury. We report that sclerostin levels are greatest in subjects with short-term SCI (≤ 5 years post-injury) and decrease significantly over the first 5 years post-injury. There was no association between sclerostin and injury duration in subjects with long-term SCI (> 5 years post-injury). In subjects with long-term SCI, sclerostin levels were positively associated with lower extremity bone density and bone mineral content. These data suggest that sclerostin levels in SCI are initially increased after SCI in response to mechanical unloading. This response is time-limited and as bone loss progresses, circulating sclerostin is lowest in subjects with severe osteoporosis. These findings support a dual role for sclerostin after SCI: a therapeutic target in acute SCI, and a biomarker of osteoporosis severity in chronic SCI. PMID:22575440

A simple theoretical model of heat and moisture transport in multi-layer garments in cool ambient air.

PubMed

Wissler, Eugene H; Havenith, George

2009-03-01

Overall resistances for heat and vapor transport in a multilayer garment depend on the properties of individual layers and the thickness of any air space between layers. Under uncomplicated, steady-state conditions, thermal and mass fluxes are uniform within the garment, and the rate of transport is simply computed as the overall temperature or water concentration difference divided by the appropriate resistance. However, that simple computation is not valid under cool ambient conditions when the vapor permeability of the garment is low, and condensation occurs within the garment. Several recent studies have measured heat and vapor transport when condensation occurs within the garment (Richards et al. in Report on Project ThermProject, Contract No. G6RD-CT-2002-00846, 2002; Havenith et al. in J Appl Physiol 104:142-149, 2008). In addition to measuring cooling rates for ensembles when the skin was either wet or dry, both studies employed a flat-plate apparatus to measure resistances of individual layers. Those data provide information required to define the properties of an ensemble in terms of its individual layers. We have extended the work of previous investigators by developing a rather simple technique for analyzing heat and water vapor transport when condensation occurs within a garment. Computed results agree well with experimental results reported by Richards et al. (Report on Project ThermProject, Contract No. G6RD-CT-2002-00846, 2002) and Havenith et al. (J Appl Physiol 104:142-149, 2008). We discuss application of the method to human subjects for whom the rate of sweat secretion, instead of the partial pressure of water on the skin, is specified. Analysis of a more complicated five-layer system studied by Yoo and Kim (Text Res J 78:189-197, 2008) required an iterative computation based on principles defined in this paper.

Learning by Creating and Exchanging Objects: The SCY Experience

ERIC Educational Resources Information Center

De Jong, Ton; Van Joolingen, Wouter R.; Giemza, Adam; Girault, Isabelle; Hoppe, Ulrich; Kindermann, Jorg; Kluge, Anders; Lazonder, Ard W.; Vold, Vibeke; Weinberger, Armin; Weinbrenner, Stefan; Wichmann, Astrid; Anjewierden, Anjo; Bodin, Marjolaine; Bollen, Lars; D'Ham, Cedric; Dolonen, Jan; Engler, Jan; Geraedts, Caspar; Grosskreutz, Henrik; Hovardas, Tasos; Julien, Rachel; Lechner, Judith; Ludvigsen, Sten; Matteman, Yuri; Meistadt, Oyvind; Naess, Bjorge; Ney, Muriel; Pedaste, Margus; Perritano, Anthony; Rinket, Marieke; Von Schlanbusch, Henrik; Sarapuu, Tago; Schulz, Florian; Sikken, Jakob; Slotta, Jim; Toussaint, Jeremy; Verkade, Alex; Wajeman, Claire; Wasson, Barbara; Zacharia, Zacharias C.; Van Der Zanden, Martine

2010-01-01

Science Created by You (SCY) is a project on learning in science and technology domains. SCY uses a pedagogical approach that centres around products, called "emerging learning objects" (ELOs) that are created by students. Students work individually and collaboratively in SCY-Lab (the general SCY learning environment) on "missions" that are guided…

75 FR 24747 - SCI, LLC/Zener-Rectifier Operations Division A Wholly Owned Subsidiary of SCI, LLC/ON...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-05-05

... DEPARTMENT OF LABOR Employment and Training Administration [TA-W-70,235] SCI, LLC/Zener-Rectifier... Adjustment Assistance on October 19, 2009, applicable to workers of SCI LLC/Zener-Rectifier, Operations... Technical Resources were employed on-site at the Phoenix Arizona location of SCI LLC/Zener-Rectifier...

Building Parts Inventory Files Using the AppleWorks Data Base Subprogram and Apple IIe or GS Computers.

ERIC Educational Resources Information Center

Schlenker, Richard M.

This manual is a "how to" training device for building database files using the AppleWorks program with an Apple IIe or Apple IIGS Computer with Duodisk or two disk drives and an 80-column card. The manual provides step-by-step directions, and includes 25 figures depicting the computer screen at the various stages of the database file…

Role of chlorogenic acid quinone and interaction of chlorogenic acid quinone and catechins in the enzymatic browning of apple.

PubMed

Amaki, Kanako; Saito, Eri; Taniguchi, Kumiko; Joshita, Keiko; Murata, Masatsune

2011-01-01

Chlorogenic acid (CQA) is one of the major polyphenols in apple and a good substrate for the polyphenol oxidase (PPO) in apple. Apple contains catechins as well as CQA, and the role of CQA quinone and its interaction with catechins in the enzymatic browning of apple were examined. Browning was repressed and 2-cysteinyl-CQA was formed when cysteine was added to apple juice. CQA quinone was essential for browning to occur. Although catechins and CQA were oxidized by PPO, some catechins seemed to be non-enzymatically oxidized by CQA quinone.

Identification of genes for melatonin synthetic enzymes in 'Red Fuji' apple (Malus domestica Borkh.cv.Red) and their expression and melatonin production during fruit development.

PubMed

Lei, Qiong; Wang, Lin; Tan, Dun-Xian; Zhao, Yu; Zheng, Xiao-Dong; Chen, Hao; Li, Qing-Tian; Zuo, Bi-Xiao; Kong, Jin

2013-11-01

Melatonin is present in many edible fruits; however, the presence of melatonin in apple has not previously been reported. In this study, the genes for melatonin synthetic enzymes including tryptophan decarboxylase, tryptamine 5-hydroxylase (T5H), arylalkylamine N-acetyltransferase, and N-acetylserotonin methyltransferase were identified in 'Red Fuji' apple. Each gene has several homologous genes. Sequence analysis shows that these genes have little homology with those of animals and they only have limited homology with known genes of rice melatonin synthetic enzymes. Multiple origins of melatonin synthetic genes during the evolution are expected. The expression of these genes is fully coordinated with melatonin production in apple development. Melatonin levels in apple exhibit an inverse relationship with the content of malondialdehyde, a product of lipid peroxidation. Two major melatonin synthetic peaks appeared on July 17 and on October 8 in both unbagged and bagged apple samples. At the periods mentioned above, apples experienced rapid expansion and increased respiration. These episodes significantly elevate reactive oxygen species production in the apple. Current data further confirmed that melatonin produced in apple was used to neutralize the toxic oxidants and protect the developing apple against oxidative stress. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Monte Carlo simulation of the risk of contamination of apples with Escherichia coli O157:H7.

PubMed

Duffy, Siobain; Schaffner, Donald W

2002-10-25

Quantitative descriptions of the frequency and extent of contamination of apple cider with pathogenic bacteria were obtained using literature data and computer simulation. Probability distributions were chosen to describe the risk of apple contamination by each suspected pathway. Tree-picked apples may be contaminated by birds infected with Escherichia coli O157:H7 when orchards were located near a sewage source (ocean or landfill). Dropped apples could become contaminated from either infected animal droppings or from contaminated manure if used as fertilizer. A risk assessment model was created in Analytica. The results of worst-case simulations revealed that 6-9 log CFU E. coli O157:H7 might be found on a harvest of 1000 dropped apples, while 3-4 log CFU contamination could be present on 1000 tree-picked apples. This model confirms that practices such as using dropped apples and using animal waste as fertilizer increase risk in the production of apple cider, and that pasteurization may not eliminate all contamination in juice from heavily contaminated fruit. Recently published FDA regulations for juices requiring a 5-log CFU/ml reduction of pathogenic bacteria in fresh juices should be a fail-safe measure for apples harvested in all but the worst-case scenarios.

Anthropogenic and natural drivers of gene flow in a temperate wild fruit tree: a basis for conservation and breeding programs in apples

PubMed Central

Cornille, Amandine; Feurtey, Alice; Gélin, Uriel; Ropars, Jeanne; Misvanderbrugge, Kristine; Gladieux, Pierre; Giraud, Tatiana

2015-01-01

Gene flow is an essential component of population adaptation and species evolution. Understanding of the natural and anthropogenic factors affecting gene flow is also critical for the development of appropriate management, breeding, and conservation programs. Here, we explored the natural and anthropogenic factors impacting crop-to-wild and within wild gene flow in apples in Europe using an unprecedented dense sampling of 1889 wild apple (Malus sylvestris) from European forests and 339 apple cultivars (Malus domestica). We made use of genetic, environmental, and ecological data (microsatellite markers, apple production across landscapes and records of apple flower visitors, respectively). We provide the first evidence that both human activities, through apple production, and human disturbance, through modifications of apple flower visitor diversity, have had a significant impact on crop-to-wild interspecific introgression rates. Our analysis also revealed the impact of previous natural climate change on historical gene flow in the nonintrogressed wild apple M. sylvestris, by identifying five distinct genetic groups in Europe and a north–south gradient of genetic diversity. These findings identify human activities and climate as key drivers of gene flow in a wild temperate fruit tree and provide a practical basis for conservation, agroforestry, and breeding programs for apples in Europe. PMID:25926882

Sensitivity of the SCI-FI/AT in Individuals With Traumatic Spinal Cord Injury.

PubMed

Keeney, Tamra; Slavin, Mary; Kisala, Pamela; Ni, Pengsheng; Heinemann, Allen W; Charlifue, Susan; Fyffe, Denise C; Marino, Ralph J; Morse, Leslie R; Worobey, Lynn A; Tate, Denise; Rosenblum, David; Zafonte, Ross; Tulsky, David; Jette, Alan M

2018-03-31

To examine the ability of the Spinal Cord Injury-Functional Index/Assistive Technology (SCI-FI/AT) measure to detect change in persons with spinal cord injury (SCI). Multisite longitudinal (12-mo follow-up) study. Nine SCI Model Systems programs. Adults (N=165) with SCI enrolled in the SCI Model Systems database. Not applicable. SCI-FI/AT computerized adaptive test (CAT) (Basic Mobility, Self-Care, Fine Motor Function, Wheelchair Mobility, and/or Ambulation domains) completed at discharge from rehabilitation and 12 months after SCI. For each domain, effect size estimates and 95% confidence intervals were calculated for subgroups with paraplegia and tetraplegia. The demographic characteristics of the sample were as follows: 46% (n=76) individuals with paraplegia, 76% (n=125) male participants, 57% (n=94) used a manual wheelchair, 38% (n=63) used a power wheelchair, 30% (n=50) were ambulatory. For individuals with paraplegia, the Basic Mobility, Self-Care, and Ambulation domains of the SCI-FI/AT detected a significantly large amount of change; in contrast, the Fine Motor Function and Wheelchair Mobility domains detected only a small amount of change. For those with tetraplegia, the Basic Mobility, Fine Motor Function, and Self-Care domains detected a small amount of change whereas the Ambulation item domain detected a medium amount of change. The Wheelchair Mobility domain for people with tetraplegia was the only SCI-FI/AT domain that did not detect significant change. SCI-FI/AT CAT item banks detected an increase in function from discharge to 12 months after SCI. The effect size estimates for the SCI-FI/AT CAT vary by domain and level of lesion. Findings support the use of the SCI-FI/AT CAT in the population with SCI and highlight the importance of multidimensional functional measures. Copyright © 2018 American Congress of Rehabilitation Medicine. Published by Elsevier Inc. All rights reserved.

Insulin released from titanium discs with insulin coatings-Kinetics and biological activity.

PubMed

Malekzadeh, B Ö; Ransjo, M; Tengvall, P; Mladenovic, Z; Westerlund, A

2017-10-01

Local administration of insulin from a titanium surface has been demonstrated to increase bone formation in non-diabetic rats. The authors hypothesized that insulin was released from the titanium surface and with preserved biological activity after the release. Thus, in the present in vitro study, human recombinant insulin was immobilized onto titanium discs, and the insulin release kinetics was evaluated using Electro-chemiluminescence immunoassay. Neutral Red uptake assay and mineralization assay were used to evaluate the biological effects of the released insulin on human osteoblast-like MG-63 cells. The results confirmed that insulin was released from titanium surfaces during a six-week period. Etching the disc prior to insulin coating, thickening of the insulin coating and incubation of the discs in serum-enriched cell culture medium increased the release. However, longer storage time decreased the release of insulin. Furthermore, the released insulin had retained its biological activity, as demonstrated by the significant increase in cell number and a stimulated mineralization process, upon exposure to released insulin. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 1847-1854, 2017. © 2016 Wiley Periodicals, Inc.

Development of chitosan/poly-γ-glutamic acid/pluronic/curcumin nanoparticles in chitosan dressings for wound regeneration.

PubMed

Lin, Yu-Hsin; Lin, Jui-Hsiang; Hong, Ya-Shiuan

2017-01-01

The hydrophobic polyphenol curcumin has anti-inflammatory, antimicrobial, and wound-healing properties that warrant its pharmacological consideration. We report a curcumin nanoparticle with a tripolymeric composite that can be used as a delivery device for wound healing. The present composite nanoparticles were prepared with three biocompatible polymers of chitosan, poly-γ-glutamic acid, and pluronic using a simple ionic gelation technology. Pluronic was used to enhance the solubility of curcumin in chitosan/poly-γ-glutamic acid nanoparticles, leading to the incorporation of chitosan/poly-γ-glutamic acid/pluronic/curcumin nanoparticles into chitosan membranes, and reduced inflammation and bacterial infection during wound regeneration. Nanoparticles were of 193.1 ± 8.9 nm and had a zeta potential of 20.6 ± 2.4 mV. Moreover, in vitro analyses indicated controlled curcumin release in a simulated skin tissue model. Subsequent in vivo studies show that chitosan wound dressing containing chitosan/poly-γ-glutamic acid/pluronic/curcumin nanoparticles promoted neocollagen regeneration and tissue reconstruction. © 2015 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 81-90, 2017. © 2015 Wiley Periodicals, Inc.

Long-term healing of mildly cross-linked decellularized bovine pericardial aortic patch.

PubMed

Umashankar, P R; Sabareeswaran, A; Shenoy, Sachin J

2017-10-01

Glutaraldehyde treated bovine pericardium is extensively used in cardiovascular surgery. However, frequent occurrence of failure modes, such as calcification and structural failure, has hard pressed the need for finding an alternate technology. Decellularized bovine pericardium is an emerging technology. Mildly cross-linked decellularized bovine pericardium promotes positive remodeling with insignificant calcification and acute inflammation. In the present study, mildly cross-linked decellularized bovine pericardium was evaluated as a cardiovascular patch by studying mechanical strength as well as graft remodeling, resistance to calcific degeneration and inflammatory response using long duration porcine aortic implantation. It was observed that decellularized bovine pericardium, although thinner and less elastic had equivalent tensile properties such as tensile strength and stiffness when compared to commercially available glutaraldehyde-treated bovine pericardium. It showed the potential for site appropriate remodeling evidenced by host cell incorporation, thinner neointima, graft degradation, and neocollagenisation making it suitable for vascular patch application, whereas glutaraldehyde-treated pericardium failed to integrate with host tissue through timely degradation and host cell incorporation or neocollagenization. Conversely, it elicited persistent acute inflammation and produced calcification. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 2145-2152, 2017. © 2016 Wiley Periodicals, Inc.

Hemocompatibility and oxygenation performance of polysulfone membranes grafted with polyethylene glycol and heparin by plasma-induced surface modification.

PubMed

Wang, Weiping; Zheng, Zhi; Huang, Xin; Fan, Wenling; Yu, Wenkui; Zhang, Zhibing; Li, Lei; Mao, Chun

2017-10-01

Polyethylene glycol (PEG) and heparin (Hep) were grafted onto polysulfone (PSF) membrane by plasma-induced surface modification to prepare PSF-PEG-Hep membranes used for artificial lung. The effects of plasma treatment parameters, including power, gas type, gas flow rate, and treatment time, were investigated, and different PEG chains were bonded covalently onto the surface in the postplasma grafting process. Membrane surfaces were characterized by water contact angle, PEG grafting degree, attenuated total reflectance-Fourier transform infrared spectroscopy, ultraviolet-visible spectrophotometry, X-ray photoelectron spectroscopy, critical water permeability pressure, and scanning electron microscopy. Protein adsorption, platelet adhesion, and coagulation tests showed significant improvement in the hemocompatibility of PSF-PEG-Hep membranes compared to pristine PSF membrane. Gas exchange tests through PSF-PEG6000-Hep membrane showed that when the flow rate of porcine blood reached 5.0 L/min, the permeation fluxes of O 2 and CO 2 reached 192.6 and 166.9 mL/min, respectively, which were close to the gas exchange capacity of a commercial membrane oxygenator. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 1737-1746, 2017. © 2016 Wiley Periodicals, Inc.

A search game model of the scatter hoarder's problem

PubMed Central

Alpern, Steve; Fokkink, Robbert; Lidbetter, Thomas; Clayton, Nicola S.

2012-01-01

Scatter hoarders are animals (e.g. squirrels) who cache food (nuts) over a number of sites for later collection. A certain minimum amount of food must be recovered, possibly after pilfering by another animal, in order to survive the winter. An optimal caching strategy is one that maximizes the survival probability, given worst case behaviour of the pilferer. We modify certain ‘accumulation games’ studied by Kikuta & Ruckle (2000 J. Optim. Theory Appl.) and Kikuta & Ruckle (2001 Naval Res. Logist.), which modelled the problem of optimal diversification of resources against catastrophic loss, to include the depth at which the food is hidden at each caching site. Optimal caching strategies can then be determined as equilibria in a new ‘caching game’. We show how the distribution of food over sites and the site-depths of the optimal caching varies with the animal's survival requirements and the amount of pilfering. We show that in some cases, ‘decoy nuts’ are required to be placed above other nuts that are buried further down at the same site. Methods from the field of search games are used. Some empirically observed behaviour can be shown to be optimal in our model. PMID:22012971

Tribology of flexible and sliding spinal implants: Development of experimental and numerical models.

PubMed

Le Cann, Sophie; Chaves-Jacob, Julien; Rossi, Jean-Marie; Linares, Jean-Marc; Chabrand, Patrick

2018-01-01

New fusionless devices are being developed to get over the limits of actual spinal surgical treatment, based on arthrodesis. However, due to their recentness, no standards exist to test and validate those devices, especially concerning the wear. A new tribological first approach to the definition of an in vitro wear protocol to study wear of flexible and sliding spinal devices is presented in this article, and was applied to a new concept. A simplified synthetic spine portion (polyethylene) was developed to reproduce a simple supra-physiological spinal flexion (10° between two vertebrae). The device studied with this protocol was tested in wet environment until 1 million cycles (Mc). We obtained an encouraging estimated wear volume of same order of magnitude compared to similar devices. An associated finite element (FE) numerical model has permitted to access contact information and study the effect of misalignment of one screw. First results could point out how to improve the design and suggest that a vertical misalignment of a screw (under or over-screwing) has more impact than a horizontal one. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 106B: 104-111, 2018. © 2016 Wiley Periodicals, Inc.

Feasibility of using bulk metallic glass for self-expandable stent applications.

PubMed

Praveen Kumar, Gideon; Jafary-Zadeh, Mehdi; Tavakoli, Rouhollah; Cui, Fangsen

2017-10-01

Self-expandable stents are widely used to restore blood flow in a diseased artery segment by keeping the artery open after angioplasty. Despite the prevalent use of conventional crystalline metallic alloys, for example, nitinol, to construct self-expandable stents, new biomaterials such as bulk metallic glasses (BMGs) are being actively pursued to improve stent performance. Here, we conducted a series of analyses including finite element analysis and molecular dynamics simulations to investigate the feasibility of using a prototypical Zr-based BMG for self-expandable stent applications. We model stent crimping of several designs for different percutaneous applications. Our results indicate that BMG-based stents with diamond-shaped crowns suffer from severe localization of plastic deformation and abrupt failure during crimping. As a possible solution, we further illustrate that such abrupt failure could be avoided in BMG-based stents without diamond shape crowns. This work would open a new horizon for a quest toward exploiting superior mechanical and functional properties of metallic glasses to design future stents. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 1874-1882, 2017. © 2016 Wiley Periodicals, Inc.

Pit initiation on nitinol in simulated physiological solutions.

PubMed

Pound, Bruce G

2018-05-01

Inclusions appear to play a crucial role in the initiation of pitting on nitinol, but the reason remains unclear. Furthermore, it has not been established whether the type of inclusion is a central factor. In this study, potentiodynamic polarization together with scanning electron microscopy and energy dispersive X-ray spectroscopy were used to provide more insight into the initiation of pits on electropolished nitinol wire. Corrosion was limited to a single primary pit on each of the few wire samples that exhibited breakdown. The pit contained numerous Ti 2 NiO x inclusions, but secondary pits that developed within the primary pit provided evidence that these inclusions were the sites of pit initiation. Although several theories have been proposed to account for pit initiation at inclusions in mechanically polished and electropolished nitinol, titanium depletion in the adjacent alloy matrix appears to provide the most viable explanation. The key factor appears to be the size of the inclusion and therefore the extent of titanium depletion in the alloy matrix. The type of inclusion evidently plays a secondary role at most. © 2017 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 106B: 1605-1610, 2018. © 2017 Wiley Periodicals, Inc.

DPSC colonization of functionalized 3D textiles.

PubMed

Ortiz, Marine; Rosales-Ibáñez, Raúl; Pozos-Guillén, Amaury; De Bien, Charlotte; Toye, Dominique; Flores, Héctor; Grandfils, Christian

2017-05-01

Fiber scaffolds are attractive materials for mimicking, within a 3D in vitro system, any living environment in which animal cells can adhere and proliferate. In three dimensions, cells have the ability to communicate and organize into complex architectures similar to those found in their natural environments. The aim of this study was to evaluate, in terms of cell reactivity, a new in vitro cell model: dental pulp stem cells (DPSCs) in a 3D polymeric textile. Scaffolds were knitted from polyglycolic acid (PGA) or polydioxanone (PDO) fibers differing in surface roughness. To promote cell adhesion, these hydrophobic fabrics were also functionalized with either chitosan or the peptide arginine-glycine-aspartic acid (RGD). Cell behavior was examined 1, 10, and 21 days post-seeding with a LIVE/DEAD ® Kit. Confocal laser scanning microscopy (CLSM) highlighted the biocompatibility of these materials (cell survival rate: 94% to 100%). Fiber roughness was found to influence cell adhesion and viability significantly and favorably. A clear benefit of polymeric textile functionalization with chitosan or RGD was demonstrated in terms of cell adhesion and viability. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part B: Appl Biomater, 105B: 785-794, 2017. © 2016 Wiley Periodicals, Inc.

Acute and Chronic Deficits in the Urinary Bladder after Spinal Contusion Injury in the Adult Rat

PubMed Central

Herrera, Juan J.; Haywood-Watson, Ricky J.L.

2010-01-01

Abstract Traumatic spinal cord injury (SCI) permanently alters bladder function in humans. Hematuria and cystitis occur in both human SCI as well as in rodent models of SCI. Others have reported early SCI-dependent disruption to bladder uroepithelial integrity that results in increased permeability to urine and urine-borne substances. This can result in cystitis, or inflammation of the bladder, an ongoing pathological condition present throughout the chronic phase of SCI in humans. The goals of our study were twofold: (1) to begin to examine the inflammatory and molecular changes that occur within the bladder uroepithelium using a clinically-relevant spinal contusion model of injury, and (2) to assess whether these alterations continue into the chronic phase of SCI. Rats received either moderate SCI or sham surgery. Urine was collected from SCI and sham subjects over 7 days or at 7 months to assess levels of excreted proteins. Inflammation in the bladder wall was assessed via biochemical and immunohistochemical methods. Bladder tight junction proteins, mediators of uroepithelial integrity, were also measured in both the acute and chronic phases of SCI. Urine protein and hemoglobin levels rapidly increase following SCI. An SCI-dependent elevation in numbers of neutrophils within the bladder wall peaked at 48 h. Bladder tight junction proteins demonstrate a rapid but transient decrease as early as 2 h post-SCI. Surprisingly, elevated levels of urine proteins and significant deficits in bladder tight junction proteins could be detected in chronic SCI, suggesting that early pathological changes to the bladder may continue throughout the chronic phase of injury. PMID:19891526

Ensuring the genetic diversity of apples

USDA-ARS?s Scientific Manuscript database

Apples (Malus × domestica Borkh.) are a nutritious source of antioxidants, polyphenolics, vitamins, and fiber. Many of the apple cultivars that are currently produced were identified over a century ago and do not offer resistance to pathogens and tolerance to climatic threats. Apple breeding program...

Efficacy of phytic acid as an inhibitor of enzymatic and non-enzymatic browning in apple juice.

PubMed

Du, Yunjian; Dou, Siqi; Wu, Shengjun

2012-11-15

Browning decreases the commercial value of apple juice, and therefore colour preservation during processing and storage is the main objective of manufacturers. In this study, the efficacy of phytic acid as a browning inhibitor for use on apple juice was investigated. Browning of apple juice treated with phytic acid was monitored during processing and storage. 0.1 mM Phytic acid inhibited the polyphenol oxidase (PPO) from the apple juice by 99.2%. Consequently, the apple juice treated with phytic acid had significantly lower browning formation during processing and after 6 months of storage at room temperature compared with the control (p<0.05). Results indicate that this is a promising way to inhibit browning in apple juice. Copyright © 2012 Elsevier Ltd. All rights reserved.

In vivo automated quantification of quality of apples during storage using optical coherence tomography images

NASA Astrophysics Data System (ADS)

Srivastava, Vishal; Dalal, Devjyoti; Kumar, Anuj; Prakash, Surya; Dalal, Krishna

2018-06-01

Moisture content is an important feature of fruits and vegetables. As 80% of apple content is water, so decreasing the moisture content will degrade the quality of apples (Golden Delicious). The computational and texture features of the apples were extracted from optical coherence tomography (OCT) images. A support vector machine with a Gaussian kernel model was used to perform automated classification. To evaluate the quality of wax coated apples during storage in vivo, our proposed method opens up the possibility of fully automated quantitative analysis based on the morphological features of apples. Our results demonstrate that the analysis of the computational and texture features of OCT images may be a good non-destructive method for the assessment of the quality of apples.

Production of volatiles in fresh-cut apple: effect of applying alginate coatings containing linoleic acid or isoleucine.

PubMed

Maya-Meraz, Irma O; Espino-Díaz, Miguel; Molina-Corral, Francisco J; González-Aguilar, Gustavo A; Jacobo-Cuellar, Juan L; Sepulveda, David R; Olivas, Guadalupe I

2014-11-01

One of the main quality parameters in apples is aroma, its main precursors are fatty acids (FA) and amino acids (AA). In this study, alginate edible coatings were used as carriers of linoleic acid or isoleucine to serve as precursors for the production of aroma in cut apples. Apple wedges were immersed in a CaCl2 solution and coated with one of the following formulations: alginate solution (Alg-Ca), Alg-Ca-low-level linoleic acid (0.61 g/Lt), (LFA), Alg-Ca-high-level linoleic acid (2.44 g/L; HFA), Alg-Ca-low-level isoleucine (0.61 g/L; LAA), and Alg-Ca-high-level isoleucine (2.44 g/L; HAA). Apple wedges were stored at 3 °C and 85% relative humidity for 21 d and key volatiles were studied during storage. Addition of precursors, mainly isoleucine, showed to increase the production of some key volatiles on coated fresh-cut apples during storage. The concentration of 2-methyl-1-butanol was 4 times higher from day 12 to day 21 in HAA, while 2-methyl butyl acetate increased from day 12 to day 21 in HAA. After 21 d, HAA-apples presented a 40-fold value of 2-methyl-butyl acetate, compared to Alg-Ca cut apples. Values of hexanal increased during cut apple storage when the coating carried linoleic acid, mainly on HFA, from 3 to 12 d. The ability of apples to metabolize AA and FA depends on the concentration of precursors, but also depends on key enzymes, previous apple storage, among others. Further studies should be done to better clarify the behavior of fresh-cut apples as living tissue to metabolize precursors contained in edible coatings for the production of volatiles. © 2014 Institute of Food Technologists®

Colonic availability of polyphenols and D-(-)-quinic acid after apple smoothie consumption.

PubMed

Hagl, Stephanie; Deusser, Hannah; Soyalan, Buelent; Janzowski, Christine; Will, Frank; Dietrich, Helmut; Albert, Franz Werner; Rohner, Simone; Richling, Elke

2011-03-01

The aim of this study was to determine the amounts of polyphenols and D-(-)-quinic acid reaching the ileostomy bags of probands (and thus the colon in healthy humans) after ingestion of apple smoothie, a beverage containing 60% cloudy apple juice and 40% apple puree. Ten healthy ileostomy subjects each ingested 0.7 L of apple smoothie (a bottle). Their ileostomy bags were collected directly before and 1, 2, 4, 6 and 8 h after smoothie consumption, and the polyphenol and D-(-)-quinic acid contents of the ileostomy fluids were examined using HPLC-DAD and HPLC-MS/MS. The total polyphenol and D-(-)-quinic acid content of the apple smoothie was determined to be 1955.6±124.6 mg/0.7 L, which is very high compared to cloudy apple juices. The most abundant substances found in the ileostomy bags were oligomeric procyanidins (705.6±197.9 mg), D-(-)-quinic acid (363.4±235.5 mg) and 5-caffeoylquinic acid (76.7±26.8 mg). Overall recovery of ingested polyphenols and D-(-)-quinic acid in the ileostomy bags was 63.3±16.1%. The amounts of polyphenol and D-(-)-quinic acids reaching the ileostomy bags are considerably higher after apple smoothie consumption than after the consumption of cloudy apple juice or cider. These results suggest that the food matrix might affect the colonic availability of polyphenols, and apple smoothies could be more effective in the prevention of chronic colon diseases than both cloudy apple juice and apple cider. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Apple EIN3 BINDING F-box 1 inhibits the activity of three apple EIN3-like transcription factors

PubMed Central

Tacken, Emma J.; Ireland, Hilary S.; Wang, Yen-Yi; Putterill, Jo; Schaffer, Robert J.

2012-01-01

Background and aims Fruit ripening in Malus× domestica (apple) is controlled by ethylene. Work in model species has shown that following the detection of ethylene, the ETHYLENE INSENSITIVE 3 (EIN3) transcription factor is stabilized, leading to an increase in transcript accumulation of ethylene-responsive genes, such as POLYGALACTURONASE1 (PG1). In the absence of ethylene, the EIN3 BINDING F-box (EBF) proteins rapidly degrade EIN3 via the ubiquitination/SCF (Skp, Cullin, F-Box) proteasome pathway. In this study, we aim to identify and characterize the apple EBF genes, and test their activity against apple EIN3-like proteins (EILs). Methodology The apple genome sequence was mined for EBF-like genes. The expression of EBF-like genes was measured during fruit development. Using a transient assay in Nicotiana benthamiana leaves, the activity of three apple EILs was tested against the PG1 promoter, with and without ethylene and EBF1. Principal results Four EBF-like genes in apple were identified and grouped into two sub-clades. Sub-clade I genes had constant expression over fruit development while sub-clade II genes increased in expression at ripening. EBF1 was shown to reduce the transactivation of the apple PG1 promoter by the EIL1, EIL2 and EIL3 transcription factors in the presence of ethylene. Conclusions The apple EBF1 gene identified here is likely to be a functionally conserved EBF orthologue, modulating EIL activity in apples. The activity of EBF1 suggests that it is not specific to a single EIL, instead acting as a global regulator of apple EIL transcription factors. PMID:23585922

Birch pollinosis and atopy caused by apple, peach, and hazelnut; comparison of three extraction procedures with two apple strains.

PubMed

de Groot, H; de Jong, N W; Vuijk, M H; Gerth van Wijk, R

1996-10-01

This study aimed, first, to study the prevalence in The Netherlands of atopy caused by apple, peach, and hazelnut in patients with tree pollinosis, and, second, to compare three extraction procedures for skin prick testing with two different apple strains. Skin prick tests and RAST were performed on 79 consecutive patients with tree pollinosis, visiting the department of allergology during spring 1995. In skin prick tests, we used three different extracts (juice, freeze-dried extract, and low-temperature acetone powder extract) of two apple strains, Golden Delicious and Granny Smith. Case histories for apple, peach, and hazelnut were positive in 35 (44.3%), 23 (29%), and 35 (44.3%) patients, respectively. More than two-thirds of the patients had symptoms characteristic of oral allergy syndrome. Skin prick tests for apple, peach, and hazelnut were positive in 51 (64.6%), 61 (77.2%), and 71 (89.9%) patients, respectively. Granny Smith showed more positive skin reactions and a better agreement with clinical history than Golden Delicious, and juice was superior to the two other extraction procedures for both apple strains. RAST for apple, peach, and hazelnut was positive in 53 (68.8%), 13 (16.9%), and 31 (40.3%) patients, respectively. Concordance between skin prick test and case history was found in 77%, 52%, and 54%, for apple, peach, and hazelnut, respectively. We found a high percentage of concurrence of clinical allergy to birch pollen and apple, peach, and hazelnut, confirmed by both skin prick testing and RAST. Approximately half of these patients had symptoms (especially oral allergy syndrome) after eating these products. We also found an easy extraction procedure (juice extract) suitable for apple skin prick testing, superior even to freeze-dried extraction or the low-temperature acetone powder technique.

Reduced generation time of apple seedlings to within a year by means of a plant virus vector: a new plant-breeding technique with no transmission of genetic modification to the next generation.

PubMed

Yamagishi, Noriko; Kishigami, Ryusuke; Yoshikawa, Nobuyuki

2014-01-01

Fruit trees have a long juvenile phase. For example, the juvenile phase of apple (Malus × domestica) generally lasts for 5-12 years and is a serious constraint for genetic analysis and for creating new apple cultivars through cross-breeding. If modification of the genes involved in the transition from the juvenile phase to the adult phase can enable apple to complete its life cycle within 1 year, as seen in herbaceous plants, a significant enhancement in apple breeding will be realized. Here, we report a novel technology that simultaneously promotes expression of Arabidopsis FLOWERING LOCUS T gene (AtFT) and silencing of apple TERMINAL FLOWER 1 gene (MdTFL1-1) using an Apple latent spherical virus (ALSV) vector (ALSV-AtFT/MdTFL1) to accelerate flowering time and life cycle in apple seedlings. When apple cotyledons were inoculated with ALSV-AtFT/MdTFL1 immediately after germination, more than 90% of infected seedlings started flowering within 1.5-3 months, and almost all early-flowering seedlings continuously produced flower buds on the lateral and axillary shoots. Cross-pollination between early-flowering apple plants produced fruits with seeds, indicating that ALSV-AtFT/MdTFL1 inoculation successfully reduced the time required for completion of the apple life cycle to 1 year or less. Apple latent spherical virus was not transmitted via seeds to successive progenies in most cases, and thus, this method will serve as a new breeding technique that does not pass genetic modification to the next generation. © 2013 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Synergistic effect of PEGylated resveratrol on delivery of anticancer drugs.

PubMed

Wang, Wenlong; Zhang, Liang; Le, Yuan; Chen, Jian-Feng; Wang, Jiexin; Yun, Jimmy

2016-02-10

Resveratrol (RES) is a natural polyphenol which can be considered as a nutraceutical because of its benefits such as anticancer and antioxidant activity. In this paper, we designed polymer-RES conjugates as anticancer drug carrier for synergistic therapeutic effect in cancer treatment. Bicalutamide (BIC) was used as a model drug to investigate the drug release behaviors and in vitro anticancer performance. PEG-RES and PEG-Glycine-RES nanoparticles were prepared and characterized. The size of the prepared particles was around 50 nm with RES content of 17.2 and 16.3 wt% for PEG-RES and PEG-Glycine-RES, respectively, and BIC loading efficiency were of 81.6% and 84.5%, separately. Release rate of RES from conjugates depended on the stability of ester group against hydrolysis. BIC release was much faster than RES release. The anticancer activity of BIC loaded PEGylated RES nanoparticles was much better than that of free BIC, indicating the conjugates provided a synergetic cytotoxicity to cancer cells. Confocal laser scanning microscopy observation and flow cytometry analyses indicated that PEGylated RES conjugates were more efficiently internalized into cells, released drug into cytoplasm. These results suggest that PEGylated RES conjugates show great potential for cancer therapy. Copyright © 2015 Elsevier B.V. All rights reserved.

Bedrock topography beneath uppermost part of Aletsch glacier, Central Swiss Alps, revealed from cosmic-ray muon radiography

NASA Astrophysics Data System (ADS)

Nishiyama, Ryuichi; Ariga, Akitaka; Ariga, Tomoko; Käser, Samuel; Lechmann, Alessandro; Mair, David; Scampoli, Paola; Vladymyrov, Mykhailo; Ereditato, Antonio; Schlunegger, Fritz

2017-04-01

In mountainous landscapes such as the Central Alps of Europe, the bedrock topography is one of the most interesting subjects of study since it separates the geological substratum (bedrock) from the overlying unconsolidated units (ice). The geometry of the bedrock topography puts a tight constraint on the erosional mechanism of glaciers. In previous studies, it has been inferred mainly from landscapes where glaciers have disappeared after the termination of the last glacial epoch. However, the number of studies with a focus on the structure beneath active glaciers is limited, because existing exploration methods have limitation in resolution and mobility. The Eiger-μ project proposes a new technology, called muon radiography, to investigate the bedrock geometry beneath active glaciers. The muon radiography is a recent technique that relies on the high penetration power of muon components in natural cosmic rays. Specifically, one can resolve the internal density profile of a gigantic object by measuring the attenuation rate of the intensity of muons after passing through it, as in medical X-ray diagnostic. This technique has been applied to many fields such as volcano monitoring (eg. Ambrosino et al., 2015; Jourde et al., 2016; Nishiyama et al., 2016), detection of seismic faults (eg. Tanaka et al., 2011), inspection inside nuclear reactors, etc. The first feasibility test of the Eiger-μ project has been performed at Jungfrau region, Central Swiss Alps, Switzerland. We installed cosmic-ray detectors consisting of emulsion films at three sites along the Jungfrau railway tunnel facing Aletsch glacier (Jungfraufirn). The detectors stayed 47 days in the tunnel and recorded the tracks of muons which passed through the glacier and bedrock (thickness is about 100 m). Successively the films were chemically developed and scanned at University of Bern with microscopes originally developed for the analysis of physics experiments on neutrino oscillation. The analysis of muon absorption rate enabled us to image a three-dimensional boundary shape between dense granite bedrock (˜ 2.7 g/cm3) and light ice part (˜ 0.8 g/cm3) in the very uppermost part of Aletsch glacier. This is the first application of muon radiography to cryogenic science. Further measurements are presently ongoing to image inside a much larger edifice of Eiger glacier, which straddles on the western flank of the famous Eiger mountain. References: Ambrosino et al. (2015), J. Geophys. Res. Solid Earth, 120, 7290-7307. Jourde et al. (2016), Scientific Reports, 6, 33406. Nishiyama et al. (2016), Pure Appl. Geophys., doi:10.1007/s00024-016-1430-9. Tanaka et al. (2011), Earth Planet Sci. Lett., 306, 156-162.

Transcriptomic analysis of apple fruit ripening and texture attributes

USDA-ARS?s Scientific Manuscript database

Molecular events regulating cultivar-specific apple fruit ripening and sensory quality are largely unknown. Such knowledge is essential for genomic-assisted apple breeding and postharvest quality management. The ripening behavior and texture attributes of two apple cultivars, ‘Pink Lady’ and ‘Honey...

Where to prick the apple for skin testing?

PubMed

Vlieg-Boerstra, B J; van de Weg, W E; van der Heide, S; Dubois, A E J

2013-09-01

Mal d 1 is not equally distributed over the apple. We aimed to examine the influence of the location of pricking in the apple on prick-to-prick skin prick test (PTP) results. PTPs were performed in autumn 2007 and spring 2008, before the birch pollen season, in 32 Dutch adults with symptoms of oral allergy to fresh apple, using apples harvested in autumn 2007. PTPs with fresh intact and unpeeled Pink Lady, Golden Delicious, Elise, Santana and Modi apples were performed using material obtained from approximately 2 cm near the stalk (top), and the middle region. All PTP responses were greater when performed with apple material near the stalk than from the middle region. In 2007, these differences were statistically significant for Pink Lady, Golden Delicious and Elise, and in 2008, for Pink Lady and Modi. When performing PTPs, the apple should be pricked near the stalk rather than in the middle. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Targeting Translational Successes through CANSORT-SCI: Using Pet Dogs To Identify Effective Treatments for Spinal Cord Injury.

PubMed

Moore, Sarah A; Granger, Nicolas; Olby, Natasha J; Spitzbarth, Ingo; Jeffery, Nick D; Tipold, Andrea; Nout-Lomas, Yvette S; da Costa, Ronaldo C; Stein, Veronika M; Noble-Haeusslein, Linda J; Blight, Andrew R; Grossman, Robert G; Basso, D Michele; Levine, Jonathan M

2017-06-15

Translation of therapeutic interventions for spinal cord injury (SCI) from laboratory to clinic has been historically challenging, highlighting the need for robust models of injury that more closely mirror the human condition. The high prevalence of acute, naturally occurring SCI in pet dogs provides a unique opportunity to evaluate expeditiously promising interventions in a population of animals that receive diagnoses and treatment clinically in a manner similar to persons with SCI, while adhering to National Institutes of Health guidelines for scientific rigor and transparent reporting. In addition, pet dogs with chronic paralysis are often maintained long-term by their owners, offering a similarly unique population for study of chronic SCI. Despite this, only a small number of studies have used the clinical dog model of SCI. The Canine Spinal Cord Injury Consortium (CANSORT-SCI) was recently established by a group of veterinarians and basic science researchers to promote the value of the canine clinical model of SCI. The CANSORT-SCI group held an inaugural meeting November 20 and 21, 2015 to evaluate opportunities and challenges to the use of pet dogs in SCI research. Key challenges identified included lack of familiarity with the model among nonveterinary scientists and questions about how and where in the translational process the canine clinical model would be most valuable. In light of these, we review the natural history, outcome, and available assessment tools associated with canine clinical SCI with emphasis on their relevance to human SCI and the translational process.

High Prevalence of Stress and Low Prevalence of Alzheimer Disease CSF Biomarkers in a Clinical Sample with Subjective Cognitive Impairment.

PubMed

Eckerström, Marie; Berg, Anne Ingeborg; Nordlund, Arto; Rolstad, Sindre; Sacuiu, Simona; Wallin, Anders

2016-01-01

Subjective cognitive impairment (SCI) is a trigger for seeking health care in a possible preclinical phase of Alzheimer's disease (AD), although the characteristics of SCI need clarification. We investigated the prevalence of psychosocial stress, depressive symptoms and CSF AD biomarkers in SCI and MCI (mild cognitive impairment). Memory clinic patients (SCI: n = 90; age: 59.8 ± 7.6 years; MCI: n = 160; age: 63.7 ± 7.0 years) included in the Gothenburg MCI study were examined at baseline. Variables were analyzed using logistic regression with SCI as dependent variable. Stress was more prevalent in SCI (51.1%) than MCI (23.1%); p < 0.0005. SCI patients had more previous depressive symptoms (p = 0.006), but showed no difference compared to MCI patients considering current depressive symptoms. A positive CSF AD profile was present in 14.4% of SCI patients and 35.0% of MCI patients (p = 0.001). Stress (p = 0.002), previous stress/depressive symptoms (p = 0.006) and a negative CSF AD profile (p = 0.036) predicted allocation to the SCI group. Psychosocial stress is more prevalent in SCI than previously acknowledged. The high prevalence and long-term occurrence of stress/depressive symptoms in SCI in combination with a low prevalence of altered CSF AD biomarkers strengthens the notion that AD is not the most likely etiology of SCI. © 2016 S. Karger AG, Basel.

Antioxidant activity of apple peels.

PubMed

Wolfe, Kelly; Wu, Xianzhong; Liu, Rui Hai

2003-01-29

Consumption of fruits and vegetables has been shown to be effective in the prevention of chronic diseases. These benefits are often attributed to the high antioxidant content of some plant foods. Apples are commonly eaten and are large contributors of phenolic compounds in European and North American diets. The peels of apples, in particular, are high in phenolics. During applesauce and canned apple manufacture, the antioxidant-rich peels of apples are discarded. To determine if a useful source of antioxidants is being wasted, the phytochemical content, antioxidant activity, and antiproliferative activity of the peels of four varieties of apples (Rome Beauty, Idared, Cortland, and Golden Delicious) commonly used in applesauce production in New York state were investigated. The values of the peels were compared to those of the flesh and flesh + peel components of the apples. Within each variety, the total phenolic and flavonoid contents were highest in the peels, followed by the flesh + peel and the flesh. Idared and Rome Beauty apple peels had the highest total phenolic contents (588.9 +/- 83.2 and 500.2 +/- 13.7 mg of gallic acid equivalents/100 g of peels, respectively). Rome Beauty and Idared peels were also highest in flavonoids (306.1 +/- 6.7 and 303.2 +/- 41.5 mg of catechin equivalents/100 g of peels, respectively). Of the four varieties, Idared apple peels had the most anthocyanins, with 26.8 +/- 6.5 mg of cyanidin 3-glucoside equivalents/100 g of peels. The peels all had significantly higher total antioxidant activities than the flesh + peel and flesh of the apple varieties examined. Idared peels had the greatest antioxidant activity (312.2 +/- 9.8 micromol of vitamin C equivalents/g of peels). Apple peels were also shown to more effectively inhibit the growth of HepG(2) human liver cancer cells than the other apple components. Rome Beauty apple peels showed the most bioactivity, inhibiting cell proliferation by 50% at the low concentration of 12.4 +/- 0.4 mg of peels/mL. The high content of phenolic compounds, antioxidant activity, and antiproliferative activity of apple peels indicate that they may impart health benefits when consumed and should be regarded as a valuable source of antioxidants.

Identification, characterization, and utilization of genome-wide simple sequence repeats to identify a QTL for acidity in apple

PubMed Central

2012-01-01

Background Apple is an economically important fruit crop worldwide. Developing a genetic linkage map is a critical step towards mapping and cloning of genes responsible for important horticultural traits in apple. To facilitate linkage map construction, we surveyed and characterized the distribution and frequency of perfect microsatellites in assembled contig sequences of the apple genome. Results A total of 28,538 SSRs have been identified in the apple genome, with an overall density of 40.8 SSRs per Mb. Di-nucleotide repeats are the most frequent microsatellites in the apple genome, accounting for 71.9% of all microsatellites. AT/TA repeats are the most frequent in genomic regions, accounting for 38.3% of all the G-SSRs, while AG/GA dimers prevail in transcribed sequences, and account for 59.4% of all EST-SSRs. A total set of 310 SSRs is selected to amplify eight apple genotypes. Of these, 245 (79.0%) are found to be polymorphic among cultivars and wild species tested. AG/GA motifs in genomic regions have detected more alleles and higher PIC values than AT/TA or AC/CA motifs. Moreover, AG/GA repeats are more variable than any other dimers in apple, and should be preferentially selected for studies, such as genetic diversity and linkage map construction. A total of 54 newly developed apple SSRs have been genetically mapped. Interestingly, clustering of markers with distorted segregation is observed on linkage groups 1, 2, 10, 15, and 16. A QTL responsible for malic acid content of apple fruits is detected on linkage group 8, and accounts for ~13.5% of the observed phenotypic variation. Conclusions This study demonstrates that di-nucleotide repeats are prevalent in the apple genome and that AT/TA and AG/GA repeats are the most frequent in genomic and transcribed sequences of apple, respectively. All SSR motifs identified in this study as well as those newly mapped SSRs will serve as valuable resources for pursuing apple genetic studies, aiding the apple breeding community in marker-assisted breeding, and for performing comparative genomic studies in Rosaceae. PMID:23039990

Antioxidant activity of apples--an impact of maturity stage and fruit part.

PubMed

Duda-Chodak, Aleksandra; Tarko, Tomasz; Tuszyński, Tadeusz

2011-01-01

Recently, many studies have been oriented towards improving methods and efficiency of antioxidants recovery from different fruit and their wastes.The aim of the study was to evaluate antioxidant potential of apple seeds and peel, which constitute the fruit industry wastes, and compare it to apple flesh. Antioxidant activity of apples at different maturity and storage stage were analysed too. The Idared and the Šampion cultivars of apples were used in the study. Antioxidant activity was estimated using ABTS and DPPH assays, and polyphenols profile was determined by HPLC method. Seeds of analysed apple cultivars were characterised by a significantly higher antioxidant capacity and by higher concentrations of polyphenols analysed when compared to their peel and flesh. There were present two predominant compounds: phloridzin in seeds (84% and 72%) and quercetin glycosides in peels (54% and 38%, Idared and Šampion cultivars, respectively). No quercetin glycosides in seeds were found. The capacity to scavenge an ABTS radical, but not DPPH, decreased during ripening of apples, while cold storage resulted in enhanced antioxidant potential. It can be concluded that unripe apples together with apple seeds and peel (fruit industry wastes) constitute a valuable source of polyphenols.

2-20 ns interframe time 2-frame 6.151 keV x-ray imaging on the recently upgraded Z Accelerator: A progress report

NASA Astrophysics Data System (ADS)

Bennett, G. R.; Smith, I. C.; Shores, J. E.; Sinars, D. B.; Robertson, G.; Atherton, B. W.; Jones, M. C.; Porter, J. L.

2008-10-01

When used for the production of an x-ray imaging backlighter source on Sandia National Laboratories' recently upgraded 26MA Z Accelerator, the terawatt-class, multikilojoule, 526.57nm Z-Beamlet laser (ZBL) [P. K. Rambo et al., Appl. Opt. 44, 2421 (2005)], in conjunction with the 6.151keV (1s2-1s2p triplet line of He-like Mn) curved-crystal imager [D. B. Sinars et al., Rev. Sci. Instrum. 75, 3672 (2004); G. R. Bennett et al., Rev. Sci. Instrum. 77, 10E322 (2006)], is capable of providing a high quality x radiograph per Z shot for inertial confinement fusion (ICF), complex hydrodynamics, and other high-energy-density physics experiments. For example, this diagnostic has recently afforded microgram-scale mass perturbation measurements on an imploding ignition-scale 1mg ICF capsule [G. R. Bennett et al., Phys. Rev. Lett. 99, 205003 (2007)], where the perturbation was initiated by a surrogate deuterium-tritium (DT) fuel fill tube. Using an angle-time multiplexing technique, ZBL now has the capability to provide two spatially and temporally separated foci in the Z chamber, allowing "two-frame" imaging to be performed, with an interframe time range of 2-20ns. This multiplexing technique allows the full area of the four-pass amplifiers to be used for the two pulses, rather than split the amplifiers effectively into two rectangular sections, with one leg delayed with respect to the other, which would otherwise double the power imposed onto the various optics thereby halving the damage threshold, for the same irradiance on target. The 6.151keV two frame technique has recently been used to image imploding wire arrays, using a 7.3ns interframe time. The diagnostic will soon be converted to operate with p-rather than s-polarized laser light for enhanced laser absorption in the Mn foil, plus other changes (e.g., operation at the possibly brighter 6.181keV Mn 1s2-1s2p singlet line), to increase x-ray yields. Also, a highly sensitive inline multiframe ultrafast (1ns gate time) digital x-ray camera is being developed [G. R. Bennett et al., Rev. Sci. Instrum. 77, 10E322 (2006)] to extend the system to "four-frame" and markedly improve the signal-to-noise ratio. [At present, time-integrating Fuji BAS-TR2025 image plate (scanned with a Fuji BAS-5000 device) forms the time-integrated image-plane detector.

Use, knowledge, and perception of the scientific contribution of Sci-Hub in medical students: Study in six countries in Latin America.

PubMed

Mejia, Christian R; Valladares-Garrido, Mario J; Miñan-Tapia, Armando; Serrano, Felipe T; Tobler-Gómez, Liz E; Pereda-Castro, William; Mendoza-Flores, Cynthia R; Mundaca-Manay, Maria Y; Valladares-Garrido, Danai

2017-01-01

Sci-Hub is a useful web portal for people working in science as it provides access to millions of free scientific articles. Satisfaction and usage should be explored in the Latino student population. The objective of this study was to evaluate the use, knowledge, and perception of the scientific contribution of Sci-Hub in medical students from Latin America. A multicenter, observational, analytical study was conducted in 6632 medical students from 6 countries in Latin America. We surveyed from a previously validated instrument, delving into knowledge, monthly average usage, satisfaction level, and perception of the scientific contributions provided by Sci-Hub. Frequencies and percentages are described, and generalized linear models were used to establish statistical associations. Only 19.2% of study participants knew of Sci-Hub and its function, while the median use was twice a month. 29.9% of Sci-Hub-aware participants claimed they always find the desired scientific information in their Sci-Hub search; 62.5% of participants affirmed that Sci-Hub contributes to scientific investigation; only 2.2% reported that Sci-Hub does not contribute to science. The majority of Latino students are not aware of Sci-Hub.

7 CFR 51.311 - Marking requirements.

Code of Federal Regulations, 2012 CFR

2012-01-01

... STANDARDS) United States Standards for Grades of Apples Marking Requirements § 51.311 Marking requirements... minimum diameter of apples packed in a closed container shall be indicated on the container. For apple... varieties, the minimum diameter and minimum weight of apples packed in a closed container shall be indicated...

7 CFR 773.1 - Introduction.

Code of Federal Regulations, 2012 CFR

2012-01-01

... SPECIAL PROGRAMS SPECIAL APPLE LOAN PROGRAM § 773.1 Introduction. This part contains the terms and conditions for loans made under the Special Apple Loan Program. These regulations are applicable to... program objective is to assist producers of apples suffering from economic loss as a result of low apple...

7 CFR 51.311 - Marking requirements.

Code of Federal Regulations, 2010 CFR

2010-01-01

... STANDARDS) United States Standards for Grades of Apples Marking Requirements § 51.311 Marking requirements... minimum diameter of apples packed in a closed container shall be indicated on the container. For apple... varieties, the minimum diameter and minimum weight of apples packed in a closed container shall be indicated...

7 CFR 51.311 - Marking requirements.

Code of Federal Regulations, 2011 CFR

2011-01-01

... STANDARDS) United States Standards for Grades of Apples Marking Requirements § 51.311 Marking requirements... minimum diameter of apples packed in a closed container shall be indicated on the container. For apple... varieties, the minimum diameter and minimum weight of apples packed in a closed container shall be indicated...

7 CFR 773.1 - Introduction.

Code of Federal Regulations, 2010 CFR

2010-01-01

... SPECIAL PROGRAMS SPECIAL APPLE LOAN PROGRAM § 773.1 Introduction. This part contains the terms and conditions for loans made under the Special Apple Loan Program. These regulations are applicable to... program objective is to assist producers of apples suffering from economic loss as a result of low apple...

7 CFR 773.1 - Introduction.

Code of Federal Regulations, 2014 CFR

2014-01-01

... SPECIAL PROGRAMS SPECIAL APPLE LOAN PROGRAM § 773.1 Introduction. This part contains the terms and conditions for loans made under the Special Apple Loan Program. These regulations are applicable to... program objective is to assist producers of apples suffering from economic loss as a result of low apple...

7 CFR 773.1 - Introduction.

Code of Federal Regulations, 2011 CFR

2011-01-01

... SPECIAL PROGRAMS SPECIAL APPLE LOAN PROGRAM § 773.1 Introduction. This part contains the terms and conditions for loans made under the Special Apple Loan Program. These regulations are applicable to... program objective is to assist producers of apples suffering from economic loss as a result of low apple...

7 CFR 773.1 - Introduction.

Code of Federal Regulations, 2013 CFR

2013-01-01

... SPECIAL PROGRAMS SPECIAL APPLE LOAN PROGRAM § 773.1 Introduction. This part contains the terms and conditions for loans made under the Special Apple Loan Program. These regulations are applicable to... program objective is to assist producers of apples suffering from economic loss as a result of low apple...

In-situ Measurements Of The Radiolytic Destruction Of Glycine In Ices: Applications To The Martian Subsurface

NASA Astrophysics Data System (ADS)

Gerakines, Perry A.; Hudson, R. L.

2012-10-01

Amino acids and other organic molecules are thought to be easily destroyed on the surface of Mars by the high flux of incident ultraviolet rays or by chemical interactions with oxidizing substances in the soil. However, organic molecules may survive in the subsurface, where chemical processes are driven by penetrating galactic cosmic rays such as MeV protons. Models of the radiation dose as a function of depth on Mars have shown that the contribution of galactic cosmic rays dominates from about one centimeter to a few meters [1]. Theoretical models have also been published to aid in understanding molecular destruction at these depths, but these usually are based on room-temperature laboratory data, studies of single-component samples, and ex-situ methods of chemical analysis. Recent studies of amino-acid survivability include those involving UV photolysis [2, 3] and gamma radiolysis [4], but nearly all chemical and kinetic analyses from such experiments involved room-temperature measurements on samples irradiated and then removed from sealed containers. We report new laboratory studies of the radiation-induced destruction of glycine-containing ices. In-situ infrared spectroscopy was used to study decay rates as a function of temperature and initial glycine concentrations. Our results indicate that glycine's destruction rate depends on temperature, the presence of H2O-ice, and the initial relative abundance of glycine. These trends are not obvious in previous work, suggesting that room-temperature measurements on pure glycine's radiation stability are not directly applicable to Mars and other environments. This work has been supported by the Goddard Center for Astrobiology. [1] Dartnell, L. R., et al., 2007. Geophys. Res. Letters 34:L02207. [2] ten Kate, I. L., et al., 2006. Planet. Space Sci. 54, 296-302. [3] Orzechowska, G. E., et al., 2007. Icarus 187, 584-591. [4] Kminek, G., Bada, J. L., 2006. Earth Planet. Sci. Lett. 245, 1-5.

Sulfur isotope fractionation derived from reaction-transport modeling in the Eastern Equatorial Pacific (ODP Leg 201, Site 1226)

NASA Astrophysics Data System (ADS)

Tsang, M. Y.; Wortmann, U.

2016-12-01

Recent theoretical models suggest that low cell-specific sulfate reduction rates (csSRR) in marine sediments should result in high S-isotope fractionation factors (1). Existing studies on marginal sediments show actual fractionation factors indeed approach the theoretical equilibrium fractionation of 70‰ (2,3,4). Here we apply a reaction transport model (REMAP) (5) to data from ODP Site 1226 in the abyssal plain of the Eastern Equatorial Pacific (same location as Leg 138, Site 846). Our results suggest volumetric sulfate reduction rates vary from 346 fmol/cm3/day at 3 mbsf to 0.4 fmol/cm3/day in deeper sediments. Using existing cell counts, this implies csSRR between 10-3 and 10-6 fmol/cell/day, orders of magnitudes lower than those observed in shallower marine settings (10-1 to 10-4 fmol/cell/day) (6). We show that the observed S-isotopes are best explained with a constant fractionation factor of 48‰, considerably smaller than the 70‰ predicted by theoretical models (1). We hypothesize that this is due to in-situ sulfide re-oxidation and disproportionation, promoted by high contents of sedimentary Fe(III) and Mn(IV) at Site 1226 (7). We will further explore this hypothesis in our poster. Wing B.A. & Halevy I. Proc. Natl. Acad. Sci. USA 111, 18116-18125 (2014). Wortmann U.G. Geochem. Geophys. Geosyst. 7 (2006). Rudnicki M., Elderfield H. & Spiro B. Geochim. Cosmochim. Acta 65, 777-789 (2001). Tudge A.P. & Thode H.G. Canadian J. Res. 28, 567-578 (1950). Chernyavsky B.M. & Wortmann U.G. Geochem. Geophys. Geosyst. 8 (2007). Hoehler T.M. & Jørgensen B.B. Nature Rev. Microbiol. 11, 83-94 (2013). Gurvich E.G., Levitan M.A. & Kuzmina T.G. in Proc. of the Ocean Drilling Prog., Sci. Results, N. Pisias et al., Eds. (1995), vol. 138, pp. 769-778.

Modified Blumlein pulse-forming networks for bioelectrical applications.

PubMed

Romeo, Stefania; Sarti, Maurizio; Scarfì, Maria Rosaria; Zeni, Luigi

2010-07-01

Intense nanosecond pulsed electric fields (nsPEFs) have been shown to induce, on intracellular structures, interesting effects dependent on electrical exposure conditions (pulse length and amplitude, repetition frequency and number of pulses), which are known in the literature as "bioelectrical effects" (Schoenbach et al., IEEE Trans Plasma Sci 30:293-300, 2002). In particular, pulses with a shorter width than the plasma membrane charging time constant (about 100 ns for mammalian cells) can penetrate the cell and trigger effects such as permeabilization of intracellular membranes, release of Ca(2+) and apoptosis induction. Moreover, the observed effects have led to exploration of medical applications, like the treatment of melanoma tumors (Nuccitelli et al., Biochem Biophys Res Commun 343:351-360, 2006). Pulsed electric fields allowing such effects usually range from several tens to a few hundred nanoseconds in duration and from a few to several tens of megavolts per meter in amplitude (Schoenbach et al., IEEE Trans Diel Elec Insul 14:1088-1109, 2007); however, the biological effects of subnanosecond pulses have been also investigated (Schoenbach et al., IEEE Trans Plasma Sci 36:414-422, 2008). The use of such a large variety of pulse parameters suggests that highly flexible pulse-generating systems, able to deliver wide ranges of pulse durations and amplitudes, are strongly required in order to explore effects and applications related to different exposure conditions. The Blumlein pulse-forming network is an often-employed circuit topology for the generation of high-voltage electric pulses with fixed pulse duration. An innovative modification to the Blumlein circuit has been recently devised which allows generation of pulses with variable amplitude, duration and polarity. Two different modified Blumlein pulse-generating systems are presented in this article, the first based on a coaxial cable configuration, matching microscopic slides as a pulse-delivery system, and the other based on microstrip transmission lines and designed to match cuvettes for the exposure of cell suspensions.

Mapping Ejecta Thickness Around Small Lunar Craters

NASA Astrophysics Data System (ADS)

Brunner, A.; Robinson, M. S.

2016-12-01

Detailed knowledge of the distribution of ejecta around small ( 1 km) craters is still a key missing piece in our understanding of crater formation. McGetchin et al. [1] compiled data from lunar, terrestrial, and synthetic craters to generate a semi-empirical model of radial ejecta distribution. Despite the abundance of models, experiments, and previous field and remote sensing studies of this problem, images from the 0.5 m/pixel Lunar Reconnaissance Orbiter Camera (LROC) Narrow Angle Camera (NAC) [2] provides the first chance to quantify the extent and thickness of ejecta around kilometer scale lunar craters. Impacts excavate fresh (brighter) material from below the more weathered (darker) surface, forming a relatively bright ejecta blanket. Over time space weathering tends to lower the reflectance of the ejected fresh material [3] resulting in the fading of albedo signatures around craters. Relatively small impacts that excavate through the high reflectance immature ejecta of larger fresh craters provide the means of estimating ejecta thickness. These subsequent impacts may excavate material from within the high reflectance ejecta layer or from beneath that layer to the lower-reflectance mature pre-impact surface. The reflectance of the ejecta around a subsequent impact allows us to categorize it as either an upper or lower limit on the ejecta thickness at that location. The excavation depth of each crater found in the ejecta blanket is approximated by assuming a depth-to-diameter relationship relevant for lunar simple craters [4, e.g.]. Preliminary results [Figure] show that this technique is valuable for finding the radially averaged profile of the ejecta thickness and that the data are roughly consistent with the McGetchin equation. However, data from craters with asymmetric ejecta blankets are harder to interpret. [1] McGetchin et al. (1973) Earth Planet. Sci. Lett., 20, 226-236. [2] Robinson et al. (2010) Space Sci. Rev., 150, 1-4, 81-124. [3] Denevi et al. (2014) J. Geophys. Res. Planets, 119, 5, 976-997. [4] Wood and Anderson (1978), LPSC IX, 3669-3689.

Antioxidant activity and HPLC analysis of polyphenol-enriched extracts from industrial apple pomace.

PubMed

Bai, Xuelian; Zhang, Huawei; Ren, Shuang

2013-08-15

Phenolic compounds are the predominant ingredients in apple pomace. However, polyphenols from industrial apple pomace, which usually consists of several cultivars, have not been studied in detail. The present work focused on the antioxidant assay and HPLC analysis of polyphenol-enriched extracts from industrial apple pomace. Six fractions of apple polyphenols, API to APVI, were acquired through extraction and purification using absorbent macroporous resin. Fraction APIII, eluted by 40% aqueous ethanol, had the highest content of total phenolics (1.48 ± 0.03 g gallic acid equivalents g(-1) dry apple pomace), which consisted of chlorogenic acid, caffeic acid, syrigin, procyanidin B2, (-)-epicatechin, cinnamic acid, coumaric acid and quercetin. Antioxidant assays showed that APIII had the strongest antioxidant activity of DPPH radical scavenging rate (90.96% ± 10.23%), ABTS radical inhibition rate (89.78% ± 6.54%) and the strongest reducing power (8.30 ± 0.71 µmol Trolox equivalents kg(-1) dry apple pomace). It also indicated that procyanidin B2, chlorogenic acid, (-)-epicatechin and quercetin had stronger antioxidant capacity than other phenols. Our data suggested that extracts from industrial apple pomace were rich in phenols and exhibited potent antioxidant activity. Extraction of polyphenols from industrial apple pomace would bring a great benefit and improve development of apple juice and cider industries. © 2013 Society of Chemical Industry.

Thyme and Savory Essential Oil Efficacy and Induction of Resistance against Botrytis cinerea through Priming of Defense Responses in Apple

PubMed Central

Banani, Houda; Olivieri, Leone; Santoro, Karin; Garibaldi, Angelo; Gullino, Maria Lodovica

2018-01-01

The efficacy of thyme and savory essential oils were investigated against Botrytis cinerea on apple fruit. Apples treated with thyme and savory essential oils showed significantly lower gray mold severity and incidence. Thyme essential oil at 1% concentration showed the highest efficacy, with lower disease incidence and smaller lesion diameter. The expression of specific pathogenesis-related (PR) genes PR-8 and PR-5 was characterized in apple tissues in response to thyme oil application and B. cinerea inoculation. After 6 h of pathogen inoculation, thyme essential oil induced a 2.5-fold increase of PR-8 gene expression compared to inoculated fruits. After 24 h of inoculation, PR-8 was highly induced (7-fold) in both thyme oil-treated and untreated apples inoculated with B. cinerea. After 48 h of inoculation, PR-8 expression in thyme-treated and inoculated apples was 4- and 6-fold higher than in inoculated and water-treated apples. Neither thyme oil application nor B. cinerea inoculation markedly affected PR-5 expression. These results suggest that thyme oil induces resistance against B. cinerea through the priming of defense responses in apple fruit, and the PR-8 gene of apple may play a key role in the mechanism by which thyme essential oil effectively inhibits gray mold in apple fruit. PMID:29360731

Dopant-assisted atmospheric pressure photoionization of patulin in apple juice and apple-based food with liquid chromatography-tandem mass spectrometry.

PubMed

Zhang, Kai; Wong, Jon W; Mai, Huy; Trucksess, Mary W

2014-05-07

A dopant-assisted atmospheric pressure photoionization (APPI) with liquid chromatography tandem mass spectrometry (LC-MS/MS) method was developed to determine patulin in apple juice and apple-based food. Different dopants, dopant flow rates, and LC separation conditions were evaluated. Using toluene as the dopant, the LC-APPI-MS/MS method achieved a linear calibration from 12.5 to 2000 μg/L (r(2) > 0.99). Matrix-dependent limits of quantitation (LOQs) were from 8 μg/L (solvent) to 12 μg/L (apple juice). [(13)C]-Patulin-fortified apple juice samples were directly analyzed by the LC-APPI-MS/MS method. Other apple-based food was fortified with [(13)C]-patulin, diluted using water (1% formic acid), centrifuged, and filtered, followed by LC-APPI-MS/MS analysis. In clear apple juice, unfiltered apple cider, applesauce, and apple-based baby food, average recoveries were 101 ± 6% (50 μg/kg), 103 ± 5% (250 μg/kg), and 102 ± 5% (1000 μg/kg) (av ± SD, n = 16). Using the suggested method, patulin was detected in 3 of 30 collected market samples with concentrations ranging from

Thyme and Savory Essential Oil Efficacy and Induction of Resistance against Botrytis cinerea through Priming of Defense Responses in Apple.

PubMed

Banani, Houda; Olivieri, Leone; Santoro, Karin; Garibaldi, Angelo; Gullino, Maria Lodovica; Spadaro, Davide

2018-01-23

The efficacy of thyme and savory essential oils were investigated against Botrytis cinerea on apple fruit. Apples treated with thyme and savory essential oils showed significantly lower gray mold severity and incidence. Thyme essential oil at 1% concentration showed the highest efficacy, with lower disease incidence and smaller lesion diameter. The expression of specific pathogenesis-related (PR) genes PR-8 and PR-5 was characterized in apple tissues in response to thyme oil application and B. cinerea inoculation. After 6 h of pathogen inoculation, thyme essential oil induced a 2.5-fold increase of PR-8 gene expression compared to inoculated fruits. After 24 h of inoculation, PR-8 was highly induced (7-fold) in both thyme oil-treated and untreated apples inoculated with B. cinerea . After 48 h of inoculation, PR-8 expression in thyme-treated and inoculated apples was 4- and 6-fold higher than in inoculated and water-treated apples. Neither thyme oil application nor B. cinerea inoculation markedly affected PR-5 expression. These results suggest that thyme oil induces resistance against B. cinerea through the priming of defense responses in apple fruit, and the PR-8 gene of apple may play a key role in the mechanism by which thyme essential oil effectively inhibits gray mold in apple fruit.

A Review of Studies on the System-Wide Implementation of Evidence-Based Psychotherapies for Posttraumatic Stress Disorder in the Veterans Health Administration.

PubMed

Rosen, C S; Matthieu, M M; Wiltsey Stirman, S; Cook, J M; Landes, S; Bernardy, N C; Chard, K M; Crowley, J; Eftekhari, A; Finley, E P; Hamblen, J L; Harik, J M; Kehle-Forbes, S M; Meis, L A; Osei-Bonsu, P E; Rodriguez, A L; Ruggiero, K J; Ruzek, J I; Smith, B N; Trent, L; Watts, B V

2016-11-01

Since 2006, the Veterans Health Administration (VHA) has instituted policy changes and training programs to support system-wide implementation of two evidence-based psychotherapies (EBPs) for posttraumatic stress disorder (PTSD). To assess lessons learned from this unprecedented effort, we used PubMed and the PILOTS databases and networking with researchers to identify 32 reports on contextual influences on implementation or sustainment of EBPs for PTSD in VHA settings. Findings were initially organized using the exploration, planning, implementation, and sustainment framework (EPIS; Aarons et al. in Adm Policy Ment Health Health Serv Res 38:4-23, 2011). Results that could not be adequately captured within the EPIS framework, such as implementation outcomes and adopter beliefs about the innovation, were coded using constructs from the reach, effectiveness, adoption, implementation, maintenance (RE-AIM) framework (Glasgow et al. in Am J Public Health 89:1322-1327, 1999) and Consolidated Framework for Implementation Research (CFIR; Damschroder et al. in Implement Sci 4(1):50, 2009). We highlight key areas of progress in implementation, identify continuing challenges and research questions, and discuss implications for future efforts to promote EBPs in large health care systems.

Path perception during rotation: influence of instructions, depth range, and dot density

NASA Technical Reports Server (NTRS)

Li, Li; Warren, William H Jr

2004-01-01

How do observers perceive their direction of self-motion when traveling on a straight path while their eyes are rotating? Our previous findings suggest that information from retinal flow and extra-retinal information about eye movements are each sufficient to solve this problem for both perception and active control of self-motion [Vision Res. 40 (2000) 3873; Psych. Sci. 13 (2002) 485]. In this paper, using displays depicting translation with simulated eye rotation, we investigated how task variables such as instructions, depth range, and dot density influenced the visual system's reliance on retinal vs. extra-retinal information for path perception during rotation. We found that path errors were small when observers expected to travel on a straight path or with neutral instructions, but errors increased markedly when observers expected to travel on a curved path. Increasing depth range or dot density did not improve path judgments. We conclude that the expectation of the shape of an upcoming path can influence the interpretation of the ambiguous retinal flow. A large depth range and dense motion parallax are not essential for accurate path perception during rotation, but reference objects and a large field of view appear to improve path judgments.

Recommendations for the National Institute for Neurologic Disorders and Stroke spinal cord injury common data elements for children and youth with SCI.

PubMed

Mulcahey, M J; Vogel, L C; Sheikh, M; Arango-Lasprilla, J C; Augutis, M; Garner, E; Hagen, E M; Jakeman, L B; Kelly, E; Martin, R; Odenkirchen, J; Scheel-Sailer, A; Schottler, J; Taylor, H; Thielen, C C; Zebracki, K

2017-04-01

In 2014, the adult spinal cord injury (SCI) common data element (CDE) recommendations were made available. This project was a review of the adult SCI CDE for relevance to children and youth with SCI. The objective of this study was to review the National Institute of Neurologic Disorders and Stroke (NINDS) adult SCI CDEs for relevance to children and youth with SCI. International. The pediatric working group consisted of international members with varied fields of expertise related to pediatric SCI. The group convened biweekly meetings for 6 months in 2015. All of the adult SCI CDEs were reviewed, evaluated and modified/created for four age groups: 0-5 years, 6-12 years, 13-15 years and 16-18 years. Whenever possible, results of published research studies were used to guide recommendations. In the absence of empirical support, grey literature and international content expert consensus were garnered. Existing pediatric NINDS CDEs and new CDEs were developed in areas where adult recommendations were not appropriate. After internal working group review of domain recommendations, these pediatric CDEs were vetted during a public review from November through December 2015. Version 1.0 of the pediatric SCI CDEs was posted in February 2016. The pediatric SCI CDEs are incorporated directly into the NINDS SCI CDE sets and can be found at https://commondataelements.ninds.nih.gov.

Analysis of hyperspectral scattering images using locally linear embedding algorithm for apple mealiness classification

USDA-ARS?s Scientific Manuscript database

Hyperspectral scattering technique provides a means for assessing the structural and/or physical properties of apples. It could thus be useful for detection of apple mealiness, which is a symptom of physiological disorder, resulting in an undesirable texture and taste for apples and degrading their ...

7 CFR 51.318 - Serious damage.

Code of Federal Regulations, 2012 CFR

2012-01-01

... Standards for Grades of Apples Definitions § 51.318 Serious damage. “Serious damage” means any specific... or shipping quality of the apple. In addition, specific defect measurements are based on an apple... combination of lesser bruises which detract from the appearance or edible quality of the apple to an extent...

7 CFR 51.318 - Serious damage.

Code of Federal Regulations, 2010 CFR

2010-01-01

... Standards for Grades of Apples Definitions § 51.318 Serious damage. “Serious damage” means any specific... or shipping quality of the apple. In addition, specific defect measurements are based on an apple... combination of lesser bruises which detract from the appearance or edible quality of the apple to an extent...

7 CFR 457.158 - Apple crop insurance provisions.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 7 Agriculture 6 2012-01-01 2012-01-01 false Apple crop insurance provisions. 457.158 Section 457... CORPORATION, DEPARTMENT OF AGRICULTURE COMMON CROP INSURANCE REGULATIONS § 457.158 Apple crop insurance provisions. The apple crop insurance provisions for the 2011 and succeeding crop years are as follows: FCIC...

7 CFR 457.158 - Apple crop insurance provisions.

Code of Federal Regulations, 2013 CFR

2013-01-01

... 7 Agriculture 6 2013-01-01 2013-01-01 false Apple crop insurance provisions. 457.158 Section 457... CORPORATION, DEPARTMENT OF AGRICULTURE COMMON CROP INSURANCE REGULATIONS § 457.158 Apple crop insurance provisions. The apple crop insurance provisions for the 2011 and succeeding crop years are as follows: FCIC...

7 CFR 51.318 - Serious damage.

Code of Federal Regulations, 2011 CFR

2011-01-01

... Standards for Grades of Apples Definitions § 51.318 Serious damage. “Serious damage” means any specific... or shipping quality of the apple. In addition, specific defect measurements are based on an apple... combination of lesser bruises which detract from the appearance or edible quality of the apple to an extent...

7 CFR 51.312 - Mature.

Code of Federal Regulations, 2010 CFR

2010-01-01

... Standards for Grades of Apples Definitions § 51.312 Mature. “Mature” means that the apples have reached the... apple becomes overripe it will show varying degrees of firmness, depending upon the stage of the ripening process. The following terms are used for describing different stages of firmness of apples: (a...

7 CFR 51.312 - Mature.

Code of Federal Regulations, 2011 CFR

2011-01-01

... Standards for Grades of Apples Definitions § 51.312 Mature. “Mature” means that the apples have reached the... apple becomes overripe it will show varying degrees of firmness, depending upon the stage of the ripening process. The following terms are used for describing different stages of firmness of apples: (a...

7 CFR 457.158 - Apple crop insurance provisions.

Code of Federal Regulations, 2014 CFR

2014-01-01

... 7 Agriculture 6 2014-01-01 2014-01-01 false Apple crop insurance provisions. 457.158 Section 457... CORPORATION, DEPARTMENT OF AGRICULTURE COMMON CROP INSURANCE REGULATIONS § 457.158 Apple crop insurance provisions. The apple crop insurance provisions for the 2011 and succeeding crop years are as follows: FCIC...

7 CFR 51.320 - Diameter.

Code of Federal Regulations, 2013 CFR

2013-01-01

..., CERTIFICATION, AND STANDARDS) United States Standards for Grades of Apples Definitions § 51.320 Diameter. When measuring for minimum size, “diameter” means the greatest dimension of the apple measured at right angles to... dimension of the apple determined by passing the apple through a round opening in any position. U.S...

7 CFR 457.158 - Apple crop insurance provisions.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 6 2011-01-01 2011-01-01 false Apple crop insurance provisions. 457.158 Section 457... CORPORATION, DEPARTMENT OF AGRICULTURE COMMON CROP INSURANCE REGULATIONS § 457.158 Apple crop insurance provisions. The apple crop insurance provisions for the 2011 and succeeding crop years are as follows: FCIC...

7 CFR 51.320 - Diameter.

Code of Federal Regulations, 2014 CFR

2014-01-01

..., CERTIFICATION, AND STANDARDS) United States Standards for Grades of Apples Definitions § 51.320 Diameter. When measuring for minimum size, “diameter” means the greatest dimension of the apple measured at right angles to... dimension of the apple determined by passing the apple through a round opening in any position. U.S...

7 CFR 51.312 - Mature.

Code of Federal Regulations, 2012 CFR

2012-01-01

... Standards for Grades of Apples Definitions § 51.312 Mature. “Mature” means that the apples have reached the... apple becomes overripe it will show varying degrees of firmness, depending upon the stage of the ripening process. The following terms are used for describing different stages of firmness of apples: (a...

Biodiversity of Total Phenolics, Antioxidant Capacity, and Juice Quality in Apple Cider Taxa

USDA-ARS?s Scientific Manuscript database

Apples are known to contain antioxidants that may play an important role in human health by providing protection against reactive free radicals affecting a wide range of biological molecules including nucleic acids, lipids, and proteins. While fresh apple juice is a main product of processed apples,...

Detection of drought tolerant genes within seedling apple rootstocks in Syria

USDA-ARS?s Scientific Manuscript database

This investigation was conducted to detect the drought tolerant genes (four genes) within seedling apple rootstocks derived from five apple genotypes, including Syrian apple cultivars. The results showed that the gene MdPepPro (a cyclophilin) was found in all studied genotypes and their progenies e...

The vulnerability of US apple (Malus) genetic resources

USDA-ARS?s Scientific Manuscript database

Apple is one of the top three U.S. fruit crops in production and value. Apple production has high costs for land, labor and inputs, and orchards are a long-term commitment. Production is dominated by only a few apple scion cultivars and rootstocks, which increases susceptibility to dynamic external ...

75 FR 11071 - Removal of Varietal Restrictions on Apples from Japan

Federal Register 2010, 2011, 2012, 2013, 2014

2010-03-10

... on Apples from Japan AGENCY: Animal and Plant Health Inspection Service, USDA. ACTION: Proposed rule... Japan to allow all varieties of Malus domestica apples into the United States under the same conditions... apples from Japan to be imported into the United States while continuing to protect against the...

Interaction Between Eddies and Mean Flow in Jupiter's Atmosphere: Analysis of Cassini Imaging Data

NASA Technical Reports Server (NTRS)

Salyk, Colette; Ingersoll, Andrew P.; Lorre, Jean; Vasavada, Ashwin; DelGenio, Anthony D.

2006-01-01

Beebe et al. [Beebe, R.F., et al., 1980. Geophys. Res. Lett. 17, 1-4] and Ingersoll et al. [Ingersoll, A.P., et al., 1981. J. Geophys. Res. 86, 8733-8743] used images from Voyagers 1 and 2 to analyze the interaction between zonal winds and eddies in Jupiter's atmosphere. They reported a high positive correlation between Jupiter's eddy momentum flux, pu'v', and the variation of zonal velocity with latitude, du/dy. This correlation implied a surprisingly high rate of conversion of energy from eddies to zonal flow: approx. 1.5-3.0 W/sq m, a value more than 10% of Jupiter s thermal flux emission. However, Sromovsky et al. [Sromovsky, L.A., et al., 1982. J. Atmos. Sci. 39,1413-1432] argued that possible biases in the analysis could have caused an artificially high correlation. In addition, significant differences in the derived eddy flux between datasets put into question the robustness of any one result. We return to this long-standing puzzle using images of Jupiter from the Cassini flyby of December 2000. Our method is similar to previous analyses, but utilizes an automatic feature tracker instead of the human eye. The number of velocity vectors used in this analysis is over 200,000, compared to the 14,000 vectors used by Ingersoll et al. We also find a positive correlation between u'v' and du/dy and derive a global average power per unit mass, u'v' du/dy, ranging from (7.1-12.3) x 10(exp -5)W/kg. Utilizing Ingersoll et al.'s estimate of the mass per unit area involved in the transport, this would imply a rate of energy conversion of approx.0.7-1.2 W/sq m. We discuss the implications of this result and employ several tests to demonstrate its robustness.

Charging and performance of the CubeSTAR satellite studied by numerical simulations

NASA Astrophysics Data System (ADS)

Miloch, Wojciech; Bekkeng, Tore André; Lindem, Torfinn

2012-07-01

A good understanding of spacecraft-plasma interaction is important for all space missions and experiments. The spacecraft potential is determined by the plasma, photoemission and other currents [1]. A charged object can significantly disturb the surrounding plasma, and lead to wake formation. The wake features, such as ion focusing, can influence the measurements of the plasma by the instruments onboard. A study of this problem using analytical models is difficult and can not account for all phenomena. This has encouraged use of numerical models for self-consistent studies of the plasma-object interactions on a detailed kinetic level [2][3]. With three-dimensional particle-in-cell (PIC) simulations [3][4], we address the spacecraft-plasma interaction in various plasma environments, and account for the self-consistent charging of the spacecraft by plasma and photoemission currents. As a specific case, we consider the interactions between plasma and a CubeSTAR satellite. CubeSTAR is a nano-satellite for the space weather studies being constructed in Norway, with the launch scheduled for year 2013. With a novel Langmuir probe system [5], it will measure the absolute electron densities with a high spatial resolution, allowing for studies of small scale plasma irregularities. We perform a systematic study of the role of the wakefield on the measurements with the Langmuir probes onboard the CubeSTAR for the plasma conditions relevant for the planned polar orbit. The simulation results are of relevance also for other spacecraft missions. [1] Whipple E C, Rep. Prog. Phys. 44, 1197 (1981). [2] Roussel J F and Berthelier J J, J. Geophys. Res. 109, A01104 (2004). [3] Yaroshenko V V et al., J. Geophys. Res. 116, A12218 (2011). [4] Miloch W J Kroll M and Block D 2010 Phys. Plasmas 17, 103703 (2010). [5] Bekkeng T A et al. Meas. Sci. Technol. 21, 085903 (2010).

Spinal cord injury below-level neuropathic pain relief with dorsal root entry zone microcoagulation performed caudal to level of complete spinal cord transection.

PubMed

Falci, Scott; Indeck, Charlotte; Barnkow, Dave

2018-06-01

OBJECTIVE Surgically created lesions of the spinal cord dorsal root entry zone (DREZ) to relieve central pain after spinal cord injury (SCI) have historically been performed at and cephalad to, but not below, the level of SCI. This study was initiated to investigate the validity of 3 proposed concepts regarding the DREZ in SCI central pain: 1) The spinal cord DREZ caudal to the level of SCI can be a primary generator of SCI below-level central pain. 2) Neuronal transmission from a DREZ that generates SCI below-level central pain to brain pain centers can be primarily through sympathetic nervous system (SNS) pathways. 3) Perceived SCI below-level central pain follows a unique somatotopic map of DREZ pain-generators. METHODS Three unique patients with both intractable SCI below-level central pain and complete spinal cord transection at the level of SCI were identified. All 3 patients had previously undergone surgical intervention to their spinal cords-only cephalad to the level of spinal cord transection-with either DREZ microcoagulation or cyst shunting, in failed attempts to relieve their SCI below-level central pain. Subsequent to these surgeries, DREZ lesioning of the spinal cord solely caudal to the level of complete spinal cord transection was performed using electrical intramedullary guidance. The follow-up period ranged from 1 1/2 to 11 years. RESULTS All 3 patients in this study had complete or near-complete relief of all below-level neuropathic pain. The analyzed electrical data confirmed and enhanced a previously proposed somatotopic map of SCI below-level DREZ pain generators. CONCLUSIONS The results of this study support the following hypotheses. 1) The spinal cord DREZ caudal to the level of SCI can be a primary generator of SCI below-level central pain. 2) Neuronal transmission from a DREZ that generates SCI below-level central pain to brain pain centers can be primarily through SNS pathways. 3) Perceived SCI below-level central pain follows a unique somatotopic map of DREZ pain generators.

Not just quantity: gluteus maximus muscle characteristics in able-bodied and SCI individuals--implications for tissue viability.

PubMed

Wu, Gary A; Bogie, Kath M

2013-08-01

Some individuals with spinal cord injury (SCI) remain pressure ulcer (PU) free whilst others experience a recurring cycle of tissue breakdown. Detailed analysis of gluteal muscle characteristics may provide insights to local tissue viability variability. The study hypothesis was that SCI individuals have altered muscle composition compared to able-bodied (AB). Ten AB and ten SCI received a supine pelvic CT scan, with contrast. Cross-sectional area (CSA) and overall muscle volume were derived using image analysis. Gluteal muscle tissue type was classified at the S2/S3 sacral vertebrae midpoint, the superior greater trochanters margin (GT) and the inferior ischial tuberosities margin (IT) using the linear transformation Hounsfield Unit scale. SCI gluteal CSA was less than for AB throughout the muscle, with the greatest relative atrophy at the IT (48%). Average AB gluteal volume was nearly double SCI. Eight SCI had over 20% infiltrative adipose tissue, three with over 50%. SCI gluteal CSA and intramuscular fat infiltration were significantly negatively correlated (p < 0.05). SCI IT axial slices showed less lean muscle and higher intramuscular fat infiltration than more proximally (p < 0.05). SCI gluteal muscle characteristics were indicative of impaired tissue viability. SCI disuse muscle atrophy was anticipated; the analytic approach further indicated that intramuscular atrophy was not uniform. SCI muscle composition showed increased proportions of both low density muscle and adipose tissue. CT scan with contrast is effective for gluteal muscle characterization. This assessment technique may contribute to determination of personalized risk for PU development and other secondary complications. Published by Elsevier Ltd.

Targeting Translational Successes through CANSORT-SCI: Using Pet Dogs To Identify Effective Treatments for Spinal Cord Injury

PubMed Central

Granger, Nicolas; Olby, Natasha J.; Spitzbarth, Ingo; Jeffery, Nick D.; Tipold, Andrea; Nout-Lomas, Yvette S.; da Costa, Ronaldo C.; Stein, Veronika M.; Noble-Haeusslein, Linda J.; Blight, Andrew R.; Grossman, Robert G.; Basso, D. Michele; Levine, Jonathan M.

2017-01-01

Abstract Translation of therapeutic interventions for spinal cord injury (SCI) from laboratory to clinic has been historically challenging, highlighting the need for robust models of injury that more closely mirror the human condition. The high prevalence of acute, naturally occurring SCI in pet dogs provides a unique opportunity to evaluate expeditiously promising interventions in a population of animals that receive diagnoses and treatment clinically in a manner similar to persons with SCI, while adhering to National Institutes of Health guidelines for scientific rigor and transparent reporting. In addition, pet dogs with chronic paralysis are often maintained long-term by their owners, offering a similarly unique population for study of chronic SCI. Despite this, only a small number of studies have used the clinical dog model of SCI. The Canine Spinal Cord Injury Consortium (CANSORT-SCI) was recently established by a group of veterinarians and basic science researchers to promote the value of the canine clinical model of SCI. The CANSORT-SCI group held an inaugural meeting November 20 and 21, 2015 to evaluate opportunities and challenges to the use of pet dogs in SCI research. Key challenges identified included lack of familiarity with the model among nonveterinary scientists and questions about how and where in the translational process the canine clinical model would be most valuable. In light of these, we review the natural history, outcome, and available assessment tools associated with canine clinical SCI with emphasis on their relevance to human SCI and the translational process. PMID:28230415

Bounds for the Z-spectral radius of nonnegative tensors.

PubMed

He, Jun; Liu, Yan-Min; Ke, Hua; Tian, Jun-Kang; Li, Xiang

2016-01-01

In this paper, we have proposed some new upper bounds for the largest Z-eigenvalue of an irreducible weakly symmetric and nonnegative tensor, which improve the known upper bounds obtained in Chang et al. (Linear Algebra Appl 438:4166-4182, 2013), Song and Qi (SIAM J Matrix Anal Appl 34:1581-1595, 2013), He and Huang (Appl Math Lett 38:110-114, 2014), Li et al. (J Comput Anal Appl 483:182-199, 2015), He (J Comput Anal Appl 20:1290-1301, 2016).

Spinal-Cord-Injured Individual's Experiences of Having a Partner: A Phenomenological-Hermeneutic Study.

PubMed

Angel, Sanne

2015-06-01

Having a partner is a strong factor in adaptation to the new life situation with a spinal cord injury (SCI). Still, more knowledge in detail about the partner's influences according to the experiences of individuals with SCI could contribute to the understanding of the situation after an injury. The aim of this phenomenological-hermeneutic article is to achieve a deeper understanding of nine individuals' experiences the first 2 years after SCI. In rehabilitation after SCI, the partner supported the SCI individual's life spirit by not giving up and by still seeing possibilities in the future. The partner reinforced the SCI individual's commitment to life by sharing experiences; providing love, trust, and hope; and giving priority to the best things in life for the SCI individual. This implied cohabitation providing concrete help and an intimacy that helped to cope with problems and anxieties and allowed SCI individuals the ability to self-realize. This promoted feelings of profound gratitude but also dependency. Thus, the SCI individual benefitted from the partner's support mentally and physically, which enabled a life that would not otherwise be possible.

Global meaning in people with spinal cord injury: Content and changes

PubMed Central

Littooij, Elsbeth; Widdershoven, Guy A.M.; Stolwijk-Swüste, Janneke M.; Doodeman, Suzan; Leget, Carlo J.W.; Dekker, Joost

2016-01-01

Background After spinal cord injury (SCI), people are confronted with abrupt discontinuity in almost all areas of life, leading to questions on how to live a meaningful life again. Global meaning refers to basic ideas and goals that guide people in giving meaning to their lives, in specific situations. Little is known about global meaning relating to SCI and whether global meaning changes after SCI. Purpose The purpose of this study was twofold: (i) to explore the content of global meaning of people with SCI, and (ii) to explore whether or not global meaning changes after SCI. Methods In-depth semi-structured interviews were conducted with 16 people with SCI. Interviews were analyzed according to the method of grounded theory. Results (i) Five aspects of global meaning were found: core values, relationships, worldview, identity and inner posture. (ii) Overall, little change in the content of global meaning was found after SCI; specific aspects of global meaning were foregrounded after SCI. Conclusion Five aspects of global meaning were found in people with SCI. Global meaning seems hardly subject to change. PMID:25615571

Evaluation and Management of SCI-Associated Pain.

PubMed

Saulino, Michael; Averna, Justin F

2016-09-01

Traumatic spinal cord injury (SCI) is a devastating neurological condition. Treatment of SCI-related pain is challenging for the treating physician, as normal neural pathways are disrupted. Patients with SCI consistently rate pain as one of the most difficult problems associated with their injury. SCI-related pain can be refractory and complete relief is often not possible. The multidimensional nature of SCI-related pain affects the neural system including autonomic nervous system deregulation and can alter metabolic and biochemical processes throughout the body. Co-morbid psychological illnesses such as depression and adjustment disorder are seen in a significant percentage of patients. Despite a better understanding of the underlying pain mechanisms and advances in procedural, pharmacologic, and non-pharmacologic therapies, treatment of pain after SCI remains elusive. This manuscript reviews the current evidence-based evaluation and management of the SCI patient with the overarching goal of providing appropriate and effective management of their pain. In particular, additional well-designed studies are needed to help elucidate effective treatments for SCI-related neuropathic pain in an effort to help provide these patients with better management of their pain and improve their quality of life.

Resting-state synchrony between the retrosplenial cortex and anterior medial cortical structures relates to memory complaints in subjective cognitive impairment.

PubMed

Yasuno, Fumihiko; Kazui, Hiroaki; Yamamoto, Akihide; Morita, Naomi; Kajimoto, Katsufumi; Ihara, Masafumi; Taguchi, Akihiko; Matsuoka, Kiwamu; Kosaka, Jun; Tanaka, Toshihisa; Kudo, Takashi; Takeda, Masatoshi; Nagatsuka, Kazuyuki; Iida, Hidehiro; Kishimoto, Toshifumi

2015-06-01

Subjective cognitive impairment (SCI) is a clinical state characterized by subjective cognitive deficits without cognitive impairment. To test the hypothesis that this state might involve dysfunction of self-referential processing mediated by cortical midline structures, we investigated abnormalities of functional connectivity in these structures in individuals with SCI using resting-state functional magnetic resonance imaging. We performed functional connectivity analysis for 23 individuals with SCI and 30 individuals without SCI. To reveal the pathophysiological basis of the functional connectivity change, we performed magnetic resonance-diffusion tensor imaging. Positron emission tomography-amyloid imaging was conducted in 13 SCI and 15 nonSCI subjects. Individuals with SCI showed reduced functional connectivity in cortical midline structures. Reduction in white matter connections was related to reduced functional connectivity, but we found no amyloid deposition in individuals with SCI. The results do not necessarily contradict the possibility that SCI indicates initial cognitive decrements, but imply that reduced functional connectivity in cortical midline structures contributes to overestimation of the experience of forgetfulness. Copyright © 2015 Elsevier Inc. All rights reserved.

Hyperspectral reflectance and fluorescence line-scan imaging system for online detection of fecal contamination on apples

NASA Astrophysics Data System (ADS)

Kim, Moon S.; Cho, Byoung-Kwan; Yang, Chun-Chieh; Chao, Kaunglin; Lefcourt, Alan M.; Chen, Yud-Ren

2006-10-01

We have developed nondestructive opto-electronic imaging techniques for rapid assessment of safety and wholesomeness of foods. A recently developed fast hyperspectral line-scan imaging system integrated with a commercial apple-sorting machine was evaluated for rapid detection of animal feces matter on apples. Apples obtained from a local orchard were artificially contaminated with cow feces. For the online trial, hyperspectral images with 60 spectral channels, reflectance in the visible to near infrared regions and fluorescence emissions with UV-A excitation, were acquired from apples moving at a processing sorting-line speed of three apples per second. Reflectance and fluorescence imaging required a passive light source, and each method used independent continuous wave (CW) light sources. In this paper, integration of the hyperspectral imaging system with the commercial applesorting machine and preliminary results for detection of fecal contamination on apples, mainly based on the fluorescence method, are presented.

Current trends and future prospects of biotechnological interventions through tissue culture in apple.

PubMed

Bhatti, Shammi; Jha, Gopaljee

2010-11-01

Apple (Malus domestica Borkh.), which is a widely cultivated, important economic fruit crop with nutritive and medicinal importance, has emerged as a model horticultural crop in this post-genomic era. Apple cultivation is heavily dependent on climatic condition and is susceptible to several diseases caused by fungi, bacteria, viruses, insects, etc. Extensive research work has been carried out to standardize tissue culture protocols and utilize them in apple improvement. We review the in vitro shoot multiplication, rooting, transformation and regeneration methodologies in apple and tabulate various such protocols for easy reference. The utility and limitation of transgenesis in apple improvement have also been summarized. The concepts of marker-free plants, use of non-antibiotic resistance selectable markers, and cisgenic and intragenic approaches are highlighted. Furthermore, the limitations, current trends and future prospects of tissue culture-mediated biotechnological interventions in apple improvement are discussed.

A Comprehensive Review of Apples and Apple Components and Their Relationship to Human Health12

PubMed Central

Hyson, Dianne A.

2011-01-01

There has been an increasing appreciation and understanding of the link between dietary fruit and vegetable intake and improved health in humans. The widespread and growing intake of apples and apple juice/products and their rich phytochemical profile suggest their important potential to affect the health of the populations consuming them. This review summarizes current clinical, in vitro, and in vivo data and builds upon earlier published reports that apple may reduce the risk of chronic disease by various mechanisms, including antioxidant, antiproliferative, and cell signaling effects. Exposure to apples and apple products has been associated with beneficial effects on risk, markers, and etiology of cancer, cardiovascular disease, asthma, and Alzheimer’s disease. Recent work suggests that these products may also be associated with improved outcomes related to cognitive decline of normal aging, diabetes, weight management, bone health, pulmonary function, and gastrointestinal protection. PMID:22332082

Changes in primary metabolites and polyphenols in the peel of "Braeburn" apples (Malus domestica Borkh.) during advanced maturation.

PubMed

Bizjak, Jan; Mikulic-Petkovsek, Maja; Stampar, Franci; Veberic, Robert

2013-10-30

During the two growing seasons the evolution of primary metabolites and wide range of polyphenols in the "Braeburn" apple peel during advanced maturation were investigated. During the five weeks sucrose significantly increased, whereas fructose and glucose fluctuated around the same level in one season and decreased in another. Regarding malic and citric acids, an expected decrease was recorded. The concentrations of hydroxycinnamic acids, dihydrochalcones, and flavanols remained quite constant or slightly decreased during advanced apple ripening. On the contrary an intensive accumulation of quercetin glycosides and anthocyanins took place during this period, starting with the onset of rapid formation approximately 3 weeks before the technological maturity of apples. Total phenolic content was relatively constant or slightly increased. The present results suggest that measures designed to improve the apple color and quality of "Braeburn" apples should be performed approximately 3-4 weeks before the expected technological maturity of apples.

Characterization of apple stem grooving virus and apple chlorotic leaf spot virus identified in a crab apple tree.

PubMed

Li, Yongqiang; Deng, Congliang; Bian, Yong; Zhao, Xiaoli; Zhou, Qi

2017-04-01

Apple stem grooving virus (ASGV), apple chlorotic leaf spot virus (ACLSV), and prunus necrotic ringspot virus (PNRSV) were identified in a crab apple tree by small RNA deep sequencing. The complete genome sequence of ACLSV isolate BJ (ACLSV-BJ) was 7554 nucleotides and shared 67.0%-83.0% nucleotide sequence identity with other ACLSV isolates. A phylogenetic tree based on the complete genome sequence of all available ACLSV isolates showed that ACLSV-BJ clustered with the isolates SY01 from hawthorn, MO5 from apple, and JB, KMS and YH from pear. The complete nucleotide sequence of ASGV-BJ was 6509 nucleotides (nt) long and shared 78.2%-80.7% nucleotide sequence identity with other isolates. ASGV-BJ and the isolate ASGV_kfp clustered together in the phylogenetic tree as an independent clade. Recombination analysis showed that isolate ASGV-BJ was a naturally occurring recombinant.

Co-encapsulated resveratrol and quercetin in chitosan and peg modified chitosan nanoparticles: For efficient intra ocular pressure reduction.

PubMed

Natesan, Subramanian; Pandian, Saravanakumar; Ponnusamy, Chandrasekar; Palanichamy, Rajaguru; Muthusamy, Sivakumar; Kandasamy, Ruckmani

2017-11-01

Natural anti-oxidants resveratrol (RES) and quercetin (QUR) posses the ability to reduce intra ocular pressure efficiently. Concurrent administration of RES and QUR was able to enhance the bioavailability of RES. Present research work describes upsurge of QUR in RES loaded chitosan (CS) nanoparticles (NPs) and polyethylene glycol (PEG) modified CS NPs for improved delivery and synergic effects on reducing intra ocular pressure for the treatment of glaucoma. CS NPs and PEG modified CS NPs were prepared by ionic gelation of tripolyphosphate and CS. The synthesised NPs were spherical in shape and RES entrapment and loading efficiency in the formulation decreased with increasing PEG concentration. Particle size of the formulation increased while incorporating PEG and drugs. The crystalline nature of RES and QUR changed in the NPs and that was confirmed by XRD study. Free radical neutralising efficiency improved while incorporating QUR in the formulation. Ex-vivo corneal permeation of RES was higher from RES and QUR loaded formulation than RES alone containing NPs and free RES dispersion. RES and QUR loaded PEG modified CS NPs showed sustained and enhanced reduction of intra ocular pressure (5.5±0.5mmHg) in normotensive rabbits. Copyright © 2017 Elsevier B.V. All rights reserved.

Dumping Low and High Resolution Graphics on the Apple IIe Microcomputer System.

ERIC Educational Resources Information Center

Fletcher, Richard K., Jr.; Ruckman, Frank, Jr.

This paper discusses and outlines procedures for obtaining a hard copy of the graphic output of a microcomputer or "dumping a graphic" using the Apple Dot Matrix Printer with the Apple Parallel Interface Card, and the Imagewriter Printer with the Apple Super Serial Interface Card. Hardware configurations and instructions for high…

7 CFR 319.56-22 - Apples and pears from certain countries in Europe.

Code of Federal Regulations, 2012 CFR

2012-01-01

... 7 Agriculture 5 2012-01-01 2012-01-01 false Apples and pears from certain countries in Europe. 319... Vegetables § 319.56-22 Apples and pears from certain countries in Europe. (a) Importations allowed. The... applicable provisions of this subpart: (1) Apples from Belgium, Denmark, France, Germany, Great Britain...

7 CFR 51.317 - Damage.

Code of Federal Regulations, 2012 CFR

2012-01-01

... Standards for Grades of Apples Definitions § 51.317 Damage. “Damage” means any specific defect defined in... quality of the apple. In addition, specific defect measurements are based on an apple three inches in... cannot be seen when the apple is placed stem end or calyx end down on a flat surface shall not be...

7 CFR 33.1 - Act.

Code of Federal Regulations, 2011 CFR

2011-01-01

... AUTHORITY OF THE EXPORT APPLE ACT Definitions § 33.1 Act. Act and Export Apple Act are synonymous and mean “An act to promote the foreign trade of the United States in apples to protect the reputation of American-grown apples in foreign markets, to prevent deception or misrepresentation as to the quality of...

7 CFR 51.300 - U.S. Extra Fancy.

Code of Federal Regulations, 2012 CFR

2012-01-01

... Standards for Grades of Apples Grades § 51.300 U.S. Extra Fancy. “U.S. Extra Fancy” consists of apples of..., scab, freezing injury, visible water core, and broken skins. The apples are also free from injury... rubs, hail, drought spots, scars, disease, insects, or other means. The apples are free from damage...

7 CFR 51.346 - Tolerances.

Code of Federal Regulations, 2010 CFR

2010-01-01

... Standards for Grades of Apples for Processing Tolerances § 51.346 Tolerances. When a lot of apples is required to meet one of the U.S. grades, the apples shall not be further advanced in maturity than... apples which fail to meet the requirements of the grade: Provided, That included in this amount not more...

7 CFR 51.317 - Damage.

Code of Federal Regulations, 2010 CFR

2010-01-01

... Standards for Grades of Apples Definitions § 51.317 Damage. “Damage” means any specific defect defined in... quality of the apple. In addition, specific defect measurements are based on an apple three inches in... cannot be seen when the apple is placed stem end or calyx end down on a flat surface shall not be...

Teaching Bad Apples: A Fun Way to Tackle Difficult Teaching Situations

ERIC Educational Resources Information Center

Turcotte, Nathaniel; Betrus, Anthony

2016-01-01

"Teaching Bad Apples" is a game developed in 2014 for current and future teachers. It plays much like "Apples to Apples" or "Cards Against Humanity," with each player in turn reading a situation card, followed by the other players choosing their response cards. Each situation, however dramatic or bizarre, is…

7 CFR 51.346 - Tolerances.

Code of Federal Regulations, 2012 CFR

2012-01-01

... Standards for Grades of Apples for Processing Tolerances § 51.346 Tolerances. When a lot of apples is required to meet one of the U.S. grades, the apples shall not be further advanced in maturity than... apples which fail to meet the requirements of the grade: Provided, That included in this amount not more...

7 CFR 33.1 - Act.

Code of Federal Regulations, 2010 CFR

2010-01-01

... AUTHORITY OF THE EXPORT APPLE ACT Definitions § 33.1 Act. Act and Export Apple Act are synonymous and mean “An act to promote the foreign trade of the United States in apples to protect the reputation of American-grown apples in foreign markets, to prevent deception or misrepresentation as to the quality of...

7 CFR 33.1 - Act.

Code of Federal Regulations, 2014 CFR

2014-01-01

... AUTHORITY OF THE EXPORT APPLE ACT Definitions § 33.1 Act. Act and Export Apple Act are synonymous and mean “An act to promote the foreign trade of the United States in apples to protect the reputation of American-grown apples in foreign markets, to prevent deception or misrepresentation as to the quality of...

7 CFR 51.317 - Damage.

Code of Federal Regulations, 2011 CFR

2011-01-01

... Standards for Grades of Apples Definitions § 51.317 Damage. “Damage” means any specific defect defined in... quality of the apple. In addition, specific defect measurements are based on an apple three inches in... cannot be seen when the apple is placed stem end or calyx end down on a flat surface shall not be...

7 CFR 319.56-22 - Apples and pears from certain countries in Europe.

Code of Federal Regulations, 2011 CFR

2011-01-01

... 7 Agriculture 5 2011-01-01 2011-01-01 false Apples and pears from certain countries in Europe. 319... Vegetables § 319.56-22 Apples and pears from certain countries in Europe. (a) Importations allowed. The... applicable provisions of this subpart: (1) Apples from Belgium, Denmark, France, Germany, Great Britain...

7 CFR 51.316 - Injury.

Code of Federal Regulations, 2012 CFR

2012-01-01

... Standards for Grades of Apples Definitions § 51.316 Injury. “Injury” means any specific defect defined in... shipping quality of the apple. In addition, specific defect measurements are based on an apple three inches... cannot be seen when the apple is placed stem end or calyx end down on a flat surface shall not be...

7 CFR 51.346 - Tolerances.

Code of Federal Regulations, 2011 CFR

2011-01-01

... Standards for Grades of Apples for Processing Tolerances § 51.346 Tolerances. When a lot of apples is required to meet one of the U.S. grades, the apples shall not be further advanced in maturity than... apples which fail to meet the requirements of the grade: Provided, That included in this amount not more...

75 FR 69628 - Non-Frozen Apple Juice Concentrate From the People's Republic of China: Final Results of Sunset...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-11-15

... DEPARTMENT OF COMMERCE International Trade Administration [A-570-855] Non-Frozen Apple Juice... order on non-frozen apple juice concentrate from the People's Republic of China (``PRC''). Because the... June 5, 2000, the Department issued an antidumping duty order on certain non-frozen apple juice...

7 CFR 51.346 - Tolerances.

Code of Federal Regulations, 2014 CFR

2014-01-01

..., CERTIFICATION, AND STANDARDS) United States Standards for Grades of Apples for Processing Tolerances § 51.346 Tolerances. When a lot of apples is required to meet one of the U.S. grades, the apples shall not be further...) For defects. 10 percent for apples which fail to meet the requirements of the grade: Provided, That...

7 CFR 33.1 - Act.

Code of Federal Regulations, 2012 CFR

2012-01-01

... AUTHORITY OF THE EXPORT APPLE ACT Definitions § 33.1 Act. Act and Export Apple Act are synonymous and mean “An act to promote the foreign trade of the United States in apples to protect the reputation of American-grown apples in foreign markets, to prevent deception or misrepresentation as to the quality of...

77 FR 51575 - Certain Devices With Secure Communication Capabilities, Components Thereof, and Products...

Federal Register 2010, 2011, 2012, 2013, 2014

2012-08-24

... investigation named Apple Inc. (``Apple'') of Cupertino, California as the sole respondent. No Commission investigative attorney is participating in this investigation. On April 30, 2012, Apple moved to terminate the... opposition to the motion. The ALJ issued the subject ID on July 18, 2012, granting Apple's motion for...

7 CFR 33.1 - Act.

Code of Federal Regulations, 2013 CFR

2013-01-01

... AUTHORITY OF THE EXPORT APPLE ACT Definitions § 33.1 Act. Act and Export Apple Act are synonymous and mean “An act to promote the foreign trade of the United States in apples to protect the reputation of American-grown apples in foreign markets, to prevent deception or misrepresentation as to the quality of...